WO2017186882A1

WO2017186882A1 - A method of predicting a response to an anti-tumor treatment by means of signal interfering dna molecules

Info

Publication number: WO2017186882A1
Application number: PCT/EP2017/060131
Authority: WO
Inventors: Marie Dutreix
Original assignee: Onxeo; Institut Curie; Institut National De La Sante Et De La Recherche Medicale (Inserm); Centre National De La Recherche Scientifique
Priority date: 2016-04-29
Filing date: 2017-04-27
Publication date: 2017-11-02

Abstract

The present invention relates to a method of predicting a response to an anti-tumor treatment, more particularly to the identification of a marker for predicting whether a nucleic acid molecule able to inhibit DNA repair (Dbait molecule) would be effective for treating a tumor in a patient.

Description

A METHOD OF PREDICTING A RESPONSE TO AN ANTI-TUMOR

TREATMENT BY MEANS OF SIGNAL INTERFERING DNA MOLECULES

FIELD OF THE INVENTION

BACKGROUND OF THE INVENTION

DT01 (now called AsiDNA) is a signal interfering DNA (siDNA) designed to counteract DNA repair. It consists of 32 base-pair deoxyribonucleotides forming an intramolecular DNA double helix that mimics DNA lesions. It acts as a bait for DNA damage signaling enzymes, such as the poly(ADP-ribose) polymerase (PA P) and the DNA-dependent protein kinase (DNA-PK), and induces a "false" DNA damage signal, ultimately inhibiting recruitment of many proteins involved in the DNA break repair pathways, and consequently disabling DNA repair activity at damage sites (Quanz et al, 2009a; Quanz et al, 2009b). As a result, DT01 synergistically increased the efficacy of different DNA damaging therapies in several preclinical models of cancer (Devun et al, 2014; Devun et al, 2012; Herath et al, 2016; Quanz et al, 2009a). The combination of intratumoral and peritumoral subcutaneous injection of DT01 with RT showed supra-additive efficacy in human melanoma xenografted in mice (Biau et al, 2014). As concomitant chloroquine increased cellular uptake of DT01 (Berthault et al, 2011), a daily dose of chloroquine was administered to patients. Safety, pharmacokinetics and preliminary signs of efficacy intratumoral and peritumoral injections of DT01 were evaluated in combination with radiotherapy in a first-in-human phase I trial in patients with unresectable skin metastases from melanoma (DRUM ; NCT01469455).

The Tissue Inhibitor of Metalloproteinases 3 (TIMP3) expression was reported to be inversely correlated with disease progression and angiogenic capacity of melanoma (Das et al, 2014), to be deregulated in high stage melanoma (Liu et al, 2008) and to be an independent prognostic factor for disease-free survival in HCC (Gu et al, 2014). Moreover, TIMP3 gene methylation was reported to be a marker of HNSCC low recurrence (Rettori, 2013), and survival of patient with glioblastoma (Saraiva- Esperon, 2014) and useful for the diagnosis of non-hereditary breast cancer (Murria, 2015).

However, until now TIMP3 has never been disclosed nor even suggested as a predictive biomarker of response to DNA repair inhibitors and more precisely to DBait molecules such as DT01. SUMMARY OF THE INVENTION

It is now provided an in vitro method for determining the likelihood for a patient affected with a tumor to respond to a treatment with a nucleic acid molecule able to inhibit DNA repair (Dbait molecule), especially those called coDBait which are conjugated to cholesterol. According to the invention, this method comprises determining expression level of TIMP3 gene in a biological sample of said patient.

It is further provided a method for treating a patient affected with a tumor, comprising administering a Dbait molecule as described herein, optionally in combination with an anti-tumor agent, such as a DNA damaging agent or radiotherapy, to said patient, wherein said patient has been previously classified as "responder" by the method described herein, comprising determining expression level of TIMP3 gene, in a biological sample of said patient, before the course of the treatment.

DETAILED DESCRIPTION OF THE INVENTION

Definitions:

The term "patient" refers to a human or non-human animal, preferably a mammal, including male, female, adult and children in need of a treatment wherein inhibition of DNA repair is desired.

As used herein, the term "treatment" or "therapy" includes curative and/or prophylactic treatment. More particularly, curative treatment refers to any of the alleviation, amelioration and/or elimination, reduction and/or stabilization (e.g., failure to progress to more advanced stages) of a symptom, as well as delay in progression of a symptom of a particular disorder. Prophylactic treatment refers to any of: halting the onset, reducing the risk of development, reducing the incidence, delaying the onset, reducing the development, as well as increasing the time to onset of symptoms of a particular disorder.

The terms "responder" or "responsive to a treatment" refer to a patient in whom the onset of at least one of the symptoms is delayed or prevented, upon or after treatment, or whose symptoms or at least one of the symptom stabilize, diminish or disappear, or whose tumor growth, volume or spread stops or decreases, e.g. decreases of at least 30% in the sum of lesion diameter (RECIST criteria).

The term "resistant to a treatment" or "non-responsive to a treatment" refers to a patient in whom the onset of symptoms is not delayed nor prevented, upon or after treatment, who shows no stabilization, diminution, nor disappearance of any of the symptoms, and whose tumor growth, volume and spread does not stop nor decrease, in particular does not decrease of more than 30% in the sum of lesion diameter (RECIST criteria).

As used herein, the term "TIMP3" (also known as MIG-5) refers to a gene that belongs to the tissue inhibitor of metalloproteinases gene family and encodes the metalloproteinase inhibitor 3 consisting of 211 amino acids. A sequence of human TIMP3 mRNA is available on Genbank Access Number NM_000362. A sequence of human TIMP3 protein is available on Genbank Access Number NP_000353. The term "TIMP3" includes naturally occurring TIMP3 polypeptide as well as variants, fragments and modified forms thereof. The term "polypeptide" means herein a polymer of amino acids having no specific length and does not exclude post-translational modifications that include but are not limited to phosphorylation, acetylation, glycosylation and the like.

The invention relates to an in vitro method for determining the likelihood for a patient affected with a tumor to respond to a treatment with a nucleic acid molecule able to inhibit DNA repair (DBait molecule), especially those which are conjugated to cholesterol. According to the invention, this method comprises determining expression level of TIMP3 gene in a biological sample of said patient. Determination of the expression level:

As used herein, the term "determining" includes qualitative and/or quantitative determination (i.e. detecting and/or measuring the expression level) with or without reference to a control or a predetermined value. As used herein, "detecting" means determining if TIMP3 is present or not in a biological sample and "measuring" means determining the amount of TIMP3 in a biological sample. As used herein, the term "biological sample" has its general meaning in the art and refers to any biological sample which may be obtained from a subject for the purpose of in vitro evaluation. The biological sample is preferably a blood sample (e.g. whole blood sample, serum sample, or plasma sample). Alternatively, the biological sample may be a sample comprising tumor cells, preferably a tumor tissue biopsy. For instance, it may be formalin-fixed paraffin embedded tumor tissue that can be used for immunohistochemistry (IHC) or fresh frozen tumor tissue. The biological sample may also be a sample comprising lymphocytes, especially circulating lymphocytes (e.g. a blood cell sample).

Determination of the expression level of TIMP3 gene may be performed by a variety of techniques. Generally, the expression level as determined is a relative expression level. For example, the determination comprises contacting the biological sample with selective reagents such as probes, primers or ligands, and thereby detecting the presence, or measuring the amount, of polypeptide or nucleic acids of interest originally in said biological sample. Contacting may be performed in any suitable device, such as a plate, microtiter dish, test tube, well, glass, column, and so forth. In specific embodiments, the contacting is performed on a substrate coated with the reagent, such as a nucleic acid array or a specific ligand array. The substrate may be a solid or semi- so lid substrate such as any suitable support comprising glass, plastic, nylon, paper, metal, polymers and the like. The substrate may be of various forms and sizes, such as a slide, a membrane, a bead, a column, a gel, etc. The contacting may be made under any condition suitable for a detectable complex, such as a nucleic acid hybrid or an antibody-antigen complex, to be formed between the reagent and the nucleic acids or polypeptides of the biological sample.

In a particular embodiment, the expression level of the TIMP3 gene may be determined by assessing the quantity of mRNA.

Methods for assessing the quantity of mRNA are well known in the art. For example the nucleic acid contained in the samples (e.g., cell or tissue prepared from the patient) is first extracted according to standard methods, for example using lytic enzymes or chemical solutions or extracted by nucleic- acid-binding resins following the manufacturer's instructions.

The extracted mRNA is then detected by hybridization (e. g., Northern blot analysis) and/or amplification (e.g., RT-PCR). Preferably quantitative or semi-quantitative RT-PCR is preferred. Realtime quantitative or semi-quantitative RT-PCR is particularly advantageous.

Other methods of amplification include ligase chain reaction (LCR), transcription-mediated amplification, strand displacement amplification (SDA) and nucleic acid sequence based amplification (NASBA).

Nucleic acids having at least 10 nucleotides and exhibiting sequence complementarity or homology to the mRNA of interest herein find utility as hybridization probes or amplification primers. It is understood that such nucleic acids need not be identical, but are typically at least about 80% identical to the homologous region of comparable size, more preferably 85% identical and even more preferably 90-95% identical. In certain embodiments, it will be advantageous to use nucleic acids in combination with appropriate means, such as a detectable label, for detecting hybridization. A wide variety of appropriate indicators are known in the art including, fluorescent, radioactive, enzymatic or other ligands (e. g. avidin/biotin).

The preferred method uses quantitative RT-PCR employing primers of about at least 10 nucleotides that specifically hybridize with of a region of the gene to detect. Two primers that anneal to opposite strands of the target region so as to form an amplification product during a PCR reaction. The amplicon size is typically between about 60 to about 500bp, preferably about 80 to about 250 bp. The primer oligonucleotides generally comprise from 10 to 40 nucleotides, preferably from 10 to 30 nucleotides, still preferably from 15 to 25 nucleotides. The primer oligonucleotides preferably have a melting temperature (Tm) around 56-64°C. The primer oligonucleotides are preferably 100% complementary to a portion of the target sequence.

The RT-qPCR can also advantageously use a probe that is an oligonucleotide that anneals to a sequence on the target DNA found between the forward (5') and reverse (3') PCR primer binding sites. Tm of the probe is generally higher than Tm of the primers

The PCR described herein is thus preferably repeated for two or more cycles, preferably from 10 to 50 cycles. The length and temperature of each step of a PCR cycle, as well as the number of cycles, are adjusted according to the stringency requirements in effect. Annealing temperature and timing are determined both by the efficiency with which a primer is expected to anneal to a template. An annealing temperature of between 30°C and 72°C is used. Initial denaturation of the template molecules normally occurs at between 92°C and 99°C for about 15 seconds, preferably for about 1 or 4 minutes to about 10-15 minutes, followed by 20-50 cycles consisting of denaturation (94-99°C or 15 seconds to 1 minute), annealing (e.g. 60°C; from 15s to 2 minutes), and extension (72°C for 1 minute) for a simple PCR (the extension and the annealing occurring at the same time, in a 60°C step, for 1 min, in a qPCR). An optional final extension step (useful in simple PCR) is generally carried out for about 4 minutes at 72°C, and may be followed by an indefinite (0-24 hour) step at 4°C. Real-time reaction conditions further utilize a nucleic acid detection agent (e.g., dye or probe) in order to measure/detect the PCR product as it is produced.

In another embodiment, the expression level is determined by DNA chip analysis. Such DNA chip or nucleic acid microarray consists of different nucleic acid probes that are chemically attached to a substrate, which can be a microchip, a glass slide or a microsphere-sized bead. A microchip may be constituted of polymers, plastics, resins, polysaccharides, silica or silica-based materials, carbon, metals, inorganic glasses, or nitrocellulose. Probes comprise nucleic acids such as cDNAs or oligonucleotides that may be about 10 to about 60 base pairs. To determine the expression level, a sample from a test subject, optionally first subjected to a reverse transcription, is labelled and contacted with the microarray in hybridization conditions, leading to the formation of complexes between target nucleic acids that are complementary to probe sequences attached to the microarray surface. The labelled hybridized complexes are then detected and can be quantified or semi- quantified. Labelling may be achieved by various methods, e.g. by using radioactive or fluorescent labelling. Many variants of the microarray hybridization technology are available to the man skilled in the art.

In a particular embodiment, the expression level is determined by determining the number of copies of the genes. Comparative genomic hybridization (CGH) was developed to survey DNA copy-number variations across a whole genome. With CGH, differentially labelled test and reference genomic DNAs are co-hybridized to normal metaphase chromosomes, and fluorescence ratios along the length of chromosomes provide a cytogenetic representation of DNA copy-number variation. Array-based CGH, in which fluorescence ratios at arrayed DNA elements provide a locus-by-locus measure of DNA copy-number variation, represents another means of achieving increased mapping resolution.

In a particular embodiment, the expression level of the TIMP3 gene may be determined by assessing the quantity of proteins encoded by the TIMP3 gene (e.g. measuring the concentration of TIMP3 polypeptide in a fluid sample such as for instance a blood sample).

Once the blood sample from the patient is prepared, the concentration of TIMP3 polypeptide may be measured by any known method in the art. Measuring or determining protein expression levels in a biological sample may be performed by any suitable method (see, e.g., Harlow and Lane (1988) "Antibodies: A Laboratory Manual", Cold Spring Harbor Laboratory: Cold Spring Harbor, NY).

Such methods comprise contacting the biological sample with a binding partner capable of selectively interacting with the protein present in said sample. The binding partner is generally an antibody that may be polyclonal or monoclonal, preferably monoclonal, and antigen-binding fragments (e.g., Fab fragments or scFvs) of antibodies. Antibodies, including monoclonal and polyclonal antibodies, fragments and chimeras, may be prepared using methods known in the art (see, for example, Kohler and Milstein (1975) Nature 256:495-497; Kozbor et al. (1985) J Immunol Methods 81 :31-42; Cote et al. (1983) Proc Natl Acad Sci USA 80:2026-203; and Zhang et al. (2002) J Biol Chem 277:39379-39387). Antibodies to be used in the methods of the invention can be purified by methods well known in the art. Antibodies may also be obtained from commercial sources.

Example of said commercial antibodies anti-TIMP3 includes, but are not limited to, the monoclonal anti-TIMP3 antibody [MM0036-7D3] (ab61316) purchased from Abeam.

In certain embodiments, the binding partner is directly or indirectly labeled with a detectable moiety. The role of a detectable agent is to facilitate the detection step of the diagnostic method by allowing visualization of the complex formed by binding of the binding partner to the protein marker (or fragment thereof). The detectable agent can be selected such that it generates a signal that can be measured and whose intensity is related (preferably proportional) to the amount of protein marker present in the sample being analyzed. Methods for labeling biological molecules such as polypeptides and antibodies are well-known in the art. Any of a wide variety of detectable agents can be used in the practice of the present invention. Suitable detectable agents include, but are not limited to: various ligands, radionuclides, fluorescent dyes, chemiluminescent agents, microparticles (such as, for example, quantum dots, nanocrystals, phosphors and the like), enzymes (such as, e.g., those used in an ELISA, i.e., horseradish peroxidase, beta-galactosidase, luciferase, alkaline phosphatase), colorimetric labels, magnetic labels, and biotin, digoxigenin or other haptens and proteins for which antisera or monoclonal antibodies are available.

In certain embodiments, the binding partners (e.g., antibodies) may be immobilized on a carrier or support (e.g., a bead, a magnetic particle, a latex particle, a microtiter plate well, a cuvette, or other reaction vessel). Examples of suitable carrier or support materials include agarose, cellulose, nitrocellulose, dextran, Sephadex^®, Sepharose^®, liposomes, carboxymethyl cellulose, polyacrylamides, polystyrene, gabbros, filter paper, magnetite, ion-exchange resin, plastic film, plastic tube, glass, polyamine-methyl vinyl-ether-maleic acid copolymer, amino acid copolymer, ethylene-maleic acid copolymer, nylon, silk, and the like. Binding partners may be indirectly immobilized using second binding agents specific for the first binding agents (e.g., mouse antibodies specific for the protein markers may be immobilized using sheep anti-mouse IgG Fc fragment specific antibody coated on the carrier or support).

Protein expression levels in a biological sample may be determined using immunoassays. Examples of such assays are time resolved fluorescence immunoassays (T -FIA), radioimmunoassays, enzyme immunoassays (e.g., ELISA), immunofluorescence immunoprecipitation, latex agglutination, hemagglutination, Western blot, and histochemical tests, which are conventional methods well- known in the art. Methods of detection and quantification of the signal generated by the complex formed by binding of the binding agent with the protein marker will depend on the nature of the assay and of the detectable moiety (e.g., fluorescent moiety).

In one example, an immunoassay can be used for detecting and/or measuring the protein expression of TIMP3 protein. For the purposes of detection, an immunoassay can be performed with an antibody that bears a detection moiety (e.g., a fluorescent agent or enzyme). Proteins from a biological sample can be conjugated directly to a solid-phase matrix (e.g., a multi-well assay plate, nitrocellulose, agarose, Sepharose^®, encoded particles, or magnetic beads) or it can be conjugated to a first member of a specific binding pair (e.g., biotin or streptavidin) that attaches to a solid-phase matrix upon binding to a second member of the specific binding pair (e.g., streptavidin or biotin). Such attachment to a solid-phase matrix allows the proteins to be purified away from other interfering or irrelevant components of the biological sample prior to contact with the detection antibody and also allows for subsequent washing of unbound antibody. Here, the presence or amount of bound detectably-labeled antibody indicates the presence or amount of protein in the biological sample. More particularly, an ELISA method can be used, wherein the wells of a microtiter plate are coated with a set of antibodies against TIMP3. A blood sample containing or suspected of containing TIMP3 is then added to the coated wells. After a period of incubation sufficient to allow the formation of antibody-antigen complexes, the plate(s) can be washed to remove unbound moieties and a detectably labeled secondary binding molecule added. The secondary binding molecule is allowed to react with any captured sample marker protein, the plate washed and the presence of the secondary binding molecule detected using methods well known in the art.

Example of said ELISA include, but are not limited to, the Human TIMP3 (MIG-5) ELISA Kit (abll9608) purchased by Abeam, Cambridge, MA, USA as described in the Example Section below.

Alternatively, the protein expression level may be determined using mass spectrometry based methods or image-based methods known in the art for the detection of proteins. Other suitable methods include 2D-gel electrophoresis, proteomics-based methods such as the identification of individual proteins recovered from the gel (e.g., by mass spectrometry or N- terminal sequencing) and/or bioinformatics.

In another embodiment, an immunohistochemistry (IHC) method may be used.

IHC specifically provides a method of detecting a target protein in a biological sample or tissue specimen in situ. The overall cellular integrity of the sample is maintained in IHC, thus allowing detection of both the presence and location of the target of interest. Typically a biological sample is fixed with formalin, embedded in paraffin and cut into sections for staining and subsequent inspection by light microscopy. Current methods of IHC use either direct labelling or secondary antibody-based or hapten-based labelling. Examples of known IHC systems include, for example, EnVision™ (DakoCytomation), Powervision^® (Immunovision, Springdale, Ariz.), the NBA™ kit (Zymed Laboratories Inc., South San Francisco, Calif.), HistoFine^® (Nichirei Corp, Tokyo, Japan).

The method according to the invention then generally involves comparing the expression level of said gene to at least one control value. The term "control value" is a reference value corresponding to the expression level of TIMP3 gene in a group of tumors showing a predetermined response profile, i.e. a group of responder patients or a group of resistant patients (unlikely to respond to the treatment).

The method further comprises determining whether the expression level of TIMP3 gene are high or low compared to the reference expression level. For instance, an increase expression of TIMP3 gene compared to the control value may be indicative of a patient being likely to respond to the treatment, or wherein a decreased expression of TIMP3 gene compared to the control value may be indicative of a patient being unlikely to respond to the treatment. Accordingly, the expression level of TIMP3 gene is informative of the status of the patient who, before any treatment, can be classified as (i) likely to respond, and for whom a treatment with a Dbait molecule described herein is recommended, and (ii) unlikely to respond, and for whom a treatment with such Dbait molecules is not recommended. Accordingly, in one embodiment, the in vitro method for determining the likelihood for a patient affected with a tumor to respond to a treatment with a nucleic acid molecule able to inhibit DNA repair as defined herein, comprises the steps of (i) determining expression level of TIMP3 gene in a biological sample obtained from said patient before treatment and (ii) comparing the expression level of TIMP3 gene determined at step (i) to a reference expression level, wherein an increase of expression level of TIMP3 gene compared to the reference expression level is indicative of a patient being likely to respond to the treatment.

The expression level of TIMP3 gene may also be informative to monitor the efficacy of said treatment, during the course of the treatment. In that situation, the term "control value" may refer to the expression level of TIMP3 gene at a different time. The invention further provides a method for monitoring the patient's response to the treatment. In one embodiment, the in vitro method for monitoring the response of a patient affected with a tumor to respond to a treatment with a nucleic acid molecule able to inhibit DNA repair as defined herein, comprises the steps of (i) determining expression level of TIMP3 gene in a biological sample obtained from said patient during treatment and (ii) comparing the expression level of TIMP3 gene determined at step (i) to a reference expression level, wherein a change the expression level of TIMP3 gene compared to the reference expression level is indicative of the patient responds to the treatment.

It should be further noted that when a change in expression level of TIMP3 gene (m NA or protein) is detected, it may be useful to determine the presence of an epigenetic modification of TIMP3 gene (e.g. the DNA methylation of the TIMP3 gene promoter) and thus determine the reason of this change. Accordingly, the invention also relates to a method for determining the likelihood for a patient affected with a tumor to respond to a treatment with a nucleic acid molecule able to inhibit DNA repair (Dbait molecule), said method comprises detecting an epigenetic modification of TIMP3 gene in a biological sample obtained from said patient, wherein the presence of an epigenetic modification of TIMP3 gene is indicative of a patient being likely to respond to the treatment.

Epigenetic modification of a gene can be determined by any method known in the art. One method is to determine the presence of methylated CpG dinucleotide motifs in the silenced gene or the absence of methylation CpG dinucleotide motifs in the activated gene. Typically these methylated motifs reside near the transcription start site, for example, within about 3 kbp, within about 2.5 kbp, within about 2 kbp, within about 1.5 kbp, within about 1 kbp, within about 750 bp, or within about 500 bp. CpG dinucleotides susceptible to methylation are typically concentrated in the promoter region, intron region or exon region of human genes. Thus, the methylation status of the promoter and/or intron and/or exon region of at least one gene can be assessed.

In one embodiment, the epigenetic modification of TIMP3 gene is DNA methylation.

In a particular embodiment, the epigenetic modification of TIMP3 gene is the DNA methylation of the

TIMP3 gene promoter.

One of the principle mechanisms of epigenetic gene regulation is DNA methylation in which methyl groups are added to CpG sites within DNA sequences. Levels of DNA methylation are correlated with gene expression and low levels of methylation are typically associated with increased gene expression and high levels with reduced expression or gene silencing.

Thus, an epigenetic modification of the TIMP3 gene such as DNA methylation of the TIMP3 gene promoter results in a decreased expression of TIMP3. DNA methylation of the TIMP3 gene promoter can be monitored using bisulfite DNA treatment and sequencing. Briefly, genomic DNA isolated from cells of interest is modified by bisulfite treatment according to the manufacturer's instructions (MethylDetector, Active Motif). Converted TIMP3 promoter DNA is identified by PC with specific primers and direct sequencing reaction is performed using standard conditions according to the manufacturer's instructions (Applied Biosystems). Alternatively, DNA methylation analysis has also been performed successfully with a number of techniques which include the MALDI-TOFF, MassARRAY, MethyLight, Quantitative analysis of ethylated alleles (QAMA), enzymatic regional methylation assay (ERMA), HeavyMethyl, QBSUPT, MS-SNuPE, MethylQuant, Quantitative PCR sequencing, and Oligonucleotide-based microarray systems.

Nucleic acid molecules able to inhibit DNA repair (DBait molecules):

The signal interfering DNA (siDNA) designed to counteract DNA repair also known as DBait molecules encompassed in the invention can be described by one of the following formulae:

(I) {C-L_m)p NNNN-(N L-N

NN NN-(N)„-N

(ID

wherein N is a deoxynucleotide, n is an integer from 1 to 195, the underlined N refers to a nucleotide having or not a modified phosphodiester backbone, L' is a linker, C is the molecule facilitating endocytosis selected from a lipophilic molecule or a ligand which targets cell receptor enabling receptor mediated endocytosis, L is a linker, m and p, independently, are an integer being 0 or 1.

In preferred embodiments, the molecule of formulae (I), (II), or (III) has one or several of the following features:

- N is a deoxynucleotide, preferably selected from the group consisting of A (adenine), C (cytosine), T (thymine) and G (guanine) and selected so as to avoid occurrence of a CpG dinucleotide and to have less than 80% or 70%, even less than 60% or 50% sequence identity to any gene in a human genome.; and/or,

- n is an integer from 1 to 195, preferably from 3 to 195, optionally from 1 to 95, from 2 to 95, from 3 to 95, from 5 to 95, from 15 to 195, from 19-95, from 21 to 95, from 27 to 95, from 1 to 45, from 2 to 35, from 3 to 35, from 5 to 35, from 15 to 45, from 19 to 45, from 21 to 45, or from 27 to 45. In a particularly preferred embodiment, n is 27; and/or,

- the underlined N refers to a nucleotide having or not a phosphorothioate or methylphosphonate backbone, more preferably a phosphorothioate backbone; preferably, the underlined N refers to a nucleotide having a modified phosphodiester backbone; and/or,

- the linked L' is selected from the group consisting of hexaethyleneglycol, tetradeoxythymidylate (T4) and l,19-bis(phospho)-8-hydraza-2-hydroxy-4-oxa-9-oxo-nonadecane; and/or,

- m is 1 and L is a carboxamido polyethylene glycol, more preferably carboxamido triethylene or tetraethylene glycol; and/or,

- C is selected from the group consisting of a cholesterol, single or double chain fatty acids such as octadecyl, oleic acid, dioleoyl or stearic acid, or ligand (including peptide, protein, aptamer) which targets cell receptor such as folic acid, tocopherol, sugar such as galactose and mannose and their oligosaccharide, peptide such as GD and bombesin, and protein such transferring and integrin, preferably is a cholesterol or a tocopherol, still more preferably a cholesterol. Preferably, C-Lm is a triethyleneglycol linker (10-O-[l-propyl-3-N-carbamoylcholesteryl]- triethyleneglycol radical. Alternatively, C-Lm is a tetraethyleneglycol linker (10-O-[l-propyl-3-N- carbamoylcholesteryl]-tetraethyleneglycol radical.

In a particular embodiment, the nucleic acid molecules can be Dbait molecules such as those extensively described in PCT patent applications WO2005/040378, WO2008/034866 and WO2008/084087, the disclosure of which is incorporated herein by reference.

Dbait molecules may be defined by a number of characteristics necessary for their therapeutic activity, such as their minimal length, the presence of at least one free end, and the presence of a double stranded portion, preferably a DNA double stranded portion. As will be discussed below, it is important to note that the precise nucleotide sequence of Dbait molecules does not impact on their activity. Furthermore, Dbait molecules may contain a modified and/or non-natural backbone.

Preferably, Dbait molecules are of non-human origin (i.e., their nucleotide sequence and/or conformation (e.g., hairpin) does not exist as such in a human cell), most preferably of synthetic origin. As the sequence of the Dbait molecules plays little, if any, role, Dbait molecules have preferably no significant degree of sequence homology or identity to known genes, promoters, enhancers, 5'- or 3'- upstream sequences, exons, introns, and the like. In other words, Dbait molecules have less than 80% or 70%, even less than 60% or 50% sequence identity to any gene in a human genome. Methods of determining sequence identity are well known in the art and include, e.g., Blast. Dbait molecules do not hybridize, under stringent conditions, with human genomic DNA. Typical stringent conditions are such that they allow the discrimination of fully complementary nucleic acids from partially complementary nucleic acids.

In addition, the sequence of the Dbait molecules is preferably devoid of CpG in order to avoid the well-known toll-like receptor-mediated immunological reactions.

The length of Dbait molecules may be variable, as long as it is sufficient to allow appropriate binding of Ku protein complex comprising Ku and DNA-PKcs proteins. It has been showed that the length of Dbait molecules must be greater than 20 bp, preferably about 32 bp, to ensure binding to such a Ku complex and allowing DNA-PKcs activation. Preferably, Dbait molecules comprise between 20-200 bp, more preferably 24-100 bp, still more preferably 26-100, and most preferably between 24-200, 25-200, 26-200, 27-200, 28-200, 30-200, 32-200, 24-100, 25-100, 26-100, 27-100, 28-100, 30-100, 32- 200 or 32-100 bp. For instance, Dbait molecules comprise between 24-160, 26-150, 28-140, 28-200, 30-120, 32-200 or 32-100 bp. By "bp" is intended that the molecule comprise a double stranded portion of the indicated length. In a particular embodiment, the Dbait molecules having a double stranded portion of at least 32 pb, or of about 32 bp, comprise the same nucleotide sequence than Dbait32, Dbait32Ha, Dbait32Hb, Dbait32Hc or Dbait32Hd. Optionally, the Dbait molecules have the same nucleotide composition than Dbait32, Dbait32Ha, Dbait32Hb, Dbait32Hc or Dbait32Hd but their nucleotide sequence is different. Then, the Dbait molecules comprise one strand of the double stranded portion with 3 A, 6 C, 12 G and 11 T. Preferably, the sequence of the Dbait molecules does not contain any CpG dinucleotide.

Alternatively, the double stranded portion comprises at least 16, 18, 20, 22, 24, 26, 28, 30 or 32 consecutive nucleotides of Dbait32, Dbait32Ha, Dbait32Hb, Dbait32Hc or Dbait32Hd. In a more particular embodiment, the double stranded portion consists in 20, 22, 24, 26, 28, 30 or 32 consecutive nucleotides of Dbait32, Dbait32Ha, Dbait32Hb, Dbait32Hc or Dbait32Hd.

The nucleic acid as disclosed herein must have at least one free end, as a mimic of DSB.

In a particular embodiment, they contain only one free end. Preferably, Dbait molecules are made of hairpin nucleic acids with a double-stranded DNA stem and a loop. The loop can be a nucleic acid, or other chemical groups known by skilled person or a mixture thereof. A nucleotide linker may include from 2 to 10 nucleotides, preferably, 3, 4 or 5 nucleotides. Non-nucleotide linkers non exhaustively include abasic nucleotide, polyether, polyamine, polyamide, peptide, carbohydrate, lipid, polyhydrocarbon, or other polymeric compounds (e. g. oligoethylene glycols such as those having between 2 and 10 ethylene glycol units, preferably 3, 4, 5, 6, 7 or 8 ethylene glycol units). A preferred linker is selected from the group consisting of hexaethyleneglycol, tetradeoxythymidylate (T4) and other linkers such as l,19-bis(phospho)-8-hydraza-2-hydroxy-4-oxa-9-oxo-nonadecane and 2,19- bis(phosphor)-8-hydraza-l-hydroxy-4-oxa-9-oxo-nonadecane. Accordingly, in a particular embodiment, the Dbait molecules can be a hairpin molecule having a double stranded portion or stem comprising at least 16, 18, 20, 22, 24, 26, 28, 30 or 32 consecutive nucleotides of Dbait32, Dbait32Ha, Dbait32Hb, Dbait32Hc or Dbait32Hd and a loop being a hexaethyleneglycol linker, a tetradeoxythymidylate linker (T4) l,19-bis(phospho)-8-hydraza-2-hydroxy-4-oxa-9-oxo-nonadecane or 2,19-bis(phosphor)-8-hydraza-l-hydroxy-4-oxa-9-oxo-nonadecane. In a more particular embodiment, those Dbait molecules can have a double stranded portion consisting in 20, 22, 24, 26, 28, 30 or 32 consecutive nucleotides of Dbait32, Dbait32Ha, Dbait32Hb, Dbait32Hc or Dbait32Hd. Dbait molecules preferably comprise a 2'-deoxynucleotide backbone, and optionally comprise one or several (2, 3, 4, 5 or 6) modified nucleotides and/or nucleobases other than adenine, cytosine, guanine and thymine. Accordingly, the Dbait molecules are essentially a DNA structure. In particular, the double-strand portion or stem of the Dbait molecules is made of deoxyribonucleotides. Preferred Dbait molecules comprise one or several chemically modified nucleotide(s) or group(s) at the end of one or of each strand, in particular in order to protect them from degradation. In a particular preferred embodiment, the free end(s) of the Dbait molecules is(are) protected by one, two or three modified phosphodiester backbones at the end of one or of each strand. Preferred chemical groups, in particular the modified phosphodiester backbone, comprise phosphorothioates. Alternatively, preferred Dbait have 3'- 3' nucleotide linkage, or nucleotides with methylphosphonate backbone. Other modified backbones are well known in the art and comprise phosphoramidates, morpholino nucleic acid, 2'-0,4'-C methylene/ethylene bridged locked nucleic acid, peptide nucleic acid (PNA), and short chain alkyl, or cycloalkyi intersugar linkages or short chain heteroatomic or heterocyclic intrasugar linkages of variable length, or any modified nucleotides known by skilled person. In a first preferred embodiment, the Dbait molecules have the free end(s) protected by one, two or three modified phosphodiester backbones at the end of one or of each strand, more preferably by three modified phosphodiester backbones (in particular phosphorothioate or methylphosphonate) at least at the 3'end, but still more preferably at both 5' and 3' ends. In a most preferred embodiment, the Dbait molecule is a hairpin nucleic acid molecule comprising a DNA double-stranded portion or stem of 32 bp and a loop linking the two strands of the DNA double- stranded portion or stem comprising or consisting of a linker selected from the group consisting of hexaethyleneglycol, tetradeoxythymidylate (T4) and l,19-bis(phospho)-8-hydraza-2-hydroxy-4-oxa-9- oxo-nonadecane and 2,19-bis(phosphor)-8-hydraza-l-hydroxy-4-oxa-9-oxo-nonadecane, the free ends of the DNA double-stranded portion or stem (i.e. at the opposite of the loop) having three modified phosphodiester backbones (in particular phosphorothioate internucleotidic links).

Said nucleic acid molecules are made by chemical synthesis, semi-biosynthesis or biosynthesis, any method of amplification, followed by any extraction and preparation methods and any chemical modification. Linkers are provided so as to be incorporable by standard nucleic acid chemical synthesis.

More preferably, nucleic acid molecules are manufactured by specially designed convergent synthesis: two complementary strands are prepared by standard nucleic acid chemical synthesis with the incorporation of appropriate linker precursor, after their purification, they are covalently coupled together. The molecules facilitating endocytosis are conjugated to Dbait molecules, preferably through a linker. Any linker known in the art may be used to covalently attach the molecule facilitating endocytosis to Dbait molecules For instance, WO09/126933 provides a broad review of convenient linkers pages 38- 45. The linker can be non-exhaustively, aliphatic chain, polyether, polyamine, polyamide, peptide, carbohydrate, lipid, polyhydrocarbon, or other polymeric compounds (e. g. oligoethylene glycols such as those having between 2 and 10 ethylene glycol units, preferably 3, 4, 5, 6, 7 or 8 ethylene glycol units, still more preferably 3 ethylene glycol units), as well as incorporating any bonds that may be break down by chemical or enzymatical way, such as a disulfide linkage, a protected disulfide linkage, an acid labile linkage (e.g., hydrazone linkage), an ester linkage, an ortho ester linkage, a phosphonamide linkage, a biocleavable peptide linkage, an azo linkage or an aldehyde linkage. Such cleavable linkers are detailed in WO2007/040469 pages 12-14, in WO2008/022309 pages 22-28.

In a particular embodiment, the nucleic acid molecule can be linked to one molecule facilitating endocytosis. Alternatively, several molecules facilitating endocytosis (e.g., two, three or four) can be attached to one nucleic acid molecule.

In a specific embodiment, the linker between the molecule facilitating endocytosis, in particular cholesterol, and nucleic acid molecule is CO-NH-(CH2-CH₂-0)_n, wherein n is an integer from 1 to 10, preferably n being selected from the group consisting of 3, 4, 5 and 6. In a very particular embodiment, the linker is CO-NH-(CH2-CH₂-0)₄ (carboxamido tetraethylene glycol) or CO-NH-(CH₂- CH₂-0)₃ (carboxamido triethylene glycol). The linker can be linked to nucleic acid molecules at any convenient position which does not modify the activity of the nucleic acid molecules. In particular, the linker can be linked at the 5' end. Therefore, in a preferred embodiment, the contemplated conjugated Dbait molecule is a Dbait molecule having a hairpin structure and being conjugated to the molecule facilitating endocytosis, preferably through a linker, at its 5' end. In another specific embodiment, the linker between the molecule facilitating endocytosis, in particular cholesterol, and nucleic acid molecule is dialkyl-disulfide {e.g., (CH₂)_r-S-S-(CH2)_s with r and s being integer from 1 to 10, preferably from 3 to 8, for instance 6}.

In a most preferred embodiment, the conjugated Dbait molecule is a hairpin nucleic acid molecule comprising a DNA double-stranded portion or stem of 32 bp and a loop linking the two strands of the DNA double-stranded portion or stem comprising or consisting of a linker selected from the group consisting of hexaethyleneglycol, tetradeoxythymidylate (T4), l,19-bis(phospho)-8-hydraza-2- hydroxy-4-oxa-9-oxo-nonadecane and 2,19-bis(phosphor)-8-hydraza-l-hydroxy-4-oxa-9-oxo- nonadecane, the free ends of the DNA double-stranded portion or stem (i.e. at the opposite of the loop) having three modified phosphodiester backbones (in particular phosphorothioate internucleotidic links) and said Dbait molecule being conjugated to a cholesterol at its 5' end, preferably through a linker (e.g. carboxamido oligoethylene glycol, preferably carboxamido triethylene or tetraethylene glycol). In a particular embodiment, the nucleic acid molecules can be conjugated Dbait molecules such as those extensively described in PCT patent application WO2011/161075, the disclosure of which is incorporated herein by reference. In a preferred embodiment, NNNN-(N)_n-N comprises at least 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30 or 32 consecutive nucleotides of Dbait32, Dbait32Ha, Dbait32Hb, Dbait32Hc or Dbait32Hd or consists in 20, 22, 24, 26, 28, 30 or 32 consecutive nucleotides of Dbait32, Dbait32Ha, Dbait32Hb, Dbait32Hc or Dbait32Hd. In a particular embodiment, NNNN-(N)_n-N comprises or consists in Dbait32, Dbait32Ha, Dbait32Hb, Dbait32Hc or Dbait32Hd, more preferably Dbait32Hc.

In a preferred embodiment, the Dbait molecule or hairpin nucleic acid molecule has the following formulae

Wherein

- NNNN-(N)_n-N comprises at 28, 30 or 32 nucleotides , preferably 32 nucleotides and/or

- the underlined nucleotide refers to a nucleotide having or not a phosphorothioate or methylphosphonate backbone, more preferably a phosphorothioate backbone; preferably, the underlined nucleotide refers to a nucleotide having a phosphorothioate or methylphosphonate backbone, more preferably a phosphorothioate backbone and/or, - the linked L' is selected from the group consisting of hexaethyleneglycol, tetradeoxythymidylate (T4) and l,19-bis(phospho)-8-hydraza-2-hydroxy-4-oxa-9-oxo-nonadecane; and/or,

- p is 1; and/or, - C is selected from the group consisting of a cholesterol, single or double chain fatty acids such as octadecyl, oleic acid, dioleoyl or stearic acid, or ligand (including peptide, protein, aptamer) which targets cell receptor such as folic acid, tocopherol, sugar such as galactose and mannose and their oligosaccharide, peptide such as GD and bombesin, and protein such transferring and integrin, preferably is a cholesterol. In a very specific embodiment, the Dbait molecule or hairpin nucleic acid molecule (AsiDNA or DT01) has the following formula:

___ GCTGTGCCCACAACCCAGCAAACAAGCCTAGA-

L'

CGACACGGGTGTTGGGTCGTTTGTTCGGATCT

(Ma) (SEQ ID NO: 1) wherein C-L_m is the tetraethyleneglycol linker (10-O-[l-propyl-3-N-carbamoylcholesteryl]- tetraethyleneglycol radical, and L' is l,19-bis(phospho)-8-hydraza-2-hydroxy-4-oxa-9-oxo- nonadecane; also represented by the following formulae:

The patient: The patient to treat, who is preferably a human patient, is affected with a tumor, in particular a cancer tumor. The tumor may be a haematologic cancer, in particular acute myelogenous leukaemia (AML), chronic lymphocytic leukaemia (CLL), multiple myeloma, Hodgkin's disease, non- Hodgkin's lymphoma, B cell, cutaneous T cell lymphoma, or a non-haematologic cancer, for instance brain, epidermoid (in particular lung, breast, ovarian), head and neck (squamous cell), bladder, gastric, pancreatic, head, neck, renal, colon, prostate, colorectal, oesophageal or thyroid cancer, and melanoma. Different types of cancers may include, but are not limited to fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendothelio-sarcoma, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, lymphoma, leukemia, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilms' tumor, cervical cancer, testicular tumor, lung carcinoma, small cell lung carcinoma, bladder carcinoma, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, melanoma, neuroblastoma, and retinoblastoma, uveal melanoma and breast cancer.

The tumor may be any tumor or cancer, such as a breast tumor, an ovarian tumor, a lung tumor or a prostate tumor. In one embodiment, the cancer can be selected from melanoma, glioblastoma, breast cancer, colon cancer, lung cancer, gastrointestinal cancer, liver cancer and head and neck cancer. In a preferred embodiment, the cancer tumor is a melanoma.

Treatment:

The invention also relates to the a nucleic acid molecule able to inhibit DNA repair (Dbait molecule), as above-defined, for use in treating a tumor in a patient, which patient has been classified as being likely to respond by a method of the invention as described above. It is further provided a method for treating a patient affected with a tumor, which method comprises administering a Dbait molecule as described herein, optionally in combination with an anti-tumor agent, such as a DNA damaging agent or radiotherapy, to said patient, wherein said patient has been previously classified as "responder" by the method described herein, comprising determining expression level of TIMP3 gene, in a biological sample of said patient, before or during the course of the treatment. Dbait molecules as defined herein, can be used alone or in combination with an anti-tumor treatment, preferably a DNA damaging agent or radiotherapy, for simultaneous administration (i.e., at the same time, as a single composition or separate compositions), or sequential administration.

DNA damaging treatment:

In addition to the Dbait molecules, preferably conjugated Dbait molecules, the treatment may also further comprise an antitumor treatment, preferably a treatment by a DNA damaging agent or radiotherapy. The DNA-damaging treatment can be radiotherapy or chemotherapy with a DNA- damaging antitumor agent, or a combination thereof.

DNA strand breakage can be achieved by ionized radiation (radiotherapy). Radiotherapy includes, but is not limited to, γ-rays, X-rays, and/or the directed delivery of radioisotopes to tumor cells. Other radiotherapies include microwaves and UV-irradiation. Other approaches to radiation therapy are also contemplated in the present invention.

The DNA-damaging antitumor agent is preferably selected from the group consisting of an inhibitor of topoisomerases I or II, a DNA crosslinker, a DNA alkylating agent, an anti-metabolic agent and inhibitors of the mitotic spindles.

Inhibitors of topoisomerases I and/or II include, but are not limited to, etoposide, topotecan, camptothecin, irinotecan, amsacrine, intoplicine, anthracyclines such as doxorubicin, epirubicine, daunorubicine, idanrubicine and mitoxantrone. Inhibitors of Topoisomerase I and II include, but are not limited to, intoplecin. In a preferred embodiment, the DNA-damaging antitumor agent is doxorubicin.

DNA crosslinkers include, but are not limited to, cisplatin, carboplatin and oxaliplatin. In a preferred embodiment, the DNA-damaging antitumor agent is selected from the group consisting of carboplatin and oxaliplatin.

Anti-metabolic agents block the enzymes responsible for nucleic acid synthesis or become incorporated into DNA, which produces an incorrect genetic code and leads to apoptosis. Non- exhaustive examples thereof include, without limitation, folic acid antagonists, pyrimidine analogs, purine analogs and adenosine deaminase inhibitors, and more particularly Methotrexate, Floxuridine, Cytarabine, 6-Mercaptopurine, 6- Thioguanine, Fludarabine phosphate, Pentostatine, 5- fluorouracil (5-FU), gemcitabine and capecitabine. The DNA-damaging anti-tumor agent can be alkylating agents including, without limitation, nitrogen mustards, ethylenimine derivatives, alkyl sulfonates, nitrosoureas, metal salts and triazenes. Non- exhaustive examples thereof include Uracil mustard, Chlormethine, Cyclophosphamide (CYTOXAN^®), Ifosfamide, Melphalan, Chlorambucil, Pipobroman, Triethylenemelamine,

Triethylenethiophosphoramine, Busulfan, Carmustine, Lomustine, Fotemustine, cisplatin, carboplatin, oxaliplatin, thiotepa, Streptozocin, Dacarbazine, and Temozolomide.

Inhibitors of the mitotic spindles include, but are not limited to, paclitaxel, docetaxel, vinorelbine, larotaxel (also called X P9881; Sanofi-Aventis), XRP6258 (Sanofi-Aventis), BMS-184476 (Bristol- Meyer-Squibb), BMS-188797 (Bristol-Meyer-Squibb), BMS-275183 (Bristol-Meyer-Squibb), ortataxel (also called IDN 5109, BAY 59-8862 or SB-T-101131 ; Bristol-Meyer-Squibb), RPR 109881A (Bristol- Meyer-Squibb), RPR 116258 (Bristol-Meyer-Squibb), NBT-287 (TAPESTRY), PG-paclitaxel (also called CT-2103, PPX, paclitaxel poliglumex, paclitaxel polyglutamate or Xyotax™), ABRAXANE^® (also called Nab-Paclitaxel ; ABRAXIS BIOSCIENCE), Tesetaxel (also called DJ-927), IDN 5390 (INDENA), Taxoprexin (also called docosahexanoic acid-paclitaxel ; PROTARGA), DHA-paclitaxel (also called Taxoprexin^®), and MAC-321 (WYETH). Also see the review of Hennenfent & Govindan (2006, Annals of Oncology, 17, 735-749).

Preferably, the DNA-damaging antitumor agent is an inhibitor of topoisomerases I and/or II, a DNA crosslinker, an anti-metabolic agent or a combination thereof. In a preferred embodiment, the DNA- damaging antitumor agent is selected from the group consisting of doxorubicin, 5-FU, carboplatin and oxaliplatin or a combination thereof. In a most preferred embodiment, the conjugated DBait molecule is DT01 (now called AsiDNA) and the DNA-damaging antitumor agent is selected from the group consisting of doxorubicin, carboplatin, 5-FU and oxaliplatin. Tumor to be treated

The terms "tumor", "cancer" or "cancerous" refer to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth. Examples of cancer include, for example, leukemia, lymphoma, blastoma, carcinoma and sarcoma. More particular examples of such cancers include chronic myeloid leukemia, acute lymphoblastic leukemia, Philadelphia chromosome positive acute lymphoblastic leukemia (Ph+ ALL), squamous cell carcinoma, small-cell lung cancer, non-small cell lung cancer, glioma, gastrointestinal cancer, renal cancer, ovarian cancer, liver cancer, colorectal cancer, endometrial cancer, kidney cancer, prostate cancer, thyroid cancer, neuroblastoma, pancreatic cancer, glioblastoma multiforme, cervical cancer, stomach cancer, bladder cancer, hepatoma, breast cancer, colon carcinoma, and head and neck cancer, gastric cancer, germ cell tumor, pediatric sarcoma, sinonasal natural killer, multiple myeloma, acute myelogenous leukemia (AML), chronic lymphocytic leukemia, mastocytosis and any symptom associated with mastocytosis. In one embodiment, the cancer can be selected from melanoma, glioblastoma, breast cancer, colon cancer, lung cancer, gastrointestinal cancer, liver cancer and head and neck cancer.

In a particular embodiment, the cancer is a radioresistant or chemoresistant cancer. More particularly, the cancer is selected from the group consisting of a radioresistant melanoma, a triple- negative breast cancer (TNBC), a chemoresistant hepatocellular carcinoma (HCC), a chemoresistant lung cancer, a chemoresistant ovarian cancer and a metastatic liver cancer. More specifically, the cancer is selected from the group consisting of a doxorubicin-resistant hepatocarcinoma (HCC), a platinum-resistant triple-negative breast cancer, a platinum-resistant ovarian cancer and a colorectal liver metastasis. Regimen, dosages and administration routes

The effective dosage of each of the combination partners employed in the combined preparation of the invention may vary depending on the particular compound or pharmaceutical composition employed, the mode of administration, the condition being treated, the severity of the condition being treated. Thus, the dosage regimen of the combined preparation of the invention is selected in accordance with a variety of factors including the route of administration and the patient status. A physician, clinician or veterinarian of ordinary skill can readily determine and prescribe the effective amount of the single active ingredients required to prevent, counter or arrest the progress of the condition. Optimal precision in achieving concentration of the active ingredients within the range that yields efficacy without toxicity requires a regimen based on the kinetics of the active ingredients' availability to target sites.

When a DNA-damaging antitumor agent is used in combination with the Dbait molecule (preferably a conjugated Dbait molecule), the DNA-damaging antitumor agent and the Dbait molecules may be administered by the same route or by distinct routes. The administration route for the DNA- damaging antitumor agent may be oral, parenteral, intravenous, intratumoral, subcutaneous, intracranial, intraartery, topical, rectal, transdermal, intradermal, nasal, intramuscular, intraosseous, and the like.

The Dbait molecule (preferably a conjugated Dbait molecule) is to be administered before and/or simultaneously with and/or after the irradiation and/or the administration of the DNA-damaging antitumor agent, more preferably before and/or simultaneously with the irradiation and/or the administration of the DNA-damaging antitumor agent. The irradiation and/or the administration of the DNA-damaging antitumor agent is performed so as the Dbait molecules are present in the tumoral cells when the irradiation is applied or when the DNA-damaging antitumor agent reach the tumoral cells. The physician, clinician or veterinarian of ordinary skill can determine the regimen based on the active ingredients, their kinetics of availability to target sites or their pharmacokinetic profiles in plasma. Preliminary results indicate that Dbait molecules stay active during one day. In a first preferred embodiment, the irradiation is to be applied or the DNA-damaging antitumor agent is to be administered at the beginning of the treatment with Dbait molecules or after the treatment with Dbait molecules. For instance, the irradiation is to be applied or the DNA-damaging antitumor agent is to be administered 3-24 h after the beginning of the treatment with Dbait molecules. The DNA-damaging antitumor agent and Dbait molecules may also be simultaneously administered.

Once the treatment by radiotherapy or with the DNA-damaging antitumor agent has begun, the treatment with the Dbait molecules (preferably conjugated Dbait molecules) can continue as long as the treatment by radiotherapy or with the DNA-damaging antitumor agent is to be applied or administered. Alternatively, the treatment with the conjugated Dbait molecules can also end.

For Dbait molecules (preferably a conjugated Dbait molecules), the effective dosage of the DNA- damaging antitumor agent employed in the combined preparation may vary depending on the mode of administration, the condition being treated, the severity of the condition being treated. Thus, the dosage regimen of the Dbait molecules (preferably conjugated Dbait molecule) is selected in accordance with a variety of factors including the route of administration and the patient status. A physician, clinician or veterinarian of ordinary skill can readily determine and prescribe the effective amount of the Dbait molecules required to prevent, counter or arrest the progress of the cancer, in particular in combination with the selected DNA damaging treatment. The one skilled in the art can adapt the amount in order to obtain an efficient amount of the Dbait molecules (preferably conjugated Dbait molecules) in the tumor of at least 0.01 mg per 1 cm³ of tumor, preferably 0.1 - 40 mg per 1 cm³ of tumor, most preferably 1 - 20 mg per 1 cm³ of tumor, in particular in a daily treatment protocol or in a weekly treatment protocol. For instance, for a intravenous, intraperitoneal or intraarterial route, the efficient amount or unit dosage of the Dbait molecules may be of 0.1 to 100 mg, preferably of 4 to 40 mg. Accordingly, the efficient amount or unit dosage of the Dbait molecules may be of 0.06 to 0.6 mg/kg of patient. Of course, the dosage and the regimen can be adapted by the one skilled in art in consideration of the chemotherapy and/or radiotherapy regimen.

For radiotherapy, any radiotherapy regimen known in the art may be used, in particular stereotactic irradiation (e.g., 15 Gy) or a fractionated irradiation. The use of a fractionated irradiation may be particularly efficient, for instance irradiation may applied every day or every 2-5 days, preferably every 3-4 days, in a period of one, two, three, four, five or six weeks. The irradiation may be from 1 to 10 Gy, preferably from 2 to 5 Gy, in particular 2, 3, 4 or 5 Gy. For instance, fractionated irradiation of 15x2Gy in six weeks, or of 4 to 6x5Gy in two weeks may be contemplated. In a preferred embodiment, the contemplated radiotherapy is a protocol with 4 irradiations of 5 Gy in two weeks. Different regimens or conditions of combined treatments of cancer with irradiation and Dbait molecules have been tested and allowed to demonstrate the radio-sensibilization of tumors by Dbait molecules depends on the doses of Dbait molecules but not of the irradiation doses.

For chemotherapy, the effective dosage of the DNA-damaging antitumor agent employed in the combined preparation, kit or product of the invention or in combination with the composition of the invention may vary depending on the particular DNA-damaging antitumor agent employed, the mode of administration, the condition being treated, the severity of the condition being treated. Thus, the dosage regimen of the DNA-damaging antitumor agent is selected in accordance with a variety of factors including the route of administration and the patient status. A physician, clinician or veterinarian of ordinary skill can readily determine and prescribe the effective amount of the DNA- damaging antitumor agent required to prevent, counter or arrest the progress of the cancer.

The treatment may include one or several cycles, for instance two to ten cycles, in particular two, three, four or five cycles. The cycles may be continued or separated. For instance, each cycle is separated by a period of time of one to eight weeks, preferably three to four weeks.

In one embodiment, a quinoline endosomolytic agent is to be administered before and/or simultaneously with the nucleic acid molecule, preferably the conjugated nucleic acid molecule. In particular, the quinoline endosomolytic agent is to be administered as a pre-treatment of at least one week by oral route, and then the nucleic acid molecule and the quinoline endosomolytic agent are to be administered as a combined preparation for simultaneous, separate or sequential use.

In a preferred embodiment, the quinoline endosomolytic agent is chloroquine or hydroxychloroquine, preferably chloroquine.

Further aspects and advantages of the present invention will be disclosed in the following experimental section, which should be regarded as illustrative and not limiting the scope of the present application.

Markers of sensitivity to a Dbait molecule

It has been also found that marker sets consisting of particular genes differentially expressed in tumors advantageously provide improved accuracy of determining sensitivity to a Dbait molecule and therefore predicting effectiveness of a treatment against a cancer with a Dbait molecule as defined herein. The marker sets of the invention may be used in a clinical setting to provide information about the likelihood that a cancer patient would or would not respond to a treatment with such Dbait molecule. The marker sets of the invention makes it possible to classify the patient as either a potential responder or a non-responder.

Accordingly, the invention provides an in vitro method for determining the sensitivity of a cancer cell and/or a tumor to a Dbait molecule, which method comprises determining the expression level of at least one gene selected from the group consisting of PPP2R5C, CCNA1, FANCE, CULl, MRE11A, MAX, XRCC1, PPP2R5D or AKT3 genes in said cancer cell and/or a tumor.

The invention provides an in vitro method for determining the likelihood for a patient affected with a tumor to respond to a treatment with to a Dbait molecule, which method comprises determining the expression level of at least one gene selected from the group consisting of PPP2R5C, CCNA1, FANCE, CULl, MRE11A, MAX, XRCC1, PPP2R5D or AKT3 genes in a biological sample of said patient.

As used herein, the term "PPP2R5C" refers to a gene that encodes the serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit gamma isoform consisting of 524 amino acids. A sequence of human PPP2R5C mRNA is available on Genbank Access Number NM_001161725. A sequence of human PPP2R5C protein is available on Genbank Access Number NP_001155197. The term "PPP2R5C" includes naturally occurring PPP2R5C polypeptide as well as variants, fragments and modified forms thereof.

As used herein, the term "CCNA1" refers to a gene that belongs to the highly conserved cyclin family and encodes the Cyclin Al consisting of 464 amino acids. A sequence of human CCNA1 mRNA is available on Genbank Access Number NM_001111045. A sequence of human CCNA1 protein is available on Genbank Access Number NP_001104515. The term "CCNA1" includes naturally occurring CCNA1 polypeptide as well as variants, fragments and modified forms thereof.

As used herein, the term "FANCE" refers to a gene that encodes the Fanconi anemia group E protein consisting of 536 amino acids. A sequence of human FANCE mRNA is available on Genbank Access Number NM_021922. A sequence of human FANCE protein is available on Genbank Access Number NP_068741. The term "FANCE" includes naturally occurring FANCE polypeptide as well as variants, fragments and modified forms thereof.

As used herein, the term "CULl" refers to a gene from cullin family that encodes the Cullin 1 consisting of 776 amino acids and involved in in protein degradation and protein ubiquitination. A sequence of human CULl mRNA is available on Genbank Access Number NM_003592. A sequence of human CUL1 protein is available on Genbank Access Number NP_003583. The term "CUL1" includes naturally occurring CUL1 polypeptide as well as variants, fragments and modified forms thereof.

As used herein, the term "MRE11A" refers to a gene that encodes the soluble-strand break repair protein MRE11A consisting of 680 amino acids. A sequence of human MRE11A mRNA is available on Genbank Access Number NM_005590. A sequence of human MRE11A protein is available on Genbank Access Number NP_005581. The term "MRE11A" includes naturally occurring MRE11A polypeptide as well as variants, fragments and modified forms thereof.

As used herein, the term "MAX" refers to a gene that encodes a basic helix-loop-helix/leucine zipper protein called Myc-associated factor X consisting of 87 amino acids. A sequence of human MAX mRNA is available on Genbank Access Number NM_001271068. A sequence of human MAX protein is available on Genbank Access Number NP_001257997. The term "MAX" includes naturally occurring MAX polypeptide as well as variants, fragments and modified forms thereof.

As used herein, the term "XRCC1" refers to a gene that encodes DNA repair protein XRCC1 also known as X-ray repair cross-complementing protein 1 consisting of 633 amino acids. A sequence of human XRCC1 mRNA is available on Genbank Access Number NM_006297. A sequence of human XRCC1 protein is available on Genbank Access Number NP_006288. The term "XRCC1" includes naturally occurring XRCC1 polypeptide as well as variants, fragments and modified forms thereof.

As used herein, the term "PPP2R5D" refers to a gene that encodes the serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit delta isoform consisting of 451 amino acids. A sequence of human PPP2R5D mRNA is available on Genbank Access Number NM_001270476. A sequence of human PPP2R5D protein is available on Genbank Access Number NP_001257405. The term "PPP2R5D" includes naturally occurring PPP2R5D polypeptide as well as variants, fragments and modified forms thereof.

As used herein, the term "AKT3" refers to a gene that encodes the RAC-gamma serine/threonine- protein kinase consisting of 465 amino acids. A sequence of human AKT3 mRNA is available on Genbank Access Number NM_001206729. A sequence of human AKT3 protein is available on Genbank Access Number NP_001193658. The term "AKT3" includes naturally occurring AKT3 polypeptide as well as variants, fragments and modified forms thereof. In one embodiment, the method comprises determining expression level of at least two genes, or of at least three genes, or of at least four, or of at least five, or of at least six, or of at least seven, or of at least eight, or of at least nine, or of at least ten, or of the eleven genes selected from the group consisting of PPP2 5C, CCNA1, FANCE, CUL1, MRE11A, MAX, XRCC1, PPP2R5D or AKT3 genes in a biological sample of said patient.

Determination of the level of expression of a gene can be performed by a variety of techniques, from a biological sample as previously described. The expression may be typically determined by measuring the quantity of mRNA. In a particular embodiment, the level of expression is determined by assessing the quantity of protein expressed by said gene, e.g. by Western blot. Measuring the quantity of protein may be performed in place, or in addition, to measuring the quantity of mRNA.

The biological sample is preferably a sample comprising tumor DNA or RNA, preferably a tumor tissue biopsy. For instance, it may be formalin-fixed paraffin embedded tumor tissue or fresh frozen tumor tissue. In one embodiment, the cancer cell or the tumor is a breast cancer cell or a breast tumor.

The method then generally involves comparing the expression level of said genes to at least one control value. The term "control value" is a reference value corresponding to the expression level of each of said genes in a group of tumors showing a predetermined response profile, i.e. a group of responder patients or a group of resistant patients (unlikely to respond to the treatment).

Based on the gene expression levels, the classification of the patient may be determined using any commonly used suitable algorithm, such as, for example, the nearest shrunken centroid (NSC) algorithm or Prediction Analysis of Microarrays" (PAM), the support vector machine (SVM) algorithm, or the k-nearest neighbour algorithm. Preferably, PAM is used, as described in Tibshirani et al., PNAS 2002, 99(10):6567-6572). "Prediction Analysis of Microarrays" (PAM) performs sample classification from gene expression data using the nearest shrunken centroid method. The method further comprises determining whether the expression levels of said genes are high or low compared to the reference expression level(s). For instance, a decreased expression of some of said genes compared to the control value may be indicative of a patient being likely to respond to the treatment, or wherein an increased expression of some of said genes compared to the control value may be indicative of a patient being unlikely to respond to the treatment. Accordingly, in one embodiment, an increased expression level of at least one gene selected from the group consisting of PPP2 5C, CCNA1, FANCE, CUL1, MRE11A, MAX compared to the control value is indicative of a patient being unlikely to respond to the treatment. In another embodiment, a decreased expression level of at least one gene selected from the group consisting of XRCC1, PPP2R5D or AKT3 genes is indicative of a patient being unlikely to respond to the treatment.

The reference expression level(s) may be the expression level of a gene having a stable expression in responsive patients and/or the expression level of a gene having a stable expression in resistant patients. Scores can be predetermined, as described in greater details in the experimental section below. The reference expression levels may also be the mean expression levels of said genes among a cohort of human tumor samples. The combined expression profile of these genes is informative of the status of the patient who, before any treatment, can be classified as (i) likely to respond, and for whom a treatment with Dbait molecule described herein is recommended, and (ii) unlikely to respond, and for whom a treatment with such Dbait molecule is not recommended.

The combined expression profile of these genes may also be informative to monitor the efficacy of said treatment, during the course of the treatment. In that situation, the term "control value" may refer to the expression level of the genes at a different time. At last it is provided a kit for use in such methods, comprising primers and/or probes specific of each of PPP2R5C, CCNA1, FANCE, CUL1, MRE11A, MAX, XRCC1, PPP2R5D and AKT3 genes.

A number of references are cited in the present specification; each of these cited references is incorporated herein by reference.

DESCRIPTION OF THE FIGURES

Figure 1: Dot plot showing the correlation between the best overall responses of the 21 evaluable patients and their pre-treatment plasma concentrations of TIMP3.

EXAMPLES EXAMPLE 1: First-in-human phase I study of the DNA repair inhibitor DT01 in combination with radiotherapy in patients with skin metastases from melanoma. Identification of predictive marker of response by immunoassay. The results obtained in the first-in-human trial (NCT01469455) of a drug which is intended to sensitize melanoma to radiotherapy by an original approach. This innovative drug concept, called siDNA (for signal interfering DNA), acts as a DNA repair inhibitor. The first-in-class drug, DTOl (now called AsiDNA), mimics DNA double-strand breaks and targets DNA damage repair/signalling pathways by inducing "false" DNA damage signals which prevents efficient DNA repair. The mechanism of action of these molecule was described in an article published in 2009 (M. Quanz et al. 2009, Clinical Cancer research 15(4):1308-16), and the preclinical studies for the setup of the treatment protocol were published in 2014 (J. Biau et al. 2014 Neoplasia 16(10):835-44).

The study was designed to i) assess the safety of DTOl administered intratumorally and subcutaneously in patients, ii) bring the proof of concept of the ability of DTOl to increase efficacy of radiotherapy, and iii) evaluate potential biomarkers. With 23 included patients, our data show that DTOl in combination with radiotherapy is well tolerated with the most frequent adverse events being reversible grade 1 and 2 injection site reactions. The addition of DTOl to radiotherapy produced an overall complete response rate of 30%, as compared to 9% in historical controls (Olivier et al. 2007, Cancer 110(8): 1791-1795). Moreover, there was a significant relation between DTOl systemic exposure and efficacy. Finally, the baseline plasma concentration of the TIMP3 protein was correlated to response.

MATERIALS AND METHODS

All patients provided written informed consent. The study was approved by an independent ethics committee (Comite de Protection des Personnes lie de France III) and was conducted in accordance with the Declaration of Helsinki, the ICH Harmonised Tripartite Guideline for Good Clinical Practice.

Patient selection: Adult patients with histologically confirmed skin metastases from cutaneous melanoma (with at least two measurable tumor lesions of <4 cm in largest diameter), including melanoma-in-transit, who were not eligible for immediate surgery and refractory to conventional treatment were eligible for the study. The lesions had to be in a non-previously irradiated field. Patients had to have adequate hematopoietic, renal and liver functions and an Eastern Cooperative Oncology Group performance status of 0 or 1.

Exclusion criteria included: Any serious concomitant systemic disorders incompatible with the study (e.g. active infection), known central nervous system metastases, history of epilepsy, history of porphyria, active psoriasis, clinically significant hepatic disease or renal disease, severe gastrointestinal, neurological, and blood disorders. Patients receiving anti-vitamin K or cyclosporin therapy within ten days prior to first dose of study treatment, anticancer therapy within four weeks prior to first dose of study treatment (three months for ipilimumab) were also excluded, as were patients with significant coagulation abnormalities, hypersensitivity to 4-aminoquinoline compounds (chloroquine) or to any of its derivatives, retinal or visual field changes attributable to previous chloroquine administration or any other etiology, positive for HIV and Hepatitis B or C.

Study design and treatment: This first-in-human phase I trial (NCT01469455) was an open label, non-randomized, multi-centre study. Patients were assigned sequentially to escalating daily total dose of DT01 (16, 32, 48, 64 and 96 mg) using a traditional 3+3 design. An expansion cohort was planned at the recommended phase I I dose. The primary objective was to evaluate the safety and tolerability profiles of DT01 in combination with RT and concomitant dosing of chloroquine. The secondary objectives were to determine the dose- limiting toxicities (DLTs), the recommended phase I I dose, the pharmacokinetics (PK) parameters of DT01, pharmacodynamics biomarkers, and to identify preliminary signs of efficacy.

DT01 was administered three times a week (every other day) over 2 weeks (six administrations of DT01 in total) with two tumors per patient treated each by intratumoral (IT) and peritumoral (PT) subcutaneous injections between 3 and 5 hours prior to the RT sessions. In the irradiated field, the two injected tumors were chosen by the investigators in an unblinded fashion. The total daily dose levels were 16, 32, 48, 64 and 96 mg per patient. For each DT01 injected tumor (i.e. two lesions per patient), half of the total dose was given. Each tumor received the DT01 into two injections (1 intratumoral and 1 peritumoral) at 16, 32, 48 and 64 mg dose levels and three injections (1 intratumoral and 2 or 3 peritumoral) at 96 mg dose level with constant volumes of 0.4 mL per injection. At 96 mg dose level, nine additional patients were added. Three of them were treated with IT and PT injections of DT01 as in the escalating dose study and six of them with only PT injections after protocol amendment to compare the different routes efficiency at the same dose (i.e. 96 mg) with the same number of patients (i.e. 6 per route).

RT was administered on all the DT01 injected tumors and on all other nodules in the involved field. RT was delivered by orthovoltage irradiation, or using photons, electrons or combined electron and photon irradiation to the total dose of 30 Gy in ten fractions and two weeks. As concomitant chloroquine increased cellular uptake of DT01 in vitro (Berthault et al, 2011) patients received a daily oral dose of chloroquine (100 mg) from Day -7 pre-dose to Day 12 (last day of radiotherapy). Blood samples for PK analysis were obtained on PK day 1 at 0 (predose) and at 1, 2.5, 4.5, 6.5, 9 and 24 hours, after a single dose of DT01. Plasma TIMP3 concentration was determined with the TIMP3 (M IG-5) human ELISA kit (Abeam, Cambridge, MA, USA) on non-diluted plasma samples.

The evaluation was realized clinically by investigators with the measurements of the tumor shrinking by measuring the largest diameter of the target lesions over time. A partial response was defined as a decrease >30%, while a progressive disease was defined as an increase >20% as compared to the baseline. Complete response corresponded disappearance of all target lesions. Each target lesion was measured by clinical examination at baseline and Days 26, 40, 54, 90, 180, 270 and 360, or at patient last visit. Baseline tumor burden was assessed during a pre-visit occurring between one and three weeks before Day 1. Patient response was estimated by the variation of the sum of the target lesion diameter.

RESULTS

The baseline plasma concentration of the TI M P3 protein was correlated to response. Baseli ne plasma concentration of TI M P3 positively correlated with ORR (r = 0.423) (Figure 1). Pre-treatment plasmatic concentrations of TIM P3 positively correlated with efficacy, making TIMP3 a predictive biomarker of efficacy.

EXAMPLE 2:

MATERIALS AND METHODS

Measurement of cellular sensitivity to drugs: AsiDNA cytotoxicity was measured by relative survival and cell death quantification. Adherent cells were seeded in 24-well culture plates at appropriate densities and incubated 24hours at 37°C before AsiDNA addition. Cells were harvested day 6 after treatment, stained with 0.4% trypan blue (Sigma Aldrich, Saint-Louis, USA) and counted with a Burker chamber. Cell survival was calculated as ratio of living treated cells to living mock-treated cells. Cell death was calculated as the number of dead cells on the total number of counted cells.

High-throughput data sources and analysis: m NA expression data for BC cell lines were produced using Human Exon 1.0 ST Affymetrix microarrays. Raw data were RMA normalized and summarized with FAST DB annotation (version 2013_1). Gene expression were log2 transformed and mean centered over all the cell lines samples and then grouped into the two groups (AsiDNA sensitive and AsiDNA resistant). Each gene was assigned with a score using median expression level across samples of the same group the data was visualized on Atlas of Cancer Signaling Network resource (ACSN) map. Spearman rank correlation study: The correlations were assessed by a leave-one-out (LOO) Spearman rank correlation. Multiple correction testing was done with Benjamin-Hochberg method (doi = 10.2307/2346101). All tests were considered as two-sided. For each treatment, a list of correlated genes is ranked by correlation p-value. In order to discover the most unique correlated genes with one treatment, a stepwise p-value selection was used so that no gene whose correlation p-value under the selected p-value were retrieved in both treatment. The unique, non-overlapping set of gene robustly correlated with survival to each one of the drugs is provided. The selected p- value (threshold p-value) determined for the ranked genes included in ACSN is 0.005.

RESULTS

BC cell lines show different sensitivities to AsiDNA: Efficacy of AsiDNA was assessed by measuring cell death and proliferation in 12BC cell lines including 4S/?C4-mutated cell lines. In addition, HeLa cells silenced for BRCA1 or BRCA2 genes were used as a control of B CA mutation factor and 3 immortalized mammary cell lines (MCF10A, MCF12A and 184B5) as non-tumor controls. The concentration of AsiDNA (4.8μΜ) was chosen based on the 75-80% survival in the BC227 BRCA2^{~ ~} mutant. In all BC cell lines, the decrease in the relative number of cells correlated with an increase in cell death indicating that the number of living cells reflects a cytotoxic and not a cytostatic effect. AsiDNA treatment had no effect on the three control non-tumor cell lines. In contrast, tumor cell lines revealed survival varying from 100% to 60% for AsiDNA. All the BRCA ^ cell lines were sensitive to both treatments. Among the BRCA proficient tumor cell lines, MDAMB468, BC173 and HCC1143 were sensitive to AsiDNA.

Analysis of multi-level omics data reveals a profile for sensitivity to AsiDNA in BC cell lines: In order to determine how gene expression profile could explain the differences in sensitivities to AsiDNA, the correlation between BC cell lines basal transcriptomic data and their sensitivity to this drug was assessed. 9 genes were directly involved in DNA repair pathways and correlated with the sensitivities to AsiDNA (Table 1). name Correlation with survival to AsiDNA

PPP2R5C 0.88

CCNA1 0.82

FANCE 0.78

CUL1 0.72

M RE 11 A 0.69

MAX 0.67

XRCC1 -0.63

PPP2R5D -0.82

AKT3 -0.83

Table 1: Correlation of DNA repair genes expression with survival to AsiDNA.

An enrichment study of functional modules with the two "sensitivity" gene lists for AsiDNA using an Atlas of Cancer Signaling Network resource (ACSN), demonstrated that a number of molecular mechanisms are associated with the sensitivity to this drug. Interestingly, several molecular mechanisms such as MOMP regulation, Cytoskeleton and Polarity, WNT non-canonical pathway etc. were implicated in response to this drug. Multi-level omics data assessment by integrating mRNA expression, copy number variations and mutational profiles from the BC cell lines in the context of ACSN was performed to generate network-based molecular portraits of resistance to this drug. In particular, cell lines resistant to AsiDNA are characterized by multiple perturbations as expression elevation, copy number gains and mutations in processes involved in cell proliferation, cell survival, EMT and cell motility functional modules. These data suggest that cells resistant to AsiDNA most likely have a higher proliferation status corresponding to an increase in DNA repair, especially through HR and Fanconi repair pathways.

Claims

1- An in vitro method for determining the likelihood for a patient affected with a tumor to respond to a treatment with a signal interfering DNA (siDNA) molecule able to inhibit DNA repair, which method comprises determining expression level of TIMP3 gene in a biological sample obtained from said patient.

2- The method of claim 1, wherein the siDNA molecule is a nucleic acid molecule having one of the following formula:

wherein N is a deoxynucleotide, n is an integer from 15 to 195, the underlined N refers to a nucleotide having or not a modified phosphodiester backbone, L' is a linker, C is the molecule facilitating endocytosis selected from a lipophilic molecule or a ligand which targets cell receptor enabling receptor mediated endocytosis, L is a linker, m and p, independently, are an integer being 0 or 1.

3- The method of claim 2, wherein the nucleic acid molecule of formula (I) (II) or (III) has one or several of the following features:

- N is a deoxynucleotide selected from the group consisting of A (adenine), C (cytosine), T (thymine) and G (guanine) and selected so as to avoid occurrence of a CpG dinucleotide and to have less than 80% sequence identity to any gene in a human genome; and/or,

- the linked L' is selected from the group consisting of hexaethyleneglycol, tetradeoxythymidylate (T4), l,19-bis(phospho)-8-hydraza-2-hydroxy-4-oxa-9-oxo-nonadecane and 2,19-bis(phosphor)-8- hydraza-l-hydroxy-4-oxa-9-oxo-nonadecane; and/or,

- m is 1 and L is a carboxamido polyethylene glycol, more preferably carboxamido triethylene or tetraethylene glycol; and/or, - C is selected from the group consisting of a cholesterol, single or double chain fatty acids such as octadecyl, oleic acid, dioleoyl or stearic acid, or ligand (including peptide, protein, aptamer) which targets cell receptor such as folic acid, tocopherol, sugar such as galactose and mannose and their oligosaccharide, peptide such as GD and bombesin, and protein such transferring and integrin, preferably is a cholesterol or a tocopherol, still more preferably a cholesterol.

4- The method of claim 3, wherein the nucleic acid molecule is

wherein the underlined nucleotide refers to a nucleotide having a phosphorothioate backbone, the linked L' is l,19-bis(phospho)-8-hydraza-2-hydroxy-4-oxa-9-oxo-nonadecane; m is 1 and L is a carboxamido tetraethylene glycol, C is cholesterol.

5- The method according to any one claims 1 to 4, wherein the expression level of TIMP3 gene is determined by measuring the concentration in a blood sample obtained from said patient.

6- The method according to any one claims 1 to 5, further comprising comparing the expression level of said gene to at least one control value. 7- The method of any one claims 6, wherein an increase of expression of TIMP3 gene compared to the control value is indicative of a patient being likely to respond to the treatment.

8- The method of any one claims 1 to 7, wherein the biological sample is a blood plasma sample.

9- The method of any of claims 1 to 8, wherein the tumor is a cancer selected from the group consisting of melanoma, glioblastoma, breast cancer, colon cancer, lung cancer, gastrointestinal cancer, liver cancer and head and neck cancer.

10- The method of claim 9, wherein the cancer is melanoma.

11- The method of any of claims 1 to 10, wherein the nucleic acid molecule is used in standalone or in combination with radiotherapy and/or chemotherapy.

12- A nucleic acid molecule, as defined in any of claims 1 to 4, for use in treating cancer in a patient, which patient has been classified as being likely to respond by the method of any of claims 1 to 11.

13- The nucleic acid molecule for the use according to claim 12, wherein the nucleic acid molecule is used in combination with radiotherapy and/or chemotherapy.