WO2017186815A1

WO2017186815A1 - Antisense oligonucleotides for enhanced expression of frataxin

Info

Publication number: WO2017186815A1
Application number: PCT/EP2017/059983
Authority: WO
Inventors: Paraskevi CHARITOU; Heidi Leonardina Maria DE GRUYTER; Pontus Fredrik Gunnar KLEIN
Original assignee: Proqr Therapeutics Ii B.V.
Priority date: 2016-04-26
Filing date: 2017-04-26
Publication date: 2017-11-02

Abstract

The invention relates to new (preferably single stranded antisense) oligonucleotides that can be used in the prevention or treatment of Friedreich's ataxia. In a preferred aspect, the oligonucleotides comprise at least 51 nucleotides and further comprise single or multiple modified nucleotides and/or modified internucleoside linkages. The invention further relates to the use of said oligonucleotides in methods of preventing or treating Friedreich's ataxia.

Description

Antisense oligonucleotides for enhanced expression of frataxin

Field of the invention

The invention relates to the field of medicine. In particular it relates to new antisense oligonucleotides and their use in the treatment or prevention of Friedreich's ataxia, by enhancing the expression of the frataxin protein.

Background of the invention

Friedreich's ataxia is a genetic disorder caused by a mutant expansion of the trinucleotide GAA in an intron of the gene encoding the frataxin protein. Friedreich's ataxia causes progressive damage to the nervous system, resulting in early symptoms of poor coordination. The disease may lead to scoliosis, heart disease and diabetes. Generally patients become wheelchair-bound in later stages of the disease, and often die because of cardiac insufficiency (for a review of clinical features, see Parkinson et al. 2013. J Neurochem 126 (suppl.1 ): 103-1 17).

The most common genetic mutation causing Friedreich's ataxia is the presence of a trinucleotide repeat (TNR) of the GAA triplet in the first intron of the frataxin (FXN) gene. The majority of patients have expansions of the GAA repeat on both alleles, while the rest have only one allele with expansions and other mutations in the other allele; they are compound heterozygous. Normal alleles possess 35 or fewer GAA repeats, while disease alleles carry anywhere from 66 to more than 1700 repeats. Generally, the size of the repeat expansion correlates inversely with age of onset and directly with disease severity and rate of progression. Frataxin is a mitochondrial protein. Although its function is not entirely resolved, it appears to play a role in the assembly of iron-sulfur clusters, and is highly expressed in tissues with a high metabolic rate such as liver, kidney and heart. The protein is synthesized as a 210 amino acid (aa) precursor that is rapidly targeted to the mitochondria. The precursor undergoes a two-step proteolytic processing resulting in a mature version of 130 aa. Friedreich's ataxia is therefore considered a mitochondrial disease, wherein patients do express the normal protein, but at reduced levels. The expansion of the GAA repeat in the first intron causes reduced expression of the protein; there are different theories on how this in fact functions, but at least it may be that the transcriptional repression seems to be caused by an R-loop that forms between the expanded repeat RNA and complementary genomic DNA.

Treatment of the disease is aimed at mitochondrial functioning and at induced expression of the protein. These include, amongst others, the use of idebenone, coenzyme Q10, Vincerinone™, etc. (review: Strawser et al. 2014. Expert Rev Neurother 14:949-957), prevention of degradation of frataxin (WO 2016/046759), the use of siRNA/shRNA (WO 2015/020993), aromatic-cationic peptides (WO 2015/017861 ), the use of inhibitors of miRNAs (WO 2014/095922), targeting the FXN promoter (WO 2013/071440), mitochondrial targeting of frataxin itself (WO 2012/174452), use of interferon gamma (WO 2012/028961 ) or erythropoietin (WO 201 1/050808), the use of histone deacetylase inhibitors to reverse the epigenetic changes (Gottesfeld et al. 2013. J Neurochem 126:147-154; Sandi et al. 201 1. Neurobiol Dis 42:496-505; Chan et al. 2013. Hum Mol Genet 22:2662-2675; Libri et al. 2014. Lancet 384:504-513; Soragni et al. 2014. Ann Neurol 76:489-508), and gene therapy. The disadvantage of these approaches is that they predominantly rely on nonspecific actions, or result in non-specific effects. It is preferred to have a specific targeting of the TNR's that cause the reduced expression of frataxin, without targeting other systems in the cell or patient. Such specific targeted modulation of frataxin expression may be achieved through the use of (antisense) oligonucleotides that are specifically directed against the expanded repeat RNA. Examples of such oligonucleotide-based therapies for Friedreich's ataxia are disclosed in WO 2008/018795, WO 2012/138289, WO 2012/170771 and WO 2015/023939. Despite these efforts there remains a need for further improved alternative therapeutics to treat or prevent Friedreich's ataxia.

Summary of the invention

The present invention relates to an oligonucleotide of at least 51 nucleotides in length comprising at least the nucleotide sequence of SEQ ID NO:2. Preferably, said oligonucleotide is a single stranded antisense oligonucleotide. In another preferred aspect, said oligonucleotide according to the invention comprises at least one modified internucleoside linkage, such as a phosphorothioate linkage. Even more preferred, the oligonucleotide according to the invention comprises alternating phosphorothioate and phosphodiester linkages. In yet another preferred embodiment, the oligonucleotide of the present invention comprises at least one modified nucleotide, such as a 2'-0 alkyl modified ribose, preferably a 2'-0 Methyl modified ribose, a 2'- Ethyl modified ribose, a 2'-0 Propyl modified ribose, and/or a substituted derivative of any of these modifications, such as a halogenated derivative.

In another aspect the invention relates to a viral vector expressing an oligonucleotide according to the invention, when placed under conditions conducive to expression of said oligonucleotide. The present invention also relates to a pharmaceutical composition comprising an oligonucleotide according to the invention or a viral vector according to the invention, and a pharmaceutically acceptable excipient. In yet another embodiment, the invention relates to an oligonucleotide, a viral vector, or a pharmaceutical composition according to the invention, for use in the prevention or treatment of Friedreich's ataxia. In another embodiment, the invention relates to a use of an oligonucleotide, or a viral vector according to the invention, in the preparation of a medicament for use in the prevention or treatment of Friedreich's ataxia. The present invention also relates to a method for the prevention or treatment of a human subject suffering from, or being at risk of suffering from Friedreich's ataxia, said method comprising the step of administering an oligonucleotide, a viral vector, or a pharmaceutical composition according to the invention to said subject. Preferably, said method comprises the step of providing said cell with an oligonucleotide, or with a viral vector according to the invention. In yet another preferred aspect, said cell is an in vitro cell or an in vivo cell of a human subject suffering from, or being at risk of suffering from Friedreich's ataxia, wherein said cell comprises between 60-2000 GAA repeats in the first intron of the FXN gene. Brief description of the drawings

Figure 1 shows the expression of frataxin (FXN) mRNA upon a double transfection with a set of different AONs in a concentration of 25 nM (twice). NT means not treated cells. The names of the different AONs are as outlined in example 1 . Statistical significance was determined by one-way analysis of variance (ANOVA) and Tukey's post hoc test for multiple comparisons, ^*p<0.05, ^**p<0,01 , ^***p<0,001 , n=8.

Figure 2 shows the expression of frataxin (FXN) mRNA upon a single transfection with a set of different AONs in a concentration of 50 nM. NT means non treated cells. The names of the different AONs are as outlined in example 1 . Statistical significance was determined by oneway analysis of variance (ANOVA) and Tukey's post hoc test for multiple comparisons, ^***p<0,001 , n=6.

Detailed description

The present invention relates to new antisense oligonucleotides (AONs) that are directed against the trinucleotide repeat (TNR) present in intronic sequences within the pre- mRNA transcribed from the frataxin (FXN) gene. It is known in the art that these GAA repeats (that may comprise as many as anything between 60-2000 units) inhibit the expression of the frataxin protein. Hence, it is a goal of the present invention to provide AONs that target the GAA repeats in the intronic FXN sequences thereby inducing the expression of the normal frataxin protein.

The present invention relates to compositions and methods for modulating frataxin expression, more specifically by upregulating mRNA coding for frataxin. New AONs have been identified that are useful in selectively upregulating frataxin expression in cells. The AONs provided herein are complementary to specified regions of the sense strand of the FXN gene, preferably the human FXN gene, and therefore complementary to the corresponding regions in the FXN mRNA, preferably the human FXN mRNA. The induced expression of frataxin is especially useful in the treatment or prevention of diseases caused by the TNRs in the FXN gene, especially Friedreich's ataxia. Hence, the present invention relates to new AONs for use in the treatment and/or prevention of Friedreich's ataxia. It furthermore relates to the use of the AONs of the present invention in the preparation of medicaments for the treatment and/or prevention of Friedreich's ataxia. In another embodiment, the present invention relates to methods of treating Friedreich's ataxia by comprising administering one or more of the AONs of the present invention to a patients suffering from or being at risk of Friedreich's ataxia. The AONs of the present invention may be chemically modified for improved delivery, cellular uptake, endosomal escape, hybridization, efficacy and/or stability aspects. The methods of the present invention also relate to methods for delivery of the AONs of the present invention to cells comprising an FXN gene that comprises 60 to 2000 or more TNR's of the GAA triplet in the first intron, in one or both alleles. In a preferred embodiment, said cell is a cell of a human subject that suffers from or that is at risk of suffering from Friedreich's ataxia.

In a preferred aspect, the oligonucleotide of the present invention is a single stranded oligonucleotide. In yet another preferred embodiment, the oligonucleotides of the present invention comprise 51 nucleotides or more, such as 51 , 52, 53, 54, 55, 56, 57, 58, 58, 59, 60, 61 , 62, 63, 64, 65, 70, 75 or more. Preferably said oligonucleotide comprises the consecutive nucleotides as provided in SEQ ID NO:2. It is preferred that an oligonucleotide of the invention comprises one or more residues that are modified to increase nuclease resistance, and/or to increase the affinity of the oligonucleotide for the target sequence. Therefore, in a preferred embodiment, the oligonucleotide sequence comprises at least one nucleotide analogue or equivalent, wherein a nucleotide analogue or equivalent is defined as a residue having a modified base, and/or a modified backbone, and/or a non-natural internucleoside linkage, or a combination of these modifications. In a preferred embodiment, the nucleotide analogue or equivalent comprises a modified backbone. Examples of such backbones are provided by morpholino backbones, carbamate backbones, siloxane backbones, sulfide, sulfoxide and sulfone backbones, formacetyl and thioformacetyl backbones, methyleneformacetyl backbones, riboacetyl backbones, alkene containing backbones, sulfamate, sulfonate and sulfonamide backbones, methyleneimino and methylenehydrazino backbones, and amide backbones. Phosphorodiamidate morpholino oligomers are modified backbone oligonucleotides that have previously been investigated as antisense agents. Morpholino oligonucleotides have an uncharged backbone in which the deoxyribose sugar of DNA is replaced by a six membered ring and the phosphodiester linkage is replaced by a phosphorodiamidate linkage. Morpholino oligonucleotides are resistant to enzymatic degradation and appear to function as antisense agents by arresting translation or interfering with pre-mRNA splicing rather than by activating RNase H. Morpholino oligonucleotides have been successfully delivered to tissue culture cells by methods that physically disrupt the cell membrane, and one study comparing several of these methods found that scrape loading was the most efficient method of delivery; however, because the morpholino backbone is uncharged, cationic lipids are not effective mediators of morpholino oligonucleotide uptake in cells. A recent report demonstrated triplex formation by a morpholino oligonucleotide and, because of the non-ionic backbone, these studies showed that the morpholino oligonucleotide was capable of triplex formation in the absence of magnesium. It is further preferred that the linkage between the residues in a backbone do not include a phosphorus atom, such as a linkage that is formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. A preferred nucleotide analogue or equivalent comprises a Peptide Nucleic Acid (PNA), having a modified polyamide backbone. PNA-based molecules are true mimics of DNA molecules in terms of base-pair recognition. The backbone of the PNA is composed of N-(2-aminoethyl)-glycine units linked by peptide bonds, wherein the nucleobases are linked to the backbone by methylene carbonyl bonds. An alternative backbone comprises a one-carbon extended pyrrolidine PNA monomer. Since the backbone of a PNA molecule contains no charged phosphate groups, PNA-RNA hybrids are usually more stable than RNA-RNA or RNA-DNA hybrids, respectively. A further preferred backbone comprises a morpholino nucleotide analog or equivalent, in which the ribose or deoxyribose sugar is replaced by a 6-membered morpholino ring. A most preferred nucleotide analog or equivalent comprises a phosphorodiamidate morpholino oligomer (PMO), in which the ribose or deoxyribose sugar is replaced by a 6-membered morpholino ring, and the anionic phosphodiester linkage between adjacent morpholino rings is replaced by a non-ionic phosphorodiamidate linkage. In yet a further embodiment, a nucleotide analogue or equivalent of the invention comprises a substitution of one of the non-bridging oxygens in the phosphodiester linkage. This modification slightly destabilizes base-pairing but adds significant resistance to nuclease degradation. A preferred nucleotide analogue or equivalent comprises phosphorothioate, chiral phosphorothioate, phosphorodithioate, phosphotriester, aminoalkylphosphotriester, H-phosphonate, methyl and other alkyl phosphonate including 3'- alkylene phosphonate, 5'-alkylene phosphonate and chiral phosphonate, phosphinate, phosphoramidate including 3'-amino phosphoramidate and aminoalkylphosphoramidate, thionophosphoramidate, thionoalkylphosphonate, thionoalkylphosphotriester, selenophosphate or boranophosphate. A further preferred oligonucleotide or equivalent according to the invention comprises one or more sugar moieties that are mono- or disubstituted at the 2', 3' and/or 5' position such as a -OH; -F; substituted or unsubstituted, linear or branched lower (CI-C10) alkyl, alkenyl, alkynyl, alkaryl, allyl, or aralkyl, that may be interrupted by one or more heteroatoms; 0-, S-, or N-alkyl; 0-, S-, or N-alkenyl; 0-, S-or N- alkynyl; 0-, S-, or N- allyl; O-alkyl-O-alkyl, -methoxy, -aminopropoxy; methoxyethoxy; dimethylaminooxyethoxy; and -dimethylaminoethoxyethoxy. The sugar moiety can be a pyranose or derivative thereof, or a deoxypyranose or derivative thereof, preferably ribose or derivative thereof, or deoxyribose or derivative of. A preferred derivatized sugar moiety comprises a Locked Nucleic Acid (LNA), in which the 2'-carbon atom is linked to the 3' or 4' carbon atom of the sugar ring thereby forming a bicyclic sugar moiety. A preferred LNA comprises 2'-0, 4'-C-ethylene-bridged nucleic acid. These substitutions render the nucleotide analogue or equivalent RNase H and nuclease resistant and increase the affinity for the target RNA. In another embodiment, a nucleotide analogue or equivalent of the invention comprises one or more base modifications or substitutions. Modified bases comprise synthetic and natural bases such as inosine, xanthine, hypoxanthine and other -aza, deaza, -hydroxy, -halo, -thio, thiol, -alkyl, -alkenyl, -alkynyl, thioalkyl derivatives of pyrimidine and purine bases that are or will be known in the art. It is understood by a skilled person that it is not necessary for all positions in an AON to be modified uniformly. In addition, more than one of the aforementioned analogues or equivalents may be incorporated in a single AON or even at a single position within an AON. In certain embodiments, an AON of the invention has at least two different types of analogues or equivalents.

According to another highly preferred embodiment oligonucleotides according to the invention comprise a 2'-0 (preferably lower) alkyl phosphorothioate antisense oligonucleotide, such as 2'-0-methyl modified ribose (RNA), 2'-0-methoxyethyl modified ribose, 2'-0-ethyl modified ribose, 2'-0-propyl modified ribose, and/or substituted derivatives of these modifications such as halogenated derivatives. An effective and preferred (antisense) oligonucleotide format according to the invention comprises 2'-0-methyl modified ribose moieties with a phosphorothioate backbone, preferably wherein substantially all ribose moieties are 2'-0-methyl and substantially all internucleosidic linkages are phosphorothioate linkages. In an alternative preferred embodiment, the oligonucleotides of the present invention have alternating modified linkages such as alternating phosphorothioate and phosphodiester linkages. Particularly suitable examples of chemically modified antisense oligonucleotides, especially for targeting skeletal muscle and the heart, are tricyclo-DNA (tcDNA) versions of the oligonucleotides targeting the GAA repeats according to the invention. tcDNA have been disclosed in WO 2010/1 15993 and WO 2013/053928.

An oligonucleotide can be linked to a moiety that enhances uptake of the oligonucleotide in cells. Examples of such moieties are cholesterols, carbohydrates, vitamins, biotin, lipids, phospholipids, cell-penetrating peptides including but not limited to antennapedia, TAT, transportan and positively charged amino acids such as oligoarginine, poly-arginine, oligolysine or polylysine, antigen-binding domains such as provided by an antibody, a Fab fragment of an antibody, or a single chain antigen binding domain such as a cameloid single domain antigen-binding domain.

An oligonucleotide according to the invention may be indirectly administrated using suitable means known in the art. It may for example be provided to an individual or a cell, tissue or organ of said individual in the form of an expression vector wherein the expression vector encodes a transcript comprising said oligonucleotide. The expression vector is preferably introduced into a cell, tissue, organ or individual via a gene delivery vehicle. In a preferred embodiment, there is provided a viral-based expression vector comprising an expression cassette or a transcription cassette that drives expression or transcription of an oligonucleotide as disclosed herein. Accordingly, the invention provides a viral vector expressing an oligonucleotide according to the invention when placed under conditions conducive to expression of the oligonucleotide. A cell can be provided with an oligonucleotide capable of interfering with essential sequences that result in highly efficient enhancement of frataxin expression by plasmid-derived oligonucleotide expression or viral expression provided by adenovirus- or adeno-associated virus-based vectors. Expression may be driven by a polymerase ll-promoter (Pol II) such as a U7 promoter or a polymerase III (Pol III) promoter, such as a U6 RNA promoter. A preferred delivery vehicle is a viral vector such as an adenoassociated virus vector (AAV), or a retroviral vector such as a lentivirus vector and the like. Also, plasmids, artificial chromosomes, plasmids usable for targeted homologous recombination and integration in the human genome of cells may be suitably applied for delivery of an oligonucleotide as defined herein. Preferred for the current invention are those vectors wherein transcription is driven from Pol-Ill promoters, and/or wherein transcripts are in the form fusions with U1 or U7 transcripts. It is within the skill of the artisan to design suitable transcripts. Preferred are Pol-Ill driven transcripts, preferably, in the form of a fusion transcript with an U1 or U7 transcript.

An AAV vector according to the present invention is a recombinant AAV vector and refers to an AAV vector comprising part of an AAV genome comprising an encoded oligonucleotide according to the invention encapsidated in a protein shell of capsid protein derived from an AAV serotype as depicted elsewhere herein. Part of an AAV genome may contain the inverted terminal repeats (ITR) derived from an adeno-associated virus serotype, such as AAV1 , AAV2, AAV3, AAV4, AAV5, AAV8, AAV9 and others. Protein shell comprised of capsid protein may be derived from an AAV serotype such as AAV1 , 2, 3, 4, 5, 8, 9 and others. A protein shell may also be named a capsid protein shell. AAV vector may have one or preferably all wild type AAV genes deleted, but may still comprise functional ITR nucleic acid sequences. Functional ITR sequences are necessary for the replication, rescue and packaging of AAV virions. The ITR sequences may be wild type sequences or may have at least 80%, 85%, 90%, 95, or 100% sequence identity with wild type sequences or may be altered by for example in insertion, mutation, deletion or substitution of nucleotides, as long as they remain functional. In this context, functionality refers to the ability to direct packaging of the genome into the capsid shell and then allow for expression in the host cell to be infected or target cell. In the context of the present invention a capsid protein shell may be of a different serotype than the AAV vector genome ITR. An AAV vector according to present the invention may thus be composed of a capsid protein shell, i.e. the icosahedral capsid, which comprises capsid proteins (VP1 , VP2, and/or VP3) of one AAV serotype, e.g. AAV serotype 2, whereas the ITRs sequences contained in that AAV5 vector may be any of the AAV serotypes described above, including an AAV2 vector. An "AAV2 vector" thus comprises a capsid protein shell of AAV serotype 2, while e.g. an "AAV5 vector" comprises a capsid protein shell of AAV serotype 5, whereby either may encapsidate any AAV vector genome ITR according to the invention.

A nucleic acid molecule encoding an oligonucleotide according to the present invention represented by a nucleic acid sequence of choice is preferably inserted between the AAV genome or ITR sequences, for example an expression construct comprising an expression regulatory element operably linked to a coding sequence and a 3' termination sequence.

"AAV helper functions" generally refers to the corresponding AAV functions required for AAV replication and packaging supplied to the AAV vector in trans. AAV helper functions complement the AAV functions which are missing in the AAV vector, but they lack AAV ITRs (which are provided by the AAV vector genome). AAV helper functions include the two major ORFs of AAV, namely the rep coding region and the cap coding region or functional substantially identical sequences thereof. Rep and Cap regions are well known in the art. The AAV helper functions can be supplied on an AAV helper construct, which may be a plasmid. Introduction of the helper construct into the host cell can occur e.g. by transformation, transfection, or transduction prior to or concurrently with the introduction of the AAV genome present in the AAV vector as identified herein. The AAV helper constructs of the invention may thus be chosen such that they produce the desired combination of serotypes for the AAV vector's capsid protein shell on the one hand and for the AAV genome present in said AAV vector replication and packaging on the other hand. "AAV helper virus" provides additional functions required for AAV replication and packaging. Suitable AAV helper viruses include adenoviruses, herpes simplex viruses (such as HSV types 1 and 2) and vaccinia viruses. Preferably, an AAV genome as present in a recombinant AAV vector according to the present invention does not comprise any nucleotide sequences encoding viral proteins. AAV vectors with tropism for skeletal muscle or the heart, are particularly advantageous for expressing GAA-repeat targeting AONs according to the invention.

The oligonucleotide according to the invention, which is preferably an antisense oligonucleotide (AON), may be delivered as such. However, the oligonucleotide may also be encoded by the viral vector. Typically, this is in the form of an RNA transcript that comprises the sequence of an oligonucleotide according to the invention in a part of the transcript.

Improvements in means for providing an individual or a cell, tissue, organ of said individual with an oligonucleotide according to the invention, are anticipated considering the progress that has already thus far been achieved. Such future improvements may of course be incorporated to achieve the mentioned effect on frataxin expression using a method of the invention. An oligonucleotide according to the invention can be delivered as is to an individual, a cell, tissue or organ of said individual. When administering an oligonucleotide according to the invention, it is preferred that the molecule is dissolved in a solution that is compatible with the delivery method. The skilled person may select and adapt any of the known and/or other commercially available alternative excipients and delivery systems to package and deliver an oligonucleotide for use in the current invention to deliver it for the prevention, treatment or delay of Friedreich's ataxia. In a preferred embodiment, an oligonucleotide according to the invention is formulated in a composition or a medicament or a composition, which is provided with at least an excipient and/or a targeting ligand for delivery and/or a delivery device thereof to a cell and/or enhancing its intracellular delivery. It is to be understood that if a composition comprises an additional constituent such as an adjunct compound, each constituent of the composition may not be formulated in one single combination or composition or preparation. Depending on their identity, the skilled person will know which type of formulation is the most appropriate for each constituent as defined herein. If required, an oligonucleotide according to the invention or a vector, preferably a viral vector, expressing an oligonucleotide according to the invention can be incorporated into a pharmaceutically active mixture by adding a pharmaceutically acceptable carrier. Accordingly, the invention also provides a composition, preferably a pharmaceutical composition, comprising an oligonucleotide according to the invention, or a viral vector according to the invention and a pharmaceutically acceptable excipient. Such composition may comprise a single oligonucleotide or viral vector according to the invention, but may also comprise multiple, distinct oligonucleotides or viral vectors according to the invention. Such a pharmaceutical composition may comprise any pharmaceutically acceptable excipient, including a carrier, filler, preservative, adjuvant, solubilizer and/or diluent.

The present invention therefore relates to an oligonucleotide of at least 51 nucleotides in length comprising at least the nucleotide sequence of SEQ ID NO:2. Preferably, the oligonucleotide according to the invention is from 51 to about 200 nucleotides in length, preferably from 51 to 150 nucleotides in length, and more preferably from 51 to 100 nucleotides in length. In one particularly preferred embodiment, the oligonucleotide of the present invention consists of 51 nucleotides, comprising the nucleotide sequence of SEQ ID NO:2. In another preferred aspect, said oligonucleotide is a single stranded antisense oligonucleotide. In yet another preferred embodiment, the oligonucleotide of the present invention comprises at least one modified internucleoside linkage, preferably a phosphorothioate linkage, more preferably the oligonucleotide according to the invention comprises alternating phosphorothioate and phosphodiester linkages. In another preferred aspect of the invention, the oligonucleotide of the present invention comprises at least one modified nucleotide, such as a 2'-0 alkyl modified ribose, preferably a 2'-0 Methyl modified ribose, a 2'- Ethyl modified ribose, a 2'-0 Propyl modified ribose, and/or a substituted derivative of any of these modifications, such as a halogenated derivative.

The present invention also relates to a viral vector expressing an oligonucleotide according to the invention, when placed under conditions conducive to expression of said oligonucleotide. Preferred viral vectors that may express an oligonucleotide according to the invention are as described herein. The present invention also relates to a pharmaceutical composition comprising an oligonucleotide according to the invention, or to a viral vector according to the invention, and a pharmaceutically acceptable excipient, which have been described herein.

In another aspect, the invention relates to an oligonucleotide according to the invention, to a viral vector according to the invention, or to a pharmaceutical composition according to the invention, for use in the prevention or treatment of Friedreich's ataxia.

In yet another aspect, the invention relates to a use of an oligonucleotide according to the invention, or to a viral vector according to the invention, in the preparation of a medicament for use in the prevention or treatment of Friedreich's ataxia.

In yet another aspect, the invention relates to a method for the prevention or treatment of a human subject suffering from, or being at risk of suffering from Friedreich's ataxia, said method comprising the step of administering an oligonucleotide according to the invention, a viral vector according to the invention, or a pharmaceutical composition according to the invention to said subject.

In another aspect, the invention relates to a method for increasing expression of frataxin (FXN) protein in a cell, said method comprising providing said cell with an oligonucleotide according to the invention, or with a viral vector according to the invention. Preferably, said cell is an in vitro cell or an in vivo cell of a human subject suffering from, or being at risk of suffering from Friedreich's ataxia, wherein said cell comprises between 60-2000 GAA repeats in the first intron of the FXN gene. As known in the art, Friedreich's ataxia generally occurs when patients carry 60 or more GAA repeats in their frataxin gene. It will be appreciated by those skilled in the art that any human subject that suffers from a disease that is a result of any range of GAA repeats in the first intron of the frataxin gene may and/or will benefit from the administration of the oligonucleotide(s) of the present invention. It will also be understood that it may be that a combination or a set of oligonucleotides as disclosed herein may be used in a particular therapeutic setting. Hence, in yet another aspect the invention relates to a set of oligonucleotides according to the invention. In this document and in its claims, the verb "to comprise" and its conjugations is used in its non-limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded. In addition, reference to an element by the indefinite article "a" or "an" does not exclude the possibility that more than one of the element is present, unless the context clearly requires that there be one and only one of the elements. The indefinite article "a" or "an" thus usually means "at least one". The word "about" or "approximately" when used in association with a numerical value (e.g. about 10) preferably means that the value may be the given value (of 10) more or less 0.1 % of the value. The sequence information as provided herein should not be so narrowly construed as to require inclusion of erroneously identified bases. The skilled person is capable of identifying such erroneously identified bases and knows how to correct for such errors. All patent and literature references cited in the present specification are hereby incorporated by reference in their entirety.

Examples

Example 1. Increase of frataxin levels upon transfection with new antisense oligonucleotides.

To determine whether antisense oligonucleotides (AONs) targeting the frataxin (FXN) GAA repeat region in intron 1 of the gene, would be able to upregulate FXN mRNA levels in FRDA-patient derived fibroblasts, GM04078 FRDA fibroblasts were used (obtained from Coriell Institute for Medical Research, NJ, USA). These fibroblasts carry alleles of expanded GAA repeats with approximately 340 and 480 GAA units respectively. Besides that, fibroblasts from a healthy control individual (referred to as GM23974) were used as a reference. The AONs that were used in this experiment are provided in Table 1 .

Table 1. Antisense oligonucleotides (AONs) used to upregulate FXN mRNA levels, with their respective SEQ ID NO's, sequences and modifications. RaNA #329 and RaNA #329L are derived from WO 2015/023939. mX= 2'-0 Methyl-RNA; * = phosphorothioate (PS) linkage; + = LNA base

Cells were cultured in DMEM (Thermo Scientific) supplemented with 15% fetal bovine serum (VWR) and 1 % Pen/Strep (Sigma). 24 h after seeding, cells were transfected with AONs using MaxPEI (Polysciences) in a 1 :5 AON to PEI weight/weight ratio at a final concentration of 25 nM, according to manufacturer's instruction. Medium was changed to growth medium after 6 h. After 24 h, the transfection procedure was repeated as described above. 48 h after the second transfection, cells were harvested and RNA was isolated using the RNA Cell Miniprep system (Promega) according to manufacturer's instructions. RNA concentration was measured using a NanoDrop 2000 spectrophotometer. cDNA was prepared with the Verso cDNA Synthesis Kit (Thermo Scientific) with 750 ng RNA, and the reaction was performed at 42°C for 30 min. FXN and GUSB (beta-glucuronidase; housekeeping gene) mRNA was quantified by semi-quantitative real-time polymerase chain reaction (qPCR) with SYBR Select Master Mix (Thermo Scientific) and the following primers:

FXN_F: 5' - CGACATCGATGCGACCTG - 3' (SEQ ID NO:6)

FXN_R: 5' - GCCCAAAGTTCCAGATTTCC - 3' (SEQ ID NO:7)

GUSB_F: 5' - GCGGTCGTGATGTGGTCTGT - 3' (SEQ ID NO:8)

GUSB_R: 5' - GTGAGCGATCACCATCTTCAAGT - 3' (SEQ ID NO:9)

FXN mRNA levels (Ct values) were normalized with GUSB mRNA levels.

Results depicted in Figure 1 show that FXN mRNA was reduced in GM04078 FRDA cells to 60% of GM23974 healthy control cells. Cells transfected with the oligonucleotides of the present invention that are 51 nucleotides in length (FA1_51 and FA1_51 B) showed increased FXN mRNA levels to approximately 80 % of control, higher than the 21 -mer and higher than what was observed with the AON from the prior art: RaNA #329 (WO 2015/023939) that was used in two different versions: RaNA #329, which constitutes of 2'O-methyl RNA nucleotides with phosphorothioate linkages, and RaNA #329L which has interspersed LNA and DNA nucleotides as originally described (see Table 1 for details). Statistical analysis was performed using Graphpad Prism (GraphPad Software, Inc) with results as depicted and as described in the brief description of the drawings.

Example 2. Increased concentration of oligonucleotides carrying alternating linkages.

It was found that transfection with the FA1_51 oligonucleotide resulted in a noticeable cytotoxicity at concentrations higher than 25 nM (data not shown). It is believed that long continuous stretches of phosphorothioate linkages may cause this toxicity. To solve this problem a new oligonucleotide was developed with alternating phosphorothioate and phosphodiester linkages that is referred to as FA1_51 B (for details, see Table 1 ). Use of this AON indeed showed reduced cytotoxicity as compared to the fully phosphorothioated FA1_51 (data not shown). This allowed an increase of the oligonucleotide concentration to 50 nM in a single transfection. The experiment was similar as to what has been described in Example 1 , except for the higher concentration. In accordance with this, qPCR analysis was performed as described in example 1 , and revealed a dramatic increase in FXN expression to approximately 1 1 1 % over what was seen in control cells, and which was also significantly higher than RaNA #329L which only reached 70 % of control cells (Figure 2). Statistical analysis was performed using Graphpad Prism (GraphPad Software, Inc) with results as depicted and as described in the brief description of the drawings.

Claims

1 . An oligonucleotide of at least 51 nucleotides in length comprising at least the nucleotide sequence of SEQ ID NO:2.

2. The oligonucleotide according to claim 1 , wherein said oligonucleotide is a single stranded antisense oligonucleotide.

3. The oligonucleotide according to claim 1 or 2, wherein the oligonucleotide comprises at least one modified internucleoside linkage.

4. The oligonucleotide according to claim 3, wherein said modified internucleoside linkage is a phosphorothioate linkage.

5. The oligonucleotide according to claim 3 or 4, wherein the oligonucleotide comprises alternating phosphorothioate and phosphodiester linkages.

6. The oligonucleotide according to any one of claims 1 to 3, wherein the oligonucleotide comprises at least one modified nucleotide.

7. The oligonucleotide according to any one of claims 1 to 4, wherein said oligonucleotide comprises a 2'-0 alkyl modified ribose, preferably a 2'-0 Methyl modified ribose, a 2'- Ethyl modified ribose, a 2'-0 Propyl modified ribose, and/or a substituted derivative of any of these modifications, such as a halogenated derivative.

8. A viral vector expressing an oligonucleotide according to claim 1 or 2, when placed under conditions conducive to expression of said oligonucleotide.

9. A pharmaceutical composition comprising an oligonucleotide according to any one of claims 1 to 7, or a viral vector according to claim 8, and a pharmaceutically acceptable excipient.

10. An oligonucleotide according to any one of claims 1 to 7, a viral vector according to claim 8, or a pharmaceutical composition according to claim 9, for use in the prevention or treatment of Friedreich's ataxia.

1 1 . Use of an oligonucleotide according to any one of claims 1 to 7, or a viral vector according to claim 8, in the preparation of a medicament for use in the prevention or treatment of Friedreich's ataxia.

12. A method for the prevention or treatment of a human subject suffering from, or being at risk of suffering from Friedreich's ataxia, said method comprising the step of administering an oligonucleotide according to any one of claims 1 to 7, a viral vector according to claim 8, or a pharmaceutical composition according to claim 9 to said subject.

13. A method for increasing expression of frataxin (FXN) in a cell, said method comprising providing said cell with an oligonucleotide according to any one of claims 1 to 7, or with a viral vector according to claim 8.

14. The method of claim 13, wherein said cell is an in vitro cell or an in vivo cell of a human subject suffering from, or being at risk of suffering from Friedreich's ataxia, wherein said cell comprises between 60-2000 GAA repeats in the first intron of the FXN gene.