WO2017185062A1 - Biomarqueurs prédictifs de l'efficacité de tas-102 - Google Patents

Biomarqueurs prédictifs de l'efficacité de tas-102 Download PDF

Info

Publication number
WO2017185062A1
WO2017185062A1 PCT/US2017/028997 US2017028997W WO2017185062A1 WO 2017185062 A1 WO2017185062 A1 WO 2017185062A1 US 2017028997 W US2017028997 W US 2017028997W WO 2017185062 A1 WO2017185062 A1 WO 2017185062A1
Authority
WO
WIPO (PCT)
Prior art keywords
patient
seq
therapy
cancer
sequence
Prior art date
Application number
PCT/US2017/028997
Other languages
English (en)
Inventor
Heinz-Josef Lenz
Original Assignee
University Of Southern California
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University Of Southern California filed Critical University Of Southern California
Publication of WO2017185062A1 publication Critical patent/WO2017185062A1/fr
Priority to US16/159,373 priority Critical patent/US20190233884A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57419—Specifically defined cancers of colon

Definitions

  • polymorphism is the occurrence in a population of two or more genetically determined alternative phenotypes due to different alleles. Polymorphism can be observed at the level of the whole individual (phenotype), in variant forms of proteins and blood group substances (biochemical polymorphism), morphological features of
  • chromosomes chromosomal polymorphism
  • DNA polymorphism DNA polymorphism
  • Polymorphism also plays a role in determining differences in an individual's response to drugs.
  • Pharmacogenetics and pharmacogenomics are multidisciplinary research efforts to study the relationship between genotype, gene expression profiles, and phenotype, as expressed in variability between individuals in response to or toxicity from drugs. Indeed, it is now known that cancer chemotherapy is limited by the predisposition of specific populations to drug toxicity or poor drug response.
  • TAS-102 is an oral combination of trifluridine (FTD) and tipiracil hydrochloride approved for the treatment of colorectal cancer.
  • TAS-102's primary anti-tumor mechanism of action is incorporating the novel nucleoside analog, FTD, into DNA. It is described herein that colorectal cancer patients harboring certain genotypes are likely to experience more desirable clinical outcomes when treated with a therapy comprising TAS-102 as compared to those not having the genotype.
  • This disclosure relates to methods and kits for one or more of: screening a biological sample for a relevant polymorphism, classifying a patient as eligible for TAS-102 therapy, identifying patients likely to respond to TAS-102 therapy, treating a patient based on the patient's genotype, and increasing survival of a patient.
  • This disclosure provides an in vitro method of detecting a polymorphism in a patient with cancer or a patient suspected of having cancer, e.g., GI cancer, colon cancer, rectal cancer, or colorectal cancer, the method comprising, or alternatively consisting essentially of, or yet further consisting of screening a biological sample from the patient to detect the genotypes of (G/C) or (G/G) for rs609429, (A/G) or (A/A) for rs861539, (A/G) or (G/G) for rs760370, or (C/T) or (T/T) for rs9394992.
  • the patient is known to have the cancer.
  • the patient is suspected of having the cancer.
  • a method for selecting a cancer patient e.g., a GI cancer patient, a colon cancer patient, a rectal cancer patient, or a colorectal cancer patient for a therapy comprising, or alternatively consisting essentially of, or yet further consisting of administration of an effective amount of TAS-102, the method comprising, or alternatively consisting essentially of, or yet further consisting of screening a biological sample isolated from the patient for a polymorphism, and selecting the patient for the therapy if the genotype of (G/C) or (G/G) for rs609429, (A/G) or (A/A) for rs861539, (A/G) or (G/G) for rs760370, or (C/T) or (T/T) for rs9394992 is present in the sample.
  • a cancer patient e.g., a GI cancer patient, a colon cancer patient, a rectal cancer patient, or a colorectal cancer patient for a therapy
  • the patient is known to have the cancer.
  • the patient is suspected of having the cancer.
  • the TAS- 102 therapy can be first line, second line, third line, fourth line or fifth line therapy and can be administered alone or in combination with other therapies, e.g., surgical resection, radiation therapy or other chemical or biological based therapies.
  • a method for classifying a cancer patient e.g., a GI cancer patient, a colon cancer patient, a rectal cancer patient, or a colorectal cancer patient as eligible for a therapy comprising, or alternatively consisting essentially of, or yet further consisting of administration of an effective amount of TAS-102, the method comprising, or alternatively consisting essentially of, or yet further consisting of screening a biological sample isolated from the patient for a polymorphism, and classifying the patient as eligible for the therapy if the genotype of (G/C) or (G/G) for rs609429, (A/G) or (A/A) for rs861539, (A/G) or (G/G) for rs760370, or (C/T) or (T/T) for rs9394992 is present in the sample.
  • a cancer patient e.g., a GI cancer patient, a colon cancer patient, a rectal cancer patient, or a colorectal
  • the patient is known to have the cancer. In another aspect the patient is suspected of having the cancer.
  • the TAS-102 therapy can be first line, second line, third line, fourth line or fifth line therapy and can be administered alone or in combination with other therapies, e.g., surgical resection, radiation therapy or other chemical or biological based therapies.
  • a cancer patient e.g., a GI cancer patient, a colon cancer patient, a rectal cancer patient, or a colorectal cancer patient is likely to experience a relatively longer or shorter progression free survival following a therapy comprising, or alternatively consisting essentially of, or yet further consisting of administration of an effective amount of TAS-102
  • the method comprising, or alternatively consisting essentially of, or yet further consisting of screening a biological sample isolated from the patient for a polymorphism, and identifying that the patient is likely to experience a longer progression free survival if the genotype of (G/C) or (G/G) for rs609429, (A/G) or (A/A) for rs861539, (A/G) or (G/G) for rs760370, or (C/T) or (T/T) for rs9394992 is present in the sample, relative to a corresponding cancer patient not having the genotyp
  • the patient is known to have the cancer. In another aspect the patient is suspected of having the cancer.
  • the TAS-102 therapy can be first line, second line, third line, fourth line or fifth line therapy and can be administered alone or in combination with other therapies, e.g., surgical resection, radiation therapy or other chemical or biological based therapies.
  • a method for identifying whether a cancer patient e.g., a GI cancer patient, a colon cancer patient, a rectal cancer patient, or a colorectal cancer patient is likely to experience TAS-102 related toxicity following a therapy comprising, or alternatively consisting essentially of, or yet further consisting of administration of an effective amount of TAS-102, the method comprising, or alternatively consisting essentially of, or yet further consisting of screening a biological sample isolated from the patient for a polymorphism, and identifying that the patient is likely to experience toxicity if the genotype of (G/C) or (G/G) for rs609429 is present in the sample, relative to a corresponding cancer patient not having the genotype.
  • a cancer patient e.g., a GI cancer patient, a colon cancer patient, a rectal cancer patient, or a colorectal cancer patient is likely to experience TAS-102 related toxicity following a therapy comprising, or alternatively consisting essentially of, or yet further
  • the patient is known to have the cancer. In another aspect the patient is suspected of having the cancer.
  • the TAS-102 therapy can be first line, second line, third line, fourth line or fifth line therapy and can be administered alone or in combination with other therapies, e.g., surgical resection, radiation therapy or other chemical or biological based therapies.
  • a method for treating a cancer patient e.g., a GI cancer patient, a colon cancer patient, a rectal cancer patient, or a colorectal cancer patient selected for treatment based on the presence of the genotype of (G/C) or (G/G) for rs609429, (A/G) or (A/A) for rs861539, (A/G) or (G/G) for rs760370, or (C/T) or (T/T) for rs9394992 in a biological sample from the patient, comprising, or alternatively consisting essentially of, or yet further consisting of administering to the patient a therapy comprising, or alternatively consisting essentially of, or yet further consisting of an effective amount of TAS-102.
  • a cancer patient e.g., a GI cancer patient, a colon cancer patient, a rectal cancer patient, or a colorectal cancer patient selected for treatment based on the presence of the genotype of (G/C)
  • the patient is known to have the cancer. In another aspect the patient is suspected of having the cancer.
  • the TAS-102 therapy can be first line, second line, third line, fourth line or fifth line therapy and can be administered alone or in combination with other therapies, e.g., surgical resection, radiation therapy or other chemical or biological based therapies.
  • a method for increasing the progression-free and/or overall survival of a cancer patient comprising, or alternatively consisting essentially of, or yet further consisting of screening a biological sample isolated from the patient for a polymorphism, and classifying the patient as eligible for the therapy with an effective amount of TAS-102 if the genotype of (G/C) or (G/G) for rs609429, (A/G) or (A/A) for rs861539, (A/G) or (G/G) for rs760370, or (C/T) or (T/T) for rs9394992 is present in the sample or not eligible for the therapy comprising administration of an effective amount of TAS-102 if the genotype of (G/C) or (G/G) for rs609429, (A/G
  • the patient is known to have the cancer. In another aspect the patient is suspected of having the cancer.
  • the TAS-102 therapy can be first line, second line, third line, fourth line or fifth line therapy and can be administered alone or in combination with other therapies, e.g., surgical resection, radiation therapy or other chemical or biological based therapies.
  • kits for performing the methods described herein comprising or alternatively consisting essentially of, or yet further consisting of reagents to identify or determine the genotype of the sample or a patient and instructions for use.
  • Figures 1(A)-(D) illustrate data for overall survival (OS) between the (C/C) and (C/G) or (G/G) genotypes for ⁇ Z rs609429 following TAS-102 treatment.
  • Figure 1(A) depicts OS by combination of ATM rs609429 in the evaluation cohort.
  • Figure 1(B) depicts OS by combination of ATM rs609429 in the control cohort.
  • Figure 1(C) depicts PFS by combination of ATM rs609429 in the validation cohort.
  • Figure 1(D) depicts OS by combination of ATM rs609429 in the validation cohort.
  • the light gray line represents the Any G genotype (C/G or G/G) and the dark gray line depicts the (C/C) genotype.
  • Figure 2 illustrates data for progression-free survival (PFS) and overall survival (OS) between the (G/G) and (G/A) genotypes for XRCC3 rs861539 following TAS-102 treatment.
  • the log-rank P values are 0.024 for PFS and 0.012 for OS.
  • Figure 3 illustrates data for overall survival (OS) or survival functions between the (C/C) and (C/G) or (G/G) genotypes for ⁇ 7 rs609429 following TAS-102 treatment (JPN TAS-102 cohort) versus treatment with the multi-kinase inhibitor Regorafenib (ITA REGORA cohort).
  • Figure 4 illustrates data for progression-free survival (PFS) between the (G/G) and (G/A) genotypes for XRCC3 rs861539 following TAS-102 treatment (JPN TAS-102 cohort) versus treatment with the multi-kinase inhibitor Regorafenib (ITA REGORA cohort).
  • the light gray line represents the (G/A) genotype and the dark gray line represents the (G/G) genotpe.
  • Figure 5 illustrates data for overall survival (OS) between the (G/G) and (G/A) genotypes for XRCC3 rs861539 following TAS-102 treatment (JPN TAS-102 cohort) versus treatment with the multi-kinase inhibitor Regorafenib (ITA REGORA cohort).
  • the light gray line represents the (G/A) genotype and the dark gray line represents the (G/G) genotpe.
  • Figure 6 illustrates data for progression -free survival (PFS) and overall survival (OS) between the (A/A) and (A/G) or (G/G) genotypes for hENT rs760370 following TAS- 102 treatment.
  • the light gray line represents the (A/G) or (G/G) genotypes and the dark gray line represents the (A/ A) genotype.
  • Figure 7 illustrates data for progression-free survival (PFS) and overall survival (OS) between the (C/C) and (C/T) or (T/T) genotypes for hENT rs9394992 following TAS- 102 treatment.
  • the light gray line represents the (C/T) or (T/T) genotypes and the dark gray line represents the (C/C) genotype.
  • Figure 8 illustrates data for progression -free survival (PFS) and overall survival (OS) among the (G/G), (G/A) and (A/A) genotypes ⁇ rs2289669 following TAS- 102 treatment.
  • the light gray line represents the (G/A) genotype
  • the medium gray line represents the (A/ A) genotype
  • the dark gray line represents the (G/G) genotype.
  • Figure 9 illustrates the expected OCT2 and ATATEl gene-gene interaction of the TAS-102 cohort.
  • the dark gray squares represent good and the light gray squares represent poor.
  • Figure 10 illustrates data for progression-free survival (PFS) and overall survival (OS) or the combination of OCT2 rs3 ⁇ 6000 MATE1 rs2289669 genotypes following TAS- 102 treatment.
  • the dark graylines represent poor and the light gray lines represent good.
  • compositions and methods include the recited elements, but not excluding others.
  • Consisting essentially of when used to define compositions and methods shall mean excluding other elements of any essential significance to the composition or method.
  • Consisting of shall mean excluding more than trace elements of other ingredients for claimed compositions and substantial method steps. Embodiments defined by each of these transition terms are within the scope of this disclosure. Accordingly, it is intended that the methods and compositions can include additional steps and components (comprising) or alternatively including steps and compositions of no significance (consisting essentially of) or alternatively, intending only the stated method steps or compositions (consisting of).
  • cancer intends a malignant phenotype characterized by the uncontrolled proliferation of malignant cells.
  • the methods and compositons of this disclosure are useful for the treatment and disagnosis of cancer of the gastrointestinal (GI) tract, such as gastric cancer, GI cancer, colon cancer, rectal cancer, and/or colorectal cancer.
  • GI gastrointestinal
  • the cancer can be metastatic, non-metastatic and pre-clinical.
  • corresponding cancer when referring to a comparison or relative term indicates that the measured or detected polymorphism is compared to a patient having the same cancer type, e.g., colorectal cancer is compared to colorectal cancer.
  • chemotherapy encompasses cancer therapies that employ chemical or biological agents or other therapies, such as radiation therapies, e.g., a small molecule drug or a large molecule, such as antibodies, RNAi and gene therapies.
  • radiation therapies e.g., a small molecule drug or a large molecule, such as antibodies, RNAi and gene therapies.
  • Non-limiting examples of chemotherapies are provided below. It should be understood, although not always explicitly stated, that when a particular therapy is noted, the scope of the invention includes equivalents unless excluded.
  • Trifluridine/tipiracil (TAS-102, CAS Number 733030-01-8 ) is sold under the trade name of Lonsurf. It is a combination of two active pharmaceutical ingredients:
  • Trifluridine has the chemical formula C 10 H 11 F 3 N 2 O 5 and is also known as ⁇ , ⁇ , ⁇ - trifluorothymidine; 5-trifluromethyl-2'-deoxyuridine; and FTD5-trifluoro-2'-deoxythymidine (CAS number 70-00-8).
  • Tipiracil has the chemical formula C 9 H 11 CIN 4 O 2 and inhibits the enzyme thymidine phosphorylase, preventing rapid metabolism of trifluridine, increasing the bioavailability of trifluridine.
  • TAS-102 intends not only Lonsurf, but also equivalents thereof. Equivalents thereof include trifluridine alone, trifluridine that modified to increase its halfiife and/or resistance to metabolism by thymidine phosphorylase, or substitution of one or both of trifluridine and/or tipiracil hydrochloride with a chemical equivalent. Non-limiting examples of chemical equivalents include pharmaceutically acceptable salts or solvates of the active ingredients.
  • TAS-102 intends the combination therapy marketed by Taiho under the tradename Lonsurf.
  • TAS- 102 is part of a combination therapy including TAS-102 or an equivalent thereof and one or more of surgical resection, radiation therapy or other line therapies.
  • TAS-102 Cancer chemotherapy has been used for the treatment of cancers for many decades.
  • Alternatives to TAS-102 include those known in the art, e.g., 5-FU, platinum-based therapies, radiation therapy, surgical resection. Non-limiting examples are disclosed herein.
  • Irinotecan (CPT-11) is sold under the trade name of Camptosar®. It is a semisynthetic analogue of the alkaloid camptothecin, which is activated by hydrolysis to SN-38 and targets topoisomerase I. Chemical equivalents are those that inhibit the interaction of topoisomerase I and DNA to form a catalytically active topoisomerase I-DNA complex. Chemical equivalents inhibit cell cycle progression at G2-M phase resulting in the disruption of cell proliferation. An equivalent of irinotecan is a composition that inhibits a
  • Non-limiting examples of an equivalent of irinotecan include topotecan, camptothecin and lamellarin D, etoposide, or doxorubicin.
  • Oxaliplatin trans-/-diaminocyclohexane oxalatoplatinum; L-OHP; CAS No.
  • oxaliplatin 61825-94-3 is sold under the trade name of Elotaxin. It is a platinum derivative that causes cell cytotoxicity. Oxaliplatin forms both inter- and intra-strand cross links in DNA, which prevent DNA replication and transcription, causing cell death.
  • Non-limiting examples of an equivalent of oxaliplatin include carboplatin and cisplatin.
  • Topoisomerase inhibitors are agents designed to interfere with the action of topoisomerase enzymes (topoisomerase I and II), which are enzymes that control the changes in DNA structure by catalyzing the breaking and rejoining of the phosphodiester backbone of DNA strands during the normal cell cycle.
  • topoisomerase inhibitors include irinotecan, topotecan, camptothecin and lamellarin D, or compounds targeting topoisomerase IA.
  • topoisomerase inhibitors include etoposide, doxorubicin or compounds targeting topoisomerase II.
  • Pyrimidine antimetabolite includes, without limitation, fluorouracil (5-FU), its equivalents and prodrugs.
  • a pyrimidine antimetabolite is a chemical that inhibits the use of a pyrimidine. The presence of antimetabolites can have toxic effects on cells, such as halting cell growth and cell division, so these compounds can be used as chemotherapy for cancer.
  • Fluorouracil (5-FU) belongs to the family of therapy drugs called pyrimidine based anti-metabolites. It is a pyrimidine analog, which is transformed into different cytotoxic metabolites that are then incorporated into DNA and RNA thereby inducing cell cycle arrest and apoptosis.
  • Chemical equivalents are pyrimidine analogs which result in disruption of DNA replication. Chemical equivalents inhibit cell cycle progression at S phase resulting in the disruption of cell cycle and consequently apoptosis.
  • Equivalents to 5-FU include prodrugs, analogs and derivative thereof such as 5'-deoxy-5-fluorouridine
  • 5-FU based adjuvant therapy refers to 5-FU alone or alternatively the combination of 5-FU with other treatments, that include, but are not limited to radiation, methyl-CCNU, leucovorin, oxaliplatin, irinotecin, mitomycin, cytarabine, levamisole.
  • Capecitabine is a prodrug of (5-FU) that is converted to its active form by the tumor-specific enzyme PynPase following a pathway of three enzymatic steps and two intermediary metabolites, 5'-deoxy-5-fluorocytidine (5'-DFCR) and 5'-deoxy-5-fluorouridine (5'-DFUR).
  • Capecitabine is marketed by Roche under the trade name Xeloda®.
  • a therapy comprising a pyrimidine antimetabolite includes, without limitation, a pyrimidine antimetabolite alone or alternatively the combination of a pyrimidine
  • antimetabolite with other treatments that include, but are not limited to, radiation, methyl- CCNU, leucovorin, oxaliplatin, irinotecin, mitomycin, cytarabine, levamisole.
  • Specific treatment adjuvant regimens are known in the art as FOLFOX, FOLFOX4, FOLFOX6, FOLFIRI, MOF (semustine (methyl-CCNU), vincrisine (Oncovin) and 5-FU).
  • FOLFIRI is a chemotherapy regimen for treatment of colorectal cancer. It is made up of the following drugs: FOL - folinic acid (leucovorin), a vitamin B derivative used as a "rescue" drug for high doses of the drug methotrexate and that modulates/potentiates/reduces the side effects of fluorouracil; F - fluorouracil (5-FU), a pyrimidine analog and
  • IRI - irinotecan Camptosar
  • a topoisomerase inhibitor which prevents DNA from uncoiling and duplicating.
  • FOLFOX is a chemotherapy regimen for treatment of colorectal cancer, is made up of the following drugs: FOL - folinic acid (leucovorin), F - fluorouracil (5-FU), and OX- oxaliplatin.
  • FOLFOXFIRI is a chemotherapy regimen for treatment of colorectal cancer, is made up of the following drugs: FOL - folinic acid (leucovorin), F - fluorouracil (5-FU), OX- oxaliplatin and IRI - irinotecan (Camptosar).
  • Bevacizumab (BV) is sold under the trade name Avastin® by Genentech. It is a humanized monoclonal antibody that binds to and inhibits the biologic activity of human vascular endothelial growth factor (VEGF). Biological equivalent antibodies are identified herein as modified antibodies which bind to the same epitope of the antigen, prevent the interaction of VEGF to its receptors (FltOl, KDR a.k.a. VEGFR2) and produce a substantially equivalent response, e.g., the blocking of endothelial cell proliferation and angiogenesis. Bevacizumab is also in the class of cancer drugs that inhibit angiogenesis (angiogenesis inhibitors).
  • angiogenesis inhibitors angiogenesis inhibitors
  • first line or “second line” or “third line” refers to the order of treatment received by a patient.
  • First line therapy regimens are treatments given first, whereas second or third line therapy are given after the first line therapy or after the second line therapy, respectively.
  • the National Cancer Institute defines first line therapy as "the first treatment for a disease or condition.
  • primary treatment can be surgery, chemotherapy, radiation therapy, or a combination of these therapies.
  • First line therapy is also referred to those skilled in the art as "primary therapy and primary treatment.” See National Cancer Institute website at cancer.gov.
  • a patient is given a subsequent chemotherapy regimen because the patient did not shown a positive clinical or sub-clinical response to the first line therapy or the first line therapy has stopped.
  • the term “equivalent” or “biological equivalent” of an antibody means the ability of the antibody to selectively bind its epitope protein or fragment thereof as measured by ELISA or other suitable methods.
  • Biologically equivalent antibodies include, but are not limited to, those antibodies, peptides, antibody fragments, antibody variant, antibody derivative and antibody mimetics that bind to the same epitope as the reference antibody.
  • the term “equivalent” of "chemical equivalent” of a chemical means the ability of the chemical to selectively interact with its target protein, DNA, RNA or fragment thereof as measured by the inactivation of the target protein, incorporation of the chemical into the DNA or RNA or other suitable methods.
  • Chemical equivalents include, but are not limited to, those agents with the same or similar biological activity and include, without limitation a pharmaceutically acceptable salt or mixtures thereof that interact with and/or inactivate the same target protein, DNA, or RNA as the reference chemical.
  • alleles refers to alternative forms of a gene or portions thereof. Alleles occupy the same locus or position on homologous chromosomes. When a subject has two identical alleles of a gene, the subject is said to be homozygous for the gene or allele. When a subject has two different alleles of a gene, the subject is said to be heterozygous for the gene. Alleles of a specific gene can differ from each other in a single nucleotide, or several nucleotides, and can include substitutions, deletions and insertions of nucleotides. An allele of a gene can also be a form of a gene containing a mutation.
  • determining the genotype of a cell or tissue sample intends to identify the genotypes of polymorphic loci of interest in the cell or tissue sample.
  • a polymorphic locus is a single nucleotide polymorphic (SNP) locus. If the allelic composition of a SNP locus is heterozygous, the genotype of the SNP locus will be identified as "X/Y" wherein X and Y are two different nucleotides. If the allelic composition of a SNP locus is heterozygous, the genotype of the SNP locus will be identified as "X/X" wherein X identifies the nucleotide that is present at both alleles.
  • a “synonymous” SNP refers to a SNP that does not cause a change in the polypeptide encoded by the gene.
  • a “non-synonymous SNP” is a SNP that does result in a change in the polypeptide encoded by the gene.
  • a non-synonymous S P may result in an amino acid substitution or the introduction of a premature stop codon.
  • genetic marker refers to an allelic variant of a polymorphic region of a gene of interest and/or the expression level of a gene of interest.
  • polymorphism refers to the coexistence of more than one form of a gene or portion thereof.
  • a portion of a gene of which there are at least two different forms, i.e., two different nucleotide sequences, is referred to as a "polymorphic region of a gene.”
  • a polymorphic region can be a single nucleotide, the identity of which differs in different alleles.
  • genotype refers to the specific allelic composition of an entire cell or a certain gene and in some aspects a specific polymorphism associated with that gene, whereas the term “phenotype” refers to the detectable outward manifestations of a specific genotype.
  • the KRAS gene ( M_004985, M_033360) is a proto-oncogene that encodes a GTPase important in in signal transduction. Mutations in the KRAS gene are found at high rates in cancers, including but not limited to colorectal cancers. Common KRAS mutations in colorectal cancer include but are not limited to mutations at codons 12 or 13 of exon 2 that result in amino acid substitutions in the protein sequenc such as Glyl2Asp [GGT > GAT] G12D, Glyl2Val [GGT > GAC] G12V, Glyl2Cys [GGT > TGT] G12C, Glyl2Ser
  • the BRAF gene (NM 004333) is a proto-oncogene that is often mutated in colorectal cancers.
  • the BRAF gene encodes a signal transduction kinase of the Raf family.
  • Common mutations of the BRAF gene that are relevant to cancer result in amino acid substitutions in the protein sequence including but not limited to V600E, R461I, I462S, G463E, G463V, G465A, G465E, G465V, G468A, G468E, N580S, E585K, D593V, F594L, G595R, L596V, T598I, V599D, V599E, V599K, V599R, V600K, A727V.
  • KRAS wild-type and "BRAF wild-type” refers to a genotype of a cell or patient in which no mutation is detected in the corresponding gene. In some aspects, no mutation is detected that affects the function or activity of the gene.
  • the rs760370 polymorphism is located at chromosome position 44173216 on chromosome 6 according to the Genome Reference Consortium Human Build 38 patch release 2 (GRCh38.p2, NCBI).
  • the rs760370 polymorphism is located within the human equilibrative nucleoside transporter 1 hENTl, mRNA: M_001078174, M_001078175, M_001078176, M_001078177, M_001304462, M_001304463, M_001304465, M_001304466, M_004955) gene (also known as SLC29A1, solute carrier family 29 member 1).
  • the following nucleotide sequence represents a region of human DNA comprising the rs760370 polymorphism:
  • the partial sequence of the (A) allele of the rs760370 polymorphism is: TGGGTGGAGGTGGAGACAGGTTTGCAGGAAGGAGTGAAAGACAACCCCACC (SEQ ID NO:33) and the partial sequence of the (G) allele is:
  • the rs609429 polymorphism (also named IVS48+238C>G) is located at chromosome position 20322886 on chromosome 11 according to the Genome Reference Consortium Human Build 38 patch release 2 (GRCh38.p2, NCBI).
  • the rs609429 is located at chromosome position 20322886 on chromosome 11 according to the Genome Reference Consortium Human Build 38 patch release 2 (GRCh38.p2, NCBI).
  • polymorphism is and intron polymorphism located within the ataxia telangiectasia ⁇ A M, mRNA: NM_000051, NM_138292, NM_138293) gene.
  • ATM a serine/threonine protein kinase, is a key activator of the cellular response to DNA double-strand breaks managing subsequent phosphorylation of proteins such as p53, Chk2, and BRCA1.
  • the minor allele (G) generates a weak 5' splice site and decreases gene expression.
  • the following nucleotide sequence represents a region of human DNA comprising the rs609429 polymorphism:
  • rs861539 polymorphism is located at chromosome position 85475893 on chromosome 14 according to the Genome Reference Consortium Human Build 38 patch release 2 (GRCh38.p2, NCBI).
  • the rs861539 polymorphism is located within the X-ray repair complementing defective repair in Chinese hamster cells 3 (XRCC3, mRNA: NM_001100118, NM_001100119, NM_005432) gene.
  • XRCC3 is a member of the DNA repair genes encoding the
  • RecA/RAD51 -related protein family for the maintenance of genome stability in homologous recombination repair for DNA double-strand breaks.
  • the polymorphism is in the coding region of the XRCC3 gene and results in a T241M change in the XRCC3 protein.
  • the following nucleotide sequence represents a region of human DNA comprising the rs861539 polymorphism: AGGCATCTGCAGTCCCTGGGGGCCA[C/T]GC
  • the partial sequence of the (C) allele of rs861539 is: AGGCATCTGCAGTCCCTGGGGGCCACGCTGCGTGAGCTGAG CAGTGCCTTC (SEQ ID NO:31) and the partial sequence of the (T) allele is AGGCATC TGCAGTCCCTGGGGGCCATGCTGCGTGAGCTGAGCAGTGCCTTC (SEQ ID NO:32).
  • the rs9394992 polymorphism is located at chromosome position 44168255 on chromosome 6 according to the Genome Reference Consortium Human Build 38 patch release 2 (GRCh38.p2, NCBI), which is also within the hENTl gene.
  • the following nucleotide sequence represents a region of human DNA comprising the rs9394992 polymorphism: CCTGTGGGCAG
  • TTCCCTGAAGGCCTCGCCGGCTCCATTTGCCTTATTGCAC SEQ ID NO: 35
  • the partial sequence of the (T) allele is: CCTGTGGGCAG
  • the OCT2 rs316019 polymorphism is located at chromosome position
  • nucleotide sequence represents a region of human DNA comprising the rs316019 polymorphism:
  • CTGGAGGTGGTTGCAGTTCACAGTTGCTCTGCCCAACTTCTTCTTCTTGCT SEQ ID NO:39
  • the partial sequence of the (T) allele of rs316019 is:
  • the MATE1 rs2289669 polymorphism is located at chromosome position
  • nucleotide sequence represents a region of human DNA comprising the rs2289669 polymorphism:
  • encode refers to a polynucleotide which is said to "encode” a polypeptide if, in its native state or when manipulated by methods well known to those skilled in the art, it can be transcribed and/or translated to produce the mRNA for the polypeptide and/or a fragment thereof.
  • the antisense strand is the
  • isolated refers to molecules or biological or cellular materials being substantially free from other materials.
  • isolated refers to nucleic acid, such as DNA or RNA, or protein or polypeptide, or cell or cellular organelle, or tissue or organ, separated from other DNAs or RNAs, or proteins or
  • isolated also refers to a nucleic acid or peptide that is substantially free of cellular material, viral material, or culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized.
  • isolated nucleic acid is meant to include nucleic acid fragments which are not naturally occurring as fragments and would not be found in the natural state.
  • isolated is also used herein to refer to polypeptides which are isolated from other cellular proteins and is meant to encompass both purified and recombinant polypeptides.
  • isolated is also used herein to refer to cells or tissues that are isolated from other cells or tissues and is meant to encompass both cultured and engineered cells or tissues.
  • a response to treatment includes a reduction in cachexia, increase in survival time, elongation in time to tumor progression, reduction in tumor mass, reduction in tumor burden and/or a prolongation in time to tumor metastasis, time to tumor recurrence, tumor response, complete response, partial response, stable disease, progressive disease, progression free survival, overall survival, each as measured by standards set by the National Cancer Institute and the U.S. Food and Drug Administration for the approval of new drugs.
  • an effective amount or “therapeutically effect amount” intends to indicate the amount of a compound or agent administered or delivered to the patient which is most likely to result in the desired response to treatment.
  • the amount is empirically determined by the patient's clinical parameters including, but not limited to the Stage of disease, age, gender, histology, and likelihood for tumor recurrence.
  • a "patient” as used herein intends an animal patient, a mammal patient or yet further a human patient.
  • a mammal includes but is not limited to a simian, a murine, a bovine, an equine, a porcine or an ovine subject.
  • clinical outcome refers to any clinical observation or measurement relating to a patient's reaction to a therapy.
  • clinical outcomes include tumor response (TR), overall survival (OS), progression free survival (PFS), disease free survival, time to tumor recurrence (TTR), time to tumor progression (TTP), relative risk (RR), objective response rate (RR or ORR), toxicity or side effect.
  • TAS-102 related toxicity refers to harmful, toxic, or adverse effects or events caused by treatment with TAS-102. Such effects include but are not limited to febrile neutropenia, leukopenia, stomatitis, neutropenia, hand-foot syndrome, cardiac ischemia, thrombocytopenia, increase in alanine aminotransferase level, increase in aspartate aminotransferase level, increase in total bilirubin, increase in alkaline phosphatase level, increase in creatinine level, anemia, anorexia, nausea, vomiting, decreased appetite, fatigue, abdominal pain, fever, asthenia, and diarrhea.
  • the comparative reference for relative terms such as "increased” or “decreased” in the preceding list is the levels in the patient or subject prior to TAS-102 treatment or the levels in a group of treated patients or subjects compared to untreated control patients or subjects.
  • TAS-102 related toxic effects are detailed in Mayer et al. New England J Med., 372: 1909-1919 (May 2015).
  • acute drug toxicity involves harmful or adverse effects in an organism through a single or short-term exposure to a drug substance or other therapeutic biological products.
  • “Subchronic” toxicity is the ability of a drug substance to cause harmful or adverse effects for more than one year but less than the lifetime of the exposed organism.
  • “Chronic” toxicity is the ability of a drug substance or combination therapy to cause harmful effects over an extended period, usually upon repeated or continuous exposure, sometimes lasting for the entire life of the exposed organism. Adverse events are classified and graded by severity. Grade 1 adverse events: Mild; asymptomatic or mild symptoms; clinical or diagnostic observations only; intervention not indicated. Grade 2 adverse events: Moderate; minimal, local or noninvasive intervention indicated; limiting age-appropriate instrumental activities of daily living (ADL). Grade 3 adverse events: Severe or medically significant but not immediately life-threatening;
  • suitable for a therapy or “suitably treated with a therapy” shall mean that the patient is likely to exhibit one or more desirable clinical outcomes as compared to patients having the same disease and receiving the same therapy but possessing a different characteristic that is under consideration for the purpose of the comparison.
  • the characteristic under consideration is a genetic polymorphism or a somatic mutation.
  • the characteristic under consideration is expression level of a gene or a polypeptide.
  • a more desirable clinical outcome is relatively higher likelihood of or relatively better tumor response such as tumor load reduction.
  • a more desirable clinical outcome is relatively longer overall survival.
  • a more desirable clinical outcome is relatively longer progression free survival or time to tumor progression.
  • a more desirable clinical outcome is relatively longer disease free survival.
  • a more desirable clinical outcome is relative reduction or delay in tumor recurrence.
  • a more desirable clinical outcome is relatively decreased metastasis.
  • a more desirable clinical outcome is relatively lower relative risk.
  • a more desirable clinical outcome is relatively reduced toxicity or side effects.
  • more than one clinical outcomes are considered simultaneously.
  • a patient possessing a characteristic such as a genotype of a genetic polymorphism, can exhibit more than one more desirable clinical outcomes as compared to patients having the same disease and receiving the same therapy but not possessing the characteristic. As defined herein, the patient is considered suitable for the therapy.
  • progression free survival or overall survival is weighted more heavily than tumor response in a collective decision making.
  • Response criteria herein are based on the RECIST criteria (Therasse and Arbuck et al., 2000, New Guidelines to Evaluate Response to Treatment in Solid Tumors, J Natl Cancer Inst, 92:205-16).
  • a "complete response” (CR) to a therapy refers to the clinical status of a patient with evaluable but non-measurable disease, whose tumor and all evidence of disease have disappeared following administration of the therapy.
  • PR partial response
  • PR refers to a response that is anything less than a complete response.
  • SD stable disease
  • PD Progressive disease indicates that the tumor has grown (i.e. become larger) or spread (i.e.
  • Non-response to a therapy refers to status of a patient whose tumor or evidence of disease has remained constant or has progressed.
  • OS Global System for Mobile communications
  • Progression free survival PFS or “Time to Tumor Progression” (TTP) refers to the length of time following a therapy, during which the tumor in a cancer patient does not grow.
  • Progression-free survival includes the amount of time a patient has experienced a complete response, partial response or stable disease.
  • Disease free survival refers to the length of time following a therapy, during which a cancer patient survives with no signs of the cancer or tumor.
  • TTR Tumor Recurrence
  • Relative Risk in statistics and mathematical epidemiology, refers to the risk of an event (or of developing a disease) relative to exposure. Relative risk is a ratio of the probability of the event occurring in the exposed group versus a non-exposed group.
  • Objective response rate refers to the proportion of responders (patients with either a partial (PR) or complete response (CR)) compared to nonresponders (patients with either SD or PD). Response duration can be measured from the time of initial response until documented tumor progression.
  • identify or “identifying” is to associate or affiliate a patient closely to a group or population of patients who likely experience the same or a similar clinical response to a therapy.
  • selecting a patient for a therapy refers to making an indication that the selected patient is suitable for the therapy.
  • Such an indication can be made in writing by, for instance, a handwritten prescription or a computerized report making the corresponding prescription or recommendation.
  • the genetic marker or polymorphism is measured before and/or during treatment, and the values obtained are used by a clinician in assessing any of the following: (a) probable or likely suitability of an individual to initially receive treatment(s); (b) probable or likely unsuitability of an individual to initially receive treatment(s); (c) responsiveness to treatment; (d) probable or likely suitability of an individual to continue to receive treatment(s); (e) probable or likely unsuitability of an individual to continue to receive treatment(s); (f) adjusting dosage; (g) predicting likelihood of clinical benefits; or (h) toxicity.
  • measurement of the genetic marker or polymorphism in a clinical setting is a clear indication that this parameter was used as a basis for initiating, continuing, adjusting and/or ceasing administration of the treatments described herein.
  • Having the same cancer is used when comparing one patient to another or alternatively, one patient population to another patient population.
  • the two patients or patient population will each have or be suffering from colon cancer.
  • a "normal cell corresponding to the tumor tissue type” refers to a normal cell from a same tissue type as the tumor tissue.
  • a non-limiting examples is a normal lung cell from a patient having lung tumor, or a normal colon cell from a patient having colon tumor.
  • Amplification means one or more methods known in the art for copying a target nucleic acid, thereby increasing the number of copies of a selected nucleic acid sequence. Amplification can be exponential or linear. A target nucleic acid can be either DNA or RNA. The sequences amplified in this manner form an
  • amplicon While the exemplary methods described hereinafter relate to amplification using the polymerase chain reaction (“PCR"), numerous other methods are known in the art for amplification of nucleic acids (e.g., isothermal methods, rolling circle methods, etc.). The skilled artisan will understand that these other methods can be used either in place of, or together with, PCR methods.
  • PCR polymerase chain reaction
  • complement means the complementary sequence to a nucleic acid according to standard Watson/Crick base pairing rules.
  • a complement sequence can also be a sequence of RNA complementary to the DNA sequence or its complement sequence, and can also be a cDNA.
  • substantially complementary means that two sequences hybridize under stringent hybridization conditions. The skilled artisan will understand that substantially complementary sequences need not hybridize along their entire length. In particular, substantially complementary sequences comprise a contiguous sequence of bases that do not hybridize to a target or marker sequence, positioned 3' or 5' to a contiguous sequence of bases that hybridize under stringent hybridization conditions to a target or marker sequence.
  • hybridize or “specifically hybridize” refers to a process where two complementary nucleic acid strands anneal to each other under appropriately stringent conditions. Hybridizations are typically conducted with probe-length nucleic acid molecules. Nucleic acid hybridization techniques are well known in the art. Those skilled in the art understand how to estimate and adjust the stringency of hybridization conditions such that sequences having at least a desired level of complementarity will stably hybridize, while those having lower complementarity will not.
  • Primer refers to an oligonucleotide that is capable of acting as a point of initiation of synthesis when placed under conditions in which primer extension is initiated (e.g., primer extension associated with an application such as PCR).
  • the primer is complementary to a target nucleotide sequence and it hybridizes to a substantially
  • oligonucleotide “primer” can occur naturally, as in a purified restriction digest or can be produced synthetically.
  • primer as used herein includes all forms of primers that can be synthesized including, peptide nucleic acid primers, locked nucleic acid primers, phosphorothioate modified primers, labeled primers, and the like.
  • Primers are typically between about 5 and about 100 nucleotides in length, such as between about 15 and about 60 nucleotides in length, such as between about 20 and about 50 nucleotides in length, such as between about 25 and about 40 nucleotides in length.
  • primers can be at least 8, at least 12, at least 16, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60 nucleotides in length.
  • An optimal length for a particular primer application can be readily determined in the manner described in H. Erlich, PCR Technology. Principles and Application for DNA Amplification (1989).
  • Probe refers to nucleic acid that interacts with a target nucleic acid via hybridization.
  • a probe can be fully complementary to a target nucleic acid sequence or partially complementary. The level of complementarity will depend on many factors based, in general, on the function of the probe.
  • a probe or probes can be used, for example to detect the presence or absence of a mutation in a nucleic acid sequence by virtue of the sequence characteristics of the target. Probes can be labeled or unlabeled, or modified in any of a number of ways well known in the art.
  • a probe can specifically hybridize to a target nucleic acid.
  • Probes can be DNA, RNA or a RNA/DNA hybrid. Probes can be
  • Probes can comprise modified nucleobases, modified sugar moieties, and modified internucleotide linkages.
  • a probe can be fully complementary to a target nucleic acid sequence or partially complementary.
  • a probe can be used to detect the presence or absence of a target nucleic acid.
  • Probes are typically at least about 10, 15, 21, 25, 30, 35, 40, 50, 60, 75, 100 nucleotides or more in length.
  • Detecting refers to determining the presence of a nucleic acid of interest in a sample or the presence of a protein of interest in a sample. Detection does not require the method to provide 100% sensitivity and/or 100% specificity.
  • Detectable label refers to a molecule or a compound or a group of molecules or a group of compounds used to identify a nucleic acid or protein of interest. In some cases, the detectable label can be detected directly. In other cases, the detectable label can be a part of a binding pair, which can then be subsequently detected. Signals from the detectable label can be detected by various means and will depend on the nature of the detectable label. Detectable labels can be isotopes, fluorescent moieties, colored substances, and the like. Examples of means to detect detectable label include but are not limited to spectroscopic, photochemical, biochemical, immunochemical, electromagnetic,
  • radiochemical, or chemical means such as fluorescence, chemifluorescence, or
  • TaqMan® PCR detection system refers to a method for real time PCR.
  • a TaqMan® probe which hybridizes to the nucleic acid segment amplified is included in the PCR reaction mix.
  • the TaqMan® probe comprises a donor and a quencher fluorophore on either end of the probe and in close enough proximity to each other so that the fluorescence of the donor is taken up by the quencher.
  • the 5'-exonuclease activity of the Taq polymerase cleaves the probe thereby allowing the donor fluorophore to emit fluorescence which can be detected.
  • test sample refers to any liquid or solid material containing nucleic acids.
  • a test sample is obtained from a biological source (i.e., a "biological sample”), such as cells in culture or a tissue sample from an animal, preferably, a human.
  • a biological sample such as cells in culture or a tissue sample from an animal, preferably, a human.
  • the sample is a biopsy sample.
  • Target nucleic acid refers to segments of a chromosome, a complete gene with or without intergenic sequence, segments or portions a gene with or without intergenic sequence, or sequence of nucleic acids to which probes or primers are designed.
  • Target nucleic acids can include wild type sequences, nucleic acid sequences containing mutations, deletions or duplications, tandem repeat regions, a gene of interest, a region of a gene of interest or any upstream or downstream region thereof.
  • Target nucleic acids can represent alternative sequences or alleles of a particular gene.
  • Target nucleic acids can be derived from genomic DNA, cDNA, or RNA.
  • target nucleic acid can be native DNA or a PCR-amplified product.
  • stringency is used in reference to the conditions of temperature, ionic strength, and the presence of other compounds, under which nucleic acid hybridizations are conducted. With high stringency conditions, nucleic acid base pairing will occur only between nucleic acids that have sufficiently long segments with a high frequency of complementary base sequences. Exemplary hybridization conditions are as follows. High stringency generally refers to conditions that permit hybridization of only those nucleic acid sequences that form stable hybrids in 0.018 M NaCl at 65°C.
  • High stringency conditions can be provided, for example, by hybridization in 50% formamide, 5> ⁇ Denhardt's solution, 5> ⁇ SSC (saline sodium citrate) 0.2% SDS (sodium dodecyl sulfate) at 42°C, followed by washing in O. l xSSC, and 0.1% SDS at 65°C.
  • Moderate stringency refers to conditions equivalent to hybridization in 50% formamide, 5 Denhardt's solution, 5xSSC, 0.2% SDS at 42°C, followed by washing in 0.2xSSC, 0.2% SDS, at 65°C.
  • Low stringency refers to conditions equivalent to hybridization in 10% formamide, 5xDenhardt's solution, 6xSSC, 0.2% SDS, followed by washing in 1°SSC, 0.2% SDS, at 50°C.
  • the term "substantially identical" refers to a polypeptide or nucleic acid exhibiting at least 50%, 75%, 85%, 90%, 95%, or even 99% identity to a reference amino acid or nucleic acid sequence over the region of comparison.
  • the length of comparison sequences will generally be at least 20, 30, 40, or 50 amino acids or more, or the full length of the polypeptide.
  • the length of comparison sequences will generally be at least 10, 15, 20, 25, 30, 40, 50, 75, or 100 nucleotides or more, or the full length of the nucleic acid.
  • the disclosure further provides diagnostic, prognostic and therapeutic methods, which are based, at least in part, on determination of the identify of a genotype of interest identified herein.
  • information obtained using the diagnostic assays described herein is useful for determining if a subject is suitable for cancer treatment of a given type. Based on the prognostic information, a doctor can recommend a therapeutic protocol, useful for reducing the malignant mass or tumor in the patient or treat cancer in the individual.
  • a patient's likely clinical outcome following a clinical procedure such as a therapy or surgery can be expressed in relative terms.
  • a patient having a particular genotype or expression level can experience relatively longer overall survival than a patient or patients not having the genotype or expression level.
  • the patient having the particular genotype or expression level alternatively, can be considered as likely to survive.
  • a patient having a particular genotype or expression level can experience relatively longer progression free survival, or time to tumor progression, than a patient or patients not having the genotype or expression level.
  • the patient having the particular genotype or expression level alternatively, can be considered as not likely to suffer tumor progression.
  • a patient having a particular genotype or expression level can experience relatively shorter time to tumor recurrence than a patient or patients not having the genotype or expression level.
  • the patient having the particular genotype or expression level is
  • a patient having a particular genotype or expression level can experience relatively more complete response or partial response than a patient or patients not having the genotype or expression level.
  • the patient having the particular genotype or expression level alternatively, can be considered as likely to respond. Accordingly, a patient that is likely to survive, or not likely to suffer tumor progression, or not likely to suffer tumor recurrence, or likely to respond following a clinical procedure is considered suitable for the clinical procedure.
  • information obtained using the diagnostic assays described herein can be used alone or in combination with other information, such as, but not limited to, genotypes or expression levels of other genes, clinical chemical parameters, histopathological parameters, or age, gender and weight of the subject.
  • the information obtained using the diagnostic assays described herein is useful in determining or identifying the clinical outcome of a treatment, selecting a patient for a treatment, or treating a patient, etc.
  • the information obtained using the diagnostic assays described herein is useful in aiding in the determination or identification of clinical outcome of a treatment, aiding in the selection of a patient for a treatment, or aiding in the treatment of a patient and etc.
  • the genotypes or expression levels of one or more genes as disclosed herein are used in a panel of genes, each of which contributes to the final diagnosis, prognosis or treatment.
  • a mammal includes but is not limited to a human, a simian, a murine, a bovine, an equine, a porcine or an ovine subject.
  • TAS-102 is a combination of two active pharmaceutical ingredients: trifluridine, a nucleoside analog, and tipiracil hydrochloride, a thymidine phosphorylase inhibitor.
  • Tipiracil hydrochloride prevents rapid metabolism of trifluridine, increasing the bioavailability of trifluridine approved for the treatment of metastatic colorectal cancer.
  • More desirable clinical outcomes for a cancer patient following a therapy include, without limitation, higher likelihood to respond to the therapy, relatively longer progression free survival (PFS), relatively longer overall survival (OS), relatively longer time to tumor recurrence (TTR), lower likelihood to experience an adverse effect or toxicity, or relatively milder adverse effect or toxicity.
  • PFS progression free survival
  • OS relatively longer overall survival
  • TTR tumor recurrence
  • cancer patients harboring certain genotypes are likely to experience more desirable clinical outcomes when treated with a therapy comprising, consisting essentially of, or yet consisting of, cetuximab, or therapy comprising TAS-102.
  • More desirable clinical outcomes for a cancer patient following a therapy include, without limitation, higher likelihood to respond to the therapy, relatively longer progression free survival (PFS), relatively longer overall survival (OS), relatively longer time to tumor recurrence (TTR), lower likelihood to experience an adverse effect or toxicity, or relatively milder adverse effect or toxicity.
  • genotypes noted here only refer to one O A strand; for instance, genotype C/G is equivalent to G/C on the opposite strand and should be understood to encompass both strands. "Findings with respect to the interaction between MATE1 rs2289669 and OCT2 rs316019 polymorphisms on PFS and OS are further described herein (see Examples).
  • polymorphism in a patient with cancer or a patient suspected of having cancer e.g., GI cancer, colon cancer, rectal cancer, or colorectal cancer
  • the method comprising, or alternatively consisting essentially of, or yet further consisting of screening a biological sample from the patient to detect the genotypes of (G/C) or (G/G) for rs609429, (A/G) or (A/A) for rs861539, (A/G) or (G/G) for rs760370, or (C/T) or (T/T) for rs9394992.
  • the patient is known to have the cancer.
  • the patient is suspected of having the cancer.
  • the screening comprises, or alternatively consists essentially of, or yet further consists of detecting the genotypes of (G/C) or (G/G) for rs609429 in the sample. In some embodiments, the screening comprises, or alternatively consists essentially of, or yet further consists of detecting the genotypes of (A/G) or (A/ A) for rs861539 in the sample. In some embodiments, the screening comprises, or alternatively consists essentially of, or yet further consists of detecting the genotypes of (A/G) or (G/G) for rs760370 in the sample.
  • the screening comprises, or alternatively consists essentially of, or yet further consists of detecting the genotypes of (C/T) or (T/T) for rs9394992 in the sample.
  • the method further comprises, or alternatively consists essentially of, or yet further consists of, administering a therapy comprising administration of an effective amount of TAS-102.
  • the therapy can be first line, second line, third line, fourth line of fifth line therapy and is some aspects, can be administered alone or in combination with other therapies, e.g., surgical resection, radiation therapy or other chemical or biological based therapies.
  • a cancer patient e.g. a GI cancer, colon cancer, a rectal cancer or a colorectal cancer patient for a therapy comprising administration of an effective amount of TAS-102
  • the method comprising, or alternatively consisting essentially of, or yet further consists of, screening a biological sample isolated from the patient for an rs609429 polymorphism, and selecting the patient for the therapy if the genotype of (G/C) or (G/G) for rs609429 is present in the sample.
  • the patient is not selected for a therapy comprising, or alternatively consisting essentially of, or yet further consists of, a therapeutically effective amount of TAS-102 if the genotype of (G/C) or (G/G) for rs609429 is not present in the sample.
  • the patient is not selected for a therapy comprising, or alternatively consisting essentially of, or yet further consists of, TAS-102 if the genotype of (C/C) for rs609429 is present in the sample.
  • the patient is selected for a TAS-102-free therapy if the genotype of (G/C) or (G/G) for rs609429 is not present in the sample.
  • Non-limiting examples of other cancer therapies are known in the art and described herein.
  • the patient is selected for a TAS-102-free therapy if the genotype of (C/C) for rs609429 is present in the sample.
  • the therapy can be first line, second line, third line, fourth line of fifth line therapy and is some aspects, can be administered alone or in combination with other therapies, e.g., surgical resection, radiation therapy or other chemical or biological based therapies.
  • a method for classifying a cancer patient e.g. a GI cancer, colon cancer, a rectal cancer, or a colorectal cancer patient as eligible for a therapy comprising, or alternatively consisting essentially of, or yet further consists of, administration of an effective amount of TAS-102, the method comprising, or alternatively consisting essentially of, or yet further consists of, screening a biological sample isolated from the patient for an rs609429 polymorphism, and classifying the patient as eligible for the therapy if the genotype of (G/C) or (G/G) for rs609429 is present in the sample.
  • the method comprises, or consists essentially of, or yet further consists of, classifying the patient as not eligible for the therapy comprising, or alternatively consisting essentially of, or yet further consists of, administration of an effective amount of TAS-102 if the genotype of (G/C) or (G/G) for rs609429 is not present in the sample.
  • the patient is classified as not eligible for the therapy comprising TAS-102 if the genotype of (C/C) for rs609429 is present in the sample.
  • the method further comprises administering a therapy comprising, or alternatively consisting essentially of, or yet further consists of, a therapeutically effective amount of TAS-102.
  • the therapy can be first line, second line, third line, fourth line of fifth line therapy and is some aspects, can be administered alone or in combination with other therapies, e.g., surgical resection, radiation therapy or other chemical or biological based therapies.
  • a method for increasing the progression-free and/or overall survival of a cancer patient comprising, or alternatively consisting essentially of, or yet further consists of, screening a biological sample isolated from the patient for an rs609429 polymorphism, and classifying the patient as eligible for a therapy comprising administration of an effective amount of TAS-102 if the genotype of (G/C) or (G/G) for rs609429 is present in the sample, or not eligible for the therapy comprising, or alternatively consisting essentially of, or yet further consists of, TAS-102 if the genotype of (G/C) or (G/G) for rs609429 is not present in the sample.
  • the patient is classified as not eligible for the therapy comprising, or alternatively consisting essentially of, or yet further consists of, TAS-102 if the genotype of (C/C) for rs609429 is present in the sample.
  • the method further comprises administering a therapy comprising, or alternatively consisting essentially of, or yet further consists of, an effective amount of TAS-102 or a TAS-102-free therapy in accordance with the classification.
  • the therapy can be first line, second line, third line, fourth line of fifth line therapy and is some aspects, can be administered alone or in combination with other therapies, e.g., surgical resection, radiation therapy or other chemical or biological based therapies.
  • a cancer patient e.g. a GI cancer, colon cancer, a rectal cancer or a colorectal cancer patient is likely to experience a relatively longer or shorter progression free survival (PFS) following a therapy comprising administration of an y effective amount of TAS-102
  • the method comprising, or alternatively consisting essentially of, or yet further consists of, screening a biological sample isolated from the patient for an rs609429 polymorphism, and identifying that the patient as likely to experience a longer progression free survival if the genotype of (G/C) or (G/G) for rs609429 is present in the sample, relative to a corresponding cancer patient not having the genotype.
  • the method comprises identifying that the patient is likely to experience a shorter progression free survival if the genotype of (G/C) or (G/G) for rs609429 is not present in the sample, relative to a corresponding cancer patient having the genotype or relative to a corresponding cancer patient having the genotype of (C/C) for rs609429. In some embodiments, the method comprises identifying that the patient is likely to experience a shorter progression free survival if the genotype of (C/C) for rs609429 is present in the sample, relative to a corresponding cancer patient not having the genotype or relative to a colorectal cancer patient having the genotype of (G/C) or (G/G) for rs609429.
  • the therapy can be first line, second line, third line, fourth line of fifth line therapy and is some aspects, can be administered alone or in combination with other therapies, e.g., surgical resection, radiation therapy or other chemical or biological based therapies.
  • a method for treating a cancer patient e.g. a GI cancer, colon cancer, a rectal cancer or a colorectal cancer patient selected for treatment based on the presence of the genotype of (G/C) or (G/G) for rs609429 in a biological sample from the patient, the method comprising, or alternatively consisting essentially of, or yet further consists of, administering to the patient a therapy comprising, or alternatively consisting essentially of, or yet further consists of, an effective amount of TAS-102.
  • a method for treating a cancer patient e.g. a GI cancer, colon cancer, a rectal cancer or a colorectal cancer patient selected for treatment based on the absence of the genotype of (C/C) for rs609429 in a biological sample from the patient, the method
  • the therapy can be first line, second line, third line, fourth line of fifth line therapy and is some aspects, can be administered alone or in combination with other therapies, e.g., surgical resection, radiation therapy or other chemical or biological based therapies.
  • the methods noted above further comprise screening a biological sample isolated from the patient for the rs609429 polymorphism.
  • a method for treating a cancer patient e.g. a GI cancer, colon cancer, a rectal cancer or a colorectal cancer patient, the method comprising, or alternatively consisting essentially of, or yet further consists of, screening a biological sample isolated from the patient for the rs609429 polymorphism and administering to the patient a therapy comprising, or alternatively consisting essentially of, or yet further consists of, an effective amount of TAS-102 if the sample has the genotype of (G/C) or (G/G) for rs609429.
  • a method for modifying the treatment of a cancer patient e.g. a GI cancer, colon cancer, a rectal cancer or a colorectal cancer patient receiving a therapy, the therapy comprising, or alternatively consisting essentially of, or yet further consists of, an effective amount of TAS-102 based on the presence of the genotype of (G/C) or (G/G) for rs609429 in a biological sample from the patient.
  • a therapy comprising, or alternatively consisting essentially of, or yet further consists of, an effective amount of TAS- 102.
  • the method further comprises, or alternatively consists essentially of, or yet further consists of screening a biological sample isolated from the patient for an rs609429 polymorphism, and modifying the dosage or frequency of the therapy based on the genotype for rs609429.
  • the dosage or frequency of the therapy, or components thereof e.g., one or more therapeutic agents of the therapy
  • the dosage or frequency of the therapy, or components thereof is increased if the genotype of (G/C) or (G/G) for rs609429 is not present in the sample.
  • the dosage or frequency of the therapy, or components thereof is increased if the genotype of (C/C) for rs609429 is present in the sample.
  • the therapy is discontinued if the genotype of (G/C) or (G/G) for rs609429 is not present in the sample. In some embodiments, the therapy is discontinued if the genotype of (C/C) for rs609429 is present in the sample. In some embodiments, the therapy is continued if the genotype of (G/C) or (G/G) for rs609429 is present in the sample.
  • the therapy can be first line, second line, third line, fourth line of fifth line therapy and is some aspects, can be administered alone or in combination with other therapies, e.g., surgical resection, radiation therapy or other chemical or biological based therapies.
  • any appropriate technique can be used for screening the biological sample isolated from the patient for an rs609429 polymorphism.
  • a non-limiting example comprises contacting the biological sample with a nucleic acid probe that specifically binds to nucleic acid containing the rs609429 polymorphism and overlaps the polymorphic site.
  • the nucleic acid specifically binds to a nucleic acid having the sequence of SEQ ID NO: 1, SEQ ID NO:29, or SEQ ID NO:30 and overlaps the polymorphic site.
  • the a nucleic acid is labeled with a detectable moiety, having about 5, about 10, about 15, about 20, about 25, about 30, about 35, or about 40 nucleotides upstream and/or downstream of the polymorphic region.
  • whole genome sequencing can be used to determine the identity of the genome at the site of interest.
  • screening a biological sample isolated from the patient for an rs609429 polymorphism comprises amplifying nucleic acid containing the rs609429 polymorphism.
  • nucleic acid containing the rs609429 polymorphism is amplified using a forward primer comprising nucleic acid having the sequence of SEQ ID NO:8 and a reverse primer comprising nucleic acid having the sequence of SEQ ID NO:9.
  • a cancer patient e.g. a GI cancer, colon cancer, a rectal cancer or a colorectal cancer patient for a therapy
  • the selection method comprises, or alternatively consists essentially of, or yet further consists of, screening a biological sample isolated from the patient for an rs861539 polymorphism, and selecting the patient for the therapy if the genotype of (A/G) or (A/ A) for rs861539 is present in the sample. In some embodiments, the patient is not selected for the therapy if the genotype of (A/G) or (A/ A) for rs861539 is not present in the sample. In some embodiments, the patient is not selected for the therapy if the genotype of (G/G) for rs861539 is present in the sample.
  • the patient is selected for a TAS-102-free therapy if the genotype of (A/G) or (A/ A) for rs861539 is not present in the sample. In some embodiments, the patient is selected for a TAS-102-free therapy if the genotype of (G/G) for rs861539 is present in the sample.
  • the therapy can be first line, second line, third line, fourth line of fifth line therapy and is some aspects, can be administered alone or in combination with other therapies, e.g., surgical resection, radiation therapy or other chemical or biological based therapies.
  • a cancer patient e.g. a GI cancer, colon cancer, a rectal cancer or a colorectal cancer patient as eligible for a therapy
  • the therapy comprising, or alternatively consisting essentially of, or yet further consists of, administration of an effective amount of TAS-102, comprising screening a biological sample isolated from the patient for an rs861539 polymorphism, and classifying the patient as eligible for the therapy if the genotype of (A/G) or (A/ A) for rs861539 is present in the sample.
  • the method comprises classifying the patient as not eligible for the therapy comprising TAS-102 if the genotype of (A/G) or (A/ A) for rs861539 is not present in the sample. In some embodiments, the patient is classified as not eligible for the therapy comprising administration of an effective amount of TAS-102 if the genotype of (G/G) for rs861539 is present in the sample. In some embodiments, the method further comprises, or alternatively consists essentially of, or yet further consists of, administering a therapy comprising administration of an effective amount of TAS-102.
  • the therapy can be first line, second line, third line, fourth line of fifth line therapy and is some aspects, can be administered alone or in combination with other therapies, e.g., surgical resection, radiation therapy or other chemical or biological based therapies.
  • a cancer patient e.g. a GI cancer, colon cancer, a rectal cancer or a colorectal cancer patient
  • methods for increasing the progression- free and/or overall survival of a cancer patient comprising, or alternatively consisting essentially of, or yet further consists of, screening a biological sample isolated from the patient for an rs861539 polymorphism, and classifying the patient as eligible for the therapy with TAS-102 if the genotype of (A/G) or (A/ A) for rs861539 is present in the sample or not eligible for the therapy comprising, or alternatively consisting essentially of, or yet further consists of, administriaon of an effective amount of TAS-102 if the genotype of (A/G) or (A/ A) for rs861539 is not present in the sample.
  • the patient is classified as not eligible for the therapy comprising, or alternatively consisting essentially of, or yet further consists of, administration of an effective amount of TAS-102 if the genotype of (G/G) for rs861539 is present in the sample.
  • the method further comprises administering a therapy comprising an effective amount of TAS-102 or a TAS-102-free therapy in accordance with the classification.
  • the therapy can be first line, second line, third line, fourth line of fifth line therapy and is some aspects, can be administered alone or in combination with other therapies, e.g., surgical resection, radiation therapy or other chemical or biological based therapies.
  • a cancer patient e.g. a GI cancer, colon cancer, a rectal cancer or a colorectal cancer patient is likely to experience a relatively longer or shorter progression free survival (PFS) following a therapy
  • PFS progression free survival
  • an administration of an effective amount of TAS-102 comprising, or alternatively consisting essentially of, or yet further consists of, screening a biological sample isolated from the patient for an rs861539 polymorphism, and identifying that the patient is likely to experience a longer progression free survival if the genotype of (A/G) or (A/ A) for rs861539 is present in the sample, relative to the patient not having the genotype.
  • the method comprises identifying that the patient is likely to experience a shorter progression free survival if the genotype of (A/G) or (A/ A) for rs861539 is not present in the sample, relative to a patient having the genotype or relative to a patient having the genotype of (G/G) for rs861539. In some embodiments, the method comprises identifying that the patient is likely to experience a shorter progression free survival if the genotype of (G/G) for rs861539 is present in the sample, relative to the patient not having the genotype or relative to the patient having the genotype of (A/G) or (A/ A) for rs861539.
  • the therapy can be first line, second line, third line, fourth line of fifth line therapy and is some aspects, can be administered alone or in combination with other therapies, e.g., surgical resection, radiation therapy or other chemical or biological based therapies.
  • a cancer patient e.g. a GI cancer, colon cancer, a rectal cancer or a colorectal cancer patient selected for treatment based on the presence of the genotype of (A/G) or (A/ A) for rs861539 in a biological sample from the patient, comprising, or alternatively consisting essentially of, or yet further consists of, administering to the patient a therapy comprising, or alternatively consisting essentially of, or yet further consists of, an effective amount of TAS-102.
  • methods for treating a cancer patient e.g.
  • the therapy can be first line, second line, third line, fourth line of fifth line therapy and is some aspects, can be administered alone or in combination with other therapies, e.g., surgical resection, radiation therapy or other chemical or biological based therapies.
  • the method further comprises, or consists essentially of, or yet further consists of, screening a biological sample isolated from the patient for the rs861539 polymorphism.
  • methods for treating a cancer patient e.g.
  • a GI cancer, colon cancer, a rectal cancer or a colorectal cancer patient comprising, or alternatively consisting essentially of, or yet further consists of, screening a biological sample isolated from the patient for the rs861539 polymorphism and administering to the patient a therapy comprising, or alternatively consisting essentially of, or yet further consists of, an effective amount of TAS-102 if the sample has the genotype of (A/G) or (A/ A) for rs861539.
  • the therapy can be first line, second line, third line, fourth line of fifth line therapy and is some aspects, can be administered alone or in combination with other therapies, e.g., surgical resection, radiation therapy or other chemical or biological based therapies.
  • a cancer patient e.g. a GI cancer, colon cancer, a rectal cancer or a colorectal cancer patient receiving a therapy
  • the therapy comprising, or alternatively consisting essentially of, or yet further consists of, an effective amount of TAS-102 based on the presence of the genotype of (A/G) or (A/ A) for rs861539 in a biological sample from the patient.
  • modifying the treatment of the patient receiving a therapy comprising, or alternatively consisting essentially of, or yet further consists of, an effective amount of TAS- 102
  • the method comprising screening a biological sample isolated from the patient for an rs861539 polymorphism, and modifying the dosage or frequency of the therapy comprising, or alternatively consisting essentially of, or yet further consists of, an effective amount of TAS-102 based on the genotype for rs861539.
  • the dosage or frequency of the therapy, or components thereof e.g., one or more therapeutic agents of the therapy
  • the dosage or frequency of the therapy, or components thereof is increased if the genotype of (G/G) for rs861539 is present in the sample.
  • the therapy is discontinued if the genotype of (A/G) or (A/A) for rs861539 is not present in the sample.
  • the therapy is discontinued if the genotype of (G/G) for rs861539 is present in the sample.
  • the therapy is continued if the genotype of (A/G) or (A/ A) for rs861539 is present in the sample.
  • the therapy can be first line, second line, third line, fourth line of fifth line therapy and is some aspects, can be administered alone or in combination with other therapies, e.g., surgical resection, radiation therapy or other chemical or biological based therapies.
  • screening a biological sample isolated from the patient for an rs861539 polymorphism comprises contacting the biological sample with a nucleic acid probe that specifically binds to nucleic acid containing the rs861539 polymorphism and overlaps the polymorphic site.
  • the nucleic acid specifically binds to a nucleic acid having the sequence of SEQ ID NO:2, SEQ ID NO:31, or SEQ ID NO:32 and overlaps the polymorphic site.
  • the a nucleic acid is labeled with a detectable moiety, having about 5, about 10, about 15, about 20, about 25, about 30, about 35, or about 40 nucleotides upstream and/or downstream of the polymorphic region. In other aspects, it comprises whole genome sequencing of the patient's genotype.
  • screening a biological sample isolated from the patient for an rs861539 polymorphism comprises amplifying nucleic acid containing the rs861539 polymorphism.
  • nucleic acid containing the rs861539 polymorphism is amplified using a forward primer comprising nucleic acid having the sequence of SEQ ID NO: 10 and a reverse primer comprising nucleic acid having the sequence of SEQ ID NO: 11.
  • nucleic acid containing the rs861539 polymorphism is amplified using a forward primer comprising nucleic acid having the sequence of SEQ ID NO:49 and a reverse primer comprising nucleic acid having the sequence of SEQ ID NO: 11.
  • a cancer, patient e.g., a GI cancer patient, a colon cancer patient, a rectal cancer patient, or a colorectal cancer patient for a therapy comprising, or alternatively consisting essentially of, or yet further consists of, administration of an effective amount of TAS-102, the method comprising screening a biological sample isolated from the patient for an rs760370 polymorphism, and selecting the patient for the therapy if the genotype of (A/G) or (G/G) for rs760370 is present in the sample.
  • the patient is not selected for the therapy comprising, or alternatively consisting essentially of, or yet further consists of, administration of an effective amount of TAS-102 if the genotype of (A/G) or (G/G) for rs760370 is not present in the sample.
  • the patient is not selected for a therapy comprising administration of an effective amount of TAS-102 if the genotype of (A/ A) for rs760370 is present in the sample.
  • the patient is selected for a TAS-102-free therapy if the genotype of (A/G) or (G/G) for rs760370 is not present in the sample.
  • the patient is selected for a TAS-102-free therapy if the genotype of (A/ A) for rs760370 is present in the sample.
  • the therapy can be first line, second line, third line, fourth line of fifth line therapy and is some aspects, can be administered alone or in combination with other therapies, e.g., surgical resection, radiation therapy or other chemical or biological based therapies.
  • a cancer, patient e.g., a GI cancer patient, a colon cancer patient, a rectal cancer patient, or a colorectal cancer patient as eligible for a therapy
  • the therapy comprising, or alternatively consisting essentially of, or yet further consists of, administration of TAS-102
  • the method comprising, or alternatively consisting essentially of, or yet further consists of, screening a biological sample isolated from the patient for an rs760370 polymorphism, and classifying the patient as eligible for the therapy if the genotype of (A/G) or (G/G) for rs760370 is present in the sample.
  • the method comprises classifying the patient as not eligible for the therapy comprising, or alternatively consisting essentially of, or yet further consists of, TAS-102 if the genotype of (A/G) or (G/G) for rs760370 is not present in the sample.
  • the patient is classified as not eligible for the therapy comprising, or alternatively consisting essentially of, or yet further consists of, TAS-102 if the genotype of (A/ A) for rs760370 is present in the sample.
  • the method further comprises, or consists essentially of, or consists of, administering a therapy comprising an effective amount of TAS-102.
  • the therapy can be first line, second line, third line, fourth line of fifth line therapy and is some aspects, can be administered alone or in combination with other therapies, e.g., surgical resection, radiation therapy or other chemical or biological based therapies.
  • a cancer, patient e.g., a GI cancer patient, a colon cancer patient, a rectal cancer patient, or a colorectal cancer patient
  • methods for increasing the progression- free and/or overall survival of a cancer, patient comprising, or alternatively consisting essentially of, or yet further consists of, screening a biological sample isolated from the patient for an rs760370 polymorphism, and classifying the patient as eligible for the therapy with TAS-102 if the genotype of (A/G) or (G/G) for rs760370 is present in the sample or not eligible for the therapy comprising, or alternatively consisting essentially of, or yet further consists of, administration of an effective amount of TAS-102 if the genotype of (A/G) or (G/G) for rs760370 is not present in the sample.
  • the patient is classified as not eligible for the therapy comprising TAS-102 if the genotype of (A/ A) for rs760370 is present in the sample.
  • the method further comprises, or consists essentially of, or consists of, administering a therapy comprising, or alternatively consisting essentially of, or yet further consists of, an effective amount of TAS-102 or a TAS-102-free therapy in accordance with the classification.
  • the therapy can be first line, second line, third line, fourth line of fifth line therapy and is some aspects, can be
  • a cancer, patient e.g., a GI cancer patient, a colon cancer patient, a rectal cancer patient, or a colorectal cancer patient is likely to experience a relatively longer or shorter progression free survival (PFS) following a therapy
  • the thera;y comprising, or alternatively consisting essentially of, or yet further consists of, an effective amount of TAS-102, comprising, or alternatively consisting essentially of, or yet further consists of, screening a biological sample isolated from the patient for an rs760370 polymorphism, and identifying that the patient is likely to experience a longer progression free survival if the genotype of (A/G) or (G/G) for rs760370 is present in the sample, relative to a corresponding cancer patient not having the genotype.
  • PFS progression free survival
  • the method comprises identifying that the patient is likely to experience a shorter progression free survival if the genotype of (A/G) or (G/G) for rs760370 is not present in the sample, relative to a corresponding cancer patient having the genotype or relative to a cancer patient having the genotype of (A/ A) for rs760370. In some embodiments, the method comprises identifying that the patient is likely to experience a shorter progression free survival if the genotype of (A/ A) for rs760370 is present in the sample, relative to a corresponding cancer patient not having the genotype or relative to a corresponding cancer patient having the genotype of (A/G) or (G/G) for rs760370.
  • the therapy can be first line, second line, third line, fourth line of fifth line therapy and is some aspects, can be administered alone or in combination with other therapies, e.g., surgical resection, radiation therapy or other chemical or biological based therapies.
  • a cancer, patient e.g., a GI cancer patient, a colon cancer patient, a rectal cancer patient, or a colorectal cancer patient selected for treatment based on the presence of the genotype of (A/G) or (G/G) for rs760370 in a biological sample from the patient, comprising, or alternatively consisting essentially of, or yet further consists of, administering to the patient a therapy comprising, or alternatively consisting essentially of, or yet further consists of, administration of an effective amount of TAS-102.
  • kits for treating the cancer patient selected for treatment based on the absence of the genotype of (A/ A) for rs760370 in a biological sample from the patient comprising, or alternatively consisting essentially of, or yet further consists of, administering to the patient a therapy comprising an effective amount of TAS-102.
  • the therapy can be first line, second line, third line, fourth line of fifth line therapy and is some aspects, can be administered alone or in combination with other therapies, e.g., surgical resection, radiation therapy or other chemical or biological based therapies.
  • the method further comprises screening a biological sample isolated from the patient for the rs760370 polymorphism.
  • methods for treating a cancer, patient e.g., a GI cancer patient, a colon cancer patient, a rectal cancer patient, or a colorectal cancer patient, comprising, or alternatively consisting essentially of, or yet further consists of, screening a biological sample isolated from the patient for the rs760370 polymorphism and administering to the patient a therapy comprising, or alternatively consisting essentially of, or yet further consists of, an effective amount of a TAS-102 if the sample has the genotype of (A/G) or (G/G) for rs760370.
  • the therapy can be first line, second line, third line, fourth line of fifth line therapy and is some aspects, can be administered alone or in combination with other therapies, e.g., surgical resection, radiation therapy or other chemical or biological based therapies.
  • kits for modifying the treatment of patient receiving a therapy comprising, or alternatively consisting essentially of, or yet further consists of, administration of an effective amount of TAS-102 based on the presence of the genotype of (A/G) or (G/G) for rs760370 in a biological sample from the patient.
  • the dosage or frequency of the therapy, or components thereof is increased if the genotype of (A/G) or (G/G) for rs760370 is not present in the sample. In some embodiments, the dosage or frequency of the therapy, or components thereof, is increased if the genotype of (A/ A) for rs760370 is present in the sample. In some embodiments, the therapy is discontinued if the genotype of (A/G) or (G/G) for rs760370 is not present in the sample. In some embodiments, the therapy is discontinued if the genotype of (A/ A) for rs760370 is present in the sample.
  • the therapy is continued if the genotype of (A/G) or (G/G) for rs760370 is present in the sample.
  • the therapy can be first line, second line, third line, fourth line of fifth line therapy and is some aspects, can be administered alone or in combination with other therapies, e.g., surgical resection, radiation therapy or other chemical or biological based therapies.
  • screening a biological sample isolated from the patient for an rs760370 polymorphism comprises contacting the biological sample with a nucleic acid probe that specifically binds to nucleic acid containing the rs760370 polymorphism and overlaps the polymorphic site.
  • the nucleic acid specifically binds to a nucleic acid having the sequence of SEQ ID NO:3, SEQ ID NO:33, or SEQ ID NO:34 and overlaps the polymorphic site.
  • the a nucleic acid is labeled with a detectable moiety, having about 5, about 10, about 15, about 20, about 25, about 30, about 35, or about 40 nucleotides upstream and/or downstream of the polymorphic region.
  • the genotype is determined by a method comprising whole genome sequencing.
  • screening a biological sample isolated from the patient for an rs760370 polymorphism comprises amplifying nucleic acid containing the rs760370 polymorphism.
  • nucleic acid containing the rs760370 polymorphism is amplified using a forward primer comprising nucleic acid having the sequence of SEQ ID NO: 12 and a reverse primer comprising nucleic acid having the sequence of SEQ ID NO: 13.
  • a cancer, patient e.g., a GI cancer patient, a colon cancer patient, a rectal cancer patient, or a colorectal cancer patient for a therapy comprising, or alternatively consisting essentially of, or yet further consists of, administration of an effective amount of TAS-102, the method comprising, or alternatively consisting essentially of, or yet further consists of, screening a biological sample isolated from the patient for an rs9394992 polymorphism, and selecting the patient for the therapy if the genotype of (C/T) or (T/T) for rs9394992 is present in the sample.
  • the patient is not selected for a therapy comprising, or alternatively consisting essentially of, or yet further consists of, administration of an effective amount of TAS-102 if the genotype of (C/T) or (T/T) for rs9394992 is not present in the sample.
  • the patient is not selected for a therapy comprising, or alternatively consisting essentially of, or yet further consists of, administration of an effective amount TAS-102 if the genotype of (G/G) for rs9394992 is present in the sample.
  • the patient is selected for a TAS-102-free therapy if the genotype of (C/T) or (T/T) for rs9394992 is not present in the sample.
  • the patient is selected for a TAS-102-free therapy if the genotype of (G/G) for rs9394992 is present in the sample.
  • the therapy can be first line, second line, third line, fourth line of fifth line therapy and is some aspects, can be
  • a colorectal cancer patient as eligible for a therapy
  • the therapy comprising, or alternatively consisting essentially of, or yet further consists of, administration of an effective amount of TAS-102, comprising screening a biological sample isolated from the patient for an rs9394992 polymorphism, and classifying the patient as eligible for the therapy if the genotype of (C/T) or (T/T) for rs9394992 is present in the sample.
  • the method comprises classifying the patient as not eligible for the therapy comprising TAS-102 if the genotype of (C/T) or (T/T) for rs9394992 is not present in the sample. In some embodiments, the patient is classified as not eligible for the therapy comprising administration an effective amount of TAS-102 if the genotype of (G/G) for rs9394992 is present in the sample. In some embodiments, the method further comprises, or consists essentially of, or consists of, administering a therapy comprising administration of an effective amount of TAS-102.
  • the therapy can be first line, second line, third line, fourth line of fifth line therapy and is some aspects, can be administered alone or in combination with other therapies, e.g., surgical resection, radiation therapy or other chemical or biological based therapies.
  • a cancer, patient e.g., a GI cancer patient, a colon cancer patient, a rectal cancer patient, or a colorectal cancer patient
  • the method comprising, or alternatively consisting essentially of, or yet further consists of, screening a biological sample isolated from the patient for an rs9394992 polymorphism, and classifying the patient as eligible for the therapy comprising administration of an effective amount of TAS-102 if the genotype of (C/T) or (T/T) for rs9394992 is present in the sample or not eligible for the therapy comprising, or alternatively consisting essentially of, or yet further consists of, TAS- 102 if the genotype of (C/T) or (T/T) for rs9394992 is not present in the sample.
  • the patient is classified as not eligible for the therapy comprising, or alternatively consisting essentially of, or yet further consists of, administration of an effective amount of TAS-102 if the genotype of (G/G) for rs9394992 is present in the sample.
  • the method further comprises, or consists essentially of, or yet further consists of, administering a therapy comprising, or alternatively consisting essentially of, or yet further consists of, an effective amount of TAS-102 or a TAS-102-free therapy in accordance with the classification.
  • the therapy can be first line, second line, third line, fourth line of fifth line therapy and is some aspects, can be administered alone or in combination with other therapies, e.g., surgical resection, radiation therapy or other chemical or biological based therapies.
  • a cancer, patient e.g., a GI cancer patient, a colon cancer patient, a rectal cancer patient, or a colorectal cancer patient is likely to experience a relatively longer or shorter progression free survival (PFS) following a therapy
  • the therapy comprising, or alternatively consisting essentially of, or yet further consists of, administration of an effective amount of TAS-102
  • the method comprising, or alternatively consisting essentially of, or yet further consists of, screening a biological sample isolated from the patient for an rs9394992 polymorphism, and identifying that the patient is likely to experience a longer progression free survival if the genotype of (C/T) or (T/T) for rs9394992 is present in the sample, relative to a corresponding cancer patient not having the genotype.
  • the method comprises identifying that the patient is likely to experience a shorter progression free survival if the genotype of (C/T) or (T/T) for rs9394992 is not present in the sample, relative to a corresponding cancer patient having the genotype or relative to the cancer patient having the genotype of (G/G) for rs9394992. In some embodiments, the method comprises identifying that the patient is likely to experience a shorter progression free survival if the genotype of (G/G) for rs9394992 is present in the sample, relative to the corresponding cancer patient not having the genotype or relative to the cancer patient having the genotype of (C/T) or (T/T) for rs9394992.
  • the therapy can be first line, second line, third line, fourth line of fifth line therapy and is some aspects, can be administered alone or in combination with other therapies, e.g., surgical resection, radiation therapy or other chemical or biological based therapies.
  • a cancer, patient e.g., a GI cancer patient, a colon cancer patient, a rectal cancer patient, or a colorectal cancer patient selected for treatment based on the presence of the genotype of (C/T) or (T/T) for rs9394992 in a biological sample isolated from the patient, comprising, or alternatively consisting essentially of, or yet further consists of, administering to the patient a therapy comprising administration of an effective amount of TAS-102.
  • a cancer, patient e.g., a GI cancer patient, a colon cancer patient, a rectal cancer patient, or a colorectal cancer patient selected for treatment based on the presence of the genotype of (C/T) or (T/T) for rs9394992 in a biological sample isolated from the patient, comprising, or alternatively consisting essentially of, or yet further consists of, administering to the patient a therapy comprising administration of an effective amount of TAS-102.
  • kits for treating the cancer patient selected for treatment based on the absence of the genotype of (G/G) for rs9394992 in a biological sample from the patient comprising, or alternatively consisting essentially of, or yet further consists of, administering to the patient a therapy comprising administration of an effective amount of TAS-102.
  • the therapy can be first line, second line, third line, fourth line of fifth line therapy and is some aspects, can be administered alone or in combination with other therapies, e.g., surgical resection, radiation therapy or other chemical or biological based therapies.
  • the method further comprises, or consists essentially of, or consists of, screening a biological sample isolated from the patient for the rs9394992 polymorphism.
  • methods for treating a cancer, patient e.g., a GI cancer patient, a colon cancer patient, a rectal cancer patient, or a colorectal cancer patient, the method comprising, or alternatively consisting essentially of, or yet further consists of, screening a biological sample isolated from the patient for the rs9394992 polymorphism and administering to the patient a therapy comprising, or alternatively consisting essentially of, or yet further consists of, an effective amount of TAS-102 if the sample has the genotype of (C/T) or (T/T) for rs9394992.
  • kits for modifying the treatment of patient receiving a therapy comprising, or alternatively consisting essentially of, or yet further consists of, administration of an effective amount of TAS-102 based on the presence of the genotype of (C/T) or (T/T) for rs9394992 in a biological sample from the patient.
  • a therapy comprising, or alternatively consisting essentially of, or yet further consists of, administration of an effective amount of TAS-102
  • the method comprising, or alternatively consisting essentially of, or yet further consists of, screening a biological sample isolated from the patient for an rs9394992 polymorphism, and modifying the dosage or frequency of the therapy comprising an effective amount of TAS-102 based on the genotype for rs9394992.
  • the dosage or frequency of the therapy, or components thereof e.g., one or more therapeutic agents of the therapy
  • the dosage or frequency of the therapy, or components thereof is increased if the genotype of (G/G) for rs9394992 is present in the sample.
  • the therapy is discontinued if the genotype of (C/T) or (T/T) for rs9394992 is not present in the sample.
  • the therapy is discontinued if the genotype of (G/G) for rs9394992 is present in the sample.
  • the therapy is continued if the genotype of (C/T) or (T/T) for rs9394992 is present in the sample.
  • the therapy can be first line, second line, third line, fourth line of fifth line therapy and is some aspects, can be administered alone or in combination with other therapies, e.g., surgical resection, radiation therapy or other chemical or biological based therapies.
  • screening a biological sample isolated from the patient for an rs9394992 polymorphism comprises contacting the biological sample with a nucleic acid probe that specifically binds to nucleic acid containing the rs9394992 polymorphism and overlaps the polymorphic site.
  • the nucleic acid specifically binds to a nucleic acid having the sequence of SEQ ID NO:4, SEQ ID NO:35, or SEQ ID NO:36 and overlaps the polymorphic site.
  • the a nucleic acid is labeled with a detectable moiety, having about 5, about 10, about 15, about 20, about 25, about 30, about 35, or about 40 nucleotides upstream and/or downstream of the polymorphic region.
  • the sample is screened by a method comprising whole genome sequencing of the region comprising the polymorphism.
  • screening a biological sample isolated from the patient for an rs9394992 polymorphism comprises amplifying nucleic acid containing the rs9394992 polymorphism.
  • nucleic acid containing the rs9394992 polymorphism is amplified using a forward primer comprising nucleic acid having the sequence of SEQ ID NO: 14 and a reverse primer comprising nucleic acid having the sequence of SEQ ID NO: 15.
  • the OCT2 rs316000 polymorphism is located at chromosome position 99991562 on chromosome 6 according to the Genome Reference Consortium
  • TCAAGAACTTTTCCTGTGCATTCTC[A/G]ACTTGGCTACCTGGTACAAGAGTCC SEQ ID NO:5
  • the partial sequence of the (A) allele of the rs3166000 polymorphism is: TCAAGAACTTTTCCTGTGCATTCTCAACTTGGCTACCTGGTACAAGAGTCC (SEQ ID NO:37)
  • the partial sequence of the (G) allele is: TCAAGAACTTTTCCTGTGC ATTCTCGACTTGGCTACCTGGTACAAGAGTCC (SEQ ID NO: 38).
  • a cancer, patient e.g., a GI cancer patient, a colon cancer patient, a rectal cancer patient, or a colorectal cancer patient for a therapy
  • the therapy comprising, or alternatively consisting essentially of, or yet further consists of, administration of an effective amount of TAS-102
  • the method comprising, or alternatively consisting essentially of, or yet further consists of, screening a biological sample isolated from the patient for an OCT2 rs316000 or OCT2 rs316019 polymorphism and aMATEI rs2289669 polymorphism.
  • a cancer, patient e.g., a GI cancer patient, a colon cancer patient, a rectal cancer patient, or a colorectal cancer patient as eligible for a therapy
  • a therapy comprising, or alternatively consisting essentially of, or yet further consists of, administration of an effective amount of TAS-102
  • the method comprising, or alternatively consisting essentially of, or yet further consists of, screening a biological sample isolated from the patient for an OCT2 rs316000 or OCT2 rs316019 polymorphism and aMATEI rs2289669 polymorphism.
  • a cancer, patient e.g., a GI cancer patient, a colon cancer patient, a rectal cancer patient, or a colorectal cancer patient
  • the method comprising, or alternatively consisting essentially of, or yet further consists of, screening a biological sample isolated from the patient for an an OCT2 rs316000 or OCT2 rs316019 polymorphism and aMATEI rs2289669 polymorphism.
  • a cancer, patient e.g., a GI cancer patient, a colon cancer patient, a rectal cancer patient, or a colorectal cancer patient is likely to experience a relatively longer or shorter progression free survival (PFS) following a therapy comprising, or alternatively consisting essentially of, or yet further consists of, administration of an effective amount of TAS-102, the method comprising, or alternatively consisting essentially of, or yet further consists of, screening a biological sample isolated from the patient for an OCT2 rs316000 or OCT2 rs316019 polymorphism and aMATEI rs2289669 polymorphism.
  • PFS progression free survival
  • a cancer patient, e.g., a GI cancer patient, a colon cancer patient, a rectal cancer patient, or a colorectal cancer patient selected for treatment based on the presence of the genotype of an OCT2 rs316000 or OCT2 rs316019
  • inventions are methods for modifying the treatment of patient receiving a therapy comprising, or alternatively consisting essentially of, or yet further consists of, administration of an effective amount of TAS-102 based on the presence of the genotype of an OCT2 rs316000 or OCT2 rs316019 polymorphism and aMATEI rs2289669 polymorphism.
  • the sample is also screened an hENTl rs760370 or an hENTl rs9394992 polymorphism.
  • the therapy can be first line, second line, third line, fourth line of fifth line therapy and is some aspects, can be administered alone or in combination with other therapies, e.g., surgical resection, radiation therapy or other chemical or biological based therapies.
  • the patient has a wild-type KRAS and/or BRAF gene.
  • the patient for the methods described herein suffers colon cancer, non-metastatic colorectal cancer or metastatic colorectal cancer.
  • the biological sample is a tissue or a cell sample.
  • the sample comprises at least one of a tumor cell, a normal cell adjacent to a tumor, a normal cell corresponding to the tumor tissue type, a blood cell, a peripheral blood lymphocyte, or combinations thereof.
  • the sample is at least one of blood, plasma, serum, an original sample recently isolated from the patient, a fixed tissue, a previously frozen tissue, a biopsy tissue, a resection tissue, a microdissected tissue, or combinations thereof.
  • the screening the polymorphism is by a method comprising PCR, RT-PCR, real-time PCR, PCR-RFLP, sequencing, or whole genome sequencing, a nucleic acid probe hybridization in solution or on a solid support, such as a chip or a microarray.
  • the patient is a mammal, such as a human patient.
  • kits for screening for selecting a cancer, patient e.g., a GI cancer patient, a colon cancer patient, a rectal cancer patient, or a colorectal cancer patient for a therapy comprising, or alternatively consisting essentially of, or yet further consists of, TAS-102 or for classifying the cancer patient as eligible for a therapy comprising TAS-102.
  • the kit comprises primer for amplification of nucleic acid containing a polymorphism selected from among a rs609429, rs861539, rs760370, rs9394992, rs2289669, and rs316019 polymorphism.
  • the kit comprises a forward primer having the sequence of SEQ ID NO:8 and a reverse primer having the sequence of SEQ ID NO: 9, a forward primer having the sequence of SEQ ID NO: 10 and a reverse primer having the sequence of SEQ ID NO: 11, a forward primer having the sequence of SEQ ID NO: 49 and a reverse primer having the sequence of SEQ ID NO: 11, a forward primer having the sequence of SEQ ID NO: 12 and a reverse primer having the sequence of SEQ ID NO: 13, a forward primer having the sequence of SEQ ID NO: 14 and a reverse primer having the sequence of SEQ ID NO: 15, a forward primer having the sequence of SEQ ID NO: 16 and a reverse primer having the sequence of SEQ ID NO: 17, a forward primer having the sequence of SEQ ID NO: 18 and a reverse primer having the sequence of SEQ ID NO: 19, or a forward primer having the sequence of SEQ ID NO: 20 and a reverse primer having the sequence of SEQ ID NO:21.
  • the kit comprises a nucleic acid probe that specifically binds to nucleic acid containing the polymorphism and overlaps the polymorphic site.
  • the nucleic acid probe specifically binds to a nucleic acid having the sequence of any of SEQ ID NO: 1-7 or SEQ ID NO:29-42 and overlaps the polymorphic site.
  • the nucleic acid probe has about 5, about 10, about 15, about 20, about 25, about 30, about 35 or about 40 or more contiguous nucleotides of any of SEQ ID NO: 1-7 or SEQ ID NO:29-42 and overlaps the polymorphic site.
  • the disclosure further provides diagnostic, prognostic and therapeutic methods, which are based, at least in part, on determination of the identify of a genotype of interest identified herein.
  • information obtained using the diagnostic assays described herein is useful for determining if a subject is suitable for cancer treatment of a given type. Based on the prognostic information, a doctor can recommend a therapeutic protocol, useful for reducing the malignant mass or tumor in the patient or treat cancer in the individual.
  • a patient's likely clinical outcome following a clinical procedure such as a therapy or surgery can be expressed in relative terms.
  • a patient having a particular genotype or expression level can experience relatively longer overall survival than a patient or patients not having the genotype or expression level.
  • the patient having the particular genotype or expression level alternatively, can be considered as likely to survive.
  • a patient having a particular genotype or expression level can experience relatively longer progression free survival, or time to tumor progression, than a patient or patients not having the genotype or expression level.
  • the patient having the particular genotype or expression level alternatively, can be considered as not likely to suffer tumor progression.
  • a patient having a particular genotype or expression level can experience relatively shorter time to tumor recurrence than a patient or patients not having the genotype or expression level.
  • the patient having the particular genotype or expression level is
  • a patient having a particular genotype or expression level can experience relatively more complete response or partial response than a patient or patients not having the genotype or expression level.
  • the patient having the particular genotype or expression level alternatively, can be considered as likely to respond. Accordingly, a patient that is likely to survive, or not likely to suffer tumor progression, or not likely to suffer tumor recurrence , or likely to respond following a clinical procedure is considered suitable for the clinical procedure.
  • information obtained using the diagnostic assays described herein can be used alone or in combination with other information, such as, but not limited to, genotypes or expression levels of other genes, clinical chemical parameters, histopathological parameters, or age, gender and weight of the subject.
  • the information obtained using the diagnostic assays described herein is useful in determining or identifying the clinical outcome of a treatment, selecting a patient for a treatment, or treating a patient, etc.
  • the information obtained using the diagnostic assays described herein is useful in aiding in the determination or identification of clinical outcome of a treatment, aiding in the selection of a patient for a treatment, or aiding in the treatment of a patient and etc.
  • the genotypes or expression levels of one or more genes as disclosed herein are used in a panel of genes, each of which contributes to the final diagnosis, prognosis or treatment.
  • a mammal includes but is not limited to a human, a simian, a murine, a bovine, an equine, a porcine or an ovine subject.
  • a method for selecting a cancer, patient e.g., a GI cancer patient, a colon cancer patient, a rectal cancer patient, or a colorectal cancer patient for a therapy comprising administration of an effective amount of TAS-102
  • the method comprising screening a biological sample isolated from the patient for an rs861539 polymorphism, and selecting the patient for the therapy if the genotype of (G/C) or (G/G) for rs609429, (A/G) or (A/A) for rs861539, (A/G) or (G/G) for rs760370, or (C/T) or (T/T) for rs9394992 is present in the sample.
  • the patient is not selected for the therapy if the genotype of (G/C) or (G/G) for rs609429, (A/G) or (A/A) for rs861539, (A/G) or (G/G) for rs760370, or (C/T) or (T/T) for rs9394992 is not present in the sample.
  • the patient is not selected for the therapy if the genotype of (C/C) for rs609429, (G/G) for rs861539, (A/ A) for rs760370, or (G/G) for rs9394992 is present in the sample.
  • the patient is selected for a TAS-102-free therapy if the genotype of (G/C) or (G/G) for rs609429, (A/G) or (A/A) for rs861539, (A/G) or (G/G) for rs760370, or (C/T) or (T/T) for rs9394992 is not present in the sample.
  • Alternative therapies are known in the art, some of which are described herein.
  • the patient is selected for a TAS- 102-free therapy if the genotype of (C/C) for rs609429, (G/G) for rs861539, (A/A) for rs760370, or (G/G) for rs9394992 is present in the sample.
  • a cancer, patient e.g., a GI cancer patient, a colon cancer patient, a rectal cancer patient, or a colorectal cancer
  • a method for identifying whether a cancer, patient e.g., a GI cancer patient, a colon cancer patient, a rectal cancer patient, or a colorectal cancer patient is likely to experience TAS-102 related toxicity following a therapy
  • the therapy comprising, or alternatively consisting essentially of, or yet further consisting of administration of an effective amount of TAS-102
  • the method comprising, or alternatively consisting essentially of, or yet further consisting of screening a biological sample isolated from the patient for a polymorphism, and identifying that the patient is likely to experience toxicity if the genotype of (G/C) or (G/G) for rs609429 is present in the sample, relative to a corresponding patient not having the genotype.
  • the TAS-102 related toxicity comprises, or alternatively consists essentially of, or yet further consists of one or more of the group of: febrile neutropenia, leukopenia, stomatitis, neutropenia, hand-foot syndrome, cardiac ischemia, thrombocytopenia, increase in alanine aminotransferase level, increase in aspartate aminotransferase level, increase in total bilirubin, increase in alkaline phosphatase level, increase in creatinine level, anemia, anorexia, nausea, vomiting, alopecia, decreased appetite, fatigue, abdominal pain, fever, asthenia, or diarrhea.
  • the toxicity comprises neutropenia.
  • the toxicity is limited to adverse events of grade 3 severity or higher. In other aspects, the toxicity is limited to adverse events of grade 3 severity or lower.
  • the patient suffers from colorecatal cancer, non-metastatic colorectal cancer or metastatic colorectal cancer.
  • the cancer is colorectal cancer or metastatic or non-metastatic colon cancer.
  • the colorectal cancer is metastatic or non-metastatic rectal cancer.
  • the genotype is determined by a method comprising, or alternatively consisting essentially of, or yet further consisting of, sequencing, hybridization, nucleic acid amplification, including polymerase chain reaction (PCR), real-time PCR, reverse transcriptase PCR (RT-PCR), nested PCR, ligase chain reaction, or PCR-RFLP, or microarray. These methods as well as equivalents or alternatives thereto are described herein.
  • the genotype is determined by a method comprising whole genome sequencing of the chromosome harboring the gene or region of interest.
  • a mammal includes but is not limited to a human, a simian, a murine, a bovine, an equine, a porcine or an ovine subject.
  • Information obtained using the diagnostic assays described herein is useful for determining if a subject will likely, more likely, or less likely to respond to cancer treatment of a given type. Based on the prognostic information, a doctor can recommend a therapeutic protocol, useful for treating reducing the malignant mass or tumor in the patient or treat cancer in the individual.
  • knowledge of the identity of a particular allele in an individual allows customization of therapy for a particular disease to the individual's genetic profile, the goal of "pharmacogenomics".
  • an individual's genetic profile can enable a doctor: 1) to more effectively prescribe a drug that will address the molecular basis of the disease or condition; 2) to better determine the appropriate dosage of a particular drug and 3) to identify novel targets for drug development.
  • the identity of the genotype or expression patterns of individual patients can then be compared to the genotype or expression profile of the disease to determine the appropriate drug and dose to administer to the patient.
  • the methods and compositions disclosed herein can be used to detect nucleic acids associated with a polymorphism using a biological sample obtained from a patient.
  • Biological samples can be obtained by standard procedures and can be used immediately or stored, under conditions appropriate for the type of biological sample, for later use. Any liquid or solid biological material obtained from the patient believed to contain nucleic acids comprising the region containing the polymorphism can be an suitable sample.
  • Methods of obtaining test samples are known to those of skill in the art and include, but are not limited to, aspirations, tissue sections, swabs, drawing of blood or other fluids, surgical or needle biopsies.
  • the biological sample is a tissue or a cell sample. Suitable patient samples in the methods include, but are not limited to, blood, plasma, serum, a biopsy tissue, fine needle biopsy sample, amniotic fluid, plasma, pleural fluid, saliva, semen, serum, tissue or tissue homogenates, frozen or paraffin sections of tissue or combinations thereof.
  • the biological sample comprises, or alternatively consisting essentially of, or yet further consisting of, at least one of a tumor cell, a normal cell adjacent to a tumor, a normal cell corresponding to the tumor tissue type, a blood cell, a peripheral blood lymphocyte, or combinations thereof.
  • the biological sample is an original sample recently isolated from the patient, a fixed tissue, a frozen tissue, a resection tissue, or a microdissected tissue.
  • the biological samples are processed, such as by sectioning of tissues, fractionation, purification, nucleic acid isolation, or cellular organelle separation.
  • nucleic acid is isolated from the sample according to any methods known to those of skill in the art.
  • genomic DNA is isolated from the biological sample.
  • RNA is isolated from the biological sample.
  • cDNA is generated from mRNA in the sample.
  • the nucleic acid is not isolated from the biological sample (e.g., the polymorphism is detected directly from the biological sample).
  • detection of polymorphisms can be accomplished by molecular cloning of the specified allele and subsequent sequencing of that allele using techniques known in the art, in some aspects, after isolation of a suitable nucleic acid sample.
  • the gene sequences can be amplified directly from a genomic DNA preparation from the biological sample using PCR, and the sequence composition is determined by sequencing the amplified product (i.e., amplicon).
  • the PCR product can be analyzed following digestion with a restriction enzyme, a method known as PCR-RFLP.
  • the polymorphism is detected using allele specific hybridization using probes overlapping the polymorphic site.
  • the nucleic acid probes are between 5 and 40 nucleotides in length. In some aspects, the nucleic acid probes are about 5, about 10, about 15, about 20, about 25, about 30, about 35, or about 40 or more nucleotides flanking the polymorphic site.
  • the nucleic acid specifically binds to a nucleic acid having the sequence of any of SEQ ID NO: 1- 7 or SEQ ID NO:29-42 and overlaps the polymorphic site.
  • Exemplary probes include nucleic acid probes having about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40 or more contiguous nucleotides of any of SEQ ID NO: 1-7 or SEQ ID NO:29-42 and overlaps the polymorphic site.
  • nucleic acid probes capable of hybridizing specifically to the nucleic acid containing the allelic variant are attached to a solid phase support, e.g., a "chip” or “microarray.
  • a solid phase support e.g., a "chip” or “microarray.
  • Such gene chips or microarrays can be used to detect genetic variations by a number of techniques known to one of skill in the art.
  • oligonucleotides are arrayed on a gene chip for determining the DNA sequence by the sequencing by hybridization approach.
  • the probes of the disclosure also can be used for fluorescent detection of a genetic sequence.
  • a probe also can be affixed to an electrode surface for the electrochemical detection of nucleic acid sequences.
  • probes or primers for the gene of interest are provided alone or in combination with other probes and/or primers.
  • a suitable sample is obtained from the patient extraction of genomic DNA, RNA, or any combination thereof and amplified if necessary.
  • the DNA or RNA sample is contacted to the gene chip or microarray panel under conditions suitable for hybridization of the gene(s) of interest to the probe(s) or primer(s) contained on the gene chip or microarray.
  • the probes or primers can be detectably labeled thereby identifying the polymorphism in the gene(s) of interest.
  • a chemical or biological reaction can be used to identify the probes or primers which hybridized with the DNA or RNA of the gene(s) of interest.
  • the genetic profile of the patient is then determined with the aid of the aforementioned apparatus and methods.
  • whole genome sequencing in particular with the "next generation sequencing” techniques, which employ massively parallel sequencing of DNA templates, can be used to obtain genotypes of relevant polymorphisms.
  • exemplary NGS sequencing platforms for the generation of nucleic acid sequence data include, but are not limited to, Illumina's sequencing by synthesis technology (e.g., Illumina MiSeq or HiSeq System), Life Technologies' Ion Torrent semiconductor sequencing technology (e.g., Ion Torrent PGM or Proton system), the Roche (454 Life Sciences) GS series and Qiagen (Intelligent BioSystems) Gene Reader sequencing platforms.
  • nucleic acid comprising the polymorphism is amplified to produce an amplicon containing the polymorphism.
  • Nucleic acids can be amplified by various methods known to the skilled artisan. Nucleic acid amplification can be linear or exponential. Amplification is generally carried out using polymerase chain reaction (PCR) technologies.
  • PCR polymerase chain reaction
  • PCR amplification methods can also be used and include, for example, isothermal amplification methods, rolling circle methods, Hot-start PCR, real-time PCR, Allele-specific PCR, Assembly PCR or Polymerase Cycling Assembly (PCA), Asymmetric PCR, Colony PCR, Emulsion PCR, Fast PCR, Real-Time PCR, nucleic acid ligation, Gap Ligation Chain Reaction (Gap LCR), Ligation-mediated PCR, Multiplex Ligation-dependent Probe Amplification, (MLPA), Gap Extension Ligation PCR (GEXL- PCR), quantitative PCR (Q-PCR), Quantitative real-time PCR (QRT-PCR), multiplex PCR, Helicase-dependent amplification, Intersequence-specific (ISSR) PCR, Inverse PCR, Linear- After-The-Exponential-PCR (LATE-PCR), Methylation-specific PCR (MSP), Nested PCR, Overlap-extension PCR, PAN- AC assay, Reverse Tra
  • nucleic acid comprising the polymorphism is amplified to produce an amplicon containing the polymorphism.
  • nucleic acid comprising any of SEQ ID NO: 1-7 or SEQ ID NO:29-42 is amplified to generate an amplicon comprising any of SEQ ID NO: 1-7 or SEQ ID NO:29-42.
  • nucleic acid containing the polymorphism is amplified using a forward primer and a reverse primer the flank the polymorphism.
  • nucleic acid containing the polymorphism is amplified using a forward primer having the sequence of SEQ ID NO: 8 and a reverse primer having the sequence of SEQ ID NO: 9, a forward primer having the sequence of SEQ ID NO: 10 and a reverse primer having the sequence of SEQ ID NO: 11, a forward primer having the sequence of SEQ ID NO: 49 and a reverse primer having the sequence of SEQ ID NO: 11, a forward primer having the sequence of SEQ ID NO: 12 and a reverse primer having the sequence of SEQ ID NO: 13, a forward primer having the sequence of SEQ ID NO: 14 and a reverse primer having the sequence of SEQ ID NO: 15, a forward primer having the sequence of SEQ ID NO: 16 and a reverse primer having the sequence of SEQ ID NO: 17, a forward primer having the sequence of SEQ ID NO: 18 and a reverse primer having the sequence of SEQ ID NO: 19, or a forward primer having the sequence of SEQ ID NO: 20 and a reverse primer having the sequence of SEQ ID NO:21.
  • the amplicon containing the polymorphism is detected using a nucleic acid probe. In some aspects, the amplicon containing the polymorphism is detected by hybridizing a nucleic acid probe containing the polymorphism or a complement thereof to the corresponding complementary strand of the amplicon and detecting the hybrid formed between the nucleic acid probe and the
  • polymorphism is sequenced (e.g., dideoxy chain termination methods (Sanger method and variants thereof), Maxam & Gilbert sequencing, pyrosequencing, exonuclease digestion and next-generation sequencing methods).
  • the amplification includes a labeled primer or probe, thereby allowing detection of the amplification products corresponding to that primer or probe.
  • the amplification can include a multiplicity of labeled primers or probes; such primers can be distinguishably labeled, allowing the simultaneous detection of multiple amplification products.
  • the amplification products are detected by any of a number of methods such as gel electrophoresis, column chromatography, hybridization with a nucleic acid probe, or sequencing the amplicon.
  • Detectable labels can be used to identify the primer or probe hybridized to a genomic nucleic acid or amplicon. Detectable labels include but are not limited to
  • fluorophores isotopes (e.g., P, P, . S, H, C, I, I) electron-dense reagents (e.g., gold, silver), nanoparticles, enzymes commonly used in an ELISA (e.g., horseradish peroxidase, beta-galactosidase, luciferase, alkaline phosphatase), chemilumini scent compounds, colorimetric labels (e.g., colloidal gold), magnetic labels (e.g., Dynabeads®), biotin, digoxigenin, haptens, proteins for which antisera or monoclonal antibodies are available, ligands, hormones, oligonucleotides capable of forming a complex with the corresponding oligonucleotide complement.
  • ELISA e.g., horseradish peroxidase, beta-galactosidase, luciferase, alkaline phosphatase
  • a primer or probe is labeled with a fluorophore that emits a detectable signal.
  • fluorophore refers to a molecule that absorbs light at a particular wavelength (excitation frequency) and subsequently emits light of a longer wavelength (emission frequency).
  • a suitable reporter dye is a fluorescent dye, any reporter dye that can be attached to a detection reagent such as an oligonucleotide probe or primer is suitable for use in the methods described.
  • Suitable fluorescent moieties include, but are not limited to, the following fluorophores working individually or in combination: 4- acetamido-4'-isothiocyanatostilbene-2,2'disulfonic acid; acridine and derivatives, e,g, acridine, acridine isothiocyanate; Alexa Fluors: Alexa Fluor® 350, Alexa Fluor® 488, Alexa Fluor® 546, Alexa Fluor® 555, Alexa Fluor® 568, Alexa Fluor® 594, Alexa Fluor® 647 (Molecular Probes); 5-(2'-aminoethyl)aminonaphthalene-l-sulfonic acid (EDANS); 4-amino-N-[3- vinylsulfonyl)phenyl]naphthalimide-3,5 disulfonate (Lucifer Yellow VS); N-(4-anilino-l- naphthyl)maleimide; anthranil
  • erythrosin eosin, eosin isothiocyanate; erythrosin and derivatives: erythrosin B, erythrosin
  • rhodamine and derivatives 6-carboxy-X-rhodamine (ROX), 6-carboxyrhodamine (R6G), lissamine rhodamine B sulfonyl chloride, rhodamine (Rhod), rhodamine B, rhodamine 123, rhodamine green, rhodamine X isothiocyanate, riboflavin, rosolic acid, sulforhodamine B, sulforhodamine 101, sulfonyl chloride derivative of sulforhodamine 101
  • the primer or probe is further labeled with a quencher dye such as Tamra, Dabcyl, or Black Hole Quencher®(BHQ), especially when the reagent is used as a self-quenching probe such as a TaqMan®(U.S. Pat. Nos. 5,210,015 and 5,538,848) or
  • methods for real time PCR use fluorescent primers/probes, such as the TaqMan® primers/probes (Heid, et al., Genome Res 6: 986-994, 1996), molecular beacons, and ScorpionTM primers/probes.
  • Real-time PCR quantifies the initial amount of the template with more specificity, sensitivity and reproducibility, than other forms of
  • the probes employed in Scorpion®TM and TaqMan® technologies are based on the principle of fluorescence quenching and involve a donor fluorophore and a quenching moiety.
  • donor fluorophore as used herein means a fluorophore that, when in close proximity to a quencher moiety, donates or transfers emission energy to the quencher. As a result of donating energy to the quencher moiety, the donor fluorophore will itself emit less light at a particular emission frequency that it would have in the absence of a closely positioned quencher moiety.
  • quencher moiety means a molecule that, in close proximity to a donor fluorophore, takes up emission energy generated by the donor and either dissipates the energy as heat or emits light of a longer wavelength than the emission wavelength of the donor. In the latter case, the quencher is considered to be an acceptor fluorophore.
  • the quenching moiety can act via proximal (i.e., collisional) quenching or by Forster or fluorescence resonance energy transfer (“FRET"). Quenching by FRET is generally used in TaqMan® primers/probes while proximal quenching is used in molecular beacon and ScorpionTM type primers/probes.
  • the detectable label can be incorporated into, associated with or conjugated to a nucleic acid primer or probe. Labels can be attached by spacer arms of various lengths to reduce potential steric hindrance or impact on other useful or desired properties. See, e.g., Mansfield, Mol. Cell. Probes (1995), 9: 145-156.
  • Detectable labels can be incorporated into nucleic acid probes by covalent or non- covalent means, e.g., by transcription, such as by random-primer labeling using Klenow polymerase, or nick translation, or, amplification, or equivalent as is known in the art.
  • a nucleotide base is conjugated to a detectable moiety, such as a fluorescent dye, e.g., Cy3TM or Cy5TM and then incorporated into nucleic acid probes during nucleic acid synthesis or amplification.
  • Nucleic acid probes can thereby be labeled when synthesized using Cy3TM- or Cy5TM-dCTP conjugates mixed with unlabeled dCTP.
  • Nucleic acid probes can be labeled by using PCR or nick translation in the presence of labeled precursor nucleotides, for example, modified nucleotides synthesized by coupling allylamine-dUTP to the succinimidyl-ester derivatives of the fluorescent dyes or haptens (such as biotin or digoxigenin) can be used; this method allows custom preparation of most common fluorescent nucleotides, see, e.g., Henegariu et al., Nat. Biotechnol. (2000), 18:345-348.
  • Nucleic acid probes can be labeled by non-covalent means known in the art.
  • Kreatech Biotechnology's Universal Linkage System® ULS®
  • ULS® Kreatech Biotechnology's Universal Linkage System®
  • This technology can also be used to label proteins by binding to nitrogen and sulfur containing side chains of amino acids. See, e.g., U.S. Pat. Nos. 5,580,990; 5,714,327; and 5,985,566; and European Patent No. 0539466.
  • Labeling with a detectable label also can include a nucleic acid attached to another biological molecule, such as a nucleic acid, e.g., an oligonucleotide, or a nucleic acid in the form of a stem-loop structure as a "molecular beacon” or an "aptamer beacon".
  • a nucleic acid e.g., an oligonucleotide
  • a nucleic acid in the form of a stem-loop structure as a "molecular beacon” or an "aptamer beacon”.
  • Molecular beacons as detectable moieties are described; for example, Sokol ⁇ Proc. Natl. Acad. Sci. USA (1998), 95: 11538-11543) synthesized "molecular beacon” reporter oligodeoxynucleotides with matched fluorescent donor and acceptor chromophores on their 5' and 3' ends.
  • the molecular beacon In the absence of a complementary nucleic acid strand, the molecular beacon remains in a stem-loop conformation where fluorescence resonance energy transfer prevents signal emission.
  • the stem-loop structure opens increasing the physical distance between the donor and acceptor moieties thereby reducing fluorescence resonance energy transfer and allowing a detectable signal to be emitted when the beacon is excited by light of the appropriate wavelength.
  • Antony Biochemistry (2001), 40:9387-9395
  • a molecular beacon consist of a G-rich 18-mer triplex forming oligodeoxyribonucleotide. See also U.S. Pat. Nos. 6,277,581 and 6,235,504.
  • Aptamer beacons are similar to molecular beacons; see, e.g., Hamaguchi, Anal. Biochem. (2001), 294: 126-131; Poddar, Mol. Cell. Probes (2001), 15: 161-167; Kaboev, Nucleic Acids Res . (2000), 28:E94. Aptamer beacons can adopt two or more conformations, one of which allows ligand binding. A fluorescence-quenching pair is used to report changes in conformation induced by ligand binding. See also, e.g., Yamamoto et al., Genes Cells (2000), 5:389-396; Smimov et al., Biochemistry (2000), 39: 1462-1468.
  • the nucleic acid primer or probe can be indirectly detectably labeled via a peptide.
  • a peptide can be made detectable by incorporating predetermined polypeptide epitopes recognized by a secondary reporter (e.g., leucine zipper pair sequences, binding sites for secondary antibodies, transcriptional activator polypeptide, metal binding domains, epitope tags).
  • a label can also be attached via a second peptide that interacts with the first peptide (e.g., S— S association).
  • detection of the complex containing the nucleic acid from a sample hybridized to a labeled probe can be achieved through use of a labeled antibody against the label of the probe.
  • the probe is labeled with digoxigenin and is detected with a fluorescent labeled anti-digoxigenin antibody.
  • the probe is labeled with FITC, and detected with fluorescent labeled anti-FITC antibody. These antibodies are readily available commercially.
  • the probe is labeled with FITC, and detected with anti-FITC antibody primary antibody and a labeled anti-anti FITC secondary antibody.
  • Nucleic acids can be amplified prior to detection or can be detected directly during an amplification step (i.e., "real-time" methods, such as in TaqMan® and ScorpionTM methods).
  • the target sequence is amplified using a labeled primer such that the resulting amplicon is detectably labeled.
  • the primer is fluorescently labeled.
  • the target sequence is amplified and the resulting amplicon is detected by electrophoresis.
  • nucleic acid molecules can be double-stranded molecules and that reference to a particular site on one strand refers, as well, to the corresponding site on a complementary strand.
  • reference to an adenine, a thymine (uridine), a cytosine, or a guanine at a particular site on one strand of a nucleic acid molecule also defines the thymine (uridine), adenine, guanine, or cytosine (respectively) at the corresponding site on a complementary strand of the nucleic acid molecule.
  • uridine adenine, guanine, or cytosine
  • the primers and probes comprise additional nucleotides corresponding to sequences of universal primers (e.g., T7, M13, SP6, T3) which add the additional sequence to the amplicon during amplification to permit further amplification and/or prime the amplicon for sequencing.
  • universal primers e.g., T7, M13, SP6, T3
  • the disclosure further provides methods of treating a patient selected by any method of the above embodiments, or identified as likely to experience a more favorable clinical outcome by any of the above methods, following the therapy.
  • the methods entail administering to the patients such a therapy.
  • a cancer patient, e.g., a GI cancer patient, a colon cancer patient, a rectal cancer patient, or a colorectal cancer patient selected for treatment based on the presence of the genotype of (G/C) or (G/G) for rs609429, (A/G) or (A/A) for rs861539, (A/G) or (G/G) for rs760370, or (C/T) or (T/T) for rs9394992 in a biological sample from the patient, comprising administering to the patient a therapy comprising administration of an effective amount of TAS-102.
  • a therapy comprising administration of an effective amount of TAS-102.
  • the patient is treated with a TAS-102-free therapy if the genotype of (G/C) or (G/G) for rs609429, (A/G) or (A/A) for rs861539, (A/G) or (G/G) for rs760370, or (C/T) or (T/T) for rs9394992 is not present in the sample.
  • the patient is treated with a TAS-102-free therapy if the genotype of (C/C) for rs609429, (G/G) for rs861539, (A/A) for rs760370, or (G/G) for rs9394992 is present in the sample.
  • Alternative therapies are known in the art, non-limiting examples of such are described herein.
  • the patient is selected by a method comprising screening a tissue or cell sample isolated from the patient for the polymorphism.
  • exemplary methods for screening are described in the diagnostic methods provided above and throughout the present disclosure. Any such diagnostic methods disclosed for the detection of a polymorphism can be combined with the treatment methods provided herein.
  • the patient suffers from colorectal cancer, non-metastatic colorectal cancer or metastatic colorectal cancer.
  • the colorectal cancer is colon cancer. In some aspects, the colorectal cancer is rectal cancer.
  • Exemplary dosing schedules for the treatment of colorectal cancer with TAS-102 include but are not limited to 35 mg/m 2 twice daily with meals for 5 days, with 2 days of rest for 2 weeks followed by a 14-day rest period.
  • therapy further comprises oxaliplatin or irinotecan.
  • TAS-102-free therapy comprises therapeutically effective amounts of oxaliplatin and/or irinotecan.
  • the therapy or TAS-102-free therapy further comprises a therapeutically effective amount of folinic acid and/or a pyrimidine analog.
  • the therapy or TAS-102-free therapy comprises FOLFOX (leucovorin + Fluorouracil (5-FU) + oxaliplatin).
  • the therapy or TAS-102-free therapy comprises FOLFIRI (leucovorin + Fluorouracil (5-FU) + irinotecan).
  • the therapy or TAS-102- firee comprises FOLFOXFIRI (leucovorin + Fluorouracil (5-FU) + oxaliplatin + irinotecan).
  • the therapy or TAS-102-free further comprises a therapeutically effective amount of bevacizumab.
  • Exemplary dosing schedules for the treatment of colorectal cancer with irinotecan as a monotherapy include but are not limited to 125 mg/m 2 IV infusion over 90 minutes on days 1, 8, 15, 22, then 2 weeks off, then repeat or 350 mg/ m 2 IV infusion over 30-90 minutes once every 3 weeks.
  • Exemplary dosing schedules for the treatment of colorectal cancer with irinotecan as combination therapy include but are not limited to 180 mg/m 2 IV infusion over 30-90 minutes once on days 1, 15, and 29 IV (infuse over 30-90 min), followed by infusion with leucovorin and 5-fluorouracil; next cycle begins on day 43 (6 week cycle) or 125 mg/ m 2 on days 1, 8, 15, and 22 (infuse over 90 min), followed by bolus doses of leucovorin and 5- fluorouracil.
  • Oxaliplatin include but are not limited to Oxaliplatin 75-85 mg/m 2 IV + leucovorin 200 mg/m 2 IV infused over 2 hr, then 5-FU 300-400 mg/m 2 IV bolus over 2-4 minutes, then 5-FU 500-600 mg/m 2 IV infusion in D5W (500 mL) over 22 hr on day 1 and then repeat on day 2 without oxaliplatin, and then repeat the 2-day regimen every 2 weeks.
  • treatment is provided following tumor resection.
  • a mammal includes but is not limited to a human, a simian, a murine, a bovine, an equine, a porcine or an ovine subject.
  • a formulation comprising the necessary therapy or equivalent thereof is further provided herein.
  • the formulation can further comprise one or more preservatives or stabilizers.
  • compositions typically intends a combination of the active agent and another carrier, e.g., compound or composition, inert (for example, a detectable agent or label) or active, such as an adjuvant, diluent, binder, stabilizer, buffers, salts, lipophilic solvents, preservative, adjuvant or the like and include pharmaceutically acceptable carriers.
  • Carriers also include pharmaceutical excipients and additives proteins, peptides, amino acids, lipids, and carbohydrates.
  • chemotherapeutic agent of the disclosure e.g., encapsulation in liposomes, microparticles, microcapsules, expression by recombinant cells, receptor-mediated endocytosis. See e.g., Wu and Wu (1987) J. Biol. Chem. 262:4429-4432 for construction of a therapeutic nucleic acid as part of a retroviral or other vector, etc.
  • Methods of delivery include but are not limited to intra-arterial, intra-muscular, intravenous, intranasal and oral routes.
  • agents identified herein as effective for their intended purpose can be administered to subjects or individuals identified by the methods herein as suitable for the therapy.
  • Therapeutic amounts can be empirically determined and will vary with the pathology being treated, the subject being treated and the efficacy and toxicity of the agent.
  • a therapy or a medicament comprising an effective amount of a chemotherapeutic as described herein for treatment of a human cancer patient having the appropriate expression level of the gene of interest as identified in the experimental examples.
  • a therapy comprising a platinum drug, or alternatively a platinum drug therapy, for use in treating a human cancer patient having the appropriate expression level of the gene of interest as identified in the experimental examples.
  • compositions are well known to those of ordinary skill in the art and include, but are not limited to, oral, microinjection, intravenous or parenteral administration.
  • the compositions are intended for topical, oral, or local administration as well as intravenously, subcutaneously, or intramuscularly. Administration can be effected continuously or intermittently throughout the course of the treatment.
  • kits or panel for use in detecting the rs609429, rs861539, rs760370, rs9394992, rs2289669, and/or rs316019 polymorphisms in patient biological samples are provided.
  • a kit comprises at least one reagent necessary to perform the assay.
  • the kit can comprise an enzyme, a buffer or any other necessary reagent (e.g. PCR reagents and buffers).
  • a kit contains, in an amount sufficient for at least one assay, any of the hybridization assay probes, amplification primers, and/or antibodies suitable for detection in a packaging material.
  • the kit or panel comprises primer and/or probes suitable for screening for the polymorphism(s).
  • the various components of the kit can be provided in a variety of forms.
  • the required enzymes, the nucleotide triphosphates, the probes, primers, and/or antibodies are be provided as a lyophilized reagent.
  • These lyophilized reagents can be pre-mixed before lyophilization so that when reconstituted they form a complete mixture with the proper ratio of each of the components ready for use in the assay.
  • the kits can contain a reconstitution reagent for reconstituting the lyophilized reagents of the kit.
  • the enzymes, nucleotide triphosphates and required cofactors for the enzymes are provided as a single lyophilized reagent that, when reconstituted, forms a proper reagent for use in the present amplification methods.
  • the kit or panel is for determining the likely clinical outcome of a colorectal cancer patient receiving a therapy comprising TAS-102. In some aspects, the kit or panel is for determining the eligibility of a colorectal cancer patient for receiving a therapy comprising TAS-102.
  • kits will also include instructions recorded in a tangible form (e.g., contained on paper or an electronic medium) for using the packaged probes, primers, and/or antibodies in a detection assay for determining the presence or amount of the rs609429, rs861539, rs760370, rs9394992, rs2289669, and/or rs316019 polymorphisms in a test sample.
  • instructions recorded in a tangible form e.g., contained on paper or an electronic medium
  • a detection assay for determining the presence or amount of the rs609429, rs861539, rs760370, rs9394992, rs2289669, and/or rs316019 polymorphisms in a test sample.
  • kits further comprise a solid support for anchoring the nucleic acid of interest on the solid support.
  • the target nucleic acid can be anchored to the solid support directly or indirectly through a capture probe anchored to the solid support and capable of hybridizing to the nucleic acid of interest.
  • solid support include but are not limited to beads, microparticles (for example, gold and other nano particles), microarray, microwells, multiwell plates.
  • the solid surfaces can comprise a first member of a binding pair and the capture probe or the target nucleic acid can comprise a second member of the binding pair. Binding of the binding pair members will anchor the capture probe or the target nucleic acid to the solid surface. Examples of such binding pairs include but are not limited to biotin/streptavidin, hormone/receptor, ligand/receptor, and antigen/antibody.
  • the kit further comprises an effective amount of the therapy.
  • the therapy comprises, or alternatively consists essentially of, or yet alternatively consisting of, administration of a therapeutically effective amount of TAS-102.
  • the kit can comprise at least one probe or primer which is capable of specifically hybridizing to the gene of interest and instructions for use.
  • the kits comprise at least one of the above described nucleic acids.
  • Exemplary kits for amplifying at least a portion of the gene of interest comprise two primers.
  • the kit comprises a forward primer having the sequence of SEQ ID NO:8 and a reverse primer having the sequence of SEQ ID NO: 9, a forward primer having the sequence of SEQ ID NO: 10 and a reverse primer having the sequence of SEQ ID NO: 11, a forward primer having the sequence of SEQ ID NO: 49 and a reverse primer having the sequence of SEQ ID NO: 11, a forward primer having the sequence of SEQ ID NO: 12 and a reverse primer having the sequence of SEQ ID NO: 13, a forward primer having the sequence of SEQ ID NO: 14 and a reverse primer having the sequence of SEQ ID NO: 15, a forward primer having the sequence of SEQ ID NO: 16 and a reverse primer having the sequence of SEQ ID NO: 17, a forward primer having the sequence of SEQ ID NO: 18 and a reverse primer having the sequence of SEQ ID NO: 19, or a forward primer having the sequence of SEQ ID NO: 20 and a reverse primer having the sequence of SEQ ID NO:21.
  • the kit further comprises a nucleic acid probe for the detection of the amplicon.
  • the nucleic acid probe has about 5, about 10, about 15, about 20, or about 25, or about 30, about 35, about 40 or more contiguous nucleotides of any of SEQ ID NO: 1-7 and overlaps the polymorphic site.
  • the nucleic acid primers and/or probes are lyophilized.
  • At least one of the primers for amplification is capable of hybridizing to the allelic variant sequence.
  • at least one of the primers for amplification has about 5, about 10, about 15, about 20, or about 25, or about 30, about 35, about 40 or more contiguous nucleotides of any of SEQ ID NO: 1-7 and overlaps the polymorphic site.
  • kits are suitable for detection of genotype by, for example, fluorescence detection, by electrochemical detection, or by other detection.
  • Oligonucleotides whether used as probes or primers, contained in a kit can be detectably labeled. Labels can be detected either directly, for example for fluorescent labels, or indirectly. Indirect detection can include any detection method known to one of skill in the art, including biotin-avidin interactions, antibody binding and the like. Fluorescently labeled oligonucleotides also can contain a quenching molecule. Oligonucleotides can be bound to a surface. In one embodiment, the surface is silica or glass. In another embodiment, the surface is a metal electrode.
  • test samples used in the diagnostic kits include cells, protein or membrane extracts of cells, or biological fluids such as sputum, blood, serum, plasma, or urine.
  • the test samples can also be a tumor cell, a normal cell adjacent to a tumor, a normal cell
  • test sample used in the above-described method will vary based on the assay format, nature of the detection method and the tissues, cells or extracts used as the sample to be assayed. Methods for preparing protein extracts or membrane extracts of cells are known in the art and can be readily adapted in order to obtain a sample which is compatible with the system utilized.
  • kits can include all or some of the positive controls, negative controls, reagents, primers, sequencing markers, probes and antibodies described herein for determining the subject's genotype in the polymorphic region of the gene of interest or target region.
  • these suggested kit components can be packaged in a manner customary for use by those of skill in the art.
  • these suggested kit components can be provided in solution or as a liquid dispersion or the like.
  • Typical packaging materials would include solid matrices such as glass, plastic, paper, foil, micro-particles and the like, capable of holding within fixed limits hybridization assay probes, and/or amplification primers.
  • the packaging materials can include glass vials used to contain sub-milligram (e.g., picogram or nanogram) quantities of a contemplated probe, primer, or antibodies or they can be microtiter plate wells to which probes, primers, or antibodies have been operatively affixed, i.e., linked so as to be capable of participating in an amplification and/or detection methods.
  • the instructions will typically indicate the reagents and/or concentrations of reagents and at least one assay method parameter which might be, for example, the relative amounts of reagents to use per amount of sample.
  • assay method parameter which might be, for example, the relative amounts of reagents to use per amount of sample.
  • specifics as maintenance, time periods, temperature, and buffer conditions can also be included.
  • kits having any of the hybridization assay probes, amplification primers, or antibodies described herein, whether provided individually or in one of the combinations described above, for use in determining the presence or amount of the polymorphism(s) in a test sample.
  • Trifluridine is an active cytotoxic component of TAS-102, and incorporation of triphosphorylated FTD into DNA confers its antitumor effect.
  • TAS-102 is an orally administered drug combining the thymidine-based nucleoside analogue, trifluridine (FTD), and tipiracil hydrochloride, a thymidine
  • FTD is the active anti-tumor component of TAS-102. Incorporation of tri-phosphorylated FTD into DNA acts as the drug's main antitumor mechanism of action.
  • the TPI ensures sufficient blood concentration of FTD by preventing its rapid degradation (Temmink et al., Bijnsdorp et al. [3,4]).
  • the mechanism of DNA repair following FTD incorporation is still unclear.
  • Homologous recombination is the primary mechanism of DNA repair triggered by DSBs.
  • the initial cellular DDR to DSBs is mediated by the upstream DDR kinase, ataxia telangiectasia mutated (ATM).
  • ATM subsequently phosphorylates downstream HR-related key genes (Branzei et al., Liu et al., Krajewska et al., Jasin et al. [6,7,8,9]).
  • Cell cycle checkpoints also play an important role in DNA damage and mediate cell cycle arrest to promote DNA repair.
  • ⁇ Z and Ataxia Telangiectasia and Rad3 -Related Protein are known as upstream proteins of checkpoints, responding to different types of DNA damage.
  • Cell cycle arrest mediated by phosphorylation of ATR-checkpoint kinase 1 (Chkl or CHEKl) and the ⁇ 7 -checkpoint kinase 2 (Chk2 or CHEK2) by ATR and ,4 Z as DDR suppresses the activity of cyclin-dependent kinase (CDK), leading to cell cycle arrest and DNA repair (Branzei et al. [6]).
  • CDK cyclin-dependent kinase
  • Applicant analyzed genomic DNA extracted from 233 blood samples of three different cohorts: an evaluation set of 52 patients receiving TAS-102 (median age 61 years, male 44%, median followup time 6.4 months); a validation cohort of 129 patients receiving TAS-102, and a control cohort of 52 patients receiving regorafenib without history of TAS- 102 treatment (median age 64 years, male 44%, all patients deceased).
  • SNPs Single nucleotide polymorphisms (SNPs) of genes involved in HR (ATM, BRCAl, BRCA2, XRCC3, FANCD2, H2AX, RAD 51) and cell cycle checkpoints (ATR, CHEKl, CHEK2, CDKN1A, TP53, CHE1, PIN1, PCNA) were analyzed by PCR-based direct sequencing for association with HR (ATM, BRCAl, BRCA2, XRCC3, FANCD2, H2AX, RAD 51) and cell cycle checkpoints (ATR, CHEKl, CHEK2, CDKN1A, TP53, CHE1, PIN1, PCNA) were analyzed by PCR-based direct sequencing for association with
  • PFS progression-free survival
  • OS overall survival
  • This study was a retrospective exploratory study that investigated three independents cohorts consisted of patients with refractory mCRC patients; an evaluation cohort of 52 patients receiving TAS-102 referred at Cancer Institute Hospital in Japan, a control cohort of 52 patients treated with regorafenib referred at Azienda Ospedaliero- Universitaria Pisana and a validation cohort of 129 patients receiving TAS-102 referred at Azienda Ospedaliero-Universitaria Pisana, Pisa, Italy, Istituto Oncologico Veneto, Padova, Italy, Istituto Nazionale Tumori, Milano in Italy. All patients underwent the treatment in salvage-line setting. Eligible patients had a histologically confirmed diagnosis of mCRC; history of previous standard chemotherapy consisting of 5-FU, L-OHP, CPT-11,
  • TAS- 102 (Taiho Pharmaceutical Co., Ltd., Tokyo, Japan) 35 mg per square meter twice daily days 1-5 and 8-12, every 4 weeks.
  • Patients in the control group received 160 mg regorafenib (Bayer, Leverkusen, Germany) once daily from day 1 to 21 every 4 weeks.
  • Doses were adjusted based on haematological and non-haematological adverse events at treating physician's discretion in accordance with the manufacturer's recommendations.
  • the analyses were approved by the University of Southern California (USC) Institutional Review Board of Medical Sciences and conducted at the USC/Norris Comprehensive Cancer Center in accordance with the Declaration of Helsinki and Good Clinical Practice Guidelines.
  • the candidate 22 SNPs in the HR pathway and cell cycle checkpoint used in this study mapped to the following genes: ⁇ 7 (NM_000051, NM_138292, NM_138293), BRCA1 (NM_007294, NM_007295, NM_007296, NM_007297, NM_007298), BRCA2 (NM_000059), XRCC3 (NM_001100118, NM_001100119, NM_005432), FANCD2
  • Genomic DNA was extracted from peripheral whole blood in patients of all cohorts using the QIAmp Kit (Qiagen, Valencia, CA, USA) according to the manufacturer's protocol (www.qiagen.com).
  • the candidate SNPs were tested using PCR-based direct DNA sequence analysis by ABI 3100A Capillary Genetic Analyzer and Sequencing Scanner vl .O (Applied Biosystems). Both forward and reverse primers used for amplification of extracted DNA are listed in Table 2. For quality control purposes, a randomly selected 10% of the samples was analyzed by direct DNA sequencing for each SNP, and the genotype
  • concordance rate was of 99% or more.
  • the investigators analyzing SNPs were blinded to the clinical data.
  • H2AX 3 prime near AGACCAAAGGGGTG
  • TP53 Protein coding TTCTGGGAAGGGACA synonymous
  • CEU refers to the frequency in the Caucasian population.
  • JPN refers to the frequency
  • UTR refers to either the 5' or 3' untranslated region of the gene or mRNA.
  • sequence of the amplicon from the (C) allele is 5'- GCCTTGGGCAAGGGTACTTAATCTTTTCTCAACCTCAATTTCCTGGTTATAAAATG AGAAGATACCTAACTT
  • sequence of the amplicon from the (A) allele is 5'-CCGCATCCTGGCTA AAAATACGAGCTCAGGGGTGCAACCCTGCCTTGGTGCTCACCTGGTTGATG C AC AGC AC AGGGC TC TGGA AGGC AC TGC TC AGCTC AC GC AGC ATGG CCCCCAGGGACTGCAGATGCCTGGCCCTGGGGGCGGAGGCCTGG CTGTC AAATTC AC AGCGGAATGG-3 ' (SEQ ID NO: 96), and the sequence of the amplicon from the (G) allele is 5'-CCGCATCCTGG
  • the sequence of the amplicon from the (A) allele is 5'-CTCACCTGGTTGATGCACAG
  • PFS progression-free survival
  • OS overall survival
  • DCR disease control rate
  • the baseline demographic and clinical characteristics that remained statistically significantly associated with PFS and OS in multivariable analyses were included in the final models.
  • the median follow-up time, median PFS and OS were 6.4 months, 2.6 months and 8.0 months in the evaluation cohort, 5.3 months, 2.0 months and 5.7 months in the validation cohort, and 5.3 months, 1.9 months and 5.3 months in the control cohort, respectively. All patients deceased at the last follow-up time in the control cohort.
  • the baseline characteristics of the evaluation, validation, and control cohorts are summarized in Table 3. Patient's gender, performance status, and adjuvant treatment history were differently distributed. The associations between baseline characteristics and clinical outcome were summarized in Tables 4-6 for evaluation, validation, and control cohorts, respectively.
  • liver metastasis, KRAS wild type and prior exposure to anti-EGFR anti-body was significantly associated with shorter PFS; history of adjuvant treatment was associated with longer PFS in evaluation cohort.
  • the number of prior chemotherapy, adjuvant treatment history and anti-EGFR anti-body were correlated with OS.
  • age ⁇ 61 and previous exposure of anti-EGFR antibodies are significantly associated with shorter PFS and OS; liver metastasis and ECOG performance status > 1 significantly correlated with shorter PFS and OS, respectively.
  • patients with poor ECOG performance status and multiple metastatic sites had shorter PFS and OS; age ⁇ 61 and liver metastasis also showed significantly shorter PFS.
  • Table 4 Baseline characteristics and clinical outcome in the evaluation cohort treated with TAS-102.
  • Table 5 Baseline characteristics and clinical outcomes in the validation cohort treated with TAS-102
  • Table 6 Baseline characteristics and clinical outcomes in the control cohort treated with regorafenib
  • G/G 15 2.0(1.2, 6.1) 0.85 (0.45, 1.63) 1.32(0.67,2.59)
  • G/A 50 2.0(1.9,2.3) 0.96 (0.62, 1.50) 0.95 (0.59, 1.51)
  • A/A 25 1.9(1.8,2.0) 1.34(0.80,2.25) 1.26 (0.74,2.14)
  • A/A 25 1.9(1.8,2.0) 1.37(0.86,2.18) 1.30(0.81,2.09)
  • G/A 30 1.9 (1.8, 3.1) 0.83 (0.44, 1.56) 0.92 (0.47, 1.79)
  • T/C 26 1.8 (1.6, 3.1) 1.02 (0.54, 1.95) 1.15 (0.58, 2.27)
  • T/T 22 8.3 (5.7, 15.6+) 0.71 (0.29, 1.74) 0.71 (0.29, 1.77)
  • A/A 7 5.4 (2.3, 9.1) 0.34 (0.04, 2.95) 0.54 (0.21, 1.40)
  • Table 10 Gene polymorphism and disease control rate in the evaluation cohort treated with TAS-102 (additional genes)
  • ⁇ * P value was based on the log-rank test in the univariate analysis and Wald test in the multivariable analysis within Cox regression model ⁇ %) adjusted for liver metastasis and adjuvant history in the evaluation cohort; age group. a Grouped together for analysis.
  • A/C 14 3.5 (1.5, 4.9) 0.76 (0.37, 1.56) 0.82 (0.39, 1.72)
  • ⁇ * P value was based on the log-rank test in the univariate analysis and Wald test in the multivariable analysis within Cox regression model ⁇ %) adjusted for liver metastasis and adjuvant history in the evaluation cohort; age group. a Grouped together for analysis.
  • Table 12 Gene polymorphism and overall survival in the evaluation cohort treated with TAS-102 (additional genes)
  • ⁇ * P value was based on the log-rank test in the univariate analysis and Wald test in the multivariable analysis within Cox regression model ⁇ %) adjusted for liver metastasis and adjuvant history in the evaluation cohort; age group. a Grouped together for analysis.
  • Table 13 Gene polymorphism and clinical outcome in the validation cohort treated with TAS-102
  • ⁇ * P value was based on the log-rank test in the univariate analysis and Wald test in the multivariable analysis within Cox regression model ⁇ %) adjusted for liver metastasis and adjuvant history in the evaluation cohort; age group. a Grouped together for analysis. + Estimates not reached yet.
  • Table 17 Toxicities and clinical outcome in the evaluation and validation cohort treated with TAS-102
  • Table 18 SNPs and grade 3 ⁇ neutropenia in the evaluation and validation cohort treated with TAS-102
  • this study demonstrates that the incorporation of FTD as the active cytotoxic component of TAS-102 into DNA induces DSBs followed by DNA repair mainly through HR pathway. Furthermore, to Applicant's knowledge, this study is the first to report that HR pathway-related genes polymorphisms, ⁇ 4Z rs609429 and XRCC3 rs861539, are associated with clinical outcomes in mCRC patients receiving TAS- 102.
  • HR is known as a conservative pathway to repair DSBs induced by DNA damaging agents (Mayer et al. [2]), and utilizes a sister DNA strand harboring correct sequence as a homologous pair for reference in the recombinant process of repairs for DSBs (Cheung-Ong et al. [10]).
  • genes regulating the activity of HR pathway can be molecular targets with regard to prediction of chemo-sensitivity or elucidation of chemo resistance.
  • ATM is an upper stream gene in the HR pathway and plays as a key activator of the cellular response to DSBs through subsequent phosphorylation of downstream HR-related genes. It is recruited and activated of by the MRN complex acting as sensor of DNA damage. ATMis also responsible for cell cycle checkpoint activation and p53, responsible for cell cycle arrest, is one of its target genes (Bijnsdorp et al. [4]). Thus, HR-derived DNA repair is harmonized with cell cycle progression through ATM activation.
  • a protein expression analysis for ATM, ⁇ - ⁇ 2 ⁇ and Ku70 in HR-pathway in stage II/III colorectal cancer tissue reported that loss of ATM expression is independently associated with shorter DFS, and suggests ATM as a negative prognostic biomarker in colorectal cancer (Boggs et al. [20]).
  • Applicant thereby identified the key activator of HR-mediated DNA repair, ATM gene, as a primary candidate that might also influence the efficacy of TAS-102 treatment or prognosis in patients with mCRC.
  • XRCC3 is another crucial member of DNA repair genes encoding the
  • RecA/RAD51 -related protein family for the maintenance of genome stability in HR repair for DNA double-strand breaks (Goode et al. [21]).
  • Association between XRCC3 rs861539 polymorphism and cancer risk have been reported in several cancer types including bladder cancer, melanoma and lung cancer [21,27,28,29,30].
  • Two studies for lung cancer showed no association with the gene variants (Butkiewicz et al. and David-Beabes et al. [27,28]).
  • XRCC3 T241M C/C variants are associated with decreased GC risk (Wang et al. [33]). Furthermore, no evidence of association of the S Ps with response to chemotherapy or clinical outcomes was observed in the studies. Without being bound by theory, XRCC3 T241M (rs861539) polymorphism might be involved in cancer development, but its role as a predictive marker remains unknown.
  • chemotherapeutic agents especially biologic agents such as pharmacological inhibitors of the enzyme poly ADP ribose polymerase (PARP) inhibitor that deteriorate the DNA repair in cancer cells leading to cell death (Mayer et al. [2]).
  • PARP poly ADP ribose polymerase
  • Applicant observed an ethnic difference in the allele frequency in XRCC3 rs861539 that showed the lack of A/A variant (0% vs. 20.0%) and high frequency of the G/G variant (67.3% vs. 40.0%) in the evaluation cohort compared to those of the validation cohort.
  • a trend toward shorter OS in the G/G variant compared with the G/A variant was confirmed in the validation cohort when Applicant excluded the A/A variant from the analysis, which is consistent with those observed in the evaluation cohort; though without statistical significance.
  • Applicant's data demonstrates that the dominant wild-type variants, C/C in ⁇ 7 rs609429 and G/G in XRCC3 rs861539, affect chemosensitivity to TAS-102 treatment leading to shorter PFS or OS. Without being bound by theory, Applicant believes that this is caused by insufficient DNA repair for DSBs by FTD incorporation into DNA. In addition, Applicant found an association between grade 3 ⁇ neutropenia and ATM rs609429. Without being bound by theory, this association can be explained by the maintenance of increased FTD concentration in tumor cells of patients carrying the G allele compared with the concentration level in those with the C/C variant.
  • Applicant has demonstrated more clearly the DNA repair mechanism and identified candidate markers for clinical outcomes in mCRC patients treated with TAS-102 by comparing the three independent cohorts including an evaluation cohort for discovery, a control cohort with comparable clinical characteristics and disease stage and a larger validation cohort with comparable clinical characteristics and receiving the same treatment.
  • hENTl human equilibrative nucleoside transporter
  • TK1 thymidine kinase 1
  • Applicant analyzed genomic DNA extracted from 104 blood samples of two different cohorts: an evaluation set of 52 patients receiving TAS-102 (median age 61 years, male 44%, median followup time, 6.4 months), and a control group of 52 patients receiving regorafenib without history of TAS-102 treatment (median age 64 years, male 44%, all patients deceased).
  • Single nucleotide polymorphisms (S Ps) of genes in FTD metabolism (7X7, hENTl) were analyzed by PCR-based direct sequencing.
  • the candidate SNPs were selected by their frequency and potential function. Associations between selected SNPs and PFS and OS were evaluated by KaplanMeier and logrank tests in the overall population. Cox proportional hazard regression model was used in multivariate analyses.
  • PCR primers used in the example are provided in Table 19 below.
  • sequence of the amplicon generated for the (A) allele is: 5'TGGGGGACACTCAGTAGAGGGAGGGCAAAAGGAGAGTCCCTGCTCCCAGAGCT GAGAGGAGAGATGGCTCAGGAGGGGCTCCCAGGCTGAGGGGATAGTGACTGTA GTGGAGGGGGGCGCCAAGCTTACTTGGGTGGAGGTGGAGACAGGTTTGCAGGAA GGAGTGAAAGACAACCCCACCATACACGTT3' (SEQ ID NO: 86) and the sequence generated for the (G) allele is:
  • TPI thymidine phosphorylase inhibitor
  • OCT2 Organic cation transporter 2
  • MATE1 Multidrug and toxin extrusion
  • Applicant tested whether gene polymorphisms in genes involved in TPI metabolism are associated with outcomes in patients with refractory metastatic colorectal cancer (mCRC) treated with T AS- 102.
  • S Ps Single nucleotide polymorphisms
  • FANCD2 associated with sporadic breast cancer risk FANCD2 associated with sporadic breast cancer risk. Carcinogenesis. 2006; 27: 1930-7.
  • Mcllwraith MJ Vaisman A, Liu Y, Fanning E, Woodgate R, West SC. Human DNA polymerase eta promotes DNA synthesis from strand invasion intermediates of homologous recombination. Mol Cell 2005; 20: 783-92.
  • Modesti M Kanaar R. Homologous recombination: from model organisms to human disease. Genome Biol 2001; 2: REVIEWS1014.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne des procédés pour identifier l'issue clinique de patients atteints d'un cancer colorectal après une thérapie comprenant du TAS-102. Ces procédés consistent à cribler un échantillon de cellules ou de tissu isolé à partir du patient pour détecter un polymorphisme de rs609429, rs861539, rs760370 ou rs9394992. Après avoir déterminé si le patient est susceptible d'être traité avec succès, l'invention concerne en outre des procédés pour traiter ces patients.
PCT/US2017/028997 2016-04-22 2017-04-21 Biomarqueurs prédictifs de l'efficacité de tas-102 WO2017185062A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US16/159,373 US20190233884A1 (en) 2016-04-22 2018-10-12 Hent1 plus mate1/oct2 polymorphisms predict efficacy and toxicity of tas-102 in metastatic colorectal cancer patients

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201662326611P 2016-04-22 2016-04-22
US62/326,611 2016-04-22

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US16/159,373 Continuation US20190233884A1 (en) 2016-04-22 2018-10-12 Hent1 plus mate1/oct2 polymorphisms predict efficacy and toxicity of tas-102 in metastatic colorectal cancer patients

Publications (1)

Publication Number Publication Date
WO2017185062A1 true WO2017185062A1 (fr) 2017-10-26

Family

ID=60116466

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2017/028997 WO2017185062A1 (fr) 2016-04-22 2017-04-21 Biomarqueurs prédictifs de l'efficacité de tas-102

Country Status (1)

Country Link
WO (1) WO2017185062A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108315398A (zh) * 2018-04-26 2018-07-24 宁波美丽人生医学检验所有限公司 一种用于检测双胍类药物相关基因的引物组合物及试剂盒
CN109999053A (zh) * 2019-04-26 2019-07-12 周德旺 曲氟尿苷或曲氟尿苷替匹嘧啶组合物的医药用途
CN110196327A (zh) * 2019-05-18 2019-09-03 贵州医科大学附属医院 基于基因变异分析检测直肠癌细胞药物敏感性的试剂盒
CN110760581A (zh) * 2019-07-10 2020-02-07 中山大学 Mate1基因在治疗结直肠癌中的应用

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030118991A1 (en) * 1998-02-02 2003-06-26 Yosef Shiloh Ataxia-telangiectasia gene and its genomic organization
US20150307947A1 (en) * 2012-12-04 2015-10-29 Caris Mpi, Inc. Molecular profiling for cancer
US20160082032A1 (en) * 2013-05-17 2016-03-24 Taiho Pharmaceutical Co., Ltd. Therapeutic effect prediction method for colorectal cancer patient in whom expression of tk1 protein has increased

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030118991A1 (en) * 1998-02-02 2003-06-26 Yosef Shiloh Ataxia-telangiectasia gene and its genomic organization
US20150307947A1 (en) * 2012-12-04 2015-10-29 Caris Mpi, Inc. Molecular profiling for cancer
US20160082032A1 (en) * 2013-05-17 2016-03-24 Taiho Pharmaceutical Co., Ltd. Therapeutic effect prediction method for colorectal cancer patient in whom expression of tk1 protein has increased

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
AZIJLI ET AL.: "The novel thymidylate synthase inhibitor trifluorothymidine (TFT) and TRAIL synergistically eradicate non-small cell lung cancer cells", CANCER CHEMOTHER PHARMACOL, vol. 73, no. 6, June 2014 (2014-06-01), pages 1273 - 1283, XP035313344 *
BIJNSDORP ET AL.: "Synergistic interaction between trifluorothymidine and docetaxel is sequence dependent", CANCER SCI., vol. 11, no. 9, November 2008 (2008-11-01), pages 2302 - 2308, XP009500660 *
SUENAGA ET AL.: "Genetic variants of DNA repair-related genes predict efficacy of TAS-102 in patients with refractory metastatic colorectal cance r", ANNALS OF ONCOLOGY, vol. 28, no. 5, 9 February 2017 (2017-02-09), pages 1015 - 1022 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108315398A (zh) * 2018-04-26 2018-07-24 宁波美丽人生医学检验所有限公司 一种用于检测双胍类药物相关基因的引物组合物及试剂盒
CN109999053A (zh) * 2019-04-26 2019-07-12 周德旺 曲氟尿苷或曲氟尿苷替匹嘧啶组合物的医药用途
WO2020215999A1 (fr) * 2019-04-26 2020-10-29 张若文 Utilisation médicale de trifluridine ou d'une composition de trifluridine-tipiracil
CN110196327A (zh) * 2019-05-18 2019-09-03 贵州医科大学附属医院 基于基因变异分析检测直肠癌细胞药物敏感性的试剂盒
CN110196327B (zh) * 2019-05-18 2022-04-29 贵州医科大学附属医院 基于基因变异分析检测直肠癌细胞药物敏感性的试剂盒
CN110760581A (zh) * 2019-07-10 2020-02-07 中山大学 Mate1基因在治疗结直肠癌中的应用
CN110760581B (zh) * 2019-07-10 2021-11-19 中山大学 Mate1基因在治疗结直肠癌中的应用

Similar Documents

Publication Publication Date Title
US20120100997A1 (en) Cd133 polymorphisms and expression predict clinical outcome in patients with cancer
US20170198353A1 (en) Kras mutations and resistance to anti-egfr treatment
WO2013172933A1 (fr) Profil génétique ethnique de gènes impliqués dans l'angiogenèse pouvant prédire des différences régionales d'efficacité du bévacizumab dans le cancer gastrique
WO2010124264A2 (fr) Variants génétiques dans la voie angiogénique en association avec un résultat clinique
WO2017185062A1 (fr) Biomarqueurs prédictifs de l'efficacité de tas-102
EP2115163A2 (fr) Polymorphismes geniques comme predicteurs specifiques au sexe dans la therapie contre le cancer
US20110178110A1 (en) Genotype and Expression Analysis for Use in Predicting Outcome and Therapy Selection
CA2675354A1 (fr) Polymorphismes geniques en tant que predicteurs de progression tumorale et leur utilisation en cancerotherapie
US20120108445A1 (en) Vegf and vegfr1 gene expression useful for cancer prognosis
CA2675369A1 (fr) Polymorphismes d'un promoteur de facteur tissulaire
US20190161803A1 (en) Polymorphisms toll like receptor genes predicts clinical outcomes of colorectal cancer patients
WO2013172918A1 (fr) Polymorphisme du gène ksr1 destiné à être utilisé pour prédire le résultat et la sélection de la thérapie
US20190233884A1 (en) Hent1 plus mate1/oct2 polymorphisms predict efficacy and toxicity of tas-102 in metastatic colorectal cancer patients
US20110160216A1 (en) Thymidylate Synthase Haplotype is Associated with Tumor Recurrence in Stage II and Stage III Colon Cancer Patients
US10563267B2 (en) Polymorphism biomarkers predict clinical outcomes of cancer patients receiving regorafenib
US20180311347A1 (en) Polymorphisms in cachexia predict clinical outcomes of colorectal cancer patients receiving irinotecan and bevacizumab
US20120100135A1 (en) Genetic polymorphisms associated with clinical outcomes of topoisomerase inhibitor therapy for cancer
KR20140064923A (ko) 혈관신생 억제제에 대한 반응성
US8568968B2 (en) EGFR polymorphisms predict gender-related treatment
US20110105529A1 (en) ERCC-1 Gene Expression Predicts Chemotherapy Outcome
US20130023430A1 (en) Cancer stem cell gene variants are associated with tumor recurrence
US20120094844A1 (en) Genetic variants in il-6, p53, mmp-9 and cxcr predict clinical outcome in patients with cancer
US20120288861A1 (en) Germline polymorphisms in the sparc gene associated with clinical outcome in gastric cancer
KR20140064924A (ko) 항-혈관신생 치료와 연관된 고혈압 위험성의 예측 방법
WO2013172922A1 (fr) Analyse du génotype lmtk3 destinée à être utilisée pour prédire le résultat et la sélection de la thérapie

Legal Events

Date Code Title Description
NENP Non-entry into the national phase

Ref country code: DE

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17786775

Country of ref document: EP

Kind code of ref document: A1

122 Ep: pct application non-entry in european phase

Ref document number: 17786775

Country of ref document: EP

Kind code of ref document: A1