WO2017185041A1

WO2017185041A1 - Compositions and methods for insect control

Info

Publication number: WO2017185041A1
Application number: PCT/US2017/028957
Authority: WO
Inventors: Irene Newton
Original assignee: Indiana University Research And Technology Corporation
Priority date: 2016-04-21
Filing date: 2017-04-21
Publication date: 2017-10-26
Also published as: US20230022700A1; US20190127425A1

Abstract

Described herein are expression vectors encoding the Wolbachia protein WalE1. Also described are insects transformed with an expression vector of the present disclosure, and progeny thereof. Also described are methods for improving Wolbachia replication and transmission in its insect host by overexpressing WalE1 in the insect host. Improved Wolbachia replication and transmission provides for insect population control and pathogen resistance in insects, which can reduce disease transmission.

Description

COMPOSITIONS AND METHODS FOR INSECT CONTROL CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to United States Provisional Application No.

62/325,923, which was filed on April 21, 2016, the entire disclosure of which is expressly incorporated herein by reference for all purposes.

STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

[0002] This invention was made with government support under grant no. 1456545 awarded by the National Science Foundation. The Government has certain rights in the invention.

SEQUENCE LISTING

[0003] The instant application contains a Sequence Listing which has been submitted via

EFS-web and is hereby incorporated by reference in its entirety. The ASCII copy, created on April 20, 2017, is named 2016-129-02-WO-E ST25, and is 13,727 bytes in size.

BACKGROUND

[0004] Wolbachia pipientis is a ubiquitous alpha-proteobacterium related to the

Rickettsial pathogens Ehrlichia and Anaplasma that infects arthropods and nematodes. Wolbachia pipientis, which infects approximately 40% of insect species, is passed from generation to generation both vertically (through the oocyte) and horizontally (by environmental transmission).

[0005] Wolbachia pipientis causes a persistent infection within insects, often inducing reproductive effects including sperm-egg incompatibility (cytoplasmic incompatibility), male- killing, and feminization. Due to the induced cytoplasmic incompatibility effect, production of unviable progeny occurs when an uninfected male mates with a Wolbachia-mfected female. The endosymbiotic bacteria rapidly invade and spread within the host population. Certain strains of Wolbachia also have life -shortening effects in the host.

[0006] In addition to its effects on fertility and life-span, Wolbachia has also been observed to protect insect hosts from RNA virus infection by inhibiting replication (e.g., dengue virus, Chikungunya virus, and yellow fever virus). For example, the introduction of wMel and wMelPop-CLA strains of Wolbachia into the mosquito Aedes aegypti, the main vector of dengue virus, resulted in the generation of insects that do not support replication of the virus, thus inhibiting its transmission. SUMMARY

[0007] The following embodiments and aspects thereof are described and illustrated in conjunction with systems, tools and methods that are meant to be illustrative, not limiting in scope. In various embodiments, one or more of the above-described problems have been reduced or eliminated, while other embodiments are directed to other improvements.

[0008] The present disclosure provides expression vectors encoding the Wolbachia protein WalEl and functional fragments thereof, insects transformed with an expression vector of the present disclosure and progeny thereof, and methods for enhancing Wolbachia replication and transmission in its insect host by overexpressing WalEl in the insect host. Enhanced Wolbachia replication and transmission results in insect population control and enhanced pathogen resistance in insects, which can both reduce disease transmission.

[0009] In one aspect, provided herein is an expression vector, comprising a

polynucleotide that encodes WalEl (WD0830) or a functional fragment of WalEl (WD0830). In some embodiments, the polynucleotide is operably linked to an expression control sequence. In some embodiments, the polynucleotide is codon optimized for expression in a particular host. The expression vector can be expressible in an insect, such as Aedes albopictus, Aedes aegypti, Anopheles gamibiae, Anopheles stephansi, Culex pipiens, Culex tarsalis, Culex quinquefasciatus, an insect of the Culicidae family, or an insect of the Drosophilidae family. In some embodiments, the insect is a disease vector, such as a mosquito.

[0010] In some embodiments, functional fragments of WalEl are those that have a synuclein domain. In some embodiment, the synuclein domain is an alpha-synuclein domain.

[0011] In another aspect, provided herein is an insect transformed with an expression vector of the present disclosure. Also provided are progeny of the transformed insect. In some embodiments, the transformed insect or progeny thereof overexpress WalEl or a functional fragment of WalEl, where the overexpressing is relative to an insect that has not been transformed with the expression vector.

[0012] In another aspect provided herein is a method for increasing Wolbachia replication and transmission in an insect host population. In some embodiments, the method comprises the steps of overexpressing WalEl or a functional fragment thereof in at least one insect, and introducing the insect overexpressing WalEl or the functional fragment thereof, or a progeny thereof, to an insect population. Overexpression of WalEl or a functional fragment of WalEl can be achieved by transforming at least one insect host or insect host cell with an expression vector described herein. Through vertical inheritance, progeny of the transformed insect will also overexpress WalEl. [0013] In some embodiments, the transformed insect is already infected by Wolbachia. In other embodiments, the insect is both transformed with an expression vector described herein and inoculated with Wolbachia.

[0014] The overexpression of WalEl or a functional fragment thereof increases

Wolbachia replication and transmission in the transgenic insect. Such control can reduce the risk of disease transmission from disease vectors such as mosquitos. Further, as Wolbachia can confer or enhance pathogen resistance in certain insects, such as mosquitos, the methods herein also provide for conferring or enhancing pathogen resistance in an insect. In certain aspects, the pathogens are viruses, protozoans, or worms.

[0015] In another aspect provided herein is a CRISPR-on system comprising dCas9 fused with a transcriptional activation domain and a single guide RNA (sgRNA) having a

complementary nucleic acid sequence to a WalEl (WD0830) expression control element.

[0016] In another aspect provided herein is a kit that has at least one container and the expression vector described herein. Kits can also include at least one live insect or insect embryo. In certain aspects, the live insect or insect embryo is infected with Wolbachia.

[0017] In addition to the aspects and embodiments described above, further aspects and embodiments will become apparent by reference to the drawings and by study of the following descriptions.

BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Certain embodiments are illustrated in the referenced figures of the drawings. It is intended that the embodiments and figures disclosed herein are to be considered illustrative rather than limiting.

[0019] FIG. 1 A depicts an alignment of the synuclein domain from WD0830 (WalE 1) and Wolbachia homologs compared to mammalian alpha synuclein (mouse). Conserved residues are indicated at the top of the alignment. The sequences correspond to SEQ ID NOs: 3-14, in order of appearance.

[0020] FIG. IB illustrates the conservation (percent protein identity) and length of the

WD0830 homolog across the Wolbachia genus. Area and percent of similarity is indicated by the colored line across the WD0830 open reading frame.

[0021] FIG. 1C depicts the phylogeny of the various open reading frames generated from codon alignment (clustalw) edited by eye and then used as input to RAxML (GTR+GAMMA), which recovers major Wolbachia clades.

[0022] FIG. 2A is a box plot representative of yeast carrying plasmids that conditionally express GFP (pFus), GFP-WD0830, or two other Wolbachia proteins (WD0462 and WD0041) grown for 48 hours under inducing (4% galactose) conditions (mean of 3 replicate experiments) ** = p < 0.001 (t-test comparing final optical density (OD) achieved by strains expressing GFP- WD0830 to GFP alone).

[0023] FIG. 2B is a series of representative images of yeast expressing GFP-WD0830 or

GFP alone and stained with rhodaminelabelled phalloidin. Arrowheads point to cortical actin punctae in control yeast (GFP only) and actin filaments in GFP-WD0830 expressing yeast.

[0024] FIG. 3A is an image of two gels. Purified WD0830 and alpha-actinin (positive control actin binding protein) were incubated with polymerized rabbit skeletal actin and subjected to centrifugation at 150K x g, fractionated by SDSPAGE, and silver stained to visualize proteins in the supernatant (S) and the pellet (P).

[0025] FIG. 3B is an image of two gels. To identify actin bundling activity, polymerized rabbit skeletal actin was incubated with or without WD0830 as well as with or without bovine serum albumin (BSA, as a negative control) and subjected to a low speed (14K x g) centrifugation before high speed (150K x g) centrifugation. LSP: low speed pellet. HSS: high speed supernatant. HSP: high speed pellet.

[0026] FIG. 3C is a series of representative images visualizing actin bundling.

Polymerized rabbit skeletal actin was incubated with either WD0830 or BSA then directly stained with Acti-stain 555, mounted on a slide and visualized by fluorescence microscopy (scale bar = 100 urn; all images taken at the same magnification).

[0027] FIG. 4 is a bar graph illustrating expression of WD0830 (WalEl) during fly development. Depicted is qRT-PCR analysis of Wolbachia- fQcted flies at noted stages of development (each developmental stage represented by 5 biological replicates). WD0830 (WalEl) expression is presented relative to Wolbachia FtsZ at each developmental stage.

[0028] FIG. 5A presents two photographs that allow the comparison of fluorescent in situ hybridization probe EUB338 staining of Wolbachia in infected flies (stock #145) versus uninfected flies (stock #25211). Green signal is from EUB338-Alexa488 and blue signal is from host nuclei (DAPI stain).

[0029] FIG. 5B presents a montage of four single-plane fluorescent microscopic images

(raw images, unaltered) visualizing RFP-WD0830 in transgenic flies, expressed using the Osk- Gal4 driver. RFP-WD0830 localizes to the developing oocyte and maintains this localization during oogenesis (arrowheads).

[0030] FIG. 5C presents a series of images depicting localization of Wolbachia and RFP-

WD0830 in stage 9-10 oocytes in egg chambers from control (w-;osk-GAL4/+; +) animals, expressing GAL4 alone under the control of osk or experimental (w-; osk-GAL4/+; P{UASp- RFP.WALE1 }6M/+) transgenic animals where RFP-WD0830 expression is driven under the control of osk-GAL4. These tissues were stained for chromosomal DNA (DAPI) and in situ probed for Wolbachia using EUB338. [0031] FIG. 6A is a bar graph indicating that the density of Wolbachia localizing to the developing oocyte is increased when WD0830 is expressed (as measured by EUB338 staining, see methods; N >= 25 for each background; T-test: t = 3.565; df = 32.055; p = 0.001).

[0032] FIG. 6B is a bar graph indicating that Wolbachia density in whole transgenic animals is increased (assessed by qPCR (wsp/Rpl32)) relative to control animals (T-test: t = 2.65; df = 6; p = 0.038).

[0033] FIG. 6C is a bar graph indicating that 6 hour embryos from transgenic animals

(F2) have greater Wolbachia loads (assessed by qPCR) compared to genetic control (fold difference in wsp/Rpl32 = 3.4- 16.8; T-test: t= 2.530; df = 12.362; p = 0.026).

[0034] FIG. 6D depicts the amount of F-actin staining (based on fluorescent-phalloidin binding) in ring canals adjacent to developing oocytes is altered upon RFP-WD0830 expression. Representative actin ring canals in transgenic flies expressing WD0830 (w-; osk- GAL4/+;P{UASp-RFP.WalEl }6M/+) compared to genetic controls (w-;osk-GAL4/+;+).

[0035] FIG. 6E is a bar graph indicating that expression of RFP-WD0830 increases the staining associated with actin ring canals adjacent to the developing oocyte ( > 24 for each genotype; t = 2.8314; df = 47; p = 0.006).

DETAILED DESCRIPTION

[0036] In the following sections, various exemplary compositions and methods are described in order to detail various embodiments. It will be evident to one skilled in the art that practicing the various embodiments does not require the employment of all of the specific details outlined herein, but rather that vector backbone, protein fragment composition and other specific details may be modified through experimentation. In some embodiments, well known methods or components have not been included in the description.

[0037] The present disclosure and accompanying Examples describe the identification and characterization of Wolbachia effector protein WD0830, which has been termed Wolbachia actin localizing effector I (WalEl). As illustrated by FIGS. 1A-1C, WalEl is a well conserved Wolbachia protein having a synuclein domain, a eukaryotic domain known to interact with actin. Alpha-synuclein, the mammalian homolog, co-localizes with actin filaments in vivo, and in quantitative proteomics assays, has been observed to interact with components of the cytoskeleton (such as cofilin and destrin).

[0038] Important to Wolbachia 's ability to induce reproductive effects in generation after generation is its ability to persist within and be passaged through the host germ line.

[0039] As depicted in FIGS. 2A-2B, WalEl ectopically expressed in yeast localizes to and manipulates the yeast actin cytoskeleton, resulting in growth inhibition. Further, WalEl binds to and bundles filamentous (F) actin in co-sedimentation assays {see FIGS. 3A-3C). In female transgenic flies harboring Wolbachia and overexpressing WalEl, the Wolbachia protein localizes to developing oocytes. In these same flies, Wolbachia accumulates to higher titer than genetic controls, with Wolbachia localizing more strongly to the developing oocyte. This effect spans generations, as offspring from these transgenic lines lay eggs with increased Wolbachia titers compared to controls. As described and demonstrated in the description and accompanying Examples presented herein, WalEl functions to manipulate actin during host development and facilitate Wolbachia replication and transmission.

[0040] In various aspects, the present disclosure provides new materials and methods for overexpressing WalEl in Wolbachia- fQcted hosts. WalEl, as described for the first time in the present disclosure and accompanying Examples, is a Wolbachia secreted effector protein that facilitates Wolbachia bacterial replication and transmission in an insect or nematode. In some embodiments, overexpression of WalEl is achieved by transforming an insect or nematode host or host cell with a transgene vector and expressing the transgene vector in the insect or nematode. In some embodiments, the transgene vector comprises a transgene polynucleotide that encodes the WalEl protein or a functional fragment of the WalEl protein. The vector can comprise a polynucleotide that encodes a WalEl protein, or a functional fragment of the WalEl protein, of any Wolbachia species or strain. In some embodiments, the Wolbachia species is Wolbachia pipientis. In some embodiments, the Wolbachia strain is, wHa, wMel, wWil, wUni, wNo, wPip, wPel, wPela, wOv, wOo, wBm, wMelPop, wMelPop-CLA, wMelCS, wAu, wRi, wMau, or wCer2, although additional Wolbachia strains can be used, and are contemplated herein.

[0041] In one embodiment the vector comprises a polynucleotide that encodes a polypeptide having an amino acid sequence that is at least 90% identical to the amino acid sequence of wMel WalEl protein (SEQ ID NO: 2). In other embodiments, the vector comprises a polynucleotide that encodes a polypeptide having an amino acid sequence that is from about 90% identical to 100% identical to the amino acid sequence of wMel WalEl protein (SEQ ID NO: 2). In another embodiment, the vector comprises a polynucleotide that encodes a polypeptide having the sequence of SEQ ID NO: 2.

[0042] In some embodiments, a functional fragment of WalEl is a protein fragment that has a synuclein domain. In other embodiments, a functional fragment of WalEl is a protein fragment that has an alpha-synuclein domain. In yet other embodiments, the functional fragment of WalEl comprises a polypeptide having an amino acid sequence that is at least 90% identical to any one of SEQ ID NOs: 3-10 or 12-14. In some embodiments, the functional fragment of WalEl comprises a polypeptide having the sequence of any one of SEQ ID NOs: 3-10 or 12-14.

[0043] In some embodiments vector is in the form of a plasmid, a viral particle, a phage, and the like. In some embodiments, the vector is an expression vector. The expression vector can be, for example, an episomal expression vector, an integrative expression vector, or a viral expression vector. In some embodiments, the structural polynucleotide sequence encoding the WalEl protein or protein fragment is inserted into the expression vector. Methods and procedures for inserting the polynucleotide sequence into the expression vector are known in the art.

[0044] A "vector" or "recombinant vector" is a nucleic acid molecule that is used as a tool for manipulating a nucleic acid sequence of choice or for introducing such a nucleic acid sequence into a host cell. A vector may be suitable for use in cloning, sequencing, or otherwise manipulating one or more nucleic acid sequences of choice, such as by expressing or delivering the nucleic acid sequence(s) of choice into a host cell to form a recombinant cell. Such a vector typically contains heterologous nucleic acid sequences not naturally found adjacent to a nucleic acid sequence of choice, although the vector can also contain regulatory nucleic acid sequences (e.g., promoters, untranslated regions) that are naturally found adjacent to the nucleic acid sequences of choice or that are useful for expression of the nucleic acid molecules.

[0045] A vector can be either RNA or DNA, either prokaryotic or eukaryotic, and typically is a plasmid. The vector can be maintained as an extrachromosomal element (e.g., a plasmid) or it can be integrated into the chromosome of a recombinant host cell. The entire vector can remain in place within a host cell, or under certain conditions, the plasmid DNA can be deleted, leaving behind the nucleic acid molecule of choice. An integrated nucleic acid molecule can be under chromosomal promoter control, under native or plasmid promoter control, or under a combination of several promoter controls. Single or multiple copies of the nucleic acid molecule can be integrated into the chromosome. A recombinant vector can contain at least one selectable marker.

[0046] The term "expression vector" refers to a recombinant vector that is capable of directing the expression of a nucleic acid sequence that has been cloned into it after insertion into a host cell or other (e.g., cell-free) expression system. A nucleic acid sequence is "expressed" when it is transcribed to yield an mRNA sequence. In most cases, this transcript will be translated to yield an amino acid sequence. The cloned gene is usually placed under the control of (i.e., operably linked to) an expression control sequence.

[0047] Vectors and expression vectors may contain one or more regulatory sequences or expression control sequences. Regulatory sequences broadly encompass expression control sequences (e.g., transcription control sequences or translation control sequences), as well as sequences that allow for vector replication in a host cell. Transcription control sequences are sequences that control the initiation, elongation, or termination of transcription. Suitable regulatory sequences include any sequence that can function in a host cell or organism into which the recombinant nucleic acid molecule is to be introduced, including those that control transcription initiation, such as promoter, enhancer, terminator, operator and repressor sequences. Additional regulatory sequences include translation regulatory sequences, origins of replication, and other regulatory sequences that are compatible with the recombinant cell. The expression vectors may contain elements that allow for constitutive expression or inducible expression of the protein or proteins of interest. Numerous inducible and constitutive expression systems are known in the art

[0048] In some embodiments, the polynucleotide sequence of the expression vector that encodes the WalEl protein or functional fragment thereof is operably linked to at least one expression control sequence. As used herein, the term "operably linked" refers to the association of two or more polynucleotide fragments so that the function of one is affected by the other. The term "expression control sequence," as used herein, refers to a polynucleotide having a particular sequence that regulates the expression of a polynucleotide to which it is operatively linked.

Expression control sequences can control the transcription, post-transcriptional events, and translation of polynucleotide sequences. Suitable expression control sequences include constitutive promoters and inducible promoters. Appropriate promoters can be selected based on the particular vector backbone being used. Vector backbones generally possess a promoter upstream of the insertion site. It should be understood that the design of the expression vector may depend on such factors as the choice of the host cell to be transformed and/or the type of polypeptide to be expressed.

[0049] Expression and recombinant vectors may contain a selectable marker, a gene encoding a protein necessary for survival or growth of a host cell transformed with the vector. The presence of this gene allows growth of only those host cells that express the vector when grown in the appropriate selective media. Typical selection genes encode proteins that confer resistance to antibiotics or other toxic substances, complement auxotrophic deficiencies, or supply critical nutrients not available from a particular media. Markers may be an inducible or non-inducible gene and will generally allow for positive selection. Non-limiting examples of selectable markers include the ampicillin resistance marker (i.e., beta-lactamase), tetracycline resistance marker, neomycin/kanamycin resistance marker (i.e., neomycin phosphotransferase), dihydrofolate reductase, glutamine synthetase, and the like. The choice of the proper selectable marker will depend on the host cell, and appropriate markers for different hosts as understood by those of skill in the art.

[0050] Suitable expression vectors may include (or may be derived from) plasmid vectors that are well known in the art, such as those commonly available from commercial sources.

Vectors can contain one or more replication and inheritance systems for cloning or expression, one or more markers for selection in the host, and one or more expression cassettes. The inserted coding sequences can be synthesized by standard methods, isolated from natural sources, or prepared as hybrids. Ligation of the coding sequences to transcriptional regulatory elements or to other amino acid encoding sequences can be carried out using established methods. A large number of vectors, including bacterial, yeast, and mammalian vectors, have been described for replication and/or expression in various host cells or cell-free systems, and may be used with the sequences described herein for simple cloning or protein expression

[0051] In some embodiments, the polynucleotide encoding the WalEl protein or functional fragment thereof is codon optimized. Any of the polynucleotides described herein can be utilized in a codon optimized form. In some embodiments, a polynucleotide is codon optimized for use in a selected host insect or nematode. Codon optimization can improve WalEl protein or functional protein fragment expression in the host by increasing the translational efficiency of the polynucleotide that encodes the WalEl protein or functional protein fragment. Codon optimization can be performed with the assistance of publicly available software, such as Gene Designer (DNA 2.0). In some embodiments, additional modifications to the encoding polynucleotide are performed to minimize unwanted restriction sites, internal ribosomal binding site sequences, and other sequences such as internal termination sequences and repeat sequences. These codon-optimization methods have been demonstrated to result in up to approximately 1000 fold higher expression of heterologous genes in target organisms (see, e.g., Welch et al., PLoS One 4, e7002;2009 and Welch et al., Journal of the Royal Society; Interface 6 (Suppl 4), S467-S476; 2009). Accordingly, in some embodiments, the polynucleotide sequences encoding WalEl, or a fragment thereof, are modified so that they will have improved expression in a target host.

[0052] In some embodiments, the transgene vector encoding WalEl, or a fragment thereof, is expressible in an insect. The term "expressible in an insect," as used herein, describes the ability of the transgene vector, such as an expression vector, to express the transgene in the host insect. For example, in some embodiments, the vectors described herein are readily expressed in a target host insect, resulting in the overexpression of WalEl or a functional fragment thereof relative to a target host insect harboring Wolbachia but lacking the vector.

[0053] Insect target hosts include, but are not limited to, insects of the Culicidae and

Drosophilidae families. A particular target host is Drosophila melanogaster. Other target hosts include disease vectors, including but not limited to Asian tiger mosquito (Aedes albopictus) and yellow fever mosquito {Aedes aegypti), which can also transmit mosquito-borne viruses such as dengue and West-Nile; malaria mosquitoes (Anopheles gamibiae, Anopheles stephansi); and other species, such as Culex pipiens, Culex tarsalis, and Culex quinquefasciatus, which are all known West-Nile virus mosquito vectors.

[0054] In some embodiments, the vector backbone is selected to optimize host cell transformation efficiency and transgene expression. Many vectors capable of effectively transforming cells of a particular host insect, or group of host insects, and inducing expression of a transgene in the host have been identified and are known in the art. [0055] In one aspect, provided herein are insects or nematodes transformed with a transgene vector described herein, and the progeny of the transformed insects or nematodes. In some embodiments, the transformed insect or nematode, or progeny thereof, overexpresses WalEl relative to an insect or nematode harboring Wolbachia but that has not been transformed with the transgene vector. Because of the effects of WalEl on Wolbachia replication and transmission, Wolbachia- arboring insects or nematodes overexpressing WalEl will exhibit increased

Wolbachia replication and transmission. In one embodiment, Wolbachia-irrfected Drosophila melanogaster transformed with an expression vector encoding WalEl have a significantly increased Wolbachia titer in the presumptive oocyte and increased Wolbachia copy number in the next generation. In other embodiments, Aedes albopictus, Aedes aegypti, Anopheles gamibiae, Anopheles stephansi, Culex pipiens, Culex tarsalis, and Culex quinquefasciatus, and insects of the Culicidae and Drosophilidae families transformed with a transgene vector described herein are provided.

[0056] In some embodiments, overexpression of WalEl is achieved by upregulating the endogenous gene's expression in a host infected with Wolbachia. In one embodiment, a CRISPR- on (clustered regularly interspaced short palindromic repeat) system is used to upregulate endogenous WalEl. The CRISPR-on system is a two-component transcriptional activator based on the CRISPR/Cas system comprising a nuclease-dead Cas9 (dCas9) protein fused with a transcriptional activation domain and a single guide RNA (sgRNA) with complementary sequence to a target gene promoter. The CRISPR-on system is described, for example, in International Patent Application publication WO/2014/172470 and in Yang H. et al., Cell Res., Aug. 2013, which are hereby incorporated by reference in their entirety. To upregulate endogenous WalEl, sgRNA complementary to the WalEl -encoding polypeptide described above, or an associated expression control sequence, is fused with the dCas9 activator. The construct is then transformed into the target host. The WalEl -specific sgRNA sequence guides the dCas9 activator to the WalEl gene, resulting in upregulation of endogenous WalEl expression.

[0057] Also provided herein are methods for increasing Wolbachia replication and transmission in a host insect or nematode. In some embodiments, a target host is transformed with an expression vector described herein. Insect transformation methods are well known in the art, and commonly involve microinjection of developing insect embryos. In some embodiments, microinjection methods are selected to accommodate the physical and developmental characteristics of the target insects. Microinjection methods generally rely on the use of fine glass needles in conjunction with micromanipulators and a microscope. In some embodiments, a vector described herein is delivered via microinjection directly to insect germ cells. See O'Brochta and Atkinson, (2004) Transformation Systems in Insects, in Miller and Capy (Eds) Mobile Genetic Elements (pp.227-254), Humana Press, Totowa, NJ. [0058] When the target host is infected with Wolbachia, this will result in overexpression of WalEl, or a functional fragment thereof. As described in the Examples and depicted in FIGS. 6A-C, the overexpression of WalEl results in increased Wolbachia density in developing D. melanogaster oocytes (FIG. 6A) and adult transgenic flies (FIG. 6B) relative to controls. Progeny have greater Wolbachia loads compared to genetic controls (FIG. 6C). Controls, or control insects, as the term is used herein, are insects harboring Wolbachia but have not been induced to overexpress WalEl.

[0059] In some embodiments, the target host to be transformed is already infected by

Wolbachia. In other embodiments, Wolbachia is introduced to the target host before, concurrently with, or after transformation with a vector described herein. One or more strains of Wolbachia can be introduced to the target host. Additional strains can be introduced to a target host that already harbors a particular Wolbachia strain. Strains that can be introduced to a target host include any Wolbachia strain, including for example wHa, wMel, wWil, wUni, wNo, wPip, wPel, wPela, wOv, wOo, wBm, wMelPop, wMelPop-CLA, wMelCS, wAu, wRi, wMau, and wCer2. By introducing the bacteria to host species that do not generally harbor Wolbachia, and supporting bacterial replication and transmission, new host species are capable of hosting large Wolbachia loads. This can be beneficial for both insect population control and insect host pathogen resistance as described herein.

[0060] Causing WalEl overexpression in at least one insect host and releasing the WalEl overexpressing host(s) into a general insect population can result in an increase in Wolbachia density and load throughout the general population over time. In some embodiments, the at least one insect host overexpressing WalEl can be crossed at least once to produce a small population of transgenic insect hosts overexpressing WalEl. This small population can then be introduced into a larger general population.

[0061] In some embodiments, increased replication and transmission of Wolbachia results in control of an insect population. Wolbachia is known to induce reproductive effects in many insects, including cytoplasmic incompatibility, male-killing, and feminization. Further, Wolbachia has been demonstrated to reduce insect life-span in certain species. Thus, by increasing replication and transmission of Wolbachia in an insect population and causing or amplifying these effects, the population can be controlled.

[0062] In other embodiments, increased replication and transmission of Wolbachia in a host insect confers or improves pathogen resistance in the host insect. Wolbachia has been observed to protect insect hosts from RNA virus infection by inhibiting viral replication. This in turn can reduce virus transmission to humans. Pathogens to which resistance can be increased by the presence of Wolbachia include but are not limited to alphaviruses such as Chikungunya virus, Equine Encephalitis virus, and Western Equine Encephalitis virus; Flaviviruses such as dengue virus, West Nile virus, and Yellow Fever virus; Bunyaviruses such as La Crosse virus, Rift Valley fever virus, and Colorado tick fever virus; protozoans such as malaria parasites of the genus Plasmodium; and worms such as filarial nematodes. Reports have indicated that the pathogen- resistant effect of Wolbachia may be dependent on the particular strain {see, e.g., Hussain M. et al., J. Virol. 87(2): 851-858, 2013 (epub October 31, 2012)). In some embodiments, one or more specific strains of Wolbachia are introduced to a host insect transformed with a vector described herein in order to improve pathogen resistance in the host insect. The ability of particular

Wolbachia strains to confer or improve pathogen resistance is known in the art

[0063] Also provided herein are kits for use with the methods and expression vectors described herein. Expression vectors and/or host insects can be provided in the kit. The kits can also comprise a suitable container, an expression vector detailed herein, a live insect host, including insect embryos, and optionally one or more additional agents or materials, such as those supplies necessary for insect transformation, including needles and agents or media. In some embodiments the expression vector of the kit can be suitably aliquoted.

[0064] The container means of the kits will generally comprise at least one vial, test tube, flask, bottle, syringe or other container means, into which an expression vector may be placed.

EXAMPLES

[0065] The materials, methods, and embodiments described herein are further defined in the following Examples. Certain embodiments are defined in the Examples herein. It should be understood that these Examples, while indicating certain embodiments, are given by way of illustration only. From the disclosure herein and these Examples, one skilled in the art can ascertain the essential characteristics of this disclosure, and without departing from the spirit and scope thereof, can make various changes and modifications to the subject matter provided by this disclosure to adapt it to various usages and conditions.

EXAMPLE I. rvMel protein WD0830 elicits a growth defect in yeast and co-localizes with actin.

[0066] When expressed in the yeast Saccharomyces cerevisiae, bacterial effectors, but not housekeeping proteins, often result in growth inhibition due to conserved targeting of eukaryotic cellular processes. Thus, given the genetic intractability of Wolbachia and the lack of any in vitro assays to identify secreted proteins, the behavior of WD0830 was investigated when expressed in a yeast. The growth of yeast expressing a GFP WD0830 fusion protein was markedly suppressed as compared to expression of GFP alone, demonstrating the role of WD0830 as a secreted substrate {see FIG. 2A). This statistically significant growth-defect (p<0.0001) was not observed in yeast that harbored clones encoding two other hypothetical Wolbachia proteins {see FIG. 2 A; WD0041 or WD0462). [0067] Given that effectors often exhibit similar subcellular localization patterns when expressed in yeast and mammalian cells, using fluorescence microscopy, the subcellular localization pattern of the GFP-WD0830-fusion protein was investigated when expressed in yeast. As depicted in FIG. 2B, GFP-WD0830 localized to filamentous structures within the yeast cell. This localization is reminiscent of actin filaments observed in wild type yeast expressing the Salmonella typhimurium type 3 secreted effector Sip A, a protein that promotes bundling of actin filaments. The actin cytoskeleton of yeast that expresses GFP or GFP-WD0830 was stained with rhodamine -labelled phalloidin. As depicted in the GFP -only panel of FIG. 2B, the yeast actin cytoskeleton normally comprises cortical actin patches, and in polarized cells, actin filaments (which can be difficult to visualize). These structures were no longer observed in yeast that expressed GFP-WD0830. Rather, thick cables that co-localize with the labeled actin were observed, structures similar to those previously observed with expression of a Salmonella type 3 secreted effector, SipA, in yeast.

Methods

Amplification, cloning and transformation of wMel genes

[0068] Genes from the wMel genome were amplified using modified forward primers to facilitate cloning using the Gateway pENTR-D/TOPO system and transformed into One Shot Top 10 competent cells using standard protocols. Transformations were plated on selective plates and entry vector constructs generated by this reaction were sequence verified to confirm that protein products generated were in frame and correctly cloned. Correct entry vectors were used in combination with the pFus yeast destination vector in an LR clonase reaction and these resultant expression vectors were verified by restriction enzyme digests and sequencing.

Yeast molecular biology, quantitative growth assays and microscopy

[0069] Yeast strain S288C (BY4741 MATa) was transformed with sequence-verified expression vectors generated above using the PEG/Lithium acetate method. Yeast transformants were inoculated into selective synthetic media with 2% (w/v) glucose. These cultures were grown overnight to saturation (at 30°C) before transfer into media containing 2% raffinose. After cultures reached an OD600 of 0.3-0.4 they were pinned into selective synthetic media containing 2% galactose (to induce expression) or 2% glucose (to repress). These growth assays were performed in triplicate. Optical densities of yeast growing in both conditions were measured using an Epoch plate reader at 24, 36, and 48 hours growth at 30°C.

[0070] Yeast harboring the expression vectors containing Wolbachia GFP -proteins were grown overnight in selective synthetic media containing 2% raffinose. Optical density measurements were taken and the yeast were diluted to an OD600 of 0.1 in synthetic media containing 2% galactose to induce expression. Localization of Wolbachia proteins was monitored in live yeast at 6 hrs and 24 hrs post-induction by live observation on a Nikon E800 fluorescent microscope with 40x oil objective and processed using Metamorph imaging software. To determine co-localization of the GFP -fusion protein with either actin or nuclei yeast were fixed in either 4% paraformaldehyde or Karnovsky fixative for 20 minutes at room temperature after a 6 hour induction and imaged using a 60x objective. Staining with rhodamine-labeled phalloidin to visualize the actin cytoskeleton was performed, and staining with DAPI (in mounting media) allowed for visualization of nuclei.

Yeast protein expression and Western blots

[0071] Yeast harboring expression vectors containing proteins of interest were grown overnight in selective synthetic media containing 2% glucose. These cultures were diluted to an OD600 of 1.0 in synthetic media containing 4% galactose for 6, 16, or 24 hours before cells were harvested by centrifugation and frozen at -80 °C. Frozen yeast pellets were disrupted using bead beating (Lysing matrix C on an MP FastPrep system, 20s speed 6) in 750μ1 of Lysis Buffer (150mM NaCl, 1% Triton X-100, 50 mM Tris HC1, pH 8) supplemented with HALT Protease Inhibitor Cocktail and 5mM EDTA. Lysates were centrifuged at 10,000 X g for 1 min. at 4 °C to pellet cell debris and supernatants were used for subsequent Western blots.

[0072] Proteins were separated on 4-20% Tris-Glycine NB precast gels and transferred to

PVDF membrane in Tris-Glycine transfer buffer with 15% methanol at 40v on ice for 3-4 hours. The membrane was blocked for 5 minutes in Starting Block T20 (TBS) Blocking Buffer, followed by incubation in antibody (for 1 hour at RT or O/N at 4 °C). SuperSignal West Pico

Chemiluminescent Substrate was used to detect HRP on immunoblots. Blots were re-probed after stripping in lOOmM Glycine, 0.15 ND-40, 1% SDS, pH 2 for 1 hour at RT, then O/N at 4 °C. PageRuler Prestained Protein Ladder was used as a molecular mass marker. Antibodies utilized include anti-actin at 1: 1000; anti-GFP-HRP at 1:5000; and anti-PGK at 1: 10,000.

EXAMPLE II. WD0830 interacts directly with and bundles F-actin

[0073] To test whether Wolbachia protein directly binds to filamentous (F)-actin, it was determined whether WD0830 purified from E. coli directly bound purified actin filaments in a sedimentation assay. In this assay, proteins that bind to F-actin will co-sediment and thus pellet after ultracentrifugation. The ability of E. co/z^'-purified WD0830 and alpha-actinin, a well- characterized actin binding protein, to directly interact with polymerized rabbit skeletal muscle actin was investigated and compared. As a negative control, bovine serum albumin (BSA) was included. In the co-sedimentation assay, proteins were incubated with polymerized actin and after subjecting the proteins to 150,000 x g, both supernatants and pellets were separated by and visualized in a silver-stained SDS-PAGE gel. Proteins that directly interacted with actin were found in the pellet fraction only when actin was present. WD0830 and alpha-actinin both co- sedimented with actin (P fractions, FIG. 3A). The amount of Wolbachia protein WD0830 detected in the pellet was 24% (±10%, N = 3) of the total when actin was present compared to 3% (±2%, N = 3) without actin present (see FIG. 3A), which was consistent with direct binding. This enrichment was in the same range as observed for alpha-actinin, the positive control (28% in the pellet with actin compared to 4% in the pellet without actin). No sedimentation of BSA with actin was observed (see FIG. 3B). This result demonstrated that WD0830 directly interacts with actin.

[0074] Because GFP-WD0830 in yeast appeared to generate actin filaments similar to those generated by the Salmonella effector SipA, an actin bundling protein, the ability of WD0830 to bundle actin as assessed by a low speed sedimentation assay was compared. Strikingly, only in the presence of WD0830 did F-actin sediment at low speed (14K x g) (see FIG 3B; LSP), consistent with bundling of actin by WD0830. The state of actin filaments was visualized after incubation with WD0830, with BSA, or without additional proteins, and was compared to incubation alone using fluorescence microscopy. In the presence of WD0830, but not BSA, F-actin bundles were observed (see FIG. 3C).

Methods

Actin sedimentation and bundling assays

[0075] WD0830 was heterologously expressed in E. coli and centrifuged at high speed

(150,000 x g) for 1 hour at 4 °C before use. The supernatant was then used in actin sedimentation assays with purified rabbit skeletal actin. Actin was stored in G buffer before use (5mM Tris-HCL pH 8.0 and 0.2 mM CaC12, 0.2 mM ATP and 0.5 mM DTT). Polymerization was induced by the addition of 50 mM KC1, 2mM MgC12 and 1 mM ATP (final concentrations). The total amount of actin used in each assay was kept constant (40 μΐ of a 1 mg/mL stock added to each reaction). Either WD0830 (at 40 ng/mL final concentration), the actin binding protein alpha-actinin (used as a positive control for F-actin binding and sedimentation), BSA, or nothing additional (negative controls) was added to individual actin samples. These were first centrifuged at 14,000 x g for 1 hour at 24 °C (to identify actin bundling activity) and then centrifuged at 150,000 x g for 1.5 hr at 24 °C (to identify actin binding). Laemmli buffer was added to the supernatants and pellets resulting from this centrifugation and these samples were run on an SDS-PAGE gel to visualize the proteins using silver stain. The gel lanes were scanned and densitometry measured using ImageJ software. To image actin filaments, F-actin was prepared as above and before centrifugation, stained with Acti-stain 555 fluorescent phalloidin.

EXAMPLE III. Characterization of native and ectopic WD0830 expression during

Drosophila development.

[0076] To determine the levels of WD0830 expression during a natural infection, RNA from olbachia-irrfected Drosophila was harvested at seven different time points during fly development: embryos, lst-3rd instar, early and late pupae, and adults (male and female).

WD0830 expression was quantified and normalized to the ftsZ gene using qRT-PCR. FtsZ is a core conserved bacterial protein involved in cell division, known to be highly expressed throughout host development, making it an appropriate reference for transcription rates relative to bacterial growth. Expression of WD0830 relative to ftsZ was up-regulated during pupation, the developmental period during which ovary development begins and larval prepupal ovaries differentiate into the well characterized adult structures, a critical time point during Drosophila development (see FIG. 4). Components of secretion systems, including the invlspa genes encoding the type III machinery, have been demonstrated to be up-regulated during host pupal development in other facultative intracellular symbionts, although the genes encoding the machinery of the Wolbachia type IV components have also been observed to be constitutively expressed throughout the host life cycle. The data presented here indicate that WD0830, relative to bacterial cell division, was most highly expressed during pupal development, coincident with the development and maturation of important adult structures such as the reproductive system (p < 0.05).

[0077] WD0830 is expressed during a natural infection and during key time points (e.g., in the development of the reproductive organs). Because Wolbachia colonize the reproductive tract, and the actin cytoskeleton influences maternal transmission, it was determined whether the heterologous expression of WD0830 would affect the dynamics of a Wolbachia infection.

Drosophila is an excellent model insect system in which to study a Wolbachia infection. The primary vertical colonization of flies by the bacteria occurs during oogenesis. Development of the oocyte begins in the anterior tip of the ovary, in a region called the germarium, a structure containing the germline stem cells from which oocytes differentiate. Wolbachia was observed throughout progressive stages of oocyte development within a single egg chamber and in the reproductive tissues (see FIG. 5A).

[0078] RFP-WD0830 was overexpressed in Wolbachia infected transgenic flies using a variety of drivers (osk-GAL4, MTD-GAL4, matalpha4-GAL4). For each of these drivers, the same localization of the expressed protein was observed (see FIG. 5B; osk-GAL4, UAS-RFP-WD0830 presented as representative). RFP-WD0830 localized to the developing oocyte early and maintained this localization throughout oogenesis (see FIG. 5B). Expression of WD0830 in transgenic flies did not result in gross differences in fly fecundity; number of progeny between osk-GAL4; RFP-WD0830 flies and genetic controls did not significantly differ; t = 1.486; df = 17.076, p = 0.155). In addition, density of Wolbachia in the developing oocyte was quantified using fluorescence in situ hybridization (see FIG. 5A), and no significant differences in Wolbachia density were observed in entire stage 9-10 egg chambers between control and transgenic flies (N >= 25 for each background; p > 0.05). However, the density of Wolbachia found within the developing oocyte was statistically significantly increased in RFP-WD0830-expressing flies compared to genetic controls (N >= 25 for each background; T-test: t = 3.565; df = 32.055; p = 0.001; see FIG. 5C and FIG. 6A). This higher titer infection was also observed utilizing qPCR on whole transgenic female flies over-expressing WD0830 compared to control flies (wsp/rpl32; t = 2.65; df = 6; p = 0.038; see Figure 6B).

[0079] Because the localization of WD0830 correlated with increased Wolbachia staining in developing oocytes, it was determined whether embryos derived from transgenic females overexpressing WD0830 would harbor higher Wolbachia titers. Using qPCR (wsp/Rpl32) on 6 hour embryos, it was determined that when transgenic flies express WD0830, their embryos harbor a greater quantity of Wolbachia than seen in genetic controls (with an increase between 3.4-16.8 for comparisons between embryos from three independent, transgenic lines expressing WD0830 and Fl embryos from control crosses, see FIG. 6C). Therefore, ectopic expression of WD0830 in an infected Drosophila melanogaster germ line increased the Wolbachia titer in the presumptive oocyte and increases the copy numbers of Wolbachia detected in the next generation (as demonstrated via qPCR).

[0080] Overexpression of WD0830 in yeast corresponded to a change in the organization of the cortical F-actin cytoskeleton. Therefore, changes in the F-actin skeleton in transgenic flies were characterized. Nurse cells transfer their cytoplasmic contents through F-actin derived structures termed "ring canals," into the developing oocyte. This process is called "cytoplasmic dumping" and Wolbachia are thought to be delivered to the oocyte via this same route. Changes to the amount of F-actin associated with ring canals were investigated (based on fluorescent- phalloidin staining) when RFP-WD0830 is overexpressed. RFP-WD0830 accumulation in the cytoplasm of the developing oocyte was observed {see FIG. 5B) and in early egg chambers (stages 5-9), RFP-WD0830 expression resulted in thicker actin ring canals adjacent to the developing oocyte (see FIG. 6D). Overall, expression of RFP-WD0830 results in a 30% increase in the amount of F-actin staining in ring canals adjacent to the oocyte (N > 24 for each genotype; t = 2.8314; df = 47; p = 0.006; see FIG. 6E). Regardless of the stage examined, RFP-WD0830- expressing flies exhibited more fluorescent-phalloidin staining in actin ring canals compared to genetic controls (with a maximal 2 fold observed increase of in stage 5-6 oocytes).

[0081] WalEl is the first Wolbachia protein identified to bind to and modify actin in vitro and alter infection dynamics in vivo. walEl expression is upregulated during critical stages of host development and WalEl transgenic flies produce oocytes and embryos with larger quantities of Wolbachia.

Methods

Drosophila immunohistochemistry and microscopy

[0082] Ovaries for immunolocalization were dissected in PBS solution 4 days after fly eclosion. Published protocols for fluorescent in situ hybridization were used (Toomey M.F., et al. (2013) PNAS, 110: 10788-10793), with the following modifications: post-fixation in 4% paraformaldehyde in DEPC treated PBS; ovaries were dehydrated in methanol and stored overnight at -20 °C. In the morning, washes in DEPC-PBST preceded a 5 minute proteinase K treatment (0.05 mg/mL) at 37 °C before incubation in hybridization buffer (50% formamide, 5X SSC, 250 mg/L SS DNA, 0.5x Denhardts, 20 mM Tris-HCl and 0.1% SDS). Universal bacterial probe EUB338 conjugated to Alexa488 was used to detect Wolbachia in the ovarioles.

Rhodamine-labelled Phalloidin or Acti-stain 488 Fluorescent Phalloidin was used for F-actin detection, depending on the cross and the wavelengths utilized. Hybridized ovaries were mounted in Slow Fade "Gold" + DAPI antifade reagent.

[0083] Images were taken as Z-series stacks at 1.5 um intervals using a Nikon E800 fluorescent microscope with 40x oil objective and processed using Metamorph imaging software (Molecular Devices). Care was taken such that exposure times were normalized across all experiments. For quantification of both Wolbachia within the developing oocyte and actin ring canal staining intensity, maximum projections from stacks generated were used, excluding the peritoneal sheath. The irregular blob tool was used to outline the entire oocyte, using DAPI staining as a guide. For quantification of actin ring canal intensity, the oval tool bas used to outline ring canals adjacent to the developing oocyte.

Transgenic Drosophila stocks and staging of flies

[0084] Codon optimized WD0830 constructs were generated using the Gateway pENTR-

D/TOPO system and transformed into One Shot ToplO competent cells. Correct entry vectors were used in combination with the pPRW destination vector (Drosophila Genomics Resource Center, plasmid stock # 1137, features Gateway cassette, UASp promoter, N-terminal mRFP, and mini-white (complement)) in an LR clonase reaction and these resultant expression vectors were verified by restriction enzyme digests and sequencing. These constructs result in an N-terminal mRFP tag for WD0830. The purified plasmids were injected into Drosophila embryos. Thirteen independent lines on the X, second and third chromosomes were recovered. Standard methods were used for all crosses and culturing. Drosophila stocks were obtained from the Bloomington Drosophila Stock Center (BDSC) (flystocks.bio.indiana.edu/). Stock number 145, which carries wl, was used as the Wolbachia-mfected control line used in characterization of WD0830 expression over development. The three Wolbachia-contai ing Gal4-driver stocks from BDSC used were as follows: "Oskar Driver," w[1118] ; P Al l/CyO (BDSC#44241); "Maternal Triple Driver, (MTD)," P{w[+mC]=otu-GAL4: :VP16.R} l, w[*]; P{w[+mC]=GAL4-nos.NGT}40; P{w[+mC]=GAL4: :VP16-nos.UTR}CG6325[MVDl] (BDSC#31777); and "Maternal Alpha Tubulin 67C driver," w[*] ; P{w[+mC]=matalpha4-GAL-VP16}V37 (BDSC#7063).

[0085] Thirteen insertions stocks carrying pPRW-WD0830 on the X, 2 or 3rd chromosomes were created in a w[l 118], Wolbachia-positvvQ background and named

P{w[+mC]=UASp-RFP.WalEl } (BestGene, Inc., Chino Hills, CA, USA). Homozygous viable insertions P{w[+mC]=UASp-RFP.WalEl }2M (Ch 2) , 4M (Ch 3), 6M (Ch 3) and 7M (Ch3) were examined most extensively. Oskar-GAL4 driver and P{w[+mC]=UASp-RFP.WalEl }6M stocks were crossed for quantification of actin, Wolbachia, and localization of RFP-WD0830. Wolbachia infection status for stocks acquired from the BDSC and from BestGene, Inc. was determined via PCR.

Nucleic acid extractions and quantitative PCR

[0086] To identify Wolbachia titer within embryos from mothers expressing WalEl, individual embryos were homogenized in 10 μΐ, of water and this lysate was diluted 1 : 100 for quantitative PCR. Additionally, pools of 20-30 embryos were subjected to DNA extraction, and nucleic acids were diluted to < 20 ng total for qPCR. Quantitative PCR was performed on this DNA to detect the Wolbachia titer (with reference to the host) using a StepOne Real-time PCR system and SybrGreen chemistry, wsp primers were used for Wolbachia (Forward:

CATTGGTGTTGGTGTTGGTG (SEQ ID NO: 15); Reverse: ACCGAAATAACGAGCTCCAG (SEQ ID NO: 16)), and Rpl32 primers for the host (Forward: CCGCTTCAAGGGACAGTATC (SEQ ID NO: 17); Reverse: CAATCTCCTTGCGCTTCTTG (SEQ ID NO: 18)), with the following protocol: 95 °C for 10 min, then 40 cycles of 95 °C for 15 seconds and 60 °C for 1 minute. To characterize WalEl expression throughout fly development, RNA and DNA were extracted from individual flies (stock 145) at different stages of development using a modified Trizol extraction protocol in which 500 μΐ, of Trizol was added to flies and samples homogenized using a pestle. After a 5 minute incubation at room temperature, a 12,000 rcf centrifugation (at 4 °C for 10 min) was followed by a chloroform extraction. Aqueous phase containing RNA was extracted a second time with phenolxhloroform before isopropanol precipitation of RNA. This RNA pellet was washed and resuspended in The RNA Storage Solution. DNA extraction from the same flies was performed using ethanol precipitation of the organic phase during the first chloroform extraction. To detect the number of WalEl transcripts, the RNA extracted from these flies was used. The SensiFAST SYBER Hi-ROX One-step RT mix and the StepOne Real-time PCR system was used on this RNA with the following primer set: WalElF:

TGGGAAGAAAAGGCTCTGAA (SEQ ID NO: 19), WalElR: TCAATGAGGCGCTTCTAGGT (SEQ ID NO: 20). As a reference for transcription activity of the core Wolbachia genome, the Wolbachia FtsZ gene was used (Forward: TTTTGTTGTCGCAAATACCG (SEQ ID NO: 21); Reverse:CCATTCCTGCTGTGATGAAA (SEQ ID NO: 22)). The wsp qPCR primer sets were not employed, as wsp's function is unclear and it is not known if wsp is stably expressed during development or in different tissues. Primers were designed to FtsZ because as a core protein involved in cell division, the quantities of FtsZ would better correlate with bacterial numbers and activity. Reactions were performed in duplicate or triplicate in a 96-well plate and calibration standards used to calculate primer efficiencies. These efficiencies, along with the CT values generated by the machine, were used to calculate the relative amounts of Wolbachia using the ΔΔ Ct (Livak) and Pfaffl methods.

[0087] The Examples discussed above are provided for purposes of illustration and are not intended to be limiting. Still other embodiments and modifications are also contemplated.

[0088] While a number of exemplary aspects and embodiments have been discussed above, those of skill in the art will recognize certain possible modifications, permutations, additions and sub combinations thereof. It is therefore intended that the following appended claims and claims hereafter introduced are to be interpreted to include all such modifications, permutations, additions and sub-combinations as are within their true spirit and scope.

Claims

CLAIMS What is claimed is:

1. An expression vector comprising a polynucleotide that encodes WalEl (WD0830) or a

functional fragment of WalEl (WD0830), wherein the polynucleotide is operably linked to an expression control sequence and the expression vector is expressible in an insect.

2. The expression vector of claim 1, wherein the insect is Aedes albopictus, Aedes aegypti, Anopheles gamibiae, Anopheles stephansi, Culex pipiens, Culex tarsalis, Culex

quinquefasciatus, an insect of the Culicidae family, or an insect of the Drosophilidae family.

3. The expression vector of claim 1, wherein the functional fragment of WalEl (WD0830)

comprises a synuclein domain.

4. The expression vector of claim 3, wherein the synuclein domain is an alpha-synuclein domain.

5. The expression vector of any one of claims 1, wherein the polynucleotide is codon optimized.

6. The expression vector of claim 1, wherein WalEl (WD0830) or the functional fragment of WalEl (WD0830) comprises a polypeptide having an amino acid sequence at least 90% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 3-10 and 12-14.

7. The expression vector of claim 1, wherein WalEl (WD0830) has an amino acid sequence at least 90% identical to the amino acid sequence of SEQ ID NO: 2.

8. The expression vector of claim 1, wherein the vector is a viral vector.

9. An insect transformed with the expression vector of any one of claims 1-8, or progeny of an insect transformed with the expression vector of claim 1-8.

10. The insect of claim 9, wherein the insect or progeny of the insect overexpresses WalEl

(WD0830) or a functional fragment of WalEl (WD0830) relative to an insect that was not transformed with the expression vector.

11. A method for increasing Wolbachia replication and transmission in an insect population, the method comprising overexpressing WalEl (WD0830) or a functional fragment of WalEl (WD0830) in at least one insect capable of breeding with the insect population, and introducing the at least one insect overexpressing WalEl (WD0830) or a functional fragment of WalEl (WD0830), or progeny thereof, into the insect population, wherein overexpression is relative to a control insect.

12. The method of claim 11, wherein overexpression is achieved by expressing an expression vector in the at least one insect, the expression vector comprises a polynucleotide that encodes WalEl (WD0830) or a functional fragment of WalEl (WD0830) and the polynucleotide is operably linked to an expression control sequence

13. The method of claim 12, further comprising crossing the at least one insect with at least one other insect to produce progeny overexpressing WalEl (WD0830) or a functional fragment of WalEl (WD0830) prior to introducing the at least one insect overexpressing WalEl

(WD0830) or a functional fragment of WalEl (WD0830) into the insect population.

14. The method of claim 12, wherein the functional fragment of WalEl (WD0830) comprises a synuclein domain.

15. The method of claim 12, wherein the synuclein domain is an alpha-synuclein domain.

16. The method of claim 12, wherein the polynucleotide is codon optimized.

17. The method of claim 14, wherein WalEl (WD0830) or the function fragment of WalEl

(WD0830) comprises a polypeptide having an amino acid sequence at least 90% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 3-10 and 12-14.

18. The method of claim 12, wherein WalEl (WD0830) has an amino acid sequence at least 90% identical to the amino acid sequence of SEQ ID NO: 2.

19. The method of claim 11, wherein the overexpression is induced in one or more insects

harboring Wolbachia prior to the overexpression.

20. The method of claim 11, further comprising infecting the at least one insect with Wolbachia before, concurrently with, or after inducing the overexpression.

21. The method of claim 12, wherein the pathogen is selected from the group consisting of a virus, a protozoan, and a worm.

22. The method of claim 21, wherein the virus is selected from the group consisting of

Chikungunya virus, dengue virus, West-Nile virus, Yellow Fever virus.

23. The method of claim 21, wherein the protozoan is a malaria parasite of the genus Plasmodium.

24. The method of claim 21, wherein the worm is a filarial nematode.

25. The method of claim 11, wherein the insect is Aedes albopictus, Aedes aegypti, Anopheles gamibiae, Anopheles stephansi, Culex pipiens, Culex tarsalis, Culex quinquefasciatus, an insect of the Culicidae family, or an insect of the Drosophilidae family.

26. A method for controlling an insect population, and/or conferring or increasing viral resistance in the insect population, the method comprising expressing the expression vector of any one of claims 1-8 in at least one insect of the insect population.

27. A CRISPR-on system comprising dCas9 fused with a transcriptional activation domain, and a single guide RNA (sgRNA) having a complementary nucleic acid sequence to a WalEl (WD0830) expression control element.