WO2017180063A1 - A potential combination therapy using an inhibitor of glucose transport and an intracellular calcium inducer to target cancer metabolism - Google Patents

A potential combination therapy using an inhibitor of glucose transport and an intracellular calcium inducer to target cancer metabolism Download PDF

Info

Publication number
WO2017180063A1
WO2017180063A1 PCT/SG2017/050208 SG2017050208W WO2017180063A1 WO 2017180063 A1 WO2017180063 A1 WO 2017180063A1 SG 2017050208 W SG2017050208 W SG 2017050208W WO 2017180063 A1 WO2017180063 A1 WO 2017180063A1
Authority
WO
WIPO (PCT)
Prior art keywords
glucose
inhibitor
glut1
cells
sarco
Prior art date
Application number
PCT/SG2017/050208
Other languages
French (fr)
Inventor
Koji ITAHANA
David Marc VIRSHUP
Ha Yin LEE
Yoko ITAHANA
Original Assignee
National University Of Singapore
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by National University Of Singapore filed Critical National University Of Singapore
Publication of WO2017180063A1 publication Critical patent/WO2017180063A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/69—Boron compounds
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/21—Esters, e.g. nitroglycerine, selenocyanates
    • A61K31/215—Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids
    • A61K31/235—Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids having an aromatic ring attached to a carboxyl group
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/365—Lactones
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/425—Thiazoles
    • A61K31/427—Thiazoles not condensed and containing further heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/4406—Non condensed pyridines; Hydrogenated derivatives thereof only substituted in position 3, e.g. zimeldine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/502—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/502—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
    • G01N33/5023—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects on expression patterns

Definitions

  • the present invention relates to methods and compositions for modulating the survival of glucose deprivation-sensitive cancer cells. More particularly, the invention provides a method for modulating a calcium signalling pathway in glucose-deprivation sensitive cancer cells to induce cell death upon glucose withdrawal, by inhibiting glucose import and raising cytoplasmic calcium.
  • cancer treatment There are many types of cancer treatment, and the particular treatment administered will depend on the type of cancer a patient has and how advanced it is.
  • the main types of cancer treatment include: radiation therapy, chemotherapy, hormone therapy, surgery, immunotherapy, targeted therapy, stem cell transplantation and precision medicine. These therapies may be administered singly or in combinations.
  • An increase in glucose uptake and dependence is one of the hallmarks of cancer, and is thought, in part, to support aerobic glycolysis. Rapidly dividing cancer cells employ aerobic glycolysis for the production of metabolic intermediates, amino acids, nucleic acids and energy in the form of ATP.
  • Examples include human colon adenocarcinoma (for example, SW480 cell line); osteosarcoma (for example, U20S and SaOS2 cell lines); brain glioma (for example, U251 MG cell line); glioblastoma (for example, U87MG cell line); pancreatic ductal cancer (for example, PANC-1 cell line); hepatocellular cancer (for example, HepG2 cell line) and ovarian teratocarcinoma (for example, PA-1 cell line).
  • PANC-1 cell line pancreatic ductal cancer
  • hepatocellular cancer for example, HepG2 cell line
  • ovarian teratocarcinoma for example, PA-1 cell line.
  • One avenue to deprive cells of glucose is to block glucose transporters, which are expressed in both cancer and normal cells.
  • the invention provides a method for modulating a calcium signalling pathway in glucose-deprivation sensitive cancer cells to induce cell death upon glucose withdrawal. More particularly, inhibiting glucose import and raising cytoplasmic calcium induces RIPK-1 -dependent cancer cell death while sparing normal cells.
  • the present invention provides an in vitro or in vivo method for modulating survival of glucose deprivation-sensitive cancer cells comprising the steps of:
  • the present invention provides a composition and/or kit comprising at least one modulator that reduces intracellular glucose concentration and at least one modulator of cytosolic calcium concentration for use in inducing cell death in at least one glucose deprivation-sensitive cancer cell.
  • the composition and/or kit comprises at least one glucose transporter inhibitor and at least one sarco/endoplasmic reticulum Ca 2+ - ATPase inhibitor.
  • the present invention provides a use of at least one modulator that reduces intracellular glucose concentration and at least one modulator of intracellular calcium concentration for the preparation of a medicament for inducing RIPK1 -dependent cell death in at least one glucose deprivation-sensitive cancer cell.
  • the medicament comprises at least one modulator that induces intracellular glucose deprivation of the at least one glucose deprivation- sensitive cancer cell and at least one modulator that inhibits calcium uptake by the sarco/endoplasmic reticulum of the at least one glucose deprivation-sensitive cancer cell.
  • the present invention provides a method of treating a glucose deprivation-sensitive cancer, the method comprising administering to a subject in need of such treatment a composition or medicament according to any aspect of the herein described invention.
  • FIGURES Figures 1A-E show flow cytometry analysis (A, B and C) and photomicrographs (D, E).
  • A Shows that a subset of cancer cell lines is sensitive to glucose deprivation-induced cell death; namely, SW480, U20S, U251MG, SaOS2 and U87MG.
  • the indicated cancer cell lines and normal fibroblasts were cultured in media with or without 10% serum and glucose for 4 hr (for U20S cells) or overnight (remaining cell lines). Cells were collected and stained with PI and analysed by flow cytometry to show the percentage of Pl-positive dead cells. A representative analysis from three independent experiments is shown.
  • SW480 human colon adenocarcinoma cell line
  • U20S human osteosarcoma cell line
  • U251 MG human brain glioma cell line
  • SaOS2 human osteosarcoma cell line
  • U87MG human glioblastoma cell line
  • A549 human lung carcinoma cell line
  • H1299 human non-small cell lung carcinoma cell line
  • IMR-90 human normal lung fibroblasts
  • WI-38 human normal lung fibroblasts.
  • (C) Shows that re-addition of glucose alone is sufficient to rescue glucose deprivation- induced cell death.
  • U20S cells were cultured in media with 0.1 mM, 0.4 mM or 25 mM glucose in the absence of serum, or with 25 mM glucose and 10% serum for 4 hr, and analysed as in (A).
  • (D) Phase contrast microscopy shows the morphology of the cells upon glucose and serum deprivation when treated as in (A). Scale bars, 50 pm.
  • (E) Shows cancer cells that are sensitive to glucose deprivation-induced cell death. Phase contrast images of cells treated overnight as indicated. Scale bars, 50 pm.
  • FIGS. 2A-E show that glucose deprivation-induced cell death is independent of ATP depletion and glycolysis.
  • A is a histogram showing that 2-DG induces ATP depletion in glucose-depleted U20S cells. Cells treated as indicated for 4 hr were collected, and the levels of intracellular ATP were measured. The mean of triplicate 30 samples ⁇ SD is shown. *** p ⁇ 0.001 , * p ⁇ 0.05, n.s.; not significant, unpaired two-tailed student's t-test.
  • (B) shows flow cytometry analysis indicating that 2-DG rescues cell death after glucose depletion.
  • U20S cells were treated with or without 2- DG for 4 hr as indicated, followed by staining with PI and analysed by flow cytometry. A representative analysis from three independent experiments is shown. Percentage of Pl-positive dead cells is shown in the panel.
  • C Phase contrast images of cells in (B) are shown. Scale bars, 50 pm.
  • D Low amounts of 2-DG are sufficient to rescue glucose deprivation- induced cell death. U20S cells were treated as indicated for 4 hr, stained with PI and analysed by flow cytometry. Shown is the representative analysis of three independent experiments. The percentage of Pl-positive dead cells is shown in the panel.
  • E is a histogram showing that glucose deprivation does not increase reactive oxygen species (ROS).
  • ROS reactive oxygen species
  • U20S cells were treated as indicated for 4 hr followed by staining with H2DCFDA dye for 1 hr and analysed by flow cytometry.
  • ROS levels were indicated by the relative levels of the mean CM-H2DCFDA fluorescence in each sample compared with sample containing glucose. The mean of triplicate samples ⁇ SD is shown. ** p ⁇ 0.01 , n.s.; not significant, unpaired two-tailed student's t-test.
  • H202; Hydrogen Peroxide. H202 was used as a positive control for increasing ROS, and ascorbic acid was used as an antioxidant.
  • Figures 3A-D show that glucose deprivation-induced cell death is RIPK1- dependent.
  • A Glucose withdrawal does not cause the appearance of markers of apoptosis. U20S cells treated as indicated for 4 hr were collected, and PARP1 cleavage and CASP3 cleavage were analysed by Western blotting with the indicated antibodies. Cells irradiated by UV (60 J/m2) served as a positive control for PARP1 cleavage and CASP3 cleavage. 2-DG was added at 1 mM.
  • B RIPK1 phosphorylation by glucose deprivation is rescued by 2-DG.
  • U20S cells were treated as indicated for 4 hr, collected, and analysed by Western blotting with the indicated antibodies.
  • C Glucose deprivation induced RIPK1 phosphorylation.
  • U20S cells were cultured in media containing 10% double-dialyzed serum treated as indicated for 4 hr, and the cell lysates were analysed by a Western blotting with indicated antibodies using 8% acrylamide SDS-PAGE gel. Samples were prepared in biological duplicates.
  • D RIPK1 knockdown efficiency. U20S cells were transfected with control (sictrl) or two independent RIPK1 siRNA and treated as indicated for 4 hr. Protein lysates were analysed by Western blotting with the indicated antibodies.
  • Figures 4A-H show that glucose deprivation induces PP2Ac demethylation.
  • A Glucose deprivation induces the phosphorylation of multiple kinases. Cell extracts from U20S cells cultured in the presence and absence of serum and glucose for 4 hr were analyzed by Western blotting with the indicated antibodies.
  • B Glucose deprivation induces PP2Ac demethylation. U20S cells were treated as indicated for 4 hr, lysed, and analysed by Western blotting with the indicated antibodies. Cell extracts were treated separately with NaOH to obtain fully demethylated PP2Ac.
  • U20S cells were cultured in the media containing 10% double-dialyzed serum with or without 1 mM glucose for 4 hr and analysed by Western blotting.
  • F Pyruvate cannot prevent glucose deprivation-induced PP2Ac demethylation.
  • U20S cells were treated as indicated for 4 hr, lysed and analysed by Western blotting.
  • G Low amounts of glucose are sufficient to inhibit PP2Ac demethylation.
  • U20S cells were treated as indicated for 4 hr, and analysed by Western blotting with the indicated antibodies.
  • H Low amounts of 2-DG are sufficient to inhibit PP2Ac demethylation.
  • U20S cells were treated for 4 hr and analysed according to (G).
  • FIGS 5A-F show that PP2Ac demethylation is required for glucose deprivation-induced cell death.
  • A PP2Ac demethylation occurs before RIPK1 phosphorylation.
  • Cell extracts from a time course of U20S cells cultured in the absence of glucose were analysed by Western blotting with the indicated antibodies.
  • Ctrl U20S cells were cultured in the presence (ctrl) or absence (-serum; - glucose) of glucose and serum. Times indicated are in minutes.
  • B PP2Ac demethylation induced by glucose-deprivation does not require protein synthesis.
  • U20S cells were treated as indicated, with or without 100 ⁇ cycloheximide, lysed and analysed by Western blotting.
  • U20S cells were transfected with control or two independent PPME1 siRNA and treated as indicated, lysed and analysed by Western blotting.
  • D Phase contrast images of the cells in (C) are shown. Scale bars, 50 ⁇ .
  • E Depletion of PPME1 prevents glucose deprivation induced cell death.
  • U20S cells treated as in (C) were stained with PI and analysed by flow cytometry to determine the percentage of PI- positive dead cells. Shown is the representative analysis of three independent experiments.
  • Figures 6A-I show inhibition of calcium signalling rescues glucose deprivation- induced cell death and PP2Ac demethylation.
  • A Depletion of CAMK1 prevents glucose deprivation-induced PP2Ac demethylation.
  • U20S cells were transfected with control or two independent CAMK1 siRNA and treated as indicated for 4 hr. Lysates was analysed by Western blotting with the indicated antibodies.
  • B Depletion of CAMK1 rescues glucose deprivation-induced cell death.
  • U20S cells transfected with siRNA and treated as indicated were stained with PI and analysed by flow cytometry to determine the percentage of Pl-positive dead cells. Shown is the representative analysis of three independent experiments.
  • U20S cells were withdrawn glucose in the presence or absence of 1 mM of 2-DG for 4 hr followed by staining with 5 ⁇ fluo-4AM for 15 min. Fluorescent images of cells are shown. Scale bars, 50 pm.
  • Nifedipine inhibits glucose deprivation-induced PP2Ac demethylation.
  • U20S cells were treated as indicated with increasing concentrations of nifedipine. Lysates were analysed by Western blotting with the indicated antibodies.
  • Nifedipine inhibits glucose deprivation-induced cell death.
  • U20S cells were treated as indicated in (D), stained with PI and analysed by flow cytometry to determine the percentage of Pl-positive dead cells. Shown is the representative analysis of three independent experiments.
  • G Glucose deprivation increases calcium concentration in the cytoplasm significantly. U20S cells were treated as indicated for 4 hr followed by staining with 5 ⁇ of Fluo-4AM for 15 min.
  • Intracellular calcium levels were quantified and indicated by the relative levels of the mean Fluo- 4AM fluorescence in each sample compared with samples in the first bar graph. The mean of triple biological sample ⁇ SD is shown. *** p ⁇ 0.001 , unpaired two-tailed student's t-test.
  • H Inhibition of ROS does not prevent calcium influx to the cytoplasm.
  • U20S cells were treated as indicated for 4 hr with or without 1 mM of N-acetyl-cysteine (NAC) followed by staining with 5 ⁇ of fluo- 4AM for 15 min. Fluorescent images of cells are shown. Scale bars, 50 ⁇ . Bar chart that quantifies the calcium fluorescence intensity is also shown.
  • PCR products were visualized by DNA agarose gel electrophoresis. TBP is shown as the positive control for the amplification. PCR was also performed without a template cDNA as the negative control. The expected size of PCR products is 103bp (CACNA1C), 81 bp (CACNA1 D), 100 bp (CACNA1 F), 105 bp (CACNA1S) and 103 bp (TBP) respectively.
  • B Depletion of CACNA1 D but not CACNA1 C prevents PP2Ac demethylation induced by glucose deprivation.
  • U20S cells were transfected with control or two independent CACNA1 C or CACNA1 D siRNAs, and treated as indicated for 4 hrs in the presence of 10% dialysed serum. Lysates were analysed by Western blot with the indicated antibodies. Glucose; 1 mM glucose.
  • C Depletion of CACNA1 D but not CACNA1 C prevents calcium influx and rescues cell death induced by glucose deprivation.
  • U20S cells were transfected with siRNAs and treated as indicated for 4 hrs in presence of 10% dialysed serum. The cells were then stained with fluo-4AM. Phase contrast and fluorescent images of cells are shown. Scale bars, 50 pm. Glu; 1 mM glucose.
  • Glucose deprivation induces plasma membrane depolarization.
  • U20S cells were placed in the media as indicated in the presence of 10% dialysed serum. Dibac4 was also included in the media for staining. 120 mM KCI was used to stimulate plasma membrane depolarization as the positive control. Fluorescent images of cells are shown. Scale bar, 50 pm. Glu; 1 mM Glucose. 2-DG; 1 mM 2-DG. Ni; nifedipine.
  • E-G Plasma membrane depolarization induced by glucose deprivation is observed only in glucose-deprivation sensitive U20S cells (E), but not in insensitive H1299 cells (F), and it is an upstream event of calcium influx (G).
  • U20S or H1299 cells were placed in the media as indicated in the presence of 10% dialysed serum.
  • Dibac4 was also included in the media for staining. Fluorescence intensity of stained cells was measured by a plate reader and are shown as the relative levels of the mean Dibac4 fluorescence in each sample compared with the sample in the first bar (mean ⁇ SD). Assays were performed three to six times. *** p ⁇ 0.001 , n.s.; not significant, unpaired two-tailed student's West. Glu; 1 mM Glucose. 2-DG; 1 mM 2-DG.
  • Figures 8A-H show the therapeutic potential of utilizing Ca-PP2A pathway to kill cancer cells sensitive to glucose deprivation.
  • A The residual glucose level in cancer cells that are sensitive to glucose deprivation-induced cell death is lower than in those that are resistant.
  • Various cell lines were treated for 4 hr as indicated and lysates were used to measure the levels of intracellular glucose.
  • B A combination of STF-31 and thapsigargin (TG) induces PP2Ac demethylation.
  • U20S and WI-38 cells were cultured in 1 mM of glucose containing media and treated with inhibitors as indicated for 1 day. Lysates were analysed by Western blot and the indicated antibodies.
  • Fold change was quantified by measuring the band intensity for demethylated PP2Ac and normalized against total PP2Ac band intensity.
  • STF-31 12.5 ⁇ , TG: 10 nM.
  • C STF-31 increases the calcium concentration in the cytoplasm in U20S cells. Fluorescent images of U20S and WI-38 cells treated with 12.5 ⁇ of STF-31 for 1 day in the presence of 1 mM of glucose followed by staining with Fluo-4AM for 15 min. Scale bars, 50 pm.
  • D A combination of STF-31 and thapsigargin (TG) enhances cell death.
  • U20S and WI-38 cells were treated with the indicated inhibitors in the presence of 1 mM of glucose as in (B), stained with PI and analysed by flow cytometry to determine the percentage of Pl-positive dead cells. Shown is the representative analysis of three independent experiments.
  • STF-31 12.5 ⁇ , TG: 10 nM.
  • E A combination of STF-31 and 2-APB or WZB-117 and 2-APB enhance cell death.
  • U20S and WI-38 cells were treated with the indicated inhibitors in the presence of 1 mM of glucose as in (B), stained with PI and analysed by flow cytometry to determine the percentage of Pl- positive dead cells. Shown is the representative analysis of three independent experiments.
  • Glucose deprivation induces the opening of a calcium channel at the plasma membrane. This leads to the influx of calcium that activates CAMK1.
  • CAMK1 regulates PPME1 which induced the demethylation of PP2Ac.
  • PP2Ac demethylation causes the phosphorylation of RIPK1 direct or indirectly, leading to cell death.
  • H GLUT1 inhibitor increases cytoplasmic calcium in U20S.
  • STF-31 increases the calcium concentration in the cytoplasm in U20S.
  • U20S and WI-38 cells were cultured in 1 mM glucose containing media with or without 12.5 ⁇ STF-31 for 1 day followed by staining with 5 ⁇ of fluo-4AM for 15 min.
  • Intracellular calcium levels were quantified and indicated by the relative levels of the mean Fluo-4AM fluorescence in each sample compared with samples in the first bar graph. The mean of triple biological samples ⁇ SD is shown. ** p ⁇ 0.01 , n.s.; not significant, unpaired two-tailed student's t-test.
  • the term “comprising” or “including” is to be interpreted as specifying the presence of the stated features, integers, steps or components as referred to, but does not preclude the presence or addition of one or more features, integers, steps or components, or groups thereof.
  • the term “comprising” or “including” also includes “consisting of”.
  • the variations of the word “comprising”, such as “comprise” and “comprises”, and “including”, such as “include” and “includes”, have correspondingly varied meanings.
  • modulator is used herein to refer to any substance that effects change in the activity of a target receptor and/or a metabolic or signalling pathway.
  • thapsigargin can modulate cytosolic calcium concentration by inhibiting sarco/endoplasmic reticulum Ca 2+ -ATPase activity.
  • subject is herein defined as vertebrate, particularly mammal, more particularly human.
  • the subject may particularly be at least one animal model, e.g., a mouse, rat and the like.
  • the subject may be a human with a cancer comprising glucose deprivation-sensitive cancer cells.
  • treatment refers to prophylactic, ameliorating, therapeutic or curative treatment.
  • CACNA1 C voltage-dependent L-type calcium channel subunit alpha - 1C
  • CACNA1 D voltage-dependent L-type calcium channel subunit alpha - 1 D
  • CACNA1 F voltage-dependent L-type calcium channel subunit alpha - 1 F
  • CACNA1S voltage-dependent L-type calcium channel subunit alpha - 1S CAMK1 ; calcium/calmodulin-dependent protein kinase
  • PARP1 poly ADP-ribose polymerase 1
  • TBP TATA-box binding protein
  • the present invention provides an in vitro or in vivo method for modulating survival of glucose deprivation-sensitive cancer cells comprising the steps of:
  • Glucose deprivation may be achieved by different means depending on the context. For example, if the glucose deprivation-sensitive cancer cells are grown in vitro they may be deprived of intracellular glucose by culturing them in glucose-free media whereby the intracellular glucose will become depleted over time. Alternatively, or in addition, the cells may be grown in media in the presence of a glucose transporter inhibitor. If a subject is to be treated for the presence of a cancer which comprises glucose deprivation-sensitive cancer cells, they may be administered a pharmaceutical composition comprising a substance which inhibits uptake of glucose by the cells, thereby depriving them of glucose. The present inventors have found that glucose deprivation induces a calcium influx into the glucose deprivation-sensitive cancer cells.
  • the modulator of intracellular calcium may be one which increases, inhibits an increase or decreases cytosolic calcium, depending on whether the intention is to prevent or promote glucose deprivation- induced cell death.
  • the modulator increases cytosolic calcium above the level of a cell that has not been administered the modulator.
  • said at least one modulator in step ii) modulates at least one sarco/endoplasmic reticulum Ca 2+ -ATPase.
  • the at least one modulator may reduce cytosolic calcium by activating at least one sarco/endoplasmic reticulum Ca 2+ -ATPase, thereby inhibiting cell death.
  • the at least one modulator is an inhibitor of said sarco/endoplasmic reticulum Ca 2+ -ATPase, thereby increasing the concentration of cytosolic calcium.
  • An alternative or addition to the inhibition of calcium uptake by the sarco/endoplasmic reticulum may comprise the contacting of said cells with a modulator that promotes release of calcium into the cytosol from intracellular stores such as from the Golgi and/or mitochondria.
  • an in vitro or in vivo method for modulating survival of glucose deprivation-sensitive cancer cells comprising the steps of: (i) depriving at least one glucose deprivation-sensitive cancer cell of intracellular glucose; and
  • step i) and/or step ii) activates calcium/calmodulin- dependent protein kinase (CAMK1), and/or increases the level of protein phosphatase 2Ac (PP2Ac) demethylation and/or increases the level of receptor-interacting serine/threonine-protein kinase 1 (RIPK1 ) phosphorylation. More particularly, it appears that the method of the invention leads to CAMK1 activation, PP2Ac demethylation, and RIPK1 phosphorylation within the glucose deprivation-sensitive cell.
  • CAMK1 calcium/calmodulin- dependent protein kinase
  • PP2Ac protein phosphatase 2Ac
  • RIPK1 receptor-interacting serine/threonine-protein kinase 1
  • the combination of glucose deprivation and the at least one modulator raises the level of cytosolic calcium to a threshold that activates cell death. Without being bound by theory, it appears that the combination activates RIPK1 -dependent cell death of the glucose deprivation-sensitive cancer cells, while sparing normal cells. A key difference between the glucose deprivation-sensitive cancer cells and normal cells is the inability of said cancer cells to sustain intracellular glucose levels.
  • glucose deprivation is achieved by inhibiting at least one glucose transporter, or by culturing said cells in glucose-free media, that leads to the modulation of at least one calcium channel at the plasma membrane. More preferably, the glucose deprivation modulates at least one L- type calcium channel. Even more preferably, glucose deprivation opens at least one CACNA1 D (also known as Cav1.3) L-type calcium channel, which appears to be in response to membrane depolarization. Opening of the calcium channel results in Ca 2+ influx into the cell.
  • CACNA1 D also known as Cav1.3
  • the at least one glucose transporter is selected from one or more of the group comprising GLUT1 , GLUT2, GLUT3 and GLUT4, preferably from GLUT1 and GLUT4. More preferably, the at least one glucose transporter is GLUT1 which is frequently overexpressed in cancer. It would be understood by the skilled person that any GLUT1 inhibitors known in the art may be suitable for the invention.
  • the GLUT1 inhibitor is selected from the group comprising STF-31 (4-[[[[4-(1 ,1- Dimethylethyl)phenyl]sulfonyl]amino]methyl]-A/-3-pyridinylbenzamide); WZB-117 (3- Fluoro-1 ,2-phenylene bis(3-hydroxybenzoate)); Fasentin (N-[4-chloro-3- (trifluoromethyl)phenyl]-3-oxobutanamide); Apigenin (5,7-Dihydroxy-2-(4- hydroxyphenyl)-4H-chromen-4-one); Genistein (4',5,7-Trihydroxyisoflavone); oxime- based GLUT1 inhibitors and pyrrolidinone derived GLUT1 inhibitors.
  • the GLUT4 inhibitor is selected from the group comprising amprenavir (Agenerase), atazanavir (Reyataz), darunavir (Prezista), fosamprenavir (Telzir, Lexiva), indinavir (Crixivan), lopinavir/ritonavir (Kaletra, Aluvia), nelfinavir (Viracept), ritonavir (Norvir), saquinavir (Invirase)* , tipranavir (Aptivus) and Curcumin.
  • the listed inhibitors could inhibit GLUT1 and GLUT4.
  • the GLUT4 inhibitor is Ritonavir ((1 E,2S)-N-[(2S,4S,5S)-4-Hydroxy-
  • Any sarco/endoplasmic reticulum Ca 2+ -ATPase inhibitors known in the art may be suitable for the invention.
  • the sarco/endoplasmic reticulum Ca 2+ -ATPase inhibitor is selected from the group comprising thapsigargin ((SS.Sa ⁇ S ⁇ S.ea ⁇ /S.SS ⁇ bSJ-e-CAcetyloxy ⁇ .S.Sa ⁇ .S.e.ea.y.e.Qb-decahydro-S.Sa- dihydroxy-3,6,9-trimethyl-8-[[(2Z)-2-methyl-1 -oxo-2-butenyl]oxy]-2-oxo-4-(1- oxobutoxy)azuleno[4,5-£>]furan-7-yl octanoate); cyclopiazonic acid and 2- aminoethoxydiphenyl borate (2-APB).
  • thapsigargin (SS.Sa ⁇ S ⁇ S.ea ⁇ /S.SS ⁇ bSJ-e-CAcetyloxy ⁇ .S.Sa ⁇ .S.e.ea.y
  • the GLUT1 inhibitor is STF-31 and the sarco/endoplasmic reticulum Ca 2+ - ATPase inhibitor is thapsigargin; ii) the GLUT1 inhibitor is WZB-117 and the sarco/endoplasmic reticulum Ca 2+ -
  • ATPase inhibitor is thapsigargin; or iii) the GLUT1 inhibitor is WZB-117 and the sarco/endoplasmic reticulum Ca 2+ - ATPase inhibitor is 2-APB; and iv) the GLUT4 inhibitor is Ritonavir and the sarco/endoplasmic reticulum Ca 2+ - ATPase inhibitor is thapsigargin. It would be understood that an analogue or prodrug form of a glucose transporter inhibitor and/or sarco/endoplasmic reticulum Ca 2+ -ATPase inhibitor could be used according to any aspect of the invention.
  • the inventors' data suggests that the induced demethylation of PP2Ac causes phosphorylation of RIPK1 to promote RIPK1 -dependent cell death.
  • the present invention provides a composition and/or kit comprising at least one modulator that reduces intracellular glucose concentration and at least one modulator of cytosolic calcium concentration for use in inducing RIPK1 -dependent cell death in at least one glucose deprivation-sensitive cancer cell.
  • the at least one modulator that reduces intracellular glucose concentration and the at least one modulator of cytosolic calcium concentration may be formulated in separate compositions that are administered in combination, simultaneously or sequentially, to treat glucose deprivation-sensitive cancer cells in a subject. Moreover, chemotherapy often requires the administration of a combination of agents in series and in cycles.
  • the compositions of the invention may be suitable for administration with other known chemotherapeutic and/or pharmacotherapeutic agents.
  • reference to a "composition" may include reference to at least one composition.
  • composition and/or kit activates calcium/calmodulin-dependent protein kinase (CAMK1 ) and/or increases the level of PP2Ac demethylation and/or increases the level of RIPK1 phosphorylation in at least one treated glucose deprivation-sensitive cancer cell.
  • CAMK1 calcium/calmodulin-dependent protein kinase
  • the composition and/or kit comprises at least one modulator that induces intracellular glucose deprivation of the at least one glucose deprivation-sensitive cancer cell and at least one modulator that inhibits calcium uptake by the sarco/endoplasmic reticulum of the at least one glucose deprivation-sensitive cancer cell.
  • An alternative or addition to the modulator that inhibits calcium uptake by the sarco/endoplasmic reticulum may comprise a modulator that promotes release of calcium into the cytosol from intracellular stores such as from the Golgi and/or mitochondria, or any other source.
  • the composition and/or kit comprises at least one modulator that reduces intracellular glucose concentration which leads to the modulation of at least one L-type calcium channel at the plasma membrane, and at least one modulator of intracellular calcium concentration, wherein said modulator modulates at least one sarco/endoplasmic reticulum Ca 2+ -ATPase and/or promotes release of calcium into the cytosol from intracellular stores, for use in inducing cell death in at least one glucose deprivation-sensitive cancer cell.
  • the composition and/or kit comprises at least one glucose transporter inhibitor and at least one sarco/endoplasmic reticulum Ca 2+ -ATPase inhibitor.
  • the at least one glucose transporter is selected from one or more of the group comprising GLUT1 , GLUT2, GLUT3 and GLUT4.
  • the at least one glucose transporter is GLUT1.
  • the GLUT1 inhibitor is selected from the group comprising STF-31 , WZB-117, Fasentin, Apigenin, Genistein, oxime-based GLUT1 inhibitors and pyrrolidinone derived GLUT1 inhibitors.
  • the GLUT4 inhibitor is selected from the group comprising amprenavir (Agenerase), atazanavir (Reyataz), darunavir (Prezista), fosamprenavir ( Telzir, Lexiva), indinavir (Crixivan), lopinavir/ritonavir (Kaletra, Aluvia), nelfinavir (Viracept), ritonavir (Norvir), saquinavir (Invirase), tipranavir (Aptivus) and Curcumin.
  • the GLUT4 inhibitor is Ritonavir (Rito).
  • the composition and/or kit comprises at least one sarco/endoplasmic reticulum Ca 2+ -ATPase inhibitor selected from the group comprising thapsigargin, cyclopiazonic acid and 2-aminoethoxydiphenyl borate (2-APB).
  • sarco/endoplasmic reticulum Ca 2+ -ATPase inhibitor selected from the group comprising thapsigargin, cyclopiazonic acid and 2-aminoethoxydiphenyl borate (2-APB).
  • composition and/or kit comprises STF-31 and thapsigargin; Ritonavir and thapsigargin; WZB-117 and thapsigargin; or WZB-117 and 2-APB. More preferably, the composition and/or kit comprises STF-31 and thapsigargin.
  • the composition and/or kit comprises at least one modulator that reduces intracellular glucose concentration and at least one modulator of intracellular calcium concentration that combine synergistically to induce RIPK1- dependent cell death.
  • the intracellular glucose modulator and the intracellular calcium modulator may be in separate compositions or in the same composition, administered at the same time, or at different times such as one on day 1 and the other on day 2 and then alternating etc, provided that the therapy is the combination of the two modulators.
  • the kit as described herein does not necessarily contain only a single pill/tablet/capsule/composition comprising a single modulator. It could contain each compound (intracellular glucose modulator and the intracellular calcium modulator) differently formulated, but with included instructions indicating the regime by which each should be administered to a patient.
  • the composition is a therapeutic composition.
  • the present invention provides a use of at least one modulator that reduces intracellular glucose concentration and at least one modulator of intracellular calcium concentration for the preparation of a medicament for inducing RIPK1 -dependent cell death in at least one glucose deprivation-sensitive cancer cell.
  • the medicament may comprise separate compositions that may be administered in combination, simultaneously or sequentially, to treat glucose deprivation-sensitive cancer cells in a subject.
  • the medicament comprises at least one modulator that induces intracellular glucose deprivation, which leads to the modulation of at least one L-type calcium channel at the plasma membrane, of the at least one glucose deprivation-sensitive cancer cell and at least one modulator that inhibits calcium uptake by the sarco/endoplasmic reticulum and/or promotes release of calcium into the cytosol from intracellular stores of the at least one glucose deprivation-sensitive cancer cell.
  • the medicament comprises at least one modulator which activates calcium/calmodulin-dependent protein kinase (CAMK1 ) and/or increases the level of PP2Ac demethylation and/or increases the level of RIPK1 phosphorylation. More preferably, said at least one modulator activates CAMK1 and increases the level of PP2Ac demethylation and increases the level of RIPK1 phosphorylation.
  • CAMK1 calcium/calmodulin-dependent protein kinase
  • said at least one modulator activates CAMK1 and increases the level of PP2Ac demethylation and increases the level of RIPK1 phosphorylation.
  • the medicament comprises at least one glucose transporter inhibitor and at least one sarco/endoplasmic reticulum Ca 2+ -ATPase inhibitor.
  • the at least one glucose transporter is selected from one or more of the group comprising GLUT1 , GLUT2, GLUT3 and GLUT4. More preferably, the at least one glucose transporter is GLUT1. In another preferred embodiment, the medicament comprises at least one
  • GLUT1 inhibitor selected from the group comprising STF-31 , WZB-117, Fasentin, Apigenin, Genistein, oxime-based GLUT1 inhibitors and pyrrolidinone derived GLUT1 inhibitors.
  • the GLUT4 inhibitor is selected from the group comprising amprenavir (Agenerase), atazanavir (Reyataz), darunavir (Prezista), fosamprenavir (Telzir, Lexiva), indinavir (Crixivan), lopinavir/ritonavir (Kaletra, Aluvia), nelfinavir (Viracept), ritonavir (Norvir), saquinavir (Invirase), tipranavir (Aptivus) and Curcumin.
  • the GLUT4 inhibitor is Ritonavir (Rito).
  • the medicament comprises at least one sarco/endoplasmic reticulum Ca 2+ -ATPase inhibitor selected from the group comprising thapsigargin, cyclopiazonic acid and 2-aminoethoxydiphenyl borate (2-APB).
  • the medicament comprises; i) STF-31 or a soluble analog thereof [Chan DA, et al. Sci Transl Med 3: 94ra70 (2011 )] and thapsigargin or prodrug thereof; ii) WZB-117 and thapsigargin or prodrug thereof; iii) WZB-117 and 2-APB; or iv) Ritonavir and thapsigargin or prodrug thereof.
  • the present invention provides a method of treating a glucose deprivation-sensitive cancer, the method comprising administering to a subject in need of such treatment a composition or medicament according to any aspect or embodiment of the herein described invention.
  • the method may comprise administration in combination, simultaneously or sequentially, a composition or medicament according to any aspect of the invention to treat a subject in need of such treatment.
  • Suitable methods for administering a therapeutic composition in accordance with the methods of the present invention may include, but are not limited to, systemic administration, parenteral administration (including intravascular, intramuscular, intraarterial administration), oral delivery, topical administration, rectal delivery, vaginal delivery, subcutaneous administration, intraperitoneal administration, inhalation, surgical implantation and local injection. Regardless of the route of administration, the compositions of the present invention are typically administered in combination, simultaneously or sequentially, in amounts effective to achieve the desired response.
  • the terms "effective amounts” and “therapeutically effective amounts” refer to an amount of each of the active components of the therapeutic composition (e.g., at least one modulator that reduces intracellular glucose concentration and at least one modulator of intracellular calcium concentration, and a pharmaceutically acceptable vehicle, carrier, or excipient) sufficient to produce a measurable biological response (e.g., a decrease in the amount of glucose deprivation-sensitive cancer cells).
  • a measurable biological response e.g., a decrease in the amount of glucose deprivation-sensitive cancer cells.
  • Actual dosage levels of active ingredients in a therapeutic composition of the present invention can be varied so as to administer an amount of the active substances that is effective to achieve the desired therapeutic response for a particular subject and/or application.
  • each composition in any particular case will depend upon a variety of factors including the activity of the therapeutic composition, formulation, the route of administration, sequential or simultaneous administration, combination with other drugs or treatments, severity of the condition being treated, and the physical condition and prior medical history of the subject being treated.
  • a solid oral composition such as a tablet or capsule may contain from 1 to 99% (w/w) active ingredient; from 0 to 99% (w/w) diluent or filler; from 0 to 20% (w/w) of a disintegrant; from 0 to 5% (w/w) of a lubricant; from 0 to 5% (w/w) of a flow aid; from 0 to 50% (w/w) of a granulating agent or binder; from 0 to 5% (w/w) of an antioxidant; and from 0 to 5% (w/w) of a pigment.
  • a controlled release tablet may in addition contain from 0 to 90% (w/w) of a release-controlling polymer.
  • a parenteral formulation (such as a solution or suspension for injection or a solution for infusion) may contain from 1 to 50% (w/w) active ingredient; and from 50% (w/w) to 99% (w/w) of a liquid or semisolid carrier or vehicle (e.g. a solvent such as water); and 0-20% (w/w) of one or more other excipients such as buffering agents, antioxidants, suspension stabilisers, tonicity adjusting agents and preservatives.
  • a liquid or semisolid carrier or vehicle e.g. a solvent such as water
  • one or more other excipients such as buffering agents, antioxidants, suspension stabilisers, tonicity adjusting agents and preservatives.
  • a minimal dose is administered, and the dose is escalated in the absence of dose-limiting toxicity to a minimally effective amount. Determination and adjustment of a therapeutically effective dose, as well as evaluation of when and how to make such adjustments, are known to those of ordinary skill in the art.
  • Compounds of the present invention will generally be administered as a pharmaceutical formulation in admixture with a pharmaceutically acceptable adjuvant, diluent or carrier, which may be selected with due regard to the intended route of administration and standard pharmaceutical practice.
  • a pharmaceutically acceptable adjuvant diluent or carrier
  • Such pharmaceutically acceptable carriers may be chemically inert to the active compounds and may have no detrimental side effects or toxicity under the conditions of use.
  • Suitable pharmaceutical formulations may be found in, for example, Remington The Science and Practice of Pharmacy, 19th ed., Mack Printing Company, Easton, Pennsylvania (1995).
  • a parenterally acceptable aqueous solution may be employed, which is pyrogen free and has requisite pH, isotonicity, and stability.
  • Suitable solutions will be well known to the skilled person, with numerous methods being described in the literature. A brief review of methods of drug delivery may also be found in e.g. Langer R, Science 249: 1527-1533 (1990). Otherwise, the preparation of suitable formulations may be achieved routinely by the skilled person using routine techniques and/or in accordance with standard and/or accepted pharmaceutical practice.
  • cytosolic calcium may be used as a basis for a method to screen for cancer cells/tumor types that are sensitive to glucose deprivation.
  • the assay may involve glucose deprivation, followed by staining the cells with a calcium dye (e.g. Fluo-4) and screening for an increase in the cytosolic calcium level.
  • a calcium dye e.g. Fluo-4
  • the assay may involve glucose deprivation, followed by staining the cells with a calcium dye (e.g. Fluo-4) and screening for an increase in the cytosolic calcium level.
  • a calcium dye e.g. Fluo-4
  • the present invention provides a method of determining whether a cell or tissue from a subject is glucose deprivation sensitive, comprising the steps;
  • the method of determining whether a cell or tissue from a subject is glucose-deprivation sensitive comprises the steps; (a) contact the cell or tissue sample with at least one modulator that reduces intracellular glucose concentration and at least one modulator of cytosolic calcium concentration,
  • U20S human osteosarcoma cell line
  • SaOS2 human osteosarcoma cell line
  • SW480 human colon adenocarcinoma cell line
  • U87MG human glioblastoma cell line
  • U251 MG human brain glioma cell line
  • A549 human lung carcinoma cell line
  • H1299 human non-small cell lung carcinoma cell line
  • IMR-90 human normal lung fibroblast cells
  • WI-38 human normal lung fibroblast cells
  • DMEM Dulbecco's modified Eagle's medium
  • FBS fetal bovine serum
  • SW480 was cultured in high glucose (25mM) RPMI1640 medium (Gibco, Life Technologies) supplemented with 10% FBS, 100 units of penicillin and 100 pg/rnl of streptomycin.
  • Cells were transiently transfected with plasmid or siRNA according to the standard calcium phosphate method (Kingston RE, et al., Curr Protoc Cell Biol Chapter 20, Unit 20 23 (2003)).
  • glucose deprivation assay as serum contained glucose, cells were incubated in the media that did not contain glucose and serum. Cells were deprived of serum and glucose for 4 hr to overnight.
  • programmed cell death assay cells were irradiated with 60 J/m 2 of UV.
  • 2-Deoxy-D-glucose (2-DG) and glucose were purchased from Sigma Aldrich and dissolved in water at concentrations of -276 mM (50 mg/ml).
  • Dialyzed serum (GE Healthcare Hyclone) contained less than 1 mM of glucose. To further dilute the glucose without affecting the concentration of growth factors, slide- A-lyzer G2 dialysis cassette 10k MWCO (10,000 molecular weight as a cut off) was used to dialyze the dialyzed serum. Dialyzed serum was dialyzed in ice cold 1xPBS buffer overnight in cold room.
  • siRNA sequences are as follows:
  • PPME1J GAAGGAAGUGAGUCUAUAAtt (SEQ ID NO: 1 );
  • PPME1_2 GGAAGAAAGCGGGACUUUUtt (SEQ ID NO: 2);
  • CAMK1J AUACAGCUCUAGAUAAGAA (SEQ ID NO: 3);
  • CAMK1_2 CCAUAGGUGUCAUCGCCUA (SEQ ID NO: 4);
  • RIPK1J GCAAAGACCUUACGAGAAU (SEQ ID NO: 5);
  • RIPK1_2 CCACUAGUCUGACGGAUAA (SEQ ID NO: 6);
  • CACNA1 C_1 CTGGTTTGGTTCGGTTATCTAdTdT (SEQ ID NO: 7);
  • CACNA1 C_2 TCCAGGGATGTTAGTCTGTATdTdT (SEQ ID NO: 8);
  • CACNA1 D_1 CACGCGAACGAGGCAAACTATdTdT (SEQ ID NO: 9);
  • CACNA1 D_2 CCGGAACACGATACTGGGTTAdTdT (SEQ ID NO: 10).
  • CACNA1 C-For TGATTCCAACGCCACCAATTC, (SEQ ID NO: 11 );
  • CACNA1 C-Rev GAGGAGTCCATAGGCGATTACT (SEQ ID NO: 12);
  • CACNA1C_#1-For CCATTGTGTATGCCCAATAATTTGT (SEQ ID NO: 13); CACNA1 C_#1 -Rev; CAAACCCACCTGTACACCCA (SEQ ID NO: 14
  • CACNA1 C_#2-For ATG G G ATCATG G CTTATG G CG (SEQ ID NO: 15;
  • CACNA1 C_#2-Rev CCAGGTTGTCCACAGCAATG (SEQ ID NO: 16;
  • CACNA1 D-For CGCGAACGAGGCAAACTATG (SEQ ID NO: 17;
  • CACNA1 D-Rev TTG GAG CTATTCGG CTG AG AA (SEQ ID NO: 18;
  • CACNA1 F-For GATCCAGGAGTATGCCAACAA (SEQ ID NO: 23;
  • CACNA1 F-Rev GAAGGAAGACACATAGGCAGAG (SEQ ID NO: 24)
  • CACNA1 S-Rev GTTCCAG AATCACG GTG AAG AC (SEQ ID NO: 26]
  • Relative expression was calculated using TBP as an internal control by BioRad CFX manager software. PCR products were verified by sequencing.
  • anti- Dvl2 (clone 30D2, cat# 3224), anti CASP3 (cat #9661 ) (Cell Signaling); anti-De-me PP2Ac (clone 4B7, cat #sc-13601 ), anti-CAMK1 (clone H-125, cat #sc-33165) and anti- TP53 (clone D01 , cat #sc-126) (Santa Cruz Biotechnology); anti-RIPK1 (clone 38 cat #610458) and anti-PARP1 (clone C210 cat # 556362) (BD Pharmingen); anti PPME1 (cat # 07-095), anti-total PP2Ac (cat # 07-324) and anti-actin (clone C4, cat # MAB1501 ) (Merck Millipore); anti PP2Aa (custom made antibody from David Virshup, Duke-NUS Medical School, Singapore); anti-Me PP2Ac (custom made antibody from Egon Ogri
  • NP-40 lysis buffer 50 m Tris HCI, pH 7.5, 100 mM NaCI, 0.5% NP-40, 1 mM phenylmethylsulfonyl fluoride. Lysates were collected and analyzed according to the manufacturer's instructions (Promega, CellTiter-Glo luminescent cell viability assay).
  • Treated or untreated cells were stained with PI to determine the percentage of cell death. After trypsinization, the cells were centrifuged and the pellet was washed once with 1xPBS. After centrifugation, the pellet was resuspended with 1xPBS containing 10 pg/ml of PI. Cells were stained for 15 min and data were collected with MACsquant analyzer (Miltenyi Biotec). Quantification and analysis of the data were done with Flowjo software.
  • DiBac4 (Enzo Life Science) in the presence or absence of glucose. 2-DG, nifedipine or KCI was also included in the media depending on the experiments.
  • images were immediately taken by Leica fluorescence microscope (within 5 mins).
  • fluorescence intensity was measured by a plate reader (Infinite M200, TECAN, Switzerland). Briefly, cells were stained with 5 ⁇ of DiBac4 for 5 min, washed once with the media with indicated treatment without DiBac4 and the fluorescence intensity monitored by TECAN (excitation: 490nm, emission: 522nm).
  • Double-dialyzed serum should retain the necessary growth factors and have undetectable levels of glucose.
  • U20S cells grown in double-dialyzed serum-containing media without glucose underwent cell death, inferred by PI staining ( Figure 1 B).
  • Re-addition of as little as 0.1 mM glucose was sufficient to rescue glucose deprivation-induced cell death, even in the absence of serum ( Figure 1 C). Based on these data, we conclude that the lack of glucose triggers cell death in sensitive cells.
  • Glucose deprivation induces RIPK1 -dependent cell death
  • Necroptosis is a caspase- independent form of programmed cell death [Degterev A, et al., Nat Chem Biol 1 : 1 12- 1 19 (2005)] and can occur rapidly in a receptor-interacting protein kinase (RIPK)-dependent manner [Vanden Berghe T, et al., Nat Rev Mol Cell Biol 15: 135-147 (2014)]. Since U20S cells died around 4 hr after glucose removal, we next examined RIPK1 phosphorylation, a marker of necroptosis [Newton K, Trends Cell Biol 25: 347- 353 (20 5)].
  • RIPK1 phosphorylation a marker of necroptosis
  • Protein phosphatase 2A (PP2A) is known to regulate the phosphorylation of these latter substrates, and PP2A activity can be regulated by demethylation of its catalytic subunit, PP2Ac [Xing Y, et al., Cell 133: 154-163 (2008)].
  • Glucose deprivation triggers a cytosolic influx of calcium
  • CACNA1 D Voltage-sensitive calcium channel Cav1.3
  • L-type calcium channels are voltage sensitive and open in response to plasma membrane depolarization (Catterall W A, Voltage-gated calcium channels. Cold Spring Harb Perspect Biol 3: a003947 (2011 ); Pietrobon D, Hess P, Nature 346: 651 -655 (1990)).
  • U20S cells displayed marked depolarization after glucose deprivation (Figure 7D and 7E).
  • Cytosolic calcium can increase either due to influx of extracellular calcium after opening of membrane calcium channels, or due to release from intracellular stores.
  • a problem with relying on modulating intracellular calcium to kill cancer cells is the difficulty in avoiding damaging normal cells [Orrenius S, et ah, Nat Rev Mol Cell Biol 4: 552-565 (2003)].
  • a way of minimising off-target toxicity is to administer a calcium modulator as a prodrug [Doan NT, et al., Steroids 97: 2-7 (2015)].
  • FIG. 8G A schematic model of cell death induced by glucose deprivation is shown in Figure 8G.
  • Glucose deprivation induces plasma membrane depolarization, leading to an opening of a calcium channel at the plasma membrane. This causes the calcium influx that activates CA K1.
  • Activated CAMK1 triggers the PPME1 -mediated demethylation of PP2Ac.
  • PP2Ac demethylation induces the phosphorylation of RIPK1 , leading to RIPK1- dependent cell death.
  • Me methylation
  • P phosphorylation.
  • PP2Ac demethylation activates Receptor-interacting serine/threonine protein kinase 1 (RIPKI)-dependent cell death.
  • PP2Ac demethylation and cell death are rescued with glucose and, unexpectedly, with its non-metabolizable analog 2-deoxy-d-glucose (2-DG), a glycolytic inhibitor.
  • 2-DG 2-deoxy-d-glucose
  • Cancer cells sensitive to glucose removal lose the ability to sustain intracellular glucose levels after glucose deprivation. Although the underlying mechanism remains to be investigated, our studies uncovered a previously unexpected role for glucose in maintaining plasma membrane potential to block a calcium influx.
  • the findings disclosed herein reveal a novel function of glucose as a signalling molecule to protect cells from cell death, independently of glycolysis.
  • Soderling TR The Ca-calmodulin-dependent protein kinase cascade. Trends Biochem Sci 24: 232-236 (1999).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Urology & Nephrology (AREA)
  • Molecular Biology (AREA)
  • Hematology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Pathology (AREA)
  • General Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Cell Biology (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • Food Science & Technology (AREA)
  • Toxicology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Organic Chemistry (AREA)
  • Emergency Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The present invention relates to modulating cancer cell death. More particularly, the present invention relates to methods, compositions and kits for modulating the survival of glucose deprivation-sensitive cancer cells by inhibiting glucose transporters and modulating cytosolic calcium levels.

Description

A POTENTIAL COMBINATION THERAPY USING AN INHIBITOR OF GLUCOSE TRANSPORT AND AN INTRACELLULAR CALCIUM INDUCER TO TARGET CANCER METABOLISM.
FIELD OF THE INVENTION The present invention relates to methods and compositions for modulating the survival of glucose deprivation-sensitive cancer cells. More particularly, the invention provides a method for modulating a calcium signalling pathway in glucose-deprivation sensitive cancer cells to induce cell death upon glucose withdrawal, by inhibiting glucose import and raising cytoplasmic calcium.
BACKGROUND OF THE INVENTION
There are many types of cancer treatment, and the particular treatment administered will depend on the type of cancer a patient has and how advanced it is. The main types of cancer treatment include: radiation therapy, chemotherapy, hormone therapy, surgery, immunotherapy, targeted therapy, stem cell transplantation and precision medicine. These therapies may be administered singly or in combinations. However, due to unwanted side-effects on normal cells and the ability of many cancer cells to become resistant to therapies, there is a need to develop new and/or improved treatments. An increase in glucose uptake and dependence is one of the hallmarks of cancer, and is thought, in part, to support aerobic glycolysis. Rapidly dividing cancer cells employ aerobic glycolysis for the production of metabolic intermediates, amino acids, nucleic acids and energy in the form of ATP. This phenomenon is known as the Warburg effect [Vander Heiden MG, et al., Science 324: 1029-1033 (2009)]. This dependence on glucose distinguishes cancer cells from normal cells and often increases their sensitivity to glucose deprivation, thereby providing a potential cancer therapeutic target. There are several types of cancer from which glucose deprivation- sensitive cells have been isolated and cell lines established. Examples include human colon adenocarcinoma (for example, SW480 cell line); osteosarcoma (for example, U20S and SaOS2 cell lines); brain glioma (for example, U251 MG cell line); glioblastoma (for example, U87MG cell line); pancreatic ductal cancer (for example, PANC-1 cell line); hepatocellular cancer (for example, HepG2 cell line) and ovarian teratocarcinoma (for example, PA-1 cell line). One avenue to deprive cells of glucose is to block glucose transporters, which are expressed in both cancer and normal cells. However, there are several glucose transporter types (GLUT1-4) and inhibiting glucose transporters in cancer cells inevitably inhibits normal cells that also use glucose transporters for their functions [Qian Y, et al., World J Transl Med 3, 37-57 (2014)]. Thus the therapeutic window must be carefully managed. Moreover, the sensitivity to glucose withdrawal is varied in each cancer type, and the underlying mechanism of cell death is not clear [Reitzer LJ, et al., J Biol Chem 254: 2669-2676 (1979); Wice BM, et al., J Biol Chem 256: 7812-7819 (1981 )]. Some cancer cells use glutamine, and others can shift from glucose metabolism to glutamine metabolism, thereby bypassing glucose transport inhibition. Drugs targeting other metabolic pathways such as glutamine transport/metabolism or targeting cancer cell growth signalling must be used together with glucose transporter inhibitors to shut down energy metabolism in cancer cells more effectively. However, such combination therapies will significantly affect normal cells since they also use these metabolic pathways.
With a view to increasing the efficiency and specificity of sensitizing cancer cells to glucose deprivation-induced cell death, the intracellular signalling pathways triggered by glucose depletion and calcium modulation were examined in the present study.
SUMMARY OF THE INVENTION
The invention provides a method for modulating a calcium signalling pathway in glucose-deprivation sensitive cancer cells to induce cell death upon glucose withdrawal. More particularly, inhibiting glucose import and raising cytoplasmic calcium induces RIPK-1 -dependent cancer cell death while sparing normal cells.
According to a first aspect, the present invention provides an in vitro or in vivo method for modulating survival of glucose deprivation-sensitive cancer cells comprising the steps of:
(i) depriving at least one glucose deprivation-sensitive cancer cell of intracellular glucose; and (ii) contacting the at least one glucose-deprived cancer cell with at least one modulator of cytosolic calcium concentration.
According to another aspect, the present invention provides a composition and/or kit comprising at least one modulator that reduces intracellular glucose concentration and at least one modulator of cytosolic calcium concentration for use in inducing cell death in at least one glucose deprivation-sensitive cancer cell.
In a preferred embodiment, the composition and/or kit comprises at least one glucose transporter inhibitor and at least one sarco/endoplasmic reticulum Ca2+- ATPase inhibitor. According to another aspect, the present invention provides a use of at least one modulator that reduces intracellular glucose concentration and at least one modulator of intracellular calcium concentration for the preparation of a medicament for inducing RIPK1 -dependent cell death in at least one glucose deprivation-sensitive cancer cell. In a preferred embodiment, the medicament comprises at least one modulator that induces intracellular glucose deprivation of the at least one glucose deprivation- sensitive cancer cell and at least one modulator that inhibits calcium uptake by the sarco/endoplasmic reticulum of the at least one glucose deprivation-sensitive cancer cell. According to another aspect, the present invention provides a method of treating a glucose deprivation-sensitive cancer, the method comprising administering to a subject in need of such treatment a composition or medicament according to any aspect of the herein described invention.
BRIEF DESCRIPTION OF THE FIGURES Figures 1A-E show flow cytometry analysis (A, B and C) and photomicrographs (D, E). (A) Shows that a subset of cancer cell lines is sensitive to glucose deprivation-induced cell death; namely, SW480, U20S, U251MG, SaOS2 and U87MG. The indicated cancer cell lines and normal fibroblasts were cultured in media with or without 10% serum and glucose for 4 hr (for U20S cells) or overnight (remaining cell lines). Cells were collected and stained with PI and analysed by flow cytometry to show the percentage of Pl-positive dead cells. A representative analysis from three independent experiments is shown. SW480 = human colon adenocarcinoma cell line; U20S = human osteosarcoma cell line; U251 MG = human brain glioma cell line; SaOS2 = human osteosarcoma cell line; U87MG = human glioblastoma cell line; A549 = human lung carcinoma cell line; H1299 = human non-small cell lung carcinoma cell line; IMR-90 = human normal lung fibroblasts; and WI-38 = human normal lung fibroblasts. (B) Demonstrates that glucose and serum depletion-induced cell death is independent of serum deprivation. U20S cells were cultured in media containing 10% double-dialyzed serum with or without 1 mM glucose for 4 hr and analysed as in (A). (C) Shows that re-addition of glucose alone is sufficient to rescue glucose deprivation- induced cell death. U20S cells were cultured in media with 0.1 mM, 0.4 mM or 25 mM glucose in the absence of serum, or with 25 mM glucose and 10% serum for 4 hr, and analysed as in (A). (D) Phase contrast microscopy shows the morphology of the cells upon glucose and serum deprivation when treated as in (A). Scale bars, 50 pm. (E) Shows cancer cells that are sensitive to glucose deprivation-induced cell death. Phase contrast images of cells treated overnight as indicated. Scale bars, 50 pm.
Figures 2A-E show that glucose deprivation-induced cell death is independent of ATP depletion and glycolysis. (A) is a histogram showing that 2-DG induces ATP depletion in glucose-depleted U20S cells. Cells treated as indicated for 4 hr were collected, and the levels of intracellular ATP were measured. The mean of triplicate 30 samples ±SD is shown. ***p <0.001 , *p <0.05, n.s.; not significant, unpaired two-tailed student's t-test. (B) shows flow cytometry analysis indicating that 2-DG rescues cell death after glucose depletion. U20S cells were treated with or without 2- DG for 4 hr as indicated, followed by staining with PI and analysed by flow cytometry. A representative analysis from three independent experiments is shown. Percentage of Pl-positive dead cells is shown in the panel. (C) Phase contrast images of cells in (B) are shown. Scale bars, 50 pm. (D) Low amounts of 2-DG are sufficient to rescue glucose deprivation- induced cell death. U20S cells were treated as indicated for 4 hr, stained with PI and analysed by flow cytometry. Shown is the representative analysis of three independent experiments. The percentage of Pl-positive dead cells is shown in the panel. (E) is a histogram showing that glucose deprivation does not increase reactive oxygen species (ROS). U20S cells were treated as indicated for 4 hr followed by staining with H2DCFDA dye for 1 hr and analysed by flow cytometry. ROS levels were indicated by the relative levels of the mean CM-H2DCFDA fluorescence in each sample compared with sample containing glucose. The mean of triplicate samples ±SD is shown. ** p <0.01 , n.s.; not significant, unpaired two-tailed student's t-test. H202; Hydrogen Peroxide. H202 was used as a positive control for increasing ROS, and ascorbic acid was used as an antioxidant.
Figures 3A-D show that glucose deprivation-induced cell death is RIPK1- dependent. (A) Glucose withdrawal does not cause the appearance of markers of apoptosis. U20S cells treated as indicated for 4 hr were collected, and PARP1 cleavage and CASP3 cleavage were analysed by Western blotting with the indicated antibodies. Cells irradiated by UV (60 J/m2) served as a positive control for PARP1 cleavage and CASP3 cleavage. 2-DG was added at 1 mM. (B) RIPK1 phosphorylation by glucose deprivation is rescued by 2-DG. U20S cells were treated as indicated for 4 hr, collected, and analysed by Western blotting with the indicated antibodies. (C) Glucose deprivation induced RIPK1 phosphorylation. U20S cells were cultured in media containing 10% double-dialyzed serum treated as indicated for 4 hr, and the cell lysates were analysed by a Western blotting with indicated antibodies using 8% acrylamide SDS-PAGE gel. Samples were prepared in biological duplicates. (D) RIPK1 knockdown efficiency. U20S cells were transfected with control (sictrl) or two independent RIPK1 siRNA and treated as indicated for 4 hr. Protein lysates were analysed by Western blotting with the indicated antibodies. (E) FACS scan showing that RIPK1 depletion rescues cell death induced by glucose deprivation. U20S cells treated as in (D) were collected and stained with PI and analysed by flow cytometry to determine the percentage Pl-positive dead cells. A representative analysis from three independent experiments is shown.
Figures 4A-H show that glucose deprivation induces PP2Ac demethylation. (A) Glucose deprivation induces the phosphorylation of multiple kinases. Cell extracts from U20S cells cultured in the presence and absence of serum and glucose for 4 hr were analyzed by Western blotting with the indicated antibodies. (B) Glucose deprivation induces PP2Ac demethylation. U20S cells were treated as indicated for 4 hr, lysed, and analysed by Western blotting with the indicated antibodies. Cell extracts were treated separately with NaOH to obtain fully demethylated PP2Ac. Fold change was obtained by measuring the band intensity of demethylated PP2Ac and normalized against total PP2Ac band intensity. (C) Cancer cell lines that are sensitive to glucose deprivation-induced cell death display increased PP2Ac demethylation and RIPK1 phosphorylation upon glucose withdrawal. Indicated cancer cell lines and normal primary cell lines were treated as indicated for 4 hr, lysed and analysed by Western blotting with the indicated antibodies. (D) 2-DG inhibits glucose deprivation-induced PP2Ac demethylation. U20S cells were treated as indicated for 4 hr and lysates were analysed by Western blotting. (E) Only addition of glucose can inhibit PP2Ac demethylation. U20S cells were cultured in the media containing 10% double-dialyzed serum with or without 1 mM glucose for 4 hr and analysed by Western blotting. (F) Pyruvate cannot prevent glucose deprivation-induced PP2Ac demethylation. U20S cells were treated as indicated for 4 hr, lysed and analysed by Western blotting. (G) Low amounts of glucose are sufficient to inhibit PP2Ac demethylation. U20S cells were treated as indicated for 4 hr, and analysed by Western blotting with the indicated antibodies. (H) Low amounts of 2-DG are sufficient to inhibit PP2Ac demethylation. U20S cells were treated for 4 hr and analysed according to (G).
Figures 5A-F show that PP2Ac demethylation is required for glucose deprivation-induced cell death. (A) PP2Ac demethylation occurs before RIPK1 phosphorylation. Cell extracts from a time course of U20S cells cultured in the absence of glucose were analysed by Western blotting with the indicated antibodies. Ctrl U20S cells were cultured in the presence (ctrl) or absence (-serum; - glucose) of glucose and serum. Times indicated are in minutes. (B) PP2Ac demethylation induced by glucose-deprivation does not require protein synthesis. U20S cells were treated as indicated, with or without 100 μΜ cycloheximide, lysed and analysed by Western blotting. (C) Depletion of PPME1 inhibits PP2Ac demethylation and RIPK1 phosphorylation. U20S cells were transfected with control or two independent PPME1 siRNA and treated as indicated, lysed and analysed by Western blotting. (D) Phase contrast images of the cells in (C) are shown. Scale bars, 50 μιτι. (E) Depletion of PPME1 prevents glucose deprivation induced cell death. U20S cells treated as in (C) were stained with PI and analysed by flow cytometry to determine the percentage of PI- positive dead cells. Shown is the representative analysis of three independent experiments. (F) Depletion of RIPK1 does not prevent glucose-deprivation induced PP2Ac demethylation. U20S cells transfected with control or two independent RIPK1 siRNA were treated as indicated for 4 hr. Lysates was collected and analysed by Western blotting, sictrl = siRNA control.
Figures 6A-I show inhibition of calcium signalling rescues glucose deprivation- induced cell death and PP2Ac demethylation. (A) Depletion of CAMK1 prevents glucose deprivation-induced PP2Ac demethylation. U20S cells were transfected with control or two independent CAMK1 siRNA and treated as indicated for 4 hr. Lysates was analysed by Western blotting with the indicated antibodies. (B) Depletion of CAMK1 rescues glucose deprivation-induced cell death. U20S cells transfected with siRNA and treated as indicated were stained with PI and analysed by flow cytometry to determine the percentage of Pl-positive dead cells. Shown is the representative analysis of three independent experiments. (C) Glucose deprivation increases the calcium concentration in the cytoplasm. U20S cells were withdrawn glucose in the presence or absence of 1 mM of 2-DG for 4 hr followed by staining with 5 μΜ fluo-4AM for 15 min. Fluorescent images of cells are shown. Scale bars, 50 pm. (D) Nifedipine inhibits the glucose deprivation-induced increase in calcium concentration in the cytoplasm. U20S cells were glucose-deprived in the presence or absence of 25 μΜ nifedipine for 4 hr followed by staining with fluo-4AM for 15 min. Fluorescent images of cells are shown. Scale bars, 50 pm. (E) Nifedipine inhibits glucose deprivation-induced PP2Ac demethylation. U20S cells were treated as indicated with increasing concentrations of nifedipine. Lysates were analysed by Western blotting with the indicated antibodies. (F) Nifedipine inhibits glucose deprivation-induced cell death. U20S cells were treated as indicated in (D), stained with PI and analysed by flow cytometry to determine the percentage of Pl-positive dead cells. Shown is the representative analysis of three independent experiments. (G) Glucose deprivation increases calcium concentration in the cytoplasm significantly. U20S cells were treated as indicated for 4 hr followed by staining with 5 μΜ of Fluo-4AM for 15 min. Intracellular calcium levels were quantified and indicated by the relative levels of the mean Fluo- 4AM fluorescence in each sample compared with samples in the first bar graph. The mean of triple biological sample ±SD is shown. *** p <0.001 , unpaired two-tailed student's t-test. (H) Inhibition of ROS does not prevent calcium influx to the cytoplasm. U20S cells were treated as indicated for 4 hr with or without 1 mM of N-acetyl-cysteine (NAC) followed by staining with 5 μΜ of fluo- 4AM for 15 min. Fluorescent images of cells are shown. Scale bars, 50 μηι. Bar chart that quantifies the calcium fluorescence intensity is also shown. The mean of triple biological sample ±SD is shown, n.s.; not significant. (I) Nifedipine inhibits calcium influx to the cytoplasm significantly. U20S cells were treated as indicated for 4 hr, followed by staining with fluo-4AM and analysed according to (A). The mean of triple biological sample ±SD is shown. *** p <0.001 , unpaired two-tailed student's t-test. Figures 7A-G show glucose depletion induces plasma membrane depolarization via CACNA1D. (A) Only CACNA1C and CACNA D are expressed in U20S cells. RNA was extracted from U20S cells and mRNA expression of L-type calcium channel a-1 subunits were analysed by RT-PCR. PCR products were visualized by DNA agarose gel electrophoresis. TBP is shown as the positive control for the amplification. PCR was also performed without a template cDNA as the negative control. The expected size of PCR products is 103bp (CACNA1C), 81 bp (CACNA1 D), 100 bp (CACNA1 F), 105 bp (CACNA1S) and 103 bp (TBP) respectively. (B) Depletion of CACNA1 D but not CACNA1 C prevents PP2Ac demethylation induced by glucose deprivation. U20S cells were transfected with control or two independent CACNA1 C or CACNA1 D siRNAs, and treated as indicated for 4 hrs in the presence of 10% dialysed serum. Lysates were analysed by Western blot with the indicated antibodies. Glucose; 1 mM glucose. (C) Depletion of CACNA1 D but not CACNA1 C prevents calcium influx and rescues cell death induced by glucose deprivation. U20S cells were transfected with siRNAs and treated as indicated for 4 hrs in presence of 10% dialysed serum. The cells were then stained with fluo-4AM. Phase contrast and fluorescent images of cells are shown. Scale bars, 50 pm. Glu; 1 mM glucose. (D) Glucose deprivation induces plasma membrane depolarization. U20S cells were placed in the media as indicated in the presence of 10% dialysed serum. Dibac4 was also included in the media for staining. 120 mM KCI was used to stimulate plasma membrane depolarization as the positive control. Fluorescent images of cells are shown. Scale bar, 50 pm. Glu; 1 mM Glucose. 2-DG; 1 mM 2-DG. Ni; nifedipine. (E-G) Plasma membrane depolarization induced by glucose deprivation is observed only in glucose-deprivation sensitive U20S cells (E), but not in insensitive H1299 cells (F), and it is an upstream event of calcium influx (G). U20S or H1299 cells were placed in the media as indicated in the presence of 10% dialysed serum. Dibac4 was also included in the media for staining. Fluorescence intensity of stained cells was measured by a plate reader and are shown as the relative levels of the mean Dibac4 fluorescence in each sample compared with the sample in the first bar (mean ± SD). Assays were performed three to six times. *** p <0.001 , n.s.; not significant, unpaired two-tailed student's West. Glu; 1 mM Glucose. 2-DG; 1 mM 2-DG.
Figures 8A-H show the therapeutic potential of utilizing Ca-PP2A pathway to kill cancer cells sensitive to glucose deprivation. (A) The residual glucose level in cancer cells that are sensitive to glucose deprivation-induced cell death is lower than in those that are resistant. Various cell lines were treated for 4 hr as indicated and lysates were used to measure the levels of intracellular glucose. (B) A combination of STF-31 and thapsigargin (TG) induces PP2Ac demethylation. U20S and WI-38 cells were cultured in 1 mM of glucose containing media and treated with inhibitors as indicated for 1 day. Lysates were analysed by Western blot and the indicated antibodies. Fold change was quantified by measuring the band intensity for demethylated PP2Ac and normalized against total PP2Ac band intensity. (STF-31 : 12.5 μΜ, TG: 10 nM). (C) STF-31 increases the calcium concentration in the cytoplasm in U20S cells. Fluorescent images of U20S and WI-38 cells treated with 12.5 μΜ of STF-31 for 1 day in the presence of 1 mM of glucose followed by staining with Fluo-4AM for 15 min. Scale bars, 50 pm. (D) A combination of STF-31 and thapsigargin (TG) enhances cell death. U20S and WI-38 cells were treated with the indicated inhibitors in the presence of 1 mM of glucose as in (B), stained with PI and analysed by flow cytometry to determine the percentage of Pl-positive dead cells. Shown is the representative analysis of three independent experiments. (STF-31 : 12.5 μΜ, TG: 10 nM). (E) A combination of STF-31 and 2-APB or WZB-117 and 2-APB enhance cell death. U20S and WI-38 cells were treated with the indicated inhibitors in the presence of 1 mM of glucose as in (B), stained with PI and analysed by flow cytometry to determine the percentage of Pl- positive dead cells. Shown is the representative analysis of three independent experiments. (STF-31 : 12.5 μΜ, 2-APB: 20 μΜ; WZB-117: 12.5 μΜ). (F) A combination of Ritonavir (Rito) and thapsigargin (TG) or WZB-117 and thapsigargin (TG) enhance cell death. U20S and WI-38 cells were treated with the indicated inhibitors in the presence of 1 mM of glucose as in (B), stained with PI and analysed by flow cytometry to determine the percentage of Pl-positive dead cells. Shown is the representative analysis of three independent experiments. (Rito: 12.5 μΜ, TG: 10 nM; WZB-117: 12.5 μΜ). (G) A schematic model of cell death induced by glucose deprivation. Glucose deprivation induces the opening of a calcium channel at the plasma membrane. This leads to the influx of calcium that activates CAMK1. Next, CAMK1 regulates PPME1 which induced the demethylation of PP2Ac. PP2Ac demethylation causes the phosphorylation of RIPK1 direct or indirectly, leading to cell death. (H) GLUT1 inhibitor increases cytoplasmic calcium in U20S. STF-31 increases the calcium concentration in the cytoplasm in U20S. U20S and WI-38 cells were cultured in 1 mM glucose containing media with or without 12.5 μΜ STF-31 for 1 day followed by staining with 5 μΜ of fluo-4AM for 15 min. Intracellular calcium levels were quantified and indicated by the relative levels of the mean Fluo-4AM fluorescence in each sample compared with samples in the first bar graph. The mean of triple biological samples ±SD is shown. ** p <0.01 , n.s.; not significant, unpaired two-tailed student's t-test.
DETAILED DESCRIPTION OF THE INVENTION
Definitions
Certain terms employed in the specification, examples and appended claims are collected here for convenience.
As used herein, the term "comprising" or "including" is to be interpreted as specifying the presence of the stated features, integers, steps or components as referred to, but does not preclude the presence or addition of one or more features, integers, steps or components, or groups thereof. However, in context with the present disclosure, the term "comprising" or "including" also includes "consisting of". The variations of the word "comprising", such as "comprise" and "comprises", and "including", such as "include" and "includes", have correspondingly varied meanings.
The term "modulator" is used herein to refer to any substance that effects change in the activity of a target receptor and/or a metabolic or signalling pathway. For example, thapsigargin can modulate cytosolic calcium concentration by inhibiting sarco/endoplasmic reticulum Ca2+-ATPase activity.
The term "subject" is herein defined as vertebrate, particularly mammal, more particularly human. For purposes of research, the subject may particularly be at least one animal model, e.g., a mouse, rat and the like. In particular, for treatment of cancer, the subject may be a human with a cancer comprising glucose deprivation-sensitive cancer cells.
The term "treatment", as used in the context of the invention refers to prophylactic, ameliorating, therapeutic or curative treatment. Abbreviations:
CACNA1 C; voltage-dependent L-type calcium channel subunit alpha - 1C
CACNA1 D; voltage-dependent L-type calcium channel subunit alpha - 1 D
CACNA1 F; voltage-dependent L-type calcium channel subunit alpha - 1 F
CACNA1S; voltage-dependent L-type calcium channel subunit alpha - 1S CAMK1 ; calcium/calmodulin-dependent protein kinase
CASP3; caspase 3
CSNK1 D; casein kinase 1δ
De-Me PP2Ac; de-methylated protein phosphatase 2Ac
DVL2; dishevelled homolog Me PP2Ac; methylated protein phosphatase 2Ac
2-DG; 2-Deoxy-D-glucose
HCC; hepatocellular carcinoma
PARP1 ; poly ADP-ribose polymerase 1
PI; propidium iodide PPME1 ; Protein phosphatase methylesterase 1 RIPK1 ; receptor-interacting serine/threonine-protein kinase 1
ROS; reactive oxygen species
TBP; TATA-box binding protein
According to a preferred aspect, the present invention provides an in vitro or in vivo method for modulating survival of glucose deprivation-sensitive cancer cells comprising the steps of:
(i) depriving at least one glucose deprivation-sensitive cancer cell of intracellular glucose; and
(ii) contacting the at least one glucose-deprived cancer cell with at least one modulator of cytosolic calcium concentration.
Glucose deprivation may be achieved by different means depending on the context. For example, if the glucose deprivation-sensitive cancer cells are grown in vitro they may be deprived of intracellular glucose by culturing them in glucose-free media whereby the intracellular glucose will become depleted over time. Alternatively, or in addition, the cells may be grown in media in the presence of a glucose transporter inhibitor. If a subject is to be treated for the presence of a cancer which comprises glucose deprivation-sensitive cancer cells, they may be administered a pharmaceutical composition comprising a substance which inhibits uptake of glucose by the cells, thereby depriving them of glucose. The present inventors have found that glucose deprivation induces a calcium influx into the glucose deprivation-sensitive cancer cells.
The modulator of intracellular calcium according to any aspect of the invention may be one which increases, inhibits an increase or decreases cytosolic calcium, depending on whether the intention is to prevent or promote glucose deprivation- induced cell death. Preferably, the modulator increases cytosolic calcium above the level of a cell that has not been administered the modulator. The combination of depriving the glucose deprivation-sensitive cancer cells of glucose and contacting them with a modulator that increases cytosolic calcium promotes cell death and, therefore, has utility in in vitro studies and in the treatment of subjects with cancers susceptible to such treatment.
In a preferred embodiment of the invention, said at least one modulator in step ii) modulates at least one sarco/endoplasmic reticulum Ca2+-ATPase. The at least one modulator may reduce cytosolic calcium by activating at least one sarco/endoplasmic reticulum Ca2+-ATPase, thereby inhibiting cell death. More preferably, the at least one modulator is an inhibitor of said sarco/endoplasmic reticulum Ca2+-ATPase, thereby increasing the concentration of cytosolic calcium. An alternative or addition to the inhibition of calcium uptake by the sarco/endoplasmic reticulum may comprise the contacting of said cells with a modulator that promotes release of calcium into the cytosol from intracellular stores such as from the Golgi and/or mitochondria.
In a preferred embodiment of the invention, there is provided an in vitro or in vivo method for modulating survival of glucose deprivation-sensitive cancer cells comprising the steps of: (i) depriving at least one glucose deprivation-sensitive cancer cell of intracellular glucose; and
(ii) contacting the at least one glucose-deprived cancer cell with at least one modulator of cytosolic calcium concentration, wherein said modulator modulates at least one sarco/endoplasmic reticulum Ca2+-ATPase and/or promotes release of calcium into the cytosol from intracellular stores.
Without being bound by theory, according to a preferred embodiment of the method of the present invention, step i) and/or step ii) activates calcium/calmodulin- dependent protein kinase (CAMK1), and/or increases the level of protein phosphatase 2Ac (PP2Ac) demethylation and/or increases the level of receptor-interacting serine/threonine-protein kinase 1 (RIPK1 ) phosphorylation. More particularly, it appears that the method of the invention leads to CAMK1 activation, PP2Ac demethylation, and RIPK1 phosphorylation within the glucose deprivation-sensitive cell.
In a preferred embodiment of the invention, the combination of glucose deprivation and the at least one modulator raises the level of cytosolic calcium to a threshold that activates cell death. Without being bound by theory, it appears that the combination activates RIPK1 -dependent cell death of the glucose deprivation-sensitive cancer cells, while sparing normal cells. A key difference between the glucose deprivation-sensitive cancer cells and normal cells is the inability of said cancer cells to sustain intracellular glucose levels.
In another preferred embodiment of the invention, glucose deprivation is achieved by inhibiting at least one glucose transporter, or by culturing said cells in glucose-free media, that leads to the modulation of at least one calcium channel at the plasma membrane. More preferably, the glucose deprivation modulates at least one L- type calcium channel. Even more preferably, glucose deprivation opens at least one CACNA1 D (also known as Cav1.3) L-type calcium channel, which appears to be in response to membrane depolarization. Opening of the calcium channel results in Ca2+ influx into the cell.
In another preferred embodiment of the invention, the at least one glucose transporter is selected from one or more of the group comprising GLUT1 , GLUT2, GLUT3 and GLUT4, preferably from GLUT1 and GLUT4. More preferably, the at least one glucose transporter is GLUT1 which is frequently overexpressed in cancer. It would be understood by the skilled person that any GLUT1 inhibitors known in the art may be suitable for the invention. In another preferred embodiment of the invention, the GLUT1 inhibitor is selected from the group comprising STF-31 (4-[[[[4-(1 ,1- Dimethylethyl)phenyl]sulfonyl]amino]methyl]-A/-3-pyridinylbenzamide); WZB-117 (3- Fluoro-1 ,2-phenylene bis(3-hydroxybenzoate)); Fasentin (N-[4-chloro-3- (trifluoromethyl)phenyl]-3-oxobutanamide); Apigenin (5,7-Dihydroxy-2-(4- hydroxyphenyl)-4H-chromen-4-one); Genistein (4',5,7-Trihydroxyisoflavone); oxime- based GLUT1 inhibitors and pyrrolidinone derived GLUT1 inhibitors.
It has been reported that HIV protease inhibitors could be selective against GLUT4 [Murata H, Hruz PW, Mueckler M. AIDS 16(6): 859-63 (2002)]. In another preferred embodiment of the invention, the GLUT4 inhibitor is selected from the group comprising amprenavir (Agenerase), atazanavir (Reyataz), darunavir (Prezista), fosamprenavir (Telzir, Lexiva), indinavir (Crixivan), lopinavir/ritonavir (Kaletra, Aluvia), nelfinavir (Viracept), ritonavir (Norvir), saquinavir (Invirase)* , tipranavir (Aptivus) and Curcumin. Based on GLUT1 and GLUT4 sequence homology it is possible that the listed inhibitors could inhibit GLUT1 and GLUT4. Preferably the GLUT4 inhibitor is Ritonavir ((1 E,2S)-N-[(2S,4S,5S)-4-Hydroxy-
5-{(E)-[hydroxy(1 ,3-thiazol-5-ylmethoxy)methylene]amino}-1 ,6-diphenyl-2-hexanyl]-2- [(E)-(hydroxy{[(2-isopropyl-1 ,3-thiazol-4-yl)methyl](methyl)amino}methylene)amino]-3- methylbutanimidic acid).
Any sarco/endoplasmic reticulum Ca2+-ATPase inhibitors known in the art may be suitable for the invention.
In another preferred embodiment of the invention, the sarco/endoplasmic reticulum Ca2+-ATPase inhibitor is selected from the group comprising thapsigargin ((SS.Sa ^S^S.ea^/S.SS^bSJ-e-CAcetyloxy^.S.Sa^.S.e.ea.y.e.Qb-decahydro-S.Sa- dihydroxy-3,6,9-trimethyl-8-[[(2Z)-2-methyl-1 -oxo-2-butenyl]oxy]-2-oxo-4-(1- oxobutoxy)azuleno[4,5-£>]furan-7-yl octanoate); cyclopiazonic acid and 2- aminoethoxydiphenyl borate (2-APB).
In another preferred embodiment of the invention, i) the GLUT1 inhibitor is STF-31 and the sarco/endoplasmic reticulum Ca2+- ATPase inhibitor is thapsigargin; ii) the GLUT1 inhibitor is WZB-117 and the sarco/endoplasmic reticulum Ca2+-
ATPase inhibitor is thapsigargin; or iii) the GLUT1 inhibitor is WZB-117 and the sarco/endoplasmic reticulum Ca2+- ATPase inhibitor is 2-APB; and iv) the GLUT4 inhibitor is Ritonavir and the sarco/endoplasmic reticulum Ca2+- ATPase inhibitor is thapsigargin. It would be understood that an analogue or prodrug form of a glucose transporter inhibitor and/or sarco/endoplasmic reticulum Ca2+-ATPase inhibitor could be used according to any aspect of the invention.
The inventors' data suggests that the induced demethylation of PP2Ac causes phosphorylation of RIPK1 to promote RIPK1 -dependent cell death.
According to another aspect, the present invention provides a composition and/or kit comprising at least one modulator that reduces intracellular glucose concentration and at least one modulator of cytosolic calcium concentration for use in inducing RIPK1 -dependent cell death in at least one glucose deprivation-sensitive cancer cell.
The at least one modulator that reduces intracellular glucose concentration and the at least one modulator of cytosolic calcium concentration may be formulated in separate compositions that are administered in combination, simultaneously or sequentially, to treat glucose deprivation-sensitive cancer cells in a subject. Moreover, chemotherapy often requires the administration of a combination of agents in series and in cycles. The compositions of the invention may be suitable for administration with other known chemotherapeutic and/or pharmacotherapeutic agents. As used herein, reference to a "composition" may include reference to at least one composition.
In a preferred embodiment of the invention, use of the composition and/or kit activates calcium/calmodulin-dependent protein kinase (CAMK1 ) and/or increases the level of PP2Ac demethylation and/or increases the level of RIPK1 phosphorylation in at least one treated glucose deprivation-sensitive cancer cell.
In a preferred embodiment of the invention, the composition and/or kit comprises at least one modulator that induces intracellular glucose deprivation of the at least one glucose deprivation-sensitive cancer cell and at least one modulator that inhibits calcium uptake by the sarco/endoplasmic reticulum of the at least one glucose deprivation-sensitive cancer cell. An alternative or addition to the modulator that inhibits calcium uptake by the sarco/endoplasmic reticulum may comprise a modulator that promotes release of calcium into the cytosol from intracellular stores such as from the Golgi and/or mitochondria, or any other source. In a preferred embodiment of the invention, the composition and/or kit comprises at least one modulator that reduces intracellular glucose concentration which leads to the modulation of at least one L-type calcium channel at the plasma membrane, and at least one modulator of intracellular calcium concentration, wherein said modulator modulates at least one sarco/endoplasmic reticulum Ca2+-ATPase and/or promotes release of calcium into the cytosol from intracellular stores, for use in inducing cell death in at least one glucose deprivation-sensitive cancer cell.
In a preferred embodiment of the invention, the composition and/or kit comprises at least one glucose transporter inhibitor and at least one sarco/endoplasmic reticulum Ca2+-ATPase inhibitor.
In a preferred embodiment, the at least one glucose transporter is selected from one or more of the group comprising GLUT1 , GLUT2, GLUT3 and GLUT4. Preferably, the at least one glucose transporter is GLUT1.
In a preferred embodiment, the GLUT1 inhibitor is selected from the group comprising STF-31 , WZB-117, Fasentin, Apigenin, Genistein, oxime-based GLUT1 inhibitors and pyrrolidinone derived GLUT1 inhibitors.
In a preferred embodiment, the GLUT4 inhibitor is selected from the group comprising amprenavir (Agenerase), atazanavir (Reyataz), darunavir (Prezista), fosamprenavir ( Telzir, Lexiva), indinavir (Crixivan), lopinavir/ritonavir (Kaletra, Aluvia), nelfinavir (Viracept), ritonavir (Norvir), saquinavir (Invirase), tipranavir (Aptivus) and Curcumin.
In another preferred embodiment, the GLUT4 inhibitor is Ritonavir (Rito).
In a preferred embodiment, the composition and/or kit comprises at least one sarco/endoplasmic reticulum Ca2+-ATPase inhibitor selected from the group comprising thapsigargin, cyclopiazonic acid and 2-aminoethoxydiphenyl borate (2-APB).
In another preferred embodiment, the composition and/or kit comprises STF-31 and thapsigargin; Ritonavir and thapsigargin; WZB-117 and thapsigargin; or WZB-117 and 2-APB. More preferably, the composition and/or kit comprises STF-31 and thapsigargin.
In a preferred embodiment, the composition and/or kit comprises at least one modulator that reduces intracellular glucose concentration and at least one modulator of intracellular calcium concentration that combine synergistically to induce RIPK1- dependent cell death.
According to a preferred embodiment of the invention, the intracellular glucose modulator and the intracellular calcium modulator may be in separate compositions or in the same composition, administered at the same time, or at different times such as one on day 1 and the other on day 2 and then alternating etc, provided that the therapy is the combination of the two modulators.
Moreover, the kit as described herein does not necessarily contain only a single pill/tablet/capsule/composition comprising a single modulator. It could contain each compound (intracellular glucose modulator and the intracellular calcium modulator) differently formulated, but with included instructions indicating the regime by which each should be administered to a patient.
Preferably, the composition is a therapeutic composition.
According to another aspect, the present invention provides a use of at least one modulator that reduces intracellular glucose concentration and at least one modulator of intracellular calcium concentration for the preparation of a medicament for inducing RIPK1 -dependent cell death in at least one glucose deprivation-sensitive cancer cell.
The medicament may comprise separate compositions that may be administered in combination, simultaneously or sequentially, to treat glucose deprivation-sensitive cancer cells in a subject. In a preferred embodiment, the medicament comprises at least one modulator that induces intracellular glucose deprivation, which leads to the modulation of at least one L-type calcium channel at the plasma membrane, of the at least one glucose deprivation-sensitive cancer cell and at least one modulator that inhibits calcium uptake by the sarco/endoplasmic reticulum and/or promotes release of calcium into the cytosol from intracellular stores of the at least one glucose deprivation-sensitive cancer cell.
In a preferred embodiment, the medicament comprises at least one modulator which activates calcium/calmodulin-dependent protein kinase (CAMK1 ) and/or increases the level of PP2Ac demethylation and/or increases the level of RIPK1 phosphorylation. More preferably, said at least one modulator activates CAMK1 and increases the level of PP2Ac demethylation and increases the level of RIPK1 phosphorylation.
In a preferred embodiment, the medicament comprises at least one glucose transporter inhibitor and at least one sarco/endoplasmic reticulum Ca2+-ATPase inhibitor.
In a preferred embodiment, the at least one glucose transporter is selected from one or more of the group comprising GLUT1 , GLUT2, GLUT3 and GLUT4. More preferably, the at least one glucose transporter is GLUT1. In another preferred embodiment, the medicament comprises at least one
GLUT1 inhibitor selected from the group comprising STF-31 , WZB-117, Fasentin, Apigenin, Genistein, oxime-based GLUT1 inhibitors and pyrrolidinone derived GLUT1 inhibitors.
In a preferred embodiment, the GLUT4 inhibitor is selected from the group comprising amprenavir (Agenerase), atazanavir (Reyataz), darunavir (Prezista), fosamprenavir (Telzir, Lexiva), indinavir (Crixivan), lopinavir/ritonavir (Kaletra, Aluvia), nelfinavir (Viracept), ritonavir (Norvir), saquinavir (Invirase), tipranavir (Aptivus) and Curcumin.
In another preferred embodiment, the GLUT4 inhibitor is Ritonavir (Rito). In another preferred embodiment, the medicament comprises at least one sarco/endoplasmic reticulum Ca2+-ATPase inhibitor selected from the group comprising thapsigargin, cyclopiazonic acid and 2-aminoethoxydiphenyl borate (2-APB).
More preferably, the medicament comprises; i) STF-31 or a soluble analog thereof [Chan DA, et al. Sci Transl Med 3: 94ra70 (2011 )] and thapsigargin or prodrug thereof; ii) WZB-117 and thapsigargin or prodrug thereof; iii) WZB-117 and 2-APB; or iv) Ritonavir and thapsigargin or prodrug thereof.
According to another aspect, the present invention provides a method of treating a glucose deprivation-sensitive cancer, the method comprising administering to a subject in need of such treatment a composition or medicament according to any aspect or embodiment of the herein described invention. The method may comprise administration in combination, simultaneously or sequentially, a composition or medicament according to any aspect of the invention to treat a subject in need of such treatment.
Suitable methods for administering a therapeutic composition in accordance with the methods of the present invention may include, but are not limited to, systemic administration, parenteral administration (including intravascular, intramuscular, intraarterial administration), oral delivery, topical administration, rectal delivery, vaginal delivery, subcutaneous administration, intraperitoneal administration, inhalation, surgical implantation and local injection. Regardless of the route of administration, the compositions of the present invention are typically administered in combination, simultaneously or sequentially, in amounts effective to achieve the desired response. As used herein, the terms "effective amounts" and "therapeutically effective amounts" refer to an amount of each of the active components of the therapeutic composition (e.g., at least one modulator that reduces intracellular glucose concentration and at least one modulator of intracellular calcium concentration, and a pharmaceutically acceptable vehicle, carrier, or excipient) sufficient to produce a measurable biological response (e.g., a decrease in the amount of glucose deprivation-sensitive cancer cells). Actual dosage levels of active ingredients in a therapeutic composition of the present invention can be varied so as to administer an amount of the active substances that is effective to achieve the desired therapeutic response for a particular subject and/or application. Of course, the effective amount and timing of administration of each composition in any particular case will depend upon a variety of factors including the activity of the therapeutic composition, formulation, the route of administration, sequential or simultaneous administration, combination with other drugs or treatments, severity of the condition being treated, and the physical condition and prior medical history of the subject being treated.
For example, a solid oral composition such as a tablet or capsule may contain from 1 to 99% (w/w) active ingredient; from 0 to 99% (w/w) diluent or filler; from 0 to 20% (w/w) of a disintegrant; from 0 to 5% (w/w) of a lubricant; from 0 to 5% (w/w) of a flow aid; from 0 to 50% (w/w) of a granulating agent or binder; from 0 to 5% (w/w) of an antioxidant; and from 0 to 5% (w/w) of a pigment. A controlled release tablet may in addition contain from 0 to 90% (w/w) of a release-controlling polymer.
A parenteral formulation (such as a solution or suspension for injection or a solution for infusion) may contain from 1 to 50% (w/w) active ingredient; and from 50% (w/w) to 99% (w/w) of a liquid or semisolid carrier or vehicle (e.g. a solvent such as water); and 0-20% (w/w) of one or more other excipients such as buffering agents, antioxidants, suspension stabilisers, tonicity adjusting agents and preservatives.
Preferably, a minimal dose is administered, and the dose is escalated in the absence of dose-limiting toxicity to a minimally effective amount. Determination and adjustment of a therapeutically effective dose, as well as evaluation of when and how to make such adjustments, are known to those of ordinary skill in the art.
Compounds of the present invention will generally be administered as a pharmaceutical formulation in admixture with a pharmaceutically acceptable adjuvant, diluent or carrier, which may be selected with due regard to the intended route of administration and standard pharmaceutical practice. Such pharmaceutically acceptable carriers may be chemically inert to the active compounds and may have no detrimental side effects or toxicity under the conditions of use. Suitable pharmaceutical formulations may be found in, for example, Remington The Science and Practice of Pharmacy, 19th ed., Mack Printing Company, Easton, Pennsylvania (1995). For parenteral administration, a parenterally acceptable aqueous solution may be employed, which is pyrogen free and has requisite pH, isotonicity, and stability. Suitable solutions will be well known to the skilled person, with numerous methods being described in the literature. A brief review of methods of drug delivery may also be found in e.g. Langer R, Science 249: 1527-1533 (1990). Otherwise, the preparation of suitable formulations may be achieved routinely by the skilled person using routine techniques and/or in accordance with standard and/or accepted pharmaceutical practice.
Upon glucose deprivation, some cancer cells have an increase in the cytosolic calcium level. This change in cytosolic calcium may be used as a basis for a method to screen for cancer cells/tumor types that are sensitive to glucose deprivation. For cancer cell lines, the assay may involve glucose deprivation, followed by staining the cells with a calcium dye (e.g. Fluo-4) and screening for an increase in the cytosolic calcium level. In respect of tumor tissues from a patient, after collection they may be deprived of glucose and stained with a calcium dye to screen for an increase in calcium level compared to untreated tissue, whereby a relative increase would be determinative of glucose deprivation sensitivity in the tumor sample.
The data described herein show that glucose deprivation of glucose deprivation-sensitive cells triggers a unique pathway that results in calcium influx which activates CAMK1 and downstream causes PP2Ac demethylation and/or RIPK1 phosphorylation. An alternative or addition to determining changes in cytosolic calcium would be to determine the level of CAMK1 activation and/or PP2Ac demethylation and/or RIPK1 phosphorylation in glucose-deprived cells or tissues compared to untreated controls. Suitable methods to quantitate these glucose starvation-induced changes are shown in the Examples herein. According to another aspect, the present invention provides a method of determining whether a cell or tissue from a subject is glucose deprivation sensitive, comprising the steps;
(a) contact the cell or tissue sample with at least one modulator that reduces intracellular glucose concentration, (b) quantitate the level of cytosolic calcium; and/or
(c) quantitate the level of activated CAMK1 and/or the level of PP2Ac demethylation and/or the level of RIPK1 phosphorylation compared to a reference sample representing a cell or tissue resistant to glucose deprivation, and/or (d) quantitate the level of plasma membrane depolarization, wherein a difference relative to the reference sample indicates the cell or tissue is glucose deprivation-sensitive.
In a preferred embodiment, the method of determining whether a cell or tissue from a subject is glucose-deprivation sensitive comprises the steps; (a) contact the cell or tissue sample with at least one modulator that reduces intracellular glucose concentration and at least one modulator of cytosolic calcium concentration,
(b) quantitate the level of cytosolic calcium; and/or
(c) quantitate the level of activated CAMK1 and/or the level of PP2Ac demethylation and/or the level of RIPK1 phosphorylation compared to a reference sample representing a cell or tissue resistant to glucose deprivation, and/or
(d) quantitate the level of plasma membrane depolarization, wherein a difference relative to the reference sample indicates the cell or tissue is glucose deprivation-sensitive. Any listing or discussion of an apparently prior-published document in this specification should not necessarily be taken as an acknowledgement that such document is part of the state of the art or is common general knowledge.
Having now generally described the invention, the same will be more readily understood through reference to the following examples which are provided by way of illustration, and are not intended to be limiting of the present invention. A person skilled in the art will appreciate that the present invention may be practised without undue experimentation according to the method given herein. The methods, techniques and chemicals are as described in the references given or from protocols in standard biotechnology and molecular biology text books.
EXAMPLES Standard molecular biology techniques known in the art and not specifically described were generally followed as described in Sambrook and Russel, Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (2001).
EXAMPLE 1
Cell cultures and transfection
U20S (human osteosarcoma cell line); SaOS2 (human osteosarcoma cell line);
SW480 (human colon adenocarcinoma cell line); U87MG (human glioblastoma cell line); U251 MG (human brain glioma cell line); A549 (human lung carcinoma cell line); H1299 (human non-small cell lung carcinoma cell line); IMR-90 (human normal lung fibroblast cells); and WI-38 (human normal lung fibroblast cells) were purchased from ATCC (American Type Culture Collection). All cell lines were cultured in high glucose (25 mM) Dulbecco's modified Eagle's medium (DMEM) (Gibco, Life Technologies) supplemented with 10% fetal bovine serum (FBS) (Thermo Science), 100 units of penicillin and 100 g/ml of streptomycin (Gibco, Life Technologies) in 5% C02 humidified atmosphere at 37°C unless otherwise stated. U251 MG was cultured in the same condition supplemented with 1x MEM non-essential amino acids (Gibco, Life Technologies) and 1x sodium pyruvate (Gibco, Life Technologies). SW480 was cultured in high glucose (25mM) RPMI1640 medium (Gibco, Life Technologies) supplemented with 10% FBS, 100 units of penicillin and 100 pg/rnl of streptomycin.
Cells were transiently transfected with plasmid or siRNA according to the standard calcium phosphate method (Kingston RE, et al., Curr Protoc Cell Biol Chapter 20, Unit 20 23 (2003)). For the glucose deprivation assay, as serum contained glucose, cells were incubated in the media that did not contain glucose and serum. Cells were deprived of serum and glucose for 4 hr to overnight. For the programmed cell death assay, cells were irradiated with 60 J/m2 of UV. 2-Deoxy-D-glucose (2-DG) and glucose were purchased from Sigma Aldrich and dissolved in water at concentrations of -276 mM (50 mg/ml). 2-APB, cycloheximide (CHX), thapsigargin (TG), nifedipine, Ritonavir, WZB-117 (all purchased from Sigma Aldrich) and STF-31 (Santa Cruz) were dissolved in DMSO at concentrations of 10 mM. N-acetyl-cysteine (NAC) (Sigma Aldrich) were dissolved in water at concentrations of 1 M.
Dialysis of dialyzed serum (double-dialyzed serum)
Dialyzed serum (GE Healthcare Hyclone) contained less than 1 mM of glucose. To further dilute the glucose without affecting the concentration of growth factors, slide- A-lyzer G2 dialysis cassette 10k MWCO (10,000 molecular weight as a cut off) was used to dialyze the dialyzed serum. Dialyzed serum was dialyzed in ice cold 1xPBS buffer overnight in cold room.
siRNA silencing experiments
All siRNAs were obtained from Ambion. Control siRNA (ON TARGET plus non targeting pool) were obtained from Dharmacon. Multiple targeted siRNA sequences are as follows:
PPME1J : GAAGGAAGUGAGUCUAUAAtt (SEQ ID NO: 1 );
PPME1_2: GGAAGAAAGCGGGACUUUUtt (SEQ ID NO: 2);
CAMK1J : AUACAGCUCUAGAUAAGAA (SEQ ID NO: 3);
CAMK1_2: CCAUAGGUGUCAUCGCCUA (SEQ ID NO: 4);
RIPK1J : GCAAAGACCUUACGAGAAU (SEQ ID NO: 5);
RIPK1_2: CCACUAGUCUGACGGAUAA (SEQ ID NO: 6);
CACNA1 C_1 ; CTGGTTTGGTTCGGTTATCTAdTdT (SEQ ID NO: 7);
CACNA1 C_2; TCCAGGGATGTTAGTCTGTATdTdT (SEQ ID NO: 8);
CACNA1 D_1 ; CACGCGAACGAGGCAAACTATdTdT (SEQ ID NO: 9);
CACNA1 D_2; CCGGAACACGATACTGGGTTAdTdT (SEQ ID NO: 10).
All siRNA were used at 20nM for transfection.
RT- PCR experiments and analysis
Total RNA was extracted using RNeasy kit (QIAGEN). cDNA was synthesized using iScript cDNA synthesis kit (BioRad). RT-PCR was performed with KAPA SYBR fast qPCR kit (KAPA Biosystems) using the CFX96 System (BioRad). The following primers were used.
CACNA1 C-For; TGATTCCAACGCCACCAATTC, (SEQ ID NO: 11 );
CACNA1 C-Rev; GAGGAGTCCATAGGCGATTACT (SEQ ID NO: 12);
CACNA1C_#1-For; CCATTGTGTATGCCCAATAATTTGT (SEQ ID NO: 13); CACNA1 C_#1 -Rev; CAAACCCACCTGTACACCCA (SEQ ID NO: 14
CACNA1 C_#2-For; ATG G G ATCATG G CTTATG G CG (SEQ ID NO: 15;
CACNA1 C_#2-Rev; CCAGGTTGTCCACAGCAATG (SEQ ID NO: 16;
CACNA1 D-For; CGCGAACGAGGCAAACTATG (SEQ ID NO: 17;
CACNA1 D-Rev; TTG GAG CTATTCGG CTG AG AA (SEQ ID NO: 18;
CACNA1 D_#1 -For; GCAGCATCAACGGCAGC (SEQ ID NO: 19;
CACNA1 D_#1 -Rev; CG G CTG AG AAGTTGGTCCTT (SEQ ID NO: 20;
CACNA1 D_#2-For; AGAGGACCCCATCCGCA (SEQ ID NO: 21 ;
CACNA1 D_#2-Rev; GGCCCCTTTGTGGAGGAAA (SEQ ID NO: 22;
CACNA1 F-For; GATCCAGGAGTATGCCAACAA (SEQ ID NO: 23;
CACNA1 F-Rev; GAAGGAAGACACATAGGCAGAG (SEQ ID NO: 24)
CACNA1 S-For; TTGCCTACGGCTTCTTATTCCA (SEQ ID NO: 25;
CACNA1 S-Rev; GTTCCAG AATCACG GTG AAG AC (SEQ ID NO: 26]
TBP-For; CGCCGAATATAATCCCAAGC ( (SSEEQQ IIDD NNOO:: 2277)); and TBP-Rev; TCCTGTGCACACCATTTTCC (SEQ ID NO: 28)
Relative expression was calculated using TBP as an internal control by BioRad CFX manager software. PCR products were verified by sequencing.
Protein analysis
For western blot, all cells were lysed with 2% SDS lysis buffer (50 mM TrisHCI, pH 6.8, 10% glycerol and 2% SDS). Proteins were separated with 8% or 1 1 % SDS- PAGE. Detection was done by HRP-conjugated anti-mouse or anti-rabbit IgG secondary antibodies (Jackson ImmunoResearch) followed by chemiluminescence (SuperSignal, Pierce) or infrared fluorescence conjugated anti-mouse or anti-rabbit IgG secondary antibodies (Dy-light, Jackson ImmunoResearch) followed by infrared fluorescence detection (LI-COR Odyssey). The following antibodies were used: anti- Dvl2 (clone 30D2, cat# 3224), anti CASP3 (cat #9661 ) (Cell Signaling); anti-De-me PP2Ac (clone 4B7, cat #sc-13601 ), anti-CAMK1 (clone H-125, cat #sc-33165) and anti- TP53 (clone D01 , cat #sc-126) (Santa Cruz Biotechnology); anti-RIPK1 (clone 38 cat #610458) and anti-PARP1 (clone C210 cat # 556362) (BD Pharmingen); anti PPME1 (cat # 07-095), anti-total PP2Ac (cat # 07-324) and anti-actin (clone C4, cat # MAB1501 ) (Merck Millipore); anti PP2Aa (custom made antibody from David Virshup, Duke-NUS Medical School, Singapore); anti-Me PP2Ac (custom made antibody from Egon Ogris, Max F. Perutz Laboratories, Vienna, Austria); anti-CSNK1 D (custom made antibody from Eli Lily Laboratories). Alkaline demethylation assay was done as previously described [Turowski P, et al., J Cell Biol 129: 397-410 (1995)]. Briefly, cell extracts were lysed with 2% SDS lysis buffer containing 1 mM NaOH and incubated for 30 min at room temperature. Extracts was neutralized with 1 M HCI.
ATP measurement assay
For ATP measurement assay, cells were lysed with 0.5% NP-40 lysis buffer (50 m Tris HCI, pH 7.5, 100 mM NaCI, 0.5% NP-40, 1 mM phenylmethylsulfonyl fluoride). Lysates were collected and analyzed according to the manufacturer's instructions (Promega, CellTiter-Glo luminescent cell viability assay).
Glucose measurement assay
Amplex Red glucose/glucose oxidase assay kit (Life Technologies) was used. Cells were lysed with 0.5% NP-40 lysis buffer and lysates were analysed according to the manufacturer's instructions. Glucose concentration of each lysate was calculated by comparing to the glucose standard curve as recommended by the manufacturer. Glucose concentration was further normalized against the protein amount of the lysate loaded and plotted in the graph.
PI (propidium iodide) staining for cell death assay
Treated or untreated cells were stained with PI to determine the percentage of cell death. After trypsinization, the cells were centrifuged and the pellet was washed once with 1xPBS. After centrifugation, the pellet was resuspended with 1xPBS containing 10 pg/ml of PI. Cells were stained for 15 min and data were collected with MACsquant analyzer (Miltenyi Biotec). Quantification and analysis of the data were done with Flowjo software.
ROS measurement assay
Cells were deprived of glucose and stained with H2DCFDA to detect ROS. After
4 hr of glucose deprivation, cells were trypsinized and washed once with 1xPBS. Cells were stained with 10 μΜ of H2DCFDA diluted in phenol red free DMEM for 1 hr and analyzed by MACsquant analyzer. Quantification and analysis of the data were done with Flowjo software.
Calcium Flux measurement assay
Cells were deprived of glucose and stained with Fluo-4AM (Life Technologies) to detect changes in calcium flux. Cells were incubated with phenol-free DMEM for imaging purposes. 5 μΜ of Fluo-4AM were added to the cells and incubated at 37°C for 15 min. Images were obtained with fluorescence microscope (Olympus) to observe the difference in calcium levels before and after glucose deprivation. Quantification of fluorescence intensity was done with ImageJ software.
Membrane potential depolarization measurement assay
Cells were placed in DMEM containing 10% dialysed serum and 5 μΜ of
DiBac4 (Enzo Life Science) in the presence or absence of glucose. 2-DG, nifedipine or KCI was also included in the media depending on the experiments. For imaging, images were immediately taken by Leica fluorescence microscope (within 5 mins). For quantification, fluorescence intensity was measured by a plate reader (Infinite M200, TECAN, Switzerland). Briefly, cells were stained with 5 μΜ of DiBac4 for 5 min, washed once with the media with indicated treatment without DiBac4 and the fluorescence intensity monitored by TECAN (excitation: 490nm, emission: 522nm).
EXAMPLE 2 Cancer cell lines display different sensitivities towards glucose deprivation- induced cell death
We characterized a panel of cancer cell lines based on their sensitivity to glucose starvation. The standard culture media contain 25 mM glucose. Since 10% serum contains about 0.4 mM glucose, we incubated the cells in media with or without both glucose and serum, and evaluated cell death by propidium iodide (PI) exclusion, which was detected by flow cytometry analysis. Five of the seven lines tested displayed substantial cell death in less than 9 hr of glucose- and serum-starvation (SW480, U20S, U251 MG, SaOS2, U87MG; Figure 1A). In contrast, two cancer cell lines (A549, H1299) and two normal primary cell lines (IMR-90, WI-38) remained impermeable to PI (Figure 1A) and survived for up to a week in serum- and glucose-free media (data not shown). We used U20S cells for our subsequent analyses since it displayed the most rapid (4-6 hr) cell death after glucose removal.
To determine if the cell death induced by the combination of glucose and serum depletion was independent of serum deprivation, we compared survival in medium with double-dialyzed serum in the presence or absence of supplemental glucose. Double- dialyzed serum should retain the necessary growth factors and have undetectable levels of glucose. U20S cells grown in double-dialyzed serum-containing media without glucose underwent cell death, inferred by PI staining (Figure 1 B). Re-addition of as little as 0.1 mM glucose was sufficient to rescue glucose deprivation-induced cell death, even in the absence of serum (Figure 1 C). Based on these data, we conclude that the lack of glucose triggers cell death in sensitive cells. Since the amount of glucose that is available in 10% serum (about 0.4 mM) is sufficient to prevent cell death, we decided to remove both glucose and serum in subsequent experiments. We performed phase contrast microscopy to evaluate the morphology of the cells upon glucose deprivation. Glucose deprivation increased the number of cells that were round, and loosely attached to the plate in the five sensitive cell lines, but did not affect the morphology of the insensitive cell lines (Figures 1 D and 1 E). We evaluated the kinetics of U20S cell death upon glucose deprivation (data not shown), which revealed that the cells exhibited the typical rounding morphology within 4-6 hr, starting from 2 hr after glucose removal.
EXAMPLE 3 Glucose deprivation-induced cell death is independent of ATP depletion and glycolysis
Cancer cells use glucose to generate ATP, and ATP depletion can affect cell survival [Eguchi Y, et al., Cancer Res 57: 1835-1840 (1997); Leist M, et al., J Exp Med 185: 1481-1486 (1997); Richter C, et al., FEBS Lett 378: 107-110 (1996)]. To determine if ATP depletion was the cause of cell death induced by glucose deprivation, we inhibited glycolysis with the glucose analogue 2-DG to block ATP production. If cell death is triggered by ATP depletion as a consequence of glucose withdrawal, then the addition of 2-DG to the cells would be predicted to accelerate ATP depletion and hence cell death. As expected, ATP was depleted by the deprivation of glucose and serum (Figure 2A, columns 1 and 3). Although the addition of 1 mM 2-DG in the presence of 25 mM glucose was not sufficient to reduce ATP abundance (Figure 2A, columns 1 and 2), 1 mM 2-DG reduced intracellular ATP markedly and significantly in the absence of glucose and serum in culture (Figure 2A, columns 3 and 4). However, surprisingly, 2- DG completely rescued the cell death induced by glucose deprivation, as determined by both PI exclusion and cell morphology (Figures 2B, 2C). The addition of as little as 0.1 mM 2-DG attenuated cell death (Figure 2D). The finding that micromolar 2-DG could prevent cell death suggested that glucose deprivation affected cell signalling rather than cell metabolism (the Warburg effect). Consistent with this idea, there was no increase in reactive oxygen species (ROS) in cells undergoing cell death, at least after 4 hr of glucose and serum removal (Figure 2E), suggesting that changes in ROS are not involved in this cell death mechanism. Whereas Eguchi Y, et al., [Cancer Res 57: 1835-1840 (1997)] showed that inhibition of glucose is promising in cancers which lost VHL which results in high glycolysis by upregulating HIF-1 and 2, the data shown herein indicate that glucose deprivation-induced cell death was independent of glycolysis and ATP loss. EXAMPLE 4
Glucose deprivation induces RIPK1 -dependent cell death
To gain insight into the mechanism of cell death induced by glucose deprivation, we evaluated markers of apoptotic cell death pathway. We found that, in contrast to ultraviolet light exposure, glucose withdrawal did not cause the appearance of markers of apoptosis such as PARP1 (poly ADP-ribose polymerase 1 ) cleavage or CASP3 (caspase 3) cleavage in U20S cells (Figure 3A, lane 4). Similarly, treatment of glucose-deprived cells with 2-DG had no effect on these markers, suggesting ATP depletion also did not lead to apoptosis (Figure 3A, lane 5). Necroptosis is a caspase- independent form of programmed cell death [Degterev A, et al., Nat Chem Biol 1 : 1 12- 1 19 (2005)] and can occur rapidly in a receptor-interacting protein kinase (RIPK)- dependent manner [Vanden Berghe T, et al., Nat Rev Mol Cell Biol 15: 135-147 (2014)]. Since U20S cells died around 4 hr after glucose removal, we next examined RIPK1 phosphorylation, a marker of necroptosis [Newton K, Trends Cell Biol 25: 347- 353 (20 5)]. We found that glucose withdrawal reduced the electrophoretic mobility of RIPK1 , consistent with its reported phosphorylation pattern and activation (Figure 3B, lane 3). RIPK1 phosphorylation upon glucose deprivation was further confirmed by 8% acrylamide SDS-PAGE (Figure 3C). Treatment with 2-DG completely prevented RIPK1 phosphorylation by glucose deprivation (Figure 3B) consistent with its ability to rescue cell death induced by the lack of glucose. If RIPK1 is required for cell death upon the withdrawal of glucose, then knockdown of RIPK1 by RNAi would be predicted to prevent glucose deprivation-induced cell death. We transfected two independent siRNAs that target RIPK1 individually into U20S cells and verified their efficiency (Figure 3D). We found that RIPK1 knockdown restored cancer cell viability upon glucose withdrawal (Figure 3E). These data suggested that the mode of cell death induced by glucose deprivation was RIPK1 -dependent cell death. EXAMPLE 5
Glucose deprivation induces PP2Ac demethylation
We noticed that in addition to RIPK1 , proteins including casein kinase 1 δ (CSNK1 D) and the segment polarity protein dishevelled homolog (DVL2) were also markedly phosphorylated upon glucose withdrawal (Figure 4A). Based on this, we speculated that there was reduced activity of an upstream serine/threonine phosphatase. Protein phosphatase 2A (PP2A) is known to regulate the phosphorylation of these latter substrates, and PP2A activity can be regulated by demethylation of its catalytic subunit, PP2Ac [Xing Y, et al., Cell 133: 154-163 (2008)]. Indeed, we observed substantially increased levels of demethylated PP2Ac after glucose withdrawal (Figure 4B). We estimated that about 30% of total PP2Ac underwent demethylation after glucose withdrawal by comparing the lysate to NaOH-treated extracts, which contain fully demethylated PP2Ac (Figure 4B). Thus, demethylation of PP2Ac may be triggering RIPK1 phosphorylation and necroptosis. Consistent with this, we found that all of the cancer cell lines that were sensitive to glucose deprivation- induced cell death had increased PP2Ac demethylation and RIPK1 phosphorylation upon glucose withdrawal (Figure 4C). In contrast, the levels of demethylated PP2Ac remained low in all of the cancer and normal primary cell lines that were resistant to glucose deprivation-induced cell death (Figure 4C). Importantly, 2-DG inhibited PP2Ac demethylation caused by glucose deprivation (Figure 4D, lanes 3 and 4), consistent with its ability to inhibit glucose deprivation-induced cell death (Figures 2B and 2C). Even low concentrations (0.1 mM) of glucose or 2-DG attenuated PP2Ac demethylation (Figures 4G and 4H), consistent with their ability to rescue cell death (Figures 1 C and 2E). Although cells grown in dialyzed serum-containing media without glucose underwent PP2Ac demethylation, addition of glucose also completely abrogated PP2Ac demethylation (Figure 4E), indicating that glucose deprivation is the cause of PP2Ac demethylation. As pyruvate is the end product of glycolysis and the initiator of ATP synthesis in the TCA (tricarboxylic acid) cycle, we investigated whether pyruvate would prevent PP2Ac demethylation. However, pyruvate supplementation did not inhibit PP2Ac demethylation caused by glucose deprivation (Figure 4F, lanes 3 and 5), consistent with our findings above that glucose deprivation-induced cell death was independent of ATP depletion (Figures 2A-C). Again, we found that serum depletion alone did not induce PP2Ac demethylation (Figure 4F, lane 2 and 4), consistent with the inability to induce cell death by itself (Figure 1C). Together, these data indicate that PP2Ac demethylation correlates with glucose-deprivation induced cell death, and that both are independent of glycolysis. EXAMPLE 6
PP2Ac demethylation is required for cell death upon glucose withdrawal
We next tested if PP2Ac demethylation was required for glucose deprivation- induced RIPK1 -dependent cell death. Time course experiments following glucose withdrawal revealed that demethylated PP2Ac was initially detectable around 15 min after glucose deprivation and increased from 1 hr onwards (Figure 5A). Further, RIPK1 phosphorylation occurred after PP2Ac demethylation (Figure 5A). These data suggested that PP2Ac demethylation precedes RIPK1 phosphorylation and cell death. We reasoned that glucose deprivation could promote PP2Ac demethylation either by inhibition of the methylation of newly synthesized, unmethylated, PP2Ac or by demethylating the existing, methylated, PP2Ac. To distinguish between these possibilities, we treated the cells with cycloheximide to inhibit new protein synthesis. As shown in Figure 5B, glucose withdrawal efficiently induced PP2Ac demethylation even in the presence of cycloheximide (Figure 5B). This is consistent with active demethylation of the existing, methylated, PP2Ac following glucose removal. PPME1 is the only known enzyme that demethylates PP2Ac and no other substrate of PPME1 is known [Xing Y, et al., Cell 133: 154-163 (2008)]. To determine if demethylation of PP2Ac by PPME1 is required for cell death, we knocked down PPME1 using two independent siRNAs and monitored PP2Ac demethylation and cell death after glucose withdrawal. We found that PPME1 knockdown efficiently inhibited PP2Ac demethylation and RIPK1 phosphorylation (Figure 5C) as well as cell death (Figures 5D and 5E) after glucose withdrawal. Time-lapse video microscopy showed that PPME1 siRNA significantly delayed cell death as compared to control siRNA (data not shown). These data reveal that PP2Ac demethylation by PPME1 is necessary for glucose deprivation-induced cell death. To ask whether PP2Ac demethylation occurred upstream of RIPK1 phosphorylation upon glucose withdrawal, we knocked down RIPK1 and monitored PP2Ac demethylation. Although knockdown of RIPK1 restored cancer cell viability (Figure 3D), it did not affect the induction of PP2Ac demethylation by glucose deprivation (Figure 5F), suggesting that PP2Ac demethylation precedes RIPK1 phosphorylation. Altogether, these data indicate that glucose deprivation induces PP2Ac demethylation, which leads to RIPK1 phosphorylation and RIPK1 - dependent cell death.
EXAMPLE 7
Glucose deprivation triggers a cytosolic influx of calcium
We investigated the mechanism by which glucose deprivation induced PP2Ac demethylation and cancer cell death. We screened a kinase inhibitor library consisting of 81 compounds and identified candidate kinases required for cell death upon glucose deprivation. Of the candidates, we investigated whether CAMK1 plays a role in glucose deprivation-induced PP2Ac demethylation and RIPK1 -dependent cell death by using RNAi to knockdown CAMK1. Two independent siRNAs displayed efficient and specific knockdown of CAMK1 in U20S cells (Figure 6A). We found that these CAMK1 siRNAs blocked both PP2Ac demethylation and cell death upon glucose deprivation (Figure 6A, 6B), indicating that CA K1 is required for these phenotypes. Glucose deprivation could regulate CAMK1 directly or indirectly. Because CAMK1 is regulated by the intracellular calcium concentration [Soderling TR, Trends Biochem Sci 24: 232-236 (1999)], we investigated whether glucose deprivation affects calcium levels. We incubated U20S cells with the fluorescent calcium indicator Fluo-4A . Cells cultured in the absence, but not in the presence, of glucose, displayed green fluorescence, indicating that glucose withdrawal increased the intracellular calcium concentration significantly (Figure 6C, and quantified in Figure 6G). Furthermore, treating the cells with 2-DG in the absence of glucose inhibited the increase in intracellular calcium significantly (Figure 6C, and quantified in Figure 6G), consistent with its ability to inhibit PP2Ac demethylation and cell death after glucose withdrawal (Figures 4D and 2B). Thus, a cytosolic calcium influx correlates with PP2Ac demethylation and cell death phenotypes regulated by glucose and 2-DG.
Next, we characterized the calcium signalling induced by glucose deprivation. Time lapse video microscopy was used to evaluate the kinetics of intracellular calcium levels upon glucose withdrawal. We found that the increase in calcium occurred within 15 min (data not shown), preceding the demethylation of PP2Ac. The antioxidant N- acetyl-cysteine did not rescue calcium release after glucose removal for 4 hr (Figure 6H), consistent with the data showing that glucose removal does not affect ROS (Figure 2D). Calcium could be delivered to the cytosol from two sources: from outside the plasma membrane or from within the cell's calcium storage organelles. To determine the source of calcium, we used nifedipine, an antagonist of calcium channels on the plasma membrane. If PP2Ac demethylation is inhibited by nifedipine, this would suggest that glucose deprivation induces the opening of the calcium channel on the plasma membrane and that the calcium source is from outside of the cells. Indeed, nifedipine significantly inhibited the increase in green fluorescence in glucose-deprived cells stained with Fluo-4AM (Figure 6D, and quantified in Figure 6I). Thus, calcium from outside the cell is transported into the cytoplasm upon glucose deprivation. Correspondingly, nifedipine also inhibited the PP2Ac demethylation and cell death upon glucose deprivation (Figures 6E and 6F). These data support a model in which glucose deprivation induces an influx of calcium, which in turn triggers RIPK1- dependent cell death through PP2Ac demethylation.
EXAMPLE 8
Voltage-sensitive calcium channel Cav1.3 (CACNA1 D) is required for glucose depletion-induced cell death Since nifedipine inhibited calcium influx and cell death induced by glucose deprivation, we investigated the potential calcium channels that were involved in this pathway. Nifedipine affects L-type calcium channels, and there are four L-type calcium channels which differ in their a-1 subunits: CACNA1 S (also known as Cav1.1 ), CACNA1C (also known as Cav1.2), CACNA1 D (also known as Cav1.3), and CACNA1F (also known as Cav1.4). We examined the mRNA expression of these channels in U20S cells and found that only CACNA1 C and CACNA1 D were expressed (Figure 7A). We depleted CACNA1 C and CACNA1 D by RNAi (Figure 7C) and found that knockdown of CACNA1 D but not CACNA1 C prevented calcium influx, PP2Ac demethylation and cell death after glucose deprivation (Figure 7B and 7C), suggesting that CACNA1 D is required to trigger this cell death pathway.
L-type calcium channels are voltage sensitive and open in response to plasma membrane depolarization (Catterall W A, Voltage-gated calcium channels. Cold Spring Harb Perspect Biol 3: a003947 (2011 ); Pietrobon D, Hess P, Nature 346: 651 -655 (1990)). We therefore, investigated whether depolarization occurred after glucose deprivation. We stained U20S cells with Dibac4, an oxonol fluorescent dye that detects plasma membrane depolarization (Adams D. S, Levin M, Cold Spring Harb Protoc 2012: 459-464 (2012)). Interestingly, U20S cells displayed marked depolarization after glucose deprivation (Figure 7D and 7E). The addition of 120 mM KCI was used as a positive control since it has been known to actively induce membrane depolarization (Figure 7D and 7E) (Adams D. S, Levin M, Cold Spring Harb Protoc 2012: 459-464 (2012)). As expected, 2-DG inhibited the glucose deprivation induced depolarization (Figure 7D and 7E), consistent with its ability to rescue PP2Ac demethylation and cell death (Figure 4D and 2B). On the other hand, we did not observe membrane depolarization of the insensitive cancer cell line H1299 upon glucose deprivation (Figure 7F).
Additionally, we tested if membrane depolarization is upstream of the induction of calcium influx. We treated U20S cells with nifedipine in the presence or absence of glucose and stained the cells with Dibac4. Indeed, even though nifedipine completely inhibited calcium influx (Figure 6D and 6I), it did not inhibit membrane depolarization, as shown by the Dibac4 fluorescence (Figure 7D row 2 and Figure 7G), suggesting that plasma membrane depolarization precedes calcium influx upon glucose deprivation. The membrane depolarization and calcium influx could conceivably induce apoptosis via mitochondrial membrane potential changes followed by cytochrome c release to the cytosol. However, we did not detect mitochondrial membrane potential changes or cytochrome c release after glucose deprivation, consistent with the data showing a lack of apoptosis markers after glucose deprivation (data not shown). EXAMPLE 9
Therapeutic intervention targeting calcium signalling and glucose deprivation
Low levels of glucose or 2-DG were sufficient to prevent RIPK1 -dependent cell death by glucose deprivation. We hypothesized that the cell lines that are resistant to glucose deprivation-induced cell death may therefore have higher intracellular glucose levels. Following glucose deprivation, we analysed intracellular glucose levels. Indeed, we found that resistant cancer cell lines as well as normal primary IMR-90 and WI-38 cells maintained higher levels of intracellular glucose compared to sensitive cell lines after glucose withdrawal (Figure 8A). Thus, intracellular glucose levels correlate well with the sensitivity of each cell type to glucose removal.
The inability of these sensitive cancer cell lines to maintain intracellular glucose levels upon glucose deprivation may make these cells vulnerable to therapeutic intervention. We evaluated the effects of a glucose transport inhibitor on sensitive and normal primary cell lines. We reasoned that cell lines whose intracellular glucose levels were not maintained upon glucose removal would be more sensitive to this inhibitor for cell death through PP2Ac demethylation, whereas there would be less or no effect on normal primary cell lines. Thus, we tested the effect of STF-31 , an inhibitor of the glucose transporter GLUT1 [Chan DA, et al. Sci Transl Med 3: 94ra70 (2011 )]. Although STF-31 alone did not induce PP2Ac demethylation in WI-38 cells, STF-31 slightly induced PP2Ac demethylation in U20S cells (Figure 8B, lanes 1 and 2). We also noticed that STF-31 alone slightly induced increases in calcium levels in the cytoplasm in U20S, but not in WI-38, indicated by Fluo-4 staining (Figure 8C, and quantified in Figure 8H), suggesting that by inhibiting glucose transport, STF-31 reduced the intracellular glucose levels enough to trigger calcium signalling in U20S cells, but not in WI-38 cells.
An increase in cytosolic calcium concentration triggers diverse signalling pathways and biological processes, including cell death and potentially provides another mechanism to target therapeutically. Cytosolic calcium can increase either due to influx of extracellular calcium after opening of membrane calcium channels, or due to release from intracellular stores. However, a problem with relying on modulating intracellular calcium to kill cancer cells is the difficulty in avoiding damaging normal cells [Orrenius S, et ah, Nat Rev Mol Cell Biol 4: 552-565 (2003)]. A way of minimising off-target toxicity is to administer a calcium modulator as a prodrug [Doan NT, et al., Steroids 97: 2-7 (2015)]. Given our findings that an influx of calcium promotes PP2Ac demethylation, we tested whether low doses of a calcium modulator could be combined with a glucose transporter inhibitor to enhance calcium signalling and cell death. Cells were treated with a combination of STF-31 and thapsigargin, which raises cytosolic calcium levels by inhibiting the endoplasmic reticulum Ca2+-ATPase, to maximize the increase of the intracellular calcium. Indeed, cells treated with STF-31 and thapsigargin displayed higher levels of demethylated PP2Ac than treated with either drug alone in U20S cells (Figure 8B). Treatment with either drug alone or combination of the drugs did not affect the levels of PP2Ac demethylation in WI-38 cells (Figure 8B).
We combined STF-31 and thapsigargin to determine whether they would synergize to induce RIPK1 -dependent cell death of U20S cancer cells, and found that the combination of STF-31 and thapsigargin caused at least about 4-fold increase in cell death compared to either drug alone (Figure 8D). In contrast, WI-38 normal cells did not undergo cell death after treatment with the combination of STF-31 and thapsigargin (Figure 8D). Therefore, cancer cells that lack the ability to maintain intracellular glucose levels can be potentially targeted by combined glucose transport inhibition together with enhanced cytosolic Ca2+ accumulation without affecting the normal cells.
Given these results, other combinations of calcium modulator and glucose transporter inhibitor were tested (Figures 8E and 8F). Another calcium inducer, 2-APB, was tested together with either STF-31 or WZB-117. The combination of STF-31 or WZB-117 and 2-APB only induced cell death in U20S and this combination caused at least 4-fold increase in cell death compared to either drug alone (Figure 8E). Other GLUT1 (WZB-117) and GLUT4 (Ritonavir) inhibitors, together with thapsigargin, also induced a maximal cell death in U20S only. We tested the combination of WZB-117 or Ritonavir with TG and only a combination therapy would induce at least a 4-fold increase in cell death as compared to either drug alone (Figure 8F). A schematic model of cell death induced by glucose deprivation is shown in Figure 8G. Glucose deprivation induces plasma membrane depolarization, leading to an opening of a calcium channel at the plasma membrane. This causes the calcium influx that activates CA K1. Activated CAMK1 triggers the PPME1 -mediated demethylation of PP2Ac. PP2Ac demethylation induces the phosphorylation of RIPK1 , leading to RIPK1- dependent cell death. Me: methylation; P: phosphorylation.
SUMMARY
Many cancer cells depend on glucose, as aerobic glycolysis provides both energy and anabolic building blocks. However, the sensitivity to glucose withdrawal is different in each cancer type, and the underlying mechanism of cell death is not clear. Here, we show that demethylation of the catalytic subunit of protein phosphatase 2A (PP2A) occurs uniquely in a subset of cancer cells that are sensitive to glucose deprivation. Glucose deprivation of these cells triggers plasma membrane depolarization which leads to an influx of calcium into the cytoplasm activating Calcium/calmodulin-dependent protein kinase, CAMK1 , and, in turn, the PP2Ac demethylase PPME1. PP2Ac demethylation activates Receptor-interacting serine/threonine protein kinase 1 (RIPKI)-dependent cell death. PP2Ac demethylation and cell death are rescued with glucose and, unexpectedly, with its non-metabolizable analog 2-deoxy-d-glucose (2-DG), a glycolytic inhibitor. Cancer cells sensitive to glucose removal lose the ability to sustain intracellular glucose levels after glucose deprivation. Although the underlying mechanism remains to be investigated, our studies uncovered a previously unexpected role for glucose in maintaining plasma membrane potential to block a calcium influx. The findings disclosed herein reveal a novel function of glucose as a signalling molecule to protect cells from cell death, independently of glycolysis. When glucose is withdrawn by, for example, modulation of glucose transport the glucose deprivation-sensitive cells die. However, if the cells are also administered a modulator to increase intracellular calcium there is a synergistic effect and at least four times the number of glucose deprivation-sensitive cancer cells are killed compared to either modulator alone. Our data indicate that such a combination approach will have a synergistic therapeutic efficacy over either approach alone. References
Adams D. S, Levin M. Measuring resting membrane potential using the fluorescent voltage reporters DiBAC4(3) and CC2-DMPE. Cold Spring Harb Protoc 2012: 459-464 (2012). Catterall W. A. Voltage-gated calcium channels. Cold Spring Harb Perspect Biol 3: a003947 (2011 ).
Chan DA, et al. Targeting GLUT1 and the Warburg effect in renal cell carcinoma by chemical synthetic lethality. Sci Transl Med 3: 94ra70 (20 1 ).
Degterev A, et al. Chemical inhibitor of nonapoptotic cell death with therapeutic potential for ischemic brain injury. Nat Chem Biol 1 : 1 12-119 (2005).
Doan NT, et al. Targeting thapsigargin towards tumors. Steroids 97: 2-7 (2015).
Eguchi Y, Shimizu S, Tsujimoto Y. Intracellular ATP levels determine cell death fate by apoptosis or necrosis. Cancer Res 57: 1835-1840 (1997).
Kingston RE, Chen CA, Okayama H. Calcium phosphate transfection. Curr Protoc Cell Biol Chapter 20, Unit 20 23 (2003).
Langer R. New methods of drug delivery. Science 249: 1527-1533 (1990).
Leist M, Single B, Castoldi AF, Kuhnle S, Nicotera P. Intracellular adenosine triphosphate (ATP) concentration: a switch in the decision between apoptosis and necrosis. J Exp Med 185: 1481-1486 (1997). Murata H1 , Hruz PW, Mueckler M. Indinavir inhibits the glucose transporter isoform Glut4 at physiologic concentrations. AIDS 16(6): 859-63 (2002).
Newton K. RIPK1 and RIPK3: critical regulators of inflammation and cell death. Trends Cell Biol 25: 347-353 (2015).
Orrenius S, Zhivotovsky B, Nicotera P. Regulation of cell death: the calcium-apoptosis link. Nat Rev Mol Cell Biol 4: 552-565 (2003). Pietrobon D, Hess P. Novel mechanism of voltage-dependent gating in L-type calcium channels, Nature 346: 651-655 (1990).
Qian Y, Wang X, Chen X. Inhibitors of glucose transport and glycolysis as novel anticancer therapeutics. World J Transl Med 3: 37-57 (2014). Reitzer LJ, Wice BM, Kennell D. Evidence that glutamine, not sugar, is the major energy source for cultured HeLa cells. J Biol Chem 254: 2669-2676 (1979).
Richter C, Schweizer M, Cossarizza A, Franceschi C. Control of apoptosis by the cellular ATP level. FEBS Lett 378: 107-110 (1996).
Sambrook and Russel. Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (2001 ).
Soderling TR. The Ca-calmodulin-dependent protein kinase cascade. Trends Biochem Sci 24: 232-236 (1999).
Turowski P, Fernandez A, Favre B, Lamb NJ, Hemmings BA. Differential methylation and altered conformation of cytoplasmic and nuclear forms of protein phosphatase 2A during cell cycle progression. J Cell Biol 129: 397-410 (1995).
Vanden Berghe T, Linkermann A, Jouan-Lanhouet S, Walczak H, Vandenabeele P. Regulated necrosis: the expanding network of non-apoptotic cell death pathways. Nat Rev Mol Cell Biol 15: 135-147 (2014).
Vander Heiden MG, Cantley LC, Thompson CB. Understanding the Warburg effect: the metabolic requirements of cell proliferation. Science 324: 1029-1033 (2009).
Wice BM, Reitzer LJ, Kennell D. The continuous growth of vertebrate cells in the absence of sugar. J Biol Chem 256: 7812-7819 (1981 ).
Xing Y, Li Z, Chen Y, Stock JB, Jeffrey PD, Shi Y. Structural mechanism of demethylation and inactivation of protein phosphatase 2A. Cell 133: 154-163 (2008).

Claims

Claims:
1. An in vitro or in vivo method for modulating survival of glucose deprivation- sensitive cancer cells comprising the steps of:
(i) depriving at least one glucose deprivation-sensitive cancer cell of intracellular glucose; and
(ii) contacting the at least one glucose-deprived cancer cell with at least one modulator of cytosolic calcium concentration, wherein said modulator modulates at least one sarco/endoplasmic reticulum Ca2+-ATPase and/or promotes release of calcium into the cytosol from intracellular stores.
2. The method according to claim 1 , wherein the glucose deprivation is achieved by inhibiting at least one glucose transporter, or by culturing said cells in glucose-free media, which leads to the modulation of at least one L-type calcium channel at the plasma membrane.
3. The method according to claim 2, wherein the at least one glucose transporter is selected from one or more of the group GLUT1 , GLUT2, GLUT3 and GLUT4.
4. The method according to claim 3, wherein the GLUT1 inhibitor is selected from the group comprising STF-31 (4-[[[[4-(1 ,1-Dimethylethyl)phenyl]sulfonyl]amino]methyl]- /V-3-pyridinylbenzamide); WZB-117 (3-Fluoro-1 ,2-phenylene bis(3-hydroxybenzoate)); Fasentin (N-[4-chloro-3-(trifluoromethyl)phenyl]-3-oxobutanamide); Apigenin (5,7- Dihydroxy-2-(4-hydroxyphenyl)-4H-chromen-4-one); Genistein (4',5,7-
Trihydroxyisoflavone); oxime-based GLUT1 inhibitors and pyrrolidinone derived GLUT1 inhibitors, and wherein the GLUT4 inhibitor is selected from the group comprising amprenavir (Agenerase), atazanavir (Reyataz), darunavir (Prezista), fosamprenavir (Telzir, Lexiva), indinavir {Crixivan), lopinavir/ritonavir (Kaletra, Aluvia), nelfinavir (Viracept), ritonavir (Norvir), saquinavir (Invirase), tipranavir (Aptivus) and Curcumin.
5. The method according to any one of claims 1 to 4, wherein the sarco/endoplasmic reticulum Ca2+-ATPase modulator is selected from the group comprising thapsigargin, cyclopiazonic acid and 2-aminoethoxydiphenyl borate (2- APB).
6. The method according to any one of claims 3 to 5, wherein; i) the GLUT1 inhibitor is STF-31 and the sarco/endoplasmic reticulum Ca2+-ATPase inhibitor is thapsigargin; ii) the GLUT1 inhibitor is WZB-117 and the sarco/endoplasmic reticulum Ca2+-ATPase inhibitor is thapsigargin; or iii) the GLUT1 inhibitor is WZB-117 and the sarco/endoplasmic reticulum Ca2+-ATPase inhibitor is 2-APB; and iv) the GLUT4 inhibitor is Ritonavir and the sarco/endoplasmic reticulum Ca2+-ATPase inhibitor is thapsigargin.
7. A composition and/or kit comprising at least one modulator that reduces intracellular glucose concentration which leads to the modulation of at least one L-type calcium channel at the plasma membrane, and at least one modulator of intracellular calcium concentration, wherein said modulator modulates at least one sarco/endoplasmic reticulum Ca +-ATPase and/or promotes release of calcium into the cytosol from intracellular stores, for use in inducing cell death in at least one glucose deprivation-sensitive cancer cell.
8. The composition and/or kit according to claim 7, wherein the at least one modulator that reduces intracellular glucose concentration inhibits at least one glucose transporter.
9. The composition and/or kit according to claim 8, wherein the at least one glucose transporter is selected from one or more of the group comprising GLUT1 , GLUT2, GLUT3 and GLUT4.
10. The composition and/or kit according to claim 9, wherein the GLUT1 inhibitor is selected from the group comprising STF-31 , WZB-117, Fasentin, Apigenin, Genistein, oxime-based GLUT1 inhibitors and pyrrolidinone derived GLUT1 inhibitors and wherein the GLUT4 inhibitor is selected from the group comprising amprenavir (Agenerase), atazanavir (Reyataz), darunavir (Prezista), fosamprenavir (Telzir, Lexiva), indinavir (Crixivan), lopinavir/ritonavir (Kaletra, Aluvia), nelfinavir (Viracept), ritonavir (Norvir), saquinavir (Invirase), tipranavir (Aptivus) and Curcumin.
1 1. The composition and/or kit according to any one of claims 8 to 10, wherein the sarco/endoplasmic reticulum Ca2+-ATPase inhibitor is selected from the group comprising thapsigargin, cyclopiazonic acid and 2-aminoethoxydiphenyl borate (2- APB).
12. The composition and/or kit according to claim 10 or 1 1 , wherein; i) the GLUT1 inhibitor is STF-31 and the sarco/endoplasmic reticulum Ca2+-ATPase inhibitor is thapsigargin; ii) the GLUT1 inhibitor is WZB-117 and the sarco/endoplasmic reticulum Ca2+-ATPase inhibitor is thapsigargin; or iii) the GLUT1 inhibitor is WZB-117 and the sarco/endoplasmic reticulum Ca2+-ATPase inhibitor is 2-APB; and iv) the GLUT4 inhibitor is Ritonavir and the sarco/endoplasmic reticulum Ca2+-ATPase inhibitor is thapsigargin.
13. Use of at least one modulator that reduces intracellular glucose concentration which leads to the modulation of at least one L-type calcium channel at the plasma membrane, and at least one modulator of intracellular calcium concentration, wherein said modulator modulates at least one sarco/endoplasmic reticulum Ca2+-ATPase and/or promotes release of calcium into the cytosol from intracellular stores, for the preparation of a medicament for inducing cell death in at least one glucose deprivation- sensitive cancer cell.
14. The use according to claim 13, wherein the at least one modulator that reduces intracellular glucose concentration comprises at least one glucose transporter inhibitor.
15. The use according to claim 14, wherein the at least one glucose transporter is selected from one or more of the group comprising GLUT1 , GLUT2, GLUT3 and GLUT4.
16. The use according to claim 15, wherein the GLUT1 inhibitor is selected from the group comprising STF-31 , WZB17, Fasentin, Apigenin, Genistein, oxime-based GLUT1 inhibitors and pyrroiidinone derived GLUT1 inhibitors and wherein the GLUT4 inhibitor is is selected from the group comprising amprenavir (Agenerase), atazanavir (Reyataz), darunavir (Prezista), fosamprenavir (Telzir, Lexiva), indinavir (Crixivan), lopinavir/ritonavir (Kaletra, Aluvia), nelfinavir (Viracept), ritonavir (Norvir), saquinavir (Invirase), tipranavir (Aptivus) and Curcumin.
17. The use according to any one of claims 13 to 16, wherein the sarco/endoplasmic reticulum Ca2+-ATPase inhibitor is selected from the group comprising thapsigargin, cyclopiazonic acid and 2-aminoethoxydiphenyl borate (2- APB).
18. The use according to claim 17, wherein; i) the GLUT1 inhibitor is STF-31 and the sarco/endoplasmic reticulum Ca2+-ATPase inhibitor is thapsigargin; ii) the GLUT1 inhibitor is WZB-117 and the sarco/endoplasmic reticulum Ca2+-ATPase inhibitor is thapsigargin; or iii) the GLUT1 inhibitor is WZB-117 and the sarco/endoplasmic reticulum Ca2+-ATPase inhibitor is 2-APB; and iv) the GLUT4 inhibitor is Ritonavir and the sarco/endoplasmic reticulum Ca2+-ATPase inhibitor is thapsigargin.
19. A method of treating a glucose deprivation-sensitive cancer, the method comprising administering to a subject in need of such treatment a composition or medicament defined in any one of claims 7 to 18.
20. A method of determining whether a cell or tissue from a subject is glucose deprivation-sensitive, comprising the steps;
(a) contact the cell or tissue sample with at least one modulator that reduces intracellular glucose concentration, and (b) quantitate the level of cytosolic calcium; and/or
(c) quantitate the level of activated CAMK1 and/or the level of PP2Ac demethylation and/or the level of RIPK1 phosphorylation compared to a reference sample representing a cell or tissue resistant to glucose deprivation, and/or
(d) quantitate the level of plasma membrane depolarization, wherein a difference relative to the reference sample indicates the cell or tissue is glucose deprivation-sensitive.
21. The method of claim 20, comprising the steps;
(a) contact the cell or tissue sample with at least one modulator that reduces intracellular glucose concentration and at least one modulator of cytosolic calcium concentration, and
(b) quantitate the level of cytosolic calcium; and/or
(c) quantitate the level of activated CAMK1 and/or the level of PP2Ac demethylation and/or the level of RIPK1 phosphorylation compared to a reference sample representing a cell or tissue resistant to glucose deprivation, and/or (d) quantitate the level of plasma membrane depolarization, wherein a difference relative to the reference sample indicates the cell or tissue is glucose deprivation-sensitive.
PCT/SG2017/050208 2016-04-13 2017-04-13 A potential combination therapy using an inhibitor of glucose transport and an intracellular calcium inducer to target cancer metabolism WO2017180063A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
SG10201602902S 2016-04-13
SG10201602902S 2016-04-13

Publications (1)

Publication Number Publication Date
WO2017180063A1 true WO2017180063A1 (en) 2017-10-19

Family

ID=60042608

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/SG2017/050208 WO2017180063A1 (en) 2016-04-13 2017-04-13 A potential combination therapy using an inhibitor of glucose transport and an intracellular calcium inducer to target cancer metabolism

Country Status (1)

Country Link
WO (1) WO2017180063A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019216489A1 (en) * 2018-05-09 2019-11-14 주식회사 하임바이오 Pharmaceutical composition for prevention or treatment of cancer
CN115364224A (en) * 2022-08-25 2022-11-22 杭州天玑济世生物科技有限公司 Use of GLUT1 inhibitors as inducers of mitophagy

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030236300A1 (en) * 1999-10-27 2003-12-25 Yale University Conductance of improperly folded proteins through the secretory pathway and related methods for treating disease
WO2015187827A1 (en) * 2014-06-03 2015-12-10 The Trustees Of The University Of Pennsylvania Novel effective antiviral compounds and methods using same

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030236300A1 (en) * 1999-10-27 2003-12-25 Yale University Conductance of improperly folded proteins through the secretory pathway and related methods for treating disease
WO2015187827A1 (en) * 2014-06-03 2015-12-10 The Trustees Of The University Of Pennsylvania Novel effective antiviral compounds and methods using same

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BOST ET AL.: "Energy Disruptors: Rising Stars in Anticancer Therapy?", ONCOGENESIS, vol. 5, January 2016 (2016-01-01), pages el88, XP055433361 *
GRAHAM ET AL.: "Glucose Deprivation Activates a Metabolic and Signaling Amplification Loop Leading to Cell Death", MOLECULAR SYSTEMS BIOLOGY, vol. 8, 2012, XP055433359 *
HERSEY ET AL.: "Adaptation to ER Stress as a Driver of Malignancy and Resistance to Therapy in Human Melanoma", PIGMENT CELL & MELANOMA RESEARCH, vol. 21, no. 3, 2008, pages 358 - 367, XP055433362 *
SCHONTHAL ET AL.: "Endoplasmic Reticulum Stress: Its Role in Disease and Novel Prospects for Therapy", SCIENTIFICA, vol. 2012, 2012, XP055433364 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019216489A1 (en) * 2018-05-09 2019-11-14 주식회사 하임바이오 Pharmaceutical composition for prevention or treatment of cancer
CN115364224A (en) * 2022-08-25 2022-11-22 杭州天玑济世生物科技有限公司 Use of GLUT1 inhibitors as inducers of mitophagy
CN115364224B (en) * 2022-08-25 2024-02-02 杭州天玑济世生物科技有限公司 Use of GLUT1 inhibitors as mitochondrial autophagy inducers

Similar Documents

Publication Publication Date Title
Zhang et al. Honokiol ameliorates myocardial ischemia/reperfusion injury in type 1 diabetic rats by reducing oxidative stress and apoptosis through activating the SIRT1-Nrf2 signaling pathway
Su et al. Emodin induces apoptosis in human lung adenocarcinoma cells through a reactive oxygen species-dependent mitochondrial signaling pathway
Yu et al. Paeoniflorin protects human EA. hy926 endothelial cells against gamma-radiation induced oxidative injury by activating the NF-E2-related factor 2/heme oxygenase-1 pathway
Wang et al. 4-Hydroxybenzoic acid (4-HBA) enhances the sensitivity of human breast cancer cells to adriamycin as a specific HDAC6 inhibitor by promoting HIPK2/p53 pathway
Xu et al. Plumbagin from Plumbago Zeylanica L induces apoptosis in human non-small cell lung cancer cell lines through NF-κB inactivation
Duong et al. Inhibition of NRF2 by PIK-75 augments sensitivity of pancreatic cancer cells to gemcitabine
Jiang et al. Epigallocatechin‑3‑gallate inhibits self‑renewal ability of lung cancer stem‑like cells through inhibition of CLOCK
Ji et al. Effect of Hydroxysafflor yellow A on human umbilical vein endothelial cells under hypoxia
Zhang et al. Gastrodin inhibits high glucose‑induced human retinal endothelial cell apoptosis by regulating the SIRT1/TLR4/NF‑κBp65 signaling pathway
Fatfat et al. Thymoquinone enhances the anticancer activity of doxorubicin against adult T-cell leukemia in vitro and in vivo through ROS-dependent mechanisms
Wang et al. Dihydrotanshinone induces p53-independent but ROS-dependent apoptosis in colon cancer cells
Lampiasi et al. The novel NF-κB inhibitor DHMEQ synergizes with celecoxib to exert antitumor effects on human liver cancer cells by a ROS-dependent mechanism
US9447054B2 (en) Anticancer supplement agent including benzo[D]oxazol derivative as effective ingredient
BR112013024211B1 (en) TREATMENT OF SOLID TUMORS
Liu et al. Antioxidant effects of sulforaphane in human HepG2 cells and immortalised hepatocytes
Xu et al. 3-(1H-Benzo [d] imidazol-6-yl)-5-(4-fluorophenyl)-1, 2, 4-oxadiazole (DDO7232), a novel potent Nrf2/ARE inducer, ameliorates DSS-induced murine colitis and protects NCM460 cells against oxidative stress via ERK1/2 phosphorylation
Jose et al. Redox mechanism of levobupivacaine cytostatic effect on human prostate cancer cells
Feng et al. Metformin enhances radiation response of ECa109 cells through activation of ATM and AMPK
Duan et al. Critical roles for nitric oxide and ERK in the completion of prosurvival autophagy in 4OHTAM-treated estrogen receptor-positive breast cancer cells
Shi et al. Demethoxycurcumin was prior to temozolomide on inhibiting proliferation and induced apoptosis of glioblastoma stem cells
Jiang et al. Catalpol ameliorates doxorubicin‑induced inflammation and oxidative stress in H9C2 cells through PPAR‑γ activation
Zhao et al. Saikosaponin b2 enhances the hepatotargeting effect of anticancer drugs through inhibition of multidrug resistance-associated drug transporters
Shen et al. Cambogin exerts anti-proliferative and pro-apoptotic effects on breast adenocarcinoma through the induction of NADPH oxidase 1 and the alteration of mitochondrial morphology and dynamics
WO2017180063A1 (en) A potential combination therapy using an inhibitor of glucose transport and an intracellular calcium inducer to target cancer metabolism
Breton et al. Combinative effects of β-Lapachone and APO866 on pancreatic cancer cell death through reactive oxygen species production and PARP-1 activation

Legal Events

Date Code Title Description
NENP Non-entry into the national phase

Ref country code: DE

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17782755

Country of ref document: EP

Kind code of ref document: A1

122 Ep: pct application non-entry in european phase

Ref document number: 17782755

Country of ref document: EP

Kind code of ref document: A1