WO2017176796A1 - Compositions and methods for preventing and treating disease - Google Patents
Compositions and methods for preventing and treating disease Download PDFInfo
- Publication number
- WO2017176796A1 WO2017176796A1 PCT/US2017/025995 US2017025995W WO2017176796A1 WO 2017176796 A1 WO2017176796 A1 WO 2017176796A1 US 2017025995 W US2017025995 W US 2017025995W WO 2017176796 A1 WO2017176796 A1 WO 2017176796A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- cell
- albumin
- fragment
- culture medium
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/164—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N25/00—Biocides, pest repellants or attractants, or plant growth regulators, characterised by their forms, or by their non-active ingredients or by their methods of application, e.g. seed treatment or sequential application; Substances for reducing the noxious effect of the active ingredients to organisms other than pests
- A01N25/26—Biocides, pest repellants or attractants, or plant growth regulators, characterised by their forms, or by their non-active ingredients or by their methods of application, e.g. seed treatment or sequential application; Substances for reducing the noxious effect of the active ingredients to organisms other than pests in coated particulate form
- A01N25/28—Microcapsules or nanocapsules
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/10—Animals; Substances produced thereby or obtained therefrom
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/50—Isolated enzymes; Isolated proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P41/00—Drugs used in surgical methods, e.g. surgery adjuvants for preventing adhesion or for vitreum substitution
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P21/00—Preparation of peptides or proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
- C12Q1/025—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Definitions
- kits further comprise calcium and/or a salt thereof for use in increasing secretion of the polypeptide from the bacterial cell into the culture medium.
- the polypeptide is an adenylate cyclase toxin (ACT) polypeptide or a fragment thereof; a pertussis toxin (PT) polypeptide or a fragment thereof; a filamentous hemagglutinin adhesin (FHA) polypeptide or a fragment thereof; a pertactin (PRN) polypeptide or a fragment thereof; a fimbriae 2 (Fim2) polypeptide or a fragment thereof; a fimbriae 3 (Fim3) polypeptide or a fragment thereof; or any combination thereof.
- ACT adenylate cyclase toxin
- PT pertussis toxin
- FHA filamentous hemagglutinin adhesin
- PRN pertactin
- Fim2 fimbriae 2
- Fim3 fimbriae 3
- Figures 2A and 2B are a bar graph and a digital image of a western blot showing that serum elicited a significant increase in amount of total and extracellular Bp ACT.
- Bp UT25 was grown in SSM +/- 10% fetal bovine serum (FBS) for 8 hours.
- the total fraction (black bars) included both culture supernatant and bacterial cells.
- the supernatant (gray bars) was collected after centrifugation.
- AC enzyme activity (expressed as pmoles cAMP/10 minutes/10 l/OD 6 oo) was measured as described in Materials and Methods for the EXAMPLES below and normalized by OD 6 oo- Data represent the mean +/- SD of nine (9) independent experiments.
- Figures 3A and 3B are graphs of AC enzyme activity (expressed as pmoles cAMP/10 minutes/10 ⁇ ) versus time (hours in Figure 3A, minutes in Figure 3B) showing the response to serum was rapid and peaked at 24 hours of growth.
- Bp UT25 was grown in SSM +/- 10% FBS and samples were taken at indicated time points. The supernatant was collected after centrifugation.
- AC enzyme activity was measured as described in Materials and Methods for the EXAMPLES below.
- Figure 3A data represent the mean +/- SD of three (3) independent experiments. Comparisons between enzyme activity +/- FBS at all time points were statistically significant as determined by an unpaired t- test (p ⁇ 0.05).
- Figures 8A and 8B are a bar graph and a digital image of a western blot showing that albumin was required for increased ACT amount during growth in the presence of mouse serum.
- Bp UT25 was grown in
- WP_033452809.1 WP_033452812.1 , WP_015064783.1 , WP_033468323.1 , and WP_033446920.1 , respectively.
- ACT is a single polypeptide of 1706 amino acid residues. It has a calculated molecular weight of about 177 kiloDaltons (kDa), but runs as a protein of approximately 200 kDa when analyzed by SDS-PAGE (Glaser et al., 1988a; Hewlett et al. , 1989; Rogel et al., 1989; Bellalou et al., 1990a). ACT belongs to the RTX (repeats-in-toxin) family of proteins and has two activities (Glaser et al., 1988b).
- the toxin function involves insertion of the adenylate cyclase (AC) catalytic domain into the cytoplasm of host cells, activation by the host protein calmodulin, and conversion of intracellular ATP into cyclic AMP, resulting in dysregulation of signaling processes and depletion of ATP in the intoxicated cell (Hanski, 1989; Gray et al. , 1998).
- AC adenylate cyclase
- synthetic peptides or polypeptides refers to non-naturally occurring peptides and polypeptides. Synthetic peptides and polypeptides can be synthesized, for example, using an automated polypeptide synthesizer. Various solid phase peptide synthesis methods are known to those of skill in the art.
- Recombinant polynucleotide refers to a polynucleotide having sequences that are not naturally joined together.
- An amplified or assembled recombinant polynucleotide may be included in a suitable vector, and the vector can be used to transform a suitable host cell.
- a "recombinant polypeptide” is one which is produced upon expression of a recombinant polynucleotide.
- sample refers preferably to a biological sample from a subject, including, but not limited to, normal tissue samples, diseased tissue samples, biopsies, blood, saliva, feces, semen, tears, and urine.
- a sample can also be any other source of material obtained from a subject which contains cells, tissues, or fluid of interest.
- a sample can also be obtained from cell or tissue culture.
- Standard refers to something used for comparison.
- it can be a known standard agent or compound which is administered and used for comparing results when administering a test compound, or it can be a standard parameter or function which is measured to obtain a control value when measuring an effect of an agent or compound on a parameter or function.
- Standard can also refer to an "internal standard", such as an agent or compound which is added at known amounts to a sample and is useful in determining such things as purification or recovery rates when a sample is processed or subjected to purification or extraction procedures before a marker of interest is measured.
- Internal standards are often a purified marker of interest which has been labeled, such as with a radioactive isotope, allowing it to be distinguished from an endogenous marker.
- a cell in accordance with the presently disclosed subject matter can be any cell, including any bacterial cell, which responds to a sufficient amount of albumin by increasing accumulation one or more polypeptides in the cell, and/or increasing secretion of the one or more polypeptides.
- a cell in accordance with the presently disclosed subject matter can be any cell, including any bacterial cell, which responds to a sufficient amount of calcium to enhance secretion of one or more polypeptides from the cell.
- vaccine antigens include but are not limited to pertussis toxin (PT) polypeptides and/or fragments thereof (see e.g., SEQ ID NOs: 26-35 and 54-
- a library can comprise a random collection of molecules.
- a library can comprise a collection of molecules having a bias for a particular sequence, structure, or conformation. See e.g. , U.S. Patent Nos. 5,264,563 and 5,824,483, herein incorporated by reference. Methods for preparing libraries containing diverse populations of various types of molecules are known in the art, for example as described in U.S. Patents cited herein above. Numerous libraries are also commercially available.
- a candidate compound as identified or prepared herein is used in a method for treating or preventing a disease or disorder in a subject in need thereof.
- the method comprises administering to the subject an effective amount of a molecule that inhibits albumin-induced signaling, thereby treating or preventing a disease or disorder in the subject.
- a candidate compound as identified or prepared herein is used in a method for treating or preventing an infection in a subject in need thereof In some embodiments, the method comprising administering to the subject an effective amount of a molecule that inhibits albumin-induced signaling, thereby treating or preventing an infection in the subject.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Medicinal Chemistry (AREA)
- Veterinary Medicine (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Agronomy & Crop Science (AREA)
- Pest Control & Pesticides (AREA)
- Plant Pathology (AREA)
- Dentistry (AREA)
- Environmental Sciences (AREA)
- Immunology (AREA)
- Virology (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Toxicology (AREA)
- General Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Surgery (AREA)
- Epidemiology (AREA)
- Oncology (AREA)
- Communicable Diseases (AREA)
- Gastroenterology & Hepatology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
Abstract
A method for increasing production of a polypeptide in a bacterial cell in culture is provided. The method can comprise contacting a bacterial cell in a culture medium with an amount of an albumin polypeptide sufficient to induce an increase in accumulation of the polypeptide in the bacterial cell and/or an increase in secretion of the polypeptide from the bacterial cell into the culture medium relative to a bacterial cell grown in a culture medium in the absence of the albumin polypeptide. The bacterial cell can be a Bordetella species cell, optionally wherein the Bordetella species cell is a Bordetella
pertussis cell, a Bordetella bronchiseptica cell or a Bordetella parapertussis cell. Kits, vaccine production methods, screening methods and therapeutic methods are also disclosed.
Description
DESCRIPTION
COMPOSITIONS AND METHODS FOR PREVENTING AND TREATING DISEASE
CROSS-REFERENCE TO RELATED APPLICATION This application claims the benefit of U.S. Provisional Patent Application Serial No. 62/318, 158, filed April 4, 2016, the disclosure of which is incorporated herein by reference in its entirety.
GRANT STATEMENT
This invention was made with government support under Grant No. AI018000 and Contract No. HHSN272201200005C awarded by the National Institutes of Health. The government has certain rights in the invention.
TECHNICAL FIELD
The presently disclosed subject matter relates to compositions and methods for preventing and treating diseases, disorders, and conditions associated with bacterial infection. In some embodiments, the presently disclosed subject matter relates to compositions and methods for increasing production of bacterial polypeptides in order to employ the same in vaccines.
BACKGROUND
Pertussis (whooping cough) is a respiratory illness caused by Bordetella pertussis {Bp) that can be life-threatening, especially in infants. In 2012, the number of cases of whooping cough in the United States was the highest since 1960 despite high vaccine coverage (Warfel & Edwards, 2015). The limited duration of protection by acellular pertussis vaccines is a major factor in the resurgence of pertussis (Cherry, 2013).
There are several acellular pertussis vaccines (aPVs) that have used in the United States and other countries, such as DAPTACEL® brand (Sanofi
Pasteur, Swiftwater, Pennsylvania, United States of America), TRIPEDIA® brand (Sanofi Pasteur, Swiftwater, Pennsylvania, United States of America) and INFANRIX® brand (GlaxoSmithKline, Research Triangle Park, North
Carolina, United States of America), which are generally produced by purification of various antigens from B. pertussis grown in culture. After purification, fractions containing select antigens, generally pertussis toxin (PT)
and filamentous haemagglutinin adhesin (FHA), have been combined and treated to inactivate PT to produce the vaccines. The process of purification and inactivation of Bp antigens is expensive and time-consuming, and although attempts have been made to produce antigens by recombinant means, no fully recombinant anti-Sp vaccines are currently available in the United States.
Disclosed herein are compositions and methods that can be employed to increase the production of bacterial antigens including but not limited to B. pertussis antigens, thereby increasing the ease of purification and thus availability of said antigens.
SUMMARY
This Summary lists several embodiments of the presently disclosed subject matter, and in many cases lists variations and permutations of these embodiments. This Summary is merely exemplary of the numerous and varied embodiments. Mention of one or more representative features of a given embodiment is likewise exemplary. Such an embodiment can typically exist with or without the feature(s) mentioned; likewise, those features can be applied to other embodiments of the presently disclosed subject matter, whether listed in this Summary or not. To avoid excessive repetition, this Summary does not list or suggest all possible combinations of such features.
In some embodiments, the presently disclosed subject matter provides methods for increasing production of polypeptide in bacterial cells in culture. In some embodiments, the methods comprise contacting a bacterial cell in a culture medium with an amount of an albumin polypeptide sufficient to induce an increase in accumulation of the polypeptide in the bacterial cell and/or an increase in secretion of the polypeptide from the bacterial cell into the culture medium relative to a bacterial cell grown in a culture medium in the absence of the albumin polypeptide. In some embodiments, the bacterial cell is a Bordetella species cell, optionally wherein the Bordetella species cell is a Bordetella pertussis cell, a Bordetella bronchiseptica cell or a Bordetella parapertussis cell. In some embodiments, the polypeptide is a Bp adenylate cyclase toxin (ACT) polypeptide or a fragment thereof; pertussis toxin (PT) polypeptide or a fragment thereof; Bp filamentous hemagglutinin adhesin
(FHA) polypeptide or a fragment thereof; Bp pertactin (PRN) polypeptide or a fragment thereof; Bp fimbriae 2 (Fim2) polypeptide or a fragment thereof; Bp fimbriae 3 (Fim3) polypeptide or a fragment or thereof; or a combination thereof. In some embodiments, the culture medium comprises sufficient calcium to enhance secretion of the polypeptide from the bacterial cell into the culture medium. In some embodiments, the concentration of calcium in the culture medium is at least about 0.15 mM, 0.2 mM, 0.3 mM, 0.4 mM, or 0.5 mM. In some embodiments, the amount of the albumin polypeptide is at least 0.2 mg/ml, 0.3 mg/ml, 0.4 mg/ml, or 0.5 mg/ml in the culture medium.
The presently disclosed subject matter also provides in some embodiments kits comprising albumin and instructions for its use in increasing accumulation of a polypeptide in a bacterial cell in a culture medium and/or for increasing secretion of the polypeptide from the bacterial cell into a culture medium. In some embodiments, the bacterial cell is a Bordetella species cell, optionally wherein the Bordetella species cell is a Bordetella pertussis cell, a Bordetella bronchiseptica cell, or a Bordetella parapertussis cell. In some embodiments, the polypeptide is an adenylate cyclase toxin (ACT) polypeptide or a fragment thereof; pertussis toxin (PT) polypeptide or a fragment thereof; filamentous hemagglutinin adhesin (FHA) polypeptide or a fragment thereof; pertactin (PRN) polypeptide or a fragment thereof; fimbriae 2 (Fim2) polypeptide or a fragment thereof; fimbriae 3 (Fim3) polypeptide or a fragment thereof; or a combination thereof. In some embodiments, the polypeptide is a Bp polypeptide.
In some embodiments, the kits further comprise calcium and/or a salt thereof for use in increasing secretion of the polypeptide from the bacterial cell into the culture medium.
In some embodiments, the kits further comprise a ligand adapted for removing the albumin from the culture medium. In some embodiments, the ligand binds specifically to the albumin when the albumin is present in the culture medium. In some embodiments, the ligand is an antibody or a fragment or derivative thereof. In some embodiments, the ligand comprises a bead, optionally a magnetic bead, to which the albumin is directly or indirectly conjugated. In some embodiments, the albumin is indirectly conjugated to the
bead via a tether, optionally wherein the tether comprising an antibody or a fragment or derivative thereof that specifically binds to the albumin and is conjugated to the bead.
In some embodiments, the presently disclosed subject matter also provides methods for screening for molecules that inhibit albumin-induced signaling in bacterial cells. In some embodiments, the methods comprise contacting a bacterial cell growing in a culture medium with a candidate compound, wherein the culture medium comprises at least 0.5 mM calcium, optionally 0.5-2.0 mM calcium, and at least 0.2 mg/ml albumin, optionally at least 0.5 mg/ml albumin; and comparing accumulation of a gene product in the culture medium in presence of the candidate compound to accumulation of the gene product in the culture medium in absence of the candidate compound, wherein reduced accumulation of the gene product in the culture medium in presence of the candidate compound as compared to in absence of the candidate compound is indicative of the candidate compound being a molecule that inhibits albumin-induced signaling in the bacterial cell.
In some embodiments, the presently disclosed subject matter also provides methods for screening for molecule that inhibit albumin-induced signaling in bacterial cells, wherein the method comprises contacting a bacterial cell growing in a culture medium with a candidate compound, wherein the culture medium comprises less than about 0.5 mM calcium, optionally less than about 0.4 mM calcium, optionally less than about 0.3 mM calcium, and optionally less than about 0.2 mM calcium, and at least about 0.2 mg/ml, 0.3 mg/ml, 0.4 mg/ml, 0.5 mg/ml albumin; and comparing accumulation of a gene product in the bacterial cell in presence of the candidate compound to accumulation of the gene product in the bacterial cell in absence of the candidate compound, wherein reduced accumulation of the gene product in the bacterial cell in presence of the candidate compound as compared to in absence of the candidate compound is indicative of the candidate compound being a molecule that inhibits albumin-induced signaling in the bacterial cell.
In some embodiments of the screening methods, the bacterial cell is a
Bordetella species cell, optionally wherein the Bordetella species cell isa
Bordeteiia pertussis cell, a Bordeteiia bronchiseptica cell, or a Bordeteiia parapertussis cell. In some embodiments, the polypeptide is an adenylate cyclase toxin (ACT) polypeptide or a fragment thereof; a pertussis toxin (PT) polypeptide or a fragment thereof; a filamentous hemagglutinin adhesin (FHA) polypeptide or a fragment thereof; a pertactin (PRN) polypeptide or a fragment thereof; a fimbriae 2 (Fim2) polypeptide or a fragment thereof; a fimbriae 3 (Fim3) polypeptide or a fragment thereof; or any combination thereof. In some embodiments, one or more of the ACT, PT, FHA, PRN, Fim2, and/or Fim3 polypeptides or fragments thereof are Bp polypeptides or fragments thereof. In some embodiments, the candidate compound is a fragment of an albumin polypeptide. In some embodiments, the candidate compound is an antibody or a small molecule.
In some embodiments, the presently disclosed subject matter provides methods for treating or preventing bacterial infections in subjects in need thereof. In some embodiments, the methods comprise administering to a subject an effective amount of a molecule that inhibits albumin-induced signaling, thereby treating or preventing a bacterial infection in the subject. In some embodiments, the bacteria is a Bordeteiia species, optionally wherein the Bordeteiia species is Bordeteiia pertussis, Bordeteiia bronchiseptica, or Bordeteiia parapertussis
The presently disclosed subject matter also provides methods for producing vaccine components. In some embodiments, the methods comprise growing bacterial cells in a culture medium comprising a sufficient concentration of albumin to induce an increase in accumulation of the polypeptide in the cells and/or secretion of the polypeptide from the cells into the culture medium; and isolating the polypeptide from the cells and/or the culture medium, whereby a vaccine component is produced. In some embodiments, the bacterial cells comprise a Bordeteiia species cell, optionally wherein the Bordeteiia species cell is a Bordeteiia pertussis cell, a Bordeteiia bronchiseptica cell or a Bordeteiia parapertussis cell. In some embodiments, the polypeptide is an adenylate cyclase toxin (ACT) polypeptide or a fragment thereof; a pertussis toxin (PT) polypeptide or a fragment thereof; a filamentous hemagglutinin adhesin (FHA) polypeptide or a fragment thereof; a
pertactin (PRN) polypeptide or a fragment thereof; a fimbriae 2 (Fim2) polypeptide or a fragment thereof; a fimbriae 3 (Fim3) polypeptide or a fragment thereof; or any combination thereof. In some embodiments, one or more of the ACT, PT, FHA, PRN, Fim2, and/or Fim3 polypeptides or fragments thereof are Bp polypeptides or fragments thereof. In some embodiments, the presently disclosed methods further comprise inactivating the polypeptide or the fragment or thereof. In some embodiments the culture medium comprises at least about 0.2 mg/ml, 0.3 mg/ml, 0.4 mg/ml, or 0.5 mg/ml albumin. In some embodiments, the culture medium comprises at least about 0.2 mM, 0.3 mM, 0.4 mM, or 0.5 mM calcium. In some embodiments, the polypeptide is purified from the culture medium using a ligand that binds to the polypeptide. In some embodiments, the ligand is an antibody or a fragment or derivative thereof. In some embodiments, the ligand comprises a bead, optionally a magnetic bead, to which the ligand or the fragment or derivative thereof is directly or indirectly conjugated. In some embodiments, the ligand is indirectly conjugated to the bead via a tether, optionally wherein the tether comprises polyethylene glycol.
In some embodiments, the presently disclosed methods further comprise combining the polypeptide with one or more additional polypeptides to produce an antigen pool to be employed in a vaccine. In some embodiments, the one or more additional polypeptides are selected from the group consisting of a pertussis toxin (PT), a filamentous hemagglutinin adhesin (FHA), a pertactin (PRN), a fimbriae 2 (Fim2), a fimbriae 3 (Fim3), a diphtheria toxoid, a tetanus toxoid, a polio antigen, a Haemophilus influenzae type b antigen, a HepB antigen, or any combination thereof. In some embodiments, one or more of the ACT, PT, FHA, PRN, Fim2, and/or Fim3 polypeptides or fragments thereof are Bp polypeptides or fragments thereof.
In some embodiments, the presently disclosed methods further comprise adding one or more pharmaceutically acceptable carriers and/or excipients, thereby producing a vaccine. In some embodiments, the vaccine is in the form of an injectable or an aerosol.
Various aspects and embodiments of the presently disclosed subject matter are described in further detail below.
These and other aspects and embodiments which will be apparent to those of skill in the art upon reading the specification provide the art with immunological tools and agents useful for diagnosing, prognosing, monitoring, and/or treating human cancers.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 is a graph of AC enzymatic activity (expressed as pmoles cAMP/10 minutes/10 μΙ) versus time (hours) used to convert enzyme activity measurements to milliUnits/ml (mU/ml). Bp UT25 was grown in Stainer- Scholte medium (SSM; Stainer & Scholte, 1970) with (black squares) or without (black triangles) 10% fetal bovine serum (FBS) and samples were taken at indicated time points. The total fraction included both culture supernatant and bacterial cells. Adenylate cyclase (AC) enzyme activity was measured as described in Materials and Methods for the EXAMPLES below. Data represent the mean +/- standard deviation (SD) calculated using GraphPad Prism 7 software of three (3) independent experiments and is the same data presented in Figure 2A. One unit is defined as 1 pmol of cAMP formed in 1 minute at pH 8 at 30°C.
Figures 2A and 2B are a bar graph and a digital image of a western blot showing that serum elicited a significant increase in amount of total and extracellular Bp ACT. Bp UT25 was grown in SSM +/- 10% fetal bovine serum (FBS) for 8 hours. The total fraction (black bars) included both culture supernatant and bacterial cells. The supernatant (gray bars) was collected after centrifugation. In Figure 2A, AC enzyme activity (expressed as pmoles cAMP/10 minutes/10 l/OD6oo) was measured as described in Materials and Methods for the EXAMPLES below and normalized by OD6oo- Data represent the mean +/- SD of nine (9) independent experiments. A student's t-test was used to determine statistical significance. ***p < 0.0001 . Figure 2B is a digital image of western blot analysis using a rabbit polyclonal anti-ACT antibody, detecting the approximately 200 kDa ACT protein. FBS: fetal bovine serum. -: no FBS. +: 10% FBS included.
Figures 3A and 3B are graphs of AC enzyme activity (expressed as pmoles cAMP/10 minutes/10 μΙ) versus time (hours in Figure 3A, minutes in Figure 3B) showing the response to serum was rapid and peaked at 24 hours
of growth. Bp UT25 was grown in SSM +/- 10% FBS and samples were taken at indicated time points. The supernatant was collected after centrifugation. AC enzyme activity was measured as described in Materials and Methods for the EXAMPLES below. In Figure 3A, data represent the mean +/- SD of three (3) independent experiments. Comparisons between enzyme activity +/- FBS at all time points were statistically significant as determined by an unpaired t- test (p < 0.05). Comparisons between bacterial density +/- FBS were statistically significant (p < 0.05) at 8, 16, 24, and 32 hours. Solid triangles: AC enzyme activity in SSM minus FBS. Solid squares: AC enzyme activity in SSM + 10% FBS. Solid lines: OD60o in SSM minus FBS. Dott lines: OD60o in SSM + 10% FBS. In Figure 3B, data represent the mean +/- SD of two (2) independent experiments done in duplicate. The total fraction included both culture supernatant and bacterial cells. The supernatant was collected after centrifugation. Open circles: AC enzyme activity in the supernatant for cells grown in SSM minus FBS. Solid circles: total AC enzyme activity for cells grown in SSM + 10% FBS. Open squares: AC enzyme activity in the supernatant for cells grown in SSM + 10% FBS. Solid squares: total AC enzyme activity for cells grown in SSM + 10% FBS.
Figure 4 is a bar graph showing that albumin and calcium acted synergistically to increase ACT production and secretion. Bp UT25 was grown in SSM +/- 2 mg/ml BSA, 2 mM CaCI2, and/or 10% FBS (as indicated) for 8 hours. The total fraction (black bars) included both culture supernatant and bacterial cells. The supernatant (gray bars) was collected after centrifugation. AC enzyme activity (expressed as pmoles cAMP/10 minutes/10 μΙ/Οϋ6οο) was measured as described in Materials and Methods for the EXAMPLES below and normalized by OD6oo- Data represent the mean +/- SD of three (3) independent experiment done in duplicate. Statistical significance was assessed using a two-way ANOVA. **p < 0.01 ; ***p < 0.001 as compared to growth in SSM.
Figure 5 is a bar graph showing that albumin and calcium-stripped albumin had equivalent effects on ACT amount and release. Bp UT25 was grown in SSM +/- 2 mg/ml BSA or EGTA-treated BSA for 8 hours. The total fraction (black bars) included both culture supernatant and bacterial cells. The
supernatant (gray bars) was collected after centrifugation. AC enzyme activity (expressed as pmoles cAMP/10 minutes/10 μΙ/Οϋ6οο) was measured as described in Materials and Methods for the EXAMPLES below and normalized by OD6oo- Data represent the mean +/- SD of three (3) independent experiments done in duplicate. Statistical significance was assessed using a two-way ANOVA, and comparisons between SSM+BSA and SSM+EGTA- treated BSA were not significantly different.
Figure 6 is a graph of AC enzyme activity (expressed as pmoles cAMP/10 minutes/10 μΙ/Οϋ6οο) versus calcium concentration (in mM) showing that the maximum effect on ACT amount and release required a minimum of 0.5 mM calcium. Bp UT25 was grown in SSM with 2 mg/ml BSA with indicated concentrations of total calcium for 8 hours. The total fraction (solid line and solid black circle) included both culture supernatant and bacterial cells. The supernatant (dashed line and open circle) was collected after centrifugation. AC enzyme activity was measured as described in Materials and Methods for the EXAMPLES below and normalized by OD6oo- Data presented are the mean +/- SD of a single experiment done in duplicate but representative of four (4) similar experiments.
Figure 7 is a digital image of a Coomassie blue-stained SDS-PAGE gel showing that serum collected from analbuminemic mice lacked albumin. Wild- type C56BL/6 mouse serum or ALB-/- mouse serum were analyzed by SDS- PAGE and Coomassie staining to detect protein profiles. The band corresponding to albumin in the wild-type sample is indicated with an arrow.
Figures 8A and 8B are a bar graph and a digital image of a western blot showing that albumin was required for increased ACT amount during growth in the presence of mouse serum. In Figure 8A, Bp UT25 was grown in
SSM +/- wild-type C56BL/6 mouse serum or ALB" " mouse serum +/- 2 mg/ml
BSA, all with 2 mM CaCI2, for 8 hours. The total fraction (black bars) included both culture supernatant and bacterial cells. The supernatant (gray bars) was collected after centrifugation. AC enzyme activity (expressed as pmoles cAMP/10 minutes/10 l/OD6oo) was measured as described in Materials and
Methods for the EXAMPLES below and normalized by OD6oo- Data represent the mean +/- SD of three (3) independent experiments done in duplicate.
Statistical significance was assessed using a two-way ANOVA. ***p < 0.001 as compared to growth in SSM. Figure 8B shows the results of western blot analysis using a rabbit polyclonal anti-ACT antibody, detecting the approximately 200 kDa ACT protein. SSM: growth in SSM without added serum. SSM + WT serum: growth in SSM plus wild-type C56BL/6 mouse serum. SSM + ALB-/- serum: growth in SSM plus albumin-minus (Alb-/-) mouse serum. S: supernatant. T: total. a-ACT: anti-ACT.
Figure 9 is a graph of AC enzyme activity (expressed as pmoles cAMP/10 minutes/10 μΙ/Οϋ6οο) versus albumin concentration (in mg/ml) showing that human serum (Total HS: dashed line and solid black squares) and human serum albumin (Total HSA: solid line and solid black circles) increased ACT amount and shifted localization of ACT to the supernatant. Bp UT25 was grown in SSM +/- HS or HSA (as indicated), all with 2 mM CaCI2, for 8 hours. The total fraction included both culture supernatant and bacterial cells. AC enzyme activity was measured as described in Materials and Methods for the EXAMPLES below and normalized by OD6oo- Data represent the mean +/- SD of two (2) independent experiments done in duplicate.
Figures 10A and 10B are bar graphs showing that the regulation of cyaA during growth +/- HSA was not occurring at the level of transcription through the Bvg two-component system. In Figure 10A, RNA was isolated from Bp UT25 grown in SSM alone (black bars), SSM + 2 mg/ml HSA (dark gray bars), and SSM + 40 mM MgS04 (light gray bars) with 2 mM calcium for 4 hours. Expression of target genes was determined using the relative quantification method and shown as relative fold expression on the y-axis. Statistical significance was analyzed by an unpaired t-test. Data represent the mean +/- SD of three (3) independent experiments. ***p < 0.001 as compared to growth in SSM. cyaA: Bp adenylate cyclase. bvgA: Bp transcriptional regulator BvgA. ptxA: Bp pertussis toxin subunit 1 precursor. ptxA: Bp pertussis toxin subunit 1 precursor. fhaB: Bp filamentous hemagglutinin/adhesin. In Figure 10B, Bp UT25 was grown in SSM with calcium +/- 2 mg/ml HSA and/or 40 mM MgS04 for 4 hours (same conditions and cultures that were used for RNA expression analyses). AC enzyme activity (expressed as pmoles cAMP/10 minutes/10 l/OD6oo) was measured
in the total fraction as described in Materials and Methods for the EXAMPLES below and normalized by OD6oo- Data represent the mean +/- SD of three (3) independent experiments done in duplicate. ***p < 0.001 as compared to growth in SSM alone; ###p < 0.001 as compared to growth in SSM + MgS04. SSM: growth in SSM without added serum. SSM + HSA: growth in SSM plus human serum albumin. SSM + MgS04: growth in SSM plus 40 mM magnesium sulfate. SSM + MgS04 + HAS: growth in SSM plus 40 mM magnesium sulfate and 2 mg/ml human serum albumin.
Figure 1 1 is a bar graph showing that transcription of genes encoded in the cya operon is not altered +/- HSA. RNA was isolated from Bp UT25 grown in SSM alone (black bars), SSM + 2 mg/ml HSA (dark gray bars), or SSM + 40 mM MgS04 (light gray bars) with 2 mM calcium for 4 hours. Expression of target genes was determined using the relative quantification method. Statistical significance was analyzed by an unpaired t-test. Data represent the mean +/- SD of three (3) independent experiments. **p < 0.01 ; ***p < 0.001 as compared to growth in SSM. cyaB: Bp cyclolysin secretion ATP-binding protein cyaA. cyaD: Bp cyclolysin secretion cyaD protein. cyaE: Bp cyclolysin secretion cyaE protein. cyaX: Bp cyaX protein. cyaC: Bp cyclolysin-activating lysine-acyltransferase.
Figure 12 is a digital image of a composite of the results of western blow analyses showing that respiratory secretions, isolated by bronchoalveolar lavage (BAL), contained albumin. BAL was performed on 7 patients with interstitial lung disease or bronchiectasis, and the resulting samples were pooled and concentrated as described in Materials and Methods for the EXAMPLES. SSM + BAL , SSM + 2.3 mg/ml HSA, and 5% HS samples were analyzed by western blotting with an anti-BSA antibody as well as SDS-PAGE and Coomassie staining to detect protein profiles and confirm the presence of albumin. The amount of albumin present in the pooled BAL sample was determined to be approximately 2.0 mg/ml by SDS- PAGE using purified HSA as a standard over a range of concentrations and confirmed by western blot analyses with an anti-BSA antibody to be comparable to the amount of albumin present in 5% HS. Molecular weights of known components of serum and respiratory secretions: albumin (66 kDa),
gammaglobulin heavy chains (55-60 kDa), and gammaglobulin light chains (25-28 kDa). BAL: SSM + BAL. 2.3 mg/ml HSA: SSM + 2.3 mg/ml human serum albumin. 5% HS: SSM + 5% human serum.
Figures 13A and 13B are a bar graph and digital image of a western blot, respectively, showing that respiratory secretions increased total and extracellular ACT amount. In Figure 13A, Bp UT25 was grown in SSM + saline, SSM + BAL (described in Figure 12), SSM + 5% HS, or SSM + 2 mg/ml HSA, all with 2 mM CaC , for 8 hours. The total fraction (black bars) included both culture supernatant and bacterial cells. The supernatant (gray bars) was collected after centrifugation. AC enzyme activity (expressed as pmoles cAMP/10 minutes/10 l/OD6oo) was measured as described in Materials and Methods for the EXAMPLES below and normalized by OD6oo- Data represent the mean +/- SD of two (2) independent experiments done in duplicate. Statistical significance was assessed using a two-way ANOVA. ***p < 0.001 as compared to growth in SSM. Figure 13B is a western blot of Bp UT25 grown in SSM +/- saline, BAL, 2 mg/ml HSA, or 5% HS, all with 2 mM CaC , using a rabbit polyclonal anti-ACT antibody, showing detection of the approximately 200 kDa ACT protein. SSM: SSM alone. SSM + BAL: SSM plus concentrated BAL, as described in Figure 12. SSM + 5% HS: SSM plus 5% human serum. SSM + HAS: SSM plus 2 mg/ml human serum albumin.
Figure 14 is a graph of percent viable cells versus AC enzyme activity (expressed as pmoles cAMP/10 minutes/10 μΙ) showing that extracellular ACT produced during growth with respiratory secretions was a functional toxin. J774 cells were incubated with the supernatant from growth of Bp UT25 in SSM + BAL (black circles) or rACT (black squares; normalized to equivalent enzyme activity) for 3 hours at 37°C. The number of viable cells was calculated using the CCK8 assay (see Materials and Methods for the EXAMPLES ). Data represent the mean +/- one (1 ) SD of a single experiment done in triplicate, which was representative of three (3) additional experiments.
Figure 15 is a bar graph of AC enzyme activity (expressed as pmoles cAMP/10 minutes/10 μΙ) showing that albumin increases intracellular ACT in a strain that is unable to secrete ACT due to deletion of the Type I Secretion
System (T1 SS). Bp UT25 A T1SS was grown in SSM alone (SSM), SSM supplemented with 2 mM calcium (SSM + Ca), SSM supplemented with 2 mg/ml BSA (SSM + BSA), or SSM supplemented with both 2 mM calcium and 2 mg/ml BSA (SSM + BSA + Ca) for 2 hours. The supernatantsupernatants (light gray bars; level too low to show in Figure 15) were collected after centrifugation. The pellet was treated with 4M urea for 20 minutes at room temperature, and then the supernatant was collected after centrifugation as the surface-associated ACT fraction (dark gray bars). The resulting pellet was then solubilized with 8M urea to isolate the intracellular ACT fraction (black bars). AC enzyme activity was measured and normalized by OD6oo- Data represent the mean +/- SD of two (2) independent experiments done in duplicate. Statistical significance was assessed using a 2-way ANOVA. *** p < 0.001 as compared to growth in SSM.
Figure 16 is a digital image of a western blot demonstrating that albumin binds to Bp in a Bvg-dependent manner. Bp strains (UT25, BP338, BP348, and BP347) were grown in SSM with 2 mM calcium +/- 2 mg/ml BSA (as indicated) for 6 hours. The bacteria were then extensively washed (7 wash steps with three changes to fresh tubes to eliminate carry-over albumin not bound to the bacterial surface) with SSM (without calcium or albumin). Purified BSA was loaded as a positive control (400 ng). Samples were normalized by bacterial density and analyzed by western blotting with an anti- BSA antibody. Data represent a single experiment which was representative of three (3) additional experiments.
Figure 17 is a digital image of a western blot showing the effect of albumin on amount and localization of filamentous hemagglutinin (FHA) and pertussis toxin (PT). Bp UT25 was grown in SSM with 2 mM calcium +/- 0.46 mg/ml or 4.6 mg/ml HSA (as indicated) for 8 hours. The total fraction (T) included both culture supernatant and bacterial cells. The supernatant (S) was collected after centrifugation. Samples were normalized by bacterial density and analyzed by western blotting with a rabbit polyclonal anti-FHA or anti-PT antibody. Data represent a single experiment which was representative of two (2) additional experiments
BRIEF DESCRIPTION OF THE SEQUENCE LISTING
SEQ ID NO: 1 is an amino acid sequence of a Bordetella pertussis ACT holoenzyme polypeptide. It corresponds to Accession No. NP_879578.1 in the GENBANK® biosequence database.
SEQ ID NO: 2 is an amino acid sequence of a Bordetella pertussis AC
Domain polypeptide. It corresponds to amino acids 1 -400 of SEQ ID NO: 1 .
SEQ ID NOs: 3 and 4 are amino acid sequences of the T25 and T18 peptides, respectively, derived from the Bordetella pertussis AC Domain polypeptide of SEQ ID NO: 1 . They correspond to amino acids 1 -225 and 226-400 of SEQ ID NO: 1 , respectively.
SEQ ID NO: 5 is an amino acid sequence of an inactivated Bordetella pertussis AC Domain polypeptide. The polypeptide has been inactivated by substituting the aspartic acid at amino acid 188 of SEQ ID NO: 1 with a cysteine and the isoleucine at amino acid 189 of SEQ ID NO: 1 with a threonine.
SEQ ID NOs: 6-25 are the nucleotide sequences of the primers listed in Table 1.
SEQ ID NOs: 26-30 are the amino acid sequences of subunits 1 -5, respectively, of a Bordetella pertussis PT polypeptide. SEQ ID NOs: 26-30 correspond to GENBANK® biosequence database Accession Nos.
NP_882282.1 , NP_882283.1 , NP_882286.1 , NP_882284.1 , and
NP_882285.1 , respectively.
SEQ ID NOs: 31 -35 are the amino acid sequences of subunits 1 -5, respectively, of a Bordetella bronchiseptica PT polypeptide. SEQ ID NOs: 31 - 35 correspond to GENBANK® biosequence database Accession Nos.
WP_033452809.1 , WP_033452812.1 , WP_015064783.1 , WP_033468323.1 , and WP_033446920.1 , respectively.
SEQ ID NOs: 36 and 37 are the amino acid sequences of FHA polypeptides from Bordetella pertussis and Bordetella bronchiseptica, respectively. SEQ ID NOs: 36 and 37 correspond to GENBANK® biosequence database Accession Nos. NP_880571 .1 and YP_006966876.1 , respectively.
SEQ ID NOs: 38 and 39 are the amino acid sequences of Fim2 and
Fim3 polypeptides, respectively, from Bordetella pertussis. SEQ ID NOs: 38 and 39 correspond to GENBANK® biosequence database Accession Nos. NP_879898.1 and NP_880302.1 , respectively.
SEQ ID NOs: 40 and 41 are the amino acid sequences of Fim2 and Fim3 polypeptides, respectively, from Bordetella bronchiseptica. SEQ ID NOs: 40 and 41 correspond to GENBANK® biosequence database Accession Nos. YP_006967303.1 and YP_006967865.1 , respectively.
SEQ ID NOs: 42 and 43 are the amino acid sequences of PRN polypeptides from Bordetella pertussis and Bordetella bronchiseptica, respectively. SEQ ID NOs: 42 and 43 correspond to GENBANK® biosequence database Accession Nos. NP_879839.1 and WP_033839724.1 , respectively.
SEQ ID NO: 44 is an amino acid sequence of a Bordetella bronchiseptica ACT holoenzyme polypeptide. SEQ ID NO: 44 corresponds to Accession No. WP_080702041 .1 in the GENBANK® biosequence database.
SEQ ID NO: 45 is an amino acid sequence of a Bordetella bronchiseptica AC Domain polypeptide. SEQ ID NO: 45 corresponds to amino acids 1 -400 of SEQ ID NO: 44.
SEQ ID NOs: 46 and 47 are amino acid sequences of the T25 and T18 peptides, respectively, derived from the Bordetella bronchiseptica AC Domain polypeptide of SEQ ID NO: 1 . SEQ ID NOs: 46 and 47 correspond to amino acids 1 -225 and 226-400 of SEQ ID NO: 1 , respectively.
SEQ ID NO: 48 is an amino acid sequence of an inactivated Bordetella bronchiseptica AC Domain polypeptide. The polypeptide has been inactivated by substituting the aspartic acid at amino acid 188 of SEQ ID NO: 44 with a cysteine and the isoleucine at amino acid 189 of SEQ ID NO: 44 with a threonine.
SEQ ID NO: 49 is an amino acid sequence of a Bordetella parapertussis ACT holoenzyme polypeptide (hemolysin). SEQ ID NO: 49 corresponds to Accession No. WP_010927405.1 in the GENBANK® biosequence database.
SEQ ID NO: 50 is an amino acid sequence of a Bordetella parapertussis AC Domain polypeptide. SEQ ID NO: 50 corresponds to amino
acids 35-434 of SEQ ID NO: 49.
SEQ ID NOs: 51 and 52 are amino acid sequences of the T25 and T18 peptides, respectively, derived from the Bordetella parapertussis AC Domain polypeptide of SEQ ID NO: 49. SEQ ID NOs: 51 and 52 correspond to amino acids 35-249 and 250-434 of SEQ ID NO: 49, respectively.
SEQ ID NO: 53 is an amino acid sequence of an inactivated Bordetella parapertussis AC Domain polypeptide. The polypeptide has been inactivated by substituting the aspartic acid at amino acid 222 of SEQ ID NO: 49 with a cysteine and the isoleucine at amino acid 223 of SEQ ID NO: 49 with a threonine.
SEQ ID NOs: 54-58 are the amino acid sequences of subunits 1 -5, respectively, of a Bordetella parapertussis PT polypeptide. SEQ ID NOs: 54- 58 correspond to GENBANK® biosequence database Accession Nos. WP_010929490.1 , YP_006898153.1 , YP_006898156.1 , YP_006898154.1 , and YP_006898155.1 , respectively.
SEQ ID NO: 59 is the amino acid sequence of an FHA polypeptide from Bordetella parapertussis. SEQ ID NO: 59 corresponds to GENBANK® biosequence database Accession No. YP_006896577.1 .
SEQ ID NOs: 60 and 61 are the amino acid sequences of Fim2 and Fim3 polypeptides, respectively, from Bordetella parapertussis. SEQ ID NOs: 60 and 61 correspond to GENBANK® biosequence database Accession Nos. YP_006895663.1 and YP_006895400.1 , respectively.
SEQ ID NO: 62 is the amino acid sequence of a PRN polypeptide from Bordetella parapertussis. SEQ ID NO: 62 corresponds to GENBANK® biosequence database Accession No. YP_006897297.1 .
DETAILED DESCRIPTION ACT is a single polypeptide of 1706 amino acid residues. It has a calculated molecular weight of about 177 kiloDaltons (kDa), but runs as a protein of approximately 200 kDa when analyzed by SDS-PAGE (Glaser et al., 1988a; Hewlett et al. , 1989; Rogel et al., 1989; Bellalou et al., 1990a). ACT belongs to the RTX (repeats-in-toxin) family of proteins and has two activities (Glaser et al., 1988b). The toxin function involves insertion of the adenylate cyclase (AC) catalytic domain into the cytoplasm of host cells,
activation by the host protein calmodulin, and conversion of intracellular ATP into cyclic AMP, resulting in dysregulation of signaling processes and depletion of ATP in the intoxicated cell (Hanski, 1989; Gray et al. , 1998). At higher concentrations, ACT undergoes oligomerization to form pores in the target cell membrane (Gray et al., 1998; Basler et al., 2006; Vojtova- Vodolanova er a/., 2009); these pores are responsible for hemolysis during Bp growth on Bordet-Gengou agar (Ehrmann et al., 1992). The repeat regions in the RTX domain bind calcium, and calcium-binding induces conformational changes that are critical for efficient secretion and toxin activity (Hewlett et al., 1991 ; Rose et al., 1995; Rhodes et al., 2001 ; Chenal et al., 2009; Chenal et al., 2010; Bumba er a/. , 2016). ACT uses the β2 integrin, CD1 1 b/CD18, as its receptor (Guermonprez et al. , 2001 ; Eby et al., 2012), suggesting that a primary role for ACT in the pathogenesis of pertussis is inhibition of the functions of CD1 1 b/CD18-expressing myeloid leukocytes (including neutrophils, monocytes, macrophages, and dendritic cells), which are involved in the clearance of Bp (Mattoo & Cherry, 2005; Carbonetti, 2010; Eby et al., 2012; Eby er a/., 2015).
ACT is encoded within the cya operon that includes the structural gene cyaA, as well as cyaB, cyaD, and cyaE encoding the Type 1 Secretion System (T1 SS) by which it is secreted, the acyl transferase cyaC which is responsible for post-translational acylation, and cyaX, of unknown function but annotated as a LysR-family transcriptional regulator (Glaser et al., 1988b; Betsou et al., 1993; Thomas et al., 2014). Expression of cyaA, as well as other Bp factors critical to establishing infection, is controlled by the Bvg two- component regulatory system, which has been described as the master transcriptional regulator of virulence in Bordetellae (Arico et al., 1989; Cotter & Jones, 2003; Melvin et al., 2014). To initiate transcription of the Bvg regulon, the sensor kinase BvgS phosphorylates the response regulator BvgA, which binds to promoter elements upstream of target genes (Boucher et al., 1994; Boucher & Stibitz, 1995; Steffen et al., 1996; Boucher et al., 1997). The default operation of this regulatory system appears to be in the "on" position, since the only signals that have been identified are those that decrease expression of target genes, for example magnesium sulfate (MgS04) or a shift
in temperature from 37°C to 25°C (Melton & Weiss, 1989). A Bvg-activated state, promoting transcription of cyaA, is required and sufficient for infection (Cotter & Miller, 1994).
During in vitro growth in SSM, ACT is primarily associated with the bacterial cell surface (Hewlett et al., 1976; Confer & Eaton, 1982; Bellalou et al., 1990a; Zaretzky et al. , 2002); however, it was shown previously that it is the released, not surface-associated, ACT that is responsible for increasing cAMP and causing cytotoxicity (Gray et al., 2004). This is consistent with the study of nasal washes from humans with pertussis and from infected baboons, showing that ACT is virtually all in the released form in vivo (Eby et al., 2013). These observations together support the concept that released ACT is the active and most relevant molecule during infection and suggest that the in vitro conditions currently in use to study ACT and other components of pertussis pathogenesis are not representative of the environment within the host. While seeking to understand the differences between culture conditions in vitro and the environment within the host respiratory tract, it was noted that ACT was also primarily in the supernatant when Bp is studied in vitro with eukaryotic cells (Eby et al., 2013). Under these conditions, Bp is exposed to tissue culture media supplemented with 10% heat-inactivated fetal bovine serum. Since serum components are present in respiratory secretions, this led to the hypothesis that one or more molecules in serum might promotes ACT release into the culture medium. The testing of this hypothesis yielded the data presented herein.
The presently disclosed subject matter now will be described more fully hereinafter, in which some, but not all embodiments of the presently disclosed subject matter are described. Indeed, the presently disclosed subject matter can be embodied in many different forms and should not be construed as limited to the embodiments set forth herein; rather, these embodiments are provided so that this disclosure will satisfy applicable legal requirements.
I. Definitions
While the following terms are believed to be well understood by one of ordinary skill in the art, the following definitions are set forth to facilitate explanation of the presently disclosed subject matter.
All technical and scientific terms used herein, unless otherwise defined below, are intended to have the same meaning as commonly understood by one of ordinary skill in the art. Mention of techniques employed herein are intended to refer to the techniques as commonly understood in the art, including variations on those techniques or substitutions of equivalent techniques that would be apparent to one of skill in the art. While the following terms are believed to be well understood by one of ordinary skill in the art, the following definitions are set forth to facilitate explanation of the presently disclosed subject matter. Thus, unless defined otherwise, all technical and scientific terms and any acronyms used herein have the same meanings as commonly understood by one of ordinary skill in the art in the field of the presently disclosed subject matter. Although any compositions, methods, kits, and means for communicating information similar or equivalent to those described herein can be used to practice the presently disclosed subject matter, particular compositions, methods, kits, and means for communicating information are described herein. It is understood that the particular compositions, methods, kits, and means for communicating information described herein are exemplary only and the presently disclosed subject matter is not intended to be limited to just those embodiments.
The articles "a", "an", and "the" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.
As used herein, the term "about" means approximately, in the region of, roughly, or around. When the term "about" is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values set forth. For example, in one aspect, the term "about" is used herein to modify a numerical value above and below the stated value by a variance of in some embodiments ± 20%, in some embodiments ± 15%, in some embodiments ± 10%, in some embodiments ± 5%, in some embodiments ± 1 %, in some embodiments ± 0.5%, in some embodiments ± 0.1 %, and in some embodiments less than ± 0.1 %.
The term "comprising", which is synonymous with "including"
"containing" or "characterized by" is inclusive or open-ended and does not
exclude additional, unrecited elements or method steps. "Comprising" is a term of art used in claim language which means that the named elements are essential, but other elements can be added and still form a construct within the scope of the claim.
As used herein, the phrase "consisting of" excludes any element, step, or ingredient not specified in the claim. When the phrase "consists of" appears in a clause of the body of a claim, rather than immediately following the preamble, it limits only the element set forth in that clause; other elements are not excluded from the claim as a whole.
As used herein, the phrase "consisting essentially of" limits the scope of a claim to the specified materials or steps, plus those that do not materially affect the basic and novel characteristic(s) of the claimed subject matter.
With respect to the terms "comprising", "consisting of", and "consisting essentially of, where one of these three terms is used herein, the presently disclosed and claimed subject matter can include the use of either of the other two terms.
As used herein, the term "and/or" when used in the context of a listing of entities, refers to the entities being present singly or in combination. Thus, for example, the phrase "A, B, C, and/or D" includes A, B, C, and D individually, but also includes any and all combinations and subcombinations of A, B, C, and D.
As used herein, amino acids are represented by the full name thereof, by the three letter code corresponding thereto, and/or by the one-letter code corresponding thereto, as indicated in the following:
Full Name Three-Letter Code One-Letter Code
Aspartic Acid Asp D
Glutamic Acid Glu E
Lysine Lys K
Arginine Arg R
Histidine His H
Tyrosine Tyr Y
Cysteine Cys C
Asparagine Asn N
Glutamine Gin Q
Serine Ser S
Threonine Thr T
Glycine Gly G
Alanine Ala A
Valine Val V
Leucine Leu L
Isoleucine He 1
Methionine Met M
Proline Pro P
Phenylalanine Phe F
Tryptophan Trp W
The phrase "amino acid" is used interchangeably with "amino acid residue", and may refer to a free amino acid and/or to an amino acid residue of a peptide. It will be apparent from the context in which the term is used whether it refers to a free amino acid or a residue of a peptide.
Amino acids have the following general structure:
They may be classified into seven groups on the basis of the side chain R: (1 ) aliphatic side chains; (2) side chains containing a hydroxylic (OH) group; (3) side chains containing sulfur atoms; (4) side chains containing an acidic or amide group; (5) side chains containing a basic group; (6) side chains containing an aromatic ring; and (7) proline, an imino acid in which the side chain is fused to the amino group.
The nomenclature used to describe the peptide compounds of the presently disclosed subject matter follows the conventional practice wherein the amino group is presented to the left and the carboxy group to the right of each amino acid residue. In the formulae representing selected specific embodiments of the presently disclosed subject matter, the amino- and
carboxy-terminal groups, although not specifically shown, will be understood to be in the form they would assume at physiologic pH values, unless otherwise specified.
The term "basic" and the phrase "positively charged" as they relate to amino acids refer herein to amino acids in which the R groups have a net positive charge at pH 7.0, and include, but are not limited to, the standard amino acids lysine, arginine, and histidine.
As used herein, an "analog" of a chemical compound is a compound that, by way of example, resembles another in structure but is not necessarily an isomer (e.g. , 5-fluorouracil is an analog of thymine).
The term "antibody" indicates an immunoglobulin protein, or fragment or derivative thereof, including but not limited to a polyclonal antibody, a monoclonal antibody, a chimeric antibody, a hybrid antibody, a single chain antibody (e.g., a single chain antibody represented in a phage library), a mutagenized antibody, a humanized antibody, and antibody fragments that comprise an antigen binding site {e.g., Fab and Fv antibody fragments).
The term "antigen" as used herein refers to a molecule that provokes an immune response in vitro and/or in vivo. This immune response can involve antibody production, the activation of specific immunologically- competent cells, or both. An antigen can be derived from an organism, a subunit of a protein, a killed or inactivated whole cell or lysate, or any other source to which an organism's immune system or a component thereof (e.g., an immune cell) can react.
The term "binding" refers to the adherence of molecules to one another, such as, but not limited to, enzymes to substrates, ligands to receptors, antibodies to antigens, DNA binding domains of proteins to DNA, and DNA or RNA strands to complementary strands.
As used herein, the phrase "binding partner" refers to a molecule capable of binding to another molecule. In some embodiments, binding partner bind to each other in vitro, ex vivo, in vivo, and/or under physiological conditions.
As used herein, the phrases "biologically active fragment" and
"bioactive fragment" of polypeptides, including antibodies, encompass natural
and synthetic portions of full-length polypeptides that have one or more desirable characteristics of the full-length polypeptides, including but not limited to specific binding to their natural ligand(s) and/or performing desirable functions of the polypeptides.
The phrase "biological sample", as used herein, refers to samples obtained and/or otherwise isolated from a subject, including, but not limited to, skin, hair, tissue, blood, plasma, cells, sweat, and urine.
A "compound", as used herein, refers to any type of substance or agent that is commonly considered a drug, or a candidate for use as a drug, as well as combinations and mixtures of the above.
As used herein, the phrase "conservative amino acid substitution" is defined herein as an amino acid exchange within one of the following five groups:
A. Small aliphatic, nonpolar, or slightly polar residues: Ala, Ser, Thr, Pro, Gly;
B. Polar, negatively charged residues and their amides: Asp, Asn, Glu, Gin;
C. Polar, positively charged residues: His, Arg, Lys;
D. Large, aliphatic, nonpolar residues: Met, Leu, lie, Val, Cys; and
E. Large, aromatic residues: Phe, Tyr, Trp.
Thus, a conservative amino acid substitution includes a substitution of in some embodiments any small aliphatic, nonpolar, or slightly polar residue for any other small aliphatic, nonpolar, or slightly polar residues; in some embodiments any polar, negatively charged residue and its amide for any other polar, negatively charged residue and its amide; in some embodiments any polar, positively charged residue for any other polar, positively charged residue; in some embodiments any large, aliphatic, nonpolar residue for any other large, aliphatic, nonpolar residue; and/or in some embodiments any large, aromatic residue for any other large, aromatic residue.
As used herein, a "derivative" of a compound refers to a chemical compound that may be produced from another compound of similar structure in one or more steps, as in replacement of H by an alkyl, acyl, or amino group.
A "disease" is a state of health of an animal wherein the animal cannot
maintain homeostasis, and wherein if the disease is not ameliorated then the animal's health would be expected to deteriorate.
In contrast, a "disorder" in an animal is a state of health in which the animal is able to maintain homeostasis, but in which the animal's state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the animal's state of health.
As used herein, the term "domain" refers to a part of a molecule or structure that shares common physicochemical features, such as, but not limited to, hydrophobic, polar, globular, and helical domains, and/or properties such as ligand binding, signal transduction, cell penetration, and the like. Specific examples of binding domains include, but are not limited to, DNA binding domains and ATP binding domains.
As used herein, an "effective amount" or "therapeutically effective amount" means an amount sufficient to produce a desired effect, such as ameliorating or alleviating symptoms of a disease or disorder. In the context of administering compounds in the form of a combination, such as multiple compounds, the amount of each compound, when administered in combination with another compound(s), may be different from when that compound is administered alone. Thus, an effective amount of a combination of compounds refers collectively to the combination as a whole, although the actual amounts of each compound may vary. The term "more effective" means that the selected effect is ameliorated and/or alleviated to a greater extent by one treatment relative to a second treatment to which it is being compared.
As used herein, an "essentially pure" preparation of a particular protein or peptide is a preparation wherein in some embodiments at least about 95%, in some embodiments at least about 97%, and in some embodiments at least about 99%, by weight, of the total protein or total peptide in the preparation is the particular protein or peptide of interest.
A "fragment" or "segment" is a portion of an amino acid sequence (i.e., a subsequence) comprising at least one amino acid or a portion of a nucleic acid sequence comprising at least one nucleotide. The terms "fragment" and
"segment" are used interchangeably herein.
As used herein, a "functional" biological molecule is a biological molecule in a form in which it exhibits a desirable property by which it can be characterized. A functional enzyme, for example, is one which exhibits the characteristic catalytic activity by which the enzyme is characterized.
By "interaction" between a first protein and a second protein is meant the interaction such as binding which is necessary for an event or process to occur, such as sperm-egg binding, fusion, and fertilization. In some embodiments, the interaction may be similar to a receptor-ligand type of binding or interaction.
A "ligand" is a molecule that specifically binds to a target molecule such as but not limited to a receptor. A "receptor" is a molecule that specifically binds to a ligand. In some embodiments, the attribution of a given molecule as being a "ligand" or a "receptor" is merely one of convenience in the event that the "receptor" can be a molecule that is not recognized as a "receptor" as that term might be understood with respect to cell biology and/or signal transduction.
As such, in some embodiments a ligand or a receptor (e.g., an antibody) "specifically binds to" or "is specifically immunoreactive with" a compound when the ligand or receptor functions in a binding reaction which is determinative of the presence of the compound in a sample of heterogeneous compounds. Thus, under designated assay (e.g. , immunoassay) conditions, the ligand or receptor binds preferentially to a particular compound and does not bind in a significant amount to other compounds present in the sample. For example, a polynucleotide specifically binds under hybridization conditions to a compound polynucleotide comprising a complementary sequence; an antibody specifically binds under immunoassay conditions to an antigen bearing an epitope against which the antibody was raised. A variety of immunoassay formats may be used to select antibodies specifically immunoreactive with a particular protein. For example, solid-phase ELISA immunoassays are routinely used to select monoclonal antibodies specifically immunoreactive with a protein. See Harlow & Lane, 1988 for a description of immunoassay formats and conditions that can be used to determine specific
immunoreactivity.
The term "peptide" typically refers to short polypeptides. In some embodiments, a peptide of the presently disclosed subject matter is thus at least or about 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, or 15 amino acids long, including but not limited to at least 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20,
21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40,
41 , 42, 43, 44, 45, 46, 47, 48, 49, or 50 amino acids long. The peptides of the presently disclosed subject matter can in some embodiments also have a length that falls in the ranges of 6-8, 8-10, 9-12, 10-13, 1 1 -14, 12-15, 15-20, 20-25, 25-30, 30-35, 35-40, and 45-50 amino acids.
As used herein, the term "plurality" means at least two and, unless specifically limited herein, has no upper boundary.
As used herein, the term "polypeptide" refers to a polymer composed of amino acid residues, related naturally occurring structural variants, and/or synthetic non-naturally occurring analogs thereof linked via peptide bonds, related naturally occurring structural variants, and synthetic non-naturally occurring analogs thereof.
As used herein, the phrase "synthetic peptides or polypeptides" refers to non-naturally occurring peptides and polypeptides. Synthetic peptides and polypeptides can be synthesized, for example, using an automated polypeptide synthesizer. Various solid phase peptide synthesis methods are known to those of skill in the art.
In some embodiments, the presently disclosed subject matter provides polypeptides whose production in a bacterial cell is responsive to the presence of an amount of albumin and/or calcium in a culture medium. In some embodiments, the albumin is present in serum in the culture medium.
In some embodiments, the polypeptide is a Bordetella adenylate cyclase toxin (ACT) polypeptide or a fragment or variant thereof. See, for example SEQ ID NOs: 1 , 44 or 49. As used herein, the phrases "Adenylate Cyclase Toxin" and "ACT" refer to a bifunctional hemolysin-adenylate cyclase gene and/or gene product encoding or having an amino acid sequence emplified by, but not limited to, that set forth in GENBANK® biosequence database Accession No. NP_879578.1 . This amino acid sequence is set forth
in SEQ ID NO: 1 . While this particular amino acid sequence represents the amino acid sequence of ACT from Bordetella pertussis Tohama I, it is recognized that the genomes of other isolates of B. pertussis might encode ACT polypeptides with one or more modifications of the sequence of SEQ ID NO: 1 . For example, the ACT polypeptide of certain isolates of B. pertussis include a serine at position 304 in place of the asparagine of SEQ ID NO: 1 . The presently disclosed subject matter is understood to encompass all such ACT polypeptides, both naturally occurring and artificially produced. In some embodiments, the polypeptide comprises, consists essentially of, or consists of an amino acid sequence of SEQ ID NOs: 1 , 44 or 49.
As used herein, the phrases "Adenylate Cyclase domain" and "AC domain" refer to the catalytic domain of an ACT polypeptide. The AC domain of B. pertussis ACT includes the N-terminal approximately 400 amino acids of an ACT polypeptide. Exemplary AC domains include in some embodiments amino acids 1 -398, in some embodiments amino acids 1 -399, and in some embodiments amino acids 1 -400 of SEQ ID NO: 1 (i.e. , SEQ ID NO:2). Here as well, it is recognized that the genomes of other isolates of B. pertussis might encode AC domain polypeptides with one or more modifications of the sequence of SEQ ID NO:2, and the presently disclosed subject matter is understood to encompass all such AC domain polypeptides, both naturally occurring and artificially produced. In some embodiments, the polypeptide comprises, consists essentially of, or consists of an amino acid sequence of SEQ ID NO:2, 45 or 50.
In some embodiments, other polypeptides in which the production/maturation is induced by albumin and/or calcium are prepared, such as but not limited to other vaccine antigens. Representative vaccine antigens include but are not limited to pertussis toxin (PT) polypeptide or a fragment or variant thereof; filamentous hemagglutinin adhesin (FHA) polypeptide or a fragment or variant thereof; pertactin (PRN) polypeptide or a fragment or variant thereof; Bp fimbriae 2 (Fim2) polypeptide or a fragment or variant thereof; Bp fimbriae 3 (Fim3) polypeptide or a fragment or variant thereof; or a combination thereof. See, for example SEQ ID NOs:26-43 and
53-62. In some embodiments, the polypeptide comprises, consists essentially
of, or consists of an amino acid sequence selected from the group consisting of SEQ ID NOs:26-43 and 53-62.
Variants, both naturally occurring and artificially produced, are also encompassed by the presently disclosed subject matter. In some embodiments, a variant of a peptide or polypeptide of the presently disclosed subject matter is characterized by having a substantially identical amino acid sequence to one or more of SEQ ID NOs: 1 -5 and 26-62. Variants can include polypeptides from any cell, including any bacterial cell, which responds to a sufficient amount of albumin and/or calcium by increasing accumulation of the polypeptide in the cell, and/or increasing in secretion of the polypeptide.
As used herein, a "substantially identical amino acid sequences" includes those amino acid sequences which have in some embodiments at least about 80% identity, in some embodiments at least about 85% identity, in some embodiments at least about 90% identity, in some embodiments at least about 91 % identity, in some embodiments at least about 92% identity, in some embodiments at least about 93% identity, in some embodiments at least about 94% identity, in some embodiments at least about 95% identity, in some embodiments at least about 96% identity, in some embodiments at least about 97% identity, in some embodiments at least about 98% identity, and in some embodiments at least about 99% or more identity to an amino acid sequence as set forth herein. Amino acid sequence identity, similarity, or identity can be computed by using the BLASTP and TBLASTN programs which employ the BLAST (basic local alignment search tool) 2.0.14 algorithm (Altschul et al., 1990a; Altschul et al. , 1990b; Karlin & Altschul, 1990; Karlin & Altschul, 1993; Altschul et al. , 1997). The default settings used for these programs are suitable for identifying substantially similar amino acid sequences for purposes of the presently disclosed subject matter.
"Primer" refers to a polynucleotide that is capable of specifically hybridizing to a designated polynucleotide template and providing a point of initiation for synthesis of a complementary polynucleotide. Such synthesis occurs when the polynucleotide primer is placed under conditions in which synthesis is induced, i.e., in the presence of nucleotides, a complementary polynucleotide template, and an agent for polymerization such as DNA
polymerase. A primer is typically single-stranded, but may be double- stranded. Primers are typically deoxyribonucleic acids, but a wide variety of synthetic and naturally occurring primers are useful for many applications. A primer is complementary to the template to which it is designed to hybridize to serve as a site for the initiation of synthesis, but need not reflect the exact sequence of the template. In such a case, specific hybridization of the primer to the template depends on the stringency of the hybridization conditions. Primers can be labeled with, e.g., chromogenic, radioactive, or fluorescent moieties and used as detectable moieties.
As used herein, the term "purified" and like terms relate to an enrichment of a molecule or compound relative to other components normally associated with the molecule or compound in a native environment. The term "purified" does not necessarily indicate that complete purity of the particular molecule has been achieved during the process. A "highly purified" compound as used herein refers to a compound that is greater than 90% pure. In particular, purified sperm cell DNA refers to DNA that does not produce significant detectable levels of non-sperm cell DNA upon PCR amplification of the purified sperm cell DNA and subsequent analysis of that amplified DNA. A "significant detectable level" is an amount of contaminate that would be visible in the presented data and would need to be addressed/explained during analysis of the forensic evidence.
"Recombinant polynucleotide" refers to a polynucleotide having sequences that are not naturally joined together. An amplified or assembled recombinant polynucleotide may be included in a suitable vector, and the vector can be used to transform a suitable host cell.
A recombinant polynucleotide may serve a non-coding function (e.g., promoter, origin of replication, ribosome-binding site, etc.) as well.
A "recombinant polypeptide" is one which is produced upon expression of a recombinant polynucleotide.
A "sample", as used herein, refers preferably to a biological sample from a subject, including, but not limited to, normal tissue samples, diseased tissue samples, biopsies, blood, saliva, feces, semen, tears, and urine. A sample can also be any other source of material obtained from a subject
which contains cells, tissues, or fluid of interest. A sample can also be obtained from cell or tissue culture.
By the term "specifically binds to", as used herein, is meant when a compound or ligand functions in a binding reaction or assay conditions which is determinative of the presence of the compound in a sample of heterogeneous compounds.
The term "standard", as used herein, refers to something used for comparison. For example, it can be a known standard agent or compound which is administered and used for comparing results when administering a test compound, or it can be a standard parameter or function which is measured to obtain a control value when measuring an effect of an agent or compound on a parameter or function. Standard can also refer to an "internal standard", such as an agent or compound which is added at known amounts to a sample and is useful in determining such things as purification or recovery rates when a sample is processed or subjected to purification or extraction procedures before a marker of interest is measured. Internal standards are often a purified marker of interest which has been labeled, such as with a radioactive isotope, allowing it to be distinguished from an endogenous marker.
The term "substantially pure" describes a compound, e.g. , a protein or polypeptide which has been separated from components which naturally accompany it. Typically, a compound is substantially pure when at least 10%, more preferably at least 20%, more preferably at least 50%, more preferably at least 60%, more preferably at least 75%, more preferably at least 90%, and most preferably at least 99% of the total material (by volume, by wet or dry weight, or by mole percent or mole fraction) in a sample is the compound of interest. Purity can be measured by any appropriate method, e.g., in the case of polypeptides by column chromatography, gel electrophoresis, or HPLC analysis. A compound, e.g., a protein, is also substantially purified when it is essentially free of naturally associated components or when it is separated from the native contaminants which accompany it in its natural state.
A "therapeutic" treatment is a treatment administered to a subject who exhibits signs of pathology (e.g., a disease or disorder) for the purpose of
diminishing or eliminating those signs.
The term to "treat", as used herein, means reducing the frequency with which symptoms are experienced by a patient or subject or administering an agent or compound to reduce the frequency with which symptoms are experienced.
II. Methods for Polypeptide and/or Vaccine Production
The presently disclosed subject matter provides in some embodiments methods for increasing production of a polypeptide in a cell. In some embodiments, the method comprises contacting a cell in a culture medium with an amount of an albumin polypeptide sufficient to induce an increase in accumulation of the polypeptide in the cell, and/or an increase in secretion of the polypeptide from the cell into the culture medium relative to a cell grown in a culture medium in the absence of the albumin polypeptide. In some embodiments, the albumin is present in serum in the culture medium.
A cell in accordance with the presently disclosed subject matter can be any cell, including any bacterial cell, which responds to a sufficient amount of albumin by increasing accumulation one or more polypeptides in the cell, and/or increasing secretion of the one or more polypeptides. In some embodiments, a cell in accordance with the presently disclosed subject matter can be any cell, including any bacterial cell, which responds to a sufficient amount of calcium to enhance secretion of one or more polypeptides from the cell.
In some embodiments, the cell is a Bordetella pertussis {Bp) cell, optionally a Bp cell in culture. The same response to serum has been observed in Bordetella bronchiseptica and Bordetella parapertussis. Thus, in some embodiments, the cell is a Bordetella bronchiseptica cell or a Bordetella parapertussis cell. Thus, in some embodiments, the cell is a Bordetella species cell, such as a Bordetella pertussis cell, a Bordetella bronchiseptica cell, or a Bordetella parapertussis cell. Other bacteria produce related RTX toxins and/or other molecules secreted through the T1 SS. For example,
Escherichia coli produces a hemolysin that is secreted through the T1 SS. In some embodiments, the cell can thus be a cell from another bacterium that produces RTX toxins and/or other molecules that are secreted through the
T1 SS.
In some embodiments, the culture medium comprises sufficient calcium to enhance secretion of one or more polypeptides from the cell into the culture medium. The concentration of calcium in the culture medium is in some embodiments at least about 0.15 mM, in some embodiments at least about 0.2 mM, in some embodiments at least about 0.3 mM, in some embodiments at least about 0.4 mM, in some embodiments at least about 0.5 mM. In some embodiments, the concentration of calcium in the culture medium is less than or equal to about 2.0 mM. Thus, the concentration of calcium in the culture medium is in some embodiments 0.15-2.0 mM, in some embodiments 0.2-2.0 mM, in some embodiments 0.3-2.0 mM, in some embodiments 0.4-2.0 mM, and in some embodiments 0.5-2.0 mM. It is noted that SSM medium is approximately 0.136 mM calcium, and this level is not sufficient to promote ACT secretion. The amount of the albumin in the culture medium is in some embodiments at least about 0.2 mg/ml, in some embodiments at least about 0.3 mg/ml, in some embodiments at least about 0.4 mg/ml, in some embodiments at least about 0.5 mg/ml, in some embodiments at least about 1 .0 mg/ml, in some embodiments at least about 1 .5 mg/ml, and in some embodiments at least about 2.0 mg/ml, . By way of example and not limitation for human serum albumin (HAS), at least about 0.23 mg/ml is sufficient to enhance secretion of one or more polypeptides from the cell into the culture medium. In some embodiments, for bovine serum albumin (BSA), higher concentrations of albumin are desired, such as at least about 0.5 mg/ml, at least about 1 .0 mg/ml, or at least about 2.0 mg/ml.
In some embodiments, the polypeptide is an adenylate cyclase toxin
(ACT) polypeptide, or a fragment or variant thereof. In some embodiments, the polypeptide is a Bp ACT polypeptide, or a fragment or variant thereof including, but not limited to a polypeptide having an amino acid sequence comprising, consisting essentially of, or consisting of a amino acid sequence as set forth in SEQ ID NOs: 1 -5. In some embodiments, the polypeptide is an adenylate cyclase toxin (ACT) polypeptide or a fragment or variant thereof from a species other than B. pertussis including, but not limited to B. bronchiseptica or B. parapertussis. See, for example SEQ ID NOs: 44 and
49. In some embodiments, the ACT polypeptide or a fragment or variant thereof comprises an AC domain of an ACT polypeptide. See, for example SEQ ID NOs:2-5. In some embodiments, the polypeptide is an AC domain of an ACT polypeptide or a fragment or variant thereof from a species other than B. pertussis including, but not limited to B. bronchiseptica or B. parapertussis. See, for example SEQ ID NOs: 46-48 and 50-53. In some embodiments, other polypeptides for which the production/maturation is induced by albumin are prepared, such as but not limited to other vaccine antigens. Representative vaccine antigens include but are not limited to pertussis toxin (PT) polypeptides or fragments thereof (such as but not limited to SEQ ID NOs: 26-35 and 54-58); filamentous hemagglutinin adhesin (FHA) polypeptides or fragments thereof (such as but not limited to SEQ ID NOs: 36, 37, and 59); fimbriae 2 (Fim2) polypeptides or fragments thereof (such as but not limited to SEQ ID NOs: 38, 40, and 60); fimbriae 3 (Fim3) polypeptides or fragments thereof (such as but not limited to SEQ ID NOs: 39, 41 , and 61 ); pertactin (PRN) polypeptides or fragments thereof (such as but not limited to SEQ ID NOs: 42, 43, and 62), or any combination thereof. An increased PT amount and secretion has been observed and in the presence of albumin and calcium. The amount of FHA is not dramatically affected by albumin and calcium, but FHA release is increased. Preliminary mass spectroscopy data - /+ FBS indicated that both PRN and Fim3 are increased by serum, presumptively also as a response to albumin and calcium.
In some embodiments, a method for producing a vaccine component is also provided. In some embodiments, the method comprises growing cells in a culture medium comprising a sufficient concentration of albumin to induce an increase in accumulation of the polypeptide in the cells and/or secretion of the polypeptide from the cells into the culture medium; and isolating the polypeptide from the cells and/or the culture medium, whereby a vaccine component is produced.
A cell in accordance with the presently disclosed subject matter can be any cell, including any bacterial cell, which responds to a sufficient amount of an albumin by increasing accumulation of a polypeptide in the cell, and/or increasing in secretion of the polypeptide. In some embodiments, a cell in
accordance with the presently disclosed subject matter can be any cell, including any bacterial cell, that responds to a sufficient concentration of calcium to enhance secretion of a polypeptide from the cell.
In some embodiments, the cell is a Bordetella pertussis {Bp) cell in culture. The same response to serum has been observed in Bordetella bronchiseptica and Bordetella parapertussi. Thus, in some embodiments, the cell is a Bordetella bronchiseptica cell or a Bordetella parapertussis cell. In some embodiments, then, the cell is a Bordetella species cell, such as a Bordetella pertussis cell, a Bordetella bronchiseptica cell, or a Bordetella parapertussis cell.
In some embodiments, the vaccine component comprises a vaccine antigen. In some embodiments, the vaccine antigen comprises a peptide and/or a polypeptide. In some embodiments, the polypeptide is an adenylate cyclase toxin (ACT) polypeptide or a fragment or variant thereof. See, for example SEQ ID NOs: 1 -5 and 44-63. In some embodiments, the ACT polypeptide or a fragment or variant thereof comprises an AC domain of an
ACT polypeptide. See, for example SEQ ID NOs:2-5, 45-48, and 50-53. In some embodiments, other polypeptides in which production/maturation is induced by albumin are prepared, such as but not limited to other vaccine antigens. Representative vaccine antigens include but are not limited to pertussis toxin (PT) polypeptides or fragments thereof (see e.g., SEQ ID NOs:
26-35 and 54-58); filamentous hemagglutinin adhesin (FHA) polypeptides or fragments thereof (see e.g., SEQ ID NOs: 36, 37, and 59); pertactin (PRN) polypeptides or fragments thereof (see e.g., SEQ ID NOs: 42, 43, and 62); fimbriae 2 (Fim2) polypeptides or fragments thereof (see e.g. , SEQ ID NOs:
38, 40, and 60); fimbriae 3 (Fim3) polypeptides or fragments thereof (see e.g.,
SEQ ID NOs: 39, 41 , and 61 ); or any combination thereof. An increased PT amount and secretion was observed in response to albumin and calcium. The amount of FHA was not dramatically affected by albumin and calcium, but
FHA release is increased. Preliminary mass spectroscopy data -/+ FBS indicated that both PRN and Fim3 were increased by serum, which is presumed to also be a response to albumin and calcium
In some embodiments, the culture medium comprises sufficient
calcium to enhance secretion of the polypeptide from the cell into the culture medium. In some embodiments, the concentration of calcium in the culture medium is at least about 0.5 mM. In some embodiments, the amount of the albumin polypeptide is at least about 0.2 mg/ml in the culture medium. By way of example for HSA, at least about 0.23 mg/ml is sufficient. In some embodiments, for BSA, higher concentrations of albumin are desired, such as at least about 0.5 mg/ml, at least about 1 .0 mg/ml, or at least about 2.0 mg/ml.
In some embodiments, the vaccine component, such as a peptide or polypeptide, is purified from the culture medium using a ligand that binds to the component. In some embodiments, the ligand is an antibody or a fragment or derivative thereof, wherein the antibody, fragment, or derivative comprises at least one paratope that binds to the peptide or polypeptide. In some embodiments, the ligand comprises a bead, optionally a magnetic bead, to which the ligand or the fragment or derivative thereof is directly or indirectly conjugated. In some embodiments, the ligand is indirectly conjugated to the bead via a tether. Optionally, the tether comprises polyethylene glycol.
In some embodiments, the method comprises combining the peptide or polypeptide with one or more additional peptides and/or polypeptides to produce an antigen pool to be employed in a vaccine. In some embodiments, the one or more additional peptides and/or polypeptides are selected from the group consisting of pertussis toxin (PT), optionally Bp PT; filamentous hemagglutinin adhesin (FHA), optionally Bp FHA; pertactin (PRN), optionally Bp PRN; fimbriae 2 (Fim2), optionally Bp Fim2; fimbriae 3 (Fim3), optionally Bp Fim3; diphtheria toxoid (DT), tetanus toxoid (TT), and combinations thereof. Other polypeptides include antigens found in pertussis combination vaccines that contain Haemophilus (including Haemophilus influenza type b), polio, and/or HepB components, as are known in the art.
In some embodiments, the method comprises inactivating the polypeptide. In some embodiments, the inactivated polypeptide is combined with one or more additional polypeptides to produce an antigen pool to be employed in a vaccine. The one or more additional polypeptides can be selected from the group consisting of pertussis toxin (PT), optionally Bp PT; filamentous hemagglutinin adhesin (FHA), optionally Bp FHA; pertactin
(PRN), optionally Bp PRN; fimbriae 2 (Fim2), optionally Bp Fim2; fimbriae 3 (Fim3), optionally Bp Fim3; diphtheria toxoid (DT), tetanus toxoid (TT), and combinations thereof. Other polypeptides include antigens found in pertussis combination vaccines that contain Haemophilus (including Haemophilus influenza type b), polio, and/or HepB components, as are known in the art.
In some embodiments, the method comprises adding to the vaccine component and/or antigen pool one or more pharmaceutically acceptable carriers and/or excipients, thereby producing a vaccine. In some embodiments the vaccine is in the form of an injectable or an aerosol.
III. Methods of Screening and Compositions Identified by the Same
A method for screening for a molecule that inhibits albumin-induced signaling in a cell, such as a Bordetella pertussis {Bp) cell, is provided in accordance with the presently disclosed subject matter. In some embodiments, the method comprises contacting a cell growing in a culture medium with a candidate compound, wherein the culture medium comprises at least about 0.5 mM calcium and at least about 0.2 mg/ml albumin; and comparing accumulation of a gene product in the culture medium in presence of the candidate compound to accumulation of the gene product in the culture medium in absence of the candidate compound. A reduced accumulation of the gene product in the culture medium in presence of the candidate compound as compared to in absence of the candidate compound is indicative of the candidate compound being a molecule that inhibits albumin- induced signaling in the cell.
In some embodiments, a method for screening for a molecule that inhibits albumin-induced signaling in a cell, such as a Bordetella pertussis
(Bp) cell, comprises contacting a cell growing in a culture medium with a candidate compound, wherein the culture medium comprises less than about
0.5 mM calcium and at least about 0.2 mg/ml albumin; and comparing accumulation of a gene product in the cell, such as a Bp cell, in presence of the candidate compound to accumulation of the gene product in absence of the candidate compound. In some embodiments, reduced accumulation of the gene product in the cell in presence of the candidate compound as compared to in absence of the candidate compound is indicative of the
candidate compound being a molecule that inhibits albumin-induced signaling in the cell.
A cell in accordance with the presently disclosed subject matter can be any cell, including any bacterial cell, which responds to a sufficient amount of an albumin by increasing accumulation of a polypeptide in the cell, and/or increasing in secretion of the polypeptide. In some embodiments, a cell in accordance with the presently disclosed subject matter can be any cell, including any bacterial cell, that responds to a sufficient calcium to enhance secretion of a polypeptide from the cell.
In some embodiments, the cell is a Bordetella pertussis {Bp) cell. The same response to serum has been observed in Bordetella bronchiseptica and Bordetella parapertussis. Thus, in some embodiments, the cell is a Bordetella bronchiseptica cell or a Bordetella parapertussis cell. In some embodiments, then, the cell is a Bordetella species cell, such as a Bordetella pertussis cell, a Bordetella bronchiseptica cell or a Bordetella parapertussis cell.
By way of example for HSA, at least about 0.23 mg/ml is sufficient. In some embodiments, for BSA, higher concentrations of albumin are desired, such as at least about 0.5 mg/ml, at least about 1 .0 mg/ml, or at least about 2.0 mg/ml.
In some embodiments, the gene product is an adenylate cyclase toxin
(ACT) polypeptide or a fragment or variant thereof. See, for example SEQ ID
NOs: 1 -5 and 44-53. In some embodiments, the ACT polypeptide or a fragment or variant thereof comprises an AC domain of an ACT polypeptide.
See, for example SEQ ID NOs:2-5, 45-48, and 50-53. In some embodiments, other gene products in which production/maturation is induced by albumin are employed, such as but not limited to other vaccine antigens. Representative vaccine antigens include but are not limited to pertussis toxin (PT) polypeptides and/or fragments thereof (see e.g., SEQ ID NOs: 26-35 and 54-
58); filamentous hemagglutinin adhesin (FHA) polypeptides and/or fragments thereof (see e.g., 36, 37, and 59); pertactin (PRN) polypeptides and/or fragments thereof (see e.g. , 42, 43, and 62); fimbriae 2 (Fim2) polypeptides and/or fragments thereof (see e.g., 38, 40, and 60); fimbriae 3 (Fim3) polypeptides and/or fragments thereof (see e.g., 39, 41 , and 61 ); or any
combination thereof. Increased PT amount in response to albumin has been observed and in the presence of calcium, secretion also appears to be increased. The amount of FHA is not dramatically affected by albumin and calcium, but FHA release is increased. Preliminary mass spectroscopy data - /+ FBS indicated that both PRN and Fim3 are increased by serum, presumptively also as a response to albumin and calcium..
As used herein, the phrase "candidate compound" refers to any molecule for which testing for an ability to modulate production and/or maturation of a polypeptide of the presently disclosed subject matter might be desired. Representative candidate compounds include but are not limited to peptides, oligomers, nucleic acids (e.g. , aptamers), small molecules (e.g., chemical compounds), antibodies or fragments thereof, nucleic acid-protein fusions, any other affinity agent, and combinations thereof. In some embodiments, a candidate compound of the presently disclosed subject matter comprises an albumin polypeptide or a fragment of an albumin polypeptide. In some embodiments, the candidate compound is an antibody or fragment or derivative thereof. In some embodiments, the candidate compound is a small molecule. A candidate substance to be tested can be a purified molecule, a homogenous sample, or a mixture of molecules or compounds.
The term "small molecule" as used herein refers to a compound, for example an organic compound, with a molecular weight of less than about 1 ,000 daltons, more preferably less than about 750 daltons, still more preferably less than about 600 daltons, and still more preferably less than about 500 daltons. A small molecule also preferably has a computed log octanol-water partition coefficient in the range of about -4 to about +14, more preferably in the range of about -2 to about +7.5.
Test substances can be obtained or prepared as a library. As used herein, the term "library" means a collection of molecules. A library can contain a few or a large number of different molecules, varying from about ten molecules to several billion molecules or more. A molecule can comprise a naturally occurring molecule, a recombinant molecule, or a synthetic molecule. A plurality of test substances in a library can be assayed
simultaneously. Optionally, test substances derived from different libraries can be pooled for simultaneous evaluation.
A library can comprise a random collection of molecules. Alternatively, a library can comprise a collection of molecules having a bias for a particular sequence, structure, or conformation. See e.g. , U.S. Patent Nos. 5,264,563 and 5,824,483, herein incorporated by reference. Methods for preparing libraries containing diverse populations of various types of molecules are known in the art, for example as described in U.S. Patents cited herein above. Numerous libraries are also commercially available.
IV. Therapeutic Methods and Compositions
In some embodments, a candidate compound as identified or prepared herein is used in a method for treating or preventing a disease or disorder in a subject in need thereof. In some embodiments, the method comprises administering to the subject an effective amount of a molecule that inhibits albumin-induced signaling, thereby treating or preventing a disease or disorder in the subject.
In some embodments, a candidate compound as identified or prepared herein is used in a method for treating or preventing an infection in a subject in need thereof In some embodiments, the method comprising administering to the subject an effective amount of a molecule that inhibits albumin-induced signaling, thereby treating or preventing an infection in the subject.
In some embodiments, a vaccine as prepared herein is administered to a subject in need thereof. In some embodiments, the vaccine is used in treating or preventing an infection in a subject in need thereof.
In some embodiments, the infection is a Bordetella species infection, such as a Bordetella pertussis infection, a Bordetella bronchiseptica infection, or a Bordetella parapertussis infection.
The term "subject" as used herein includes any vertebrate species, preferably warm-blooded vertebrates such as mammals and birds. More particularly, the methods of the presently disclosed subject matter are provided for the treatment of mammals such as humans, as well as those mammals of importance due to being endangered (such as Siberian tigers), of economical importance (animals raised on farms for consumption by humans)
and/or social importance (animals kept as pets or in zoos) to humans, for instance, carnivores other than humans (such as cats and dogs), swine (pigs, hogs, and wild boars), ruminants and livestock (such as cattle, oxen, sheep, giraffes, deer, goats, bison, and camels), and horses. Also provided is the treatment of birds, including those kinds of birds that are endangered or kept in zoos, as well as fowl, and more particularly domesticated fowl or poultry, such as turkeys, chickens, ducks, geese, guinea fowl, and the like, as they are also of economical importance to humans.
Suitable formulations for administration of a therapeutic composition of the presently disclosed subject matter to a subject include aqueous and nonaqueous sterile injection solutions which can contain anti-oxidants, buffers, bacteriostats, bactericidal antibiotics and solutes which render the formulation isotonic with the bodily fluids of the intended recipient; and aqueous and nonaqueous sterile suspensions which can include suspending agents and thickening agents. The formulations can be presented in unit-dose or multi- dose containers, for example sealed ampoules and vials, and can be stored in a frozen or freeze-dried (lyophilized) condition requiring only the addition of sterile liquid carrier, for example water for injections, immediately prior to use. Some preferred ingredients are sodium dodecyl sulphate (SDS), for example in the range of 0.1 to 10 mg/ml, preferably about 2.0 mg/ml; and/or mannitol or another sugar, for example in the range of 10 to 100 mg/ml, preferably about 30 mg/ml; phosphate-buffered saline (PBS), and any other formulation agents conventional in the art.
A therapeutic composition of the presently disclosed subject matter can be administered to a subject systemically, parenterally, or orally. The term "parenteral" as used herein includes intravenous injection, intra-muscular injection, intra-arterial injection, and infusion techniques. For delivery of compositions to pulmonary pathways, compositions can be administered as an aerosol or coarse spray. A delivery method is selected based on considerations such as the type of the type of carrier, therapeutic efficacy of the composition, and the condition to be treated. An effective amount of a composition of the presently disclosed subject matter is administered to a subject.
Actual dosage levels of active ingredients in a therapeutic composition of the presently disclosed subject matter can be varied so as to administer an amount of the composition that is effective to achieve the desired therapeutic response for a particular subject. The selected dosage level will depend upon a variety of factors including the activity of the therapeutic composition, formulation, the route of administration, combination with other drugs or treatments, the disease or disorder to be treated, and the physical condition and prior medical history of the subject being treated. Determination and adjustment of an effective amount or dose, as well as evaluation of when and how to make such adjustments, are known to those of ordinary skill in the art of medicine.
For soluble formulations of a composition of the presently disclosed subject matter, conventional methods of extrapolating human dosage are based on doses administered to a murine animal model can be carried out using the conversion factor for converting the mouse dosage to human dosage: Dose Human per kg = Dose Mouse per kg χ 12. Drug doses are also given in milligrams per square meter of body surface area because this method rather than body weight achieves a good correlation to certain metabolic and excretionary functions. Moreover, body surface area can be used as a common denominator for drug dosage in adults and children as well as in different animal species as described by Freireich et al. (1966) Cancer Chemother Rep 50:219-244. Briefly, to express a mg/kg dose in any given species as the equivalent mg/m2 dose, the dose is multiplied by the appropriate km factor. In adult humans, 100 mg/kg is equivalent to 100 mg/kgx37 kg/m2 =3700 mg/m2.
For additional guidance regarding dose, see Berkow et al. (1997) The Merck Manual of Medical Information, Home ed. Merck Research Laboratories, Whitehouse Station, New Jersey; Goodman et al. (1996) Goodman & Gilman's the Pharmacological Basis of Therapeutics, 9th ed. McGraw-Hill Health Professions Division, New York; Ebadi (1998) CRC Desk
Reference of Clinical Pharmacology. CRC Press, Boca Raton, Florida, United
States of America; Katzung (2001 ) Basic & Clinical Pharmacology, 8th ed.
Lange Medical Books/McGraw-Hill Medical Pub. Division, New York;
Remington et al. (1975) Remington's Pharmaceutical Sciences, 15th ed. Mack Pub. Co., Easton, Pennsylvania; Speight et al. (1997) Avery's Drug Treatment: A Guide to the Properties, Choice, Therapeutic Use and Economic Value of Drugs in Disease Management, 4th ed. Adis International, Auckland/ Philadelphia, United States of America; Duch et al. (1998) Toxicol Lett 100- 101 :255-263.
V. Kits and Storage
In some embodiments, a kit is disclosed, wherein the kit comprises albumin and instructions for its use in increasing accumulation of a polypeptide in a cell, such as a Bp cell, in a culture medium and/or for increasing secretion of the polypeptide from the cell, such as a Bp cell into a culture medium. In some embodiments, the polypeptide is an adenylate cyclase toxin (ACT) polypeptide or a fragment or variant thereof, optionally a Bp ACT polypeptide or a fragment or variant thereof. In some embodiments, the kit further comprises calcium and/or a salt thereof for use in increasing secretion of the polypeptide from the cell, such as a Bp cell, into the culture medium. In some embodiments, the kit is employed for carrying out any and methods disclosed herein and can be used to contain the components, and amounts thereof, used in any and all methods as disclosed herein.
A cell in accordance with the presently disclosed subject matter can be any cell, including any bacterial cell, which responds to a sufficient amount of an albumin by increasing accumulation of a polypeptide in the cell, and/or increasing in secretion of the polypeptide. In some embodiments, a cell in accordance with the presently disclosed subject matter can be any cell, including any bacterial cell, that responds to a sufficient calcium to enhance secretion of a polypeptide from the cell. In some embodiments, the cell is a Bordetella species cell, such as a Bordetella pertussis cell, a Bordetella bronchiseptica cell, or a Bordetella parapertussis cell.
In some embodiments, the kit comprises a ligand adapted for removing the albumin from the culture medium. In some embodiments, the ligand binds specifically to the albumin when the albumin is present in the culture medium.
In some embodiments, the ligand is an antibody or a fragment or derivative thereof. In some embodiments, the ligand comprises a bead, optionally a
magnetic bead, to which the albumin is directly or indirectly conjugated. In some embodiments, the albumin is indirectly conjugated to the bead via a tether, optionally wherein the tether comprising an antibody or a fragment or derivative thereof that specifically binds to the albumin and is conjugated to the bead.
In some embodiments, a kit is disclosed comprising (a) a container that contains at least one composition as described herein, in solution or in lyophilized form; (b) optionally, a second container containing a diluent or reconstituting solution for the lyophilized formulation; and (c) optionally, instructions for (i) use of the solution or (ii) reconstitution and/or use of the lyophilized formulation. The kit may further comprise one or more of (iii) a buffer, (iv) a diluent, (v) a filter, (vi) a needle, or (v) a syringe. In some embodiments, the container is selected from the group consisting of: a bottle, a vial, a syringe, a test tube, or a multi-use container. In some embodiments, the composition is lyophilized.
The kits can contain exactly, about, or at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 45, 46, 47, 48, 49, 50, 51 , or more compositions. Each composition in the kit can be used or administered at the same time or at different times.
In some embodiments, the kits can comprise a lyophilized formulation of the presently disclosed compositions in a suitable container and instructions for its reconstitution and/or use. Suitable containers include, for example, bottles, vials {e.g., dual chamber vials), syringes (such as dual chamber syringes), and test tubes. The container can be formed from a variety of materials such as glass or plastic. In some embodiments, the kit and/or the container contain(s) instructions on or associated therewith that indicate(s) directions for reconstitution and/or use of a lyophilized formulation. For example, the label can indicate that the lyophilized formulation is to be reconstituted to concentrations as described herein. Lyophilized and liquid formulations are typically stored at -20°C to -80°C.
The container holding the composition(s) can be a multi-use vial, which in some embodiments allows for repeat uses (e.g., from 2-6 or more uses) of
the reconstituted formulation. The kit can further comprise a second container comprising a suitable diluent {e.g., sodium bicarbonate solution).
In some embodiments, upon mixing of the diluent and the lyophilized formulation, the final concentration of an active agent in the reconstituted formulation is at least about 0.20, 0.25, 0.5, 0.75, 1.0, 1 .25, 1 .5, 1 .75, or 2.0 mg/mL/albumin. In some embodiments, upon mixing of the diluent and the lyophilized formulation, the concentration of calcium in the reconstituted formulation is at least or about 0.5 pg/mL/calcium.
The kit can further include other materials desirable from a commercial and/or user standpoint, including other buffers, diluents, filters, needles, syringes, and package inserts with or without instructions for use.
The kits can have a single container that contains the formulation of the compositions with or without other components (e.g., other compounds or compositions of these other compounds) or can have a distinct container for each component.
Additionally, the kits can include a formulation of the presently disclosed compositions packaged for use in combination with the coadministration of a second compound, e.g., a candidate compound. One or more of the components of the kit can be pre-complexed or one or more components can be in a separate distinct container prior to use. One or more of the components of the kit can be provided in one or more liquid solutions. In some embodiments, the liquid solution is an aqueous solution. In a further embodiment, the liquid solution is a sterile aqueous solution. One or more of the components of the kit can also be provided as solids, which in some embodiments can be converted into liquids by addition of suitable solvents, which in some embodiments can be provided in another distinct container.
The container of a kit can be a vial, a test tube, a flask, a bottle, a syringe, or any other structure suitable for enclosing a solid or liquid. Typically, when there is more than one component, the kit contains a second vial or other container that allows for separate use. The kit can also contain another container for an acceptable diluent. In some embodiments, a therapeutic kit contains an apparatus (e.g., one or more needles, syringes, eye droppers, pipette, etc.), which enables use of the agents of the disclosure
that are components of the kit.
EXAMPLES
The following Examples provide further illustrative embodiments. In light of the present disclosure and the general level of skill in the art, those of skill will appreciate that the following EXAMPLES are intended to be exemplary only and that numerous changes, modifications, and alterations can be employed without departing from the scope of the presently disclosed subject matter.
Materials and Methods for the EXAMPLES
Growth of B. pertussis, B. parapertussis (Bpp), and B. bronchiseptica (Bb). For the majority of the experiments presented here, Bp clinical isolate UT25 (Parker et al., 1980) was used. Bp, Bpp, and Bb strains (listed in Table 2) were plated on Bordet-Gengou agar (GIBCO™ brand, available from Thermo Fisher Scientific Inc., Waltham, Massachusetts, United States of America) containing 15% defibrinated sheep blood (Cocalico Biologicals Inc., Reamstown, Pennsylvania, United States of America) and incubated for 48-72 hours at 37°C. Bacteria were transferred to modified synthetic Stainer-Scholte liquid media (SSM; Stainer & Scholte, 1970; Hewlett & Wolff, 1976), grown for 20-24 hours at 35.5°C shaking, and then diluted to an OD60o of 0.08 and grown another 20-24 hours. On the day of the experiment, bacteria were diluted to an OD6oo of 0.1 and grown for 8 hours, unless otherwise stated. Bacteria were cultured as indicated in the presence or absence of fetal bovine serum (FBS; GIBCO™ brand, available from Thermo Fisher Scientific Inc., Waltham, Massachusetts, United States of America), mouse serum, human serum (from a pool of healthy human donors as approved by the Institutional Review Board at the University of Virginia), bovine serum albumin (Sigma A3059, further purified fraction V, fatty acid depleted, essentially γ-globulin free, ~99% pure; Sigma-Aldrich Corp., St. Louis, Missouri, United States of America), or human serum albumin (Sigma A3782, fatty acid free, globulin
101 free, >99% pure; Sigma-Aldrich Corp., St. Louis, Missouri, United States of America). All serum was heat-inactivated for 30 minutes at 56°C before addition to bacterial cultures. At indicated time points, 1 ml of bacterial culture
was removed (total) and an equal volume of culture was spun at 15,000 rotations per minute (rpm) for 10 min and the supernatant reserved (supernatant). Samples were stored at -80°C until tested.
Adenylate cyclase enzymatic activity. Bp organisms were grown as described in the BRIEF DESCRIPTION OF THE DRAWINGS, and the total and supernatant fractions were obtained as described. Adenylate cyclase enzymatic activity was measured by the conversion of [32P] ATP to [32P]cAMP as described previously (Hewlett et al. , 1989). Briefly, each assay tube contained 60 mM Tricine, 10 mM MgCI2, 2 mM ATP with 3 x 105 cpm of [a- 32P] ATP and 1 μΜ calmodulin at pH 8.0. The reaction was carried out at 30°C for 10 minutes and terminated by the addition of 100 μΙ of a solution containing 1 % SDS, 20 mM ATP, and 6.24 mM cAMP, with 2.0 x 104 cpm of [3H] cAMP. Cyclic AMP was quantified by the double column method of Salomon et al. (Salomon et al., 1974) and reported at pmoles cAMP/10 min/10 μΙ. All measurements were taken on the linear part of a curve comparing ACT amount and enzyme activity, generated using known concentrations of recombinant ACT, providing reproducible quantification of the amount of ACT present in the sample (Eby et al., 2013). Data are also presented as mU/ml where one unit of AC corresponds to 1 pmole of cAMP formed in 1 minute at pH 8.0 at 30°C (Ladant et ai, 1986) in Figure 1 .
Western blot analysis. Bp organisms were grown as described in the BRIEF DESCRIPTION OF THE DRAWINGS, and the total and supernatant fractions were obtained as described. Samples were normalized according to optimal density at 600 nm, boiled in reducing sample buffer (Thermo Fisher Scientific Inc., Waltham, Massachusetts, United States of America) for 5 minutes, and loaded on a 10% polyacrylamide gel for electrophoresis. Gels were then electroblotted at 20 volts onto PVDF membranes overnight at 4°C. The membrane was blocked with 5% nonfat dry milk in PBS + 0.1 % TWEEN® 20 brand non-ionic detergent, pH 7.4 (PBS-T) for 1 hour and then incubated with primary antibodies (Polyclonal rabbit anti-ACT antibody, which recognizes all major domains of the toxin molecule (Gray et al., 2001 ), anti-
BSA (EMD Millipore Corp., Billerica, Massachusetts, United States of
America), polycolonal rabbit anti-PT antibody, or polyclonal rabbit anti-FHA
antibody)) at 1 : 10,000 for 2 hours. The membrane was extensively washed in PBS-T and probed with anti-rabbit IgG HRP-linked antibody (Cell Signaling Technologies, Danvers, Massachusetts, United States of America) at a 1 : 15,000 dilution. ECL chemiluminescence (Amersham, available from GE Healthcare Bio-Sciences, Pittsburgh, Pennsylvania, United States of America) was used to detect HRP-labeled secondary antibodies.
Measurement of albumin binding to Bp. Bp strains were grown in SSM with 2 mM calcium +/- 2 mg/ml BSA (as indicated) for 6 hours. The bacteria were then extensively washed (7 wash steps with three changes to fresh tubes to eliminate carry-over albumin not bound to the bacterial surface) with SSM (without calcium or albumin). Purified BSA was loaded as a positive control (400 ng). Samples were normalized by bacterial density and analyzed by Western blotting with an anti-BSA antibody.
Fractionation of FBS. Spin columns with 10 kilodalton (kDa) or 50 kDa size exclusions (AMICON® brand, available from EMD Millipore Corp., Billerica, Massachusetts, United States of America) were used to fractionate FBS according to manufacturer's instructions. Thirteen ml of FBS was concentrated into 1 ml with a 50 kDa molecular weight cut off column, generating the > 50 kDa and < 50 kDa fractions. Four ml of flow-through was added to a spin column with a 10 kDa molecular weight cut off and centrifuged until almost the entire volume was collected as flow-through to generate the < 10 kDa fraction. Fractions were added to bacterial cultures at concentrations as equivalent as possible to 10% FBS.
EGTA treatment of BSA. Three ml of BSA at 50 mg/ml was dialyzed against 1 liter of PBS, pH 7.5 + 2 mM EGTA, 4 times for a total of 4 liters, using a Slide-A-Lyzer Dialysis cassette (Thermo Fisher Scientific Inc., Waltham, Massachusetts, United States of America). This material was then dialyzed versus PBS, pH 7.5 and the protein measured before its use in indicated experiments.
Mouse serum. Mice were euthanized and blood collected through ventricular puncture. Serum was isolated from whole blood using a BD
Microtainer serum separator following manufacturer's instructions. All mice were treated in accordance with the Animal Care and Use Committee at The
Jackson Laboratory. Total protein was quantified using the Pierce BCA Protein Assay (Thermo Fisher Scientific Inc., Waltham, Massachusetts, United States of America) to be 65 mg/ml for the wild-type serum and 44 mg/ml for the analbuminemic serum, and the concentration of albumin in 10% wild-type mouse serum was determined to be 2 mg/ml by SDS-PAGE with a concentration range (0.25-4 mg/ml) of purified BSA.
RNA extraction and qRT-PCR. Bp was grown as indicated. Bacterial cells from three biological replicate cultures were pelleted and treated with RNAprotect (QIAGEN Inc., Germantown, Maryland, United States of America). RNA was extracted using the RNeasy kit (QIAGEN Inc., Germantown, Maryland, United States of America) following the manufacturer's instructions. Primers used in real-time qPCR assays were validated before use, and their sequences are listed in Table 1 . Reaction mixtures were prepared as previously described (Walters & Sperandio, 2006). qRT-PCR was performed using a one-step reaction in an ABI 7500-FAST sequence 162 detection system (APPLIED BIOSYSTEMS™ brand, available from Thermo Fisher Scientific Inc., Waltham, Massachusetts, United States of America). All data were normalized to the levels of rpoB and analyzed using the comparative cycle threshold (CT) method (Livak & Schmittgen, 2001 ). The relative quantification method was used to determine the expression level of target genes in various growth conditions. Statistical significance was determined by an unpaired t-test, and a p value of < 0.05 was considered significant.
Table 1
Primers Employed for qPCR
bvgA Bp F AG GTC ATC AATG C C G C C A Bibova et ai, 2013
(SEQ ID NO: 10)
bvgA Bp R GCAGGACGGTCAGTTCGC Bibova et ai, 2013
(SEQ ID NO: 1 1 )
fhaB Bp F CAAGGGCGGCAAGGTGA Bibova et ai, 2013
(SEQ ID NO: 12)
fhaB Bp R AC AG G ATG G C G AAC AG G CT Bibova et ai, 2013
(SEQ ID NO: 13)
ptxA Bp F CCAGAACGGATTCACGGC Bibova et ai, 2013
(SEQ ID NO: 14)
ptxA Bp R CTGCTGCTGGTGGAGACGA Bibova et ai, 2013
(SEQ ID NO: 15)
cyaBRTF TCATGCTGGCTCGCTATCAC [this disclosure]
(SEQ ID NO: 16)
cyaBRTR TCGCTACAGAATGCCTGCTC [this disclosure]
(SEQ ID NO: 17)
cyaDRTF AGCAAGGACATCGGCTTTGT [this disclosure]
(SEQ ID NO: 18)
cyaDRTR TTCGAGCGTTCCGTACTTCG [this disclosure]
(SEQ ID NO: 19)
cyaERTF CGCCCTATTATCCCAGCGTC [this disclosure]
(SEQ ID NO: 20)
cyaERTR TACCGCCATCACATTGTTGC [this disclosure]
(SEQ ID NO: 21 )
cyaXRTF CCGATGTCTTGCGCCTGTAT [this disclosure]
(SEQ ID NO: 22)
cyaXRTR GCGCATACGACACATAGGGA [this disclosure]
(SEQ ID NO: 23)
cyaCRTF ATGAACTCTCCCATGCACCG [this disclosure]
(SEQ ID NO: 24)
cyaCRTR TATG C AAC C G G C AC GTC ATT [this disclosure]
(SEQ ID NO: 25)
Bronchoalveolar lavage (BAD. BAL was performed for clinical indications on 7 patients with interstitial lung disease or bronchiectasis using published protocols (Anonymous, 1990). Three 50 ml aliquots of saline were sequentially perfused and then aspirated in the right middle lobe or lingula. A 10 ml aliquot of the sample that would have otherwise been discarded was used for this study via a protocol that was classified as exempt by the Institutional Review Board at the University of Virginia. Samples were centrifuged at 3,000 rpm to remove cells, and the supernatants were pooled and concentrated 10-fold using AMICON® CENTRICON® brand spin columns with a 10 kDa molecular weight cut off (EMD Millipore Corp., Billerica, Massachusetts, United States of America). The concentrated BAL was filter sterilized before addition to bacterial cultures.
Culture of J774.1 cells. J774.1 (J774) cells, a murine macrophage cell line, were maintained at 37°C in Dulbecco's Modified Eagle's medium with high glucose (GIBCO™ brand, available from Thermo Fisher Scientific Inc., Waltham, Massachusetts, United States of America) plus 10% heat- inactivated FBS in 5% CO2.
Cytotoxicity Assay. ACT causes cytotoxicity of J774 cells (Hewlett et a/., 2006, Vojtova et al. , 2006). J774 cells (30,000 in 90 μΙ) were seeded in each well of a 96-well plate and allowed to attach overnight at 37°C, 5%, CO2. Samples were added and cells incubated at 37°C for 3 hours. The number of viable cells was determined using the CCK8 Assay (Dijindo Molecular Technologies, Gaithersburg, Maryland, United States of America), which measures the reduction of WST-8, a water-soluble tetrazolium salt by dehydrogenases in viable cells. The percentage of viable cells was determined by the following equation:
[(Experimental - Blank/Control cells - Blank)] x 100. A blank is a well containing media and CCK8 reagent, but no cells. Control cells are J774 cells that are not treated.
EXAMPLE 1
Serum Increases the Amount of ACT and
Shifts Localization to the Supernatant
To test the hypothesis that serum promoted an increase in extracellular ACT, the amount of ACT was measured in cultures of wild-type Bp strain UT25 grown in Stainer-Scholte medium (SSM; see Stainer & Scholte, 1970) with and without 10% FBS for 8 hours. The amount and relative distribution of ACT were determined by enzyme activity using a cell-free assay measuring conversion of [32P]-ATP to [32P]-cAMP (Hewlett et al., 1989, Salomon et al., 1974; Figure 2A), and relative differences in protein amount were confirmed by Western blotting with a polyclonal rabbit anti-ACT antibody, recognizing the full-length, 200 kDa protein (Figure 2B). It has been shown previously that this AC assay is highly sensitive and quantitative with a linear range of 0.064-80 ng/ml (Eby et al., 2013). When necessary, samples were diluted to be within this range of toxin concentrations. In addition, it was confirmed the presence of FBS had no effect on enzymatic activity of purified ACT. As seen previously, >90% of the total ACT is associated with the bacterium during growth in SSM (Hewlett et al., 1976); however, during growth in the presence of FBS, 90% of this ACT was located in the supernatant (Figure 2A), similar to published observations about the distribution of ACT in vivo (Eby et al., 2013). In addition, there was an unexpected 12.6-fold increase in the amount of ACT during growth with FBS relative to absence of serum (Figure 2A), resulting in concentrations equivalent to 2 pg/ml ACT in the supernatant at 8 hours. These data supported the hypothesis that serum components change the distribution of ACT and also reveal that they stimulate an increase in the amount of ACT.
To understand whether there are differences in growth +/- FBS that could account for ACT amount and localization, Bp UT25 was grown in SSM
+/- 10% FBS and measured bacterial growth by optical density at 600 nm
(OD6oo) every 8 hours for two days. The bacterial densities were significantly higher between 8-32 hours when Bp was grown in SSM + FBS versus SSM alone (Figure 3A). Because of this difference in growth, quantities of ACT by enzyme activity presented herein, except for Figure 3, were normalized to
bacterial density (OD6oo)- Importantly, the quantity of ACT peaked at 24 hours in the presence or absence of FBS, but that amount was nearly 30-fold greater at this time point for Bp grown with serum versus without (Figure 3A). The response to serum was rapid, including even modest increases at the zero time point, most likely due to the ~10 minute sample processing time (Figure 3B). By 30 minutes, there was a 3-fold increase in the amount of toxin and 59% of the total ACT was in the supernatant. By 120 minutes, there was a 10.9-fold increase in the amount of ACT during growth in SSM + FBS versus SSM and 85% of the total ACT was in the supernatant. These early increases occurred with minimal changes in bacterial density. Together, these results showed that the response to serum was rapid, robust, and peaked near the end of the logarithmic phase of Bp growth.
Multiple wild-type and mutant strains of Bp, B. parapertussis (Bpp), and B. bronchiseptica {Bb) were tested to determine if the response to serum is conserved. All strains were grown in SSM or SSM + 10% FBS for 8 hours. ACT was detected by measuring AC enzyme activity, and the percent activity in the supernatant and fold increase in total ACT were determined (Table 2). Seven strains of Bp (all strains tested except a Bvg(-) strain, discussed further below) responded to serum by increasing the amount of ACT and releasing the majority of the ACT to the supernatant. Bp strain UT25 makes approximately 10-fold more ACT than the reference strain Bp Tohama, and the elevated level of ACT produced by UT25 was more comparable to the level of ACT produced by recent clinical isolates that were tested. For this reason, Bp UT25 was used for the majority of the experiments presented herein. As shown previously (Zaretzky et al., 2002), Bp strains deficient in the adhesin filamentous hemagglutinin (FHA, encoded by fhaB) had a higher percentage of ACT present in the supernatant during growth in SSM (Table 2). It was found, however, that Bp BP353, a BP338 derivative with a Tn5 insertion in fhaB, still responded to FBS; the amount of ACT increased 9.2- fold and 100% of ACT was present in the supernatant. Bpp CN8234 responded to serum comparably to Bp with a 7.2-fold increase in total ACT and a shift from 16% to 88% in the supernatant (Table 2). Strains of Bb had a higher percentage of ACT localized to the supernatant during growth in SSM
compared to Bp, but both the total amount (3.1 -fold or 5.1 -fold depending on strain) and percentage of ACT in the supernatant were enhanced by serum. As might be expected, basal levels of ACT in the supernatant in the absence of FBS were higher in the Bb fhaB deletion strain RBX9 compared to its wild- type parent strain Bb RB50, but the levels of total and supernatant-localized ACT were further enhanced during growth in the presence of serum, consistent with data from the Bp BP353 strain. These findings demonstrated that the response to serum was conserved amongst Bp, Bpp, and Bb, and also indicated that strains secreting higher levels of ACT under basal conditions still responded to serum by further increasing ACT amount and the proportion in the supernatant.
Table 2
Response to Serum is Conserved Amongst B. pertussis, Bordetella
parapertussis, and B. bronchiseptica Strains Tested
Bb RB50 Laboratory Strain 61 99 3.1
(Cotter & Miller, 1994)
Bb RBX9 RB50 AfhaB 88 99 3.8
(Cotter et a/., 1998)
Bb 1289 Hypervirulent isolate 64 95 5.2
(Buboltz ef a/., 2009)
% AC enzyme activity in supernatant in SSM without FBS
b % AC enzyme activity in supernatant in SSM + FBS
c Fold increase in AC enzyme activity in the presence of FBS as compared to in the absence of FBS
EXAMPLE 2
Albumin and Calcium Act Svnergisticallv to Increase ACT Amount
and Distribution to the Supernatant
To determine which components in serum promoted the observed changes in ACT amount and distribution, preliminary fractionation of serum using spin columns with different size exclusions (<10 kD, <50 kD, and >50 kD) were performed. Bp UT25 was then cultured in SSM with the individual serum fractions for 8 hours as indicated in Table 3. ACT was detected by measuring AC enzyme activity, and the percent activity in the supernatant and fold increase in total ACT were determined. The responses to the <10 kD and <50 kD fractions, as reflected by percentage of ACT in the supernatant and fold increases in ACT, were comparable, suggesting that active component or components in these two fractions were less than 10 kDa in size. There was partial activity in each of the three fractions, and the majority of the response to serum was recapitulated by recombining the <50 kD and >50 kD fractions (Table 3). These experiments suggested that the combined activity of at least two factors in serum was responsible for the observed effects on ACT amount and localization.
Table 3
ACT Production During Growth of Bp UT25 with Crude Fractions of FBS
A recent publication by Bumba et al. elucidated the requirement for physiological concentrations of calcium (2 mM, equivalent to concentration in human respiratory tract) to enhance secretion of ACT (Bumba et al., 2016; Potter et al., 1967). SSM contains 0.136 mM calcium, which was not sufficient for proper folding of ACT and thus resulted in less efficient secretion and accumulation of unfolded, secreted ACT on the bacterial surface (Potter et al., 1967). These authors showed that growth of Bp Tohama in SSM (with 1 g/L hepatikis and 1 g/L casamino acids) in the presence of 2 mM calcium allowed for proper folding of ACT and increased efficiency of secretion by greater than 20-fold with ~95% of total ACT localized to the supernatant. There was, however, minimal effect on the total amount of ACT produced (Bumba et al., 2016). Because of their findings, it was hypothesized that calcium is the active molecule in the < 10kD fraction. Under the growth conditions described herein, there was an increase in the proportion of ACT released to the supernatant when Bp was grown in SSM with 2 mM calcium compared to SSM alone (26.3 ± 7.6% and 1 1 .4 ± 2.9%, respectively) but no increase in the total amount of ACT (Figure 4).
Recapitulation of the response to FBS by the < 50kD and >50 kD fractions suggested a combined effect of at least two components, and whether calcium and another molecule, greater than 50 kDa, together affected the amount and distribution of ACT was tesetd. Albumin has a molecular weight of 66 kDa and is the most abundant protein in serum, accounting for
about 60% of the total serum protein, yielding concentrations ranging between 20-36 mg/ml in FBS and 35-52 mg/ml in human serum (Peters, 1996). Albumin is also present in respiratory secretions, and its abundance increases during inflammation (Masson et al., 1965; Yeager, 1971 ; Nicholson et al., 2000). In addition, previous work by Bellalou et al. showed that growth of Bp with albumin-supplemented SSM resulted in a high level of ACT in the supernatant (Bellalou et al., 1990b). On the basis of this information, whether albumin could be the active component in the >50 kD fraction was tesed. When Bp UT25 was grown with SSM + 2 mg/ml bovine serum albumin (BSA) for 8 hours, there was a 1.9-fold increase in the amount of ACT and 50% of the total ACT was detected in the supernatant (Figure 4). This suggested that BSA, or perhaps protein in general, shifted localization of ACT to the supernatant but not to the magnitude detected with FBS.
Next, BSA was tesed in combination with 2 mM calcium and the results were striking; BSA and calcium together promoted a 6.3-fold increase in ACT production and 93% of the ACT was localized to the supernatant (Figure 4). Also tested was whether contamination of purified albumin with calcium contributed to the effect on ACT. Bp UT25 was grown with BSA or EGTA- treated BSA, both in the absence of supplemented calcium, and the response in total and released ACT was compared. It was determined that there was no significant difference between BSA or EGTA-treated BSA (Figure 5). These findings were consistent with preliminary fractionation data implicating two separate components and suggesting synergistic roles for calcium and albumin to enhance ACT amount and change its localization during growth with FBS.
To determine what concentration of calcium is required for the full response to albumin, Bp UT25 was grown in SSM + 2 mg/ml BSA with varying concentrations of calcium between 0.136 mM (present in SSM) and 2 mM. It was determined that 0.5 mM calcium was sufficient to promote the full increase in ACT amount and release by albumin (Figure 6). Of note, SSM supplemented with 10% FBS contains about 0.47 mM calcium, which is close to the determined concentration of calcium required for the maximal effect of albumin. Because calcium was necessary for the response to BSA and the
physiological concentration of calcium in the human respiratory tract is ~2 mM, the experiments described herein below were performed in the presence of 2 mM calcium.
EXAMPLE 3
Albumin is Required for Increased ACT Amount and Altered Distribution
During Growth in the Presence of Mouse Serum
Next, whether albumin was both necessary and sufficient (the sole protein in serum required) for the effects on ACT amount was tested. Roopenian et al. have developed an albumin-deficient (analbuminemic; ALB-/-) mouse strain for studying the metabolism of human albumin and the pharmacokinetics of albumin-conjugated drugs (Roopenian et al. , 2015). Serendipitously, this animal provides a unique resource with which to probe the specificity of albumin in the observed effects on ACT disclosed herein. Similar to humans with a genetic deficiency in albumin, analbuminemic mice increase concentrations of other serum proteins to compensate for the loss of albumin (Roopenian et al., 2015). Serum from these mice was used to investigate the role of albumin in alteration of the amount and distribution of ACT, adjusted to assure comparable protein concentrations. Consistent with published data on this mouse strain (Roopenian et al., 2015), it was determined that total protein in the analbuminemic (ALB_ ~) mouse serum was 68% of that in serum from the wild-type, C57BL/6 mouse, and it was confirmed that the analbuminemic mouse serum lacked albumin as demonstrated by SDS-PAGE and Coomassie straining (Figure 7).
Because of the difference in protein concentrations, Bp UT25 was grown in the presence of 2 mM calcium and 6.8% wild-type mouse serum or 10% analbuminemic mouse serum, yielding equivalent total protein concentrations. The wild-type mouse serum enhanced ACT amount by 15.7- fold and 90% of ACT was the supernatant compared to 21 % in SSM. ACT levels in the total and supernatant fractions were not significantly different during growth with the analbuminemic mouse serum compared to growth in SSM alone (Figures 8A and 8B). Since total protein was equivalent in both conditions, these data indicated that the effects were specific to albumin and not simply a consequence of elevated protein concentrations during growth
with serum or purified albumin. Further, the response was restored (16.4-fold increase and 99% of total ACT in the supernatant) when 2 mg/ml BSA, a concentration equivalent to amount of albumin present in wild-type mouse serum, was added to the analbuminemic serum (Figure 8A). Together, these data strongly supported the concept that albumin, in the presence of calcium, was responsible for the increase in ACT amount and shift to localization in the supernatant elicited by mouse serum, highlighting the key roles of these two molecules in regulating the availability of this critical bacterial virulence factor.
EXAMPLE 4
Human Serum Albumin, either Purified and Present in Human Serum,
Increased the Amount and Release of ACT
Because Bp is a human pathogen, whether albumin in human samples could influence ACT amount and localization was tesetd. HS was combined from a pool of healthy donors; the concentration of albumin in the pool was determined by the Clinical Chemistry Lab at the University of Virginia to be 46 mg/ml. Bp UT25 was grown for 8 hours in SSM with HS, ranging from 0.05% to 2%, or the equivalent concentration of HSA, ranging from 0.0225 - 0.92 mg/ml, all in the presence of 2 mM calcium. As shown in Figure 9, there was an albumin concentration-dependent response of Bp UT25 to heat-inactivated
HS or HSA. In the presence of 2 mM calcium, >85% of the total ACT was found in the supernatant at all concentrations of HSA and HS tested, suggesting that human albumin at very low concentrations (<0.0225 mg/ml) was able to shift the predominant distribution of ACT to the supernatant. In the presence of calcium, the quantity of ACT plateaued at albumin concentrations of >0.23 mg/ml albumin (Figure 9). These data suggested that albumin, in the presence of calcium, was the critical component in human serum to increase
ACT amount and alter its distribution.
EXAMPLE 5
Role of Bvg 2 -component System in Control of
ACT Expression in Response to Albumin
As with other virulence factors, ACT expression in Bordetellae is transcriptionally controlled by the Bvg two-component system. For that reason, whether the increased amount of ACT detected during growth with
albumin was due to higher levels of Bvg activation and enhanced transcription of cyaA was tested. qRT-PCR analyses were performed on bvgA and cyaA as well as fhaB and ptxA, two other genes within the bvg regulon which encode filamentous hemagglutinin and pertussis toxin, respectively. Expression of none of these genes was significantly different +/- HSA in the presence of calcium (Figure 10A), indicating that increased ACT during growth in the presence of albumin was not due to further activation of Bvg and that cyaA was not being regulated at the transcriptional level +/- albumin. The Bvg(+) state was, however, required for expression of ACT; when Bp is modulated to Bvg(-), either genetically by a transposon insertion in bvgA (Table 2) or chemically with 40 mM MgS04 (Figure 10B), virtually no ACT was detected either with or without HSA or FBS. There was a small but significant increase in the amount of ACT during growth with MgS04 and HSA, when added simultaneously, compared to MgS04 alone (Figure 10B); possible explanations include that the response to albumin was faster than modulation with MgS04 or that albumin acted through an additional mechanism that was not dependent on Bvg activation and cyaA transcription. In summary, these data suggested that regulation of ACT production by albumin was downstream of transcriptional regulation of cyaA by the Bvg system, potentially through a previously uncharacterized post-transcriptional regulatory process.
Since it was found that more ACT was being released in the presence of albumin and calcium, whether HSA increased transcription of the genes within the cya operon - the T1 SS {cyaBDE), cyaC (acyl transferase responsible for post-translational acylation of cyaA), and cyaX (a putative transcriptional regulator of unknown function; Betsou et al. , 1993; Thomas et al., 2014) was tested. The T1 SS is comprised of three proteins: an ATP- binding inner membrane protein (CyaB), an outer-membrane protein (CyaE), and a membrane-fusion protein spanning the periplasm (CyaD) to connect CyaB and CyaE (30). As determined by qRT-PCR, the expression of none of these genes was significantly altered +/- HSA (Figure 1 1 ), but, as anticipated, expression of all genes was significantly reduced during growth with 40 mM
MgS04. These data indicated that HSA was also not acting transcriptionally to
regulate genes encoded within the cya operon that are involved in secretion or activation of ACT.
EXAMPLE 6
Human Respiratory Secretions Contain Albumin and Stimulate
Increased Amounts of Extracellular ACT
To address the role of albumin during human infection with Bp, human respiratory secretions were tested for the ability to affect ACT amount and distribution. Respiratory secretions contain serum components, notably albumin, and the concentrations of these components increases during inflammation (Masson et al. , 1965; Yeager, 1971 ; Nicholson et al., 2000). Bronchoalveolar lavage (BAL) was performed on 7 patients with interstitial lung disease or bronchiectasis, and the resulting samples were pooled and concentrated as described. The amount of albumin present in the pooled BAL sample was determined to be approximately 2.0 mg/ml by SDS-PAGE using purified HSA as a standard over a range of concentrations and confirmed by Western blot analyses with an anti-BSA antibody to be comparable to the amount of albumin present in 5% HS (2.3 mg/ml; see Figure 12). Since endogenous calcium was diluted during sample acquisition with saline washes, the BAL pool was tested in the presence of calcium at a physiological concentration (2 mM). As shown in Figures 1 1A and 1 1 B, growth of Bp UT25 in the BAL specimen elicited an 8.7-fold increase in ACT amount and a shift in distribution to the supernatant (96%) compared to SSM alone (22%). Similar concentrations of HS and purified HSA elicited 9.3 and 9.1 -fold increases in ACT amount and 96% or 97% of ACT in the supernatant, respectively (Figures 13A and 13B).
To determine if the increased ACT obtained during growth in the BAL was comparable in toxin activity, the culture supernatant from Bp UT25 grown in SSM + BAL was incubated for 8 hours with J774 cells and cytotoxicity was measured. ACT produced in the presence of human respiratory secretions elicited concentration-dependent cytotoxicity of J774 cells and was equivalent to recombinant ACT (rACT) at concentrations with equal enzyme activity
(Figure 14). These results confirmed that albumin was present in human respiratory secretions, which Bp encounters during infection of the human
respiratory tract, and that these secretions promoted an increase in the amount of functional ACT that was almost entirely present in the supernatant. Thus, albumin, in the presence of calcium, appeared to act as a critical factor in the host environment to increase active, newly secreted ACT, which was essential for establishment of Bp infection.
EXAMPLE 7
ACT Amount in the Absence of the Type 1 Secretion System
ACT amount was also determined in a Bp strain that lacked a functional Type 1 Secretion System (Bp UT25 AT1SS) The results are shown in Figure 15.
Bp UT25 AT1SS was grown in SSM alone (SSM), SSM supplemented with 2 mM calcium (SSM + Ca), SSM supplemented with 2 mg/ml BSA (SSM + BSA), or SSM supplemented with both 2 mM calcium and 2 mg/ml BSA (SSM + BSA + Ca) for 2 hours. SupernatantSupernatants (light gray bars; level too low to show in Figure 15) were collected after centrifugation. The pellet was treated with 4M urea for 20 minutes at room temperature, and then the supernatant was collected after centrifugation as the surface-associated ACT fraction (dark gray bars). The resulting pellet was then solubilized with 8M urea to isolate the intracellular ACT fraction (black bars). AC enzyme activity was measured and normalized by OD6oo- Data represent the mean +/- SD of two (2) independent experiments done in duplicate. Statistical significance was assessed using a 2-way ANOVA (*** p≤ 0.001 as compared to growth in SSM).
In this strain, detectable ACT was almost entirely intracellular. Comparing equivalent conditions the presence or absence of calcium alone showed no significant difference in intracellular ACT, suggesting that calcium did not influence ACT amount in the Type 1 secretion-deficient strain and supported the hypothesized role for calcium as enhancing ACT secretion. Growth in the presence of albumin had about 1 .7-fold more intracellular ACT than growth in the absence of albumin. These data implicated albumin (possibly acting extracellularly) in increasing intracellular ACT and led to the hypothesis that albumin acted as a signaling molecule to increase ACT amount.
EXAMPLE 8
Albumin Binds to Bvg+ Bp
One mechanism for extracellular albumin to increase intracellular ACT is through engagement of a surface-exposed, bacterial receptor and initiation of intracellular signaling events. Whether albumin physically interacted with Bp was tested by growing Bp in SSM with 2 mM calcium +/- 2 mg/ml BSA, extensively washing the bacteria, and then performing western blot analyses with an anti-BSA antibody. It was determined that BSA bound to both wild- type Bp strains tested (UT25 and BP338) as well as an ACT-deficient BP338 derivative (Bp BP348; see Figure 16). Interestingly, BSA did not bind to Bp BP347, a Bvg(-) BP338 derivative, suggesting that BSA binding required Bvg activation. These data potentially implicated a Bvg-regulated outer membrane factor as an albumin receptor in Bp and provided further support for the role of albumin as a extracellular signal to modulate ACT production in Bp.
EXAMPLE 9
Albumin Affects Amount and/or Localization of Other
Bp Virulence Determinants
Since albumin could act as a signal to alter ACT production, whether the albumin regulon extended beyond ACT to other well-characterized Bp virulence factors was determined. Bp UT25 was grown for 8 hours in SSM with 2 mM calcium +/- 0.46 or 4.6 mg/ml HSA, corresponding to the concentration of albumin in 1 % and 10% concentrations of the human serum pool described herein, respectively. The samples were normalized by bacterial density, and western blot analyses were performed with an anti-FHA or anti-PT polyclonal antibody. Increased PT amount and secretion in the presence of albumin and calcium were observed. The amount of FHA was not dramatically affected by albumin and calcium, but FHA release was increased. Preliminary mass spectroscopy data -/+ FBS indicated that both PRN and Fim3 were increased by serum, which could be a response to albumin and calcium. These data were consistent with a more global response to albumin by Bp that could involve modulation of localization and amount of key virulence traits in response to the host molecule albumin.
Discussion of the EXAMPLES
Pertussis (whooping cough), caused by Bordetella pertussis {Bp), is resurging in the United States and worldwide. Adenylate cyclase toxin (ACT) is a critical factor in establishing infection with Bp and acts by specifically inhibiting the response of myeloid leukocytes to the pathogen. Disclosed herein is the discovery that serum components, as observed during growth in fetal bovine serum (FBS), elicited a robust increase in the amount of ACT, and at least 90% of this ACT was localized to the supernatant, unlike growth without FBS in which at least 90% was associated with the bacterium. As set forth herein, albumin, in the presence of physiological concentrations of calcium, acted specifically to enhance ACT amount and localization to the supernatant and that respiratory secretions, which contain albumin, promoted an increase in amount and localization of active ACT that was comparable to that elicited by serum and albumin. The response to albumin was not mediated through regulation of ACT at the transcriptional level or by activation of the Bvg two-component system. As a further illustration of the specificity of this phenomenon, serum collected from mice that lacked albumin did not stimulate an increase in ACT. These data, demonstrating that albumin and calcium acted synergistically in the host environment to increase production and release of ACT, strongly suggested that this phenomenon reflected a novel host-pathogen interaction that is central to infection with Bp and other Bordetellae.
During quantification of ACT in samples from Sp-infected humans and baboons, it was observed that ACT localization was different than during in vitro growth of Bp (Zaretzky et al. , 2002; Eby et al., 2013). While working to make in vitro conditions more reflective of the environment within the host respiratory tract, it was found that serum components, specifically albumin and calcium, stimulated a robust increase in ACT and changed its distribution. It had previously been reported that Bp secreted high levels of ACT during growth in SSM with albumin (Bellalou et al., 1990b). As dislosed herein, it was determined that ACT amount was increased even further in the presence of albumin and calcium together. Since calcium alone did not increase the amount of ACT but did affect release under our growth conditions, it appeared
that calcium enhanced the effect of albumin by aiding in secretion of ACT (Bumba et al. , 2016). Both albumin and calcium are present in the human respiratory tract, and it was determined that respiratory secretions stimulated ACT production and release (Figure 13), leading to the hypothesis that what is described herein represented the magnitude and localization of ACT during Sp-host interactions. Furthermore, these results indicated that current conditions established for in vitro growth in SSM are not representative of bacterial growth or virulence factor expression within the host, and may stimulate a shift within the Bordetella research community to define new culture conditions that more accurately replicate the host environment.
Albumin comprises approximately 60% of the total serum protein in healthy human adults and performs many functions, importantly maintaining oncotic pressure and binding fatty acids, ions, amino acids, and drugs (Evans, 2002; Fasano et al. , 2005; Merlot et al., 2014). The non-oncotic properties of albumin include transport of metabolites and drugs, free radical scavenging, and modulation of the inflammatory response (Evans, 2002). The data disclosed herein indicated that albumin was responsible for a massive increase in ACT. While not wishing to be bound by any particular theory of operation, those properties of albumin that are required and the mechanism involved could include direct protein-protein interactions between albumin and ACT and/or albumin and a bacterial protein receptor/signaling molecule. It is also feasible, although it is believed to be unlikely, that the effects were not from albumin itself but from a molecule that albumin delivers to the bacterial cell. Because of the data presented herein, this molecule would need to be present in the highly purified albumin employed herein. Regardless of the mechanism, the concept that a host protein, present at the site of infection, was acting specifically to elicit a significant enhancement in the amount of toxin represents an additional level of regulation of a well characterized, critical virulence factor in response to the host environment.
When the Bvg two-component regulatory system was discovered more than thirty years ago, it was termed the master regulator of virulence, at least for the Bordetella species in which it was studied (Arico et al., 1989; Cotter &
Jones, 2003; Melvin et al. , 2014). It is now known that there are other
pathways by which virulence is controlled in this genus (Bibova et al., 2013; Hanawa et al., 2013; Ahuja et al., 2016; Barbier et al., 2016; Coutte et al., 2016), but how these pathways relate to one another and to Bvg is still to be fully determined. The Bvg system controls production of many bacterial proteins, importantly ACT and other virulence factors, and expression is down regulated in response to sulfate, nicotinic acid, and a shift to lower temperature (25°C). Except for studies showing that Bvg activation is sufficient for infection and that the Bvg(-) phase is not required for infection (Cotter & Miller, 1994; Vergara-lrigaray et al., 2005; Martinez de Tejada et al., 1998), there is no direct linkage between what is known about Bvg regulation in vitro and the behavior of Bp in vivo. It is still not known whether Bvg modulation occurs in vivo and, if modulation occurs, what signals within the host are responsible. The data presented herein suggested that response to albumin operates downstream from Bvg, and it is postulated that it may represent a novel mechanism for fine-tuning expression of virulence traits at the post-transcriptional level.
Shown herein is that human respiratory secretions elicited an increased amount of released ACT (Figure 13), highlighting that this regulatory mechanism likely is activated within the host environment and may be a critical determinant in controlling ACT amount and localization during infection. The present disclosure is believed to represent the first steps to understanding a previously unrecognized regulatory process involving communication between the host and pathogen through which albumin affects production of ACT.
Previous studies have identified that albumin influences the growth and virulence of microorganisms (de Chateau et al., 1996; Egesten et al. , 201 1 ; Kruczek et al. , 2012; Traglia et al., 2016). Specifically, albumin has been shown to bind to the bacterial surface of Group B streptococci and inactivate the antibacterial peptide CXCL9, increase expression of virulence genes in Pseudomonas aeruginosa, and specifically induce natural competence in
Acinetobacter baumannii (Egesten et al., 201 1 ; Kruczek et al. , 2012; Traglia et al., 2016). Albumin and serum also affect other RTX toxins. Albumin enhances the activity of the leukotoxin produced by Mannheimia haemoiytica
(formerly Pasteurella haemolytica), through disruption of toxin aggregates (Waurzyniak et al., 1994; Urban-Chmiel et al. , 2004). This mechanism is not, however, consistent with the presently disclosed observations about ACT; mainly, a functional difference between rACT and ACT secreted in the presence of albumin was not observed (Figure 14), and a corresponding increase in ACT amount and enzyme activity was detected (Figure 2). ACT aggregation would decrease the functional activity but would not impact enzyme activity. Additionally, serum and albumin promote the release of leukotoxin from Actinobacillus actinomycetemcomitans from the cell surface, although the association of this leukotoxin with the membrane appears to be different than that of ACT with Bp (Johansson et al., 2003).
Although ACT is established as a critical virulence factor and protective antigen, it was not considered for inclusion in the acellular pertussis vaccines because its purification and characterization were not adequately defined when those products were being developed. Serious evaluation of ACT as a vaccine antigen has been stimulated more recently by the limited duration of protection by current acellular pertussis vaccines and resultant increase in reported pertussis cases. Because only 10% of the total ACT is in the supernatant during growth in SSM, previous studies of ACT have been limited to use of recombinant ACT (from Escherichia coli) or surface-associated ACT (extracted from Bp with urea and refolded in the presence of calcium). It is now recognized that standard conditions for in vitro culture lack sufficient calcium for folding and efficient secretion of ACT and are not reflective of what Bp encounters within 514 the host (Potter et al. , 1967; Bumba et al., 2016).
Furthermore, previous work suggested that there may be structural or functional differences between secreted and surface-associated ACT (Rose et al., 1995; Gray et al., 2004; Hanawa et al. , 2013; Bumba et al., 2016). Disclosed herein is the discovery that albumin, in the presence of physiological concentrations of calcium, stimulated a massive increase of secreted ACT. It is possible that previous observations about ACT amount and localization have been influenced by growth conditions in vitro that are not equivalent to the environment within the host during infection, as has been shown for the effect of physiological concentrations of calcium on ACT folding
and secretion (Masure et al., 1988; Rose et al. , 1995; Rhodes et a/., 2001 ; Chenal et al., 2009; Chenal et al., 2010; Karst et al., 2014; Bumba et al., 2016), and it has now been determined that albumin, in combination with calcium, had an even more robust effect on ACT amount and secretion. Growth under these conditions produced large quantities of secreted ACT, which were not possible to obtain previously, but as set forth herein are now available for use as a vaccine antigen.
In summary, disclosed herein is the identification of albumin and calcium as stimulators of a robust increase in the amount of ACT produced by Bp, that the localization of ACT shifted from being primarily on the surface of the bacterium to the majority of the toxin being in the supernatant, and that this toxin was functionally equivalent to purified ACT in its ability to intoxicate cells. These findings represent a significant and new contribution to knowledge with respect to Bp adenylate cyclase biology by revealing conditions to greatly enhance production of secreted ACT, and conditions that better replicated ACT production and localization within the respiratory tract.
REFERENCES
All references listed in the instant disclosure, including but not limited to all patents, patent applications and publications thereof, scientific journal articles, and database entries (including but not limited to GENBANK® biosequence database entries and including all annotations available therein) are incorporated herein by reference in their entireties to the extent that they supplement, explain, provide a background for, and/or teach methodology, techniques, and/or compositions employed herein. The discussion of the references is intended merely to summarize the assertions made by their authors. No admission is made that any reference (or a portion of any reference) is relevant prior art. Applicants reserve the right to challenge the accuracy and pertinence of any cited reference.
Ahuja et al. (2016) Differential regulation of type III secretion and virulence genes in Bordetella pertussis and Bordetella bronchiseptica by a secreted anti-sigma factor. Proc Natl Acad Sci U S A 1 13:2341 -2348. Altschul et al. (1990a) Basic local alignment search tool. J Mol Biol 215:403-
410.
Altschul et al. (1990b) Protein database searches for multiple alignments.
Proc Natl Acad Sci USA 87(14):5509-5513.
Altschul et al. (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25:3389-3402. Anonymous (1990) Clinical guidelines and indications for bronchoalveolar lavage (BAL): Report of the European Society of Pneumology Task
Group on BAL. Eur Respir J 3:937-976.
Arico et al. (1989) Sequences required for expression of Bordetella pertussis virulence factors share homology with prokaryotic signal transduction proteins. Proc Natl Acad Sci U S A 86:6671 -6675.
Barbier et al. (2016) Modulation of pertussis and adenylate cyclase toxins by sigma factor RpoE in Bordetella pertussis. Infect Immun 85: e00565-
16.
Basler et al. (2006) Pore-forming and enzymatic activities of Bordetella pertussis adenylate cyclase toxin synergize in promoting lysis of monocytes. Infect Immun 74:2207-2214.
Bellalou et al. (1990a) Synthesis and secretion of Bordetella pertussis adenylate cyclase as a 200-kilodalton protein. Infect Immun 58: 1 195-
1200.
Bellalou et al. (1990b) Deletions affecting hemolytic and toxin activities of
Bordetella pertussis adenylate cyclase. Infect Immun 58:3242-3247. Betsou et al. (1993) CyaC-mediated activation is important not only for toxic but also for protective activities of Bordetella pertussis adenylate cyclase-hemolysin. Infect Immun 61 :3583-3589.
Bibova et al. (2013) The RNA chaperone Hfq is required for virulence of
Bordetella pertussis. Infect Immun 81 :4081 -4090.
Boinett et al. (2015) Complete Genome Sequence of Bordetella pertussis
D420. Genome Announc 3: 10.1 128/genomeA.00657-15.
Boucher & Stibitz (1995) Synergistic binding of RNA polymerase and BvgA phosphate to the pertussis toxin promoter of Bordetella pertussis. J
Bacteriol 177:6486-6491 .
Boucher et al. (1994) The modular architecture of bacterial response regulators. Insights into the activation mechanism of the BvgA transactivator of Bordetella pertussis. J Mol Biol 241 :363-377.
Boucher et al. (1997) Nature of DNA binding and RNA polymerase interaction of the Bordetella pertussis BvgA transcriptional activator at the fha promoter. J Bacteriol 179: 1755-1763.
Buboltz et al. (2009) Role of the type III secretion system in a hypervirulent lineage of Bordetella bronchiseptica. Infect Immun 77:3969-3977.
Bumba et al. (2016) Calcium-Driven Folding of RTX Domain beta-Rolls
Ratchets Translocation of RTX Proteins through Type I Secretion
Ducts. Mol Cell 62:47-62.
Carbonetti (2010). Pertussis toxin and adenylate cyclase toxin: key virulence factors of Bordetella pertussis and cell biology tools. Future Microbiol
5:455-469.
Chenal et al. (2009) RTX calcium binding motifs are intrinsically disordered in the absence of calcium: implication for protein secretion. J Biol Chem 284: 1781 -1789.
Chenal et al. (2010) Calcium-induced folding and stabilization of the intrinsically disordered RTX domain of the CyaA toxin. Biophys J 99:3744-3753.
Cherry (2013) Pertussis: challenges today and for the future. PLoS Pathog 9:e1003418.
Confer & Eaton (1982) Phagocyte impotence caused by an invasive bacterial adenylate cyclase. Science 217:948-950.
Cotter & Jones (2003) Phosphorelay control of virulence gene expression in Bordetella. Trends Microbiol 1 1 :367-373.
Cotter & Miller (1994) BvgAS-mediated signal transduction: analysis of phase- locked regulatory mutants of Bordetella bronchiseptica in a rabbit model. Infect Immun 62:3381 -3390.
Cotter et al. (1998) Filamentous hemagglutinin of Bordetella bronchiseptica is required for efficient establishment of tracheal colonization. Infect Immun 66:5921 -5929.
Coutte et al. (2016) The multifaceted RisA regulon of Bordetella pertussis. Sci Rep 6:32774.
de Chateau et al. (1996) Protein PAB, an albumin-binding bacterial surface protein promoting growth and virulence. J Biol Chem 271 :26609- 26615.
Eby et al. (2012) Role of CD1 1 b/CD18 in the process of intoxication by the adenylate cyclase toxin of Bordetella pertussis. Infect Immun 80:850- 859.
Eby et al. (2013) Quantification of the adenylate cyclase toxin of Bordetella pertussis in vitro and during respiratory infection. Infect Immun
81 : 1390-1398.
Eby et al. (2015) Review of the neutrophil response to Bordetella pertussis infection. Pathog Dis 73:ftv081 .
Egesten et al. (201 1 ) Binding of albumin promotes bacterial survival at the epithelial surface. J Biol Chem 286:2469-2476.
Ehrmann et al. (1992) Enzymatic activity of adenylate cyclase toxin from
Bordetella pertussis is not required for hemolysis. FEBS Lett 304:51 -
56.
Evans (2002) Review article: albumin as a drug-biological effects of albumin unrelated to oncotic pressure. Aliment Pharmacol Ther 16 Suppl 5:6-
1 1 .
Fasano et al. (2005) The extraordinary ligand binding properties of human serum albumin. IUBMB Life 57:787-796.
Glaser et al. (1988a) The calmodulin-sensitive adenylate cyclase of Bordetella pertussis: cloning and expression in Escherichia coli. Mol Microbiol
2: 19-30.
Glaser et al. (1988b) Bordetella pertussis adenylate cyclase: the gene and the protein. Tokai J Exp Clin Med 13 Suppl:239-252.
Goodwin & Weiss (1990) Adenylate cyclase toxin is critical for colonization and pertussis toxin is critical for lethal infection by Bordetella pertussis in infant mice. Infect Immun 58:3445-3447.
Gray et al. (1998) Distinct mechanisms for K+ efflux, intoxication, and hemolysis by Bordetella pertussis AC toxin. J Biol Chem 273: 18260- 18267.
Gray et al. (2001 ) Translocation-specific conformation of adenylate cyclase toxin from Bordetella pertussis inhibits toxin-mediated hemolysis. J
Bacteriol 183:5904-5910.
Gray et al. (2004) Newly secreted adenylate cyclase toxin is responsible for intoxication of target cells by Bordetella pertussis. Mol Microbiol
53: 1709-1719.
Guermonprez et al. (2001 ) The adenylate cyclase toxin of Bordetella pertussis binds to target cells via the alpha(M)beta(2) integrin (CD1 1 b/CD18). J Exp Med 193: 1035-1044.
Guiso et al. (1991 ) Protective activity of Bordetella adenylate cyclase- hemolysin against bacterial colonization. Microb Pathog 1 1 :423- 431 .
Hanawa et al. (2013) Role of Bordetella pertussis RseA in the cell envelope stress response and adenylate cyclase toxin release. Pathog Dis 69:7- 20.
Hanski (1989) Invasive adenylate cyclase toxin of Bordetella pertussis.
Trends Biochem Sci 14:459-463.
Harlow & Lane (1988) Antibodies: A Laboratory Manual, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, New York, United States of
America.
Hewlett & Wolff (1976) Soluble adenylate cyclase from the culture medium of Bordetella pertussis: purification and characterization. J Bacteriol 127:890-898.
Hewlett et al. (1976) Extracytoplasmic adenylate cyclase of Bordetella pertussis. Proc Natl Acad Sci U S A 73: 1926-1930.
Hewlett et al. (1989) Adenylate cyclase toxin from Bordetella pertussis.
Identification and purification of the holotoxin molecule. J Biol Chem
264: 19379-19384.
Hewlett et al. (1991 ) Adenylate cyclase toxin from Bordetella pertussis.
Conformational change associated with toxin activity. J Biol Chem 266: 17503-17508.
Hewlett et al. (2006) Macrophage cytotoxicity produced by adenylate cyclase toxin from Bordetella pertussis: more than just making cyclic AMP! Mol
Microbiol 59:447-459.
Johansson et al. (2003) Serum-mediated release of leukotoxin from the cell surface of the periodontal pathogen Actinobacillus actinomycetemcomitans. Eur J Oral Sci 1 1 1 :209-215.
Karlin & Altschul (1990) Methods for assessing the statistical significance of molecular sequence features by using general scoring schemes. Proc
Natl Acad Sci USA 87:2264-2268.
Karlin & Altschul (1993) Applications and statistics for multiple high-scoring segments in molecular sequences. Proc Natl Acad Sci USA 90:5873-5877. Karst et al. (2014) Calcium, acylation, and molecular confinement favor folding of Bordetella pertussis adenylate cyclase CyaA toxin into a monomeric and cytotoxic form. J Biol Chem 289:30702-30716.
Kruczek et al. (2012) Serum albumin alters the expression of iron-controlled genes in Pseudomonas aeruginosa. Microbiology 158:353-367.
Ladant et al. (1986) Bordetella pertussis adenylate cyclase. Purification, characterization, and radioimmunoassay. J Biol Chem 261 : 16264-
16269.
Livak & Schmittgen (2001 ) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method
Methods 25:402-408.
Martinez de Tejada et al. (1998) Neither the Bvg- phase nor the vrg6 locus of
Bordetella pertussis is required for respiratory infection in mice. Infect
Immun 66:2762- 2768.
Masson et al. (1965) Studies on the proteins of human bronchial secretions.
Biochim Biophys Acta 1 1 1 :466-478.
Masure et al. (1988) The interaction of Ca2+ with the calmodulin-sensitive adenylate cyclase from Bordetella pertussis. J Biol Chem 263:6933-
6940.
Mattoo & Cherry (2005) Molecular pathogenesis, epidemiology, and clinical manifestations of respiratory infections due to Bordetella pertussis and other Bordetella subspecies. Clin Microbiol Rev 18:326-382.
McLafferty et al. (1988) Nucleotide sequence and characterization of a repetitive DNA element from the genome of Bordetella pertussis with characteristics of an insertion sequence. J Gen Microbiol 134:2297- 2306.
Meade et al. (2014) Possible options for new pertussis vaccines. J Infect Dis 209 Suppl 1 :S24-7.
Melton & Weiss (1989) Environmental regulation of expression of virulence determinants in Bordetella pertussis. J Bacteriol 171 :6206-6212.
Melvin et al. (2014) Bordetella pertussis pathogenesis: current and future challenges. Nat Rev Microbiol 12:274-288.
Menozzi et al. (1994) Heparin-inhibitable lectin activity of the filamentous hemagglutinin adhesin of Bordetella pertussis. Infect Immun 62:769-
778.
Merlot et al. (2014) Unraveling the mysteries of serum albumin-more than just a serum protein. Front Physiol 5:299.
Nicholson et al. (2000) The role of albumin in critical illness. Br J Anaesth
85:599-610.
Parker et al. (1980) Variability in derivative strains of Bordetella pertussis. Dev
Biol Stan 45: 1 19-127.
Peters (1996) All about albumin: biochemistry, genetics, and medical applications. Academic Press, San Francisco, California.
Plotkin (2014) Pertussis: pertussis control strategies and the options for improving current vaccines. Expert Rev Vaccines 13: 1071 -1072.
Potter et al. (1967) Studies on pulmonary secretions. II. Osmolality and the ionic environment of pulmonary secretions from patients with cystic fibrosis, bronchiectasis, and laryngectomy. Am Rev Respir Dis 96:83-
87.
Rhodes et al. (2001 ) Structural consequences of divalent metal binding by the adenylyl cyclase toxin of Bordetella pertussis. Arch Biochem Biophys 395: 169-176.
Rogel et al. (1989) Bordetella pertussis adenylate cyclase: purification and characterization of the toxic form of the enzyme. EMBO J 8:2755-2760.
Roopenian et al. (2015) Albumin-deficient mouse models for studying metabolism of human albumin and pharmacokinetics of albumin-based drugs. MAbs 7:344-351 .
Rose et al. (1995) Interaction of calcium with Bordetella pertussis adenylate cyclase toxin. Characterization of multiple calcium sites and calcium- induced conformational changes. J Biol Chem 270:26370-26376.
Salomon et al. (1974) A highly sensitive adenylate cyclase assay. Anal Biochem 58:541 -548.
Sato & Arai (1972) Leucocytosis-promoting factor of Bordetella pertussis. I.
Purification and characterization. Infect I mm un 6:899-904.
Sebo et al. (2014) Adenylate cyclase toxin-hemolysin relevance for pertussis vaccines. Expert Rev Vaccines 13: 1215-1227.
Stainer & Scholte (1970) A simple chemically defined medium for the production of phase I Bordetella pertussis. J Gen Microbiol 63:21 1 -220.
Steffen et al. (1996) Phosphorylated BvgA is sufficient for transcriptional activation of virulence-regulated genes in Bordetella pertussis. EMBO J 15: 102-109.
Thomas et al. (2014) The Type 1 secretion pathway - the hemolysin system and beyond. Biochim Biophys Acta 1843: 1629-1641 .
Traglia et al. (2016) Serum Albumin and Ca2+ Are Natural Competence
Inducers in the Human Pathogen Acinetobacter baumannii. Antimicrob
Agents Chemother 60:4920-4929.
Urban-Chmiel et al. (2004) Evaluation of Mannheimia haemolytica leukotoxin prepared in nonsupplemented and BSA or FBS supplemented RPMI
1640 medium. Pol J Vet Sci 7: 1 -8.
U.S. Patent Nos. 5,264,563 and 5,824,483.
Vergara-lrigaray et al. (2005) Evaluation of the role of the Bvg intermediate phase in Bordetella pertussis during experimental respiratory infection. Infect Immun 73:748-760.
Vojtova et al. (2006) Bordetella adenylate cyclase toxin: a swift saboteur of host defense. Curr Opin Microbiol 9:69-75.
Vojtova-Vodolanova et al. (2009) Oligomerization is involved in pore formation by Bordetella adenylate cyclase toxin. FASEB J 23:2831 -2843.
Walters & Sperandio (2006) Autoinducer 3 and epinephrine signaling in the kinetics of locus of enterocyte effacement gene expression in enterohemorrhagic Escherichia coli. Infect Immun 74:5445-5455.
Warfel & Edwards (2015) Pertussis vaccines and the challenge of inducing durable immunity. Curr Opin Immunol 35:48-54.
Waurzyniak er a/. (1994) Enhancement of Pasteurella haemolytica leukotoxic activity by bovine serum albumin. Am J Vet Res 55: 1267-1274.
Weiss & Goodwin (1989) Lethal infection by Bordetella pertussis mutants in the infant mouse model. Infect Immun 57:3757-3764.
Weiss et al. (1983) Tn5-induced mutations affecting virulence factors of Bordetella pertussis. Infect Immun 42:33-41 .
Yeager (1971 ) Tracheobronchial secretions. Am J Med 50:493-509.
Zaretzky et al. (2002) Mechanism of association of adenylate cyclase toxin with the surface of Bordetella pertussis: a role for toxin- haemagglutinin interaction. Mol Microbiol 45: 1589-1598.
Headings are included herein for reference and to aid in locating certain sections. These headings are not intended to limit the scope of the concepts described therein under, and these concepts can have applicability in other sections throughout the entire specification.
It will be understood that various details of the presently disclosed subject matter may be changed without departing from the scope of the presently disclosed subject matter. Furthermore, the foregoing description is for the purpose of illustration only, and not for the purpose of limitation.
Claims
What is claimed is:
1 . A method for increasing production of a polypeptide in a bacterial cell in culture, the method comprising contacting a bacterial cell in a culture medium with an amount of an albumin polypeptide sufficient to induce an increase in accumulation of the polypeptide in the bacterial cell and/or an increase in secretion of the polypeptide from the bacterial cell into the culture medium relative to a bacterial cell grown in a culture medium in the absence of the albumin polypeptide.
2. The method of claim 1 , wherein the bacterial cell is a Bordeteiia species cell, optionally wherein the Bordeteiia species cell is a Bordeteiia pertussis cell, a Bordeteiia bronchiseptica cell, or a Bordeteiia parapertussis cell.
3. The method of claim 1 or claim 2, wherein the polypeptide is a Bp adenylate cyclase toxin (ACT) polypeptide or a fragment thereof; pertussis toxin (PT) polypeptide or a fragment thereof; Bp filamentous hemagglutinin adhesin (FHA) polypeptide or a fragment thereof; Bp pertactin (PRN) polypeptide or a fragment thereof; Bp fimbriae 2 (Fim2) polypeptide or a fragment thereof; Bp fimbriae 3 (Fim3) polypeptide or a fragment or thereof; or a combination thereof.
4. The method of any one of claims 1 -3, wherein the culture medium comprises sufficient calcium to enhance secretion of the polypeptide from the bacterial cell into the culture medium.
5. The method of claim 4, wherein the concentration of calcium in the culture medium is at least about 0.5 mM.
6. The method of claim 1 , wherein the amount of the albumin polypeptide is at least 0.2 mg/ml in the culture medium.
7. A kit comprising albumin and instructions for its use in increasing accumulation of a polypeptide in a bacterial cell in a culture medium and/or for increasing secretion of the polypeptide from the bacterial cell into a culture medium.
8. The kit of claim 7, wherein the bacterial cell is a Bordeteiia species cell, optionally wherein the Bordeteiia species cell is a Bordeteiia pertussis
cell, a Bordetella bronchiseptica cell, or a Bordetella parapertussis cell.
9. The kit of claim 7 or claim 8, wherein the polypeptide is a Bp adenylate cyclase toxin (ACT) polypeptide or a fragment thereof; pertussis toxin (PT) polypeptide or a fragment thereof; Bp filamentous hemagglutinin adhesin (FHA) polypeptide or a fragment thereof; Bp pertactin (PRN) polypeptide or a fragment thereof; Bp fimbriae 2 (Fim2) polypeptide or a fragment thereof; Bp fimbriae 3 (Fim3) polypeptide or a fragment thereof; or a combination thereof.
10. The kit of any one of claims 7-9, wherein the kit further comprises calcium and/or a salt thereof for use in increasing secretion of the polypeptide from the bacterial cell into the culture medium.
1 1 . The kit of any one of claims 7-10, further comprising a ligand adapted for removing the albumin from the culture medium.
12. The kit of claim 1 1 , wherein the ligand binds specifically to the albumin when the albumin is present in the culture medium.
13. The kit of claim 12, wherein the ligand is an antibody or a fragment or derivative thereof.
14. The kit of any one of claims 1 1 -13, wherein the ligand comprises a bead, optionally a magnetic bead, to which the albumin is directly or indirectly conjugated.
15. The kit of claim 14, wherein the albumin is indirectly conjugated to the bead via a tether, optionally wherein the tether comprising an antibody or a fragment or derivative thereof that specifically binds to the albumin and is conjugated to the bead.
16. A method for screening for a molecule that inhibits albumin-induced signaling in a bacterial cell, the method comprising:
a. contacting a bacterial cell growing in a culture medium with a candidate compound, wherein the culture medium comprises at least 0.5 mM calcium and at least 0.2 mg/ml albumin; and b. comparing accumulation of a gene product in the culture medium in presence of the candidate compound to accumulation of the gene product in the culture medium in absence of the candidate compound,
wherein reduced accumulation of the gene product in the culture medium in presence of the candidate compound as compared to in absence of the candidate compound is indicative of the candidate compound being a molecule that inhibits albumin-induced signaling in the bacterial cell.
A method for screening for a molecule that inhibits albumin-induced signaling in a bacterial cell, the method comprising:
a. contacting a bacterial cell growing in a culture medium with a candidate compound, wherein the culture medium comprises less than about 0.5 mM calcium and at least about 0.2 mg/ml albumin ; and
b. comparing accumulation of a gene product in the bacterial cell in presence of the candidate compound to accumulation of the gene product in the bacterial cell in absence of the candidate compound.
wherein reduced accumulation of the gene product in the bacterial cell in presence of the candidate compound as compared to in absence of the candidate compound is indicative of the candidate compound being a molecule that inhibits albumin-induced signaling in the bacterial cell. The method of claim 16 or 17, wherein the bacterial cell is a Bordetella species cell, optionally wherein the Bordetella species cell isa Bordetella pertussis cell, a Bordetella bronchiseptica cell, or a Bordetella parapertussis cell.
The method of any one of claims 16-18, wherein the polypeptide is a Bp adenylate cyclase toxin (ACT) polypeptide or a fragment thereof; pertussis toxin (PT) polypeptide or a fragment thereof; Bp filamentous hemagglutinin adhesin (FHA) polypeptide or a fragment thereof; Bp pertactin (PRN) polypeptide or a fragment thereof; Bp fimbriae 2 (Fim2) polypeptide or a fragment thereof; Bp fimbriae 3 (Fim3) polypeptide or a fragment thereof; or a combination thereof.
The method of any one of claims 16-19, wherein the candidate compound is a fragment of an albumin polypeptide.
The method of any one of claims 16-19, wherein the candidate
compound is an antibody or a small molecule.
22. A method for treating or preventing a bacterial infection in a subject in need thereof, the method comprising administering to the subject an effective amount of a molecule that inhibits albumin-induced signaling, thereby treating or preventing a bacterial infection in the subject.
23. The method of claim 22, wherein the bacteria is a Bordetella species, optionally wherein the Bordetella species is Bordetella pertussis, Bordetella bronchiseptica or Bordetella parapertussi.
24. A method for producing a vaccine component, the method comprising: a. growing bacterial cells in a culture medium comprising a sufficient concentration of albumin to induce an increase in accumulation of the polypeptide in the cells and/or secretion of the polypeptide from the cells into the culture medium; and b. isolating the polypeptide from the cells and/or the culture medium,
whereby a vaccine component is produced.
25. The method of claim 24, wherein the bacterial cells comprise a Bordetella species cell, optionally wherein the Bordetella species cell is a Bordetella pertussis cell, a Bordetella bronchiseptica cell, or a Bordetella parapertussis cell.
26. The method of claim 24 or claim 25, wherein the polypeptide is a Bp adenylate cyclase toxin (ACT) polypeptide or a fragment thereof; pertussis toxin (PT) polypeptide or a fragment thereof; Bp filamentous hemagglutinin adhesin (FHA) polypeptide or a fragment thereof; Bp pertactin (PRN) polypeptide or a fragment thereof; Bp fimbriae 2 (Fim2) polypeptide or a fragment thereof; Bp fimbriae 3 (Fim3) polypeptide or a fragment thereof; or a combination thereof.
27. The method of any one of claims 24-26, further comprising inactivating the polypeptide or the fragment or thereof.
28. The method of any one of claims 24-27, wherein the culture medium comprises at least about 0.2 mg/ml albumin.
29. The method of any one of claims 24-28, wherein the culture medium comprises at least about 0.5 mM calcium.
The method of any one of claims 24-29, wherein the polypeptide is purified from the culture medium using a ligand that binds to the polypeptide.
The method of claim 30, wherein the ligand is an antibody or a fragment or derivative thereof.
The method of claim 30 or claim 31 , wherein the ligand comprises a bead, optionally a magnetic bead, to which the ligand or the fragment or derivative thereof is directly or indirectly conjugated.
The method of claim 32, wherein the ligand is indirectly conjugated to the bead via a tether, optionally wherein the tether comprises polyethylene glycol.
The method of any one of claims 24-33, further comprising combining the polypeptide with one or more additional polypeptides to produce an antigen pool to be employed in a vaccine.
The method of claim 34, wherein the one or more additional polypeptides are selected from the group consisting of pertussis toxin (PT), Bp filamentous hemagglutinin adhesin (FHA), Bp pertactin (PRN), Bp fimbriae 2 (Fim2), Bp fimbriae 3 (Fim3), diphtheria toxoid, tetanus toxoid, a polio antigen, a Haemophilus influenzae type b antigen, a HepB antigen, or a combination thereof.
The method of any one of claims 24-35, further comprising adding one or more pharmaceutically acceptable carriers and/or excipients, thereby producing a vaccine.
The method of claim 36, wherein the vaccine is in the form of an injectable or an aerosol.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US16/091,039 US20190071706A1 (en) | 2016-04-04 | 2017-04-04 | Compositions and methods for preventing and treating disease |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201662318158P | 2016-04-04 | 2016-04-04 | |
| US62/318,158 | 2016-04-04 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2017176796A1 true WO2017176796A1 (en) | 2017-10-12 |
Family
ID=60000644
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2017/026012 Ceased WO2017176807A2 (en) | 2016-04-04 | 2017-04-04 | Compositions for inhibiting formation of and/or disrupting bacterial biofilms and methods of use therefor |
| PCT/US2017/025995 Ceased WO2017176796A1 (en) | 2016-04-04 | 2017-04-04 | Compositions and methods for preventing and treating disease |
Family Applications Before (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2017/026012 Ceased WO2017176807A2 (en) | 2016-04-04 | 2017-04-04 | Compositions for inhibiting formation of and/or disrupting bacterial biofilms and methods of use therefor |
Country Status (2)
| Country | Link |
|---|---|
| US (2) | US20190071706A1 (en) |
| WO (2) | WO2017176807A2 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108396030A (en) * | 2018-05-10 | 2018-08-14 | 中山大学 | Litopenaeus vannamei antibacterial peptide gene Lv-BigPEN and its recombinant protein and application |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20190071706A1 (en) | 2016-04-04 | 2019-03-07 | University Of Virginia Patent Foundation | Compositions and methods for preventing and treating disease |
| US20210220462A1 (en) * | 2018-08-23 | 2021-07-22 | Glaxosmithkline Biologicals Sa | Immunogenic proteins and compositions |
| WO2020097213A2 (en) * | 2018-11-07 | 2020-05-14 | The Regents Of The University Of Michigan | Compositions and methods for production of cysteine |
| US20220362361A1 (en) * | 2019-10-18 | 2022-11-17 | University Of Virginia Patent Foundation | Compositions and methods for producing enhanced immune responses and rapid antibody production |
| CN112451481B (en) * | 2020-12-27 | 2023-01-13 | 西北农林科技大学 | Application of gamma globulin in preparing medicine for preventing and treating intravascular hemolysis induced by puerarin injection |
| US12332198B2 (en) * | 2022-07-11 | 2025-06-17 | Ohio State Innovation Foundation | Metabolite based diagnostics for periprosthetic joint infection |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014005039A2 (en) * | 2012-06-29 | 2014-01-03 | Cytosorbents Corporation | Methods of using polymers |
Family Cites Families (24)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4057626A (en) | 1976-10-08 | 1977-11-08 | Richardson-Merrell Inc. | Process for detoxifying influenza B virus |
| FR2638169B1 (en) * | 1988-10-25 | 1991-01-11 | Pasteur Institut | ADENYL CYCLASE DERIVATIVES AND THEIR BIOLOGICAL USES |
| FR2736064B1 (en) * | 1995-06-30 | 1997-09-05 | Pasteur Institut | PROTECTIVE EPITOPES OF ADENYL CYCLASE-HEMOLYSIN (AC-HTY). THEIR APPLICATION TO THE TREATMENT OR PREVENTION OF BORDETELLA INFECTIONS |
| US20020037260A1 (en) | 1997-10-16 | 2002-03-28 | Budny John A. | Compositions for treating biofilm |
| US6830745B1 (en) | 1997-10-16 | 2004-12-14 | Pharmacal Biotechnologies, Llc | Compositions for treating biofilm |
| EP1068871A1 (en) | 1999-07-07 | 2001-01-17 | Jean-Paul Perraudin | Novel methods and medicament for treating infections diseases involving microbial biofilms |
| JP2003532698A (en) * | 2000-05-10 | 2003-11-05 | プリンストン ユニバーシティ | Compounds and methods for regulating bacterial growth and pathogenesis |
| US6726898B2 (en) | 2000-11-17 | 2004-04-27 | Gary R. Jernberg | Local delivery of agents for disruption and inhibition of bacterial biofilm for treatment of periodontal disease |
| US9089407B2 (en) | 2001-04-23 | 2015-07-28 | Massachusetts Institute Of Technology | Antibacterial coatings that inhibit biofilm formation on implants |
| US20040009927A1 (en) * | 2002-05-13 | 2004-01-15 | Tony Romeo | Methods and compounds for reducing biofilm formulation |
| EP2277551B1 (en) | 2002-09-06 | 2013-05-08 | Cerulean Pharma Inc. | Cyclodextrin-based polymers for delivering the therapeutic agents covalently bound thereto |
| US7393924B2 (en) | 2004-01-06 | 2008-07-01 | Franco Vitaliano | Smart bio-nanoparticle elements |
| US20060105025A1 (en) | 2004-11-15 | 2006-05-18 | Hill Ira D | Recovery pet chews |
| EP2308504A3 (en) | 2005-09-01 | 2011-11-30 | Novartis Vaccines and Diagnostics GmbH | Multiple vaccines including serogroup C meningococcus |
| US20100021391A1 (en) | 2006-07-14 | 2010-01-28 | Montana State University | Novel nanoparticles for biofilm targeting |
| US8119156B2 (en) | 2006-10-24 | 2012-02-21 | Aradigm Corporation | Dual action, inhaled formulations providing both an immediate and sustained release profile |
| ES2331271B1 (en) * | 2007-06-29 | 2010-10-14 | Universidad Del Pais Vasco | METHOD FOR THE INTERNALIZATION OF NON INVASIVE BACTERIA IN EUCARIOT CELLS. |
| GB0905451D0 (en) | 2009-03-31 | 2009-05-13 | Novabiotics Ltd | Biofilms |
| WO2012103257A2 (en) | 2011-01-25 | 2012-08-02 | The Regents Of The University Of California | Transcutaneous multimodal delivery systems |
| IN2014CN04700A (en) | 2011-12-21 | 2015-09-18 | Bionet Asia Co Ltd | |
| EP2958557B1 (en) | 2013-02-25 | 2019-11-27 | University Of Rochester | Nanoparticles for controlled release of anti-biofilm agents |
| EP2994154B1 (en) * | 2013-05-10 | 2020-02-26 | Academisch Ziekenhuis Leiden h.o.d.n. LUMC | Antimicrobial peptide |
| EP2975126A1 (en) * | 2014-07-15 | 2016-01-20 | Institut Pasteur | In vivo detection of proteins interaction based on adenylate cyclase hybrid system |
| US20190071706A1 (en) * | 2016-04-04 | 2019-03-07 | University Of Virginia Patent Foundation | Compositions and methods for preventing and treating disease |
-
2017
- 2017-04-04 US US16/091,039 patent/US20190071706A1/en not_active Abandoned
- 2017-04-04 US US16/091,046 patent/US11207378B2/en active Active
- 2017-04-04 WO PCT/US2017/026012 patent/WO2017176807A2/en not_active Ceased
- 2017-04-04 WO PCT/US2017/025995 patent/WO2017176796A1/en not_active Ceased
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014005039A2 (en) * | 2012-06-29 | 2014-01-03 | Cytosorbents Corporation | Methods of using polymers |
Non-Patent Citations (3)
| Title |
|---|
| BOGDAN ET AL.: "Bordetella Pertussis Autoregulates Pertussis Toxin Production Through The Metabolism Of Cysteine", INFECTION AND IMMUNITY, vol. 69, November 2001 (2001-11-01), pages 6823 - 6830, XP055430752 * |
| JOHN ET AL.: "Bacillus Anthracis Co-opts Nitric Oxide And Host Serum Albumin For Pathogenicity In Hypoxic Conditions", FRONTIERS IN CELLULAR AND INFECTION MICROBIOLOGY, vol. 3, 17 May 2013 (2013-05-17), pages 1 - 13, XP055430759 * |
| LEE ET AL.: "A Program Of Yersinia Enterocolitica Type III Secretion Reactions Is Activated By Specific Signals", JOURNAL OF BACTERIOLOGY, vol. 183, September 2001 (2001-09-01), pages 4970 - 4978, XP055430758 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108396030A (en) * | 2018-05-10 | 2018-08-14 | 中山大学 | Litopenaeus vannamei antibacterial peptide gene Lv-BigPEN and its recombinant protein and application |
| CN108396030B (en) * | 2018-05-10 | 2021-08-06 | 中山大学 | Antimicrobial Peptide Gene Lv-BigPEN of Penaeus vannamei and Its Recombinant Protein and Application |
Also Published As
| Publication number | Publication date |
|---|---|
| US20190111106A1 (en) | 2019-04-18 |
| WO2017176807A3 (en) | 2018-04-12 |
| US20190071706A1 (en) | 2019-03-07 |
| US11207378B2 (en) | 2021-12-28 |
| WO2017176807A9 (en) | 2018-05-11 |
| WO2017176807A2 (en) | 2017-10-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20190071706A1 (en) | Compositions and methods for preventing and treating disease | |
| Gasperini et al. | Outer membrane vesicles (OMV)-based and proteomics-driven antigen selection identifies novel factors contributing to Bordetella pertussis adhesion to epithelial cells | |
| US7226597B2 (en) | Mutants of Clostridium difficile toxin B and methods of use | |
| Hoffman et al. | Bordetella adenylate cyclase toxin interacts with filamentous haemagglutinin to inhibit biofilm formation in vitro | |
| US20240115687A1 (en) | Attenuating bacterial virulence by attenuating bacterial folate transport | |
| Rodrigues et al. | Development and evaluation of a new recombinant protein vaccine (YidR) against Klebsiella pneumoniae infection | |
| JP2003531841A (en) | Compounds and methods for treatment and prevention of microbial infections | |
| Gonyar et al. | Albumin, in the presence of calcium, elicits a massive increase in extracellular Bordetella adenylate cyclase toxin | |
| EP3458088A2 (en) | Compositions and methods for treating secondary tuberculosis and nontuberculous mycobacterium infections | |
| US20240309390A1 (en) | Minicells from highly genome reduced escherichia coli: cytoplasmic and surface expression of recombinant proteins and incorporation in the minicells | |
| CN111787943B (en) | Epsilon toxin from Clostridium perfringens as a vaccine | |
| Huang et al. | Identification and characterisation a surface-associated arginine peptidase in Streptococcus suis serotype 2 | |
| JP4302784B2 (en) | Adenyl cyclase-protective epitope of hemolysin (AC-Hly) and its application in the treatment or prevention of Bordetella infection | |
| US20130196367A1 (en) | Modulators of candida hyphal morphogenesis and uses thereof | |
| WO2011103465A2 (en) | Botulinum neurotoxin antigenic compositions and methods | |
| JPH11337548A (en) | New DbpB | |
| Ernst | Novel Strategies to Inhibit Pertussis Toxin. Toxins 2022, 14, 187 | |
| Wang et al. | TLR4 agonist combined with trivalent protein JointS of Streptococcus suis provides immunological protection in animals. Vaccines (Basel). 2021; 9 (2): 184 | |
| Qin et al. | Protective antigens hidden in the bovine Clostridium vaccine | |
| Kling | Characterization of new approaches to inhibit Pertussis toxin based on human peptides and cellular chaperone inhibitors | |
| KR20190071720A (en) | Combination of vasoconstrictive and antimicrobial treatment of injection | |
| WO2011097688A1 (en) | Protein domains and uses therefor | |
| WO2005004791A2 (en) | Compounds and methods for the treatment and prevention of bacterial infection |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 17779687 Country of ref document: EP Kind code of ref document: A1 |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 17779687 Country of ref document: EP Kind code of ref document: A1 |



