WO2017175842A1 - Compound and pharmaceutical composition pertaining to modification of splicing - Google Patents

Abstract

Provided are a compound and a pharmaceutical composition pertaining to the modification of splicing, the use of these, or a method for preventing, improving, suppressing the advance of, and/or treating a genetic disease in which the compound and pharmaceutical composition are used. In one or more embodiments, a pharmaceutical composition for modifying splicing has as an active ingredient a compound represented by general formula (I) or a prodrug thereof or a pharmacologically acceptable salt thereof, said compound having the ability to inhibit the phosphorylase activity of protein kinase. X²: -(bond) or -NH-

Description

Compounds and pharmaceutical compositions for splicing modification

The present disclosure relates to compounds and pharmaceutical compositions relating to splicing modification, their use, and methods for the prevention, amelioration, progression inhibition and / or treatment of genetic diseases using them.

Duchenne muscular dystrophy (DMD) is composed of 79 exons, which are the cause of the dystrophin gene, and has an optional repeat structure, so exon skip induction therapy is possible. In other words, frame shifts due to gene mutations and the appearance of stop codons cause dystrophin protein abnormalities, but functionally full-length dystrophin protein that lacks skipped exons by artificially skipping mutant exons to match the frame It is believed that symptoms can be alleviated.

It has been reported that a low molecular weight compound is effective in promoting exon skipping of a dystrophin gene having a certain mutation and that DMD can be treated by exon skipping with the low molecular weight compound (Non-patent Document 1).

The present disclosure, in one aspect, provides compounds and pharmaceutical compositions capable of modifying splicing, their use, and methods for preventing, ameliorating, suppressing progression and / or treating genetic diseases using them.

In one aspect, the present disclosure includes a compound represented by the following general formula (I), a prodrug thereof, or a pharmaceutically acceptable salt thereof as an active ingredient, and the compound has an ability to inhibit the phosphorylation activity of a protein kinase. The present invention relates to a pharmaceutical composition for modifying splicing.

[Here, in the general formula (I),
X ¹ is

R ³ , R ⁴ and R ⁵ are each independently hydrogen, a halogen atom, a carboxyl group, an amino group, a hydroxyl group, a C _1-4 alkyl group, or a C _1-4 substituted with a halogen atom. An alkyl group,
X ² is — (bond) or —NH—,
R ¹ is

R ⁶ , R ⁷ , R ⁸ , and R ⁹ each independently represent hydrogen, a halogen atom, a carboxyl group, an amino group, a hydroxyl group, a C _1-4 alkyl group, or a C atom substituted with a halogen atom. _1-4 alkyl group,
R ² is hydrogen, a halogen atom, a carboxyl group, an amino group, a hydroxyl group, a C _1-4 alkyl group, or a C _1-4 alkyl group substituted with a halogen atom. ]

In another aspect, the present disclosure relates to a method for preventing, ameliorating, suppressing progression and / or treating a genetic disease, the method comprising administering to a subject a pharmaceutical composition according to the present disclosure.

In another aspect, the present disclosure provides a compound represented by the above general formula (I) or a prodrug thereof for producing a pharmaceutical composition for preventing, ameliorating, suppressing progression and / or treating a genetic disease Or the use of a pharmaceutically acceptable salt thereof.

In another aspect, the present disclosure relates to the use of a compound represented by the above general formula (I) or a prodrug thereof or a pharmaceutically acceptable salt thereof for modifying splicing. Moreover, this indication is related with the compound represented by the said general formula (I), its prodrug, or its pharmaceutically acceptable salt in another aspect.

FIG. 1 is an example of the results of measuring the blood concentration when compound 3 and TG003 were administered to mice once subcutaneously. FIG. 2 shows an example of the result of confirming the Clk inhibitory activity by in vitro kinase analysis of Compound 3. FIG. 3 is a schematic diagram of a reporter plasmid capable of detecting exon skip. FIG. 4 is an example of the results of detecting the inhibitory effect of Compound 3 on SR protein phosphorylation in HeLa cells into which a DMD patient reporter was introduced. FIG. 5 is an example of the result of detecting the exon skip activity of Compound 3 using a DMD patient reporter introduced into HeLa cells. FIG. 6 is an example of the result of confirming that the frequency of exon skip is increased in patient-derived muscle cells by the addition of Compound 3. FIG. 7 is an example of the result of confirming that the expression level of dystrophin protein is increased in patient-derived muscle cells by the addition of Compound 3. FIG. 8 is an example of the results of confirming the uptake of compound 3 in muscle tissue after oral administration of compound 3. FIG. 9 is an example of the results of confirming the inhibitory effect on phosphorylation of SR protein in muscle tissue after oral administration of compound 3. FIG. 10 is an example of the results of confirming that splicing changes in muscle tissue after oral administration of Compound 3 to mice. FIG. 11 shows an example of the result of detecting the exon skip activity of a compound using a DMD patient reporter introduced into HeLa cells. FIG. 12 is an example of the results of confirming that the frequency of specific exon skipping is increased in patient-derived muscle cells by the addition of Compound 3.

The present disclosure is based on the knowledge that in one aspect, a compound represented by the following general formula (I) can exhibit an effect of altering splicing. The present disclosure is also based on the finding that, in one aspect, alteration of splicing enables prevention, improvement, progression inhibition, and / or treatment of genetic diseases.

The present disclosure, in one aspect, relates to a compound represented by the following general formula (I), a prodrug thereof, or a pharmaceutically acceptable salt thereof. In the present disclosure, a compound represented by the following general formula (I) or a prodrug thereof or a pharmaceutically acceptable salt thereof is also referred to as a “compound according to the present disclosure”.

[Here, in the general formula (I),
X ¹ is

R ³ , R ⁴ and R ⁵ are each independently hydrogen, a halogen atom, a carboxyl group, an amino group, a hydroxyl group, a C _1-4 alkyl group, or a C _1-4 substituted with a halogen atom. An alkyl group,
X ² is — (bond) or —NH—,
R ¹ is

R ⁶ , R ⁷ , R ⁸ , and R ⁹ each independently represent hydrogen, a halogen atom, a carboxyl group, an amino group, a hydroxyl group, a C _1-4 alkyl group, or a C atom substituted with a halogen atom. _1-4 alkyl group,
R ² is hydrogen, a halogen atom, a carboxyl group, an amino group, a hydroxyl group, a C _1-4 alkyl group, or a C _1-4 alkyl group substituted with a halogen atom. ]
In the present disclosure, a bond with a wavy line indicates a bond portion with the formula (I).

In one or a plurality of embodiments, the compound according to the present disclosure has the ability to inhibit the phosphorylation activity of protein kinase. The protein kinase that the compound according to the present disclosure inhibits is not particularly limited, and examples include kinases such as Haspin, CLK1, DYRK1A, DYRK2, DYRK1B, HGK, DYRK3, CDK9 / CycT1, and MINK2.

The compound according to the present disclosure is presumed to induce splicing modification by having the ability to inhibit the phosphorylation activity of protein kinase, but the present disclosure is not limited to this mechanism. Good.

In the present disclosure, “splicing modification” means that the mode of pre-mRNA splicing changes. In one or more embodiments, alteration of splicing may include exon skipping or suppression thereof, intron insertion or suppression thereof, selective splicing enhancement or suppression thereof. Splicing modifications can be performed in vivo, ex vivo, or in vitro.

In the present disclosure, “exon skip” means that one or more exons are removed when a gene composed of a plurality of exons and a plurality of introns is removed from the transcribed mRNA precursor to form a mature mRNA. That means.

In the present disclosure, “gene disease” refers to a disease caused by a genetic abnormality. When splicing alterations occur, it may be possible to prevent, ameliorate, inhibit progression, and / or treat genetic diseases.

Therefore, in one aspect, the present disclosure relates to a pharmaceutical composition containing the compound according to the present disclosure as an active ingredient. In the present disclosure, a pharmaceutical composition containing the compound according to the present disclosure as an active ingredient is also referred to as a “pharmaceutical composition according to the present disclosure”.

The pharmaceutical composition according to the present disclosure is, in one or more embodiments, a pharmaceutical composition for modifying splicing, and in one or more embodiments, is a pharmaceutical composition for inducing exon skip. . In one or a plurality of embodiments, the pharmaceutical composition according to the present disclosure is a pharmaceutical composition for modifying splicing by having an ability to inhibit the phosphorylation activity of a protein kinase, and further includes one or more In the embodiment of the present invention, the pharmaceutical composition for inducing exon skipping by having the ability to inhibit the phosphorylation activity of protein kinase.

As one or a plurality of embodiments of the genetic disease that can be improved, suppressed or treated by modifying splicing, muscular dystrophy can be mentioned. As described above, Duchenne muscular dystrophy (DMD) is considered to be caused by the fact that functional dystrophin protein is not expressed due to gene mutation such as frame shift of dystrophin gene and stop codon. On the other hand, the dystrophin gene consists of 79 exons and has an optional repeat structure. It is believed that by artificially skipping a mutant exon containing the gene mutation so that the frame matches, a functional full-length dystrophin protein can be induced although the skipped exon is lacking, and the symptoms can be alleviated.

Therefore, in one or a plurality of embodiments, the pharmaceutical composition according to the present disclosure is a pharmaceutical composition for preventing, improving, suppressing progression, and / or treating a genetic disease. In one or a plurality of embodiments, the genetic disease is a genetic disease in which a mutation causing the disease can be eliminated or suppressed by altering splicing, and in one or a plurality of embodiments, exon skipping is performed. It refers to a genetic disease that can occur to eliminate or suppress a mutation that causes the disease. An example of the genetic disease is muscular dystrophy, but the present invention is not limited thereto. In the present disclosure, “muscular dystrophy” includes progressive muscular dystrophy in one or a plurality of embodiments, and includes Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) in one or more embodiments. .

In the general formula (I), R ² , R ³ , R ⁴ , R ⁵ , R ⁶ , R ⁷ , R ⁸ and R ⁹ are each independently a hydrogen atom or a halogen atom in one or more embodiments. , A C _1-4 alkyl group, or a C _1-4 alkyl group substituted with a halogen atom.

In the present disclosure, examples of the C _1-4 alkyl group include a methyl group, an ethyl group, a propyl group, an isopropyl group, an n-butyl group, an isobutyl group, a sec-butyl group, and a tert-butyl group. In the present disclosure, examples of the halogen atom include a fluorine atom, a chlorine atom, a bromine atom, and an iodine atom.

In one or more embodiments of the present disclosure, the compound represented by the general formula (I) is:

R ² , R ³ , R ⁴ , R ⁵ , R ⁶ and R ⁷ are the same as described above.

In one or more embodiments of the present disclosure, the compound represented by the general formula (I) is:

R ² , R ³ , R ⁴ , R ⁶ and R ⁷ are the same as described above.

In one or more embodiments of the present disclosure, the compound represented by the general formula (I) is:

R ² , R ³ , R ⁴ , R ⁵ , R ⁶ and R ⁷ are the same as described above.

In one or more embodiments of the present disclosure, the compound represented by the general formula (I) is:

R ² , R ³ , R ⁶ , R ⁷ , R ⁸ and R ⁹ are the same as described above.

The “pharmaceutically acceptable salt” in the present disclosure includes a pharmacologically and / or pharmaceutically acceptable salt, and includes, for example, an inorganic acid salt, an organic acid salt, an inorganic basic salt, an organic basic salt, acidic or basic. Amino acid salts and the like.

Preferable examples of the inorganic acid salt include hydrochloride, hydrobromide, sulfate, nitrate, phosphate and the like, and preferable examples of the organic acid salt include, for example, acetate, succinate, Examples thereof include fumarate, maleate, tartrate, citrate, lactate, stearate, benzoate, methanesulfonate, and p-toluenesulfonate.

Preferred examples of the inorganic base salt include alkali metal salts such as sodium salt and potassium salt, alkaline earth metal salts such as calcium salt and magnesium salt, aluminum salt and ammonium salt. Preferable examples of the organic base salt include diethylamine salt, diethanolamine salt, meglumine salt, N, N′-dibenzylethylenediamine salt and the like.

Preferred examples of the acidic amino acid salt include aspartate and glutamate. Preferable examples of the basic amino acid salt include arginine salt, lysine salt, ornithine salt and the like.

In the present disclosure, the “salt of a compound” may include a hydrate that can be formed by absorbing moisture when the compound is left in the air. Further, in the present disclosure, the “salt of a compound” may include a solvate that can be formed by absorbing a certain kind of other solvent.

In the present disclosure, the “prodrug” includes, in one or a plurality of embodiments, those that are easily hydrolyzed in vivo and regenerate the compound represented by the general formula (I). If it is a compound, the compound which the carboxyl group became the alkoxycarbonyl group, the compound which became the alkylthiocarbonyl group, or the compound which became the alkylaminocarbonyl group is mentioned. Further, for example, in the case of a compound having an amino group, a compound in which the amino group is substituted with an alkanoyl group to become an alkanoylamino group, a compound in which the amino group is substituted with an alkoxycarbonyl group to become an alkoxycarbonylamino group, an acyloxymethylamino group, Or a compound that has become hydroxylamine. In addition, for example, in the case of a compound having a hydroxyl group, a compound in which the hydroxyl group is substituted with the acyl group to become an acyloxy group, a compound that has become a phosphate ester, or a compound that has become an acyloxymethyloxy group can be given. Examples of the alkyl moiety of the group used for forming a prodrug include an alkyl group described later, and the alkyl group may be substituted (for example, by an alkoxy group having 1 to 6 carbon atoms). In one or a plurality of embodiments, for example, when a compound in which a carboxyl group is an alkoxycarbonyl group is taken as an example, lower (for example, 1-6 carbon atoms) alkoxycarbonyl such as methoxycarbonyl, ethoxycarbonyl, methoxymethoxycarbonyl, ethoxymethoxy, etc. Examples include lower (for example, 1-6 carbon atoms) alkoxycarbonyl substituted by alkoxy groups such as carbonyl, 2-methoxyethoxycarbonyl, 2-methoxyethoxymethoxycarbonyl, pivaloyloxymethoxycarbonyl and the like.

In the present disclosure, the “pharmaceutical composition” may be a dosage form suitable for an administration form by applying a well-known formulation technique in one or a plurality of embodiments. Examples of the dosage form include, but are not limited to, oral administration in a dosage form such as a tablet, capsule, granule, powder, pill, troche, syrup, and liquid. Alternatively, parenteral administration in dosage forms such as injections, liquids, aerosols, suppositories, patches, lotions, liniments, ointments, eye drops and the like can be mentioned. These preparations can be produced by known methods using additives such as, but not limited to, excipients, lubricants, binders, disintegrants, stabilizers, flavoring agents, and diluents.

Examples of the excipient include, but are not limited to, starch such as starch, potato starch, and corn starch, lactose, crystalline cellulose, calcium hydrogen phosphate, and the like. Examples of the coating agent include, but are not limited to, ethyl cellulose, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, shellac, talc, carnauba wax, paraffin, and the like. Examples of the binder include, but are not limited to, polyvinyl pyrrolidone, macrogol and the same compound as the excipient. Examples of the disintegrant include, but are not limited to, compounds similar to the excipients and chemically modified starch and celluloses such as croscarmellose sodium, sodium carboxymethyl starch, and crosslinked polyvinylpyrrolidone. . Examples of the stabilizer include, but are not limited to, paraoxybenzoates such as methylparaben and propylparaben; alcohols such as chlorobutanol, benzyl alcohol, and phenylethyl alcohol; benzalkonium chloride; phenol, cresol Mention may be made of such phenols; thimerosal; dehydroacetic acid; and sorbic acid. Examples of the flavoring agent include, but are not limited to, sweeteners, acidulants, and fragrances that are commonly used.

In the production of the liquid agent, the solvent is not limited to these, but ethanol, phenol, chlorocresol, purified water, distilled water and the like can be used, and a surfactant or an emulsifier can also be used as necessary. . Examples of the surfactant or emulsifier include, but are not limited to, polysorbate 80, polyoxyl 40 stearate, lauromacrogol, and the like.

The method of using the pharmaceutical composition according to the present disclosure may vary depending on symptoms, age, administration method, and the like. Although the method of use is not limited to these, the compound represented by the above general formula (I), which is an active ingredient, is administered orally intermittently or continuously so that the concentration in the body is between 100 nM and 1 mM. , Transdermal, submucosal, subcutaneous, intramuscular, intravascular, intracerebral, or intraperitoneal. As a non-limiting embodiment, in the case of oral administration, the lower limit is 0.01 mg (preferably converted into the compound represented by the above general formula (I) per day for a subject (adult if human)) 0.1 mg), and as an upper limit, 2000 mg (preferably 500 mg, more preferably 100 mg) can be divided into one or several doses and administered according to symptoms. As a non-limiting embodiment, in the case of intravenous administration, the lower limit is 0.001 mg (preferably 0.01 mg) and the upper limit is 500 mg (preferably 50 mg) per day for a subject (adult if human). Is divided into one or several times and administered according to symptoms.

In one or a plurality of embodiments, the pharmaceutical composition according to the present disclosure preferably induces splicing modification in a cell or tissue in which a gene causing a genetic disease is expressed or not expressed. For example, in the case of muscular dystrophy, it is preferable to induce exon skip in cells of muscle tissue or muscle cells. Individuals for which the splicing alteration is induced include humans and / or non-human animals. In one or a plurality of embodiments, the pharmaceutical composition according to the present disclosure is for prevention, improvement, progression suppression, and / or treatment of genetic diseases.

In one or a plurality of embodiments, the present disclosure relates to a method for preventing, ameliorating, suppressing progression, and / or treating a genetic disease, which includes administering a pharmaceutical composition according to the present disclosure to a subject. . In one or a plurality of embodiments, administration of the pharmaceutical composition according to the present disclosure can be based on the above-described method of using the pharmaceutical composition. Examples of the subject include humans and non-human animals.

In one or a plurality of embodiments, the present disclosure provides a compound represented by the above general formula (I) or a prodrug thereof or a pharmaceutically acceptable agent for the prevention, amelioration, progression inhibition, and / or treatment of a genetic disease. Related to the use of salt.
In one or a plurality of other embodiments of the present disclosure, the present disclosure is represented by the general formula (I) for producing a pharmaceutical composition for preventing, ameliorating, suppressing progression, and / or treating a genetic disease. It relates to the use of a compound or a prodrug thereof or a pharmaceutically acceptable salt thereof.

In one or a plurality of embodiments, the present disclosure relates to a method for inducing splicing modification, which includes administering a pharmaceutical composition according to the present disclosure to a subject. In one or a plurality of embodiments, administration of the pharmaceutical composition according to the present disclosure can be based on the above-described method of using the pharmaceutical composition. Targets include cells, tissues, organs, individuals, humans, and non-human animals.

In one or a plurality of embodiments, the present disclosure relates to the use of a compound represented by the general formula (I) or a prodrug thereof or a pharmaceutically acceptable salt thereof for inducing splicing modification.
In one or more embodiments of the present disclosure, the present disclosure relates to a compound represented by the general formula (I) or a prodrug thereof, or a pharmaceutically acceptable salt thereof for producing a pharmaceutical composition for inducing splicing alteration. Related to the use of salt.

That is, the present disclosure may relate to one or more of the following embodiments;
[1] A compound represented by the following general formula (I), a prodrug thereof, or a pharmaceutically acceptable salt thereof.

[Here, in the general formula (I),
X ¹ is

R ³ , R ⁴ and R ⁵ are each independently hydrogen, a halogen atom, a carboxyl group, an amino group, a hydroxyl group, a C _1-4 alkyl group, or a C _1-4 substituted with a halogen atom. An alkyl group,
X ² is — (bond) or —NH—,
R ¹ is

R ⁶ , R ⁷ , R ⁸ , and R ⁹ each independently represent hydrogen, a halogen atom, a carboxyl group, an amino group, a hydroxyl group, a C _1-4 alkyl group, or a C atom substituted with a halogen atom. _1-4 alkyl group,
R ² is hydrogen, a halogen atom, a carboxyl group, an amino group, a hydroxyl group, a C _1-4 alkyl group, or a C _1-4 alkyl group substituted with a halogen atom. ]
[2] The compound according to [1] or a prodrug thereof, or a pharmaceutically acceptable salt thereof, which has an inhibitory activity on the phosphorylating activity of protein kinase.
[3] In the general formula (I), R ² , R ³ , R ⁴ , R ⁵ , R ⁶ , R ⁷ , R ⁸ and R ⁹ are each independently hydrogen, halogen atom, C _1-4 The compound according to [1] or [2], a prodrug thereof or a pharmaceutically acceptable salt thereof, which is an alkyl group or a C _1-4 alkyl group substituted with a halogen atom.
[4] The compound represented by the general formula (I) is:

Or a prodrug or pharmaceutically acceptable salt thereof according to any one of [1] to [3].
[5] The compound represented by the general formula (I) is:

Or a prodrug or pharmaceutically acceptable salt thereof according to any one of [1] to [3].
[6] The compound represented by the general formula (I) is:

Or a prodrug or pharmaceutically acceptable salt thereof according to any one of [1] to [3].
[7] The compound represented by the general formula (I) is:

Or a prodrug or pharmaceutically acceptable salt thereof according to any one of [1] to [3].
[8] A pharmaceutical composition comprising as an active ingredient the compound according to any one of [1] to [7], a prodrug thereof, or a pharmaceutically acceptable salt thereof.
[9] The pharmaceutical composition according to [8] for modifying splicing.
[10] The pharmaceutical composition according to [8] or [9] for inducing exon skip.
[11] The pharmaceutical composition according to any one of [8] to [10], wherein the splicing is modified by having an ability to inhibit the phosphorylation activity of protein kinase.
[12] The pharmaceutical composition according to any one of [8] to [11], which induces exon skipping by having an ability to inhibit the phosphorylation activity of protein kinase.
[13] The pharmaceutical composition according to any one of [8] to [12] for prevention, improvement, progression inhibition, and / or treatment of a genetic disease.
[14] The pharmaceutical composition according to any one of [8] to [13], wherein the genetic disease is a genetic disease in which a mutation causing the disease can be eliminated or suppressed by altering splicing.
[15] The pharmaceutical composition according to any one of [8] to [14], wherein the genetic disease is muscular dystrophy.
[16] A method for the prevention, amelioration, progression inhibition, and / or treatment of a genetic disease, comprising administering the pharmaceutical composition according to any one of [8] to [15] to a subject .
[17] The method according to [16], wherein the subject is a human or a non-human animal.
[18] The method according to [16] or [17], wherein the genetic disease is a genetic disease in which a mutation causing the disease can be eliminated or suppressed by altering splicing.
[19] The method according to any one of [16] to [18], wherein the genetic disease is muscular dystrophy.
[20] Use of a compound represented by the above general formula (I) or a prodrug thereof or a pharmaceutically acceptable salt thereof for the prevention, amelioration, progression inhibition and / or treatment of a genetic disease.
[21] A compound represented by the above general formula (I) or a prodrug thereof, or a pharmaceutically acceptable product thereof, for producing a pharmaceutical composition for preventing, improving, suppressing progression and / or treating a genetic disease Use of salt.
[22] The use according to [20] or [21], wherein the genetic disease is a genetic disease in which splicing is altered so that a mutation causing the disease can be eliminated or suppressed.
[23] The use according to any one of [20] to [22], wherein the genetic disease is muscular dystrophy.
[24] A method for inducing splicing modification, comprising administering to a subject the pharmaceutical composition according to any one of [8] to [15].
[25] The method according to [24], wherein the subject is a cell, tissue, organ, individual, human, or non-human animal.
[26] The method according to [24] or [25], wherein the splicing modification is exon skip.
[27] Use of the compound represented by the general formula (I) or a prodrug thereof or a pharmaceutically acceptable salt thereof for inducing splicing modification.
[28] Use of the compound represented by the general formula (I) or a prodrug thereof or a pharmaceutically acceptable salt thereof for producing a pharmaceutical composition for inducing splicing modification.
[29] The method according to [27] or [28], wherein the splicing modification is exon skip.

Hereinafter, the present disclosure will be described in more detail by way of examples. However, these examples are illustrative, and the present disclosure is not limited to these examples. It should be noted that all documents cited in this disclosure are incorporated as part of this disclosure.

The following compound 1-15 used in this example was prepared.

Of the above compounds 1-6, the synthesis methods of compounds 1, 2 and 3 are shown below as representative examples.
Method for synthesizing compound 1:

Under an argon atmosphere, 5-bromoindazole (197 mg, 1.00 mmol, commercial product), 5-quinolineboronic acid (259 mg, 1.50 mmol, commercial product), tris (dibenzylideneacetone) dipalladium (Pd ₂ dba ₃ ) ( 9.20 mg, 10.0 μmol, commercial product), 2-dicyclohexylphosphino-2 ', 4', 6'-triisopropylbiphenyl (Xphos) (19.1 mg, 40.1 μmol, commercial product), tripotassium phosphate, n-hydrated The product (425 mg, 2.00 mmol, commercial product) in 1-butanol (10 mL, commercial product) was heated and stirred at 100 ° C. for 18 hours. After cooling to room temperature, water (5 mL) was added, and the mixture was extracted with ethyl acetate (5 mL × 3). The organic layer was dried over sodium sulfate and filtered, and the filtrate was concentrated under reduced pressure. The residue obtained was purified by medium pressure column chromatography (Yamazen, AI-580 and Parallel Frac FR-360) (Yamazen Universal Columns Premium cartridge [silica] 40 g, chloroform / methanol = 20/1). The solid was washed with dichloromethane to give 5- (5-quinolyl) indazole (Compound 1) (202 mg, 824 μmol, 82.4%) as a skin-colored solid.
TLC R _f = 0.20 (dichloromethane / methanol = 20/1); Mp 255 ° C (decomp); ¹ H NMR (400 MHz, CD ₃ OD) δ 7.51-7.56 (m, 2H), 7.67 (dd, J = 0.8 , 6.8 Hz, 1H), 7.74 (d, J = 8.4 Hz, 1H), 7.86-7.92 (m, 2H), 8.10 (d, J = 8.4 Hz, 1H), 8.18 (d, J = 0.8 Hz, 1H ), 8.38 (d, J = 8.0 Hz, 1H), 8.90 (dd, J = 1.6, 4.4 Hz, 1H); ¹³ C NMR (100 MHz, CD ₃ OD) δ 112.1, 123.4, 123.9, 125.5, 129.3, 129.4, 130.0, 131.1, 131.5, 134.0, 136.2, 137.5, 142.0, 143.4, 150.0, 151.9; IR (cm ^-1 ) 746, 772, 802, 887, 918, 937, 1061, 1101, 1238, 1290, 1337, 1395, 1510, 1574, 1738, 2849, 2901, 2928, 3030, 3094.

Method for synthesizing compound 2:

Under an argon atmosphere, 5-bromoindazole (197 mg, 1.00 mmol, commercial product), 5-isoquinolineboronic acid (259 mg, 1.50 mmol, commercial product), tris (dibenzylideneacetone) dipalladium (Pd ₂ dba ₃ ) ( 9.20 mg, 10.0 μmol, commercial product), 2-dicyclohexylphosphino-2 ', 4', 6'-triisopropylbiphenyl (Xphos) (19.1 mg, 40.1 μmol, commercial product), tripotassium phosphate, n-hydrated The product (425 mg, 2.00 mmol, commercial product) in 1-butanol (10 mL, commercial product) was heated and stirred at 100 ° C. for 5.5 hours. After cooling to room temperature, water (5 mL) was added, and the mixture was extracted with ethyl acetate (5 mL × 3). The organic layer was dried over sodium sulfate and filtered, and the filtrate was concentrated under reduced pressure. The obtained residue was purified by medium pressure column chromatography (Yamazen, AI-580 and Parallel Frac FR-360) (Yamazen Universal Columns Premium cartridge [silica] 40 g, chloroform / methanol = 20/1), and 5- ( 5-Isoquinolyl) indazole (Compound 2) (182 mg, 742 μmol, 74.2%) was obtained as a colorless solid.
TLC R _f = 0.20 (dichloromethane / methanol = 20/1); Mp 250 ° C (decomp.); ¹ H NMR (400 MHz, CD ₃ OD) δ 7.57 (dd, J = 1.6, 8.8 Hz, 1H), 7.75 (d, J = 8.8 Hz, 1H), 7.79-7.88 (m, 3H), 7.94 (dd, J = 0.8, 1.6 Hz, 1H), 8.17-8.20 (m, 2H), 8.44 (d, J = 6.4 Hz, 1H), 9.35 (d, J = 0.8 Hz, 1H); ¹³ C NMR (100 MHz, CD ₃ OD) δ 112.2, 121.3, 123.8, 125.5, 129.3, 129.5, 131.0, 131.5, 133.7, 134.1, 136.2 , 136.9, 141.8, 142.0, 144.0, 154.5; IR (cm ^-1 ) 650, 712, 754, 768, 779, 812, 835, 895, 943, 986, 1034, 1161, 1292, 1342, 1379, 1489, 1585 , 1614, 2770, 2851, 2901, 3030, 3117.

Method for synthesizing compound 3:

Under an argon atmosphere, 5-bromoindazole (118 mg, 0.601 mmol, commercial product), 4-pyridylboronic acid (110 mg, 0.898 mmol, commercial product), tris (dibenzylideneacetone) dipalladium (Pd ₂ dba ₃ ) ( 27.5 mg, 30.0 μmol, commercial product), 2-dicyclohexylphosphino-2 ', 4', 6'-triisopropylbiphenyl (Xphos) (57.6 mg, 0.118 mmol, commercial product), tripotassium phosphate, n-hydrated The product (255 mg, <1.20 mmol, commercial product) in 1-butanol (2.4 ml, commercial product) was heated and stirred at 100 ° C. for 24 hours. The mixture was allowed to cool to room temperature, filtered through celite, and the filtrate was concentrated under reduced pressure. The resulting orange residue was purified by thin layer chromatography (chloroform / methanol = 10/1), and then 5- (4-quinolyl) indazole (compound 3) (24.4 mg, 0.125 mmol, 20.8%) was obtained. Obtained as a yellow solid.
TLC R _f = 0.26 (dichloromethane / methanol = 20/1); IR (cm-1) 792, 798, 802, 1030, 1349, 1420, 1490, 1603, 3361; 1H NMR (CDCl ₃ , 500 MHz) δ 7.57 (AA 'BB', 2 H), 7.62 (d, J = 8.5 Hz, 1H), 7.70 (dd, J = 1.3, 8.5 Hz, 1H), 8.06 (d, J = 1.3 Hz, 1H), 8.18 ( s, 1H), 8.68 (AA 'BB', 2 H) (The signal for NH of indazole was not observed); 13C NMR (CDCl ₃ , 126 MHz) δ 110.5, 119.7, 121.4, 121.8, 123.9, 126.3, 131.5 , 135.6, 140.2, 150.1; HRMS (ESI +) m / z 196.0867 ([M + H] +, C12H10N3 requires 196.0869).

Of the above compounds 7-9, the synthesis method of compound 8 is shown below as a representative.
Method for synthesizing compound 8:

In an argon atmosphere, 5-aminoquinoline (144 mg, 999 μmol, commercial product), 3-bromopyridine (150 μL, 1.54 mmol, commercial product), tris (dibenzylideneacetone) dipalladium (Pd ₂ dba ₃ ) (45.8 mg, 50.0 μmol, commercial product), 4,5-bis (diphenylphosphino) -9,9-dimethylxanthene (xantphos) (57.9 mg, 100 μmol, commercial product), sodium tert-butoxy (192 mg, 2.00 mmol) , Commercial product) in 1,4-dioxane (10 mL, commercial product) was heated and stirred at 110 ° C. for 14 hours. After cooling to room temperature, water (5 mL) was added, and the mixture was extracted with ethyl acetate (5 mL × 3). The organic layer was dried over sodium sulfate and filtered, and the filtrate was concentrated under reduced pressure. The resulting residue was roughly purified by medium pressure column chromatography (Yamazen, W-Prep 2XY A-type) (Biotage ZIP ™ sphere cartridge [silica] 30 g, dichloromethane / methanol = 20/1 → 5/1) Then, the obtained solid was washed with hexane / dichloromethane = 30/1 to obtain 5- (3-pyridylamino) quinoline (Compound 8) (120 mg, 542 μmol, 54.3%) as a pale yellow solid. It was.
TLC R _f = 0.30 (dichloromethane / methanol = 20/1); Mp 180 ° C (decomp.); ¹ H NMR (400 MHz, CDCl ₃ ) δ 6.08 (br s, 1H), 7.13-7.22 (m, 2H) , 7.38-7.42 (m, 2H), 7.66 (dd, J = 8.8, 8.8 Hz, 1H), 7.91 (d, J = 8.8 Hz, 1H), 8.18 (dd, J = 1.6, 4.4 Hz, 1H), 8.33-8.37 (m, 2H), 8.95 (dd, J = 1.6, 4.4 Hz, 1H); ¹³ C NMR (100 MHz, CDCl ₃ ) δ 117.5, 120.8, 123.1, 123.3, 123.8, 125.6, 129.6, 130.6, 137.7, 139.6, 141.2, 142.0, 149.3, 150.7; IR (cm ^-1 ) 652, 710, 762, 783, 814, 966, 1018, 1063, 1240, 1294, 1317, 1395, 1470, 1485, 1537, 1570, 3005, 3044, 3109, 3175.

Of the above compounds 10-13, the synthesis method of compound 12 is shown below as a representative.
Method for synthesizing compound 12:

Under an argon atmosphere, 5-bromoquinoline (84.2 mg, 405 μmol, commercial product), 4-pyridylboronic acid (73.8 mg, 600 μmol, commercial product), tetrakis (triphenylphosphine) palladium (Pd (PPh ₃ ) ₄ ) (23.1 mg, 20.0 μmol, commercial product), sodium carbonate monohydrate (99.2 mg, 800 μmol, commercial product) in toluene (1.3 mL, commercial product), ethanol (1.3 mL, commercial product), purified water ( 1.3 mL) of the mixed solution was heated and stirred at 90 ° C. for 25 hours. After allowing to cool to room temperature, water (2 mL) was added, and the mixture was extracted with ethyl acetate (2 mL × 3). The organic layer was dried over sodium sulfate and filtered, and the filtrate was concentrated under reduced pressure. The resulting residue was purified by medium pressure column chromatography (Yamazen, W-Prep 2XY A-type) (Biotage ZIP ™ sphere cartridge [silica] 30 g, ethyl acetate 100% → dichloromethane / methanol = 95/5) Then, 5- (4-pyridyl) quinoline (Compound 12) (77.7 mg, 377 μmol, 93.0%) was obtained as a yellow solid.
TLC R _f = 0.35 (dichloromethane / methanol = 20/1); Mp 113 ° C; ¹ H NMR (400 MHz, CDCl ₃ ) δ 7.39-7.43 (m, 3H), 7.52 (dd, J = 1.2, 7.2 Hz, 1H), 7.80 (dd, J = 7.2, 8.8 Hz, 1H), 8.17-8.22 (m, 2H), 8.75-8.78 (AA'BB ', 2H), 8.98 (dd, J = 1.6, 4.0 Hz, 1H ); ¹³ C NMR (100 MHz, CDCl ₃ ) δ 121.6, 124.9 (2C), 125.9, 127.3, 128.9, 130.3, 133.4, 137.5, 147.2, 148.5, 150.0 (2C), 150.7; IR (cm ^-1 ) 650 , 696, 743, 750, 797, 839, 962, 989, 1111, 1229, 1304, 1391, 1418, 1495, 1543, 1570, 1589, 3026.

Of the above compounds 14-15, the synthesis method of compound 14 is shown below as a representative.
Method for synthesizing compound 14:

Under argon atmosphere, 5-bromobenzofuran (79.6 mg, 404 μmol, commercial product), 4-pyridylboronic acid (73.8 mg, 600 μmol, commercial product), tetrakis (triphenylphosphine) palladium (Pd (PPh ₃ ) ₄ ) (23.1 mg, 20.0 μmol, commercial product), sodium carbonate monohydrate (99.2 mg, 800 μmol, commercial product) in toluene (1.3 mL, commercial product), ethanol (1.3 mL, commercial product), purified water ( 1.3 mL) was heated and stirred at 90 ° C. for 8 hours. After allowing to cool to room temperature, water (2 mL) was added, and the mixture was extracted with ethyl acetate (2 mL × 3). The organic layer was dried over sodium sulfate and filtered, and the filtrate was concentrated under reduced pressure. The obtained residue was purified by medium pressure column chromatography (Yamazen, W-Prep 2XY A-type) (Biotage ZIP ™ sphere cartridge [silica] 45 g, dichloromethane / methanol = 10/1), and then hexane / Recrystallization from dichloromethane gave 5- (4-pyridyl) benzofuran (Compound 14) (56.8 mg, 289 μmol, 71.6%) as a colorless solid.
TLC R _f = 0.50 (dichloromethane / methanol = 10/1); Mp 96 ° C; ¹ H NMR (400 MHz, CDCl ₃ ) δ 6.84 (dd, J = 0.8, 2.0 Hz, 1H), 7.52-7.54 (AA´ BB´, 2H), 7.54-7.62 (m, 2H), 7.68 (d, J = 2.0 Hz, 1H), 7.86 (dd, J = 0.4, 1.6 Hz, 1H), 8.64-8.66 (AA´BB´, 2 C), ¹³ C NMR (100 MHz, CDCl ₃ ) δ 106.8, 112.0, 119.9, 121.9 (2C), 123.6, 128.2, 133.3, 146.1, 148.8, 150.2 (2C), 155.4; IR (cm ^-1 ) 746, 775, 806, 874, 1018, 1109, 1219, 1265, 1414, 1460, 1537, 1595, 1728, 2853, 2924, 3036, 3094.

Experimental Example 1: Evaluation of blood pharmacokinetics of Compound 3 Compound 3 was suspended in 0.5% carboxymethylcellulose at 30 mg / kg and injected subcutaneously into mice. The blood concentration of Compound 3 at the time of single subcutaneous administration was detected with a ZOBAX HILIC Plus (agilent) column. As a control compound, Cdc2-like kinase (CLK) inhibitor TG003 (CAS 300801-52-9) was used. The specific protocol is as follows. The result is shown in FIG.

Compound 3 and TG003 were each dissolved in 5% DMSO, 5% saltol, 9% Tween-80, 81% physiological saline, and then subcutaneously in Jcl: TTC mice (7 weeks old, male male, provided by Charles River Laboratories). 30 mg / kg was injected. After compound injection, whole blood was collected under anesthesia with isoflurane (manufactured by Mylan) at 30 minutes, 90 minutes, 180 minutes, and 360 minutes, and serum was separated by centrifugation. The concentrations of Compound 3 and TG003 in serum were measured by LC / MS using ZORBAX HILIC Plus (compound 3) or ZORBAX Eclipse C18 (TG003) column (manufactured by Agilent Technologies).

As shown in FIG. 1, Compound 3 was present in blood at 10 μM after 6 hours of single subcutaneous administration (30 mg / kg) to mice, and showed much higher blood stability than TG003.

Experimental Example 2: Evaluation of kinase activity of compound 3 Clk inhibitory activity was confirmed by in vitro kinase analysis of compound 3. Using the RS peptide as a substrate, the inhibitory activity of Compound 1 was examined under the condition of 1 μM ATP in the presence of Clk1 protein. The specific protocol is as follows. The result is shown in FIG.

Compound 3 and TG003 were serially diluted to 30 μM, 10 μM, 3 μM, 1 μM, 0.3 μM, 0.1 μM, 0.03 μM, 0.01 μM, 0.003 μM, 0.001 μM, respectively, and 10 mM MOPS-KOH (pH 6.5), 10 mM magnesium chloride, 200 μM EDTA, 1 μM ATP, 0.167 μCi of [γ- ³² P] ATP, 0.417 μg RS peptide (NH2-RSPSYGRSRSRSRSRSRSRSRSNSRSRSY-OH, SEQ ID NO: 1), recombinant GST tag human CLK1 (Carnabio) 25 μl of the reaction solution was prepared. After the mixture was reacted at 30 ° C. for 30 minutes, a 5% phosphoric acid solution was added to stop the reaction. 25 μl of the reaction solution was dropped on P81 phosphocellulose paper, dried, and washed 3 times with 5% phosphoric acid solution. Γ- ³² P of the membrane was measured with a liquid scintillation counter. The background value (reaction solution adjusted without adding CLK1) was subtracted from the measured value, and a reaction curve was drawn from the obtained value by 4-parameter logistic regression. From this, the IC ₅₀ of the compound was calculated.

As shown in FIG. 2, in in vitro kinase analysis for CLK1, IC50 (93.9 to 122.5 nM) of compound 3 showed strong CLK inhibitory activity, although inferior to TG003 (13.13 to 20.29 nM).

Experimental Example 3: Inhibition of phosphorylation of compound 3 and evaluation of exon skip activity A DMD patient (c.4303G> T) reporter (H492-dys Ex31 plasmid) (Non-patent Document 1) shown in FIG. 3 was introduced into HeLa cells.
Compound 3 was added to the HeLa cells, and inhibition of phosphorylation of SR protein which is a substrate of CLK was verified by Western blot. The specific protocol is as follows. The result is shown in FIG. The same concentration TG003 was used as a control in the evaluation.

HeLa cells are seeded at 1x10 ⁵ cells per well in a 12-well plate and cultured for 48 hours. Each compound 3 and TG003 diluted in DMSO solution is 5 μM, 10 μM, 20 μM, and the DMSO concentration is 0.1%. Added by concentration. One hour after administration, after washing twice with PBS at 4 ° C., 200 μl of CelLytic M (Sigma Aldrich) supplemented with protease inhibitors (Nacalai Tesque) and phosphatase inhibitors (Nacalai Tesque) was added to the wells. The lysate was recovered. The protein concentration of the supernatant collected by centrifugation at 15,000 xg for 30 minutes was quantified with a protein assay reagent (Protein Assay Reagent, manufactured by Thermo). Adjust the extract so that the protein concentration is equal, add sample buffer (manufactured by Nacalai Tesque), incubate at 95 ° C for 5 minutes, and then SDS-PAE gel (10% SuperSep ™ Ace gel, Wako) SDS-PAGE was performed using In Western blotting, after sample migration was completed, transfer to a PVDF membrane (manufactured by Pall) was performed with a blotting apparatus at 100 V for 3 hours. After completion of transcription, blocking was performed with Blocking One (Nacalai Tesque) for 30 minutes at room temperature, and anti-phosphorylated SR protein antibody (Invitrogen, clone 1H4) and anti-Lamin B antibody (Santa Cruz, clone) were used as primary antibodies. M-20) was diluted 500-fold and 1,000-fold with Can Get Signal (Toyobo Co., Ltd.). Anti-mouse IgG-HRP labeled antibody (manufactured by GE Healthcare) as a secondary antibody was diluted 5,000 times and anti-goat IgG-HRP labeled antibody (manufactured by Jackson ImmunoResearch) was diluted 10,000 times before detection. The detection was performed using Immunostar LD (manufactured by Wako Co., Ltd.) as a chromogenic substrate, using a ChemiDoc ™ MP imaging system with a membrane sandwiched between OHP films.

In addition, exon skip by compound 3 was evaluated by semi-quantitative RT-PCR. The specific protocol is as follows. The result is shown in FIG. The same concentration TG003 was used as a control in the evaluation.

At the same time, 1x10 ⁵ HeLa cells are seeded per well in a 12-well plate, and at the same time, 0.1 µg of H492-dys Ex31m splicing reporter (Fig. 3) is transfected using transfection reagent (Lipofectamin 2000, manufactured by Invitrogen). did. After culturing for 24 hours, Compound 3, TG003 diluted in DMSO solution was added at 5 μM, 10 μM, 20 μM, 30 μM, 50 μM, and the DMSO concentration at 0.1%, respectively. 24 hours after administration, 800 μl of RNA extraction reagent (Sepazole RNA I Super G, manufactured by Nacalai Tesque) was added to the wells, and the cells were collected. After recovering RNA according to the attached protocol, incubate with DNase (Promega) at 37 ° C for 30 minutes, add the attached reaction stop solution and incubate at 65 ° C for 10 minutes to inactivate DNase I let you. DNase-treated RNA was prepared from 50 pmol of random hexamer (Takara Bio) using Superscript II (Takara Bio) according to the attached protocol, 10 minutes at 30 ° C, 42 First-strand cDNA was obtained by incubation at 50 ° C. for 50 minutes and at 70 ° C. for 15 minutes to carry out reverse transcription. Using the obtained cDNA, using Ex Taq polymerase (Takara Bio) according to the attached protocol, prepare a reaction solution containing 0.4 μM primer (sequence is described below), PCR thermal cycler (BioRad) Then, the denaturation step at 95 ° C. for 20 seconds, the annealing step at 58 ° C. for 20 seconds, the extension step at 72 ° C. for 1 minute was repeated 32 cycles for the reporter Clk1, and 25 cycles were repeated for GAPDH. The reaction solution was mixed with a loading buffer (Takara Bio) and electrophoresed on a 2.5% agarose gel in 1 × TAE buffer (Nacalai Tesque). The gel was stained with ethidium bromide and the product was detected with ultraviolet light using a ChemiDoc ™ MP imaging system. The amplified PCR product was quantified using Image Lab software (Bio-Rad). The reporter exon 31 exon skipping ratio was derived as the ratio of skipping products to the total of transcripts exon 31 skipped and transcripts containing exon 31.
The primers used for each amplification are as follows:
Human CLK1 forward, 5'-ATG AGA CAC TCA AAG AGA ACT TAC TG-3 '(SEQ ID NO: 2); human CLK1 reverse, 5'-CTT TAT GAT CGA TGC ACT CCA C-3' (SEQ ID NO: 3); GAPDH Forward, 5'-CCA TCA CCA TCT TCC AGG AGC GAG-3 '(SEQ ID NO: 4); GAPDH Reverse, 5'-GTG ATG GCA TGG ACT GTG GTC ATG-3' (SEQ ID NO: 5); Splicing Reporter Forward, 5 '-ATT ACT CGC TCA GAA GCT GTG TTG C-3' (SEQ ID NO: 6); Splicing Reporter Reverse, 5'-AAG TCT CTC ACT TAG CAA CTG GCA G-3 '(SEQ ID NO: 7).

As shown in FIG. 4, Compound 3 exhibited phosphorylation inhibitory effect on ClSF substrates SRSF4 and SRSF6. In addition, as shown in FIG. 5, Compound 3 exhibited an exon skip activity equivalent to TG003.

Experimental Example 4: Evaluation of exon skip activity 2 of compound 3
The effect of compound 3 on exon skip of dystrophin gene exon 31 in cells derived from DMD patients (c.4303G> T) was evaluated by semi-quantitative RT-PCR. The specific protocol is as follows. The result is shown in FIG.

Immortal muscular dystrophy patient-derived cells (ref. Nishida, A. et al. Brain Dev. 38, 738-745 (2016).) Were cultured in 12-well plates for 24 hours, and then diluted with DMSO solution, Compound 3, TG003, 10 μM, 20 μM and 50 μM were added at respective concentrations so that the DMSO concentration was 0.1%. 48 hours after administration, 800 μl of RNA extraction reagent (Trizol, manufactured by Thermo) was added to the wells, and the cells were collected. RNA was collected using an RNA extraction kit (Direct-zol RNA purification kit, manufactured by Gimo Research) according to the attached protocol. Prepare the reaction solution containing 50 pmol of random hexamer (manufactured by Takara Bio) using Superscript II (manufactured by Takara Bio) according to the attached protocol. The first strand cDNA was obtained by performing a reverse transcription reaction by incubating at 70 ° C. for 50 minutes for 50 minutes. Using the obtained cDNA, using Ex Taq polymerase (Takara Bio) according to the attached protocol, prepare a reaction solution containing 0.4 μM primer (sequence is described below), PCR thermal cycler (BioRad) Then, PCR was carried out by repeating 32 cycles of a denaturation step at 95 ° C. for 20 seconds, an annealing step at 58 ° C. for 20 seconds, and an extension step at 72 ° C. for 1 minute. The reaction solution was mixed with a loading buffer (Takara Bio) and electrophoresed on a 2.5% agarose gel in 1 × TAE buffer (Nacalai Tesque). The gel was stained with ethidium bromide and the product was detected with ultraviolet light using a ChemiDoc ™ MP imaging system. Quantification was performed on the amplified RCR product using an Agilent 2100 Bioanalyzer System (manufactured by Agilent Technologies) using a DNA 1000 laboratory chip kit (manufactured by Agilent Technologies). The exon 31 exon skipping ratio was derived as the ratio of the skipping product to the total of the transcripts exon 31 skipped and the transcript containing exon 31. Primers used for amplification are as follows:
Dystrophin Forward, 5'-CCT GTA GCA CAA GAG GCC TTA-3 '(SEQ ID NO: 8); Dystrophin Reverse, 5'-TCC ACA CTC TTT GTT TCC AAT G-3' (SEQ ID NO: 9)

As shown in FIG. 6, in the analysis using muscle cells derived from patients, the addition of compound 3 showed enhanced skipping of DMD exon 31 having a genetic mutation.

Experimental Example 5: Exon skip activity evaluation 3 of compound 3
It was confirmed by Western blot using a dystrophin antibody (ab15277) that dystrophin protein increases in cells derived from DMD patients (c.4303G> T) by the addition of compound 3. The result is shown in FIG.

As shown in FIG. 7, when Compound 3 was added to patient-derived muscle cells, increased expression of dystrophin protein was observed in a concentration-dependent manner.

Experimental Example 6: Oral administration of compound 3 After oral administration of compound 3 to mice, uptake of compound 3 in muscle tissue was confirmed (LC / MS). A 0.5% carboxy-methylcellulose solution of Compound 3 was orally administered to mice (30 mg / kg), and the compound concentration in muscle tissue was analyzed by LC / MS. The specific protocol is as follows. The result is shown in FIG.

Compound 3 was dissolved in 0.5% carboxymethylcellulose physiological saline and then injected subcutaneously at 30 mg / kg in Jcl: TCR mice (7-week-old, 雄, Charles River Laboratories). After the compound injection, the mice were dislocated from the cervical vertebra after 30 minutes, 90 minutes, 180 minutes, and 360 minutes, respectively, and then the anterior tibial muscle was collected. Formic acid diluted to 1% with methanol with respect to 50 破 砕 μl of crushed solution by adding 5 times the amount of physiological saline to the collected tibial muscle and crushing with bead crusher (bead crusher μT-12, manufactured by Sakai Taitec Co., Ltd.) After adding 100 μl of ammonium and stirring, it was centrifuged. The obtained supernatant (90 μl) was added with 510 μl of water and centrifuged, and the supernatant (300 μl) was filtered with a 0.45 μm pore filter (Cosmo spin filter, manufactured by Nacalai Tesque), and then centrifuged to collect the supernatant. The concentration of Compound 3 in the collected solution was measured by LC / MS using a Poroshell 120 PFP column (manufactured by Agilent Technologies).

As shown in FIG. 8, Compound 3 could be detected by LC / MS in muscle tissue at 30 mg / kg orally administered with Compound 3, and a peak value of 4.5 μM was obtained at 1.5 hours.

Experimental Example 7: Oral administration 2 of compound 3
The inhibitory effect on phosphorylation of SR protein, which is a substrate of CLK, was verified by Western blotting using muscle tissue isolated 1.5 hours after administration, where peak values were observed in mice after oral administration. The specific protocol is as follows. The result is shown in FIG.

Compound 3 was dissolved in 0.5% carboxymethylcellulose physiological saline and injected subcutaneously at 30 mg / kg into Jcl: TCR mice (7 weeks old, male, provided by Charles River Laboratories). After 90 minutes from the compound injection, the mice were dislocated from the cervical spine, and then the anterior tibial muscle was collected. 200 μl CelLytic MT (Sigma Aldrich) supplemented with protease inhibitor (Nacalai Tesque) and phosphatase inhibitor (Nacalai Tesque) was added to the collected anterior tibial muscle, and a bead crusher (Bead crusher μT-12 And lysate was recovered. After centrifugation at 15,000 × g for 30 minutes, the protein concentration of the collected supernatant was quantified with a protein assay reagent (Protein Assay Reagent, manufactured by Thermo). Adjust the extract so that the protein concentration is equal, add sample buffer (manufactured by Nacalai Tesque), incubate at 95 ° C for 5 minutes, and then SDS-PAE gel (10% SuperSep ™ Ace gel, Wako) SDS-PAGE was performed using In Western blotting, after sample migration was completed, transfer to a PVDF membrane (manufactured by Pall) at 100 V for 3 hours was performed using a blotting apparatus. After completion of transcription, blocking was performed with Blocking One (Nacalai Tesque) for 30 minutes at room temperature, and anti-phosphorylated SR protein antibody (Invitrogen, clone 1H4) and anti-Lamin B antibody (Santa Cruz, clone) were used as primary antibodies. M-20) was diluted 500-fold and 1,000-fold with Can Get Signal (Toyobo Co., Ltd.). Anti-mouse IgG-HRP labeled antibody (manufactured by GE Healthcare) as a secondary antibody was diluted 5,000 times and anti-goat IgG-HRP labeled antibody (manufactured by Jackson ImmunoResearch) was diluted 10,000 times before detection. The detection was performed using Immunostar LD (manufactured by Wako Co., Ltd.) as a chromogenic substrate, using a ChemiDoc ™ MP imaging system with a membrane sandwiched between OHP films.
After completion of transcription, blocking is performed with Blocking One (Nacalai Tesque) for 30 minutes at room temperature, and anti-dystrophin antibody (Abcam) and anti-α tubulin antibody (Invitrogen, clone DM1A) are each used as primary antibodies. Dilution was performed 200 times and 2,000 times with Signal (Toyobo Co., Ltd.). Detection was performed after anti-rabbit IgG-HRP labeled antibody (GE Healthcare) was diluted 20,000 times and anti-mouse IgG-HRP labeled antibody (Jackson ImmunoResearch) was diluted 5,000 times as secondary antibodies. The detection was performed using Immunostar LD (manufactured by Wako Co., Ltd.) as a chromogenic substrate, using a ChemiDoc ™ MP imaging system with a membrane sandwiched between OHP films. SRSF4 bands were quantified using Image Lab software (Bio-Rad).

In addition, the splicing change in the muscle tissue sample was examined by semi-quantitative RT-PCR. The specific protocol is as follows. The result is shown in FIG.

Compound 3 was dissolved in 0.5% carboxymethylcellulose physiological saline and injected subcutaneously at 30 mg / kg into Jcl: TCR mice (7 weeks old, male, provided by Charles River Laboratories). After lapse of 180 minutes after the compound injection, the mouse was dislocated from the cervical vertebra, and then the anterior tibial muscle was collected. RNA was extracted from the collected anterior tibial muscle using an RNA extraction kit (RNeasy purification kit, Qiagen). First, 300 μl of the RLT buffer attached to the kit was added and crushed with a bead crusher (bead crusher μT-12, manufactured by Taitec Co., Ltd.), and the lysate was recovered. 590 μl of ultrapure water and 10 μl of proteinase K solution (20 mg / ml, manufactured by Nacalai Tesque) were added, followed by proteinase treatment at 55 ° C. for 10 minutes. Thereafter, the supernatant was collected by centrifugation, and purified according to the protocol attached to the kit. Prepare the reaction solution containing 50 pmol of random hexamer (manufactured by Takara Bio Inc.) using the Superscript II (manufactured by Takara Bio Inc.) using the Superscript II (manufactured by Takara Bio Inc.). The first strand cDNA was obtained by incubating for 15 minutes at 70 ° C. for reverse transcription. Using the obtained cDNA, using Ex Taq polymerase (Takara Bio) according to the attached protocol, prepare a reaction solution containing 0.4 μM primer (sequence is described below), PCR thermal cycler (BioRad) Then, the denaturation step at 95 ° C. for 20 seconds, the annealing step at 58 ° C. for 20 seconds, the extension step at 72 ° C. for 1 minute was repeated 32 cycles for the reporter Clk1, and 25 cycles were repeated for GAPDH. The reaction solution was mixed with a loading buffer (Takara Bio) and electrophoresed on a 2.5% agarose gel in 1 × TAE buffer (Nacalai Tesque). The gel was stained with ethidium bromide and the product was detected with ultraviolet light using a ChemiDoc ™ MP imaging system. The amplified PCR product was quantified using Image Lab software (Bio-Rad).
The primers used for each amplification are as follows:
Mouse CLK1 forward, 5'-ATG AGA CAT TCA AAG AGA ACT TAC TG-3 '(SEQ ID NO: 10); Mouse Clk1 reverse, 5'-CAC TTT ATG ATC GAT GCA TTC C-3' (SEQ ID NO: 11); GAPDH Forward, 5'-CCA TCA CCA TCT TCC AGG AGC GAG-3 '(SEQ ID NO: 4); GAPDH reverse, 5'-GTG ATG GCA TGG ACT GTG GTC ATG-3' (SEQ ID NO: 5)

As shown in FIG. 9, Compound 3 exhibited an inhibitory effect on phosphorylation of SRSF4, which is a substrate of Clk, in muscle tissue after oral administration. As shown in FIG. 10, Compound 3 was confirmed to increase Clcl mature splicing product, which is known to be induced by Clk activity inhibition, in muscle tissue after oral administration of mice.

Experimental Example 8: Evaluation of exon skip activity In the same manner as in Experimental Example 3, the effects of compounds 1-4, 6, 8, 10, 12, 14, and 15 on exon skip were evaluated by semi-quantitative RT-PCR. . The specific protocol is as follows. The results are shown in Table 1 below and FIG.

At the same time, 1x10 ⁵ HeLa cells are seeded per well in a 12-well plate, and at the same time, 0.1 µg of H492-dys Ex31m splicing reporter (Fig. 3) is transfected using transfection reagent (Lipofectamin 2000, manufactured by Invitrogen). did. After culturing for 24 hours, each compound diluted in DMSO solution was added at a concentration of 10 μM and a DMSO concentration of 0.1%. 24 hours after administration, 800 μl of RNA extraction reagent (Sepazole RNA I Super G, manufactured by Nacalai Tesque) was added to the wells, and the cells were collected. After recovering RNA according to the attached protocol, incubate with DNase (Promega) at 37 ° C for 30 minutes, add the attached reaction stop solution and incubate at 65 ° C for 10 minutes to inactivate DNase I let you. DNase-treated RNA was prepared from 50 pmol of random hexamer (Takara Bio) using Superscript II (Takara Bio) according to the attached protocol, 10 minutes at 30 ° C, 42 First-strand cDNA was obtained by incubation at 50 ° C. for 50 minutes and at 70 ° C. for 15 minutes to carry out reverse transcription. Using the obtained cDNA, using Ex Taq polymerase (Takara Bio) according to the attached protocol, prepare a reaction solution containing 0.4 μM primer (sequence is described below), PCR thermal cycler (BioRad) PCR was performed by repeating 32 cycles of a denaturation step at 95 ° C for 20 seconds, an annealing step at 58 ° C for 20 seconds, and an extension step at 72 ° C for 1 minute. The reaction solution was mixed with a loading buffer (Takara Bio) and electrophoresed on a 2.5% agarose gel in 1 × TAE buffer (Nacalai Tesque). The gel was stained with ethidium bromide and the product was detected with ultraviolet light using a ChemiDoc ™ MP imaging system. The amplified PCR product was quantified using Image Lab software (Bio-Rad). The reporter exon 31 exon skipping ratio was derived as the ratio of skipping products to the total of transcripts exon 31 skipped and transcripts containing exon 31.
Primers used for amplification are as follows:
Splicing Reporter Forward, 5'-ATT ACT CGC TCA GAA GCT GTG TTG C-3 '(SEQ ID NO: 6); Splicing Reporter Reverse, 5'-AAG TCT CTC ACT TAG CAA CTG GCA G-3' (SEQ ID NO: 7).

As shown in Table 1 and FIG. 11, each of the compounds used exhibited an effect of improving the exon skip rate.

Experimental Example 9: Evaluation of exon skip activity of compound 3 4
The effect of Compound 3 on exon skip of dystrophin gene exon 31 in cells derived from DMD patients (c.4303G> T) was evaluated in more detail. The specific protocol is as follows. The result is shown in FIG.

Immortalized muscular dystrophy patient-derived cells (ref. Nishida, A. et al. Brain Dev. 38, 738-745 (2016)) were cultured in a 12-well plate for 24 hours, and then compound 3, TG003 diluted in DMSO solution and 20 μM and DMSO were added at respective concentrations so that the concentration was 0.1%. 48 hours after administration, 800 μl of RNA extraction reagent (Trizol, manufactured by Sakai Thermo) was added to the wells, and the cells were collected. RNA was collected using an RNA extraction kit (Direct-zol RNA purification kit, manufactured by Zimo Research) according to the attached protocol. Prepare the reaction solution containing 50 pmol of random hexamer (manufactured by Takara Bio Inc.) using Superscript II (manufactured by Takara Bio Inc.) according to the attached protocol. The first strand cDNA was obtained by performing a reverse transcription reaction by incubating at 70 ° C. for 50 minutes for 50 minutes. Using the obtained cDNA, Ex Taq polymerase (manufactured by TAKARA BIO INC.), According to the attached protocol, prepare a reaction solution containing 0.4 μM primer (sequence is described below), PCR thermal cycler (manufactured by BioRad) Then, PCR was carried out by repeating 32 cycles of a denaturation step at 95 ° C. for 20 seconds, an annealing step at 58 ° C. for 20 seconds, and an extension step at 72 ° C. for 1 minute. The reaction solution was mixed with a loading buffer (Takara Bio) and electrophoresed on a 2.5% agarose gel in 1 × TAE buffer (Nacalai Tesque). The gel was stained with ethidium bromide and the product was detected with ultraviolet light using a ChemiDoc ™ MP imaging system. Primers used for amplification are as follows:

Exon 1-8 forward, 5'- ATGCTTTGGTGGGAAGAAGTAG -3 '(SEQ ID NO: 12);
Exon 1-8 reverse, 5'-CTGTTGAGAATAGTGCATTTGAT-3 '(SEQ ID NO: 13);
Exon 7-11 forward, 5'-GTGGTTTGCCAGCAGTCAGCCACA-3 '(SEQ ID NO: 14);
Exon 7-11 reverse, 5'-TCCTGTTCCAATCAGCTTACTTC -3 '(SEQ ID NO: 15);
Exon 10-14 forward, 5'- TTGCAAGCACAAGGAGAGATT-3 '(SEQ ID NO: 16);
Exon 10-14 reverse, 5'-ACGTTGCCATTTGAGAAGGAT-3 '(SEQ ID NO: 17);
Exon 13-18 forward, 5'-GCTGCTTTGGAAGAACAACTT -3 '(SEQ ID NO: 18);
Exon 13-18 reverse, 5'- CTTCTGAGCGAGTAATCCAGCT -3 '(SEQ ID NO: 19);
Exon 17-21 forward, 5'- AGGCAGATTACTGTGGATTCTGA -3 '(SEQ ID NO: 20);
Exon 17-21 reverse, 5'- TTGTCTGTAGCTCTTTCTCTC -3 '(SEQ ID NO: 21);
Exon 21-25 forward, 5'-CAACCTCAAATTGAACGATT-3 '(SEQ ID NO: 22);
Exon 21-25 reverse, 5'- CCCACCTTCATTGACACTGTT -3 '(SEQ ID NO: 23);
Exon 24-28 forward, 5'-GAGCATTGTCAAAAGCTAGAGGA-3 '(SEQ ID NO: 24);
Exon 24-28 reverse, 5'-CAATAACTCATGCCAACATGCCCA-3 '(SEQ ID NO: 25);
Exon 27-32 forward, 5'- CCTGTAGCACAAGAGGCCTTA -3 '(SEQ ID NO: 26);
Exon 27-32 reverse, 5'-TCCACACTCTTTGTTTCCAATG -3 '(SEQ ID NO: 27);
Exon 31-35 forward, 5'-GCCCAAAGAGTCCTGTCTCA-3 '(SEQ ID NO: 28);
Exon 31-35 Reverse, 5'-GTGCACCTTCTGTTTCTCAA-3 '(SEQ ID NO: 29);
Exon 34-38 forward, 5'-GAATGGCTGGCAGCTACAGA -3 '(SEQ ID NO: 30);
Exon 34-38 reverse, 5'-TTAACTGCTCCAATTCCTTCAA-3 '(SEQ ID NO: 31);
Exon 36-41 forward, 5'-TTTGACCAGAATGTGGACCA-3 '(SEQ ID NO: 32);
Exon 36-41 reverse, 5'-TGCGGCCCCATCCTCAGACAA-3 '(SEQ ID NO: 33);
Exon 40-45 forward, 5'- AGCCTACCTGAGCCCAGAGATG -3 '(SEQ ID NO: 34);
Exon 40-45 reverse, 5'-CTTCCCCAGTTGCATTCAAT-3 '(SEQ ID NO: 35);
Exon 44-48 forward, 5'- GCTGAACAGTTTCTCAGAAAGACACAA -3 '(SEQ ID NO: 36);
Exon 44-48 reverse, 5'-CAACTGATTCCTAATAGGAGA -3 '(SEQ ID NO: 37);
Exon 48-52 forward, 5'-CAAGGAGAAATTGAAGCTCAA-3 '(SEQ ID NO: 38);
Exon 48-52 reverse, 5'- CGATCCGTAATGATTGTTCTAGC -3 '(SEQ ID NO: 39);
Exon 51-59 forward, 5'-TGGACAGAACTTACCGACTGG -3 '(SEQ ID NO: 40);
Exon 51-59 reverse, 5'-GTAACAGGACTGCATCATCG-3 '(SEQ ID NO: 41);
Exon 55-59 forward, 5'-AGAGGCTGCTTTGGAAGAAA-3 '(SEQ ID NO: 42);
Exon 55-59 reverse, 5'- CCCACTCAGTATTGACCTCCTC -3 '(SEQ ID NO: 43);
Exon 58-68 forward, 5'-GACAGAGCAGCCTTTGGAAG -3 '(SEQ ID NO: 44);
Exon 58-68 reverse, 5'- GGACACGGATCCTCCCTGTTCG -3 '(SEQ ID NO: 45);
Exon 64-68 forward, 5'- CTCCGAAGACTGCAGAAGGC -3 '(SEQ ID NO: 46);
Exon 64-68 reverse, 5'-TTTCTGCAGCAGCCACTCT -3 '(SEQ ID NO: 47);
Exon 67-72 forward, 5'-ATTGAGCCAAGTGTCCGG-3 '(SEQ ID NO: 48);
Exon 67-72 reverse, 5'- TATCATCGTGTGAAAGCTGAG -3 '(SEQ ID NO: 49);
Exon 70-79 forward, 5'-GAATGGGCTACCTGCCAGTG -3 '(SEQ ID NO: 50);
Exon 70-79 reverse, 5'- ATCGCTCTGCCCAAATCATCTG -3 '(SEQ ID NO: 51);

As shown in FIG. 12, it was shown that Compound 3 induces skipping of patient variant exon 31 (fragment of exons: 27-32) but does not affect skipping of other exons.

Sequence number 1: RS peptide Sequence number 2: Human CLK1 forward Sequence number 3: Human CLK1 reverse Sequence number 4: GAPDH forward Sequence number 5: GAPDH reverse Sequence number 6: Splicing reporter forward Sequence number 7: Splicing reporter reverse Sequence number 8: Dystrophin Forward SEQ ID NO: 9: Dystrophin Reverse SEQ ID NO: 10: Mouse CLK1 Forward SEQ ID NO: 11: Mouse CLK1 Reverse SEQ ID NO: 12: Exon 1-8 Forward SEQ ID NO: 13: Exon 1-8 Reverse SEQ ID NO: 14: Exon 7-11 Forward Sequence SEQ ID NO: 16: Exon 10-14 Reverse SEQ ID NO: 17: Exon 10-14 Reverse SEQ ID NO: 18: Exon 13-18 Forward SEQ ID NO: 19: Exon 13-18 Reverse SEQ ID NO: 20: Exon 17 -21 Forward SEQ ID NO: 21: Exon 17-21 River SEQ ID NO: 22: exon 21-25 forward SEQ ID NO: 23: exon 21-25 reverse SEQ ID NO: 24: exon 24-28 forward SEQ ID NO: 25: exon 24-28 reverse SEQ ID NO: 26: exon 27-32 forward SEQ ID NO: 27: exon 27-32 reverse SEQ ID NO: 28: exon 31-35 forward SEQ ID NO: 29: exon 31-35 reverse SEQ ID NO: 30: exon 34-38 forward SEQ ID NO: 31: exon 34-38 reverse SEQ ID NO: 32: exon 36-41 forward sequence SEQ ID NO: 34: Exon 40-45 Forward SEQ ID NO: 35: Exon 40-45 Reverse SEQ ID NO: 36: Exon 44-48 Forward SEQ ID NO: 37: Exon 44-48 Reverse SEQ ID NO: 38: Exon 48 -52 Forward SEQ ID NO: 39: Exon 48-52 Reverse SEQ ID NO: 40: Exon 51-59 Forward SEQ ID NO: 41: Exon 51-59 Reverse Sequence Issue 42: Exon 55-59 Forward SEQ ID NO: 43: Exon 55-59 Reverse SEQ ID NO: 44: Exon 58-68 Forward SEQ ID NO: 45: Exon 58-68 Reverse SEQ ID NO: 46: Exon 64-68 Forward SEQ ID NO: 47: Exon 64 -68 reverse SEQ ID NO: 48: exon 67-72 forward SEQ ID NO: 49: exon 67-72 reverse SEQ ID NO: 50: exon 70-79 forward SEQ ID NO: 51: exon 70-79 reverse

Claims (12)

1. A pharmaceutical composition for modifying splicing comprising:
   A pharmaceutical composition comprising a compound represented by the following general formula (I) or a prodrug thereof or a pharmaceutically acceptable salt thereof as an active ingredient, wherein the compound has an ability to inhibit the phosphorylation activity of protein phosphorylase.
   

   

   [Here, in the general formula (I),
   X ¹ is
   

   

   R ³ , R ⁴ and R ⁵ are each independently hydrogen, a halogen atom, a carboxyl group, an amino group, a hydroxyl group, a C _1-4 alkyl group, or a C _1-4 substituted with a halogen atom. An alkyl group,
   X ² is — (bond) or —NH—,
   R ¹ is
   

   

   R ⁶ , R ⁷ , R ⁸ , and R ⁹ each independently represent hydrogen, a halogen atom, a carboxyl group, an amino group, a hydroxyl group, a C _1-4 alkyl group, or a C atom substituted with a halogen atom. _1-4 alkyl group,
   R ² is hydrogen, halogen atom, carboxyl group, amino group, hydroxyl group, C _1-4 alkyl groups C ₁ or substituted by halogen atom, - ₄ alkyl group. ]
2. The pharmaceutical composition according to claim 1, for inducing exon skipping.
3. The pharmaceutical composition according to claim 1 or 2, for the prevention, improvement, progression inhibition and / or treatment of genetic diseases.
4. The compound represented by the general formula (I) is:
   

   

   The pharmaceutical composition according to any one of claims 1 to 3, wherein
5. The compound represented by the general formula (I) is:
   

   

   The pharmaceutical composition according to any one of claims 1 to 3, wherein
6. The compound represented by the general formula (I) is:
   

   

   The pharmaceutical composition according to any one of claims 1 to 3, wherein
7. The compound represented by the general formula (I) is:
   

   

   The pharmaceutical composition according to any one of claims 1 to 3, wherein
8. A method for preventing, improving, suppressing progression and / or treating a genetic disease, comprising administering the pharmaceutical composition according to any one of claims 1 to 7 to a subject.
9. A compound represented by the following general formula (I) or a prodrug thereof or a pharmaceutically acceptable salt thereof for producing a pharmaceutical composition for prevention, improvement, progression inhibition and / or treatment of a genetic disease use.
   

   

   [Here, in the general formula (I),
   X ¹ is
   

   

   R ³ , R ⁴ and R ⁵ are each independently hydrogen, a halogen atom, a carboxyl group, an amino group, a hydroxyl group, a C _1-4 alkyl group, or a C _1-4 substituted with a halogen atom. An alkyl group,
   X ² is — (bond) or —NH—,
   R ¹ is
   

   

   R ⁶ , R ⁷ , R ⁸ , and R ⁹ each independently represent hydrogen, a halogen atom, a carboxyl group, an amino group, a hydroxyl group, a C _1-4 alkyl group, or a C atom substituted with a halogen atom. _1-4 alkyl group,
   R ² is hydrogen, a halogen atom, a carboxyl group, an amino group, a hydroxyl group, a C _1-4 alkyl group, or a C _1-4 alkyl group substituted with a halogen atom. ]
10. Use of a compound represented by the following general formula (I) or a prodrug thereof or a pharmaceutically acceptable salt thereof for modifying splicing.
    

    

    [Here, in the general formula (I),
    X ¹ is
    

    

    R ³ , R ⁴ and R ⁵ are each independently hydrogen, a halogen atom, a carboxyl group, an amino group, a hydroxyl group, a C _1-4 alkyl group, or a C _1-4 substituted with a halogen atom. An alkyl group,
    X ² is — (bond) or —NH—,
    R ¹ is
    

    

    R ⁶ , R ⁷ , R ⁸ , and R ⁹ each independently represent hydrogen, a halogen atom, a carboxyl group, an amino group, a hydroxyl group, a C _1-4 alkyl group, or a C atom substituted with a halogen atom. _1-4 alkyl group,
    R ² is hydrogen, a halogen atom, a carboxyl group, an amino group, a hydroxyl group, a C _1-4 alkyl group, or a C _1-4 alkyl group substituted with a halogen atom. ]
11. A pharmaceutical composition comprising, as an active ingredient, a compound represented by the following general formula (I) or a prodrug thereof or a pharmaceutically acceptable salt thereof, wherein the compound has an activity to inhibit protein phosphorylation activity.
    

    

    [Here, in the general formula (I),
    X ¹ is
    

    

    R ³ , R ⁴ and R ⁵ are each independently hydrogen, a halogen atom, a carboxyl group, an amino group, a hydroxyl group, a C _1-4 alkyl group, or a C _1-4 substituted with a halogen atom. An alkyl group,
    X ² is — (bond) or —NH—,
    R ¹ is
    

    

    R ⁶ , R ⁷ , R ⁸ , and R ⁹ each independently represent hydrogen, a halogen atom, a carboxyl group, an amino group, a hydroxyl group, a C _1-4 alkyl group, or a C atom substituted with a halogen atom. _1-4 alkyl group,
    R ² is hydrogen, a halogen atom, a carboxyl group, an amino group, a hydroxyl group, a C _1-4 alkyl group, or a C _1-4 alkyl group substituted with a halogen atom. ]
12. The compound represented by the following general formula, its prodrug, or its pharmaceutically acceptable salt.
    

    

    [In the above general formula, R ² , R ³ , R ⁴ , R ⁵ , R ⁶ , R ⁷ , R ⁸ , R ⁹ are each independently hydrogen, halogen atom, carboxyl group, amino group, A hydroxyl group, a C _1-4 alkyl group, or a C _1-4 alkyl group substituted with a halogen atom. ]

Images