WO2017168031A1 - Use of tcfl5/cha as a new marker for the prognosis and/or differential diagnosis of acute lymphoblastic leukemia - Google Patents

Use of tcfl5/cha as a new marker for the prognosis and/or differential diagnosis of acute lymphoblastic leukemia Download PDF

Info

Publication number
WO2017168031A1
WO2017168031A1 PCT/ES2017/070201 ES2017070201W WO2017168031A1 WO 2017168031 A1 WO2017168031 A1 WO 2017168031A1 ES 2017070201 W ES2017070201 W ES 2017070201W WO 2017168031 A1 WO2017168031 A1 WO 2017168031A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
tcfl5
cha
isoforms
patients
Prior art date
Application number
PCT/ES2017/070201
Other languages
Spanish (es)
French (fr)
Inventor
Manuel Fresno Escudero
Núria GIRONÈS PUJOL
Manuel RAMÍREZ ORELLANA
Original Assignee
Universidad Autónoma de Madrid
Fundación Para La Investigación Biomédica Del Hospital Infantil Universitario Niño Jesús
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Universidad Autónoma de Madrid, Fundación Para La Investigación Biomédica Del Hospital Infantil Universitario Niño Jesús filed Critical Universidad Autónoma de Madrid
Publication of WO2017168031A1 publication Critical patent/WO2017168031A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids

Definitions

  • the present invention belongs to the technical field of biotechnology and medicine.
  • it provides a prognostic method of acute lymphoblastic leukemia (ALL) based on the determination of the expression levels of each and every isoform of the TCFL5 gene, including CHA.
  • ALL acute lymphoblastic leukemia
  • kit for the implementation of said method It also refers to a method for differential diagnosis, classification or stratification of patients based on said prognosis; a method for treatment; and a method for monitoring disease progression and / or treatment efficacy in patients with ALL.
  • T-LLA and B-LLA The acute lymphoblastic leukemias T and B (T-LLA and B-LLA) are a group of malignant neoplasms characterized by bone marrow invasion of hematopoietic precursors (Inaba, H., M. Greaves, and CG Mullighan, Acute lymphoblastic leukaemia Lancet, 2013. 381 (9881): p. 1943-55). Immature leukemic cells usually invade the blood quite quickly. These cells can spread to other parts of the body, such as lymph nodes, liver, spleen, central nervous system (the brain and spinal cord) and testicles (in men).
  • ALL represents 12% of leukemias diagnosed in the US and Europe and 60% of all cases occur in people under 20 years. ALL is the most frequent leukemia in children (3 out of 4) and the cost of treatment is approximately 100,0006 per patient. The LLA exceeds 6,000 new cases a year in the US and a similar percentage in Europe. About 20% of patients have treatment failure, including patients who were initially considered low risk. Relapsing ALL can be considered the fifth most common cancer in children and represents a significant percentage of annual deaths of children associated with cancer (Bhojwani, D. and CH Pul, Relapsed childhood acute lymphoblastic leukaemia. Lancet Oncol, 2013. 14 (6 ): p. e205-17).
  • T-ALL represents 10% -15% of pediatric ALL and 25% of adult ALL cases and remains an aggressive disease with 5-year disease-free survival between 20 and 50%. The prognosis is still poor in children and adults. Early relapses are common in T-ALL and are associated with a poor prognosis.
  • the basis of the current treatment is the hemopathological diagnosis and can be grouped into subtypes, based on chromosomal translocations and gene expression profiles (Inaba, H., et al., Acute lymphoblastic leukaemia. Lancet, 2013. 381 (9881): p .1943-55).
  • TCFL5 is a transcription factor of the basic helix-loop-helix family and one of the 14 genes that characterize TEL / AML1-positive leukemias (Gandemer V, Rio AG, from Tayrac M, et al. Five distinct biological! Processes and 14 differentially expressed genes characterize TEUAML1-positive leukemia BMC Genomics. 2007; 8: 385). It has also been identified as one of the 5 genetic factors associated with vincristine resistance in ALL (Silveira VS, et al. Gene expression pattern contributing to prognostic factors in childhood acute lymphoblastic leukemia. Leuk Lymphoma. 2013; 54: 310-314 , Table 1). Silveira VS, et al. They also describe a significant association between higher levels of TCFL5 gene expression and bone marrow status and with a negative B-LLA ETV6 / RUNX1 phenotype.
  • TCFL5 has also been described as a NOTCH-1 target gene, an important mediator in the development of T-ALL leukemia (Weerkamp, F., et al., Identification of Notch target genes in uncommitted T-cell progenitors: No direct induction of a T-cell specific gene program Leukemia, 2006. 20 (11): p. 1967-77).
  • the CHA transcription factor was first cloned by the inventors, being described as an isoform of the TCFL5 gene (Rodr ⁇ guez, CI, N. Girones, and M. Fresno, Cha, a basic helix-loop-helix transcription factor involved in the regulation of upstream stimulatory factor activity J Biol Chem, 2003. 278 (44): p. 43135-45).
  • the stratification of ALL patients allows the intensity of the therapy to be adapted to the risk of relapse of the patient, thus contributing to improving the survival rate of the patients and / or preventing relapses.
  • Gene expression profiles can provide a good tool for subclassification and therapeutic stratification of patients (Zhou, Y., et al., Advances in the molecular pathobiology of B-lymphoblastic leukemia. Hum Pathol 2012. 43: 1347-1362 ; Mullighan, CG, Molecular genetics of B-precursor acute lymphoblastic leukemia. J Clin Invest 2012. 122: 3407-3415; Mullighan, CG, Genomic profiling of B- progenitor acute lymphoblastic leukemia.
  • genetic markers associated with high risk were identified in B-ALL patients and their use for diagnosis, prognosis and / or in determining the efficacy of treatment. More specifically the methods described comprise the determination of the expression levels of genes selected from the following group: CENTG2 (ArfGAP with GTPase domain, ankyrin repeat and PH domain 1); PTPRM (protein tyrosine phosphatase, receptor type, M); STAPI (signal transducing adapter family member 1); CCNJ (cyclin J); PCDH17 (procadherin 17); MCAM (melanoma cell adhesion molecule); CAPN3 (calpain 3); CABLESI (Cdk5 and Abl enzyme substrate 1); GPR155 (G protein-coupled receptor 155); MUC4 (mucin 4); GPRI 10 (G protein-coupled receptor 1 10); IGJ (immunoglobulin J polypeptide); NRXN3 (neurexin 3); CD99 (CD99 molecule);
  • WO2015 / 092755 reports a method for the diagnosis or prognosis of acute high hyperdiploidy lymphoblastic leukemia (HeH-ALL) by simultaneous determination of the presence / absence of chromosomes 6, 18 and 21 using iFISH technology.
  • WO2008 / 019872 refers to a method for the diagnosis of acute lymphoblastic leukemia in children by determining the expression levels of at least 14 genes of those described in Tables 1-4 or 5-16, especially those shown in Figure 3 of said publication: DNTT, SBGR101, DEFA3, CAMP, FCER2, DEFA4, BPI, PGLYRP1, LTF, SBGR2, NM_003526, CEACAM8, RNASE3, and ELA2.
  • the inventors performed a bioinformatic analysis based on data from TCFL5 mRNA sequences published in the RNAseq RNA sequencing databases (NCBI, Ensemble, Vega and EC gene) in which the exon junctions were analyzed, and established consensus messengers expressed in human (see Figure 1 and Table I of Example 1).
  • the inventors established that the TCFL5 gene has 6 different major isoforms at the mRNA level: (1) TCFL5R, (2) TCFL5R4b, (3) TCFL5R7, (4) TCFL5R4b6 (5) TCFL5R6 and (6) CHA (Tcfl5R2b or R2b), increasing the number of isoforms with respect to the 2 isoforms previously described: TCFL5 and CHA.
  • TCFL5 when referring to the TCFL5 isoform, it refers to that which has E1, E2a, E3, E4 (E4a or E4b), E5 and E8; that is, it encompasses TCFL5R and TCFL5R4b.
  • CHA isoform
  • CHA uses an alternative promoter located between exon 1 and 2, presenting as initial exon E2b.
  • E2b E3, E4, E5 and E8.
  • TCFL5 the absence of E1 and by presenting E2b instead of E2a (the portion of the E2a sequence other than E2b has been indicated in italics in Figure 3).
  • exon 2b contains a 5'UTR and a coding region coincident with E2a so that at the protein level the sequence corresponding to E2 is identical in TCFL5 and CHA, and therefore CHA differs only by the absence of the sequence amino acid corresponding to E1.
  • TCFL5R2b TCFL5R2b
  • TCFL5R2b TCFL5R2b
  • Fig. 2 and 7B mRNA level
  • Fig. 7A protein
  • TCFL5 as a prognostic marker and / or differential diagnosis in ALL will depend on whether the expression levels of the TCFL5 isoform are determined, on the CHA isoform (TCFL5R2b ) or both.
  • Fig. 6C and Table VI of Example 5 The inventors established an association between low levels of TCFL5 / CHA expression and a high-risk ALL prognosis (Fig. 6C and Table VI of Example 5). In particular, they observed that the expression of mRNA of TCFL5 / CHA at the time of diagnosis is much lower in high-risk ALL than in non-high-risk (medium or low) ALL (Table VII of Example 5). In Fig. 6A (Table IV of Example 5) it is shown that at the time of diagnosis the expression of TCFL5 / CHA in patients with ALL-T is less than in patients with ALL-B, although the difference is not statistically significant.
  • the inventors determined that there is a correlation between the levels of expression of TCFL5 / CHA in patients with ALL and the progression of the disease and / or efficacy of the treatment. More specifically, they observed that the expression of TCFL5 / CHA mRNA in ALL is significantly lower in relapse than in diagnosis (Fig. 6B and Table V of Example 5), said association is especially observed in B-ALL samples (Table VIII of Example 5).
  • the present invention relates in a first aspect to a method for the prognosis and / or differential diagnosis of patients with acute lymphoblastic leukemia (ALL), which comprises the determination of the expression levels of the TCFL5 gene where said determination includes the quantification of the CHA isoform.
  • ALL acute lymphoblastic leukemia
  • it refers to a method for the prognosis and / or differential diagnosis of patients with acute lymphoblastic leukemia (ALL) comprising the following stages:
  • TCFL5 / CHA expression levels refers to the expression levels of TCFL5 and CHA together.
  • the present invention relates to the in vitro use of the expression levels of the TCFL5 and CHA isoforms of the TCFL5 gene determined, preferably simultaneously, in an isolated biological sample of a patient with acute lymphoblastic leukemia (ALL) for the prognosis and / or differential diagnosis of patients with ALL, where a reduction in the values of TCFL5 / CHA in the patient sample with respect to reference values is indicative of high-risk ALL.
  • ALL acute lymphoblastic leukemia
  • the present invention also relates to a method for monitoring disease progression and / or efficacy of treatment in patients with ALL comprising the following stages:
  • the present invention relates to the in vitro use of the expression levels of the TCFL5 and CHA isoforms of the TCFL5 gene determined, preferably simultaneously, in an isolated biological sample of a patient with acute lymphoblastic leukemia (ALL) for the monitoring of disease progression and / or efficacy of treatment in patients with ALL, where a reduction in the values of the patient sample with respect to reference values is indicative of relapse.
  • ALL acute lymphoblastic leukemia
  • the invention also refers to a method for determining the most suitable treatment for an ALL patient comprising the classification of said patient according to the method for the prognosis and / or differential diagnosis of the first aspect of the invention.
  • the present invention relates to a method for the treatment of ALL patients where said treatment is determined based on the classification of said patient according to the method for the prognosis and / or differential diagnosis of the first aspect of the invention.
  • the invention refers to a kit for the prognosis, differential diagnosis and / or monitoring of patients with acute lymphoblastic leukemia (ALL) comprising:
  • a primer and / or probe comprising or consisting of a sequence selected from the group consisting of SEQ ID NO: 5 to SEQ ID NO: 76, and sequences identical to any of them at least 75%; Y
  • the invention also relates to the use of a kit for the prognosis, differential diagnosis and / or monitoring of patients with acute lymphoblastic leukemia (ALL) in a method according to the first aspect of the invention, wherein said kit comprises: a. a reagent to determine, preferably simultaneously, the expression levels of the TCFL5 and CHA isoforms of the TCFL5 gene; Y
  • the invention is related to a polynucleotide consisting of a nucleotide sequence selected from the group consisting of SEQ ID NO: 5 to SEQ ID NO: 76, and sequences identical to any of them at least 75%.
  • Fig. 1 Transcribed mRNA consensus majority of the TCFL5 gene. They were determined by analysis of exon junctions on already published databases of RNAseq sequences of the TCFL5 gene.
  • Fig. 2 TCFL5 mRNA transcripts corresponding to exon E1 vs E2 encoders present in different cells / tissues. They were determined by analysis of the already published RNAseq databases referring to the TCFL5 gene and are represented by color codes (darker higher frequency), with respect to the 2 exons. A high expression of coding E2 is observed in cells and tissues where the expression of E1 is low, indicating a differential expression of CHA with respect to the other isoforms of the TCFL5 gene (they present E1).
  • Fig. 3 Sequence of TCFL5 RNAm (SEQ ID NO: 1). The 5'UTR and 3'UTR regions are indicated. Likewise, the sequence corresponding to the coding region in which the different exons E1, E2, E3, E4, E5 and E8 are indicated with alternating colors (gray and black) is specified. In this sequence, exon 2 is E2a, the part of exon 2a used by TCFL5 but not by CHA is represented in italics and the CHA initiator ATG within exon 2 has been highlighted in bold (the untranslated part of this exon for CHA is different and represents exon 2b, not shown). The common region for both isoforms is shown shaded in gray. Likewise, some of the sequences used for the design of primers where the forward primer joins E5 and the reverse to E8 have been framed.
  • Fig. 4 Alignment of the coding sequences of TCFL5 and CHA (mRNA).
  • Fig. 5 Expression of TCFL5 and CHA in Jurkat cells: effects of DAPT (Notchl inhibitor) on the levels of TCFL5 / CHA expression at the protein level (Western Blot).
  • DAPT Notchl inhibitor
  • Fig. 6 Expression of TCFL5 / CHA in ALL samples obtained from patients: The expression levels of TCFL5 / CHA at the mRNA level are shown individually for each of the study groups. The graphs compare the values obtained in samples (A) of B-ALL vs T-ALL, (B) collected at the time of diagnosis vs. relapses and (C) classified according to the degree of low, medium or high risk of according to the criteria specified in materials and methods.
  • Fig. 7 Expression of TCFL5 / CHA in ALL leukemia samples obtained from patients at the time of diagnosis (LLA012, LL014) and relapse (LLA751, LLA783).
  • A Expression of CHA and TCFL5 proteins by Western Blot;
  • B Quantification of the mRNA of TCFL5 / CHA by qRT-PCR.
  • monitoring or monitoring of disease progression refers to determining the evolution of the disease, for example determining whether there is a relapse.
  • efficacy of a treatment refers to the degree to which a treatment achieves the desired or intended result, for example, the ability of a drug to achieve the desired effect.
  • treatment encompasses both a prophylactic and therapeutic treatment.
  • therapeutic treatment refers to one whose objective is to move from a disease or pathological state to a state of health.
  • prophylactic treatment refers to the prevention of a pathological state.
  • terapéuticaally effective amount refers to an amount that is effective, after the administration of a single or multiple dose to a subject (eg, a human patient) in prophylactic treatment or therapeutic of a disease, disorder or pathological condition.
  • probe refers to synthetically or biologically produced nucleic acids, between 10 and 285 nucleotides in length that contain specific nucleotide sequences that allow specific and preferred hybridization under predetermined conditions to the sequences. of target nucleic acid, and optionally have been modified for detection or to enhance assay performance.
  • a minimum of ten nucleotides is necessary to obtain statistically specificity and to form stable hybridization products, and a maximum of 285 nucleotides generally represents an upper limit for the length at which the reaction parameters can be easily adjusted to determine erroneously paired sequences and preferential hybridization.
  • the probes may contain certain constituent elements that contribute to their correct or optimal operation under certain test conditions.
  • the probes can be modified to improve their resistance to degradation by nucleases, to carry out the detection of ligands (for example, fluorescein marking) or to facilitate their capture on a solid support (for example, polyA tail ).
  • ligands for example, fluorescein marking
  • a solid support for example, polyA tail
  • the term "primers” as used herein refers to oligonucleotides or probes that can be used in an amplification procedure, such as a polymerase chain reaction (“PCR”), to amplify a nucleotide sequence. Primers are designed based on the polynucleotide sequence of a particular target sequence, for example, a specific mRNA sequence. The design and validation of primers and probes is well known in the art.
  • hybridization refers to a process whereby, under predetermined reaction conditions, two partially, substantially or completely complementary strands of nucleic acid are allowed to come into contact antiparallel to form a double-stranded nucleic acid with specific and stable hydrogen bonds, following explicit rules that make the nucleic acid bases can match each other.
  • partially complementary refers to a nucleotide sequence that is at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% complementary to a reference nucleotide sequence.
  • substantially complementary refers to a nucleotide sequence that is at least about 95%, 96%, 97%, 98%, or 99% complementary to a reference nucleotide sequence.
  • substantially hybridization means that the amount of hybridization observed will be such that someone who observes the results considers the positive result with respect to hybridization data in positive and negative controls. Data that are considered “background noise” are not substantial hybridization.
  • restrictive hybridization conditions means from about 35 ° C to 65 ° C in an approximately 0.9 molar NaCl saline solution.
  • the restriction can also be governed by such reaction parameters as the concentration and type of ionic species present in the hybridization solution, the types and concentrations of agents Denaturants present, and hybridization temperature. In general, as hybridization conditions become more restrictive, longer probes are preferred if stable hybrids are to be formed. As a rule, the restriction of the conditions under which hybridization will take place will determine certain characteristics of the preferred probes to be used.
  • antibody includes monoclonal and polyclonal antibodies, as well as recombinant antibodies.
  • recombinant antibody refers to an antibody produced or expressed using a recombinant expression vector, wherein the expression vector comprises a nucleic acid encoding the recombinant antibody, such that the introduction of the expression vector in an appropriate host cell results in the production or expression of the recombinant antibody.
  • the recombinant antibodies can be chimeric or humanized antibodies, mono- or multi-specific antibodies.
  • antibody also refers to fragments and derivatives of all of the foregoing, and may further comprise any variant thereof that retain the ability to specifically bind an epitope.
  • Antibodies may include, but are not limited to monoclonal antibodies (mAbs), single domain antibodies (sdAb), single chain antibodies (scFv), Fab fragments, F (ab ') 2, Fv fragments (sdFv) disulfides, anti - idiotype (anti-ld antibodies), intra-bodies, synthetic antibodies, and epitope binding fragments of any of the foregoing.
  • mAbs monoclonal antibodies
  • sdAb single domain antibodies
  • scFv single chain antibodies
  • Fab fragments fragments
  • F (ab ') 2 Fv fragments (sdFv) disulfides
  • anti-ld antibodies anti-idiotype antibodies
  • kit indicates a set of reagents and adjuvants required for an analysis. Although a kit consists of most cases of several units, the various elements of analysis presented in a single unit, which should be considered as kits, may also be available.
  • ALL acute lymphoblastic leukemia
  • the invention relates to a method for the prognosis and / or differential diagnosis of patients with acute lymphoblastic leukemia (ALL) comprising the determination of the levels of expression of the TCFL5 gene where said determination includes the quantification of the isoform CHA.
  • ALL acute lymphoblastic leukemia
  • ALL acute lymphoblastic leukemia
  • the method according to the first aspect of the invention allows differential diagnosis, classification or stratification of ALL patients based on prognosis e.g., high-risk ALL.
  • the invention relates to a method for the differential diagnosis of patients with acute lymphoblastic leukemia (ALL) which comprises the determination of the levels of expression of the TCFL5 gene where said determination includes the quantification of the CHA isoform.
  • ALL acute lymphoblastic leukemia
  • ALL acute lymphoblastic leukemia
  • simultaneous determination refers to the joint determination and by a single reaction, for example by the use of primers that amplify the common region to both isoforms (mRNA) and / or the use of affinity reagents that specifically bind to the polypeptides encoded by them.
  • the TCFL5 gene (NCBI Gene ID: 10732) has been described in humans and encodes a basic helix-loop-helix transcription factor. It is located on chromosome 20 (20q13.33) and has 8 exons (E1-E8) that undergo alternative splicing giving rise to 6 majority forms according to bionformatic analyzes carried out by the inventors of RNA sequencing databases "RNAseq" (NCBI, Ensemble, Vega and EC gene).
  • Such isoforms of the TCFL5 gene are: (1) TCFL5R, (2) TCFL5R4b, (3) TCFL5R7, (4) TCFL5R4b6 (5) TCFL5R6 and (6) CHA (Tcfl5R2b or R2b), increasing the number of isoforms with respect to the 2 isoforms previously described: Tcfl5R and CHA (Tcfl5R2b).
  • Tcfl5R2b TCFL5R
  • CHA Tcfl5R2b
  • sequence of the transcription variant or isoform CHA is identified in the present invention as SEQ ID NO: 2 (NCBI: AJ271337.1).
  • polypeptides encoded by the TCFL5 and CHA (mRNA) isoforms correspond to the amino acid sequences SEQ ID NO: 3 and SEQ ID NO: 4, respectively.
  • the determination of the TCFL5 and CHA isoforms according to the method of the invention is preferably carried out with reagents that detect both isoforms of the TCFL5 gene (at the mRNA or protein level) simultaneously, more preferably the detection and / or quantification of said Isoforms are specific for TCFL5 and CHA, not detecting and / or quantifying other isoforms of the TCFL5 gene.
  • the expression levels of the TCFL5 and CHA isoforms are determined at the level of messenger RNA (mRNA).
  • Molecular biology methods for quantifying target nucleic acid sequences are well known in the art. These procedures include, but are not limited to endpoint PCR, competitive PCR, reverse transcriptase associated with PCR (RT-PCR), quantitative PCR (qPCR), reverse transcriptase associated with qPCR (RT-qPCR), PCR-pyrosequencing, PCR -ELISA, DNA microarrays, mass spectrometry, in situ hybridization assays such as dot blotting or fluorescence in situ hybridization assay (FISH), branched DNA (bDNA; Nolte, Adv. Clin.
  • Such methods may also include pre-conversion of mRNA into cDNA through reaction with a reverse transcriptase (RT), for example the PCR reaction is usually preceded by the conversion of mRNA into cDNA and is referred to as RT-PCR.
  • RT reverse transcriptase
  • Primers and / or probes in general, react by offering a direct and linear response to increasing amounts of target nucleic acid sequences. Thanks to the comparison with appropriate standards, the amount of a nucleic acid sequence given in a sample can be easily quantified.
  • said molecular procedure for gene quantification is selected from the group consisting of quantitative polymerase chain reaction (qPCR), PCR-pyrosequencing, fluorescence in situ hybridization (FISH), DNA microarrays and PCR-ELISA.
  • a preferred quantification procedure is FISH, which combines the hybridization of probes with fluorescent optical microscopy, confocal laser microscopy or flow cytometry for the direct quantification of individual target sequences.
  • qPCR quantitative PCR
  • the qPCR or real-time PCR is well known by an expert in the field.
  • Different instruments for carrying out said reaction are marketed, such as ABI Prism 7700 SDS, GeneAmp 5700 SDS, ABI Prism 7900 HT SDS of Applied Biosystems; iCycler iQ from Bio-Rad; Cepheid Smart Cycler; Rotor-Gene from Corbett Research; LightCycler by Roche Molecular Biochemicals and Mx4000 Multiplex by Stratagene.
  • the qPCR procedure allows the exact quantification of the PCR product in real time by measuring the accumulation of the PCR product very early in the exponential phase of the reaction, thus reducing the bias in the quantification linked to the efficiency of the PCR amplification that is produces in endpoint PCR.
  • Real-time PCR is well known in the art and therefore, is not described in detail herein.
  • An overview of the technology and protocols for qPCR are available, for example, from the providers mentioned above, for example, http://www.sigmaaldrich.com/technical- documents / protocols / biology / sybr-green-qpcr.
  • biochemical detection refers to a procedure for reporting the amplification of the specific PCR product in real-time PCR. These biochemical detection are classified into two main groups.
  • the first group comprises double stranded DNA interleaving molecules: such as SYBR Green I and EvaGreen; and the second group includes oligonucleotides typically labeled with a fluorophore.
  • the latter has been divided into three subgroups: (i) primers-probes (Scorpions, Amplifluor®, LUX TM, Cyclicons, Angler®); (ii) hydrolysis (TaqMan, MGB-TaqMan, Snake assay) and hybridization (Hybprobe or FRET, Molecular Beacons, HyBeacon TM, MGB-Pleiades, MGB-Eclipse, ResonSense®, Yin-Yang or displacing); and (iii) nucleic acid analogs (PNA, LNA®, ZNA TM, unnatural bases: Plexor TM primer, Tiny-Molecular Beacon), see E. Navarro eta I.. Cl ⁇ nica Chimica Acta, Volume 439,
  • said probes are double-labeled oligonucleotides, such as hydrolysis probes or molecular beacons.
  • the 5 'end of the oligonucleotide is typically labeled with a fluorescent indicator (reporter) molecule such as FAM, TET or JOE while the 3' end is labeled with a quencher (quencher) molecule, such as TAM or BHQ1.
  • the probe sequence is specific for a region of interest in the amplified target molecule.
  • said probe is a hydrolysis probe that is designed so that the length of the sequence places the fluorophore 5 'and the deactivating molecule 3' in close proximity sufficiently narrow to suppress fluorescence.
  • indicator and extinguishing molecules for use in qPCR probes are well known in the art. These are available, for example, from https://www.eurofinsgenomics.eu/en/dna-rna-oligonucleotides/optimised-application-oligos/qpcr- probes.aspx.
  • probes and / or primers are used to quantify nucleotide sequences.
  • the term "a primer and / or probe” specifically includes “primers and / or probes", encompassing for example a primer, a probe, a primer and a probe, a pair of primers, and a pair of primers and a probe. Both terms are used interchangeably in the present invention.
  • the probes and / or primers used in the method of the invention specifically hybridize with SEQ ID NO: 1 and / or SEQ ID NO: 2.
  • Such probes and / or primers are partially complementary, preferably substantially or completely complementary to SEQ ID NO: 1 and / or SEQ ID NO: 2 or fragments thereof as described herein.
  • a probe and / or primer is a polynucleotide sequence of between 10 and 30 nucleotides, more preferably between 15 and 26 nucleotides, even more preferably between 18 and 22 nucleotides, and still much more preferably of about 20 nucleotides.
  • said primers and / or probes have been modified for detection or to enhance assay performance.
  • said primers and / or probes comprise or consist of a sequence selected from the group consisting of SEQ ID NO: 5 to SEQ ID NO: 76 (see Table III), and sequences identical to any of them in at least 75%.
  • said primers and / or probes comprise or consist of a sequence selected from the group consisting of SEQ ID NO: 5 to SEQ ID NO: 76 (see Table III).
  • said primers and / or probes are specific for the quantification / amplification of a region between exons 3 and 8 of TCFL5R (SEQ ID NO: 1) allowing to quantify specifically and simultaneously the expression of TCFL5 (independently that exon 4 presents the variant E4a or E4b) and CHA (TCFL5R2b).
  • the expression levels of the TCFL5 / CHA isoforms at the mRNA level are determined by quantifying a sequence between the first nucleotide of E3 and the last nucleotide of E8.
  • said primers and / or probes specifically hybridize with sequences comprised in any of exons E3, E4, E5 and / or E8, including when both primers hybridize to the same exon and any combination thereof.
  • said primers and / or probes comprise or consist of a sequence selected from the group consisting of SEQ ID NO: 5 to SEQ ID NO: 42; SEQ ID NO: 45 to SEQ ID NO: 62 and SEQ ID NO: 71 to SEQ ID NO: 74 (see Table III), and sequences identical to any of them at least 75%. More preferably, said primers and / or probes comprise or consist of a pair of primers selected from the group consisting of SEQ ID NO: 5 to SEQ ID NO: 42; SEQ ID NO: 45 to SEQ ID NO: 62 and SEQ ID NO: 71 to SEQ ID NO: 74 (see Table III).
  • said primers and / or probes specifically hybridize with sequences comprised in any of exons E3, E4 and / or E5 (amplifying a region common to all isoforms), including when both primers hybridize to the same exon and any combination thereof.
  • said primers and / or probes comprise or consist of a sequence selected from the group consisting of SEQ ID NO: 5 to SEQ ID NO: 42 and SEQ ID NO: 71 to SEQ ID NO: 72 (see Table III), and sequences identical to any of them in at least 75%.
  • said primers and / or probes comprise or consist of a pair of primers selected from the group consisting of SEQ ID NO: 5 to SEQ ID NO: 42 and SEQ ID NO: 71 to SEQ ID NO: 72 (see Table III ).
  • said primers and / or probes amplify the common and specific region of the TCFL5R and CHA isoforms, more specifically a primer and / or hybrid probe at E3 or E5 and the other at E8, or both at E8.
  • said primers and / or probes comprise or consist of a sequence selected from the group consisting of SEQ ID NO: 45 to SEQ ID NO: 62 and SEQ ID NO: 73 to SEQ ID NO: 74 (see Table III), and sequences identical to any of them in at least 75% More preferably, said primers and / or probes comprise or consist of a pair of primers selected from the group consisting of SEQ ID NO: 45 to SEQ ID NO: 62 and SEQ ID NO: 73 to SEQ ID NO: 74 (see Table III ).
  • one of the primers and / or probes hybrid specifically with a sequence comprised in E5 and the other in E8.
  • said primers and / or probes comprise or consist of a sequence selected from the group consisting of SEQ ID NO: 45 to SEQ ID NO: 54 and SEQ ID NO: 73 to SEQ ID NO: 74 (see Table III), and sequences identical to any of them in at least 75%.
  • said primers and / or probes comprise or consist of a pair of primers selected from the group consisting of SEQ ID NO: 45 to SEQ ID NO: 54 and SEQ ID NO: 73 to SEQ ID NO: 74 (see Table III ).
  • one of the primers and / or probes hybrid specifically with a sequence comprised in E3 and the other in E8.
  • said primers and / or probes comprise or consist of a sequence selected from the group consisting of SEQ ID NO: 55 to SEQ ID NO: 56 (see Table III), and sequences identical to any of them at least 75% .
  • said primers and / or probes comprise or consist of a pair of primers selected from the group consisting of SEQ ID NO: 55 to SEQ ID NO: 56 (see Table III).
  • both primers and / or probes hybridize to E8.
  • said primers and / or probes comprise or consist of a sequence selected from the group consisting of SEQ ID NO: 57 to SEQ ID NO: 62 (see Table III), and sequences identical to any of them at least 75% .
  • said primers and / or probes comprise or consist of a pair of primers selected from the group consisting of SEQ ID NO: 57 to SEQ ID NO: 62 (see Table III).
  • said primers and / or probes comprise or consist of a sequence selected from the group consisting of SEQ ID NO: 45 (First TCFL5 / CHA 01 Forward): GAGACTGACAAGGCCACAACT, SEQ ID NO: 46 (First TCFL5 / CHA 01 Reverse) : CCGCAAAATACGCTCTCAA, and sequences identical to any of them in at least 75%.
  • the oligonucleotide sequences with an identity of at least 75% mentioned in the present invention preferably have an identity of at least 80%, at least one 85%, at least 90%, at least 95%, more preferably, 96%, 97%, 98%, 99% or 100% with the respective reference sequences.
  • these sequences with an identity of at least 75% may have the same number of nucleotides, or have more or less nucleotides than the reference sequence.
  • identity refers to an exact correspondence of nucleotide with nucleotide or amino acid with amino acid of two polypeptide or polynucleotide sequences or, respectively. Two or more sequences (of polynucleotides or amino acids) can be compared by determining their "percent identity.”
  • the "percent identity” of two sequences, whether nucleic acid or amino acid sequences, is the number of exact matches between two aligned sequences divided by the length of the shortest sequence and multiplied by 100.
  • Suitable programs to calculate identity in percentage or similarity between sequences they are well known in the art, such as the NCBI BLAST program, used for example with the default parameters (http://www.ncbi.nlm.gov/cgi-bin/BLAST).
  • Quantification levels can be absolute or relative. In general, it is preferred that the expression levels be normalized. Normalization can be performed with respect to different measurements in the sample, such as by sample weight, quantification of human cells, quantification of total DNA, and / or quantification of the expression levels of a constitutive expression gene. These procedures are well known to one skilled in the art.
  • normalization is carried out with respect to the quantification of the expression levels of a constitutive expression gene.
  • genes that are constitutively expressed or “genes of constitutive expression” are understood to be those genes that have been described that are constantly transcribed. Examples of constitutively expressed genes are 2-myoglobulin, ubiquitin, 18S ribosomal protein, cyclophilin A, GAPDH, tyrosine activation protein 3- monooxygenase / tryptophan 5-monooxygenase (YWHAZ), beta-actin, ⁇ -2 - microglobulin or hypoxanthine-guanine phosphoribosyltransferase (HPRT).
  • the quantification of the TCFL5 / CHA expression levels is performed by RT-qPCR and comprises the normalization of the expression levels with respect to a constitutive expression gene.
  • the detection and / or quantification of the TCFL5 / CHA isoforms can also be carried out at the protein level.
  • Polypeptides encoded by the TCFL5 and CHA (mRNA) isoforms correspond to the amino acid sequences referred to as SEQ ID NO: 3 and SEQ ID NO: 4 in the present invention.
  • immunoassays There are various methods for quantifying peptides and proteins well known to a person skilled in the art, such as immunoassays. Various types of immunoassays are known to a person skilled in the art for the specific quantification of proteins of interest, either in solution or using a solid phase assay.
  • affinity reagents which may be specific receptors or ligands, for example antibodies, preferably labeled.
  • Western blotting or immunoblotting allows comparing abundances of proteins separated by an electrophoretic gel, eg. SDS-PAGE.
  • the proteins separated by gel electrophoresis are transferred onto a sheet of polymeric material (generally nitrocellulose, nylon, or polyvinylidene difluoride), where they are immobilized.
  • Target proteins are revealed by using a solution that contains a specific antibody.
  • the antibody can be conjugated directly with a radioactive, fluorescent or enzymatic marker (direct detection method) or a secondary antibody can be used that recognizes the primary antibody and therefore amplifies the signal (indirect detection method or sandwich type assay) .
  • a specific capture antibody for the target protein is immobilized on a polymeric or plastic surface and a solution containing the protein of interest (eg, serum or cell lysate) is added to the support. Finally, the sample is incubated on the support for a time to allow antigen-antibody complexes to form. Next, one or more washes are usually performed to remove the solution and the target protein is detected with a second antibody that recognizes a different protein epitope than the one recognized by the capture antibody. As in the case of Western Blot, this detection antibody can be directly labeled or can be recognized with a secondary antibody.
  • the protein of interest eg, serum or cell lysate
  • An immunoassay commonly used for protein quantification is the enzyme-linked immunosorbent assay (ELISA) in which the detection antibody carries an enzyme that converts a commonly colorless substrate into a colored compound or a non-fluorescent substrate into a fluorescent compound. Also, in other solid phase immunoassays, the antibody may be labeled with a radioactive or fluorescent isotope.
  • ELISA enzyme-linked immunosorbent assay
  • MS mass spectrometry
  • LC / MS liquid chromatography coupled to mass spectrometry
  • LC / MS tandem LC-MS / MS
  • the quantification of TCFL5 / CHA is performed by an immunoassay comprising the use of any antibody that detects both isoforms, such as HPA055223 ( Sigma) or SAB4500152 (Sigma), or antibodies specific to each of them.
  • the degree of variation (increase or decrease) in the expression values of TCFL5 / CHA in the patient sample with respect to the reference values can be, for example, at least 5%, 10%, 15%, 20% , 25%, 30%, 35%, 40%, 45%, 50%, 75%, 90%, 100%, 110%, 120%, 130%, 140%, 150% or more.
  • said variation is statistically significant.
  • statically significant refers to a p-value of less than 0.05, for example, a p-value of less than 0.025, a p-value of less than 0.01 or a value of p of less than 0.005, using an appropriate statistical test. A person skilled in the art will know how to define the most appropriate statistical tests.
  • a parametric model such as the student's t test or the ANOVA test is used; and when at least one of these two requirements is not achieved, then, in general, a non-parametric model such as the Mann-Whitney U test or the Kruskal-Wallis test is used.
  • Biological samples for use in the methods of the invention can be obtained from a variety of biological tissues or fluids, in particular blood, but bone marrow, lymph, cerebrospinal fluid, synovial fluid, and the like can also be used. . Such samples can be separated by centrifugation, decantation, density gradient separation, apheresis, affinity selection, FACS, etc.
  • the biological samples used in the method of the present invention are preferably samples of bone marrow, peripheral blood or cerebrospinal fluid. Said types of sample are routinely used in clinical practice and a person skilled in the art will know how to identify the appropriate means for obtaining and preserving them (Coustan-Smith E et al., Blood. 2002 Oct 1; 100 (7): 2399 -402; Martinez-Laperche C et al., American journal of hematology 88: 359-64).
  • the biological sample Once the biological sample is obtained, it can be used directly, frozen, or kept in an appropriate culture medium. Several culture media can be used to keep cells in culture. Samples can be obtained by any suitable procedure, such as blood collection, venous puncture, biopsy, or the like.
  • Mononuclear cells are generally isolated from said biological sample, by methods known in the state of the art. Mononuclear cells are typically isolated by density gradient centrifugation, for example with Ficoll® or Percoll®.
  • the determination of the expression levels of the TCFL5 and CHA isoforms is performed in a cell population that has been isolated from a biological sample of the patient by a method comprising a density gradient centrifugation.
  • the purification of a cell population of interest in a biological sample comprises a positive and / or negative selection based on the expression of characteristic cell surface markers.
  • the determination of the expression levels of the TCFL5 and CHA isoforms is performed in a population of ALL cells that has been isolated from a biological sample of the patient by a method that further comprises positive selection by the use of cell surface markers associated with leukemia.
  • LLA-B cells can be selected by removal of other MCs such as T lymphocytes (CD2 +, or CD3 + cells), and / or by the presence of specific surface markers, such as CD19 (B lymphocyte specific ), and / or CD10 (antigen associated with lymphoblastic leukemia).
  • the LLA-B cells are isolated by a selection comprising the expression of CD19, and / or CD10.
  • the population of ALL cells can be selected based on the expression of at least one cell surface marker.
  • Selection is usually carried out using proteins that specifically bind to one of said cell surface proteins, typically antibodies, and that can be linked to solid supports (e.g., particles or plastic surfaces) or can be conjugated with tidal molecules (for example, fluorochrome) that can be detected, for example, by flow cytometry.
  • proteins that specifically bind to one of said cell surface proteins typically antibodies, and that can be linked to solid supports (e.g., particles or plastic surfaces) or can be conjugated with tidal molecules (for example, fluorochrome) that can be detected, for example, by flow cytometry.
  • the patient's biological sample and the reference biological sample are of the same type, that is, they have the same biological origin and have been isolated using the same procedures.
  • Said biological samples can be taken around the time of diagnosis, before, during or after treatment, preferably they are taken around the time of diagnosis.
  • the reference values may be the expression levels determined for the expression product in one or more reference samples (for example, mean values +/- sme) or predetermined values.
  • said reference value is referred to as cut-off or threshold value.
  • a variety of statistical and mathematical methods to establish the threshold or cut-off value are known in the state of the art.
  • a threshold or cut-off expression value for a particular biomarker can be selected, for example, using a Receiver Operating Characteristic (ROC) analysis.
  • ROC Receiver Operating Characteristic
  • cut-off value can be varied, for example, by moving it along the ROC chart, to obtain different sensitivity or specificity values and therefore affecting the overall performance of the assay.
  • the best cut-off point refers to the value obtained from the ROC chart for a biomarker that produces the best sensitivity and specificity. Sensitivity and specificity values are calculated over the range of thresholds (cut-offs).
  • the threshold or cut-off values can be selected so that the sensitivity and / or specificity values are at least about 70%, and can be, for example, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or at least 100% in at least 60% of the study population, or in at least 65%, 70%, 75% or 80% of the study population.
  • the reference or control samples for obtaining the reference values correspond to one or more samples of lymphocytes isolated from healthy donors (eg, peripheral blood or bone marrow) or to established lymphocyte lines B (Raji, ATCC® CCL-86 TM) or human T (Jurkat, Clone E6-1 (ATCC® TIB-152 TM)
  • the reference samples for obtaining the reference or control values correspond to one or more cell samples of patients with ALL or to established cell lines of ALL
  • the cell lines and / or cell samples of donors (healthy or patient) used have been previously characterized, for example, according to their phenotype (eg, LLA-B or LLA-T), immunophenotype (a standard panel includes: CD10, CD19, CD20, CD34, CD38 and CD45), genetic markers of LLA-B (eg PAX5, IKZF1, or EBF1) and cytogenetics (eg, presence of translocations MLL-AF4, ETV6-RUNX1 or BCR
  • LLA-T eg HOX11 L2, LYL1 plus LM02, TAL1 plus LM01 or LM02, HOX1 1 , and MLL-EN, NOTCH1, c-MYC, etc.
  • Characteristic cell lines of LLA-B include but are not limited to CCL-120 (ATCC).
  • characteristic cell lines of LLA-T include but are not limited to CCL-1 19, CCL-120.1, CRL-1552, CRL-2264, CRL-2265, PTS-CCL-119, CRM-CCL-1 19, CRM -CCL- 1 19D, CRL-1 1386, TI B-195 (all of ATCC).
  • said patient samples have been associated with patients at medium and / or low risk both LLA-B and LLA-T.
  • the method of the invention is used for the prognosis and / or differential diagnosis of patients with ALL-B or ALL-T.
  • patients with ALL-B Preferably, in patients with ALL-B.
  • said patients are children.
  • the infant population in ALL is typically defined as those patients who are under 20 years old.
  • said patients are between 0 and 15 years old, and even between 0-12 months.
  • said patients are between 1 and 19 years old.
  • the classification of the disease can be, for example, a preference classification based on the risk of relapse (remission vs. therapeutic failure); but that can also be based on the clinical characteristics of the patients, on the cytogenetic data; in the subtype of leukemia; the response to treatment and / or the etiology of the disease. Typically, those with the highest chance of relapse are defined as high-risk patients.
  • These criteria for the classification and / or stratification of patients are well known by a person skilled in the art and are described for example in Ceppi F, et al., (2015) Risk factors for relapse in childhood acute lymphoblastic leukemia: prediction and prevention.
  • ALL patients are usually classified into one of the following risk groups:
  • STANDARD RISK or LOW RISK The patient must meet each and every one of the following criteria:
  • MEDIUM RISK Those patients who do not meet the criteria of Standard Risk or High Risk.
  • said method further comprises the detection or quantification of one or more Genetic markers described with prognostic value for ALL, preferably comprises determining the presence of one or more of the translocations selected from the group consisting of t (12; 21), t (1; 19), t (9; 22) and t (4; 11), Hypodiploidy ⁇ 44 chromosomes or DNA index ⁇ 0.81.
  • Said method may further comprise the determination of one or more of the biochemical and / or clinical parameters described above commonly used for stratification of ALL patients according to risk.
  • the method of the invention may further comprise the storage of the results obtained in a data storage device.
  • said Data storage device is a sheet of paper.
  • said data storage device is a computer readable medium.
  • a computer-readable medium may be any apparatus that may include, store, communicate, propagate or transport the results of the determination of the process of the invention.
  • the medium may be an electronic, magnetic, optical, electromagnetic, infrared or semiconductor system (or apparatus or device) or a propagation medium.
  • a further aspect of the invention relates to a computer-implemented method, in which the method is any of the methods described herein or any combination thereof.
  • any computer program capable of implementing any of the methods of the present invention or used to implement any of these methods or any combination thereof is also part of the present invention.
  • any device or apparatus comprising or carrying a computer program capable of carrying out, or for the application of any of the methods of the present invention or any combination thereof is also included as part of the present specification.
  • the present invention relates to the in vitro use of the expression levels of the TCFL5 and CHA isoforms of the TCFL5 gene determined, preferably simultaneously, in an isolated biological sample of a patient with acute lymphoblastic leukemia (ALL) for the prognosis and / or differential diagnosis of patients with ALL, where a reduction in the expression values of TCFL5 / CHA in the patient sample with respect to reference values is indicative of high-risk ALL.
  • ALL acute lymphoblastic leukemia
  • the invention also refers to a method for the personalization of the treatment or for the determination of the most appropriate treatment based on the patient's risk profile, wherein said method comprises the prognosis and / or differential diagnosis according to the risk according to the method of the first aspect of the invention.
  • the invention refers to a method for the treatment of ALL patients that comprises the administration of a therapeutically effective amount of a drug or combination of drugs where said treatment is determined based on the classification or stratification of said patient. depending on the risk according to the method of First aspect of the invention.
  • Such therapy is typically formed by the association of several drugs, including, among others, vincristine, prednisone and anthracyclines (daunorubicin or idarubicin or doxorubicin), L-asparaginase, and methotrexate, etc ((lnaba, H., M. Greaves, and CG Mullighan , Acute lymphoblastic leukaemia, Lancet, 2013. 381 (9881): p. 1943-55).
  • drugs including, among others, vincristine, prednisone and anthracyclines (daunorubicin or idarubicin or doxorubicin), L-asparaginase, and methotrexate, etc ((lnaba, H., M. Greaves, and CG Mullighan , Acute lymphoblastic leukaemia, Lancet, 2013. 381 (9881): p. 1943-55).
  • a greater intensity of treatment is characterized by a greater dosage and / or frequency of administrations with respect to the administration of the same drug or combination of drugs in a patient classified as medium or low risk.
  • a treatment of greater intensity may also consist of the administration of other drugs whose use is considered more aggressive, for example, being associated with a higher toxicity.
  • the present invention also relates to a method for monitoring disease progression and / or efficacy of treatment in patients with ALL comprising the determination of levels of expression of the TCFL5 gene where said determination includes quantification of the CHA isoform.
  • it refers to a method for monitoring disease progression and / or efficacy of treatment in patients with ALL comprising the following stages:
  • the sampling is done at the beginning of the treatment, throughout the treatment and / or once the treatment is finished, in a cyclic or timely manner.
  • the invention refers to the use in vitro of the expression levels of the TCFL5 and CHA isoforms of the TCFL5 gene determined, preferably simultaneously, in an isolated biological sample of a patient with acute lymphoblastic leukemia (ALL) for the monitoring of patients with ALL, where a reduction in values TCFL5 / CHA expression in the patient sample with reference values is indicative of relapse.
  • ALL acute lymphoblastic leukemia
  • the invention relates to a method of obtaining useful data for the prognosis, differential diagnosis and / or monitoring of patients with acute lymphoblastic leukemia (ALL) comprising: a. determine, preferably simultaneously, the expression levels of the TCFL5 and CHA isoforms of the TCFL5 gene in a biological sample isolated from said patient.
  • ALL acute lymphoblastic leukemia
  • the invention refers to a kit for the prognosis, differential diagnosis and / or monitoring of patients with ALL in a method according to the previous aspects of the invention, wherein said kit comprises: a. a reagent to determine the expression levels of the TCFL5 gene where said determination includes the quantification of the CHA isoform; Y
  • said kit comprises: a. a reagent to determine, preferably simultaneously, the expression levels of the TCFL5 and CHA isoforms of the TCFL5 gene; Y
  • kits for the prognosis, differential diagnosis and / or monitoring of patients with acute lymphoblastic leukemia comprising:
  • a primer and / or probe comprising or consisting of a sequence selected from the group consisting of SEQ ID NO: 5 to SEQ ID NO: 76, and sequences identical to any of them at least 75%; Y b. optionally, instructions for the use of said primer and / or probe for the determination of the expression levels of said isoforms in a biological sample isolated from said patient. More preferably, said primers and / or probes comprise or consist of a sequence selected from the group consisting of SEQ ID NO: 5 to SEQ ID NO: 42; SEQ ID NO: 45 to SEQ ID NO: 62 and SEQ ID NO: 71 to SEQ ID NO: 74, and sequences identical to any of them at least 75%.
  • said primers and / or probes comprise or consist of a sequence selected from the group consisting of SEQ ID NO: 45 to SEQ ID NO: 62 and SEQ ID NO: 73 to SEQ ID NO: 74, and sequences identical to any of them at least 75%.
  • kit for the prognosis, differential diagnosis and / or monitoring of patients with ALL comprising:
  • a pair of primers selected from the group consisting of the SEQ sequences
  • said primer and / or probe comprises or consists of a sequence selected from the group consisting of SEQ ID NO: 45, SEQ ID NO: 46 and sequences identical to any of them at least 75%.
  • SEQ ID NO: 45 amino acid sequence
  • SEQ ID NO: 46 amino acid sequence sequences identical to any of them at least 75%.
  • Other preferred sequences have been described under the first aspect of the invention.
  • said kit further comprises reagents suitable for quantitative PCR quantification.
  • reagents suitable for quantitative PCR quantification includes a DNA polymerase, such as Taq DNA polymerase (for example, the hot-start Taq DNA polymerase), a suitable buffer (for example Tris-HCI, pH 8-9), magnesium (for example, MgCI 2 ) , deoxynucleotides (dNTPs) and optionally other reagents, such as gelatin and / or bovine albumin.
  • a DNA polymerase such as Taq DNA polymerase (for example, the hot-start Taq DNA polymerase)
  • a suitable buffer for example Tris-HCI, pH 8-9
  • magnesium for example, MgCI 2
  • dNTPs deoxynucleotides
  • optionally other reagents such as gelatin and / or bovine albumin.
  • said kit In addition to reagents for carrying out the PCR amplification reaction, said kit also usually carries reagents for the detection and quantification of the amplified products as described herein, for example double DNA intercalating fluorescent molecules. labeled chain or oligonucleotides (for example, fluorescent hydrolysis probes).
  • said kit further comprises reagents suitable for carrying out the mRNA transotranscription.
  • a reverse transcnptase such as the murine leukemia virus (MuLV RT) reverse transcnptase
  • a suitable buffer for example Tris-HCI, pH 8-9
  • magnesium eg, MgCI 2
  • dNTPs eg, RNase inhibitors
  • RNase inhibitors e.g, RNase inhibitors
  • said reagent for the determination, preferably simultaneously, of the expression levels of the TCFL5 and CHA isoforms of the TCFL5 gene is a polypeptide, preferably an antibody, capable of specifically binding to the TCFL5 and CHA isoforms to protein level
  • Said kit may comprise in a particular embodiment reagents for performing an immunohistochemical (ICH) assay, which typically comprises a secondary antibody conjugated with enzyme (for example conjugated to horseradish peroxidase) or alkaline phosphatase), an enzyme substrate and a dye, for example, hematoxylin.
  • ICH immunohistochemical
  • the invention also relates to the use of a kit for the prognosis, differential diagnosis and / or monitoring of patients with ALL in a method according to the above aspects of the invention, wherein said kit comprises: a. a reagent to determine the expression levels of the TCFL5 gene where said determination includes the quantification of the CHA isoform; Y
  • kit for the prognosis, differential diagnosis and / or monitoring of patients with ALL in a method according to the above aspects of the invention, wherein said kit comprises: to a reagent to determine, preferably simultaneously, the expression levels of the TCFL5 and CHA isoforms of the TCFL5 gene; Y
  • step a) for the determination of the expression levels of said isoforms in a biological sample isolated from said patient has been described herein.
  • Particular embodiments and preferred features of this aspect of the invention have been defined in previous aspects, in particular in the first aspect of the invention.
  • the invention relates to a nucleotide or polynucleotide molecule, preferably a probe and / or primer, which specifically hybridizes to SEQ ID NO: 1 and / or SEQ ID NO: 2.
  • Said probes and / or primers are partially complementary, preferably substantially or completely complementary to SEQ ID NO: 1 and / or SEQ ID NO: 2 or fragments thereof as described in other aspects of the invention.
  • the present invention refers to a composition comprising said polynucleotide and one or more excipients.
  • said sequence is selected from the group consisting of SEQ ID NO: 5 to SEQ ID NO: 76, and sequences identical to any of them at least 75%.
  • said primers and / or probes comprise or consist of a sequence selected from the group consisting of SEQ ID NO: 5 to SEQ ID NO: 42; SEQ ID NO: 45 to SEQ ID NO: 62 and SEQ ID NO: 71 to SEQ ID NO: 74, and sequences identical to any of them at least 75%.
  • said primers and / or probes comprise or consist of a sequence selected from the group consisting of SEQ ID NO: 45 to SEQ ID NO: 62 and SEQ ID NO: 73 to SEQ ID NO: 74, and sequences identical to any of them at least 75%.
  • said sequence is selected from the group consisting of SEQ ID NO: 45, SEQ ID NO: 46, and sequences identical to any of them at least 75%.
  • Other preferred sequences have been described under the first aspect of the invention.
  • the invention relates to the use of a nucleotide sequence that specifically hybridizes to SEQ ID NO: 1 and / or SEQ ID NO: 2 as a primer and / or probe in an in vitro method for prognosis, diagnosis and / or monitoring of patients with ALL according to the previous aspects of the invention.
  • said sequence is selected from the group consisting of SEQ ID NO: 5 to SEQ ID NO: 76, and sequences identical to any of them in at least 75%.
  • said primers and / or probes comprise or consist of a sequence selected from the group consisting of SEQ ID NO: 5 to SEQ ID NO: 42; SEQ ID NO: 45 to SEQ ID NO: 62 and SEQ ID NO: 71 to SEQ ID NO: 74, and sequences identical to any of them at least 75%.
  • said primers and / or probes comprise or consist of a sequence selected from the group consisting of SEQ ID NO: 45 to SEQ ID NO: 62 and SEQ ID NO: 73 to SEQ ID NO: 74, and sequences identical to any of them at least 75%.
  • said sequence is selected from the group consisting of SEQ ID NO: 45, SEQ ID NO: 46 and sequences identical to any of them at least 75%.
  • Other preferred sequences have been described under the first aspect of the invention.
  • the invention relates to a method for the determination in vitro, preferably simultaneously, of the expression levels of the TCFL5 and CHA isoforms of the TCFL5 gene in an isolated biological sample of a patient with acute lymphoblastic leukemia (ALL) ); where the expression levels of the TCFL5 and CHA isoforms are determined at the mRNA level by the use of a primer and / or probe selected from the group consisting of the sequences SEQ ID NO: 5 to SEQ ID NO: 76, and identical sequences to any of them at least 75%.
  • ALL acute lymphoblastic leukemia
  • said primers and / or probes comprise or consist of a sequence selected from the group consisting of SEQ ID NO: 5 to SEQ ID NO: 42; SEQ ID NO: 45 to SEQ ID NO: 62 and SEQ ID NO: 71 to SEQ ID NO: 74, and sequences identical to any of them at least 75%. Even more preferably, said primers and / or probes comprise or consist of a sequence selected from the group consisting of SEQ ID NO: 45 to SEQ ID NO: 62 and SEQ ID NO: 73 to SEQ ID NO: 74, and sequences identical to any of them at least 75%.
  • said primer and / or probe consists of a nucleotide sequence selected from the group consisting of SEQ ID NO: 45, SEQ ID NO: 46 and a sequence identical to any of them at least 75%.
  • SEQ ID NO: 45 SEQ ID NO: 45
  • SEQ ID NO: 46 SEQ ID NO: 46
  • sequence identical to any of them at least 75% Other preferred sequences have been described under the first aspect of the invention.
  • any embodiment analyzed in this specification can be implemented with respect to any method, kit, a polynucleotide, reagent or use of the invention, and vice versa.
  • those detailed features and particular embodiments relating to the first aspect of the invention may also be implemented with respect to other aspects of the invention.
  • the particular embodiments described herein are shown by way of illustration and not as limitations of the invention. The main characteristic features of the present invention can be used in various embodiments without departing from the scope of the invention. Those skilled in the art will recognize, or will be able to determine using no more than routine experimentation, numerous equivalents to the specific procedures described herein. These equivalents are considered to be within the scope of the present invention and are contemplated by the claims.
  • the words “understand” (and any way of understanding, such as “understand” and “understand”), “have” (and any form of having, such as “have” and “ has “),” include “(and any way of including, such as” include “and” include ”) or” contain “(and any way of containing, such as” contains “and” contain ”) are inclusive or open and do not exclude elements or stages of the procedure not mentioned, additional.
  • the term “comprises” encompasses and specifically describes “consists essentially of” and “consists of”.
  • the term “consisting essentially of” limits the scope of a claim to the specified materials or stages and those that do not materially affect the basic (s) and novel (s) feature (s). s) of the claimed invention.
  • the term “consisting of” excludes any element, step or ingredient not specified in the claim except, for example, impurities usually associated with the element or limitation.
  • A, B, C or combinations thereof refers to all permutations and combinations of the enumerated points preceding the term.
  • A, B, C or combinations thereof is intended to include the minus one of: A, B, C, AB, AC, BC or ABC, and if the order is important in a particular context, also BA, CA, CB, CBA, BCA, ACB, BAC or CAB.
  • combinations containing repetitions of one or more points or terms such as BBB, AAA, AB, BBC, AAABCCCC, CBBAAA, CABABB, and so on, are expressly included.
  • the person skilled in the art will understand that there is typically no limit on the number of points or terms in any combination, unless it is evident otherwise from the context.
  • approximation words such as, without limitation, "about”, “about”, “approximately” refer to a condition that, when modified as such, is understood to be not necessarily absolute or perfect It would be considered close enough for those skilled in the art to ensure the designation of the condition as present.
  • the extent to which the description can vary will depend on how large a change can be instituted and a person skilled in the art still recognizes that the modified characteristic trait still has the required characteristics and capabilities of the unmodified characteristic trait.
  • a numerical value in this document that is modified by an approximation word such as “approximately” may vary from the value set at ⁇ 1, 2, 3, 4, 5, 6, 7 , 10, 12 or 15%, or less, preferably represents the set value ( ⁇ 0%).
  • Bone marrow aspirate samples were obtained at the time of diagnosis or relapse of 60 children with ALL (ages 0-15 years) from the Ni ⁇ o Jes ⁇ s University Hospital in Madrid. 18 LLA-T and 42 LLA-B
  • Three risk groups were distinguished based on an evaluation of the data related to the patient's age and the results obtained in one or more of the following genetic and / or biochemical tests:
  • STANDARD RISK or LOW RISK The patient must meet each and every one of the following criteria:
  • MEDIUM RISK Those patients who do not meet the criteria of Standard Risk or High Risk. Western blot
  • the membrane was developed using the SuperSignal kit (Thermo Scientific) or the Immun-Star HRP kit (BIO_RAD) following the manufacturer's recommendations.
  • the extraction of mononucleated cells from patients was performed by density gradient centrifugation. Bone marrow samples from patients are diluted in half in PBS. In a separate tube, 5 ml of Ficoll (Ficoll® Paque Plus, Sigma-Aldrich) are prepared. The diluted bone marrow sample is placed on the ficoll slowly supporting the tip on the tube wall to generate two phases. It is centrifuged at 1500 rpm for 25 minutes with low deceleration at room temperature. We are left with the white phase that is where the mononucleated cells are found. Wash with PBS 1400 rpm for 7 minutes to remove traces of ficoll. After washing, the pellet is resuspended in fetal bovine serum (FBS) and cryopreserved in vials of a maximum of 12.5x10 6 cells.
  • FBS fetal bovine serum
  • RNA extraction was carried out with RNeasy Plus Mini Kit (Qiagen) following the manufacturer's instructions.
  • RNeasy Plus Mini Kit Qiagen
  • For the retrotranscription the TaqMan Reverse Transcription Reagents Kit (Applied Biosystem, Life Technologies) was used following the program: one cycle at 42 ° C for 45 minutes and one last cycle at 99 ° C for 3 minutes.
  • SYBR GREEN PCR Master Mix (Applied Biosystem, Life Technologies) was used following the program: one cycle 50 ° C for 2 min, 95 ° C for 10 minutes, 40 cycles at 95 ° C for 15 seconds and 58 ° C for 1 minutes, continuous melting curve.
  • TCFL5 / CHA_F (SEQ ID NO: 45): 5 'GAGACTGACAAGGCCACAACT 3'
  • TCFL5 / CHA_R (SEQ ID NO: 46): 5 'CCGCAAAATACGCTCTCAA 3'
  • RNA extraction and RT-qPCR (Protocol used in example 6)
  • RNA samples were stored in TRIzol (Life Technologies) at 70 ° C until use.
  • Total RNA extraction was performed with RNeasy Plus Mini Kit (Qiagen) following the manufacturer's recommendations.
  • Quantitative RT-qPCR The mRNA was retrotranscribed to complementary DNA (cDNA) and the genes were quantified with specific oligonucleotides (SEQ ID NO: 45 (TCFL5 / CHA 01 Forward) and SEQ ID NO: 46 (TCFL5 / CHA 01 reverse) of Table III) with the GoTaq 2-Step RT-PCR System kit (Promega) following the manufacturer's recommendations.
  • the values obtained for each gene were normalized with the House keeping HPRT (Hypoxanthine-guanine phosphoribosyltransferase) gene to obtain AC T , after which they were normalized with the value of the control sample to obtain ⁇ ⁇ .
  • the primers used to quantify HPRT expression were HPRT-Forward (SEQ ID NO: 79): CTGGAAAGAATGTCTTGATTGTGG; and HPRT-Reverse (SEQ ID NO: 80): CATCTTGGATTATACTGCCTGAC.
  • Example 1 Determination of consensus messengers and identification of new isoforms of TCFL5
  • Table I shows the consensus mRNAs or isoforms identified from the mRNA sequences published in the different databases.
  • Table I The access codes for each of the TCFL5 mRNAs described in databases and the association according to the bioinformatic analysis performed by the inventors are indicated.
  • Table II provides additional data regarding the variants or isoforms and the corresponding mRNA sequences.
  • H20C8515.3 features a longer 3'UTR.
  • R AB012124.1 begins 39 bases after skipping the 1st ATG, so it could be a partial messenger. In addition, it has a shorter 3'UTR.
  • Q9UL49-1 is the translation of this messenger.
  • AF070992.1 starts 170 bases after skipping the 1st ATG, so it could be a messenger
  • exon 4 has 3 bases less at its 5 'end (exon 4b).
  • exon 7 It presents an alternative final exon (called exon 7).
  • R7 XM_005260184.1, ENST00000217162, BC046933.1 and H20C8515.8 show differences in the length of their UTRs.
  • exon 6 It presents an alternative final exon (called exon 6) and uses alternative exon 4 (3 bases less in
  • BC065520.1 has some sequencing errors.
  • CHA uses an alternative initial exon (exon 2b) that contains a 5'UTR and a coding region
  • H20C8515.2 and H20C8515.5 have 3'UTRs longer.
  • the TCFL5 gene is composed of 8 exons (see Figure 1) with exons 3 (E3) and 5 (E5) common to all isoforms.
  • Exon 1 (E1) is present in 5 of the 6 isoforms, its expression missing only in the isoform called CHA (R2b).
  • the last exon may be represented by exon 8, in the case of the consensus isoform TCFL5 (TCFL5R) and the CHA isoform, by exon 7 or by exon 6.
  • the consensus isoform TCFL5 (TCFL5R) and the isoform that ends with exon 6, can present an exon 4 that lacks the first codons (R4b6).
  • the CHA isoform has an exon 2 different from the rest (E2b).
  • Example 2 Design of oligonucleotides for the detection of TCFL5 / CHA
  • primers were designed that quantify TCFL5, CHA independently and TCFL5 / CHA together.
  • TCFL5 / CHA primers were designed that amplify a region common to both isoforms, that is, the region between exons 3 and 8 (see Figs. 1 and 3).
  • E1 and E2 in the databases cited above was analyzed and a preferential expression of E1 was observed in brain, heart, liver, lung, kidney and testis, while E2 was preferentially expressed in the Jurkat T cell line , peripheral blood mononucleated cells (PBMNCs), monocytes and T and B cells. The results are shown in Fig. 2.
  • PBMNCs peripheral blood mononucleated cells
  • monocytes monocytes
  • T and B cells T and B cells.
  • Fig. 2 Example 4.- Determination of the expression levels of TCFL5 and CHA in cell lines treated with DAPT
  • TCFL5 The expression levels of the TCFL5, CHA and HSP90 isoforms (as a control) in Jurkat cells (Clone E6-1, ATCC® TIB-152 TM) were determined by Western Blot. The results in Fig. 5 show that a difference in expression is observed between the CHA and TCFL5 isoforms for different concentrations of DAPT.
  • Example 5 Comparison of TCFL5 / CHA mRNA expression levels in samples of ALL patients (ALL-B vs. ALL-T, diagnosis vs. relapse, high risk vs. medium vs. low, and non-high risk vs. high risk)
  • TCFL5 / CHA were determined by Real Time qPCR.
  • Example 6 Determination of TCFL5 / CHA mRNA in ALL patients (diagnosis vs. relapse)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to a method for the prognosis and/or the differential diagnosis of patients with Acute Lymphoblastic Leukemia (ALL) comprising the following steps: a) simultaneously determining the levels of expression of the isoforms TCFL5 and CHA of the gene TCFL5 in an isolated biological sample from said patient; and b) comparing the levels of expression of TCFL5/CHA in the sample from the patient with reference values, wherein a reduction in the values of the sample from the patient relative to the reference values is indicative of high risk ALL, wherein preferably said reference samples correspond to one or more samples from patients with ALL or to established lines of ALL. Also provided is a kit for carrying out the method. The invention also relates to a method for the differential diagnosis, the classification or stratification of the patients based on said prognosis; a treatment method; and a method for monitoring the progression of the disease and/or effectiveness of the treatment in patients with ALL.

Description

USO DE TCFL5/CHA COMO NUEVO MARCADOR PARA EL PRONÓSTICO Y/O DIAGNÓSTICO DIFERENCIAL DE LEUCEMIAS LINFOBLÁSTICAS AGUDAS  USE OF TCFL5 / CHA AS A NEW MARKER FOR THE PROGNOSIS AND / OR DIFFERENTIAL DIAGNOSIS OF ACUTE LYMPHOBLASTIC LEUKEMIES
CAMPO DE LA INVENCION FIELD OF THE INVENTION
La presente invención pertenece al campo técnico de biotecnología y medicina. En particular, proporciona un método pronóstico de leucemias linfoblásticas agudas (LLA) basado en la determinación de los niveles de expresión de todas y cada una de las isoformas del gen TCFL5, incluyendo CHA. Proporciona también un kit para la implementación de dicho método. Asimismo, se refiere a un método para el diagnóstico diferencial, la clasificación o estratificación de los pacientes en base a dicho pronóstico; un método para el tratamiento; y un método para la monitorización de la progresión de la enfermedad y/o eficacia del tratamiento en pacientes con LLA. The present invention belongs to the technical field of biotechnology and medicine. In particular, it provides a prognostic method of acute lymphoblastic leukemia (ALL) based on the determination of the expression levels of each and every isoform of the TCFL5 gene, including CHA. It also provides a kit for the implementation of said method. It also refers to a method for differential diagnosis, classification or stratification of patients based on said prognosis; a method for treatment; and a method for monitoring disease progression and / or treatment efficacy in patients with ALL.
ANTECEDENTES DE LA INVENCION BACKGROUND OF THE INVENTION
Las leucemias linfoblásticas agudas T y B (T-LLA y B-LLA) son un grupo de neoplasias malignas caracterizadas por la invasión de la médula ósea de precursores hematopoyéticos (Inaba, H., M. Greaves, and C.G. Mullighan, Acute lymphoblastic leukaemia. Lancet, 2013. 381(9881): p. 1943-55). Las células leucémicas inmaduras usualmente invaden la sangre con bastante rapidez. Estas células se pueden propagar a otras partes del cuerpo, como a los ganglios linfáticos, el hígado, el bazo, el sistema nervioso central (el cerebro y la médula espinal) y los testículos (en los hombres). The acute lymphoblastic leukemias T and B (T-LLA and B-LLA) are a group of malignant neoplasms characterized by bone marrow invasion of hematopoietic precursors (Inaba, H., M. Greaves, and CG Mullighan, Acute lymphoblastic leukaemia Lancet, 2013. 381 (9881): p. 1943-55). Immature leukemic cells usually invade the blood quite quickly. These cells can spread to other parts of the body, such as lymph nodes, liver, spleen, central nervous system (the brain and spinal cord) and testicles (in men).
La LLA representa el 12% de las leucemias diagnosticadas en EEUU y Europa y el 60% de todos los casos ocurre en personas menores de 20 años. La LLA es la leucemia más frecuente en niños (3 de cada 4) y el coste del tratamiento se sitúa en aproximadamente 100.0006 por paciente. La LLA supera los 6.000 nuevos casos al año en EEUU y un porcentaje similar en Europa. Alrededor de 20% de los pacientes presenta fracaso al tratamiento, incluyendo pacientes que se consideraron inicialmente como de bajo riesgo. Las LLA recidivantes pueden considerarse como el quinto cáncer más común en niños y representa un porcentaje importante de las muertes anuales de niños asociadas a cáncer (Bhojwani, D. and C.H. Pul, Relapsed childhood acute lymphoblastic leukaemia. Lancet Oncol, 2013. 14(6): p. e205-17). Un aspecto importante en el manejo clínico de B-LLA es la intensidad de la quimioterapia en función del riesgo de recaída (Zhou, Y., et ai, Advances in the molecular pathobiology of B-lymphoblastic leukemia. Hum Pathol, 2012. 43(9): p. 1347-62). Las T-LLA representan el 10%-15% de las LLA pediátricas y el 25% de los casos de LLA de adultos y sigue siendo una enfermedad agresiva con supervivencia libre de enfermedad a 5 años entre el 20 y el 50%. El pronóstico sigue siendo pobre en niños y adultos. Las recaídas tempranas son comunes en T-LLA y se asocian con un mal pronóstico. La base del tratamiento actual es el diagnóstico hemopatológico y se pueden agrupar en subtipos, basado en translocaciones cromosómicas y en perfiles de expresión génica (Inaba, H., et al., Acute lymphoblastic leukaemia. Lancet, 2013. 381(9881): p. 1943-55). ALL represents 12% of leukemias diagnosed in the US and Europe and 60% of all cases occur in people under 20 years. ALL is the most frequent leukemia in children (3 out of 4) and the cost of treatment is approximately 100,0006 per patient. The LLA exceeds 6,000 new cases a year in the US and a similar percentage in Europe. About 20% of patients have treatment failure, including patients who were initially considered low risk. Relapsing ALL can be considered the fifth most common cancer in children and represents a significant percentage of annual deaths of children associated with cancer (Bhojwani, D. and CH Pul, Relapsed childhood acute lymphoblastic leukaemia. Lancet Oncol, 2013. 14 (6 ): p. e205-17). An important aspect in the clinical management of B-ALL is the intensity of chemotherapy based on the risk of relapse (Zhou, Y., et ai, Advances in the molecular pathobiology of B-lymphoblastic leukemia. Hum Pathol, 2012. 43 ( 9): p. 1347-62). T-ALL represents 10% -15% of pediatric ALL and 25% of adult ALL cases and remains an aggressive disease with 5-year disease-free survival between 20 and 50%. The prognosis is still poor in children and adults. Early relapses are common in T-ALL and are associated with a poor prognosis. The basis of the current treatment is the hemopathological diagnosis and can be grouped into subtypes, based on chromosomal translocations and gene expression profiles (Inaba, H., et al., Acute lymphoblastic leukaemia. Lancet, 2013. 381 (9881): p .1943-55).
TCFL5 es un factor de transcripción de la familia basic helix-loop-helix y uno de los 14 genes que caracterizan las leucemias TEL/AML1 -positivas (Gandemer V, Rio AG, de Tayrac M, et al. Five distinct biológica! processes and 14 differentially expressed genes characterize TEUAML1- positive leukemia. BMC Genomics. 2007;8:385). Asimismo, ha sido identificado como uno de los 5 factores genéticos asociados a la resistencia a vincristina en LLA (Silveira VS, et al. Gene expression pattern contributing to prognostic factors in childhood acute lymphoblastic leukemia. Leuk Lymphoma. 2013;54:310-314, Tabla 1). Silveira VS, et al. también describen una asociación significativa entre niveles más altos de expresión del gen TCFL5 y el estado de la médula ósea y con un fenotipo B-LLA ETV6/RUNX1 negativo. TCFL5 is a transcription factor of the basic helix-loop-helix family and one of the 14 genes that characterize TEL / AML1-positive leukemias (Gandemer V, Rio AG, from Tayrac M, et al. Five distinct biological! Processes and 14 differentially expressed genes characterize TEUAML1-positive leukemia BMC Genomics. 2007; 8: 385). It has also been identified as one of the 5 genetic factors associated with vincristine resistance in ALL (Silveira VS, et al. Gene expression pattern contributing to prognostic factors in childhood acute lymphoblastic leukemia. Leuk Lymphoma. 2013; 54: 310-314 , Table 1). Silveira VS, et al. They also describe a significant association between higher levels of TCFL5 gene expression and bone marrow status and with a negative B-LLA ETV6 / RUNX1 phenotype.
TCFL5 ha sido también descrito como un gen diana de NOTCH-1 , un importante mediador en el desarrollo de leucemias T-LLA (Weerkamp, F., et al., Identification of Notch target genes in uncommitted T-cell progenitors: No direct induction of a T-cell specific gene program. Leukemia, 2006. 20(11): p. 1967-77). El factor de transcripción CHA fue clonado por primera vez por los inventores, siendo descrito como una isoforma del gen TCFL5 (Rodríguez, C.I., N. Girones, and M. Fresno, Cha, a basic helix-loop-helix transcription factor involved in the regulation of upstream stimulatory factor activity. J Biol Chem, 2003. 278(44): p. 43135-45). TCFL5 has also been described as a NOTCH-1 target gene, an important mediator in the development of T-ALL leukemia (Weerkamp, F., et al., Identification of Notch target genes in uncommitted T-cell progenitors: No direct induction of a T-cell specific gene program Leukemia, 2006. 20 (11): p. 1967-77). The CHA transcription factor was first cloned by the inventors, being described as an isoform of the TCFL5 gene (Rodríguez, CI, N. Girones, and M. Fresno, Cha, a basic helix-loop-helix transcription factor involved in the regulation of upstream stimulatory factor activity J Biol Chem, 2003. 278 (44): p. 43135-45).
La estratificación de los pacientes de LLA permite adaptar la intensidad de la terapia al riesgo de recaída del paciente, contribuyendo así a mejorar la tasa de supervivencia de los pacientes y/o a evitar recaídas. Los perfiles de expresión génica pueden proporcionar una buena herramienta para la subclasificación y la estratificación terapéutica de los pacientes (Zhou, Y., et al., Advances in the molecular pathobiology of B-lymphoblastic leukemia. Hum Pathol 2012. 43: 1347-1362; Mullighan, C. G., Molecular genetics of B-precursor acute lymphoblastic leukemia. J Clin Invest 2012. 122: 3407-3415; Mullighan, C. G., Genomic profiling of B- progenitor acute lymphoblastic leukemia. Best Pract Res Clin Haematol 2011. 24: 489-503; Harvey, R. C, et al., Identification of novel cluster groups in pediatric high-risk B-precursor acute lymphoblastic leukemia with gene expression profiling: correlation with genome-wide DNA copy number alterations, clinical characteristics, and outcome. Blood 2010. 116: 4874-4884;Van Vlierberghe P, Ferrando A. The molecular basis of T cell acute lymphoblastic leukemia. J Clin Invest. 2012; 122:3398-3406 ). En EEUU se realizó un gran ensayo clínico denominado "high-risk ALL Therapeutically Applicable Research to Genérate Effective Treatments" (TARGET) fruto de la colaboración entre el Instituto Nacional del Cáncer (NCI) y el Grupo de Oncología Infantil (COG), para la identificación y validación de nuevas dianas terapéuticas. Se analizaron 207 muestras de 272 (75%) pacientes de LLA de células B precursoras de alto riesgo de los pacientes participantes en el ensayo clínico COG p9906 en un esfuerzo para identificar subgrupos de estos pacientes de alto riesgo caracterizados por presentar perfiles de expresión génica característicos. Los resultados de dicho estudio se describen en la solicitud de patente WO2009/064481. En particular, se identificaron marcadores genéticos asociados con alto riesgo en pacientes de B- LLA y el uso de los mismos para el diagnóstico, pronóstico y/o en la determinación de la eficacia del tratamiento. Más específicamente los métodos descritos comprenden la determinación de los niveles de expresión de genes seleccionados del siguiente grupo: CENTG2 (ArfGAP with GTPase domain, ankyrin repeat and PH domain 1); PTPRM (protein tyrosine phosphatase, receptor type, M); STAPI (signal transducing adaptor family member 1); CCNJ (cyclin J); PCDH17 (procadherin 17); MCAM (melanoma cell adhesión molecule); CAPN3 (calpain 3); CABLESI (Cdk5 and Abl enzyme substrate 1); GPR155 (G protein-coupled receptor 155); MUC4 (mucin 4); GPRI 10 (G protein-coupled receptor 1 10); IGJ (immunoglobulin J polypeptide); NRXN3 (neurexin 3); CD99 (CD99 molecule); CRLF2 (cytokine receptor-like factor 2); ENAM (enamelin); TP53INP1 (tumor protein p53 inducible nuclear protein 1); IFITMI (inferieron induced transmembrane protein 1); IFITM2 (inferieron induced transmembrane protein 2); JJTTM3 (inferieron induced transmembrane protein 3); TTYH2 (tweety homolog 2); SEMA6A (semaphorin 6A); TNFSF4 (tumor necrosis factor superfamily, member 4); y SLC37A3 (solute carrier family 37, member 3). WO2015/092755 reporta un método para el diagnóstico o pronóstico de leucemia linfoblástica aguda de alta hiperdiploidia (HeH-ALL en sus siglas en inglés) mediante la determinación simultanea de la presencia/ausencia de los cromosomas 6, 18 y 21 utilizando la tecnología iFISH. WO2008/019872 se refiere a un método para el diagnóstico de leucemia linfoblástica aguda en niños mediante la determinación de los niveles de expresión de al menos 14 genes de los descritos en las tablas 1-4 o 5-16, en especial aquellos mostrados en la Figura 3 de dicha publicación: DNTT, SBGR101 , DEFA3, CAMP, FCER2, DEFA4, BPI, PGLYRP1 , LTF, SBGR2, NM_003526, CEACAM8, RNASE3, y ELA2. The stratification of ALL patients allows the intensity of the therapy to be adapted to the risk of relapse of the patient, thus contributing to improving the survival rate of the patients and / or preventing relapses. Gene expression profiles can provide a good tool for subclassification and therapeutic stratification of patients (Zhou, Y., et al., Advances in the molecular pathobiology of B-lymphoblastic leukemia. Hum Pathol 2012. 43: 1347-1362 ; Mullighan, CG, Molecular genetics of B-precursor acute lymphoblastic leukemia. J Clin Invest 2012. 122: 3407-3415; Mullighan, CG, Genomic profiling of B- progenitor acute lymphoblastic leukemia. Best Pract Res Clin Haematol 2011. 24: 489 -503; Harvey, R. C, et al., Identification of novel cluster groups in pediatric high-risk B-precursor acute lymphoblastic leukemia with gene expression profiling: correlation with genome-wide DNA copy number alterations, clinical characteristics, and outcome. Blood 2010. 116: 4874-4884; Van Vlierberghe P, Ferrando A. The molecular basis of T cell acute lymphoblastic leukemia. J Clin Invest. 2012; 122: 3398-3406). In the US, a large clinical trial called "high-risk ALL Therapeutically Applicable Research to Genérate Effective Treatments" (TARGET) was carried out as a result of the collaboration between the National Cancer Institute (NCI) and the Children's Oncology Group (COG), for the Identification and validation of new therapeutic targets. 207 samples of 272 (75%) high-risk precursor B-cell ALL patients from the patients participating in the COG p9906 clinical trial were analyzed in an effort to identify subgroups of these high-risk patients characterized by presenting characteristic gene expression profiles . The results of said study are described in patent application WO2009 / 064481. In particular, genetic markers associated with high risk were identified in B-ALL patients and their use for diagnosis, prognosis and / or in determining the efficacy of treatment. More specifically the methods described comprise the determination of the expression levels of genes selected from the following group: CENTG2 (ArfGAP with GTPase domain, ankyrin repeat and PH domain 1); PTPRM (protein tyrosine phosphatase, receptor type, M); STAPI (signal transducing adapter family member 1); CCNJ (cyclin J); PCDH17 (procadherin 17); MCAM (melanoma cell adhesion molecule); CAPN3 (calpain 3); CABLESI (Cdk5 and Abl enzyme substrate 1); GPR155 (G protein-coupled receptor 155); MUC4 (mucin 4); GPRI 10 (G protein-coupled receptor 1 10); IGJ (immunoglobulin J polypeptide); NRXN3 (neurexin 3); CD99 (CD99 molecule); CRLF2 (cytokine receptor-like factor 2); ENAM (enamelin); TP53INP1 (tumor protein p53 inducible nuclear protein 1); IFITMI (inferred induced transmembrane protein 1); IFITM2 (inferred induced transmembrane protein 2); JJTTM3 (inferred induced transmembrane protein 3); TTYH2 (tweety homolog 2); SEMA6A (semaphorin 6A); TNFSF4 (tumor necrosis superfamily factor, member 4); and SLC37A3 (solute carrier family 37, member 3). WO2015 / 092755 reports a method for the diagnosis or prognosis of acute high hyperdiploidy lymphoblastic leukemia (HeH-ALL) by simultaneous determination of the presence / absence of chromosomes 6, 18 and 21 using iFISH technology. WO2008 / 019872 refers to a method for the diagnosis of acute lymphoblastic leukemia in children by determining the expression levels of at least 14 genes of those described in Tables 1-4 or 5-16, especially those shown in Figure 3 of said publication: DNTT, SBGR101, DEFA3, CAMP, FCER2, DEFA4, BPI, PGLYRP1, LTF, SBGR2, NM_003526, CEACAM8, RNASE3, and ELA2.
Así pues, a pesar de los avances en el tratamiento de la LLA, existe una necesidad urgente de identificar biomarcadores específicos que permitan monitorizar la eficacia del tratamiento y el pronóstico de la enfermedad. La mejora de los métodos pronósticos es esencial para poder predecir de manera fiable el riesgo del paciente y así optimizar la estrategia de tratamiento permitiendo personalizar la terapia, reduciendo la toxicidad en pacientes de bajo riesgo y permitiendo terapias agresivas en pacientes de riesgo elevado. La adopción de la terapia más adecuada para cada paciente de LLA gracias a su correcta clasificación en función del pronóstico de la enfermedad permitirá aumentar el porcentaje de éxito del tratamiento, consiguiendo un mayor porcentaje de supervivencia y evitando recaídas, presentando también como ventaja la reducción de los costes de tratamiento y hospitalización asociados. Thus, in spite of the advances in the treatment of ALL, there is an urgent need to identify specific biomarkers that allow monitoring the efficacy of the treatment and the prognosis of the disease. The improvement of prognostic methods is essential to be able to reliably predict the patient's risk and thus optimize the treatment strategy by allowing the therapy to be personalized, reducing toxicity in low-risk patients and allowing aggressive therapies in high-risk patients. The adoption of the most appropriate therapy for each ALL patient thanks to its correct classification according to the prognosis of the disease will allow increasing the success rate of the treatment, achieving a higher survival percentage and avoiding relapses, also presenting the reduction of the associated treatment and hospitalization costs.
BREVE DESCRIPCION DE LA INVENCION BRIEF DESCRIPTION OF THE INVENTION
Los inventores efectuaron un análisis bioinformático partiendo de datos de secuencias de RNAm de TCFL5 publicadas en las bases de datos de secuenciación de RNA "RNAseq" (NCBI, Ensemble, Vega y EC gene) en el que se analizaron las uniones de exones, y se establecieron los mensajeros consenso expresados en humano (ver Figura 1 y Tabla I del Ejemplo 1). En base a dichos resultados, los inventores establecieron que el gen TCFL5 presenta a nivel de RNAm 6 isoformas mayoritarias distintas: (1) TCFL5R, (2) TCFL5R4b, (3) TCFL5R7, (4) TCFL5R4b6 (5) TCFL5R6 y (6) CHA (Tcfl5R2b o R2b), aumentando el número de isoformas respecto a las 2 isoformas previamente descritas: TCFL5 y CHA.  The inventors performed a bioinformatic analysis based on data from TCFL5 mRNA sequences published in the RNAseq RNA sequencing databases (NCBI, Ensemble, Vega and EC gene) in which the exon junctions were analyzed, and established consensus messengers expressed in human (see Figure 1 and Table I of Example 1). Based on these results, the inventors established that the TCFL5 gene has 6 different major isoforms at the mRNA level: (1) TCFL5R, (2) TCFL5R4b, (3) TCFL5R7, (4) TCFL5R4b6 (5) TCFL5R6 and (6) CHA (Tcfl5R2b or R2b), increasing the number of isoforms with respect to the 2 isoforms previously described: TCFL5 and CHA.
En el presente documento cuando se hace referencia a la isoforma TCFL5 se refiere a aquella que presenta E1 , E2a, E3, E4 (E4a o E4b), E5 y E8; es decir, engloba a TCFL5R y TCFL5R4b. In this document, when referring to the TCFL5 isoform, it refers to that which has E1, E2a, E3, E4 (E4a or E4b), E5 and E8; that is, it encompasses TCFL5R and TCFL5R4b.
La isoforma CHA fue descrita previamente por los inventores (Rodríguez, C.I., N. Girones, and M. Fresno, Cha, a basic helix-loop-helix transcription factor involved in the regulation of upstream stimulatory factor activity. J Biol Chem, 2003. 278(44): p. 43135-45) y se origina debido a que CHA utiliza un promotor alternativo situado entre el exón 1 y 2, presentando como exón inicial E2b. A nivel RNAm CHA presenta E2b, E3, E4, E5 y E8. Así pues se diferencia de TCFL5 por la ausencia de E1 y por presentar E2b en lugar de E2a (la porción de la secuencia de E2a distinta de E2b se ha indicado en cursiva en la Figura 3). The CHA isoform was previously described by the inventors (Rodríguez, CI, N. Girones, and M. Fresno, Cha, a basic helix-loop-helix transcription factor involved in the regulation of upstream stimulatory factor activity. J Biol Chem, 2003. 278 (44): p. 43135-45) and originates because CHA uses an alternative promoter located between exon 1 and 2, presenting as initial exon E2b. At the RNAm level, CHA presents E2b, E3, E4, E5 and E8. Thus, it differs from TCFL5 by the absence of E1 and by presenting E2b instead of E2a (the portion of the E2a sequence other than E2b has been indicated in italics in Figure 3).
Es importante considerar que el exón 2b contiene un 5'UTR y una región codificante coincidente con E2a por lo que a nivel proteico la secuencia correspondiente a E2 es idéntica en TCFL5 y CHA, y por tanto CHA se diferencia únicamente por la ausencia de la secuencia aminoacídica correspondiente a E1. It is important to consider that exon 2b contains a 5'UTR and a coding region coincident with E2a so that at the protein level the sequence corresponding to E2 is identical in TCFL5 and CHA, and therefore CHA differs only by the absence of the sequence amino acid corresponding to E1.
Asimismo, los inventores detectaron por primera vez que para un mismo tejido, línea celular o muestra de paciente, bajo las mismas condiciones experimentales, las isoformas TCFL5 y CHA (TCFL5R2b) presentan una expresión diferencial, en concreto se observaron distintos grados de expresión tanto a nivel de RNAm (Fig.2 y 7B) como proteico (Fig.7A). Likewise, the inventors detected for the first time that for the same tissue, cell line or patient sample, under the same experimental conditions, the TCFL5 and CHA isoforms (TCFL5R2b) have a differential expression, in particular different degrees of expression were observed both at the mRNA level (Fig. 2 and 7B) and protein (Fig. 7A).
La determinación precisa del riesgo de un paciente a sufrir una recaída constituye el paradigma fundamental en el tratamiento de la leucemia linfoblástica aguda (LLA). Dicha estratificación de los pacientes en función del riesgo permite adaptar la intensidad de la terapia al riesgo de recaída del paciente. Considerando la expresión diferencial de dichas isoformas, los inventores emitieron la hipótesis de que el uso de TCFL5 como marcador pronóstico y/o de diagnóstico diferencial en LLA dependerá de si se determinan los niveles de expresión de la isoforma TCFL5, de la isoforma CHA (TCFL5R2b) o de ambas. The precise determination of a patient's risk of relapse constitutes the fundamental paradigm in the treatment of acute lymphoblastic leukemia (ALL). Said stratification of the patients according to the risk allows the intensity of the therapy to be adapted to the risk of relapse of the patient. Considering the differential expression of these isoforms, the inventors hypothesized that the use of TCFL5 as a prognostic marker and / or differential diagnosis in ALL will depend on whether the expression levels of the TCFL5 isoform are determined, on the CHA isoform (TCFL5R2b ) or both.
En base a dicha hipótesis, procedieron al diseño de cebadores y sondas que detectan el RNAm de las isoformas TCFL5 y CHA respectivamente de manera específica e independiente, y ambas isoformas simultáneamente (TCFL5/CHA). Based on this hypothesis, they proceeded to design primers and probes that detect the mRNA of the TCFL5 and CHA isoforms respectively in a specific and independent manner, and both isoforms simultaneously (TCFL5 / CHA).
Los inventores establecieron una asociación entre niveles bajos de expresión de TCFL5/CHA y un pronóstico de LLA de alto riesgo (Fig.6C y Tabla VI del Ejemplo 5). En particular, observaron que la expresión de RNAm de TCFL5/CHA en el momento del diagnóstico es mucho menor en las LLA de alto riesgo respecto de las LLA de riesgo no alto (medio o bajo) (Tabla VII del Ejemplo 5). En la Fig.6A (Tabla IV del Ejemplo 5) se muestra que en el momento del diagnóstico la expresión de TCFL5/CHA en pacientes de LLA-T es menor que en pacientes de LLA-B, aunque la diferencia no es estadísticamente significativa. The inventors established an association between low levels of TCFL5 / CHA expression and a high-risk ALL prognosis (Fig. 6C and Table VI of Example 5). In particular, they observed that the expression of mRNA of TCFL5 / CHA at the time of diagnosis is much lower in high-risk ALL than in non-high-risk (medium or low) ALL (Table VII of Example 5). In Fig. 6A (Table IV of Example 5) it is shown that at the time of diagnosis the expression of TCFL5 / CHA in patients with ALL-T is less than in patients with ALL-B, although the difference is not statistically significant.
Una asociación entre niveles bajos de expresión de TCFL5/CHA y un pronóstico de LLA de alto riesgo se observó también al analizar exclusivamente muestras de LLA-B (Tablas IX y X del Ejemplo 5) que es el grupo representado de manera mayoritaria en la cohorte analizada.  An association between low levels of TCFL5 / CHA expression and a high-risk ALL prognosis was also observed by exclusively analyzing samples of ALL-B (Tables IX and X of Example 5) which is the group represented mostly in the cohort. analyzed.
Asimismo, los inventores determinaron que existe una correlación entre los niveles de expresión de TCFL5/CHA en pacientes con LLA y la progresión de la enfermedad y/o eficacia del tratamiento. Más específicamente, observaron que la expresión de RNAm de TCFL5/CHA en LLA es significativamente menor en la recaída que en el diagnóstico (Fig.6B y Tabla V del Ejemplo 5), dicha asociación se observa especialmente en muestras de B-LLA (Tabla VIII del Ejemplo 5). Likewise, the inventors determined that there is a correlation between the levels of expression of TCFL5 / CHA in patients with ALL and the progression of the disease and / or efficacy of the treatment. More specifically, they observed that the expression of TCFL5 / CHA mRNA in ALL is significantly lower in relapse than in diagnosis (Fig. 6B and Table V of Example 5), said association is especially observed in B-ALL samples (Table VIII of Example 5).
Por tanto, de acuerdo con dichos hallazgos la presente invención se refiere en un primer aspecto a un método para el pronóstico y/o diagnóstico diferencial de pacientes con leucemia linfoblástica aguda (LLA) que comprende la determinación de los niveles de expresión del gen TCFL5 donde dicha determinación incluye la cuantificación de la isoforma CHA. En una realización preferida, se refiere a un método para el pronóstico y/o diagnóstico diferencial de pacientes con leucemia linfoblástica aguda (LLA) que comprende las siguientes etapas: Therefore, according to these findings, the present invention relates in a first aspect to a method for the prognosis and / or differential diagnosis of patients with acute lymphoblastic leukemia (ALL), which comprises the determination of the expression levels of the TCFL5 gene where said determination includes the quantification of the CHA isoform. In a preferred embodiment, it refers to a method for the prognosis and / or differential diagnosis of patients with acute lymphoblastic leukemia (ALL) comprising the following stages:
a. determinar , preferiblemente de manera simultánea, los niveles de expresión de las isoformas TCFL5 y CHA del gen TCFL5 en una muestra biológica aislada de dicho paciente; y  to. determining, preferably simultaneously, the expression levels of the TCFL5 and CHA isoforms of the TCFL5 gene in a biological sample isolated from said patient; Y
b. comparar los niveles de expresión de TCFL5/CHA en la muestra del paciente con valores de referencia,  b. compare TCFL5 / CHA expression levels in the patient sample with reference values,
donde una reducción en los valores de la muestra del paciente respecto a los valores de referencia es indicativa de LLA de alto riesgo. where a reduction in the values of the patient sample with respect to the reference values is indicative of high-risk ALL.
El término "los niveles de expresión de TCFL5/CHA" tal y como se utiliza en la presente invención hace referencia a los niveles de expresión de TCFL5 y CHA de manera conjunta. The term "TCFL5 / CHA expression levels" as used in the present invention refers to the expression levels of TCFL5 and CHA together.
En un aspecto asociado, la presente invención se refiere al uso in vitro de los niveles de expresión de las isoformas TCFL5 y CHA del gen TCFL5 determinados, preferiblemente de manera simultánea, en una muestra biológica aislada de un paciente con leucemia linfoblástica aguda (LLA) para el pronóstico y/o diagnóstico diferencial de pacientes con LLA, donde una reducción en los valores de TCFL5/CHA en la muestra del paciente respecto a valores de referencia es indicativa de LLA de alto riesgo. In an associated aspect, the present invention relates to the in vitro use of the expression levels of the TCFL5 and CHA isoforms of the TCFL5 gene determined, preferably simultaneously, in an isolated biological sample of a patient with acute lymphoblastic leukemia (ALL) for the prognosis and / or differential diagnosis of patients with ALL, where a reduction in the values of TCFL5 / CHA in the patient sample with respect to reference values is indicative of high-risk ALL.
En otro aspecto, la presente invención se refiere también a un método para la monitorización de la progresión de la enfermedad y/o eficacia del tratamiento en pacientes con LLA que comprende las siguientes etapas: In another aspect, the present invention also relates to a method for monitoring disease progression and / or efficacy of treatment in patients with ALL comprising the following stages:
a. determinar, preferiblemente de manera simultánea, los niveles de expresión de las isoformas TCFL5 y CHA del gen TCFL5 en una muestra biológica aislada de dicho paciente; y  to. determining, preferably simultaneously, the expression levels of the TCFL5 and CHA isoforms of the TCFL5 gene in a biological sample isolated from said patient; Y
b. comparar los niveles de expresión de TCFL5/CHA en la muestra del paciente con valores de referencia,  b. compare TCFL5 / CHA expression levels in the patient sample with reference values,
donde una reducción en los valores de la muestra del paciente respecto a los valores de referencia es indicativo de recaída. where a reduction in the values of the patient sample with respect to the reference values is indicative of relapse.
En un aspecto relacionado, la presente invención se refiere al uso in vitro de los niveles de expresión de las isoformas TCFL5 y CHA del gen TCFL5 determinados, preferiblemente de manera simultánea, en una muestra biológica aislada de un paciente con leucemia linfoblástica aguda (LLA) para la monitorización de la progresión de la enfermedad y/o eficacia del tratamiento en pacientes con LLA, donde una reducción en los valores de la muestra del paciente respecto a valores de referencia es indicativa de recaída. La invención hace referencia también a un método para la determinación del tratamiento más adecuado para un paciente de LLA que comprende la clasificación de dicho paciente de acuerdo con el método para el pronóstico y/o diagnóstico diferencial del primer aspecto de la invención. In a related aspect, the present invention relates to the in vitro use of the expression levels of the TCFL5 and CHA isoforms of the TCFL5 gene determined, preferably simultaneously, in an isolated biological sample of a patient with acute lymphoblastic leukemia (ALL) for the monitoring of disease progression and / or efficacy of treatment in patients with ALL, where a reduction in the values of the patient sample with respect to reference values is indicative of relapse. The invention also refers to a method for determining the most suitable treatment for an ALL patient comprising the classification of said patient according to the method for the prognosis and / or differential diagnosis of the first aspect of the invention.
En un aspecto adicional, la presente invención se refiere a un método para el tratamiento de pacientes de LLA donde dicho tratamiento se determina en función de la clasificación de dicho paciente de acuerdo con el método para el pronóstico y/o diagnóstico diferencial del primer aspecto de la invención. In a further aspect, the present invention relates to a method for the treatment of ALL patients where said treatment is determined based on the classification of said patient according to the method for the prognosis and / or differential diagnosis of the first aspect of the invention.
En otro aspecto, la invención hace referencia a un kit para el pronóstico, diagnóstico diferencial y/o monitorización de pacientes con leucemia linfoblástica aguda (LLA) que comprende: In another aspect, the invention refers to a kit for the prognosis, differential diagnosis and / or monitoring of patients with acute lymphoblastic leukemia (ALL) comprising:
a. un cebador y/o sonda que comprende o consiste en una secuencia seleccionada del grupo que consiste en SEQ ID NO: 5 a SEQ ID NO: 76, y secuencias idénticas a cualquiera de las mismas en al menos 75%; y  to. a primer and / or probe comprising or consisting of a sequence selected from the group consisting of SEQ ID NO: 5 to SEQ ID NO: 76, and sequences identical to any of them at least 75%; Y
b. opcionalmente, instrucciones para el uso de dicho reactivo para la determinación de los niveles de expresión de dichas isoformas en una muestra biológica aislada de dicho paciente.  b. optionally, instructions for the use of said reagent for the determination of the expression levels of said isoforms in a biological sample isolated from said patient.
La invención se refiere también al uso de un kit para el pronóstico, diagnóstico diferencial y/o monitorización de pacientes con leucemia linfoblástica aguda (LLA) en un método de acuerdo con el primer aspecto de la invención, donde dicho kit comprende: a. un reactivo para determinar, preferiblemente de manera simultánea, los niveles de expresión de las isoformas TCFL5 y CHA del gen TCFL5; y The invention also relates to the use of a kit for the prognosis, differential diagnosis and / or monitoring of patients with acute lymphoblastic leukemia (ALL) in a method according to the first aspect of the invention, wherein said kit comprises: a. a reagent to determine, preferably simultaneously, the expression levels of the TCFL5 and CHA isoforms of the TCFL5 gene; Y
b. opcionalmente, instrucciones para el uso de dicho reactivo para la determinación de los niveles de expresión de dichas isoformas en una muestra biológica aislada de dicho paciente.  b. optionally, instructions for the use of said reagent for the determination of the expression levels of said isoforms in a biological sample isolated from said patient.
En un aspecto adicional, la invención está relacionada con un polinucleótido que consiste en una secuencia nucleotídica seleccionada del grupo que consiste en SEQ ID NO: 5 a SEQ ID NO: 76, y secuencias idénticas a cualquiera de las mismas en al menos 75%. In a further aspect, the invention is related to a polynucleotide consisting of a nucleotide sequence selected from the group consisting of SEQ ID NO: 5 to SEQ ID NO: 76, and sequences identical to any of them at least 75%.
BREVE DESCRIPCION DE LAS FIGURAS Fig.1 : Transcritos RNAm consenso mayoritarios del gen TCFL5. Se determinaron mediante análisis de las uniones de exones sobre las bases de datos ya publicadas de secuencias de RNAseq del gen TCFL5. Fig.2: Transcritos de RNAm de TCFL5 correspondientes al exón E1 vs E2 codificantes presentes en diferentes células/tejidos. Se determinaron mediante análisis de las bases de datos ya publicadas de RNAseq referentes al gen TCFL5 y se representan por códigos de colores (más oscuro mayor frecuencia), respecto a los 2 exones. Se observa una expresión alta de E2 codificante en células y tejidos donde la expresión de E1 es baja, indicando una expresión diferencial de CHA respecto al resto de isoformas del gen TCFL5 (presentan E1). BRIEF DESCRIPTION OF THE FIGURES Fig. 1: Transcribed mRNA consensus majority of the TCFL5 gene. They were determined by analysis of exon junctions on already published databases of RNAseq sequences of the TCFL5 gene. Fig. 2: TCFL5 mRNA transcripts corresponding to exon E1 vs E2 encoders present in different cells / tissues. They were determined by analysis of the already published RNAseq databases referring to the TCFL5 gene and are represented by color codes (darker higher frequency), with respect to the 2 exons. A high expression of coding E2 is observed in cells and tissues where the expression of E1 is low, indicating a differential expression of CHA with respect to the other isoforms of the TCFL5 gene (they present E1).
Fig.3: Secuencia de TCFL5 RNAm (SEQ ID NO: 1). Se indican las regiones 5'UTR y 3'UTR. Asimismo, se especifica la secuencia correspondiente a la región codificante en la que los distintos exones E1 , E2, E3, E4, E5 y E8 se indican con alternancia de colores (gris y negro). En esta secuencia el exón 2 es E2a, la parte del exón 2a utilizado por TCFL5 pero no por CHA es representada en cursiva y el ATG iniciador de CHA dentro del exón 2 se ha resaltado en negrita (la parte no traducida de este exón para CHA es distinta y representa el exón 2b, no mostrado). La región común para ambas isoformas se muestra sombreada en gris. Asimismo, se han enmarcado unas de las secuencias utilizadas para el diseño de cebadores donde el cebador forward se une a E5 y el reverse a E8. Fig. 3: Sequence of TCFL5 RNAm (SEQ ID NO: 1). The 5'UTR and 3'UTR regions are indicated. Likewise, the sequence corresponding to the coding region in which the different exons E1, E2, E3, E4, E5 and E8 are indicated with alternating colors (gray and black) is specified. In this sequence, exon 2 is E2a, the part of exon 2a used by TCFL5 but not by CHA is represented in italics and the CHA initiator ATG within exon 2 has been highlighted in bold (the untranslated part of this exon for CHA is different and represents exon 2b, not shown). The common region for both isoforms is shown shaded in gray. Likewise, some of the sequences used for the design of primers where the forward primer joins E5 and the reverse to E8 have been framed.
Fig.4: Alineamiento de las secuencias codificantes de TCFL5 y CHA (RNAm). Fig. 4: Alignment of the coding sequences of TCFL5 and CHA (mRNA).
Fig.5: Expresión de TCFL5 y CHA en células Jurkat: efectos de DAPT (inhibidor de Notchl) sobre los niveles de expresión de TCFL5/CHA a nivel proteína (Western Blot). Fig. 5: Expression of TCFL5 and CHA in Jurkat cells: effects of DAPT (Notchl inhibitor) on the levels of TCFL5 / CHA expression at the protein level (Western Blot).
Fig.6: Expresión de TCFL5/CHA en muestras de LLA obtenidas de pacientes: Los niveles de expresión de TCFL5/CHA a nivel de RNAm se muestran de manera individualizada para cada uno de los grupos de estudio. En las gráficas se comparan los valores obtenidos en muestras (A) de B-ALL vs T-ALL, (B) recogidas en el momento de diagnóstico vs recaídas y (C) clasificadas en función del grado de riesgo bajo, medio o alto de acuerdo con los criterios especificados en materiales y métodos. Fig. 6: Expression of TCFL5 / CHA in ALL samples obtained from patients: The expression levels of TCFL5 / CHA at the mRNA level are shown individually for each of the study groups. The graphs compare the values obtained in samples (A) of B-ALL vs T-ALL, (B) collected at the time of diagnosis vs. relapses and (C) classified according to the degree of low, medium or high risk of according to the criteria specified in materials and methods.
Fig.7: Expresión de TCFL5/CHA en muestras de leucemias ALL obtenidas de pacientes en el momento del diagnóstico (LLA012, LL014) y recaída (LLA751 , LLA783). (A) Expresión de las proteínas CHA y TCFL5 por Western Blot; (B) Cuantificacion del RNAm de TCFL5/CHA por qRT-PCR. DESCRIPCION DETALLADA DE LA INVENCION Fig. 7: Expression of TCFL5 / CHA in ALL leukemia samples obtained from patients at the time of diagnosis (LLA012, LL014) and relapse (LLA751, LLA783). (A) Expression of CHA and TCFL5 proteins by Western Blot; (B) Quantification of the mRNA of TCFL5 / CHA by qRT-PCR. DETAILED DESCRIPTION OF THE INVENTION
Definiciones Definitions
El término "seguimiento o monitorización de la progresión de la enfermedad" como se usa en el presente documento se refiere a determinar la evolución de la enfermedad, por ejemplo determinar si existe una recaída. The term "monitoring or monitoring of disease progression" as used herein refers to determining the evolution of the disease, for example determining whether there is a relapse.
El término "eficacia de un tratamiento" como se usa en el presente documento se refiere al grado en el que un tratamiento logra el resultado deseado o previsto, por ejemplo, la capacidad de un fármaco para lograr el efecto deseado. The term "efficacy of a treatment" as used herein refers to the degree to which a treatment achieves the desired or intended result, for example, the ability of a drug to achieve the desired effect.
El término "tratamiento" engloba tanto un tratamiento profiláctico como terapéutico. El término "tratamiento terapéutico" como se usa en el presente documento se refiere a aquel cuyo objetivo es pasar de un estado de enfermedad o patológico a un estado de salud. El término "tratamiento profiláctico" tal y como se usa en el presente documento se refiere a la prevención de un estado patológico. The term "treatment" encompasses both a prophylactic and therapeutic treatment. The term "therapeutic treatment" as used herein refers to one whose objective is to move from a disease or pathological state to a state of health. The term "prophylactic treatment" as used herein refers to the prevention of a pathological state.
El término "cantidad terapéuticamente efectiva" como se usa en el presente documento, se refiere a una cantidad que es efectiva, tras la administración de una dosis única o múltiple a un sujeto (por ejemplo, a un paciente humano) en el tratamiento profiláctico o terapéutico de una enfermedad, trastorno o afección patológica. The term "therapeutically effective amount" as used herein, refers to an amount that is effective, after the administration of a single or multiple dose to a subject (eg, a human patient) in prophylactic treatment or therapeutic of a disease, disorder or pathological condition.
El término "sonda" como se usa en el presente documento se refiere a ácidos nucleicos producidos de forma sintética o biológica, de entre 10 y 285 nucleótidos de longitud que contienen secuencias nucleotídicas específicas que permiten una hibridación específica y preferente bajo condiciones predeterminadas a las secuencias de ácido nucleico diana, y opcionalmente se han modificado para la detección o para potenciar el rendimiento del ensayo. En general, es necesario un mínimo de diez nucleótidos para obtener estadísticamente la especificidad y para formar productos de hibridación estables, y un máximo de 285 nucleótidos representa en general un límite superior para la longitud en la que los parámetros de reacción se pueden ajustar fácilmente para determinar secuencias erróneamente emparejadas e hibridación preferente. Opcionalmente, las sondas pueden contener determinados elementos constitutivos que contribuyen a su funcionamiento correcto u óptimo en determinadas condiciones de ensayo. Por ejemplo, las sondas se pueden modificar para mejorar su resistencia a la degradación por nucleasas, para llevar a cabo la detección de ligandos (por ejemplo, mareaje con fluoresceína) o para facilitar su captura sobre un soporte sólido (por ejemplo, cola de polyA). El término "cebadores" como se usa en el presente documento se refiere a oligonucleótidos o sondas que se pueden usar en un procedimiento de amplificación, tal como una reacción en cadena de la polimerasa ("PCR"), para amplificar una secuencia de nucleótidos. Los cebadores se diseñan en base a la secuencia polinucleotídica de una secuencia diana particular, por ejemplo, una secuencia de RNAm específica. El diseño y la validación de cebadores y sondas es bien conocido en la técnica. Para procedimientos de PCR en tiempo real cuantitativa, véase, por ejemplo, Rodríguez A et al. (Methods Mol Biol., 2015, 1275:31-56). El término "específico" como se usa en el presente documento quiere decir que una secuencia nucleotídica se hibridará a/amplificará una secuencia diana predeterminada y no se hibridará sustancialmente a/amplificará una secuencia no diana en las condiciones de ensayo, en general se usan condiciones restrictivas. El término "hibridación" como se usa en el presente documento se refiere a un procedimiento por el que, en condiciones de reacción predeterminadas, dos hebras parcial, sustancial o completamente complementarias de ácido nucleico se deja que entren en contacto de forma antiparalela para formar un ácido nucleico bicatenario con enlaces de hidrógeno específicos y estables, siguiendo reglas explícitas que hacen que las bases de ácidos nucleicos se puedan emparejar entre sí. The term "probe" as used herein refers to synthetically or biologically produced nucleic acids, between 10 and 285 nucleotides in length that contain specific nucleotide sequences that allow specific and preferred hybridization under predetermined conditions to the sequences. of target nucleic acid, and optionally have been modified for detection or to enhance assay performance. In general, a minimum of ten nucleotides is necessary to obtain statistically specificity and to form stable hybridization products, and a maximum of 285 nucleotides generally represents an upper limit for the length at which the reaction parameters can be easily adjusted to determine erroneously paired sequences and preferential hybridization. Optionally, the probes may contain certain constituent elements that contribute to their correct or optimal operation under certain test conditions. For example, the probes can be modified to improve their resistance to degradation by nucleases, to carry out the detection of ligands (for example, fluorescein marking) or to facilitate their capture on a solid support (for example, polyA tail ). The term "primers" as used herein refers to oligonucleotides or probes that can be used in an amplification procedure, such as a polymerase chain reaction ("PCR"), to amplify a nucleotide sequence. Primers are designed based on the polynucleotide sequence of a particular target sequence, for example, a specific mRNA sequence. The design and validation of primers and probes is well known in the art. For quantitative real-time PCR procedures, see, for example, Rodríguez A et al. (Methods Mol Biol., 2015, 1275: 31-56). The term "specific" as used herein means that a nucleotide sequence will hybridize to / amplify a predetermined target sequence and not substantially hybridize to / amplify a non-target sequence under test conditions, in general conditions are used. restrictive The term "hybridization" as used herein refers to a process whereby, under predetermined reaction conditions, two partially, substantially or completely complementary strands of nucleic acid are allowed to come into contact antiparallel to form a double-stranded nucleic acid with specific and stable hydrogen bonds, following explicit rules that make the nucleic acid bases can match each other.
El término "parcialmente complementaria" tal y como se usa en el presente documento se refiere a una secuencia nucleotídica que es al menos aproximadamente 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, o 99% complementaria a una secuencia nucleotídica de referencia. The term "partially complementary" as used herein refers to a nucleotide sequence that is at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% complementary to a reference nucleotide sequence.
El término "sustancialmente complementaria" tal y como se usa en el presente documento se refiere a una secuencia nucleotídica que es al menos aproximadamente 95%, 96%, 97%, 98%, o 99% complementaria a una secuencia nucleotídica de referencia. El término "hibridación sustancial" quiere decir que la cantidad de hibridación observada será tal que alguien que observe los resultados considere el resultado positivo con respecto a los datos de hibridación en controles positivos y negativos. Los datos que se consideran "ruido de fondo" no son de hibridación sustancial. El término "condiciones de hibridación restrictivas" quiere decir de aproximadamente 35 °C a 65 °C en una solución salina de NaCI aproximadamente 0,9 molar. La restricción también se puede regir por dichos parámetros de reacción como la concentración y el tipo de especies iónicas presentes en la solución de hibridación, los tipos y concentraciones de agentes desnaturalizantes presentes, y la temperatura de hibridación. En general, como las condiciones de hibridación se vuelven más restrictivas, son preferentes sondas más largas si se van a formar híbridos estables. Como norma, la restricción de las condiciones bajo las que va a tener lugar la hibridación determinará ciertas características de las sondas preferentes que se van a emplear. The term "substantially complementary" as used herein refers to a nucleotide sequence that is at least about 95%, 96%, 97%, 98%, or 99% complementary to a reference nucleotide sequence. The term "substantial hybridization" means that the amount of hybridization observed will be such that someone who observes the results considers the positive result with respect to hybridization data in positive and negative controls. Data that are considered "background noise" are not substantial hybridization. The term "restrictive hybridization conditions" means from about 35 ° C to 65 ° C in an approximately 0.9 molar NaCl saline solution. The restriction can also be governed by such reaction parameters as the concentration and type of ionic species present in the hybridization solution, the types and concentrations of agents Denaturants present, and hybridization temperature. In general, as hybridization conditions become more restrictive, longer probes are preferred if stable hybrids are to be formed. As a rule, the restriction of the conditions under which hybridization will take place will determine certain characteristics of the preferred probes to be used.
El término "anticuerpo" incluye anticuerpos monoclonales y policlonales, así como anticuerpos recombinantes. El término "anticuerpo recombinante" tal y como se utiliza en la presente invención se refiere a un anticuerpo producido o expresado utilizando un vector de expresión recombinante, donde el vector de expresión comprende un ácido nucleico que codifica el anticuerpo recombinante, tal que la introducción del vector de expresión en una célula huésped apropiada resulta en la producción o expresión del anticuerpo recombinante. Los anticuerpos recombinantes pueden ser anticuerpos quiméricos o humanizados, anticuerpos mono- o multi- específicos. El término "anticuerpo" también se refiere a fragmentos y derivados de todos los anteriores, y puede comprender además cualquier variante de los mismos que retienen la capacidad de unirse específicamente a un epítopo. Los anticuerpos pueden incluir, pero no se limitan a anticuerpos monoclonales (mAbs), anticuerpos de dominio único (sdAb), anticuerpos de cadena sencilla (scFv), fragmentos Fab, F (ab')2, fragmentos Fv (sdFv) disulfuros, anti- idiotipo (anticuerpos anti-ld), intra-cuerpos, anticuerpos sintéticos, y fragmentos de unión a epítopo de cualquiera de los anteriores. El término "anticuerpo" también se refiere a una proteína de fusión que incluye una región equivalente a la región Fe de una inmunoglobulina. The term "antibody" includes monoclonal and polyclonal antibodies, as well as recombinant antibodies. The term "recombinant antibody" as used in the present invention refers to an antibody produced or expressed using a recombinant expression vector, wherein the expression vector comprises a nucleic acid encoding the recombinant antibody, such that the introduction of the expression vector in an appropriate host cell results in the production or expression of the recombinant antibody. The recombinant antibodies can be chimeric or humanized antibodies, mono- or multi-specific antibodies. The term "antibody" also refers to fragments and derivatives of all of the foregoing, and may further comprise any variant thereof that retain the ability to specifically bind an epitope. Antibodies may include, but are not limited to monoclonal antibodies (mAbs), single domain antibodies (sdAb), single chain antibodies (scFv), Fab fragments, F (ab ') 2, Fv fragments (sdFv) disulfides, anti - idiotype (anti-ld antibodies), intra-bodies, synthetic antibodies, and epitope binding fragments of any of the foregoing. The term "antibody" also refers to a fusion protein that includes a region equivalent to the Fe region of an immunoglobulin.
El término "kit" indica un conjunto de reactivos y coadyuvantes requeridos para un análisis. Aunque un kit consiste en la mayoría de los casos de varias unidades, también pueden estar disponibles los varios elementos de análisis presentados en una única unidad, que deben considerarse como kits. The term "kit" indicates a set of reagents and adjuvants required for an analysis. Although a kit consists of most cases of several units, the various elements of analysis presented in a single unit, which should be considered as kits, may also be available.
Un método para el pronóstico y/o diagnóstico diferencial de pacientes con leucemia linfoblástica aguda (LLA) A method for the prognosis and / or differential diagnosis of patients with acute lymphoblastic leukemia (ALL)
En un primer aspecto, la invención se refiere a un método para el pronóstico y/o diagnóstico diferencial de pacientes con leucemia linfoblástica aguda (LLA) que comprende la determinación de los niveles de expresión del gen TCFL5 donde dicha determinación incluye la cuantificación de la isoforma CHA. In a first aspect, the invention relates to a method for the prognosis and / or differential diagnosis of patients with acute lymphoblastic leukemia (ALL) comprising the determination of the levels of expression of the TCFL5 gene where said determination includes the quantification of the isoform CHA.
En una realización preferida, se refiere a un método para el pronóstico de pacientes con leucemia linfoblástica aguda (LLA) que comprende las siguientes etapas: a. determinar, preferiblemente de manera simultánea, los niveles de expresión de las isoformas TCFL5 y CHA del gen TCFL5 en una muestra biológica aislada de dicho paciente; y In a preferred embodiment, it refers to a method for the prognosis of patients with acute lymphoblastic leukemia (ALL) comprising the following stages: to. determining, preferably simultaneously, the expression levels of the TCFL5 and CHA isoforms of the TCFL5 gene in a biological sample isolated from said patient; Y
b. comparar los niveles de expresión de TCFL5/CHA en la muestra del paciente con valores de referencia,  b. compare TCFL5 / CHA expression levels in the patient sample with reference values,
donde una reducción en los valores de la muestra del paciente respecto a los valores de referencia es indicativa de LLA de alto riesgo. where a reduction in the values of the patient sample with respect to the reference values is indicative of high-risk ALL.
El método según el primer aspecto de la invención permite el diagnóstico diferencial, la clasificación o estratificación de los pacientes de LLA en base al pronóstico e.g., LLA de alto riesgo. The method according to the first aspect of the invention allows differential diagnosis, classification or stratification of ALL patients based on prognosis e.g., high-risk ALL.
En un aspecto relacionado la invención se refiere a un método para el diagnóstico diferencial de pacientes con leucemia linfoblástica aguda (LLA) que comprende la determinación de los niveles de expresión del gen TCFL5 donde dicha determinación incluye la cuantificacion de la isoforma CHA. In a related aspect, the invention relates to a method for the differential diagnosis of patients with acute lymphoblastic leukemia (ALL) which comprises the determination of the levels of expression of the TCFL5 gene where said determination includes the quantification of the CHA isoform.
En una realización preferida, se refiere a un método para el diagnóstico diferencial de pacientes con leucemia linfoblástica aguda (LLA) que comprende las siguientes etapas: In a preferred embodiment, it refers to a method for the differential diagnosis of patients with acute lymphoblastic leukemia (ALL) comprising the following stages:
a. determinar, preferiblemente de manera simultánea, los niveles de expresión de las isoformas TCFL5 y CHA del gen TCFL5 en una muestra biológica aislada de dicho paciente; y  to. determining, preferably simultaneously, the expression levels of the TCFL5 and CHA isoforms of the TCFL5 gene in a biological sample isolated from said patient; Y
b. comparar los niveles de expresión de TCFL5/CHA en la muestra del paciente con valores de referencia,  b. compare TCFL5 / CHA expression levels in the patient sample with reference values,
donde una reducción en los valores de la muestra del paciente respecto a los valores de referencia es indicativa de LLA de alto riesgo. where a reduction in the values of the patient sample with respect to the reference values is indicative of high-risk ALL.
Donde la expresión "determinación simultánea" se refiere a la determinación conjunta y mediante una única reacción, por ejemplo mediante el uso de cebadores que amplifican la región común a ambas isoformas (RNAm) y/o el uso de reactivos de afinidad que se unen específicamente a los polipéptidos codificados por las mismas. Where the term "simultaneous determination" refers to the joint determination and by a single reaction, for example by the use of primers that amplify the common region to both isoforms (mRNA) and / or the use of affinity reagents that specifically bind to the polypeptides encoded by them.
El gen TCFL5 (NCBI Gene ID: 10732) se ha descrito en humanos y codifica para un factor de transcripción de tipo basic hélix-loop-helix. Está localizado en el cromosoma 20 (20q13.33) y presenta 8 exones(E1-E8) que sufren "splicing" alternativos dando lugar a 6 formas mayoritarias según análisis bionformaticos llevados a cabo por los inventores de las bases de datos de secuenciación de RNA "RNAseq" (NCBI, Ensemble, Vega y EC gene). Dichas isoformas del gen TCFL5 son: (1) TCFL5R, (2) TCFL5R4b, (3) TCFL5R7, (4) TCFL5R4b6 (5) TCFL5R6 y (6) CHA (Tcfl5R2b o R2b), aumentando el número de isoformas respecto a las 2 isoformas previamente descritas: Tcfl5R y CHA (Tcfl5R2b). Ver Figura 1 y Tabla I del Ejemplo 1. La secuencia canónica de la variante de transcripción o isoforma TCFL5 (RNAm) es TCFL5R y se identifica en la presente invención como SEQ ID NO: 1 (NCBI: NM_006602). The TCFL5 gene (NCBI Gene ID: 10732) has been described in humans and encodes a basic helix-loop-helix transcription factor. It is located on chromosome 20 (20q13.33) and has 8 exons (E1-E8) that undergo alternative splicing giving rise to 6 majority forms according to bionformatic analyzes carried out by the inventors of RNA sequencing databases "RNAseq" (NCBI, Ensemble, Vega and EC gene). Such isoforms of the TCFL5 gene are: (1) TCFL5R, (2) TCFL5R4b, (3) TCFL5R7, (4) TCFL5R4b6 (5) TCFL5R6 and (6) CHA (Tcfl5R2b or R2b), increasing the number of isoforms with respect to the 2 isoforms previously described: Tcfl5R and CHA (Tcfl5R2b). See Figure 1 and Table I of Example 1. The canonical sequence of the transcript variant or isoform TCFL5 (mRNA) is TCFL5R and is identified in the present invention as SEQ ID NO: 1 (NCBI: NM_006602).
La secuencia de la variante de transcripción o isoforma CHA (RNAm) se identifica en la presente invención como SEQ ID NO:2 (NCBI: AJ271337.1). The sequence of the transcription variant or isoform CHA (mRNA) is identified in the present invention as SEQ ID NO: 2 (NCBI: AJ271337.1).
Los polipéptidos codificados por las isoformas TCFL5 y CHA (RNAm) corresponden a las secuencias de aminoácidos SEQ ID NO:3 y SEQ ID NO:4, respectivamente. The polypeptides encoded by the TCFL5 and CHA (mRNA) isoforms correspond to the amino acid sequences SEQ ID NO: 3 and SEQ ID NO: 4, respectively.
La determinación de las isoformas TCFL5 y CHA de acuerdo con el método de la invención se realiza preferiblemente con reactivos que detectan ambas isoformas del gen TCFL5 (a nivel de RNAm o proteico) de manera simultánea, más preferiblemente la detección y/o cuantificación de dichas isoformas es específica para TCFL5 y CHA, no detectándose y/o cuantificándose otras isoformas del gen TCFL5. En un modo de realización particular, los niveles de expresión de las isoformas TCFL5 y CHA se determinan a nivel de RNA mensajero (RNAm). The determination of the TCFL5 and CHA isoforms according to the method of the invention is preferably carried out with reagents that detect both isoforms of the TCFL5 gene (at the mRNA or protein level) simultaneously, more preferably the detection and / or quantification of said Isoforms are specific for TCFL5 and CHA, not detecting and / or quantifying other isoforms of the TCFL5 gene. In a particular embodiment, the expression levels of the TCFL5 and CHA isoforms are determined at the level of messenger RNA (mRNA).
Los procedimientos de biología molecular para cuantificar las secuencias de ácidos nucleicos diana son bien conocidos en la técnica. Estos procedimientos incluyen, pero no se limitan a PCR de punto final, PCR competitiva, transcriptasa inversa asociada a PCR (RT-PCR), PCR cuantitativa (qPCR), transcriptasa inversa asociada a qPCR (RT-qPCR), PCR- pirosecuenciación, PCR-ELISA, micromatrices de ADN, espectrometría de masas, ensayos de hibridación in situ tales como inmunotransferencia por puntos (dot-blot) o ensayo de hibridación in situ con fluorescencia (FISH), ADN ramificado (bDNA; Nolte, Adv. Clin. Chem. 1998,33:201- 235) y versiones múltiplex de dichos procedimientos (véase, por ejemplo, Andoh et al., Current Pharmaceutical Design, 2009; 15,2066-2073), así como la próxima generación de cualquiera de las técnicas enumeradas y combinaciones de las mismas, todos los cuales están dentro del alcance de la presente invención. Dichos procedimientos pueden incluir también la pre- conversión del RNAm en cDNA a través de la reacción con una transcriptasa inversa (RT), por ejemplo la reacción de PCR es habitualmente precedida de la conversión del RNAm en cDNA y se refiere como RT-PCR. Molecular biology methods for quantifying target nucleic acid sequences are well known in the art. These procedures include, but are not limited to endpoint PCR, competitive PCR, reverse transcriptase associated with PCR (RT-PCR), quantitative PCR (qPCR), reverse transcriptase associated with qPCR (RT-qPCR), PCR-pyrosequencing, PCR -ELISA, DNA microarrays, mass spectrometry, in situ hybridization assays such as dot blotting or fluorescence in situ hybridization assay (FISH), branched DNA (bDNA; Nolte, Adv. Clin. Chem 1998,33: 201-235) and multiplex versions of such procedures (see, for example, Andoh et al., Current Pharmaceutical Design, 2009; 15,2066-2073), as well as the next generation of any of the techniques listed and combinations thereof, all of which are within the scope of the present invention. Such methods may also include pre-conversion of mRNA into cDNA through reaction with a reverse transcriptase (RT), for example the PCR reaction is usually preceded by the conversion of mRNA into cDNA and is referred to as RT-PCR.
Los cebadores y/o sondas, en general, reaccionan ofreciendo una respuesta directa y lineal a cantidades crecientes de las secuencias de ácidos nucleicos dianas. Gracias a la comparación con estándares apropiados, se puede cuantificar fácilmente la cantidad de una secuencia de ácidos nucleicos dados en una muestra. Preferentemente, dicho procedimiento molecular para cuantificación génica se selecciona del grupo que consiste en reacción en cadena de la polimerasa cuantitativa (qPCR), PCR-pirosecuenciación, hibridación in situ con fluorescencia (FISH), micromatrices de ADN y PCR-ELISA. Primers and / or probes, in general, react by offering a direct and linear response to increasing amounts of target nucleic acid sequences. Thanks to the comparison with appropriate standards, the amount of a nucleic acid sequence given in a sample can be easily quantified. Preferably, said molecular procedure for gene quantification is selected from the group consisting of quantitative polymerase chain reaction (qPCR), PCR-pyrosequencing, fluorescence in situ hybridization (FISH), DNA microarrays and PCR-ELISA.
Un procedimiento de cuantificación preferido es FISH, que combina la hibridación de sondas con microscopía óptica fluorescente, microscopía láser confocal o citometría de flujo para la cuantificación directa de secuencias diana individuales. A preferred quantification procedure is FISH, which combines the hybridization of probes with fluorescent optical microscopy, confocal laser microscopy or flow cytometry for the direct quantification of individual target sequences.
Otro procedimiento de cuantificación preferido es la PCR cuantitativa (qPCR) asociada a la transcriptasa inversa. La qPCR o PCR en tiempo real es bien conocidad por un experto en la materia. Se comercializan distintos instrumentos para llevar a cabo dicha reacción, tales como ABI Prism 7700 SDS, GeneAmp 5700 SDS, ABI Prism 7900 HT SDS de Applied Biosystems; iCycler iQ de Bio-Rad; Smart Cycler de Cepheid; Rotor-Gene de Corbett Research; LightCycler de Roche Molecular Biochemicals y Mx4000 Multiplex de Stratagene. El procedimiento de qPCR permite la cuantificación exacta del producto de PCR en tiempo real midiendo la acumulación del producto de PCR muy pronto en la fase exponencial de la reacción, reduciendo así el sesgo en la cuantificación ligado a la eficacia de la amplificación de PCR que se produce en la PCR de punto final. La PCR en tiempo real es bien conocida en la técnica y por tanto, no se describe en detalle en el presente documento. Una visión general de la tecnología y los protocolos para qPCR están disponibles, por ejemplo, de los proveedores mencionados anteriormente, por ejemplo, http://www.sigmaaldrich.com/technical- documents/protocols/biology/sybr-green-qpcr.html o http://www.sigmaaldrich.com/life- science/molecular-biology/pcr/quantitative-pcr/qpcr-technical-guide.html. Una revisión del uso de qPCR en la cuantificación de mRNA se encuentra por ejemplo en Wong ML y Medrano JF, Biotechniques 2005, 39(1):75-85. Están disponibles diferentes bioquímicas de detección para qPCR. Se pueden usar todas ellas con los instrumentos de qPCR mencionados anteriormente. El término "bioquímica de detección" se refiere a un procedimiento para informar de la amplificación del producto de PCR específico en PCR en tiempo real. Dichas bioquímicas de detección se clasifican en dos grupos principales. El primer grupo comprende moléculas de intercalado de ADN de doble cadena: tales como SYBR Green I y EvaGreen; y el segundo grupo incluye oligonucleótidos marcados típicamente con un fluoróforo. Este último, a su vez, se ha dividido en tres subgrupos: (i) cebadores-sondas (Scorpions, Amplifluor®, LUX™, Cyclicons, Angler®); (ii) sondas de hidrólisis (TaqMan, MGB-TaqMan, Snake assay) y de hibridación (Hybprobe or FRET, Molecular Beacons, HyBeacon™, MGB-Pleiades, MGB- Eclipse, ResonSense®, Yin-Yang or displacing); y (iii) análogos de ácidos nucleicos (PNA, LNA®, ZNA ™, bases no naturales: Plexor™ primer, Tiny-Molecular Beacon), ver E. Navarro eta I. .Clínica Chimica Acta, Volume 439, 15 January 2015, Pages 231-250. Another preferred quantification procedure is quantitative PCR (qPCR) associated with reverse transcriptase. The qPCR or real-time PCR is well known by an expert in the field. Different instruments for carrying out said reaction are marketed, such as ABI Prism 7700 SDS, GeneAmp 5700 SDS, ABI Prism 7900 HT SDS of Applied Biosystems; iCycler iQ from Bio-Rad; Cepheid Smart Cycler; Rotor-Gene from Corbett Research; LightCycler by Roche Molecular Biochemicals and Mx4000 Multiplex by Stratagene. The qPCR procedure allows the exact quantification of the PCR product in real time by measuring the accumulation of the PCR product very early in the exponential phase of the reaction, thus reducing the bias in the quantification linked to the efficiency of the PCR amplification that is produces in endpoint PCR. Real-time PCR is well known in the art and therefore, is not described in detail herein. An overview of the technology and protocols for qPCR are available, for example, from the providers mentioned above, for example, http://www.sigmaaldrich.com/technical- documents / protocols / biology / sybr-green-qpcr. html or http://www.sigmaaldrich.com/life- science / molecular-biology / pcr / quantitative-pcr / qpcr-technical-guide.html. A review of the use of qPCR in the quantification of mRNA is found for example in Wong ML and Medrano JF, Biotechniques 2005, 39 (1): 75-85. Different biochemical detection are available for qPCR. All of them can be used with the qPCR instruments mentioned above. The term "biochemical detection" refers to a procedure for reporting the amplification of the specific PCR product in real-time PCR. These biochemical detection are classified into two main groups. The first group comprises double stranded DNA interleaving molecules: such as SYBR Green I and EvaGreen; and the second group includes oligonucleotides typically labeled with a fluorophore. The latter, in turn, has been divided into three subgroups: (i) primers-probes (Scorpions, Amplifluor®, LUX ™, Cyclicons, Angler®); (ii) hydrolysis (TaqMan, MGB-TaqMan, Snake assay) and hybridization (Hybprobe or FRET, Molecular Beacons, HyBeacon ™, MGB-Pleiades, MGB-Eclipse, ResonSense®, Yin-Yang or displacing); and (iii) nucleic acid analogs (PNA, LNA®, ZNA ™, unnatural bases: Plexor ™ primer, Tiny-Molecular Beacon), see E. Navarro eta I.. Clínica Chimica Acta, Volume 439, 15 January 2015, Pages 231-250.
En un modo de realización preferente, dichas sondas son oligonucleótidos de doble mareaje, tales como sondas de hidrólisis o balizas moleculares. El extremo 5' del oligonucleótido, típicamente, se marca con una molécula indicadora (repórter) fluorescente tales como FAM, TET o JOE mientras que el extremo 3' se marca con una molécula desactivadora (quencher), tales como TAM o BHQ1. La secuencia de la sonda es específica para una región de interés en la molécula diana amplificada. En un modo de realización más preferente, dicha sonda es una sonda de hidrólisis que está diseñada de modo que la longitud de la secuencia sitúa el fluoroforo 5' y la molécula desactivadora 3' en proximidad suficientemente estrecha para suprimir la fluorescencia. Varias moléculas indicadoras y extintoras para su uso en sondas de qPCR son bien conocidas en la técnica. Estas están disponibles, por ejemplo, de https://www.eurofinsgenomics.eu/en/dna-rna-oligonucleotides/optimised-application-oligos/qpcr- probes.aspx. In a preferred embodiment, said probes are double-labeled oligonucleotides, such as hydrolysis probes or molecular beacons. The 5 'end of the oligonucleotide is typically labeled with a fluorescent indicator (reporter) molecule such as FAM, TET or JOE while the 3' end is labeled with a quencher (quencher) molecule, such as TAM or BHQ1. The probe sequence is specific for a region of interest in the amplified target molecule. In a more preferred embodiment, said probe is a hydrolysis probe that is designed so that the length of the sequence places the fluorophore 5 'and the deactivating molecule 3' in close proximity sufficiently narrow to suppress fluorescence. Several indicator and extinguishing molecules for use in qPCR probes are well known in the art. These are available, for example, from https://www.eurofinsgenomics.eu/en/dna-rna-oligonucleotides/optimised-application-oligos/qpcr- probes.aspx.
Generalmente, para la cuantificacion de secuencias de nucleotidos se utilizan sondas y/o cebadores. El término "un cebador y/o sonda" incluye específicamente "cebadores y/o sondas", englobando por ejemplo a un cebador, una sonda, un cebador y una sonda, una pareja de cebadores, y una pareja de cebadores y una sonda. Ambos términos se utilizan de manera indistinta en la presente invención. Las sondas y/o cebadores utilizadas en el método de la invención hibridan específicamente con SEQ ID NO: 1 y/o SEQ ID NO: 2. Dichas sondas y/o cebadores son parcialmente complementarias, preferiblemente sustancial o completamente complementarias a SEQ ID NO: 1 y/o SEQ ID NO: 2 o a fragmentos de las mismas tal y como se describe en el presente documento. Generally, probes and / or primers are used to quantify nucleotide sequences. The term "a primer and / or probe" specifically includes "primers and / or probes", encompassing for example a primer, a probe, a primer and a probe, a pair of primers, and a pair of primers and a probe. Both terms are used interchangeably in the present invention. The probes and / or primers used in the method of the invention specifically hybridize with SEQ ID NO: 1 and / or SEQ ID NO: 2. Such probes and / or primers are partially complementary, preferably substantially or completely complementary to SEQ ID NO: 1 and / or SEQ ID NO: 2 or fragments thereof as described herein.
Preferiblemente, una sonda y/o cebador es un secuencia de polinucleótidos de entre 10 y 30 nucleotidos, más preferiblemente de entre 15 y 26 nucleotidos, aún más preferiblemente de entre 18 y 22 nucleotidos, y aún mucho más preferiblemente de alrededor de 20 nucleotidos. En una realización particular, dichos cebadores y/o sondas han sido modificados para la detección o para potenciar el rendimiento del ensayo. Preferably, a probe and / or primer is a polynucleotide sequence of between 10 and 30 nucleotides, more preferably between 15 and 26 nucleotides, even more preferably between 18 and 22 nucleotides, and still much more preferably of about 20 nucleotides. In a particular embodiment, said primers and / or probes have been modified for detection or to enhance assay performance.
En una realización particular, dichos cebadores y/o sondas comprenden o consisten en una secuencia seleccionada del grupo que consiste en SEQ ID NO: 5 a SEQ I D NO: 76 (ver Tabla III), y secuencias idénticas a cualquiera de las mismas en al menos 75%. Preferiblemente, dichos cebadores y/o sondas comprenden o consisten en una secuencia seleccionada del grupo que consiste en SEQ ID NO: 5 a SEQ ID NO: 76 (ver Tabla III). En otra realización particular, dichos cebadores y/o sondas son específicos para la cuantificación/amplificación de una región comprendida entre los exones 3 y 8 de TCFL5R (SEQ ID NO: 1) permitiendo cuantificar de manera específica y simultánea la expresión de TCFL5 (independientemente de que el exón 4 presente la variante E4a o E4b) y CHA (TCFL5R2b). In a particular embodiment, said primers and / or probes comprise or consist of a sequence selected from the group consisting of SEQ ID NO: 5 to SEQ ID NO: 76 (see Table III), and sequences identical to any of them in at least 75%. Preferably, said primers and / or probes comprise or consist of a sequence selected from the group consisting of SEQ ID NO: 5 to SEQ ID NO: 76 (see Table III). In another particular embodiment, said primers and / or probes are specific for the quantification / amplification of a region between exons 3 and 8 of TCFL5R (SEQ ID NO: 1) allowing to quantify specifically and simultaneously the expression of TCFL5 (independently that exon 4 presents the variant E4a or E4b) and CHA (TCFL5R2b).
En dicho modo de realización particular, la determinación de los niveles de expresión de las isoformas TCFL5/CHA a nivel RNAm se efectúa mediante la cuantificación de una secuencia comprendida entre el primer nucleótido de E3 y el último nucleótido de E8. En una realización preferida, dichos cebadores y/o sondas hibridan específicamente con secuencias comprendidas en cualquiera de los exones E3, E4, E5 y/o E8, incluyendo cuando ambos cebadores hibridan en un mismo exón y cualquier combinación de los mismos. Preferiblemente, dichos cebadores y/o sondas comprenden o consisten en una secuencia seleccionada del grupo que consiste en SEQ ID NO: 5 a SEQ ID NO: 42; SEQ ID NO: 45 a SEQ ID NO: 62 y SEQ ID NO: 71 a SEQ ID NO: 74 (ver Tabla III), y secuencias idénticas a cualquiera de las mismas en al menos 75%. Más preferiblemente, dichos cebadores y/o sondas comprenden o consisten en una pareja de cebadores seleccionada del grupo que consiste en SEQ ID NO: 5 a SEQ ID NO: 42; SEQ ID NO: 45 a SEQ ID NO: 62 y SEQ ID NO: 71 a SEQ ID NO: 74 (ver Tabla III). In said particular embodiment, the expression levels of the TCFL5 / CHA isoforms at the mRNA level are determined by quantifying a sequence between the first nucleotide of E3 and the last nucleotide of E8. In a preferred embodiment, said primers and / or probes specifically hybridize with sequences comprised in any of exons E3, E4, E5 and / or E8, including when both primers hybridize to the same exon and any combination thereof. Preferably, said primers and / or probes comprise or consist of a sequence selected from the group consisting of SEQ ID NO: 5 to SEQ ID NO: 42; SEQ ID NO: 45 to SEQ ID NO: 62 and SEQ ID NO: 71 to SEQ ID NO: 74 (see Table III), and sequences identical to any of them at least 75%. More preferably, said primers and / or probes comprise or consist of a pair of primers selected from the group consisting of SEQ ID NO: 5 to SEQ ID NO: 42; SEQ ID NO: 45 to SEQ ID NO: 62 and SEQ ID NO: 71 to SEQ ID NO: 74 (see Table III).
En otra realización preferida, dichos cebadores y/o sondas hibridan específicamente con secuencias comprendidas en cualquiera de los exones E3, E4 y/o E5 (amplificando una región común a todas las isoformas), incluyendo cuando ambos cebadores hibridan en un mismo exón y cualquier combinación de los mismos. Preferiblemente, dichos cebadores y/o sondas comprenden o consisten en una secuencia seleccionada del grupo que consiste en SEQ ID NO: 5 a SEQ ID NO: 42 y SEQ ID NO: 71 a SEQ ID NO: 72 (ver Tabla III), y secuencias idénticas a cualquiera de las mismas en al menos 75%. Más preferiblemente, dichos cebadores y/o sondas comprenden o consisten en una pareja de cebadores seleccionada del grupo que consiste en SEQ ID NO: 5 a SEQ ID NO: 42 y SEQ ID NO: 71 a SEQ ID NO: 72 (ver Tabla III). In another preferred embodiment, said primers and / or probes specifically hybridize with sequences comprised in any of exons E3, E4 and / or E5 (amplifying a region common to all isoforms), including when both primers hybridize to the same exon and any combination thereof. Preferably, said primers and / or probes comprise or consist of a sequence selected from the group consisting of SEQ ID NO: 5 to SEQ ID NO: 42 and SEQ ID NO: 71 to SEQ ID NO: 72 (see Table III), and sequences identical to any of them in at least 75%. More preferably, said primers and / or probes comprise or consist of a pair of primers selected from the group consisting of SEQ ID NO: 5 to SEQ ID NO: 42 and SEQ ID NO: 71 to SEQ ID NO: 72 (see Table III ).
En otra realización preferida, dichos cebadores y/o sondas amplifican la región común y específica de las isoformas TCFL5R y CHA, más específicamente un cebador y/o sonda híbrida en E3 o E5 y el otro en E8, o ambos en E8. Preferiblemente, dichos cebadores y/o sondas comprenden o consisten en una secuencia seleccionada del grupo que consiste en SEQ ID NO: 45 a SEQ ID NO: 62 y SEQ ID NO: 73 a SEQ ID NO: 74 (ver Tabla III), y secuencias idénticas a cualquiera de las mismas en al menos 75%. Más preferiblemente, dichos cebadores y/o sondas comprenden o consisten en una pareja de cebadores seleccionada del grupo que consiste en SEQ ID NO: 45 a SEQ ID NO: 62 y SEQ ID NO: 73 a SEQ ID NO: 74 (ver Tabla III). In another preferred embodiment, said primers and / or probes amplify the common and specific region of the TCFL5R and CHA isoforms, more specifically a primer and / or hybrid probe at E3 or E5 and the other at E8, or both at E8. Preferably, said primers and / or probes comprise or consist of a sequence selected from the group consisting of SEQ ID NO: 45 to SEQ ID NO: 62 and SEQ ID NO: 73 to SEQ ID NO: 74 (see Table III), and sequences identical to any of them in at least 75% More preferably, said primers and / or probes comprise or consist of a pair of primers selected from the group consisting of SEQ ID NO: 45 to SEQ ID NO: 62 and SEQ ID NO: 73 to SEQ ID NO: 74 (see Table III ).
En una realización más preferida, uno de los cebadores y/o sondas híbrida específicamente con una secuencia comprendida en E5 y el otro en E8. Preferiblemente, dichos cebadores y/o sondas comprenden o consisten en una secuencia seleccionada del grupo que consiste en SEQ ID NO: 45 a SEQ ID NO: 54 y SEQ ID NO: 73 a SEQ ID NO: 74 (ver Tabla III), y secuencias idénticas a cualquiera de las mismas en al menos 75%. Más preferiblemente, dichos cebadores y/o sondas comprenden o consisten en una pareja de cebadores seleccionada del grupo que consiste en SEQ I D NO: 45 a SEQ I D NO: 54 y SEQ ID NO: 73 a SEQ ID NO: 74 (ver Tabla III). In a more preferred embodiment, one of the primers and / or probes hybrid specifically with a sequence comprised in E5 and the other in E8. Preferably, said primers and / or probes comprise or consist of a sequence selected from the group consisting of SEQ ID NO: 45 to SEQ ID NO: 54 and SEQ ID NO: 73 to SEQ ID NO: 74 (see Table III), and sequences identical to any of them in at least 75%. More preferably, said primers and / or probes comprise or consist of a pair of primers selected from the group consisting of SEQ ID NO: 45 to SEQ ID NO: 54 and SEQ ID NO: 73 to SEQ ID NO: 74 (see Table III ).
En otra realización más preferida, uno de los cebadores y/o sondas híbrida específicamente con una secuencia comprendida en E3 y el otro en E8. Preferiblemente, dichos cebadores y/o sondas comprenden o consisten en una secuencia seleccionada del grupo que consiste en SEQ ID NO: 55 a SEQ ID NO: 56 (ver Tabla III), y secuencias idénticas a cualquiera de las mismas en al menos 75%. Más preferiblemente, dichos cebadores y/o sondas comprenden o consisten en una pareja de cebadores seleccionada del grupo que consiste en SEQ ID NO: 55 a SEQ ID NO: 56 (ver Tabla III). In another more preferred embodiment, one of the primers and / or probes hybrid specifically with a sequence comprised in E3 and the other in E8. Preferably, said primers and / or probes comprise or consist of a sequence selected from the group consisting of SEQ ID NO: 55 to SEQ ID NO: 56 (see Table III), and sequences identical to any of them at least 75% . More preferably, said primers and / or probes comprise or consist of a pair of primers selected from the group consisting of SEQ ID NO: 55 to SEQ ID NO: 56 (see Table III).
En otra realización más preferida adicional, ambos cebadores y/o sondas hibridan en E8. Preferiblemente, dichos cebadores y/o sondas comprenden o consisten en una secuencia seleccionada del grupo que consiste en SEQ ID NO: 57 a SEQ ID NO: 62 (ver Tabla III), y secuencias idénticas a cualquiera de las mismas en al menos 75%. Más preferiblemente, dichos cebadores y/o sondas comprenden o consisten en una pareja de cebadores seleccionada del grupo que consiste en SEQ ID NO: 57 a SEQ ID NO: 62 (ver Tabla III). In another more preferred embodiment, both primers and / or probes hybridize to E8. Preferably, said primers and / or probes comprise or consist of a sequence selected from the group consisting of SEQ ID NO: 57 to SEQ ID NO: 62 (see Table III), and sequences identical to any of them at least 75% . More preferably, said primers and / or probes comprise or consist of a pair of primers selected from the group consisting of SEQ ID NO: 57 to SEQ ID NO: 62 (see Table III).
Más preferiblemente, dichos cebadores y/o sondas comprenden o consisten en una secuencia seleccionada del grupo que consiste en SEQ ID NO: 45 (Primer TCFL5/CHA 01 Forward): GAGACTGACAAGGCCACAACT, SEQ ID NO: 46 (Primer TCFL5/CHA 01 Reverse): CCGCAAAATACGCTCTCAA, y secuencias idénticas a cualquiera de las mismas en al menos 75%. More preferably, said primers and / or probes comprise or consist of a sequence selected from the group consisting of SEQ ID NO: 45 (First TCFL5 / CHA 01 Forward): GAGACTGACAAGGCCACAACT, SEQ ID NO: 46 (First TCFL5 / CHA 01 Reverse) : CCGCAAAATACGCTCTCAA, and sequences identical to any of them in at least 75%.
Las secuencias oligonucleotídicas con una identidad de al menos un 75 % mencionadas en la presente invención presentan preferiblemente una identidad de al menos un 80 %, al menos un 85 %, al menos un 90 %, al menos un 95 %, más preferentemente, 96 %, 97 %, 98 %, 99 % o un 100 % con las respectivas secuencias de referencia. Además, estas secuencias con una identidad de al menos un 75 % pueden tener el mismo número de nucleótidos, o bien presentar más o menos nucleótidos que la secuencia de referencia. The oligonucleotide sequences with an identity of at least 75% mentioned in the present invention preferably have an identity of at least 80%, at least one 85%, at least 90%, at least 95%, more preferably, 96%, 97%, 98%, 99% or 100% with the respective reference sequences. In addition, these sequences with an identity of at least 75% may have the same number of nucleotides, or have more or less nucleotides than the reference sequence.
El término "identidad" tal como se usa en el presente documento se refiere a una correspondencia exacta de nucleótido con nucleótido o aminoácido con aminoácido de dos secuencias de polipéptido o polinucleótidos o, respectivamente. Pueden compararse dos o más secuencias (de polinucleótidos o aminoácidos) determinando su "porcentaje de identidad". El "porcentaje de identidad" de dos secuencias, ya sean secuencias de ácido nucleico o de aminoácidos, es el número de coincidencias exactas entre dos secuencias alineadas dividido entre la longitud de la secuencia más corta y multiplicado por 100. Programas adecuados para calcular la identidad en porcentaje o similitud entre secuencias se conocen bien en la técnica, tal como el programa BLAST de NCBI, usado por ejemplo con los parámetros por defecto (http://www.ncbi.nlm.gov/cgi-bin/BLAST). The term "identity" as used herein refers to an exact correspondence of nucleotide with nucleotide or amino acid with amino acid of two polypeptide or polynucleotide sequences or, respectively. Two or more sequences (of polynucleotides or amino acids) can be compared by determining their "percent identity." The "percent identity" of two sequences, whether nucleic acid or amino acid sequences, is the number of exact matches between two aligned sequences divided by the length of the shortest sequence and multiplied by 100. Suitable programs to calculate identity in percentage or similarity between sequences they are well known in the art, such as the NCBI BLAST program, used for example with the default parameters (http://www.ncbi.nlm.gov/cgi-bin/BLAST).
Los niveles de cuantificación pueden ser absolutos o relativos. En general, es preferente que los niveles de expresión se normalicen. La normalización se puede realizar con respecto a diferentes medidas en la muestra, tal como por peso de la muestra, cuantificación de células humanas, cuantificación de ADN total, y/o cuantificación de los niveles de expresión de un gen de expresión constitutiva. Estos procedimientos son bien conocidos para un experto en la técnica. Quantification levels can be absolute or relative. In general, it is preferred that the expression levels be normalized. Normalization can be performed with respect to different measurements in the sample, such as by sample weight, quantification of human cells, quantification of total DNA, and / or quantification of the expression levels of a constitutive expression gene. These procedures are well known to one skilled in the art.
En un modo de realización particular, la normalización se lleva a cabo con respecto a la cuantificación de los niveles de expresión de un gen de expresión constitutiva. En la presente invención se entiende por "genes que se expresan de forma constitutiva" o "genes de expresión constitutiva", a aquellos genes que se ha descrito que se transcriben de manera constante. Ejemplos de genes que se expresan de forma constitutiva son 2-mioglobulina, ubiquitina, proteína ribosomal 18S, ciclofilina A, GAPDH, proteína de activación de la tirosina 3- monooxigenasa/triptófano 5-monooxigenasa (YWHAZ), beta-actina, β-2- microglobulina o hipoxantina-guanina fosforibosiltransferasa (HPRT). In a particular embodiment, normalization is carried out with respect to the quantification of the expression levels of a constitutive expression gene. In the present invention, "genes that are constitutively expressed" or "genes of constitutive expression" are understood to be those genes that have been described that are constantly transcribed. Examples of constitutively expressed genes are 2-myoglobulin, ubiquitin, 18S ribosomal protein, cyclophilin A, GAPDH, tyrosine activation protein 3- monooxygenase / tryptophan 5-monooxygenase (YWHAZ), beta-actin, β-2 - microglobulin or hypoxanthine-guanine phosphoribosyltransferase (HPRT).
En un modo de realización preferente, la cuantificación de los niveles de expresión de TCFL5/CHA se realiza por RT-qPCR y comprende la normalización de los niveles de expresión respecto a un gen de expresión constitutiva. In a preferred embodiment, the quantification of the TCFL5 / CHA expression levels is performed by RT-qPCR and comprises the normalization of the expression levels with respect to a constitutive expression gene.
La detección y/o cuantificación de las isoformas TCFL5/CHA se puede llevar a cabo también a nivel proteico. Los polipéptidos codificados por las isoformas TCFL5 y CHA (RNAm) corresponden a las secuencias de aminoácidos referidas como SEQ ID NO:3 y SEQ ID NO:4 en la presente invención. Existen diversos métodos para la cuantificación de péptidos y proteínas bien conocidos por un experto en la materia, tales como inmunoensayos. Diversos tipos de inmunoensayos son conocidos por un experto en la materia para la cuantificación de manera específica de proteínas de interés, ya sea en solución o utilizando un ensayo en fase sólida. Dichos métodos están basados en el uso de reactivos de afinidad, que pueden ser receptores o ligandos específicos, por ejemplo anticuerpos, preferiblemente marcados. Por ejemplo, el Western Blot o inmunotransferencia permite comparar las abundancias de proteínas separadas mediante un gel electroforético, eg. SDS-PAGE. En esta técnica, las proteínas separadas por electroforesis en gel se transfieren sobre una lámina de material polimérico (generalmente de nitrocelulosa, nylon, o difluoruro de polivinilideno), donde se inmovilizan. Las proteínas diana se revelan mediante el uso de una solución que contiene un anticuerpo específico. El anticuerpo puede conjugarse directamente con un marcador radiactivo, fluorescente o enzimático (método de detección directa) o bien se puede usar un anticuerpo secundario que reconoce el anticuerpo primario y por lo tanto amplifica la señal (método de detección indirecta o ensayo de tipo sándwich). The detection and / or quantification of the TCFL5 / CHA isoforms can also be carried out at the protein level. Polypeptides encoded by the TCFL5 and CHA (mRNA) isoforms correspond to the amino acid sequences referred to as SEQ ID NO: 3 and SEQ ID NO: 4 in the present invention. There are various methods for quantifying peptides and proteins well known to a person skilled in the art, such as immunoassays. Various types of immunoassays are known to a person skilled in the art for the specific quantification of proteins of interest, either in solution or using a solid phase assay. Such methods are based on the use of affinity reagents, which may be specific receptors or ligands, for example antibodies, preferably labeled. For example, Western blotting or immunoblotting allows comparing abundances of proteins separated by an electrophoretic gel, eg. SDS-PAGE. In this technique, the proteins separated by gel electrophoresis are transferred onto a sheet of polymeric material (generally nitrocellulose, nylon, or polyvinylidene difluoride), where they are immobilized. Target proteins are revealed by using a solution that contains a specific antibody. The antibody can be conjugated directly with a radioactive, fluorescent or enzymatic marker (direct detection method) or a secondary antibody can be used that recognizes the primary antibody and therefore amplifies the signal (indirect detection method or sandwich type assay) .
Tradicionalmente, la cuantificación específica de proteínas en solución se ha efectuado mediante inmunoensayos en un soporte sólido. Típicamente, se inmoviliza un anticuerpo de captura específico para la proteína diana en una superficie polimérica o de plástico y se añade al soporte una solución que contiene la proteína de interés (por ejemplo, suero o lisado celular). Finalmente, se incuba la muestra en el soporte durante un tiempo para permitir que se formen los complejos antígeno-anticuerpo. A continuación, se suelen realizar uno o más lavados para eliminar la solución y la proteína diana se detecta con un segundo anticuerpo que reconoce un epítopo de proteína diferente al reconocido por el anticuerpo de captura. Al igual que en el caso del Western Blot, este anticuerpo de detección puede estar marcado directamente o puede ser reconocido con un anticuerpo secundario. Un inmunoensayo comúnmente utilizado para la cuantificación de proteínas es el ensayo de inmunoabsorción ligado a enzimas (ELISA) en el que el anticuerpo de detección lleva una enzima que convierte un sustrato comúnmente incoloro en un compuesto coloreado o un sustrato no fluorescente en un compuesto fluorescente. Asimismo, en otros inmunoensayos en fase sólida, el anticuerpo puede estar marcado con un isótopo radioactivo o con fluorescencia. Traditionally, the specific quantification of proteins in solution has been carried out by immunoassays on a solid support. Typically, a specific capture antibody for the target protein is immobilized on a polymeric or plastic surface and a solution containing the protein of interest (eg, serum or cell lysate) is added to the support. Finally, the sample is incubated on the support for a time to allow antigen-antibody complexes to form. Next, one or more washes are usually performed to remove the solution and the target protein is detected with a second antibody that recognizes a different protein epitope than the one recognized by the capture antibody. As in the case of Western Blot, this detection antibody can be directly labeled or can be recognized with a secondary antibody. An immunoassay commonly used for protein quantification is the enzyme-linked immunosorbent assay (ELISA) in which the detection antibody carries an enzyme that converts a commonly colorless substrate into a colored compound or a non-fluorescent substrate into a fluorescent compound. Also, in other solid phase immunoassays, the antibody may be labeled with a radioactive or fluorescent isotope.
Otros métodos que pueden ser utilizados para la cuantificación de las isoformas TCFL5 y CHA de acuerdo con la invención son técnicas basadas en espectrometría de masas (MS) tales como la cromatografía liquida acoplada a la espectrometría de masas (LC/MS), descrita por ejemplo en US2010/0173786, o el tándem LC-MS/MS (WO2012/155019, US2011/0039287, Rauh M., J Chromatogr B Analyt Technol Biomed Life Sci. 2012 Feb 1 ¡883-884:59-67), así como el uso de arrays de péptidos, proteínas o anticuerpos y versiones múltiplex de las técnicas mencionadas, así como la próxima generación de dichas técnicas y combinaciones de las mismas. En un modo de realización particular de la invención, opcionalmente en combinación con una o más de las características descritas anteriormente, la cuantificación de TCFL5/CHA se realiza mediante un inmunoensayo que comprende el uso de cualquier anticuerpo que detecte ambas isoformas, tales como HPA055223 (Sigma) o SAB4500152 (Sigma), o bien anticuerpos específicos de cada una de ellas. Other methods that can be used for the quantification of the TCFL5 and CHA isoforms according to the invention are techniques based on mass spectrometry (MS) such as liquid chromatography coupled to mass spectrometry (LC / MS), described for example in US2010 / 0173786, or the tandem LC-MS / MS (WO2012 / 155019, US2011 / 0039287, Rauh M., J Chromatogr B Analyt Technol Biomed Life Sci. 2012 Feb 1 ¡883-884: 59-67), as well such as the use of peptide arrays, proteins or antibodies and multiplex versions of the mentioned techniques, as well as the next generation of said techniques and combinations thereof. In a particular embodiment of the invention, optionally in combination with one or more of the features described above, the quantification of TCFL5 / CHA is performed by an immunoassay comprising the use of any antibody that detects both isoforms, such as HPA055223 ( Sigma) or SAB4500152 (Sigma), or antibodies specific to each of them.
El grado de variación (incremento o reducción) en los valores de expresión de TCFL5/CHA en la muestra del paciente respecto a los valores de referencia puede ser, por ejemplo, de al menos el 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 75%, 90%, 100%, 110%, 120%, 130%, 140%, 150% o más. Preferiblemente, dicha variación es estadísticamente significativa. Como se usa en este documento, "estadísticamente significativa" se refiere a un valor de p de menos de 0,05, por ejemplo, un valor de p de menos de 0,025, un valor de p de menos de 0,01 o un valor de p de menos de 0,005, utilizando una prueba estadística apropiada. Un experto en la técnica sabrá definir aquellas pruebas estadísticas más apropiadas. Preferentemente, en aquellos casos en los que haya una distribución normal y homocedasticidad, se usa un modelo paramétrico tal como la prueba de la t de student o la prueba de ANOVA; y cuando no se logre al menos uno de estos dos requisitos, entonces se usa, en general, un modelo no paramétrico tal como la prueba de la U de Mann-Whitney o la prueba de Kruskal-Wallis. Las muestras biológicas para el uso en los métodos de la invención pueden obtenerse a partir de una variedad de tejidos o fluidos biológicos, en particular de sangre, pero también pueden ser utilizadas muestras de médula ósea, linfa, líquido cefalorraquídeo, líquido sinovial, y similares. Tales muestras se pueden separar por centrifugación, decantación, separación en gradiente de densidad, aféresis, selección por afinidad, FACS, etc. antes del análisis. Las muestras biológicas utilizadas en el método de la presente invención son preferiblemente muestras de médula ósea, de sangre periférica o de líquido cefalorraquídeo. Dichos tipos de muestra se utilizan de manera habitual en la práctica clínica y un experto en la materia sabrá identificar los medios adecuados para su obtención y conservación (Coustan-Smith E et al., Blood. 2002 Oct 1 ;100(7):2399-402; Martinez-Laperche C et al., American journal of hematology 88: 359-64). Una vez obtenida la muestra biológica, se puede utilizar directamente, congelar, o mantener en un medio de cultivo apropiado. Varios medios de cultivo pueden ser empleados para mantener las células en cultivo. Las muestras se pueden obtener por cualquier procedimiento adecuado, tal como la extracción de sangre, punción venosa, biopsia, o similares. The degree of variation (increase or decrease) in the expression values of TCFL5 / CHA in the patient sample with respect to the reference values can be, for example, at least 5%, 10%, 15%, 20% , 25%, 30%, 35%, 40%, 45%, 50%, 75%, 90%, 100%, 110%, 120%, 130%, 140%, 150% or more. Preferably, said variation is statistically significant. As used herein, "statistically significant" refers to a p-value of less than 0.05, for example, a p-value of less than 0.025, a p-value of less than 0.01 or a value of p of less than 0.005, using an appropriate statistical test. A person skilled in the art will know how to define the most appropriate statistical tests. Preferably, in those cases where there is a normal distribution and homocedasticity, a parametric model such as the student's t test or the ANOVA test is used; and when at least one of these two requirements is not achieved, then, in general, a non-parametric model such as the Mann-Whitney U test or the Kruskal-Wallis test is used. Biological samples for use in the methods of the invention can be obtained from a variety of biological tissues or fluids, in particular blood, but bone marrow, lymph, cerebrospinal fluid, synovial fluid, and the like can also be used. . Such samples can be separated by centrifugation, decantation, density gradient separation, apheresis, affinity selection, FACS, etc. before the analysis The biological samples used in the method of the present invention are preferably samples of bone marrow, peripheral blood or cerebrospinal fluid. Said types of sample are routinely used in clinical practice and a person skilled in the art will know how to identify the appropriate means for obtaining and preserving them (Coustan-Smith E et al., Blood. 2002 Oct 1; 100 (7): 2399 -402; Martinez-Laperche C et al., American journal of hematology 88: 359-64). Once the biological sample is obtained, it can be used directly, frozen, or kept in an appropriate culture medium. Several culture media can be used to keep cells in culture. Samples can be obtained by any suitable procedure, such as blood collection, venous puncture, biopsy, or the like.
Las células mononucleares (MC) son generalmente aisladas de dicha muestra biológica, mediante métodos conocidos en el estado del arte. Las células mononucleares se aislan típicamente mediante centrifugación por gradiente de densidad, por ejemplo con Ficoll® o Percoll®. Mononuclear cells (MC) are generally isolated from said biological sample, by methods known in the state of the art. Mononuclear cells are typically isolated by density gradient centrifugation, for example with Ficoll® or Percoll®.
En una realización particular, la determinación de los niveles de expresión de las isoformas TCFL5 y CHA se efectúa en una población celular que se ha aislado de una muestra biológica del paciente mediante un procedimiento que comprende una centrifugación por gradiente de densidad. In a particular embodiment, the determination of the expression levels of the TCFL5 and CHA isoforms is performed in a cell population that has been isolated from a biological sample of the patient by a method comprising a density gradient centrifugation.
Tras el aislamiento de MCs de las muestras biológicas, una selección específica del tipo celular de interés puede llevarse a cabo usando uno de los muchos métodos descritos en la literatura, sobre la base de la expresión de marcadores de superficie celular específicos y, si procede, de otras proteínas, así como la actividad de proliferación, el metabolismo y / o el estado morfológico de las células. Típicamente, la purificación de una población celular de interés en una muestra biológica comprende una selección positiva y/o negativa en base a la expresión de marcadores de superficie celular característicos. Following the isolation of MCs from biological samples, a specific selection of the cell type of interest can be carried out using one of the many methods described in the literature, based on the expression of specific cell surface markers and, if appropriate, of other proteins, as well as proliferation activity, metabolism and / or morphological state of the cells. Typically, the purification of a cell population of interest in a biological sample comprises a positive and / or negative selection based on the expression of characteristic cell surface markers.
En otra realización particular, la determinación de los niveles de expresión de las isoformas TCFL5 y CHA se efectúa en una población de células de LLA que se ha aislado de una muestra biológica del paciente mediante un procedimiento que comprende además la selección positiva mediante el uso de marcadores de superficie celular asociados a leucemia. In another particular embodiment, the determination of the expression levels of the TCFL5 and CHA isoforms is performed in a population of ALL cells that has been isolated from a biological sample of the patient by a method that further comprises positive selection by the use of cell surface markers associated with leukemia.
Típicamente se utilizan combinaciones de marcadores celulares que se encuentran en LLA y no en líneas celulares normales que se encuentren habitualmente también en dicha muestra biológica. Por ejemplo, las células LLA-B pueden ser seleccionadas por eliminación de otras MCs tales como los linfocitos T (células CD2+, o CD3+), y/o por la presencia de marcadores de superficie específicos, como por ejemplo CD19 (específico de linfocitos B), y/o CD10 (antígeno asociado a la leucemia linfoblástica). En una realización particular, las células de LLA-B se aislan mediante una selección que comprende la expresión de CD19, y/o CD10. La población de células de LLA se puede seleccionar sobre la base de la expresión de al menos un marcador de superficie celular. La selección normalmente se lleva a cabo utilizando proteínas que se unen específicamente a una de dichas proteínas de superficie celular, típicamente anticuerpos, y que se puede vincular a soportes sólidos (por ejemplo, partículas o superficies de plástico) o pueden ser conjugadas con moléculas de mareaje (por ejemplo, fluorocromo) que pueden ser detectadas por ejemplo mediante citometría de flujo. Typically, combinations of cell markers that are found in ALL and not in normal cell lines that are usually also found in said biological sample are used. For example, LLA-B cells can be selected by removal of other MCs such as T lymphocytes (CD2 +, or CD3 + cells), and / or by the presence of specific surface markers, such as CD19 (B lymphocyte specific ), and / or CD10 (antigen associated with lymphoblastic leukemia). In a particular embodiment, the LLA-B cells are isolated by a selection comprising the expression of CD19, and / or CD10. The population of ALL cells can be selected based on the expression of at least one cell surface marker. Selection is usually carried out using proteins that specifically bind to one of said cell surface proteins, typically antibodies, and that can be linked to solid supports (e.g., particles or plastic surfaces) or can be conjugated with tidal molecules (for example, fluorochrome) that can be detected, for example, by flow cytometry.
Preferiblemente, la muestra biológica del paciente y la muestra biológica de referencia son del mismo tipo, es decir, tienen un mismo origen biológico y han sido aisladas utilizando los mismos procedimientos. Dichas muestras biológicas pueden ser tomadas alrededor del momento del diagnóstico, antes, durante o después del tratamiento, preferiblemente son tomadas alrededor del momento del diagnóstico. Los valores de referencia pueden ser los niveles de expresión determinados para el producto de expresión en una o varias muestras de referencia (por ejemplo, valores medios +/- s.m.e.) o bien valores predeterminados. Típicamente dicho valor de referencia se refiere como valor umbral o de corte (cut-off). Una variedad de métodos estadísticos y matemáticos para establecer el valor umbral o de corte son conocidos en el estado de la técnica. Un valor de expresión umbral o de corte para un biomarcador particular puede ser seleccionado, por ejemplo, utilizando un análisis de Receiver Operating Characteristic (ROC). Un experto en la técnica apreciará que dicho valor de corte se puede variar, por ejemplo, moviéndolo a lo largo del gráfico ROC, para obtener diferentes valores de sensibilidad o especificidad y por tanto afectando el rendimiento general del ensayo. El mejor punto de corte ("best cut-off") se refiere al valor obtenido del gráfico ROC para un biomarcador que produce la mejor sensibilidad y especificidad. Los valores de sensibilidad y especificidad se calculan sobre el rango de umbrales (cut-offs). Así pues, los valores de umbral o de corte pueden ser seleccionados de manera que los valores de sensibilidad y / o especificidad son al menos aproximadamente 70%, y pueden ser, por ejemplo, al menos 75%, al menos 80%, al menos 85%, al menos 90 %, al menos 95%, al menos 96%, al menos 97%, al menos 98%, al menos 99% o al menos 100% en al menos 60% de la población de estudio, o en al menos 65%, 70 %, 75% o 80% de la población de estudio. En una realización particular, las muestras de referencia o control para la obtención de los valores de referencia corresponden a una o más muestras de linfocitos aislados de donantes sanos (por ejemplo, de sangre periférica o de médula ósea) o bien a líneas establecidas de linfocitos B (Raji, ATCC® CCL-86™) o T humanos (Jurkat, Clone E6-1 (ATCC® TIB-152™). En otra realización particular, las muestras de referencia para la obtención de los valores de referencia o control corresponden a una o más muestras celulares de pacientes con LLA o a líneas celulares establecidas de LLA. Típicamente, las líneas celulares y/o muestras celulares de donantes (sanos o pacientes) utilizadas han sido previamente caracterizadas, por ejemplo, de acuerdo a su fenotipo (e.g., LLA-B o LLA-T), inmunofenotipo (un panel standard incluye: CD10, CD19, CD20, CD34, CD38 y CD45), marcadores genéticos de LLA-B (e.g. PAX5, IKZF1 , o EBF1) y citogenéticos (e.g., presencia de translocaciones MLL-AF4, ETV6-RUNX1 o BCR- ABL1. TEL-AML-1), o LLA-T (e.g. HOX11 L2, LYL1 más LM02, TAL1 más LM01 o LM02, HOX1 1 , y MLL-EN, NOTCH1 , c-MYC, etc) características demográficas y/o clínicas del donante (e.g., edad, sexo, origen étnico, contaje de glóbulos blancos (WBC) etc.), y/o respuesta al tratamiento. Líneas celulares características de LLA-B incluyen pero no se limitan a CCL-120 (ATCC). Asimismo, líneas celulares características de LLA-T incluyen pero no se limitan a CCL- 1 19, CCL-120.1 , CRL-1552, CRL-2264, CRL-2265, PTS-CCL-119, CRM-CCL-1 19, CRM-CCL- 1 19D, CRL-1 1386, TI B-195 (todas de ATCC). Preferably, the patient's biological sample and the reference biological sample are of the same type, that is, they have the same biological origin and have been isolated using the same procedures. Said biological samples can be taken around the time of diagnosis, before, during or after treatment, preferably they are taken around the time of diagnosis. The reference values may be the expression levels determined for the expression product in one or more reference samples (for example, mean values +/- sme) or predetermined values. Typically said reference value is referred to as cut-off or threshold value. A variety of statistical and mathematical methods to establish the threshold or cut-off value are known in the state of the art. A threshold or cut-off expression value for a particular biomarker can be selected, for example, using a Receiver Operating Characteristic (ROC) analysis. One skilled in the art will appreciate that said cut-off value can be varied, for example, by moving it along the ROC chart, to obtain different sensitivity or specificity values and therefore affecting the overall performance of the assay. The best cut-off point refers to the value obtained from the ROC chart for a biomarker that produces the best sensitivity and specificity. Sensitivity and specificity values are calculated over the range of thresholds (cut-offs). Thus, the threshold or cut-off values can be selected so that the sensitivity and / or specificity values are at least about 70%, and can be, for example, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or at least 100% in at least 60% of the study population, or in at least 65%, 70%, 75% or 80% of the study population. In a particular embodiment, the reference or control samples for obtaining the reference values correspond to one or more samples of lymphocytes isolated from healthy donors (eg, peripheral blood or bone marrow) or to established lymphocyte lines B (Raji, ATCC® CCL-86 ™) or human T (Jurkat, Clone E6-1 (ATCC® TIB-152 ™) In another particular embodiment, the reference samples for obtaining the reference or control values correspond to one or more cell samples of patients with ALL or to established cell lines of ALL Typically, the cell lines and / or cell samples of donors (healthy or patient) used have been previously characterized, for example, according to their phenotype (eg, LLA-B or LLA-T), immunophenotype (a standard panel includes: CD10, CD19, CD20, CD34, CD38 and CD45), genetic markers of LLA-B (eg PAX5, IKZF1, or EBF1) and cytogenetics (eg, presence of translocations MLL-AF4, ETV6-RUNX1 or BCR-ABL1. TEL-AML-1), or LLA-T (eg HOX11 L2, LYL1 plus LM02, TAL1 plus LM01 or LM02, HOX1 1 , and MLL-EN, NOTCH1, c-MYC, etc.) demographic and / or clinical characteristics of the donor (eg, age, sex, ethnicity, white blood cell count (WBC) etc.), and / or response to treatment. Characteristic cell lines of LLA-B include but are not limited to CCL-120 (ATCC). Also, characteristic cell lines of LLA-T include but are not limited to CCL-1 19, CCL-120.1, CRL-1552, CRL-2264, CRL-2265, PTS-CCL-119, CRM-CCL-1 19, CRM -CCL- 1 19D, CRL-1 1386, TI B-195 (all of ATCC).
Preferiblemente, dichas muestras de pacientes han sido asociadas a pacientes de riesgo medio y/o bajo tanto LLA-B, como LLA-T .{Zhou, Y., You, M. J., Young, K. H., Lin, P., Lu, G., Medeiros, L J., and Bueso-Ramos, C. E. (2012) Advances in the molecular pathobiology of B- lymphoblastic leukemla. Human pathology 43, 1347-136 Van Vlierberghe, P., and Ferrando, A. (2012) The molecular basis of T cell acute lymphoblastic leukemla. J Clin Invest 122, 3398- 3406) Preferably, said patient samples have been associated with patients at medium and / or low risk both LLA-B and LLA-T. {Zhou, Y., You, MJ, Young, KH, Lin, P., Lu, G ., Medeiros, L J., and Bueso-Ramos, CE (2012) Advances in the molecular pathobiology of B-lymphoblastic leukemla. Human pathology 43, 1347-136 Van Vlierberghe, P., and Ferrando, A. (2012) The molecular basis of T cell acute lymphoblastic leukemla. J Clin Invest 122, 3398-3406)
En un modo de realización particular del método de la invención se utiliza para el pronóstico y/o diagnóstico diferencial de pacientes de LLA-B o LLA-T. Preferiblemente, en pacientes de LLA- B. Independientemente del tipo de LLA diagnosticado, en un modo de realización preferido, dichos pacientes son niños. La población infantil en LLA se define típicamente como aquellos pacientes que tienen menos de 20 años. En una realización, preferida, dichos pacientes tienen entre 0 y 15 años, e incluso entre 0-12 meses. En otra realización preferida, dichos pacientes tienen entre 1 y 19 años. In a particular embodiment of the method of the invention it is used for the prognosis and / or differential diagnosis of patients with ALL-B or ALL-T. Preferably, in patients with ALL-B. Regardless of the type of ALL diagnosed, in a preferred embodiment, said patients are children. The infant population in ALL is typically defined as those patients who are under 20 years old. In a preferred embodiment, said patients are between 0 and 15 years old, and even between 0-12 months. In another preferred embodiment, said patients are between 1 and 19 years old.
En el tratamiento de pacientes con LLA, es práctica habitual el determinar el tratamiento más adecuado en función del diagnóstico, estratificación o clasificación del paciente como perteneciente a un grupo de riesgo, es decir se escoge o personaliza el tratamiento según el grupo de riesgo al que pertenecen, siendo menos intenso en los de riesgo medio o bajo y mayor en los de riesgo alto. In the treatment of patients with ALL, it is common practice to determine the most appropriate treatment based on the diagnosis, stratification or classification of the patient as belonging to a risk group, that is, the treatment is chosen or customized according to the risk group to which they belong, being less intense in those of medium or low risk and greater in those of high risk.
La clasificación de la enfermedad puede ser, por ejemplo, una clasificación de preferencia basada en el riesgo de recaída (remisión vs fracaso terapéutico); pero que también puede basarse en las características clínicas de los pacientes, en los datos citogenéticos; en el subtipo de leucemia; la respuesta al tratamiento y/o en la etiología de la enfermedad. Típicamente, se definen como pacientes de alto riesgo aquellos que presentan mayores probabilidades de recaída. Dichos criterios para la clasificación y/o estratificación de pacientes son bien conocidos por un experto en la materia y se describen por ejemplo en Ceppi F, et al., (2015) Risk factors for relapse in childhood acute lymphoblastic leukemia: prediction and prevention. Expert review of hematology 8: 57-70; Hunger SP, Mullighan CG (2015) Acute Lymphoblastic Leukemia in Children. The New England journal of medicine 373: 1541-52; Teachey DT, Hunger SP (2013) Predicting relapse risk in childhood acute lymphoblastic leukaemia. British journal of haematology 162: 606-20): En general, se distinguen 3 grupos de riesgo en función de una evaluación de los datos relativos a la edad del paciente y a los resultados obtenidos en una o más de las siguientes pruebas genéticas y/o bioquímicas: The classification of the disease can be, for example, a preference classification based on the risk of relapse (remission vs. therapeutic failure); but that can also be based on the clinical characteristics of the patients, on the cytogenetic data; in the subtype of leukemia; the response to treatment and / or the etiology of the disease. Typically, those with the highest chance of relapse are defined as high-risk patients. These criteria for the classification and / or stratification of patients are well known by a person skilled in the art and are described for example in Ceppi F, et al., (2015) Risk factors for relapse in childhood acute lymphoblastic leukemia: prediction and prevention. Expert review of hematology 8: 57-70; Hunger SP, Mullighan CG (2015) Acute Lymphoblastic Leukemia in Children. The New England journal of medicine 373: 1541-52; Teachey DT, Hunger SP (2013) Predicting relapse risk in childhood acute lymphoblastic leukaemia. British journal of haematology 162: 606-20): In general, 3 risk groups are distinguished based on an evaluation of the data related to the patient's age and the results obtained in one or more of the following genetic tests and / or biochemistry:
Técnicas de laboratorio generalmente usadas en el diagnóstico y/o recaída: Laboratory techniques generally used in diagnosis and / or relapse:
- Hematimetría estándar con hemocitómetro. - Standard hematimetry with hemocytometer.
- Citología convencional en extensión de muestra de médula ósea y en citospin de muestra de líquido cefalorraquídeo.  - Conventional cytology in bone marrow sample extension and in cerebrospinal fluid sample cytospin.
- Citometría de flujo multiparamétrica, preferiblemente en muestra de médula ósea.  - Multiparameter flow cytometry, preferably in a bone marrow sample.
- Técnicas citogenéticas clásicas y de bandeo de cromosomas, preferiblemente en muestra de médula ósea.  - Classic cytogenetic techniques and chromosome banding, preferably in a bone marrow sample.
- RT-PCR con cebadores específicos para las translocaciones t(12;21), t(1 ; 19), t(9;22) y t(4;1 1), preferiblemente en muestras de médula ósea.  - RT-PCR with specific primers for translocations t (12; 21), t (1; 19), t (9; 22) and t (4; 1 1), preferably in bone marrow samples.
- FISH con sondas para las translocaciones t(12;21), t(1 ; 19), t(9;22) y break apart en MLL, preferiblemente en muestras de médula ósea.  - FISH with probes for translocations t (12; 21), t (1; 19), t (9; 22) and break apart in MLL, preferably in bone marrow samples.
En base a los resultados obtenidos en dichas pruebas, los pacientes de LLA se suelen clasificar en uno de los siguientes grupos de riesgo: Based on the results obtained in these tests, ALL patients are usually classified into one of the following risk groups:
RIESGO ESTÁNDAR o RIESGO BAJO: El paciente debe reunir todos y cada uno de los siguientes criterios: STANDARD RISK or LOW RISK: The patient must meet each and every one of the following criteria:
- Edad >1 y <10 años.  - Age> 1 and <10 years.
- Leucocitos <20 x109/l al diagnóstico. - Leukocytes <20 x10 9 / l at diagnosis.
- Inmunofenotipo no T.  - Immunophenotype no T.
- Ausencia de infiltración del SNC y/o testes.  - Absence of infiltration of the CNS and / or tests.
- Citogenética (uno de los dos criterios siguientes es suficiente):  - Cytogenetics (one of the following two criteria is sufficient):
■ Alta Hiperdiploidía (51-67 cromosomas), índice de DNA 1 , 10-1 ,44 (siempre confirmado por otras técnicas citogenéticas). ■ t(12;21) positiva ■ High Hyperdiploidy (51-67 chromosomes), DNA index 1, 10-1, 44 (always confirmed by other cytogenetic techniques). ■ t (12; 21) positive
- Ausencia de t(1 ; 19)  - Absence of t (1; 19)
- No reordenamiento MLL  - No MLL rearrangement
- Presencia de < 1.000 blastos/mm3 en día +8 de la Inducción, en sangre periférica - Presencia de < 5% de blastos y < 0,1 % de enfermedad residual mínima (ERM) en médula ósea en día +15 de la Inducción y al final de la inducción IA  - Presence of <1,000 blasts / mm3 in day +8 of Induction, in peripheral blood - Presence of <5% of blasts and <0.1% of minimal residual disease (MRE) in bone marrow in day +15 of Induction and at the end of the induction IA
RIESGO ALTO: La existencia de cualquiera de los siguientes criterios determina la inclusión del paciente en este grupo: HIGH RISK: The existence of any of the following criteria determines the inclusion of the patient in this group:
- t(4;1 1) (MLL/AF4).  - t (4; 1 1) (MLL / AF4).
- t(9;22) p190.  - t (9; 22) p190.
- Hipodiploidía <44 cromosomas o índice DNA <0,81 (se requiere confirmación por otras técnicas).  - Hypodiploidy <44 chromosomes or DNA index <0.81 (confirmation by other techniques is required).
- > 1.000 blastos en día +8 de la Inducción, en sangre periférica.  -> 1,000 blasts in day +8 of Induction, in peripheral blood.
- > 25% de blastos y >10% de ERM en el día +15 de la Inducción, en médula ósea.  -> 25% of blasts and> 10% of MRE on the +15 day of Induction, in bone marrow.
- ERM > 1 % en el día +33 de la Inducción, en médula ósea.  - MRE> 1% on day +33 of Induction, in bone marrow.
- ERM > 0,1 % antes de la Consolidación, en médula ósea.  - ERM> 0.1% before consolidation, in bone marrow.
RIESGO MEDIO: Aquellos pacientes que no reúnan los criterios de Riesgo Estándar ni de Riesgo Alto. MEDIUM RISK: Those patients who do not meet the criteria of Standard Risk or High Risk.
Dichos criterios son descritos en mayor detalle en la Guía de Recomendación Terapéutica SEHOP/PETHEMA 2013. En un modo de realización particular, opcionalmente en combinación con una o más de las características definidas descritas, dicho método comprende además la detección o cuantificación de uno o más marcadores genéticos descritos con valor pronóstico para LLA, preferiblemente comprende la determinación de la presencia de una o más de las translocaciones seleccionadas del grupo que consiste en t(12;21), t(1 ; 19), t(9;22) y t(4; 11), Hipodiploidía <44 cromosomas o índice DNA <0,81. These criteria are described in greater detail in the SEHOP / PETHEMA 2013 Therapeutic Recommendation Guide. In a particular embodiment, optionally in combination with one or more of the defined characteristics described, said method further comprises the detection or quantification of one or more Genetic markers described with prognostic value for ALL, preferably comprises determining the presence of one or more of the translocations selected from the group consisting of t (12; 21), t (1; 19), t (9; 22) and t (4; 11), Hypodiploidy <44 chromosomes or DNA index <0.81.
Dicho método puede comprender además la determinación de uno o más de los parámetros bioquímicos y/o clínicos descritos más arriba habitualmente utilizados para la estratificación de los pacientes de LLA en función del riesgo. Said method may further comprise the determination of one or more of the biochemical and / or clinical parameters described above commonly used for stratification of ALL patients according to risk.
El método de la invención puede comprender además el almacenaje de los resultados obtenidos en dispositivo de almacenamiento de datos. En un modo de realización, dicho dispositivo de almacenamiento de datos es una lámina de papel. En un modo de realización preferente, dicho dispositivo de almacenamiento de datos es un medio legible por ordenador. Como se usa en el presente documento, "un medio legible por ordenador" puede ser cualquier aparato que pueda incluir, almacenar, comunicar, propagar o transportar los resultados de la determinación del procedimiento de la invención. El medio puede ser un sistema (o aparato o dispositivo) electrónico, magnético, óptico, electromagnético, infrarrojo o semiconductor o un medio de propagación. The method of the invention may further comprise the storage of the results obtained in a data storage device. In one embodiment, said Data storage device is a sheet of paper. In a preferred embodiment, said data storage device is a computer readable medium. As used herein, "a computer-readable medium" may be any apparatus that may include, store, communicate, propagate or transport the results of the determination of the process of the invention. The medium may be an electronic, magnetic, optical, electromagnetic, infrared or semiconductor system (or apparatus or device) or a propagation medium.
Los métodos de la presente invención pueden ser implementados por un ordenador. Por lo tanto, un aspecto adicional de la invención se refiere a un método implementado por ordenador, en el que el método es cualquiera de los métodos descritos en el presente documento o cualquier combinación de los mismos. The methods of the present invention can be implemented by a computer. Therefore, a further aspect of the invention relates to a computer-implemented method, in which the method is any of the methods described herein or any combination thereof.
Así pues, cualquier programa de ordenador capaz de implementar cualquiera de los métodos de la presente invención o utilizado para implementar cualquiera de estos métodos o cualquier combinación de los mismos, también forma parte de la presente invención. Asimismo, cualquier dispositivo o aparato que comprende o que lleva un programa de ordenador capaz de llevar a cabo, o para la aplicación de cualquiera de los métodos de la presente invención o cualquier combinación de los mismos, se incluye también como parte de la presente memoria descriptiva. Thus, any computer program capable of implementing any of the methods of the present invention or used to implement any of these methods or any combination thereof, is also part of the present invention. Likewise, any device or apparatus comprising or carrying a computer program capable of carrying out, or for the application of any of the methods of the present invention or any combination thereof, is also included as part of the present specification. descriptive
En un aspecto asociado, la presente invención se refiere al uso in vitro de los niveles de expresión de las isoformas TCFL5 y CHA del gen TCFL5 determinados, preferiblemente de manera simultánea, en una muestra biológica aislada de un paciente con leucemia linfoblástica aguda (LLA) para el pronóstico y/o diagnóstico diferencial de pacientes con LLA, donde una reducción en los valores de expresión de TCFL5/CHA en la muestra del paciente respecto a valores de referencia es indicativa de LLA de alto riesgo. In an associated aspect, the present invention relates to the in vitro use of the expression levels of the TCFL5 and CHA isoforms of the TCFL5 gene determined, preferably simultaneously, in an isolated biological sample of a patient with acute lymphoblastic leukemia (ALL) for the prognosis and / or differential diagnosis of patients with ALL, where a reduction in the expression values of TCFL5 / CHA in the patient sample with respect to reference values is indicative of high-risk ALL.
Método para la personalización del tratamiento en función del riesgo Method for personalization of risk-based treatment
La invención hace también referencia a un método para la personalización del tratamiento o para la determinación del tratamiento más adecuado en función del perfil de riesgo del paciente, donde dicho método comprende el pronóstico y/o diagnóstico diferencial en función del riesgo según el método del primer aspecto de la invención. En un aspecto relacionado, la invención hace referencia a un método para el tratamiento de pacientes de LLA que comprende la administración de una cantidad terapéuticamente efectiva de un fármaco o combinación de fármacos donde dicho tratamiento se determina en función de la clasificación o estratificación de dicho paciente en función del riesgo según el método del primer aspecto de la invención. Dicha terapia está típicamente formado por la asociación de varios fármacos, pudiendo incluir entre otros vincristina, prednisona y antraciclinas (daunorrubicina o idarubicinao doxorrubicina), L-asparaginasa, y metotrexato , etc((lnaba, H., M. Greaves, and C.G. Mullighan, Acute lymphoblastic leukaemia. Lancet, 2013. 381(9881): p. 1943-55). The invention also refers to a method for the personalization of the treatment or for the determination of the most appropriate treatment based on the patient's risk profile, wherein said method comprises the prognosis and / or differential diagnosis according to the risk according to the method of the first aspect of the invention. In a related aspect, the invention refers to a method for the treatment of ALL patients that comprises the administration of a therapeutically effective amount of a drug or combination of drugs where said treatment is determined based on the classification or stratification of said patient. depending on the risk according to the method of First aspect of the invention. Such therapy is typically formed by the association of several drugs, including, among others, vincristine, prednisone and anthracyclines (daunorubicin or idarubicin or doxorubicin), L-asparaginase, and methotrexate, etc ((lnaba, H., M. Greaves, and CG Mullighan , Acute lymphoblastic leukaemia, Lancet, 2013. 381 (9881): p. 1943-55).
En la práctica clínica actual aquellos pacientes de LLA clasificados como de alto riesgo recibirán un tratamiento quimioterapéutico de mayor intensidad. Una mayor intensidad del tratamiento se caracteriza por una mayor dosificación y/o frecuencia de las administraciones respecto a la administración del mismo fármaco o combinación de fármacos en un paciente clasificado como de riesgo medio o bajo. Asimismo, un tratamiento de mayor intensidad puede consistir también en la administración de otros fármacos cuya utilización se considera más agresiva, por ejemplo al estar asociados a una mayor toxicidad. Método para la monitorización de la enfermedad y/o eficacia del tratamiento In current clinical practice, ALL patients classified as high-risk will receive more intensive chemotherapeutic treatment. A greater intensity of treatment is characterized by a greater dosage and / or frequency of administrations with respect to the administration of the same drug or combination of drugs in a patient classified as medium or low risk. Likewise, a treatment of greater intensity may also consist of the administration of other drugs whose use is considered more aggressive, for example, being associated with a higher toxicity. Method for disease monitoring and / or treatment efficacy
En otro aspecto, la presente invención se refiere también a un método para la monitorización de la progresión de la enfermedad y/o eficacia del tratamiento en pacientes con LLA que comprende la determinación de los niveles de expresión del gen TCFL5 donde dicha determinación incluye la cuantificación de la isoforma CHA.  In another aspect, the present invention also relates to a method for monitoring disease progression and / or efficacy of treatment in patients with ALL comprising the determination of levels of expression of the TCFL5 gene where said determination includes quantification of the CHA isoform.
En una realización preferida, se refiere a un método para la monitorización de la progresión de la enfermedad y/o eficacia del tratamiento en pacientes con LLA que comprende las siguientes etapas: In a preferred embodiment, it refers to a method for monitoring disease progression and / or efficacy of treatment in patients with ALL comprising the following stages:
a. determinar, preferiblemente de manera simultánea, los niveles de expresión de las isoformas TCFL5 y CHA del gen TCFL5 en una muestra biológica aislada de dicho paciente; y  to. determining, preferably simultaneously, the expression levels of the TCFL5 and CHA isoforms of the TCFL5 gene in a biological sample isolated from said patient; Y
b. comparar los niveles de expresión de TCFL5/CHA en la muestra del paciente con valores de referencia,  b. compare TCFL5 / CHA expression levels in the patient sample with reference values,
donde una reducción en los valores de la muestra del paciente respecto a los valores de referencia es indicativo de recaída. Típicamente, la toma de muestras se realiza al inicio del tratamiento, a lo largo del tratamiento y/o una vez finalizado el tratamiento, de manera cíclica o puntual. where a reduction in the values of the patient sample with respect to the reference values is indicative of relapse. Typically, the sampling is done at the beginning of the treatment, throughout the treatment and / or once the treatment is finished, in a cyclic or timely manner.
En un aspecto relacionado, la invención hace referencia al uso in vitro de los niveles de expresión de las isoformas TCFL5 y CHA del gen TCFL5 determinados, preferiblemente de manera simultánea, en una muestra biológica aislada de un paciente con leucemia linfoblástica aguda (LLA) para la monitorización de pacientes con LLA, donde una reducción en los valores de expresión de TCFL5/CHA en la muestra del paciente respecto a valores de referencia es indicativa de recaída. In a related aspect, the invention refers to the use in vitro of the expression levels of the TCFL5 and CHA isoforms of the TCFL5 gene determined, preferably simultaneously, in an isolated biological sample of a patient with acute lymphoblastic leukemia (ALL) for the monitoring of patients with ALL, where a reduction in values TCFL5 / CHA expression in the patient sample with reference values is indicative of relapse.
En un aspecto adicional, la invención se refiere a un método de obtención de datos útiles para el pronóstico, diagnóstico diferencial y/o monitorización de pacientes con leucemia linfoblástica aguda (LLA) que comprende: a. determinar, preferiblemente de manera simultánea, los niveles de expresión de las isoformas TCFL5 y CHA del gen TCFL5 en una muestra biológica aislada de dicho paciente. In a further aspect, the invention relates to a method of obtaining useful data for the prognosis, differential diagnosis and / or monitoring of patients with acute lymphoblastic leukemia (ALL) comprising: a. determine, preferably simultaneously, the expression levels of the TCFL5 and CHA isoforms of the TCFL5 gene in a biological sample isolated from said patient.
Realizaciones particulares y características preferidas de estos aspectos de la invención se han definido en aspectos anteriores, en particular en el primer aspecto de la invención. Kit para el pronóstico, diagnóstico diferencial y/o monitorización de pacientes con LLA Particular embodiments and preferred features of these aspects of the invention have been defined in previous aspects, in particular in the first aspect of the invention. Kit for prognosis, differential diagnosis and / or monitoring of patients with ALL
En otro aspecto, la invención hace referencia a un kit para el pronóstico, diagnóstico diferencial y/o monitorización de pacientes con LLA en un método de acuerdo con los aspectos anteriores de la invención, donde dicho kit comprende: a. un reactivo para determinar los niveles de expresión del gen TCFL5 donde dicha determinación incluye la cuantificación de la isoforma CHA; y  In another aspect, the invention refers to a kit for the prognosis, differential diagnosis and / or monitoring of patients with ALL in a method according to the previous aspects of the invention, wherein said kit comprises: a. a reagent to determine the expression levels of the TCFL5 gene where said determination includes the quantification of the CHA isoform; Y
b. opcionalmente, instrucciones para el uso de dicho reactivo para la determinación de los niveles de expresión de dichas isoformas en una muestra biológica aislada de dicho paciente.  b. optionally, instructions for the use of said reagent for the determination of the expression levels of said isoforms in a biological sample isolated from said patient.
En una realización preferida, dicho kit comprende: a. un reactivo para determinar, preferiblemente de manera simultánea, los niveles de expresión de las isoformas TCFL5 y CHA del gen TCFL5; y In a preferred embodiment, said kit comprises: a. a reagent to determine, preferably simultaneously, the expression levels of the TCFL5 and CHA isoforms of the TCFL5 gene; Y
b. opcionalmente, instrucciones para el uso de dicho reactivo para la determinación de los niveles de expresión de dichas isoformas en una muestra biológica aislada de dicho paciente.  b. optionally, instructions for the use of said reagent for the determination of the expression levels of said isoforms in a biological sample isolated from said patient.
En una realización más preferida, se refiere a un kit para el pronóstico, diagnóstico diferencial y/o monitorización de pacientes con leucemia linfoblástica aguda (LLA) que comprende: In a more preferred embodiment, it refers to a kit for the prognosis, differential diagnosis and / or monitoring of patients with acute lymphoblastic leukemia (ALL) comprising:
a. un cebador y/o sonda que comprende o consiste en una secuencia seleccionada del grupo que consiste en SEQ ID NO: 5 a SEQ ID NO: 76, y secuencias idénticas a cualquiera de las mismas en al menos 75%; y b. opcionalmente, instrucciones para el uso de dicho cebador y/o sonda para la determinación de los niveles de expresión de dichas isoformas en una muestra biológica aislada de dicho paciente. Más preferiblemente, dichos cebadores y/o sondas comprenden o consisten en una secuencia seleccionada del grupo que consiste en SEQ ID NO: 5 a SEQ ID NO: 42; SEQ ID NO: 45 a SEQ ID NO: 62 y SEQ ID NO: 71 a SEQ ID NO: 74, y secuencias idénticas a cualquiera de las mismas en al menos 75%. Aún más preferiblemente, dichos cebadores y/o sondas comprenden o consisten en una secuencia seleccionada del grupo que consiste en SEQ ID NO: 45 a SEQ ID NO: 62 y SEQ ID NO: 73 a SEQ ID NO: 74, y secuencias idénticas a cualquiera de las mismas en al menos 75%. to. a primer and / or probe comprising or consisting of a sequence selected from the group consisting of SEQ ID NO: 5 to SEQ ID NO: 76, and sequences identical to any of them at least 75%; Y b. optionally, instructions for the use of said primer and / or probe for the determination of the expression levels of said isoforms in a biological sample isolated from said patient. More preferably, said primers and / or probes comprise or consist of a sequence selected from the group consisting of SEQ ID NO: 5 to SEQ ID NO: 42; SEQ ID NO: 45 to SEQ ID NO: 62 and SEQ ID NO: 71 to SEQ ID NO: 74, and sequences identical to any of them at least 75%. Even more preferably, said primers and / or probes comprise or consist of a sequence selected from the group consisting of SEQ ID NO: 45 to SEQ ID NO: 62 and SEQ ID NO: 73 to SEQ ID NO: 74, and sequences identical to any of them at least 75%.
En una realización preferida, hace referencia a un kit para el pronóstico, diagnóstico diferencial y/o monitorización de pacientes con LLA que comprende: In a preferred embodiment, it refers to a kit for the prognosis, differential diagnosis and / or monitoring of patients with ALL comprising:
a. un par de cebadores seleccionados del grupo que consiste en las secuencias SEQ to. a pair of primers selected from the group consisting of the SEQ sequences
ID NO: 45 a SEQ ID NO: 62 y SEQ ID NO: 73 a SEQ ID NO: 74; y secuencias idénticas a cualquiera de las mismas en al menos un 85%; y ID NO: 45 to SEQ ID NO: 62 and SEQ ID NO: 73 to SEQ ID NO: 74; and sequences identical to any of them in at least 85%; Y
b. opcionalmente, instrucciones para el uso de dicho par de cebadores para la determinación de los niveles de expresión de dichas isoformas en una muestra biológica aislada de dicho paciente.  b. optionally, instructions for the use of said pair of primers for the determination of the expression levels of said isoforms in a biological sample isolated from said patient.
Preferiblemente, dicho cebador y/o sonda comprende o consiste en una secuencia seleccionada del grupo que consiste en SEQ ID NO: 45, SEQ ID NO: 46 y secuencias idénticas a cualquiera de las mismas en al menos 75%. Otras secuencias preferidas han sido descritas bajo el primer aspecto de la invención. Preferably, said primer and / or probe comprises or consists of a sequence selected from the group consisting of SEQ ID NO: 45, SEQ ID NO: 46 and sequences identical to any of them at least 75%. Other preferred sequences have been described under the first aspect of the invention.
En una realización particular de este aspecto de la invención, opcionalmente en combinación con una o más características de las realizaciones particulares descritas, dicho kit comprende además reactivos adecuados para llevar a cabo una cuantificación por PCR cuantitativa. Típicamente, incluye una DNA polimerasa, tal y como la Taq DNA polimerasa (por ejemplo la hot-start Taq DNA polimerasa), un tampón adecuado (por ejemplo Tris-HCI, pH 8-9), magnesio (por ejemplo, MgCI2), deoxinucleótidos (dNTPs) y opcionalmente otros reactivos, tales como gelatina y/o albúmina bovina. Además de reactivos para llevar a cabo la reacción de amplificación por PCR, dicho kit suele también llevar reactivos para la detección y cuantificación de los productos amplificados tal y como se ha descrito en el presente documento, por ejemplo moléculas fluorescentes de intercalado de ADN de doble cadena u oligonucleótidos marcados (por ejemplo, sondas de hidrólisis fluorescentes). En otra realización particular de este aspecto de la invención, opcionalmente en combinación con una o más características de las realizaciones particulares descritas, dicho kit comprende además reactivos adecuados para llevar a cabo la retrotranscripción del RNAm. Típicamente, incluye una transcnptasa reversa, tal y como la transcnptasa reversa del virus de la leucemia murina (MuLV RT), un tampón adecuado (por ejemplo Tris-HCI, pH 8-9), magnesio (por ejemplo, MgCI2), dNTPs, inhibidores de RNasa, y opcionalmente puede incluir otros reactivos tales como oligodTs marcados. In a particular embodiment of this aspect of the invention, optionally in combination with one or more features of the particular embodiments described, said kit further comprises reagents suitable for quantitative PCR quantification. Typically, it includes a DNA polymerase, such as Taq DNA polymerase (for example, the hot-start Taq DNA polymerase), a suitable buffer (for example Tris-HCI, pH 8-9), magnesium (for example, MgCI 2 ) , deoxynucleotides (dNTPs) and optionally other reagents, such as gelatin and / or bovine albumin. In addition to reagents for carrying out the PCR amplification reaction, said kit also usually carries reagents for the detection and quantification of the amplified products as described herein, for example double DNA intercalating fluorescent molecules. labeled chain or oligonucleotides (for example, fluorescent hydrolysis probes). In another particular embodiment of this aspect of the invention, optionally in combination with one or more features of the particular embodiments described, said kit further comprises reagents suitable for carrying out the mRNA transotranscription. Typically, it includes a reverse transcnptase, such as the murine leukemia virus (MuLV RT) reverse transcnptase, a suitable buffer (for example Tris-HCI, pH 8-9), magnesium (eg, MgCI 2 ), dNTPs , RNase inhibitors, and optionally may include other reagents such as labeled oligodTs.
En otra realización más preferida, dicho reactivo para la determinación, preferiblemente de manera simultánea, de los niveles de expresión de las isoformas TCFL5 y CHA del gen TCFL5 es un polipéptido, preferiblemente un anticuerpo, capaz de unirse específicamente a las isoformas TCFL5 y CHA a nivel proteico. Un experto en la técnica sabrá cómo generar anticuerpos que se unan a la región común de dichas isoformas. Dicho kit puede comprender en una realización particular reactivos para realizar un ensayo de inmunohistoquímica (ICH), que típicamente comprende un anticuerpo secundario conjugado con enzima (por ejemplo conjugado con peroxidasa de rábano picante (horseradish peroxidase) o fosfatasa alcalina), un sustrato enzimático y un colorante, por ejemplo, hematoxilina. In another more preferred embodiment, said reagent for the determination, preferably simultaneously, of the expression levels of the TCFL5 and CHA isoforms of the TCFL5 gene is a polypeptide, preferably an antibody, capable of specifically binding to the TCFL5 and CHA isoforms to protein level One skilled in the art will know how to generate antibodies that bind to the common region of said isoforms. Said kit may comprise in a particular embodiment reagents for performing an immunohistochemical (ICH) assay, which typically comprises a secondary antibody conjugated with enzyme (for example conjugated to horseradish peroxidase) or alkaline phosphatase), an enzyme substrate and a dye, for example, hematoxylin.
Realizaciones particulares y características preferidas de este aspecto de la invención se han definido en aspectos anteriores, en particular en el primer aspecto de la invención. Particular embodiments and preferred features of this aspect of the invention have been defined in previous aspects, in particular in the first aspect of the invention.
La invención se refiere también al uso de un kit para el pronóstico, diagnóstico diferencial y/o monitorización de pacientes con LLA en un método de acuerdo con los aspectos anteriores de la invención, donde dicho kit comprende: a. un reactivo para determinar los niveles de expresión del gen TCFL5 donde dicha determinación incluye la cuantificación de la isoforma CHA; y The invention also relates to the use of a kit for the prognosis, differential diagnosis and / or monitoring of patients with ALL in a method according to the above aspects of the invention, wherein said kit comprises: a. a reagent to determine the expression levels of the TCFL5 gene where said determination includes the quantification of the CHA isoform; Y
b. opcionalmente, instrucciones para el uso de dicho reactivo para la determinación de los niveles de expresión de dichas isoformas en una muestra biológica aislada de dicho paciente.  b. optionally, instructions for the use of said reagent for the determination of the expression levels of said isoforms in a biological sample isolated from said patient.
En una realización preferida, se refiere al uso de un kit para el pronóstico, diagnóstico diferencial y/o monitorización de pacientes con LLA en un método de acuerdo con los aspectos anteriores de la invención, donde dicho kit comprende: a un reactivo para determinar, preferiblemente de manera simultánea, los niveles de expresión de las isoformas TCFL5 y CHA del gen TCFL5; y In a preferred embodiment, it refers to the use of a kit for the prognosis, differential diagnosis and / or monitoring of patients with ALL in a method according to the above aspects of the invention, wherein said kit comprises: to a reagent to determine, preferably simultaneously, the expression levels of the TCFL5 and CHA isoforms of the TCFL5 gene; Y
b opcionalmente, instrucciones para el uso de dicho reactivo para la determinación de los niveles de expresión de dichas isoformas en una muestra biológica aislada de dicho paciente.  b optionally, instructions for the use of said reagent for the determination of the expression levels of said isoforms in a biological sample isolated from said patient.
Dicho cebador y/o sonda mencionado en la etapa a) para la determinación de los niveles de expresión de dichas isoformas en una muestra biológica aislada de dicho paciente ha sido descrito en el presente documento. Realizaciones particulares y características preferidas de este aspecto de la invención se han definido en aspectos anteriores, en particular en el primer aspecto de la invención. Said primer and / or probe mentioned in step a) for the determination of the expression levels of said isoforms in a biological sample isolated from said patient has been described herein. Particular embodiments and preferred features of this aspect of the invention have been defined in previous aspects, in particular in the first aspect of the invention.
Polinucleótido de la invención Polynucleotide of the invention
En un aspecto adicional, la invención está relacionada con una molécula nucleotídica o polinucleótido, preferiblemente una sonda y/o cebador, que híbrida específicamente a SEQ ID NO: 1 y/o SEQ ID NO: 2. Dichas sondas y/o cebadores son parcialmente complementarias, preferiblemente sustancial o completamente complementarias a SEQ ID NO: 1 y/o SEQ ID NO: 2 o a fragmentos de las mismas tal y como se ha descrito en otros aspectos de la invención. Asimismo, la presente invención hace referencia a una composición que comprende dicho polinucleótido y uno o más excipientes.  In a further aspect, the invention relates to a nucleotide or polynucleotide molecule, preferably a probe and / or primer, which specifically hybridizes to SEQ ID NO: 1 and / or SEQ ID NO: 2. Said probes and / or primers are partially complementary, preferably substantially or completely complementary to SEQ ID NO: 1 and / or SEQ ID NO: 2 or fragments thereof as described in other aspects of the invention. Likewise, the present invention refers to a composition comprising said polynucleotide and one or more excipients.
Preferiblemente, dicha secuencia es seleccionada del grupo que consiste en SEQ ID NO: 5 a SEQ ID NO: 76, y secuencias idénticas a cualquiera de las mismas en al menos 75%. Más preferiblemente, dichos cebadores y/o sondas comprenden o consisten en una secuencia seleccionada del grupo que consiste en SEQ ID NO: 5 a SEQ ID NO: 42; SEQ ID NO: 45 a SEQ ID NO: 62 y SEQ ID NO: 71 a SEQ ID NO: 74, y secuencias idénticas a cualquiera de las mismas en al menos 75%. Aún más preferiblemente, dichos cebadores y/o sondas comprenden o consisten en una secuencia seleccionada del grupo que consiste en SEQ ID NO: 45 a SEQ ID NO: 62 y SEQ ID NO: 73 a SEQ ID NO: 74, y secuencias idénticas a cualquiera de las mismas en al menos 75%. En una realización más preferida, dicha secuencia es seleccionada del grupo que consiste en SEQ ID NO: 45, SEQ ID NO: 46, y secuencias idénticas a cualquiera de las mismas en al menos 75%. Otras secuencias preferidas han sido descritas bajo el primer aspecto de la invención. En un aspecto relacionado, la invención se refiere al uso de una secuencia nucleotídica que híbrida específicamente a SEQ ID NO: 1 y/o SEQ ID NO: 2 como cebador y/o sonda en un método in vitro para el pronóstico, diagnóstico y/o monitorización de pacientes con LLA de acuerdo con los aspectos anteriores de la invención. Preferiblemente, dicha secuencia es seleccionada del grupo que consiste en SEQ ID NO: 5 a SEQ ID NO: 76, y secuencias idénticas a cualquiera de las mismas en al menos 75%. Más preferiblemente, dichos cebadores y/o sondas comprenden o consisten en una secuencia seleccionada del grupo que consiste en SEQ ID NO: 5 a SEQ ID NO: 42; SEQ ID NO: 45 a SEQ ID NO: 62 y SEQ ID NO: 71 a SEQ ID NO: 74, y secuencias idénticas a cualquiera de las mismas en al menos 75%. Aún más preferiblemente, dichos cebadores y/o sondas comprenden o consisten en una secuencia seleccionada del grupo que consiste en SEQ ID NO: 45 a SEQ ID NO: 62 y SEQ ID NO: 73 a SEQ ID NO: 74, y secuencias idénticas a cualquiera de las mismas en al menos 75%. En una realización más preferida, dicha secuencia es seleccionada del grupo que consiste en SEQ ID NO: 45, SEQ ID NO: 46 y secuencias idénticas a cualquiera de las mismas en al menos 75%. Otras secuencias preferidas han sido descritas bajo el primer aspecto de la invención. Preferably, said sequence is selected from the group consisting of SEQ ID NO: 5 to SEQ ID NO: 76, and sequences identical to any of them at least 75%. More preferably, said primers and / or probes comprise or consist of a sequence selected from the group consisting of SEQ ID NO: 5 to SEQ ID NO: 42; SEQ ID NO: 45 to SEQ ID NO: 62 and SEQ ID NO: 71 to SEQ ID NO: 74, and sequences identical to any of them at least 75%. Even more preferably, said primers and / or probes comprise or consist of a sequence selected from the group consisting of SEQ ID NO: 45 to SEQ ID NO: 62 and SEQ ID NO: 73 to SEQ ID NO: 74, and sequences identical to any of them at least 75%. In a more preferred embodiment, said sequence is selected from the group consisting of SEQ ID NO: 45, SEQ ID NO: 46, and sequences identical to any of them at least 75%. Other preferred sequences have been described under the first aspect of the invention. In a related aspect, the invention relates to the use of a nucleotide sequence that specifically hybridizes to SEQ ID NO: 1 and / or SEQ ID NO: 2 as a primer and / or probe in an in vitro method for prognosis, diagnosis and / or monitoring of patients with ALL according to the previous aspects of the invention. Preferably, said sequence is selected from the group consisting of SEQ ID NO: 5 to SEQ ID NO: 76, and sequences identical to any of them in at least 75%. More preferably, said primers and / or probes comprise or consist of a sequence selected from the group consisting of SEQ ID NO: 5 to SEQ ID NO: 42; SEQ ID NO: 45 to SEQ ID NO: 62 and SEQ ID NO: 71 to SEQ ID NO: 74, and sequences identical to any of them at least 75%. Even more preferably, said primers and / or probes comprise or consist of a sequence selected from the group consisting of SEQ ID NO: 45 to SEQ ID NO: 62 and SEQ ID NO: 73 to SEQ ID NO: 74, and sequences identical to any of them at least 75%. In a more preferred embodiment, said sequence is selected from the group consisting of SEQ ID NO: 45, SEQ ID NO: 46 and sequences identical to any of them at least 75%. Other preferred sequences have been described under the first aspect of the invention.
Realizaciones particulares y características preferidas de estos aspectos de la invención se han definido en aspectos anteriores, en particular en el primer aspecto de la invención. Particular embodiments and preferred features of these aspects of the invention have been defined in previous aspects, in particular in the first aspect of the invention.
En otro aspecto, la invención hace referencia a un método para la determinación in vitro, preferiblemente de manera simultánea, de los niveles de expresión de las isoformas TCFL5 y CHA del gen TCFL5 en una muestra biológica aislada de un paciente con leucemia linfoblástica aguda (LLA); donde los niveles de expresión de las isoformas TCFL5 y CHA se determinan a nivel de RNAm mediante el uso de un cebador y/o sonda seleccionado del grupo que consiste en las secuencias SEQ ID NO: 5 a SEQ I D NO: 76, y secuencias idénticas a cualquiera de las mismas en al menos 75%. Más preferiblemente, dichos cebadores y/o sondas comprenden o consisten en una secuencia seleccionada del grupo que consiste en SEQ ID NO: 5 a SEQ ID NO: 42; SEQ ID NO: 45 a SEQ ID NO: 62 y SEQ ID NO: 71 a SEQ ID NO: 74, y secuencias idénticas a cualquiera de las mismas en al menos 75%. Aún más preferiblemente, dichos cebadores y/o sondas comprenden o consisten en una secuencia seleccionada del grupo que consiste en SEQ ID NO: 45 a SEQ ID NO: 62 y SEQ ID NO: 73 a SEQ ID NO: 74, y secuencias idénticas a cualquiera de las mismas en al menos 75%. En una realización más preferida, dicho cebador y/o sonda consiste en una secuencia nucleotídica seleccionada del grupo que consiste en SEQ ID NO: 45, SEQ ID NO: 46 y una secuencia idéntica a cualquiera de las mismas en al menos 75%. Otras secuencias preferidas han sido descritas bajo el primer aspecto de la invención. In another aspect, the invention relates to a method for the determination in vitro, preferably simultaneously, of the expression levels of the TCFL5 and CHA isoforms of the TCFL5 gene in an isolated biological sample of a patient with acute lymphoblastic leukemia (ALL) ); where the expression levels of the TCFL5 and CHA isoforms are determined at the mRNA level by the use of a primer and / or probe selected from the group consisting of the sequences SEQ ID NO: 5 to SEQ ID NO: 76, and identical sequences to any of them at least 75%. More preferably, said primers and / or probes comprise or consist of a sequence selected from the group consisting of SEQ ID NO: 5 to SEQ ID NO: 42; SEQ ID NO: 45 to SEQ ID NO: 62 and SEQ ID NO: 71 to SEQ ID NO: 74, and sequences identical to any of them at least 75%. Even more preferably, said primers and / or probes comprise or consist of a sequence selected from the group consisting of SEQ ID NO: 45 to SEQ ID NO: 62 and SEQ ID NO: 73 to SEQ ID NO: 74, and sequences identical to any of them at least 75%. In a more preferred embodiment, said primer and / or probe consists of a nucleotide sequence selected from the group consisting of SEQ ID NO: 45, SEQ ID NO: 46 and a sequence identical to any of them at least 75%. Other preferred sequences have been described under the first aspect of the invention.
Realizaciones particulares y características preferidas de estos aspectos de la invención se han definido en aspectos anteriores, en particular en el primer aspecto de la invención. Particular embodiments and preferred features of these aspects of the invention have been defined in previous aspects, in particular in the first aspect of the invention.
Se contempla que cualquier modo de realización analizado en esta memoria descriptiva se puede implementar con respecto a cualquier método, kit, un polinucleótido, reactivo o uso de la invención, y viceversa. En particular, aquellas características detalladas y realizaciones particulares relativas al primer aspecto de la invención podrán también implementarse respecto a otros aspectos de la invención. Se entenderá que los modos de realización particulares descritos en el presente documento se muestran a modo de ilustración y no como limitaciones de la invención. Los rasgos característicos principales de la presente invención se pueden emplear en varios modos de realización sin apartarse del alcance de la invención. Los expertos en la técnica reconocerán, o serán capaces de determinar usando no más que experimentación rutinaria, numerosos equivalentes a los procedimientos específicos descritos en el presente documento. Se considera que estos equivalentes están dentro del alcance de la presente invención y están contemplados por las reivindicaciones. It is contemplated that any embodiment analyzed in this specification can be implemented with respect to any method, kit, a polynucleotide, reagent or use of the invention, and vice versa. In particular, those detailed features and particular embodiments relating to the first aspect of the invention may also be implemented with respect to other aspects of the invention. It will be understood that the particular embodiments described herein are shown by way of illustration and not as limitations of the invention. The main characteristic features of the present invention can be used in various embodiments without departing from the scope of the invention. Those skilled in the art will recognize, or will be able to determine using no more than routine experimentation, numerous equivalents to the specific procedures described herein. These equivalents are considered to be within the scope of the present invention and are contemplated by the claims.
El uso de la palabra "un" o "una" cuando se usa junto con el término "que comprende" en las reivindicaciones y/o la memoria descriptiva puede querer decir "uno" pero también es coherente con el significado de "uno o más", "al menos uno" y "uno o más de uno". El uso del término "o" en las reivindicaciones se usa para querer decir "y/o" a menos que se indique explícitamente para referirse a alternativas solo o las alternativas son mutuamente exclusivas, aunque la divulgación respalda una definición que se refiere solo a alternativas y "y/o". En toda esta solicitud, el término "aproximadamente" se usa para indicar que un valor incluye la variación de error inherente para el dispositivo, empleándose el procedimiento para determinar el valor, o la variación que existe entre los sujetos de estudio. The use of the word "a" or "a" when used in conjunction with the term "comprising" in the claims and / or the specification may mean "one" but is also consistent with the meaning of "one or more "," at least one "and" one or more than one ". The use of the term "or" in the claims is used to mean "and / or" unless explicitly stated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers only to alternatives. and me". Throughout this application, the term "approximately" is used to indicate that a value includes the variation of error inherent in the device, using the procedure to determine the value, or the variation that exists between the subjects of study.
Como se usa en esta memoria descriptiva y reivindicaciones, las palabras "comprender" (y cualquier forma de comprender, tal como "comprenden" y "comprende"), "tener" (y cualquier forma de tener, tal como "tienen" y "tiene"), "incluir" (y cualquier forma de incluir, tal como "incluye" y "incluyen") o "contener" (y cualquier forma de contener, tal como "contiene" y "contienen") son inclusivas o abiertas y no excluyen elementos o etapas del procedimiento no citados, adicionales. El término "comprende" engloba y específicamente describe "consiste esencialmente en" y "consiste en". Como se usa en el presente documento, la expresión "que consiste esencialmente en" limita el alcance de una reivindicación a los materiales o etapas especificados y a aquellos que no afectan materialmente a la(s) característica(s) básica(s) y novedosa(s) de la invención reivindicada. Como se usa en el presente documento, la expresión "que consiste en" excluye cualquier elemento, etapa o ingrediente no especificado en la reivindicación excepto, por ejemplo, impurezas habitualmente asociadas con el elemento o la limitación. As used in this specification and claims, the words "understand" (and any way of understanding, such as "understand" and "understand"), "have" (and any form of having, such as "have" and " has ")," include "(and any way of including, such as" include "and" include ") or" contain "(and any way of containing, such as" contains "and" contain ") are inclusive or open and do not exclude elements or stages of the procedure not mentioned, additional. The term "comprises" encompasses and specifically describes "consists essentially of" and "consists of". As used herein, the term "consisting essentially of" limits the scope of a claim to the specified materials or stages and those that do not materially affect the basic (s) and novel (s) feature (s). s) of the claimed invention. As used herein, the term "consisting of" excludes any element, step or ingredient not specified in the claim except, for example, impurities usually associated with the element or limitation.
El término "o combinaciones de los mismos" como se usa en el presente documento se refiere a todas las permutaciones y combinaciones de los puntos enumerados que preceden al término. Por ejemplo, "A, B, C o combinaciones de los mismos" se pretende que incluya al menos uno de: A, B, C, AB, AC, BC o ABC, y si el orden es importante en un contexto particular, también BA, CA, CB, CBA, BCA, ACB, BAC o CAB. Continuando con este ejemplo, se incluyen expresamente combinaciones que contienen repeticiones de uno o más puntos o términos, tales como BBB, AAA, AB, BBC, AAABCCCC, CBBAAA, CABABB, y así sucesivamente. El experto en la técnica entenderá que típicamente no existe un límite sobre el número de puntos o términos en cualquier combinación, a menos que sea evidente de otro modo a partir del contexto. The term "or combinations thereof" as used herein refers to all permutations and combinations of the enumerated points preceding the term. For example, "A, B, C or combinations thereof" is intended to include the minus one of: A, B, C, AB, AC, BC or ABC, and if the order is important in a particular context, also BA, CA, CB, CBA, BCA, ACB, BAC or CAB. Continuing with this example, combinations containing repetitions of one or more points or terms, such as BBB, AAA, AB, BBC, AAABCCCC, CBBAAA, CABABB, and so on, are expressly included. The person skilled in the art will understand that there is typically no limit on the number of points or terms in any combination, unless it is evident otherwise from the context.
Como se usa en el presente documento, palabras de aproximación tales como, sin limitación, "sobre", "alrededor de", "aproximadamente" se refieren a una condición que, cuando se modifica así, se entiende que no es necesariamente absoluta o perfecta sino que se consideraría lo suficientemente próxima para los expertos en la técnica para garantizar la designación de la condición como presente. La medida en que puede variar la descripción dependerá de lo grande que se pueda instituir un cambio y todavía reconozca un experto en la técnica que el rasgo característico modificado todavía tenga las características y capacidades requeridas del rasgo característico no modificado. En general, pero sujeto al análisis precedente, un valor numérico en el presente documento que se modifica por un palabra de aproximación tal como "aproximadamente" puede variar desde el valor establecido en ± 1 , 2, 3, 4, 5, 6, 7, 10, 12 o 15 %, o menos, preferiblemente representa el valor establecido (± 0%).. As used herein, approximation words such as, without limitation, "about", "about", "approximately" refer to a condition that, when modified as such, is understood to be not necessarily absolute or perfect It would be considered close enough for those skilled in the art to ensure the designation of the condition as present. The extent to which the description can vary will depend on how large a change can be instituted and a person skilled in the art still recognizes that the modified characteristic trait still has the required characteristics and capabilities of the unmodified characteristic trait. In general, but subject to the preceding analysis, a numerical value in this document that is modified by an approximation word such as "approximately" may vary from the value set at ± 1, 2, 3, 4, 5, 6, 7 , 10, 12 or 15%, or less, preferably represents the set value (± 0%).
EJEMPLOS EXAMPLES
Sitios WEB para el análisis de las bases de datos utilizadosWebsites for the analysis of the databases used
• Secuencias: • Sequences:
1. http://www.ncbi.nlm.nih.gov/  1. http://www.ncbi.nlm.nih.gov/
2. http://www.ensembl.org/index.html  2. http://www.ensembl.org/index.html
3. http://vega.sanger.ac.uk/index.html  3. http://vega.sanger.ac.uk/index.html
4. http://genome.ewha.ac.kr/ECgene/ · Alineamientos:  4. http://genome.ewha.ac.kr/ECgene/ · Alignments:
1. http://www.ncbi.nlm.nih.gov/  1. http://www.ncbi.nlm.nih.gov/
2. http://www.ensembl.org/index.html  2. http://www.ensembl.org/index.html
3. http://multalin.toulouse.inra.fr/multalin/  3. http://multalin.toulouse.inra.fr/multalin/
4. http://www.ncbi.nlm.nih.gov/spidey/  4. http://www.ncbi.nlm.nih.gov/spidey/
• Arrays: • Arrays:
1. http://www.ncbi.nlm.nih.gov/ 2. https://www.oncomine.org/resource/login.html 1. http://www.ncbi.nlm.nih.gov/ 2. https://www.oncomine.org/resource/login.html
3. http://www-test.ebi.ac.uk/gxa/  3. http://www-test.ebi.ac.uk/gxa/
4. http://www.cbioportal.org/  4. http://www.cbioportal.org/
5. http://www.tumorportal.org  5. http://www.tumorportal.org
Materiales y Métodos Obtención de muestras de pacientes Materials and Methods Obtaining patient samples
Se obtuvieron muestras de aspirado de médula ósea en el momento del diagnóstico o de la recaída, de 60 niños con LLA (edades 0-15 años) del Hospital Universitario Niño Jesús de Madrid. 18 LLA-T y 42 LLA-B  Bone marrow aspirate samples were obtained at the time of diagnosis or relapse of 60 children with ALL (ages 0-15 years) from the Niño Jesús University Hospital in Madrid. 18 LLA-T and 42 LLA-B
Clasificación de los pacientes Patient Classification
Se distinguieron 3 grupos de riesgo en función de una evaluación de los datos relativos a la edad del paciente y a los resultados obtenidos en una o más de las siguientes pruebas genéticas y/o bioquímicas:  Three risk groups were distinguished based on an evaluation of the data related to the patient's age and the results obtained in one or more of the following genetic and / or biochemical tests:
- Hematimetría estándar con hemocitómetro. - Standard hematimetry with hemocytometer.
- Citología convencional en extensión de muestra de médula ósea y en citospin de muestra de líquido cefalorraquídeo.  - Conventional cytology in bone marrow sample extension and in cerebrospinal fluid sample cytospin.
- Citometría de flujo multiparamétrica, preferiblemente en muestra de médula ósea.  - Multiparameter flow cytometry, preferably in a bone marrow sample.
- Técnicas citogenéticas clásicas y de bandeo de cromosomas, preferiblemente en muestra de médula ósea.  - Classic cytogenetic techniques and chromosome banding, preferably in a bone marrow sample.
- RT-PCR con cebadores específicos para las translocaciones t(12;21), t(1 ; 19), t(9;22) y t(4;1 1), preferiblemente en muestras de médula ósea.  - RT-PCR with specific primers for translocations t (12; 21), t (1; 19), t (9; 22) and t (4; 1 1), preferably in bone marrow samples.
- FISH con sondas para las translocaciones t(12;21), t(1 ; 19), t(9;22) y break apart en MLL, preferiblemente en muestras de médula ósea.  - FISH with probes for translocations t (12; 21), t (1; 19), t (9; 22) and break apart in MLL, preferably in bone marrow samples.
En base a los resultados obtenidos en dichas pruebas, los pacientes de LLA se clasificaron en uno de los siguientes grupos de riesgo: Based on the results obtained in these tests, ALL patients were classified into one of the following risk groups:
RIESGO ESTÁNDAR o RIESGO BAJO: El paciente debe reunir todos y cada uno de los siguientes criterios: STANDARD RISK or LOW RISK: The patient must meet each and every one of the following criteria:
- Edad >1 y <10 años.  - Age> 1 and <10 years.
- Leucocitos <20 x109/l al diagnóstico. - Leukocytes <20 x10 9 / l at diagnosis.
- Inmunofenotipo no T.  - Immunophenotype no T.
- Ausencia de infiltración del SNC y/o testes. Citogenética (uno de los dos criterios siguientes es suficiente): - Absence of infiltration of the CNS and / or tests. Cytogenetics (one of the following two criteria is sufficient):
■ Alta Hiperdiploidía (51-67 cromosomas), índice de DNA 1 , 10-1 ,44 (siempre confirmado por otras técnicas citogenéticas). ■ High Hyperdiploidy (51-67 chromosomes), DNA index 1, 10-1, 44 (always confirmed by other cytogenetic techniques).
■ t(12;21) positiva ■ t (12; 21) positive
Ausencia de t(1 ; 19)  Absence of t (1; 19)
No reordenamiento MLL  No MLL rearrangement
Presencia de < 1.000 blastos/mm3 en día +8 de la Inducción, en sangre periférica Presencia de < 5% de blastos y < 0,1 % de enfermedad residual mínima (ERM) médula ósea en día +15 de la Inducción y al final de la inducción IA  Presence of <1,000 blasts / mm3 in day +8 of Induction, in peripheral blood Presence of <5% of blasts and <0.1% of minimal residual disease (MRE) bone marrow in day +15 of Induction and at the end of induction IA
RIESGO ALTO: La existencia de cualquiera de los siguientes criterios determina la inclusión del paciente en este grupo: HIGH RISK: The existence of any of the following criteria determines the inclusion of the patient in this group:
- t(4;1 1) (MLL/AF4).  - t (4; 1 1) (MLL / AF4).
- t(9;22) p190.  - t (9; 22) p190.
Hipodiploidía <44 cromosomas o índice DNA <0,81 (se requiere confirmación por otras técnicas).  Hypodiploidy <44 chromosomes or DNA index <0.81 (confirmation by other techniques required).
> 1.000 blastos en día +8 de la Inducción, en sangre periférica.  > 1,000 blasts per day +8 Induction, in peripheral blood.
> 25% de blastos y >10% de ERM en el día +15 de la Inducción, en médula ósea.  > 25% blasts and> 10% MRE on the +15 day of Induction, in bone marrow.
ERM > 1 % en el día +33 de la Inducción, en médula ósea.  MRE> 1% on day +33 of Induction, in bone marrow.
ERM > 0,1 % antes de la Consolidación, en médula ósea.  ERM> 0.1% before consolidation, in bone marrow.
RIESGO MEDIO: Aquellos pacientes que no reúnan los criterios de Riesgo Estándar ni de Riesgo Alto. Western blot MEDIUM RISK: Those patients who do not meet the criteria of Standard Risk or High Risk. Western blot
Se utilizaron 20 ng de proteína correspondientes a las muestras de los pacientes por pocilio en geles al 10% de SDS-poliacrilamida y se aplicaron 90Voltios hasta que el frente de azul de bromocresol migró a la posición deseada. Las proteínas fueron transferidas (100Voltios a 4°C) a una membrana de nitrocelulosa durante 1 h 30min con el buffer e transferencia.  20 ng of protein corresponding to the patient samples per well in 10% gels of SDS-polyacrylamide were used and 90Volts were applied until the bromocresol blue front migrated to the desired position. The proteins were transferred (100 Volts at 4 ° C) to a nitrocellulose membrane for 1 h 30 min with the buffer and transfer.
Una vez transferidas las proteínas a la membrana de nitrocelulosa, se bloquearon uniones inespecíficas mediante su incubación durante una hora en una solución de BSA (Suero de Albúmina Bovina) al 5% en TBS-T. Antes de realizar el bloqueo, se realizó una tinción reversible con Rojo Ponceau que permite visualizar las proteínas transferidas. Once the proteins were transferred to the nitrocellulose membrane, nonspecific binding was blocked by incubation for one hour in a 5% solution of BSA (Bovine Albumin Serum) in TBS-T. Before performing the block, reversible staining was performed with Ponceau Red that allows visualizing the transferred proteins.
Los tiempos de incubación al igual que las concentraciones utilizadas de los anticuerpos se realizaron siguiendo las recomendaciones del fabricante. Se utilizó el anticuerpo policlonal anti TCFL5/CHA (SAB4500152, Sigma-Aldrich) y el anticuerpo secundario policlonal de cabra anti conejo Goat (A-21431 , Invitrogen). Entre dichas incubaciones se realizan 3 lavados de 15min con TBS-T y el último lavado con TBS. Incubation times as well as the concentrations of the antibodies used were made following the manufacturer's recommendations. The polyclonal anti TCFL5 / CHA antibody (SAB4500152, Sigma-Aldrich) and the goat polyclonal secondary antibody were used Goat rabbit (A-21431, Invitrogen). Among these incubations, 3 15-minute washes with TBS-T and the last wash with TBS are performed.
El revelado de la membrana se realizó con el kit SuperSignal (Thermo Scientific) o el kit Immun- Star HRP (BIO_RAD) siguiendo las recomendaciones del fabricante.  The membrane was developed using the SuperSignal kit (Thermo Scientific) or the Immun-Star HRP kit (BIO_RAD) following the manufacturer's recommendations.
Para la reutilización de las membranas se realizó un stripping con el Restore Western Blot Stripping Buffer (Thermo Scientific) siguiendo las recomendaciones del fabricante. For the reuse of the membranes a stripping was performed with the Restore Western Blot Stripping Buffer (Thermo Scientific) following the manufacturer's recommendations.
Aislamiento de células mononucleadas a partir de muestras de médula ósea Isolation of mononucleated cells from bone marrow samples
La extracción de células mononucleadas de pacientes se realizó mediante centrifugación por gradiente de densidad. Las muestras de medula osea de pacientes se diluyen a la mitad en PBS. En un tubo a parte se preparan 5 mi de Ficoll (Ficoll® Paque Plus, Sigma-Aldrich). La muestra de médula osea diluida se pone sobre el ficoll lentamente apoyando la punta sobre la pared del tubo para generar dos fases. Se centrifuga a 1500 rpm durante 25 minutos con deceleración baja a temperatura ambiente. Nos quedamos con la fase blanca que es donde se encuentran las células mononucleadas. Se lavan con PBS 1400 rpm durante 7 minutos para eliminar restos de ficoll. Tras el lavado, el pellet se resuspende en suero fetal bovino (FBS) y se criopreserva en viales de como máximo 12,5x106 células. The extraction of mononucleated cells from patients was performed by density gradient centrifugation. Bone marrow samples from patients are diluted in half in PBS. In a separate tube, 5 ml of Ficoll (Ficoll® Paque Plus, Sigma-Aldrich) are prepared. The diluted bone marrow sample is placed on the ficoll slowly supporting the tip on the tube wall to generate two phases. It is centrifuged at 1500 rpm for 25 minutes with low deceleration at room temperature. We are left with the white phase that is where the mononucleated cells are found. Wash with PBS 1400 rpm for 7 minutes to remove traces of ficoll. After washing, the pellet is resuspended in fetal bovine serum (FBS) and cryopreserved in vials of a maximum of 12.5x10 6 cells.
Extracción de RNA y RT-qPCR (Protocolo utilizado en el ejemplo 5) RNA extraction and RT-qPCR (Protocol used in example 5)
Una vez aisladas las células la extracción del RNA se llevó a cabo con RNeasy Plus Mini Kit (Qiagen) siguiendo las instrucciones del fabricante. Para la retrotranscripcion se utilizó el Kit TaqMan Reverse Transcription Reagents (Applied Biosystem, Life Technologies) siguiendo el programa: un ciclo a 42°C durante 45 minutos y un último ciclo a 99°C durante 3 minutos. Por último para la PCR a tiempo real se utilizó SYBR GREEN PCR Master Mix (Applied Biosystem, Life Technologies) siguiendo el programa: un ciclo 50°C durante 2 min, 95°C duante 10 minutos, 40 ciclos a 95°C durante 15 segundos y 58°C durante 1 minutos, curva de melting continua. La secuencia de los oligonucleótidos utilizados son TCFL5/CHA_F (SEQ ID NO: 45): 5' GAGACTGACAAGGCCACAACT 3', TCFL5/CHA_R (SEQ ID NO:46): 5' CCGCAAAATACGCTCTCAA 3', Beta-actina_F (SEQ ID NO: 77): CATGTACGTTGCTATCCAGGC; Beta-actina_R (SEQ ID NO: 78): CTCCTTAATGTCACGCACGAT. Once the cells were isolated, RNA extraction was carried out with RNeasy Plus Mini Kit (Qiagen) following the manufacturer's instructions. For the retrotranscription the TaqMan Reverse Transcription Reagents Kit (Applied Biosystem, Life Technologies) was used following the program: one cycle at 42 ° C for 45 minutes and one last cycle at 99 ° C for 3 minutes. Finally, for real-time PCR, SYBR GREEN PCR Master Mix (Applied Biosystem, Life Technologies) was used following the program: one cycle 50 ° C for 2 min, 95 ° C for 10 minutes, 40 cycles at 95 ° C for 15 seconds and 58 ° C for 1 minutes, continuous melting curve. The sequence of the oligonucleotides used are TCFL5 / CHA_F (SEQ ID NO: 45): 5 'GAGACTGACAAGGCCACAACT 3', TCFL5 / CHA_R (SEQ ID NO: 46): 5 'CCGCAAAATACGCTCTCAA 3', Beta-actin_F (SEQ ID NO: 77 ): CATGTACGTTGCTATCCAGGC; Beta-actina_R (SEQ ID NO: 78): CTCCTTAATGTCACGCACGAT.
Extracción de RNA y RT-qPCR (Protocolo utilizado en el ejemplo 6) RNA extraction and RT-qPCR (Protocol used in example 6)
Las muestras se conservaron en TRIzol (Life Technologies) a 70°C hasta su uso. La extracción del RNA total se realizó con RNeasy Plus Mini Kit (Qiagen) siguiendo las recomendaciones del fabricante. RT-qPCR cuantitativa. El RNAm se retrotranscribió a DNA complementario (DNAc) y se cuantificaron los genes con oligonucleótidos específicos (SEQ ID NO: 45 (TCFL5/CHA 01 Forward) y SEQ ID NO: 46 (TCFL5/CHA 01 reverse) de la Tabla III) con el kit GoTaq 2-Step RT-PCR System (Promega) siguiendo las recomendaciones del fabricante. The samples were stored in TRIzol (Life Technologies) at 70 ° C until use. Total RNA extraction was performed with RNeasy Plus Mini Kit (Qiagen) following the manufacturer's recommendations. Quantitative RT-qPCR. The mRNA was retrotranscribed to complementary DNA (cDNA) and the genes were quantified with specific oligonucleotides (SEQ ID NO: 45 (TCFL5 / CHA 01 Forward) and SEQ ID NO: 46 (TCFL5 / CHA 01 reverse) of Table III) with the GoTaq 2-Step RT-PCR System kit (Promega) following the manufacturer's recommendations.
Para la amplificación de los genes por PCR se sometieron las muestras a 95°C durante 5min, a continuación se realizaron 45 ciclos de 15s a 95°C, 30s a 59°C y 15s a 72°C; finalmente, se realiza un ciclo a 95°C en el termociclador ABIPrism 7900 HT SDS (Applied Biosystems). Los cálculos de cuantificación de la expresión de genes se realizaron por el método de comparación del ciclo umbral (Comparative Threshold Method, CT). Los valores obtenidos para cada gen se normalizaron con el gen House keeping HPRT (Hypoxantina-guanina fosforibosiltransferasa) para obtener el ACT, tras lo cual se normalizaron con el valor de la muestra control para obtener el ΔΔΟτ. La cantidad relativa, RQ, se calculó a partir de la siguiente formula RQ = 2"ΔΔ Γ. Los cebadores utilizados para cuantificar la expresión de HPRT fueron HPRT- Forward (SEQ ID NO: 79): CTGGAAAGAATGTCTTGATTGTGG; y HPRT- Reverse (SEQ ID NO: 80): CATCTTGGATTATACTGCCTGAC. For the amplification of the genes by PCR the samples were subjected to 95 ° C for 5min, then 45 cycles of 15s at 95 ° C, 30s at 59 ° C and 15s at 72 ° C were performed; finally, a cycle is carried out at 95 ° C in the ABIPrism 7900 HT SDS (Applied Biosystems) thermal cycler. Calculations of quantification of gene expression were performed by the method of comparing the threshold cycle (Comparative Threshold Method, C T ). The values obtained for each gene were normalized with the House keeping HPRT (Hypoxanthine-guanine phosphoribosyltransferase) gene to obtain AC T , after which they were normalized with the value of the control sample to obtain ΔΔΟ τ . The relative amount, RQ, was calculated from the following formula RQ = 2 "ΔΔ Γ . The primers used to quantify HPRT expression were HPRT-Forward (SEQ ID NO: 79): CTGGAAAGAATGTCTTGATTGTGG; and HPRT-Reverse (SEQ ID NO: 80): CATCTTGGATTATACTGCCTGAC.
Análisis estadísticos Statistical analysis
Los análisis de significancia y correlación estadísticos de expresión génica, se realizaron con las herramientas de análisis de GraphPad (5.0 para Windows) mediante los tests de ANOVA y T de Student para los análisis individuales y, de Spearman para los estudios de correlación tomando los datos como no paramétricos. Resultados  Statistical significance and correlation analyzes of gene expression were performed with GraphPad analysis tools (5.0 for Windows) using Student's ANOVA and T tests for individual analyzes and Spearman's for correlation studies taking the data as non parametric. Results
Ejemplo 1.- Determinación de mensajeros consenso e identificación de nuevas isoformas de TCFL5  Example 1.- Determination of consensus messengers and identification of new isoforms of TCFL5
Se efectuó un análisis bioinformático partiendo de datos de secuencias de RNAm de TCFL5 publicadas y analizando lecturas de uniones de exones, se establecieron los mensajeros consenso expresados en humano aumentando la cifra de las 2 isoformas previamente descritas (TCFL5 y CHA) a 6 isoformas. A bioinformatic analysis was carried out based on data from published mRNA sequences of TCFL5 and analyzing exon junction readings, consensus messengers expressed in human were established increasing the figure of the 2 isoforms previously described (TCFL5 and CHA) to 6 isoforms.
La Tabla I muestra los RNAm consenso o isoformas identificadas a partir de las secuencias de RNAm publicadas en las distintas bases de datos.
Figure imgf000039_0001
Variantes Exones Table I shows the consensus mRNAs or isoforms identified from the mRNA sequences published in the different databases.
Figure imgf000039_0001
Exon variants
(mRNA)  (mRNA)
TCFL5R (R) E1 NM_006602, ENST00000335351 OTTHUMT00000080079 H20C8515.6,  TCFL5R (R) E1 NM_006602, ENST00000335351 OTTHUMT00000080079 H20C8515.6,
E2a AB012124.1 , H20C8515.3 E3 AF070992.1  E2a AB012124.1, H20C8515.3 E3 AF070992.1
E4  E4
E5  E5
E8  E8
TCFL5R4b E1 XM_005260185.1  TCFL5R4b E1 XM_005260185.1
(R4b) E2a  (R4b) E2a
E3  E3
E4b  E4b
E5  E5
E8  E8
TCFL5R7 E1 XM_005260184.1 , ENST00000217162  TCFL5R7 E1 XM_005260184.1, ENST00000217162
(R7) E2a BC046933.1 ,  (R7) E2a BC046933.1,
E3 H20C8515.9  E3 H20C8515.9
E4  E4
E5  E5
E7  E7
TCFL5R4b6 E1 XM_005260186.1 ,  TCFL5R4b6 E1 XM_005260186.1,
(R4b6) E2a BC065520.1 ,  (R4b6) E2a BC065520.1,
E3  E3
E4b  E4b
E5  E5
E6  E6
TCFL5R6 E1 H20C8515.9  TCFL5R6 E1 H20C8515.9
(R6) E2a  (R6) E2a
E3  E3
E4  E4
E5  E5
E6  E6
CHA E2b AJ271337.1 H20C8515.5, CHA E2b AJ271337.1 H20C8515.5,
(R2b) E3 H20C8515.2 (R2b) E3 H20C8515.2
E4  E4
E5  E5
E8  E8
Tabla I. Se indican los códigos de acceso para cada uno de los RNAm de TCFL5 descritos en bases de datos y la asociación de acuerdo con el análisis bioinformático efectuado por los inventores. Table I. The access codes for each of the TCFL5 mRNAs described in databases and the association according to the bioinformatic analysis performed by the inventors are indicated.
La Tabla II proporciona datos adicionales referentes a las variantes o isoformas y a las secuencias de RNAm correspondientes. Variantes Comentarios Table II provides additional data regarding the variants or isoforms and the corresponding mRNA sequences. Variants Comments
Variante de referencia (RefSeq, NM_006602).  Reference variant (RefSeq, NM_006602).
H20C8515.3 presenta un 3'UTR más largo.  H20C8515.3 features a longer 3'UTR.
R AB012124.1 comienza 39 bases después saltándose el 1 er ATG, por lo que podría ser un mensajero parcial. Además, presenta un 3'UTR más corto. Q9UL49-1 es la traducción de este mensajero. AF070992.1 comienza 170 bases después saltándose el 1 er ATG, por lo que podría ser un mensajero R AB012124.1 begins 39 bases after skipping the 1st ATG, so it could be a partial messenger. In addition, it has a shorter 3'UTR. Q9UL49-1 is the translation of this messenger. AF070992.1 starts 170 bases after skipping the 1st ATG, so it could be a messenger
Esta variante es idéntica a R salvo porque su exón 4 tiene 3 bases menos en su extremo 5' (exón 4b).This variant is identical to R except that its exon 4 has 3 bases less at its 5 'end (exon 4b).
R4b R4b
Existen EST que soportan la existencia de esta variante.  There are ESTs that support the existence of this variant.
Presenta un exón final alternativo (denominado exón 7).  It presents an alternative final exon (called exon 7).
R7 XM_005260184.1 , ENST00000217162, BC046933.1 y H20C8515.8 muestran diferencias en la longitud de sus UTRs.  R7 XM_005260184.1, ENST00000217162, BC046933.1 and H20C8515.8 show differences in the length of their UTRs.
Presenta un exón final alternativo (denominado exón 6) y utiliza el exón 4 alternativo (3 bases menos en It presents an alternative final exon (called exon 6) and uses alternative exon 4 (3 bases less in
R4b6 R4b6
su extremo 5', exón 4b). BC065520.1 presenta algunos errores de secuenciación.  its 5 'end, exon 4b). BC065520.1 has some sequencing errors.
R6 Idéntica a R4b6 pero utiliza el exón 4 completo (exón 4a). Soportado por una EST.  R6 Identical to R4b6 but use full exon 4 (exon 4a). Supported by an EST.
CHA. Utiliza un exón inicial alternativo (exón 2b) que contiene un 5'UTR y una región codificante CHA. It uses an alternative initial exon (exon 2b) that contains a 5'UTR and a coding region
R2b coincidente con E2a. R2b coinciding with E2a.
H20C8515.2 y H20C8515.5 presentan 3'UTRs más largos.  H20C8515.2 and H20C8515.5 have 3'UTRs longer.
En base a dicho análisis bioinformático, se estableció que el gen TCFL5 se compone de 8 exones (ver Figura 1) siendo los exones 3 (E3) y 5 (E5) comunes a todas las isoformas. El exón 1 (E1) está presente en 5 de las 6 isoformas, faltando su expresión únicamente en la isoforma denominada CHA (R2b). El último exón puede estar representado por el exón 8, en el caso de la isoforma consenso TCFL5 (TCFL5R) y la isoforma CHA, por el exón 7 o bien por el exón 6. A su vez, la isoforma consenso TCFL5 (TCFL5R) y la isoforma que acaba con el exón 6, pueden presentar un exón 4 al cual le faltan los primeros codones (R4b6). Por su parte, la isoforma CHA presenta un exón 2 distinto al resto (E2b). Based on this bioinformatic analysis, it was established that the TCFL5 gene is composed of 8 exons (see Figure 1) with exons 3 (E3) and 5 (E5) common to all isoforms. Exon 1 (E1) is present in 5 of the 6 isoforms, its expression missing only in the isoform called CHA (R2b). The last exon may be represented by exon 8, in the case of the consensus isoform TCFL5 (TCFL5R) and the CHA isoform, by exon 7 or by exon 6. In turn, the consensus isoform TCFL5 (TCFL5R) and the isoform that ends with exon 6, can present an exon 4 that lacks the first codons (R4b6). For its part, the CHA isoform has an exon 2 different from the rest (E2b).
Ejemplo 2.- Diseño de oligonucleotidos para la detección de TCFL5/CHA Example 2.- Design of oligonucleotides for the detection of TCFL5 / CHA
En base a dicha determinación de los exones y variantes de los mismos que componen cada una de las isoformas, se procedió al diseño de cebadores que cuantifican TCFL5, CHA de manera independiente y TCFL5/CHA conjuntamente. Based on this determination of the exons and variants thereof that make up each of the isoforms, primers were designed that quantify TCFL5, CHA independently and TCFL5 / CHA together.
Para la cuantificacion de TCFL5/CHA se diseñaron cebadores que amplificaran una región común a ambas isoformas, es decir la región comprendida entre los exones 3 y 8 (ver Figs. 1 y 3). For the quantification of TCFL5 / CHA primers were designed that amplify a region common to both isoforms, that is, the region between exons 3 and 8 (see Figs. 1 and 3).
Asimismo, para la cuantificacion de las isoformas TCFL5 y CHA de manera específica, es decir cuantificando únicamente las isoformas TCFL5 y CHA (TCFL5R2b), se diseñaron cebadores específicos para la amplificación de una región comprendida entre los exones 5 y 8 de TCFL5 (ver Figs. 1 y 3). Tabla III.-Likewise, for the quantification of the TCFL5 and CHA isoforms specifically, that is, quantifying only the TCFL5 and CHA isoforms (TCFL5R2b), specific primers were designed for the amplification of a region between exons 5 and 8 of TCFL5 (see Figs 1 and 3). Table III.-
Primers para amplificar todas las isoformas Primers to amplify all isoforms
Nombre Pareja Nombre Nombre  Name Couple Name Name
Forward (51 - 3') Reverse (51 - 3') Exon cebadores secuencia secuencia Forward (5 1 - 3 ') Reverse (5 1 - 3') Exon primers sequence sequence
SEQID SEQID  SEQID SEQID
TodoTCFL5_01 TGCCTGAGCAAGTTTGGATT CGCATTCTACTCCGATTCCT 3y4  AllTCFL5_01 TGCCTGAGCAAGTTTGGATT CGCATTCTACTCCGATTCCT 3y4
NO:5 NO:6  NO: 5 NO: 6
SEQID SEQID  SEQID SEQID
TodoTCFL5_02 GAGTCCTCACAGGCAAACCT GATTCAACTCATCACAGCAAATG 4y 5  AllTCFL5_02 GAGTCCTCACAGGCAAACCT GATTCAACTCATCACAGCAAATG 4y 5
NO:7 NO:8  NO: 7 NO: 8
SEQID SEQID  SEQID SEQID
TodoTCFL5_03 CAACGTAGGGAGAGGCATAAC CAGAACGGCACTAAGAGATTCA 4y 5  AllTCFL5_03 CAACGTAGGGAGAGGCATAAC CAGAACGGCACTAAGAGATTCA 4y 5
NO:9 NO:10  NO: 9 NO: 10
SEQID SEQID  SEQID SEQID
TodoTCFL5_04 G CCTGAG CAAGTTTG G ATTAAAG GTGTCCAACTGACGCATTCTA 3y4  AllTCFL5_04 G CCTGAG CAAGTTTG G ATTAAAG GTGTCCAACTGACGCATTCTA 3y4
NO:ll NO:12  NO: ll NO: 12
SEQID SEQID  SEQID SEQID
TodoTCFL5_05 CACTAAACAGACGTTAGGTAGTAGAA GATTCCTCTTCAGTGCTTGTTTG 3y4  AllTCFL5_05 CACTAAACAGACGTTAGGTAGTAGAA GATTCCTCTTCAGTGCTTGTTTG 3y4
NO:13 NO:14  NO: 13 NO: 14
SEQID SEQID  SEQID SEQID
TodoTCFL5_06 AGGCATAACCGAATGGAAAG TTGCAGAACGGCACTAAGAG 4y 5  AllTCFL5_06 AGGCATAACCGAATGGAAAG TTGCAGAACGGCACTAAGAG 4y 5
NO:15 NO:16  NO: 15 NO: 16
SEQID SEQID  SEQID SEQID
TodoTCFL5_07 TGCCTGAGCAAGTTTGGAT ACGCATTCTACTCCGATTCC 3y4  AllTCFL5_07 TGCCTGAGCAAGTTTGGAT ACGCATTCTACTCCGATTCC 3y4
NO:17 NO:18  NO: 17 NO: 18
SEQID SEQID  SEQID SEQID
TodoTCFL5_08 AGAAATTGAATCCACTAAACAGACG CCAACTGACGCATTCTACTCC 3y4  AllTCFL5_08 AGAAATTGAATCCACTAAACAGACG CCAACTGACGCATTCTACTCC 3y4
NO:19 NO:20  NO: 19 NO: 20
SEQID SEQID  SEQID SEQID
TodoTCFL5_09 TCAACGTAGGGAGAGGCATA ACGGCACTAAGAGATTCAACTC 4y 5  AllTCFL5_09 TCAACGTAGGGAGAGGCATA ACGGCACTAAGAGATTCAACTC 4y 5
NO:21 NO:22  NO: 21 NO: 22
SEQID SEQID  SEQID SEQID
TodoTCFL5_10 TG CAATTTACATACCCACTGTTTAC CTCTAG G CAATCCAATATCCTG G 2y3  AllTCFL5_10 TG CAATTTACATACCCACTGTTTAC CTCTAG G CAATCCAATATCCTG G 2y3
NO:23 NO:24  NO: 23 NO: 24
SEQID SEQID  SEQID SEQID
TodoTCFL5_ll TGAATCTCTTAGTGCCGTTCTG CTCCATGTCTTTCCTG GATGTAT 5  AllTCFL5_ll TGAATCTCTTAGTGCCGTTCTG CTCCATGTCTTTCCTG GATGTAT 5
NO:25 NO:26  NO: 25 NO: 26
SEQID SEQID  SEQID SEQID
TodoTCFL5_12 GAGCCCTTGGAGAGATTCAG AGGTGCCACCGCCACACAAG 5  AllTCFL5_12 GAGCCCTTGGAGAGATTCAG AGGTGCCACCGCCACACAAG 5
NO:27 NO:28  NO: 27 NO: 28
SEQID SEQID  SEQID SEQID
TodoTCFL5_13 CTCTTAGTG CCGTTCTG CAA CTGTG GTCCACTG CAGAGTT 5  AllTCFL5_13 CTCTTAGTG CCGTTCTG CAA CTGTG GTCCACTG CAGAGTT 5
NO:29 NO:30  NO: 29 NO: 30
SEQID SEQID  SEQID SEQID
TodoTCFL5_14 GGGAGGAAGGTCTCAACGTA G GATTCTG CGCCTTCTATCT 4  AllTCFL5_14 GGGAGGAAGGTCTCAACGTA G GATTCTG CGCCTTCTATCT 4
NO:31 NO:32  NO: 31 NO: 32
SEQID SEQID  SEQID SEQID
TodoTCFL5_15 GAGCTCTGCTCGGCTAGTCT GAGCTCTGCTCGGCTAGTCT 4  AllTCFL5_15 GAGCTCTGCTCGGCTAGTCT GAGCTCTGCTCGGCTAGTCT 4
NO:33 NO:34  NO: 33 NO: 34
SEQID SEQID  SEQID SEQID
TodoTCFL5_16 GCAAACAAGCACTGAAGAGG G GG CTCTTCG CTCTACATTT 4  AllTCFL5_16 GCAAACAAGCACTGAAGAGG G GG CTCTTCG CTCTACATTT 4
NO:35 NO:36  NO: 35 NO: 36
SEQID SEQID  SEQID SEQID
TodoTCFL5_17 TGCCTGAGCAAGTTTGGAT ACGCATTCTACTCCGATTCC 3y4  AllTCFL5_17 TGCCTGAGCAAGTTTGGAT ACGCATTCTACTCCGATTCC 3y4
NO:37 NO:38  NO: 37 NO: 38
SEQID SEQID  SEQID SEQID
TodoTCFL5_18 AGAGCCCTTGGAGAGATTCA CCTACGCTGAGACCTTCCTC 3y4  AllTCFL5_18 AGAGCCCTTGGAGAGATTCA CCTACGCTGAGACCTTCCTC 3y4
NO:39 NO:40  NO: 39 NO: 40
SEQID SEQID  SEQID SEQID
TodoTCFL5_19 AAGGTCTCAGCGTAGGGAGA TTGCAGAACGGCACTAAGAG 3y4  AllTCFL5_19 AAGGTCTCAGCGTAGGGAGA TTGCAGAACGGCACTAAGAG 3y4
NO:41 NO:42 SEQID SEQID NO: 41 NO: 42 SEQID SEQID
TodoTCFL5_20 GAGCAAGTTTGGATTAAAGTGGG ACTGACGCATTCTACTCCGA 3y4  AllTCFL5_20 GAGCAAGTTTGGATTAAAGTGGG ACTGACGCATTCTACTCCGA 3y4
NO:71 NO:72  NO: 71 NO: 72
Primers para amplificar todas las isoformas menos CHA  Primers to amplify all isoforms except CHA
Nombre pareja Nombre Nombre  Couple Name Name Name
Forward (51 - 3') Reverse (51 - 3') Exon cebadores secuencia secuencia Forward (5 1 - 3 ') Reverse (5 1 - 3') Exon primers sequence sequence
SEQID SEQID  SEQID SEQID
7 5noCHA_01 TTCAACAG CATCCCCG C GTTGCTGAAGAGGAACATTCAT ly2  7 5NOCHA_01 TTCAACAG CATCCCCG C GTTGCTGAAGAGGAACATTCAT ly2
NO:43 NO:44  NO: 43 NO: 44
Primers para amplificar TCFL5/CHA  Primers to amplify TCFL5 / CHA
Nombre pareja Nombre Nombre  Couple Name Name Name
Forward (51 - 3') Reverse (51 - 3') Exon cebadores secuencia secuencia Forward (5 1 - 3 ') Reverse (5 1 - 3') Exon primers sequence sequence
SEQID SEQID SEQID SEQID
TCFL5/CHA_01 GAGACTGACAAGGCCACAACT CCG CAAAATACG CTCTCAA 5y8 TCFL5 / CHA_01 GAGACTGACAAGGCCACAACT CCG CAAAATACG CTCTCAA 5y8
NO:45 NO:46  NO: 45 NO: 46
SEQID SEQID SEQID SEQID
TCFL5/CHA_02 CTGACAAG G CCACAACTCTG CTTTAGCCTTCGGCCAGTT 5y8 TCFL5 / CHA_02 CTGACAAG G CCACAACTCTG CTTTAGCCTTCGGCCAGTT 5y8
NO:47 NO:48  NO: 47 NO: 48
SEQID SEQID SEQID SEQID
TCFL5/CHA_03 ATCTCTTAGTG CCGTTCTG C CCG CAAAATACG CTCTCAAATTC 5y8 TCFL5 / CHA_03 ATCTCTTAGTG CCGTTCTG C CCG CAAAATACG CTCTCAAATTC 5y8
NO:49 NO:50  NO: 49 NO: 50
SEQID SEQID SEQID SEQID
TCFL5/CHA_04 GTGATCGGACTGAACAGGAA CGAGTTTCAGGGATGACCTC 5y8 TCFL5 / CHA_04 GTGATCGGACTGAACAGGAA CGAGTTTCAGGGATGACCTC 5y8
NO:51 NO:52  NO: 51 NO: 52
SEQID SEQID SEQID SEQID
TCFL5/CHA_05 CTGACAAG G CCACAACTCTG CTTTAGCCTTCGGCCAGTT 5y8 TCFL5 / CHA_05 CTGACAAG G CCACAACTCTG CTTTAGCCTTCGGCCAGTT 5y8
NO:53 NO:54  NO: 53 NO: 54
SEQID SEQID SEQID SEQID
TCFL5/CHA_06 GTCCCGTCAGCTTGAGTCACG CTG CAGTG G ACCACAG CATTCC 3y8 TCFL5 / CHA_06 GTCCCGTCAGCTTGAGTCACG CTG CAGTG G ACCACAG CATTCC 3y8
NO:55 NO:56  NO: 55 NO: 56
SEQID SEQID SEQID SEQID
TCFL5/CHA_07 AAACTGGCCGAAGGCTAAA GTCCGATCACTTGATCTCCATC 8 TCFL5 / CHA_07 AAACTGGCCGAAGGCTAAA GTCCGATCACTTGATCTCCATC 8
NO:57 NO:58  NO: 57 NO: 58
SEQID SEQID SEQID SEQID
TCFL5/CHA_08 GTGATCGGACTGAACAGGAA TACTG G AGTCCCGTCAG CTT 8 TCFL5 / CHA_08 GTGATCGGACTGAACAGGAA TACTG G AGTCCCGTCAG CTT 8
NO:59 NO:60  NO: 59 NO: 60
SEQID SEQID SEQID SEQID
TCFL5/CHA_9 AATTTGAGAGCGTATTTTGCGG GGATTCCTGTTCAGTCCGATC 8 TCFL5 / CHA_9 AATTTGAGAGCGTATTTTGCGG GGATTCCTGTTCAGTCCGATC 8
NO:61 NO:62  NO: 61 NO: 62
SEQID SEQID SEQID SEQID
TCFL5/CHA_10 CACAGCATTCCTGAAATACATCC GTCTG GTCAG CTTTAG CCT 5y8 TCFL5 / CHA_10 CACAGCATTCCTGAAATACATCC GTCTG GTCAG CTTTAG CCT 5y8
NO:73 NO:74  NO: 73 NO: 74
Primers para amplificar CHA  Primers to amplify CHA
Nombre pareja Nombre Nombre  Couple Name Name Name
Forward (51 - 3') Reverse (51 - 3') Exon cebadores secuencia secuencia Forward (5 1 - 3 ') Reverse (5 1 - 3') Exon primers sequence sequence
SEQID SEQID  SEQID SEQID
SoloCHA_01 GGAAGAGGAGGACTTCCACA AGCAATACGTGGCAGACAAG 2b  SoloCHA_01 GGAAGAGGAGGACTTCCACA AGCAATACGTGGCAGACAAG 2b
NO:63 NO:64  NO: 63 NO: 64
SEQID SEQID  SEQID SEQID
SoloCHA_02 GCTCATCCCAGCCTGTAGTT TGTGGAAGTCCTCCTCTTCC 2b  SoloCHA_02 GCTCATCCCAGCCTGTAGTT TGTGGAAGTCCTCCTCTTCC 2b
NO:65 NO:66  NO: 65 NO: 66
SEQID SEQID  SEQID SEQID
SoloCHA_03 CATTCTTG G ATGTCAG G G AA TAGAGCTCAAAGCCTGCAAA 2b  SoloCHA_03 CATTCTTG G ATGTCAG G G AA TAGAGCTCAAAGCCTGCAAA 2b
NO:67 NO:68  NO: 67 NO: 68
SEQID SEQID  SEQID SEQID
SoloCHA_04 GAGAGTTGG GTTG CTGTCTG G GTTCAGATGGATGTCGAATGAGAG 2b  SoloCHA_04 GAGAGTTGG GTTG CTGTCTG G GTTCAGATGGATGTCGAATGAGAG 2b
NO:69 NO:70  NO: 69 NO: 70
SEQID SEQID E2b SEQID SEQID E2b
SoloCHA_05 G ACTTCCACAG CAG CG ATAG CTCTAG G CAATCCAATATCCTG SoloCHA_05 G ACTTCCACAG CAG CG ATAG CTCTAG G CAATCCAATATCCTG
NO:75 NO:76 y3 Ejemplo 3.- Diferente expresión de TCFL5 y CHA en tejidos y líneas celulares humanos NO: 75 NO: 76 y3 Example 3.- Different expression of TCFL5 and CHA in human tissues and cell lines
Se analizó la expresión de E1 y E2 codificante en las bases de datos citadas anteriormente y se observó una expresión preferente de E1 en cerebro, corazón, hígado, pulmón, riñon y testículo, mientras que el E2 se expresó preferencialmente en la línea celular T Jurkat, células mononucleadas de sangre periférica (PBMNCs), monocitos y células T y B. Los resultados se muestran en la Fig. 2. Ejemplo 4.- Determinación de los niveles de expresión de TCFL5 y CHA en líneas celulares tratadas con DAPT The expression of coding E1 and E2 in the databases cited above was analyzed and a preferential expression of E1 was observed in brain, heart, liver, lung, kidney and testis, while E2 was preferentially expressed in the Jurkat T cell line , peripheral blood mononucleated cells (PBMNCs), monocytes and T and B cells. The results are shown in Fig. 2. Example 4.- Determination of the expression levels of TCFL5 and CHA in cell lines treated with DAPT
Se determinaron mediante Western Blot los niveles de expresión de las isoformas TCFL5, CHA y HSP90 (como control), en células Jurkat (Clone E6-1 , ATCC® TIB-152™). Los resultados en la Fig.5 muestran que se observa una diferencia de expresión entre las isoformas CHA y TCFL5 para distintas concentraciones de DAPT. The expression levels of the TCFL5, CHA and HSP90 isoforms (as a control) in Jurkat cells (Clone E6-1, ATCC® TIB-152 ™) were determined by Western Blot. The results in Fig. 5 show that a difference in expression is observed between the CHA and TCFL5 isoforms for different concentrations of DAPT.
Ejemplo 5.- Comparación de los niveles de expresión de TCFL5/CHA RNAm en muestras de pacientes de LLA (LLA-B vs LLA-T, diagnóstico vs recaídas, riesgo alto vs medio vs bajo, y riesgo no alto vs riesgo alto) Example 5.- Comparison of TCFL5 / CHA mRNA expression levels in samples of ALL patients (ALL-B vs. ALL-T, diagnosis vs. relapse, high risk vs. medium vs. low, and non-high risk vs. high risk)
Los pacientes fueron clasificados en función del riesgo tal y como se describe en materiales y métodos. Los niveles de expresión de RNAm de TCFL5/CHA fueron determinados mediante Real Time qPCR. Patients were classified according to risk as described in materials and methods. The mRNA expression levels of TCFL5 / CHA were determined by Real Time qPCR.
Los datos se muestran en la Tablas IV-IX y en las gráficas en la figura 6 A, B y C, The data is shown in Tables IV-IX and in the graphs in Figure 6 A, B and C,
correspondientes a los datos en las Tablas IV, V y VI respectivamente. Se observan diferencias significativas entre las muestras en el momento del diagnóstico vs recaídas, LLA-B vs LLA-T y entre muestras de pacientes con bajo, medio y alto riesgo de recaída. corresponding to the data in Tables IV, V and VI respectively. Significant differences are observed between the samples at the time of diagnosis vs. relapse, ALL-B vs. ALL-T and between samples of patients with low, medium and high risk of relapse.
Tabla IV.- LLA-B (B) versus LLA-T (T), solo muestras al diagnóstico: Table IV.- ALL-B (B) versus ALL-T (T), only samples at diagnosis:
Figure imgf000045_0001
Figure imgf000045_0001
Tabla V.- Diagnósticos (DX) versus recaídas (REC): Table V.- Diagnoses (DX) versus relapses (REC):
Figure imgf000045_0002
Figure imgf000045_0002
Tabla VI.- Riesgo bajo (B), medio (M), alto (A), sólo muestras al diagnóstico: Table VI.- Low risk (B), medium (M), high (A), only samples at diagnosis:
Figure imgf000045_0003
Figure imgf000045_0003
Tabla VIL- Riesgo no alto (NA) versus riesgo alto (A), solo muestras al diagnóstico: VIL Table- Non-high risk (NA) versus high risk (A), only samples at diagnosis:
Figure imgf000045_0004
Figure imgf000045_0004
Las tablas siguientes presentan dichas comparaciones efectuadas sólo con las muestras de LLA-B (el grupo más numeroso). The following tables present these comparisons made only with the samples of LLA-B (the largest group).
Tabla VIII.- Diagnósticos (DX) versus recaídas (REC): Table VIII.- Diagnoses (DX) versus relapses (REC):
Figure imgf000046_0001
Figure imgf000046_0001
Tabla IX.- Riesgo bajo (B), medio (M), alto (A), sólo muestras al diagnóstico: Table IX.- Low (B), medium (M), high (A) risk, only samples at diagnosis:
Figure imgf000046_0002
Figure imgf000046_0002
Tabla X.- Riesgo no alto (NA) versus riesgo alto (A), solo muestras al diagnóstico: Table X.- Non-high risk (NA) versus high risk (A), only samples at diagnosis:
Figure imgf000046_0003
eem = error estándar de la media; p = significación estadística
Figure imgf000046_0003
eem = standard error of the mean; p = statistical significance
A los resultados de la tabla VI se le aplicó un análisis de discriminantes mediante el programa IBM SPSS Statistics Base con el objeto de averiguar el valor pronóstico (predictivo de riesgo de recaída) de los valores de expresión de TCFL5/CHA. Los resultados indican que los valores de expresión de TCFL5/CHA permiten predecir un 87% de los pacientes de alto riesgo (Tabla XI) A discriminant analysis was applied to the results of Table VI using the IBM SPSS Statistics Base program in order to determine the prognostic value (predictive of relapse risk) of the expression values of TCFL5 / CHA. The results indicate that the expression values of TCFL5 / CHA allow 87% of high-risk patients to be predicted (Table XI)
Tabla XI.- Pronóstico según los grupos de riesgo de recaída bajo, medio y alto según los niveles de expresión de TCFL5/CHA. Table XI.- Prognosis according to the low, medium and high relapse risk groups according to the expression levels of TCFL5 / CHA.
Pronóstico según los niveles de TCFL5/CHA Forecast according to TCFL5 / CHA levels
Riesgo Bajo Medio Alto Total Risk Low Medium High Total
Recuento Bajo 6 6 6 18Count Low 6 6 6 18
Clasificación Medio 1 4 7 12 clínica Alto 0 1 7 8 Classification Medium 1 4 7 12 clinic High 0 1 7 8
% Bajo 33,3 33,3 33,3 100,0 % Low 33.3 33.3 33.3 100.0
Medio 8,30 33,3 58,3 100,0Medium 8.30 33.3 58.3 100.0
Alto 0,0 12,5 87,5 100,0 High 0.0 12.5 87.5 100.0
Ejemplo 6.- Determinación de TCFL5/CHA RNAm en pacientes de LLA (diagnóstico vs recaídas) Example 6.- Determination of TCFL5 / CHA mRNA in ALL patients (diagnosis vs. relapse)
Determinación de los niveles de expresión de las isoformas TCFL5 y CHA a nivel de RNAm y proteína en muestras de pacientes de LLA clasificadas de alto o bajo riesgo de acuerdo con los criterios indicados en materiales y métodos. Los resultados se muestran en las Figuras 7A y 7B donde se observan mayores niveles de expresión de TCFL5/CHA en el momento del diagnóstico.  Determination of the levels of expression of the TCFL5 and CHA isoforms at the level of mRNA and protein in samples of ALL patients classified as high or low risk according to the criteria indicated in materials and methods. The results are shown in Figures 7A and 7B where higher levels of TCFL5 / CHA expression are observed at the time of diagnosis.

Claims

REIVINDICACIONES
Método pronóstico y/o para el diagnóstico diferencial de pacientes con leucemia linfoblástica aguda (LLA) que comprende las siguientes etapas: Prognostic method and / or for the differential diagnosis of patients with acute lymphoblastic leukemia (ALL) comprising the following stages:
a. determinar de manera específica y simultánea los niveles de expresión de las isoformas TCFL5 y CHA del gen TCFL5 en una muestra biológica aislada de dicho paciente; y b. comparar los niveles de expresión de TCFL5/CHA en la muestra del paciente con valores de referencia,  to. Specifically and simultaneously determine the expression levels of the TCFL5 and CHA isoforms of the TCFL5 gene in an isolated biological sample of said patient; and b. compare TCFL5 / CHA expression levels in the patient sample with reference values,
donde una reducción en los valores de la muestra del paciente respecto a los valores de referencia es indicativa de LLA de alto riesgo, y  where a reduction in the values of the patient sample with respect to the reference values is indicative of high-risk ALL, and
donde el término isoforma TCFL5 se refiere a las isoformas TCFL5R y TCFL5R4b.  where the term isoform TCFL5 refers to the isoforms TCFL5R and TCFL5R4b.
El método según la reivindicación 1 , donde dichas muestras de referencia corresponden a una o más muestras de pacientes con LLA o a líneas establecidas de LLA. The method according to claim 1, wherein said reference samples correspond to one or more samples of patients with ALL or to established lines of ALL.
El método según cualquiera de las reivindicaciones 1 o 2, donde los niveles de expresión de las isoformas TCFL5 y CHA se determinan a nivel de RNA mensajero (RNAm). The method according to any one of claims 1 or 2, wherein the expression levels of the TCFL5 and CHA isoforms are determined at the level of messenger RNA (mRNA).
El método según la reivindicación 3, donde los niveles de expresión de las isoformas TCFL5 y CHA se determinan mediante RT-PCR cuantitativa. The method according to claim 3, wherein the expression levels of the TCFL5 and CHA isoforms are determined by quantitative RT-PCR.
El método según cualquiera de las reivindicaciones 1 a 4, donde la determinación de los niveles de expresión de dichas isoformas se efectúa mediante el uso de un par de cebadores seleccionados del grupo que consiste en: The method according to any of claims 1 to 4, wherein the determination of the expression levels of said isoforms is carried out by using a pair of primers selected from the group consisting of:
a) un cebador que híbrida específicamente con una secuencia comprendida en el exón E3 y un cebador que híbrida con una secuencia comprendida en el exón E8;  a) a primer that hybridizes specifically with a sequence comprised in exon E3 and a primer that hybridizes with a sequence comprised in exon E8;
b) un cebador que híbrida específicamente con una secuencia comprendida en el exón E5 y un cebador que híbrida con una secuencia comprendida en el exón E8;  b) a primer that hybridizes specifically with a sequence comprised in exon E5 and a primer that hybridizes with a sequence comprised in exon E8;
c) un par de cebadores donde ambos hibridan específicamente con una secuencia comprendida en el exón E8.  c) a pair of primers where both hybridize specifically with a sequence comprised in exon E8.
El método según la reivindicación 5, donde dicho par de cebadores es seleccionado del grupo que consiste en las secuencias SEQ ID NO: 45 a SEQ ID NO: 62 y SEQ ID NO: 73 a SEQ ID NO: 74; y secuencias idénticas a cualquiera de las mismas en al menos un 85%. The method according to claim 5, wherein said pair of primers is selected from the group consisting of the sequences SEQ ID NO: 45 to SEQ ID NO: 62 and SEQ ID NO: 73 to SEQ ID NO: 74; and sequences identical to any of them in at least 85%.
7. El método según cualquiera de las reivindicaciones 5 o 6, donde dicho par de cebadores es seleccionado del grupo que consiste en los siguientes pares de cebadores: 7. The method according to any of claims 5 or 6, wherein said pair of primers is selected from the group consisting of the following pairs of primers:
- SEQ ID NO: 45 y SEQ ID NO: 46; - SEQ ID NO: 45 and SEQ ID NO: 46;
- SEQ ID NO:47 y SEQ ID NO:48;  - SEQ ID NO: 47 and SEQ ID NO: 48;
- SEQ ID NO:49 y SEQ ID NO:50;  - SEQ ID NO: 49 and SEQ ID NO: 50;
- SEQ ID NO:51 y SEQ ID NO:52;  - SEQ ID NO: 51 and SEQ ID NO: 52;
- SEQ ID NO:53 y SEQ ID NO:54,  - SEQ ID NO: 53 and SEQ ID NO: 54,
- SEQ ID NO:55 y SEQ ID NO:56;  - SEQ ID NO: 55 and SEQ ID NO: 56;
- SEQ ID NO:57 y SEQ ID NO:58;  - SEQ ID NO: 57 and SEQ ID NO: 58;
- SEQ ID NO:59 y SEQ ID NO:60;  - SEQ ID NO: 59 and SEQ ID NO: 60;
- SEQ ID NO:61 y SEQ ID NO:62;  - SEQ ID NO: 61 and SEQ ID NO: 62;
- SEQ ID NO:73 y SEQ ID NO:74; y secuencias idénticas a cualquiera de las mismas en al menos un 85%.  - SEQ ID NO: 73 and SEQ ID NO: 74; and sequences identical to any of them in at least 85%.
8. El método según cualquiera de las reivindicaciones 5 a 7, donde dicho par de cebadores consiste en las secuencias SEQ ID NO: 45 y SEQ ID NO: 46; y secuencias idénticas a cualquiera de las mismas en al menos un 85%. 8. The method according to any of claims 5 to 7, wherein said pair of primers consists of the sequences SEQ ID NO: 45 and SEQ ID NO: 46; and sequences identical to any of them in at least 85%.
9. El método según cualquiera de las reivindicaciones 1 o 2, donde los niveles de expresión de las isoformas TCFL5 y CHA se determinan a nivel proteico. 9. The method according to any of claims 1 or 2, wherein the expression levels of the TCFL5 and CHA isoforms are determined at the protein level.
10. El método según la reivindicación 9, donde los niveles de expresión de las isoformas TCFL5 y CHA se determinan mediante un inmunoensayo. 10. The method according to claim 9, wherein the expression levels of the TCFL5 and CHA isoforms are determined by an immunoassay.
1 1. El método según cualquiera de las reivindicaciones 1 a 10, donde dicha muestra biológica es una muestra aislada de médula ósea, de sangre periférica o de líquido cefalorraquídeo. 12. El método según la reivindicación 1 1 , donde dicha muestra consiste en células mononucleares aisladas. The method according to any one of claims 1 to 10, wherein said biological sample is an isolated sample of bone marrow, peripheral blood or cerebrospinal fluid. 12. The method according to claim 1, wherein said sample consists of isolated mononuclear cells.
13. El método según cualquiera de las reivindicaciones 1 1 o 12, donde dicha muestra ha sido obtenida en el momento del diagnóstico. 13. The method according to any one of claims 1 or 12, wherein said sample has been obtained at the time of diagnosis.
14. El método según cualquiera de las reivindicaciones 1 a 13, donde dicha leucemia linfoblástica aguda es una leucemia linfoblástica aguda de células B (LLA-B) o una leucemia linfoblástica aguda de células T (LLA-T). 14. The method according to any of claims 1 to 13, wherein said acute lymphoblastic leukemia is an acute lymphoblastic B-cell leukemia (ALL-B) or an acute lymphoblastic T-cell leukemia (ALL-T).
15. El método según la reivindicación 14, donde dicha leucemia linfoblástica aguda es LLA-B. 15. The method according to claim 14, wherein said acute lymphoblastic leukemia is ALL-B.
16. El método según cualquiera de las reivindicaciones 1 a 15, donde dichos pacientes tienen menos de 20 años. 16. The method according to any of claims 1 to 15, wherein said patients are less than 20 years old.
17. El método según la reivindicación 16, donde dichos pacientes tienen entre 0 y 15 años. 17. The method according to claim 16, wherein said patients are between 0 and 15 years old.
18. El método según cualquiera de las reivindicaciones 1 a 17, donde dicho método comprende además la detección o cuantificación de uno o más marcadores genéticos asociados a LLA de alto riesgo. 18. The method according to any of claims 1 to 17, wherein said method further comprises the detection or quantification of one or more genetic markers associated with high-risk ALL.
19. El método según cualquiera de las reivindicaciones 1 a 18, donde dicho método comprende además la determinación de la presencia de una o más de las translocaciones seleccionadas del grupo que consiste en t(12;21), t(1 ; 19), t(9;22) y t(4; 1 1), Hipodiploidía <44 cromosomas o índice DNA <0,81. 19. The method according to any of claims 1 to 18, wherein said method further comprises determining the presence of one or more of the translocations selected from the group consisting of t (12; 21), t (1; 19), t (9; 22) and t (4; 1 1), hypodiploidy <44 chromosomes or DNA index <0.81.
20. Un método para la determinación del tratamiento más adecuado para un paciente de LLA que comprende el pronóstico y/o diagnóstico diferencial según el método de cualquiera de las reivindicaciones 1 a 19. 20. A method for determining the most appropriate treatment for an ALL patient comprising the prognosis and / or differential diagnosis according to the method of any of claims 1 to 19.
21. Método para la monitorización de la progresión de la enfermedad y/o eficacia del tratamiento en pacientes con LLA que comprende las siguientes etapas: 21. Method for monitoring disease progression and / or efficacy of treatment in patients with ALL comprising the following stages:
a. determinar de manera específica y simultánea los niveles de expresión de las isoformas TCFL5 y CHA del gen TCFL5 en una muestra biológica aislada de dicho paciente; y  to. Specifically and simultaneously determine the expression levels of the TCFL5 and CHA isoforms of the TCFL5 gene in an isolated biological sample of said patient; Y
b. comparar los niveles de expresión de TCFL5/CHA en la muestra del paciente con valores de referencia,  b. compare TCFL5 / CHA expression levels in the patient sample with reference values,
donde una reducción en los valores de la muestra del paciente respecto a los valores de referencia es indicativo de recaída; y  where a reduction in the values of the patient sample with respect to the reference values is indicative of relapse; Y
donde el término isoforma TCFL5 se refiere a las isoformas TCFL5R y TCFL5R4b.  where the term isoform TCFL5 refers to the isoforms TCFL5R and TCFL5R4b.
22. El método según la reivindicación 21 , donde dichas muestras de referencia corresponden a una o más muestras de pacientes con LLA o a líneas establecidas de LLA. 22. The method according to claim 21, wherein said reference samples correspond to one or more samples of patients with ALL or to established lines of ALL.
23. El método según cualquiera de las reivindicaciones 1 a 22, donde dicho método comprende además almacenar los resultados de dicho método en un dispositivo de almacenamiento de datos. 23. The method according to any of claims 1 to 22, wherein said method further comprises storing the results of said method in a data storage device.
24. Programa informático que comprende las etapas del método definido en cualquiera de las reivindicaciones 1 a 22. 25. Un kit para el pronóstico, diagnóstico diferencial y/o monitorización de pacientes con LLA que comprende: 24. Computer program comprising the steps of the method defined in any one of claims 1 to 22. 25. A kit for the prognosis, differential diagnosis and / or monitoring of patients with ALL comprising:
a. un par de cebadores seleccionados del grupo que consiste en las secuencias SEQ ID NO: 45 a SEQ ID NO: 62 y SEQ ID NO: 73 a SEQ ID NO: 74; y secuencias idénticas a cualquiera de las mismas en al menos un 85%; y  to. a pair of primers selected from the group consisting of the sequences SEQ ID NO: 45 to SEQ ID NO: 62 and SEQ ID NO: 73 to SEQ ID NO: 74; and sequences identical to any of them in at least 85%; Y
b. opcionalmente, instrucciones para el uso de dicho par de cebadores para la determinación de los niveles de expresión de dichas isoformas en una muestra biológica aislada de dicho paciente.  b. optionally, instructions for the use of said pair of primers for the determination of the expression levels of said isoforms in a biological sample isolated from said patient.
26. El kit de acuerdo con la reivindicación 25, donde dicho kit comprende además una DNA polimerasa, un tampón para mantener el pH entre 8 y 9, magnesio, deoxinucleótidos26. The kit according to claim 25, wherein said kit further comprises a DNA polymerase, a buffer for maintaining the pH between 8 and 9, magnesium, deoxynucleotides
(dNTPs) y reactivos para llevar a cabo la cuantificación de los productos amplificados. (dNTPs) and reagents to carry out the quantification of the amplified products.
27. El kit de acuerdo con la reivindicación 26, donde dichos reactivos para llevar a cabo la cuantificación de los productos amplificados son moléculas fluorescentes de intercalado de ADN de doble cadena. 27. The kit according to claim 26, wherein said reagents for carrying out the quantification of the amplified products are double stranded DNA intercalating fluorescent molecules.
28. Uso de un kit para el pronóstico, diagnóstico diferencial y/o monitorización de pacientes con LLA en un método según cualquiera de las reivindicaciones 1 a 22, donde dicho kit comprende: 28. Use of a kit for the prognosis, differential diagnosis and / or monitoring of patients with ALL in a method according to any of claims 1 to 22, wherein said kit comprises:
a. un reactivo para determinar de manera específica y simultánea los niveles de expresión de las isoformas TCFL5 y CHA del gen TCFL5; y  to. a reagent to determine specifically and simultaneously the expression levels of the TCFL5 and CHA isoforms of the TCFL5 gene; Y
b. opcionalmente, instrucciones para el uso de dicho reactivo para la determinación de los niveles de expresión de dichas isoformas en una muestra biológica aislada de dicho paciente;  b. optionally, instructions for the use of said reagent for the determination of the expression levels of said isoforms in a biological sample isolated from said patient;
donde el término isoforma TCFL5 se refiere a las isoformas TCFL5R y TCFL5R4b.  where the term isoform TCFL5 refers to the isoforms TCFL5R and TCFL5R4b.
29. Uso de un kit de acuerdo con la reivindicación 28, donde dicho kit se define de acuerdo con las reivindicaciones 25 a 27. 30. Un polinucleótido que consiste en una secuencia nucleotídica seleccionada del grupo que consiste en SEQ ID NO: 45 a SEQ ID NO: 62 y SEQ ID NO: 73 a SEQ ID NO: 74; y secuencias idénticas a cualquiera de las mismas en al menos un 85%. 29. Use of a kit according to claim 28, wherein said kit is defined according to claims 25 to 27. 30. A polynucleotide consisting of a nucleotide sequence selected from the group consisting of SEQ ID NO: 45 to SEQ ID NO: 62 and SEQ ID NO: 73 to SEQ ID NO: 74; and sequences identical to any of them in at least 85%.
PCT/ES2017/070201 2016-04-01 2017-04-03 Use of tcfl5/cha as a new marker for the prognosis and/or differential diagnosis of acute lymphoblastic leukemia WO2017168031A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
ES201630400A ES2640524B1 (en) 2016-04-01 2016-04-01 USE OF TCFL5 / CHA AS A NEW MARKER FOR THE PROGNOSIS AND / OR DIFFERENTIAL DIAGNOSIS OF ACUTE LYMPHOBLASTIC LEUKEMIES
ESP201630400 2016-04-01

Publications (1)

Publication Number Publication Date
WO2017168031A1 true WO2017168031A1 (en) 2017-10-05

Family

ID=59963569

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/ES2017/070201 WO2017168031A1 (en) 2016-04-01 2017-04-03 Use of tcfl5/cha as a new marker for the prognosis and/or differential diagnosis of acute lymphoblastic leukemia

Country Status (2)

Country Link
ES (1) ES2640524B1 (en)
WO (1) WO2017168031A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2914723A1 (en) * 2020-12-15 2022-06-15 Univ Granada Biomarkers for diagnosis, prognosis, prevention, improvement or relief in the treatment of acute lymphoblastic leukemia of pediatric B cells (Machine-translation by Google Translate, not legally binding)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003083140A2 (en) * 2002-03-22 2003-10-09 St.Jude Children's Research Hospital, Inc. Classification and prognosis prediction of acute lymphoblasstic leukemia by gene expression profiling
EP2213738A2 (en) * 2002-11-14 2010-08-04 Dharmacon, Inc. siRNA molecules targeting Bcl-2

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003083140A2 (en) * 2002-03-22 2003-10-09 St.Jude Children's Research Hospital, Inc. Classification and prognosis prediction of acute lymphoblasstic leukemia by gene expression profiling
EP2213738A2 (en) * 2002-11-14 2010-08-04 Dharmacon, Inc. siRNA molecules targeting Bcl-2

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
GANDEMER VIRGINIE ET AL.: "Five distinct biological processes and 14 differentially expressed genes characterize TEL/AML1-positive leukemia", BMC GENOMICS, vol. 8, no. 1, 23 October 2007 (2007-10-23), London, UK, pages 385, XP055427430, ISSN: 1471-2164 *
SILVEIRA VANESSA S ET AL.: "Gene expression pattern contributing to prognostic factors in childhood acute lymphoblastic leukemia", LEUKEMIA & LYMPHOMA ENGLAND, vol. 54, no. 2, 31 January 2013 (2013-01-31), pages 310 - 314, ISSN: 1029-2403 *

Also Published As

Publication number Publication date
ES2640524B1 (en) 2018-09-24
ES2640524A1 (en) 2017-11-03

Similar Documents

Publication Publication Date Title
US10941451B2 (en) Biomarker panel for the detection of cancer
KR101357032B1 (en) Method for measuring resistance or sensitivity to docetaxel
Na et al. Long non-coding RNA UCA1 contributes to the progression of prostate cancer and regulates proliferation through KLF4-KRT6/13 signaling pathway
Ruan et al. Long intergenic noncoding RNA LINC00284 knockdown reduces angiogenesis in ovarian cancer cells via up-regulation of MEST through NF-κB1
US20210395834A1 (en) Abca1 downregulation in prostate cancer
Gado et al. Assessment of the diagnostic potential of miR-29a-3p and miR-92a-3p as circulatory biomarkers in acute myeloid leukemia
Rao et al. Identification of plasma exosomes long non-coding RNA HAGLR and circulating tumor cells as potential prognosis biomarkers in non-small cell lung cancer
ES2906203T3 (en) Novel CIP2A variant and uses thereof
ES2640524B1 (en) USE OF TCFL5 / CHA AS A NEW MARKER FOR THE PROGNOSIS AND / OR DIFFERENTIAL DIAGNOSIS OF ACUTE LYMPHOBLASTIC LEUKEMIES
KR102384992B1 (en) Age-specific biomarker of a patient with colorectal cancer and use thereof
US10151001B2 (en) Quantification of Lamin C and Lamin A for tumor classification
ES2352777B1 (en) METHOD AND KIT FOR THE FORECAST OF THE MANTO CELL LYMPHOMA
EP3321683A1 (en) Method for evaluating lymph node metastatic potential of endometrial cancer
ES2616540T3 (en) Methods to determine a survival prognosis for a patient with leukemia
KR102646011B1 (en) Diagnostic methods for prognosis of non-small-cell lung cancer using BRD3 SNP
WO2014173986A2 (en) Methods for diagnosing and monitoring the response to treatment of hepatocellular carcinoma
WO2015006543A1 (en) Method for predicting and detecting tumor metastasis in kidney cancer

Legal Events

Date Code Title Description
NENP Non-entry into the national phase

Ref country code: DE

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17773358

Country of ref document: EP

Kind code of ref document: A1

122 Ep: pct application non-entry in european phase

Ref document number: 17773358

Country of ref document: EP

Kind code of ref document: A1