WO2017162840A1

WO2017162840A1 - Sensitization of cancer cells to nampt inhibitors by nicotinic acid phosphoribosyltransferase neutralization

Info

Publication number: WO2017162840A1
Application number: PCT/EP2017/057021
Authority: WO
Inventors: Alessio NENCIONI; Francesco PIACENTE; Irene CAFFA; Michel Duchosal; Aimable NAHIMANA
Original assignee: Università Degli Studi Di Genova; Centre Hospitalier Universitaire Vaudois (Chuv)
Priority date: 2016-03-24
Filing date: 2017-03-23
Publication date: 2017-09-28
Also published as: ITUA20161967A1

Abstract

Pharmaceutical preparation for use in the treatment of cancer in a mammalian patient comprising at least one therapeutic agent which inhibits nicotinic acid phosphoribosyltransferase (NAPRT) enzymatic activity and at least one inhibitor of the enzyme nicotinamide phosphoribosyltransferase (NAMPT), in order to enhance the sensitivity of neoplastic cells to NAMPT inhibitors; the therapeutic agents can consist of chemical compounds that inhibit NAPRT enzymatic activity (including non-steroidal anti-inflammatory drugs).

Description

Title: Sensitization of cancer cells to NAMPT inhibitors by nicotinic acid phosphoribosyltransferase neutralization

DESCRIPTION

Technical Field

The present invention concerns the technical field of the pharmaceutical industry.

In particular, the invention relates to a new pharmaceutical preparation for use in the treatment of cancer, especially of tumors in which nicotinic acid phosphoribosyltransferase (NAPRT) is expressed.

Prior art

In 2012 about 14.1 million new cases of cancer occurred globally (excluding non- melanoma skin cancer) (1 ). Cancer caused about 8.2 million deaths, corresponding to 14.6% of all human deaths ("The top 10 causes of death Fact sheet N 310". WHO. May 2014). Therefore, it is crucial to identify new, cost- effective treatments to improve clinical outcomes.

Alterations in cell metabolism have emerged as one of the hallmarks of cancer that could possibly lead to new targeted therapeutic approaches (2).

A strong reliance on a sustained biosynthesis of nicotinamide adenine dinucleotide (NAD+) is surely to be included among these alterations (3). Features that are commonly encountered in cancer cells and that are thought to underlie their need to support NAD+ production include aberrant metabolic processes, increased cell proliferation, and, perhaps most importantly, the need to face constant NAD+ consumption by NAD+-degrading enzymes involved in DNA repair or in cell signalling (3).

NAD+ is a key molecule in the biology of normal cells and its presence is crucial in actively proliferating cells, such as cancer cells (4-5). Notably, NAD+ acts both as a co-enzyme in cellular redox reactions and as a substrate for enzymes, which actively degrade it, (producing nicotinamide as a side product) such as sirtuins, CD38 and PARPs (6).

Blocking NAD+ biosynthesis has been proposed as a novel strategy in oncology and the NAD+ biosynthetic machinery (Figure 1 ) is emerging as one of the most promising areas of investigation for the development of new anticancer agents (7).

The enzyme nicotinamide phosphoribosyltransferase (NAMPT) catalyzes the first reaction of the synthesis of NAD+ from nicotinamide. NAMPT plays a key role in the biosynthesis of NAD+ in mammalian cells (also preventing the accumulation of nicotinamide in cells) and mounting evidence indicates that NAMPT is frequently up-regulated in both solid and hematologic cancers (5).

In preclinical studies, NAMPT inhibition was found to exhibit remarkable anticancer activity (4-5). However, the clinical results with the first NAMPT inhibitors have been disappointing (8), probably due to the activity of other alternative pathways for NAD+ biosynthesis in cancer cells, exploiting the presence of NAD+ precursors other than nicotinamide in the tumor microenvironment (including nicotinic acid - NA).

Nicotinic acid phosphoribosyltransferase (NAPRT), the rate-limiting enzyme in NAD+ biosynthesis from NA, is structurally similar to NAMPT but lacks a binding site for NAMPT inhibitors (15). NAPRT is amplified in over 30% of ovarian cancers and in percentages ranging between 6% and 17% of liver, breast, head-neck, pancreas, and prostate cancers (10), clearly suggesting a plausible pro-oncogenic function for this enzyme. Similar to NAMPT, NAPRT also increases intracellular NAD+. However, as opposite to NAMPT, NAPRT does not show feedback inhibition by NAD+ itself, which may account for the efficiency with which NAPRT protects cells from oxidative damage (16).

To address the issue of NAMPRT's profusion in cancer, the Applicant studied its expression in a large dataset, namely cBioPortal for Cancer Genomics, and assessed the pattern of NAPRT amplification in several types of human cancer.

In order to complement the information obtained by the database cBioPortal, the Applicant studied the expression of NAPRT through the Human Protein Atlas database, wherein the current knowledge of the human proteome (mainly achieved through antibody-based methods) combined with transcriptomics analysis across all major tissues and organs of human body is collected. This analysis indeed confirmed a high NAPRT expression in several types of human cancers (including ovarian, pancreatic and breast cancer) (http://www.proteinatlas.org/ENSG00000147813-NAPRT/cancer).

To investigate the expression of NAPRT protein in the NCI-60 cell line collection, the Applicant utilized the NCI-60 proteome resource (http://129.187.44.58:7070/NCI60/query/proteins). According to this database, among all of the NCI-60 cell lines, the ovarian cancer cell lines were those exhibiting the highest NAPRT expression, although certain leukemia cells, as well as breast, colorectal, and lung cancer cells also expressed significant amounts of this protein (Figure 3).

In this context, it should be noted that previous work by Shamed et al. ("Loss of NAPRT1 Expression by Cancer-Specific Promoter Methylation Provides a Novel Predictive Biomarker for NAMPT Inhibitors" Clin Cancer Res; 19(24) 2013) confirmed that, albeit NAMPT inhibitors are highly active against many cancer cell lines in vitro, addition of NA does effectively rescue those cells that express NAPRT, allowing NAD+ biosynthesis from this alternative precursor.

The present invention is based on the unprecedented finding that the down- regulation of NAPRT or its pharmacological inhibition specifically enhance the sensitivity of cancer cells to NAMPT inhibitors.

Summary of the invention

In an aspect thereof, the present invention relates to a pharmaceutical preparation for use in the treatment of tumors in which nicotinic acid phosphoribosyltransferase (NAPRT) is expressed in a mammalian patient, comprising at least one therapeutic agent which inhibits NAPRT enzymatic activity and at least one nicotinamide phosphoribosyltransferase (NAMPT) inhibitor.

In another aspect of the present invention, said at least one therapeutic agent which inhibits NAPRT enzymatic activity is contained in at least one first dosage unit optionally together with a pharmaceutically acceptable carrier and said NAMPT inhibitor is contained in at least one second dosage unit optionally together with a pharmaceutically acceptable carrier, said dosage units being distinct units intended for simultaneous or separate administration.

In another aspect, said pharmaceutical preparation consists of a pharmaceutical composition comprising said at least one therapeutic agent which inhibits NAPRT enzymatic activity and said NAMPT inhibitor together with a pharmaceutically acceptable carrier.

In another aspect, the above-mentioned therapeutic agent which inhibits NAPRT is selected among non-steroidal anti-inflammatory drugs (NSAIDs),2- hydroxynicotinic acid, isonicotinic acid, 3-pyridylsulfonic acid, pyridine, acetanilide, picolinic acid, 3-pyridilacetic acid and benzoic acid (19, 20).

Examples of NSAIDs that can be used in the present invention are reported in the following Table 1 and are, namely, flufenamic acid, mefenamic acid, phenylbutazone, indomethacin, oxyphenbutazone, salicylic acid, acetylsalicylic acid, aminopyrine, antipyrine.

Compound Appai ente Ki* su NAPRT( M)

Flufenamic acid 10

Mefenamic 50

2-Pyraziuoic acid 75

Phenylbutazone 100

Indomethacin 150

Salicylic acid 160

2-Hydroxynicotinic acid 230

2-Fluoronicotinic acid 280

Oxyphenbutazone 300

Acetylsalicylic acid 500

Sulfinpyrazone 500

6-Chloronicotinic acid 560

Isonicotinic acid 750

3-PyridylsuIfonic acid 750

Pyridine 780

2 -Amine-nicotinic acid 820

Acetanilide 1000

Aminopyrine 1000

Antipyrine 1000

Picolinic acid 1160

3-Pvridvlacetic acid 1280

Benzoic acid 1900 Preferably, the above-mentioned therapeutic agent which inhibits NAPRT is selected from non-steroidal anti-inflammatory drugs.

The above-mentioned NAMPT inhibitor is preferably selected among the group consisting of FK866, CHS-828, GNE-617 and GNE-618.

Preferably, the NAMPT inhibitor is FK866.

The patient is a mammalian patient, in particular a human patient.

As used herein, "tumor" refers to a disease or disorder characterized by uncontrolled division of cells and the ability of these cells to spread, either by direct growth into adjacent tissue through invasion, or by implantation into distant sites by metastasis. Examples of tumors include, but are not limited to, primary cancer, metastatic cancer, carcinoma, lymphoma, leukemia, sarcoma, mesothelioma, glioma, germinoma, choriocarcinoma, prostate cancer, lung cancer, breast cancer, colorectal cancer, gastrointestinal cancer, bladder cancer, pancreatic cancer, endometrial cancer, ovarian cancer, melanoma, brain cancer, testicular cancer, kidney cancer, skin cancer, thyroid cancer, head and neck cancer, liver cancer, esophageal cancer, gastric cancer, intestinal cancer, colon cancer, rectal cancer, myeloma, neuroblastoma, pheochromocytoma, and retinoblastoma.

Preferably, the tumor is ovarian cancer, breast cancer, liver cancer, pancreatic cancer, leukemia, lymphoma, myeloma.

In another aspect, the present invention relates a method for enhancing the activity of NAMPT inhibitors in vitro, which includes the exposure of cultured cells to at least one agent which inhibits NAPRT and to at least one NAMPT inhibitor.

In particular, such NAMPT inhibitor is preferably selected among the group consisting of FK866, CHS-828, GNE-617 and GNE-618.

The above-mentioned agent which inhibits NAPRT is preferably selected from NSAIDs.

In another aspect thereof, the present application relates to a nicotinamide phosphoribosyltransferase (NAMPT) inhibitor for use in a method for the treatment of tumors in which nicotinic acid phosphoribosyltransferase (NAPRT) is expressed in a mammalian patient, wherein the method comprises subjecting the patient to a nicotinic acid-free diet or to a pellagragenic diet while the patient is being treated with the NAMPT inhibitor.

Preferably, in this method, the NAMPT inhibitor is selected among the group consisting of FK866, CHS-828, GNE-617 and GNE-618 and is preferably FK866. In another aspect thereof, the present application relates to a nicotinamide phosphoribosyltransferase (NAMPT) inhibitor for use in a method for the treatment of tumors in which nicotinic acid phosphoribosyltransferase (NAPRT) is expressed in a mammalian patient, wherein the method comprises subjecting the patient to a treatment with antibiotics while the patient is being treated with the NAMPT inhibitor, to prevent the production of nicotinic acid by the intestinal microbial flora (9).

Preferably, in this method, the antibiotics are selected among the group consisting of vancomycin, neomycin, rifaximin, ciprofloxacin, and metronidazole and is preferably a combination of vancomycin, neomycin and metronidazole.

Preferably, in this method, the NAMPT inhibitor is selected among the group consisting of FK866, CHS-828, GNE-617 and GNE-618 and is preferably FK866.

In another aspect thereof, the present application relates to a nicotinamide phosphoribosyltransferase (NAMPT) inhibitor for use in a method for the treatment of tumors in which nicotinic acid phosphoribosyltransferase (NAPRT) is expressed in a mammalian patient, wherein the method comprises subjecting the patient to a nicotinic acid-free diet or to a pellagragenic diet combined with an antibiotic treatment while the patient is being treated with the NAMPT inhibitor.

Preferably, in this method, the NAMPT inhibitor is selected among the group consisting of FK866, CHS-828, GNE-617 and GNE-618 and is preferably FK866. Preferably, in this method, the antibiotics are selected among the group consisting of vancomycin, neomycin, rifaximin, ciprofloxacin, and metronidazole and is preferably a combination of vancomycin, neomycin and metronidazole.

The therapeutic preparation and composition according to the invention may be administered with any available and efficient delivery system, comprising, but not limited to, oral, buccal, parenteral, inhalatory routes, topical application, by injection, by transdermic or rectal route (e.g. by means of suppositories) in dosage unit formulations containing conventional, pharmaceutically acceptable and nontoxic carriers, adjuvants and vehicles. The administration by parenteral route comprises subcutaneous, intravenous, intramuscular, intrasternal injection or infusion techniques.

The solid dosage forms for the administration by oral route comprise, for example, capsules, tablets, powders, granules and gels. In such solid dosage forms, the therapeutic agent compound may be mixed with at least one inert diluent such as, for example, sucrose, lactose or starch. These dosage forms normally also comprise additional substances different from the inert diluents, such as, for example, lubricating agents like magnesium stearate.

The injectable preparations, for example aqueous or oily sterile injectable solutions or suspensions, may be formulated according to the known technique and by optionally using appropriate dispersing, wetting and/or suspending agents.

The pharmaceutical preparations according to the present invention may be produced by using conventional pharmaceutical techniques, as described in the various pharmacopoeias or handbooks of the field such as, for example, "Remington's Pharmaceutical Sciences Handbook", Mack Publishing, New York, 18th Ed., 1990.

The average daily dosage of the therapeutic agents according to the present invention depends on many factors, such as, for example, the seriousness of the disease and the conditions of the patient (age, weight, sex). The dose may generally vary from 0.001 mg to 10 grams per day of compound according to the invention, optionally divided into more administrations.

In view of the role of NAD+ in cancer cell proliferation, the pharmaceutical preparation according to the present invention represents a new strategic approach to enhance the sensitivity of neoplastic cells to NAMPT inhibitors by NAPRT neutralization, thus allowing the treatment of patients suffering from cancer and improving survival and quality of life of such patients.

The pharmaceutical preparation according to the present invention also represents a new strategic approach to reduce the dose of NAMPT inhibitors required to achieve anticancer effects in patients, allowing to reduce at least some of the side effects of the NAMPT inhibitors themselves (18).

The present invention will be further described with reference to the appended drawings and to certain embodiments, which are provided below by way of illustration and not of limitation.

Brief description of the drawings

Fig. 1 is a scheme showing the NAD+ biosynthetic apparatus wherein Trp: tryptophan; Na: nicotinic acid, NAM, nicotinamide, NaMN: nicotinic acid mononucleotide; NMN, nicotinamide mononucleotide; NR, nicotinamide ribose; NaAD, nicotinic acid adenine dinucleotide; QPRT, quinolinate phosphoribosyltransferase; NAPRT, nicotinic acid phosphoribosyltransferase; NAMPT, nicotinamide phosphoribosyltransferase; NMRK, nicotinamide riboside kinase; NMNAT; nicotinamide mononucleotide adenylyltransferase; PARPs: poly (ADPribose) polymerases .

Fig. 2 is a histogram showing the frequency of NAPRT gene mutation, deletion and amplification, in human cancer (adapted from cBioPortal for Cancer Genomics).

Fig. 3 is a histogram showing NAPRT protein expression in the NCI-60 cell lines (23), including cell lines from central nervous system (CNS) malignancies, breast cancer, colorectal cancer, leukemia, melanoma, non-small cell lung cancer (NSCLC), ovarian cancer, prostate cancer, and renal cancer.

Fig. 4A is an immunoblotting showing the levels of NAPRT and β-actin protein in OVCAR-5 cells. Cells were lentivirally engineered to express either a scrambled short-hairpin RNA (scr-shRNA) or either one of two NAPRT-targeting shRNAs (NAPRT-shRNA1/2).

Fig. 4B is a graph showing doubling time of OVCAR-5 cells in which NAPRT was either silenced or not. OVCAR-5 cells were lentivirally engineered to express either a scrambled shRNA (scr-shRNA) or either one of two NAPRT-targeting shRNAs (NAPRT-shRNA1/2). Doubling Time was estimated using a dedicated software; the estimated doubling time is indicated in parenthesis. Fig. 4C consists of three histograms showing the viability of OVCAR-5 cells. 3x10³ OVCAR-5 cells expressing a scr-shRNA or the NAPRT-shRNA1/2 were plated in each well of 96-well plates and incubated with FK866 and with or without nicotic acid (NA) at the indicated concentrations. OVCAR-5 cell viability was detected 72h later using sulforhodamine B.

Fig. 5A is a histogram showing the intracellular NAD+ concentration in OVCAR-5 cells. 10⁵ cells expressing either a scr-shRNA or the NAPRT-shRNA1/2 were plated in each well of 96-well plates and incubated with FK866 or only medium RPMI, with or without NA at the indicated concentrations for 36h; intracellular nucleotide concentration was normalized to protein concentration as determined by standard Bradford assay.

Fig. 5B is a histogram showing intracellular NADH concentration in OVCAR-5 cells. 10⁵ cells expressing either a scr-shRNA or the NAPRT-shRNA1/2 were plated in each well of 96-well plates and incubated with FK866 or only medium RPMI, with or without NA at the indicated concentrations for 36h; intracellular nucleotide concentration was normalized to protein concentration as determined by standard Bradford assay.

Fig. 5C is a histogram showing the intracellular ATP concentration in OVCAR-5 cells. 10⁵ cells expressing either a scr-shRNA or the NAPRT-shRNA1/2 were plated in each well of 96-well plates and incubated with FK866 or only medium RPMI, with or without NA at the indicated concentrations for 36h; intracellular nucleotide concentration was normalized to protein concentration as determined by standard Bradford assay.

Fig 6A consists of three histograms showing viability of OVCAR-8 cells. Cells were lentivirally engineered to express a scr-shRNA or the NAPRT-shRNA1/2. 3x10³ cells were plated in each well of 96-well plates and incubated with FK866 at the indicated concentrations (nM) (or vehicle) with or without 10 μΜ NA; viability was detected 72h later using sulforhodamine B. OVCAR-8 cells expressing scr-shRNA, NAPRT-shRNA1 , or NAPRT-shRNA2 were found to have doubling times of 27h, 30.7h, and 30.9h, respectively.

Fig 6B consists of three histograms showing viability of OVCAR-4 cells. Cells were lentivirally engineered to express a scr-shRNA or the NAPRT-shRNA1/2. 3x10³ cells were plated in each well of 96-well plates and incubated with FK866 at the indicated concentrations (nM) (or vehicle) with or without 10 μΜ NA; viability was detected 72h later using sulforhodamine B. Cell doubling time not available.

Fig 6C consists of three histograms showing viability of Capan-1 cells. Cells were lentivirally engineered to express a scr-shRNA or the NAPRT-shRNA1/2. 3x10³ cells were plated in each well of 96-well plates and incubated with FK866 at the indicated concentrations (nM) (or vehicle) with or without 10 μΜ NA; viability was detected 72h later using sulforhodamine B. Capan-1 scr-shRNA, NAPRT-shRNA1 , NAPRT-shRNA2 were found to have doubling times of 31 .7 h, 32.2.7h, and 36.2h, respectively. Fig 7A is a histogram showing a quantification of a cell cycle analysis of OVCAR-5 cells. Cells were lentivirally engineered to express a scr-shRNA or the NAPRT- shRNA1/2. 3x10³ cells were plated in each well of 96-well plates and incubated with FK866 at the indicated concentration (nM) (or vehicle); cell cycle was analyzed 24h after FK866 addition by flow cytometric analysis of propidium-iodide stained nuclei (as described in 26).

Fig 7B is a histogram showing a quantification of a cell cycle analysis of Capan-1 cells. Cells were lentivirally engineered to express a scr-shRNA or the NAPRT- shRNA1/2. 3x10³ cells were plated in each well of 96-well plates and incubated with FK866 at the indicated concentration (nM) (or vehicle); cell cycle was analyzed 24h after FK866 addition by flow cytometric analysis of propidium-iodide stained nuclei (as described in 26).

Fig 8 is a histogram showing the viability of OVCAR-5 cells treated with FK866 with or without 2-hydroxynicotinate. 3x10³ OVCAR-5 cells were plated in each well of 96-well plates and incubated with FK866 at the indicated concentration with or without 2-hydroxynicotinate at the indicated concentrations; cell viability was detected 72h later using sulforhodamine B.

Fig 9A is a histogram showing the viability of OVCAR-5 cells treated with FK866 with or without salicylate. 3x10³ cells were plated in each well of 96-well plates and incubated with FK866 at the indicated concentration with or without salicylate at the indicated concentrations; cell viability was detected 72h later using sulforhodamine B.

Fig 9B is a histogram showing viability of OVCAR-5 cells treated with FK866 with or without acetylsalicylic acid (aspirin). 3x10³ cells were plated in each well of 96- well plates and incubated with FK866 at the indicated concentration with or without acetylsalicylic acid (aspirin) at the indicated concentrations; cell viability was detected 72h later using sulforhodamine B.

Fig. 10 consists of histograms showing the percentage of apoptotic leukemia/lymphoma/myeloma cells treated with FK866 with or without acetylsalicylic acid (aspirin). CCRF-CEM and Jurkat are acute lymphoblastic leukemia cells; ML2, NOMO, and NB4 are acute myeloid leukemia cells; Namalwa, Daudi, and Raji are Burkitt's lymphoma cells; ARH77, RPMI8226 and U266 are multiple myeloma cells. , 3x10⁵ cells were plated in each well of 96-well plates and incubated with concentrations of FK866 corresponding to the half- maximal inhibitory concentration (IC₅o; cell viability inhibition) for each cell line with or without acetylsalicylic acid (Aspirin) at 3.5 mM, with or without 10 μΜ NA at the indicated concentrations; cell death was detected 96h later by staining with Annexin-V/ 7-aminoactinomycin D (7AAD). Early apoptotic (Annexin-V+/7AAD-) and late apoptotic/necrotic (Annexin-V+/7AAD+) cells were quantified by flow cytometry.

Fig. 1 1 shows the survival of SCID mice harboring Namalwa cell xenografts. SCID mice were injected subcutaneously into the back with 10⁷ Namalwa cells. Mice were treated with vehicle (control; CT) FK866 (10 mg/kg b.i.d; intraperitoneal injection) with or without acetylsalicylic acid (ASA; 35 mg/kg b.i.d; intraperitoneal injection).

Fig. 12 is a graph showing the viability of OVCAR-5 cells treated with the NAMPT- inhibitor GMX-1778 (also named CHS 828) with or without 2-hydroxynicotinate (2- HNA). 2x10³ OVCAR-5 cells were plated in each well of 96-well plates, allowed to adhere overnight and then incubated for 72 h with GMX-1788 with or without 2- hydroxynicotinate at the indicated concentrations; cell viability was detected 72h later using sulforhodamine B.

Detailed description

There has been a recent reawakening of interest in targeting the altered metabolic state of cancer cells to combat cancer. Although the observation that cancer cells utilize atypical metabolic pathways was originally made quite some time ago, it was unclear how to exploit this property for cancer therapeutics development. However, there are now a number of inhibitors of metabolic enzymes and a wealth of cancer-genome data that are opening new avenues to target cancer metabolism (17).

One approach is to inhibit NAD+ biosynthesis.

Cancer cells seem to require higher levels of NAD+ and NADH compared to healthy cells because they have high metabolic demands and rely heavily on glycolysis, a process that is far less efficient than oxidative phosphorylation for generating ATP. In addition, cancer cells may require more NAD+ due the NAD+- consuming enzymes, such as CD38, sirtuins and PARPs, which are frequently highly active in cancer cells (21 ).

NAD+ metabolism appears to have a crucial role in the fate of cancer cells and its levels are maintained stable through a tight equilibrium between degradation and synthesis.

In particular, NAD+ biosynthesis is mediated by two distinct mechanisms, de novo biosynthesis of NAD+ from tryptophan and the salvage pathways. Among the salvage pathways, the one converting nicotinamide to NAD+, represents the main route for NAD+ production in mammals (22).

NAMPT is the rate-limiting enzyme that catalyzes the first step in the biosynthesis of NAD+ from nicotinamide,

It is known that NAMPT can be neutralized using specific molecules (chemical inhibitors) that can act in a competitive or in a non-competitive manner to inhibit its enzymatic activity.

Among said inhibitors, the following can be mentioned: FK866, CHS 828, GNE- 617 and GNE-618.

In particular FK866, namely 2-(E)-/V-[4-(1 -Benzoyl-4-piperidinyl)butyl]-3-(3- pyridinyl)-2-propenamide hydrochloride, is a highly specific, non-competitive, potent NAMPT inhibitor. It inhibits NAD+ biosynthesis and thereby induces cell death in different types of cancer cells.

However, it was shown that these NAMPT inhibitors can be ineffective due, possibly, to the exploitation of alternative pathways for NAD+ production by cancer cells (8).

It is also known that the particularly high expression of NAPRT in ovarian, breast, pancreatic, liver, and head and neck cancer, as well as in uveal melanoma (as documented through the cBioPortal for Cancer Genomics), suggests a possible important role for this enzyme in the biology of these cancers (Figure 2).

According to these data from primary cancers obtained from the database cBioPortal and from Human Protein Atlas, using the database of proteomics "NCI- 60 proteome resource" (23), it was demonstrated that the ovarian cancer cell lines from the NCI-60 cell line panel express the highest NAPRT levels (Figure 3).

In the present invention, it has been proposed to enhance the activity of NAMPT inhibitors in tumors which express or over-express NAPRT, by interfering with NAPRT-mediated NAD+ production.

A way to interfere with NAPRT-mediated NAD+ production is through downregulation of the NAPRT protein, by the use of appropriate agentsA number of technologies have been used in the attempt to reduce the expression of a defined protein.

For example, anti-sense oligonucleotides and ribozymes have been used for more than a decade to target specific mRNAs for degradation. Although these methods worked satisfactorily in some simple experimental models, they generally failed to achieve effective gene silencing in complex mammalian systems.

More recently, extraordinary developments have seen reagents exploiting the RNAi machinery (such as short interfering RNAs, microRNAs, or shRNAs, where the latter two types of nucleic acids are typically expressed in mammalian cells by cell transfection/transduction with specific plasmids/retro-lentiviruses) become the primary means by which most researchers target specific genes for silencing. Similarly, molecular biology approaches exploiting the CR!SPR/Cas9 apparatus have also recently emerged as another promising approach for genome editing and for selectively deleting specific genes in tissues (including human tissues).

As used herein, "shRNA" refers to a particular RNA structure with the shape of an hairpin which is processed inside the cells by Argonaute proteins, such as Dicer, becoming a short interfering RNA (siRNA) and, subsequently, an antisense RNA (usually about 21 nucleotides long) that interferes with the translation of a specific mRNA and/or induces its degradation through the RNA-induced silencing complex (RISC) (24). Therefore, shRNAs prevent the production of a specific protein by selectively targeting its corresponding mRNA.

As used herein, "NAPRT-shRNA" refers to a shRNA which contains a specific sequence to target the NAPRT mRNA. Two different NAPRT-shRNAs were first used to neutralize NAPRT in the ovarian cancer line OVCAR-5 by strongly reducing its expression.

Specifically, OVCAR-5 cells were lentivirally engineered to express either one of two NAPRT-targeting shRNAs (NAPRT-shRNA1 and NAPRT-shRNA2) or a scrambled shRNA (scr-shRNA).

As used herein, "scr-shRNA" refers to a shRNA with a random sequence that is predicted not to target any mRNA. Therefore, a scr-shRNA is typically used as a negative control in RNAi experiments.

Detection of NAPRT in protein lysates obtained after shRNA expression, was done by immunoblotting (Fig. 4A), which confirmed the expected NAPRT silencing in OVACR-5 cells.

Thereafter, the role of NAPRT in OVCAR-5 cell growth and in cell response to stress conditions (such as the stress caused by inhibition of NAMPT) was evaluated.

To address the issue of the growth rate of OVCAR-5 cells expressing the scr- shRNA or the NAPRT-shRNA1/2, the Applicant studied their doubling time (the time it takes for the cells to double their number) through Doubling Time software, wherein the doubling time is calculated as: [duration^*log(2) / log(Final concentration) - log(lnitial concentration)].

Down-regulation of NAPRT itself only showed minimal effects on OVCAR-5 cell proliferation (Figure 4B). Namely, when compared with the control cells (OVCAR-5 expressing the scr-shRNA) it was only possible to observe a 5-10% increase in the doubling time in OVCAR-5 cells expressing the NAPRT-shRNA2, which virtually completely abolished NAPRT expression in these cells (NAPRT protein no longer detectable by western blotting), as shown in Figure 4A.

It was then determined whether NAPRT- silencing might have an effect on the activity of a NAMPT inhibitor, namely of FK866. For this purpose, OVCAR-5 cells expressing a scr-shRNA or the NAPRT-shRNA1/2 were incubated with different concentrations of FK866 (including concentrations considered to be low - i.e. 10 nM - as well as relatively high concentrations - i.e. 100 nM) with or without NA and cell viability was detected 72h later using sulforhodamine B.

Sulforhodamine B is a dye that binds to cellular proteins. Thus, the amount of this dye, as revealed by dissolving it and by subsequent plate reading with a spectrophotometer, is directly proportional to the number of living cells in each well.

The results showed that the down-regulation of NAPRT markedly increased the sensitivity of OVCAR-5 cells to the NAMPT inhibitor, FK866 (Figure 4C).

Notably, this surprising effect was observed with the shRNA which was most effective at reducing the expression of NAPRT, namely with the shRNA2.

Interestingly, in OVCAR-5 cells, a 10 nM FK866 concentration was sufficient to induce a marked decrease in cell viability (more than 50%), while no effect of this FK866 concentration was observed in the control cells (scr-shRNA OVCAR-5).

In order to analyze thoroughly this effect (sensitization to the NAMPT inhibitor by NAPRT silencing) and to define potential underlying mechanisms, we monitored the intracellular levels of NAD(H) and of ATP in OVCAR-5 cells in response to NAPRT silencing with or without concomitant NAMPT inhibition . Intracellular NAD(H) and ATP levels were measured as described in (23) (Figure 5).

The obtained results showed the same trend as those of the above-described cell viability test.

Specifically, nucleotide depletion in response to FK866 was exacerbated in OVCAR-5 cells expressing the NAPRT-shRNA2 with nucleotide levels that, in these cells, were typically below 5-10% of the baseline concentrations, a condition that is known to be incompatible with cell survival (25).

The effect of NAPRT silencing was also studied in two additional ovarian cancer cell lines, OVCAR-8 and OVCAR-4, as well as in Capan-1 cells (pancreatic ductal adenocarcinoma), which were all found to express high NAPRT levels - comparable to those found in OVCAR-5 (Figure 6 and data not shown).

Cells were lentivirally engineered to express either the scr-shRNA or the NAPRT- shRNA1/2, plated and incubated with FK866 at increasing concentration with or without NA and cell viability was detected 72 h later using sulforhodamine B. Cell doubling times were calculated as specified above.

The results of these experiments were similar to those obtained in OVCAR-5 cells: cell viability was essentially only reduced by FK866 in cells expressing the NAPRT-shRNA2.

Cell cycle analyses were also performed to further understand the marked antiproliferative effect of FK866 observed in cells expressing NAPRT-shRNAs. These analyses were performed by flow cytometric quantification of propidium-iodide stained cell nuclei, as in (26).

These cell cycle studies showed that NAPRT silencing (with the NAPRT-shRNA2, which induced a stronger NAPRT silencing) led to a reduced number of cells in the G1 phase of the cell cycle in response to FK866 both in OVCAR-5 and in Capan-1 cells . Such an effect was accompanied by an increased percentage of hypodyploid nuclei, suggesting the activation of apoptosis (a cell death mechanism wherein nuclei exhibit a reduced DNA content due to DNA fragmentation and leakage from the nucleus) (Figure 7A and 7B)..

Another way to interfere with NAPRT-mediated NAD+ production is through inhibition of NAPRT activity, which, in turn, can be achieved either by inhibiting its catalytic site (active site), or by preventing any post-translational modifications of NAPRT that should promote enzyme activity, i.e. the formation of NAPRT homodimers - which is functional to its catalytic activity - or, alternatively, by inhibiting protein-protein interactions of NAPRT that are important for its function in NAD+ biosynthesis.

Several chemical compounds were previously reported to inhibit NAPRT activity, including the NA analogue, 2-hydroxynicotinate and several NSAIDs (19-20). Specifically, 2-hydroxynicotinate and two NSAIDs, salicylic acid and acetylsalicylic acid (aspirin), were tested for their ability to potentiate the anti-proliferative effects of FK866 in OVCAR-5 cells, as well as in several hematologic cancer cell lines.

OVCAR-5 were plated and incubated with FK866 with or without 2- hydroxynicotinate, salicylate, or acetylsalicylic acid, and, at the end of treatment, cell viability was detected using sulforhodamine B.

Leukemia cells were cultured in the presence of concentrations of FK866 corresponding to the IC₅o (cell viability inhibition) for each cell line for two days. Thereafter, aspirin was added at a 3.5 mM final concentration. Viability was detected 48 h later by Annexin-V/7AAD staining.

Surprisingly, for all of the compounds tested (2-hydroxynicotinic acid and the two NSAIDs) it was possible to highlight a striking ability to enhance the anticancer activity of FK866 (Figure 8, 9, 10).

The potential of NAPRT inhibition by aspirin to increase the antitumor activity of FK866 was also tested in vivo in mice that had been injected subcutaneously with 10⁷ Namalwa cells. Co-administering aspirin together with FK866 indeed led to a striking and significant increase in mouse survival (Figure 1 1 ) in the absence of obvious signs of clinical toxicity in the animals.

OVCAR-5 cells were also plated and incubated with another NAMPT inhibitor, namely GMX-1778 (27), also known as CHS 828, with or without 2- hydroxynicotinate, and, at the end of treatment, cell viability was detected using sulforhodamine B (Fig. 12). It clearly appears that the presence of 2- hydroxynicotinate strongly sensitizes these cancer cells to the NAMPT-inhibitor GMX-1778..Overall, the results reported above indicate that, in cancers expressing NAPRT, NAPRT itself is probably not necessary for the basal biosynthesis of NAD+. However, the activity of NAPRT may represent an important mechanism to maintain sufficient levels of NAD+ when NAMPT is inhibited or expressed at low levels.

Apparently even low levels of NAPRT allow to produce sufficient NAD+ amounts to ensure cancer cell viability in the presence of NAMPT inhibitors. Consistent with this notion, in cancer cells expressing NAPRT, a virtually complete removal of NAPRT itself appears to be necessary for the NAMPT inhibitor, e.g. FK866 or GMX-1778, to become effective (reducing intracellular NAD+ to levels that are incompatible with cell survival ).

Thus, the results shown in the present invention indicate that the expression of NAPRT is an important mechanism of resistance to NAMPT inhibitors in certain types of cancer (such as ovarian cancer, but also hematologic cancers) and that a therapeutic strategy that consists in the combination of NAMPT inhibitors with the inhibition of NAPRT enzymatic activity, is likely to lead to significant an enhanced anti-cancer effects.

The present invention provides a new strategy for the treatment of tumors that express NAPRT and that are poorly sensitive or resistant to NAMPT inhibitors, thus representing a significant advance in the treatment of neoplastic diseases.

The present invention also indicates a strategy to achieve therapeutic effects with low doses of NAMPT inhibitors, thanks to sensitization of cancer cells to the NAMPT inhibitors by NAPRT inhibition.

In particular, based on the results of the Applicant, the administration of the pharmaceutical preparation according to the present invention is particularly indicated for the treatment of ovarian cancer, breast cancer, pancreatic cancer, and hematologic cancers wherein NAPRT is expressed or overexpressed.

Moreover, it is possible to implement different embodiments of the invention, using NAPRT-inhibiting drugs that are cheap and approved for several clinical uses, including acetylsalicylic acid, flufenamic acid and indomethacin (Table 1 ).

Methods

Cell lines and reagents

OVCAR-5, OVCAR-4, OVCAR-8, Phoenix Capan-1 , Jurkat, CCRF-CEM, ML2, NB4, NOMO, Namalwa, Daudi, Raji, ARH-77, RPMI-8226, and U266 cells were all purchased from ATCC and cultured in RPMI1640 medium supplemented with 10% FCS and antibiotics. 2-hydroxynicotinic acid, NA, aspirin, salicylate were all from Sigma Aldrich. FK866 was provided by the NIMH chemical repository.

Lentiviral transduction

Lentiviral transduction for the expression of the scr-shRNA, or of the NAPRT- shRNA1/2 (all in pLKO.1 backbone, purchased from Sigma-Aldrich) was done as described in (Cea M, et al. PLoS One. 201 1 ;6(7):e22739).

Immunoblotting

Immunoblotting was for NAPRT and β-actin detection was done as in (Cea M, et al. PLoS One. 201 1 ;6(7):e22739). The anti-NAPRT and the anti- -actin antibodies were both from Santa Cruz Biotechnology.

Flow cytometry

Cell cycle analysis of OVCAR-5 and Capan-1 cells was done as described in Caffa I, et al. (Oncotarget. 2015 May 20;6(14):1 1820-32).

Determination of intracellular NAD+, NADH and ATP levels

Determination of intracellular NAD+, NADH and ATP levels in cell lysates was done as described elsewhere (Bruzzone S, et al. PLoS One. 2009 Nov 19;4(1 1 ):e7897).

Detection viability Cell viability detection by sulforhodamine B was done as described in Caffa I, et al. (Oncotarget. 2015 May 20;6(14):1 1820-32). Vaibility detection by Annexin- V/propidium iodide stasining and flow cytometry was done as described in Nahimana et al. (Blood. 2009 Apr 2;1 13(14):3276-86).

shRNA sequences

The sequences for the scr-shRNA, NAPRT-shRNA1 and NAPRT-shRNA2 were as follows:

scr-shRNA:

CCGGGCGCGAUAGCGCUAAUAAUUUCUCGAGAAAUUAUUAGCGCUAUCGC GCUUUUU

NAPRT-shNRA1 :

CCGGCACCAUGGCGUUGGGCUAUUGCUCGAGCAAUAGCCCAACGCCAUGG UGUUUUUG

NAPRT-shRNA2:

CCGGGUCAGUCCUCAUCGUAGUCAGCUCGAGCUGACUACGAUGAGGACUG ACUUUUUG

References

1 . World Cancer Report 2014. World Health Organization. 2014. pp. Chapter 1 .1

2. Hanahan D, Weinberg RA. Hallmarks of cancer: the next generation. Cell. 201 1 ;144:646-74)

3. Garten A, Schuster S, Penke M, Gorski T, de Giorgis T, Kiess W. Physiological and pathophysiological roles of NAMPT and NAD metabolism. Nat Rev Endocrinol. 2015.

4. Hasmann M, and Schemainda I, FK866, a Highly Specific Noncompetitive Inhibitor of Nicotinamide Phosphoribosyltransferase, Represents a Novel Mechanism for Induction of Cancer Cell Apoptosis Cancer Res. 2003; 63: 7436-42

5. Shackelford RE, Mayhall K, Maxwell NM, Kandil E, Coppola D. Nicotinamide phosphoribosyltransferase in malignancy: a review. Genes Cancer. 2013;4:447- 56

6. Imai SI, Guarente L, NAD+ and sirtuins in aging and disease Trends Cell Biol. 28 April 2014 pii: S0962-8924(14)00063-4.

7. Montecucco F, Cea M, Bauer I, Soncini D, Caffa I, Lasiglie D, et al. Nicotinamide phosphoribosyltransferase (NAMPT) inhibitors as therapeutics: rationales, controversies, clinical experience. Curr Drug Targets. 2013;14:637-43)

8. von Heideman A, Berglund A, Larsson R, Nygren P. Safety and efficacy of NAD depleting cancer drugs: results of a phase I clinical trial of CHS 828 and overview of published data, Cancer Chemother Pharmacol 2010; 65:1 165-72 9. Bogan KL, Brenner C. Nicotinic acid, nicotinannide, and nicotinannide riboside: a molecular evaluation of NAD+ precursor vitamins in human nutrition. Annu Rev Nutr. 2008;28:1 15-30.

10. Gao J, Aksoy BA, Dogrusoz U, Dresdner G, Gross B, Sumer SO, et al. Integrative analysis of complex cancer genomics and clinical profiles using the cBioPortal. Sci Signal. 2013;6:pl1 .

1 1 . Sahm F, Oezen I, Opitz CA, Radlwimmer B, von Deimling A, Ahrendt T, et al. The endogenous tryptophan metabolite and NAD+ precursor quinolinic acid confers resistance of gliomas to oxidative stress. Cancer Res. 2013;73:3225-34. 12. Stockwin LH, Vistica DT, Kenney S, Schrump DS, Butcher DO, Raffeld M, et al. Gene expression profiling of alveolar soft-part sarcoma (ASPS). BMC Cancer. 2009;9:22.

13. Berger F, Lau C, Dahlmann M, Ziegler M. Subcellular compartmentation and differential catalytic properties of the three human nicotinamide mononucleotide adenylyltransferase isoforms. J Biol Chem. 2005;280:36334-41 .

14. Song T, Yang L, Kabra N, Chen L, Koomen J, Haura EB, et al. The NAD+ synthesis enzyme nicotinamide mononucleotide adenylyltransferase (NMNAT1 ) regulates ribosomal RNA transcription. J Biol Chem. 2013;288:20908-17

15. Marietta AS, Massarotti A, Orsomando G, Magni G, Rizzi M, Garavaglia S. Crystal structure of human nicotinic acid phosphoribosyltransferase. FEBS Open

Bio. 2015;5:419-28

16. Hara N, Yamada K, Shibata T, Osago H, Hashimoto T, Tsuchiya M. Elevation of cellular NAD levels by nicotinic acid and involvement of nicotinic acid phosphoribosyltransferase in human cells. J Biol Chem. 2007;282:24574-82.

17. Shames DS1 , Elkins K, Walter K, Holcomb T, Du P, Mohl D, Xiao Y, Pham T, Haverty PM, Liederer B, Liang X, Yauch RL, O'Brien T, Bourgon R, Koeppen H, Belmont LD., "Loss of NAPRT1 Expression by Cancer-Specific Promoter Methylation Provides a Novel Predictive Biomarker for NAMPT Inhibitors" Clin Cancer Res; 19(24) 2013

18. Gaut ZN Aspirin use and risk of fatal cancer, Cancer Res. 1993; 53: 6074

19. Gaut ZN, Solomon HM, Inhibition of 7- 14 C-nicotinic acid metabolism in the human blood platelet by anti-inflammatory drugs. Res Commun Chem Pathol Pharmacol. 1970; 1 : 547-52

20. Gaut ZN, Solomon HM, Inhibition of nicotinate phosphoribosyltransferase in human platelet lysate by nicotinic acid analogs, Biochem Pharmacol. 1971 ;

20(10):2903-6

21 . Houtkooper RH, Canto C, Wanders RJ, Auwerx J. The secret life of NAD+: an old metabolite controlling new metabolic signaling pathways. Endocr Rev 2010;31 :194-223. 22. Chini CC, Guerrico AM, Nin V, Camacho-Pereira J, Escande C, Barbosa MT, Chini EN. Targeting of NAD metabolism in pancreatic cancer cells: potential novel therapy for pancreatic cancers. Clin Cancer Res. 2014 Jan 1 ;20(1 ):120-30

23. Moghaddas Gholami A, Hahne H, Wu Z, Auer FJ, Meng C, Wilhelm M, Kuster B, Global proteome analysis of the NCI-60 cell line panel, Cell Reports.

2013;4(3):609-20

24. I. Bantounas, L. A. Phylactoul and J. B. Uney "RNA interference and the use of small interfering RNA to study gene function in mammalian systems" Journal of Molecular Endocrinology (2004) 33, 545-557

25. Bruzzone S, Fruscione F, Morando S, Ferrando T, Poggi A, Garuti A, D'Urso A, Selmo M, Benvenuto F, Cea M, Zoppoli G, Moran E, Soncini D, Ballestrero A, Sordat B, Patrone F, Mostoslavsky R, Uccelli A, Nencioni A. Catastrophic NAD+ depletion in activated T lymphocytes through Nampt inhibition reduces demyelination and disability in EAE, PLoS One. 2009 19; 4(1 1 ): e7897

26. Nencioni A, Lauber K, Griinebach F, Van Parijs L, Denzlinger C, Wesselborg S, Brossart P, Cyclopentenone prostaglandins induce lymphocyte apoptosis by activating the mitochondrial apoptosis pathway independent of external death receptor signaling J Immunol. 2003; 171 :5148-56.

27. Beauparlant P, et al. Anticancer Drugs. 2009; 20:346-54.

Claims

1 . A pharmaceutical preparation for use in the treatment of tumors in which nicotinic acid phosphoribosyltransferase (NAPRT) is expressed in a mammalian patient, comprising at least one therapeutic agent which inhibits NAPRT enzymatic activity and at least one nicotinamide phosphoribosyltransferase (NAMPT) inhibitor.

2. The pharmaceutical preparation according to claim 1 , wherein said at least one therapeutic agent which inhibits NAPRT enzymatic activity is contained in at least one first dosage unit optionally together with a pharmaceutically acceptable carrier and said NAMPT inhibitor is contained in at least one second dosage unit optionally together with a pharmaceutically acceptable carrier, said dosage units being distinct units intended for simultaneous or separate administration.

3 The pharmaceutical preparation according to claim 1 , consisting of a pharmaceutical composition comprising said at least one therapeutic agent which inhibits NAPRT enzymatic activity and said NAMPT inhibitor together with a pharmaceutically acceptable carrier.

4. The pharmaceutical composition according to any one of claims 1 to 3, wherein said therapeutic agent which inhibits NAPRT enzymatic activity is selected among non-steroidal anti-inflammatory drugs (NSAIDs), 2-hydroxynicotinic acid, isonicotinic acid, 3-pyridylsulfonic acid, pyridine, acetanilide, picolinic acid, 3- pyridilacetic acid, and benzoic acid.

5. The pharmaceutical composition according to claims 4, wherein said therapeutic agent, which inhibits NAPRT is selected from NSAIDs.

6. The pharmaceutical composition according to any one of the preceding claims, wherein said NAMPT inhibitor is selected among the group consisting of FK866,

CHS-828, GNE-617 and GNE-618.

7. The pharmaceutical composition according to claim 6, wherein NAMPT inhibitor is FK866.

8. The pharmaceutical composition according to any one of the preceding claims, wherein said tumors in which nicotinic acid phosphoribosyltransferase (NAPRT) is expressed include primary cancer, metastatic cancer, carcinoma, lymphoma, leukemia, sarcoma, mesothelioma, glioma, germinoma, choriocarcinoma, prostate cancer, lung cancer, breast cancer, colorectal cancer, gastrointestinal cancer, bladder cancer, pancreatic cancer, endometrial cancer, ovarian cancer, melanoma, brain cancer, testicular cancer, kidney cancer, skin cancer, thyroid cancer, head-neck cancer, liver cancer, esophageal cancer, gastric cancer, intestinal cancer, colon cancer, rectal cancer, myeloma, neuroblastoma, pheochromocytoma, and retinoblastoma.

9. The pharmaceutical composition according to claim 8, wherein said tumors are ovarian cancer, breast cancer, liver cancer, pancreatic cancer, leukemia, lymphoma, myeloma.

10. A method for enhancing the activity of NAMPT inhibitors in vitro, which includes the exposure of cultured cells to at least one therapeutic agent which inhibits NAPRT enzymatic activity and at least one NAMPT inhibitor.

1 1 . The method according claim 10, wherein the NAMPT inhibitor is selected among the group consisting of FK866, CHS-828, GNE-617 and GNE-618.

12. The method according to claim 10, wherein said therapeutic agent which inhibits NAPRT is selected from NSAIDs.

13. A nicotinamide phosphoribosyltransferase (NAMPT) inhibitor for use in a method for the treatment of tumors in which nicotinic acid phosphoribosyltransferase (NAPRT) is expressed in a mammalian patient, wherein the method comprises subjecting said patient to a nicotinic acid-free diet or to a pellagragenic diet while said patient is being treated with said NAMPT inhibitor.

14. A nicotinamide phosphoribosyltransferase (NAMPT) inhibitor for the use according to claim 13, wherein the method further comprises subjecting said patient to a treatment with antibiotics while said patient is being treated with said NAMPT inhibitor.

15. A nicotinamide phosphoribosyltransferase (NAMPT) inhibitor for use in a method for the treatment of tumors in which nicotinic acid phosphoribosyltransferase (NAPRT) is expressed in a mammalian patient, wherein the method comprises subjecting said patient a treatment with antibiotics while said patient is being treated with said NAMPT inhibitor.

16. A nicotinamide phosphoribosyltransferase (NAMPT) inhibitor for the use according to claim 13 to 15, wherein said therapeutic agent which inhibits NAPRT enzymatic activity is selected among non-steroidal anti-inflammatory drugs (NSAIDs), 2-hydroxynicotinic acid, isonicotinic acid, 3-pyridylsulfonic acid, pyridine, acetanilide, picolinic acid, 3-pyridilacetic acid, and benzoic acid.

17. A nicotinamide phosphoribosyltransferase (NAMPT) inhibitor for the use according to any one of claims 13 to 16, wherein said NAMPT inhibitor is selected among the group consisting of FK866, CHS-828, GNE-617 and GNE-618.

18. A nicotinamide phosphoribosyltransferase (NAMPT) inhibitor for the use according to any one of claims 13 to 16, wherein said NAMPT inhibitor is FK866.

19. A nicotinamide phosphoribosyltransferase (NAMPT) inhibitor for the use according to any one of claims 13 to 18, wherein said therapeutic agent which inhibits NAPRT enzymatic activity is selected from NSAIDs.

20. A nicotinamide phosphoribosyltransferase (NAMPT) inhibitor for the use according to any one of claims 14 to 19, wherein said antibiotics are selected from the group consisting of vancomycin, neomycin, rifaximin, ciprofloxacin, and metronidazole.

21 . A nicotinamide phosphoribosyltransferase (NAMPT) inhibitor for the use according to claim 20, wherein said antibiotics consist of a combination of vancomycin, neomycin and metronidazole.