WO2017161222A1 - Utilisation d'inhibiteurs des canaux chlorure activés par le calcium pour prévenir et traiter les accouchements prématurés, seuls ou en combinaison avec d'autres agents tocolytiques - Google Patents

Utilisation d'inhibiteurs des canaux chlorure activés par le calcium pour prévenir et traiter les accouchements prématurés, seuls ou en combinaison avec d'autres agents tocolytiques Download PDF

Info

Publication number
WO2017161222A1
WO2017161222A1 PCT/US2017/022873 US2017022873W WO2017161222A1 WO 2017161222 A1 WO2017161222 A1 WO 2017161222A1 US 2017022873 W US2017022873 W US 2017022873W WO 2017161222 A1 WO2017161222 A1 WO 2017161222A1
Authority
WO
WIPO (PCT)
Prior art keywords
therapeutically effective
effective amount
agent
calcium
benzbromarone
Prior art date
Application number
PCT/US2017/022873
Other languages
English (en)
Inventor
George GALLOS
Ronald WAPNER
Joy VINK
Original Assignee
The Trustees Of Columbia University In The City Of New York
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Trustees Of Columbia University In The City Of New York filed Critical The Trustees Of Columbia University In The City Of New York
Publication of WO2017161222A1 publication Critical patent/WO2017161222A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/13—Amines
    • A61K31/135—Amines having aromatic rings, e.g. ketamine, nortriptyline
    • A61K31/137—Arylalkylamines, e.g. amphetamine, epinephrine, salbutamol, ephedrine or methadone
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19—Carboxylic acids, e.g. valproic acid
    • A61K31/195—Carboxylic acids, e.g. valproic acid having an amino group
    • A61K31/196—Carboxylic acids, e.g. valproic acid having an amino group the amino group being directly attached to a ring, e.g. anthranilic acid, mefenamic acid, diclofenac, chlorambucil
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/34—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having five-membered rings with one oxygen as the only ring hetero atom, e.g. isosorbide
    • A61K31/343—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having five-membered rings with one oxygen as the only ring hetero atom, e.g. isosorbide condensed with a carbocyclic ring, e.g. coumaran, bufuralol, befunolol, clobenfurol, amiodarone
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/4422—1,4-Dihydropyridines, e.g. nifedipine, nicardipine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K33/00—Medicinal preparations containing inorganic active ingredients
    • A61K33/06—Aluminium, calcium or magnesium; Compounds thereof, e.g. clay
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00—Drugs for genital or sexual disorders; Contraceptives
    • A61P15/06—Antiabortive agents; Labour repressants

Definitions

  • the invention relates generally to blocking calcium-activated channels in uterine tissue which in turn inhibits or blocks uterine contractions leading to preterm labor.
  • This invention is useful for developing effective new tocolytic agents, and for treating and/or preventing preterm labor, alone or in combination with known tocolytic agents.
  • agents that block calcium- activated chloride channels have a synergistic effect on inhibiting or blocking uterine contractions when combined with known tocolytic agents such as magnesium sulfate and nifedipine.
  • PTB Preterm birth
  • preterm birth accounted for almost 13% of births in the developed world, with an incidence increasing 20% from 1990 (Muglia and Katz (2010); Tita and Rouse (2009)). In the United States, this amounts to greater than 520,000 preterm births occurring each year, many with substantial morbidity.
  • the Center for Disease Control estimates that preterm birth- related morbidity results in $26 billion in annual healthcare expenditures in the United States alone (Centers for Disease Control (2013)).
  • idiopathic preterm labor (PTL) ranks the highest (Goldenberg et al. (2008)). While some advancement has been made in the management of preterm labor (Tita and Rouse (2009)), current tocolytic interventions remain largely inefficacious (Haas et al. (2012)). For example, while tocolytics can delay labor up to 48 hours, they are ineffective as primary treatment and solely utilized as a means to delay birth long enough to allow for corticosteroid-mediated lung maturity. Mechanistic limitations of current tocolytics include tachyphylaxis of G-protein receptors ( 2-adrenoceptor) and blockade of only limited components of procontractile calcium releasing mechanisms (i.e. calcium channel blockers only attenuate extracellular calcium entry). Given the magnitude of this health care challenge and the lack of definitive treatments for PTL it is clear that novel therapeutic options are sorely needed.
  • AP requires raising the resting membrane potential of uterine smooth muscle (USM) cells from a relatively negative potential to a more positive threshold capable of triggering activation of voltage gated calcium (VGCC) and sodium channels (VGNaC) to facilitate the massive depolarization required for an AP (see #2 of Figure 1). While the channels involved in AP recovery have been identified (eg. BKCa, SK3) (Smith et al. (2007); Khan et al.
  • chloride channels are ideal candidates for modulation of membrane potential to maximize voltage gated calcium entry (Shmygol et al. (2007)). More recent work, suggests that this phenomenon may be a dynamic interaction between two channels: KIR7.1 (promoting relaxation via a hyperpolarizing current) and a yet to be identified calcium- activated chloride channel (CaCC) that promotes contraction (via depolarizing current) (McCloskey et al. (2014)). Indeed, another publication examining the transcriptomes of late gestation human myometrium reveals ample expression of a CaCC (known as ANOl) making this particular molecular target an attractive candidate (Chan et al. (2014)).
  • KIR7.1 promoting relaxation via a hyperpolarizing current
  • CaCC calcium- activated chloride channel
  • results herein show ANOl to be an attractive target for the treatment and prevention of preterm labor.
  • the data show ANOl to be involved in all three mechanisms of intracellular calcium elevation in the uterus, reducing calcium release from both extracellular and sarcoplasmic stores.
  • an ANOl blockade would result in a complete arrest of calcium handling in a USM cell and since calcium is a critical mediator of USM contractility, blocking ANOl would result in a more efficient tocolytic agent than the ones presently available.
  • ANOl with other known tocolytic agents is superior to preventing and/or treating preterm labor than the use of the known tocolytic agents alone.
  • the present invention relates to a method for preventing and/or treating preterm labor, comprising administering to a subject in need thereof, a therapeutically effective amount of one or more agents that block or inhibit a calcium- activated chloride channel in the uterus.
  • the calcium- activated chloride channel is anoctamin 1 (ANOl). In another preferred embodiment, the calcium-activated channel is anoctamin 2 (AN02).
  • the agents are chosen from the group consisting of gallotannins ⁇ e.g., tannic acid), benzofuran ⁇ e.g., benzbromarone; 5-[(2,6- difluorobenzyl)oxy]-2-(2-naphthyl)benzofuran-3-carboxylic acid (B25) ), anthranilic acid ⁇ e.g. , N-((4-methoxy)-2-naphthyl)-5-nitroanthranilic acid (MONNA), digallic acid, CaCC inh - A01, T16Ai nh -A01, and combinations thereof.
  • gallotannins ⁇ e.g., tannic acid
  • benzofuran ⁇ e.g., benzbromarone
  • the present invention relates to a method for preventing and/or treating preterm labor, comprising administering to a subject in need thereof, a therapeutically effective amount of one or more agents that block or inhibit a calcium- activated chloride channel in the uterus in combination with a therapeutically effective amount of one or more other tocolytic agents.
  • a therapeutically effective amount of one or more agents that block or inhibit a calcium- activated chloride channel in the uterus in combination with a therapeutically effective amount of one or more other tocolytic agents.
  • the administration of the combination of the two types of agents has a synergistic effect in preventing and/or treating preterm labor.
  • further embodiments of the present invention are methods of preventing and/or treating preterm labor, comprising administering to a subject in need thereof, a therapeutically effective amount of one or more agents that block or inhibit a calcium- activated chloride channel in the uterus in combination with a therapeutically effective amount of one or more other tocolytic agents, wherein the therapeutically effective amount of both agents is less than the therapeutically effective amount administered when the agents are used alone.
  • the calcium- activated chloride channel is anoctamin 1 (ANOl). In another preferred embodiment, the calcium-activated channel is anoctamin 2 (AN02).
  • the agents are chosen from the group consisting of gallotannins (e.g. , tannic acid), benzofuran (e.g., benzbromarone; 5-[(2,6- difluorobenzyl)oxy]-2-(2-naphthyl)benzofuran-3-carboxylic acid(B25)), anthranilic acid (e.g., N-((4-methoxy)-2-naphthyl)-5-nitroanthranilic acid (MONNA)), digallic acid, CaCC inh - A01 , T16Ain h -A01, and combinations thereof.
  • gallotannins e.g. , tannic acid
  • benzofuran e.g., benzbromarone; 5-[(2,6- difluorobenzyl)oxy]-2-(2-naphthyl)benzofuran-3-carboxylic acid(B25)
  • anthranilic acid e
  • the other tocolytic agents are terbutaline, magnesium sulfate, and nifedipine.
  • the present invention relates to a method for decreasing, inhibiting, preventing and/or treating contractions of uterine smooth muscle, comprising administering to a subject in need thereof, a therapeutically effective amount of one or more agents that block or inhibit a calcium- activated chloride channel in the uterus.
  • the calcium- activated chloride channel is anoctamin 1
  • the calcium-activated channel is anoctamin 2 (AN02).
  • the agents are chosen from the group consisting of gallotannins (e.g. , tannic acid), benzofuran (e.g., benzbromarone; 5-[(2,6- difluorobenzyl)oxy]-2-(2-naphthyl)benzofuran-3-carboxylic acid (B25) ), anthranilic acid (e.g. , N-((4-methoxy)-2-naphthyl)-5-nitroanthranilic acid (MONNA)), digallic acid, CaCCin h - A01 , T16Ain h -A01, and combinations thereof.
  • gallotannins e.g. , tannic acid
  • benzofuran e.g., benzbromarone; 5-[(2,6- difluorobenzyl)oxy]-2-(2-naphthyl)benzofuran-3-carboxylic acid (B25)
  • the present invention relates to a method for decreasing, inhibiting, preventing and/or treating contractions of uterine smooth muscle, comprising administering to a subject in need thereof, a therapeutically effective amount of one or more agents that block or inhibit a calcium-activated chloride channel in the uterus in combination with a therapeutically effective amount of one or more other tocolytic agents.
  • a method for decreasing, inhibiting, preventing and/or treating contractions of uterine smooth muscle comprising administering to a subject in need thereof, a therapeutically effective amount of one or more agents that block or inhibit a calcium-activated chloride channel in the uterus in combination with a therapeutically effective amount of one or more other tocolytic agents.
  • the combination of the two types of agents has a synergistic effect in decreasing, inhibiting, preventing and/or treating contractions of uterine smooth muscle.
  • further embodiments of the present invention are methods for decreasing, inhibiting, preventing and/or treating contractions of uterine smooth muscle, comprising administering to a subject in need thereof, a therapeutically effective amount of one or more agents that block or inhibit a calcium- activated chloride channel in the uterus in combination with a therapeutically effective amount of one or more other tocolytic agents, wherein the therapeutically effective amount of both agents is less than the therapeutically effective amount administered when the agents are used alone.
  • the calcium- activated chloride channel is anoctamin 1 (ANOl). In another preferred embodiment, the calcium-activated channel is anoctamin 2 (AN02).
  • the agents are chosen from the group consisting of gallotannins (e.g. , tannic acid), benzofuran (e.g., benzbromarone; 5-[(2,6- difluorobenzyl)oxy]-2-(2-naphthyl)benzofuran-3-carboxylic acid(B25)), anthranilic acid (e.g., N-((4-methoxy)-2-naphthyl)-5-nitroanthranilic acid (MONNA)), digallic acid, CaCC inh - A01, T16Ai nh -A01, and combinations thereof.
  • gallotannins e.g. , tannic acid
  • benzofuran e.g., benzbromarone; 5-[(2,6- difluorobenzyl)oxy]-2-(2-naphthyl)benzofuran-3-carboxylic acid(B25)
  • anthranilic acid e
  • the other tocolytic agents are terbutaline, magnesium sulfate, and nifedipine.
  • the present invention relates to a method for relaxing uterine smooth muscle, comprising administering to a subject in need thereof, a therapeutically effective amount of one or more agents that block or inhibit a calcium-activated chloride channel in the uterus.
  • the calcium- activated chloride channel is anoctamin 1 (ANOl). In another preferred embodiment, the calcium-activated channel is anoctamin 2 (AN02).
  • the agents are chosen from the group consisting of gallotannins (e.g. , tannic acid), benzofuran (e.g., benzbromarone; 5-[(2,6- difluorobenzyl)oxy]-2-(2-naphthyl)benzofuran-3-carboxylic acid (B25) ), anthranilic acid (e.g. , N-((4-methoxy)-2-naphthyl)-5-nitroanthranilic acid (MONNA)), digallic acid, CaCC inh - A01, T16Ai nh -A01, and combinations thereof.
  • gallotannins e.g. , tannic acid
  • benzofuran e.g., benzbromarone; 5-[(2,6- difluorobenzyl)oxy]-2-(2-naphthyl)benzofuran-3-carboxylic acid (B25)
  • anthranilic acid
  • the present invention relates to a method for relaxing uterine smooth muscle, comprising administering to a subject in need thereof, a therapeutically effective amount of one or more agents that block or inhibit a calcium-activated chloride channel in the uterus in combination with a therapeutically effective amount of one or more other tocolytic agents.
  • a therapeutically effective amount of one or more agents that block or inhibit a calcium-activated chloride channel in the uterus in combination with a therapeutically effective amount of one or more other tocolytic agents.
  • the combination of the two types of agents has a synergistic effect in preventing and/or treating preterm labor.
  • further embodiments of the present invention are methods for relaxing uterine smooth muscle, comprising administering to a subject in need thereof, a therapeutically effective amount of one or more agents that block or inhibit a calcium-activated chloride channel in the uterus in combination with a therapeutically effective amount of one or more other tocolytic agents, wherein the therapeutically effective amount of both agents is less than the therapeutically effective amount administered when the agents are used alone.
  • the calcium- activated chloride channel is anoctamin 1 (ANOl). In another preferred embodiment, the calcium-activated channel is anoctamin 2 (AN02).
  • the agents are chosen from the group consisting of gallotannins (e.g. , tannic acid), benzofuran (e.g., benzbromarone; 5-[(2,6- difluorobenzyl)oxy]-2-(2-naphthyl)benzofuran-3-carboxylic acid(B25)), anthranilic acid (e.g., N-((4-methoxy)-2-naphthyl)-5-nitroanthranilic acid (MONNA)), digallic acid, CaCC inh - A01, T16Ai nh -A01, and combinations thereof.
  • gallotannins e.g. , tannic acid
  • benzofuran e.g., benzbromarone; 5-[(2,6- difluorobenzyl)oxy]-2-(2-naphthyl)benzofuran-3-carboxylic acid(B25)
  • anthranilic acid e
  • the other tocolytic agents are terbutaline, magnesium sulfate, and nifedipine.
  • the preferred methods of administration of the agents are chosen from the group consisting of oral, parental, and transvaginal, with transvaginal being most preferred.
  • the present invention also provides for methods and tools for drug design, testing of agents, and tools for basic research into the causes and etiology of contractions of the uterus and preterm labor.
  • Figure 2 are representative images from intact late gestation pregnant human uterine smooth muscle sections. Confocai microscopy images employing single, double, and triple staining with immunofluorescence labeling of antibodies directed against ANOl TMEMl 6 A (left hand panel), smooth muscle actin (SMA) (second from left hand panel), and/or the nuclear counterstain DAPI (right hand panel). Calibration bars represent 60 ⁇ ,
  • Figure 3 are representative gel image of polymerase chain reaction performed with ten members of the ANO (TMEM16) family in cells and tissue including immortal human nonpregnant uterine smooth muscle cells, primary human non-pregnant uterine smooth muscle cells, human pregnant uterine smooth muscle tissue, human liver (positive control), and water (negative control). All negative water controls demonstrated no expression and all members were detected in positive control (human liver).
  • TMEM16 ANO
  • Figure 4A is a graph of ANO modulation of membrane potential (fluorescence versus time).
  • Figure 4B is a graph of the relative depolarizing shift in fluorescence of the USM cells treated with the listed agent.
  • Figures 5A and 5B are representative force tracings of contractions and inhibition of contractions of human USM with tannic acid versus vehicle ( Figure 5A) and benzbromarone versus vehicle (Figure 5B).
  • Figure 5C are representative force tracings of contractions of human USM over time, under conditions of ANOl blockade using tannic acid (lower panel) and vehicle treated control (upper panel).
  • Figure 6A is a sigmoidal dose-response curve demonstrating the percent reduction in integral force (g*sec) at different log concentrations of benzbromarone. EC5 0 of benzbromarone on the force of oxytocin-induced contraction of human USM is 63 ⁇ .
  • Figure 6B is a graph showing that benzbromarone significantly decreased percent integral force of oxytocin-induced human USM at 25 ⁇ (*p ⁇ 0.05, ***p ⁇ 0.001, n.s. not significant).
  • Figure 6C is a graph of a representative tracing demonstrating that frequency (as measured at two 30 minute time intervals) was decreased by benzbromarone in a concentration dependent manner (0 to 500 ⁇ ).
  • Figure 6D show the slopes of tracings from Figure 6C were calculated and compiled, demonstrating that benzbromarone 50 ⁇ decreases oxytocin- induced USM frequency of contraction.
  • Figure 7 are representative tracings of fura-2 ratiometric changes in calcium fluorescence induced by ⁇ oxytocin in primary cultured human uterine smooth muscle cells.
  • Figure 7A shows the ratio of fura-2 over time, in vehicle and tannic acid treated cells.
  • Figure 7B shows the shows the ratio of fura-2 over time (total influx of calcium over time) in the presence or absence of external calcium.
  • Figure 7C shows the ratio of fura-2 over time, in cells treated with DMSO (vehicle) and various amounts of benzbromarone.
  • Figure 8 is a graph showing the proof of concept of the technique utilizing simultaneous recordings of calcium fluorescence using two distinct indicators: mag-fluo-4 to measure SR calcium levels (top panel) and fura 2 (bottom panel) to measure cytosolic calcium levels.
  • Bold lines represent cells that received thapsigargin and thinner lines represent cells that received vehicle.
  • Figure 9 is a graph of the results of the technique utilizing simultaneous recordings of calcium fluorescence using two distinct indicators: mag-fluo-4 to measure SR calcium levels (top panel) and fura 2 (bottom panel) to measure cytosolic calcium levels. Thick black lines represent cells that received BB.
  • Figure 10 are graphs of the results of the technique utilizing simultaneous recordings of calcium fluorescence using two distinct indicators: mag-fluo-4 to measure SR calcium levels (top panel) and fura 2 (bottom panel) to measure cytosolic calcium levels and treating cell with varying amounts of benzbromarone, DMSO, or DMSO and vehicle.
  • Figure 11 is a graph of cytosolic calcium in time following the sarcoplasmic depletion of calcium with thapsigargin, reintroduction of calcium, and subsequent treatment with a vehicle, or benzbromarone.
  • Figure 12A is a representative image of human USM cells showing f-actin (red) and calcium (green) indicators.
  • Figure 12B shows simultaneous tracings of fluorescence of calcium via FITC and f-actin via TRITC.
  • Figure 13 shows that siRNA targeted reduction of ANOl contributes to reduced myosin light chain 20 (MLC20) phosphorylation following oxytocin stimulation in uterine smooth muscle (USM) cells.
  • Figure 13A is a representative immunoblot demonstrating ANOl siRNA knockdown results in reduced ANOl protein expression.
  • Figure 13C is a representative immunoblot demonstrating increased expression of p-MLC20 after oxytocin stimulation and decreased expression of p- MLC20 after ANOl siRNA knockdown.
  • Figure 13D is a graph of the quantification of p- MLC20 as a percent of control. Oxytocin stimulation increased p-MLC20 expression by 283 ⁇ 45%, while USM cells pretreated with ANOl siRNA only increased by 131 ⁇ 34%.
  • Figure 14 is a graph of results of RhoA activation in cells induced by a Kir7.1 blocker Vu590, and treated with benzbromarone (BB) or MONNA.
  • BB benzbromarone
  • Figure 15 A shows representative spontaneous transient inward currents (STIC) showing reversal of current at the chloride equilibrium potential.
  • Figure 15B shows in the upper panel representative whole cell STIC membrane recording illustrating oxytocin- induced current enhancement was suppressed by tannic acid. The graph in the lower panel shows the amplitude of the currents in cells treated with various agents.
  • Figure 16 are representative whole cell patch clamp tracings of cells treated with terbutaline (Figure 16A) and Sp-8-pCPT-2'0-Me-cAMPs ( Figure 16B).
  • Figure 17 are various graphs showing the differences in calcium fluorescence induced by oxytocin in human uterine smooth muscle cells treated with an ANOl inhibitor alone (MONNA or benzbromarone), another tocolytic agent alone (nifedipine), a combination of agents, or no drug treatment control (DMSO). (*** p ⁇ 0.001).
  • Figure 17A shows the results in terms of fura 2 ratio and
  • Figure 17B shows the results in terms of percent of vehicle.
  • Figure 18 shows the results of experiments performed with pregnant human USM, treated with increasing doses of benzbromarone, tannic acid, MONNA (1 ⁇ -500 ⁇ ) or vehicle control (0.1% DMSO) following contractile stimulation with oxytocin.
  • Figure 18A are representative force tracing showing the differential potency (BB>MN>TA) of benzbromarone (tracing second from top), tannic acid (tracing second from bottom) and MONNA (bottom tracing) on contractive frequency and force compared to vehicle control (top tracing).
  • *BB benzbromarone
  • TA tannic acid
  • MN MONNA.
  • Figure 18B is a graph showing the determination of IC5 0 .
  • Figure 19B is representative force tracings showing the enhanced potency of combining low dose nifedipine and benzbromarone (bottom tracing) on both frequency and force of TEA-induced contractions compared to single low dose treatments (middle tracings) or vehicle control (top tracing).
  • *BB benzbromarone
  • NIF nifedipine.
  • Figure 19C shows a graph of the compiled data illustrating the percentage of reduction in integral force (g*sec) from baseline TEA-induced contractility between treatment groups, BB alone, NIF alone and BB + NIF.
  • Figure 19D is a graph showing the initial dose-response experiments performed to assess significant reductions in contractility mediated by nifedipine and benzbromarone.
  • Figure 19E are graphs showing the results of the percent change of force of TEA-induced contractions when NIF was used alone and in combination with BB. Results were normalized to the control and reported as mean ⁇ SEM. One way ANOVA and Bonferroni's Multiple Comparison Test was used to analyze statistical differences.
  • Figure 20 shows a graph of the compiled data illustrating the percentage of reduction in integral force (g*sec) from baseline TEA-induced contractility between treatment groups, BB alone, NIF alone, MN alone, BB +MN, and BB + NIF using human USM cells. Results were normalized to the control and reported as mean ⁇ SEM. One way ANOVA and Bonferroni's Multiple Comparison Test was used to analyze statistical differences.
  • subject as used in this application means mammals. Mammals include canines, felines, rodents, bovine, equines, porcines, ovines, and primates.
  • the invention can be used in veterinary medicine, e.g., to treat companion animals, farm animals, laboratory animals in zoological parks, and animals in the wild. The invention is particularly desirable for human medical applications
  • patient as used in this application means a human subject. In some embodiments of the present invention, the “patient” is known or suspected of having or being at risk of developing preterm labor.
  • Preterm labor is defined as contractions of the uterus that begin at weeks 20- 36 of a human pregnancy.
  • therapeutically effective amount or “therapeutically effective dose” or “therapeutically effective dosage” as used herein to mean an amount sufficient to cause an improvement in a clinically significant condition in the subject, or delays or minimizes or mitigates one or more symptoms associated with the disease or disorder, or results in a desired beneficial change of physiology in the subject.
  • the clinically significant condition is preterm labor
  • the symptom is contractions of the uterine smooth muscle.
  • treat refers to a means to slow down, relieve, ameliorate or alleviate at least one of the symptoms of the disease or disorder, or reverse the disease or disorder after its onset.
  • prevent refers to acting prior to overt disease or disorder onset, to prevent the disease or disorder from developing or minimize the extent of the disease or disorder, or slow its course of development.
  • agent means a substance that produces or is capable of producing an effect and would include, but is not limited to, chemicals, pharmaceuticals, biologies, small organic molecules, antibodies, nucleic acids, peptides, and proteins.
  • screen and “screening” and the like as used herein means to test an agent to determine if it has a particular action or efficacy.
  • identification means to test agents and their ability to have a particular action or efficacy.
  • physiologically functional derivative refers to a compound (e.g, a drug precursor) that is transformed in vivo to yield a therapeutic agent.
  • the transformation may occur by various mechanisms (e.g., by metabolic or chemical processes), such as, for example, through hydrolysis in blood.
  • Prodrugs are such derivatives, and a discussion of the use of prodrugs is provided by T. Higuchi and W. Stella, "Pro-drugs as Novel Delivery Systems," Vol. 14 of the A.C.S. Symposium Series, and in Bioreversible Carriers in Drug Design, ed. Edward B. Roche, American Pharmaceutical Association and Pergamon Press, 1987.
  • an adverse effect is an unwanted reaction caused by the administration of a drug.
  • the term “about” or “approximately” means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e. , the limitations of the measurement system, i.e., the degree of precision required for a particular purpose, such as a pharmaceutical formulation.
  • “about” can mean within 1 or more than 1 standard deviations, per the practice in the art.
  • “about” can mean a range of up to 20%, preferably up to 10%, more preferably up to 5%, and more preferably still up to 1% of a given value.
  • the term can mean within an order of magnitude, preferably within 5-fold, and more preferably within 2-fold, of a value.
  • the term "about” meaning within an acceptable error range for the particular value should be assumed.
  • CaCCs Calcium-activated chloride channels or CaCCs are responsible for depolarizing spontaneous transient inward currents (STICs) in many cell types. They are activated by membrane depolarization and calcium, and allow egress of chloride ions down voltage gradient across the cell membrane.
  • Anoctamin family and clearly illustrates that the CaCCs ANOl and 2 transcripts are present throughout gestation and are preserved in cultures of human uterine smooth muscle cells (Example 1) and that the blockade of ANOl inhibited oxytocin induced human pregnant term uterine contractions ex vivo (Example 3) and stopped oxytocin induced intracellular calcium elevations (Example 4). There is also evidence herein that ANOl -mediated chloride current is responsible for spontaneous transient inward currents (STICs) in human USM cells (Example 8).
  • STICs spontaneous transient inward currents
  • Calcium elevation in myometrial cells can occur from three sources: 1. via cell membrane depolarization (raising the resting membrane potential of uterine smooth muscle (USM) cells from a relatively negative potential to a more positive threshold capable of triggering activation of voltage gated calcium (VGCC) and sodium channels (VGNaC) to facilitate the massive depolarization required for an AP); 2. calcium release from sarcoplasmic reticulum via G-protein coupled receptor agonism; and 3. store operated calcium refilling (SOCE) or repletion of SR calcium following depletion.
  • SOCE store operated calcium refilling
  • ANOl antagonism inhibits the release of calcium from the SR (Example 5), and impacts SOCE (Example 6).
  • the pharmacologic targeting of ANOl represents a novel mechanistic target involved in all three mechanisms of intracellular calcium elevation in human myometrial cells, and targeting ANOl would reduce calcium release from both extracellular and sarcoplasmic stores.
  • This multi-modal calcium blockade represents complete arrest of calcium handling in a USM cell and since calcium is a critical mediator of USM contractility, an agent targeting ANOl would be a more efficient tocolytic agent than any currently in use, having the ability to stop uterine contractions completely and for a longer period of time.
  • ANOl blockers can be used over a longer period of time than is currently allowed by the tocolytic agents, in a person who is experiencing uterine contractions leading to preterm labor, or one who is at risk for preterm labor. Also, as will be discussed below, agents that are currently known to block ANOl are considered safe for the administration to pregnant subjects.
  • the therapeutic agents exemplified herein include gallotannins (e.g., tannic acid), and benzofuran (e.g., benzbromarone), both which have been safely used in humans as anti-inflammatory agents, and anthranilic acid (e.g., N- ((4-methoxy)-2-naphthyl)-5-nitroanthranilic acid) (MONNA) (Oh et al. (2013)).
  • gallotannins e.g., tannic acid
  • benzofuran e.g., benzbromarone
  • anthranilic acid e.g., N- ((4-methoxy)-2-naphthyl)-5-nitroanthranilic acid
  • MONNA shares structural similarity with mefenamic acid, a compound from this same drug class that has been used safely in pregnant patients in the United Kingdom (Mital et al. (1992)). These agents have not previously been shown to block ANOl in uterine tissue or to decrease or inhibit contractions in uterine tissue.
  • ANOl antagonism potentiates the effects of other tocolytic agents, including those that block calcium channels, i.e, voltage gated calcium channels (VGCCs) and can thus be used in conjunction with such agents, including but not limited to nifedipine, terbutaline, and magnesium sulfate (Examples 9, 10, 12, and 13).
  • VGCCs voltage gated calcium channels
  • these studies showed significant relaxation of uterine muscle tissue at concentrations of these agents in combination, concentrations which elicited no response when the agents were used alone (Examples 12 and 13).
  • the invention provides for a method of treating preterm labor, a method for preventing preterm labor, and a method of controlling the timing of parturition. In certain embodiments, the invention provides for a method of manufacture of a medicament useful for treating and/or preventing preterm labor, for pharmaceutical compositions useful in the methods of treating and preventing preterm labor, and controlling the timing of parturition.
  • the invention relates to any one of the aforementioned methods, wherein delivery or parturition is delayed or prevented for at least about 2 days, at least about 3 days, at least about 4 days, at least about 5 days, at least about 6 days, at least about 7 days, at least about 8 days, at least about 9 days, or at least about 10 days. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein delivery or parturition is delayed or prevented until the fetus is at about 40 weeks gestational age, about 39 weeks, about 38 weeks, or about 37 weeks gestational age.
  • the invention provides for a method of reducing, decreasing, inhibiting or stopping contractions of the uterine smooth muscle. In certain embodiments, the invention provides for a method of manufacture of a medicament useful for reducing, decreasing, inhibiting or stopping contractions of the uterine smooth muscle and for pharmaceutical compositions useful in the methods of reducing, decreasing, inhibiting or stopping contractions of the uterine smooth muscle.
  • the invention provides for a method of relaxing the uterine smooth muscle. In certain embodiments, the invention provides for a method of manufacture of a medicament useful for relaxing the uterine smooth muscle and for pharmaceutical compositions useful in the methods of relaxing the uterine smooth muscle.
  • Any of the methods of the invention can be used for a subject, in particular a human subject, who is showing symptoms of preterm labor and/or contractions of the uterine smooth muscle in a pregnancy that is earlier than 37 weeks. Any of the methods of the invention can also be used on a subject who is at risk for preterm labor. Factors that could consider making a woman at risk for preterm labor, include but are not limited to, smoking prior to or during pregnancy, being overweight or underweight, drinking alcohol during pregnancy, illegal drug use during pregnancy, age (less than 17 years of age or greater than 35 years of age), limited access to prenatal care, carrying twins or other multiple pregnancies, and a personal or family history of preterm labor.
  • Certain conditions may make a woman at risk for preterm labor include but are not limited to high blood pressure, preeclampsia, diabetes, a blood clotting disorder, placenta previa, placental abruption, cervical insufficiency, or an infection, such as chlamydia, gonorrhea, trichomoniasis, kidney infection, pneumonia, appendicitis, asymptomatic bacteriuria, or bacterial vaginosis.
  • the blockage or inhibition of calcium-activated chloride channels reduces, decreases, inhibits or stops contractions of, and relaxes, the uterine smooth muscle which in turn prevents and/or treats preterm labor.
  • any agent that would block or inhibit these calcium-activated chloride channels could be used as a treatment and/or prevention of preterm labor and/or as a treatment and/or prevention of contractions of the uterine smooth muscle and/or the promotion of relaxation of the uterine smooth muscle tissue.
  • agents include but are not limited to chemicals, phytochemicals, pharmaceuticals, biologies, small organic molecules, antibodies, nucleic acids, peptides, and proteins.
  • the agents are chosen from the group consisting of gallotannins (e.g., tannic acid), benzofuran (e.g., benzbromarone; 5-[(2,6- difluorobenzyl)oxy]-2-(2-naphthyl)benzofuran-3-carboxylic acid) (B25)), anthranilic acid (e.g., N-((4-methoxy)-2-naphthyl)-5-nitroanthranilic acid) (MONNA)), digallic acid, CaCCi nh -AOl (Namkung et al. (2011)), T16A inh -A01 (Namkung et al. (2011)), and combinations thereof.
  • gallotannins e.g., tannic acid
  • benzofuran e.g., benzbromarone; 5-[(2,6- difluorobenzyl)oxy]-2-(2-naphthyl)benzofur
  • a preferred agent is benzbromane.
  • a further preferred agent is tannic acid.
  • Yet a further preferred agent is MONNA.
  • the agents that block or inhibit ANOl or AN02 are administered in combination with other tocolytic agents.
  • the other tocolytic agents are terbutaline, magnesium sulfate, and nifedipine.
  • Inhibiting the CaCCs can also be effected using "decoy” molecules which mimic the region of a target molecule in the pathway, that another molecule, binds and activates.
  • the activating molecule would bind to the decoy instead of the target, and activation could not occur.
  • Inhibition can also be effected by the use of a "dominantly interfering" molecule, or one in which the binding portion of activating molecule is retained but the molecule is truncated so that the activating domain is lacking. These molecules would bind to receptors in the pathway but be unproductive and block the receptors from binding to the activating molecule.
  • decoy molecules and dominantly interfering molecule can be manufactured by methods known in the art.
  • Inhibiting the CaCCs can also be effected using short RNA molecules. Among these are short interfering RNA (siRNA), small temporal RNAs (stRNAs), short hairpin RNA (shRNA), and micro- RNAs (miRNAs).
  • Short interfering RNAs silence genes through an mRNA degradation pathway, while stRNAs and miRNAs are approximately 21 or 22 nt RNAs that are processed from endogenously encoded hairpin-structured precursors, and function to silence genes via translational repression. See, e.g., McManus et al. (2002). RNA 8(6):842-50; Morris et al. (2004). Science 305(5688): 1289-92; He and Hannon. (2004). Nat. Rev. Genet. 5(7):522-31.
  • RNA interference a form of post-transcriptional gene silencing ("PTGS"), describes effects that result from the introduction of double- stranded RNA into cells (reviewed in Fire. (1999). Trends Genet. 15:358-363; Sharp. (1999) Genes Dev. 13: 139- 141 ; Hunter. (1999). Curr. Biol. 9:R440-R442; Baulcombe. (1999). Curr. Biol. 9:R599-R601 ; Vaucheret et al. (1998). Plant J. 16:651-659).
  • RNA interference commonly referred to as RNAi, offers a way of specifically inactivating a cloned gene, and is a powerful tool for investigating gene function.
  • RNAi The active agent in RNAi is a long double-stranded (antiparallel duplex) RNA, with one of the strands corresponding or complementary to the RNA which is to be inhibited.
  • the inhibited RNA is the target RNA.
  • the long double stranded RNA is chopped into smaller duplexes of approximately 20 to 25 nucleotide pairs, after which the mechanism by which the smaller RNAs inhibit expression of the target is largely unknown at this time. While RNAi was shown initially to work well in lower eukaryotes, for mammalian cells, it was thought that RNAi might be suitable only for studies on the oocyte and the preimplantation embryo.
  • RNAi would work in human cells if the RNA strands were provided as pre-sized duplexes of about 19 nucleotide pairs, and RNAi worked particularly well with small unpaired 3' extensions on the end of each strand (Elbashir et al. (2001). Nature 411 :494-498).
  • siRNA short interfering RNA
  • small interfering RNA were applied to cultured cells by transfection in oligofectamine micelles. These RNA duplexes were too short to elicit sequence-nonspecific responses like apoptosis, yet they efficiently initiated RNAi.
  • Many laboratories then tested the use of siRNA to knock out target genes in mammalian cells. The results demonstrated that siRNA works quite well in most instances.
  • siRNA sequences to inhibit the expression of a target protein are commercially available and find use.
  • One program, siDESIGN from Dharmacon, Inc. (Lafayette, Colo.) permits predicting siRNAs for any nucleic acid sequence, and is available on the internet at dharmacon.com.
  • Programs for designing siRNAs are also available from others, including Genscript (available on the internet at genscript.com/ssl-bin/app/rnai) and, to academic and non-profit researchers, from the Whitehead Institute for Biomedical Research found on the worldwide web at "jura. wi.mit.edu/pubint/http://iona. wi.mit.edu/siRNAext/.”
  • double-stranded (ds) RNA is a powerful way of interfering with gene expression in a range of organisms that has recently been shown to be successful in mammals (Wianny and Zernicka-Goetz. (2002)., Nat. Cell. Biol. 2:70-75).
  • Any suitable viral knockdown system could be utilized for decreasing ANO 1/2 mRNA levels including AAV, lentiviral vectors, or other suitable vectors.
  • shRNA or other ANO 1/2 blocking molecule could be delivered by targeted liposome, nanoparticle or other suitable means.
  • MicroRNA can also be used to inhibit ANO 1/2.
  • MicroRNAs are small non-coding RNAs averaging 22 nucleotides that regulate the expression of their target mRNA transcripts by binding. Binding of microRNAs to their targets is specified by complementary base pairing between positions 2-8 of the microRNA and the target 3' untranslated region (3' UTR), an mRNA component that influences translation, stability and localization. Additionally, this microRNA can also be modified for increasing other desirable properties, such as increased stability, decreased degradation in the body, and increased cellular uptake.
  • Antibodies or antibody fragments that recognize and inactivate ANOl or AN 02 can also be used in the present invention.
  • antibody and “antibodies” include polyclonal antibodies, monoclonal antibodies, humanized or chimeric antibodies, single chain Fv antibody fragments, Fab fragments, and F(ab3 ⁇ 4 fragments.
  • Polyclonal antibodies are heterogeneous populations of antibody molecules that are specific for a particular antigen, while monoclonal antibodies are homogeneous populations of antibodies to a particular epitope contained within an antigen.
  • Monoclonal antibodies are particularly useful in the present invention.
  • Antibody fragments that have specific binding affinity for a target of interest ⁇ i.e., ANOl can be generated by known techniques. Such antibody fragments include, but are not limited to, F(ab')2 fragments that can be produced by pepsin digestion of an antibody molecule, and Fab fragments that can be generated by reducing the disulfide bridges of F(ab3 ⁇ 4 fragments. Alternatively, Fab expression libraries can be constructed. See, for example, Huse et al. (1989). Single chain Fv antibody fragments are formed by linking the heavy and light chain fragments of the Fv region via an amino acid bridge (e.g., 15 to 18 amino acids), resulting in a single chain polypeptide. Single chain Fv antibody fragments recognizing a target of interest can be produced through standard techniques, such as those disclosed in U.S. Patent No. 4,946,778.
  • antibodies or fragments thereof can be tested for recognition of the target of interest by standard immunoassay methods including, for example, enzyme-linked immunosorbent assay (EL1SA) or radioimmunoassay assay (RIA).
  • EL1SA enzyme-linked immunosorbent assay
  • RIA radioimmunoassay assay
  • the present invention further provides a kit to treat and/or prevent preterm labor.
  • the kit is an assemblage of materials or components, including at least one of the inventive compositions.
  • the kit contains a composition including an agent that would block or inhibit calcium-activated chloride channels, in particular ANOl or AN02.
  • the kit would contain a composition chosen from the group consisting of gallotannins (e.g., tannic acid), benzofuran (e.g., benzbromarone; 5-[(2,6-difluorobenzyl)oxy]-2-(2-naphthyl)benzofuran-3-carboxylic acid) (B25)), anthranilic acid (e.g., N-((4-methoxy)-2-naphthyl)-5-nitroanthranilic acid) (MONNA)), digallic acid, CaCC inh -A01 (Namkung et al. (2011)), T16A inh -A01 (Namkung et al. (2011)), and combinations thereof.
  • gallotannins e.g., tannic acid
  • benzofuran e.g., benzbromarone; 5-[(2,6-difluorobenzyl)oxy]-2-(2-naphthyl
  • the kit would include other tocolytic agents.
  • the other tocolytic agents are terbutaline, magnesium sulfate, and nifedipine.
  • kits Instructions for use may be included in the kit. "Instructions for use” typically include a tangible expression describing the technique to be employed in using the components of the kit to effect a desired outcome.
  • the kit also contains other useful components, such as, diluents, buffers, pharmaceutically acceptable carriers, syringes, catheters, applicators, pipetting or measuring tools, bandaging materials or other useful paraphernalia as will be readily recognized by those of skill in the art.
  • the materials or components assembled in the kit can be provided to the practitioner stored in any convenient and suitable ways that preserve their operability and utility.
  • the components can be in dissolved, dehydrated, or lyophilized form; they can be provided at room, refrigerated or frozen temperatures.
  • the components are typically contained in suitable packaging material(s).
  • packaging material refers to one or more physical structures used to house the contents of the kit, such as inventive compositions and the like.
  • the packaging material is constructed by well-known methods, preferably to provide a sterile, contaminant-free environment.
  • Current tocolytic agents include ⁇ agonists including terbutaline, Ca2+ channel blockers including nifedipine, and T-type calcium channel inhibitors including magnesium sulfate. All tocolytic agents have adverse side effects to mother and fetus and are not used for periods more than a week.
  • ANOl and AN02 inhibitors are more effective tocolytic agents than the current agents because they specifically target and block calcium- activated chloride channels, which are involved in all three mechanisms of calcium elevation in the uterus.
  • benzbromarone is a known anti-inflammatory with mild gastrointestinal side effects. Benzbromarone is administered safely to adults at a dose of about 50 to about 300 mg daily.
  • ANOl inhibitors and known tocolytic agents worked synergistically.
  • nifedipine a Ca2+ channel blocker
  • MONNA calcium flux inhibition in human USM cells was enhanced by over 50% (Example 10).
  • ANOl inhibitors and known tocolytic agents worked synergistically in reducing contractions of the uterine smooth muscle in both mice and humans, allowing a lesser therapeutically effective amount of both agents to be administered with significant effect on reducing muscle contractions.
  • benzbromarone or MONNA was used in conjunction with nifedipine, significant relaxation was seen in uterine smooth muscle at concentrations of the agents that did not elicit a response when used alone.
  • benzbromarone was shown to effectively reduce contractions at a minimum dose of about 25-50 ⁇ and an IC5 0 of 34 ⁇ .
  • MONNA was shown to effectively reduce contractions at a minimum dose of 100 ⁇ and an IC5 0 of 59 ⁇ .
  • benzobromarone was effective in reducing contractions at 5 ⁇ , about one-fifth (1/5) to about one-tenth (1/10) of the minimum therapeutically effective amount when used alone.
  • MONNA when used in conjunction with nifedipine, was effective at 25 ⁇ , about one-quarter (1/4) of the minimum therapeutically effective amount. See Examples 11 and 13. Perhaps a more significant result was that a very low dose of nifedipine was effective in reducing uterine muscle contractions, one which elicited no response when used alone (Example 13).
  • mice benzbromarone was shown to effectively reduce contractions at an IC5 0 of 10 ⁇ .
  • Nifedipine was shown to be effective at an IC5 0 of 47 nM.
  • contractions were significantly reduced at dosages of 0.01 ⁇ of nifedipine and 1 ⁇ of benzobromarone (Example 12).
  • benzbromarone when combined with nifedipine was again effective at a minimum dose about one-tneth (1/10) of the minimum dose when used alone.
  • the nifedipine was effective at a minimum dose about one-fifth (1/5) the minimum dose when used alone.
  • one embodiment of the present invention is a method of treating and/or preventing preterm labor by administering agents that block or inhibit calcium- activated chloride channels, in particular anoctamin 1 and 2, together or in conjunction with other tocolytic agents.
  • agents that block or inhibit calcium- activated chloride channels, in particular anoctamin 1 and 2 are administered in combination with other tocolytic agents, a lesser therapeutically effective amount of both agents can be administered to reduce, decrease, inhibit or stop contractions of uterine smooth muscle, i.e, relax uterine smooth muscle tissue.
  • nifedipine is used in combination with benzbromane. In a further preferred embodimeent, nifedipine is used in combination with MONNA.
  • nifedipine when combined with an ANOl inhibitor, can used at a significantly lower therapeutically effective dose and maintain effectiveness, ranging from about one -half to one-fifth from the standard therapeutically effective dose.
  • magnesium sulfate is used in combination with benzbromane. In a further preferred embodimeent, magnesium sulfate is used in combination with MONNA.
  • magnesium sulfate when combined with an ANOl inhibitor, can used at a significantly lower therapeutically effective dose and maintain effectiveness, ranging from about one -half to one-fifth from the standard therapeutically effective dose.
  • benzobromarone when combined with nifedipine or magnesium sulfate can be used at a therapeutically effective dose ranging from about one-fifth to one-tenth of the normal therapeutically effective dose needed to inhibit uterine muscle contractions.
  • MONNA when combined with nifedipine or magnesium sulfate can be used at a therapeutically effective dose ranging from about one-half to one-quarter of the normal therapeutically effective dose needed to inhibit uterine muscle contractions when combined with nifedipine or magnesium sulfate.
  • a therapeutically effective dose will be determined by the skilled artisan considering several factors which will be known to one of ordinary skill in the art. Such factors include the particular form of the inhibitor, and its pharmacokinetic parameters such as bioavailability, metabolism, and half-life, which will have been established during the usual development procedures typically employed in obtaining regulatory approval for a pharmaceutical compound. Further factors in considering the dose include the condition or disease to be treated or the benefit to be achieved in a normal individual, the body mass of the patient, the route of administration, whether the administration is acute or chronic, concomitant medications, and other factors well known to affect the efficacy of administered pharmaceutical agents. Thus, the precise dose should be decided according to the judgment of the person of skill in the art, and each patient's circumstances, and according to standard clinical techniques.
  • the administration of any agent to prevent and/or treat preterm labor is administered once and then the subject is monitored for improvement in the condition. If the preterm labor is persisting a subsequent administration of the agent can be administered.
  • these agents can be administered on a regular basis to a subject at risk for preterm labor.
  • the administration of these agents can be once a day, twice a day, three times a day, four times a day, five times a day, up to six times a day, preferably at regular intervals.
  • a subject can be monitored for improvement during the therapy and the dosages adjusted.
  • an effective dose of the ANO 1 or ANO 2 inhibitor including but not limited to, benzbromarone or MONNA is about 0.5-1 mg/day, 1-5 mg/day, 5-10 mg/day, 10-15 mg/day, 15-20 mg/day, 20-25 mg/day, 25-30 mg/day, 30-35 mg/day, 35-40 mg/day, 40-45 mg/day, 45-50 mg/day, 50-55 mg/day, 55-60 mg/day, 60-65 mg/day, 65-70 mg/day, 70-75 mg/day, 75-80 mg/day, 80-85 mg/day, 85-90 mg/day, 90-95 mg/day or 95-100 mg/day, 100-200 mg/day, 200-300 mg/day, 300-400 mg/day, 400-500 mg/day, 500-600 mg/day, 600-700 mg/day, 700-800 mg/day, 800-900 mg/day, 900-1000 mg/day, 1000-1100 mg/day, 1100-1200 mg/day, 1200-1300 mg/day,
  • a therapeutically effective dose of benzbromarone is about 50 to about 300 mg daily.
  • One aspect of the current invention based upon the discovery of the synergistic effect of decreasing, inhibiting, preventing and/or treating contractions of the smooth uterine muscle, i.e., relaxing the smooth uterine muscle, is the co-administration of agents described herein that inhibit or block calcium- activated chloride channels, more particularly anoctamin 1 and 2, with known tocolytics, allowing about one-half (1/2), about one-quarter (1/4), about one-fifth (1/5), up to about one-tenth (1/10) of a standard or normal therapeutically effective amount or dose to be administered of both the ANOl/2 blockers and the known tocolytic to achieve the same effectiveness.
  • the dose of the ANO 1/2 inhibitors as well as the additional tocolytic agent can be from about 1/10 to 1/2 of the dosages set forth herein and/or other standard or routine dosages.
  • Magnesium sulfate is generally administered at a loading dose of about 4 to 6 grams over about 15 to 30 minutes and then a continuous infusion is given at about 1 to about 4 grams per hours. Generally magnesium sulfate is administered intravenously.
  • Terbutiline is generally given in a dosage of about 2.5 to 5.0 mg, orally 30 minutes, then every two to four hours thereafter to control contractions.
  • nifedipine is administered orally in a loading dose of 30 mg, followed by 20 mg given every four to eight hours for 24 hours, and then a maintenance dose of 10 mg every eight hours until desired time of delivery.
  • One embodiment of the present invention are methods of preventing and/or treating preterm labor, comprising administering to a subject in need thereof, a therapeutically effective amount of benzbromarone in combination with a therapeutically effective amount of nifedipine, wherein the therapeutically effective amount of both agents is less than the therapeutically effective amount administered when the agents are used alone.
  • FIG. 1 is a diagrammatic representation of a subject in need thereof.
  • FIG. 1 is a diagrammatic representation of a subject in need thereof.
  • FIG. 1 is a diagrammatic representation of a subject in need thereof.
  • FIG. 1 is a diagrammatic representation of a subject in need thereof.
  • FIG. 1 is a diagrammatically effective amount of MONNA in combination with a therapeutically effective amount of nifedipine, wherein the therapeutically effective amount of both agents is less than the therapeutically effective amount administered when the agents are used alone.
  • One embodiment of the present invention are methods for decreasing, inhibiting, preventing and/or treating contractions of uterine smooth muscle, comprising administering to a subject in need thereof, a therapeutically effective amount of benzbromarone in combination with a therapeutically effective amount of nifedipine, wherein the therapeutically effective amount of both agents is less than the therapeutically effective amount administered when the agents are used alone.
  • FIG. 1 is a diagrammatic representation of an exemplary embodiment of the present invention.
  • One embodiment of the present invention are methods for relaxing uterine smooth muscle, comprising administering to a subject in need thereof, a therapeutically effective amount of benzbromarone in combination with a therapeutically effective amount of nifedipine, wherein the therapeutically effective amount of both agents is less than the therapeutically effective amount administered when the agents are used alone.
  • FIG. 1 is a diagrammatic representation of an exemplary embodiment of the present invention.
  • One embodiment of the present invention are methods of preventing and/or treating preterm labor, comprising administering to a subject in need thereof, a therapeutically effective amount of benzbromarone in combination with a therapeutically effective amount of magnesium sulfate wherein the therapeutically effective amount of both agents is less than the therapeutically effective amount administered when the agents are used alone.
  • FIG. 1 is a diagrammatic representation of an agent that is used in this specification.
  • FIG. 1 is a diagrammatic representation of an agent that is used in this specification.
  • FIG. 1 is a diagrammatic representation of an agent that is used in this specification.
  • FIG. 1 is a diagrammatic representation of an agent that is used in this specification.
  • One embodiment of the present invention are methods for decreasing, inhibiting, preventing and/or treating contractions of uterine smooth muscle, comprising administering to a subject in need thereof, a therapeutically effective amount of benzbromarone in combination with a therapeutically effective amount of magnesium sulfate, wherein the therapeutically effective amount of both agents is less than the therapeutically effective amount administered when the agents are used alone.
  • FIG. 1 is a diagrammatic representation of an exemplary embodiment of the present invention.
  • One embodiment of the present invention are methods for relaxing uterine smooth muscle, comprising administering to a subject in need thereof, a therapeutically effective amount of benzbromarone in combination with a therapeutically effective amount of magnesium sulfate, wherein the therapeutically effective amount of both agents is less than the therapeutically effective amount administered when the agents are used alone.
  • FIG. 1 is a diagrammatic representation of an exemplary embodiment of the present invention.
  • the dose of benzbromarone is from about
  • the dose of benzbromarone is about 5 to 75 mg daily, about 10 to about 60 mg daily, or about 12.5 to about 30 mg daily.
  • the dose of MONNA is about 1/5 to 1/2 of a standard therapeutically effective dose.
  • the dose of MONNA ranges from about 0.1 mg/day to about 1000 mg/day.
  • dose of nifedipine is about 1/5 to about 1/2 of a standard therapeutically effective dose.
  • the initial loading dose of nifedipine is about 6 to about 15 mg, with about 2 to about 10 mg given thereafter.
  • the dose of magnesium sulfate is about 1/5 to about 1/2 of a standard therapeutically effective dose. In some embodiments, the initial loading dose of magnesium sulfate is about 0.8 grams to about 3 grams, followed by about 0.2 grams to 2 grams as needed.
  • the co- administration of the agents can be by any administration described herein. Moreover, it can be in one composition, or in more than one composition. The administration of the agents can be simultaneous, concurrently or sequentially.
  • the present invention encompasses the administration of agents that inhibit or block calcium- activated chloride channels, more particularly anoctamin 1 and 2, alone and in combination with other tocolytic agents.
  • Methods of administration of the agents include oral; mucosal, such as nasal, sublingual, vaginal, buccal, or rectal; parenteral, such as subcutaneous, intravenous, bolus injection, intramuscular, or intraarterial; or transdermal administration to a subject.
  • the agent must be in the appropriate form for administration of choice.
  • Preferred methods of administration are oral, parental and vaginal.
  • compositions for administration may comprise a therapeutically effective amount of the anoctamin 1 or 2 inhibitory agent and a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable refers to molecular entities and compositions that are physiologically tolerable and do not typically produce an allergic or similar untoward reaction, such as gastric upset, dizziness and the like, when administered to a human, and approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.
  • Carrier refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic is administered.
  • Such pharmaceutical carriers can be sterile liquids, such as saline solutions in water and oils, including those of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, and the like.
  • a saline solution is a preferred carrier when the pharmaceutical composition is administered intravenously.
  • Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions.
  • Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol, and the like.
  • the composition if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents.
  • compositions can take the form of solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained-release formulations, cachets, troches, lozenges, dispersions, suppositories, ointments, cataplasms (poultices), pastes, powders, dressings, creams, plasters, patches, aerosols, gels, liquid dosage forms suitable for parenteral administration to a patient, and sterile solids (e.g., crystalline or amorphous solids) that can be reconstituted to provide liquid dosage forms suitable for parenteral administration to a patient.
  • Such compositions will contain a therapeutically effective amount of the compound, preferably in purified form, together with a suitable form of carrier so as to provide the form for proper administration to the patient.
  • the formulation should suit the mode of administration.
  • compositions adapted for vaginal administration may be provided as pessaries, tampons, creams, gels, pastes, foams or spray formulations.
  • compositions adapted for oral administration may be capsules, tablets, powders, granules, solutions, syrups, suspensions (in non-aqueous or aqueous liquids), or emulsions.
  • Tablets or hard gelatin capsules may comprise lactose, starch or derivatives thereof, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, stearic acid or salts thereof.
  • Soft gelatin capsules may comprise vegetable oils, waxes, fats, semi-solid, or liquid polyols. Solutions and syrups may comprise water, polyols, and sugars.
  • An active agent intended for oral administration may be coated with or admixed with a material that delays disintegration and/or absorption of the active agent in the gastrointestinal tract. Thus, the sustained release may be achieved over many hours and if necessary, the active agent can be protected from degradation within the stomach.
  • Pharmaceutical compositions for oral administration may be formulated to facilitate release of an active agent at a particular gastrointestinal location due to specific pH or
  • compositions adapted for parenteral administration include aqueous and non-aqueous sterile injectable solutions or suspensions, which may contain anti-oxidants, buffers, baceriostats, and solutes that render the compositions substantially isotonic with the blood of the subject.
  • Other components which may be present in such compositions include water, alcohols, polyols, glycerine, and vegetable oils.
  • Compositions adapted for parental administration may be presented in unit-dose or multi-dose containers, such as sealed ampules and vials, and may be stored in a freeze-dried (lyophilized) condition requiring only the addition of a sterile carrier, immediately prior to use.
  • Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules, and tablets.
  • Suitable vehicles that can be used to provide parenteral dosage forms of the invention are well known to those skilled in the art. Examples include: Water for Injection USP; aqueous vehicles such as Sodium Chloride Injection, Ringer's Injection, Dextrose Injection, Dextrose and Sodium Chloride Injection, and Lactated Ringer's Injection; water-miscible vehicles such as ethyl alcohol, polyethylene glycol, and polypropylene glycol; and non-aqueous vehicles such as corn oil, cottonseed oil, peanut oil, sesame oil, ethyl oleate, isopropyl myristate, and benzyl benzoate.
  • compositions adapted for transdermal administration may be provided as discrete patches intended to remain in intimate contact with the epidermis of the recipient over a prolonged period of time.
  • compositions adapted for nasal and pulmonary administration may comprise solid carriers such as powders which can be administered by rapid inhalation through the nose.
  • Compositions for nasal administration may comprise liquid carriers, such as sprays or drops.
  • inhalation directly through into the lungs may be accomplished by inhalation deeply or installation through a mouthpiece.
  • These compositions may comprise aqueous or oil solutions of the active ingredient.
  • Compositions for inhalation may be supplied in specially adapted devices including, but not limited to, pressurized aerosols, nebulizers or insufflators, which can be constructed so as to provide predetermined dosages of the active ingredient.
  • compositions adapted for rectal administration may be provided as suppositories or enemas.
  • the pharmaceutical composition may be formulated, in an immediate release dosage form or a sustained release dosage form.
  • the invention relates to immediate release dosage forms.
  • An immediate release dosage form may be formulated as a tablet or multiparticulate which may be encapsulated.
  • Other immediate release dosage forms known in the art can be employed.
  • the therapeutic agent may be formulated to provide for an increased duration (sustained release) of therapeutic action.
  • the pharmaceutical composition can be formulated to deliver the therapeutic agent on a predetermined time schedules.
  • the therapeutic agent is administered via an oral solid dosage form that includes a sustained release carrier causing the sustained release of any one or more of the therapeutic agent(s) when the dosage form contacts gastrointestinal fluid.
  • the sustained release dosage form may comprise a plurality of substrates which include the drugs.
  • the substrates may comprise matrix spheroids or may comprise inert pharmaceutically acceptable beads which are coated with the drugs. The coated beads may then be overcoated with a sustained release coating comprising the sustained release carrier.
  • the matrix spheroid may include the sustained release carrier in the matrix itself; or the matrix may comprise a normal release matrix containing the drugs, the matrix having a coating applied thereon which comprises the sustained release carrier.
  • the oral solid dosage form comprises a tablet core containing the drug within a normal release matrix, with the tablet core being coated with a sustained release coating comprising the sustained release carrier.
  • the tablet contains the drug within a sustained release matrix comprising the sustained release carrier.
  • the tablet contains one or more therapeutic agent(s) within a sustained release matrix and remaining therapeutic agent(s) coated into the tablet as an immediate release layer,
  • sustained release is defined for purposes of the invention as the release of the therapeutic agent from the formulation at such a rate that blood (e,g., plasma) concentrations (levels) are maintained, within the therapeutic range but below toxic levels over a period of time of about 12 hours or longer.
  • blood e.g., plasma
  • concentrations levels
  • the therapeutic agents can be formulated as a controlled or sustained release oral formulation in any suitable tablet, coated tablet or multiparticulate formulation known to those skilled in the art.
  • the sustained release dosage form may optionally include a sustained released carrier which is incorporated into a matrix along with the active agents, or which is applied as a sustained release coating.
  • the sustained release dosage form may include one or more therapeutic agent in sustained release form and the remaining therapeutic agent(s) in the sustained release form or in immediate release form.
  • One or more therapeutic agents may be incorporated into the sustained release matrix along with another therapeutic agent, one or more therapeutic agent may be incorporated into the sustained release coating; incorporated as a separated sustained release layer or immediate release layer; or may be incorporated as a powder, granulation, etc., in a gelatin capsule with the substrates of the invention.
  • the sustained release dosage form may have one or more therapeutic agent in the sustained release form and the remaining therapeutic agent(s) in the sustained release form or immediate release form.
  • the present invention also provides for methods and tools for drug design, testing of agents, and tools for basic research into the causes and etiology of uterine contractions and preterm labor.
  • ANOl and AN02 can be used in drug screening assays, free in solution, or affixed to a solid support. All of these forms can be used in binding assays to determine if agents being tested form complexes with the protein.
  • High throughput screening can be used to screen for therapeutic agents.
  • the present invention provides for methods and assays for screening agents for prevention and/or treatment of preterm labor, comprising contacting or incubating the test agent with ANOl or AN02 and detecting the presence of a complex between the ANOl or AN02 and the agent by methods known in the art.
  • Antibodies to ANOl and AN02 can also be used in competitive drug screening assays.
  • the antibodies compete with the agent being tested for binding to the polypeptides.
  • the antibodies can be used to find agents that have antigenic determinants on ANOl or AN02, which in turn can be used to develop monoclonal antibodies that target the active sites of the polypeptides.
  • the invention also provides for polypeptides to be used for rational drug design where structural analogs of ANOl or AN02 can be designed. Such analogs would interfere with the polypeptide in vivo, such as by non-productive binding to target.
  • the three-dimensional structure of the protein is determined by any method known in the art including but not limited to x-ray crystallography, and computer modeling. Information can also be obtained using the structure of homologous proteins or target-specific antibodies.
  • agents can be designed which act as inhibitors or antagonists of the ANOl or AN02, or act as decoys, binding to target molecules non-productively and blocking binding of the active polypeptide.
  • a further embodiment of the present invention is a method and/or assay for screening and/or identifying a test agent for the prevention and/or treatment of preterm labor comprising is contacting or incubating a test agent with a nucleotide encoding ANOl or AN02, and determining if the test agent binds to the nucleotide, wherein if the test agent binds to the nucleotide, the test agent is identified as a therapeutic or preventative agent for preterm labor.
  • a further embodiment of the present invention is gene constructs comprising a nucleic acid encoding ANOl or AN02, and a vector. These gene construct can be used for testing of therapeutic agents as well as basic research regarding preterm labor. These gene constructs can also be used to transform host cells can be transformed by methods known in the art.
  • the resulting transformed cells can be used for testing for therapeutic agents as well as basic research regarding uterine contractions and preterm labor.
  • cells can be transformed with a nucleic acid encoding ANOl or AN02, and contacted with a test agent.
  • the resulting expression of the transcript can be detected and compared to the expression of the transcript in the cell before contact with the agent.
  • the expression of the transcripts in host cells can be detected and measured by any method known in the art, including but not limited to, reporter gene assays.
  • genes constructs as well as the host cells transformed with these gene constructs can also be the basis for transgenic animals for testing both as research tools and for therapeutic agents.
  • Such animals would include but are not limited to, nude mice.
  • Phenotypes can be correlated to the genes and looked at in order to determine the genes effect on the animals as well as the change in phenotype after administration or contact with a potential therapeutic agent.
  • Example 1- mRNA of the ANO Family is Expressed in Human Uterine Smooth Muscle and ANOl Protein is Expressed in Pregnant Human Uterine Smooth Muscle Tissue
  • Newly synthesized cDNA (5 ⁇ of original 20 ⁇ reaction) was used in PCR with the Advantage 2 PCR Kit (Clontech) on a MJ Research PTC-200 Peltier thermal cycler (Bio- Rad, Hercules, CA) following the manufacturer's protocol.
  • AN02 NM_020373 556 as CCCCACCTCCTGGGCTCCTC (SEQ ID NO: 4) s TGCCAGCCCGAGCAACTGAC (SEQ ID NO: 5)
  • AN03 NM_031418 290 as TTTGGAACTCCAGGGCGGGC (SEQ ID NO: 6) s TGGGGAGGGGGAGGACCAGT (SEQ ID NO: 7)
  • AN04 NM_178826 390 as CTGGGCGGCTTGCCACACTT (SEQ ID NO: 8)
  • AN05 NM_213599 413 as GGAGTGTGCTTAGGGCGGGG (SEQ ID NO:
  • Human myometrial smooth muscle strips were immediately fixed in 4% paraformaldehyde (4°C overnight), incubated in 30% sucrose in PBS for an additional 24 hours, then sectioned into 6 ⁇ frozen sections. Sections were washed in PBS, incubated with 0.1% Triton X-100 for 10 min, blocked with 15% goat serum and then incubated overnight at 4°C in primary antisera.
  • the primary antibodies used were: 1) anti-TMEM16A anti-body (rabbit, monoclonal; Abeam No. ab64085, 1 : 100 dilution in PBS) and 2) Rhodamine Phalloidin (to stain for alpha-actin, 1: 100, Life Technologies, CA).
  • the secondary for AN01/TMEM16A antibodies consisted of FITC-conjugated goat anti-rabbit IgG (green, 1 :400 dilution). Nuclear staining was achieved employing mounting medium pre-mixed with DAPI stain (Vector laboratories, #H-1500). Negative controls were performed on serial sections by omitting primary antibody. All immunofluorescence experiments were repeated at least 3 times. Samples were visualized with confocal microscopy (Nikon Eclipse, Japan) and images were acquired with NIS software version 4.10.
  • ANOl protein is expressed in pregnant human USM tissue
  • ANOl (or TMEM16A) has been shown to be an important component of smooth muscle contraction and relaxation in other types of smooth muscle (Huang et al. (2012)), the protein expression of ANOl in the human uterus was investigated. Immunofluorescence demonstrated the expression of ANOl (green) in late gestation human uterine smooth muscle ( Figure 2). Tissue was also co-stained with alpha-actin (red) to verify tissue is smooth muscle. ANOl protein is expressed abundantly throughout the myometrium.
  • FLIPR following exposure to either: the ANOl agonist, 3,4,5-Trimethoxy-N-(2-methoxy- ethyl)-N-(4-phenyl-2-thiazolyl)benzamide (Eact) (50 ⁇ ); an ANOl antagonist, benzbromarone (50 ⁇ ); K-gluconate (400 mM) (positive control for depolarization); or NS- 1619 (10 ⁇ ) (positive control for hyperpolarization).
  • Uterine strips were equilibrated under lg of tension for 1 hour in a modified Krebs- Henseleit buffer continuously bubbled with 95% 02 and 5% C02, after which they were stimulated with oxytocin 1 ⁇ . Following the development of regular phasic contractions, strips were treated with either a vehicle control or tannic acid, 200 ⁇ or benzbromarone, 100 ⁇ . Muscle-force assessments of intact human uterine strips were assessed in response to exogenous oxytocin and after treatment, with regard to pacing frequency and integrated force over 25 minutes.
  • tannic acid significantly attenuated contractile frequency and total force generated over time. However, longer treatment times were needed (over 1.5 hours) before reductions in mean amplitude became evident. The figure also shows the recovery of contractile response to oxytocin after the wash out of the tannic acid.
  • Figures 5C and 5D show the results of additional studies with tannic acid showing statistically significant reductions in contractile frequency and force/time.
  • Example 4- ANOl Antagonism Inhibits Normal Calcium Response to Exogenous Oxytocin
  • chloride efflux through ANOl channels serves as a driving force allowing for USM cells to depolarize and trigger VGCC activation and a commensurate intracellular calcium flux.
  • contractile agonist mediated contractions like oxytocin
  • intracellular flux of Ca++ is thought to result from BOTH the extracellular compartment as well as from within the SR. Since, ANOl antagonism results in a more hyperpolarized membrane potential it was anticipated ANOl blockade would suppress agonist- induced extracellular calcium entry by interference with voltage-gated mediated Ca++ entry.
  • Peak values obtained following drug or vehicle administration were then examined for group comparisons.
  • USM cells were loaded (6 hours) with a Ca++ indicator with preferential SR uptake (mag-fluo4), followed by loading (30 minutes) with a cytosolic specific Ca++ indicator (Fura-2).
  • This allows for simultaneously detection of calcium flux from the two cellular compartments.
  • This method has been utilized to detect USM SR calcium release and allows for resolution between elevations in Fura-2 fluorescence (indicating a rise in cytosolic calcium) and a commensurate fall in mag-fluo-4 (indicating SR calcium efflux) (Schmigol et al (2001)).
  • Figure 8 shows the assay worked using this proof of concept.
  • Blue lines show cells receiving thapsigargin, and red lines are cells that received vehicle.
  • Top is SR, bottom is cytosol.
  • Thapsigargin (SR calcium- ATPase) (1 ⁇ ) was added to deplete the SR of calcium under zero external calcium conditions. Calcium flux was recorded upon re-introduction of 2.5mM calcium into the external buffer. Vehicle or 100 ⁇ of benzbromarone was added.
  • Human myometrial cells Primary human myometrial cells (HuUSM) were grown to 70% confluence on sterile coated coverslips and transfected with a red fluorescent indicator (pCMVLifeAct-TagRFP) of f-actin formation according to manufacturer's recommendations (Ibidi®). Subsequent live cell imaging utilizing confocal microscopy (Nikon Eclipse Ti) allowed for real-time quantitative measurement of changes in f-actin (555/584 nm (Exmax/Emmax)) and Ca++ fluorescence evoked by contractile agonist (oxytocin luM) in the presence or absence (vehicle controls) of the ANOl antagonist benzbromarone (lOOuM).
  • p-MLC myosin light chain phosphorylation
  • siRNAs Transfection of siRNAs was performed at a concentration ⁇ with DharmaFECTl according to the manufacturer's instructions. Control cells were treated with non-targeting control siRNA. Forty-eight hours after transfection, immortalized human USM cells cultured in 6 well plates were harvested for protein. Cells were then homogenized in ice-cold modified RIPA cell lysis buffer (50mM Tris, 250mM NaCl, 5 mM EDTA, 50mM NaF ImM Na 3 V0 4 , 1% Nonide P40 and 0.02 % NaN). Following centrifugation (5000 x g, 5min, 4°C) of the whole cell lysate, supernatants were saved and protein concentrations were determined.
  • modified RIPA cell lysis buffer 50mM Tris, 250mM NaCl, 5 mM EDTA, 50mM NaF ImM Na 3 V0 4 , 1% Nonide P40 and 0.02 % NaN.
  • Figure 12A show the human USM cells showing f-actin (red) and calcium (green) indicators.
  • ANOl antagonism showed suppression in both calcium and f-actin fluorescence when compared to vehicle controls thereby linking ANO modulation to two inter-related and functionally relevant molecular events ( Figure 12B).
  • CaCC currents have been recognized in many smooth muscle beds to be important to electro-mechanical coupling at the cell membrane (Zhu et al. (2009); Hwang et al. (2009)). Although the majority of these findings were outside the uterus, there are some studies in rodents (none in human USM) that substantiate an important pro-contractile role for CaCC's.
  • ANO antagonists would work synergistically with nifedipine and/or terbutaline. For example, nifedipine-mediated reductions in intracellular calcium (by blocking VGCC's) lead to less calcium available to "activate" ANOl channels. Inversely, ANOl antagonism leads to hyperpolarization of the USM cell which interferes with VGCC activation.
  • terbutaline exerts its relaxant effects via ⁇ 2 adrenoceptor signaling leading to PKA-mediated activation of BK channels (a mechanistically distinct but complementary way to promote USM hyperpolarization).
  • the potential for amplified drug effects is further enhanced since structure/function analysis of the ANOl protein reveals a PKA phosphorylation motif.
  • Example 4 The materials and methods of Example 4 were used, except that human USM cells form Lonza and NIH were used and were pretreated with either nifedipine (0.01 ⁇ ) (a tocolytic agent and calcium blocker), MONNA (25 ⁇ ), benzbromarone (5 ⁇ ) or combinations of nifedipine with MONNA or benzbromane or DMSO (vehicle negative control). Cells were then treated with 10 ⁇ oxytocin.
  • nifedipine (0.01 ⁇ ) (a tocolytic agent and calcium blocker)
  • MONNA 25 ⁇
  • benzbromarone 5 ⁇
  • DMSO vehicle negative control
  • Figure 18A shows representative force tracings showing the differential potency of benzbromarone, tannic acid and MONNA.
  • the IC5 0 of benzbromarone, tannic acid and MONNA on oxytocin- induced contractility of human USM is 34 ⁇ , 45 ⁇ and 59 ⁇ respectively ( Figure 18B).
  • the threshold concentration to achieve Imax for benzbromarone, tannic acid and MONNA on oxytocin-induced contractility is 50 ⁇ , 100 ⁇ or 100 ⁇ respectively.
  • ANO-1 antagonism mediated by benzbromarone at 1 ⁇ (***p ⁇ 0.001), tannic acid at 10 ⁇ (***p ⁇ 0.001) or MONNA at 10 ⁇ (***p ⁇ 0.001) was observed and allowed for statistically significant reductions in frequency (Figure 18C).
  • BB benzbromarone
  • NAF nifedipine
  • Integral change in force was then measured over 20 minutes and processed as a percentage of reduction in integral force (g*sec) from baseline TEA-induced contractility.
  • Integral change in force was then measured over 60 minutes and processed as a percentage of reduction in integral force (g*sec) from baseline TEA-induced contractility. Additional organ bath experiments were conducted as described above using nifedipine alone with an EC 50 of about 2.8 X 10 8 ° M to 3.9 x 10 8 ° M or a combination of nifedipine and benzbromarone at an 4.6 X 10 - " 9 M to 1.5 X 10 - " 8
  • Results were compiled and reported as mean + SEM. Data was compiled and analyzed by One way ANOVA with Bonferroni's Multiple Comparison Test, and p ⁇ 0.05 was taken as significant.
  • Figure 19B is representative force tracings showing the enhanced potency of combining low dose nifedipine and benzbromarone (bottom tracing) on both frequency and force of TEA-induced contractions compared to single low dose treatments (middle tracings) or vehicle control (top tracing).
  • the IC5 0 of BB or NIF on TEA-induced contractility of mUSM are 10 ⁇ or 47 nM respectively.
  • Statistically non-significant reductions were observed in percent integral force following by NIF at 0.01 ⁇ and by BB at 1 ⁇ .
  • Statistically significant potentiation of relaxation was observed with low dose NIF and BB versus the BB alone or NIF alone groups (***p ⁇ 0.001) (Figure 19C).
  • Figure 19E is a graph showing the results of the percent change of force of TEA- induced contractions.
  • the combination of NIF and BB in the lower panel showed reductions of contractions at lower dosages at all time points than when NIF was used alone.
  • Example 3 Using the materials and methods of Example 3, the strips were stimulated with oxytocin 0.5 ⁇ . Following contractile stimulation with oxytocin strips were allowed to then equilibrate at increased baseline contractility for 30 minutes, after which they were treated with benzbromarone at 5 ⁇ . MONNA at 25 ⁇ , and nifedipine at 0.01 ⁇ , either alone or in combinations of BB and NIF and MN and NIF.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Inorganic Chemistry (AREA)
  • Gynecology & Obstetrics (AREA)
  • Pregnancy & Childbirth (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Endocrinology (AREA)
  • Reproductive Health (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Emergency Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention concerne des procédés et des compositions visant à bloquer les canaux activés par le calcium dans le tissu musculaire lisse de l'utérus, ce qui, à son tour, inhibe ou bloque les contractions utérines conduisant à un accouchement prématuré. Ces procédés et compositions sont utiles pour développer de nouveaux agents tocolytiques efficaces, et pour traiter et/ou prévenir les accouchements prématurés, seuls ou en combinaison avec des agents tocolytiques connus. En particulier, des agents qui bloquent les canaux chlorure activés par le calcium ont un effet synergique sur l'inhibition ou le blocage des contractions utérines lorsqu'ils sont combinés à des agents tocolytiques connus, tels que le sulfate de magnésium et la nifédipine, ce qui permet d'utiliser une bien moindre quantité des deux agents pour un résultat efficace.
PCT/US2017/022873 2016-03-17 2017-03-17 Utilisation d'inhibiteurs des canaux chlorure activés par le calcium pour prévenir et traiter les accouchements prématurés, seuls ou en combinaison avec d'autres agents tocolytiques WO2017161222A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201662309558P 2016-03-17 2016-03-17
US62/309,558 2016-03-17

Publications (1)

Publication Number Publication Date
WO2017161222A1 true WO2017161222A1 (fr) 2017-09-21

Family

ID=59852336

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2017/022873 WO2017161222A1 (fr) 2016-03-17 2017-03-17 Utilisation d'inhibiteurs des canaux chlorure activés par le calcium pour prévenir et traiter les accouchements prématurés, seuls ou en combinaison avec d'autres agents tocolytiques

Country Status (1)

Country Link
WO (1) WO2017161222A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020247756A1 (fr) * 2019-06-05 2020-12-10 Forcyte Biotechnologies, Inc. Petites molécules pour relaxer les contractions des muscules lisses de l'utérus
KR102343549B1 (ko) * 2020-07-28 2021-12-28 이화여자대학교 산학협력단 조기진통 환자에 대한 리토드린 투여 반응성 예측용 kcnmb2 snp 마커 및 이의 용도

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150018418A1 (en) * 2013-07-09 2015-01-15 Thomas Guttuso, Jr. Compositions and methods for prolonging pregnancy
US20150285800A1 (en) * 2012-10-24 2015-10-08 Winthrop-University Hospital Non-invasive biomarker to identify subject at risk of preterm delivery

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150285800A1 (en) * 2012-10-24 2015-10-08 Winthrop-University Hospital Non-invasive biomarker to identify subject at risk of preterm delivery
US20150018418A1 (en) * 2013-07-09 2015-01-15 Thomas Guttuso, Jr. Compositions and methods for prolonging pregnancy

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
BERNSTEIN ET AL.: "Calcium-activated chloride channels anoctamin 1 and 2 promote murine uterine smooth muscle contractility", AM J OBSTET GYNECOL., vol. 211, no. 6, December 2014 (2014-12-01), pages 688.e1 - 688.e10, XP055422185 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020247756A1 (fr) * 2019-06-05 2020-12-10 Forcyte Biotechnologies, Inc. Petites molécules pour relaxer les contractions des muscules lisses de l'utérus
KR102343549B1 (ko) * 2020-07-28 2021-12-28 이화여자대학교 산학협력단 조기진통 환자에 대한 리토드린 투여 반응성 예측용 kcnmb2 snp 마커 및 이의 용도

Similar Documents

Publication Publication Date Title
Bernstein et al. Calcium-activated chloride channels anoctamin 1 and 2 promote murine uterine smooth muscle contractility
Wang et al. Reduced ELABELA expression attenuates trophoblast invasion through the PI3K/AKT/mTOR pathway in early onset preeclampsia
Zheng et al. Bitter taste receptors as targets for tocolytics in preterm labor therapy
Fang et al. Melatonin induces progesterone production in human granulosa-lutein cells through upregulation of StAR expression
US10408838B2 (en) Non-invasive biomarker to identify subject at risk of preterm delivery
OA12890A (en) Methods of diagnosing and treating pre-eclampsia or eclampsia.
Kishore et al. Prostaglandin dehydrogenase is a target for successful induction of cervical ripening
Lo et al. Association of dysfunctional synapse defective 1 (SYDE1) with restricted fetal growth–SYDE1 regulates placental cell migration and invasion
Xu et al. Expression of ATP-sensitive potassium channels in human pregnant myometrium
Danielsson et al. Anoctamin channels in human myometrium: a novel target for tocolysis
Zhu et al. NPFF increases fusogenic proteins syncytin 1 and syncytin 2 via GCM1 in first trimester primary human cytotrophoblast cells
WO2017161222A1 (fr) Utilisation d'inhibiteurs des canaux chlorure activés par le calcium pour prévenir et traiter les accouchements prématurés, seuls ou en combinaison avec d'autres agents tocolytiques
Zhao et al. Letrozole regulates actin cytoskeleton polymerization dynamics in a SRC-1 dependent manner in the hippocampus of mice
US20110229423A1 (en) Pacap signaling pathway modulators for treating inflammatory skin diseases having a neurogenic component, notably rosacea, and compositions comprised thereof
Taher et al. Cholecystokinin, gastrin, cholecystokinin/gastrin receptors, and bitter taste receptor TAS2R14: trophoblast expression and signaling
Matsuki et al. Ryanodine receptor type 3 does not contribute to contractions in the mouse myometrium regardless of pregnancy
Skarra et al. CyPPA, a positive modulator of small-conductance Ca2+-activated K+ channels, inhibits phasic uterine contractions and delays preterm birth in mice
Hardigan et al. Linagliptin reduces effects of ET-1 and TLR2-mediated cerebrovascular hyperreactivity in diabetes
Sun et al. Activation of the epithelial sodium channel (EN aC) leads to cytokine profile shift to pro‐inflammatory in labor
Wang et al. Bone marrow-mesenchymal stem cells alleviate microglial Pyroptosis after intracerebral hemorrhage in rat by secreting C1q/tumor necrosis factor-related protein 3
Turkmen et al. Neurosteroid involvement in threatened preterm labour
Yu et al. RAR-related orphan receptor: an accelerated preeclampsia progression by activating the JAK/STAT3 pathway
Barghouth et al. The T-type calcium channel CaV3. 2 regulates insulin secretion in the pancreatic β-cell
Smith et al. Pathological interactions with the timing of birth and uterine activation
Liang et al. HIF‐1α is positively associated with endometrial receptivity by regulating PKM2

Legal Events

Date Code Title Description
NENP Non-entry into the national phase

Ref country code: DE

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17767593

Country of ref document: EP

Kind code of ref document: A1

122 Ep: pct application non-entry in european phase

Ref document number: 17767593

Country of ref document: EP

Kind code of ref document: A1