WO2017156591A1 - Osteoarthritis mirnas - Google Patents
Osteoarthritis mirnas Download PDFInfo
- Publication number
- WO2017156591A1 WO2017156591A1 PCT/AU2017/050241 AU2017050241W WO2017156591A1 WO 2017156591 A1 WO2017156591 A1 WO 2017156591A1 AU 2017050241 W AU2017050241 W AU 2017050241W WO 2017156591 A1 WO2017156591 A1 WO 2017156591A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- mir
- mirnas
- mmu
- seed
- osteoarthritis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Definitions
- the invention relates to osteoarthritis miRNAs, and to use of such osteoarthritis miRNAs for diagnosing and treating
- Osteoarthritis is the most prevalent musculoskeletal disease in Australia afflicting nearly 20% of the population, with half of all cases attributed to osteoarthritis. Osteoarthritis is the most common form of degenerative joint disease and it results in considerable disability and health care expenditure worldwide. In Australia, arthritis cost AU$24 billion in health care, lost time at work and disability in 2007, Of this cost, osteoarthritis accounted for over $4 billion in direct health care costs. The impact of this disease is growing as the population ages with the number of people affected expected to double by 2020. Post-traumatic osteoarthritis that develops after a joint injury accounts for up to 25% of all osteoarthritis cases.
- Osteoa thritis is a disease that impacts on all tiss es of the joint. While research continues to focus on defining the molecular mechanisms of cartilage degeneration in osteoarthritis, it is becoming increasingly clear that the entire joint, including the subchondral bone, ligaments, menisci and synovial tissues (lining, fat pad, capsule) actively contribute to the degenerative process. Nevertheless, osteoarthritis is primarily characterised by the progressive breakdown of articular cartilage.
- articular cartilage has a poor reparative capacity and ultimately it is the erosion of this tissue that signifies end-stage arthritis.
- the molecular mechanisms of osteoarthritis include microRNA (ml.RNA) modulated gene expression.
- miRNAs have been implicated in chondrogenesis (cartilage formation) , incl ding mi R- 145 (possible master regulator of chondrogenesis), miR-675 (collagen II expression in human chondrocytes), miR-140 (normal chondrogenesis and cartilage homeostasis), miR-1 (synthesis of aggrecan) , and niiR-199a (synthesis of collagen II and CO P) ⁇
- miR-140 a recent study showed co-expression of another 39 miRNAs in an ATDC5 in vitro model of chondrogenesis .
- miRNAs have been, shown to be dys regulated in. human osteoarthritis cartilage or osteoarthritis-cartilage chondrocytes from joint replacement surgery. Some miRNAs have been identified in osteoarthritis samples, including miR-140 and miR-455 in human osteoarthritis cartilage in one study, in another study miP-22 plus ano er 15 miRNAs were differe ially expressed in human
- miRNAs A number of miRNAs (miR-29, miR-141, miR-200a, raiR-206, miR-210, miR-2861) have also been associated with osteoblast differentiation. Thirty differentially expressed miRNAs have been identified in osteoarthritis bone, but these have little overlap with those that are cha ged in cartilage.
- miRNA expression datasets there is little overlap between miRNA expression datasets, for example, only 6 out of 50 miRNAs referred to above were common between any of the studies on human osteoarthritis cartilage or osteoa hritis-cartilage chondrocytes from, joint replacement surgery. Furthermore, expression of some miRNAs changed in opposite directions in different studies. For example, miR-140 was reported to be downregulated in osteoarthritis cartilage in some studies, but. upregulated in another study. These findings emphasise the variability of available o teoarthritis clinical samples.
- miRNA changes In addition to changes in miRNA in cartilage and bone in osteoarthritis, miRNA changes have been reported in synovial cells and fluid from osteoarthritis patients and there is growing evidence of miRNA involvement in synovitis/ inflammation.
- osteoarthritis Although many disease targets and. pathological pathways have been associated with osteoarthritis, diagnosis of osteoarthritis is not definitive and is based largely on observation of symptoms.
- therapeutic intervention is expected to have the most potential to delay, or reverse, disease progression and improve patient outcomes.
- miRNAs are emerging as key cellular regulators which act by fine tuning gene expression patterns during development and in disease. Recent research suggests miRNAs play an important role in cartilage development and homeostasis, but their dysregulation and likely involvement in osteoarthritic joint disease is poorly unde stood.
- osteoarthritis miRNAs Disclosed herein are osteoarthritis miRNAs and their use in diagnosing and treating osteoarthritis.
- the invention provides an isolated osteoarth itis miRNA selected from Tables 1 to 5, o an o tholog thereof.
- the osteoarthritis miRNA of the first aspect initiates and/or progresses early osteoarthritis.
- the osteoarth itis miRNA of he fi st aspect e tablis es osteoa thritis a d/or Progressive es established osteoarthritis to end-stage osteoarthritis.
- the osteoarthritis miRNA of the first aspect is represented by any one of SEQ ID NOs : 1 to 139. In one embodiment, the osteoarthritis miRNA of the first aspect is represented by any one of SEQ ID NOs : 1 to 57.
- the osteoarthritis miRNA of the first aspect is miR-6931, miR-466i, miR-574, miR-3082, miR-1187, miR-669n, miR-468, miR-6691, miR-32, miR- 66m, miR-669e or miR-672.
- the osteoarthritis miRNA of the first aspect is represented by any one of SEQ ID NOs : 1 to 12, 140 or 141.
- the osteoarthritis miRNA of the first aspect is produced from a stem-loop represented by any one of SEQ ID NOs : 142 to 155.
- the osteoarthritis miRNA of of the first aspect excludes miR-16-5p, miR-26b-5p, miR-30c-5p, miR-98-5p, miR- 149-5p, miR-210-3p, miR-107-3p, miR-185-5p, miR-223-3p, miR-337-3p, miR-342-3p, and miR-377-3p.
- the invention provides use of the osteoarthritis miRNA of the first aspect for diagnosing
- the invention provides a method of diagnosing osteoarthritis in a subject, the method comprising:
- the invention provides a method of treating osteoarthritis in a subject, the method comprising administering to the subject (a) an antagonist that inhibits an activity of an upreguiated osteoarthritis miRNA of the first aspect, wherein the subject has been diagnosed as having osteoarthritis by increased expression of the upreguiated osteoarthritis miRNA in a sample from the subj ect relative to a reference sample, or (b) a mimic that mimics an activity of a downregulated osteoarthritis miRNA of the first aspect, wherein the subject has been diagnosed as having osteoarthritis by decreased expression of the downregulated osteoarthritis miRNA. in a sample from, the sub ect relative to a reference sample.
- the sample is synovial fluid or articular cartilage. In one embodiment, the sample comprises a chondrocyte.
- the sample comprises a chondrocyte from a mamma1 ia.n sub ect.
- the mammalian subject is human.
- the reference sample is from the same subject, a different, subject, or a population of subjects.
- the antagonist that, inhibits an activity of the up egulated osteoarthritis miRNA in the subject is a nucleic acid antagonist or a small molecule.
- the nucleic acid antagonist is a peptide nucleic acid, a locked nucleic acid (LNA), a.
- nucleic acid a.ptam.er, an antisense nucleic acid, a phosphorodiamidate m.orpholino oligomer, a 2' -O-methyl RNA, an antagomir, an antiMir, a miRNA mask, a miRNA sponge, a nucleic acid analogue comprising a 2 N -O-methyl nucleotide, 2 ⁇ O-allyl nucleotide, 2 -deoxy-2 N -fluoro nucleotide, 2 * -deoxy nucleotide, 2"-0- methoxyethyl (MOE) nucleotide, or phosphorothioate li kage, a.
- MOE methoxyethyl
- DNAzyme or a ribozyme.
- the mimic that mim cs an activity of the aownregulated osteoarthritis miRNA in the subject is a peptide nucleic acid, a locked nucleic acid (LNA), a nucleic acid aptamer, a phosphorodiamidate m.orpholino oligomer, a 2' -O-methyl RNA, a nucleic a.cid an.a.I.ogue comprising a 2 ' ⁇ --0-methy1 nuc1eotide , 2 -0-a 1.1y1 nucleotide, 2 -deoxy-2 -fluoro nucleotide, 2 -deoxy nucleotide, or 2 -O-methoxyethyl (MOE) nucleotide, or comprises a phosphorothioate linkage .
- LNA locked nucleic acid
- MOE 2 -O-methoxyethyl
- the invention provides use of (a) an antagonist that inhibits an activity of an upregulated osteoarthritis miRNA of the first aspect or (b) a mimic that mimics an activity of a
- down egulated osteoarthritis miRNA of the first aspect in. the manufacture of a. medicament for treating osteoarthritis in the subject, wherein the subject has been diagnosed as having
- osteoarthritis miRNA or decreased expression of the aownregulated osteoarthritis miRNA. in a sample from, the sub ect relative to a reference sample.
- the invention provides (a) an antagonist; that inhibits an activity of an upregulated osteoarthritis miRNA. of the first aspect or (b) a mimic that mimics an activity of a down egulated
- osteoarthritis miRNA of the first aspect for treating osteoarthritis in the subject wherein the subject has been diagnosed as having osteoarthritis by increased expression of the upregulated
- osteoarthritis miRNA or decreased expression of the downregulated osteoarth itis miRNA in a sample from, the subject relative to a reference sample.
- the invention provides an isolated nucleic acid antagonist that binds an. upregulated osteoa thritis miRNA of the first aspect or binds a target mRNA of the upregulated
- osteoarthritis miRNA of the first aspect and inhibits an activity of the upregulated osteoarthritis miRNA in a subject.
- the nucleic acid antagonist of the sixth aspect comprises a. reverse complement sequence of any one of SEQ ID NOs: 156 to 183,
- the nucleic acid antagonist of the sixth aspect is a peptide nucleic acid, a locked nucleic, acid (LNA), a nucleic acid aptamer, an antisense nucleic acid, a
- LNA locked nucleic, acid
- phosphorodiamidate morpholino oligomer a 2 ' -O-m.ethyl RNA, an antagomir, an antiMir, a miRNA mask, a miRNA sponge, a nucleic acid analogue comprising a 2 N -O-methyl nucleotide, 2"-0-allyl nucleotide, 2 " -deoxy-2 N -fluoro nucleotide, 2 * -deoxy nucleotide, 2"-0- methoxyethyl (MOE) nucleotide, or phosphorothioate linkage, a DNAzyme, or a. ribozyme.
- MOE methoxyethyl
- the invention provides an isolated nucleic, acid mimic that binds a target mRNA of a downregulated osteoarthritis miRNA of the first aspect and mimics an activity of t.he down.regu1a ted os t;eoarth ri ti.s miRN .
- the isolated nucleic acid mimic of the sevent aspect is a peptide nucleic acid, a locked, nucleic acid (LNA), a nucleic acid aptamer, an antisense nucleic acid, a phosphorodiamidate morpholino oligomer, a 2'-0-methyl RNA, an antagomir, an antiMir, a miRNA mask, a miRNA sponge, a nucleic acid analogue comprising a 2 -O-methyl nucleotide, 2 -0-allyl nucleotide, 2 -deoxy-2 '' -fluoro nucleotide, 2 N -deoxy nucleotide, 2 -0- methox ethyi (MOE) nucleotide, or phosphorothioate linkage, a DNAzyme, or a ribozyme.
- LNA locked, nucleic acid
- MOE methox ethyi
- the invention provides a vector encoding the nucleic acid antagonist of the sixth aspect or the nucleic acid mimic of the seventh aspect.
- the invention provides a pharmaceutical composition comprising the nucleic acid antagonist of the sixth aspect or the nucleic acid mimic of the seventh aspect.
- the invention provides a kit comprising the nucleic acid antagonist of the sixth aspect, the nucleic acid mimic of the seventh aspect, the vector of the eighth aspect, or the pharmaceutical composition of the ninth aspect.
- the invention provides a method of treating osteoarthritis in a subject, the method comprising administering to the subject (a) an antagonist that inhibits an activity of an upregulated osteoarthritis miRNA of the first aspect, or (b) administering to the subject a mimic that mimics an activity of a downregulated osteoarthritis miP.NA of the first aspect.
- the invention provides use of (a) an antagonist that inhibits an activity of an upregulated
- osteoarthritis miRNA of the first aspect or (b) a mimic that mimics an activity of a downregulated osteoarthritis miRNA of the first aspect in the manufacture of a medicament for treating
- the invention provides a method of treating osteoarthritis i a subject, the method comprising administering to the subject (a) an antagonist that inhibits an activity of an upregulated osteoarthritis miRNA of the first aspect, or (b) administering to the subject a mimic that mimics an activity of a downregulated osteoarthritis miRNA of the first aspect excluding miR-16-5p, miR-26b-5p, miR-30c-5p, miR-98-5p, miR-149-5p, miR-210-3p, miR-107-3p, miR-185-5p, mi.R--223-3p, miR-337-3p, miR-342- 3p, and miR-377-3 .
- the invention provides use of (a) an antagonist that inhibits an activity of an unregulated
- osteoarthritis miRNA of the first aspect or (b) a mimic that mimics an activity of a downregulated osteoarthritis miRNA of the first aspect excluding miR-16-5p, miR-26b-5p, miR-30c-5p, miR-98-5p, miR- 149-5p, miR-210-3p, miR-107-3p, miR-185-5p, miR-223-3p, miR-337-3p, miR-342-3p, and miR-377-3p in the manufacture of a medicament for treating osteoarthritis in the subject.
- miR-16-5p, miR-26b-5p, miR-30c-5p, miR-98-5p, miR- 149-5p, miR-210-3p, miR-107-3p, miR-185-5p, miR-223-3p, miR-337-3p, miR-342-3p, and miR-377-3p in the manufacture of a medicament for treating osteoarthritis in the subject.
- the invention provides a method of t eating osteoarthritis i a sub ect, he method comprising administe ing to the subject (a) an antagonist that inhibits an activity of an upregulated osteoarthritis target mRNA, optionally of Table 10 or Table 11, or an ortholog thereof, or (b) an agonist that promotes an activity of a downregulated osteoarthritis target mRNA, optionally of Table 10 or Table 11, o an ortholog the eof.
- the invention provides use of (a) an antagonist that inhibits an activity of an upregulated osteoarthritis target mRNA, optionally of Table 10 o Table 11, or a ortholog thereof, or (b) an agonist that promotes an activity of a downregulated osteoarthritis target mRNA, optionally of Table 10 or Table 11, or an ortholog thereof in the manufacture of a medicament for treating osteoarthritis in a subject.
- the invention provides (a) an antagonist that inhibits an activity of an upregulated osteoarthritis target mRNA, optionally of Table 10 or Table 11, or an ortholog thereof, or (b) an agonist that promotes an activity of a downregulated osteoarthritis target mRNA, optionally of Table 10 or Table 11, or an ortholog thereof, or (b) an agonist that promotes an activity of a downregulated osteoarthritis target mRNA, optionally of Table 10 or Table 11, or an ortholog thereof, or (b) an agonist that promotes an activity of a downregulated
- osteoarthritis target mRNA optionally of Table 10 or Table 11, or an o tholog the eof for treati g osteoarthritis in a sub ect.
- the osteoarthritis is post-traumatic osteoarthritis.
- the os eoarthritis is early osteoa thritis.
- the osteoarthritis is established or end-stage osteoarthritis.
- the use of the second aspect or the method of the third aspect for diagnosing osteoarthritis may be performed in vitro.
- Figure 1 is a plot derived from. Example 1 showing one example of verification of microarray data by qPCR of Let-7c-5p at 1 week and 6 weeks post-surgery.
- Figure 2 provides scatter plots derived from Example 1 comparing miRNA expression between DMM and sham operated mice in (A) synovium (SYN) 6 weeks post-surgery and (B) subchondral bone (SCB) 6 weeks post-surgery.
- the outer heavy lines represent a fold change of 2 and the middle line represents no change.
- Figure 3 provides volcano plots derived from Example 1 showing differentially expressed miRNA in articular cartilage between DMM versus sham operated mice at 1 week post-surgery (A) and 6 weeks post-surgery (B) .
- Differential expression was defined as expression > 1.5 fold change (downregulated left broken line, up egulated right broken line) at an adjusted P ⁇ 0.05 (horizontal broken line ) .
- Figure 4 provides Venn diagrams derived from Example 1 showing differentially expressed miRNAs in articular cartilage at 1 week post-surgery and 6 weeks post-surgery (A) and showing the overlap of the data of Example 1 with previously published miRNA expression data from end-stage human osteoarthritis. Differential expression was defined as expression > 1.5 fold change at an adjusted P ⁇ 0.05.
- Figure 5 provides plots derived from Example 1 showing qPCR expression profiles of miRNAs identified in the overlap group of Figure 4B with human osteoarthritis in articular cartilage following s rgery.
- the inventors have identified for the first time a specific group of miRNAs that are dys regulated in osteoarthritis. Most dys regulated mlRNAs are upregulated in osteoarthritis, but the invention is not limited to such, because a smaller number of miRNAs are downregulated in osteoarthritis .
- the inventors have now applied this knowledge to the diagnosis and treatment of osteoarthritis, a sub-type of which is post-traumatic osteoarthritis. In particular, the inventors demonstrate herein that measurement of an osteoarthritis.
- osteoarthritis miRNA of the disclosure can be used to diagnose osteoarthritis when the osteoarthritis miRNA expression is greater or lesser in a sample of a subject than that of a normal non- arthritic sample. Given this knowledge, treatment of osteoarthritis is also enabled and encompassed by the invention.
- Osteoarthritis-associated miRNAs identified to date in end-stage clinical samples are miR-16-5p, miR-26b-5p, miR-30c-5p, miR- 98-5p, miR-149-5p, miR-210-3p, miR--107-3p, miR-185-5p, miR-223-3p, miR-337-3p, miR-342-3p, and miR-377-3p.
- osteoarthritis refers to the breakdown of cartilage in a joint.
- osteoarthritis One subtype of osteoarthritis is post-traumatic
- post-traumatic osteoarthritis refers to the breakdown of cartilage in a joint that has suffered physical injury or trauma, e.g. ligament, or meniscus damage, bone damage, or articular cartilage damage .
- the invention relates to osteoarthritis miRNAs whose
- osteoarthri is miRNAs whose expression is dysregulated in initiation and early progression of osteoarthritis will not continue to be dysregulated as osteoarthritis is established and possibly progressing to end --st ge osteoarthritis .
- osteoarthritis miRNA disclosed herein for treating established or end-stage osteoarthritis and aspects of the invention are directed to such use.
- Osteoarthritis may be diagnosed by physical examination, imaging and/or laboratory (pathology) tests. Physical examination of the affected joint may comprise checking for tenderness, swelling or redness, and for range of motion in the joint. Imaging the affected oint may i clude X-rays or magnetic resona ce imaging (MRI) .
- MRI magnetic resona ce imaging
- Cartilage loss appears in X-ray images as narrowing of the space between the bones of the affected joint.
- X-rays may also reveal bone spurs around the affected joint.
- X-rays may provide evidence of o teoarthritis i the affected joi t, befo e a s bject expe ience any symptoms.
- MRI produces detailed images of bone and soft tissues, including cartilage. At present MRI is not commonly used to diagnose osteoarthritis. However, MRI may be more useful for diagnosing initiation a d/or early progression of o teoarthritis.
- Laboratory (pathology) tests include analysis of blood or synovial fluid. Blood analysis may help eliminate other causes of joint pain, such as rheumatoid arthritis. Synovial fluid analysis may eliminate gout or infection as a cause of joint pain.
- initiation and early progression of osteoarthritis may be defined as distinct from established and end-stage osteoarthritis, i.e. non-established and non-end-stage osteoarthritis -
- initiation and early progression of osteoarthritis refers to the period immediately following a joint trauma or injury.
- the period immediately following joint injury or trauma may be 1 day, 2 days, 3 days, 4 days, 5 days,
- osteoarthritis may be diagnosed, and treated, based on the detection of dys regulation, of an osteoarthritis miRNA of the invention ,
- microRNA or “miRNA” is a recently discovered class of small ( ⁇ 23 nucleotide) noncoding R.NAs with important roles in post- transcriptional gene regulation in an expanding number biological s stems .
- Mature miRMAs range from 21-25 nucleotides in length and are produced from larger precursor miRMAs termed primary miRMAs (or pri- miRNA) .
- Primary miRMAs or pri- miRNA
- Pri-miRNAs are first transcribed by RNA polymerase 11 to generate the typical stem-loop (hairpin) structure where mature miRNA sequences are embedded.
- the pri-miRNAs are then, processed into shorter precursor miRNAs (pre-miRNAs) by ribonuclease-III (RNase 111) Drosha-DGCR8 micro-processing complex.
- RNase 111 ribonuclease-III
- Drosha-DGCR8 micro-processing complex RNA-induced silenci g complex
- Each precursor can produce two mature miRNAs: one derived from the 5' strand (-5p) and one from the 3' strand i-3p) .
- Related miRNA family members that differ by one or two nucleotides are indicated by additional lower case letters, such as, ml.R-26a and miR-26b.
- the RISC effector complexes are guided to target mRNAs where base-pairing of the miRNA to the 3' UTR of target mRNAs results in mRNA decay or translational repression of the target mRNA.
- miRNAs may also target, coding sequences and 5' UTR of mRNAs.
- each miRNA recognises many target mRNAs and mRNAs contain targets for numerous miRNAs creating rich regulatory complexity.
- mi NAs are frequently expressed as polycistronic transcripts and about one-third of ⁇ 1600 miRNA precursors (miRBase) are located in 156 co-expressed clusters.
- ortholog refers to a miRNA or rriRNA in. one species with the same function as that of a miRNA or m.R.NA in another species, respectively, with the ⁇ orthologs" arising through
- the orthologs have 90% or more complementarity. In one embodiment, the orthologs have the same nucleic acid sequence (i.e. 100% complementarity) . In one
- the miRNA orthologs have the same seed sequence.
- seed sequence often refers to a minimal sequence of perfect Watson-Crick base pairing between residues 2-8 of the miRNA and its target mR A.
- “Dys regulation” as used herein refers to upregulated or ⁇ downregulated expression o a osteoa thritis miRNA beyond a specific threshold.
- the expression threshold for "upregulated” expression is greater than 1.25- fold change increased expression at adjusted P ⁇ 0.05.
- the expression threshold for "downregulated” expression is greater than. 1.25-fold change decreased expression at adjusted F ⁇ 0.05. It follows that an "upregulated osteoarthritis miRNA” is a miRNA in any one of Tables 1 to 5 with a positive fold change and a "downregulated osteoarthritis miRNA” is a miRNA in any one of Tables 1 to 5 with a negative fold change.
- the osteoarthritis miRNA is represented by any one of SEQ ID NOs : 1 to 139. In some embodiments, the osteoarthritis miRNA is represented by any one of SEQ ID NOs: 1 to 57. In some embodiments, the osteoarthritis miRNA is mi.R-6931, miR-466i, miR-574, miR-3082, miR-1187, miR-669n, miR-468, miR-6691, miR-32, miR-466m, miP.-669e or miR-672. In some embodiments, the osteoarthritis miRNA is represented, by any one of SEQ ID NOs: 1 to 12, 140 or 141. In one embodiment, the osteoarthritis miRNA is represented by SEQ ID NO: 140 or SEQ ID NO: 141.
- the osteoarthritis miRNA is produced from a stem-loop represented by any one of SEQ ID NOs: 142 to 155.
- miRNA and small interfering RNA are both types of RNA interference (RNAi) .
- miRNA differs from siRNA in that miRNA is produced from an RNA transcript folded back on itself to form a stem-loop (hairpin) structure, whereas siRNA. is produced from, longer regions of double st a ded RNA.
- a miRNA “mimic” is a synthetic nucleic acid that replicates the endogenous function of a miRNA that has been lost or down-regulated.
- the miRNA mimic may include nucleic acid analogues.
- the miRNA mimic may be double stranded and chemically modified (e.g. 2' -O-methyl with phosphorothioate modifications), and may be a longer nucleic acid similar to the endogenous miRNA precursor .
- the nucleic acid mimic is a peptide nucleic acid, a locked nucleic acid (LNA) , a nucleic acid aptamer, a phosphorodiamidate morpholino oligomer, a 2' -O-methyl RNA, or a nucleic acid analogue comprising a 2 -O-methyl nucleotide, 2 N -0- allyl nucleotide, 2 -deoxy-2 -fluoro nucleotide, 2 -deoxy nucleotide or 2 ' -0- (methoxyethyl (MOE) nucleotide.
- the nucleic acid mimic comprises a phosphorothioate linkage.
- an "antagonist that inhibits an activity" of the osteoarthritis miRNAs disclosed herein refers to any nucleic acid or small molecule that is capable of increasing expression of a target mRNA.
- the antagonist is a "nucleic acid antagonist", which term excludes small molecules .
- the increase of target mRNA expression may be caused directly, e.g. a nucleic acid antagonist binding (hybridising) to the osteoarthritis miRNA or its target mRNA, or caused indirectly, e.g. in the case of a small molecule.
- a nucleic acid antagonist may inhibit formation of the stem-loop from which the osteoarthritis miRNA is produced.
- a "small molecule” may be an antagonist that inhibits an activity of the osteoarthritis miRNAs disclosed herein. However, based on current knowledge, it is unlikely to bind miRNA. Instead, without wishing to be bound to theory, small molecule inhibitors are thought to modulate expression of miRNAs by targeting signalling pathways that converge on the activation of transcription factors that regulate miRNA encoding genes or to modulate the machinery that contributes to itiiRNA maturation, and degradation processes .
- nucleic acid refers to single, double or triple stranded DNA, RNA, or modified versions thereof including a peptide nucleic acid or locked nucleic acid (LNA) .
- LNA locked nucleic acid
- a "target mRNA” is an niP.NA whose expression is decreased upon binding (hybridisation) of an miRNA, for example to the 3'UTR of the target mRNA.
- nucleic acid aptamer is a nucleic acid engineered through in vitro selection.
- the nucleic acid aptamer may be DNA, RNA or a nucleic acid analogue.
- the nucleic acid aptamer may bind the osteoarthritis miRNA or its target mRNA, and thus is a mimic or an antagonis that inhibits an activity of an
- osteoa rthritis miRNA osteoa rthritis miRNA
- an "anti se se nucleic acid” is a single stranded DNA or RNA that is complementary to a miRNA.
- the antisense nucleic acid may bind the osteoarthritis miRNA and is an antagonist that inhibits an activity of an osteoarthritis miRNA.
- An example of an antisense nucleic acid is an "antimiR".
- a "locked nucleic acid” or “LNA” is a nucleic acid analogue comprising a bridge between 2/ oxygen and 4' carbon that increases the hybridisation properties of an oligonucleotide comprising the LNA.
- An LNA. may be incorporated into DNA or RNA.
- the LNA may bind the osteoarthritis miRNA or its target. mRNA, and thus is a mimic or an antagonist that inhibits an activity of an osteoarthritis miRNA.
- a "phosphorodiamidate morpholino oligomer” or “PMO” comprises a backbone of methylene morpholine rings and phosphorodiamidate linkages.
- the PMO is a. nucleic acid analogue.
- the PMO may bind the osteoarthritis miRNA or its target mRNA, and thus is a mimic or an antagonist that inhibits an activity of an osteoarthritis miRNA.
- Nucleic acid analogues may find use in the invention.
- nucleotides 2 ' -deoxy-2 N -fiuoro nucleotides, 2 -deoxy nucleotides, 2 -0- (methoxyethyl (MOE) nucleotides, locked nucleic acid (LNA) nucleotides, phosphorothioate (PS) linkages, and combinations thereof that may be incorporated into a nucleic acid to increase its hybridisation properties and stability against enzymatic degradation compared to natural nucleic acids.
- MOE methoxyethyl
- LNA locked nucleic acid
- PS phosphorothioate linkages, and combinations thereof that may be incorporated into a nucleic acid to increase its hybridisation properties and stability against enzymatic degradation compared to natural nucleic acids.
- “2'TM0-methyl RNA” is RNA into which a 2 -O-methyl nucleotide has been incorporated.
- the nucleic acid analogue may bind the osteoarthritis miRNA or its target
- antisense nucleic acids that prevent miRNA binding to a desired site on an mRNA are "antagomirs", often comprising 2' -O-methyl RNA and phosphorothioates, and may be conjugated to cholesterol.
- a "miRNA mask” consists of a single-stranded 2 '-O-methyl-modified antisense oligonucleotide that is fully complementary to rniRNA binding sites in the 3' UTR of the target; mRNA, thus masking the miRNA binding site to de- repress its target mRNA.
- the miRNA mask may bind the osteoarthritis miRNA, and thus is an antagonist that inhibits an activity of an osteoarthritis miRNA.
- a "miRNA sponge” is a competitive inhibitor of miRNA.
- the miRNA sponge is expressed from a strong promoter and comprises multiple, tandem binding sites to a miRNA.
- the miRNA sponge is expressed from a vector.
- the m RNA sponge ma bind the osteoarthritis miRNA, and thus is an antagonist that inhibits an activity of an osteoarthritis miRNA.
- the antagonist that inhibits an activity of the osteoarthritis miRNA in the subject is a nucleic acid selected from the group consisting of antisense RNA, DNA or mixture thereof, DNAzyme, or ribozyme.
- the antagonist that inhibits an activity of the osteoarthritis miRNA in the subject is a nucle c acid comprising the reverse complement nucle c acid sequence of the osteoarthritis miRNA.
- the reverse complement nucleic acid will bind (hybridise) with the osteoarthritis miRNA, as well as the stem-loop sequence from which the mature osteoarthritis miRNAs of the i vention are produced.
- Example stem-loop sequences are provided in Table 7.
- the reverse complement nucleic acid may be RNA, DNA, and as for any nucleic acid herein, may comprise a nucleic acid analogue.
- Example reverse complement sequences for the osteoarthritis miRNAs of the invention are provided in Table 8.
- inhibitio of a miRNA may occur by binding the rniRNA or by binding the target mRNA.
- a nucleic acid antagonist is represented by any one of SEQ ID NOs : 156 to 183.
- a nucleic acid antagonist is a peptide nucleic acid, a locked nucleic acid (LNA), a nucleic acid aptamer, an antisense nucleic acid, a phosphorodiarnidate morpholino oligomer, a 2' -O-methyl RNA, an antagomir, an miRNA mask, an miRNA sponge, a nucleic acid analogue comprising a 2 N -O-methyl nucleotide, 2 N -0-allyl nucleotide, 2 " -deoxy-2 " -fluoro nucleotide, 2 -deoxy nucleotide, or 2 " -0- (metho yethyl (MOE) nucleotide, a DNAzyme, or a ribozyme; or comprises a phosphorothi oate linkage.
- LNA locked nucleic acid
- MOE metho yethyl
- the mimic or antagonist; that inhibits an activity of the osteoarth itis miRNA in the sub ect, whe e the ant gonist is a nucleic acid can be obtained using a number of techniques known in the art.
- nucleic acids can be chemically synthesized or recombinantly produced using methods known in the art.
- nucleic acids can be chemically synthesized using appropriately protected ribonucleotide phosphoramidites and a conventional RNA/DNA synthesizer .
- the mimic or antagonist where the antagonist is a nucleic acid may be encoded by a second nucleic acid, which may be inserted into a vector, such as a plasmid or viral vector, to express the mimic or nucleic acid antagonist at the site of osteoarthritis.
- a vector such as a plasmid or viral vector
- the vector may comprise heterologous nucleic acids .
- binding between nucleic acids may be considered in terms of perce t complementarity.
- percent complementarity between an osteoarthritis miRNA and its target mRNA is equivalent to the percentage of base pairs forming between the osteoarthritis miRNA and its target rnP.NA.
- osteoarthritis miRNA is equivalent to the percentage of base pairs forming between the osteoarthritis miRNA and the nucleic acid antagonist or the percentage of base pai s formi g betwee the nucleic acid antagonist and the target mRNA.
- Percent complementarity for the purpose of mimicking or inhibiting an activity of the osteoarthritis miRNA may be 90%, 91%, 92%, 93%, 94%, 94%, 96%, 97%, 98%, 99% or 100%.
- nucleic acid sequence of a miRNA Given the nucleic acid sequence of a miRNA, the person skilled in the art will be able to readily identify reverse complement nucleic acid sequences, stem-loops, orthologs, and design any number of mimics or binding antagonists based on complementarity amongst nucleic acids and nucleic acid analogues.
- the person skilled in the art may use databases (e.g. miRBase) comprising miRNA-- related nucleic acid sequences identified by unique accession identifiers.
- an "antagonist that inhibits an activity of an upregulated osteoarthritis target mRNA” refers to any nucleic acid, peptide, polypeptide (e.g. an antibody), or small molecule that is capable of decreasing expression, transcription o
- the antagonist that, inhibits an activit of an upregulated
- osteoa thritis targe mRNA is a "mimic" of an osteoarthritis miRNA as defined above, or other inhibitory P.NA (RNAi) . That is, the expression and activity of an osteoarthritis miRNA and its target mRNA are inversely related, so promoting activity of an osteoarthritis miRNA
- osteoarthritis miRNA can inhibit activity of a target mRNA.
- the decrease of target mRNA expression, transcription or translation may be caused directly, e.g. a mimic binding (hybridising) to the osteoarthritis miRNA or its target mRNA, or caused indirectly, e.g. in the case of a peptide, polypeptide, or small molecule.
- osteoarthritis target mRNA may be a small molecule, peptide or polypeptide (e.g. an antagonist antibody) that inhibits the activity of a protein encoded by the target. mRNA.
- an "agonist that promotes an activ ty of a downregulated osteoarthritis target mRNA” refers to any nucleic acid, peptide, polypeptide (e.g. an antibody), or small molecule that is capable of increasing expression, transcription or
- the agonist that promotes an activity of a downregulated osteoarthritis target mRNA is an antagonist of an osteoarthritis miRNA, That is, the expression and activity of an osteoarthritis miRNA and its ta get mRNA are inversely related, so i hibiti g acti ity of an osteoarth itis miRNA can promote activity of a target mRNA,
- the agonist that promotes an activity of a downregulated osteoarthritis target mRNA is a "nucleic acid antagonist" as defined above. The i crease of target.
- t a scription o translation ma be ca sed directly, e.g. a nucleic acid antagonist binding (hybridising) to the osteoarthritis miRNA or its target mRNA, or caused indirectly, e.g. in the case of a peptide,
- RNA may be a. small molecule, peptide or polypeptide (e.g. an agonist antibody) that promotes the activity of a. protein encoded by the target mRNA.
- a "small molecule" in addition to being an antagonist that inhibits an activity of the osteoarthritis miRNAs disclosed herein as defined above, may modulate expression, transcription or translation of an upregulated or downregulated target mRNA, or may modulate activity of a protein encoded by a target mRNA.
- an “antibody” is used in the broadest, sense and specifically covers monoclonal antibodies , polyclonal antibodies, multispecific antibodies (e.g. bispecific antibodies ) formed from at least one intact antibody, antibody fragments provided that the antibody fragment exhibits the desired biological activity, and peptide aptamers .
- an "antibody fragment” comprises a portion of an intact antibody, preferably the antigen, binding and/or the variable region of the intact antibody. Examples of antibody fragments include: Fab, Fab', F(ab') 2 and Fv fragments; diabodies; linear antibodies; single-chain antibody molecules; and multispecific antibodies formed from antibody fragments.
- the term "intact antibody” refers to an antibody in its substantially intact form, as opposed to an antibody fragment .
- intact antibodies include those with heavy and light chains including an Fc region.
- the constant domains may be native sequence constant domains (e.g., human native sequence constant domains) or amino acid sequence variants thereof.
- the intact antibody may have one or more effector functions.
- peptide aptamer refers to peptides, polypeptides or proteins that interfere with other protein interactions. They consist of a va iable peptide loop attached at both e ds to a protein scaffold. This double structural constraint greatly increases the binding affinity of the peptide aptamer to levels comparable to an antibody's (nanomolar range) .
- the term "subject" refers to a mammal.
- the mammal may be a primate, particularly a human, or may be a domestic, zoo, or companion animal.
- the invention disclosed herein is suitable for medical diag osis a d treatment of humans, it is also applicable to veterinary treatment, including treatment of domestic animals such as horses, cattle and sheep, companion animals such as dogs and cats, or zoo animals such as felids, canids, bovids and ungulates, as well as mice, rats and rabbits, for example.
- the osteoarthritis iRNA is in or from a sample.
- a sample is of the subject, and more particularly is a sample of a joint of the subject.
- the sample may be articular cartilage, subchondral bone, ligaments, menisci or synovial tissues, comprising lining, fat pad, capsule, or fluid.
- the sample is synovial fluid or articular cartilage.
- the sample comprises a chondrocyte.
- a sample may be obtained by biopsy, including fluid aspirate, or during surgery, for example.
- the sample may be pre-existing, for example an archived sample.
- a "reference sample” is a sample of the same type as the sample of interest but de ived from a sub ect or subjects known not to have osteoarthritis, or at least known not to have osteoarthritis in the joint from which the reference sample is taken.
- the reference sample may be from the same subject, e.g.
- Another joint not having osteoarthritis a different subject, or a population of subjects.
- Measuring expressio of a miRNA may be performed by methods known to the person skilled in the art, for example a two-step process involving reverse transcription and qPCR (yielding
- measured expression of an osteoarthritis miRNA "greater than the reference expression” means greater than a 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 225%, 250%, 275%, 300% or greater increase. For the avoidance of doubt, a 100% increase is equivalent to a doubling or 2-fold increase in
- a 200% increase is a tripling or 3-fold increase in expression and so on.
- measured expression of an osteoarth itis miRNA mea s >1,25, >1,5, or >2 fold change increased expression at adjusted P ⁇ 0.05.
- measured expression of an osteoarthritis miRNA "lesser than the reference expression” means greater than, a 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 225%, 250%, 275%, .300% or greater decrease.
- a 100% decrease is equivalent to complete ablation of expression, and a 50% decrease is equivalent to one-half or 0.5-fold expression and so on.
- measured expression of an osteoarthritis miRNA "lesser than the reference e pression” means >1.25, >1.5, or >2 fold decreased expression at. adjusted P ⁇ 0.05.
- the mimic or antagonist that inhibits an activity of the osteoarthritis miRNA in the subject will be formulated, dosed, and administered in a fashion consistent with good medical practice. It. will be appreciated by the person skilled in the art that the exact manner of formulating, dosing and administering to a subject a therapeutically effective amount of a mimic or an antagonist that inhibits an activity of the osteoarthritis miRNA in the subject will be at the discretion of a medical practitioner.
- the mode of administration including dosage, combination with other agents, timing and frequency of administration, and the like, may be affected by the diagnosis of a subject's likely responsiveness to treatment with the mimic or antagonist, as well as the subject's condition and history.
- the therapeutically effective amount of the mimic or antagonist to be administered will be governed by such considerations .
- the mimic or antagonist that inhibits an activity of the osteoarthritis miRNA in the subject, or a pharmaceutical composition comprising the mimic or antagonist may be administered to a subject. by any suitable method including parenteral (e.g. intravenous (IV) or i traa terial administration) , intramuscular, intraperitoneal, intracerobrospinal , subcutaneous (3C), intraarticular,
- parenteral e.g. intravenous (IV) or i traa terial administration
- IV intravenous
- i traa terial administration intramuscular, intraperitoneal, intracerobrospinal , subcutaneous (3C), intraarticular
- Intrasynovial , intrathecal, oral, topical and inhalation routes e.g. i trap Imonary
- Pare teral i fusions include intramuscular, TV, intraarterial, intraperitoneal and SC administration.
- the mimic or antagonist, or a pharmaceutical composition comprising the mimic or antagonist is administered to the subject intraarticularly or intrasynovially .
- i traar icular refers to administration into a joi t affected by osteoarthritis.
- I trasynovial refers to admi istration within the synovial lining of a joint.
- terapéuticaally effective amount refers to an amount of a mimic or an antagonist that inhibits an activity of the osteoarthritis miRNA in the subject effective to treat
- Non-viral strategies include nucleic acids with chemical modi fications , liposomes, polymers, hydrogels and nanoparticles , including encapsulation.
- nucleic acid modification is the replacement of each non-bridging oxygen in the ribose backbone with a sulfur atom.., thereby form ng a phosphorothioate, which possess an improved in vivo half-life relative to naked iRNAs .
- Encapsulation may be achieved using biodegradable polymers such as polylactide-polyglycolide, poly ( orthoesters ) and
- Liposomes may be, for example, a cationic liposome, e.g. DOTAP , LIPOFECTIN or LI POFECTAMINE .
- the biodegradable polymer may be a sustained-release polymer.
- the mimic or antagonist may be formulated with a nanoparticie, microsphere or hydrogel.
- miRNAs may be directly injected, thereby avoiding potential formulation issues.
- the mimic or antagonist that inhibits an activity of the osteoarthritis miRNA in the subject may be formulated as a pharmaceutical composition.
- the mimic or antagonist may be formulated with a pharmaceutically acceptable carrier.
- the term "pharmaceutical composition” refers to a composition comprising a mimic or an antagonist that inhibits an activity of the osteoarthritis miRNA in the subject as described herein that has been formulated for administration to a subject.
- the pharmaceutical composition is sterile.
- the therapeutic composition is pyrogen- free .
- the pharmaceutical composition may comprise the mimic or antagonist in any concentration that allows the administered mimic or antagonist to achieve a concentration in the range of from 0.1 g/kg to 100 mg/kg.
- the mimic or antagonist is administered to achieve a co centration of 0.1 pg/kg, 1 pg/kg, 10 p.g/kg, 100 pg/kg, 1 mg/kg, 2 mg/kg, 3 mg/kg, 4.
- the pharmaceutical compositions may comprise the mimic or antagonist in an amount of from 0.1% to 99.9% by weight.
- the mimic, nucleic acid antagonist or pharmaceutical composition may be provided in at a concentration of, for example, from about 1 nM to about 100 nM, from about 2 nM to about 50 nM, from 2 nM to about 10 nM, or 1 nM, 10 nM, 100 nM, 1 ⁇ , 10 ⁇ , 100 ⁇ , 1 mM, 10 mM, or 100 mM of mimic or nucleic acid antagonist.
- E ⁇ harmaceutically acceptable carriers include water, buffered water, saline solutions such as, for example, normal saline or bala ced saline solutio s such as Plank's or Earle's balanced solutions, glycine, and hyaluronic acid.
- the pharmaceutical composition may be formulated for
- Pharmaceutica1 comp os itions f or parenteral administration ma comprise pharmaceutically acceptable sterile aqueous or nonaqueous solutions, dispersions, suspensions or emulsions as well as sterile powders for reconstitution into sterile injectable solutions or dispersions.
- suitable aqueous and nonaqueous carriers, solvents, diluents or vehicles include water, etha ol, polyols (s ch as glycerol, propylene glycol, polyethylene glycol), carboxymethyl cellulose and mixtures thereof, vegetable oils (such as olive oil), injectable organic esters (e.g. ethyl oleate) .
- the pharmaceutical composition may comprise the mimic or antagonist in an encaps lated form, as described above.
- the pharmaceutical composition may be formulated for oral administration.
- Solid dosage forms for oral administration may include, for example, tablets, dragees, capsules, pills, and granules.
- the composition may comprise at least one pharmaceutically acceptable carrier such as sodium citrate and/or dicalcium phosphate and/or fillers or extenders such as starches, lactose, sucrose, glucose, marmitol, and silicic acid; binde rs such a s carboxy1meth y1ce11u 1ose , a 1ginates , ge1a tin, polyvinylpyrrolidone, sucrose and acacia; humectants such as glycerol; disintegrating agents such as agar-agar, calcium
- Liquid dosage forms for oral administration may include, for example, pharmaceutically acceptable emulsions, solutions,
- Liquid dosages may include inert diluents such as water or other solvents, solubilizing agents and/or emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl
- oils such as, for example, cottonseed oil, corn oil, germ oil, castor oil, olive oil, sesame oil
- glycerol tetrahydrofurfuryl alcohol
- polyethylene glycols and fatty acid esters of sorbitan and mixtures thereof.
- the pharmaceutical composition may comprise penetration e ha cers to e hance their delive y of egent.
- Penetration enhancers may include fatty acids such as oleic acid, lauric acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, reclineate, monoolein, dilaurin, caprylic acid, arachidonic acid, glyceryl 1-m.onocaprate, mono and di- giycerides and physiologically acceptable salts thereof.
- fatty acids such as oleic acid, lauric acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, reclineate, monoolein, dilaurin, caprylic acid, arachidonic acid, glyceryl 1-m.onocaprate, mono and di- giy
- the pharmaceutical composition may further include chelating agents such as, for example, ethylenediamirietetraacetic acid (EDTA), citric acid, salicylates (e.g. sodium salycilate,
- chelating agents such as, for example, ethylenediamirietetraacetic acid (EDTA), citric acid, salicylates (e.g. sodium salycilate,
- the mimic or nucleic acid, antagonist may be administered by administering cells which comprise the mimic or antagonist, where the antagonist is a nucleic acid.
- Cells that comprise the nucleic acid may be cells into which the nucleic acid has been directly introduced, or may be cells into which a second nucleic acid that encodes that mimic or nucleic acid antagonist has been introduced.
- the cell comprising the mimic or nucleic acid antagonist may be a stem cell, such as an embryonic stem cell, an adult stem cell, or an induced pluripotent stem cell (iPSC) .
- the cells may be obtained from, the subject (i.e. ex vivo) or from, an alternative source. Methods for the preparation of stem cells, differentiated cells and
- Methods suitable for the transfer of nucleic acids into mammalian cells in vitro include the use of liposomes, electroporation , microin ection, cell fusion, DEAE-dextran, the calcium phosphate precipitation method, nanoparticles or minicells.
- the mimic or nucleic acid antagonist may be introduced into cells by conjugating a moiety to enhance its cellular absorption, as well as in some cases targeting it to a particular tissue or facilitating uptake by specific types of cells.
- a hydrophobic ligand conjugated to the nucleic acid may facilitate direct permeation of the cellular membrane, or a ligand or moiety may be attached which facilitates targeting or ecep o -mediated endocytosis or cellular uptake.
- ligand or moieties include: cholesterol; other lipophilic compounds such as: 1-pyrene butyric acid, 1, 3-bis-O- (hexadecyl) glycerol, and menthol; folic acid; polyethylene glycols; carbohydrate clusters; cross-linking agents ; porph yrin conj ugates ; de1ivery ⁇ ept;i des ; monoc1ona1 antibodies against a target molecule; aptamers capable of binding to a target molecule.
- the mimic or nucleic acid antagonis may be formulated and administered, including introduced into ceils, using recombinant viral vecto s.
- the recombinant viral vectors typically comprise sequences encoding the mimic or nucleic acid antagonist and any suitable promoter for expressing the mimic or nucleic acid antagonist. Suitable promoters are known in the art and their selection is well wi hin the person skilled in the art. Any vi al vecto capable of accepting the coding sequence for the mimic or nucleic acid antagonist to be expressed can be used, for example, vectors derived from adenovirus (AV) ; adeno-associated virus (AAV) ; retroviruses ⁇ e.g.
- AV adenovirus
- AAV adeno-associated virus
- retroviruses ⁇ e.g.
- lentiviruses LV
- Rhabdoviruses murine leukemia virus
- herpes virus and the like. Selection of recombinant, viral vectors suitable for use in the invention, methods for inserting nucleic acid sequences for expressing the mimic or nucleic acid antagonist into the vector, and methods of delivering the viral vector to the cells of interest are within those skilled in the art.
- an article of manufacture and a kit comprising a container comprising the mimic, antagonist that inhibits an activity of the osteoarthritis miRNA in the subject, or pharmaceutical composition comprising the mimic or antagonist.
- the container may be a bottle or vial comprising the mimic, antagonist or pharmaceutical composition in oral or parenteral dosage form, each dosage form comprising a unit dose of the mimic, antagonist or pharmaceutical composition.
- the mimic or nucleic acid antagonist may be in the fo m of an in ectable sol tion i a disposable container.
- the article of manufacture or kit may further comprise printed instructions and/or a label or the like, indicating treatment of a subject according to the method disclosed herein.
- the mimic, antagonist or pharmaceutical composition may be administered in combination with a second pharmaceutical substance, for example, acetaminophen (paracetamol), a non-ste oidal antiinflammatory (NSAID) , a COX2 inhibitor, an oral opioid, or
- a second pharmaceutical substance for example, acetaminophen (paracetamol), a non-ste oidal antiinflammatory (NSAID) , a COX2 inhibitor, an oral opioid, or
- Administering "in combination” includes
- treat refers to both therapeutic treatment and prophylactic or preventative measures, wherein the aim is to prevent or ameliorate osteoarthritis in a subject or slow down (lessen) progression of osteoa t ritis.
- Subjects in need of treatment include those already with
- osteoarthritis as well as those in which osteoarthritis is to be prevented .
- preventing refers to keeping from occurring, or to hinder, defend from, or protect from the occurrence of osteoarth itis, including an abnormality or symptom.
- a subject in need of prevention may be prone to develop osteoarthritis.
- prevention of osteoarthritis refers to prevention of pos -traumatic os eoarthritis .
- Ameliorate or “amelioration” refer to a decrease, reduction or elimination of osteoarthritis, including an abnormality or symptom.
- a subject in need of treatment may already have osteoarthritis, or may be p one to have os eoarth ri tis , or may be in whom osteoarthritis is to be prevented.
- diagnosis refers to the identification of osteoarthritis in a subject. I is to be noted th t the te m “a” or “an” refers to o e o more, for example, "a molecule,''' is understood to represent one or more molecules. As such, the terms “a” or “an”, “one or more,” and “at least one” may be used interchangeably herein.
- Example 1 miBNA mioroarray expression profiling during onset and progression of post-traumatic osteoarthritis ⁇ wild-type mice) Method, Osteo thritis was induced in. 10-12 week old male wild-type mice by bilateral surgical destabilization of the medial meniscus (DMM) .
- DMM medial meniscus
- Total RNA was isolated from microdissected synovium and laser capture microdissected medial tibial plateau subchondral bone and articular cartilage of DMM and sham-operated mice at 1 week and 6 weeks post-surgery.
- osteoarthritis articular cartilage compared to the sham-operated control were detected ( Figure 3A, 3B) .
- the most highly dysregulated (>2-fold change, adjusted P ⁇ 0.05) osteoarthritis miRNAs at both 1 week and 6 weeks post-surgery were increased rather than decreased ( Figure 3A, 3B) .
- roiRNA expression profiling identified at 1 week post-surgery 122 osteoarthritis miRNAs (Table 1) and at 6 weeks post-surgery 74 osteoarthritis miRNAs (Table 2) dys regulated, in articular cartilage that were differentially expressed (adjusted P ⁇ 0.05) in DMM versus sham-operated groups (Figu e 4A ⁇ .
- osteoarthritis miR As were dys egulated only at 1 week post-surgery (Table 3 and Figure 4A) , and of the osteoarthritis miRNAs listed in Table 2 , 17 osteoarthritis miRNAs were dysregulated only at 6 weeks post-surgery (Table 4 and Figu e 4A) .
- miRNA Stem-loop sequence SEQ ID NO: mmu -miR- 6931 GUCACUGGGGUGGGGAGUGGGGGACUUCUGAAUCACUAGAGGC 142
- miRNA SEQ ID NO DNA Sequence SEQ ID NO: rnmu -miR- 6931-5p 1 AGUCCCCCACUCCCCACCCCA 156
- the miRNA microarray data were validated by qPCR of 20 miRNAs (examples are shown in Figure 5A to 5H) .
- the cartilage-specific miR-140 was significantly down-regulated in DMM ( Figure 5A, 5B) .
- osteoarthritis This group of 12 osteoarthritis miRNAs is different from the group of 12 osteoarthritis miRNAs with >2 fold change identified in Table 5.
- Typical osteoarthritis pathological features were demonstrated in the articular cartilage of DMM-operated mice compared with sham-operated mice, some of which were time dependent (proteoglycan loss and structural damage) .
- Microarray data revealed dynamic changes in miRNA expression profiles between normal (sham- operated) and osteoarthritis cartilage (DMM) .
- DMM normal (sham- operated) and osteoarthritis cartilage
- osteoarthritis initiation and progression in articular cartilage that have not been previously associated with osteoarthritis have been identified.
- Future studies are now focused on determining their role in osteoarthritis disease progression and identifying miRNA gene targets.
- Example 2 miRNA microarray expression profiling during onset and progression of post-traumatic osteoarthritis (wild-type and AdaxafcsSAcat mice)
- ADAMTS5 as the major agg ecanase in arthritic mouse
- AdamtsSAcat mice represent, early osteoarthritis disease processes independe t of ADAMTS5 activity and ggrecan breakdown. I contrast, miRNAs identified only in wild-type mice are likely to be involved with progressive cartilage degeneration and be relevant to targets in established human disease where cartilage degeneration has occu ed by the time of clinical dete mination.
- osteoarthritis miRNAs and will distinguish early from later osteoarthritis miRNAs.
- early and later therapies may be targeted to a subject; depending on the stage of disease at.
- the synovial tissues (joint capsule + synovial membrane + inf a-patella fat pad) are dissected free of muscle and the remai der of the joi t, placed in RNALate (Ambion) and stored at -80°C for later RNA extraction.
- Exposed tibial epiphyses are isolated, placed in RNALater containing 20% ETDA, decalcified for 72 hours and embedded in OCT.
- Serial 7 ⁇ coronal cryo-sections (30-45 per joint) are fixed in ethanol, air- dried and non-calcified medial tibial plateau articular c t lage and. underlying subchondral bone from previously assigned areas of cartilage fibrillation and loss of toluidirie blue staining are harvested separately by laser microdissection (Arcturus) .
- RNA isolation and differential expression Total RNA is isol ted from pooled microdissected sections of cartilage and bo e pooled from each DMM or sham-operated knee, e.g. using the miRCURY RNA isolation kit (Exiqon), to obtain 7-10 ng total RNA from microdissected tibial cartilage of a single mouse joint.
- PGR detection methods that can quantify mi RNA from these low levels of total RNA without amplification are employed.
- cDNA is generated, e.g. using the miRCURY LNA Universal RT miRNA system (Exiqon) .
- Quantitative PGR qPCR
- pre-validated mi NA primers to the 748 mouse miRNAs is performed, e.g. using a Roche LightCycler 430.
- RNA microarray approach such as miRCURY LNA array (Exiqon) is used, DMM and sham-operated tissue samples from different time-points are analysed,, e.g. at 1 and 6 weeks. These samples will identify the crucial miR As at early and later stages, and these differentially expressed miRNAs are measured by targeted PGR (Exiqon miRCURY LNA Universal RT PGR panels with custom LNA miRNA selection) in the wild-type and AdamtsS cat at ail time- points, e.g. 1, 2 and 6 weeks.
- PGR Exiqon miRCURY LNA Universal RT PGR panels with custom LNA miRNA selection
- miRNA qPCR data is analysed using the using the GenEx qPCR analysis software package (Exiqon) .
- CRISPR/Cas9 genome editing technology is used to generate conditional floxed miRNAs of osteoarthritis miRNAs.
- the CRISPR system has been used to generate miRNA knockouts in vivo, including silencing miRNAs (m.i.R-126a and miRNA gene cluster miR-17a-2 to miR-92a-2) in zebra fish, and deletion of the mate nally expressed IncRNA gene, Rian in mice.
- osteoarthritis miRNAs may also have roles in early cartilage development and in other developmental processes
- an inducible cartilage-spec fic system is used to allow normal development and cartilage maturation before inducing roiRNA knockdown prior to and during post-traumatic osteoarthritis initiation (DMM surgery) ,
- mice The f loxed miRNA mice are crossed with Col 2al-Cre-EP,T. mice
- Example 3 is confirmed in vivo using intra-articular viral delivery to modulate miRNA expression. This approach has been, used in re-clinical models including the mouse to overexpress or knock down miRNA, and is clinically applicable. A variety of vectors have been used, but adeno-associated-virus (AAV) provides optimal trans fection of chondrocytes with prolonged expression after a single injection and limited inflammatory response in infected cells, Intra-articular viral injection minimises systemic exposure and off-target effects on other tissues.
- AAV adeno-associated-virus
- Osteoarth itis lRNAs are targeted by intra-articular injection of an AAV expressing a miRNA antagonist (for knockdown) or miRNA mimic (for over-expression) .
- Osteoarthritis miRNA sequences are cloned into AAV expression vectors with a mCherry reporter (Vector SioLabs) to allow
- Osteoarthritis miP.NAs are measured by P.T qPCR (Qiagen miScript RT qPCR Kit) .
- RNA is isolated from tissues (e.g. liver, muscle, kidneys) that have not been directly injected with AAV.
- In situ hybridisation is also performed on sections of the knee joints to visualise the location of the osteoarthritis miRNA within the joint (meniscus, joint capsule, bone) and specific chondrocyte populations (super icial, middle, deep zones) where AAV induced miRNA. expression occurs.
- the knee joints are fixed, decalcified, p oce sed, ectio ed and chondrocyte hypertrophy, proteoglycan loss, cartilage structural damage, subchondral bone sclerosis and synovitis scored as described above (Example 3.3).
- mRNA expression profiling was performed in cartilage from wild-type (mice and Adamts5Acat mice, each with surgically induced osteoarthritis.
- Ada ts5Acat mice ADAMT35 activity is lacking and aggrecan loss and cartilage erosion are inhibited, which distinguishes mRNA expression changes that a e independent of ADAMTS5 activity and cartilage breakdown.
- Mechanical instability was introduced into the knee joints of 10 week old male mice via DMM surgery.
- Cartilage from the developing lesion in the destabilized medial meniscus and corresponding regions in sham- operated mice w s harvested by microdissection at 1, 2, and 6 weeks post-surge y, and. RNA was extracted, amplified, and hybridized to who1e-ge ome microarrays .
- Target mRNAs and their biological pathways provide additional therapeutic options for preventing and/or treating osteoarthritis, by inhibiting or promoting transcription (e.g. via miRNAs ) , and/or by inhibiting or promoting translation, and/or by inhibiting or activating proteins e coded by the target mRNAs .
- Table 10 Osteoarthritis miRNAs in articular cartilage and target mRNAs differentially expressed at 1 week post-surgery in DMM versus shain mice ith dysregulated expression.
- CAGUGCA miRNA m ⁇ RNA family raiRNA Gene Ensemble Gene ID mENA Exp name with seed Exp Log Symbol Fold sequence Ratio Change mmu-miR-1 8b-3p miR-148a-3p -0 , 385 AM0TL2 ENSMUSG00000032531 3.583
- CAGUGCA miRNA miKNA family raiBNA Gene Ensemble Gene ID mBNA Exp name with seed Exp Log Symbol Fold sequence Ratio Change inmu-raiR-1 8b-3p miR-148a-3p -0 , 385 F3 ENSMUSG00000028128 5.234
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Engineering & Computer Science (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Epidemiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Genetics & Genomics (AREA)
- General Engineering & Computer Science (AREA)
- Pathology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention relates to an isolated osteoarthritis miRNA, or an ortholog thereof, and to mimics and inhibitors thereof. The invention also relates to use of the osteoarthritis miRNAs, mimics and inhibitors thereof for diagnosing and/or treating osteoarthritis in subject.
Description
OSTEOARTHRITIS miRNAs
IPIHiljD
The invention relates to osteoarthritis miRNAs, and to use of such osteoarthritis miRNAs for diagnosing and treating
osteoarthritis .
BACKGROUND
Arthritis is the most prevalent musculoskeletal disease in Australia afflicting nearly 20% of the population, with half of all cases attributed to osteoarthritis. Osteoarthritis is the most common form of degenerative joint disease and it results in considerable disability and health care expenditure worldwide. In Australia, arthritis cost AU$24 billion in health care, lost time at work and disability in 2007, Of this cost, osteoarthritis accounted for over $4 billion in direct health care costs. The impact of this disease is growing as the population ages with the number of people affected expected to double by 2020. Post-traumatic osteoarthritis that develops after a joint injury accounts for up to 25% of all osteoarthritis cases.
Osteoa thritis is a disease that impacts on all tiss es of the joint. While research continues to focus on defining the molecular mechanisms of cartilage degeneration in osteoarthritis, it is becoming increasingly clear that the entire joint, including the subchondral bone, ligaments, menisci and synovial tissues (lining, fat pad, capsule) actively contribute to the degenerative process. Nevertheless, osteoarthritis is primarily characterised by the progressive breakdown of articular cartilage.
However, articular cartilage has a poor reparative capacity and ultimately it is the erosion of this tissue that signifies end- stage arthritis.
The molecular mechanisms of osteoarthritis include microRNA (ml.RNA) modulated gene expression.
A number of miRNAs have been implicated in chondrogenesis (cartilage formation) , incl ding mi R- 145 (possible master regulator of chondrogenesis), miR-675 (collagen II expression in human chondrocytes), miR-140 (normal chondrogenesis and cartilage
homeostasis), miR-1 (synthesis of aggrecan) , and niiR-199a (synthesis of collagen II and CO P)■ In addition to miR-140, a recent study showed co-expression of another 39 miRNAs in an ATDC5 in vitro model of chondrogenesis .
To date 50 miRNAs have been, shown to be dys regulated in. human osteoarthritis cartilage or osteoarthritis-cartilage chondrocytes from joint replacement surgery. Some miRNAs have been identified in osteoarthritis samples, including miR-140 and miR-455 in human osteoarthritis cartilage in one study, in another study miP-22 plus ano er 15 miRNAs were differe ially expressed in human
osteoarthritis cartilage, in another study 17 differentially expressed miRNAs were detected in human osteoarthritis cartilage, and in yet another study 7 of 723 miRNAs were differentially expressed in human osteoarth itis c ondrocytes. In this last study, only one miRNA was upregulated, m.i.R-483.
A number of miRNAs (miR-29, miR-141, miR-200a, raiR-206, miR-210, miR-2861) have also been associated with osteoblast differentiation. Thirty differentially expressed miRNAs have been identified in osteoarthritis bone, but these have little overlap with those that are cha ged in cartilage.
In general, there is little overlap between miRNA expression datasets, for example, only 6 out of 50 miRNAs referred to above were common between any of the studies on human osteoarthritis cartilage or osteoa hritis-cartilage chondrocytes from, joint replacement surgery. Furthermore, expression of some miRNAs changed in opposite directions in different studies. For example, miR-140 was reported to be downregulated in osteoarthritis cartilage in some studies, but. upregulated in another study. These findings emphasise the variability of available o teoarthritis clinical samples.
In addition to changes in miRNA in cartilage and bone in osteoarthritis, miRNA changes have been reported in synovial cells and fluid from osteoarthritis patients and there is growing evidence of miRNA involvement in synovitis/ inflammation.
Although many disease targets and. pathological pathways have been associated with osteoarthritis, diagnosis of osteoarthritis is not definitive and is based largely on observation of symptoms.
Moreover, all clinical studies of osteoarthritis to date have relied
or; human tissue that can only be obtained at end-stage disease (at joint replacement) . Information gathered from these studies provides little information on miRNAs involved in initiation, onset and early p og ession of osteoa thritis.
It follows that diagnosis and treatment of osteoarthritis is difficult in the early stages of osteoarthritis.
Compounding this relatively late window for diagnosis is a paucity of therapeutic options for managing osteoarthritis, let alone reversing osteoarthritis. Presently available osteoarthritis drugs have not demonstrated dramatic success, and in fact, there are no registered therapies that halt osteoarthritis onset or
progression .
Clearly, there is a need for improved, in particular earlier, diagnosis of and improved therapy for osteoarthritis. This is because early stage osteoarthritis is a critical time when
therapeutic intervention is expected to have the most potential to delay, or reverse, disease progression and improve patient outcomes.
SUM ARY
miRNAs are emerging as key cellular regulators which act by fine tuning gene expression patterns during development and in disease. Recent research suggests miRNAs play an important role in cartilage development and homeostasis, but their dysregulation and likely involvement in osteoarthritic joint disease is poorly unde stood.
Disclosed herein are osteoarthritis miRNAs and their use in diagnosing and treating osteoarthritis.
In a first aspect, the invention provides an isolated osteoarth itis miRNA selected from Tables 1 to 5, o an o tholog thereof.
In one embodiment, the osteoarthritis miRNA of the first aspect initiates and/or progresses early osteoarthritis.
In one embodiment, the osteoarth itis miRNA of he fi st aspect e tablis es osteoa thritis a d/or progres es established osteoarthritis to end-stage osteoarthritis.
In one embodiment, the osteoarthritis miRNA of the first aspect is represented by any one of SEQ ID NOs : 1 to 139.
In one embodiment, the osteoarthritis miRNA of the first aspect is represented by any one of SEQ ID NOs : 1 to 57.
In one embodiment, the osteoarthritis miRNA of the first aspect is miR-6931, miR-466i, miR-574, miR-3082, miR-1187, miR-669n, miR-468, miR-6691, miR-32, miR- 66m, miR-669e or miR-672.
In one embodiment, the osteoarthritis miRNA of the first aspect is represented by any one of SEQ ID NOs : 1 to 12, 140 or 141.
In one embodiment, the osteoarthritis miRNA of the first aspect is produced from a stem-loop represented by any one of SEQ ID NOs : 142 to 155.
In one embodiment, the osteoarthritis miRNA of of the first aspect excludes miR-16-5p, miR-26b-5p, miR-30c-5p, miR-98-5p, miR- 149-5p, miR-210-3p, miR-107-3p, miR-185-5p, miR-223-3p, miR-337-3p, miR-342-3p, and miR-377-3p.
In a second aspect, the invention provides use of the osteoarthritis miRNA of the first aspect for diagnosing
osteoarthritis in a subject.
In a third aspect, the invention provides a method of diagnosing osteoarthritis in a subject, the method comprising:
(a) measuring in a sample of the subject expression of the osteoarthritis miRNA of the first aspect;
(b) comparing the measured expression of (a) with expression of the osteoarthritis miRNA in a reference sample; and
(c) when the measured expression of (a) is greater than or lesser than the reference expression of (b) diagnosing
osteoarthritis in the subject.
In a fourth aspect, the invention provides a method of treating osteoarthritis in a subject, the method comprising administering to the subject (a) an antagonist that inhibits an activity of an upreguiated osteoarthritis miRNA of the first aspect, wherein the subject has been diagnosed as having osteoarthritis by increased expression of the upreguiated osteoarthritis miRNA in a sample from the subj ect relative to a reference sample, or (b) a mimic that mimics an activity of a downregulated osteoarthritis miRNA of the first aspect, wherein the subject has been diagnosed as having osteoarthritis by decreased expression of the downregulated
osteoarthritis miRNA. in a sample from, the sub ect relative to a reference sample.
In one embodiment, the sample is synovial fluid or articular cartilage. In one embodiment, the sample comprises a chondrocyte.
In one embodiment, the sample comprises a chondrocyte from a mamma1 ia.n sub ect.
In one embodiment, the mammalian subject is human.
In one embodiment, the reference sample is from the same subject, a different, subject, or a population of subjects.
In one embodiment, the antagonist that, inhibits an activity of the up egulated osteoarthritis miRNA in the subject is a nucleic acid antagonist or a small molecule. In one embodiment, the nucleic acid antagonist is a peptide nucleic acid, a locked nucleic acid (LNA), a. nucleic acid, a.ptam.er, an antisense nucleic acid, a phosphorodiamidate m.orpholino oligomer, a 2' -O-methyl RNA, an antagomir, an antiMir, a miRNA mask, a miRNA sponge, a nucleic acid analogue comprising a 2 N -O-methyl nucleotide, 2 ~O-allyl nucleotide, 2 -deoxy-2 N -fluoro nucleotide, 2 * -deoxy nucleotide, 2"-0- methoxyethyl (MOE) nucleotide, or phosphorothioate li kage, a.
DNAzyme, or a ribozyme.
In one embodiment, the mimic that mim cs an activity of the aownregulated osteoarthritis miRNA in the subject is a peptide nucleic acid, a locked nucleic acid (LNA), a nucleic acid aptamer, a phosphorodiamidate m.orpholino oligomer, a 2' -O-methyl RNA, a nucleic a.cid an.a.I.ogue comprising a 2 '■--0-methy1 nuc1eotide , 2 -0-a 1.1y1 nucleotide, 2 -deoxy-2 -fluoro nucleotide, 2 -deoxy nucleotide, or 2 -O-methoxyethyl (MOE) nucleotide, or comprises a phosphorothioate linkage .
Additionally or alterna tively to the fourth aspect, in a fifth aspect, the invention provides use of (a) an antagonist that inhibits an activity of an upregulated osteoarthritis miRNA of the first aspect or (b) a mimic that mimics an activity of a
down egulated osteoarthritis miRNA of the first aspect in. the manufacture of a. medicament for treating osteoarthritis in the subject, wherein the subject has been diagnosed as having
osteoarthritis by increased expression of the upregulated
osteoarthritis miRNA or decreased expression of the aownregulated
osteoarthritis miRNA. in a sample from, the sub ect relative to a reference sample.
Additionally or alternatively to the fourth aspect and fifth aspects, the invention, provides (a) an antagonist; that inhibits an activity of an upregulated osteoarthritis miRNA. of the first aspect or (b) a mimic that mimics an activity of a down egulated
osteoarthritis miRNA of the first aspect for treating osteoarthritis in the subject, wherein the subject has been diagnosed as having osteoarthritis by increased expression of the upregulated
osteoarthritis miRNA or decreased expression of the downregulated osteoarth itis miRNA in a sample from, the subject relative to a reference sample.
In a sixth aspect, the invention provides an isolated nucleic acid antagonist that binds an. upregulated osteoa thritis miRNA of the first aspect or binds a target mRNA of the upregulated
osteoarthritis miRNA of the first aspect and inhibits an activity of the upregulated osteoarthritis miRNA in a subject.
In one embodiment, the nucleic acid antagonist of the sixth aspect, comprises a. reverse complement sequence of any one of SEQ ID NOs: 156 to 183,
In one embodiment, the nucleic acid antagonist of the sixth aspect is a peptide nucleic acid, a locked nucleic, acid (LNA), a nucleic acid aptamer, an antisense nucleic acid, a
phosphorodiamidate morpholino oligomer, a 2 ' -O-m.ethyl RNA, an antagomir, an antiMir, a miRNA mask, a miRNA sponge, a nucleic acid analogue comprising a 2 N -O-methyl nucleotide, 2"-0-allyl nucleotide, 2 " -deoxy-2 N -fluoro nucleotide, 2 * -deoxy nucleotide, 2"-0- methoxyethyl (MOE) nucleotide, or phosphorothioate linkage, a DNAzyme, or a. ribozyme.
In a seventh aspect, the invention provides an isolated nucleic, acid mimic that binds a target mRNA of a downregulated osteoarthritis miRNA of the first aspect and mimics an activity of t.he down.regu1a ted os t;eoarth ri ti.s miRN .
In one embodietnent, the isolated nucleic acid mimic of the sevent aspect is a peptide nucleic acid, a locked, nucleic acid (LNA), a nucleic acid aptamer, an antisense nucleic acid, a phosphorodiamidate morpholino oligomer, a 2'-0-methyl RNA, an
antagomir, an antiMir, a miRNA mask, a miRNA sponge, a nucleic acid analogue comprising a 2 -O-methyl nucleotide, 2 -0-allyl nucleotide, 2 -deoxy-2 ''-fluoro nucleotide, 2N-deoxy nucleotide, 2 -0- methox ethyi (MOE) nucleotide, or phosphorothioate linkage, a DNAzyme, or a ribozyme.
In an eighth aspect, the invention provides a vector encoding the nucleic acid antagonist of the sixth aspect or the nucleic acid mimic of the seventh aspect.
In a ninth aspect, the invention provides a pharmaceutical composition comprising the nucleic acid antagonist of the sixth aspect or the nucleic acid mimic of the seventh aspect.
In a tenth aspect, the invention provides a kit comprising the nucleic acid antagonist of the sixth aspect, the nucleic acid mimic of the seventh aspect, the vector of the eighth aspect, or the pharmaceutical composition of the ninth aspect.
In an eleventh aspect, the invention provides a method of treating osteoarthritis in a subject, the method comprising administering to the subject (a) an antagonist that inhibits an activity of an upregulated osteoarthritis miRNA of the first aspect, or (b) administering to the subject a mimic that mimics an activity of a downregulated osteoarthritis miP.NA of the first aspect.
In a twelfth aspect, the invention provides use of (a) an antagonist that inhibits an activity of an upregulated
osteoarthritis miRNA of the first aspect or (b) a mimic that mimics an activity of a downregulated osteoarthritis miRNA of the first aspect in the manufacture of a medicament for treating
osteoarthritis in the subject.
In a thirteenth aspect, the invention provides a method of treating osteoarthritis i a subject, the method comprising administering to the subject (a) an antagonist that inhibits an activity of an upregulated osteoarthritis miRNA of the first aspect, or (b) administering to the subject a mimic that mimics an activity of a downregulated osteoarthritis miRNA of the first aspect excluding miR-16-5p, miR-26b-5p, miR-30c-5p, miR-98-5p, miR-149-5p, miR-210-3p, miR-107-3p, miR-185-5p, mi.R--223-3p, miR-337-3p, miR-342- 3p, and miR-377-3 .
In a fourteenth aspect, the invention provides use of (a) an antagonist that inhibits an activity of an unregulated
osteoarthritis miRNA of the first aspect or (b) a mimic that mimics an activity of a downregulated osteoarthritis miRNA of the first aspect excluding miR-16-5p, miR-26b-5p, miR-30c-5p, miR-98-5p, miR- 149-5p, miR-210-3p, miR-107-3p, miR-185-5p, miR-223-3p, miR-337-3p, miR-342-3p, and miR-377-3p in the manufacture of a medicament for treating osteoarthritis in the subject.
In a fifteenth aspect, the invention provides a method of t eating osteoarthritis i a sub ect, he method comprising administe ing to the subject (a) an antagonist that inhibits an activity of an upregulated osteoarthritis target mRNA, optionally of Table 10 or Table 11, or an ortholog thereof, or (b) an agonist that promotes an activity of a downregulated osteoarthritis target mRNA, optionally of Table 10 or Table 11, o an ortholog the eof.
Additionally or alternatively to the fifteenth aspect, in a sixteenth aspect, the invention provides use of (a) an antagonist that inhibits an activity of an upregulated osteoarthritis target mRNA, optionally of Table 10 o Table 11, or a ortholog thereof, or (b) an agonist that promotes an activity of a downregulated osteoarthritis target mRNA, optionally of Table 10 or Table 11, or an ortholog thereof in the manufacture of a medicament for treating osteoarthritis in a subject.
Addi ionally o alternatively to e fifteenth aspect a d sixteenth aspects, the invention provides (a) an antagonist that inhibits an activity of an upregulated osteoarthritis target mRNA, optionally of Table 10 or Table 11, or an ortholog thereof, or (b) an agonist that promotes an activity of a downregulated
osteoarthritis target mRNA, optionally of Table 10 or Table 11, or an o tholog the eof for treati g osteoarthritis in a sub ect.
In an embodiment of any one of the aspects of the invention, the osteoarthritis is post-traumatic osteoarthritis.
In an embodiment of any one of the aspects of the invention, the os eoarthritis is early osteoa thritis.
In an. embodiment of any one of the aspects of the invention, the osteoarthritis is established or end-stage osteoarthritis.
g
The use of the second aspect or the method of the third aspect for diagnosing osteoarthritis may be performed in vitro.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 is a plot derived from. Example 1 showing one example of verification of microarray data by qPCR of Let-7c-5p at 1 week and 6 weeks post-surgery. HK = Housekeeper; SYN = synovium; SCB = subchondral bone; SI = Sham at 1 week post-surgery; Dl = DMM at 1 week post-surgery; S6 = Sham at 6 weeks post-surgery; D6 = DMM at 6 weeks post-surgery.
Figure 2 provides scatter plots derived from Example 1 comparing miRNA expression between DMM and sham operated mice in (A) synovium (SYN) 6 weeks post-surgery and (B) subchondral bone (SCB) 6 weeks post-surgery. The outer heavy lines represent a fold change of 2 and the middle line represents no change.
Figure 3 provides volcano plots derived from Example 1 showing differentially expressed miRNA in articular cartilage between DMM versus sham operated mice at 1 week post-surgery (A) and 6 weeks post-surgery (B) . Differential expression was defined as expression > 1.5 fold change (downregulated left broken line, up egulated right broken line) at an adjusted P < 0.05 (horizontal broken line ) .
Figure 4 provides Venn diagrams derived from Example 1 showing differentially expressed miRNAs in articular cartilage at 1 week post-surgery and 6 weeks post-surgery (A) and showing the overlap of the data of Example 1 with previously published miRNA expression data from end-stage human osteoarthritis. Differential expression was defined as expression > 1.5 fold change at an adjusted P < 0.05.
Figure 5 provides plots derived from Example 1 showing qPCR expression profiles of miRNAs identified in the overlap group of Figure 4B with human osteoarthritis in articular cartilage following s rgery.
DETAILED DESCRIPTION
The inventors have identified for the first time a specific group of miRNAs that are dys regulated in osteoarthritis. Most
dys regulated mlRNAs are upregulated in osteoarthritis, but the invention is not limited to such, because a smaller number of miRNAs are downregulated in osteoarthritis . The inventors have now applied this knowledge to the diagnosis and treatment of osteoarthritis, a sub-type of which is post-traumatic osteoarthritis. In particular, the inventors demonstrate herein that measurement of an
osteoarthritis miRNA of the disclosure can be used to diagnose osteoarthritis when the osteoarthritis miRNA expression is greater or lesser in a sample of a subject than that of a normal non- arthritic sample. Given this knowledge, treatment of osteoarthritis is also enabled and encompassed by the invention.
None of the miRNAs identified herein by the inventors, e.g. miR-6931-5p, miR-466i-5p, miR-574-5p, miR-3082-5p, miR-1187, miR-669n, miR-468-3p, ml.R-6691-5p, miR-32-3p, iR-466 -5p, m±R-669e- 5p, and mi.R-672-5p, ha been disclosed or suggested to be involved in initiation and early progression of osteoarthritis. The inventors emphasise that all osteoarthritis-associated miRNAs identified to date have been identified in end-stage clinical samples that teach nothing abo t initiation and ea l progression of osteoarthritis .
Osteoarthritis-associated miRNAs identified to date in end- stage clinical samples are miR-16-5p, miR-26b-5p, miR-30c-5p, miR- 98-5p, miR-149-5p, miR-210-3p, miR--107-3p, miR-185-5p, miR-223-3p, miR-337-3p, miR-342-3p, and miR-377-3p.
As used herein, "osteoarthritis" refers to the breakdown of cartilage in a joint.
One subtype of osteoarthritis is post-traumatic
osteoarthritis. As used herein, "post-traumatic osteoarthritis" refers to the breakdown of cartilage in a joint that has suffered physical injury or trauma, e.g. ligament, or meniscus damage, bone damage, or articular cartilage damage .
The invention relates to osteoarthritis miRNAs whose
expression is dysregulated in initiation and early progression of osteoarthritis, as opposed to miRNAs whose expression is
dysregulated in established and end-stage osteoarthritis.
This is not to say that some osteoarthri is miRNAs whose expression is dysregulated in initiation and early progression of osteoarthritis will not continue to be dysregulated as
osteoarthritis is established and possibly progressing to end --st ge osteoarthritis .
Furthermore, the invention encompasses use of an
osteoarthritis miRNA disclosed herein for treating established or end-stage osteoarthritis, and aspects of the invention are directed to such use.
Osteoarthritis may be diagnosed by physical examination, imaging and/or laboratory (pathology) tests. Physical examination of the affected joint may comprise checking for tenderness, swelling or redness, and for range of motion in the joint. Imaging the affected oint may i clude X-rays or magnetic resona ce imaging (MRI) .
Cartilage loss appears in X-ray images as narrowing of the space between the bones of the affected joint. X-rays may also reveal bone spurs around the affected joint. X-rays may provide evidence of o teoarthritis i the affected joi t, befo e a s bject expe ience any symptoms. MRI produces detailed images of bone and soft tissues, including cartilage. At present MRI is not commonly used to diagnose osteoarthritis. However, MRI may be more useful for diagnosing initiation a d/or early progression of o teoarthritis. Laboratory (pathology) tests include analysis of blood or synovial fluid. Blood analysis may help eliminate other causes of joint pain, such as rheumatoid arthritis. Synovial fluid analysis may eliminate gout or infection as a cause of joint pain.
While not wis ing to be bound to t eory, a d owi g to t e curre t cli ical difficulty i diag osing i itiation a d early progression of osteoarthritis, it follows that initiation and early progression of osteoarthritis may be defined as distinct from established and end-stage osteoarthritis, i.e. non-established and non-end-stage osteoarthritis - With respect to post- traumatic osteoarthritis, initiation and early progression of osteoarthritis refers to the period immediately following a joint trauma or injury. The period immediately following joint injury or trauma may be 1 day, 2 days, 3 days, 4 days, 5 days,
6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks,
7 weeks, 8 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months,
12 months, 13 mon hs, 1 months, 15 months, 16 months, 17 months, 18 months, 19 months, 20 months, 21 months, 22 months, 23 months, 24 months, 1 year, 2 years, 3 years, 4 years, 5 years or 6 years, While not wishing to be bound by theory, the inventors consider that at. early stages of o teoarth itis, i.e. during initiation and early progression, it is miRNA dys regul tion in cartilage that drives osteoarthritis, but not miRNA dys regulation in other joint tissues, And in line with the invention described herein, osteoarthritis may be diagnosed, and treated, based on the detection of dys regulation, of an osteoarthritis miRNA of the invention ,
"microRNA" or "miRNA" is a recently discovered class of small (~23 nucleotide) noncoding R.NAs with important roles in post- transcriptional gene regulation in an expanding number biological s stems .
Mature miRMAs range from 21-25 nucleotides in length and are produced from larger precursor miRMAs termed primary miRMAs (or pri- miRNA) . Pri-miRNAs are first transcribed by RNA polymerase 11 to generate the typical stem-loop (hairpin) structure where mature miRNA sequences are embedded. The pri-miRNAs are then, processed into shorter precursor miRNAs (pre-miRNAs) by ribonuclease-III (RNase 111) Drosha-DGCR8 micro-processing complex. These pre-miRNAs are further processed by Dicer to liberate mature miRNAs that then associate with Argonaut family proteins to form an RNA- induced silenci g complex (RISC) .
Each precursor can produce two mature miRNAs: one derived from the 5' strand (-5p) and one from the 3' strand i-3p) . Related miRNA family members that differ by one or two nucleotides are indicated by additional lower case letters, such as, ml.R-26a and miR-26b. The RISC effector complexes are guided to target mRNAs where base-pairing of the miRNA to the 3' UTR of target mRNAs results in mRNA decay or translational repression of the target mRNA. miRNAs may also target, coding sequences and 5' UTR of mRNAs. Importantly, each miRNA recognises many target mRNAs and mRNAs contain targets for numerous miRNAs creating rich regulatory complexity.
mi NAs are frequently expressed as polycistronic transcripts and about one-third of ~1600 miRNA precursors (miRBase) are located in 156 co-expressed clusters.
As used herein, "ortholog" refers to a miRNA or rriRNA in. one species with the same function as that of a miRNA or m.R.NA in another species, respectively, with the ^orthologs" arising through
speciation. In one embodiment, the orthologs have 90% or more complementarity. In one embodiment, the orthologs have the same nucleic acid sequence (i.e. 100% complementarity) . In one
embodiment, the miRNA orthologs have the same seed sequence. Without, being bound to theory, a "seed sequence" often refers to a minimal sequence of perfect Watson-Crick base pairing between residues 2-8 of the miRNA and its target mR A.
"Dys regulation" as used herein refers to upregulated or¬ downregulated expression o a osteoa thritis miRNA beyond a specific threshold. The expression threshold for "upregulated" expression is greater than 1.25- fold change increased expression at adjusted P < 0.05. The expression threshold for "downregulated" expression is greater than. 1.25-fold change decreased expression at adjusted F< 0.05. It follows that an "upregulated osteoarthritis miRNA" is a miRNA in any one of Tables 1 to 5 with a positive fold change and a "downregulated osteoarthritis miRNA" is a miRNA in any one of Tables 1 to 5 with a negative fold change.
Fold change may be reported herein as Iog2 fold change
(log2FC) , where no change is 0, >1,25 fold change is >0,32, >1,5 fold change is >0.58, >2 fold change is >1.
In some embodiments, the osteoarthritis miRNA is represented by any one of SEQ ID NOs : 1 to 139. In some embodiments, the osteoarthritis miRNA is represented by any one of SEQ ID NOs: 1 to 57. In some embodiments, the osteoarthritis miRNA is mi.R-6931, miR-466i, miR-574, miR-3082, miR-1187, miR-669n, miR-468, miR-6691, miR-32, miR-466m, miP.-669e or miR-672. In some embodiments, the osteoarthritis miRNA is represented, by any one of SEQ ID NOs: 1 to 12, 140 or 141. In one embodiment, the osteoarthritis miRNA is represented by SEQ ID NO: 140 or SEQ ID NO: 141.
In one embodiment, the osteoarthritis miRNA is produced from a stem-loop represented by any one of SEQ ID NOs: 142 to 155.
In general , miRNA and small interfering RNA (siR A) are both types of RNA interference (RNAi) . However, miRNA differs from siRNA in that miRNA is produced from an RNA transcript folded back on itself to form a stem-loop (hairpin) structure, whereas siRNA. is produced from, longer regions of double st a ded RNA.
As used herein, a miRNA "mimic" is a synthetic nucleic acid that replicates the endogenous function of a miRNA that has been lost or down-regulated. The miRNA mimic may include nucleic acid analogues. The miRNA mimic may be double stranded and chemically modified (e.g. 2' -O-methyl with phosphorothioate modifications), and may be a longer nucleic acid similar to the endogenous miRNA precursor .
In some embodiments, the nucleic acid mimic is a peptide nucleic acid, a locked nucleic acid (LNA) , a nucleic acid aptamer, a phosphorodiamidate morpholino oligomer, a 2' -O-methyl RNA, or a nucleic acid analogue comprising a 2 -O-methyl nucleotide, 2N-0- allyl nucleotide, 2 -deoxy-2 -fluoro nucleotide, 2 -deoxy nucleotide or 2 ' -0- (methoxyethyl (MOE) nucleotide. In some embodiments, the nucleic acid mimic comprises a phosphorothioate linkage.
As used herein, as miRNA generally reduces expression of a target mRNA, an "antagonist that inhibits an activity" of the osteoarthritis miRNAs disclosed herein refers to any nucleic acid or small molecule that is capable of increasing expression of a target mRNA. in some embodiments , the antagonist is a "nucleic acid antagonist", which term excludes small molecules . The increase of target mRNA expression may be caused directly, e.g. a nucleic acid antagonist binding (hybridising) to the osteoarthritis miRNA or its target mRNA, or caused indirectly, e.g. in the case of a small molecule. A nucleic acid antagonist may inhibit formation of the stem-loop from which the osteoarthritis miRNA is produced.
As used herein, a "small molecule" may be an antagonist that inhibits an activity of the osteoarthritis miRNAs disclosed herein. However, based on current knowledge, it is unlikely to bind miRNA. Instead, without wishing to be bound to theory, small molecule inhibitors are thought to modulate expression of miRNAs by targeting signalling pathways that converge on the activation of transcription factors that regulate miRNA encoding genes or to modulate the
machinery that contributes to itiiRNA maturation, and degradation processes .
As used herein, "nucleic acid" refers to single, double or triple stranded DNA, RNA, or modified versions thereof including a peptide nucleic acid or locked nucleic acid (LNA) .
A "target mRNA" is an niP.NA whose expression is decreased upon binding (hybridisation) of an miRNA, for example to the 3'UTR of the target mRNA.
As used herein, a "nucleic acid aptamer" is a nucleic acid engineered through in vitro selection. The nucleic acid aptamer may be DNA, RNA or a nucleic acid analogue. The nucleic acid aptamer may bind the osteoarthritis miRNA or its target mRNA, and thus is a mimic or an antagonis that inhibits an activity of an
osteoa rthritis miRNA .
As used he ei , an "anti se se nucleic acid" is a single stranded DNA or RNA that is complementary to a miRNA. Thus, the antisense nucleic acid may bind the osteoarthritis miRNA and is an antagonist that inhibits an activity of an osteoarthritis miRNA. An example of an antisense nucleic acid is an "antimiR".
As used herein, a "locked nucleic acid" or "LNA" is a nucleic acid analogue comprising a bridge between 2/ oxygen and 4' carbon that increases the hybridisation properties of an oligonucleotide comprising the LNA. An LNA. may be incorporated into DNA or RNA. The LNA may bind the osteoarthritis miRNA or its target. mRNA, and thus is a mimic or an antagonist that inhibits an activity of an osteoarthritis miRNA.
As used herein, a "phosphorodiamidate morpholino oligomer" or "PMO" comprises a backbone of methylene morpholine rings and phosphorodiamidate linkages. The PMO is a. nucleic acid analogue. The PMO may bind the osteoarthritis miRNA or its target mRNA, and thus is a mimic or an antagonist that inhibits an activity of an osteoarthritis miRNA.
Nucleic acid analogues may find use in the invention. Nucleic a.cid an.a.1ogues inc1ud.e 2 N -0-methy1 n.uc1eotides, 2 " -0-a11 y1
nucleotides, 2 ' -deoxy-2 N -fiuoro nucleotides, 2 -deoxy nucleotides, 2 -0- (methoxyethyl (MOE) nucleotides, locked nucleic acid (LNA) nucleotides, phosphorothioate (PS) linkages, and combinations
thereof that may be incorporated into a nucleic acid to increase its hybridisation properties and stability against enzymatic degradation compared to natural nucleic acids. For example, "2'™0-methyl RNA" is RNA into which a 2 -O-methyl nucleotide has been incorporated. The nucleic acid analogue may bind the osteoarthritis miRNA or its target rriRNA, and thus is a mimic or an antagonist that inhibits an activity of osteoarthritis miRNA.
Other chemically engineered nucleic acids that prevent miRNA binding to a desired site on an mRNA are "antagomirs", often comprising 2' -O-methyl RNA and phosphorothioates, and may be conjugated to cholesterol.
As used herein, a "miRNA mask" consists of a single-stranded 2 '-O-methyl-modified antisense oligonucleotide that is fully complementary to rniRNA binding sites in the 3' UTR of the target; mRNA, thus masking the miRNA binding site to de- repress its target mRNA. The miRNA mask may bind the osteoarthritis miRNA, and thus is an antagonist that inhibits an activity of an osteoarthritis miRNA.
As used herein, a "miRNA sponge" is a competitive inhibitor of miRNA. The miRNA sponge is expressed from a strong promoter and comprises multiple, tandem binding sites to a miRNA. Typically, the miRNA sponge is expressed from a vector. The m RNA sponge ma bind the osteoarthritis miRNA, and thus is an antagonist that inhibits an activity of an osteoarthritis miRNA.
In other embodiments, the antagonist that inhibits an activity of the osteoarthritis miRNA in the subject is a nucleic acid selected from the group consisting of antisense RNA, DNA or mixture thereof, DNAzyme, or ribozyme.
In some embodiments, the antagonist that inhibits an activity of the osteoarthritis miRNA in the subject is a nucle c acid comprising the reverse complement nucle c acid sequence of the osteoarthritis miRNA. The reverse complement nucleic acid will bind (hybridise) with the osteoarthritis miRNA, as well as the stem-loop sequence from which the mature osteoarthritis miRNAs of the i vention are produced. Example stem-loop sequences are provided in Table 7. The reverse complement nucleic acid may be RNA, DNA, and as for any nucleic acid herein, may comprise a nucleic acid analogue.
Example reverse complement sequences for the osteoarthritis miRNAs of the invention are provided in Table 8.
Thus, it will be appreciated by the person skilled in the art that inhibitio of a miRNA may occur by binding the rniRNA or by binding the target mRNA.
In an embodiment of the invention, a nucleic acid antagonist is represented by any one of SEQ ID NOs : 156 to 183.
In an embodiment of the invention, a nucleic acid antagonist: is a peptide nucleic acid, a locked nucleic acid (LNA), a nucleic acid aptamer, an antisense nucleic acid, a phosphorodiarnidate morpholino oligomer, a 2' -O-methyl RNA, an antagomir, an miRNA mask, an miRNA sponge, a nucleic acid analogue comprising a 2 N -O-methyl nucleotide, 2N-0-allyl nucleotide, 2 " -deoxy-2 " -fluoro nucleotide, 2 -deoxy nucleotide, or 2 " -0- (metho yethyl (MOE) nucleotide, a DNAzyme, or a ribozyme; or comprises a phosphorothi oate linkage.
Other examples of, and methods of screening for, antagonists that inhibit an activity of miRNA or mimics that mimic an activity of miRNA are known to the person skilled in the art.
The mimic or antagonist; that inhibits an activity of the osteoarth itis miRNA in the sub ect, whe e the ant gonist is a nucleic acid, can be obtained using a number of techniques known in the art. For example, nucleic acids can be chemically synthesized or recombinantly produced using methods known in the art. For example, nucleic acids can be chemically synthesized using appropriately protected ribonucleotide phosphoramidites and a conventional RNA/DNA synthesizer .
In another embodiment, the mimic or antagonist where the antagonist is a nucleic acid, may be encoded by a second nucleic acid, which may be inserted into a vector, such as a plasmid or viral vector, to express the mimic or nucleic acid antagonist at the site of osteoarthritis. Thus, the vector may comprise heterologous nucleic acids .
Owing to the complementa ity of binding (hybridising) between nucleotides and nucleotide analogues, binding between nucleic acids may be considered in terms of perce t complementarity. For example, the percent complementarity between an osteoarthritis miRNA and its target mRNA is equivalent to the percentage of base pairs forming
between the osteoarthritis miRNA and its target rnP.NA. Similarly, percent complementarity between an osteoarthritis miRNA and a nucleic acid antagonist that inhibits an activity of the
osteoarthritis miRNA is equivalent to the percentage of base pairs forming between the osteoarthritis miRNA and the nucleic acid antagonist or the percentage of base pai s formi g betwee the nucleic acid antagonist and the target mRNA.
Percent complementarity for the purpose of mimicking or inhibiting an activity of the osteoarthritis miRNA may be 90%, 91%, 92%, 93%, 94%, 94%, 96%, 97%, 98%, 99% or 100%.
Given the nucleic acid sequence of a miRNA, the person skilled in the art will be able to readily identify reverse complement nucleic acid sequences, stem-loops, orthologs, and design any number of mimics or binding antagonists based on complementarity amongst nucleic acids and nucleic acid analogues. The person skilled in the art may use databases (e.g. miRBase) comprising miRNA-- related nucleic acid sequences identified by unique accession identifiers.
As used herein, an "antagonist that inhibits an activity of an upregulated osteoarthritis target mRNA" refers to any nucleic acid, peptide, polypeptide (e.g. an antibody), or small molecule that is capable of decreasing expression, transcription o
translation of a target mRNA, or is capable of inhibiting activity of the protein encoded by the target mRNA. In some embodiments , the antagonist that, inhibits an activit of an upregulated
osteoa thritis targe mRNA is a "mimic" of an osteoarthritis miRNA as defined above, or other inhibitory P.NA (RNAi) . That is, the expression and activity of an osteoarthritis miRNA and its target mRNA are inversely related, so promoting activity of an
osteoarthritis miRNA can inhibit activity of a target mRNA. The decrease of target mRNA expression, transcription or translation may be caused directly, e.g. a mimic binding (hybridising) to the osteoarthritis miRNA or its target mRNA, or caused indirectly, e.g. in the case of a peptide, polypeptide, or small molecule. An antagonist that, inhibits an activit of an upregulated
osteoarthritis target mRNA may be a small molecule, peptide or polypeptide (e.g. an antagonist antibody) that inhibits the activity of a protein encoded by the target. mRNA.
As used herein, an "agonist that promotes an activ ty of a downregulated osteoarthritis target mRNA" refers to any nucleic acid, peptide, polypeptide (e.g. an antibody), or small molecule that is capable of increasing expression, transcription or
translation of a target mRNA, or is capable of promoting activity of the protein encoded by the target mRNA. In some embodiments, the agonist that promotes an activity of a downregulated osteoarthritis target mRNA is an antagonist of an osteoarthritis miRNA, That is, the expression and activity of an osteoarthritis miRNA and its ta get mRNA are inversely related, so i hibiti g acti ity of an osteoarth itis miRNA can promote activity of a target mRNA, In one embodiment, the agonist that promotes an activity of a downregulated osteoarthritis target mRNA is a "nucleic acid antagonist" as defined above. The i crease of target. mRNA expression, t a scription o translation ma be ca sed directly, e.g. a nucleic acid antagonist binding (hybridising) to the osteoarthritis miRNA or its target mRNA, or caused indirectly, e.g. in the case of a peptide,
polypeptide, or small molecule. An agonist that promotes an activity of a dow egulated osteoarthritis target. mRNA may be a. small molecule, peptide or polypeptide (e.g. an agonist antibody) that promotes the activity of a. protein encoded by the target mRNA.
As used herein, a "small molecule", in addition to being an antagonist that inhibits an activity of the osteoarthritis miRNAs disclosed herein as defined above, may modulate expression, transcription or translation of an upregulated or downregulated target mRNA, or may modulate activity of a protein encoded by a target mRNA.
As used herein, the word "antibody" is used in the broadest, sense and specifically covers monoclonal antibodies , polyclonal antibodies, multispecific antibodies (e.g. bispecific antibodies ) formed from at least one intact antibody, antibody fragments provided that the antibody fragment exhibits the desired biological activity, and peptide aptamers . As used herein, an "antibody fragment" comprises a portion of an intact antibody, preferably the antigen, binding and/or the variable region of the intact antibody. Examples of antibody fragments include: Fab, Fab', F(ab')2 and Fv fragments; diabodies; linear antibodies; single-chain antibody
molecules; and multispecific antibodies formed from antibody fragments. As used herein, the term "intact antibody" refers to an antibody in its substantially intact form, as opposed to an antibody fragment . Specifically, intact antibodies include those with heavy and light chains including an Fc region. The constant domains may be native sequence constant domains (e.g., human native sequence constant domains) or amino acid sequence variants thereof. In some cases, the intact antibody may have one or more effector functions. The term "peptide aptamer" refers to peptides, polypeptides or proteins that interfere with other protein interactions. They consist of a va iable peptide loop attached at both e ds to a protein scaffold. This double structural constraint greatly increases the binding affinity of the peptide aptamer to levels comparable to an antibody's (nanomolar range) .
As used herein, the term "subject" refers to a mammal. The mammal may be a primate, particularly a human, or may be a domestic, zoo, or companion animal. Although it is particularly contemplated that the invention disclosed herein is suitable for medical diag osis a d treatment of humans, it is also applicable to veterinary treatment, including treatment of domestic animals such as horses, cattle and sheep, companion animals such as dogs and cats, or zoo animals such as felids, canids, bovids and ungulates, as well as mice, rats and rabbits, for example.
Generally, the osteoarthritis iRNA is in or from a sample. It follows that, as used herein, a "sample" is of the subject, and more particularly is a sample of a joint of the subject. Thus, the sample may be articular cartilage, subchondral bone, ligaments, menisci or synovial tissues, comprising lining, fat pad, capsule, or fluid. Preferably, the sample is synovial fluid or articular cartilage. In one embodiment, the sample comprises a chondrocyte.
A sample may be obtained by biopsy, including fluid aspirate, or during surgery, for example. Alternatively, the sample may be pre-existing, for example an archived sample.
As used herein, a "reference sample" is a sample of the same type as the sample of interest but de ived from a sub ect or subjects known not to have osteoarthritis, or at least known not to have osteoarthritis in the joint from which the reference sample is
taken. The reference sample may be from the same subject, e.g.
another joint not having osteoarthritis, a different subject, or a population of subjects.
Measuring expressio of a miRNA may be performed by methods known to the person skilled in the art, for example a two-step process involving reverse transcription and qPCR (yielding
quantitative expression) or microarray analysis (yielding relative expression) . Commercial reagents and apparatus are available and known to the person skilled in the art.
As used herein with regard to diagnosi g or treating
osteoarthritis, measured expression of an osteoarthritis miRNA "greater than the reference expression" means greater than a 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 225%, 250%, 275%, 300% or greater increase. For the avoidance of doubt, a 100% increase is equivalent to a doubling or 2-fold increase in
expression, a 200% increase is a tripling or 3-fold increase in expression and so on. In some embodiments, measured expression of an osteoarth itis miRNA. "g eater than the reference expression" mea s >1,25, >1,5, or >2 fold change increased expression at adjusted P < 0.05.
As used herein with regard to diagnosing or treating
osteoarthritis, measured expression of an osteoarthritis miRNA "lesser than the reference expression" means greater than, a 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 225%, 250%, 275%, .300% or greater decrease. For the avoidance of doubt, a 100% decrease is equivalent to complete ablation of expression, and a 50% decrease is equivalent to one-half or 0.5-fold expression and so on. In some embodiments, measured expression of an osteoarthritis miRNA "lesser than the reference e pression" means >1.25, >1.5, or >2 fold decreased expression at. adjusted P < 0.05.
The mimic or antagonist that inhibits an activity of the osteoarthritis miRNA in the subject will be formulated, dosed, and administered in a fashion consistent with good medical practice. It.
will be appreciated by the person skilled in the art that the exact manner of formulating, dosing and administering to a subject a therapeutically effective amount of a mimic or an antagonist that inhibits an activity of the osteoarthritis miRNA in the subject will be at the discretion of a medical practitioner. The mode of administration, including dosage, combination with other agents, timing and frequency of administration, and the like, may be affected by the diagnosis of a subject's likely responsiveness to treatment with the mimic or antagonist, as well as the subject's condition and history. Other relevant factors may include body size, body weight, age, health, sex of the subject, the site of administration, the method of administration, the scheduling of administration, possible side-effects and other factors known to medical practitioners. The therapeutically effective amount of the mimic or antagonist to be administered will be governed by such considerations .
The mimic or antagonist that inhibits an activity of the osteoarthritis miRNA in the subject, or a pharmaceutical composition comprising the mimic or antagonist, may be administered to a subject. by any suitable method including parenteral (e.g. intravenous (IV) or i traa terial administration) , intramuscular, intraperitoneal, intracerobrospinal , subcutaneous (3C), intraarticular,
intrasynovial , intrathecal, oral, topical and inhalation routes (e.g. i trap Imonary ) . Pare teral i fusions include intramuscular, TV, intraarterial, intraperitoneal and SC administration.
Preferably, the mimic or antagonist, or a pharmaceutical composition comprising the mimic or antagonist, is administered to the subject intraarticularly or intrasynovially .
"i traar icular" refers to administration into a joi t affected by osteoarthritis. "I trasynovial" refers to admi istration within the synovial lining of a joint.
The term "therapeutically effective amount" refers to an amount of a mimic or an antagonist that inhibits an activity of the osteoarthritis miRNA in the subject effective to treat
osteoarthritis in the subject.
Viral and non-viral strategies have been developed for formulating and administering miRNAs. Non-viral strategies include
nucleic acids with chemical modi fications , liposomes, polymers, hydrogels and nanoparticles , including encapsulation.
The most widely studied nucleic acid modification is the replacement of each non-bridging oxygen in the ribose backbone with a sulfur atom.., thereby form ng a phosphorothioate, which possess an improved in vivo half-life relative to naked iRNAs .
Encapsulation may be achieved using biodegradable polymers such as polylactide-polyglycolide, poly ( orthoesters ) and
poly ( anhydrides ) , anucleated bacterial minicells, a microemulsion, or liposomes. Liposomes may be, for example, a cationic liposome, e.g. DOTAP , LIPOFECTIN or LI POFECTAMINE . The biodegradable polymer may be a sustained-release polymer. The mimic or antagonist may be formulated with a nanoparticie, microsphere or hydrogel.
If intraarticular or int a syno ial admi istration, (e.g.
injection) is deemed advantageous, miRNAs may be directly injected, thereby avoiding potential formulation issues.
The mimic or antagonist that inhibits an activity of the osteoarthritis miRNA in the subject may be formulated as a pharmaceutical composition. For example, the mimic or antagonist may be formulated with a pharmaceutically acceptable carrier.
Methods for the formulation of compounds with pharmaceutical carriers are known in the art.
As used herein, the term "pharmaceutical composition" refers to a composition comprising a mimic or an antagonist that inhibits an activity of the osteoarthritis miRNA in the subject as described herein that has been formulated for administration to a subject. Preferably, the pharmaceutical composition is sterile. In one embodiment, the therapeutic composition is pyrogen- free .
The pharmaceutical composition may comprise the mimic or antagonist in any concentration that allows the administered mimic or antagonist to achieve a concentration in the range of from 0.1 g/kg to 100 mg/kg. In some embodiments, the mimic or antagonist is administered to achieve a co centration of 0.1 pg/kg, 1 pg/kg, 10 p.g/kg, 100 pg/kg, 1 mg/kg, 2 mg/kg, 3 mg/kg, 4. mg/kg, 5 mg/kg, 6 mg/kg, 7 mg/kg, 8 mg/kg, 9 mg/kg, 10 mg/kg, 11 mg/kg, 12 mg/kg, 13 mg/kg, 14 mg/kg, 15 mg/kg, 20 mg/kg, 25 mg/kg, 30 mg/kg, 35 mg/kg, 40 mg/kg, 45 mg/kg, 50 mg/kg, 55 mg/kg, 60 mg/kg, 65 mg/kg,
70 rag/kg, 75 mg/kg, 80 rag/kg, 85 mg/kg, 90 mg/kg, 95 rag/kg, or 100 mg/kg. The pharmaceutical compositions may comprise the mimic or antagonist in an amount of from 0.1% to 99.9% by weight. The mimic, nucleic acid antagonist or pharmaceutical composition may be provided in at a concentration of, for example, from about 1 nM to about 100 nM, from about 2 nM to about 50 nM, from 2 nM to about 10 nM, or 1 nM, 10 nM, 100 nM, 1 μΜ, 10 μΜ, 100 μΜ, 1 mM, 10 mM, or 100 mM of mimic or nucleic acid antagonist.
E^harmaceutically acceptable carriers include water, buffered water, saline solutions such as, for example, normal saline or bala ced saline solutio s such as Plank's or Earle's balanced solutions, glycine, and hyaluronic acid.
The pharmaceutical composition may be formulated for
parentera1 ad i nis tra t.ion. Pharmaceutica1 comp os itions f or parenteral administration ma comprise pharmaceutically acceptable sterile aqueous or nonaqueous solutions, dispersions, suspensions or emulsions as well as sterile powders for reconstitution into sterile injectable solutions or dispersions. Examples of suitable aqueous and nonaqueous carriers, solvents, diluents or vehicles include water, etha ol, polyols (s ch as glycerol, propylene glycol, polyethylene glycol), carboxymethyl cellulose and mixtures thereof, vegetable oils (such as olive oil), injectable organic esters (e.g. ethyl oleate) .
The pharmaceutical composition may comprise the mimic or antagonist in an encaps lated form, as described above.
The pharmaceutical composition may be formulated for oral administration. Solid dosage forms for oral administration may include, for example, tablets, dragees, capsules, pills, and granules. In such solid dosage forms, the composition may comprise at least one pharmaceutically acceptable carrier such as sodium citrate and/or dicalcium phosphate and/or fillers or extenders such as starches, lactose, sucrose, glucose, marmitol, and silicic acid; binde rs such a s carboxy1meth y1ce11u 1ose , a 1ginates , ge1a tin, polyvinylpyrrolidone, sucrose and acacia; humectants such as glycerol; disintegrating agents such as agar-agar, calcium
carbonate, potato or tapioca starch, alginic acid, silicates, and sodium carbonate; wetting agents such as acetyl alcohol, glycerol
monostearate; absorbants such as kaolin, and bentonite clay and/ or lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycol, sodium lauryl sulfate, and mixtures thereof, Liquid dosage forms for oral administration may include, for example, pharmaceutically acceptable emulsions, solutions,
suspensions, syrups and elixirs. Liquid dosages may include inert diluents such as water or other solvents, solubilizing agents and/or emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl
carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethyl formamide, oils (such as, for example, cottonseed oil, corn oil, germ oil, castor oil, olive oil, sesame oil), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof.
The pharmaceutical composition may comprise penetration e ha cers to e hance their delive y of egent.. Penetration enhancers may include fatty acids such as oleic acid, lauric acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, reclineate, monoolein, dilaurin, caprylic acid, arachidonic acid, glyceryl 1-m.onocaprate, mono and di- giycerides and physiologically acceptable salts thereof.
The pharmaceutical composition, may further include chelating agents such as, for example, ethylenediamirietetraacetic acid (EDTA), citric acid, salicylates (e.g. sodium salycilate,
5-methoxysa1i cy1ate, homovan i 1ate ) .
The mimic or nucleic acid, antagonist may be administered by administering cells which comprise the mimic or antagonist, where the antagonist is a nucleic acid. Cells that comprise the nucleic acid may be cells into which the nucleic acid has been directly introduced, or may be cells into which a second nucleic acid that encodes that mimic or nucleic acid antagonist has been introduced. The cell comprising the mimic or nucleic acid antagonist may be a stem cell, such as an embryonic stem cell, an adult stem cell, or an induced pluripotent stem cell (iPSC) . The cells may be obtained from, the subject (i.e. ex vivo) or from, an alternative source. Methods for the preparation of stem cells, differentiated cells and
precursors thereof, are well known in the art. Methods suitable for the transfer of nucleic acids into mammalian cells in vitro are
known in the art and include the use of liposomes, electroporation , microin ection, cell fusion, DEAE-dextran, the calcium phosphate precipitation method, nanoparticles or minicells.
The mimic or nucleic acid antagonist may be introduced into cells by conjugating a moiety to enhance its cellular absorption, as well as in some cases targeting it to a particular tissue or facilitating uptake by specific types of cells. For example, a hydrophobic ligand conjugated to the nucleic acid may facilitate direct permeation of the cellular membrane, or a ligand or moiety may be attached which facilitates targeting or ecep o -mediated endocytosis or cellular uptake. Examples of such ligand or moieties include: cholesterol; other lipophilic compounds such as: 1-pyrene butyric acid, 1, 3-bis-O- (hexadecyl) glycerol, and menthol; folic acid; polyethylene glycols; carbohydrate clusters; cross-linking agents ; porph yrin conj ugates ; de1ivery ρept;i des ; monoc1ona1 antibodies against a target molecule; aptamers capable of binding to a target molecule.
As noted above, the mimic or nucleic acid antagonis may be formulated and administered, including introduced into ceils, using recombinant viral vecto s. The recombinant viral vectors typically comprise sequences encoding the mimic or nucleic acid antagonist and any suitable promoter for expressing the mimic or nucleic acid antagonist. Suitable promoters are known in the art and their selection is well wi hin the person skilled in the art. Any vi al vecto capable of accepting the coding sequence for the mimic or nucleic acid antagonist to be expressed can be used, for example, vectors derived from adenovirus (AV) ; adeno-associated virus (AAV) ; retroviruses {e.g. lentiviruses (LV), Rhabdoviruses , murine leukemia virus); herpes virus, and the like. Selection of recombinant, viral vectors suitable for use in the invention, methods for inserting nucleic acid sequences for expressing the mimic or nucleic acid antagonist into the vector, and methods of delivering the viral vector to the cells of interest are within those skilled in the art.
Also provided is an article of manufacture and a kit, comprising a container comprising the mimic, antagonist that inhibits an activity of the osteoarthritis miRNA in the subject, or pharmaceutical composition comprising the mimic or antagonist. The
container may be a bottle or vial comprising the mimic, antagonist or pharmaceutical composition in oral or parenteral dosage form, each dosage form comprising a unit dose of the mimic, antagonist or pharmaceutical composition. For example, the mimic or nucleic acid antagonist may be in the fo m of an in ectable sol tion i a disposable container. The article of manufacture or kit may further comprise printed instructions and/or a label or the like, indicating treatment of a subject according to the method disclosed herein.
The mimic, antagonist or pharmaceutical composition may be administered in combination with a second pharmaceutical substance, for example, acetaminophen (paracetamol), a non-ste oidal antiinflammatory (NSAID) , a COX2 inhibitor, an oral opioid, or
glucocorticoid. Administering "in combination" includes
administration before, at the same time, or after the mimic, antagonist or pharmaceutical composition.
The terms "treat", "treating" or "treatment" refer to both therapeutic treatment and prophylactic or preventative measures, wherein the aim is to prevent or ameliorate osteoarthritis in a subject or slow down (lessen) progression of osteoa t ritis.
Subjects in need of treatment include those already with
osteoarthritis as well as those in which osteoarthritis is to be prevented .
The terms "preventing", "prevention", "preventative" or "prophylactic" refer to keeping from occurring, or to hinder, defend from, or protect from the occurrence of osteoarth itis, including an abnormality or symptom. A subject in need of prevention may be prone to develop osteoarthritis.
In one embodiment, prevention of osteoarthritis refers to prevention of pos -traumatic os eoarthritis .
The terms "ameliorate" or "amelioration" refer to a decrease, reduction or elimination of osteoarthritis, including an abnormality or symptom. A subject in need of treatment may already have osteoarthritis, or may be p one to have os eoarth ri tis , or may be in whom osteoarthritis is to be prevented.
The terms "diagnose", "diagnosing" or "diagnosis" refer to the identification of osteoarthritis in a subject.
I is to be noted th t the te m "a" or "an" refers to o e o more, for example, "a molecule,''' is understood to represent one or more molecules. As such, the terms "a" or "an", "one or more," and "at least one" may be used interchangeably herein.
In the claims which follow and in the description, of the i vention, except where the context requi es othe wise due to express language or necessary implication, the word "comprise" or variations such as "comprises" or "comprising" is used in an inclusive sense, i.e. to specify the presence of the stated features but not to preclude the presence or addition of further features in various embodiments of the invention.
It is to be understood that if any prior art publication is referred to herein, such reference does not constitute an admission that the publication forms a part of the common general knowledge in the art in Australia or any other country.
EXAMPLES
Example 1. miBNA mioroarray expression profiling during onset and progression of post-traumatic osteoarthritis {wild-type mice) Method, Osteo thritis was induced in. 10-12 week old male wild-type mice by bilateral surgical destabilization of the medial meniscus (DMM) . Total RNA was isolated from microdissected synovium and laser capture microdissected medial tibial plateau subchondral bone and articular cartilage of DMM and sham-operated mice at 1 week and 6 weeks post-surgery. For synovium and. subchondral bone, n=4 mice (DMM and sham) were used and for articular cartilage, n=3 each of 3 pooled mice (DMM and sham) were used.
Global miRNA expression profiling was performed using Agilent Mouse miRNA microarrays (Release 21.0, example microarray probes are identified in Table 9) , iRNAs d fferentially expressed in DMM compared to sham control determined using established bioinformatic analytics. Differential expression (i.e. dysregulation) was defined as adjusted P < 0.05. The severity of chondrocyte hypertrophy, proteoglycan loss, and structural damage in the tibial articular cartilage of the contralateral medial femoro-tibial joint was scored by one observer blinded to surgical intervention and post-operative time .
Microar ay data was validated by qPCR of multiple miRNAs, an example of which, Let-7c-5p in synovium and subchondral bone at 1 week and 6 weeks, is shown in Figure 1.
Results, Chondrocyte hypertrophy was considerably more extensive in tibial articular cartilage of DMM compared with sham- operated joints at both 1 and 6 weeks (p = 0.002 and p = 0.004, respectively) , but did not differ with time in either surgical group. There was no articular cartilage proteoglycan loss in either surgical group at 1 week, but significant proteoglycan loss was observed in the DMM group with time (P < 0.001) and in DMM versus sham-operated group at (5 weeks (P < 0.001) . Similarly, maximal and total articular cartilage structural damage scores did not differ between DMM and sham-operated groups at 1 week, but both scores progressed wi h time i DMM (P < 0.003) and in DMM versus sham- operated groups at 6 weeks (P < 0.001) .
The sensitivity of the microarrays to detect statistically valid miRNA expression changes was demonstrated by the
identification of 584 miRNAs differentially expressed between synovium, and subchondral bone (adjusted P < 0.05) . Moreover, 341 and 150 miRNAs were significantly dysregulated between 1 week and 6 week time points (fold change > 1.25; ad usted P < 0.05) i synovi m and subchondral bone, respectively.
Although these data show both tissue specific miRNA
expression patterns and temporal changes, there were no changes in miRNA expression in either the synovium or subchondral bone between DMM and sham mice at either 1 week or 6 weeks post-surgery
(Figure 2A, 2B) . Since this model represents early osteoarthritis, these data indicate that miRNA changes in subchondral bone detected by others in late disease are not involved in osteoarthritis initiation and progression.
In marked contrast to synovium and subchondral bone, significant dysregulation of many miRNAs in post-traumatic
osteoarthritis articular cartilage compared to the sham-operated control were detected (Figure 3A, 3B) . The most highly dysregulated (>2-fold change, adjusted P < 0.05) osteoarthritis miRNAs at both 1 week and 6 weeks post-surgery were increased rather than decreased (Figure 3A, 3B) .
roiRNA expression profiling identified at 1 week post-surgery 122 osteoarthritis miRNAs (Table 1) and at 6 weeks post-surgery 74 osteoarthritis miRNAs (Table 2) dys regulated, in articular cartilage that were differentially expressed (adjusted P < 0.05) in DMM versus sham-operated groups (Figu e 4A} .
Table 1. Osteoarthritis miRNAs in articular cartilage differentially expressed at 1 week post-surgery in DM versus mice. E'old change is reported as log? with threshold adjusted 0,05. miRNA sequences are provided in Tables 3 to 5.
miRBase
miR A Log2FC adj . P SEQ ID NO:
Accession
inmu -miR- 6931--5p 2 6 0 000 Μϊί«»Τ0027762 1
iranu -miR- 1187 1 9 0 000 MIMAT0005837
mmu -miR- 3082-5p 1 3 o 000 MIMAT0014872 3
mmu -miR- 574~5p 1 8 0 000 MIMAT0004893 4
mmu - iR- 466i-5p 1 8 0 000 I.MAT0017325 5
mmu -miR- 669n 1 6 0 001 MIMAT0009427 6
mmu -miR- 468-3p 1 5 0 002 MIMAT00Q2109 7
mmu -miR- 32 -3p 1 5 0 002 MI AT0017050 3
mmu -miR- 6691-5p 1 3 0 002 MIMAT0003413 9
mmu -miR- 466m- 5p 1 0 002 MIMAT0014882 10
mmu -miR- 669e-5p 1 1 0 003 ΜΙΜΑΊΌ005853 11
mmu - iR- 672~5p 1 1 0 005 MIMAT0003735 12
mmu -miR- 6348 1 1 0 007 MIMAT0025091 13
mmu -miR- 6918-5p 1 1 0 010 MIMAT0027736 14
mmu -miR- 466f--5p 1 0 0 002 MIMAT0004881 15
mmu -miR- 669c-Sp 1 0 0 002 ΜΪΜΑΤ0009421 16
mmu -miR- 466h-5p 1 0 0 004 MIMAT0004884 17
mmu -miR- 466j 1 0 0 003 ΜΪΜΑΊΌ005848 18
mmu- -miR- 669b-5p 1 0 0 002 MIMAT0003476 9
mmu- -miR- 466c-5p 0 9 0 003 ΜΪΜΑΤ0004877 20
mmu -miR- 467c-5p 0 9 0 004 MIMAT0004885 21
mmu■ -miR- 31-5p 0 9 0 010 ΜΪΜΑΤ0000538 22
mmu -miR- 669f-5p 0 3 0 003 MIMAT0017327 23
mmu- -miR- 5126 0 3 o 002 ΜΪΜΑΤ0020637 58
mmu- -miR- 195a-3p 0 3 0 003 ΜΪΜΑΤ0017000 24
mmu- - iR- 6904-5p 0 8 0 012 MTMAT0027708 25
mmu- -miR- 669k-5p 0 3 0 010 ΜΙ ίΑΊΌ0.17323 26
mmu -miR- 7682-3p 0 6 0 013 MIMAT0029885 59
mmu- -miR- 3960 0 8 0 002 MIMAT0019336 60
mmu -miR- 7118-Sp 0 3 0 002 MIMAT0028133 27
mmu- -miR- 7213-5p 0 7 0 024 ΜΪΜΑΤ0028404 61
mmu- -miR- 6546-5p 0 0 003 MIMAT0029792 62
mmu- -miR- 504-3p 0 7 0 022 MIMAT0017277 63
mmu- -miR- 6959-5p 0 7 0 010 MI AT0027818 64
mmu -miR- 16-l-3p 0 7 0 006 MIMAT0004625 28
mmu- -miR- 8110 0 6 0 002 MI T0031416 65
mmu -miR- 3095 0 6 0 020 MIMAT0031396 66
mmu- -miR- 6769b--5p 0. & 0 006 MIMAT0028040 67
mu- -miR- 7030-5p 0. 6 0 010 ΜΙΜΑΤ00Ξ7964 29
mmu- -miR- 7082-3p 0. 6 0 022 MIMAT0028071 30
mmu- -miR- 1895 0. 6 0 012 MIMAT0007867 68
mmu- -miR- 297c-5p 0 6 0 010 MI AT0004865 31
iranu- ■miR- 7038-5p 0. 6 0 010 MIMAT0027980 32
miRBase miR A Log2FC acij . P SEQ ID ΙΪΟ:
Accession
mmu -miR- -3101-3p 0. 6 0 003 MIMAT0014922 33 mmu -miR- -1927 0. 6 0 049 ΜΪΜΑΤ0009390 69 mmu -let- 0. 5 0 018 MTMAT0025123 34 mmu -miR- -1930--3p 0. 5 0 019 MIMAT0017340 70 mmu -miR- 499-3p 0. 0 010 MIMAT0017254 71 mm -miR- 129b--5p 0. 5 0 046 Μϊί«»Τ0029862 72 mmu -miR- 206-3p 0. 5 0 Oil MIMAT0000239 35 mmu -miR- 214-5p 0. 5 0 014 MIMAT0004664 73 mmu -miR- 222~3p 0. 5 0 Oil ΜΙΜΆΤ0000670 74 mmu -miR- 1224~5p 0. 5 0 004 MIMAT0005460 75 mmu -miR- 1306-3p 0. 5 0 004 ΪΜΑΤ0009411 36 mmu -miR- 700-5p 0. 5 0 012 MIMAT0017256 37 mmu -miR- 294--3p 0. 5 0 049 MI AT0000372 76 mmu -miR- 15 -3p 0. 5 0 020 ΜΪΜΑΊΌ004624 38 mmu -miR- 5622-3p 0. 5 0 050 MIKAT0022372 77 mmu -miR- 309S-3p 0. 4 0 010 MIMAT0014918 39 mmu -miR- 5099 0. 4 0 042 MIMAT0020606 40 mmu -miR- 346--5p 0. 4 0 019 MIMAT0000597 41 mmu -miR- 7034-Sp 0. 4 0 Oil MIMAT0027972 78 mmu -miR- 16-2-3p 0. 4 0 040 ΜΪΜΑΤ0017018 79 mmu -miR- 696 0. 4 0 043 ΜΪΜΑΤ0003483 80 mmu -miR- 99b-3p 0. 3 0 049 MIMAT0004525 81 mmu -miR- 6538 0. 3 0 030 ΜΪΜΑΊΌ025583 82 mmu -miR- 7013-5p 0. 3 0 042 MTMAT0027940 33 mmu- -miR- 7036a--5p 0. 3 0 033 MIMAT0027976 84 mmu -miR- 1897-5p Q. 3 0 050 MIMAT0007864 85 mmu- -miR- 149--5p --0 .3 0 049 ΜΪΜΑΤ0000159 86 mmu -miR- 99a-5p -0 , 3 0 031 MIMAT0000131 87 mmu- -miR- 210-3p -0 .3 0 049 MIMAT0000658 42 mmu- -miR- 26b-5p -0 .3 0 025 ΜΪΜΑΤ0000534 43 mmu- -miR- 331~3p -0 , 3 0 024 MTMAT0000571 88 mmu- -miR- 29b-l-5p -0 .3 0 049 Μ1 ίΑΊΌ004523 89 mmu -miR- 30e-5p - 0 , 4 0 034 ΜΪΜΑΤ0000248 90 mmu- -miR- 29c--5p --0 0 019 MIMAT0004632 91 mmu -miR- 128-3p -0 , 4 0 019 MIMAT0000140 44 mmu- -miR- 148b-3p -0 .4 0 019 ΜΪΜΑΤ0000580 92 mmu- -miR- 136-5p -0 .4 0 024 MIMAT0000148 45 mmu- -miR- 337-3p -0 , 4 0 049 TMAT0000578 93 mmu- -let- 7f-5p -0 .4 0 050 MIMAT0000525 94 mmu -miR- 151-5p -0 , 4 0 012 MIMAT0004536 46
Mill- -miR- 22-5p -0 .4 0 019 MI T0004629 95 mmu -miR- 6972-5Ό -0 .4 0 017 MIMAT0027846 96 irimu- •miR- 455--5p --0 0 , 046 ΜΪΜΑΤ0003485 97 mmu- -miR- 101c -0 .4 0. 025 MIMAT0019349 98 mmu- - iR- 495-3p -0 , 4 0. 014 MIMAT0003456 99 mmu- -miR- 28c -0 .4 0, 014 MIMAT0019339 47 mmu- -miR- 43 -5p -0 , 4 0. 025 MIMAT0001421 100 mmu- ■miR- 28a--5p --0 .4 0. 008 MIMAT0000653 48
miRBase
miRNA Log2FC acij . P SEQ ID NO:
Accession
ramu -miR- 329-3p -0 4 0 041 MIMAT0000567 49
-mxR- 181a-l-3p -0 5 0 005 MIMAT0000660 101
ramu -miR- 181c-5p -0 5 0 008 MIMAT0000674 102
-mxR- 196a-5p --0 5 0 019 MIMAT0000518 103
mmu -mxR- 30a-- 3 -0 5 0 012 MIMAT0000129 104
mm -let- 7b-5p --0 5 0 012 MIMAT0000522 105
mmu -mxR- 377-3p -0 5 0 019 MIMAT0000741 50
mmu -miR- 224-5p -0 5 o 012 MIMAT0000671 106
mmu -let- 7a-5p -0 5 0 019 MIMAT0000521 107
mmu -miR- 337-5p -0 5 0 019 MIMAT0004644 108
mmu -mxR- 1839--5p --0 5 0 014 MIMAT0009456 51
mmu -mxR- 30e-3p -0 5 0 010 MIMAT00Q0249 109
mmu -mxR- 376b-5p --0 5 0 Oil MIMAT0003388 52
mmu -mxR- 361-5p -0 5 0 012 MIMAT0000704 110
mmu -let- 7 c-5p -0 5 o 010 MIMAT0000523 111
mmu -mxR- 466g -0 5 0 020 ΜΪΜΑΤ0004883 112
mmu -miR- 411-5p -0 5 0 018 IMAT0004747 113
mm -mxR- 98--5p --0 5 0 008 MIMAT0000545 114
mmu -mxR- 379-5p -0 5 0 024 MIMAT0000743 115
mmu -mxR- 425-5p --0 5 0 008 MIMAT0004750 116
mmu -mxR- 669f-3p -0 5 0 022 MIMAT0005839 117
mmu -miR- 379-3p -0 5 o 005 IMAT0017080 53
mmu -mxR- 466f-3p -0 5 0 032 MI AT0004882 118
mmu -miR- 376c-3p -0 5 0 010 IMAT0003183 54
mm -mxR- 299b-5p --0 5 0 020 MIMAT0022836 55
mmu -mxR- 30c-5p -0 5 0 014 MIMAT0000514 119
mmu -mxR- 466i-3p --0 5 0 046 MIMAT0005834 120
mmu -mxR- 374c-5p -0 6 0 003 MIMAT0014953 121
mmu -miR- 411-3p -0 6 o 012 IMAT0001093 56
mmu -mxR- 196b-5p -0 6 0 003 MI AT0001081 57
mmu -miR- 6954-5p -0 6 0 048 IMAT0027808 122
Table 2 , Osteoarthritis miBNAs differentially expressed in articular cartilage at 6 weeks post-surgery in DMM versus sham mi
Fold change is reported as log2 with threshold adjusted P < 0.05. miRNA sequences are provided in Tables 3 to 5.
miRBase
miRNA Log2FC adj. P SEQ ID NO:
Accession
mmu-mxR- 6931-5p 1 8 0 000 MIMAT0027762 1
mmu-mxR- 5099 1 5 0 000 MIMAT0020606 40
mmu-mxR- 1187 1 4 0 003 MIMAT0005837 2
mmu-mxR- 3082-5p 1 4 0 003 MIMAT0014872 3
mmu-mxR- 574-5p 1 3 0 003 MIMAT0004893 4
mmu-mxR- 32 -3p 1 3 0 006 MI AT0017050 8
mmu-m R- 669n 1 3 0 006 IMAT0009427 6
mmu-mxR- 466i-5p 1 3 0 003 MIMAT001 325 5
mmu-mxR- 468-3p 1 2 0 006 MIMAT0002109 7
miRBase miR A Log2FC acij . P SEQ ID NO:
Accession
mmu -miR- -6691-5p 1.1 0 006 MT.MAT0009418 9 mmu -miR- -466m-5p 1.1 0 007 M.LMAT0014882 10 mmu -miR- -669e-5p 1.1 0 006 MTMAT0005853 11 mmu -miR- -672-- 5p 1.0 0 012 MIMAT0 Q3735 12 mmu -miR- 6348 1.0 0 019 MIMAT0025091 13 mmu -miR- 6913--5p 0.9 0 030 ΜΪΜΑΤ0027736 1 mmu -miR- 466f-5p 0.9 0 007 MIMAT0004881 15 mmu -miR- 466h-5p 0.9 0 012 MIMAT0004884 17 mmu -miR- 466j 0.9 0 010 MIMAT0005848 18 mmu -miR- 669b-5p 0.8 0 007 MIMAT0003476 19 mmu -miR- 467c--5p 0.8 0 009 ΜΪΜΑΤ0004885 21 mmu -miR- 31-5p 0.3 0 013 MIMAT00Q0538 22 mmu -miR- 66 So- 5ρ 0.8 0 010 MI AT0009421 16 mmu -miR- 195a-3p 0.3 0 013 ΜΪΜΑΊΌ01 000 24 mmu -miR- 66c- 5p 0.9 0 010 MIMAT0004877 20 mmu -miR- 669f-5p 0.7 0 010 MIMAT0017327 23 mmu -miR- 669k-5p 0.7 0 026 MIMAT0017323 26 mmu -miR- 7118-5p 0.7 0 006 MIMAT0028133 27 mmu -miR- 6904-Sp 0.6 0 046 MIMAT0027708 25 mmu -miR- 16-l-3p 0.6 0 018 MIMAT0004625 28 mmu -miR- 7082-3D 0.6 0 047 ΜΪΜΑΤ0028071 30 mmu -miR- 3101-3P 0.5 0 006 MIMAT0014922 33 mmu -miR- 206-3p 0.5 0 017 ΜΪΜΑΊΌ000239 35 mmu -miR- 7033-5p 0.5 0 025 MIMAT0027980 32 mmu- -miR- 7030-5p 0.5 0 031 MIMAT0027964 29 mmu -miR- 3093-3P 0.5 0 012 MIMAT0014918 39 mmu" -let- 0.5 0 046 MIMAT0025123 34 mmu -miR" 1306-3P 0.5 0 010 MIMAT0009411 36 mmu- -miR- 346-5p 0.5 0 016 IMAT0000597 41 mmu- -miR- 297C-5P 0.5 0 041 ΜΪΜΑΤ0004865 31 mmu- -miR- "15a-?.p 0.5 0 036 MTMAT0004624 38 mmu- -miR- 3470s 0.4 0 032 Μ.ΪΜΑΤ0015640 123 mmu -miR- 700-5p 0.4 0 042 MIMAT0017256 37 iri u- -mlR- 196b-5p ~ 0.3 0 046 MII»L¾T0001081 7 mmu -let-- 7d-5p -0.4 0 040 MIMAT0000383 124 mmu- -miR- 28a-5p -0.4 0 021 ΜΪΜΑΤ0000653 48 mmu- -miR- 376b-5p -0.4 0 033 ΜΙΜΆΤ0003388 52 mmu- ~miR~ 128-3p -0.4 0 022 MIMAT0000140 44 mmu- -miR- 28c -0.4 0 026 ΪΜΑΤ0019339 47 mmu -miR- 376c-3p -0.4 0 046 MIMAT0003183 54
Mill- -miR- 377-3p -0.4 0 041 MI T0000741 50 mmu -miR-- 379-3p -0.4 0 013 MIMAT0017080 53 irimu- -miR- 151- Sp ~ 0.4 0 012 MI AT0004536 46 mmu- -miR- 136-5p -0.4 0. 022 MIMAT0000148 45 mmu- -miR~ 26b-5p -0.4 0. 013 MIMAT0000534 43 mrriu- -miR- lOa-Sp -0.5 0. 026 MI A.T0000648 125 mmu- -miR- 300-3p -0.5 0. 041 MIMAT00Q0378 126 mmu- ■miR- 411-3p - 0.5 0. 046 MIMAT0001093 56
miRBase
miRNA Log2FC acij . P SEQ ID NO:
Accession
mmu-jTiiR- 382-3p -0 5 0 021 MIMAT0004691 127
irtmu-miR- 185~5p -0 5 0 046 ΜΪΜΑΤΌ000214
mmu-miR- 299b-5p -0 5 0 046 ΜΪΜΆΤ0022836 55
imnu-miR- 329-3p --0 5 0 042 MIMAT0000567 49
mmu-miR- 154-5p -0 5 0 032 MIMAT0000164 129
inmu-miR- 1839-5p --0 5 0 016 MIMAT0009456 51
mmu-miR- 486a-5p -0 5 0 023 MIMATO 003130 130
mmu-miR- 100-5p -0 5 0 029 MIMAT0000655 131
irtmu-miR- 15b-5p -0 5 0 012 MIMATO 000124 132
mmu-miR- 15a-5p -0 5 0 012 MIMATO 000526 133
imnu-miR- 342-3p --0 6 0 017 MIMATO 000590 134
iranu-miR- 210-3p -0 6 0 007 MIMATO 000658 42
inmu-miR- 107--3p --0 6 0 006 MIMATO 000647 135
mmu-miR- 434-3p -0 6 0 022 MIMAT0001422 136
mmu-miR- 129-2-3p -0 6 0 006 MIMATO 000544 137
irtmu-miR- 223~3p -1 2 0 046 MIMAT0000665 138
mmu-miR- 451a -1 3 0 046 MIMAT0001632 139
Of the osteoarthritis mi RNAs listed in Table 1, 65
osteoarthritis miR As were dys egulated only at 1 week post-surgery (Table 3 and Figure 4A) , and of the osteoarthritis miRNAs listed in Table 2 , 17 osteoarthritis miRNAs were dysregulated only at 6 weeks post-surgery (Table 4 and Figu e 4A) .
Of the dys regulated osteoarthritis miRNAs listed in Tables 1 and 2, 57 osteoarth itis miRNAs were common to both 1 and 6 week time points (Table 5 and Figure 4A) .
Table 3. Osteoarthritis mi NAs in icula c rtilag differentially expressed only at 1 week :ry in DMM versus sham mice. Fold change is reported as log, with threshold adjusted P < 0.05. ml NA log2FC adj . P mi Base Accession SEQ ID NO: Se uence
mmu -miR- 5126 0. 8 0. 002 MIMAT0020637 58 GCGGGCGGGGCCGGGGGCGGGG
mmu -miR- 7682-3p 0. 8 0. 018 MIMAT0029885 59 CCUGUGGGUUGGGUUGGCUUU
mmu -miR- 3960 0. p 0. 002 MIMAT0019336 60 GGCGGCGGCGGAGGCGGGGG
mmu -miR- 7218--5p 0. 7 0. 024 MIMAT0028404 61 UGCAGGGUUUAGUGUAGAGGG
mmu -miR- 6546- 5p 0. 7 0. 008 MIMAT0029792 62 AGGCGCCUCUGAGCUUGUGCUUGU
mmu -miR- 504-3p 0. 7 0. 022 MIMAT0017277 63 AGGGAGAGCAGGGCAGGGUUUC
mmu -mi R- 6959-5p 0. 7 0. 010 MIMAT0027818 64 UGGGAA.ACCUGLJGUCGGGCLIGUG
mmu -miR- 8110 0. 6 0. 002 MIMAT0031416 65 AAGCGUGGATJUGGGGGGGGGG
mmu -mi R- 8095 0. 6 0. 020 ΜΪΜΑΊ 031396 66 AAAGGAIJUCUGCLIGUCUGLICCC
mmu -miR- 6769b-5p 0. 6 0. 006 MIMAT0028040 67 CCUGGUGGGUGGGGAAGAGC
mmu -miR- 1895 0. 6 0. 012 MIMAT0007867 68 CCCCCGAGGAGGACGAGGAGGA
mmu -miR- 1927 0. 6 0. 049 MIMAT0009390 69 GAGCUCUGGAUGUUAGGGACUGA
mmu -miR- 1930-3p 0. 5 0. 019 MIMAT0017340 70 GGUGCAGUUACUGUGGCUGUGG
mmu -mi R- 499-3p 0. 5 0. 010 MIMAT0017254 71 G.AACAUCACAGCAAGUCUGUGCU
mmu -miR- 129b-5p 0. 5 0. 046 MIMAT0029862 72 GCUUUUUGGGGUAAGGGCUUCC
mmu -mi R- 214-5p 0. 5 0. 014 MIMAT0004664 73 UGCCUGUCUACACUUGCUGLIGC
mmu -miR- 222--3p 0. 5 0. 011 MIMAT0000670 74 AGCUACAUCUGGCUACUGGGU
mmu -miR- 1224--5p 0. 5 0. 004 MIMAT0005460 75 GUGAGGACUGGGGAGGUGGAG
mmu -miR- 294-3p 0. 5 0. 049 MIMAT0000372 76 AAAGUGCUUCCCUUUUGUGUGU
mmu -miR- 5622-- 3p 0. 5 0. 050 MIMAT0022372 77 CUUAGCUGGGUAGUGGUGGUGC
mmu -mi R- 7034-5p 0. 4 0. 011 MIMAT0027972 78 UCCGGGAGGGALIGGAUGUGCU
mmu -miR- 16-2-3p 0. 4 0. 040 MIMAT0017018 79 ACCAAUAULIAUUGUGCLIGCUUU
mmu -mi R- 696 0. 4 0. 048 ΜΪΜΑ.Τ0003483 80 GCGUGLIGCUUGCLIGUGGG
mmu -miR- 99b--3p 0. 3 0. 049 MIMAT0004525 81 CAAGCUCGUGUCUGUGGGUCCG
mmu -miR- 6538 0. 3 0. 030 MIMAT0025583 82 CGCGGGCUCCGGGGCGGCG
mmu -miR- 7018-5p 0. 3 0. 042 MIMAT0027940 83 GUGAGCA.GACAGGGAGUGGUGGGG
mmu -miR- 7036a-5p 0. 3 0. 033 MIMAT0027976 84 AGCGGGGUUCGGUGGGGAAGAGA
mmu -mi R- 1397-5p 0. 3 0. 050 MIMAT0007864 85 CUUUGGAUGGAGAAAGAGGGGG
mmu -miR- 149-5p -c .3 0. 049 MIMAT0000159 86 UCUGGCUCCGUGUCUUCACUCCC
iu-niiR- 30 c- 5p -0.5 0.014 MIMAT0000514 119 UGUAAACAUCCUACACUCUCAGC
-miR- 466i -3p -0.5 0.046 MIMAT0005834 120 AUACACACACACAUACACACUA
mmu-mi R- 374c -5p -0.6 0.003 MIMAT0014953 121 AUAAUACAACCUGCUAAGUG
mmu-mlR- 6954 -5p -0.6 0.048 MIMAT0027808 122 UGGGGCAGUUCUGGGGGCAGAU
Table 4. Osteoarthritis mi NAs ar cartilage differentially expressed only at 6 weeks post-surgery in DMM versus sham mice. Fold change is reported as log2 with threshold adjusted P < 0,05. miRNA log2FC adj . P miRBase Accession SEQ ID NO: Sequence
mmu -miR- 3470a 0.4 0 032 MIMAT0015640 123 UCACUUUGLIAGACCAGGCUGG
mmu -let- 7d-5p -0. 4 0 040 MIMAT000038.3 124 AGAGGUAGUAGGLIUGCAUAGUU
m u -miR- 10a-5p -0. 5 0 026 MIMAT0000648 125 UACCCUGUAGAUCCGAAUUUGUG
mmu -miR- 300-3p -0. 5 0 041 MIMAT0000378 126 UAUGCAAGGGCAAGCUCUCUUC
mm -miR- 382~3p -0. 5 0 021 MIMAT0004691 127 UCAUUCACGGACAACACUUUUU
mmu -miR- 185-5p -0. 5 0 046 MIMAT0000214 128 UGGAGAGAAAGGCAGUUCCUGA
mmu -mi R- 154-5p -0. 0 032 MIMAT0000164 129 UAGGLILIAUCCGLIGUUGCCLILICG
mmu -miR- 486a-5p -0. 5 0 028 MIMAT0003130 130 LICCUGUACLIGAGCUGCCCCGAG
mmu -mi R- 100-5p -0. 5 0 029 MIMAT0000655 131 AACCCGUAGAUCCGAACLILIGUG
mmu -miR- 15b-5p -0. 5 0 012 MIMAT0000124 132 UAGCAGCACAUCAUGGUUUACA
mmu -miR- 15a-5p -0. 5 0 012 MIMAT0000526 133 UAGCAGCACAUA?.UGGUUUGUG
mmu -miR- 342 ~3p -0. 6 0 017 MIMAT0000590 134 UCUCACACAGAAAUCGCACCCGU
mmu -miR- 107-3p -0. 6 0 006 MIMAT0000647 135 AGCAGCAUUGUACAGGGCUAUCA
mmu -mi R- 434-3p -0. 6 0 022 MIMAT0001422 136 UUUGAACCAUCACUCGACUCCU
mmu -miR- 129-2-3p -0. 6 0 006 MIMAT0000544 137 AAGCCCUUACCCCAAAAAGCAU
mmu -mi R- 22.3-3p -1. 0 046 MIMAT0000665 1.38 UGUCA.GUUUGUCAAAUACCCCA
mmu -miR- 451a -1. 3 0 046 MIMAT0001632 139 AAACCGUUACCAUUACUGAGUU
Table 5. Osteoarthritis miKNAs ar cartilage differentially expressed at X we k post™ surgery and 6 weeks post-surgery in UMM versus sham mice, Fold change is reported as log2 with threshold adjusted P < 0,05.
1 week 1 week 6 weeks 6 weeks
miRBase Accession SEQ ID NO: Sequence
log2FC adj . P log2FC adj . P
mm - —mi R- 6931-5p 2 .6 0. .000 1 , , 8 0. , 000 MIMAT0027762 1 UGGGGUGGGGAGUGGGGGACU
-miR- 1187 1 .9 0. , 000 1. , 4 0. , 003 ΜΙΜΆΪ0005837 UAUGUGUGUGUGUAJJGUGUGUAA
-miR- 3Q82--5p 1 .8 0. ,000 1, , 4 0. , 003 MIMAT0014872 3 GACA.GAGUGUGUGUGUCUGUGU miu - -miR- 574--5p 1 .8 0. ,000 1. , 3 0. , 003 MIMAT0004893 4 UGAGUGUGUGUGUGUGAGUGUGU
-miR- 466i-5p 1 .8 0. , 000 1, , 3 0. , 003 MIMAT0017325 5 UGUGUGUGUGUGUGUGUGUG inm - -mi R- 669n 1 .6 0. , 001 1 , .3 0. , 006 MIMAT 0009427 6 AUUUGUGUGUGGAUGUGUGU mmu- -miR- 46S-3p 1 .5 0. , 002 1. ,2 0. , 006 MIMAT 0002109 7 UAUGACUGAUGUGCGUGUGUCUG mm - -mi R- 32 -3p 1 .5 0. , 002 1 , , 3 0. , 006 MIMAT 0017050 8 CAAUUUAGUGUGUGUGAUAUU
-miR- 6691-5p 1 .3 0. , 002 1. , 1 0. , 006 MIMAT 0009418 9 AGUUGUGUGUGCAUGUAUAUGU
-miR- 466m-- Sp 1 .2 0. , 002 1, , 1 0. , 007 MIMAT0014882 10 UGUGUGCAUGUGCAUGUGUGUAU miu - -miR- ■669e-5p 1 .1 0. , 003 1. , 1 0. , 006 MIMAT0005853 11 UGUCUUGUGUGUGCAUGUUCAU inm - -miR- 672-5p 1 .1 0. , 005 1 , , 0 0. , 012 MIMAT0003735 12 UGAGGUUGGUGUACUGUGUGUGA inmu- -mi R- 6348 1 .1 0. , 007 1 , .0 0. , 019 MIMAT0025091 13 UCAGCCUUUAUAAGGUGUGUGU mmu- -miR- 6918-5p 1 .1 0. ,010 0. , 9 0. , 030 MIMAT0027736 14 UGCUGAGGACGGGAUUAGGUUCU mm - -mi R- 466f-5p 1 .0 0. , 002 0, , 9 0. , 007 MIMAT0004881 15 UACGUGUGUGUGCAUGUGCAUG
-miR- 669o-5p 1 .0 0. , 002 0. , 8 0. , 010 MIMAT 0009421 16 UAGUUGUGUGUGCAUGUUUAUGU
-miR- 466h--5p 1 .0 0. , 004 0. , 9 0. , 012 MIMAT0004884 17 UGUGUGCAUGUGCUUGUGUGUA miu - -miR- ■466j 1 . o 0. , 003 0. , 9 0. , 010 MIMAT 0005848 18 UGUGUGCAUGUGCAUGUGUGUAA inm - -miR- 669b-- 5p 1 .0 0. , 002 0, , 8 0. , 007 ΜΙΜΑΪ0003476 19 AGUUUUGUGUGCAUGUGCAUGU inmu- -mi R- •466c- 5p 0 .9 0. , 003 0, .8 0. , 010 MIMAT 0004877 20 UGAUGUGUGUGUGCAUGUACAUAU
-miR- 467c:-5p 0 .9 0. , 004 0, , 8 0. , 009 MIMAT0004885 21 UAAGUGCGUGCAUGUAUAUGUG mmu- -mi R- ■31-5p 0 .9 0. , 010 0, , 8 0. , 018 MIMAT 0000538 22 AGGCAAGAUGCUGGCAUAGCUG mmu- -miR- 669f-5p 0 .8 0. , 003 0. .7 0. , 010 MIMAT 0017327 2.3 AGUUGUGUGUGCAUGUGCAUGUGU
-miR- 195a-- 3p 0 .8 0. , 008 0. , 8 0. , 013 MIMAT0017000 24 CCAAUAUUGGCUGUGCUGCUCC miuu- -miR- 6904--5p 0 .8 0. , 012 0. , 6 0. , 046 MIMAT0027703 25 UCCUGGGGUUAGAGUUGAGUGG inmu- -miR- 669k-- 5p 0 .8 0. , 010 0, , 7 0. , 026 MIMAT0017323 26 UGUGCAUGUGUGUAUAGUUGUGUGC inmu- -mi R- 7118-5p 0 .8 0. , 002 0, .7 0. , 006 MIMAT0028133 UGGGGAAGGCGGGAGAGGGAAC
4
Amongst the 57 dysregulated osteoarthritis miRNAs listed in Table 5 with adjusted p < 0.05, 12 osteoarthritis miRNAs were
identified with a fold change > 2.0 and, including miR-6931-5p, miR- 1187, miR-3082-5p, miR-574-5p, miR-466i-5p, miR-669n, miR-468-3p, miR-32-3p, ndR-6691-5p, miR-466m-5p, miR-669e-5p, and miR-672-5p. Mature miRNA sequences, stem-loop sequences, reverse complement RNA and DMA sequences, and probe sequences for the 12 osteoarthritis miRNAs listed in Table 5 with a fold change > 2.0 are provided in Tables 6 to 9, respectively.
Table 6. Mature miRNA sequences of miRNAs with fold change > 2 listed in Table 5
miRNA Sequence SEQ ID NO:
mmu- -miR- 6931-5p UGGGGUGGGGAGUGGGGGAGU 1
mmu- -miR- 466i-5p UGUGUGUGUGUGUGUGUGUG 5
mmu -miR- 574-5p UGAGUGUGUGUGUGUGAGUGUGU 4
mmu -miR- 3082-5p GACAGAGUGUGUGUGUCUGUGU 3
mmu- -miR- 1187 UAUGUGUGUGUGUAUGUGUGUAA 2
mmu- -miR- 669n AUUUGUGUGUGGAUGUGUGU 6
mmu■ -rniR- 468-3p UAUGACUGAUGUGCGUGUGUCUG 7
mmu■ -miR- 6691 -5p AGUUGUGUGUGCAUGUAUAUGU 9
mmu- -miR- 32-3p CAAUUUAGUGUGUGUGAUAUU 8
mmu -miR- 466m-- 5p UGUGUGCAUGUGCAUGUGUGUAU 10
mmu -miR- 669e--5p UGUCUUGUGUGUGCAUGUUCAU 11
mmu- -miR- 672-5p UGAGGUUGGUGUACUGUGUGUGA 12
hsa- - miR :-574-5p UGAGUGUGUGUGUGUGAGUGUGU 140
hsa- -miR- 32-3p CAAUUUAGUGUGUGUGAUAUUU 141
Table 7. Stem-loop sequences of miRNAs with fold change > 2 listed in Table 5
miRNA Stem-loop sequence SEQ ID NO: mmu -miR- 6931 GUCACUGGGGUGGGGAGUGGGGGACUUCUGAAUCACUAGAGGC 142
UCUGGAAUGACCCAACCUCUUCAUACCCCAG
mmu -miR- 4661. AGAGAUCAUGUCAGUGAACUGCCACAUUUUUGAUAUAUAUUA 143
UGUAUGUAUGUGUGUGUGUGUGUGUGUGUGUAUAUAUAUACA CACACACAUACACACUACAUGUAUGCAACAUAUAUAC
mmu -miR- 574 UGCGGGCGUGUGAGUGUGUGUGUGUGAGUGUGUGUCGCUCCA 144
AGUCCACGCUCAUGCACACACCCACACGCCCGCACG
mmu -miR- 3082 GGACAGAGUGUGUGUGUCUGUGUGGAGACAGGAGUUGCCCAC 145
ACAUGGCACUCAACUCUGCAGG
mmu -miR- 1187 UCAUAUAGUAUUAAACCGAACUGUUUUCCUUAUAG-ACACAAU 146
UUAUUUUUACACACACACACACACACAUAUAUAUAUAUAUGU GUGUGUGUAUGUGUGUAAAU ACAAUGUUAAAAUAGUA
mmu -miR- 669n UACAUUUGUGUGUGGAUGUGUGUGUAAAUGUAUGUGCAUCCC 147
miRNA Stem-loop sequence SEQ ID NO:
AC AG C AC AU GU G
rnmu -miR- 468 AUAAGAAACUU GGC GU GU C GU GACU GAU GUACU GAUAAGAAA 148
C U C AGU G U GAU AU G AC U GAU GU G C GU GU G U CU GU CU
rnmu -miR- 6691 GUUU GU G CAU GU GC GU AUAGUU GU GU GU GC AU GUAUAU GU GU 149
GUAUAU GAAUAU AC AU AUACAUACACAC C C AU AU AUACAC GC AUU CAU AU GAACAC
rnmu -miR- 32 GGAGAUAUUGCACAUUACUAAGUUGCAUGUUGUCACGGCCUC 150
AAUGCAAUUUAGUGUGUGUGAUAUUUUC
mitiu -miR- 466m U GU GU GU GUU CUU GUGU GU GCAU GU G CAU GUGU GUAUAU G AA 151
UAUACAUAUACAUACACACAUACACACGCACGUACACACACA
mitiu -miR- 669e GCCUGGGAUUCAUGGGCUGUACCCUAUAUAUGGGCAGGUGUG 152
U GU CUU GU GU GU GCAU GUU CAUUUGU GUAU U GAAUAU GAAU AU ACACAC ACUUAC AC ACU CAU G CACACAC CACA
rnmu -miR- 672 GAUGGUGAUCUAGCCCUUUAGUUUUGAGGUUGGUGUACUGUG 153
U GU GAGU.AU ACAUAUUU AU CACAC ACAGU C ACUAU CUU C G AA AGU GAG G GU G C AC AU C
hsa -miR- 574 G G GAC CU GC GU GGGUGCGGGC GU GU G AGU GU GU GU GU GU GAG 154
UGUGUGUCGCUCCGGGUC CAC GC U CAUGCACA CAC C C CAC G CCCACACUCAGG
hsa -miR- 32 GGAGAUAUUGCACAUUACUAAGUUGCAUGUUGUCACGGCCUC 155
AAU G CAAUUUAG U GU GU G U GAUAUU UU C
Table 8 , Reverse complement RNA and DNA sequences of laiRNAs with fold change > 2 listed, in Table 5
RNA Sequence
miRNA SEQ ID NO : DNA Sequence SEQ ID NO: rnmu -miR- 6931-5p 1 AGUCCCCCACUCCCCACCCCA 156
AGTCCCCCAC CCCCACCCCA 170 rnmu -miR- 466i-5p 2 CACACACACACACACACACA 157
CACACACACACACACACACA 171 rnmu -miR- 574-5p ACACACUCACACACACACACUCA 158
ACACACTCACACACACACACTCA 172 rnmu -miR- 3082-5p 4 ACACAGACACACACACUCUGUC 159
ACACAGACACACACACTCTGTC 173 rnmu -miR- 1187 5 UUACACACAUACACACACACAUA 160
TTACACACATACACACACACATA 174 rnmu -miR- 669n 6 ACACACAUCCACACACAAAU 161
ACACACATCCACACACAAAT 175 rnmu -miR- 468--3p 7 CAGACACACGCACAUCAGUCAUA 162
CAGACACACGCACATCAGTCATA 176 mitiu -miR- 6691- 5p 8 ACAUAUACAUGCACACACAACU 163
ACATATACATGCACACACAACT 177 rnmu -miR- 32-3p 9 AAUAUCACACACACUAAAUUG 164
AATATCACACACACTAAATTG 178 rnmu -miR- 466m-5p 10 AUACACACAJJGCACAUGCACACA 165
ATACACACATGCACATGCACACA 179 rnmu -miR- 669e-5p 11 AUGAACAUGCACACACAAGACA 166
ATGAACATGCACACACAAGACA 180 rnmu -miR- 672-5p 12 UCACACACAGUACACCAACCUCA 167
TCACACACAGTACACCAACCTCA 181 hsa -miR- 574-5p 140 ACACACUCACACACACACACUCA 168
RNA Sequence
miKNA SEQ ID NO: DNA Sequence SEQ ID NO:
ACACACTCACACACACACACTCA 182 hsa-miR- 32— 3p 141 AAAUAUCACACACACUAAAUUG 169
AAATATCACACACACTAAATTG 183
Table 9 , miRNA probe sequences of miRNAs vrith fold change > 2 listed in Table 5
miRNA Probe name Sequence SEQ ID NO: nrniu-miR- 6931-5p A 5 P00006306 AGTCCCCCACTCC 184 inrau-miR- 466i-5p A 54 PC) 0005053 CACACACACACACACA 185 mmu-miR- 574-5p A 54 P3154 ACACACTCACACACACAC 186 mmu-miR- 3082-5p A 54 P00004829 ACACAGACACACACA 187 mmu-miR- 1187 A 54 P00004436 TTACACACATACACACAC 188 ramu-miR- 669n A 54 P2015 ACACACATCCACACACA 189 iranu-miR- 468-3p A 54 P1660 CAGACACACGCACATCA 190 nrniu-miR- 6691- 5p A 54 P00004591 ACATATACATGCACACAC 191 inrau-miR- 32-3p A 54 P00004821 AATATCACACACACTAAATT 192 mmu-miR- 466m-5p A 54 P00004975 ATACACACATGCACATG 193 mmu-miR- 669e-5p A 54 P00004466 ATGAACATGCACACAC 194 iranu-miR- 672-5p A 54 P2883 TCACACACAGTACACC 195
The miRNA microarray data were validated by qPCR of 20 miRNAs (examples are shown in Figure 5A to 5H) . Of these examples, the cartilage-specific miR-140 was significantly down-regulated in DMM (Figure 5A, 5B) .
Fifty dysregulated miRNAs have been reported in human osteoarthritis ca rti1age. 0f these , a group of 12 ( adj usted
P < 0.05) overlapped with this example (Figure 4B) , including miR-16 family member miR-15a-5p (SEQ ID NO: 133, Figure 5C), miR-16-5p, miR-26b-5p (SEQ ID NO: 43, Figure 5D) , miR-30c-5p (SEQ ID NO: 119, Figure 5E) , miR-98-5p (SEQ ID NO: 114, Figure 5F) , miR-149-5p (SEQ ID NO: 86, Figure 5G), miP-210-3p ( SEQ ID NO: 42, Figure 5H) , miR-107-3p (SEQ ID NO: 135) , miR-185-5p (SEQ ID NO: 128) , miR~223-3p (SEQ ID NO: 138), miR-337-3p (SEQ ID NO: 93), miR-342-3p (SEQ ID NO: 134), and miR-377-3p (SEQ ID NO: 50) . However, as noted above, previous studies using end-stage osteoarthritis samples are not necessarily elated to initiation and early progression of
osteoarthritis. This group of 12 osteoarthritis miRNAs is different from the group of 12 osteoarthritis miRNAs with >2 fold change identified in Table 5.
Conclusions. Typical osteoarthritis pathological features were demonstrated in the articular cartilage of DMM-operated mice compared with sham-operated mice, some of which were time dependent (proteoglycan loss and structural damage) . Microarray data revealed dynamic changes in miRNA expression profiles between normal (sham- operated) and osteoarthritis cartilage (DMM) . Interestingly, cha ges in miRNA expression that mirrored the temporal changes in
proteoglycan loss and structural damage were observed. Similarly, changes in miRNA expression were also demonstrated that were independent; of time, reflecting the chondrocyte hypertrophy scores that were also static. In conclusion, miRNA regulators of
osteoarthritis initiation and progression in articular cartilage that have not been previously associated with osteoarthritis have been identified. Future studies are now focused on determining their role in osteoarthritis disease progression and identifying miRNA gene targets.
Example 2. miRNA microarray expression profiling during onset and progression of post-traumatic osteoarthritis (wild-type and AdaxafcsSAcat mice)
ADAMTS5 as the major agg ecanase in arthritic mouse
cartilage, which was demonstrated by producing genetically modified mice where the ADAMTS5 catalytic domain was deleted and the enzyme was thus proteolytically inactive. In the AdamtsSAcat mice, ablation of AMTS5 acti ity is suf icient to protect, against agg ecan los and subsequent cartilage erosion in arthritis. AdamtsSAcat mice are used to discriminate between miRNA expression changes that occur upstream and downstream of aggrecan degradation.
Diff rentially expressed miRNAs in both wild-type and
AdamtsSAcat mice represent, early osteoarthritis disease processes independe t of ADAMTS5 activity and ggrecan breakdown. I contrast, miRNAs identified only in wild-type mice are likely to be involved with progressive cartilage degeneration and be relevant to targets in established human disease where cartilage degeneration has occu ed by the time of clinical dete mination.
Consequentl , the following examples 2 and 3 will confirm the findings of example 1, i.e. that miR-6931-5p, miR-466i-5p, miR- 574-5p, miR-3082-5p, miR-1187, miR-669n, miR-468-3p, miR-6691-5p,
miR-32-3p, miR-466m-5p, miR-669e-5p, and miR-672-5p are
osteoarthritis miRNAs, and will distinguish early from later osteoarthritis miRNAs. In this way, early and later therapies may be targeted to a subject; depending on the stage of disease at.
diagnosis .
2.1 Induction of arthritis and dissection of joint tissues.
Skeletally mature (10 week old) male C57BL6 mice and Adamts5Acat mice undergo surgical DMM or sham operation of the right knee. In sham operations, the meniscotibial ligament is exposed but not. cut. Animals are sacrificed at 1, 2 and 6 weeks post-surgery (n-4 per time-point) representing early to progressive cartilage
degeneratio .
Immediately after euthanasia, the synovial tissues (joint capsule + synovial membrane + inf a-patella fat pad) are dissected free of muscle and the remai der of the joi t, placed in RNALate (Ambion) and stored at -80°C for later RNA extraction. Exposed tibial epiphyses are isolated, placed in RNALater containing 20% ETDA, decalcified for 72 hours and embedded in OCT. Serial 7 μιτι coronal cryo-sections (30-45 per joint) are fixed in ethanol, air- dried and non-calcified medial tibial plateau articular c t lage and. underlying subchondral bone from previously assigned areas of cartilage fibrillation and loss of toluidirie blue staining are harvested separately by laser microdissection (Arcturus) .
2.2 rtiiRNA isolation and differential expression. Total RNA is isol ted from pooled microdissected sections of cartilage and bo e pooled from each DMM or sham-operated knee, e.g. using the miRCURY RNA isolation kit (Exiqon), to obtain 7-10 ng total RNA from microdissected tibial cartilage of a single mouse joint. To avoid amplification steps that would be necessary for tnic oa ray-ba sed approaches, PGR detection methods that can quantify mi RNA from these low levels of total RNA without amplification are employed. cDNA is generated, e.g. using the miRCURY LNA Universal RT miRNA system (Exiqon) . Quantitative PGR (qPCR) using pre-validated mi NA primers to the 748 mouse miRNAs (miRBa.se vl 9) is performed, e.g. using a Roche LightCycler 430.
Greater than 5 \ig RNA is obtained from synovial tissue samples, so miRNA microarray approach such as miRCURY LNA array
(Exiqon) is used, DMM and sham-operated tissue samples from different time-points are analysed,, e.g. at 1 and 6 weeks. These samples will identify the crucial miR As at early and later stages, and these differentially expressed miRNAs are measured by targeted PGR (Exiqon miRCURY LNA Universal RT PGR panels with custom LNA miRNA selection) in the wild-type and AdamtsS cat at ail time- points, e.g. 1, 2 and 6 weeks. This provides complete coverage of the post-traumatic osteoarthritis-related miRNAs since all these will be identified in the wild-type samples, with the Adamts5 cat mouse data providing the refining data by identifying those that are dependent or independent of ADAMTS5 activity. Significant
differences in expression levels of miRNAs between DMM and Sham- operated mouse samples from microarray data is performed using the statistical p ogram. R, using the package "litnma", which utilises linea models to identify differentially expressed tniRNA. The data is background corrected (normexp) and normalised (quantile) within limma. miRNA qPCR data is analysed using the using the GenEx qPCR analysis software package (Exiqon) .
2.3 JXJ situ hybridisation. Differentially expressed miRNA is validated and localised to cartilage versus other joint tissues
(meniscus, joint capsule, bone) and specific chondrocyte populatio s (superficial versus deep; lesion versus surrounding cartilage) by in situ hybridisation. DMM and sham operated joints are fixed in 4% para formaldeh de, decalci ied in 10% EDTA a d pa ra ffin-embedded . Hybridisation is performed using validated. miRNA LNA probes
(Exiqon) .
Example 3. Confirmation of the role of osteoarthritis miRNAs on osteoarthritis initiation and progression in vivo
3.1 Generation of osteoarthr tis rtiiRNA cartilage-specif c knockout mice by CRISPR/Cas9 genome editing. CRISPR/Cas genome editing technology is used to generate conditional floxed miRNAs of osteoarthritis miRNAs. The CRISPR system has been used to generate miRNA knockouts in vivo, including silencing miRNAs (m.i.R-126a and miRNA gene cluster miR-17a-2 to miR-92a-2) in zebra fish, and deletion of the mate nally expressed IncRNA gene, Rian in mice.
Because the osteoarthritis miRNAs may also have roles in early cartilage development and in other developmental processes, an
inducible cartilage-spec fic system is used to allow normal development and cartilage maturation before inducing roiRNA knockdown prior to and during post-traumatic osteoarthritis initiation (DMM surgery) ,
The f loxed miRNA mice are crossed with Col 2al-Cre-EP,T. mice
( JAX 006774) to generate mice ( Col2al -Cre-ER : miRf1/ f1 ) where cartilage specific knockout can be induced in mature mice by tamoxifen injection,
3.2 Confirmation of the resultant miRNA knockdown in articular cartilage. To confirm cartilage-specific knockdown, male Col2al-Cre-ER :miRfl/f1 mice are injected daily with tamoxifen (intraperitoneal injection, SOmg/kg) at 8-10 weeks of age and after 7-10 days, knee joints are harvested, Frozen sections are used to assess localised Cre-recombinase activity. Fixed, decalcified and para fin embedded joints are used for in situ hybridisation using validated miRNA L A probes (Exiqon) . Osteoarthrits miRNA knockdown is confirmed by cartilage microdissection, RNA extraction, and miRNA expression assessed by qPCR (Oiagen miScript RT qPCR. Kit} in tamoxifen- inj ected. and control mice.
Hi stopathology is used, to determine if the induction of osteoarthritis miRNA knockdown in mature cartilage brings about pathology in unchallenged joints at 4, 8 and 16 weeks post miRNA knockdown (n=16/group) . Differences in histopathological scoring of OA pathology in mouse knee joints of 20-40% (depending on tissue and parame er) can be de ected with >S5% power with n-16 pe group .
3.3 Effect of candidate miRHA knockdown on OA initiation and progression, Articular cartilage osteoarthritis miRNA knockdown is induced in skeietallv mature male Col2al-Cre-ERT : miRf1/ f1 mice at 8- 10 weeks of age by daily tamoxifen injection. Ten days later, DMM surgery is performed to induce post-traumatic osteoarthritis. For these experiments, both sham and naive controls are used.
In parallel experiments, to determine the role of the osteoarthritis mi.RNAs in osteoarth itis progression, miRNA knockdown is induced wi h tamoxifen at 1 week and 4 weeks post DMM surgery. Male Col2al-Cre--ERT:miRfl./;:l mice and control mice are harvested at 4, 8 and 16 weeks post DMM surgery ( group; power calculation as above) representing early, progressive, and late osteoarthritis.
Sections of the knee joints are stained with toluiiine blue to visualise proteoglycans and the structural integrity of the cartilage. Stained sections are scored in a blind fashion using a semi-quantitative scoring system that assesses chondrocyte
hype trophy, proteoglycan loss, and structural damage in the tibial articular cartilage of the medial femoro- tibial joints.
Example . Modulating cartilage osteoarthritis miKM&s for therapy .
Example 3 is confirmed in vivo using intra-articular viral delivery to modulate miRNA expression. This approach has been, used in re-clinical models including the mouse to overexpress or knock down miRNA, and is clinically applicable. A variety of vectors have been used, but adeno-associated-virus (AAV) provides optimal trans fection of chondrocytes with prolonged expression after a single injection and limited inflammatory response in infected cells, Intra-articular viral injection minimises systemic exposure and off-target effects on other tissues.
4.1 Administration of an AAV expressing a miRNA antagonist or miRNA mimic to DMM-oparatad mice. Osteoarth itis lRNAs are targeted by intra-articular injection of an AAV expressing a miRNA antagonist (for knockdown) or miRNA mimic (for over-expression) . Osteoarthritis miRNA sequences are cloned into AAV expression vectors with a mCherry reporter (Vector SioLabs) to allow
simultaneous verification of miRNA. expres ion and t a s fection efficiency via fluorescent microscopy. A si gle int a- rticul r injection of 1011 vg/ j oint is administered immediately (preventative) or 4 weeks (therapeutic) after DMM surgery.
4.2 Confirmation of the osteoarthritis miKNA knockdown or overexpression. To determine successful knockdown or overexpression of the osteoarthritis miRNA at 4, 8 a d 16 weeks po t-DMM surgery, knee joints are dissected to collect tibial plateau articular cartilage and epiphyseal subchondral bone and RNA extracted as described above. Approximately -~250-500μα total RNA is obtained from subchondral bone and articular cartilage of each joint.
Osteoarthritis miP.NAs are measured by P.T qPCR (Qiagen miScript RT qPCR Kit) . As controls, RNA is isolated from tissues (e.g. liver, muscle, kidneys) that have not been directly injected with AAV. In
situ hybridisation is also performed on sections of the knee joints to visualise the location of the osteoarthritis miRNA within the joint (meniscus, joint capsule, bone) and specific chondrocyte populations (super icial, middle, deep zones) where AAV induced miRNA. expression occurs.
4.3 Effect of miKNA therapy on osteoarthritis initiation and progression. Knee joints are examined histologically at 4, 8 and 16 weeks after DMM surgery and AAV injection (n=16) . DMM-operated animals injected with empty AAV are used as controls (n=16) . The knee joints are fixed, decalcified, p oce sed, ectio ed and chondrocyte hypertrophy, proteoglycan loss, cartilage structural damage, subchondral bone sclerosis and synovitis scored as described above (Example 3.3).
Exaircpla 5. Paired jiaiRNA:∑nRN& expression data analysis reveals target rttR As
As described previously (Bateman et al, Arthritis and
Rheumatism 2013; 65 (6) : 1547-60) , mRNA expression profiling was performed in cartilage from wild-type (mice and Adamts5Acat mice, each with surgically induced osteoarthritis. In Ada ts5Acat mice, ADAMT35 activity is lacking and aggrecan loss and cartilage erosion are inhibited, which distinguishes mRNA expression changes that a e independent of ADAMTS5 activity and cartilage breakdown. Mechanical instability was introduced into the knee joints of 10 week old male mice via DMM surgery. Cartilage from the developing lesion in the destabilized medial meniscus and corresponding regions in sham- operated mice w s harvested by microdissection at 1, 2, and 6 weeks post-surge y, and. RNA was extracted, amplified, and hybridized to who1e-ge ome microarrays .
The mRNA expression data from 1 week and 6 weeks DMM vs sham- operated mice and correspondi g miRNA expression data from example 1 were analysed using the niicroRNA Target Filter module within
Ingenuity Pathway Analysis to identify target mRNAs and biological effects of dysregulated osteoarthritis miRNAs . By combining in vivo expression data of miRNAs and mRNAs using a paired analysis, target mRNAs have been identified (Tables 10 and 11) . Target: mRNAs and their biological pathways provide additional therapeutic options for preventing and/or treating osteoarthritis, by inhibiting or
promoting transcription (e.g. via miRNAs ) , and/or by inhibiting or promoting translation, and/or by inhibiting or activating proteins e coded by the target mRNAs . Table 10. Osteoarthritis miRNAs in articular cartilage and target mRNAs differentially expressed at 1 week post-surgery in DMM versus shain mice ith dysregulated expression.
laiRNA miRNA family miRNA Gene Ensemble Gene ID irsRNA Exp name with seed Exp Log S mbol Fold sequence Ratio Change mrnu-miR- 98 -5p 1et- 7a-5p (and -0.49 AARSD1 ENSMUSG00000075526 2 9?4 other miRNAs
w/seed GAGGUAG)
mrnu-miR- 98-5p let-7a-5p (and -0. 94 ABL2 ENSMUSGO 0000026596 2.158 other miRNAs
Vi/ seed GAGGUAG}
mmu-miR-98-5p let-7a-5p (and -0. 94 ARL6IP6 ENSMUSGO 0000026960 3.519 other miRNAs
w/seed GAGGUAG)
mrnu-miR- 98-5p iet-7a-5p (and -0. 94 ATP2A2 ENSMUSGO 0000029467 3.343 other miRNAs
w/seed GAGGUAG)
mmu-miR-98-5p let-7a-5p (and -0.494 CA.CFD1 ENSMUSGO 0000015486 2.201 other miRNAs
w/ seed GAGGUAG)
mmu-miR-98-5p j.et-7a-5p (and -0.494 CALU ENSMUSGO 0000029767 3.067 other miRNAs
w/seed GAGGUAG)
mrnu-miR- 98-5p let-7a-5p (and -0.494 CDV3 ENSMUSGO 0000032803 2.604 other miRNAs
w/seed GAGGUAG)
rami!-miR- 98- 5p let-7a-5p (and -0. 94 CHI)9 ENSMUSG00000056608 2.565 other miRNAs
w/seed GAGGUAG)
mrnu-miR- 98-5p iet-7a-5p (and -0.494 CHSY3 ENSMUSGO 00000 8152 6.220 other miRNAs
w/seed GAGGUAG)
mmu-miR-98-5p let-7a-5p (and -0.494 DCN ENSMUSGO0000019929 3.130 other miRNAs
w/ seed GAGGUAG)
mrnu-miR-98-5p 1et- 7a-5p (a d -0.494 DPH3 ENSMUSGO 0000021905 2.462 other miRNAs
w/seed GAGGUAG)
mrnu-miR- 98-5p let-7a-5p (and -0.494 FAM118A ENSMUSGO 0000022434 2.135 other miRNAs
w/ seed GAGGUAG!
rami!-miR- 98- 5p let-7a-5p (and -0.494 GALNT1 ENSMUSG00000000420 3.566 other miRNAs
w/seed GAGGUAG)
mmu-miR-98-5p let-7a-5p (and -0.494 GAREM ENSMUSGO 0000042680 2.160 o her miRNAs
w/seed GAGGUAG)
mrnu-miR-98-5p 1et- 7a-5p (and -0.494 GJB4 ENSMUSG00000046623 3.956 other miRNAs
w/ seed GAGGUAG)
mrnu-miR- 98-5p .Iet-7a-5p (and -0.494 HBEGF ENSMUSGO 000002 486 4.754 other miRNAs
w/seed GAGGUAG)
mmu-miP.-98-5p let-7a-5p (and -0.494 ΓΙΚ2 ENSMUSGO0000000628 2.493 other miRNAs
w/ seed GAGGUAG!
miRNA miRNA family raiRNA Gene Ensemble Gene ID mRNA Exp name with seed Exp Log Symbol Fold sequence Ratio Change ramu-miR-98-5p let-7a-5p {and -0 , 494 HMGA1 ENSMUSG00000078249 4.019 other miRNAs
w/ seed GAGGUA !
rnmu--miR- 98-- 5p let--7a-5 (and -0. 94 Hmga2 ENSMUSG00000056758 4.405 other miRNAs
w/seed GAGGUAG;
mmu-itd.R-98-5p let-7a-5p (and -0.494 HS2ST1 ENSMUSG00000040151 2.657 o her miRNAs
w/seed GAGGUAG)
mrnu-miR-98-5p 1et-- 7a--5p (and. -0.494 IFRD1 ENSMUSG00000001627 2.145 other miRNAs
w/ seed GAGGUAG)
mmu-miR-98-5p j.et-7a-5p (and -0.494 LAMP2 ENSMUSG00000016534 2.003 other miRNAs
/seed GAGGUAG)
mmu-miR-98-5p let-7a-5p (and -0.494 LDLRAD4 ENSMUSG00000024544 2.706 other miRNAs
w/ seed GAGGUAG!
rnmu--miR- 98-- 5p let-7a-5p (and -0.494 LOX1,3 ENSMUSG00000000693 2.601 other miRNAs
w/seed GAGGUAG;
mmu-itd.R-98-5p let-7a-5p (and -0.494 KAP3K2 ENSMUSG00000024383 2.315 o her miRNAs
w/ seed GAGGUAG)
mmu-miR-98-5p let-7a-5p (and -0.494 MAP4K3 ENSMUSG00000024242 2.447 other miRNAs
w/ seed GAGGUAG)
mmu-miR-98-5p let-7a-5p (and -0.494 MFAP3L ENSMUSG00000031647 2.764 other miRNAs
/seed GAGGUAG)
mmu-miR-98-5p let--7a-5p (and --0.494 MTPN EMSMUSGO 0000029840 2.850 other miRNAs
w/ seed GAGGUAG!
mmu-miR-98-5p Iet-7a-Sp (and -0.494 NGF ENSMUSGO 0000027859 4.807 other miRNAs
w/seed GAGGUAG;
mmu-itd.R-98-5p let-7a-5p (and -0.494 N T2 EMSMUSGO 0000042271 2.525 o her miRNAs
w/seed GAGGUAG)
mrnu-miR-98-5p 1et-- 7a--5p (and -0.494 OPA3 ENSMUSG00000052214 2.066 other miRNAs
w/ seed GAGGUAG)
mmu-miR-98-5p j.et-7a-5p (and -0.494 OSMR ENSMUSG00000022146 2.289 other miRNAs
w/seed GAGGUAG)
mmu-miR-98-5p let--7a-5p (and -0.494 PTGS2 ENSMUSG00000032487 19.160 other miRNAs
w/ seed GAGGUAG!
mrnu-miR-98-5p 1et-- 7a--5p (and -0.494 RAB11FIP ENSMUSG00000017639 2.565 other miRNAs 4
w/ seed GAGGUAG)
mmu-miR-98-5p j.et-7a-5p (and -0.494 RGPD4 ENSMUSG00000003226 2.528 other miRNAs (include
w/seed GAGGUAG) s
others )
rnmu--miR- 98-- 5p let--7a-5 (and -0.494 RGS 16 ENSMUSG00000026475 4.031 other miRNAs
w/seed GAGGUAG)
mmu-itd.R-98-5p let-7a-5p (and -0.494 SLC1A4 EMSMUSGO 0000020142 2.449 o her miRNAs
w/seed GAGGUAG)
mmu-iniR- 98 -5p let--7a--5p (and -0.494 SLC30A4 ENSMUSG00000005802 2.768 other miRNAs
w/ seed GAGGUAG)
miRNA miKNA family raiBNA Gene Ensemble Gene ID mENA Exp name with seed Exp Log Symbol Fold sequence Ratio Change ramu-miR-98-5p let-7a-5p (and -0 , 494 SLC4A7 EMSMUSGO 0000021733 2.774 other miRNAs
w/ seed GAGGUAG!
mmu--miR- 98-- 5p let-7a-5p (and -0 , 494 SPRYD7 ENSMUSG00000021930 2.326 other rniRMAs
w/seed GAGGUAG;
mmu-itd.R-98-5p let-7a-5p (and -0. 94 STARD3NL EMSMUSGO 0000003062 2.225 o her miR As
w/seed GAGGUAG)
mrnu-miR-98-5p 1et- 7a-5p (and. -0.494 SUCLG2 ENSMUSG00000061836 3.114 other miRNAs
w/ seed GAGGUAG)
mmu-miR-98-5p let-7a-5p (and -0.494 SULF1 EMSMUSGO 0000016918 2.979 other miRNAs
/seed GAGGUAG)
mmu-miR-98-5p let-7a-5p (and -0.494 SYPL1 EMSMUSG00000020570 2.880 other rniRMAs
w/ seed GAGGUAG!
rnmu--miR- 98-- 5p let-7a-5p (and -0.494 TRIB1 ENSMUSG00000032501 2.711 other miRNAs
w/seed GAGGUAG;
mmu-itd.R-98-5p let-7a-5p (and -0.494 WDR37 EMSMUSGO 0000021147 4.184 o her miRNAs
w/ seed GAGGUAG)
mmu-miR-98-5p let-7a-5p (and -0.494 Y0D1 ENSMUSG00000046404 2.776 other miRNAs
w/ seed GAGGUAG)
mmu-miR-98-5p let-7a-5p (and -0.494 ZNF275 ENSMUSG00000031365 2.601 other miRNAs
/seed GAGGUAG)
mmu--miP.-206--3p miR-I-3p (and 0.527 ARHGEF18 EMSMUSGO 000000 568 -3.167 other rniRMAs
w/seed GGAAUGU)
rnmu-iaiR-206-3p miR-l-3p (and 0.527 EIF4E EMSMUSGO 0000028156 -3.143 other miRNAs
w/seed GGAAUGU)
mmu-miR-206- 3p miR-l-3p (and 0.527 EMILI 3 EMSMUSGO 0000050700 -2.944 o her miRNAs
w/seed GGAAUGU)
iranu-ra±R-206-3p miR-l-3p (and 0.527 HS3ST3B1 ENSMUSG00000070407 - .356 other miRNAs
w/seed GGAAUGU)
mmu-miR-206-3p miR-I-3p (and 0.527 MAP2 ENSMUSGO 0000015222 -2.560 other miRNAs
w/seed GGAAUGU)
mmu--miP.-206--3p miR-I-3p (and 0.527 0SBP'L7 EMSMUSGO0000038534 -2.560 other miRNAs
w/seed GGAAUGU)
rnmu-iaiR-206-3p miR-l-3p (and 0.527 SGI Pi EMSMUSGO 0000028524 -3.034 other miRNAs
w/seed GGAAUGU)
mmu-miR-206- 3p miR-l-3p (and 0.527 SNAI2 EMSMUSGO 0000022676 -2.118 other miRNAs
w/ seed GGAAUGU)
mrnu-miR-2C6-3p miR-l-3p (and 0.527 TRANK1 EMSMUSGO 0000062296 -2.219 other miRNAs
w/seed GGAAUGU)
mmu-miR- 99a-5p miP.-100-5p (and -0.331 GPRC5B ENSMUSGO 0000008734 3.220 other miRNAs
w/seed ACCCGUA)
mmu-miP.- 99a-5p miR-I00-5p (and -0.331 SLC44A1 ENSMUSG00000028412 2.782 other iRNAs
w/seed ACCCGUA)
miRNA miKNA family raiBNA Gene Ensemble Gene ID mENA Exp name with seed Exp Log Symbol Fold sequence Ratio Change rpitiu--miR- 99a--5p miR-iOO-bp {and -0 , 331 TRIB1 ENSMUSG00000032501 2.711 other miRNAs
w/ seed ACCCGUA)
mmu-miR- 122 -5p miR-1224-bp 0.518 COL8A2 ENSMUSG00000056174 -5.252
(and other
miRNAs w/seed
UGAGGAC )
mmu-miR-1224 --5p miR-1224-bp 0.518 G0LGA3 ENSMUSG00000029502 - .640
(ar.d other
miRNAs w/seed
UGAiGGAC )
mmu-miR- 1224-bp miP.-1224-bp 0.518 GSTM5 ENSMUSGO 0000058135 -2.732
(and other
miRNAs /seed
UGAGGAC }
mmu-mi - 1224-bp miR-122 -bp 0.518 ILI 8BP ENSMUSG00000070427 -2.178
(and other
miRNAs w/seed
UGAGGAC )
mmu-miR- 1224-5p miR-1224-bp 0, 518 MAOB ENSMUSGO 0000040147 -3.568
(and other
miRNAs w/seed
UGAGGAC )
mmu-miR- 1224-bp miP.-1224-bp 0.518 MAP2K6 ENSMUSGO 0000020623 -2.579
(and other
miRNAs w/seed
UGAGGAC }
mmu-miR- 1224-bp miR-122 -bp 0.518 NCAMl ENSMUSG000000395 2 -3.709
(and other
miRNAs w/seed
UGAGGAC )
mmu-miR- 1224-5p miR-1224-bp 0, 516 PRRX1 ENSMUSG00000026586 -2.910
(and other
miRNAs w/seed
UGAGGAC }
mmu-miP.- 128 -3p miR-128-3p (and -0 , 376 ABL2 ENSMUSG00000026596 2.156 other miRNAs
w/ seed CACAGUG)
mmu-miR- 128-3p miR-128-3p (and -0.376 ANGPT2 ENSMUSG00000031465 4.675 other miRNAs
w/seed CACAGUG)
mmu-miR- 128- 3p miR-123-3p (and -0.376 C5orf15 ENSMUSG00000036275 2.167 o her miRNAs
w/ seed CACAGUG)
ratnu-miR- 128- 3p miR-128-3p (and -0.376 CE IP ENSMUSG00000052353 3.630 other miRNAs
w/seed CACAGUG)
mmu-miR- 128-3p miR-12S-3p (and -0.376 CISD2 ENSMUSG00000028165 3.029 other miRNAs
w/seed CACAGUG)
mmu-miP.- 128 -3p miR-128-3p (and -0 , 376 CSRNPi ENSMUSG00000032515 2.565 other miRNAs
w/ seed CACAGUG!
mmu-miR- 128-3p miR-128-3p (and -0.376 DDAH1 ENSMUSG00000028194 2.848 other miRNAs
w/seed CACAGUG)
mmu-miR- 128- 3p miR-128-3p (and -0.376 DHX32 ENSMUSG00000030986 4.003 o her miRNAs
w/seed CACAGUG)
mmu-miR- 128- 3p miR-128-3p (and -0.376 DTNA ENSMUSG00000024302 5.102 other miRNAs
w/seed CACAGUG)
mmu-miR- 128-3p miR-12S-3p (and -0.376 EFR3A ENSMUSG00000015002 2.341 other miRNAs
miRNA miRNA family miRNA Gene Ensemble Gene ID mNA Exp name with seed Exp Log Symbol Fold sequence Ratio Change w/seed CACAGUG)
mmu-itiiR- 128- 3p miR-123-3p {and -0.376 EIF5 ENSMUSG00000021282 2.056 other miRNAs
w/ seed CACAGUG)
mmu-raiR- 128- 3p miR-128-3p (and -0.376 ENPEP ENSMUSGO 0000028024 4.231 other miRNAs
w/seed CACAGUG)
mmu-miR- 128-3p miR-128-3p (and -0 , 376 EPB41L1 ENSMUSGO 0000027624 3,202 other miRNAs
w/seed CACAGUG)
mmu--miP.- 128 --3p miR-128-3p {and -0 , 376 ERLECi EMSMUSGO 0000020311 2.086 other miRNAs
w/seed CACAGUG)
mmu-miR- 128-3p miR-128-3p (and -0.376 F3 ENSMUSGO 0000028128 5.234 other miRNAs
w/seed CACAGUG)
mmu-miR- 128- 3p miR-123-3p {and -0.376 FBLN2 ENSMUSGO 0000064080 3.145 other miRNAs
w/seed CACAGUG)
mmu-raiR- 128- 3p miR-128-3p (and -0.376 GALNT7 ENS USG00000031608 3.832 other miRNAs
w/seed CACAGUG;
mmu-miR- 128-3p miR-128-3p (and -0 , 376 GAREM ENSMU3G00000042680 2.160 other miRNAs
w/seed CACAGUG)
mmu-miP.- 128 -3p miR-128-3p (and -0 , 376 GCC2 ENSMUSG00000038039 2.542 other miRNAs
w/seed CACAGUG)
mmu-miR- 128-3p miR-128-3p (and -0.376 GCNT2 ENSMUSG00000021360 2.186 other miRNAs
w/seed CACAGUG)
mmu-miR-128- 3p miR-128-3p (and -0.376 GIGYF2 ENSMUSGO 0000048000 2.568 other miRNAs
w/ seed CACAGUG)
mmu-miR- 128- 3p miR-128-3p (and -0.376 GNA13 ENSMUSG00000020611 2.657 other miRNAs
w/seed CACAGUG)
mmu-miR- 128-3p miR-128-3p (and -0.376 GPD2 ENSMUSG00000026827 2.365 other miRNAs
w/seed CACAGUG)
mmu-miR-128- 3p miR-128-3p (and -0.376 GP 6 ENSMUSGO 0000021760 2.208 other miRNAs
w/ seed CACAGUG)
mmu-raiR- 128- 3p miR-128-3p (and -0.376 GSPT1 ENSMUSGO 0000062203 2.621 other miRNAs
w/seed CACAGUG)
mmu-miR- 128-3p miR-128-3p (and -0 , 376 HAPL 1 ENSMUSGO 0000021613 4.727 other miRNAs
w/seed CACAGUG)
mmu-miR- 128 -3p miR-128-3p (and -0 , 376 HBEGF ENSMUSG00000024486 4.754 other miRNAs
w/seed CACAGUG)
mmu-miR- 128-3p miR-128-3p (and -0.376 HEATR5A ENSMUSG00000035181 2.129 other miRNAs
w/seed CACAGUG)
mmu-miR-128- 3p miR-128-3p (and -0.376 TL13RA1 ENSMUSGO 0000017057 4.260 other miRNAs
w/ seed CACAGUG)
mmu-raiR- 128- 3p miR-128-3p (and -0.376 KLF3 ENSMUSG00000029176 2.514 other miRNAs
w/seed CACAGUG)
mmu-miR- 128-3p miR-128-3p (and -0 , 376 PNA3 ENSMUSGO 0000021929 2.132 other miRNAs
miRNA miRNA family raiRNA Gene Ensemble Gene ID mRNA Exp name with seed Exp Log Symbol Fold sequence Ratio Change w/seed CACAGUG)
mmu-itiiR- 128- 3p miR-128-3p {and -0.376 LAPTM B ENSMUSGO0000022257 2.242 other miRNAs
w/ seed CACAGUG)
mmu-miR- 128- 3p miR-128-3p (and -0.376 LIN7C ENSMUSGO 0000027162 2.691 other miRNAs
w/seed CACAGUG)
mmu-miR- 128-3p miR-128-3p (and -0 , 376 LUM ENSMUSGO 0000036446 4 , 857 other miRNAs
w/seed CACAGUG)
mmu--miP.- 128 --3p miR-128-3p {and -0 , 376 M1AP ENSMUSG00000030041 2.817 other miRNAs
w/seed CACAGUG)
mmu-miR- 128-3p miR-128-3p (and -0.376 MAP3K2 ENSMUSG00000024383 2.315 other miRNAs
w/seed CACAGUG)
mmu-miR- 128- 3p miR-128-3p {and -0.376 MRPL42 ENSMUSGO 0000062981 2.786 other miRNAs
w/seed CACAGUG)
mmu-miR- 128- 3p miR-128-3p (and -0.376 NCS 1 ENSMUSG00000062661 2.266 other miRNAs
w/seed CACAGUG;
mmu-miR- 128-3p miR-128-3p (and -0 , 376 NET01 ENSMUSGO 0000050321 2.208 other miRNAs
w/seed CACAGUG)
mmu-miP.- 128 -3p miR-128-3p (and -0 , 376 NHS ENSMUSGO0000059493 3.326 other miRNAs
w/seed CACAGUG)
mmu-miR- 128-3p miR-128-3p (and -0.376 NXT2 ENSMUSGO0000042271 2.525 other miRNAs
w/seed CACAGUG)
mmu-miR-128- 3p miR-128-3p (and -0.376 PAI P2 ENSMUSG00000037056 2.059 other miRNAs
w/ seed CACAGUG)
mmu-miR- 128- 3p miR-128-3p (and -0.376 PCNX ENSMUSG00000021140 2.398 other miRNAs
w/seed CACAGUG)
mmu-miR- 128-3p miR-128-3p (and -0 , 376 PDS5B ENSMUSGO 0000034021 2.152 other miRNAs
w/seed CACAGUG)
mmu-miR- 128 -3p miR-128-3p (and -0 , 376 PITHD1 ENS USG00000028669 2.493 other miRNAs
w/seed CACAGUG)
mmu-miR- 128-3p miR-128-3p (and -0.376 PLPP3 ENSMUSG00000028 17 2.892 other miRNAs
w/seed CACAGUG)
mmu-miR-128- 3p miR-128-3p (and -0.376 PN01 ENSMUSGO 0000020116 2.497 other miRNAs
w/ seed CACAGUG)
mmu-miR- 128-3p miR-12S-3p (and -0.376 RARE ENSMUSGO 000001'7491 4.056 other miRNAs
w/seed CACAGUG)
mmu-miR- 128-3p miR-128-3p (and -0 , 376 RGPD4 ENSMU3G00000003226 2.528 other miRNAs (include
w/ seed CACAGUG! s
others }
mmu-miR- 128-3p miR-128-3p (and -0.376 RPF1 ENSMUSG00000028187 3.758 other miRNAs
w/seed CACAGUG)
mmu-miR-128- 3p miR-128-3p (and -0.376 P.UNXl ENSMUSG00000022952 2.410 other miRNAs
w/ seed CACAGUG)
mmu-miR- 128- 3p miR-128-3p (and -0.376 SLC5A3 ENSMUSG00000089774 4.078
miRNA miKNA family raiBNA Gene Ensemble Gene ID mENA Exp name with seed Exp Log Symbol Fold sequence Ratio Change other miRMAs
w/ seed CACAGUG)
mmu--miR- 128 --3p miR-128-3p {and -0 , 376 SMURF2 EMSMUSGO 0000018363 2.852 other miRMAs
w/ seed CACAGUG!
mmu-miR- 128-3p miR-128-3p (and -0.376 S0CS5 EMSMUSGO 0000037104 2.471 other miRMAs
w/seed CACAGUG;
mmu-miR- 128- 3p miR-128-3p {and -0.376 SP4 EMSMUSGO 0000025323 2.296 other miRMAs
w/ seed CACAGUG)
mmu-miR- 126- 3p miR-128-3p (and -0.376 SPRY2 EMSMUSGO 000002211 3.254 other miRMAs
w/seed CACAGUG)
mmu-miR- 128-3p miR-12S-3p (and -0.376 STK38L EMSMUSGO 0000001630 4.290 other miRMAs
w/seed CACAGUG)
mmu- iR- 128 -3p miR-128-3p {and -0 , 376 TAPT1 EMSMUSG00000046985 2.316 other miRMAs
w/seed CACAGUG)
mmu-miR- 128-3p miR-128-3p (and -0.376 TMX1 ENSMUSG00000021072 2.916 other miRMAs
w/seed CACAGUG)
mmu-miR- 128- 3p miR-128-3p {and -0.376 TSPAN6 ENSMUSG00000067377 4.053 o her miRMAs
w/seed CACAGUG)
mmu-miR- 128- 3p miR-128-3p (and -0.376 TUSC3 ENSMUSG00000039530 4.411 other miRMAs
w/seed CACAGUG;
mmu-miR- 128-3p miR-128-3p (and -0 , 376 UBE2K EMSMUSGO 0000029203 2.362 other miRMAs
w/seed CACAGUG)
mmu-miP.- 128 -3p miR-128-3p (and -0 , 376 VPS 4B EMSMUSGO 0000009907 2.110 other miRMAs
w/seed CACAGUG)
mmu-miR- 128-3p miR-128-3p (and -0.376 ZFP36L1 ENSMUSG00000021127 3.521 other miRMAs
w/seed CACAGUG)
mmu-miR-128- 3p miR-128-3p (and -0.376 ZZZ3 ENSMUSG00000039066 3.706 other miRMAs
w/ seed CACAGUG)
mmu-miR- 1306-3p miR-1306~3p 0, 505 MCEMP1 ENSMUSG00000013974 -2.619
(miRMAs w/ s eed
CGUUGGC )
mmu-miR- 136-Sp miR-136-5p -0 , 389 ACTCI EMSMUSGO 0000068614 2.373
(miRMAs -w/seed
CUCCAUU )
mmu-miP.- 136-5p miR-136-5p -0 , 389 CD28 ENSMUSG00000026012 2.657
(miRNAs w/ seed
CUCCAUU )
mmu-miR- 136-5p miR-136-5p -0.389 CYP51A1 ENSMUSG00000001467 3.378
(miRNAs w/ seed
CUCCAUU )
mmu-miR-136- 5p miR- 136-5p -0.369 DSTN ENSMUSG00000015932 3.550
(miRMAs w/seed
CUCCAUU )
mmu- iR- 136-5p miR-136-5p - 389 FN1 ENSMUSGO 0000026193 9.107
(miRMAs w/seed
CUCCAUU )
mmu-miR- 136-Sp miR- 136- 5p -0 , 389 GCNT2 EMSMUSGO 0000021360 2.186
(miRMAs w/seed
CUCCAUU )
mmu- iR- 136-5p miR- 136-5p -0 , 389 MII)2 EMSMUSGO 0000000266 2.346
(miRNA.S w/ seed
miRNA m±KNA family raiRNA Gene Ensemble Gene ID mRNA Exp name with seed Exp Log Symbol Fold sequence Ratio Change
CUCCAUU )
mmu-itiiR- 136- 5p miR-136-5p -0.389 MINOS 1- ENSMUSGO0000041120 3.543
(miRNAs vi/seed NBL1/NBL
CUCCAUU ) 1
mmu-raiR- 136- 5p miR- 136-5p -0.369 MLLT11 ENS USG00000053192 2.755
(miRNAs ¾'./ s eeci
CUCCAUU )
mmu-miR- 136-Sp miR- 136- Sp -0.389 ΜΞΗ3 ENSMUSGO 0000014850 2.236
(miRNAs w/seed
CUCCAUU }
rpitiu--miR- 136--5p miR- 136- Sp -0.389 MTPN ENSMUSGO 0000029840 2.850
(miRNAs w/seed
CUCCAUU }
rnmu-raiR-136-5p miR-136-Sp -0.389 PGM3 ENSMUSGO 0000056131 3.036
(miRNAs w/ seed
CUCCAUU )
mmu-raiR- 136- 5p miR-136-5p -0.389 RADIL ENSMUSGO 0000029576 2.043
(miRNAs w/seed
CUCCAUU )
ratnu-miR- 136- 5p miR- 136-5p -0.369 SMOC2 ENSMUSGO 0000023886 1 ^5
(miRNAs w./ s eed
CUCCAUU )
mmu-miR- 136-Sp miR- 136- Sp -0.389 SNAPC1 ENSMUSGO 0000021113 2.464
(miRNAs w/seed
CUCCAUU }
rnmu-miP.- 136-5p miR- 136- Sp -0.389 STXBP3 ENSMUSGO 0000027882 2.034
(miRNAs w/ seed
CUCCAUU }
rnmu-miR- 136-5p miR-136-Sp -0.389 SUC1G2 ENSMUSGO 0000061838 3.114
(miRNAs w/seed
CUCCAUU )
mmu-raiR-136- 5p miR- 136-5p -0.369 TIMM17A ENSMUSGO 0000062580 2.530
(miRNAs w/seed
CUCCAUU )
ramu-raiR- 136- 5p miR- 136-Sp -0.369 TRAPPC6B ENSMUSGO 0000020993 2.544
(miRNAs w/seed
CUCCAUU )
mmu-miR- 136-Sp miR- 136- Sp -0.389 TRIB1 ENSMUSGO 0000032501 2.711
(miRNAs w/seed
CUCCAUU }
rnmu-miR- 136-5p miR- 136-Sp -0.389 SPAN3 ENSMUSG00000032324 3.800
(miRNAs w/ seed
CUCCAUU }
rnmu-miR- 136-5p miR-136-Sp -0.389 T SG1 ENSMUSGO 0000024098 3.740
(miRNAs w/seed
CUCCAUU )
ramu-raiR-136- Sp miR- 136-5p -0.369 UBE2D3 ENSMUSGO 0000078576 2.561
(miRNAs w/seed.
CUCCAUU )
mrnu-miR- 136-Sp miP.-136-Sp -0 389 UBE3D ENSMUSG00000032415 2.160
(miRNAs w/seed
CUCCAUU )
mmu-miR- 136-Sp miR- 136- Sp -0.389 ZCCHC14 ENSMUSGO 0000061410 2.791
(miRNAs w/seed
CUCCAUU }
rnmu- iR- 1 8b-3p miR-148a-3p -0.385 ABL2 E SMUSG00000026596 2.156
(and other
miRNAs w/seed
CAGUGCA)
ramu-raiR-1 8b--3p miR- 1 8a- 3p ""'0.365 ACVR1 ENSMUSGO 0000026836 2.661
(ar.d other
miRNAs w/seed
CAGUGCA)
miRNA m±RNA family raiRNA Gene Ensemble Gene ID mENA Exp name with seed Exp Log Symbol Fold sequence Ratio Change mmu-miR-1 8b-3p miR-148a-3p -0 , 385 AM0TL2 ENSMUSG00000032531 3.583
(and other
miRNAs w./seeel
CAGUGCA)
mmu-miR- 1 8b-3p miR-148a-3p -0.385 ANGEL2 ENSMUSG00000026634 2.092
(and other- miRNAs w/seed
CAGUGCA)
mmu-miR- 146b--3p miR-148a-3p -0 385 ANGPT2 ENSMUSG00000031465 4.675
(and other
miRNAs w/seed
CAGUGCA)
mmu-miR-148b-3p miR-148a-3p -0 , 385 ATP2A2 ENSMUSG00000029467 3.343
(and other
miRNAs w/seed
CAGUGCA)
mmu-miR- 148b-3p miR-148a-3p -0.385 CAV2 ENSMUSG00000000058 3.050
(and other
miRNAs w/seed
CAGUGCA)
mmu-miR- 148b-3p miR-14Sa-3p CDK8 ENSMUSG00000029635 2.761
(and other
miRNAs w/seed
CAGUGCA)
mmu-miP.- 148b-3p miR-148a-3p -0 , 385 CUD9 ENSMUSG00000056608 2.565
(and other
miRNAs w/seed
CAGUGCA)
mmu-miR- 148b-3p miR-148a-3p -0.385 CHMP3 ENSMUSG00000053119 2.505
(and other
miRNAs w/seed
CAGUGCA)
mmu- iR- 148b-3p miR-14Sa-3p COLIOAI ENSMUSG00000039462 9.680
(and other
miRNAs w/seed
CAGUGCA)
mmu-miR- 148b-3p miR-148a-3p -0.385 COL6A3 ENSMUSG00000048126 5.726
(and other
miRNAs w/seed
CAGUGCA)
mmu-miR- 148b--3p miR-148a~3p "~0.365 DDAK1 ENSMUSG00000028194 2.848
(and other
miRNAs w/seed
CAGUGCA)
mmu-miR- 148b-3p miP.-148a-3p -0.385 EMP1 ENSMUSG00000030208 5.836
(and other
miRNAs w/seed
CAGUGCA)
mmu-miR- 148b-3p miR-148a-3p -0.385 EPB41L1 ENSMUSG00000027624 3 ,202
(and other
miRNAs w/seed
CAGUGCA)
mmu-miR- 148b-3p miR-148a~3p "~0.365 EPN2 ENS USG00000001036 2.745
(and other
miRNAs w/seed
CAGUGCA)
mmu-m R- 1 8b-3p miR-148a-3p -0.385 ERRFI 1 ENSMU3G00000028967 6.000
(and other
miRNAs w/seed
CAGUGCA)
mmu-miR- 148b-3p miR-148a-3p -0.385 ETS1 ENSMUSG00000032035 2.457
(and other
miRNAs w/seed
CAGUGCA)
miRNA miKNA family raiBNA Gene Ensemble Gene ID mBNA Exp name with seed Exp Log Symbol Fold sequence Ratio Change inmu-raiR-1 8b-3p miR-148a-3p -0 , 385 F3 ENSMUSG00000028128 5.234
(and other
miRNAs w./seeel
CAGUGCA)
mmu-miR- 1 8b-3p miR-148a-3p -0.385 FEZ2 ENSMUSG000000 6121 2.412
(and other- miRNAs w/seed
CAGUGCA)
mmu-ralR- 146b--3p miR-148a-3p -0 385 GPRC5B ENSMUSG00000008734 3.220
(and other
miRNAs w/seed
CAGUGCA)
mmu-miR-148b-3p miR-148a-3p -0 , 385 HSPA4L ENSMUSG00000025757 4.350
(and other
miRNAs w/seed
CAGUGCA)
mmu-miR- 148b-3p miR-148a-3p -0.385 LAMP2 ENSMUSG00000016534 2.003
(and other
miRNAs w/seed
CAGUGCA)
mmu-miR- 148b-3p miR-14Sa-3p MAP2K1 ENSMU3GQ 0000004936
(and other
miRNAs w/seed
CAGUGCA)
mmu-miP.- 148b-3p miR-148a-3p -0 , 385 MAP3K2 ENSMUSG0000002 383 2=315
(and other
miRNAs w/seed
CAGUGCA)
mmu-miR- 148b-3p miR-148a-3p -0.385 NCSl ENSMUSG00000062661 2.286
(and other
miRNAs w/seed
CAGUGCA)
mmu- iR- 148b-3p miR-14Sa-3p NET01 ENSMUSG00000050321 2.208
(and other
miRNAs w/seed
CAGUGCA)
mmu-miR- 148b-3p miR-148a-3p -0.385 NHS ENSMUSG00000059493 3.326
(and other
miRNAs w/seed
CAGUGCA)
mmu-miR- 148b--3p miR-148a~3p "~0.365 PLPP3 ENSMUSG00000028517 2.892
(and other
miRNAs w/seed
CAGUGCA)
mmu-miR- 148b-3p miP.-148a-3p -0.385 PP.KG2 ENSMUSG00000029334 4.627
(and other
miRNAs w/seed
CAGUGCA)
mmu-miR- 148b-3p miR-148a-3p -0.385 RTN4 ENSMUSG00000020458 3 ,229
(and other
miRNAs w/seed
CAGUGCA)
mmu-miR- 148b-3p miR-148a~3p "~0.365 SLC5A3 ENSMUSG00000089774 4.078
(and other
miRNAs w/seed
CAGUGCA)
mmu-m R- 1 8b-3p miR-148a-3p -0.385 SLC7A2 ENSMU3G00000031596 4.389
(and other
miRNAs w/seed
CAGUGCA)
mmu-miR- 148b-3p miR-148a-3p -0.385 S0CS3 ENSMUSG00000053113 2.299
(and other
miRNAs w/seed
CAGUGCA)
miRNA miKNA family raiBNA Gene Ensemble Gene ID mENA Exp name with seed Exp Log Symbol Fold sequence Ratio Change mmu-miR-1 8b-3p miR-148a-3p -0 , 385 SPRYD7 EMSMUSGO 0000021930 2.326
(and other
miRNAs w./seeel
CAGUGCA)
mmu-miR- 1 8b-3p miR-148a-3p -0.385 SSR1 ENSMUSGO 0000021427 2.709
(and other- miRNAs w/seed
CAGUGCA)
mmu-ralR- 146b--3p miR-148a-3p -0 385 STK38L ENSMUSGO 0000001630 4.290
(and other
miRNAs w/seed
CAGUGCA)
mmu-miR-148b-3p miR-148a-3p -0 , 385 STT3A ENSMUSG00000032116 4.147
(and other
miRNAs w/seed
CAGUGCA)
mmu-miR- 148b-3p miR-148a-3p -0.385 ENSMUSGO 0000016918 2.979
(and other
miRNAs w/seed
CAGUGCA)
mmu-miR- 148b-3p miR-14Sa-3p ENSMUSGO 0000020023 7.961
(and other
miRNAs w/seed
CAGUGCA)
mmu-miP.- 148b-3p miR-148a-3p -0.385 TMEM128 ENSMUSG00000067365 2.646
(and other
miRNAs w/seed
CAGUGCA)
mmu-miR- 148b-3p miR-148a-3p -0.385 UBE2D3 ENSMUSG00000078578 2.561
(and other
miRNAs w/seed
CAGUGCA)
mmu- iR- 148b-3p miR-14Sa-3p UBE2K ENSMUSG00000029203 2.362
(and other
miRNAs w/seed
CAGUGCA)
mmu-miR- 148b-3p miR-148a-3p -0.385 USP33 ENSMUSG00000025437 2.294
(and other
miRNAs w/seed
CAGUGCA)
mmu-miR- 148b-3p miR-148a~3p "~0.365 ZBTB18 ENSMUSGO 0000063659 2.014
(and other
miRNAs w/seed
CAGUGCA)
mmu-miR- 149-Sp miP.-149-5p -0.308 AEBP1 ENSMUSGO 0000020473 2.866
(miRNAs -w/seed
CUGGCUC)
mmu-miR- 149-5p miR-149-5p -0.306 AM0TL2 ENSMUSG00000032531 3.583
(miRNAs w/seed
CUGGCUC )
mmu- iR- 149-5p miR-149-5p -0.308 APPL2 ENSMUSGO 0000020263 2.342
(miRNAs w/ seed
CUGGCUC )
mmu-miR- 149- 5p miR-149-5p -0.308 ATP2A2 ENSMUSGO0000029467 3.343
(miRNAs w/seed
CUGGCUC )
mmu-miR- 149- 5p rniR-149-5p -0.308 BAIAP2L1 ENSMUSGO0000038859 2.511
(miRNAs w/ s eed
CUGGCUC)
mmu-miR- 149-5p miR-149-5p -0.308 CCDC142 ENSMUSG00000079511 2.189
(miRNAs w/seed
CUGGCUC)
mmu-miP.- 149-5p miR-149-5p -0.306 CDK17 ENSMUSGO 0000020015 2.170
(miRNAs w/seed
miRNA miRNA family miRNA Gene Ensemble Gene ID mRNA Exp name with seed Exp Log Symbol Fold sequence Ratio Change
CUGGCUC)
mmu-itiiR- 149- 5p miR-149-5p -0.308 CNIK4 ENSMUSGO 0000062169 2.342
(miRNAs vi/seed
CUGGCUC )
mmu-ra±R-149-5p miR-149-5p -0.308 DAP ENSMUSGO 0000039166 2.566
(miRNAs ¾'./ s eeci
CUGGCUC)
mmu-miR- 1 9-Sp miR-149-5p -0.308 DDAH1 ENSMUSGO 0000028194 2.848
(miRNAs w/seed
CUGGCUC)
mmu--miR- 1 9--5p miR-149-5p -0.306 DLD ENSMUSG00000020664 2.426
(miRNAs w/seed
CUGGCUC }
mmu-miR- 1 9-5p miR-149-5p -0.308 DLL1 ENSMUSGO 0000014773 5.359
(miRNAs w/seed
CUGGCUC )
mmu-miR- 149- 5p miR-149-5p -0.308 EIF5 ENSMUSGO 0000021282 2.056
(miRNAs w/seed
CUGGCUC )
mmu-miR- 149- 5p miR-149-5p -0.308 EPB41L1 ENSMUSGO 0000027624 3.202
(miRNAs w/ s eed
CUGGCUC)
mmu-miR- 149-Sp miR-149-5p -0.308 FAM118A ENSMUSGO 0000022434 2.135
(miRNAs w/seed
CUGGCUC)
mmu-miP.- 149-5p miR-149-5p -0.306 FOSL1 ENSMUSG00000024912 4.706
(miRNAs w/seed
CUGGCUC )
mmu-miR- 149-5p miR-149-5p -0.308 FOXC1 ENSMUSGO 00000S 0295 2.359
(miRNAs w/seed
CUGGCUC )
mmu-miR- 149- 5p miR-149-5p -0.308 GAREM ENSMUSGO 0000042680 2.160
(miRNAs w/seed
CUGGCUC )
ratnu-miR- 149- 5p miR-149-5p -0.308 IL11 ENSMUSG00000004371 22.680
(miRNAs w/seed
CUGGCUC)
mmu-miR- 149-Sp miR-149-5p -0.308 LMCD1 ENSMUSGO 0000057604 2.301
(miRNAs -w/seed
CUGGCUC)
mmu-miR- 149-5p miR-149-5p -0.306 LTBP2 ENSMUSG00000002020 4.793
(miRNAs w/seed
CUGGCUC )
mmu-miR- 149-5p miR-149-5p -0.308 MAP3K2 ENSMUSG00000024383 2.315
(miRNAs w/seed
CUGGCUC )
mmu-mlR-149- 5p miR-149-5p -0.308 NPR3 ENSMUSGO 0000022206 7.306
(miRNAs w/seed
CUGGCUC )
mmu-miR- 149-5p miP.-149-Sp PLPP3 ENSMUSGO 000002851' 2.892
(miRNAs w/seed
CUGGCUC)
mmu-miR- 149-Sp miR-149-5p -0.308 PNOl ENSMUSGO 0000020116 2.497
(miRNAs w/seed
CUGGCUC )
mmu- iR- 149-5p miR-149-5p -0.306 RNF11 E SMUSG00000028557 2.276
(miRNAs w/seed
CUGGCUC )
mmu-miR- 149- 5p miR-149-5p -0.308 RNF2 ENSMUSGO 0000026484 2.544
(miRNAs w/seed
CUGGCUC )
mmu-miR- 149- 5p miR-149-5p -0.308 SRPX2 ENSMUSG00000031253 2.795
(miRNAs w/seed
miRNA miKNA family raiBNA Gene Ensemble Gene ID mENA Exp name with seed Exp Log Symbol Fold sequence Ratio Change
CUGGCUC)
mmu-itiiR- 149- 5p miR-149-5p -0.308 TNFRSF12 ENSMUSGO0000023905 5.946
(miRNAs vi/seed A
CUGGCUC )
ratnu-miR~149-5p miR-149-5p -0.308 ZNF275 ENSMUSG00000031365 2.601
(miRNAs ¾'./ s eeci
CUGGCUC)
mmu-miR- 151-Sp miR-15i-5p (and -0 , 396 HAS 1 ENSMUSGO 0000003665 5.063 other miRNAs
vi/seed CGAGGAG)
rpitiu--miR- 151--5p miR-151-5p (and -0 , 396 IQGAP1 ENSMUSGO 0000030536 2.850 other miRNAs
w/seecl CGAGGAG)
rnmu-miR- 1 1-5p miR-151-5p (and -0.396 SUCLG2 ENSMUSGO 0000061838 3.114 other miRNAs
w/seed CGAGGAG;
mmu-miR- 151- 5p miR-lSl-5p (and -0.396 TXNDC12 ENSMUSGO 0000028567 2.474 o her miRNAs
w/seed CGAGGAG)
mmu-miR- 18 lc--5p miR-181a-5p -0.450 ABL2 ENSMUSG00000026596 2.158
(and other
miRNAs w/seed
ACAUUCA)
mmu-miR- 18 lc-5p miR-181a-5p -0. 50 ABTB2 ENSMUSG00000032724 2.723
(and other
miR As w./seed
ACAUUCA)
mmu-miR- 18 lc-5p miR-181a-5p -0.450 APOO ENSMUSGO 0000079508 2.072
(and other
miRNAs w/seed
ACAUUCA)
mmu-miR- 18 lc-5p miR-181a-5p -0.450 APPL2 ENSMUSG00000020263 2.342
(and other
miRNAs w/seed
ACAUUCA)
mmu-miR- 18 lc-5p miR-181a-5p -0.450 ATP2A2 ENSMUSG00000029467 3.343
(and other
miRNAs w/seed
ACAUUCA)
mmu-miR- 18 lc-5p miR-181a-5p -0.450 CCDC117 ENSMUSGO 0000020482 2.347
(and other
miRNAs w/seed
ACAUUCA)
mmu-miR- 18 lc-5p miR-181a-5p CDK8 ENSMUSGO 0000029635 2.761
(and other
miRNAs w/seed
ACAUUCA)
rnmu-miR- 181 c-5p miR-181a-5p -0.450 CHP9 ENSMUSG00000056608 2.565
(and other
miRNAs w/seed
ACAUUCA)
mmu-miR- 18 lc-5p miR-181a-5p -0.450 CHMP3 ENSMUSGO 0000053119 2.505
(and other
miRNAs w/seed
ACAUUCA)
mmu-miR- 18 lc-5p miR-181a-5p -0.450 CYR61 ENSMUSGO 0000028195 6.512
(and other
miRNAs w/seed
ACAUUCA)
rnmu-miR- 181 c-5p miR-181a-5p -0.450 DCN ENSMUSG00000019929 3.130
(and other
miRNAs w/seed
ACAUUCA)
miRNA miKNA family raiBNA Gene Ensemble Gene ID mENA Exp name with seed Exp Log Symbol Fold sequence Ratio Change ramu-miR-181c-5p miR-181a-5p -0 , 50 DIP2C ENSMUSG00000048264 2 = 975
(and other
miRNAs w/seeel
ACAUUCA)
mmu-miR-181 c-5p miR-181a-5p -0.450 DNAJA4 ENSMUSG00000032285 2.408
(and other- miRNAs w/seed
ACAUUCA)
mmu-miR- 18 lc--5p miR-181a-5p -0.450 DTNA ENSMUSG00000024302 5.102
(and other
miRNAs w/seed
ACAUUCA)
ramu-miR-181c-5p miR-181a-5p -0.450 ENPP1 ENSMUSG00000037370 3.224
(and other
miRNAs w/seed
ACAUUCA)
mmu-itiiR- 18 lc-5p miR-181a-5p -0. 50 EPN2 ENSMUSG00000001036 2.745
(and other
miRNAs w/seed
ACAUUCA)
mmu-miR-18 lc-5p miP.-181a-5p ETS1 ENSMUSG00000032035 2.457
(and other
miRNAs w/seed
ACAUUCA)
mmu-miR- 18 lc-5p miR-181a-5p -0.450 EVI2A ENSMUSG00000078771 3.735
(and other
miRNAs w/seed
ACAUUCA)
mmu-itiiR- 18 lc-5p miR-181a-5p -0. 50 FOS ENSMUSG00000021250 10.091
(and other
miRNAs w/seed
ACAUUCA)
mtnu-miR-18 lc-5p miP.-181a-5p GCC2 ENSMUSG00000038039 2.542
(and other
miRNAs w/seed
ACAUUCA)
mmu-miR- 181 c-5p miR-181a-5p -0.450 GCNT2 ENSMUSG00000021360 2.186
(and other
miRNAs w/seed
ACAUUCA)
mmu-miR- 18 lc--5p miR-181a~5p -0.450 GHITM ENSMUSG00000041026 3.310
(and other
miRNAs w/seed
ACAUUCA)
mmu-miR- 18 lc-5p miP.-18ia-5p -0.450 GPD2 ENSMUSG00000026827 2.365
(and other
miRNAs w/seed
ACAUUCA)
mmu-miR- 181 c-5p miR-181a-5p -0.450 HAPLN1 ENSMUSG00000021613 4.727
(and other
miRNAs w/seed
ACAUUCA)
mmu-miR- 18 lc-5p miR-181a~5p -0.450 HS2ST1 ENSMUSG00000040151 2.657
(a d other
miRNAs w/seed
ACAUUCA)
mmu-miR- 181c-5p miP.-i8ia-5p -0.450 KANK1 ENSMU3G00000032702 3.326
(and other
miRNAs w/seed
ACAUUCA)
mmu-m R- 181 c- p miR-181a-5p -0.450 KCTD3 ENSMUSG00000026608 2.488
(and other
miRNAs w/seed
ACAUUCA)
miRNA raiKNA family raiBNA Gene Ensemble Gene ID mENA Exp name with seed Exp Log Symbol Fold sequence Ratio Change inmu-miR-181c-5p miR-181a-5p -0 , 50 KLF3 ENSMUSG0000002 178 2.514
(and other
miRNAs w/seeel
ACAUUCA)
mmu-miR-181 c-5p miR-181a-5p -0.450 LIN7C ENSMUSG00000027162 2.691
(and other- miRNAs w/seed
ACAUUCA)
mmu-miR- 18 lc--5p miR-181a~5p -0.450 MAP2K1 ENSMUSG00000004936 2.373
(and other
miRNAs w/seed
ACAUUCA)
inmu-miR-181c-5p miR-181a-5p -0.450 MAP3K2 ENSMUSG00000024383 2=315
(and other
miRNAs w/seed
ACAUUCA)
mmu-itiiR- 18 lc-5p miR-181a-5p -0. 50 MBNL2 ENSMUSG00000022139 3.213
(and other
miRNAs w/seed
ACAUUCA)
mmu-miR-18 lc-5p miP.-181a-5p MEX3B ENSMUSG0000005 706 4.383
(and other
miRNAs w/seed
ACAUUCA)
mmu-miR- 18 lc-5p miR-181a-5p -0.450 MFAP3L ENSMUSG00000031647 2.764
(and other
miRNAs w/seed
ACAUUCA)
mmu-itiiR- 18 lc-5p miR-181a-5p -0. 50 MID2 ENSMUSG00000000266 2.346
(and other
miRNAs w/seed
ACAUUCA)
mtnu-miR-18 lc-5p miP.-181a-5p MTP ENSMUSG00000029840 2.850
(and other
miRNAs w/seed
ACAUUCA)
mmu-miR- 181 c-5p miR-181a-5p -0.450 PLEKKA3 ENSMUSG00000002733 4.374
(and other
miRNAs w/seed
ACAUUCA)
mmu-miR- 18 lc--5p miR-181a~5p -0.450 PLPP3 ENSMUSG00000028517 2.892
(and other
miRNAs w/seed
ACAUUCA)
mmu-miR- 18 lc-5p miP.-18ia-5p -0.450 RNF2 ENSMUSG00000026484 2.544
(and other
miRNAs w/seed
ACAUUCA)
mmu-miR- 181 c-5p miR-181a-5p -0.450 RNF6 ENSMUSG00000029634 2.654
(and other
miRNAs w/seed
ACAUUCA)
mmu-miR- 18 lc-5p miR-181a~5p -0.450 P.UNXl ENSMUSG00000022952 2.410
(a d other
miRNAs w/seed
ACAUUCA)
mmu-miR- 181c-5p miP.-i8ia-5p -0.450 SACM1L ENSMU3G000000252 0 2.59S
(and other
miRNAs w/seed
ACAUUCA)
mmu-m R- 181 c- p miR-181a-5p -0.450 SLC38A2 ENSMUSG00000022462 3.065
(and other
miRNAs w/seed
ACAUUCA)
miRNA m±KNA family raiBNA Gene Ensemble Gene ID mENA Exp name with seed Exp Log Symbol Fold sequence Ratio Change ramu-miR-181c-5p miR-181a-5p -0 , 50 SLC7A2 EMSMUSGO 0000031596 4.389
(and other
miRNAs w/seeel
ACAUUCA)
mmu-miR-181 c-5p miR-181a-5p -0.450 S0CS3 ENSMUSG000000 3113 2.299
(and other- miRNAs w/seed
ACAUUCA)
mmu-miR- 18 lc--5p miR-181a~5p -0.450 STC2 ENSMUSGO 0000020303 2.504
(and other
miRNAs w/seed
ACAUUCA)
ramu-miR-181c-5p miR-181a-5p -0.450 TIMP3 ENSMUSG00000020044 3.853
(and other
miRNAs w/seed
ACAUUCA)
mmu-itiiR- 18 lc-5p miR-181a-5p -0. 50 TMEM33 ENSMUSG00000037720
(and other
miRNAs w/seed
ACAUUCA)
mmu-miR-18 lc-5p miP.-181a-5p -0.450 TNFRS 11 ENSMUSGO0000063727 6.320
(and other B
miRNAs w/seed
ACAUUCA)
mmu-miR- 18 lc-5p miR-181a-5p -0.450 TNS3 ENSMUSG00000020422 2.570
(and other
miRNAs w/seed
ACAUUCA)
mmu-itiiR- 18 lc-5p miR-181a-5p -0.450 TULP4 ENSMUSG00000034377 2.207
(and other
miRNAs w/seed
ACAUUCA)
mtnu-miR-18 lc-5p miP.-181a-5p TUSC3 ENSMUSG00000039530 4.411
(and other
miRNAs w/seed
ACAUUCA)
mmu-miR- 181 c-5p miR-181a-5p -0.450 TXNDC12 ENSMUSG00000028567 2.474
(and other
miRNAs w/seed
ACAUUCA)
mmu-miR- 18 lc--5p miR-181a~5p -0.450 USP33 ENSMUSGO 0000025437 2.294
(and other
miRNAs w/seed
ACAUUCA)
mmu-miR- 18 lc-5p miP.-18ia-5p -0.450 VBP1 ENSMUSGO 0000031197 2.301
(and other
miRNAs w/seed
ACAUUCA)
mmu-miR- 181 c-5p miR-181a-5p -0.450 WDR37 ENSMUSG00000021147 4.184
(and other
miRNAs w/seed
ACAUUCA)
mmu-miR- 18 lc-5p miR-181a~5p -0.450 YOD1 ENSMUSG00000046404 2.776
(a d other
miRNAs w/seed
ACAUUCA)
mmu-miR- 181c-5p miP.-i8ia-5p -0.450 YWHAG ENSMUSGO 0000051391 2.462
(and other
miRNAs w/seed
ACAUUCA)
mmu-m R- 181 c- p miR-181a-5p -0.450 ZCCHC14 ENSMUSG00000061410 2.791
(and other
miRNAs w/seed
ACAUUCA)
miRNA miRNA family miRNA Gene Ensemble Gene ID mRNA Exp name with seed Exp Log Symbol Fold sequence Ratio Change ramu-miR-181c-5p miR-181a-5p -0. 50 ZFP36L1 EMSMUSGO 0000021127 3.521
(and other
miRNAs w./seeel
ACAUUCA)
mmu-miR-181 c-5p miR-181a-5p -0.450 ZZZ3 ENSMUSG00000039068 3.706
(and other- miRNAs w/seed
ACAUUCA)
mmu-raiR-1839-5p miR--1839--5p -0.468 ARL4A ENSMUSG00000047446 2.769
(and other
miRNAs w/seed
AGGUAGA)
mmu-miR-1839-5p miR-1839-5p --0.466 AVPI1 EMSMUSGO 0000018821 2.061
(and other
miRNAs w/seed
AGGUAGA)
mmu-itd.R-1839-5p miR-1839-5p -0. 68 CHCKD4 EMSMUSGO 0000034203 2.354
(and other
m RNAs w/seed
AGGUAGA)
mmu-miR-1839-5p miP.-1839-5p -0.468 COX16 EMSMUSGO 0000091803
(and other
miRNAs w/seed
AGGUAGA)
mmu-miR-1839-5p miR-1839-5p --0.466 DCN ENSMUSG0000001 929 3.130
(and other
miRNAs w/seed
AGGUAGA)
mmu-miR- 1839-5p miR-1839-5p -0.468 DPH3 ENSMUSG00000021905 2.462
(and other
mi NAs w/seed
AGGUAGA)
mmu-miR-1839-5p miP.-1839-5p -0.468 FOS ENSMUSG00000021250 10.091
(and other
miRNAs w/seed
AGGUAGA)
mmu--miR- 1839-5p miR-1839-5p -0.466 HSPA4L ENSMUSG00000025757 4.350
(and other
miRNAs w/seed
AGGUAGA)
mmu-ra±R-1839-5p miR-1839--5p -0.468 TDH3A ENSMUSG00000032279 3.869
(and other
miRNAs w/seed
AGGUAGA)
mmu-miR- 1839-5p miP.-1839-5p -0.468 LAMP2 ENSMUSG00000016534 2.003
(and other
miRNAs w/seed
AGGUAGA)
mmu--miR- 1839-5p miR-1839-5p -0.466 MAP3K2 ENSMUSG00000024383 2.315
(and other
miRNAs w/seed
AGGUAGA)
mmu-ra±R-1839-5p miR-1839--5p -0.468 MTMR7 ENSMUSG00000039431 4.064
(and other
miRNAs w/seed
AGGUAGA)
mmu-miR- 183S-5p miR-1839-5p -0.468 PFN2 EMSMUSGO 0000027805 2.558
(and other
miRNAs w/seed
AGGUAGA)
mmu- iR-1839-Sp miR-1839-5p -0.468 RAB11FIP ENSMUSG00000017639 2.585
(and other 4
miRNAs w/seed
AGGUAGA)
miRNA miKNA family laiBNA Gene Ensemble Gene ID mENA Exp name with seed Exp Log Symbol Fold sequence Ratio Change mmu-miR-1839-5p miR-1839-5p -0 , 66 RARE EMSMUSGO 0000017491 4.056
(and other
miRNAs w/seeel
AGGUAGA}
mmu-miR- 1839-5p miR-1839-5p -0.468 RNF149 ENSMUSG00000048234 2.464
(and other- miRNAs w/seed
AGGUAGA)
ramu-ra±R-1839-5p miR-1839-5p -0.468 SEPT7 ENSMUSG00000001833 2.378
(and other
miRNAs w/seed
AGGUAGA)
mmu-miR-1839-5p miR-1839-5p -0 , 466 SMURF2 EMSMUSGO 0000018363 2.852
(and other
miRNAs w/seed
AGGUAGA)
mmu-itd.R-1839-5p miR-1839-5p -0.468 SPRYD7 EMSMUSGO 0000021930 2.326
(and other
miRNAs w/seed
AGGUAGA)
inmu-raiR-1839-5p miP.-1839-5p -0.468 TSPAN6 EMSMUSGO 000006 377 4.053
(and other
miRNAs w/seed
AGGUAGA)
ramu-raiR-196b-5p miR-196a-5p -0.590 ABL2 ENSMUSG00000026596 2.156
(and other
miRNAs w/seed
AiGGUAGU )
mmu-miR- 196fa-5p miR- 1 6a- bp -0.590 CDV3 ENSMUSG00000032803 2.604
(and other
miRNAs w/seed
AGGUAGU )
mmu-miR- 196b-5p miP.-196a-5p -0.590 GSPT1 ENSMUSG00000062203 2.621
(and other
miRNAs w/seed
AGGUAGU )
rnmu- iR- 196b-5p miR- 196 -5p -0.590 HMGA1 ENSMUSG00000078249 4.019
(and other
miRNAs w/seed
AGGUAGU )
mmu- iR- 196b- bp miR- 196a- 5p -0.590 LA.PTM4E ENSMUSG00000022257 2.242
(and other
miRNAs w/seed
AGGUAGU )
mmu-miR- 196b-5p miP.-196a-5p -0.590 MAP4K3 EMSMUSGO 000002 2 2 2.447
(and other
miRNAs w/seed
AGGUAGU )
mmu-miR- 196b-5p miR- 196 -5p -0.590 MBNL2 EMSMUSGO 0000022139 3.213
(and other
miRNAs w/seed
AGGUAGU )
mmu-miR- 196b- bp miR- 196a- 5p -0.590 NCS1 ENSMUSG00000062661 2.266
(and other
miRNAs w/seed
AGGUAGU )
mmu-miR- 196b-5p miR-196a-5p -0.590 NHS EMSMUSGO 0000059493 3.326
(and other
miRNAs w/seed
AGGUAGU )
mmu-miR- 196b-bp miR-196a- p -0.590 CPA3 ENSMUSG00000052214 2.066
(and other
miRNAs w/seed
AGGUAGU )
miRNA miKNA family laiRNA Gene Ensemble Gene ID mRNA Exp name with seed Exp Log Symbol Fold sequence Ratio Change mmu-miR-1 6b- 5p miR-196a-5p -0 , 590 OSMR EMSMUSGO 0000022146 2.289
(and other
miRNAs w/seecl
AGGUAGU )
mmu-miR- 1 6b-Sp mi - :96a-5p -0.590 PTTG1IP ENSMUSG000000092 1 2.365
(and other
miP As w/seed
AGGUAGU )
mmu-miR- 196b-- 5p miR- 196a-5p -0.590 SARAF ENSMUSG000C0031532 2.118
(and other
miRKAs w/seed
AGGUAGU }
mmu-miR-196b-5p miR-196a-5p -0. 90 SDCBP EMSMUSGO 0000028249 2.245
(and other
miRNAs w/seed
AGGUAGU )
mmu-miR- 196b- p miR- 1 6a- 5p -0.590 3KX24 EN3MUSG00000024535 2.592
(and other
miPNAs w/seed
AGGUAGU )
mmu-miR- 196b- 5p miR-196a-5p -0.590 3SRI ENSMUSGO 0000021 2 ' 2.709
(and other
m RKAs w/seed
AGGUAGU }
mmu-miR-196b-5p miR-196a-5p -0. 90 TMEM33 ENSMUSG00000037720 2.711
(and other
miRN-As w/seed
AGGUAGU )
mmu-miR- 196b- p miR- 196a- 5p -0.590 TMX1 ENS US O 0000021072 2.916
(and other- mi PSAs w/seed
AGGUAGU )
mmu-miR- 1 6b- 5p miR-196a-5p -0.590 WDR37 ENSMUSGO 00000211 7 4.184
(and other
miRKAs w/seed
AGGUAGU }
mmu-miR- 196b-5p miR- 196 -5p -0.590 Y0D1 ENSMUSG00000046404 2.776
(and other
miRNAs w/seed
AGGUAGU )
mmu-miR- 196b- bp miR- 196a- 5p -0.5 0 ZKF3S5B ENSMUSGO 0000027016 5.404
(and other
mi RKAs w/seed
AGGUAGU }
mmu-let-7j miP,-202-3p (and 0.5 0 ADAMT314 ENSMUSG00000059901 -2.334 oth r miRNAs
w/seed GAGGUAU)
mmu- let-7 miP.-202-3p (and 0.550 ADCY9 ENSMUSGO 0000005580 -2.161 other miRKAs
w/seed GAGGUAU!
mmu-iet-7 miR-202-3p (and 0.550 DENKD6A ENSMUSG00000040818 -2.013 other mi NAs
w/seed GAGGUAU;
mmu-let-7 miR-202-3p (and 0.550 GHR ENSMUSGO0000055737 -2.650 o her miRNAs
w/ seed GAGGUAU)
mmu-let-7j iriiR-- 202-3p (and 0.550 LRRK3 ENSMUSG00C00036295 -3.269 other miRNAs
w/seed GAGGUAU)
mmu-let- j miP.-202-3p (and 0.550 MGLL ENSMU3GO 0000033174 -3.899 other miRNAs
w/seed GAGGUAU)
mmu- let-7 miR-202-3p (and 0.550 PIK3IP1 ENSMUSG00000034614 -3.164 other miRNAs
miRNA miKNA family raiBNA Gene Ensemble Gene ID mENA Exp name with seed Exp Log Symbol Fold sequence Ratio Change w/seed GAGGUAU)
nanu-let-7j miR-202-3p {and 0, 550 PRR 1 ENSMUSG00000026586 -2.910 other miRNAs
w/ seed GAGGUAU)
mmu-le -71 miR-202-3p (and 0, 550 TRANK1 ENSMUSGO 0000062296 -2.219 other miRNAs
w/seed GAGGUAU)
mmu-miR-210-3p miR-210-3p -0 , 334 ITHD1 ENSMUSGO 0000028669 2.493
(miRNAs w/seed
UGUGCGU }
mmu--miP.-210--3p miR-210-3p -0 , 334 PXDC1 ENSMUSGO 0000021 11 2.385
(miRNAs w/seed
UGUGCGU }
mmu-miP-210-3p miR-2iO-3p -0.334 TRIB1 ENSMUSG00000032 01 2.711
(miRNAs w/ seed
UGUGCGU )
mmu-miR-222- 3p miR-22 l-3p (and 0, 522 CAMKK1 ENSMUSG00000020785 -2.048 other miRNAs
w/ seed GCUACAU)
mmu-miR-222- 3p rniR-221-3p (and 0, 522 KLHL18 ENSMUSG00000054792 -2.175 other miRNAs
w/seed GCUACAU)
mmu-miR-222-3p miP.-22i-3p (and 0.522 NCAM1 ENSMUSGO 0000039542 -3.709 other miRNAs
w/seed GCUACAU)
mmu--miP.-222--3p miR-221-3p (and 0.522 0SBPL7 ENSMUSG00000038534 -2.560 other miRNAs
/seed GCUACAU )
mmu-miR-224-5p miR-224-5p -0.459 ANGPT2 ENSMUSG00000031465 4.675
(miRNAs w/seed
AAGUCAC )
mmu--miR--224--5p miR-224-5p -0. 59 ATL2 ENSMUSGO 0000059811 2.395
(miRNAs w/seed
AAGUCAC )
mmu-miR-224- 5p miR-224-5p -0.459 CCDC117 ENSMUSGO 0000020 82 2.347
(miRNAs w/seed
AAGUCAC)
mmu-miR-224-5p miR-224- 5p -0.459 C0BLL1 ENSMUSGO 000003 903 2.479
(miRNAs w/seed
AAGUCAC)
mmu--miR-224--5p miR-224-5p -0. 59 DTNA ENSMUSG00000024302 5.102
(miRNAs w/seed
AAGUCAC )
mmu-miR-224-5p miR-224-5p -0.459 EIF2AK3 ENSMUSG00000031668 2.161
(miRNAs w/seed
AAGUCAC )
mmu--miR--224--5p miR-224-5p -0. 59 EIF5 ENSMUSGO 0000021282 2.056
(miRNAs w/seed.
AAGUCAC )
mmu- iR-224-5p miR-224-bp -0.459 FHL2 ENSMUSG00000008136 3.350
(miRNAs w/seed
AAGUCAC)
mmu-miR-224-Sp miR-224- 5p -0.459 GIGYF2 ENSMUSGO 0000048000 2.588
(miRNAs w/seed
AAGUCAC )
mmu-miR-224 -5p miR-22 -5p -0. 59 GTF3C4 ENSMUSG00000035666 2.289
(miRNAs w/seed
AAGUCAC )
mmu-miR-224- 5p miR-224-5p -0.459 IL11 ENSMUSG00000004371 22.880
(miRNAs w/seed
AAGUCAC )
mmu-miR-224- 5p miR-224-5p -0. 59 ITM2B ENSMUSGO 0000022106 2.136
(miRNAs w/seed.
miRNA miRNA family miRNA Gene Ensemble Gene ID mRNA Exp name with seed Exp Log Symbol Fold sequence Ratio Change
AAGUCAC)
mmu-miR-224- 5p miR-224-5p -0.459 LIN7C ENSMUSGO 0000027162 2.691
(miRNAs vi/seed
AAGUCAC )
ratnu-miR~22 - 5p miR--224-5p -0.459 MBNL2 ENSMUSG00000022139 3.213
(miRNAs ¾'./ s eeci
AAGUCAC)
mmu-miR-224-5p miR-224-5p -0. 59 MRPL42 ENSMUSGO 0000062981 2.786
(miRNAs w/seed
AAGUCAC)
mmu-miR-224-5p miR-224-5p -0. 59 NCS 1 ENSMUSG00000062661 2.286
(miRNAs w/seed
AAGUCAC }
rnmu-miR-224-5p miR-224~5p -0.459 NUP153 ENSMUSG00000021374 2.553
(miRNAs w/ seed
AAGUCAC )
mmu-miR-224- 5p miR-224-5p -0.459 PCNX ENSMUSGO 0000021140 2.398
(miRNAs w/seed
AAGUCAC )
ratnu-miR~22 - 5p miR--224-5p -0.459 PHLPP1 ENSMUSG00000044340 2.247
(miRNAs w./ s eed
AAGUCAC )
mmu-miR-224-Sp miR-224-5p -0.459 PLPP3 ENSMUSGO 0000028517 2.892
(miRNAs w/seed
AAGUCAC)
mmu-miR-224-5p miR-224-5p -0. 59 SLMAP ENSMUSGO 0000021870 2.110
(miRNAs w/seed
AAGUCAC }
rnmu-miR-224-5p miR-224~5p -0.459 TMBIMi ENSMUSGO 0000006301 2.230
(miRNAs w/seed
AAGUCAC )
mmu-miR-224- 5p miR--224-5p -0.459 TMEM128 ENSMUSGO 0000067365 2.646
(miRNAs w/seed
AAGUCAC )
«Hnu-ralR-22 - 5p miR--224-5p -0.459 TMX1 ENSMUSG00000021072 2.916
(miRNAs w/seed
AAGUCAC)
mmu-miR-224-Sp miR-224- 5p -0.459 TNS3 ENSMUSGO 0000020422 2.570
(miRNAs w/seed
AAGUCAC)
mmu-miR-224 -5p miR--224--5p -0. 59 TULP4 ENSMUSG00000034377 2.207
(miRNAs w/seed
AAGUCAC )
rnmu-miR-224-5p miR-224-5p -0.459 UBE2D3 ENSMUSGO 0000078578 2.581
(miRNAs w/seed
AAGUCAC )
mmu-miR-224- 5p miR-224-5p -0.459 UBE2G1 ENSMUSGO 0000020794 2.075
(miRNAs w/seed.
AAGUCAC )
rnmu-miR-224-5p miP.-224-5p -0.459 YOD'i ENSMUSG00000046404 2.776
(miRNAs w/seed
AAGUCAC)
rnmu-miR-26fa-5p miR-26a-5p (and -0.344 ABL2 ENSMUSGO 0000026596 2.158 other miRNAs
w/ seed UCAAGUA)
rnmu--miR-26b--5p miR--26a--5p (and. -0.344 ARL6IP6 ENSMUSGO 0000026960 3.519 other iRNAs
w/seed UCAAGUA)
mmu-miR-26b- 5p miR-26a-5p (and -0.344 CDK2AP1 ENSMUSGO 0000078154 2.233 o her miRNAs
w/seed UCAAGUA)
mmu-ra±R-26b- 5p miR-26a-5p (and -0.344 CDK6 ENSMUSGO 0000029635 2.761 other miRNAs
miRNA miRNA family miRNA Gene Ensemble Gene ID mRNA Exp name with seed Exp Log Symbol Fold sequence Ratio Change w/seed UCAAGUA)
mmu-miR-26b- 5p miR-26a-5p {and -0.344 CDV3 ENSMUSG00C000328C3 2.604 other mi NAs
w/ seed UCAAGUA)
mmu-ra±R-26b- 5p miR-26a-5p (and -0.344 COL10A1 ENSMUSG00000039462 9.660 other miRNAs
w/seed UCAAGUA)
mmu-miR-26fa-5p miR-26a-5p (and -0 , 344 EIF5 ENSMUSGO 0000021282 2 , 056 other miRNAs
w/seed UCAAGUA)
rpitiu--miR-26fa--5p miR-26a-5p {and -0 , 344 ENPEP ENSMUSGO 0000028024 4.231 other miRNAs
w/seed UCAAGUA)
mmu-miR-26b-5p miR-26a-5p (and -0.344 FAM118A ENSMUSGO0000022434 2.135 other miRNAs
w/seed UCAAGUA)
mmu-miR-26b- 5p miR-26a-5p {and -0.344 GALNT7 ENSMUSGO 0000031608 3.832 other miRNAs
w/ seed UCAAGUA)
mmu-ra±R-26b- 5p miR-26a-5p (and -0.344 GNA13 ENSMUSG00000020611 2.657 other miRNAs
w/seed UCAAGUA)
mmu-ra±R-26b- 5p miR-26a-5p (and -0.344 GPX6 ENSMUSGO 0000021760 2.208 other miRNAs
w/seed UCAAGUA)
mmu-miR-26b-5p miR-26a-5p (and -0.344 HAPL i ENSMUSGO 0000021613 4.727 other miRNAs
w/seed UCAAGUA)
rnmu-miP.-26fa-5p miR-26a-5p (and -0 , 344 HEATR5A ENSMUSG00000035181 2.129 other miRNAs
w/ seed UCAAGUA)
rami!-miR-26fa-5p miR-26a-5p (and. -0 , 344 HMGA1 ENSMUSG00000078249 4.019 other miRNAs
w/seed UCAAGUA)
mmu-miR-26b- 5p miR-26a-5p (and -0.344 HS2ST1 ENSMUSGO 0000040151 2.657 other miRNAs
w/seed UCAAGUA)
mmu-miR-26b- 5p miR-26a-5p (and -0.344 KPNA3 ENSMUSGO 0000021929 2.132 other miRNAs
w/seed UCAAGUA)
mtnu-miR-26b-5p miR-26a-5p (and -0.344 MAP3K2 ENSMUSGO 000002 383 2.315 other miRNAs
w/seed UCAAGUA)
rnmu-miP.-26fa-5p miR-26a-5p (and -0 , 344 MEX3B ENSMUSGO 0000057706 4.383 other miRNAs
w/ seed UCAAGUA)
mmu-miR-26b-5p miR-26a-5p (and -0.344 MFAP3L ENSMUSG00000031647 2.764 other miRNAs
w/seed UCAAGUA)
mmu-miR-26b- 5p miR-26a-5p (and -0.344 MSH3 ENSMUSGO 000001 850 2.236 other miRNAs
w/ seed UCAAGUA)
mmu-miR~26b- 5p miR-26a-5p (and -0.344 MTPN ENSMUSGO 0000029840 2.850 other miRNAs
w/seed UCAAGUA)
mmu-miR-26b-5p miR-26a-5p (and -0 , 344 MTX2 ENSMUSGO 0000027099 2.259 other miRNAs
w/seed UCAAGUA)
mmu-miR-26fa-5p miR-26a-5p (and -0 , 344 NET01 ENSMUSG00000050321 2.206 other miRNAs
w/ seed UCAAGUA)
mmu-miR-26b-5p miR-26a-5p (and -0.344 NHS ENSMUSGO00000 9493 3.326 other miRNAs
miRNA m±KNA family raiBNA Gene Ensemble Gene ID mENA Exp name with seed Exp Log Symbol Fold sequence Ratio Change w/seed UCAAGUA)
mmu-miR-26b- 5p miR-26a-5p {and -0.344 NUP153 ENSMUSG00000021374 2.553 other miRNAs
w/ seed UCAAGUA)
mmu-ra±R-26b- 5p miR-26a-5p (and -0.344 PCNX ENSMUSG00000021140 2.398 other miRNAs
w/seed UCAAGUA)
mmu-miR-26fa-5p miR-26a-5p (and -0 , 344 PTGS2 ENSMUSGO 0000032487 19.160 other miRNAs
w/seed UCAAGUA)
mmu-miR-26b-5p miR-26a-5p (and -0.344 PTP4A1 ENSMUSGO 0000026064 2.910 other miRNAs
w/seed UCAAGUA)
mmu-miR-26b-5p miR-26a-5p (and -0 , 344 RNF6 ENSMUSGO 0000029634 2 , 654 other miRNAs
w/ seed UCAAGUA)
mmu-miR-26b-5p miR-26a-5p (and. -0 , 344 SAR1B ENSMUSG00000020386 3 , 415 other miRNAs
w/seed UCAAGUA)
mmu-miR-26b- 5p miR-26a-5p (and -0.344 SGMS2 ENSMUSGO 0000050931 3.816 other miRNAs
w/seed UCAAGUA)
mmu-ra±R-26b- 5p miR-26a-5p (and -0.344 SH2D5 ENSMUSG00000045349 2.509 other miRNAs
w/seed UCAAGUA)
mtnu-miR-26b-5p miR-26a-5p (and -0.344 3LC35A3 ENSMUSGO 000002 957 2.114 other miRNAs
w/seed UCAAGUA)
mmu-miP.-26b-5p miR-26a-5p (and -0 , 344 SLC36A2 ENSMUSGO 0000022462 3.065 other miRNAs
w/ seed UCAAGUA)
mmu-miR-26b-5p miR-26a-5p (and. -0 , 344 SMAD1 ENSMUSG00000031681 2 , 821 other miRNAs
w/seed UCAAGUA)
mmu-miR-26b- 5p miR-26a-5p (and -0.344 JJ ENSMUSG00000016918 2.979 other miRNAs
w/seed UCAAGUA)
mmu-miR-26b- 5p miR-26a-5p (and -0.344 TMEM33 ENSMUSG00000037720 2.711 other miRNAs
w/seed UCAAGUA)
mmu-miR-26b-5p miR-26a-5p (and -0.344 UBE2G1 ENSMUSGO 0000020794 2.075 other miRNAs
w/seed UCAAGUA)
mmu-miP.-26b-5p miR-26a-5p (and -0 , 344 UBE2K ENSMUSG00000029203 2.362 other miRNAs
w/ seed UCAAGUA)
mmu-miR-26b-5p miR-26a-5p (and -0.344 YWHAE ENSMUSG000000208 9 2.027 other miRNAs
w/seed UCAAGUA)
mmu-miR-26b- 5p miR-26a-5p (and -0.344 ZBTB18 ENSMUSGO 0000063659 2.014 other miRNAs
w/ seed UCAAGUA)
mmu-miR~26b- 5p miR-26a-5p (and -0.344 ZNF275 ENSMUSG00000031365 2.601 other miRNAs
w/seed UCAAGUA)
mmu-miR-26h-5p miR-26a-5p (and -0 , 344 ZNF38SB ENSMUSGO 0000027016 5.404 other miRNAs
w/seed UCAAGUA)
mmu-miP.-294 -3p miR-291a-3p 0.469 ADAMTS18 ENSMUSG00000053399 -6.088
(and other
miR As w/seed
AAGUGCU )
miRNA miKNA family raiBNA Gene Ensemble Gene ID mENA Exp name with seed Exp Log Symbol Fold sequence Ratio Change mmu--miR-294--3p miR-291a-3p 0.469 ARHGEF18 ENSMUSG0000000 568 -3.167
(and other
miRNAs w./seeel
AAGUGCU }
mmu-miP-294-3p miR-291a-3p 0.469 EIF4B ENSMUSG000000586 5 -2.339
(and other- miRNAs w/seed
AAGUGCU )
mrnu-miR-294-3p miR-291a-3p 0, 469 HABP4 BNSMUSGO0000021 76 -2 , 082
(and other
miRNAs w/seed
AAGUGCU }
mmu--miP.-294--3p miR-291a-3p 0.469 IRF1 ENSMUSGO 0000018899 -2.949
(and other
mi NAs w/seed
AAGUGCU )
mmu-miR-294- 3p miR-291a-3p 0, 469 FAT213 BNSMUSGO0000000708 -3 , 095
(and other
miRNAs w/seed
AAGUGCU )
mmu-miR~294~3p miP.-291a-3p 0.469 KLHL18 ENSMUSG00000054792 -2.175
(and other
miRNAs w/seed
AAGUGCU }
mmu--miP.-294--3p miR-291a-3p 0.469 NIN ENSMUSG00000021068 -3.365
(and other
miRNAs w/seed
AAGUGCU )
mmu-miR-294- 3p miR-291a-3p 0, 469 PRR 1 BNSMUSGO0000026586 -2 , 910
(and other
miRNAs w/seed
AAGUGCU )
mmu-miR~294~3p miR-291a-3p 0.469 RASSF2 ENSMUSG0000002 339 -2.930
(and other
miRNAs w/seed
AAGUGCU }
mmu-miR-294 -3p miR-291a-3p 0.469 RELL1 ENSMUSG00000047881 -2.321
(and othe- miRNAs w/seed
AAGUGCU )
mmu-miR-294-- 3p miR-291a-3p 0.469 RTN1 ENSMUSGO 0000021087 -2.461
(and other
miRNAs w/seed
AAGUGCU )
mmu-miR-294-3p miP.-29ia-3p 0.469 SIAINl ENSMUSG00000055717 -2.148
(and other
miRNAs w/seed
AAGUGCU }
mmu-miR-294 -3p miR-291a-3p 0.469 SYDE1 ENSMUSG00000032714 -2.013
(and othe- miRNAs w/seed
AAGUGCU )
mmu--miR--294--3p miR-291a-3p 0.469 TA.OK2 ENSMUSG00000059981 -2.656
(a d other
miRNAs w/seed
AAGUGCU)
mmu-miR-294-3p miP.-29ia-3p 0.469 TBC1D2 ENSMU3G00000039813 -3.413
(and other
miRNAs w/seed
AAGUGCU }
mmu-miR-294-3p miR-291a-3p 0.469 SH 2 ENSMUSG00000047907 -2.415
(and other
miRNAs w/seed
AAGUGCU )
miRNA m±KNA family raiBNA Gene Ensemble Gene ID mENA Exp name with seed Exp Log Symbol Fold sequence Ratio Change rpitiu--miR-294--3p miR-291a-3p 0.469 ZNF362 EMSMUSGO 0000028799 -2.430
(and other
miRNAs w./seeel
AAGUGCU }
rnmu-iaiR-297c-5p miR-297a-5p 0.591 EIF4E ENSMUSG00000028156 -3.143
(and other- miRNAs w/seed
UGUAUGU )
mrnu-miR--297c--5p miR- 297a-5p 0, 591 NDNF ENSMUSG00000049001 -3.198
(and other
miRNAs w/seed
UGUAUGU }
am-miR-297c-5p miR-297a-5p 0.591 SCARA3 ENSMUSG00000034463 -3.097
(and other
miRNAs w/seed
UGUAUGU )
rnmu-mi - 3082-5p miR-3082-5p 1,849 CAMKK2 ENSMUSG00000029 71 -2.570
(and other
m RNAs w/seed
ACAGAGU )
mrnu-miR-3082-5p miR-30S2-5p EIF4E ENSMUSG000000281 6 -3.143
(and other
miRNAs w/seed
ACAGAGU }
rnmu--miR-3082-5p miR-3082-5p 1.849 KAZALD1 EMSMUSGO 0000025213 -2.211
(and other
miRNAs w/seed
ACAGAGU )
rnmu-miR- 3082-5p miR-3082-5p 1,849 KAP2 ENSMUSGO 0000015222 -2.560
(and other
miRNAs w/seed
ACAGAGU )
mrnu-miR-3082-5p miR-30S2-5p NCAM1 ENSMUSG00000039542 -3.709
(and other
miRNAs w/seed
ACAGAGU }
rnmu--miR-3082-5p miR-3082-5p 1.849 VIT ENSMUSG00000024076 -3.211
(and othe- miRNAs w/seed
ACAGAGU )
mmu-miR- 30e- 3p miR- 30a-3p (and -0.468 CYR61 ENSMUSG00000028195 6.512 other miRNAs
w/ seed UUUCAGU)
mrnu-miR-30c-5p miR-30c-b (and -0.542 ABCC9 ENSMUSG00000030249 2.333 other miRNAs
w/seed GUAAACA)
mmu-miR-30c-Sp miR-30c-5p (and -0 , 542 ABL2 ENSMUSGO 0000026596 2 , 158 other miRNAs
w/seed GUAAACA)
rnmu--miR-30c--5p miR-30c-5p (and -0 , 542 ACTCI EMSMUSGO 0000068614 2.373 other miRNAs
w/seed GUAAACA)
mrnu-miR-30c-5p miR-30c-b (and -0. 42 ACVP.l ENSMUSGO 0000026836 2.661 other miRNAs
w/seed GUAAACA)
mmu-miR-30c-Sp miR-30c-5p (and -0 , 542 ADGRA3 ENSMUSGO 0000029090 2 , 113 other miRNAs
w/ seed GUAAACA)
rnmu-miR-30c-5p miR-30c-5p (and -0 , 542 AM0TL2 ENSMUSG00000032531 3.583 other miRNAs
w/seed GUAAACA)
mmu-miR-30c-5p miR-30c-5p (and -0.542 ARL4A ENSMUSG00000047446 2.789 o her miRNAs
w/seed GUAAACA)
miRNA miKNA family raiRNA Gene Ensemble Gene ID mRNA Exp name with seed Exp Log Symbol Fold sequence Ratio Change rpitiu--miP.-30c--5p miR-30c-5p {and -0 , 542 ARL6IP6 EMSMUSGO 0000026960 3.519 other miRNAs
w/ seed GUAAACA)
mmu--miR-30c--5p miR-30c-5p (and -0 , 542 ATL2 ENSMUSG00000059811 2 , 395 other miRNAs
/seecl GUAAACA)
mmu-miR- 30c- 5p miR-30c-5p {and -0.542 ATP2A2 EMSMUSGO 0000029 67 3.343 o her miRNAs
w/seed GUAAACA)
mmu-miR--30c- 5p miR-30c-5p (and -0.542 B3GALNT2 ENS USG00000039242 2.553 other miRNAs
w/seed GUAAACA)
mmu-raiR-30c~5p miR-30c-5p (and -0. 42 BMP7 ENSMUSG0000000 S 999 4.864 other miRNAs
w/seed GUAAACA)
mmu--miP.-30c--5p miR-30c-5p {and -0 , 542 CAL'J ENSMUSG00000029767 3.067 other miRNAs
w./ seed GUAAACA)
mmu--miR-30c--5p miR-30c-5p (and. -0,542 CCDC11 ENSMUSG00000020482 2,347 other miRNAs
/seed GUAAACA)
mmu-miR- 30c- 5p miR-30c-5p (and -0.542 CHD9 EMSMUSGO 0000056608 2.565 o her miRNAs
w/ seed GUAAACA)
mmu-ra±R-30c- 5p miR-30c-5p (and -0.542 DDAK1 EMSMUSGO 0000028194 2.848 other miRNAs
w/seed GUAAACA)
mmu-miR-30c-5p miR-30c-5p (and -0. 42 DDX46 EMSMUSGO 0000021500 2.048 other miRNAs
w/seed GUAAACA)
mmu--miP.-30c--5p miR-30c-5p (and -0 , 542 DIP2C ENSMUSG00000048264 2.975 other miRNAs
w/ seed GUAAACA)
mmu-miR-30c-5p miR-30c-5p (and -0.542 DLD ENSMUSGO 0000020664 2.428 other miRNAs
/seed GUAAACA)
mmu-miR- 30c- 5p miR-30c-5p (and -0.542 DTNA EMSMUSGO 0000024302 5.102 o her miRNAs
w/seed GUAAACA)
mmu-miR-30c- 5p miR-30c-5p (and -0.542 EFR3A EMSMUSGO 0000015002 2.341 other miRNAs
w/seed GUAAACA)
mmu-miR-30c-5p miR-30c-5p (and -0.542 EIF5 EMSMUSGO 0000021282 2.056 other miRNAs
w/seed GUAAACA)
mmu-miP.-30c-5p miR-30c-5p (and -0 , 542 EPN2 EMSMUSGO 0000001036 2.745 other miRNAs
w/ seed GUAAACA)
mmu-miR-30c-5p miR-30c-5p (and -0.542 ERRFI 1 ENSMUSG00000028967 6.000 other miRNAs
w/seed GUAAACA)
mmu-miR- 30c- 5p miR-30c-5p (and -0.542 FAM210B EMSMUSGO 0000027 95 3.182 other miRNAs
w/ seed GUAAACA)
mmu-miR-30c- 5p miR-30c-5p (and -0.542 GALNT1 EMSMUSG00000000420 3.568 other miRNAs
w/seed GUAAACA)
mmu-miR-30c-Sp miR-30c-5p (and -0 , 542 GALNT7 ENSMUSGO 0000031608 3.832 other miRNAs
w/seed GUAAACA)
mmu-miP.-30c-5p miR-30c-5p (and -0 , 542 GAREM ENSMUSG00000042680 2.160 other miRNAs
/seed GUAAACA)
miRNA m±KNA family raiBNA Gene Ensemble Gene ID mENA Exp name with seed Exp Log Symbol Fold sequence Ratio Change rpitiu--miR-30c--5p miR-30c-5p {and -0 , 542 GCNT2 ENSMUSGO 0000021360 2.186 other miRNAs
w/ seed GUAAACA)
mmu--miR-30c--5p miR-30c-5p (and -0 , 542 GIGYF2 ENSMUSG00000048000 2,586 other miRNAs
/seecl GUAAACA)
mmu-miR- 30c- 5p miR-30c-5p {and -0.542 GJA1 ENSMUSGO 0000050953 2.530 o her miRNAs
w/seed GUAAACA)
mmu-miR--30c- 5p miR-30c-5p (and -0.5 2 GNA13 ENSMUSG00000020611 2.657 other miRNAs
w/seed GUAAACA)
mmu-miR- 30c- 5p miR-30c-5p {and -0.542 GPD2 ENSMUSGO0000026827 2.365 other miRNAs
w/ seed GUAAACA)
mmu-miR--30c-- 5p rriiR- 30c-5p (and -0.542 HTRA3 ENSMUSGO 0000029096 3.023 other miRNAs
w/seed GUAAACA)
mmu-miR-30c-Sp miR-30c-5p (and -0 , 542 IFRD1 ENSMUSGO 0000001627 2,145 other miRNAs
w/seed GUAAACA)
mmu--miR-30c--5p miR-30c-5p (and -0 , 542 KCTD3 ENSMUSG00000026608 2, 86 other miRNAs
w/seed GUAAACA)
mmu-raiR-30c-5p miR-30c-5p (and -0.542 KPNA3 ENSMUSG00000021929 2.132 o her miRNAs
w/seed GUAAACA)
mmu-miR- 30c- 5p miR-30c-5p (and -0.542 LIN7C ENSMUSGO 0000027162 2.691 o her miRNAs
w/ seed GUAAACA)
mmu-miR-30c-5p miP.-30c-5p (and -0. 42 M1AP ENSMUSG00000030041 2.817 other miRNAs
w/seed GUAAACA)
mmu-miR-30c-Sp miR-30c-5p (and -0 , 542 MAP3K2 ENSMUSGO 000002 383 2 , 315 other miRNAs
w/seed GUAAACA)
mmu- iR-30c-5p miR-30c-5p (and -0 , 542 MBNL2 ENSMUSGO 0000022139 3 , 213 other miRNAs
/seed GUAAACA)
mmu-miR-30c-5p miR-30c-5p (and -0.542 MEX3B ENSMUSGO00000 7706 4.383 other miRNAs
w/seed GUAAACA)
mmu-miR- 30c- 5p miR-30c-5p (and -0.542 MFAP3L ENSMUSG00000031647 2.764 other miRNAs
w/ seed GUAAACA)
mmu-miR-30c-5p miP.-30c-5p (and -0. 42 MID2 ENSMUSG00000000266 2.346 other miRNAs
w/seed GUAAACA)
mmu-miP.-30c-5p miR-30c-5p (and -0 , 542 MYO10 ENSMUSGO 0000022272 4.045 other miRNAs
w/ seed GUAAACA)
mmu- iR-30c-5p miR-30c-5p (and -0 , 542 NCS 1 ENSMUSG00000062661 2,286 other miRNAs
w/seed GUAAACA)
mmu-miR- 30c- 5p miR-30c-5p (and -0.542 NHS ENSMUSGO0000059 93 3.326 o her miRNAs
w/seed GUAAACA)
mmu-miR- 30c- 5p miR-30c-5p (and -0.542 NOV ENSMUSGO 0000037362 3.767 other miRNAs
w/seed GUAAACA)
mmu-miR-30c-5p miR-30c-5p (and -0. 42 NPR3 ENSMUSGO 0000022206 7.306 other miRNAs
w/seed GUAAACA)
miRNA miKNA family raiBNA Gene Ensemble Gene ID mENA Exp name with seed Exp Log Symbol Fold sequence Ratio Change rpitiu--miR-30c--5p miR-30c-5p {and -0 , 542 NT5E ENSMUSG00000032420 1 .162 other miRNAs
w/ seed GUAAACA)
mmu--miR-30c--5p miR-30c-5p (and -0 , 542 P4HA1 ENSMUSG00000019916 3 ,792 other miRNAs
/seecl GUAAACA)
mmu-miR- 30c- 5p miR-30c-5p {and -0.542 PBRM1 ENSMUSG00000042323 2.425 o her miRNAs
w/seed GUAAACA)
mmu-miR--30c- 5p miR-30c-5p (and -0.5 2 PFN2 ENSMUSG00000027805 2.558 other miRNAs
w/seed GUAAACA)
mmu-raiR-30c~5p miP.-30c-5p (and -0. 42 PGM3 ENSMU3G00000056131 3.036 other miRNAs
w/seed GUAAACA)
mmu--miP.-30c--5p miR-30c-5p {and -0 , 542 PTP4A1 ENSMUSG00000026064 2.910 other miRNAs
w./ seed GUAAACA)
mmu--miR-30c--5p miR-30c-5p (and. -0,542 RARE ENSMUSG00000017491 4, 056 other miRNAs
/seed GUAAACA)
mmu-miR- 30c- 5p miR-30c-5p (and -0.542 RGPD4 ENSMUSGO0000003226 2.528 o her miRNAs ( include
w/ seed GUAAACA) s
others )
mmu-raiR-30c~5p miP.-30c-5p (and -0. 42 RUNX1 ENSMUSG00000022952 2.410 other miRNAs
w/seed GUAAACA)
mmu-miR-30c-5p miR-30c-5p (and -0 , 542 SEC61A2 ENSMUSG00000025816 2.277 other miRNAs
w/ seed GUAAACA)
mmu- iR-30c-5p miR-30c-5p (and -0 , 542 SEPT7 ENSMUSG00000001833 2 , 376 other miRNAs
w/seed GUAAACA)
mmu-miR- 30c- 5p miR-30c-5p (and -0.542 SERINC3 ENSMUSG00000017707 3.171 o her miRNAs
w/seed GUAAACA)
mmu-miR- 30c- 5p miR-30c-5p (and -0.542 SGMS2 ENSMUSGO 0000050931 3.816 other miRNAs
w/ seed GUAAACA)
mmu-miR-30c-5p miP.-30c-5p (and -0. 42 8LC30A4 ENSMUSG00000005802 2.768 other miRNAs
w/seed GUAAACA)
mmu-miR-30c-Sp miR-30c-5p (and -0 , 542 SLC38A2 ENSMUSG00000022462 3.065 other miRNAs
w/seed GUAAACA)
mmu- iR-30c-5p miR-30c-5p (and -0 , 542 SLC4A7 ENSMUSG00000021733 2 , 774 other miRNAs
/seed GUAAACA)
mmu-miR- 30c- 5p miR-30c-5p (and -0.542 SLC5A3 ENSMUSG00000089774 4.078 o her miRNAs
w/seed GUAAACA)
mmu-miR-30c- 5p miR-30c-5p (and -0.542 SMAD1 ENSMUSG00000031681 2.821 other miRNAs
w/seed GUAAACA)
mmu-miR-30c-5p miP.-30c-5p (and -0.542 8DCS3 ENSMUSG00000053113 2.299 other miRNAs
w/seed GUAAACA)
mmu-miR-30c-5p miP.-30c-5p (and -0.542 SP4 ENSMUSG00000025323 2.296 other miRNAs
w/seed GUAAACA)
mmu-miR-30c-5p miR-30c-5p (and -0 , 542 SSR3 ENSMUSGO 0000027828 3.406 other miRNAs
miRNA miKNA family raiBNA Gene Ensemble Gene ID mENA Exp name with seed Exp Log Symbol Fold sequence Ratio Change w/seed GUAAACA)
mmu-itiiR- 30c- 5p miR-30c-5p {and -0.542 STK38L ENSMUSG00000001630 4.290 other miRNAs
w/ seed GUAAACA)
mmu--miR--30c-- 5p miR-30c-5p (and -0.5 2 SUCLG2 ENSMUSGO 0000061836 3.114 other miRNAs
w/seed GUAAACA)
mmu-miR-30c-Sp miR-30c-5p (and -0 , 542 SYPL1 ENSMUSGO 0000020570 2.880 other miRNAs
w/seed GUAAACA)
rpitiu--miR-30c--5p miR-30c-5p {and -0 , 542 TIMP3 ENSMUSGO 00000200 4 3.853 other miRNAs
w/seed GUAAACA)
mmu-iaiR-30c-5p miR-30c-Sp (and -0.542 TM SF1 ENSMUSG00000027800 4.155 other miRNAs
w/seecl GUAAACA)
mmu-raiR- 30c- 5p miR-30c-5p {and -0.542 TMEM59 ENSMUSG00000028618 2.514 other miRNAs
w/ seed GUAAACA)
mmu-miR-30c- 5p miR-30c-5p (and -0.542 TULP4 ENSMUSG00000034377 2.207 other miRNAs
w/seed GUAAACA)
mmu-miR-30c-Sp miR-30c-5p (and -0 , 542 TUSC3 ENSMUSGO 0000039530 4. 11 other miRNAs
w/seed GUAAACA)
mmu-miR-30c-5p miR-30c-5p (and -0 , 542 UAP1 ENSMUSGO 0000026670 2.639 other miRNAs
w/seed GUAAACA)
mmu-miR-30c-5p miR-30c-Sp (and -0.542 UBE2D3 ENSMUSG00000078578 2.581 other miRNAs
w/seed GUAAACA)
mmu-miR- 30c- 5p miR-30c-5p (and -0.542 UBE2G1 ENSMUSGO 0000020794 2.075 other miRNAs
w/ seed GUAAACA)
ratnu-miR-30c- 5p miR-30c-5p (and -0.542 UBE2K ENSMUSG00000029203 2.362 other miRNAs
w/seed GUAAACA)
mmu-miR-30c-Sp miR-30c-5p (and -0 , 542 WNT7B ENSMUSGO 0000022382 2.166 other miRNAs
w/seed GUAAACA)
mmu-miR-30c-Sp miP.-30c-Sp (and -0.542 Y0D1 ENSMUSG00000046404 2.776 other miRNAs
w/seed GUAAACA)
mmu- iR-30c-5p miR-30c-5p (and -0 , 542 ZBTB18 ENSMUSG00000063659 2.014 other miRNAs
w/ seed GUAAACA)
mmu-miR-30c-5p miR-30c-Sp (and -0.542 ZCCHC14 ENSMUSG00000061410 2.791 other miRNAs
/seed GUAAACA)
mmu-miR- 31 -Sp miR-3i-5p (and 0.887 C0R07/C0 ENSMUSG00000039637 -2.607 other miRNAs R07 - w/ seed GGCAAGA) PAM16
mmu-miR-31 -Sp miR-31-5p (and 0,887 IRF1 BNSMUSGO 0000018899 -2.949 other miRNAs
w/seed GGCAAGA)
mmu-miR-31-5p miP.-31-5p (and 0.887 RAB6B ENSMU3G00000032549 -2.856 other miRNAs
w/seed GGCAAGA)
mmu-miR-31- Sp miP.-31-5p (and 0.887 SYDE1 ENSMUSG00000032714 -2.013 other miRNAs
w/seed GGCAAGA)
mmu-miR-31-5p miR-3i-Sp (and 0.887 TEP1 ENSMUSGO0000006281 -2.344 other miRNAs
miRNA miKNA family raiRNA Gene Ensemble Gene ID mRNA Exp name with seed Exp Log Symbol Fold sequence Ratio Change w/seed GGCAAGA)
mmu-miR- 31-5p miR-31-5p (and 0,887 TSHZ2 ENSMUSGO 0000047907 -2.415 other miRNAs
w/ seed GGCAAGA)
mmu-raiR-31-5p miR-31-5p (and 0,887 ZNF362 BNSMUSGO0000028799 -2.430 other miRNAs
w/seed GGCAAGA)
mmu-miR-329-3p miR-329-3p (and -0 , 49 ABL2 ENSMUSGO 0000026596 2.158 other miRNAs
w/seed ACACACC)
mmu-miR-329--3p miR-329-3p (and -0 , 449 ARL4A ENSMUSG00000047446 2.789 other miRNAs
w/seed ACACACC)
mmu-mi -329-3p miR-329-3p (and -0.449 ATP1B3 ENSMUSGO0000032412 3.029 other miRNAs
w/seecl ACACACC)
mmu-miR-329-3p miR-329-3p (and -0. 49 BMP7 ENSMUSGO 0000008999 4.864 other miRNAs
w/seed ACACACC)
mmu-miR-329-- 3p miR-329-3p (and -0.449 CLTB ENSMUSG00000047547 2.858 other miRNAs
w/seed ACACACC)
mmu-miR-329-3p miR-329-3p (and -0.449 DTNA ENSMUSGO 0000024302 5.102 other miRNAs
w/seed ACACACC)
mmu-miR-329--3p miR-329-3p (and -0.449 KIAA0040 ENSMUSGO 0000090394 2.507 other miRNAs
w/seed ACACACC)
mmu-miR-329-3p miR-329-3p (and -0.449 MTUS2 ENSMUSGO 0000029651 2.507 other miRNAs
w/seed ACACACC)
mmu-miR- 329- 3p miR-329-3p (and -0.449 NHS ENSMUSGO0000059493 3.326 other miRNAs
w/seed ACACACC)
mmu-miR-329- 3p miR-329-3p (and -0.449 N0 1 ENSMUSGO0000001569 2.025 other miRNAs
w/seed ACACACC)
mmu-miR-329-3p miR-329-3p (and -0.449 PLEKKA3 ENSMUSGO 0000002733 4.374 other miRNAs
w/seed ACACACC)
mmu-m R-329-3p miR-329-3p (and -0.449 RAB1A ENSMUSG00000020149 2.844 other miRNAs
w/seed ACACACC)
mmu-miR-329-3p miR-329-3p (and -0.449 SLC23A2 ENSMUSG00000027340 3.665 other miRNAs
/seed ACACACC)
mmu-miR- 329- 3p miR-329-3p (and -0.449 SLC44A1 ENSMUSGO 0000028412 2.762 other miRNAs
w/seed ACACACC)
mmu-miR-329-3p miP.-329-3p (and -0.449 SLC5A3 ENSMUSGO0000089774 4.078 other miRNAs
w/seed ACACACC)
mmu-miR-329-3p miR-329-3p (and -0.449 SLC7A2 ENSMUSGO 0000031596 4.389 other miRNAs
w/ seed ACACACC )
mmu- iR-329-3p miR-329-3p (and -0.449 SMNDC1 ENSMUSGO0000025024 2.774 other miRNAs
w/seed ACACACC)
mmu-miR- 329- 3p miR-329-3p (and -0. 49 SP4 ENSMUSGO0000025323 2.296 other miRNAs
w/seed ACACACC)
mmu-miR- 329- 3p miR-329-3p (and -0.449 SSR1 ENSMUSG00000021427 2.709 other miRNAs
miRNA miKNA family raiRNA Gene Ensemble Gene ID mRNA Exp name with seed Exp Log Symbol Fold sequence Ratio Change w/seed ACACACC)
mmu-itd.R-329-3p miR-329-3p {and -0.449 TGFBI ENSMUSG00000035493 4.727 other miRNAs
w/seed ACACACC)
mmu-ra±R-329-- 3p miR-329-3p (and -0.449 VPS4B ENSMUSGO 0000009907 2.110 other miRNAs
w/seed ACACACC)
mmu-miR-329-3p miR-329-3p (and -0 , 449 ZBTB18 ENSMUSGO 0000063659 2.014 other miRNAs
w/seed ACACACC)
mmu-miR-329--3p miR-329-3p {and -0 , 49 ZZZ3 ENSMUSG00000039068 3.706 other miRNAs
w/seed ACACACC)
mmu-miR-331-3p miR-331-3p -0.345 A.BL2 ENSMUSGO 0000026 96 2.158 fmiRNAs w/ seed
CCCCUGG)
mmu-raiR- 331- 3p miR-331-3p -0.345 ABTB2 ENSMUSG00000032724 2.723
(miRNAs w/seed
CCCCUGG)
mmu-ra±R-331- 3p miR-331-3p -0.345 AL0X12 ENSMUSGO 0000000320 2.621
(miRNAs w/ s eed
CCCCUGG)
mmu-miR-331-3p miR-33i-3p -0 , 345 AM0TL2 ENSMUSGO 0000032531 3.583
(miRNAs w/seed
CCCCUGG)
mmu-miP.-331-3p miR-331-3p -0 , 345 C14orf79 ENSMUSGO 0000037594 2.390
(miRNAs w/seed
CCCCUGG)
ME-miR-331-3p miR-331-3p -0.345 CISD2 ENSMUSG00000028165 3.029
(miRNAs w/seed
CCCCUGG)
mmu-miR- 331- 3p miR-331-3p -0.345 COL6A2 ENSMUSGO 0000020241 2.940
(miRNAs w/seed
CCCCUGG)
mmu-miR-331- 3p miR-331-3p -0.345 FAM210B ENSMUSGO 0000027495 3.162
(miRNAs w/seed
CCCCUGG)
mmu-miR-331-3p miP.-33i-3p -0 , 345 FXYD3 ENSMUSGO 0000057092 2.626
(miRNAs w/seed
CCCCUGG)
mmu- iR-331 -3p miR-331-3p -0 , 345 GJB4 ENSMUSG00000046623 3.956
(miRNAs w/seed
CCCCUGG)
mmu-miR-331-3p miR-331-3p -0.345 GTF3C4 ENSMUSG00000035666 2.289
(miRNAs w/seed
CCCCUGG)
mmu-miR- 331- 3p miR-33l-3p -0.345 KANK1 ENSMUSG00000032702 3.326
(miRNAs w/seed.
CCCCUGG)
mmu- iR-331-3p miP.-331-3p -0.345 NCS 1 ENSMUSG00000062661 2.286
(miRNAs w/seed
CCCCUGG)
mmu-miR-331-3p miR-33i-3p -0 , 345 NEATCI ENSMUSGO 0000033016 2.608
(miRNAs w/seed
CCCCUGG)
mmu- iR-331 -3p miR-331-3p -0 , 345 0PA3 ENSMUSG00000052214 2.066
(miRNAs w/seed
CCCCUGG)
mmu-miR- 331- 3p miR-331-3p -0.345 PHLPP1 ENSMUSG00000044340 2.247
(miRNAs w/seed
CCCCUGG)
mmu-miR- 331- 3p miR-33 l-3p ""0.345 PITKD1 ENSMUSGO 0000028669 2.493
(miRNAs w/seed.
miRNA miKNA family raiRNA Gene Ensemble Gene ID mRNA Exp name with seed Exp Log Symbol Fold sequence Ratio Change
CCCCUGG)
mmu-itiiR- 331- 3p miR-331-3p -0.345 PITPNA ENSMUSGO0000017781 2.698
(miRNAs vi/seed
CCCCUGG)
mmu-ra±R-331- 3p rniR-331-3p -0.345 PTGES ENSMUSG00000050737 3.313
(miRNAs ¾'./ s eed
CCCCUGG)
mmu-miR-331-3p miP.-33i-3p -0 , 345 RAB11FIP ENSMUSG00000017639 2,585
(miRNAs w/seed 4
CCCCUGG)
rpitiu--miR-331--3p miR-331-3p -0 , 345 RUNX1 ENSMUSGO 00000229 2 2.410
(mi NAs w/seed
CCCCUGG)
mmu-miR-331-3p miR-331-3p -0.345 SERINC2 ENSMUSGO 0000023232 2.981
(miRNAs w/ seed
CCCCUGG)
mmu-miR- 331- 3p miR-331-3p -0.345 SLC1A4 ENSMUSGO 0000020142 2.449
(miRNAs w/seed
CCCCUGG)
mmu-miR-331- 3p rniR-331-3p -0.345 SLC23A2 ENS USG00000027340 3.665
(miRNAs w./ s eed
CCCCUGG)
mmu-miR-331-3p miP.-33i-3p -0 , 345 S0CS3 ENSMUSGO 0000053113 2.299
(miRNAs w/seed
CCCCUGG)
rnmu-miP.-331-3p miR-331-3p -0 , 345 SSR3 ENSMUSGO 0000027828 3.406
(miRNAs w/seed
CCCCUGG)
ME-miR-331-3p miR-331-3p -0.345 ADA2A ENSMUSGO0000018651 2.216
(miRNAs w/seed
CCCCUGG)
mmu-miR- 331- 3p miR-331-3p -0.345 TMCC3 ENSMUSGO 0000020023 7.961
(miRNAs w/seed
CCCCUGG)
mmu-miR-331- 3p rniR-331-3p -0.345 TNFRSF12 E SMUSG00000023905 5.946
(miRNAs w/seed A
CCCCUGG)
mmu-miR-331-3p miP.-33i-3p -0 , 345 Y0D1 ENSMUSGO 0000046404 2.776
(miRNAs w/seed
CCCCUGG)
rnmu- iR-346-5p miR-346 (and 0.399 CA7 ENSMUSGO0000031883 -2.110 other miRNAs
w/seed GUCUGCC)
mmu-miR-346-5p miR-346 (and 0.399 CERCAM ENSMUSGO0000039787 -2.485 other miRNAs
w/seed GUCUGCC)
mmu-miR- 3 6- 5p miR-346 (and 0.399 GSTM5 ENSMUSG00000058135 -2.732 other miRNAs
w/seed GUCUGCC)
mrnu-miR-346-5p miR-346 (and 0.399 IQCE ENSMUSGO 0000036555 -2.512 other miRNAs
w/seed GUCUGCC)
mmu-miR-346-5p miR-346 (and 0.399 KLF15 ENSMUSGO 0000030087 -3.260 other miRNAs
w/ seed GUCUGCC )
mmu- iR-346-5p miR-346 (and 0.399 KLHL1S ENSMUSG0000005 792 -2.175 other miRNAs
w/seed GUCUGCC)
mmu-miR- 346- 5p miR-346 (and 0, 399 LIMCH1 ENSMUSG00000037736 -2.628 o her miRNAs
w/seed GUCUGCC)
mmu-miR-3 6- 5p miR-346 (and 0.399 NIN ENSMUSGO 0000021066 -3.385 other miRNAs
miRNA miKNA family raiRNA Gene Ensemble Gene ID mENA Exp name with seed Exp Log Symbol Fold sequence Ratio Change w/seed GUCUGCC)
mmu-itiiR- 346- 5p miR-346 (and 0, 399 PIK3IP1 ENSMUSGO 0000034614 -3.184 other miRNAs
w/seed GUCUGCC)
mmu-raiR-346- 5p miR-346 (and 0, 399 PASSF2 ENSMUSG00000027339 -2.930 other miRNAs
w/seed GUCUGCC)
mmu-raiR-346-Sp miR-346 (and 0.399 RC0R2 ENSMUSGO 000002 968 -2.275 other miRNAs
w/seed GUCUGCC)
mmu-miP-346--5p miR-346 (and 0.399 ZNF362 ENSMUSGO 0000028799 -2.430 other miRNAs
w/seed GUCUGCC)
rnmu-miR-361-5p miR-361-5p -0.473 ACTCI ENSMUSGO 0000068614 2.373 fmiRNAs w/ seed
UAUCAGA)
mmu-miR- 361- 5p miR-361-5p -0.473 BE D6 ENSMUSGO 0000042182 2.641
(miRNAs w/seed
UAUCAGA)
mmu-raiR-361- 5p miR-361-5p -0.473 DPF3 ENS USG00000021221 2.811
(miRNAs w/ s eed
UAUCAGA)
mmu-raiR-361-5p miP.-36i-5p -0. 73 EIF1AX ENSMUSGO 0000057561 2.255
(miRNAs w/seed
UAUCAGA)
rpitiu--miP.-361--5p miR-361-5p -0. 73 GIGYF2 ENSMUSG00000048000 2.586
(miRNAs w/seed
UAUCAGA)
rnmu-miR-361-5p miR-361-5p -0.473 GNA13 ENSMUSG00000020611 2.657
(miRNAs w/seed
UAUCAGA)
mmu-miR- 361- 5p miR-361-5p -0.473 TL13RA1 ENSMUSGO 0000017057 4.260
(miRNAs w/seed
UAUCAGA)
mmu-ralR-361- 5p miR-361-5p -0.473 MTX2 ENSMUSGO 0000027099 2.259
(miRNAs w/seed
UAUCAGA)
mmu-raiR-361-Sp miR-361- 5ρ -0. 73 NHS ENSMUSGO0000059493 3.326
(miRNAs w/seed
UAUCAGA)
rnmu-miR-361 -5p miR-361-5p -0. 73 NUP153 ENSMUSG00000021374 2.553
(miRNAs w/ seed
UAUCAGA)
rnmu-miR-361-5p miR-361-5p -0.473 PGM3 ENSMUSGO 00000 6131 3.036
(miRNAs w/seed
UAUCAGA)
mmu-miR- 361- 5p miR- 361-5p -0.473 P.NFll ENSMUSGO 0000028557 2.278
(miRNAs w/seed.
UAUCAGA)
mrnu-miR-361-5p miR-361-5p -0.473 SDCBP ENSMUSGO 0000028249 2.245
(miRNAs w/seed
UAUCAGA)
mmu-raiR-361-Sp miR-361- 5p -0. 73 SEC61A2 ENSMUSGO 0000025816 2.277
(miRNAs w/seed
UAUCAGA)
rnmu-miR-361 -5p miR-361-5p -0. 73 SLC1A3 ENSMUSGO 0000005360 2.066
(miRNAs w/seed
UAUCAGA)
mmu-miR- 361- 5p miR-361-5p -0.473 SLC41A1 ENSMUSGO 0000013275 2.304
(miRNAs w/seed
UAUCAGA)
mmu-miR- 361- 5p miR- 361-5ρ -0.473 3NX3 ENSMUSGO 0000019804 2.445
(miRNAs w/seed.
miRNA miRNA family raiRNA Gene Ensemble Gene ID mRNA Exp name with seed Exp Log Symbol Fold sequence Ratio Change
UAUCAGA)
mmu-itiiR- 361- 5p miR-361-5p -0. 73 UBE2K ENSMUSG00000029203 2.362
(miRNAs vi/seed
UAUCAGA)
ratnu-miR~361- 5p miR-361-5p -0.473 VBP1 ENSMUSG00000031197 2.301
(miRNAs ¾'./ s eeci
UAUCAGA)
mmu-miR- 361- Sp miP.-36i-5p -0. 73 ZBTB18 ENSMUSG00000063659 2.014
(miRNAs w/seed
UAUCAGA)
ramu-i!iiR-374c-5p miR-37 c-5p -0.560 ABCC9 ENSMUSG00000030249 2.333
(and other
miRNAs w/seed
UAAUACA)
mmu-miR- 374 c- 5p miR-374c-5p -0.560 APOO ENSMUSG00000079508 2.072
(and other
miRNAs w/seed
UAAUACA)
rami-raiR-374 c- 5p miP.-374c-5p -0. 60 ATI,2 ENSMUSG00000059811 2.395
(and other
miRNAs w/seed
UAAUACA)
mmu-miR- 374 c- 5p miR-37 c-5p -0.560 BTG1 ENSMUSG00000036478 5.832
(and other
miRNAs w/seed
UAAUACA)
mmu-miR- 374 c-- p miR-374c-5p -0.560 CALU ENSMUSG00000029767 3.067
( a nd ot e r
miRNAs w/seed
UAAUACA)
mmu-raiR-374 c- 5p miR-374c-5p -0.560 CDK2 = ~i ENSMUSG00000078154 2.233
(and other
miRNAs w/seed
UAAUACA)
mmu-miR- 374 c- 5p miR-37 c-5p -0.560 CGGBP1 ENSMUSG00000054604 2.204
(and other
miRNAs w/seed
UAAUACA)
mmu-miR- 374 c-- p miR-374c-5p -0.560 CHS Ϊ3 ENSMUSG00000058152 6.220
( a nd othe r
miRNAs w/seed
UAAUACA)
mmu-miR-374c-5p miP.-374c-5p -0.560 EFR3A ENSMUSG00000015002 2.341
(and other
miRNAs w/seed
UAAUACA)
mmu-miR- 374 c- 5p miR-37 c-5p -0.560 F3 ENSMUSGO 0000028128 5.234
(and other
miRNAs w/seed
UAAUACA)
mmu-miR- 374 c- bp miR-374c-5p -0.560 GPD2 ENSMUSG00000026827 2.365
(and other
miRNAs w/seed
UAAUACA)
mmu-miR-374c-5p miP.-374c-5p -0.560 ITGB1 ENSMUSG00000025809 2.509
(and other
miRNAs w/seed
UAAUACA)
mmu-mi -374c-5p miR-374c-5p -0.560 KLF3 ENSMUSG 00000029178 2.514
(and other
miRNAs w/seed
UAAUACA)
mmu-miR- 374 c- bp miR-374c-5p -0.560 NET01 ENSMUSG00000050321 2.208
(and other
miRNA miKNA family raiBNA Gene Ensemble Gene ID mBNA Exp name with seed Exp Log Symbol Fold sequence Ratio Change miRNAs /seed
UAAUACA)
ramu-i!iiR-374c-5p miR-374c-5p -0.560 N0M1 EMSMUSGO 0000001569 2.025
(and other
miRKAs w/seeel
UAAUACA)
mmu-miR- 374c-5p miR-374c-5p -0.560 PDGFC ENSMUSG00000023019 2.715
(and other
miR As w/seed
UAAUACA)
rami-raiR-374c-5p miP.-374c-5p -0.560 PLPP3 ENSMU3G0000002 S 517 2.892
(and other
miRNAs w/seed
UAAUACA)
mmu-miR-374c-5p miR-37 c-5p -0.560 PRDX1 EMSMUSGO 0000028691 2.696
(and other
miRNAs w/seed
UAAUACA)
mmu-miR- 374c-- p miR-374c-5p -0.560 P.GPD4 ENSMUSGO0000003226 2.528
(and ot er ( incl ude
miRNAs w/seed s
UAAUACA) others )
mmu-raiR-374c-5p miP.-374c-5p -0.560 TSPA 6 EMSMUSGO 000006 377 4.0 3
(and other
miRNAs w/seed
UAAUACA)
mmu-miR-374c-5p miR-37 c-5p -0.560 Y0D1 ENSMUSG00000046404 2.776
(and other
miRNAs w/seed
UAAUACA)
mmu-miR- 376c-3p miR-376c-3p "~0.5 j2 ABCC9 ENSMUSG00000030249 2.333
(and other
miRNAs w/seed
ACAUAGA)
mmu-miR-376c-3p miP.-376c-3p -0.532 ACTCI EMSMUSGO 0000068614
(and other
miRNAs w/seed
ACAUAGA)
mmu-miR-376c-3p miR-376c-3p -0.532 ATP1B3 ENSMUSG00000032412 3.029
(and other
miRNAs w/seed
ACAUAGA)
mmu-miR- 376c-3p miR-376c-3p "~0.5 j2 DCN ENSMUSGO 0000019929 3.130
(and other
miRNAs w/seed
ACAUAGA)
mmu-miR-376c-3p miP.-376c-3p -0.532 DLL1 EMSMUSGO 000001 773 5.359
(and other
miRNAs w/seed
ACAUAGA)
mmu-miR-376c-3p miR-376c-3p -0.532 F.NPEP ENSMUSG00000028024 4.231
(and other
miRNAs w/seed
ACAUAGA)
mrnu-miR-376c-3p MR- 376c-3p -0.532 HAPLN1 ENSMUSG00000021613 4.727
(and other
miRNAs w/seed
ACAUAGA)
mmu-miR-376c-3p miR-376c-3p -0.532 HBEGF EMSMUSGO0000024486 4.754
(and other
miRKAs w/seed
ACAUAGA)
mmu-miR-376c-3p miR-376c-3p -0.532 KANK1 ENSMUSG00000032702 3.326
(and other
miRNA miKNA family raiBNA Gene Ensemble Gene ID mBNA Exp name with seed Exp Log Symbol Fold sequence Ratio Change miRNAs /seed
ACAUAGA)
ramu-raiR-376c-3p miR-376c-3p -0 , 532 LDLRAD4 ENSMUSG00000024544 2.706
(and other
miRKAs /seeel
ACAUAGA)
mmu-itiiR- 376c-3p miR-376c-3p -0.532 MFAP3L ENSMUSG00000031647 2.764
(and other
miR As w/seed
ACAUAGA)
mtnu-RiiR-376c-3p miR-376c-3p MLLT11 ENSMUSG00000053192 2.755
(and other
miRNAs w/seed
ACAUAGA)
mmu--miR-376c-3p miR-376c-3p OPA3 ENSMUSG00000052214 2.066
(and other
miRNAs w/seed
ACAUAGA)
mmu-iniR- 376c--3p miR-376c- 3p PDGFC ENSMUSG00000028019 2.715
(and ot er
miRNAs w/seed
ACAUAGA)
mtnu-RiiR-376c-3p miR-376c-3p PHLDA2 ENSMU3G00000010760 28.562
(and other
miRNAs w/seed
ACAUAGA)
mmu--miR-376c-3p miR-376c-3p -0 , 532 PLPP3 ENSMUSG00000028517 2.892
(and other
miRNAs w/seed
ACAUAGA)
mmu-miR- 376c--3p miR-376c- 3p "~0.5 j2 RARB ENSMUSG00000017491 4.056
(and other
miRNAs w/seed
ACAUAGA)
mmu-miR-376c-3p miR-376c-3p -0 , 532 SLC38A2 ENSMU3G00000022462 3.065
(and other
miRNAs w/seed
ACAUAGA)
mmu-miR-376c-3p miR-376c-3p -0.532 SLC7A2 ENSMUSG00000031 96 4.389
(and other
miRNAs w/seed
ACAUAGA)
mmu-miR- 376c~3p miR-376c- 3p "~0.5 j2 TMEM33 ENSMUSG00000037720
(and other
miRNAs w/seed
ACAUAGA)
mmu-miR-376c-3p miR-376c-3p -0 , 532 TNS3 ENSMUSG00000020422 2.570
(and other
miRNAs w/seed
ACAUAGA)
mmu-miR-377-3p miR-377-3p -0.458 ANGEL2 ENSMUSG00000026634 2.092
(miRNAs w/ seed
UCACACA)
mmu-miR- 377- 3p miR-377-3p -0.458 ANKK ENSMUSG00000022265 5.472
(miRNAs w/seed
UCACACA)
mmu-miR-377- 3p miR-377-3p -0.458 ATL2 ENSMUSG00000059811 2.395
(miRNAs w/ s eed
UCACACA)
mmu-miR-377-3p miR-377-3p -0.458 E3GALNT2 ENSMUSG00000039242
(miRNAs w/seed
UCACACA)
miRNA miKNA family raiBNA Gene Ensemble Gene ID mENA Exp name with seed Exp Log Symbol Fold sequence Ratio Change rpitiu--miR-377 --3 p miR--377--3p -0 , 56 BMP7 ENSMUSGO 0000008999 4.864
(miRNAs w/seed
UCACACA)
mmu-miR-377-3p m.iR--377--3p -0.456 CCDC117 ENSMUSG00000020482 2.347
(miRNAs w/seed
UCACACA)
mmu-miR- 377- 3p miR-377-3p -0.458 CDV3 ENSMUSG00000032803 2.604
(miRNAs w/seed
UCACACA)
ratnu-miR~377- 3p miR--377-3p -0.456 DCN ENSMUSG00000019929 3.130
(miRNAs w./ s eed
UCACACA)
mtnu-RiiR-377-3p miR-377-3p -0.456 DPH3 ENSMUSGO 0000021905 2.462
(miRNAs w/seed
UCACACA)
mmu-miR-377-3p miR-377-3p -0.456 ETS1 ENSMUSG00000032035 2.457
(miRNAs w/seed
UCACACA)
mmu-miR---377--3 p mlR--377--3p -0.456 FUTS ENSMUSG00000021065 4.249
(miRNAs w/seed
UCACACA)
mmu-miR- 377- 3p miR-377-3p -0. 58 GSPT1 ENSMUSGO 0000062203 2.621
(miRNAs w/seed
UCACACA)
mmu-in±R-377- 3p miR--377-3p -0. 58 HEATR5A ENSMUSG00000035181 2.129
(miRNAs w/ s eed
UCACACA)
mtnu-RiiR-377-3p miR-377-3p -0.458 HS2ST1 ENSMUSG000000401 1 2.657
(miRNAs w/seed
UCACACA)
mmu-miR-377-3p miR-377-3p -0.456 KMT2E ENSMUSGO 0000029004 2.479
(miRNAs w/seed
UCACACA)
nanu-iaiR-377-3p miR-377-3p -0.458 LAMP2 ENSMUSGO0000016 34 2.003
(miRNAs w/seed
UCACACA)
mmu-miR- 377- 3p miR-377-3p -0.458 NET01 ENSMUSGO 0000050321 2.208
(miRNAs w/seed
UCACACA)
ratnu-miR~377- 3p miR--377-3p -0.456 NT5E ENSMUSG00000032420 14.162
(miRNAs w/ s eed
UCACACA)
mtnu-RiiR-377-3p miR-377-3p -0.458 NUP153 ENSMUSG00000021374 2.553
(miRNAs w/seed
UCACACA)
mmu-miR-377-3p miR-377-3p -0.456 NXT2 ENSMUSG00000042271 2.525
(miRNAs w/seed
UCACACA)
mmu-miR-377-3 p miR-377-3p -0.458 PAI P2 ENSMUSG00000037058 2.059
(miRNAs w/seed
UCACACA)
ramu-iaiR-377-3p miR-377-3p -0.458 PGM3 ENSMUSGO 0000056131 3.036
(miRNAs w/seed
UCACACA)
ratnu-miR~377- 3p rniR-377-3p -0.456 PNOl ENSMUSGO 0000020116 2 an
(miRNAs w/ s eed
UCACACA)
mmu-miR-377-3p miR-377-3p -0.456 PTGES ENSMUSGO 0000050737 3,313
(miRNAs -w/seed
UCACACA)
mmu-miR-377-3p miR-377-3p -0.456 RUNX1 ENSMUSGO 00000229 2 2.410
(miRNAs w/seed
UCACACA)
miRNA miKNA family raiBNA Gene Ensemble Gene ID mENA Exp name with seed Exp Log Symbol Fold sequence Ratio Change rpitiu--miR-377 --3p miR-377-3p --0 , 456 SARAF ENSMUSG00000031532 2.116
(miRNAs w/seed
UCACACA)
mmu-miR-377-3p m.iR--377--3p -0. 56 SDCBP E SMUSGO 0000028249 2.245
(miRNAs w/seed
UCACACA)
mmu-miR- 377- 3p miR-377-3p -0.458 SEMA3E EMSMUSGO 0000063531 5.370
(miRNAs w/seed
UCACACA)
ratnu-miR~377- 3p miR--377-3p -0.456 SGK1 ENSMUSG00000019970 7.006
(miRNAs w./ s eed
UCACACA)
mtnu-RiiR-377-3p miP-377-3p -0.456 SLC4A7 ENSMUSGO 0000021733 2.774
(miRNAs w/seed
UCACACA)
mmu-miR-377-3p miR-377-3p -0.456 SLC7A2 ENSMUSGO 0000031596 4.389
(miRNAs w/seed
UCACACA)
mmu-miR-377 -3p miR--377--3p -0.456 SMIM14 ENSMUSG00000037822 2.195
(miRNAs w/seed
UCACACA)
mmu-miR- 377- 3p miR-377-3p -0.458 SNX13 ENSMUSGO 0000020590 2.466
(miRNAs w/seed
UCACACA)
mmu-in±R-377- 3p miR--377-3p -0.458 SULF1 ENSMUSGO 0000016916 2.979
(miRNAs w/ s eed
UCACACA)
mtnu-RiiR-377-3p miP-377-3p -0.458 TAPT1 ENSMUSG00000046985 2.318
(miRNAs w/seed
UCACACA)
mmu-miR-377-3p miR-377-3p --0.456 TMCC3 ENSMUSGO 0000020023 7.961
(miRNAs w/seed
UCACACA)
nanu-iaiR-377-3p miR-377-3p -0.458 TMEM33 ENSMUSG00000037720 2.711
(miRNAs w/seed
UCACACA)
mmu-miR- 377- 3p miR-377-3p -0.458 TMX1 ENSMUSGO 0000021072 2.916
(miRNAs w/seed
UCACACA)
ratnu-miR~377- 3p miR--377-3p -0.456 TRAPPC6B ENSMUSGO 0000020993 2.544
(miRNAs w/ s eed
UCACACA)
mtnu-RiiR-377-3p miP-377-3p -0.458 UBA3 ENSMUSG00000030061 2.452
(miRNAs w/seed
UCACACA)
mmu-miR-377-3p miR-377-3p --0.456 UBE2K ENSMUSG00000029203 2.362
(miRNAs w/seed
UCACACA)
mmu-miR-377-3p miR-377-3p -0.458 UTP23 ENSMUSG00000022313 2.565
(miRNAs w/seed
UCACACA)
ramu-iaiR-377-3p miR-377-3p -0.458 WDR37 ENSMUSGO0000021147 4.164
(miRNAs w/seed
UCACACA)
ratnu-miR~377- 3p rniR-377-3p -0.456 ZFP36L1 ENSMUSGO 0000021127 3.521
(miRNAs w/ s eed
UCACACA)
mmu-miR-377-3p miR-377-3p -0.456 ZZZ3 ENSMUSGO 0000039068 3.706
(miRNAs -w/seed
UCACACA)
mmu-miR-379-5p miR-379-5p (and --0.501 ABCB4 ENSMUSG00000042476 3.506 other miRNAs
w/seed GGUAGAC )
miRNA m±KNA family raiBNA Gene Ensemble Gene ID mENA Exp name with seed Exp Log Symbol Fold sequence Ratio Change mmu-miR-379-5p miR-379-5p {and -0 , 501 ARL4A EMSMUSGO 0000047446 2.789 other miRNAs
w/ seed GGUAGAC !
mmu--I'xi.R-379--5p miR-379-5p (and -0 , 501 CACFD1 ENSMUSGO 0000015488 2.201 other miRNAs
w/seed GGUAGAC)
mmu-itd.R-379-5p miR-379-5p {and -0.501 CALU EMSMUSGO 0000029767 3.067 o her miRNAs
w/seed GGUAGAC)
ratnu-miR~379-5p miR-379-5p (and -0.501 CAPZA2 ENSMUSGO 0000015733 2.066 other miRNAs
w/seed GGUAGAC)
mtnu-RiiR-379-5p miR-379-5p (and -0. 01 F0 F2 ENSMUSG00000038402 4.308 other miRNAs
w/ seed GGUAGAC)
mmu-miR-379--5p miR-379-5p {and -0.501 GAREM ENSMUSG00000042680 2.160 other miRNAs
w/ seed GGUAGA )
mmu-miR-379-5p m.iR-379-5p (and. -0.501 GPD2 ENSMUSG00000026827 2.365 other miRNAs
w/seed GGUAGAC)
mmu-miR-379- 5p miR-379-5p (and -0.501 HBEGF ENSMUSGO 0000024486 4.754 o her miRNAs
w/seed GGUAGAC)
mmu-miR-379- 5p miR-379-5p (and -0.501 HSPA4L ENSMUSGO 0000025757 4.350 other miRNAs
w/seed GGUAGAC)
mmu-miR-379-5p miR-379-5p (and -0.501 IDH3A ENSMUSG00000032279 3.869 other miRNAs
w/seed GGUAGAC)
mmu-miR-379-5p miR-379-5p (and -0.501 MAP3K2 ENSMUSGO 0000024383 2.315 other miRNAs
w/ seed GGUAGAC )
mmu-miR-379-5p miR-379-5p (and -0.501 MRPL42 ENSMUSGO0000062981 2.786 other miRNAs
w/seed GGUAGAC)
mmu-miR-379- 5p miR-379-5p (and -0.501 MYO10 ENSMUSGO 0000022272 4.045 o her miRNAs
w/seed GGUAGAC)
mrnu-miR-379-5p miR-379-5p (and -0.501 PLEKHB1 ENSMUSG00000030701 3.064 other miRNAs
w/seed GGUAGAC)
mmu-miR-379-5p miR-379-5p (and -0.501 RARE ENSMUSGO 000001 491 4.056 other miRNAs
w/seed GGUAGAC)
mmu-miR-379-5p miR-379-5p (and -0.501 RNF6 ENSMUSGO 0000029634 2.654 other miRNAs
w/ seed GGUAGAC )
mmu-miR-379-5p miR-379-5p (and -0.501 TIMP3 ENSMUSGO 0000020044 3.853 other miRNAs
w/seed GGUAGAC)
mmu-miR-379- 5p miR-379-5p (and -0.501 TMCC3 ENSMUSGO 0000020023 7.961 other miRNAs
w/seed GGUAGAC)
mrnu-miR-466i -3p miR-3941 (and -0.543 BMP2 ENSMUSG00000027356 4.797 other miRNAs
w/seed UACACAC)
mmu-miR- 466i-3p miR-3941 (and -0.543 CAV2 ENSMUSGO 0000000058 3.050 other miRNAs
w/ seed UACACAC)
mmu-miP.- 466i-3p miR-3941 (and -0.543 CYP51A1 ENSMUSGO 0000001467 3.376 other miRNAs
w/seed UACACAC)
miRNA miKNA family laiRNA Gene Ensemble Gene ID mRNA Exp name with seed Exp Log Symbol Fold sequence Ratio Change am-miP.- 4661-3p miR-3941 (and -0 , 543 GCC2 ENSMUSGO 0000038039 2.542 other miRNAs
w/ seed UACACAC !
mmu--miR-466i-3p miR-39 1 (and -0 , 543 GNA14 ENSMUSG00000024697 7,846 other miRNAs
w/seed UACACAC)
mmu--miR-466i-3p miR-3941 (and -0 , 543 HK2 ENSMUSGO0000000628 2 , 493 other miRNAs
w/seed UACACAC)
mmu-miR-466i-3p miR-3941 (and -0.543 KIAA0040 ENSMUSGO 0000090394 2.507 o her miRNAs
w/seed UACACAC)
mmu-miR-466i-3p miR-3941 (and -0.543 MTUS2 ENSMUSGO 0000029651 2.507 other miRNAs
w/seed UACACAC)
mmu-miR- 66i -3p miR-3941 (and -0 543 MYO10 ENSMUSGO 0000022272 4.045 other miRNAs
w/seed UACACAC)
mmu-miR- 466i-3p miR-3941 (and -0 , 543 NHS ENSMUSGO0000059493 3, 326 other miRNAs
w/ seed UACACAC)
mmu-miR-466i-3p miR-39 1 (and -0 , 543 NT5E ENSMUSG00000032420 14.162 other miRNAs
w/seed UACACAC)
mmu-miR-466i-3p miR-3941 (and -0.543 PROS! ENSMUSG00000022912 4.028 o her miRNAs
w/seed UACACAC)
mmu-ralR-466i--3p miR-39 1 (and -0.543 PTGES ENSMUSGO 0000050737 3.313 other miRNAs
w/seed UACACAC)
mmu-miR- 66i -3p miR-3941 (and -0. 43 PTP4A1 ENSMUSG00000026064 2.910 other miRNAs
w/seed UACACAC)
mmu-miR- 466i-3p miR-3941 (and -0 , 543 RABIA ENSMUSGO 0000020149 2 , 844 other miRNAs
w/ seed UACACAC)
mmu-miR-466i-3p miR-39 1 (and -0 , 543 RGPD4 ENSMUSG00000003226 2.526 other miRNAs ( include
w/seed UACACAC) s
others )
mmu-miR-466i-3p miR-3941 (and -0.543 RNF11 ENSMUSGO0000028557 2.278 other miRNAs
w/seed UACACAC)
mmu-miR- 66i -3p miR-3941 (and -0.543 RUNX1 ENSMUSG00000022952 2.410 other miRNAs
w/seed UACACAC)
mmu-miR- 466i-3p miR-3941 (and -0 , 543 SDCBP ENSMUSGO 0000028249 2,245 other miRNAs
w/ seed UACACAC)
mmu-miR-466i-3p miR-39 1 (and -0 , 543 SG S2 ENSMUSG00000050931 3 ,816 other miRNAs
w/seed UACACAC)
mmu-miR-466i-3p miR-3941 (and -0.543 SLC1A4 ENSMUSGO0000020142 2.449 o her miRNAs
w/seed UACACAC)
mmu-miR- 66i-3p miR-39 1 (and -0.543 SLC35A3 ENSMUSGO 0000027957 2.114 o her miRNAs
w/seed UACACAC)
mmu-miR-466i -3p miR-3941 (and -0.543 3LC44A1 ENSMUSGO 0000028412 2.782 other miRNAs
w/seed UACACAC)
mmu-miR- 466i-3p miR-3941 (and -0.543 SLC7A2 ENSMUSGO 0000031596 4 ,389 other miRNAs
miRNA miKNA family raiBNA Gene Ensemble Gene ID mENA Exp name with seed Exp Log Symbol Fold sequence Ratio Change w/seed UACACAC)
mmu-ltd.R-466i-3p miR- 3941 (and -0.543 SP4 ENSMUSGO 0000025323 2.296 other miRNAs
w/seed UACACAC)
mmu-miR-4661 --3p mlR-3941 (and -0.543 SSR1 ENSMUSG00000021427 2.709 other miRNAs
w/seed UACACAC)
mmu-miR- 466i-3p miR-3941 (and -0.543 STXBP3 ENSMUSGO 0000027882 2.034 other miRNAs
w/seed UACACAC)
mmu--miR-4661-3p miR-39 1 (and -0.543 TMCC3 ENSMUSGO 0000020023 7.961 other miRNAs
w/seed UACACAC)
mmu-mi.R-4661-3p miR-3941 (and -0.543 TRAPPC6E ENSMUSGO 0000020993 2.544 other miRNAs
w/seed UACACAC)
mmu-miR-466i-3p miR-3941 (and -0.543 TRIB1 ENSMUSGO 0000032501 2.711 other miRNAs
w/seed UACACAC)
mmu-miR-4661 ~3p miR-3941 (and -0.543 USP39 ENSMUSG00000056305 2.028 other miRNAs
w/seed UACACAC)
mmu-mlR- 466i-3p miR-3941 (and -0.543 VPS 4B ENSMUSGO 0000009907 2.110 other miRNAs
w/seed UACACAC)
mmu--mlR-3960 miR-3960 (and 0.760 ADAMTSL2 ENSMUSG00000036040 -6.467 other miRNAs
w/seed GCGGCGG)
mmu~mi.R~-3960 miR-3960 (and 0.760 ADAPI ENSMUSG00000056413 -2.592 other miRNAs
w/seed GCGGCGG)
mmu--mlR--3960 miR- 3960 (and 0.760 ARHGEF18 ENSMUSGO 0000004566 -3.167 other miRNAs
w/seed GCGGCGG)
mmu-ralR-3960 miR-3960 (and 0.760 ATP2A3 ENSMUSGO 0000020786 -2.020 other miRNAs
w/seed GCGGCGG)
mmu-mlR-3960 miR-3960 (and 0.760 C0R07/C0 ENSMU3G00000039637 -2.807 other miRNAs R07- w/seed GCGGCGG) P M16
mmu-miR---3960 miR-3960 (and 0.760 MAP2K7 ENSMUSG00000002948 -2.576 other miRNAs
w/seed GCGGCGG)
mmu-miR-411- 5p miR-411-5p (and -0.494 ABCC9 ENSMUSG00000030249 2.333 other miRNAs
w/seed AGUAGAC)
mmu-mlR- 411-Sp miP.-41i-5p (and -0.494 EIF1AX ENSMUSGO 0000057561 2.255 other miRNAs
w/seed AGUAGAC)
mmu--miR-411 --5p miR-411-5p (and -0.494 GATAD1 ENSMUSGO 0000007415 3.845 other miRNAs
w/seed AGUAGAC )
mmu-miR-411-5p miR-4il-5p (and -0.494 MAP2K1 ENSMUSGO 0000004936 2.373 other miRNAs
w/seed AGUAGAC)
mm --miR-- 11- 5p miR- 11-5p (and -0.494 MLLT11 ENSMUSG00000053192 2.755 other miRNAs
w/seed AGUAGAC)
mmu-miR-411- 5p miR-411-5p (and -0.494 PTGS2 ENSMUSG00000032487 19.160 other miRNAs
w/seed AGUAGAC)
mmu-mlR- 411-5p miP.-41i-5p (and -0.494 PXDC1 ENSMUSGO 0000021411 2.385 other miRNAs
miRNA rniKNA family raiBNA Gene Ensemble Gene ID mENA Exp name with seed Exp Log Symbol Fold sequence Ratio Change w/seed AGUAGAC)
mmu-itiiR- 11- 5p miR-411-5p {and -0.494 RNF149 ENSMUSGO 0000043234 2.464 other miRNAs
w/seed AGUAGAC)
mmu-miR- 11- 5p miR-411-5p (and -0.494 3LC4A7 ENSMUSGO 0000021733 2.774 other miRNAs
w/seed AGUAGAC)
mmu-miR- 11-Sp miR-41i-5p (and -0.494 TM4SF1 ENSMUSGO 0000027800 4.155 other miRNAs
w/seed AGUAGAC)
rpitiu--miR- 411--5p miR-411-5p {and -0. 94 TMCC3 ENSMUSGO 0000020023 7.961 other miRNAs
w/seed AGUAGAC )
mmu-iaiR-425-5p miR-425-Sp (and -0.509 EGAS2 ENSMUSGO 0000005687 2.247 other miRNAs
w/seed AUGACAC)
mmu-raiR-425- 5p miR-425-5p {and -0.509 CDADC1 ENSMUSGO 0000021982 2.151 other miRNAs
w/ seed AUGACAC)
mmu-miR- 25- 5p miR-42S-5p (and -0.509 DIP2C ENSMUSG00000048264 2.975 other miRNAs
w/ seed AUGACAC)
mmu-miR- 425-Sp miR-42S-5p (and -0.509 EPN2 ENSMUSGO 0000001036 2.745 other miRNAs
w/seed AUGACAC)
mmu-miR- 425-5p miR-425-5p (and -0.509 ERLECi ENSMUSGO 0000020311 2.086 other miRNAs
w/seed AUGACAC)
rnmu-miR-425-5p miR-425-Sp (and -0.509 GHITM ENSMUSG00000041028 3.310 other miRNAs
w/seed AUGACAC)
mmu-miR-425- 5p miR-425-5p (and -0.509 HS2ST1 ENSMUSGO 0000040151 2.657 other miRNAs
w/ seed AUGACAC)
mmu-miR- 25- 5p miR-42S-5p (and -0.509 HSPK1 ENSMUSGO 0000029657 2.4 4 other miRNAs
w/seed AUGACAC)
mmu-miR- 425-Sp miR-42S-5p (and -0.509 IL11 ENSMUSGO 0000004371 22.880 other miRNAs
w/seed AUGACAC)
mmu-miR-425-5p miR-425-5p (and -0.509 KLF3 ENSMUSG00000029178 2.51 other miRNAs
w/seed AUGACAC)
mmu-miR-425-5p miR-425-Sp (and -0.509 LAMP2 ENSMUSGO 0000016534 2.003 other miRNAs
w/seed AUGACAC)
mmu-miR-425- 5p miR-425-5p (and -0.509 LIN7C ENSMUSGO 0000027162 2.691 other miRNAs
w/ seed AUGACAC)
mmu- iR- 25-5p rniP.-42S-Sp (and -0.509 MRPS6 ENSMUSG00000039680 2.277 other miRNAs
w/seed AUGACAC)
mmu-miR- 425-Sp miR-42S-5p (and -0.509 NOV ENSMUSGO 0000037362 3.787 other miRNAs
w/ seed AUGACAC )
mmu- iR-425-5p miR-425-5p (and -0.509 RNF11 ENSMUSG00000028557 2.276 other miRNAs
w/seed AUGACAC)
mmu-miR-425- 5p miR-425-5p (and -0.509 SLITRK6 ENSMUSGO 0000045871 4.056 other miRNAs
w/seed AUGACAC)
mmu-miR-425- Sp miR-425-5p (and -0.509 UBE2G1 ENSMUSGO 000002079 2.075 other miRNAs
miRNA miKNA family raiBNA Gene Ensemble Gene ID mENA Exp name with seed Exp Log Symbol Fold sequence Ratio Change w/seed AUGACAC)
mmu-itiiR-7118-5p miR- 271 (and 0, 755 ADAMTSI4 ENSMUSG00000059901 -2 , 334 other miRNAs
w/ seed GGGGAAG)
irjriu--miR--7118--5p miR- 4271 (and 0, 755 ADCY9 BNSMUSGO0000005580 -2 ,161 other miRNAs
w/seed GGGGAAG)
mmu-miR-7118-5p miR-4271 (and 0.755 ALDH3B1 ENSMUSGO 000002 885 -2.172 other miRNAs
w/seed GGGGAAG)
mmu-miR-7118-5p miR-4271 (and 0.755 CA7 ENSMUSGO 0000031883 -2.110 other iRNAs
w/seed GGGGAAG}
rnmu-miR-7118-5p miR-4271 (and 0.755 CNN2 ENSMUSGO 0000004665 -2.932 other miRNAs
w/seed GGGGAAG;
mmu-miR-7118-5p miR-4271 (and 0, 755 FAM109A ENSMUSGO 0000044134 -2.172 other miRNAs
w/seed GGGGAAG)
mrnu-rru.R-711S-5p miR-4271 (and 0, 755 F0XRED2 ENSMUSG00000016552 -2.338 other miRNAs
w/ seed GGGGAAG )
mmu-miR-7118-5p miR-4271 (and 0.755 GLUL ENSMUSGO 0000026 73 -3.655 other miRNAs
w/seed GGGGAAG)
mmu-miR-7118-5p miR-4271 (and 0.755 GSTM5 ENSMUSGO 0000058135 -2.732 other miRNAs
w/seed GGGGAAG}
rnmu-miR-7118-5p miR-4271 (and 0.755 JMJD8 ENSMUSG00000025736 -2.723 other miRNAs
w/seed GGGGAAG)
mmu--miR-711S--5p miR-4271 (and 0.755 LYPD63 ENSMUSGO 0000026765 -3.942 other miRNAs
w/seed GGGGAAG)
irjriu--miR--7118--5p miR-4271 (and 0, 755 NKD1 ENSMUSG00000031661 -3.618 other miRNAs
w/seed GGGGAAG)
mmu-miR-7118-5p miR-4271 (and 0.755 0SBPL7 ENSMUSGO 0000038534 -2.560 other miRNAs
w/seed GGGGAAG)
rnmu-miR-7118-5p miR-4271 (and 0.755 PAD12 ENSMUSG00000028927 -7.765 other miRNAs
w/seed GGGGAAG}
rnmu-miR-7118-5p miR-4271 (and 0.755 PDZK1IP1 ENSMUSG00000028716 -2.180 other miRNAs
w/seed GGGGAAG)
mm-miR-7118 --5p miR-4271 (and 0.755 SAT2 ENSMUSGO 0000069835 -2.656 other miRNAs
w/seed GGGGAAG)
mjriu-miR-7118-5p miR-4271 (and 0.755 SFXN4 ENSMUSG00000063698 -2.253 other miRNAs
w/seed GGGGAAG)
mmu-miR-7118-5p miR-4271 (and 0.755 SKI ENSMUSGO 0000029050 -2.095 other miRNAs
w/ seed GGGGAAG)
rnmu-miR-7118-5p miR-4271 (and 0.755 S0RT1 ENSMUSGO 00000687 7 -2.464 other miRNAs
w/seed GGGGAAG}
mmu-miR-7118-5p miR-4271 (and 0, 755 TBC1D2 ENSMUSG00000039813 -3.413 other miRNAs
w/seed GGGGAAG)
mmu-miR-6769b-5p miR- 4456 (and 0.626 ADAMTS 14 ENSMUSG00000059901 -2.334 other miRNAs
miRNA miKNA family raiRNA Gene Ensemble Gene ID mRNA Exp name with seed Exp Log Symbol Fold sequence Ratio Change w/seed CUGGUGG)
mmu-itiiR- 6769b-5p miR-4456 (and 0,628 ADAP1 ENSMUSG00000056413 -2.592 other miRNAs
w/ seed CUGGUGG)
mmu-miR-6769b-5p miR-4456 (and 0,626 C19orf66 ENSMUSG00000038884 -2.556 other miRNAs
w/seed CUGGUGG)
mmu-miR- 6769b-5p miR-4456 (and 0.628 CSDC2 ENSMUSGO 0000042109 -3.036 other miRNAs
w/seed CUGGUGG)
mmu-ndR- 6769b--5p miR-4456 (and 0.628 CYS1 ENSMUSG00000062563 -3.937 other miRNAs
w/seed CUGGUGG)
mmu-miR- 6769b-5p miR-4456 (and 0.628 DEF6 ENSMUSGO 0000002257 -2.488 other miRNAs
w/seed CUGGUGG)
mmu-raiR- 6769b-5p miR-4456 (and 0.628 F0XRED2 ENSMUSG00000016552 -2.338 other miRNAs
w/ seed CUGGUGG)
mmu-miR-6769b-5p miR-4456 (and 0.626 LGALS3BP ENSMUSG00000033880 -2.621 other miRNAs
w/seed CUGGUGG)
mmu-miR- 6769b-5p miR-4456 (and 0.628 PCK2 ENSMUSGO 0000040618 -2.038 other miRNAs
w/seed CUGGUGG)
mmu-miR- 455-5p miR-455-5p (and -0.400 BAG1 EMSMUSGO 0000028416 2.734 other miRNAs
w/seed AUGUGCC)
mmu-miR-455-5p miR-455-5p (and -0.400 CD 3 ENSMUSGO 0000032803 2.604 other miRNAs
w/seed AUGUGCC)
mmu-miR- 55- 5p miR-455-5p (and -0.400 DSTN ENSMUSG00000015932 3.550 other miRNAs
w/seed AUGUGCC)
mmu-miR- 55- 5p miR-455-5p (and -0.400 EPN2 ENSMUSG00000001036 2.745 other miRNAs
w/seed AUGUGCC)
mmu-miR- 455-Sp miR-455-5p (and -0.400 ERLEC1 ENSMUSGO 0000020311 2.088 other miRNAs
w/seed AUGUGCC)
mmu-miR-455-5p miR-455-5p (and -0.400 ETS1 ENSMUSG00000032035 2.457 other miRNAs
w/seed AUGUGCC)
mmu-miR-455-5p miR-455-5p (and -0.400 GPD2 ENSMUSG00000026827 2.365 other miRNAs
w/seed AUGUGCC)
mmu-miR- 55- 5p miR- 455-5p (and -0.400 KPNA3 ENSMUSGO 0000021929 2.132 other miRNAs
w/seed AUGUGCC)
mmu-miR-455-5p miP.-455-5p (and -0.400 LDLRAD4 ENSMUSG00000024544 2.708 other miRNAs
w/seed AUGUGCC)
mmu-miR- 455-Sp miR-455- 5p (and -0.400 MFAP3L ENSMUSGO 0000031647 2.764 other miRNAs
w/ seed AUGUGCC )
mmu- iR-455-5p miR-455-5p (and -0.400 NCK2 ENSMUSGO 0000066877 2.274 other miRNAs
w/seed AUGUGCC)
mmu-miR- 55- 5p miR-455-5p (and -0.400 RNF149 ENSMUSGO 0000048234 2.464 other miRNAs
w/seed AUGUGCC)
mmu-miR-455- 5p miR- 455-5p (and -0.400 S0CS3 ENSMUSGO 0000053113 2.299 other miRNAs
miRNA miKNA family laiBNA Gene Ensemble Gene ID mENA Exp name with seed Exp Log Symbol Fold sequence Ratio Change w/seed AUGUGCC) mmu--miR- 455--5p miR- 455- 5p {and -0 , 400 TJP1 EMSMUSGO 0000030516 2.661 other miRNAs
w/ seed AUGUGCC !
mmu-miR-455-5p miR-455-15p (and -0.400 TMEM33 ENSMUSGO 0000037720 2.711 other miRNAs
w/seed AUGUGCC)
mmu-miR-455- 5p miR-455-5p {and -0. 00 TSPA 6 ENSMUSG00000067377 4.053 o her miRNAs
w/seed AUGUGCC)
mrnu-miR-455-- 5p miR-455-5p (and -0.400 UBE2K ENSMUSG00000029203 2.362 other miRNAs
w/seed AUGUGCC)
mmu-miR- 6931-5p miR-4651 (and 2.593 ADCY9 ENSMUSGO 0000005580 -2.161 other miRNAs
w/seed GGGGUGG)
mmu-miR- 693l-5p miR-4651 (and 2.593 ARHGEF18 EMSMUSGO 0000004568 -3.167 other miRNAs
w/seed GGGGUGG)
mmu-miR- 6931-5p miR-4651 (and 2.593 ARVCF ENSMUSGO 0000000325 -3.132 o her miRNAs
w/seed GGGGUGG)
mmu-miR- 6931-5p miR-4651 (and 2.593 CAMKK2 ENSMUSGO 0000029 71 -2.570 other miRNAs
w/seed GGGGUGG)
mmu-miR- 6931 -5p miR-4651 (and 2.593 COL8A2 ENSMUSG00000056174 -5.252 other miRNAs
w/seed GGGGUGG)
mmu-miR- 6931-5p miR-4651 (and 2.593 CSDC2 ENSMUSGO 0000042109 -3.036
other miRNAs
w/seed GGGGUGG)
mmu- iR- 6931-5p miR-4651 (and 2 Q3 EDNRA ENSMUSG00000031616 -2.626 other miRNAs
w/seed GGGGUGG)
mmu-miR- 6931-5p miR-4651 (and 2.593 F0XRED2 ENSMUSG00000016552 -2.338 other miRNAs
w/seed GGGGUGG)
mmu-miR- 6931- bp miR-4651 (and 2.593 GALNT16 ENSMUSGO 0000021130 -6.021 other miRNAs
w/seed GGGGUGG)
mmu- iR- 6931 -5p miR-4651 (and 2.593 GLUL ENSMUSG00000026473 -3.655 other miRNAs
w/seed GGGGUGG)
mmu-miR- 6931-5p miR-4651 (and 2.593 IMPDK1 ENSMUSGO 0000003500 -2.043 other miRNAs
w/seed GGGGUGG)
mmu- iR- 6931-5p miR-4651 (and 2.593 IVD ENSMUSGO0000027332 -2.160 other miRNAs
w/seed GGGGUGG)
mmu-miR- 6931-5p miR-4651 (and 2.593 JMJD8 ENSMUSG00000025736 -2.723 other miRNAs
w/seed GGGGUGG)
mmu-miR- 6931-5p miR-4651 (and 2.593 KLF15 ENSMUSG00000030087 -3.260 other miRNAs
w/seed GGGGUGG)
mmu-miR- 6931 -5p miR-4651 (and 2.593 KLHL18 ENSMUSG00000054792 -2.175 other miRNAs
w/seed GGGGUGG)
mmu-miR- 6931-5p miR-4651 (and 2.593 LRRC3B ENSMUSGO 0000045201 -2.166 other miRNAs
w/ seed GGGGUGG!
miRNA miKNA family laiBNA Gene Ensemble Gene ID mENA Exp name with seed Exp Log Symbol Fold sequence Ratio Change am-miP.- 6931-5p miR- 651 (and 2.593 MAP2K7 ENSMUSGO 0000002948 -2.576 other miRNAs
w/ seed GGGGUGG!
mmu--miR- 6931-5p miR-4651 (and 2.593 MYH1 ENSMUSG00000030739 -3.299 other miRNAs
w/seed GGGGUGG;
mmu-miR- 6931-5p miR-4651 (and 2 , 593 MY07A ENSMUSGO 0000030761 -2.045 o her miRNAs
w/seed GGGGUGG)
ratnu-ralR-6931 --5p miR-4651 (and 2 , 593 NCAM1 ENS USG00000039542 -3.709 other miRNAs
w/seed GGGGUGG)
ramu-raiR-6931 -5p miR-4651 (and 2.593 NKD1 ENSMUSGO 0000031661 -3.618 other miRNAs
w/seed GGGGUGG)
mmu--miR- 6931-5p miR-4651 (and 2.593 0SBPL7 ENSMUSGO 0000038534 -2.560 other miRNAs
w/seed GGGGUGG!
mmu--miR- 6931-5p miR-4651 (and ? c Q " PAD12 ENSMUSG00000028927 - .765 other miRNAs
w/seed GGGGUGG)
mmu-miR- 6931-Sp miR-4651 (and 2 , 593 PFKFB4 ENSMUSGO 00000256 8 -2.776 o her miRNAs
w/seed GGGGUGG)
mmu-miR- 6931-5p miR-4651 (and 2.593 PIGZ ENSMUSGO 0000045625 -2.462 other miRNAs
w/seed GGGGUGG)
mmu-miR- 6931 -5p miR-4651 (and 2.593 PRRX1 ENSMUSG00000026586 -2.910 other miRNAs
w/seed GGGGUGG)
mmu- iR- 6931-5p miR-4651 (and 2.593 PUM2 ENSMUSG00000020594 -2.130 other miRNAs
w/seed GGGGUGG!
mmu-miR- 6931-5p miR-4651 (and 2.593 SARDK ENSMUSGO 0000009614 -3.042 other miRNAs
w/seed GGGGUGG)
mmu-miR- 6931-Sp miR-4651 (and 2 , 593 SCARA3 ENSMUSGO 0000034 63 -3.097 o her miRNAs
w/seed GGGGUGG)
ratnu-miR- 6931 -5p miR-4651 (and 2 , 593 SFXN5 ENSMUSG00000033720 -2.558 other miRNAs
w/seed GGGGUGG)
mmu-miR- 6931 -5p miR-4651 (and 2.593 SKAP1 ENSMUSG0000005 058 -2.321 other miRNAs
w/seed GGGGUGG)
mmu- iR- 6931-5p miR-4651 (and 2.593 SKI ENSMUSG00000029050 -2.095 other miRNAs
w/seed GGGGUGG!
mmu-miR- 6931-5p miR-4651 (and 2.593 SSTR2 ENSMUSG00000047904 -2.008 other miRNAs
w/seed GGGGUGG)
mmu-miR- 6931-Sp miR-4651 (and 2 , 593 TRANK1 ENSMUSGO 0000062296 -2.219 other miRNAs
w/seed GGGGUGG)
ratnu-miR- 6931 -5p miR-4651 (and 2 , 593 TXNL4B ENSMUSG00000031723 -2.097 other miRNAs
w/seed GGGGUGG)
mmu-miR- 6931-5p miR-4651 (and 2.593 VIT ENSMU3G00000024076 -3.211 other miRNAs
w/seed GGGGUGG)
mmu- iR- 6931-5p miR-4651 (and 2.593 ZNF362 ENSMUSGO 0000028799 -2.430 other miRNAs
w/seed GGGGUGG)
miRNA miKNA family raiBNA Gene Ensemble Gene ID mENA Exp name with seed Exp Log Symbol Fold sequence Ratio Change am-miP.- 6954-5p miR- 486- 3p {and -0 , 610 AEBP1 ENSMUSGO 0000020473 2.866 other miRNAs
w/ seed GGGGCAG!
mmu-miR- 6954-5p miR-486-3p (and -0.610 BMP2 ENSMUSG00000027358 4.797 other miRNAs
w/seed GGGGCAG;
mmu-miR- 6954-5p miR-486-3p {and -0.610 C14orf79 ENSMUSG00000037594 2.390 o her miRNAs
w/seed GGGGCAG)
mmu-ralR-6954--5p miR-486-3p (and -0.610 CACFD1 ENSMUSGO 0000015486 2.201 other miRNAs
w/seed GGGGCAG)
mmu-miR- 6954-5p miP.-486-3p (and -0.610 CD14 ENSMUSG00000051439 3.745 other miRNAs
w/seed GGGGCAG)
mmu-miR- 6954-5p miR- 486- 3p {and -0 , 610 CDA ENSMUSGO 0000028755 3.141 other miRNAs
w./ seed GGGGCAG)
mmu-miR-6954-5 miR-486-3p (and. -0.610 CEMI P ENSMUSG00000052353 3.630 other miRNAs
w/seed GGGGCAG)
mmu-miR- 6954-5p miR-486-3p (and -0.610 CH P3 ENSMUSGO 0000053119 2.505 o her miRNAs
w/seed GGGGCAG)
mmu-miR-6954 --5p miR- 486-3p (and -0.610 COL6A2 ENSMUSGO 0000020241 2.940 other miRNAs
w/seed GGGGCAG)
mmu-miR- 6954-5p miP.-486-3p (and -0.610 COL6A3 ENSMUSG00000048126 5.728 other miRNAs
w/seed GGGGCAG)
mmu--miR- 6954-5p miR- 486- 3p (and -0.610 CSRNP1 ENSMUSG00000032515 2.565 other miRNAs
w/ seed GGGGCAG)
mmu-miR- 6954- p miR-486-3p (and -0.610 CTSK ENSMUSG00000028111 3.202 other miRNAs
w/seed GGGGCAG)
mmu-miR- 6954-5p miR-486-3p (and -0.610 DAP ENSMUSGO 0000039168 2.586 o her miRNAs
w/seed GGGGCAG)
mmu-miR- 6954 -5p miR-486-3p (and -0.610 DIXDCl ENSMUSG00000032064 2.563 other miRNAs
w/seed GGGGCAG)
mmu-miR- 6954-5p miP.-486-3p (and -0.610 DLD ENSMUSG00000020664 2.428 other miRNAs
w/seed GGGGCAG)
mmu- iR- 6954-5p miR- 486- 3p (and -0.610 DLL1 ENSMUSGO 000001 773 5.359 other miRNAs
w/ seed GGGGCAG)
mmu-miR- 6954- p miR-486-3p (and -0.610 D0K4 ENSMUSG00000040631 4.475 other miRNAs
w/seed GGGGCAG)
mmu-miR- 6954-5p miR-486-3p (and -0.610 EPN2 ENSMUSGO 0000001036 2.745 other miRNAs
w/seed GGGGCAG)
mmu-miR- 6954 -5p miR-486-3p (and -0.610 GJB4 ENSMUSG00000046623 3.956 other miRNAs
w/seed GGGGCAG)
mmu-miR- 6954-5p miR-486- 3p (and -0.610 GTF3C4 ENSMUSGO 0000035666 2.289 other miRNAs
w/seed GGGGCAG)
mmu- iR- 6954-5p miR- 486- 3p (and -0.610 HMGA1 ENSMUSG00000078249 4.019 other miRNAs
w/seed GGGGCAG)
miRNA miKNA family raiBNA Gene Ensemble Gene ID mENA Exp name with seed Exp Log Symbol Fold sequence Ratio Change am-miP.- 6954-5p miR- 486- 3p {and -0 , 610 HTRA3 EMSMUSGO 0000029096 3.023 other miRNAs
w/ seed GGGGCAG!
mmu-miR- 6954-5p miR-486-3p (and -0 , 610 IDH3A ENSMUSG00000032279 3.869 other miRNAs
w/seed GGGGCAG;
mmu-miR- 6954-5p miR-486-3p {and -0.610 KCNK5 EMSMUSGO 00000232 3 4.299 o her miRNAs
w/seed GGGGCAG)
mmu-ralR-6954--5p miR-486-3p (and -0.610 LRTM2 ENS USG00000055003 5.673 other miRNAs
w/seed GGGGCAG)
mmu-miR- 6954-5p miP.-486-3p (and -0.610 MMGT1 ENSMUSG00000061273 2.415 other miRNAs
w/seed GGGGCAG)
mmu-miR- 6954-5p miR- 486- 3p {and. -0 , 610 MTCH2 EMSMUSGO 0000027282 2.004 other miRNAs
w./ seed GGGGCAG!
mmu-miR-6954-5 miR-486-3p (and. -0,610 MTUS2 ENSMUSG00000029651 2.507 other miRNAs
w/seed GGGGCAG)
mmu-miR- 6954-5p miR-486-3p (and -0.610 NCS1 EMSMUSGO 0000062661 2.286 o her miRNAs
w/seed GGGGCAG)
mmu-miR-6954 --5p miR- 486-3p (and -0.610 NPR3 EMSMUSGO 0000022206 7.306 other miRNAs
w/seed GGGGCAG)
mmu-miR- 6954-5p miP.-486-3p (and -0.610 OPA3 ENSMUSG00000052214 2.066 other miRNAs
w/seed GGGGCAG)
mmu--miR- 6954-5p miR- 486- 3p (and. -0 , 610 PFKP EMSMUSGO 0000021196 3.430 other miRNAs
w/ seed GGGGCAG!
mmu-miR- 6954-5p miR-486-3p (and -0.610 PHLPP1 EMSMUSGO 00000443 0 2.247 other miRNAs
w/seed GGGGCAG)
mmu-miR- 6954-5p miR-486-3p (and -0.610 PITPNA EMSMUSGO 0000017781 2.698 o her miRNAs
w/seed GGGGCAG)
mmu-miR- 6954 -5p miR-486-3p (and -0.610 PXDC1 EMSMUSGO 0000021 11 2.365 other miRNAs
w/seed GGGGCAG)
mmu-miR- 6954-5p miP.-486-3p (and -0.610 RABll IP ENSMUSG00000017639 2.585 other miRNAs 4
w/seed GGGGCAG)
mmu- iR- 6954-5p miR- 486- 3p (and. -0 , 610 RGS16 EMSMUSGO 0000026475 4.031 other miRNAs
w/ seed GGGGCAG!
mmu-miR- 6954-5p miR-486-3p (and -0.610 SAP.IB EMSMUSGO 0000020386 3. 15 other miRNAs
w/seed GGGGCAG)
mmu-miR- 6954-5p miR-486-3p (and -0.610 SEP.INC2 EMSMUSGO 0000023232 2.981 other miRNAs
w/seed GGGGCAG)
mmu-miR- 6954 -5p miR-486-3p (and -0.610 3FN ENSMUSGO 0000047281 2.912 other miRNAs
w/seed GGGGCAG)
mmu-miR- 6954-5p miR-486- 3p (and -0 , 610 SGCG ENSMUSGO 0000035296 4.084 other miRNAs
w/seed GGGGCAG)
mmu- iR- 6954-5p miR- 486- 3p (and. -0 , 610 SLC41A1 ENSMUSG00000013275 2.304 other miRNAs
w/seed GGGGCAG)
miRNA miRNA family miRNA Gene Ensemble Gene ID mRNA Exp name with seed Exp Log Symbol Fold sequence Ratio Change am-miP.- 6954-5p miP.-486-3p {and. -0 , 610 SNX13 EMSMUSGO 0000020590 2.466 other miRNAs
w/ seed GGGGCAG!
mmu-miR- 6954-5p miR-486-3p (and -0.610 TIMP3 ENSMUSG00000020044 3.853 other miRNAs
w/seed GGGGCAG;
mmu-miR- 6954-5p miR-486-3p 'and -0.610 TULP4 EMSMUSGO 0000034377 2.207 o her miRNAs
w/seed GGGGCAG)
iranu-ralR-6954--5p miR-486-3p (and -0.610 VWA1 ENSMUSG00000042116 2.769 other miRNAs
w/seed GGGGCAG)
mmu-miR-4S5-3p miP.-495-3p (and -0.413 ACTCI ENSMUSG00000068614 2.373 other miRNAs
w/seed AACAAAC)
mmu--miP.- 495--3p miP.-495-3p {and. -0 , 13 ADGRA3 EMSMUSGO 0000029090 2.113 other miRNAs
w/ seed AACAAAC }
mmu--m R-495--3p miR-495-3p (and. -0.413 AM0TL2 ENSMUSG00000032531 3.583 other miRNAs
w/seed AACAAAC)
mmu-miR-495-3p miR-495-3p {and -0.413 ATL2 ENSMUSG00000059811 2.395 o her miRNAs
w/seed AACAAAC)
rrunu-miR-495-3p miR-495-3p (and -0.413 B3GALNT2 ENSMUSG00000039242 2.553 other miRNAs
w/seed AACAAAC)
mmu-miR-4S5-3p miP.-495-3p (and -0.413 BMP7 ENSMUSG00000008999 4.864 other miRNAs
w/seed AACAAAC)
mmu--miP.- 495--3p miP.-495-3p {and. -0 , 13 ETG1 ENSMUSG00000036478 5.832 other miRNAs
w/ seed AACAAAC }
mmu-m.i.R-495-3p miR-495-3p (and -0.413 C0PS8 EMSMUSGO 000003 432 2.715 other miRNAs
w/seed AACAAAC)
mmu-miR-495-3p miR-495-3p (and -0.413 DLL1 EMSMUSGO 0000014773 5.359 o her miRNAs
w/seed AACAAAC)
mrriu.-rrri.R--495- 3p miR-495-3p (and -0.413 EIF1AX ENSMUSG00000057561 2.255 other miRNAs
w/seed AACAAAC)
mmu-miR-495-3p miP.-495-3p (and -0.413 ETS1 ENSMUSG00000032035 2.457 other miRNAs
w/seed AACAAAC)
mmu-miP.- 495-3p miP.-495-3p (and. -0. 13 F0XC1 ENSMUSG00000050295 2.359 other miRNAs
w/ seed AACAAAC }
mmu-m.i.R-495-3p miR-495-3p (and -0.413 GALNT1 EMSMUSGO 0000000420 3.568 other miRNAs
w/seed AACAAAC)
mmu-miR-495-3p miR-495-3p (and -0.413 GCC2 EMSMUSGO 0000038039 2.542 other miRNAs
w/seed AACAAAC)
mrnu-rrri.R-495- 3p miR-495-3p (and -0.413 HBEGF EMSMUSGO 0000024 86 4.754 other miRNAs
w/seed AACAAAC)
mmu-miR-495-3p miR-495-3p (and -0. 13 LAMP2 ENSMUSGO 0000016534 2.003 other miRNAs
w/seed AACAAAC)
mmu-miP.- 495-3p miP.-495-3p (and. -0. 13 LDLRAD3 ENSMUSG00000048058 3.231 other miRNAs
/seed AACAAAC )
miRNA miRNA family miRNA Gene Ensemble Gene ID mRNA Exp name with seed Exp Log Symbol Fold sequence Ratio Change rpitiu--miR- 495--3p miR-495-3p {and -0 , 13 LDLRAD4 EMSMUSGO 0000024544 2.706 other miRNAs
w/ seed AACAAAC }
mmu-miR---495-3p miR-495-3p (and -0 , 413 LRTM2 ENSMUSG00000055003 5.673 other miRNAs
w/seed AACAAAC)
mmu-miR-495- 3p miR-495-3p {and -0.413 KAP3K2 ENSMUSG00000024383 2.315 o her miRNAs
w/seed AACAAAC)
mmu-miR-495- 3p miR-495-3p (and -0.413 MBNL2 ENSMUSG00000022139 3.213 other miRNAs
w/seed AACAAAC)
mmu-miR-4S5-3p miR-495-3p (and -0.413 MGAT2 ENSMUSG00000043998 2.892 other miRNAs
w/seed AACAAAC)
mmu--miP.- 495--3p miR-495-3p {and -0. 13 MID2 EMSMUSGO 0000000266 2.346 other miRNAs
w/ seed AACAAAC !
mmu-miR-495-3p miR-495-3p (and. -0.413 MYO10 EMSMUSGO 0000022272 4.045 other miRNAs
w/seed AACAAAC)
mmu-miR- 95- 3p miR-495-3p {and -0.413 NDFIP2 EMSMUSGO 0000053253 3.027 o her miRNAs
w/seed AACAAAC)
mmu-miR-495-3p miR-495-3p (and -0.413 NET01 ENSMUSG00000050321 2.208 other miRNAs
w/seed AACAAAC)
mmu-miR-4S5-3p miR-495-3p (and -0.413 PAI P2 ENSMUSG0000003 058 2.059 other miRNAs
w/seed AACAAAC)
mmu--miP.- 495--3p miR-495-3p (and -0. 13 PBRM1 EMSMUSGO 0000042323 2.425 other miRNAs
w/ seed AACAAAC !
mmu-mi.R-495-3p miR-495-3p (and -0.413 PEN2 EMSMUSGO 0000027805 2.558 other miRNAs
w/seed AACAAAC)
mmu-miR-495-3p miR-495-3p (and -0.413 PSMD5 EMSMUSGO 0000026869 2.325 o her miRNAs
w/seed AACAAAC)
mrnu-miR--495-- 3p miR-495-3p (and -0.413 PTP4A1 ENSMUSG00000026064 2.910 other miRNAs
w/seed AACAAAC)
mmu-miR~495~3p miR-495-3p (and -0.413 RADIL ENSMUSG00000029576 2.043 other miRNAs
w/seed AACAAAC)
mmu--miP.- 495--3p miR-495-3p (and -0. 13 SEPT7 EMSMUSGO 0000001833 2.376 other miRNAs
w/ seed AACAAAC !
mmu-mi.R-495-3p miR-495-3p (and -0.413 SGK1 EMSMUSGO 0000019970 7.008 other miRNAs
w/seed AACAAAC)
mmu-miR-495-3p miR-495-3p (and -0.413 SLC44A1 EMSMUSGO 0000028 12 2.782 other miRNAs
w/seed AACAAAC)
mrnu-miR-495- 3p miR-495-3p (and -0.413 SMNDC.1 EMSMUSGO 0000025024 2.774 other miRNAs
w/seed AACAAAC)
mmu-miR-495-3p miP.-495-3p (and -0. 13 SPRYD7 EMSMUSGO 0000021930 2.326 other miRNAs
w/seed AACAAAC)
mmu-miP.- 495-3p miR-495-3p (and -0. 13 SSR1 ENSMUSG00000021427 2.709 other miRNAs
/seed AACAAAC )
miRNA miKNA family raiBNA Gene Ensemble Gene ID mENA Exp name with seed Exp Log Symbol Fold sequence Ratio Change rpitiu--miR- 495--3p miR-495-3p {and -0 , 13 STK36L EMSMUSGO 0000001630 4.290 other miRNAs
w/ seed AACAAAC }
mmu-miR---495-3p miR-495-3p (and -0 , 413 TMEM128 ENSMUSG00000067365 2.646 other miRNAs
w/seed AACAAAC)
mmu-miR-495- 3p miR-4 5-3p {and -0.413 TNFRSF21 EMSMUSGO 0000023915 3.696 o her miRNAs
w/seed AACAAAC)
mmu-miR- 95- 3p miR-495-3p (and -0.413 TUSC3 ENSMUSG00000039530 4.411 other miRNAs
w/seed AACAAAC)
mmu-miR-4S5-3p miR-495-3p (and -0.413 ZBTBlo ENSMUSG00000063659 2.014 other miRNAs
w/seed AACAAAC)
mmu--miP.- 495--3p miR-495-3p {and -0. 13 ZCCHC1 EMSMUSGO0000061410 2.791 other miRNAs
w/ seed AACAAAC!
mmu-miR---495-3p miR-495-3p (and. -0.413 ZFP36L1 ENSMUSG00000021127 3.521 other miRNAs
w/seed AACAAAC)
mmu-miR- 6546-5p miR-566 (and 0.719 AD0RA1 EMSMUSGO 0000042 29 -4.392 o her miRNAs
w/seed GGCGCCU)
mmu--miR-- 6546--5p miR-566 (and 0.719 CNN2 ENSMUSGO 000000 665 -2.932 other miRNAs
w/seed GGCGCCU)
mmu-miR- 6546-5p miR-566 (and 0.719 ECSIT EMSMUSGO 0000066839 -2.053 other miRNAs
w/seed GGCGCCU)
mmu--miP.- 6546-5p miR-566 (and 0.719 MGLL EMSMUSG00000033174 -3.899
other miRNAs
w/seed GGCGCCU!
mmu-miR- 6546- p miR-566 (and 0.719 TXNL4B ENSMUSG00000031723 -2.097 other miRNAs
w/seed GGCGCCU)
mmu-miR- 574- 5p miR-574-5p 1.823 ΑΛΤΚ ENSMUSGO 0000025375 -5.840
(miRNAs w/seed
GAGUGUG)
mmu-miR-574- 5p miR-574-5p 1.823 CAMKK1 ENSMUSG00000020785 -2.048
(miRNAs w/ s eed
GAGUGUG)
mmu- iR-574- p miR-574-5p 1.823 JMJD8 ENSMUSG00000025736 -2.723
(miRNAs w/seed
GAGUGUG)
mmu-miR-574 -5p miR-574-5p 1.823 MAOB EMSMUSG000000401 7 -3.568
(miRNAs w/seed
GAGUGUG)
mmu-miR-574-5p miR-57'4-5p 1.823 MCPH1 EMSMUSGO 0000039842 -2.275
(miRNAs w/ seed
GAGUGUG)
mmu-miR- 574- 5p miR-574-5p 1.823 NCAMl EMSMUSGO 0000039542 -3.709
(miRNAs w/seed
GAGUGUG)
mmu-miR-574- 5p miR-574-5p 1.823 PFKFB4 EMSMUSGO 0000025646 -2.776
(miRNAs w/ s eed
GAGUGUG)
mmu-miR-574-Sp miR-57 - 5p 1.823 PIK3IP1 EMSMUSGO 000003 614 -3.184
(miRNAs w/seed
GAGUGUG)
mmu-miP.-28a-5p miR-708-5p (and -0. 30 AM0TL2 ENSMUSG00000032531 3.583 other miRNAs
w/seed AGGAGCU }
miRNA miRNA family miRNA Gene Ensemble Gene ID mRNA Exp name with seed Exp Log Symbol Fold sequence Ratio Change rpitiu--miR-28a--5p miR-708-5p {and -0 , 30 ATL2 ENSMUSGO 000005 811 2.395 other miRNAs
w/seed AGGAGCU}
rami!--miR-28a--5p miR-708-5p (and -0. 30 BAG1 ENSMUSG00000028416 2.734 other miRNAs
w/seed AGGAGCU;
mmu-miR-28a- 5p miR-708-5p {and -u .4 J0 BTG1 ENSMUSGO 0000036 78 5.832 other miRNAs
w/seed AGGAGCU)
mmu-miR-28a- 5p rriiR- 7 ϋ 3-5p (and -0.430 CHSY3 ENSMUSG00000058152 6.220 other miRNAs
w/seed AGGAGCU)
mmu-miR-28a-5p miR-7 OS-5p (and -0.430 DAP ENSMUSGO 0000039168 2. 86 other miRNAs
w/seed AGGAGCU)
Table 11 . Osteoarthritis miRNAs in articular cartilage and target niRNAs differentially expressed at 6 weeks post-surgery in DMM versus sham mice with dysregulated expression.
miRNA miRNA family miRKA Gene Ensemble Gene ID mRNA Exp name ith seed Exp Log Symbol Fold secpjience Ratio Change mmu-1et-7d-5p let-7a-5p (and -0.366 ABL2 ENSMUSGO 0000026596 2.094 other miRNAs
w/seed GAGGUAG)
mmu-1et-7ά-5 let-7a-5p (and -0.366 ACPI ENSMUSG00000044573 2.745 other miRNAs
w/ seed GAGGUAG )
mrnu-i et-7d-5p let-7'a-5p (and -0.366 AGO3 ENSMUSGO 0000028842 2.346 other miRNAs
w/seed GAGGUAG)
mmu-let-7d- 5p let-7a-5p (and -0.366 AKRlBi 0 ENSMUSGO 0000029762 2.286 other miRNAs
w/ seed GAGGUAG)
mmu-- let-7d- 5p 1et -7a-5p ( and -0.366 ATP2A2 ENSMUSG00000029467 2.144 other miRNAs
w/seed GAGGUAG)
mmu-1et-7d-5p let-7a-5p (and -0.366 CB 5 ENSMUSGO 0000009575 2.239 other miRNAs
w/seed GAGGUAG)
mmu--1 et--7d-5p 1et- 7a-5p (a d. -0.366 CFLAR ENSMUSGO 0000026031 2.797 other miRNAs
w/ seed GAGGUAG )
mrnu-i et-7d-5p let-7a-5p (and -0.366 DCN ENSMUSGO 0000019929 2.542 other miRNAs
w/seed GAGGUAG)
mmu-let-7d- 5p let-7a-5p (and -0.366 DNAJA2 ENSMUSGO 0000031701 2.120 other miRNAs
w/ seed GAGGUAG)
mmu- Iet-7d- 5p 1et -7a-5p ( and -0.366 DNAJB9 ENSMUSGO 000001 905 3.676 other miRNAs
w/seed GAGGUAG)
mmu-1et-7d-5p let-7a-5p (and -0.366 DPYSL3 ENSMUSGO 0000024501 2.360 other miRNAs
w/seed GAGGUAG)
mmu-1 et-7d-5p 1et- 7a-5p (and. -0.366 Όc"P ENSMUSG00000054889 3.441 other miRNAs
w/ seed GAGGUAG )
mrnu-i et-7d-5p let-7a-5p (and -0.366 EIF4G2 ENSMUSG00000005610 2.043 other miRNAs
w/seed GAGGUAG)
miRNA miRNA family raiRNA Gene Ensemble Gene ID mRNA Exp name with seed Exp Log Symbol Fold sequence Ratio Change mmu-let-7d- 5p let-7a-5p {and -0 , 366 ETNK1 ENSMUSG00000030275 3.249 other miRNAs
w/ seed GAGGUAG!
mmu- let-7d- 5p let-7a-5p (and -0 , 366 GABPA ENSMUSG00000008976 2.774 other miRNAs
w/seed GAGGUAG;
mmu-1et-7d-5p let-7a-5p (and -0.366 KLF9 ENSMUSG00000033863 2.650 o her miRNAs
w/seed GAGGUAG)
mmu-1 et-7d-5ρ 1et- 7a-5p (and -0.366 KPNA1 ENSMUSGO 0000022905 2.196 other miRNAs
w/ seed GAGGUAG )
mmu-1 et-7d-5p .Iet-7a-5p (and -0.366 KRAS ENSMUSG00000030265 2.071 other miRNAs
w/seed GAGGUAG)
mmu-1et-7d-5p let-7a-5p (and -0.366 NDUFA4 ENSMUSGO 0000029632 2.041 o her miRNAs
w/seed GAGGUAG)
mmu--1et-7d-5p let-7a-5p (and -0.366 PTGS2 ENSMUSG00000032487 32.609 other miRNAs
w/ seed GAGGUAG )
mmu-1 et-7d-5p .Iet-7a-5p (and -0.366 8CD ENSMUSGO 000003 071 3.883 other miRNAs
w/seed GAGGUAG)
mmu-let-7d- 5p let-7a-5p (and -0.366 SEMA4F ENSMUSGO 0000000627 2.369 other miRNAs
w/ seed GAGGUAG!
mmu-1et-7d-5p iet-7a-5p (and -0.366 TSPAN2 ENSMUSG00000027858 2.910 other miRNAs
w/seed GAGGUAG)
mmu-miR-206-3p miR-l-3p (and 0.527 A.GRN ENSMUSGO 00000 1936 -2.455 o her miRNAs
w/ seed GGAAUGU)
mmu-ralR-2 C 6- 3p miR-l-3p (and 0.527 ARHGEF18 ENSMUSGO 0000004566 -3.373 other miRNAs
w/seed GGAAUGU)
mmu-riP-206-3p miR-l-3p (and 0.527 CCND2 ENSMUSGO 0000000184 -3.473 other miRNAs
w/seed GGAAUGU)
mmu-miR-206-3p miR-l-3p (and 0.527 DGKB ENSMUSG00000036095 -2.365 other miRNAs
w/seed GGAAUGU)
mmu-miR-206-3p miR-l-3p (and 0.527 HELZ2 ENSMUSG00000027580 -2.455 other miRNAs
w/seed GGAAUGU)
mmu-miR-206-3p miR-l-3p (and 0.527 HS3ST3B1 ENSMUSGO0000070 07 -6.264 o her miRNAs
w/ seed GGAAUGU)
mmu-miR-2 C 6- 3p miR-l-3p (and 0.527 IQGAP3 ENSMUSGO 0000028068 -3.249 other miRNAs
w/seed GGAAUGU)
mmu-miR-206-3p miR-i-3p (and 0.527 LRP'i ENSMUSGO 0000040249 -3.964 other miRNAs
w/seed GGAAUGU)
mmu-miR-206-3p miR-i-3p (and 0.527 NFAT5 ENSMUSGO 00000038 7 -2.904 other miRNAs
w/seed GGAAUGU)
mmu-miR-206-3p miR-l-3p (and 0.527 PLCG'i ENSMUSGO0000016933 -2.864 other miRNAs
w/seed GGAAUGU)
mmu-miR-206-3p miR-l-3p (and 0.527 PTP 1 ENSMUSGO0000027540 -2.681 o her miRNAs
w/seed GGAAUGU)
miRNA miRNA family miRNA Gene Ensemble Gene ID mRNA Exp name with seed Exp Log Symbol Fold sequence Ratio Change rpitiu--miR-206--3p miR-l--3p (and 0.527 PTPRS ENSMUSG00000013236 -2.013
other miRNAs
w/seecl GGAAUGU)
mmu--miR-206--3p miR-l-3p (and 0.527 SLC16A3 ENSMUSG00000025161 -2.949 other miRNAs
w/seed GGAAUGU)
mmu-miR-206-3p miR-l-3p (and 0, 527 SMARCCI ENSMUSG00000032481 -2 , 236 o her miRNAs
w/seed GGAAUGU)
mmu-raiR-2 C 6- 3p miR-l-3p (and 0, 527 SOX5 ENSMUSGO 0000041540 -2 ,302 other miRNAs
w/seed GGAAUGU)
mmu-miR-206-3p miR-i-3p (and 0.527 TA0K3 ENSMUSG00000061288 -2.058 other miRNAs
w/seed GGAAUGU)
mmu-miR-206-3p miP.-i-3p (and 0.527 VEGFA ENSMUSGO 0000023951 -2.301
other miRNAs
w/seed GGAAUGU)
mmu-roiR-100--5p miR-100-5p (and. -0,514 BMPR2 ENSMUSG00000067336 3, 499 other miRNAs
w/seed ACCCGUA)
mmu-miR-1 C 0-5p miR-100-5p (and -0.514 PPP1CB ENSMUSGO 0000014956 2.198 o her miRNAs
w/ seed ACCCGUA)
mmu-miR-100-5p miR-100-5p (and -0.514 RAPIB ENSMUSGO00000 2681 2.202 o her miRNAs
w/seed ACCCGUA)
mmu-miR-107-3 miR-103-3p (and -0.617 ABL2 ENSMUSGO 0000026596 2.094 other miRNAs
w/seed GCAGCAJJ)
mmu-miR-107-3p miP.-i03-3p (and -0.617 AGO3 ENSMUSGO 0000028842 2.346 other miRNAs
w/seed GCAGCAJJ)
ramu-raiR-107-3p miP.-103-3p (and -0 , 617 ATF6 ENSMUSGO 0000026663 2 , 031 other miRNAs
w/seed GCAGCAJJ)
mmu-miR-107-3p miR-103-3p (and -0 , 617 BHLHE40 ENSMUSG00000030103 3, 031 other miRNAs
w/seed GCAGCAU )
mmu-miR-107-3p miR-103-3p (and -0.617 CHST11 ENSMUSGO0000034612 2.418 other miRNAs
w/seed GCAGCAU)
mmu-miR-107-3p miR-103-3p (and -0.617 DLL1 ENSMUSGO 0000014773 3.560 other miRNAs
w/seed GCAGCAJJ)
mm -miR-107-3p miP.-i03-3p (and -0.617 DNAJB4 ENSMUSG00000028035 2.498 other miRNAs
w/seed GCAGCAU)
ramu-miR-107-3p miP.-103-3p (and -0 , 617 DNA.JC12 ENSMUSG00000036764 2.886 other miRNAs
w/ seed GCAGCAU!
mmu-miR-107-3p miR-103-3p (and -0 , 617 DPYSL3 ENSMUSG00000024501 2 , 360 other miRNAs
■w/seecl GCAGCAU)
mmu-miR-i07-3p miR-103-3p (and -0.617 DSEL ENSMUSGO 0000038702 2.015 o her miRNAs
w/seed GCAGCAU)
mmu-miR-107-3p miR-103-3p (and -0.617 BUSPI4 ENSMUSGO 0000018646 2.053 other miRNAs
w/seed GCAGCAJJ)
mmu-miR-107-3p miP.-i03-3p (and -0.617 EIF1AX ENSMUSG0000005 561 2.244 other miRNAs
w/seed GCAGCAU)
miRNA miRNA family miRNA Gene Ensemble Gene ID mRNA Exp name with seed Exp Log Symbol Fold sequence Ratio Change rpitiu--miR-107 --3p miR-i03-3p (and -0 , 617 ETNK1 ENSMUSG00000030275 3.249 other miRNAs
w/ seecl GCAGCA.U)
mmu-miR-107-3p m.iR-103-3p (and -0 , 617 F0XC1 ENSMUSG00000050295 2.291 other miRNAs
w/seed GCAGCAU)
mmu-miR—107-3p miR-103-3p !and -0.617 GNAI3 ENSMUSG00000000001 2.247 o her miRNAs
w/seed GCAGCAU)
mrnu-miR-lC7-3p miR-103-3p (and -0.617 G0SR2 ENSMUSG00000020946 2.147 other miRNAs
w/seed GCAGCAU)
mmu-miR-107-3p miR-i03-3p (and -0.617 ILI 5 ENSMUSG00000031712 2.117 other miRNAs
w/seed GCAGCAU)
ramu-miR-107-3p miP.-103-3p {and -0 , 617 IQGAP1 EMSMUSGO 0000030536 2.301 other miRNAs
w./ seed GCAGCAU)
mmu-roiR-107-3p miR-103-3p (and. -0,617 KPNA1 ENSMUSG00000022905 2.196 other miRNAs
w/seed GCAGCAU)
ramu-raiR-107-3p miR-103-3p (and -0.617 LATS2 EMSMUSGO 0000021959 2.051 o her miRNAs
w/seed GCAGCAU)
mmu-raiR-107-3p miR-103-3p (and -0.617 LRRK2 ENSMUSG00000036273 2.663 other miRNAs
w/seed GCAGCAU)
mmu-miR-107-3p miR-i03-3p (and -0.617 NEDD9 ENSMUSG00000021365 2.542 other miRNAs
w/seed GCAGCAU)
mmu-miR-107-3p miP.-103-3p (and -0 , 617 NFIB EMSMUSGO 0000008575 2.007 other miRNAs
w/ seed GCAGCAU)
mmu-m R-107-3p miR-103-3p (and -0.617 NPR3 EMSMUSGO 0000022206 9.254 other miRNAs
w/seed GCAGCAU)
mmu-miR-107-3p miR-103-3p (and -0.617 PLAGL1 EMSMUSGO 0000019817 2.623 o her miRNAs
w/seed GCAGCAU)
mrnu-miR-lC7-3p miR-103-3p (and -0.617 REST ENSMUSG00000029249 2.113 other miRNAs
w/seed GCAGCAU)
mmu-miR-107-3p miR-i03-3p (and -0.617 SDCBP ENSMUSG0000002S249 2.811 other miRNAs
w/seed GCAGCAU)
ramu-miR-107 -3p miP.-103-3p (and -0 , 617 SGMS2 EMSMUSGO 0000050931 3.850 other miRNAs
w/ seed GCAGCAU)
mmu-miR-107-3p miR-103-3p (and -0.617 SPRY1 ENSMUSG00000037211 2.745 other miRNAs
w/seed GCAGCAU)
mmu-miR-107-3p miR-103-3p (and -0.617 UBE2Q1 EMSMUSGO 0000042572 2.323 other miRNAs
w/seed GCAGCAU)
mrnu-miR-lC7-3p miR-103-3p (and -0.617 USP6NL ENSMUSG00000039046 2.169 other miRNAs
w/seed GCAGCAU)
mmu-miR-107-3p miR-103-3p (and -0.617 VCL ENSMUSGO 0000021823 2.193 other miRNAs
w/seed GCAGCAU)
mmu-miR-10a-5p miR-i0a-5p (and -0 , 52 ABL2 ENSMUSG00000026596 2.094 other miRNAs
w/seed ACCCUGU)
miRNA miRNA family raiRNA Gene Ensemble Gene ID mENA Exp name with seed Exp Log Symbol Fold sequence Ratio Change rpitiu--miR-10a--5p miR-i0a-5p {and -0 , 52 ATP5F1 ENSMUSG00000000563 2.606 other miRNAs
w/seed ACCCUGU!
mmu--miR-10a--5p miR-10a-5p (and -0 , 52 BDH1 ENSMUSG00000046598 2.435 other miRNAs
w/seed ACCCUGU)
mmu-miR-i 0a-5p miR-10a-5p {and -0.452 CB 5 ENSMUSG00000009575 2.239 o her miRNAs
w/seed ACCCUGU)
mrnu-miR--10a- 5p miR-10a-5p (and -0.452 CFLAR ENSMUSG00000026031 2.797 other miRNAs
w/seed ACCCUGU)
mmu-raiR-10a-5p miR-i0a-5p (and -0.452 CREB1 ENSMUSG00000025958 2.764 other miRNAs
w/seed ACCCUGU)
mmu-ra -lOa-5p miR-10a-5p (and -0.452 H3F3A/H3 ENSMUSGO0000016 59 2.079 other miRNAs F3B
w/seed ACCCUGO)
mmu-miR-lOa- 5p miR-10a-5p (and -0.452 DUFA4 ENSMUSG00000029632 2.041 other miRNAs
w/ seed ACCCUGU)
mmu-miR--1 Ca- 5p miR-10a-5p (and -0.452 NDUFB6 ENSMUSG00000071014 2.495 other miRNAs
w/seed ACCCUGU)
mmu-raiP-10a-5p miP.-10a-5p (and -0.452 NR2 F2 ENSMUSG00000030551 2.586 other miRNAs
w/seed ACCCUGU)
mmu-miR-10a-5p miR-10a-5p (and -0.452 RBBP7 ENSMUSG00000031353 2.082 other miRNAs
w/seed ACCCUGU)
mmu-raiR-lOa-5p miR-10a-5p (and -0.452 RNGTT ENSMUSG00000028274 2.617 o her miRNAs
w/seed ACCCUGU)
mmu-miR-1 Oa- 5p miR-10a-5p (and -0.452 SNRPB2 ENSMUSG00000008333 2.354 other miRNAs
w/seed ACCCUGU)
mmu-miR-10a-5p miR-i0a-5p (and -0.452 TWSG1 ENSMUSG00000024098 2.488 other miRNAs
w/seed ACCCUGU)
mmu- iR-10a-5p miP.-10a-5p (and -0.452 UA 1 ENSMUSG00000026670 2.160 other miRNAs
w/seed ACCCUGU!
mmu-miR-128 -3p miR-128-3p (and -0.394 ABL2 ENSMUSG00000026596 2.094 other miRNAs
w/seed CACAGUG)
mmu-rai.R-128-3p miR-128-3p (and -0.394 BMPR2 ENSMUSG00000067336 3.499 o her miRNAs
w/seed CACAGUG)
mmu-miR-128- 3p miR-128-3p (and -0.394 CB 5 ENSMUSG00000009575 2.239 other miRNAs
w/ seed CACAGUG)
mmu-miR-128-3p miR-12S-3p (and -0.394 CCNG1 ENSMUSG00000020326 2.425 other miRNAs
w/seed CACAGUG)
mmu-miP-128-3p miP.-128-3p (and -0.394 CREB1 ENSMUSG00000025958 2.764 other miRNAs
w/ seed CACAGUG!
mmu-miR-128 -3p miR-128-3p (and -0.394 ENAH ENSMUSG00000022995 2.442 other miRNAs
w/seed CACAGUG)
mmu-miR-128-3p miR-128-3p (and -0.394 ENPEP ENSMUSG00000028024 2.888 o her miRNAs
w/seed CACAGUG)
miRNA miRNA family miRNA Gene Ensemble Gene ID mNA Exp name with seed Exp Log Symbol Fold sequence Ratio Change rpitiu--miR-128 --3p miR-128-3p {and -0 , 394 GNA.13 ENSMUSG00000020611 2.505 other miRNAs
w/ seed CACAGUG!
mmu-raiR-128-3p miR-128-3p (and -0.394 G0SR2 ENSMUSGO 0000020946 2.147 other miRNAs
w/ seed CACAGUG)
mmu-miR~128-3p miR-12S-3p (and -0.394 GPD2 ENSMUSGO 0000026827 2.526 other miRNAs
w/seed CACAGUG)
mmu-miR-128-3p miR-128-3p (and -0 , 394 GPX8 ENSMUSGO 0000021760 2.216 other miRNAs
w/ seed CACAGUG!
mmu-miR-128 -3p miR-128-3p (and -0 , 394 H3F3A/H3 ENSMUSG00000016559 2.079 other miRNAs F3B
w/seed CACAGUG)
mmu-miR-128-3p miR-123-3p (and -0.394 IL13RA1 ENSMUSG00000017057 2.672 o her miRNAs
w/seed CACAGUG)
mmu-miR--128-3p miR-128-3p (and -0.394 JAG1 ENSMUSGO 0000027276 2.578 other miRNAs
w/seed CACAGUG)
mmu-miR-128-3p miR-12S-3p (and -0.394 MAP2K4 ENSMUSGO 00000333 2 2.315 other miRNAs
w/seed CACAGUG)
mmu-miR-128-3p miR-128-3p (and -0.394 MET ENSMUSG00000009376 3.742 other miRNAs
w/ seed CACAGUG!
mmu-miR-128 -3p miR-128-3p (and -0.394 NCS 1 ENSMUSG00000062661 2.041 other miRNAs
w/seed CACAGUG)
mmu-miR-128-3p miR-123-3p (and -0.394 NFIB ENSMUSG00000008575 2.007 other miRNAs
w/seed CACAGUG)
mmu-miR-128- 3p miR-128-3p (and -0.394 NR2F2 ENSMUSG00000030551 2.566 other miRNAs
w/seed CACAGUG)
mmu-miR-128-3p miR-12S-3p (and -0.394 PAICS ENSMUSGO 000002924' 2.830 other miRNAs
w/seed CACAGUG)
mmu-miR-128-3p miR-128-3p (and -0.394 PDGE'RA ENSMUSGO 0000029231 4.314 other miRNAs
w/ seed CACAGUG!
mmu-miR-128 -3p miR-128-3p (and -0.394 PLAGL1 ENSMUSGO 0000019817 2.623 other miRNAs
w/seed CACAGUG)
mmu-miR-128-3p miR-123-3p (and -0.394 PAPIB ENSMUSGO 0000052681 2.202 other miRNAs
w/seed CACAGUG)
mmu-miR-128- 3p miR-128-3p (and -0.394 RARB ENSMUSGO 0000017491 5.626 other miRNAs
w/seed CACAGUG)
mmu-miR-128-3p miR-12S-3p (and -0.394 RND3 ENSMUSG0000001 144 3.396 other miRNAs
w/ seed CACAGUG)
mmu-miR-128-3p miR-128-3p (and -0.394 RNGTT ENSMUSGO 0000028274 2.617 other miRNAs
w/ seed CACAGUG!
mmu-miR-128-3p miR-128-3p (and -0.394 SCD ENSMUSGO0000037071 3.883 other miRNAs
w/seed CACAGUG)
mmu-miR-128-3p miR-123-3p (and -0.394 S0CS5 ENSMUSG00000037104 2.547 other miRNAs
w/seed CACAGUG)
miRNA miRNA family raiRNA Gene Ensemble Gene ID mENA Exp name with seed Exp Log Symbol Fold sequence Ratio Change rpitiu--miR-128 --3p miR-128-3p {and -0 , 394 S0CS6 ENSMUSG00000056153 2.285 other miRNAs
w/ seed CACAGUG!
mmu-miR-128 -3p m.iR-128-3p (and -0 , 394 SPRY2 ENSMUSG00000022114 5 ,249 other miRNAs
w/seed CACAGUG)
mmu-miR-128-3p miR-128-3p {and -0.394 TJP2 ENSMUSG00000024812 2.427 o her miRNAs
w/seed CACAGUG)
mmu-miR--128-3p miR-128-3p (and -0.394 TSPAN6 ENSMUSG00000067377 3.462 other miRNAs
w/seed CACAGUG)
mmu-miR-129-2-3p miR-129-l-3p -0.623 ACSBGi ENSMUSG00000032281 5.491
(and other
miRNAs w/seed
AGCCCUU )
mmu--miR-129--2 --3p miR-129-l-3p -0 , 623 BMPR2 ENSMUSG00000067336 3.499
(and other
miRNAs w/seed
AGCCCUU )
mmu-miR-129-2-3p miR-129-l-3p -0.623 CDC42EP3 ENSMUSG00000036533 2.130
(ar.d other
miRNAs w/seed
AGCCCUU )
mmu-miP.-129-2-3p miP.-129-l-3p -0 , 623 D0K4 ENSMUSG00000040631 3.290
(and other
miRNAs w/seed
AGCCCUU )
mmu--miR-129--2 --3p miR-129-l-3p -0 , 623 DYRK3 ENSMUSG00000016526 6.277
(and other
miRNAs w/seed
AGCCCUU )
mmu-miR-129-2-3p miR-129-l-3p -0.623 GJA1 ENSMUSG00000050953 3.399
(and other
miRNAs w/seed
AGCCCUU )
mmu-miR-129-2-3p miP.-129-l-3p -0 , 623 GNA13 ENSMUSG00000020611 2.505
(and other
miRNAs w/seed
AGCCCUU )
mmu-miR-129-2-3p miR-129-l-3p -0.623 H3F3A/H3 ENSMUSG00000016559 2.079
(and other F3B
miRNAs w/seed
AGCCCUU)
mmu-miR-129- 2-3p miR-129-l-3p -0.623 HSPA4 ENSMUSG00000020361 2.152
(and other
miRNAs w/seed
AGCCCUU )
mmu-miR-129-2-3p miP.-129-l-3p -0 , 623 MAP2K4 ENSMUSG00000033352 2.315
(and other
miRNAs w/seed
AGCCCUU )
mmu-miR-129-2-3p miR-129-l-3p -0.623 PERP ENSMUSG00000019851 3.004
(and other
miRNAs w/seed
AGCCCUU)
mrnu-miR-129-2-3p miR-129-l-3p -0.623 PPMID ENSMUSG00000020525 2.066
(and other
miRNAs w/seed
AGCCCUU )
mmu-miP-129-2-3p miP.-129-l-3p -0.623 PRPF40A ENSMUSG00000061136 2.542
(and other
miRNAs w/seed
AGCCCUU )
miRNA miRNA family raiRNA Gene Ensemble Gene ID mENA Exp name with seed Exp Log Symbol Fold sequence Ratio Change rpitiu--miR-129-2 --3p miR-129-l-3p -0 , 623 RAPIB ENSMUSG00000052681 2.202
(and other
miRNAs w./seeel
AGCCCUU }
mmu-miR-129-2-3p miR-129-l-3p -0.623 VTI1A ENSMUSG00000024983 2.031
(and other- miRNAs w/seed
AGCCCUU)
mmu-miR~1306--3p miR-1306-3p 0, 466 AHCYL2 ENSMUSG00000029772 -2.155
(miRNAs w/seed
CGUUGGC)
mmu-miR-1306- 3p miP.-1306-3p 0.468 ARFIP2 ENSMU3G00000030881 -2.083
(miRNAs w/seed
CGUUGGC)
mmu--miR-136--5p miR-136-5p -0 , 440 ARC ENSMUSGO 0000005871 2.949
(mi NAs w/seed
CUCCAUU )
mmu-m R-136-5p miR-136-5p -0.440 ATP5F1 ENSMUSG00000000 63 2.608
(miRNAs w/seed
CUCCAUU )
mmu-miR-136- 5p miR- 136-5p -0. 40 EMPR2 ENSMUSG00000067336 3.499
(miRNAs w/seed
CUCCAUU )
mmu-miR-136-5p miR-136-5p -0.440 ENAK ENSMUSG00000022995 2.442
(miRNAs w/seed
CUCCAUU )
mmu-miR-136-5p miR- 136- 5p -0. 40 GDI2 ENSMUSG00000021218 2.183
(miRNAs w/seed
CUCCAUU )
mmu-miR-136--5p miR- 136-5p -0. 40 HS3ST1 ENSMUSG00000051022 2.430
(miRNAs w/ seed
CUCCAUU )
mmu-miR-136-5p miR-136-5p -0.440 HSPA13 ENSMUSG00000032932 2.190
(miRNAs w/seed
CUCCAUU )
mmu-miR-136- 5p miR- 136-5p -0. 40 MAP2K4 ENSMUSG00000033352 2.315
(miRNAs w/seed
CUCCAUU )
mmu-miR-136- 5p miR- 136-5p -0.440 NDUFA4 ENSMUSG00000029632 2.041
(miRNAs w/ s eed
CUCCAUU )
mmu-miR-136-5p miR- 136- 5p -0. 40 NFIB ENSMUSG00000008575 2.007
(miRNAs w/seed
CUCCAUU )
mmu-miR-136-5p miR- 136-5p -0. 40 NR2F2 ENSMUSG00000030551 2.586
(miRNAs w/ seed
CUCCAUU )
mmu-miR-136-5p miR-136-5p -0.440 PTPRK ENSMUSG00000019889 3.050
(miRNAs w/seed
CUCCAUU )
mmu-miR-136- 5p miR- 136-5p -0. 40 P.NGTT ENSMUSG00000028274 2.617
(miRNAs w/seed.
CUCCAUU )
mmu-miR-136-5p miR-136-5p -0.440 TWSG1 ENSMUSG0000002 098 2.488
(miRNAs w/seed
CUCCAUU )
mmu-miR-151-5p miR-151-5p (and -0.433 HS3ST1 ENSMUSG00000051022 2.430 other miRNAs
w/ seed CGAGGAG)
mmu-miR-151 -5p miR- 151-5p (and -0.433 IQGAP1 ENSMUSG00000030536 2.301 other miRNAs
w/seed CGAGGAG)
mmu-miR-154-5p miR-lS4-5p -0. 90 CLTC ENSMUSG00000047126 2.604
(miRNAs w/seed
miRNA miKNA family raiBNA Gene Ensemble Gene ID mENA Exp name with seed Exp Log Symbol Fold sequence Ratio Change
AGGUUAU )
mmu-miR-154-5p miR-lS4-5p -0. 90 F2R ENSMUSGO 000004 S 376 2.615
(miRNAs vi/seed
AGGUUAU )
mrnu-miR--154-- 5p miR-154-5p -0.490 NT5E ENSMUSG00000032420 5.649
(miRNAs ¾'./ s eeci
AGGUUAU )
mmu-miR-l 54-5p miR-154-5p -0. 90 PLAGL1 ENSMUSGO 0000019817 2.623
(miRNAs w/seed
AGGUUAU }
mmu--miR-154 --5p miR-154-5p -0. 90 SULT1E1 ENSMUSG00000029272 3.276
(miRNAs w/seed
AGGUUAU }
mmu-miR~1 4-5p miR-154-5p -0.490 UBE2A ENSMUSGO 0000016308 2.073
(miRNAs w/ seed
AGGUUAU )
mmu-miR-15a-5p miR-16-5p (and -0.550 ABL2 ENSMUSGO 0000026596 2.094 o her miRNAs
w/ seed AGCAGCA)
mrnu-miR-15a- 5p miR-16-5p (and -0.550 ACSBG1 ENSMUSG00000032281 5.491 other miRNAs
w/seed AGCAGCA)
mmu-miP.-l 5a-5p miP.-16-5p (and -0.550 ADSS ENSMUSGO 0000015961 3.114 other miRNAs
w/seed AGCAGCA)
mmu- iR-15a-5p miR-i6-5p (and -0.550 ATF6 ENSMUSG00000026663 2.031 other miRNAs
w/seed AGCAGCA)
mmu-m R-1 a-5p miR-16-Sp (and -0.550 BAIAP2 ENSMUSGO 0000025372 2.417 other miRNAs
w/seed AGCAGCA)
mmu-miR-15a- 5p miR-16-5p (and -0.550 CB 5 ENSMUSG00000009575 2.239 other miRNAs
w/ seed AGCAGCA)
mrnu-miR-15a- 5p miR-16-5p (and -0.550 DDX3X ENSMUSGO 0000000787 2.250 other miRNAs
w/seed AGCAGCA)
mmu-miP.-l 5a-5p miP.-16-5p (and -0.550 DLL1 ENSMUSGO 000001 773 3.580 other miRNAs
w/seed AGCAGCA)
mmu-miR-15a-5p miR-16-Sp (and -0.550 DMPK ENSMUSG00000030409 2.017 other miRNAs
w/seed AGCAGCA)
mmu-miR-1 a-5p miR-16-Sp (and -0.550 DNAJA2 ENSMUSGO 0000031701 2.120 other miRNAs
w/seecl AGCAGCA)
mmu-miR-15a- 5p miR-16-5p (and -0.550 DNAJB4 ENSMUSGO 0000028035 2.498 other miRNAs
w/ seed AGCAGCA)
mmu-miR-15a-5p miP.-i6-5p (and -0. 50 DSEL ENSMUSG00000038702 2.015 other miRNAs
w/seed AGCAGCA)
mmu-miP.-l 5a-5p miP.-16-5p (and -0.550 DUSP10 ENSMUSGO 0000039384 3.222 other miRNAs
w/ seed AGCAGCA)
mmu-miR-15a-5p miR-16-Sp (and -0.550 EIF1AX ENSMUSGO 0000057561 2.244 other miRNAs
w/seed AGCAGCA)
mmu-miR-15a-5p miR-16-5p (and -0.550 EIF4G2 ENSMUSGO 0000005610 2.043 other miRNAs
w/seed AGCAGCA)
mmu-miR-15a- 5p miR-16-5p (and -0.550 ENAK ENSMUSGO 0000022995 2.442 other miRNAs
miRNA miKNA family raiBNA Gene Ensemble Gene ID mENA Exp name with seed Exp Log Symbol Fold sequence Ratio Change w/seed AGCAGCA)
mmu-miR-15a-5p miR-16-5p (and -0.550 ETNK1 ENSMUSG00000030275 3.249 other miRNAs
w/ seed AGCAGCA)
mrnu-miR--15a- 5p miR-16-5p (and -0.550 FGF1 ENSMUSG00000036585 5.095 other miRNAs
w/seed AGCAGCA)
mmu-miP.-l 5a-5p miP.-16-5p (and -0.550 F0SL1 ENSMUSGO 0000024912 3.373 other miRNAs
w/seed AGCAGCA)
mmu--miR-15a--5p miR-16-5p (and -0.550 GABPA ENSMUSGO 0000008976 2.774 other miRNAs
w/seed AGCAGCA)
mmu-m R-1 a-5p miR-16-5p (and -0. 50 GNA13 ENSMUSGO 0000020611 2.505 other miRNAs
w/seecl AGCAGCA)
mmu-miR-15a-5p miR-16-5p (and -0.550 GNAI3 ENSMUSGO 0000000001 2.247 other miRNAs
w/ seed AGCAGCA)
mmu-miR-15a- 5p miR-16-5p (and -0.550 H3F3A/H3 ENSMUSGO0000016559 2.079 other miRNAs F3B
w/ seed AGCAGCA)
mrnu-miR-15a- 5p miR-16-5p (and -0.550 HSPA L ENSMUSGO 0000025757 5.164 other miRNAs
w/seed AGCAGCA)
mmu-miP-15a-5p miP.-16-5p (and -0.550 IDH3A ENSMUSGO 0000032279 2.423 other miRNAs
w/seed AGCAGCA)
mmu-miR-15a-5p miR-16-Sp (and -0.550 ILI5 ENSMUSG00000031712 2.117 other miRNAs
w/seed AGCAGCA)
mmu-miR-15a-5p miR-16-5p (and -0.550 KPNA1 ENSMUSGO 0000022905 2.196 other miRNAs
w/seed AGCAGCA)
mmu-miR-15a- 5p miR-16-5p (and -0.550 KRAS ENSMUSG00000030265 2.071 other miRNAs
w/seed AGCAGCA)
mrnu-miR-15a- 5pi miR-16-5p (and -0.550 LATS2 ENSMUSG00000021959 2.051 other miRNAs
w/seed AGCAGCA)
mmu-miP-15a-5p miP.-16-5p (and -0.550 MAP2K1 ENSMUSGO 0000004936 2.173 other miRNAs
w/ seed AGCAGCA)
mmu-miR-15a-5p miR-16-Sp (and -0.550 MAP2K4 ENSMUSG00000033352 2.315 other miRNAs
w/seed AGCAGCA)
mmu-miR-1 a-5p miR-16-Sp (and -0.550 MCL1 ENSMUSGO0000038612 3.779 other miRNAs
w/seed AGCAGCA)
mmu-miR-15a- 5p miR-16-5p (and -0.550 NC0A4 ENSMUSGO 000005623 2.163 other miRNAs
w/seed AGCAGCA)
mmu-miR-1 a-5p miR-i6-5p (and -0. 50 NCS 1 ENSMUSG00000062661 2.041 other miRNAs
w/seed AGCAGCA)
mmu-miP-15a-5p miP.-16-5p (and -0.550 NEDD9 ENSMUSGO 0000021365 2.542 other miRNAs
w/ seed AGCAGCA)
mmu-miR-15a-5p miR-16-Sp (and -0.550 NPR3 ENSMUSGO0000022206 9.254 other miRNAs
w/seed AGCAGCA)
mmu-miR-15a-5p miR-16-5p (and -0.550 PLAGL1 ENSMUSGO0000019817 2.623 other miRNAs
miRNA rniKNA family raiBNA Gene Ensemble Gene ID mENA Exp name with seed Exp Log Symbol Fold sequence Ratio Change w/seed AGCAGCA)
mmu-miR-15a-5p miR-16-5p (and -0.550 PPM1D ENSMUSG00000020525 2.066 other mi NAs
w/ seed AGCAGCA)
mrnu-miR--15a- 5p miR-16-5p (and -0.550 PTGS2 ENSMUSGOOOOOO32487 32.609 other miRNAs
w/seed AGCAGCA)
mmu-miP.-l 5a-5p miP.-16-5p (and -0.550 RARB ENSMUSGO 0000017491 5.626 other miRNAs
w/seed AGCAGCA)
mmu--miR-15a--5p miR-16-5p (and -0.550 RFK EMSMUSGO 0000024712 2.120 other miRNAs
w/seed AGCAGCA)
mmu-m R-1 a-5p miR-16-Sp (and -0. 50 RTN4 ENSMUSGO 0000020458 2.207 other miRNAs
w/seecl AGCAGCA)
mmu-miR-15a-5p miR-16-5p (and -0.550 SEMA3D ENSMUSGO 0000040254 4.093 other miRNAs
w/ seed AGCAGCA)
mrnu-miR-15a- 5p miR-16-5p (and -0.550 SEPT11 ENSMUSG00000058013 2.263 other miRNAs
w/seed AGCAGCA)
mmu-miP-15a-5p miP.-16-5p (and -0.550 SGK1 ENSMUSGO 0000019970 2.706 other miRNAs
w/seed AGCAGCA)
mmu-miP.-15a-5p miR-16-5p (and -0.550 SIAlii ENSMUSG00000036840 2.464 other miRNAs
w/seed AGCAGCA)
mmu-miR-1 a-5p miR-16-Sp (and -0.550 SNRPB2 ENSMUSGO 0000008333 2.354 other miRNAs
w/seed AGCAGCA)
mmu-miR-15a- 5p miR-16-5p (and -0.550 S0CS6 ENSMUSG00000056153 2.265 other miRNAs
w/seed AGCAGCA)
mrnu-miR-15a- 5p miR-16-5p (and -0.550 SPTLC1 ENSMUSGO 0000021466 2.148 other miRNAs
w/seed AGCAGCA)
mmu-miP-15a-5p miP.-16-5p (and -0.550 UBE2Q1 ENSMU3G00000042572 2.323 other miRNAs
w/seed AGCAGCA)
mmu-miR-15a-5p miR-16-Sp (and -0.550 UGP2 ENSMUSGO 0000001891 2.457 other miRNAs
w/seed AGCAGCA)
mmu-miR-1 a-5p miR-16-Sp (and -0.550 USP6NL ENSMUSGO 0000039046 2.189 other miRNAs
/seed AGCAGCA)
mmu-miR-15a- 5p miR-16-5p (and -0.550 VCL ENSMUSGO0000021823 2.193 other miRNAs
w/ seed AGCAGCA)
mmu-miR-1 a-5p miR-i6-5p (and -0. 50 VTI1A ENSMUSGO 0000024983 2.031 other miRNAs
w/seed AGCAGCA)
mmu-miP-1839- 5p miP.-1839-5p -0, 99 CFLAR ENSMUSGO 0000026031 2.797
(and other
miR As w/seed
AGGUAGA)
mmu-miR-l 839-5p miR-1839-5p -0.499 ENSMUSGO0000019929 2.542
(and other
miRNAs w/seed
AGGUAGA)
mrnu-miR-1839-5p miR-1839-5p -0. 9 DNAJA2 ENSMUSG00000031701 2.120
(and other
miRNAs w/seed
AGGUAGA)
miRNA miRNA family miRNA Gene Ensemble Gene ID mRNA Exp name with seed Exp Log Symbol Fold sequence Ratio Change rpitiu--miR-1839-- 5p miR-1839-5p -0 , 99 EIF4G2 ENSMUSG00000005610 2.043
(and other
miRNAs w./seecl
AGGUAGA)
nsmu-miR-1839-5p miR- 1839-5 -0.499 FOS ENSMUSG000000212 0 10.974
(and other
m RRAs w/seed
AGGUAGA;
mmu-miR--1839--S miR- iS39~5p -0.499 HSPA4 L ENSMU5G00000025757 5.18
(and other
miRNAs w/seed
AGGUAGA)
rami-miR-1839-- 5p miR-1839-5p -0. 99 IDH3A ENSMUSG00000032279 2.423
(and other
miRNAs w/seed
AGGUAGA)
AGGUAGA)
nsmu-raiR-183 - miR- IS 39-5p -0. ^ PARE ENSMU3G000000 74S1 5.626
(and other
miRNAs w/seed
AGGUAGA)
mmu-miR-1839-5p miR-1839-5p -0.499 SEPT7 EMSMUSGO 0000001833 2.942
(and other
miRNAs w/seed
AGGUAGA)
mmu-miR-1839-Sp miR-1839-5p -0.499 TSPAN6 ENSMUSG00000067377 3.482
(and other- mi RNAs w/seed
AGGUAGA)
tranu-raiR-185-5p miP-iS5-5p (and -0.475 ABCG1 ENSMU3G00000024030 6.417 other miRNAs
w/seed GGAGAGA)
mmu-miR-185-5p miR- 185- 5p (and -0.475 ABL2 ENSMUSG00000026596 2.094 other miRNAs
w./ seed GGAGAGA)
mmu-miR-185-5p miR- 185- p (and -0.475 ATP2A2 EMSMUSGO 0000029467 2.144 other miRNAs
w/seecl GGAGAGA)
mmu-miR-185-5p miR- 185-5p (and -0.475 BDK1 EMSMUS600000046598 2.425 other miRNAs
w/ seed GGAGAGA)
mmu-miR--185-- 5pi miP,-iS5-5p (and -0.475 BMPR2 ENSMUSG00000067336 3.499 other miRNAs
v?/seed GGAGAGA)
inmu-raiR-185-5p miR-185-5p (and -0.475 CB 5 ENSMUSGO 0000009575 2.239 other miRNAs
w/seed GGAGAGA)
mmu-miR-185-5p miR- 185- 5p (and -0.475 C LAR ENSMUSG00000026031 2.797 other miRNAs
w/ se d GGAGAGA)
rami-mi -185- bp miR- 185- p (and -0.475 ENAH EMSMUSGOOOOOO22995 2.442 other miRNAs
w/s ed GGAGAGA)
romu-raiR-185-5p miR-185-5p (and -0.475 F13A1 EMSMUSGO 0000039109 2.902 o her miRNAs
w/seed GGAGAGA)
mmu.-raiR-185- 5pi miR-185-5p (and -0.475 GJA1 ENSMUSG00000050953 3.399 other miRNAs
•w/seed GGAGAGA)
miRNA miRNA family miRNA Gene Ensemble Gene ID mRNA Exp name with seed Exp Log Symbol Fold sequence Ratio Change rpitiu--miR-185--5p miR-185-5p (and -0 , 75 GNA13 ENSMUSG00000020611 2.505 other miRNAs
w/ seed GGAGAGA)
mmu--miR-185--5p miR-185-5p (and -0 , 475 G0SR2 ENSMUSG00000020946 2.147 other miRNAs
/seecl GGAGAGA)
mmu-miR-185-5p miR-185-5p {and -0. 75 GP 8 ENSMUSG00000021760 2.216 o her miRNAs
w/ seed GGAGAGA)
mmu.-miR--185-- 5p rriiR- 18S-5p (and -0.475 HSPA4 BNSMUSGO0000020361 2.152 other miRNAs
w/seed GGAGAGA)
mmu-miR-185-5p miR-185-5p (and -0.475 IQGAPi ENSMUSG00000030536 2.301 other miRNAs
w/seed GGAGAGA)
ramu-miR-185-5p miR-185-5p (and -0.475 LRRK2 ENSMUSG00000036273 2.683 other miRNAs
w/ seed GGAGAGA)
mmu-roiR-185--5p miR-185-5p (and. -0.475 NFIB ENSMUSG00000008575 2.007 other miRNAs
/seed GGAGAGA)
mmu-miR-185-5p miR-185-5p (and -0.475 RAB7A ENSMUSG00000079477 2.036 o her miRNAs
w/ seed GGAGAGA)
mmu-miR-185- 5p miR-185-5p (and -0.475 RHOA BNSMUSGO0000007815 2.225 other miRNAs
w/seed GGAGAGA)
mmu-miR-185~5p miR-185-5p (and -0.475 RRAS2 ENSMUSG00000055723 2.623 other miRNAs
w/seed GGAGAGA)
mrnu-raiR-185- 5p rriiR- 18S-5p (and -0.475 SEL1L BNSMUSG00000020964 2.894 other miRNAs
w/seed GGAGAGA)
mmu-miP.-185-5p miR-185-5p (and -0.475 SEMA3D ENSMU3G00000040254 4.093 other miRNAs
w/seed GGAGAGA)
mmu-miR-185-5p miR-185-5p (and -0.475 USP6NL ENSMUSG00000039046 2.189 other miRNAs
w/seed GGAGAGA)
mmu-miR-185-5p miR-185-5p (and -0.475 VTI1A ENSMUSG00000024983 2.031 o her miRNAs
w/seed GGAGAGA)
mmu-miR-185- 5p miR-185-5p (and -0.475 Y IIAG BNSMUSGO0000051391 2.172 other miRNAs
w/seed GGAGAGA)
mmu-miR-1S6b-5p miR-196a-5p -0 345 ABL2 ENSMUSG00000026596 2.094
(and other
miRNAs w/seed
AGGUAGU )
ramu-miR-196b- 5p miR-196a-5p -0.345 ANXAl ENSMUSG00000024659 2.840
(and other
miRNAs w/seed
AGGUAGU )
mmu-miR-i 96b-Sp miR-196a-5p -0.345 IMPAD1 ENSMUSG00000066324 3.758
(and other
miRNAs w/seed
AGGUAGU )
mmu-miR-196b-5p miR-196a-5p -0.345 NCS 1 ENSMUSG00000062661 2.041
(and other
miRNAs w/seed
AGGUAGU )
mmu-miR-196b- 5p miR-196a--5p -0.345 NDUFB6 ENSMUSG00000071014 2.495
(and other
miRNAs w/seed
miRNA m±KNA family raiBNA Gene Ensemble Gene ID mENA Exp name with seed Exp Log Symbol Fold sequence Ratio Change
AGGUAGU )
mmu-miR-196b-5p miR-1 6a-5p -0.345 ENSMUSG00C00029231 4.314
(and other
miRNAs w/seed
AGGUAGU )
mmu-miR-196b-5p miP.-I96a-5p -0 345 PPP1CB ENSMUSG00000014956 2.198
(and other
miRNAs vi/seed
AGGUAGU }
mmu-miR-196b- 5p miR-196a-5p -0 , 345 PRMT3 ENSMUSG00000030505 2.215
(and other
miRNAs w/seed
AGGUAGU )
mm-miR-196b-5p miR-196a-5p -0.345 SDCBP ENSMUSG00000028249 2.811
(and other
miRNAs w/seed
AGGUAGU )
mmu-miP.-196b- 5p miP.-196a-5p -0 , 345 SLC25A5 ENSMUSG00000016319 2.187
(and other
miRNAs w/seed
AGGUAGU }
mmu-Iet- j miR-202-3p (and 0.471 ADCY9 ENSMUSG00000005580 -2.809 other miRNAs
w/seed GAGGUAU )
mmu-let-7 miR-202-3p {and 0, 471 CCND2 ENSMUSG00000000184 -3.473 o her miRNAs
w/seed GAGGUAU)
mmu-1 et-7 j miR-202-3p (and 0, 471 FGF11 ENSMUSG00000042826 -2.566 other miRNAs
w/seed GAGGUAU)
mmu-1 et-7 j miP.-202-3p (and 0.471 GALE ENSMUSG00000028671 -2.069 other miRNAs
w/seed GAGGUAU)
mmu-let-7 miR-202-3p {and 0.471 GHR ENSMUSG00000055737 -3.063 other miRNAs
w/seed GAGGUAU!
mmu- 1et-7 j miR-202-3p (and 0.471 GLI2 ENSMUSG00000048402 -4.067 other miRNAs
w/seed GAGGUAU)
mmu-let-7 j miR-202-3p {and 0, 471 HMMR ENSMUSGO 0000020330 -2.285 o her miRNAs
w/seed GAGGUAU)
mrnu-1 et-7 j miR-202-3p (and 0, 471 LIMK2 ENSMUSG00000020451 -2.121 other miRNAs
w/seed GAGGUAU)
mmu-1 et-7 j miR-202-3p (and 0.471 MGLL ENSMUSGO 0000033174 -4.457 other miRNAs
w/seed GAGGUAU)
mmu-let-7 miR-202-3p {and 0.471 NRTN ENSMUSGO 0000039481 - .231 other miRNAs
w/seed GAGGUAU)
mmu-let-7 miR-202-3p (and 0.471 P0U2F1 ENSMUSG00000026565 -2.418 other miRNAs
w/seed GAGGUAU)
mm-miR-210- 3p miR-210-3p -0.568 KPNA1 ENSMUSG00000022905 2.196
(miRNAs w/seed
UGUGCGU )
m u-miR-210-3p miR-210-3p -0.568 NDUFA4 ENSMUSG00000029632 2.041
(miRNAs w/ s eed
UGUGCGU )
mmu-miR-210-3p miP.-210-3p -0 , 586 PPP1CB ENSMUSG00000014956 2.196
(miRNAs -w/seed
UGUGCGU )
miRNA miRNA family raiRNA Gene Ensemble Gene ID mR A Exp name with seed Exp Log Symbol Fold sequence Ratio Change rpitiu--miR-210--3p miR-210-3p -0.586 RAB7A ENSMUSGO 0000079477 2.036
(miRNAs w/seed
UGUGCGU }
mmu--miR-210--3p miR-210-3p -0.586 RHOQ ENSMUSG0000002 1 3 2.392
(miRNAs w/seed
UGUGCGU )
mmu-raiR-210-3p miR-210-3p -0.568 SDHD ENSMUSG00000000171 2.272 jmiR As w/seed
UGUGCGU )
mmu-raiR-210-3p miR-210-3p -0.568 USP6NL ENSMUSG00000039046 2.169
(miRNAs w/ s eed
UGUGCGU )
mmu-miR~223-3p miR-223-3p -1.191 ACSL3 ENSMUSG00000032883 2.199
(miRNAs w/seed
GUCAGUU )
mmu--miR-223--3p miR-223-3p -1.191 APC ENSMUSGO 0000005871 2.949
(miRNAs w/seed
GUCAGUU }
mmu--!tiiR-223--3p miR-223-3p -1.191 CBX5 ENSMUSG00000009575 2.239
(miRNAs w/seed
GUCAGUU )
mmu-miR-223-3p miR-223-3p -1.191 CD44 ENSMUSG00000005087 4.121
(miRNAs w/seed
GUCAGUU )
mmu-miR--223-- 3p miR-223-3p -1.191 DSEL E SMUSG00000038702 2.015
(miRNAs w/ s eed
GUCAGUU)
tnmu-miR-223-3p miR-223-3p -1.191 DUSP10 ENSMUSG00000039384 3.222
(miRNAs w/seed
GUCAGUU )
mmu--miP.-223--3p miR-223-3p -1.191 GNA13 ENSMUSG00000020611 2.505
(miRNAs w/seed
GUCAGUU }
mmu-roiR-223-3p miR-223-3p -1.191 GP 8 ENSMUSG00000021760 2.216
(miRNAs w/seed
GUCAGUU )
mmu-miR-223-3p miR-223-3p -1.191 KPNA1 ENSMUSG00000022905 2.196
(miRNAs w/seed
GUCAGUU )
mmu-miR-223- 3p miR-223-3p -1.191 LNPEP ENSMUSGO 0000023845 2.236
(miRNAs w/ s eed
GUCAGUU)
tnmu-miR-223-3p miR-223-3p -1.191 NCS 1 ENSMUSG00000062661 2.041
(miRNAs w/seed
GUCAGUU )
mmu- iR-223-3p miR-223-3p -1.191 NFIB ENSMUSGO 0000008575 2.007
(miRNAs w/seed
GUCAGUU )
mmu-miR-223-3p miR-223-3p -1.191 PEN2 ENSMUSG00000027805 2.440
(miRNAs w/seed
GUCAGUU )
mmu-miR-223-3p miR-223-3p -1.191 RRAS2 ENSMUSG00000055723 2.623
(miRNAs w/seed
GUCAGUU )
mmu-miR-223- 3p miR-223-3p -1.191 3G S2 ENSMUSG00000050931 3.850
(miRNAs w/ s eed
GUCAGUU )
mmu-miR-223-3p miP.-223-3p -1.191 SIAH1 ENSMUSGO 00000368 0 2.464
(miRNAs -w/seed
GUCAGUU )
mmu-miP.-223-3p miR-223-3p -1.191 SLC23A2 ENSMUSG00000027340 3.091
(miP.NAs w/seed
GUCAGUU )
miRNA miKNA family raiBNA Gene Ensemble Gene ID mENA Exp name with seed Exp Log Symbol Fold sequence Ratio Change rpitiu--miR-223--3p miR-223-3p -1 ,191 ΐSPAN6 ENSMUSG00000067377 3.482
(miRNAs w/seed
GUCAGUU }
mmu--miR-223--3p miR-223-3p -1 , 191 UBE2A ENSMUSG00000016308 2.073
(miRNAs w/seed
GUCAGUU )
mmu-miR-223-3p miR-223-3p -1.191 USP6NL ENSMUSG00000039046 2.169 jmiR As w/seed
GUCAGUU )
mrnu-miR--223-- 3p miR-223-3p -1.191 VTI1A ENSMUSGO 0000024983 2.031
(miRNAs w/ s eed
GUCAGUU)
mmu-miR-26b~5p miR-26a-5p (and -0.442 ABL2 ENSMUSG00000026596 2.094 other miR As
w/seed UCAAGUA)
mmu--miR-26b--5p miR-26a-5p {and -0. 42 ACSL3 ENSMUSG00000032883 2.199 other miRNAs
w./ seed UCAAGUA)
mmu--miR-26b--5p miR-26a-5p (and. -0.442 BHLHE40 ENSMUSG00000030103 3.031 other miRNAs
w/seed UCAAGUA)
mmu-miR-26b-5p miR-26a-5p {and -0.442 CDH4 ENSMUSG00000000305 3.378 o her miRNAs
w/ seed UCAAGUA)
mmu-miR-26b- 5p miR-26a-5p (and -0.442 COX5A ENSMUSG00000000086 2.193 other miRNAs
w/seed UCAAGUA)
mmu-miR-26b-5p miR-26a-5p (and -0.442 CREB1 ENSMUSG00000025958 2.764 other miRNAs
w/seed UCAAGUA)
mmu-miR-26b-5p miR-26a-5p (and -0.442 DD 3 ENSMUSG00000000787 2.250 o her miRNAs
w/ seed UCAAGUA)
mmu-miR-26b- 5p miR-26a-5p (and -0.442 DNAJA2 ENSMUSG00000031701 2.120 other miRNAs
w/seed UCAAGUA)
mmu-miR-26b-5p miP.-26a-5p (and -0. 42 EIF4G2 ENSMUSGO 0000005610 2.043 other miRNAs
w/seed UCAAGUA)
mmu-miP.-26b-5p miR-26a-5p (and -0. 42 ENPEP ENSMUSGO 0000028024 2.886 other miRNAs
w/ seed UCAAGUA)
mmu-miR-26b-5p miR-26a-5p (and -0.442 ETNK1 ENSMUSG00000030275 3.249 other miRNAs
w/seed UCAAGUA)
mmu-miR-26b-5p miR-26a-5p (and -0.442 GNA13 ENSMUSG00000020611 2.505 o her miRNAs
w/ seed UCAAGUA)
mmu-miR-26b- 5p miR-26a-5p (and -0.442 GPX6 ENSMUSGO 0000021760 2.216 other miRNAs
w/seed UCAAGUA)
mmu-miR-26b-5p miR-26a-5p (and -0.442 HSPA13 ENSMUSG00000032932 2.190 other miRNAs
w/seed UCAAGUA)
mmu-miP.-26b-5p miR-26a-5p (and -0. 42 I PADi ENSMUSGO 0000066324 3.756 other miRNAs
w/ seed UCAAGUA)
mmu-miR-26b-5p miR-26a-5p (and -0.442 JAG1 ENSMUSG00000027276 2.578 other miRNAs
w/seed UCAAGUA)
mmu-miR-26b-5p miR-26a-5p (and -0.442 KPNA1 ENSMUSG00000022905 2.196 o her miRNAs
w/seed UCAAGUA)
miRNA miKNA family raiBNA Gene Ensemble Gene ID mBNA Exp name with seed Exp Log Symbol Fold sequence Ratio Change rpitiu--miR-26b--5p miR-26a-5p {and -0 , 42 LEF1 EMSMUSGO 0000027985 3.110 other miRNAs
w/ seed UCAAGUA)
mmu--miR-26b--5p miR-26a-5p (and. -0 , 442 MCL1 ENSMUSG00000038612 3 , 779 other miRNAs
w/seecl UCAAGUA)
mmu-miR-26b-5p miR-26a-5p (and, -0.442 MED23 EMSMUSGO 0000019984 3.078 o her miRNAs
w/seed UCAAGUA)
mmu-miR-26b- 5p miR-26a-5p (and -0.442 NC0A4 ENSMUSG00000056234 2.163 other miRNAs
w/seed UCAAGUA)
mmu-miR-26b-5p miR-26a-5p (and -0.442 NDUFA4 ENSMUSG00000029632 2.041 other miRNAs
w/seed UCAAGUA)
mmu-miR-26b-5p miP.-26a-5p (and -0. 42 PTGS2 EMSMUSGO 0000032487 32.809 other miRNAs
w/ seed UCAAGUA)
mmu-raiR-26b- 5p miR-26a-5p (and -0.442 PTP4A1 ENSMUSG00000026064 3.015 other miRNAs
w/seed UCAAGUA)
mtnu-miR-26b-5p miR-26a-5p (and -0.442 RABllA ENSMUSG00000004771 2.354 other miRNAs
w/seed UCAAGUA)
mmu-miP.-26b-5p miR-26a-5p (and -0.442 RDH14 EMSMUSGO 0000020621 2.459 other miRNAs
w/seed UCAAGUA)
mmu-miR-26b-5p miR-26a-5p (and, -0.442 REST EMSMUSGO 0000029249 2.113 other miRNAs
w/seed UCAAGUA)
mmu-miR-26b- 5p miR-26a-5p (and -0.442 P.FK ENSMUSGO 000002 712 2.120 other miRNAs
w/ seed UCAAGUA)
mmu-miR-26b- 5p miR-26a-5p (and -0.442 RHOQ ENSMUSG00000024143 2.392 other miRNAs
w/seed UCAAGUA)
mmu-miR-26b-5p miR-26a-5p (and -0.442 SGMS2 ENSMUSG00000050931 3.850 other miRNAs
w/seed UCAAGUA)
mmu-miP.-26b-5p miR-26a-5p (and -0.442 S0CS6 EMSMUSGO0000056153 2.285 other miRNAs
w/ seed UCAAGUA)
mmu-miR-26b-5p miR-26a-5p (and, -0.442 ANK EMSMUSGO 0000064289 2.412 other miRNAs
w/seed UCAAGUA)
mmu-miR-26b-5p miR-26a-5p (and -0.442 TJP2 EMSMUSGO 0000024812 2.427 other miRNAs
w/ seed UCAAGUA)
mmu-miR-297c-5p miR-297a~5p 0.456 TCF3 ENSMUSG00000020167 -2.051
(and other
miRNAs w/seed
UGUAUGU )
mmu-miR-2 7c- 5p miR-297a--5p 0.458 VEGFA EMSMUSGO0000023951 -2.301
(and other
miRNAs w/seed
UGUAUGU )
mmu-miR-3082-5p miR-3082-5p 1.393 A.RHGAPS/ ENSMUSGO00000789 4 -2.048
(and other PRR5- miRNAs w/seed ARHGAP8
ACAGAGU )
mmu-miR-3082-5p miR-3082~5p j ,393 CAMKK2 ENSMUSG00000029471 -2.518
(and other
miRNAs w/seed
ACAGAGU )
miRNA miKNA family raiBNA Gene Ensemble Gene ID mENA Exp name with seed Exp Log Symbol Fold sequence Ratio Change rpitiu--miR-3082-- 5p miR-3082-5p 1.393 DCTN4 ENSMUSGO 0000024603 -2.449
(and other
miRNAs w./seeel
ACAGAGU }
nsmu-roiR~31-5p miR-3i-5p (and 0.846 AGRN ENSMUSGO 0000041936 -2.455 o her miRNAs
w/seed GGCAAGA)
mmu-miR--3 l-5p miR-3i-5p (and 0.846 AGT ENSMUSGO0000031980 -2.307 other miRNAs
w/seed GGCAAGA)
mmu-miR~31-5p miR-31-5p (and 0.846 ARHGEF2 ENSMUSG00000028059 -2.467 other miRNAs
w/seed GGCAAGA)
mmu--miR-31-- 5p miR-31-5p (and 0.846 GLI2 ENSMUSG00000048402 -4.067 other miRNAs
w/seed GGCAAGA)
mmu--!tiiR-31-- 5p miR-31-5p (and 0.846 GRB10 ENSMUSG00000020176 -2.068 other miRNAs
w/seed GGCAAGA)
mmu-miR-31-5p miR-31-5p (and 0.846 GTF2E1 ENSMUSGO 0000022826 -2.294 other miRNAs
w/seed GGCAAGA)
mmu-miR--3 l-5p miR-3i-5p (and 0.846 NFAT5 ENSMUSGO 0000003847 -2.904 other miRNAs
w/seed GGCAAGA)
mmu--!tiiR-31-- 5p miR-31-Sp (and 0.846 P4HTM ENSMUSGO 0000006675 -2.462 other miRNAs
w/seed GGCAAGA)
mmu-miR-31-5p miR-31-5p (and 0.846 ENSMUSGO 0000026565 -2.418 other miRNAs
w/seed GGCAAGA)
mmu-miR-31 -5p miR-3i-5p (and 0.846 PTP 1 ENSMUSGO 0000027540 -2.681 other miRNAs
w/seed GGCAAGA)
mmu-miR-31-5p miP.-31-5p (and 0.846 SIN3B ENSMUSG00000031622 -2.142 other miRNAs
w/seed GGCAAGA)
mmu-miP.-31-5p miR-31-5p (and 0.846 TEP1 ENSMUSGO 0000006281 -2.161 other miRNAs
w/ seed GGCAAGA)
mmu-!tiiR-31- 5p miR-31-Sp (and 0.846 TNS 1 ENSMUSG00000055322 -5.238 other miRNAs
w/seecl GGCAAGA)
mmu-miR-329-3p miR-329-3p (and -0.486 ABCG1 ENSMUSGO 0000024030 6.417 other miRNAs
w/seed ACACACC)
mmu-miR-329-3p miR-329-3p (and -0.466 ABL2 ENSMUSGO 0000026596 2.094 other miRNAs
w/seed ACACACC)
mmu-miR-329-3p miP.-329-3p (and -0.486 ACPI ENSMUSGO 000004 573 2.745 other miRNAs
w/seed ACACACC)
mmu-miR-329-3p miR-329-3p (and -0.486 BCL10 ENSMUSGO 0000028191 2.713 other miRNAs
w/ seed ACACACC )
mmu-!tiiR-329-3p miR-329-3p (and -0.486 BHLHE40 ENSMUSG00000030103 3.031 other miRNAs
w/seed ACACACC)
mmu-miR-329-3p miR-329-3p (and -0.486 BMP7 ENSMUSGO 0000008999 2.365 other miRNAs
w/seed ACACACC)
mmu-miR-329- 3p miR-329-3p (and -0.466 BMPR2 ENSMUSG00000067336 3.499 other miRNAs
w/seed ACACACC)
miRNA miRNA family raiRNA Gene Ensemble Gene ID mRNA Exp name with seed Exp Log Symbol Fold sequence Ratio Change rpitiu--miR-329--3p miR-329-3p {and -0 , 486 DPYSL2 ENSMUSG00000022048 3.089 other miRNAs
w/ seed ACACACC )
mmu--miR-329--3p miR-329-3p (and -0 , 86 DPYSL3 ENSMUSG00000024501 2.360 other miRNAs
/seecl ACACACC)
ramu-raiR-329-3p miR-329-3p 'and -0.486 DUSP10 ENSMUSG00000039384 3.222 o her miRNAs
w/seed ACACACC)
mrnu-miR-329-3p miR-329-3p (and -0.466 H3F3A/H3 ENSMUSG00000016559 2.079 other miRNAs F3B
w/seed ACACACC)
mmu-miR-329-3p miR-329-3p (and -0.486 MET ENSMUSGO 0000009376 3.742 other miRNAs
w/seed ACACACC)
mmu-miR-329-3p miR-329-3p {and -0.486 NDUFA4 ENSMUSG00000029632 2.041 other miRNAs
w/ seed ACACACC!
mmu--miR-329--3p miR-329-3p (and. -0.486 PERP ENSMUSG00000019851 3.004 other miRNAs
/seed ACACACC)
mmu-miR-329-3p miR-329-3p 'and -0.486 PLEKHA3 ENSMUSG00000002733 2.819 o her miRNAs
w/seed ACACACC)
mmu-miR-329- 3p miR-329-3p (and -0. 66 PRPF40A ENSMUSG00000061136 2.542 other miRNAs
w/seed ACACACC)
mmu-miR-329-3p miR-329-3p (and -0.486 REST ENSMUSG00000029249 2.113 other miRNAs
w/seed ACACACC)
mmu-miR-329-3p miR-329-3p {and -0.486 RFK ENSMUSGO 000002 712 2.120 other miRNAs
w./ seed ACACACC!
mmu-miR-329-3p miR-329-3p (and -0.486 SIAH'i ENSMUSG000000368 0 2.464 other miRNAs
/seed ACACACC)
mmu-miR-329-3p miR-329-3p 'and -0.486 SLC23A2 ENSMUSG00000027340 3.091 o her miRNAs
w/seed ACACACC)
mrnu-miR-329-3p miR-329-3p (and -0.466 S0CS6 ENSMUSG00000056153 2.265 other miRNAs
w/seed ACACACC)
mmu-miR~342-3p miR-342-3p -0.574 BMP7 ENSMUSG00000008999 2.385
(miRNAs w/seed
CUCACAC )
mmu- iR-342 -3p miR-342-3p -0.574 BMPR2 ENSMUSG00000067336 3.499
(miRNAs w/seed
CUCACAC )
mmu-miR-342-3p miR-342-3p -0. 74 CB 5 ENSMUSG00000009575 2.239
(miRNAs w/ seed
CUCACAC )
mmu-miR-342-3p miR-342-3p -0.574 DD 3 ENSMUSG00000000787 2.250
(miRNAs w/seed
CUCACAC )
mrnu-miR-342-3p miR-342-3p -0.574 GJA1 ENSMUSG00000050953 3.399
(miRNAs w/ s eed
CUCACAC )
mmu-miR-342-3p miP.-342-3p -0.574 G0SR2 ENSMUSG00000020946 2.147
(miRNAs w/seed
CUCACAC )
mmu-miP.-342 -3p miR-342-3p -0.574 IL11 ENSMUSG00000004371 12.369
(miRNAs w/seed
CUCACAC )
miRNA miKNA family raiBNA Gene Ensemble Gene ID mENA Exp name with seed Exp Log Symbol Fold sequence Ratio Change rpitiu--miR-342 --3p miR-342-3p -0 , 574 LATS2 EMSMUSGO 0000021959 2.051
(miRNAs w/seed
CUCACAC }
mmu--miR-342 --3p miR-342-3p -0 , 574 MAP1LC3B ENSMUSGO 0000031812 2 , 136
(miRNAs w/seed
CUCACAC )
mmu-miR-342-3p miR-342-3p -0.574 PDGFRA EMSMUSGO 0000029231 4.314 jmiR As w/seed
CUCACAC )
mmu-miR-342- 3p miR-342-3p -0.574 PFN2 ENSMUSGO 0000027805 2.440
(miRNAs ¾'./ s eed
CUCACAC )
mmu-miR-342-3p miP.-342-3p -0. 74 SEPTli ENSMUSG00000058013 2.283
(miRNAs w/seed
CUCACAC }
mmu--miP.-342 --3p miR-342-3p -0 , 574 SGMS2 ENSMUSGO 0000050931 3.850
(miRNAs w/seed
CUCACA }
mmu--miR-346--5p miR-346 (and 0.463 DCTN4 ENSMUSG00000024603 -2.449 other miRNAs
w/seed GUCUGCC)
mmu-miR-346-5p miR-346 (and 0, 463 DGKB ENSMUSGO 0000036095 -2.365 o her miRNAs
w/seed GUCUGCC)
mmu-miR-346- 5p miR-346 (and 0.463 FKBP5 ENSMUSGO 000002 222 -3.240 other miRNAs
w/seed GUCUGCC)
mmu-miR-3 6-5p miR-346 (and 0.463 GSTM5 ENSMUSG00000058135 -2.079 other miRNAs
w/seed GUCUGCC)
mmu-miP.-346-5p miR-346 (and 0.463 IRF8 ENSMUSG00000041515 -3.864 other miRNAs
w/seed GUCUGCC )
mmu-miR-3 6-5p miR-346 (and 0.463 PDE4A ENSMUSGO 0000032177 -2.713 other miRNAs
w/seed GUCUGCC)
mmu-miR-346-5p miR-346 (and 0, 463 P0U2 1 ENSMUSGO 0000026565 -2.418 o her miRNAs
w/seed GUCUGCC)
mmu-miR-346- 5p miR-346 (and 0, 463 TNS 1 ENSMUSG00000055322 -5.238 other miRNAs
w/seed GUCUGCC)
mmu-miR-346-5p miR-346 (and 0.463 UBTF ENSMUSG00000020923 -2.076 other miRNAs
w/seed GUCUGCC)
mmu-miP.-346-5p miR-346 (and 0.463 USP40 ENSMUSGO 0000005501 -2.523 other miRNAs
w/seed GUCUGCC )
mmu-miR-376c-3p miR-376c-3p -0.404 ANXA'i ENSMUSGO 0000024659 2.840
(and other
miRNAs w/seed
ACAUAGA)
mmu-miR-376c-3p MR- 376c-3p -0.404 APC ENSMUSGO 0000005871 2.949
(and other
miRNAs w/seed
ACAUAGA)
mmu-miR-376c- 3p miR-376c-3p -0,404 CREB1 ENSMUSG00000025958 2.764
(and other
miR As w/seed
ACAUAGA)
mmu-miR-376c-3p miR-376c-3p -0.404 CREM ENSMUSGO 0000063889 2.486
(and other
miRNAs w/seed
ACAUAGA)
miRNA miKNA family raiBNA Gene Ensemble Gene ID mENA Exp name with seed Exp Log Symbol Fold sequence Ratio Change mmu-miP.-376c- 3p miR-376c~3p -0 , 0 DCN ENSMUSG0000001 929 2.542
(and or.her
miR As w/seecl
ACAUAGA)
mmu-miR-376c~3p miR-376c-3p -0.404 ENSMUSG00000014773 3. 80
(and other
mi RNAs w/seed
ACAUAGA!
mmu --mj.R--376c--3p miR-376c- 3p -0.404 BNAJA2 EN3MU3G 0000031701 2.120
(and other
miRNAs w/seed
ACAUAGA)
mmu-miR-376c- 3p miR-376c-3p -0 , 404 ENPEP ENSMUSG00000028024 2.886
(and other
miRNAs w/seed
ACAUAGA)
mmu-miR-376c-3p miR-376c-3p -0.404 ENSMUSG00000030275 3.249
(and other- miR As w/s ed
ACAUAGA)
mmu-miR-376c-3p rn P.-376c-3p -0.404 NFIB ENS USG0000000 S 575 2.007
(and other
mi NAs w/seed
ACAUAGA.)
mmu-miR-376c- 3p miR~376c-3p -0.404 NP.2 F2 ENSMUSG00000030551 2.586
(and other
m NAs w/seed
A.CAUAGA i
mmu-miR-376c-3p miR-376c-3p -0.404 NUDT4 ENSMUSG00000020029 2.065
(and other
miRNAs w/seed
ACAUAGA)
mmu-miR-376c-3p miR-376c-3p -0.404 PDGFC ENSMUSG0000002 S 019 4.353
(and other
miRNAs w/seed
ACAUAGA)
mmu-miR-376c- 3p miR--.76c-.3p -0.404 PPP2CE ENSMUSG00000009630 2.086
(and other- miRNAs w/seed
ACAUAGA)
mmu-miR-376c-3p miR-376c- 3p -0.404 RARE EN3MUSG00000017491 5.626
( and ather
mi NAs w/s ed
ACAUAGA)
mmu-miR-376c- 3p miR-376c-3p -0. 04 SPRY1 ENSMUSG00000037211 2.745
(and other
miRNAs w/seed
ACAUAGA)
mmu-miR-376c- 3p miR-376c -3p -0.404 ANK E SMUSG00000064289 2.412
(and other
miRKAs w/seed
ACAUAGA)
mmu-miR-377-3p miR- 377-3ρ -0.426 ACSL3 EN3MU3G00000032883 2.199
(miRKAs w/seed
UCACACA)
mmu-miR-377-3p miR-377-3p -0.426 AF.ID B ENSMU3G000000,39219 2.28 S
(m RNAs. w/seed
CACACA!
mmu-miP.-377 -3p miP.-377-3p -0.426 AZIN1 E 3MUSG00000037458 2.161
(miRNAs w/seed
UCACACA)
mmu-miR-377 -3p miR-377-3p -0.426 BMP7 ENSMUSGO 0000008999 2.385
(miRNAs w/ seed
UCACACA)
miRNA miRNA family laiRNA Gene Ensemble Gene ID mRNA Exp name with seed Exp Log Symbol Fold sequence Ratio Change rpitiu--miR-377 --3p miR-377-3p --0.426 CUL1 ENSMUSGO 0000029686 2.610
(miRNAs w/seed
UCACACA)
mmu-miR-377-3p m.iR--377--3p -0. 26 DCN ENSMUSG00000019929 2.542
(miRNAs w/seed
UCACACA)
mmu-miR-377-3p miR-377-3p -0.426 DNAJB9 ENSMUSGO 0000014905 3.676 jmiR As w/seed
UCACACA)
mrnu-miR--377-- 3p rniR-377-3p -0.426 EIF4G2 ENS USG00000005610 2.043
(miRNAs w/ s eed
UCACACA)
mmu-raiR-377-3p miP.-377-3p -0.426 ENAK ENSMUSGO 0000022995 2.442
(miRNAs w/seed
UCACACA)
rami-miR-377 --3p miR-377-3p -0. 26 ETNK1 ENSMUSG00000030275 3.249
(miRNAs w/seed
UCACACA)
mmu-miR-377-3p miR--377--3p -0.426 ETS1 ENSMUSG00000032035 2.730
(miRNAs w/seed
UCACACA)
mmu-miR-377-3p miR-377-3p -0.426 GNAI3 ENSMUSGO 0000000001 2.247
(miRNAs w/seed
UCACACA)
rami-miR-377-- 3p miR--377-3p -0.426 GOSR2 ENSMUSGO 0000020946 2.147
(miRNAs w/ s eed
UCACACA)
mmu-raiR-377-3p miR-377-3p -0.426 H3F3A/H3 ENSMUSG00000016559 2.079
(miRNAs w/seed F3B
UCACACA)
rami-miR-377 --3p miR-377-3p -0. 26 IDS ENSMUSG00000035847 2.255
(miRNAs w/seed
UCACACA)
mmu-miR-377-3p miR-377-3p -0.426 JAG1 E SMUSG00000027276 2.578
(miRNAs w/seed
UCACACA)
ramu-raiR-377-3p miR-377-3p -0.426 LIG4 ENΞMUSG00000049717 3.615
(miRNAs w/seed
UCACACA)
mrnu-raiR--377-- 3p miR--377-3p -0.426 MAT2B ENSMUSG00000042032 3.072
(miRNAs w/ s eed
UCACACA)
mmu-raiR-377-3p miR-377-3p -0.426 NFIB ENSMUSG00000008575 2.007
(miRNAs w/seed
UCACACA)
rami-miR-377 --3p miR--377--3p -0.426 NR2 F2 ENSMUSGO 0000030551 2.586
(miRNAs w/seed
UCACACA)
mmu-mi -377-3p miR-377-3p -0.426 NT E ENSMUSGO 0000032420 5.649
(miRNAs w/seed
UCACACA)
ramu-raiR-377-3p miR-377-3p -0.426 PDGFRA ENSMUSGO 0000029231 4.314
(miRNAs w/seed
UCACACA)
mmu-raiR--377-- 3p miR--377-3p -0.426 PIAS1 ENSMUSG00000032405 2.262
(miRNAs w/ s eed
UCACACA)
mmu-miR-377-3p miR-377-3p -0.426 RFK ENSMUSGO 000002 712 2.120
(miRNAs -w/seed
UCACACA)
mmu--miP.-377 --3p miR-377-3p -0.426 SDCBP ENSMUSGO 0000028249 2.811
(miP.NAs w/seed
UCACACA)
miRNA miKNA family laiBNA Gene Ensemble Gene ID mENA Exp name with seed Exp Log Symbol Fold sequence Ratio Change rpitiu--miR-377 --3p miR-377-3p -0 , 426 SEMA3D ENSMUSGO 0000040254 4.093
(miRNAs w/seed
UCACACA)
mmu-miR-377-3p m.iR-377-3p -0 , 26 SE A3E ENSMUSG00000063531 4.494
(miRNAs w/seed
UCACACA)
mmu-miR—377-3p miR-377-3p -0. 26 SEPT11 ENSMUSG00000058013 2.283 jmiR As w/seed
UCACACA)
mmu-miR--377-- 3p miR-377-3p -0.426 SGK1 ENSMUSG00000019970 2.706
(miRNAs w/ s eed
UCACACA)
mmu-raiR-377-3p miP.-377-3p -0.426 8DCS6 ENSMUSG000000561 3 2.285
(miRNAs w/seed
UCACACA)
rami-miR-377 --3p miR-377-3p -0. 26 SPTLCi ENSMUSGO 0000021468 2.146
(miRNAs w/seed
UCACACA)
mmu-roiR- 116-- 5p miR-4271 (and 0.661 ADCY9 ENSMUSG00000005580 -2.809 other miRNAs
w/seed GGGGAAG)
mrnu-miR-711S-5 miR-4271 (and 0.661 AGRN ENSMUSGO 0000041936 -2.455 other miRNAs
w/ seed GGGGAAG)
mmu-raiR-7118- 5p miR-4271 (and 0.661 AHCYL2 ENSMUSGO 0000029772 -2.155 other miRNAs
w/seed GGGGAAG)
mmu-!tiiR-7118- 5p miR-4271 (and 0.661 ARHGEF2 ENSMUSG00000028059 -2.467 other miRNAs
w/seed GGGGAAG)
mmu-mi.R-7118-5p miR-4271 (and 0.661 ARHGEF6 ENSMUSG00000031133 -4.488 o her miRNAs
w/seed GGGGAAG)
mmu-raiR-7118-5p miR-4271 (and 0.661 DGKB ENSMUSGO 0000036095 -2.365 other miRNAs
w/ seed GGGGAAG)
mmu-miR-7118-5p miR-4271 (and 0.661 FKBP5 ENSMUSG00000024222 -3.240 other miRNAs
w/seed GGGGAAG)
mmu-raiP-7118- 5p miR-4271 (and 0.661 GLI2 ENSMUSGO 0000048402 -4.087 other miRNAs
w/ seed GGGGAAG)
mmu-!tiiR-7118- 5p miR-4271 (and 0.661 GSTM5 ENSMUSG00000058135 -2.079 other miRNAs
w/seed GGGGAAG)
mmu-miR-7118-5p miR-4271 (and 0.661 HTT ENSMUSGO 0000029104 -2.473 o her miRNAs
w/seed GGGGAAG)
mmu-raiR-7118-5p miR-4271 (and 0.661 TQGAP3 ENSMUSG00000028066 -3.249 other miRNAs
w/ seed GGGGAAG)
mmu-miR-7118-5p miR-4271 (and 0.661 LIMS2 ENSMUSG0000002 395 -2.293 other miRNAs
w/seed GGGGAAG)
mmu-raiP-7118- 5p miR-4271 (and 0.661 MARK2 ENSMUSGO 000002 969 -2.674 other miRNAs
w/ seed GGGGAAG)
mmu-!tiiR-7118- 5p miR-4271 (and 0.661 MEF2D ENSMUSG00000001419 -2.059 other miRNAs
w/seed GGGGAAG)
mmu-miR-7118-Sp miR-4271 (and 0.661 PAD12 ENSMUSGO0000028927 -4.296 o her miRNAs
w/seed GGGGAAG)
miRNA miRNA family miRNA Gene Ensemble Gene ID mRNA Exp name with seed Exp Log Symbol Fold sequence Ratio Change rpitiu--miR-7116-- 5p miR-4271 (and 0.661 PTPN1 ENSMUSG00000027540 -2.661 other miRNAs
w/ seed GGGGAAG!
mmu-miR-7118-- 5p miR-4271 (and 0.661 SLC6A1 ENSMUSG00000030310 -2.471 other miRNAs
w/seed GGGGAAG;
mmu-miR-7118-5p miR-4271 (and 0, 661 TA0K3 ENSMUSG00000061288 -2 , 058 o her miRNAs
w/seed GGGGAAG)
mrnu-miR-711S-5p miR-4271 (and 0, 661 THRA ENSMUSGO 0000058756 -2 , 267 other miRNAs
w/ seed GGGGAAG)
mmu-miR-7118-5p miR-4271 (and 0.661 TNS 1 ENSMUSGO 0000055322 -5.238 other miRNAs
w/seed GGGGAAG)
mmu-miR- 51a miR-451a (and -1 , 342 DPYSL3 ENSMUSG0000002 501 2.360 other miRNAs
w/ seed AACCGUU)
mmu--miR-451a miR-451a (and -1,342 NEDD9 ENSMUSG00000021365 2.542 other miRNAs
w/seed AACCGUU)
mmu-miR-45 la miR-451a (and -1.342 RAB5A ENSMUSG00000017831 2.245 o her miRNAs
w/ seed AACCGUU)
mmu-miR--451a miR-451a (and -1.342 SGK1 ENSMUSG00000019970 2.706 other miRNAs
w/seed AACCGUU)
mmu-miR-6931-5p miR-4651 (and 1.762 ACSSI ENS USG00000027 52 -3.399 other miRNAs
w/seed GGGGUGG)
mmu-miR-6931-- 5p miR-4651 (and 1.762 ADCY9 ENSMUSG00000005580 -2.809 other miRNAs
w/ seed GGGGUGG)
mmu-miR~6931- p miR-4651 (and 1.762 A.GRN ENSMUSGO 0000041936 -2.455 other miRNAs
w/seed GGGGUGG)
mmu-miR-6931-Sp miR-4651 (and 1, 762 ARHGDIA ENSMUSG00000025132 -2.091 o her miRNAs
w/seed GGGGUGG)
mrnu--miR--6931 --5p miR-4651 (and ARHGEF18 ENSMUSG00000004566 -3.373 other miRNAs
w/seed GGGGUGG)
mmu-miR-6931-5p miR-4651 (and 1.762 CABIN! ENSMUSG00000020196 -3.41 other miRNAs
w/seed GGGGUGG)
mmu- iR-6931- 5p miR-4651 (and 1.762 CAMKK2 ENSMUSG00000029471 -2.518 other miRNAs
w/ seed GGGGUGG!
mmu-m R-6931- p miR-4651 (and 1.762 C0L11A2 ENSMUSG00000024330
other miRNAs
w/seed GGGGUGG)
mmu-miR-6931-Sp miR-4651 (and 1, 762 COL20A1 ENSMUSG00000016356 - j 992 other miRNAs
w/seed GGGGUGG)
mrnu-miR-6931 -5p miR-4651 (and , 6 COL5A3 ENSMUSG00000004096 -2.623 other miRNAs
w/seed GGGGUGG)
mmu-miR-6931- 5p miR-4651 (and 1.762 COL8A2 ENSMU3G00000056174 -3.755 other miRNAs
w/seed GGGGUGG)
mmu-miP.-6931- 5p miR-4651 (and 1.762 DNM1 ENSMUSGO 0000026825 -2.473 other miRNAs
w/seed GGGGUGG)
miRNA miRNA family miRNA Gene Ensemble Gene ID mRNA Exp name with seed Exp Log Symbol Fold sequence Ratio Change rpitiu--miR-6931-- 5p miR- 651 (and 1.762 EDNRA ENSMUSG00000031616 -2.858 other miRNAs
w/ seed GGGGUGG!
mmu--miR-6931-- 5p miR-4651 (and 1.762 ENTPD2 ENSMUSGO 0000015085 -2.894 other miRNAs
w/seed GGGGUGG;
ramu-ra R-6931-Sp miR-4651 (and 1, 762 FKBP5 ENSMUSG00000024222 -3.240 o her miRNAs
w/seed GGGGUGG)
mmu-miR--6931 --5p miR-4651 (and 1.762 GYS 1 ENSMUSG00000003865 -3.089 other miRNAs
w/seed GGGGUGG)
mmu-miR-6931-5p miR-4651 (and 1.762 HDAC10 ENSMUSGO 0000062906 -2.293 other miRNAs
w/seed GGGGUGG)
mmu-miR-6931-- 5p miR-4651 (and 1.762 HF,T,7." ENSMUSGO 0000027580 -2.455 other miRNAs
w/seed GGGGUGG!
mmu--miR-6931-- 5p miR-4651 (and 1.762 INHA ENSMUSG00000032968 -2.556 other miRNAs
w/seed GGGGUGG)
mmu-miR-6931-Sp miR-4651 (and 1, 762 LMNA ENSMUSGO 0000028063 -2.500 o her miRNAs
w/seed GGGGUGG)
mmu-miR-6931-5p miR-4651 (and 1.762 LRP1 ENSMUSGO 0000040249 -3.964 other miRNAs
w/seed GGGGUGG)
mmu-miR-6931-5p miR-4651 (and 1.762 MAP2K7 ENSMUSG00000002948 -2.967 other miRNAs
w/seed GGGGUGG)
mmu-miP.-6931- 5p miR-4651 (and 1.762 MAPKSIP3 ENSMUSG00000024163 -3.220 other miRNAs
w/seed GGGGUGG!
mmu-mi -6931-5p miR-4651 (and 1.762 MARK2 ENSMUSG00000024969 -2.674 other miRNAs
w/seed GGGGUGG)
mmu-miR-6931-Sp miR-4651 (and 1, 762 MEF2D ENSMUSG00000001 19 -2.059 o her miRNAs
w/seed GGGGUGG)
mrnu-miR-6931 -5p miR-4651 (and PA.BP 1 ENSMUSGO 0000022194 -2.713 other miRNAs
w/seed GGGGUGG)
mmu-miR-6931-5p miR-4651 (and 1.762 PAD12 ENSMUSGO 000002892 ' -4.296 other miRNAs
w/seed GGGGUGG)
mmu- iR-6931- 5p miR-4651 (and 1.762 PDE4A ENSMUSG00000032177 -2.713 other miRNAs
w/seed GGGGUGG!
mmu-m R-6931-5p miR-4651 (and 1.762 PFKFB4 ENSMUSG000000256 8 -2.648 other miRNAs
w/seed GGGGUGG)
mmu-miR-6931-Sp miR-4651 (and 1, 762 PLXNA3 ENSMUSGO 0000031398 -2.509 other miRNAs
w/seed GGGGUGG)
mrnu-miR-6931 -5p miR-4651 (and , 6 PLXNB2 ENSMUSG00000036606 -2.154 other miRNAs
w/seed GGGGUGG)
mmu-miP-6931- 5p miR-4651 (and 1.762 P0U2F1 ENSMU3G00000026565 -2.418 other miRNAs
w/seed GGGGUGG)
mmu-miP.-6931- 5p miR-4651 (and 1.762 PTPRS ENSMUSG00000013236 -2.013 other miRNAs
w/seed GGGGUGG)
miRNA m±KNA family raiBNA Gene Ensemble Gene ID mENA Exp name with seed Exp Log Symbol Fold sequence Ratio Change rpitiu--miR-6931-- 5p miR-4651 (and 1.762 SCA.RBi ENSMUSGO 0000037936 -2.038 other miRNAs
w/ seed GGGGUGG!
mmu--miR-6931-- 5p miR-4651 (and 1.762 SLC16A3 ENSMUSG00000025161 -2.949 other miRNAs
w/seed GGGGUGG;
ramu-raiR-6931-Sp miR-4651 (and 1, 762 SMARCCI ENSMUSG00000032481 -2.236 o her miRNAs
w/seed GGGGUGG)
mmu-miR--6931 --5p miR-4651 (and 1.762 TAB1 ENS USG00000022414 -2.626 other miRNAs
w/seed GGGGUGG)
mmu-miR-6931-5p miR-4651 (and 1.762 TCF7L2 ENSMUSGO 0000024985 -2.420 other miRNAs
w/seed GGGGUGG)
mmu-miR-6931-5p miR-4651 (and 1.762 TNS 1 ENSMUSGO00000 5322 -5.238 o her miRNAs
w/seed GGGGUGG)
mmu-miR--6931--5p miR-4651 (and 1.762 UBTF ENSMUSGO 0000020923 -2.076 other miRNAs
w/seed GGGGUGG)
mmu-raiR-486a-5p miR-486-5p (and -0. 04 ARID4B ENSMUSG00000039219 2.288 other miRNAs
w/seed CCUGUAC)
mmu--miP.-486a-- 5p miR-486-5p (and -0 , 04 F2R ENSMUSG00000048376 2.615 other miRNAs
w/seed CCUGUAC !
mmu-miR-486a- 5p miR-486-5p (and -0 , 504 GPX8 ENSMUSG00000021760 2.216 other miRNAs
w/seed CCUGUAC)
mmu-miR-486a-5p miR-486-5p (and -0.504 H3F3A/H3 ENSMUSGO0000016559 2.079 o her miRNAs F3B
w/seed CCUGUAC)
mmu-miR-486a-5p miR-486-5p (and -0.504 LSMS ENSMUSG00000044155 2.338 other miRNAs
w/seed CCUGUAC)
mmu-miR-486a-5p miR-486-5p (and -0.504 MDH1 ENSMUSGO 0000020321 2.321 other miRNAs
w/seed CCUGUAC)
mmu-miR-486a- 5p miR-486-5p (and -0.504 NPR3 ENSMUSGO 0000022206 9.254 other miRNAs
w/seed CCUGUAC )
mmu-miR-486a- 5p miR-486-5p (and -0.504 PDGFC ENSMUSG00000028019 4.353 other miRNAs
w/seed CCUGUAC)
mmu-miP.-486a- 5p miR-486-5p (and -0.504 SEMA3E ENSMUSG00000063531 4.494 other miRNAs
w/seed CCUGUAC )
mmu-miR-486a- 5p miR-486-5p (and -0.504 SIAH1 ENSMUSG00000036840 2.464 other miRNAs
w/seed CCUGUAC)
mmu-miR-486a-5p miR-486-5p (and -0.504 SNRPD1 ENSMUSGO0000002477 2.585 o her miRNAs
w/seed CCUGUAC)
mrnu-miR-486a-5p miR-486-5p (and -0.504 VTI1A ENSMUSGO 0000024983 2.031 other miRNAs
w/seed CCUGUAC)
mmu-miR-574-5p miR-574-5p 1.305 FGF11 ENSMUSG00000042826 -2.586
(miRNAs w/seed
GA.GUGUG)
mmu-miP.-574 -5p miR-574-5p MEF2D ENSMUSGO 0000001419 -2.059
(miRNAs w/seed
GAGUGUG)
miRNA miRNA family raiRNA Gene Ensemble Gene ID mRNA Exp name with seed Exp Log Symbol Fold sequence Ratio Change rpitiu--miR-574 --5p miR-574-5p 1.305 PFKFB ENSMUSG00000025648 -2.648
(miRNAs w/seed
GAGUGUG)
mmu--miR-574 --5p m.iR-574-5p 1.305 PHKA2 ENSMUSG00000031295 -3.795
(miRNAs w/seed
GAGUGUG)
mmu-miR-28a-5p miR-708-5p (and -0.371 AS3MT ENSMUSG00000003559 2.124 o her miRNAs
w/seed AGGAGCU)
mmu-miR-28a- 5p miR-708-5p (and -0.371 BHLKE40 ENSMUSG00000030103 3.031 other miRNAs
w/seed AGGAGCU)
mmu-miR-28a-5p miR-7 OS-bp (and -0.371 ETG1 ENSMUSG00000036 78 3.845 other miRNAs
w/seed AGGAGCU)
mmu-miR-28a--5p miR-708-5p (and -0 , 371 C9orf3 ENSMUSG00000021458 2.996 other miRNAs
w/seed AGGAGCU)
mmu-roiR-28a-5p m.iR-708-5p (and. -0,371 CBX5 ENSMUSG00000009575 2.239 other miRNAs
w/seed AGGAGCU)
mmu-miR-28a-5p miR-703-5p (and -0.371 CREB1 ENSMUSG00000025958 2.764 other miRNAs
w/seed AGGAGCU)
mmu-miR-28a- 5p miR-708-5p (and -0.371 DSEL ENSMUSG00000038702 2.015 other miRNAs
w/seed AGGAGCU)
mmu-miR-28a-5p miR-7 OS - bp (and -0.371 ENAK ENSMUSG00000022995 2.442 other miRNAs
w/seed AGGAGCU)
mmu-miR-28a-5p miR-708-5p (and -0 , 371 FGF1 ENSMUSG00000036585 5.095 other miRNAs
w/seed AGGAGCU)
mmu-miR-28a-5p miR-708-5p (and -0.371 H3F3A/H3 ENSMUSG00000016559 2.079 other miRNAs F3B
w/seed AGGAGCU)
mmu-miR-28a-5p miR-703-5p (and -0.371 IQGAPl ENSMUSG00000030536 2.301 other miRNAs
w/seed AGGAGCU)
mmu-miR-28a- 5p miR-708-5p (and -0.371 LRRK2 ENSMUSG00000036273 2.663 other miRNAs
w/seed AGGAGCU)
mmu-miR-28a-5p miR-7 OS - bp (and -0.371 NFE2L2 ENSMUSG0000001 839 2.296 other miRNAs
w/seed AGGAGCU)
mmu-miR-28a-5p miR-708-5p (and -0 , 371 NT5E ENSMUSG00000032420 5.649 other miRNAs
w/seed AGGAGCU)
mmu-miR-28a-5p miR-708-5p (and -0.371 RAPIB ENSMUSG000000 2681 2.202 other miRNAs
w/seed AGGAGCU)
mmu-miR-28a-5p miR-703-5p (and -0.371 SEMA4F ENSMUSG00000000627 2.369 other miRNAs
w/seed AGGAGCU)
mmu-miR-28a- 5p miR-708-5p (and -0.371 UBE2A ENSMUSG00000016308 2.073 other miRNAs
w/seed AGGAGCU)
Claims
1. Use of an osteoarthritis miRNA for diagnosing
osteoarthritis in a subject, wherein the osteoarthritis miRNA is: selected from Tables 1 to 5, or an ortholog thereof;
represented by any o e of SEQ ID NOs : 1 to 139;
represented by any one of SEQ ID NOs: 1 to 57;
selected from the group consisting of miR-6931, miP.-466i, miR-574, miR-3082, miR-1187, miR-669n, miR-468, miR-6691, miR-32, miR-466m, miR-669e and miR-672;
represented by any one of SEQ ID NOs: 1 to 12, 140 or 141; or produced from a stem-loop represented by any one of SEQ ID NOs: 142 to 155,
2. Use of (a) an antagonist that inhibits an activity of an upregulated osteoarthritis miRNA or (b) a mimic that mimics an activity of a downregulated osteoarthritis miRNA in the manufacture of a medicament for treating osteoarthritis in the subject, wherein the subject has been diagnosed as having osteoarthritis by increased expression of the upregulated osteoarthritis miRNA or decreased expression of the downregulated osteoarthritis miRNA in a sample from the subject relative to a refere ce sample, wherein the osteoarthritis miRNA is :
selected from Tables 1 to 5, or an ortholog thereof;
represented by any one of SEQ ID NOs: 1 to 139;
rep esented by a y o e of SEQ ID NOs: 1 to 57;
selected from the group consisting of miR-6931, miR-466i, miR-574, miR-3082, miR-1187, miR-669n, miR-468, miR-6691, miR-32, miR-466m, miR-669e and miR-672;
represented by any one of SEQ ID NOs: 1 to 12, 140 or 141; or produced from, a stem-loop represented by any one of SEQ ID NOs: 142 to 155,
3. Use of (a) an antagonist that inhibits an activity of an upregulated osteoarthritis target mRNA, optionally of Table 10 or Table 11, or an ortholog thereof, or (b) an agonist, that promotes an activity of a downregulated osteoarthritis target mRNA, optionally of Table 10 or Table 1, or an ortholog thereof in the ma ufacture of a medicament for treating osteoarthritis in a subject.
4. An isolated osteoarthritis miRNA selected from Tables 1 to 5, or an ortholog thereof.
5. The osteoarthritis miRNA of claim 4 represented by any one of SEQ ID NOs : 1 to 139.
6. The osteoarthritis miRNA of claim 4 represented by any one of SEQ ID NOs: 1 to 57,
7. The osteoarthritis miRNA of claim 4 selected from the group consisting of miR-6931, miR-466i, miR-574, miR-3082, miR-1187, miR-669n, miR-468, miR-6691, miR-32, miR-466m, miR-669e and miR-672.
8. The os eoarthritis miRNA of any one of claims 4 to 7, represented by any one of SEQ ID NOs: 1 to 12, 140 or 141.
9. The osteoarthritis miRNA of any one of claims 4 to 8, produced from a stem-loop represented by any one of SEQ ID NOs: 142 to 155.
10. The osteoarthritis miRNA of any one of claims 4 to 9 that initiates and/or progresses early osteoarthritis.
11. The osteoarthritis miRNA of any one of claims 4 to 9 that establishes osteoarthritis and/or progresses established osteoarthritis to end-stage osteoarthritis .
12. An isolated nucleic acid antagonist that binds an upregulated osteoarthritis miRNA or binds a target itiRNA of the upregulated osteoarthritis miRNA and inhibits an activity of the upregulated osteoarthritis miRNA of any one of claims 4 to 11 in a subj ect .
13. The nucleic acid antagonist of claim 12, comprising a reverse complement sequence of any one of SEQ ID NOs: 156 to 183.
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2016901025A AU2016901025A0 (en) | 2016-03-18 | OSTEOARTHRITIS microRNAs | |
| AU2016901025 | 2016-03-18 | ||
| AU2016901172 | 2016-03-30 | ||
| AU2016901172A AU2016901172A0 (en) | 2016-03-30 | OSTEOARTHRITIS microRNAs |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2017156591A1 true WO2017156591A1 (en) | 2017-09-21 |
Family
ID=59850037
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/AU2017/050241 Ceased WO2017156591A1 (en) | 2016-03-18 | 2017-03-17 | Osteoarthritis mirnas |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2017156591A1 (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020128163A1 (en) * | 2018-12-20 | 2020-06-25 | Itä-Suomen Yliopisto | Synthetic microrna mimics |
| CN111621562A (en) * | 2020-06-17 | 2020-09-04 | 湖州市第一人民医院 | Application of non-coding RNA in preparation of osteoarthritis early diagnosis and detection product |
| DE102019122014A1 (en) * | 2019-08-15 | 2021-02-18 | Technische Universität Darmstadt | Reduction of bone resorption, especially in chronic joint diseases |
| KR20210054890A (en) * | 2019-11-06 | 2021-05-14 | (의료)길의료재단 | Pharmaceutical composition for the prevention or treatment of arthritis comprising the expression or activity inhibitors of ion transporter SLC4A7 as an active ingredient |
| US20220347349A1 (en) * | 2021-04-30 | 2022-11-03 | Stemcellago Inc. | Engineered cartilage |
| CN120154729A (en) * | 2025-05-19 | 2025-06-17 | 南昌大学第一附属医院 | Application of ATP1B3-CA9 as a target in the treatment of RA |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040013663A1 (en) * | 2001-02-28 | 2004-01-22 | Liew Choong-Chin | Identification of sequences particularly useful for the diagnosis and identification of therapeutic targets for osteoarthritis |
| WO2005079397A2 (en) * | 2004-02-13 | 2005-09-01 | Rockefeller University | Anti-microrna oligonucleotide molecules |
| CN102038959B (en) * | 2009-10-26 | 2012-12-19 | 中国科学院上海生命科学研究院 | Application of let-7/miR-98 family in preparation of medicament for treating disease related to FAS (Fatty Acid Synthase) gene |
| WO2014013258A1 (en) * | 2012-07-19 | 2014-01-23 | Reneuron Limited | Stem cell microparticles |
| WO2014195693A1 (en) * | 2013-06-03 | 2014-12-11 | Isis Innovation Limited | Prevention and treatment of atrial fibrillation |
-
2017
- 2017-03-17 WO PCT/AU2017/050241 patent/WO2017156591A1/en not_active Ceased
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040013663A1 (en) * | 2001-02-28 | 2004-01-22 | Liew Choong-Chin | Identification of sequences particularly useful for the diagnosis and identification of therapeutic targets for osteoarthritis |
| WO2005079397A2 (en) * | 2004-02-13 | 2005-09-01 | Rockefeller University | Anti-microrna oligonucleotide molecules |
| CN102038959B (en) * | 2009-10-26 | 2012-12-19 | 中国科学院上海生命科学研究院 | Application of let-7/miR-98 family in preparation of medicament for treating disease related to FAS (Fatty Acid Synthase) gene |
| WO2014013258A1 (en) * | 2012-07-19 | 2014-01-23 | Reneuron Limited | Stem cell microparticles |
| WO2014195693A1 (en) * | 2013-06-03 | 2014-12-11 | Isis Innovation Limited | Prevention and treatment of atrial fibrillation |
Non-Patent Citations (11)
| Title |
|---|
| DATABASE GenBank Accession [O] 20 November 2014 (2014-11-20), Database accession no. NR_ 105896 * |
| DATABASE GenBank Accession [O] 21 May 2015 (2015-05-21), Database accession no. NR_035415 * |
| DATABASE GenBank Accession [O] 21 May 2015 (2015-05-21), Database accession no. NR_037243 * |
| DE -UGARTE, L. ET AL.: "MiRNA profiling of whole trabecular bone: identification of osteoporosis-related changes in MiRNAs in human hip bones", BMC MEDICAL GENOMICS, vol. 8, 2015, XP055422602 * |
| FILKOVA, M. ET AL.: "MicroRNAs in Rheumatoid Arthritis", BIODRUGS, vol. 26, no. 3, 2012, pages 131 - 141 * |
| JONES, S. ET AL.: "The identification of differentially expressed microRNA in osteoarthritic tissue that modulate the production of TNF-alpha and MMP13", OSTEOARTHRITIS AND CARTILAGE, vol. 17, no. 4, 2009, pages 464 - 472, XP025969811 * |
| KIM, D. ET AL.: "Peroxisomal dysfunction is associated with up-regulation of apoptotic cell death via miR-223 induction in knee osteoarthritis patients with type 2 diabetes mellitus", BONE, vol. 64, 2014, pages 124 - 131, XP055422603 * |
| KUNG, L. ET AL.: "MicroRNA expression profiling of articular cartilage from a mouse model of post-traumatic OA", OSTEOARTHRITIS AND CARTILAGE, vol. 24, no. 1, April 2016 (2016-04-01), pages S345 - S346, XP029467273 * |
| KUNG, L. ET AL.: "Utility of circulating serum miRNAs as biomarkers of early cartilage degeneration in animal models of post-traumatic osteoarthritis and inflammatory arthritis", OSTEOARTHRITIS AND CARTILAGE, vol. 25, no. 3, 2016, pages 426 - 434, XP029926854 * |
| KUNH, L. ET AL.: "Cartilage microRNA dysregulation in mouse osteorthritis overlaps with patient disease candidates", BIORXIV, 3 March 2017 (2017-03-03), pages 113456, XP055422613 * |
| XIA, Z. ET AL.: "Altered function in cartilage derived mesenchymal stem cell leads to OA -related cartilage erosion", AMERICAN JOURNAL OF TRANSLATIONAL RESEARCH, vol. 8, no. 2, 2016, pages 433 - 446, XP055422607 * |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020128163A1 (en) * | 2018-12-20 | 2020-06-25 | Itä-Suomen Yliopisto | Synthetic microrna mimics |
| CN113227375A (en) * | 2018-12-20 | 2021-08-06 | 原住民股份有限公司 | Synthetic microRNA mimetics |
| JP2022515211A (en) * | 2018-12-20 | 2022-02-17 | アールネイティブズ・インコーポレイテッド | Synthetic microRNA mimic |
| DE102019122014A1 (en) * | 2019-08-15 | 2021-02-18 | Technische Universität Darmstadt | Reduction of bone resorption, especially in chronic joint diseases |
| DE102019122014A9 (en) * | 2019-08-15 | 2021-06-02 | Technische Universität Darmstadt | Reduction of bone resorption, especially in chronic joint diseases |
| KR20210054890A (en) * | 2019-11-06 | 2021-05-14 | (의료)길의료재단 | Pharmaceutical composition for the prevention or treatment of arthritis comprising the expression or activity inhibitors of ion transporter SLC4A7 as an active ingredient |
| CN111621562A (en) * | 2020-06-17 | 2020-09-04 | 湖州市第一人民医院 | Application of non-coding RNA in preparation of osteoarthritis early diagnosis and detection product |
| CN111621562B (en) * | 2020-06-17 | 2023-09-22 | 湖州市第一人民医院 | Application of non-coding RNA in preparation of osteoarthritis early diagnosis detection product |
| US20220347349A1 (en) * | 2021-04-30 | 2022-11-03 | Stemcellago Inc. | Engineered cartilage |
| CN120154729A (en) * | 2025-05-19 | 2025-06-17 | 南昌大学第一附属医院 | Application of ATP1B3-CA9 as a target in the treatment of RA |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10577604B2 (en) | Methods for monitoring C9ORF72 expression | |
| Mizuno et al. | MicroRNA-199a-5p is associated with hypoxia-inducible factor-1α expression in lungs from patients with COPD | |
| CN106715695B (en) | MicroRNAs for use in therapy and diagnosis and compositions comprising said microRNAs | |
| WO2017156591A1 (en) | Osteoarthritis mirnas | |
| JP6157852B2 (en) | Use of microRNA to treat diseases associated with ciliary dysfunction in multicilia epithelial cells | |
| US11912994B2 (en) | Methods for reactivating genes on the inactive X chromosome | |
| JP2015518485A (en) | Thermogenic miRNA regulator | |
| AU2012223237A1 (en) | Enhanced biodistribution of oligomers | |
| Simon et al. | Decreased myoblast differentiation in chronic binge alcohol-administered simian immunodeficiency virus-infected male macaques: role of decreased miR-206 | |
| US20200063130A1 (en) | Chimeric rna oligonucleotides and uses thereof | |
| WO2012006181A2 (en) | Compositions and methods for inhibiting oncogenic micrornas and treatment of cancer | |
| Yan et al. | MicroRNAs as potential therapeutics for treating spinal cord injury | |
| US20250051776A1 (en) | Compositions and methods of modulating long noncoding transcripts associated with ards induced pulmonary fibrosis | |
| Jia et al. | miR-379-5P inhibition enhances intestinal epithelial proliferation and barrier function recovery after ischemia/reperfusion by targeting EIF4G2 | |
| CA3238432A1 (en) | Antisense inhibitors of mir17hg pre-rna as therapeutic agents in cancer | |
| US11033570B2 (en) | Modulation of Lnc05 expression | |
| CN114786683B (en) | siRNA, pharmaceutical composition and method of treating diabetes using same | |
| KR102142791B1 (en) | Use of miR-204 inhibitors for treating osteoarthritis | |
| WO2016161058A1 (en) | Agents and methods for treating pancreatic ductal adenocarcinomas | |
| JP2023542033A (en) | How to treat fatty liver disease | |
| CN112218949B (en) | Inhibition of polyomavirus replication | |
| US20250197864A1 (en) | Lncrna transcripts in melanomagenesis | |
| AU2022224748B2 (en) | Compositions And Methods For Detecting And Treating Insulin Resistance | |
| EP2695942A1 (en) | microRNAs in therapy and diagnostic of cancer | |
| WO2026096962A1 (en) | Methods and compounds for treating, ameliorating and/or preventing fibrotic diseases |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 17765583 Country of ref document: EP Kind code of ref document: A1 |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 17765583 Country of ref document: EP Kind code of ref document: A1 |

