CN102038959B - Application of let-7/miR-98 family in preparation of medicament for treating disease related to FAS (Fatty Acid Synthase) gene - Google Patents

Abstract

The invention discloses application of a let-7/miR-98 family in preparation of a medicament for treating diseases related to an FAS (Fatty Acid Synthase) gene.

Description

The application of let-7/miR-98 family in the medicine of preparation treatment FAS gene-correlation disease

Technical field

The present invention relates to biology field, specifically is field of gene, the more particularly application of let-7/miR-98 family in the medicine of preparation treatment FAS gene-correlation disease.

Background technology

Fas (claiming CD95 again) is a surface of cell membrane molecule, and Fas, FasL exist with membrane molecule or shla molecule.Fas combines to cause Fas positive cell generation apoptosis with FasL, this signal pathway receives the regulation and control of many factors inside and outside the cell.Fas, FasL and relevant regulatory factor are formed the Fas system, have important biological function, especially in immune development, differentiation and ripe and keep playing a significant role aspect its functional stabilization.When Fas systemic-function generation obstacle, the activated T cell will be piled up in vivo, causes autoimmune disease.Lpr is a MRL strain Fas gene code deletion form gene mutation strain mice, and Fas expresses defective in the body, can cause the generation with autoantibody of accumulating of autoreactive T cell, causes occurring autoimmune diseases [1] such as systemic lupus erythematosus (sle).

In tumor cell, Fas expresses decline, participates in or promoted indirectly the supervision of tumor escape body immune system directly.Breast carcinoma Fas expresses imbalance and has not only participated in Immune escape of tumor and immunologic tolerance, also with the infiltration of tumor closely related [2].Losing that cancer of pancreas Fas expresses is relevant with invasion and attack behavior biology with the vicious transformation of pancreatic cell, and can resist apoptosis, escapes immunity of organism and keeps watch on [3].Fas/FasL Signal Regulation network has certain prospect in design medicine or gene therapy.Chopin reports such as [4], sodium butyrate can increase the Fas expression of breast cancer cell line MCF-7, thereby the apoptosis of tumor cell is increased.Yoshimoto reports such as [5]: amycin can induce lewis lung cancer Fas to express in vivo to be increased, and makes tumor cell more responsive to the Fas mediated Apoptosis.

There is the solubility FAS in article report rheumatisant lymphocytic cell surface Fas and the serum obviously to increase, and relevant with the activeness and the visceral organ injury of disease, particularly in systemic lupus erythematosus (sle) (SLE) and rheumatoid arthritis (RA) [6-10].The FAS of overexpression makes autoantigen removing obstacles such as apoptosis product such as nucleosome in SLE, stimulates pathogenic T H cell and B cell, produces a large amount of autoantibodys, and then brings out the generation of autoimmune disease and the deterioration of the state of an illness.Various biological preparation to the FAS path all show therapeutic effect in RA animal model and human trial.Be applied to treat the apoptosis that the tumor necrosis factor blocker of RA can be induced the synovial cell in addition, this effect at least a portion is by FAS mediation [11-13] at present.

Lee etc. discover, the mice kidney cancer cell of In vitro culture is its Fas up-regulated after IFN-γ and TNF-α only handle, the effect become responsive [14] to the Fas mediated Apoptosis.The secreted TNF-α of the activated macrophage of reports such as Chen, the expression that IFN-γ can raise brain glioblastoma cell Fas and FasL increase apoptosis of tumor cells [15].Discoveries such as Longley, fluorouracil make the Fas up-regulated of breast cancer cell and colon cancer cell, have strengthened Fas system mediated Apoptosis [16].Fas expression plasmids such as Aragane directly inject in the tumor body, find behind the 28d that the tumor body weight obviously is lighter than matched group [17].

Therefore, in the art, generally acknowledged generally that FAS directly mediates causing a disease and shifting of tumor.Research worker has also disclosed regulation and control Fas through experiment has direct contact for the treatment tumor.Therefore, exploitation Fas regulator is of great importance for the treatment tumor disease.

Microrna (microRNA; MiRNA) be the strand microRNA of the not coded protein of one type of about 21-25nt of length; Extensively be present in the eukaryote; Being attached to through nucleic acid array complementation property and regulating said target mrna translation or degraded said target mrna on the specific said target mrna, is a kind of molecule that plays the negative regulation effect.Research at present shows that miRNA has participated in physiological process such as organism growth, differentiation, growth, immunne response, and its expression and functional disorder possibly cause tumor that multiple pathological phenomenons such as autoimmune disease and viral infection take place.

Sophisticated miRNA can form RISC (RNA-Induced silencingcomplex) complex with other protein, combines to suppress with performance the effect [18] of target gene mRNA translation or degraded target gene mRNA with target gene mRNA through nucleic acid array complementation.The adjusting characteristics that have or do not have different from the past, miRNA quantitatively regulates target gene.These characteristics are that the antagonist and the agonist of the powerful regulating action of the single target spot of siRNA or some molecules is incomparable.This has showed the huge prospect of miRNA aspect clinical practice.

Let-7/miR-98 family is one group of sequence height homology, and intimate miRNA comprises miR-98, let-7a, let-7b, let-7c, let-7d, let-7e, let-7f, let-7g, let-7i.Let-7/miR-98 family high conservative between species; Some member is methylated, the regulation and control of posttranscriptional modification and Lin28 gene; Also regulate simultaneously target genes such as RAS, MYC, HMGA2, CDC25A, CDK6; Closely bound up with multiple biological phenomena and physiological process in the life, particularly particularly outstanding in the effect of biological development, cell proliferation and differentiation and tumor related fields.The let-7/miR-98 family member expresses the incidence and development that some diseases is participated in imbalance in the human body, in breast carcinoma, SCCHN, osteoarthritis, plays certain function [19-30] such as the miR-98 unconventionality expression.

Up to the present also there is not miRNA can regulate the relevant report of FAS.Also lack clearly for the function of the miRNA of let-7/miR-98 family and to understand.Therefore, still there is exigence this area for the novel targets and the means of regulating FAS.

Summary of the invention

This research confirms that first let-7/miR-98 can directly suppress the expression of FAS, and this provides new target spot and means for regulating the Fas/FasL signal network.

Therefore, an object of the present invention is to provide the medicine of new treatment FAS relevant disease.

In one aspect, the miRNA of let-7/miR-98 family or its regulator purposes in the medicine of preparation treatment FAS gene-correlation disease is provided.In a specific embodiment aspect this, FAS gene-correlation disease is selected from systemic lupus erythematosus (sle), rheumatoid arthritis and osteoarthritis owing to the overexpression of FAS gene causes that said disease is an autoimmune disease.In another embodiment, FAS gene-correlation disease causes that owing to FAS gene expression is suppressed said disease is a tumor, and particularly cancer is selected from breast carcinoma, SCCHN, oral cancer, pulmonary carcinoma especially.

In a specific embodiment aspect this, the miRNA of let-7/miR-98 family is selected from miR-98, let-7a, let-7b, let-7c, let-7d, let-7e, let-7f, let-7g, let-7i.

In another specific embodiment aspect this, above-mentioned regulator is selected from inhibitor and synergist.Particularly inhibitor is an anti sense nucleotide sequence.

In another embodiment, synergist is a simulation nucleic acid.

Particularly, synergist is selected from following simulation nucleic acid:

Hsa-miR-98 simulates nucleic acid (two strands): 5 ' UGAGGUAGUAAGUUGUAUUGUU3 '

3ACUCCAUCAUUCAACAUAACAA5

Hsa-let-7d simulates nucleic acid (two strands): 5 ' AGAGGUAGUAGGUUGCAUAGUU3 '

3UCUCCAUCAUCCAACGUAUCAA5

Hsa-let-7g simulates nucleic acid (two strands): 5 ' UGAGGUAGUAGUUUGUACAGUU3 '

3ACUCCAUCAUCAAACAUGUCAA5

Particularly, inhibitor is selected from following inhibition nucleic acid:

Hsa-miR-98 suppresses nucleic acid (strand): 5 ' AACAAUACAACUUACUACCUCA3 '

Description of drawings

Fig. 1 is the binding site of let-7/miR-98 and miR-23 and FAS gene 3 ' UTR secondary structure.

Fig. 2 A has shown that miRNA is for the proteic influence of FAS.Fig. 2 B has shown the simulation nucleic acid and the effect of inhibition nucleic acid to its expression of miR-98.

Fig. 3 A-D has shown the influence of miR-98 to FAS gene expression.

Fig. 4 A-E has shown the effect of let-7/miR-98 to FAS gene 3 ' UTR and mutant thereof.Wherein Fig. 4 A shown each family member sequence, with the site of FAS 3 ' UTR effect.Fig. 4 B has shown reporter gene carrier psiCHECK ^TM-2 collection of illustrative plates.Fig. 4 C has shown the influence for the expression of FAS 3 ' UTR and mutant thereof of let-7d, let-7g and miR-98 simulation nucleic acid.Fig. 4 D has shown the regulating action of miR-98 simulation nucleic acid to the FAS gene.Fig. 4 E has shown that miR-98 suppresses the regulating action of nucleic acid to the FAS gene.Fig. 4 F has shown that miR-98 simulation nucleic acid has concentration dependent to the regulating action of FAS gene.

Fig. 5 A has shown flow cytometry analysis miR-98 pair cell effect of apoptosis.Wherein visible miR-98 simulation nucleic acid has obvious inhibitory action to apoptosis, and miR-98 inhibition nucleic acid has obvious facilitation to apoptosis.Fig. 5 B has shown miR-98 simulation nucleic acid/inhibition nucleic acid and the relevant influence that contrasts the Hela apoptosis rate.Annotate: the bad cell of dying of Q1 representative, on behalf of necrosis, Q2 add the apoptotic cells in late period, and Q3 represents living cells, and Q4 represents apoptotic cells, *: p＜0.05, * *: p＜0.001.

The specific embodiment

The simulation nucleic acid of miRNA is the endogenous miRNA of simulation organism, and the method for utilization chemosynthesis is synthetic, the function of ability augment endogenous property miRNA.And miRNA suppresses the special inhibitor to specific target miRNA in the cell that nucleic acid is chemical modification, has used the antisense sequences of former RNA sequence at this.

The miRNA of synthetic has been successfully applied to reticent expection expression of target gene and functional study thereof.The further silence effect of augment endogenous miRNA of miRNA simulation nucleic acid, the expression of reduction intracellular protein carries out the acquired research of function.On the contrary, use the synthetic miRNA of method of chemosynthesis to suppress nucleic acid, special targeting suppresses one miRNA molecule; MiRNAs is to the reticent effect of specific gene in can weakening; Improve expressing quantity, carry out the afunction Journal of Sex Research, can be used to screen the miRNA target spot; The miRNA of a certain gene expression of screening regulation and control, screening influences the miRNA of cell development process.The miRNA simulation nucleic acid and the inhibition nucleic acid of chemosynthesis has become the useful tool of the function of research animal-plant gene family, and also is a kind of New Policy of treatment of cancer and clinical research.

Sequence analysis shows, have at least 1/3 human gene relevant with the miRNA regulation and control, and increasing test proves that also miRNA also has many functions undiscovered.The function of research gene normally knocks out it from genome, observe the variation before and after knocking out then, but in the functional study of miRNA, research worker generally adopts the expression that strengthens or weaken this miRNA to identify its function.

The simulation nucleic acid of miRNA can be buied from each biotech firm with inhibition nucleic acid.For example, Thermo SCIENTIFIC used herein company, or like sharp rich bio tech ltd in Guangzhou etc.

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in the restriction scope of the present invention.The experimental technique of unreceipted actual conditions in the following example; Usually according to people such as normal condition such as Sambrook; Molecular cloning: lab guide (New York:Cold SpringHarbor Laboratory Press; 1989) condition described in, or the condition of advising according to manufacturer.Unless otherwise indicated, otherwise percentage ratio and umber calculate by weight.

Only if definition separately, the same meaning that employed all specialties and scientific words and one skilled in the art are familiar with in the literary composition.In addition, any with the institute similar content of putting down in writing or the equalization method and material all can be applicable among the present invention.The usefulness that preferable implementation method described in the literary composition and material only present a demonstration.

The computer forecast target position of embodiment 1miR-98

The computer forecast analysis of the binding site of miR-98 and miR-23:

MiR-23 is a kind of Microrna relevant with neure growth.Analyze demonstration let-7/miR-98 and miR-23a/b scalable FAS expression of gene with bioinformatics TargeScan (http://www.targetscan.org), the stem loops that its binding site is present in FAS gene 3 ' UTR secondary structure respectively closes position and stem position (see figure 1).Fig. 1 has shown the binding site of let-7/miR-98 and miR-23 and FAS gene 3 ' UTR secondary structure.The binding site of let-7/miR-98 and FAS gene 3 ' UTR secondary structure is present in the stem ring land of FAS gene 3 ' UTR secondary structure, and the binding site of miR-23 and FAS gene 3 ' UTR secondary structure is present in the stem district of FAS gene 3 ' UTR secondary structure.There is report prompting miRNA target gene 3 ' UTR secondary structure to influence combining of miRNA and target sequence; Be attached to target sequence if target sequence is positioned at the annular region of secondary structure then is beneficial to miRNA, be unfavorable for miRNA play a role [31] if target sequence is positioned at the stem zone.MiR-98 and miR-23a/b possibly come from the difference of its target sequence secondary structure to the Different Effects of FAS gene.At this, the applicant has further tested their reality to the proteic influence of FAS.

Embodiment 2. flow cytometries are analyzed Microrna to the proteic influence of FAS

(1) cell culture: Hela cell Hela cell derives from American Type Culture Collecti (ATCC), available from Shanghai Inst. of Life Science, CAS cell institute.Add the cultivation of 10% hyclone and 100U/ml penicillin-streptomycin cultivation, 37 ℃ of 5%CO with DMEM ₂Hatch, changed liquid once in 2～3 days.

(2) cell transfecting: transfection the previous day is with 2 * 10 ⁵Individual cell evenly is seeded in the 6 porocyte culture plates.The coverage rate of every porocyte should be 30-50% during transfection in second day; With simulation nucleic acid and the inhibition nucleic acid of Lipofectamine 2000Reagent (Invitrogen company) transfection miR-98, miR-23a/b, and contrast.These nucleotide sequences are following:

Hsa-miR-98 simulates nucleic acid (two strands): 5 ' UGAGGUAGUAAGUUGUAUUGUU3 '

3ACUCCAUCAUUCAACAUAACAA5

Hsa-miR-98 suppresses nucleic acid (strand): 5 ' AACAAUACAACUUACUACCUCA3 '

Hsa-miR-23a simulates nucleic acid (two strands): 5 ' AUCACAUUGCCAGGGAUUUCC3 '

3UAGUGUAACGGUCCCUAAAGG5

Hsa-miR-23a suppresses nucleic acid (strand): 5 ' GGAAAUCCCUGGCAAUGUGAU5 '

Hsa-miR-23b simulates nucleic acid (two strands): 5 ' AUCACAUUGCCAGGGAUUACC3 '

3UAGUGUAACGGUCCCUAAUGG5

Hsa-miR-23b suppresses nucleic acid (strand): 5 ' GGUAAUCCCUGGCAAUGUGAU3 '

The control sequence that adopts among all experiments and following each embodiment is following:

Simulation contrast (two strands): 5 ' UCACAACCUCCUAGAAAGAGUAGA3 '

3AGUGUUGGAGGAUCUUUCUCAUCU5

Suppress contrast (strand): 5 ' CAGUACUUUUGUGUAGUACAA3 '

Above product is all purchased the company in Thermo SCIENTIFIC, and final concentration is 100nM.

(3) flow cytometer detects the antigenic expression of FAS:

Adjustment Hela cell concentration is 5 * 10 ⁵/ mL washes 2 times with dyeing buffer (PBS pH7.4 contains 2% inactivated fetal bovine serum, 0.1% sodium azide), to stop non-specific binding.Add anti-Mus anti-human fas McAb (purchasing the company in eBioscience) the working solution 10 μ L with the APC labelling, hatch 30min on ice, the dyeing buffer is washed 2 times; Detect with machine on the 200 μ L fixative re-suspended cells at last.Every batch of BIAO and BEN is all established negative control and homotype contrast.Carry out flow cytometry and measure the fluorescence intensity of FAS antigen presentation on the cell membrane.

Fig. 2 A has shown the influence of Microrna to the FAS protein expression.MFI is an average fluorescent strength.Visible from figure, the simulation nucleic acid of miR-98 has all played effect with inhibition nucleic acid for the expression of FAS.The simulation nucleic acid of miR-98 can stimulate crossing of miR-98 to express, and makes the expression of FAS descend; And the inhibition nucleic acid of miR-98 can suppress the activity of miR-98, thereby makes the fluorescence intensity of FAS rise.And miR-23a/b is inhibitor or simulates nucleic acid for the unobvious influence of the expression of FAS.This with embodiment 1 in to predict the outcome also be corresponding to.

(4) simulation nucleic acid and of the effect of inhibition nucleic acid for the miR-98 expression:

Transfection the previous day is with 2 * 10 ⁵Individual Hela cell evenly is seeded in the 6 porocyte culture plates.The coverage rate of every porocyte should be 30-50% during transfection in second day; Reach as above control sequence with Lipofectamine 2000Reagent transfection miR-98 simulation nucleic acid and inhibition nucleic acid, making its final concentration is 100nM.Transfection handles cell with 0.5mlTrizol after 48 hours and with the total RNA of phenol chloroform method extracting Trizol (Invitrogen Company products), ultraviolet spectrophotometer is measured its concentration.With TaqMan Human microRNA Assays Kit (u.s.a. applied biosystem company) 100ng RNA being reversed is specificity cDNA, and goes up detection miR-98 and U48 expression with miR-98, U48 (confidential reference items) specific probe (u.s.a. applied biosystem company) at ABI Prism7900 high throughput fluorescence quantitative PCR appearance (u.s.a. applied biosystem company).The result sees Fig. 2 B, and visible the expression of miR-98 improves in the presence of simulation nucleic acid, and in the presence of inhibition nucleic acid, the expression of miR-98 descends.

Embodiment 3miR-98 is to the influence of FAS gene expression

Of embodiment 2, dye miR-98 simulation nucleic acid at the Hela transit cell and make the miR-98 high expressed, transfection miR-98 suppresses the function that nucleic acid suppresses miR-98.After 48 hours, study the influence of miR-98 to endogenous FAS mRNA with the method for polymerase chain reaction (RT-PCR).

(1) RT-PCR of miR-98 is quantitative:

MiR-98 reverse transcriptase primer and Real-time PCR reaction probe are directly bought from ABI (Applied Biosystems company) and are obtained.The quantitative primer of target gene with ribosomal protein L 13a (RPL13A) as the internal reference gene; Primer with Oligo 6.71 software design amplification templates is following: FAS positive-sense strand 5 ' accaaggttctcatgaatctcc3 ', antisense strand 5 ' tgactccagcaatagtggtgata3 '; Giving birth to worker company by Shanghai synthesizes.RPL13A primer positive-sense strand 5 ' CCTGGAGGAGAAGAGGAAAGAGA3 ', antisense strand 5 ' TTGAGGACCTCTGTGTATTTGTCAA 3 ' also gives birth to worker company for Shanghai and synthesizes.

(2) RNA extracting and reverse transcription: with 0.5ml Trizol (Invitrogen) extracted total RNA, ultraviolet spectrophotometer (nanodrop ND-1000) is measured its concentration after 48 hours in transfection.Total RNA uses Primescri pt RT Reagent kit (TaKaRa company) reverse transcription to be cDNA with oligo dT reverse transcription.

(3) real-time fluorescence quantitative PCR (Real-time PCR): on ABI Prism7900 (Applied Biosystems company), carry out the real-time fluorescence quantitative PCR operation.FAS gene SYBR Green quantitative response condition is 95 ℃ * 15s, and 95 ℃ * 5s and 60 ℃ * 30s carry out 40 circulations then, follows 95 ℃ * 15s, 95 ℃ * 15s of 60 ℃ * 15s.

Fig. 3 has shown the influence of miR-98 to FAS gene expression.As shown in Figure 3, A: cross and express the expression that miR-98 can suppress FAS mRNA.B: the expression that reduces miR-98 can increase the expression of FAS mRNA.C: cross expression miR-98 to the proteic inhibitory action of FAS.D: reduce miR-98 and increase the proteic expression of FAS.E: the average fluorescent strength analysis showed that expression miR-98 can reduce the proteic average fluorescent strength of FAS, reduced miR-98 and increased the proteic average fluorescent strength of FAS.Annotate: *: p＜0.05, * *: p＜0.001.

4 pairs of fluorescence reporter gene system of embodiment detect the regulating action of let-7/miR-98 family member to the FAS gene

The FAS gene mRNA 3UTR fragment gram that (1) will contain the let-7/miR-98 binding site falls and is inserted into psiCHECK-2 carrier (seeing Fig. 4 A and Fig. 4 B):

At first design the pcr amplification primer (positive-sense strand: 5 one CCA CTC GAG CTA TCC ACA GGCTAA CCC CA 1, antisense strand: 5 one TAG CGG CCG CGG GTG GGG GAA AAATAA GAA 1, the FAS gene is carried out pcr amplification.Clone the dna fragmentation of one section 635bp size.After restriction endonuclease (not1 and xho1) cutting, be inserted in psiCHECK-2 carrier.

(2) mode through point mutation obtains FAS 3UTR mutational vector:

The positive-sense strand of mutant clon is: 5 one AGA ATT TAA ATA AGA ATA TAA TCA TAAGAC CTT TGC ACA 1, antisense strand is: 5 one TGT GCA AAG GTC TTA TGA TTA TAT TCT TAT TTA AAT TCT 1.

(3) transfectional cell:

With the Hela cell with 2 * 10 ⁴Individual cells/well is inoculated in 96 orifice plates; In cell, concrete grammar is seen the description of product of Invitrogen to use Lipofectamine2000Reagent with the common transfection of FAS gene mRNA 3UTR carrier that obtains in let-7d, let-7g, miR-98 simulation nucleic acid, the simulation nucleic acid of miR-23 and be correlated with contrast and step (1) and (2) behind the 24h.Used CENTRO XS after 24 hours ³LB 960 (BERTHOLDTECHNOLOGIES company) detects, and the concrete operations step is with reference to CENTRO XS ³LB 960 descriptions of product.

The simulation nucleotide sequence of above-mentioned let-7d, let-7g is following:

Hsa-let-7d simulates nucleic acid (two strands): 5 ' AGAGGUAGUAGGUUGCAUAGUU3 '

3UCUCCAUCAUCCAACGUAUCAA5

Hsa-let-7g simulates nucleic acid (two strands): 5 ' UGAGGUAGUAGUUUGUACAGUU3 '

3ACUCCAUCAUCAAACAUGUCAA5

Adopt the simulation control sequence as contrast.

Fig. 4 A shown let-7/miR-98 family each member sequence and with the bonded site of FAS 3 ' UTR.The result shows, crosses and expresses the fluorescent value (seeing Fig. 4 C) that these miRNA can reduce FAS3 ' UTR cloned plasmids.Yet the simulation nucleic acid of employing miR-23 and inhibition nucleic acid have no effect (Fig. 2 A) to the expression of Fas.

(4) miR-98 is to the regulating action of FAS gene:

As above use identical method, use miR-98 simulation nucleic acid and suppress nucleic acid and FAS3 ' UTR reporter plasmid cotransfection Hela cell.MiR-98 simulation nucleic acid causes crosses to express and causes FAS fluorescence to weaken greatly, suppresses then the raise fluorescent value of FAS 3 ' UTR cloned plasmids of nucleic acid.And when using 3 ' UTR mutant, this effect is recovered (seeing Fig. 4 D and 4E).Use the miR-98 simulation nucleic acid transfection of variable concentrations, then obvious inhibition to FAS fluorescence has Concentraton gradient effect (Fig. 4 F).Above presentation of results, miR-98 can directly regulate the expression of FAS.

Embodiment 5miR-98 is to the influence of apoptosis

In Hela cell from embodiment 2, add LEAF purification anti-people CD95 antibody (available from BiolLegend) cell death inducing after 48 hours, final concentration is 2.5 μ g/ml.Detect apoptosis with ApoScreen anchorin (Annexin) V apoptosis test kit (available from Southern Biotech) after 12 hours.

The result showed that expression miR-98 can suppress apoptosis, and suppressed the apoptosis (see figure 5) that miR-98 can increase cell.

Discuss

Above-mentioned research confirms that let-7/miR-98 family can directly act on FAS 3 ' UTR, regulates the FAS expression of gene, and influences the apoptosis of FAS mediation.We find the expression of let-7/miR-98 family and the expression negative correlation of FAS: let-7/miR-98 low expression the in SC1 type cell to analyze common data; High expressed in SC2 type cell; FAS is high expressed in SC1 type cell then, low express [28] in SC2 type cell.This is consistent with the negative regulation FAS of let-7/miR-98 family that we find.Thus, let-7/miR-98 capable of using family is to the regulating action treatment apoptosis disease relevant with autoimmune of FAS.

Citing document

[1] Watanabe-Fukunaga R; Brannan Cl; Copeland NG, the defective in the Fas antigen of et al. mediated apoptosis has been explained the lymphocytic hyperplasia disease in the mice (Lymphoproliferation disorder in miceexplained by defects in Fas antigen that mediates apoptosis). Nature Journal 1992; 356:314 7.

[2] Cian ga C; Cian gaP; CozmaL etc.; Rl 1le significance (rl 1le significance of Fas/FasL molecular system in breast cancer) the .Chir ScrMed Nat lasi of Fas/FasL molecular system in breast carcinoma, 2004,108 (2): 440-444.

[3] Bernstorff; W.V.; Deng, Fas in Normal Pancreas and the pancreas tumor (CD95/APO-1) and Fas ligand expression, the deduction (Fas (CD95/APO-1) and Fasligand expression innormal pancreas and pancreatic tumors.Implicationsfor immune privilege and immuneescape) of escaping and hiding with immunity is exempted in immunity; Cancer, 2002.94 (10): p.2552-60.

[4] Chopin V; Toillon RA; Jolly N etc. sodium butyrate is induced apoptosis (the Sodium butyrate induces p53 independent in the MCF-7 human breast cancer cell of Fas mediation of the non-dependence of p53; Fas.mediated apoptosis in MCF-7human breast cancer cells) .Br J pharmacol, 2002,135 (1): 79-86

[5] Yoshimoto Y; Kawada M; The inductive Fas of Daunorubicins such as Ikeda D expresses and participates in antitumor action (the Involvement of doxorubicin-induced Fas expression in the antitumor effect of doxorubicin on Lewis lung carcinoma in vivo) .IntImmunopharmacol of Daunorubicin to Lewis lung cancer in the body; 2005,5 (2): 281-288

[6] Nozawa K; Kayagaki N; Tokano Y, Yagita H, Okumura K; Hasimoto H. soluble Fas (APO-1, CD95) and soluble Fas part in rheumatism (Soluble Fas (APO-1, CD95) andsoluble Fasligand in rheumatic diseases). rheumatoid arthritis magazine 1997; 40:1126 9.

[7] Ates A; Kinikli G; Turgay M, Duman M. suffer from level (The levels of serum-soluble Fas in patients withrheumatoid arthritis and systemic sclerosis) the .Clin Rheumatol 2004 of serum soluble Fas among the patient of rheumatoid arthritis and Sjogren's syndrome; 23:421 5.

[8] Sahin M; Aydintug O; Tunc SE; Tutkak H, the level of serum soluble Fas among the Naziroglu M. LADA rheumatism patient (Serum soluble Fas levels in patients with autoimmunerheumatic diseases). clinical biochemistry magazine 2007; 40:6 10.

[9] Cheng J, Zhou T, the soluble form of .Fas molecules such as Liu C is to the protection (Protection from Fas-mediated apoptosis by a soluble form of the Fas molecule) of Fas mediated Apoptosis. science magazine 1994; 263:1759 62.

[10] ligand-mediated " the reverse signal transduction " of Fas such as Ekaterina Telegina.Tatiana Reshetnyak possible effect (A possible role ofFas-ligand-mediated reverse signaling in pathogenesis of rheumatoid arthritis andsystemic lupus erythematosus) in the morbidity of rheumatoid arthritis and systemic lupus erythematosus (sle). the immunology 2009:122:12-17 that communicates by letter

[11] Ohshima S; Mima T, Sasai M etc. tumor necrosis factor (TNF-α) is participated in Fas-mediated Apoptosis cell death among rheumatoid arthritis (RA) synovial cell: a kind of clinical benefit (Tumour necrosis factor α (TNF-α) interferes with Fas-mediated apoptotic cell death on rheumatoid arthritis (RA) synovialcells:a possible mechanism of rheumatoid synovial hyperplasia and a clinical benefit ofanti-TNF-α therapy for RA) of maybe mechanism treating with RA anti-TNF-α of possible rheumatoid synovial hyperplasia. cytokine 2000; 12:281 8.

[12] Catrina Al; Trollmo C; Af Klint E etc. macrophage apoptosis is induced in the anti-tumor necrosis factor treatment with Embrel and infliximab in rheumatoid arthritis knuckle; And the evidence of induction of lymphocyte apoptosis not: extend report (Evidence that anti-tumor necrosis factor therapy with bothetanercept and infliximab induces apoptosis in macrophages; But not lymphocytes, inrheumatoid arthritisjoints:extended report). rheumatoid arthritis 2005; 52:61 72.

[13] S.L.Peng.Fas (CD95) related apoptosis and rheumatoid arthritis (Fas (CD95)-relatedapoptosis and rheumatoid arthritis). rheumatology 2006; 45:26 30

[14] Lee; J.K.; Deng; Fas crosses expression IFN-γ dependency delay (IFN-gamma-dependent delay of in vivo tumor progression by Fasoverexpression on murine renal cancer cells) .J Immunol to the in-vivo tumour process, 2000.164 (1): p.231-9 in the mice kidney cancer cell.

[15] Chen; G.G.; Deng; The inductive glioma apoptosis of macrophage relates to death receptor dependency and dependent/non-dependent approach (Glioma apoptosis induced by macrophages involves both deathreceptor-dependent and independent pathways) .J Lab Clin Med, 2003.141 (3): p.190-9 simultaneously.

[16] Longley; D.B.; Deng; Thymus thuja acid synzyme and p53 effect (The roles of thymidylate synthase and p53 in regulating Fas-mediatedapoptosisin response to antimetabolites) the .Clin Cancer Res in the Fas-mediated Apoptosis of regulating antimetabolite, 2004.10 (10): p.3562-71.

[17] Aragane; Y.; Deng; CD95 (Fas/APO-1) gene transfer suppresses melanoma cells growth (Inhibition of growth of melanoma cells by CD95 (Fas/APO-1) gene transfer in vivo) .JInvest Dermatol, 2000.115 (6): p.1008-14 in vivo.

[18] Taganov KD, Boldin MP, Baltimore D etc., Microrna and immunity: the immune .2007 of little player (MicroRNAs and immunity:tiny players in a big field) on the big court, 26 (2): 133-137

[19] Pasquinelli .let-7 heterochroniies such as A.E. are regulated sequence conservation and the time of RNA and are expressed (Conservation of the sequence and temporal expression of let-7heterochronic regulatoryRNA). Nature Journal .2000; 408,86 89

[20] Lee, C.T. etc. the evolution conservative property in micro RNA regulation and control loop: the detection of Microrna gene complexity and conservative Microrna target effect (Evolutionaryconservation of microRNA regulatory circuits:an examination of microRNA genecomplexity and conserved microRNA-target interactions through metazoan phylogeny) the .DNA cytobiology .2007 in multicellular animals cell generating process; 26,209 218

[21] let-7 such as Shogo Tokumaru regulates Dicer and expresses and form negative feedback loop (let-7regulatesDicer expression and constitutes a negative feedback loop) carcinogenesis .2008; 29,2,073 2077

[22] Kiefer, the developing experimental embryology of J.C. (Epigenetics in development) .Dev.Dyn.2007; 236,1,144 1156

[23] Boyerinas, the cancer blastema of let-7 such as B. regulation and control because of evaluation (Identification oflet-7-regulated oncofetal genes). cancer research 2005; 68,2,587 2591

[24] Johnson, RAS such as S.M. receive let-7 micro-rna family regulation and control (RAS is regulated bythe let-7microRNA family). cell 2005; 120,635 647

[25] Sampson, Microrna let-7a such as V.B. downward modulation MYC also reverses the inductive growth of MYC in the Burkitt lymphoma cell (MicroRNA Let-7a down-regulates MYC and reverts MYC-inducedgrowth in Burkitt lymphoma cells). cancer research 2007; 67,9,762 9770

[26] Lee, Y.S. and Dutta, A. tumor suppression property Microrna let-7 suppresses HMGA2 proto-oncogene (The tumor suppressor microRNA let-7represses the HMGA2 oncogene). gene development 2007; 21,1,025 1030

[27] Johnson, let-7 Micrornas such as C.D. suppress cell proliferation approach (The let-7microRNA represses cell proliferation pathways in human cells) in people's cell. cancer research 2007; 67,7,713 7722

[28] Carla Hebert, waiting high animal migration group A2 is the target (High mobility group A2 is a target for miRNA-98 in head and neck squamous cellcarcinoma) of miRNA-98 in the head and neck squamous cell carcinoma. molecule cancer 2007; 6:5.

[29] Jones SW waits evaluation (The identification of differentially expressed microRNA inosteoarthritic tissue that modulate the production of TNF-alpha and MMP13) differential expression, that regulate the Microrna of TNF-α and MMP13 generation in the osteoarthrosis tissue. osteoarthritis cartilage 2009; 17 (4): 464-72.

[30] the estradiol reaction (Estradiol-regulated microRNAs control estradiol response in breast cancer cells) in the Microrna control breast cancer cell regulated of estradiol such as Bhat-Nakshatri P. nucleic acids research 2009; 1 12; Doi:10.1093/nar/gkp500

[31] Kertesz M; Lovino N; Unnerstall U, Gaul U, the effect (The role of site accessibility in microRNA target recognition) of site getatability during Segal E. Microrna is identified. natural genetics .2007; 39:1278 1284.doi:10.1038/ng2135

[32] Scott Shell; Sun-Mi Park; Let-7 such as AmiR Reza Radjabi express two kinds of differential periods (Let-7expression defines two differentiation stages of cancer) of having confirmed cancer. NAS; 2007,104 (27): 11400-11405.

Claims (5)

1.let-7/miR-98 the miRNA of family or its regulator purposes in the medicine of preparation treatment FAS gene-correlation disease; Said FAS gene-correlation disease is owing to the overexpression of FAS gene causes; Said disease is an autoimmune disease, is selected from systemic lupus erythematosus (sle), rheumatoid arthritis and osteoarthritis.

2. purposes as claimed in claim 1 is characterized in that, the said let-7/miR-98 miRNA of family is selected from miR-98, let-7a, let-7b, let-7c, let-7d, let-7e, let-7f, let-7g, let-7i.

3. purposes as claimed in claim 1 is characterized in that said regulator is selected from inhibitor and synergist.

4. purposes as claimed in claim 3 is characterized in that said inhibitor is an anti sense nucleotide sequence.

5. purposes as claimed in claim 3, said synergist are simulation nucleic acid.

Images