WO2017155416A1 - Genotyping method - Google Patents

Genotyping method Download PDF

Info

Publication number
WO2017155416A1
WO2017155416A1 PCT/NZ2017/050023 NZ2017050023W WO2017155416A1 WO 2017155416 A1 WO2017155416 A1 WO 2017155416A1 NZ 2017050023 W NZ2017050023 W NZ 2017050023W WO 2017155416 A1 WO2017155416 A1 WO 2017155416A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
dna
acid sequence
exonuclease
heteroduplex
Prior art date
Application number
PCT/NZ2017/050023
Other languages
French (fr)
Inventor
Gregory Murray COOK
Robyn Hellen LEE
Richard Colin Macknight
George Taiaroa Maskell POULTER
Russell Tony Maskell Poulter
Original Assignee
Otago Innovation Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Otago Innovation Limited filed Critical Otago Innovation Limited
Publication of WO2017155416A1 publication Critical patent/WO2017155416A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • the present invention relates generally to the field of nucleic acid sequence based genotyping, including use in diagnostics.
  • the present invention provides assays, methods and kits to identify genetic variation in a nucleic acid sample.
  • the identification of disease treatment resistant traits conferred by genetic variation in a nucleic acid sequence of interest using the assays, methods and kits of the present invention is also contemplated. For example, in determining antibiotic resistance in the treatment of infectious disease (e.g.) Tuberculosis or Malaria.
  • genotyping is used to expedite the introduction of valuable traits into crops or livestock, for the early detection of disease, and to provide traceability to valuable produce. Broader examples include forensics, biotechnology and genetic counseling . A shift to portable or decentralised DNA diagnostics would have many benefits here also.
  • test nucleic acid sequence to be tested for the genetic variation, wherein the test nucleic acid sequence is resistant to 5'-exonuclease activity
  • test nucleic acid sequence to be tested for the presence of a genetic variation that correlates to multidrug resistance tuberculosis in the patient, wherein the test nucleic acid sequence is resistant to 5'-exonuclease activity;
  • test nucleic acid sequence to be tested for the presence of a genetic variation that correlates to multidrug resistance tuberculosis in the patient, wherein the test nucleic acid sequence is resistant to 5'-exonuclease activity and comprises a nucleic acid sequence defined by SEQ ID NO: 2 ;
  • test nucleic acid sequence to be tested for the presence of a genetic variation that correlates to antibiotic resistant Plasmodium fulciparum, wherein the test nucleic acid sequence is resistant to 5'-exonuclease activity and comprises a nucleic acid sequence defined by SEQ ID NO:75;
  • control nucleic acid sequence which does not have the genetic variation, wherein the control nucleic acid sequence is resistant to 5'- exonuclease activity
  • Figure 3(d) agarose gel showing results of an EMP assay where the sequence to be protected during the assay has been defined as that of ⁇ 580 ⁇ variant', rather than the wildtype.
  • Lane 1 lkb+ Ladder bands (Invitrogen) ;
  • Lane 2 C580Y variant forward strand annealed to a wildtype reverse strand before exposure to the EMP methodology;
  • Lane 3 C580Y variant forward strand annealed to a C580Y variant reverse strand before exposure to the EMP methodology;
  • Lane 4 empty lane;
  • Lane 5 C580Y variant forward strand annealed to a wildtype reverse strand after exposure to the EMP methodology;
  • Lane 6 C580Y variant forward strand annealed to a C580Y variant reverse strand after exposure to the EMP methodology
  • Figure 4(d) binary DNA microarray output. All DNA probes on the array were originally of the same sequence (SEQ ID NO:70) at 129 basepairs in length, and attached to the epoxysilane-coated glass slide through an amine modification and a C12 linker. Before exposure to the EMP method, probe spots were annealed to a single-stranded DNA sample of wildtype sequence, or one that would create a single heteroduplex site, each being 41 base pairs long.
  • Figure 5(a) agarose gel showing the results of an EMP assay for genotyping a 1074bp region of the Plasmodium falciparum genome associated with artemisinin resistance.
  • Lane 1 lkb+ Ladder bands (Invitrogen);
  • Lane 2 wildtype forward strand annealed to a wildtype reverse strand before exposure to the EMP methodology;
  • Lane 3 wildtype forward strand annealed to a Y493H variant reverse strand before exposure to the EMP methodology;
  • Lane 4 empty lane;
  • Lane 5 wildtype forward strand annealed to a wildtype reverse strand after exposure to the EMP methodology;
  • Lane 6 wildtype forward strand annealed to a Y493H variant reverse strand after exposure to the EMP methodology.
  • Lane 1 lkb+ Ladder bands (Invitrogen); Lane 2: RPSL variant forward strand annealed to a wildtype reverse strand before exposure to the EMP methodology; Lane 3 : RPSL variant forward strand annealed to a RPSL variant reverse strand before exposure to the EMP methodology; Lane 4: empty lane; Lane 5: RPSL variant forward strand annealed to a wildtype reverse strand after exposure to the EMP methodology; Lane 6: RPSL variant forward strand annealed to a RPSL variant reverse strand after exposure to the EMP methodology.
  • Figure 5(j) agarose gel showing results of the same EMP assay for genotyping a 604bp region of the Mycobacterium tuberculosis genome as in Figure 5(i), with the Mycobacterium tuberculosis variant sequence now being protected during the assay, rather than the standard wildtype sequence.
  • Lane 1 lkb+ Ladder bands (Invitrogen); Lane 2 : shows a RPOB DV variant forward strand annealed to a wildtype reverse strand before exposure to the EMP methodology; Lane 3 : RPOB DV variant forward strand annealed to a RPOB DV variant reverse strand before exposure to the EMP methodology; Lane 4: empty lane; Lane 5 : RPOB DV variant forward strand annealed to a wildtype reverse strand after exposure to the EMP methodology; Lane 6: RPOB DV variant forward strand annealed to a RPOB DV variant reverse strand after exposure to the EMP methodology.
  • Figure 9 shows a cartoon representing the pre-melt steps associated with the enzymatic HRM concept according to the present invention.
  • Amplification and duplex formation of target amplicons with and without a mutation is followed by an enzyme treatment step.
  • the enzyme recognizes and cleaves at, or immediately adjacent to, a heteroduplex, thereby generating amplicons of different size.
  • Figure 25 shows enzymatic HRM melt curves (relative fluorescence as a function of temperature) for the 521bp Plasmodium falciparum amplicon following treatment with a heteroduplex specific enzyme (refer to Figure 4).
  • the closed squares represent the average melt curve of all homoduplex DNA following the enzyme treatment step, whereas the open squares represents the average melt curve of all heteroduplex DNA following the enzyme treatment step.
  • the average melt transition (T m ) between double and single stranded DNA occurs at a temperature of >0.5°C lower for heteroduplex DNA compared to homoduplex DNA.
  • Figure 27 shows amplicon distribution for the Arabidopsis thaliana assays, centered on a defined single nucleotide polymorphism between two ecotypes: Landsberg erecta (LER) and Columbia (COL).
  • the SNP is used in marker assisted selection strategies in many crop plants to identify valuable co-localised traits.
  • Figure 32 shows activity of 5'-exonucleases (T5, T7 and Lambda) on phosphorothioate modified 570bp Arabidopsis thaliana amplicons.
  • the phosphorothioate modifications present are indicated by the two numbers below each lane: 0-0 representing no modifications; 0-1 representing a IX reverse primer modification, 1-0 representing a IX forward primer modification ; 1-1 representing a IX reverse primer and IX forward primer modification; 0-2 representing a 2X reverse primer modification; 2-0 representing a 2X forward primer modification; 2-2 representing a 2X reverse primer and 2X forward primer modification.
  • T5 exonuclease is able to degrade all phosphorothioate- modified DNAs, while Lambda is unable to degrade any as they lack 5' phosphates.
  • T7 exonuclease demonstrated significantly reduced degradation with increasing phosphorothioate modifications.
  • Figure 34 shows the compatibility between T7 and Lambda exonucleases and 3' overhangs. Restriction enzymes that cleave DNA to give 3' overhangs (Apal, Haell and Nlalll) were selected that recognise one or more sites in the given amplicon (Tuberculosis - 604 bases). These were then applied to a 6X phosphorothioate modified version of the amplicon to generate restriction fragments with 3' overhangs. This was followed by exposure to T7, Lambda or water (control). The exonucleases degrade the restricted DNA, meaning the enzymes are compatible with 3' overhangs.
  • Haell is a partial digest.
  • a HET stage was used to generate wild-type/homoduplex DNA (left panel) and 100% heteroduplex DNA (right panel), to represent a sample that had the wild-type sequence and one that had a single mutation in the 604bp Mycobacterium tuberculosis amplicon. These were then exposed to T7 endonuclease for 20 or 40 minutes, and subsequently to T7 exonuclease. Homoduplex DNA was stable throughout this experiment (1-5), while heteroduplexed DNA was completely degraded after exposure to T7 endonuclease then T7 exonuclease (8 and 10).
  • Figure 39 shows the application of the enzymatic HRM methodology to genotyping BRCA status;
  • (a) shows the standard HRM melt curves (relative fluorescence as a function of temperature) for a 140 base pair amplicon genotyping the BRCA1 variant c.2681_2682delAA.
  • the line marked with closed squares represents the average melt curve of all wildtype/homoduplex samples following the enzyme treatment, while the line marked with open squares represents the average melt curve of all heteroduplex-containing samples.
  • the average melt transition (Tm) between double and single stranded DNA for heteroduplex-containing samples is 79.3°C compared to 79.6°C for wildtype/homoduplex.
  • (b) shows the enzymatic HRM melt curves (relative fluorescence as a function of temperature) for a 140 base pair amplicon genotyping the BRCA1 variant c.2681_2682delAA.
  • the line marked with closed squares represents the average melt curve of all wildtype/homoduplex samples following the enzyme treatment, while the line marked with open squares represents the average melt curve of all heteroduplex-containing samples.
  • the average melt transition (Tm) between double and single stranded DNA for heteroduplex-containing samples is 78.2°C compared to 80.2°C for wildtype/homoduplex.
  • the term “denature” means the separation of double stranded nucleic acid sequence to a single stranded nucleic acid sequence.
  • exonuclease means a class of enzyme capable of cleaving a nucleic acid (DNA, RNA or a DNA/RNA hybrid) at an end/terminal position. Specificity can be determined by directionality (5' or 3'), on the single or double strandedness of the molecule, or the presence of phosphate groups.
  • CEL. enzyme means a heteroduplex specific enzyme.
  • threshold minimum is defined as an amount of residual DNA remaining after the enzymic degradation of DNA susceptible to endonuclease and exonuclease activity.
  • melting temperature and T m refers to the temperature at which 50% of double strand DNA has either (i) denatured into single strand DNA or (ii) renatured to form double stranded DNA.
  • the T m corresponds to the midpoint between the minimum UV absorption and maximum UV absorption in a thermal melting profile of a DNA sample. T m depends on the proportion of GC pairs in the DNA; G-C and C-G pairs, having three hydrogen bonds, being more stable than A-T and T-A pairs which have only two hydrogen bonds.
  • Mismatches include A-G, A-C, A-A, T-G, T-C, T-T, G-G and C-C. Mismatches also include unpaired bases that form loops due to insertions or deletions within one strand of the double-stranded DNA. Thus, a mismatch may be one or more unpaired nucleotides that were incorrectly inserted into a sequence and that do not have a corresponding base with which to pair on the opposite strand or one or more unpaired bases for which the opposing nucleotide or nucleotides have been deleted from the opposing strand.
  • Such unpaired mismatches result in one or more unpaired nucleotides forming a loop that projects from the paired double-stranded DNA that flanks the mismatch.
  • An unpaired mismatch may be one or more, two or more, three or more, four or more, five or more, ten or more, 15 or more or 20 or more unpaired nucleotides within one strand of a double-stranded DNA.
  • the term "multiplexed" in the context of PCR refers to the ability to amplify in tandem two or more polymorphisms of a nucleic acid sequence in a single reaction vessel. This is a highly desirable situation since the DNA amplification step of genetic analysis is costly and time consuming. In the context of genotyping, an assay where multiple positions are genotyped simultaneously greatly increases the throughput of the assay.
  • probe means a synthesised DNA molecule designed to hybridise with a target DNA sequence to generate an effect or signal. These can be labelled (such as by a fluorophore or radioactive isotope) or unlabeled, and are also known as hybridisation probes.
  • SNiPerase means a heteroduplex specific enzyme available from Frontier Genomics that currently does not appear in the scientific literature. This is marketed as "Optimised for use with labelled and unlabelled PCR primers and probes", however, the T7 endonuclease and Surveyor® nucleases used in this work are also compatible with such molecules.
  • polymorphism refers to two or more different forms of the same gene.
  • SNP single nucleotide polymorphism, a polymorphism that results from a difference in a single nucleotide. These polymorphisms can be classed as transitions based on purine/pyrimidine status (A G and COT) or transversions (all other substitutions), and are the most frequently occurring mutations.
  • the cell or organism is sa id to be heterozygous with respect to the particular gene.
  • a wild-type allele is one which codes for particular phenotypic characteristic found in the wild-type strain of a given organism.
  • T5 Exonuclease means a 5' 3' specific exonuclease.
  • T7 Endonuclease means a heteroduplex specific enzyme, part of the phage resolvase family. T7 endonuclease was explored as an alterative to Surveyor ® and CEL family enzymes in the work described in this specification.
  • prophylactic agent refers to any molecule, compound, and/or substance that is used for the purpose of preventing a disease or disorder.
  • prophylactic agents include, but are not limited to, proteins, immunoglobulins (e.g., multi-specific Igs, single chain Igs, Ig fragments, polyclonal antibodies and their fragments, monoclonal antibodies and their fragments), antibody conjugates or antibody fragment conjugates, peptides (e.g., peptide receptors, selectins), binding proteins, proliferation based therapy, and small molecule drugs.
  • any body fluids such as a whole blood sample, plasma, serum, ovarian follicular fluid sample, seminal fluid sample, cerebrospinal fluid, saliva, sputum, urine, pleural effusions, interstitial fluid, synovial fluid, lymph, tears, for example, although whole blood sample, plasma and serum are particularly suited for use in this invention.
  • body fluid samples would be more readily analysed following a fractionation or purification procedure, for example, separation of whole blood into serum or plasma components.
  • subject as used herein is preferably a mammal and includes human, and non-human mammals such as cats, dogs, horses, cows, sheep, deer, mice, rats, primates (including gorillas, rhesus monkeys and chimpanzees), possums and other domestic farm or zoo animals.
  • non-human mammals such as cats, dogs, horses, cows, sheep, deer, mice, rats, primates (including gorillas, rhesus monkeys and chimpanzees), possums and other domestic farm or zoo animals.
  • the assays, methods and kits described herein have application to both human and non-human animals, in particular, and without limitation, humans, primates, farm animals including cattle, sheep, goats, pigs, deer, alpacas, llamas, buffalo, companion and/or pure bred animals including cats, dogs and horses.
  • Preferred subjects are humans, and most preferably "patients" who as used herein refer to living humans who may receive or are receiving medical care or assessment for a disease or condition. Further, while a subject is preferably a living organism, the invention described herein may be used in postmortem analysis as well.
  • oligonucleotide refers to a polynucleotide, typically a probe or primer, including, without limitation, single-stranded deoxyribonucleotides, single- or double- stranded ribonucleotides, RNA: DNA hybrids, and double-stranded DNAs. Oligonucleotides, such as single-stranded DNA probe oligonucleotides, are often synthesized by chemical methods, for example using automated oligonucleotide synthesizers that are commercially available, or by a variety of other methods, including in vitro expression systems, recombinant techniques, and expression in cells and organisms.
  • Hybridization generally depends on the ability of denatured DNA to reanneal when complementary strands are present in an environment below their melting temperature. The higher the degree of desired homology between the probe and hybridisable sequence, the higher the relative temperature that can be used. As a result, it follows that higher relative temperatures would tend to make the reaction conditions more stringent, while lower temperatures less so. Additional details and explanation of stringency of hybridization reactions, are found e.g., in Ausubel et al., Current Protocols in Molecular Biology, Wiley Interscience Publishers, (1995) .
  • the present invention is based on unique assays, methods and kits for genotyping nucleic acids, such as deoxyribose nucleic acid and ribose nucleic acid, obtained from any genetic source.
  • the assays, methods and kits according to the present invention have utility in determining genetic variation which may be used to correlate information concerning, for example, a disease state or identification of a particular plant cultivar.
  • EMP Enzyme Mediated Profiling
  • nucleic acid-specific endonuclease and a nucleic acid-specific 5'-exonuclease for a time and under conditions that allow activity by the endonuclease and the 5'-exonuclease on the nucleic acid sequences; wherein, genetic variation in the test nucleic acid is identified where there is no detectable amount of nucleic acid present in the test mixture above a threshold minimum.
  • primers resistant to 5'-exonuclease activity may be used in an amplification reaction to generate test and control nucleic acid sequences that are resistant to 5'-exonuclease activity.
  • chemical synthesis may be used to generate test and control nucleic acid sequences that are resistant to 5'-exonuclease activity through modification with one or more protecting group.
  • the nucleic acid-specific endonuclease and the nucleic acid-specific 5'-exonuclease may be added to the test mixture in step (iv) simultaneously (i .e. at the same time) or sequentially (i .e. one after the other at any pre-determined time interval).
  • the present invention contemplates addition of the endonuclease followed by addition of the 5'-exonuclease; or addition of the 5'-exonuclease followed by the endonuclease.
  • the enzyme of the SI family or Sl-like nuclease includes, but is not limited to, CEL1, CEL2 and ENDOl .
  • the DNA repair enzyme includes, but is not limited to, Endonuclease V, MutL and MutH .
  • nucleic acid-specific endonuclease includes, but is not limited to, T7 endonuclease I.
  • the nucleic acid-specific endonuclease is an endonuclease from a recombinant source, has been engineered, modified and/or consists of a fusion protein.
  • the activity of the endonuclease is such that it degrades any nucleic acid sequence that is sensitive to degradation by an endonuclease enzyme.
  • this includes any nucleic acid sequence that contains or comprises a heteroduplex.
  • heteroduplex nucleic acids include any double stranded nucleic acid in which there is a mis-match or non-match between base pairs, and does not exclude nucleic acids comprising multiple heteroduplexes.
  • S p stereoisomer phosphorothioate linkages S p stereoisomer phosphorothioate linkages
  • R p stereoisomer provides incomplete protection from degradation by 5'- exonucleases.
  • Incorpration of S p stereoisomer phosphorothioate linkages may be achieved during amplification via primer modification.
  • IX, 2X or 6X phosphorothioate linkages may be incorporated at each termini, although 6X phosphorothioate modification is preferred.
  • the results presented in Figures 32-37 represent IX and 2X modifications. Specifically, the results presented in Figure 32 show the activity of 5'-exonucleases (i.e. T5, T7 and Lambda) on phosphorothioate modified 570bp amplicon from Arabidopsis thaliana.
  • genetic variation in the test nucleic acid sequence correlated with a disease trait may include an infectious disease such as malaria, tuberculosis, mastitis etc.
  • a method for diagnosing multidrug resistance tuberculosis in a patient suspected of being infected by a multidrug resistant Mycobacterium tuberculosis comprising the steps of:
  • nucleic acid sequence for a time and under conditions that allow formation of homoduplex and/or heteroduplex nucleic acids
  • nucleic acid sequence for a time and under conditions that allow formation of homoduplex and/or heteroduplex nucleic acids
  • test nucleic acid sequence to be tested for the presence of a genetic variation that correlates to antibiotic resistant Plasmodium fulciparum, wherein the test nucleic acid sequence is resistant to 5'-exonuclease activity;
  • control nucleic acid sequence which does not have the genetic variation, wherein the control nucleic acid sequence is resistant to 5'- exonuclease activity
  • nucleic acid sequence for a time and under conditions that allow formation of homoduplex and/or heteroduplex nucleic acids
  • control nucleic acid sequence which does not have the genetic variation, wherein the control nucleic acid sequence is resistant to 5'- exonuclease activity
  • test nucleic acid sequence to be tested for the presence of a genetic variation that correlates to an Arabidopsis cultivar of commercial interest, wherein the test nucleic acid sequence is resistant to 5'- exonuclease activity;
  • control nucleic acid sequence which does not have the genetic variation, wherein the control nucleic acid sequence is resistant to 5'- exonuclease activity
  • test nucleic acid sequence to be tested for the presence of a genetic variation that correlates to an Arabidopsis thaliana cultivar of commercial interest, wherein the test nucleic acid sequence is resistant to 5'-exonuclease activity and comprises a nucleic acid sequence defined by SEQ ID NO: 97 or SEQ ID NO:98;
  • nucleic acid sequence for a time and under conditions that allow formation of homoduplex and/or heteroduplex nucleic acids
  • initial cleavage is achieved by a heteroduplex specific enzyme.
  • the enzyme priming step may be achieved using either a structure specific enzyme (i.e.) one which specifically targets the heteroduplex or a sequence specific enzyme (i.e.) one which specifically recognises a cleavage sequence created by one or more mutations (e.g .) a single nucleotide polymorphism.
  • the internal 5'-termini created by the heteroduplex enzyme activity which are susceptible to degradation by fast acting 5'-exonucleases, are represented by open circles, whereas the original blocked/protected 5'-termini are represented by solid diamonds.
  • the open arrows indicate the activity of the fast acting 5'- exonuclease activity.
  • enzyme mediated profiling relies on compatibility between the enzyme used in the priming step and the fast acting 5' exonucleases.
  • the enzymatic products created by the priming step must generate a variety of over-hangs blunt ends for the 5'-exonucleases to act.
  • blocking/protection of the 5'- termini is achieved via chemical modification and/or by employing an enzyme that selectively degrades 5'-termini with a phosphate group, which are present on enzymatically generated 5'-termini but absent on outer/PCR generated 5'-termini .
  • Lambda exonuclease which demonstrates only trace/background levels of exonuclease activity when applied to intact PCR products (e.g. Figures 32 & 33), now shows significantly incresased exonuclease activity towards the newly created 5-termini . This is thought to because of the previously described specificity to DNA with a 5' phosphate; PCR products lack this structure, and enzymatically cleave DNA possessing it.
  • the methods, assays and kits defined herein are configured to be performed on a surface including, for example, a microarray platform including a microarray chip or slide.
  • control nucleic acid sequence is immobilized to the surface or microarray platform.
  • control nucleic acid sequence is a synthetic probe.
  • the integration of key features of enzyme assays allows for improved sensitivity and range in resolving genetic differences between sequences of interest.
  • the assays, methods and kits according to the present invention provide improved diagnostic power for point of care applications.
  • the present invention is not limited to the detection or identification of disease states.
  • the assays, methods and kits according to the present invention may be used to profile genetic sequences known to be associated with important plant cultivars or accessions to facilitate breeding selection and crop management etc.
  • nucleic acid sequence and a nucleic acid standard
  • Figure 6 a heteroduplex is formed where mis-matched base pairs or non-matched base pairs (including deletions) occur between substantially complementary nucleic acid sequences.
  • Figure 9 shows that the heteroduplex is targeted by a structure specific enzyme (e.g. T7 Endonuclease, Surveyor) which cleaves the nucleic acid sequence at or immediately adjacent to the heteroduplex generating (duplex) nucleic acids of different size.
  • Figure 10 demonstrates how the dis/association kinetics of nucleic acid sequences (measured by the degree of helicity as a function of temperature) thereby resolving genetic differences in the nucleic acid sequences being assayed.
  • Example 2 and Figures 19 & 20 with respect to the identification of multi-drug resistant Mycobacterium tuberculosis, specifically rifampicin resistance in identifying infectious Tb;
  • Example 3 and Figures 25 & 26 with respect to the identification of antibiotic resistant Plasmodium falciparum, specifically artemisinin resistance in Malaria;
  • Example 4 and Figures 30 & 31 with respect to the identification of Arabidopsis thaliana accessions (e.g. Landsberg erecta and Colombia).
  • nucleic acids e.g. deoxyribose nucleic acid (DNA) and ribose nucleic acid ( NA)
  • DNA deoxyribose nucleic acid
  • NA ribose nucleic acid
  • test nucleic acid is derived from a sample such as a biological fluid sample, (e.g.) whole blood, serum or plasma.
  • a biological fluid sample e.g. whole blood, serum or plasma.
  • the enzymatic HRM technique according to the present invention was validated using DNA amplified from three genetically distinct genomes, namely Mycobacterium tuberculosis, Arabidopsis thaliana and Plasmodium falciparum.
  • the amplicons selected for these experiments possessed a GC content that substantially mirrored that of the overall genome.
  • the Mycobacterium tuberculosis amplicons contained between 65-67% GC content (Example 2; Table I); the Plasmodium falciparum amplicons contained between 30-39% GC content (Example 3; Table II); and the Arabidopsis thaliana amplicons contained between 43-49% GC content (Example 4; Table III). That the assays, methods and kits according to the present invention could resolve the melt profile of DNA amplified from all three genomes with improved sensitivity and increased range demonstrates that the enzymatic HRM technique may be successfully applied to genetically diverse genomes, irrespective of overall GC content.
  • the data presented in this specification shows that the enzymatic HRM methodology according to the present invention was able to resolve differences between heteroduplex and homoduplex nucleic acid sequences (thereby identifying genetic differences in the sequences being assayed) with significantly improved sensitivity and increased range (size of the amplicons being assayed).
  • the structure specific enzyme is any enzyme that will recognise and cleave at, immediately adjacent to, or adjacent to, the heteroduplex. This includes cleavage 5' or 3' to the heteroduplex.
  • the heteroduplex specific enzyme is selected from the group consisting of bacteriophage resolvases, an enzyme of the SI family or Sl-like nuclease and a DNA repair enzyme.
  • bacteriophage resolvases include, but are not limited to, T4E7 and T4E1.
  • an enzyme of the SI family or Sl-like nuclease include, but are not limited to, CEL1, CEL2 and ENDOl.
  • DNA repair enzymes include, but are not limited to, Endonuclease V, MutL and MutH.
  • the structure specific enzyme may direct nuclease activity to the heteroduplex mediated through other small molecules or protein domains recruited by, or fused to, the heteroduplex specific enzyme.
  • the nucleic acid standard represents the wild-type sequence (e.g. synthetic sequence) or is the wild-type sequence. In yet other examples, the nucleic acid standard is the wild-type sequence, and is amplified in the same amplification reaction as the test nucleic acid.
  • Amplification of the test nucleic acid sequence may be performed using any known amplification means.
  • the amplification isothermal or non-isothermal mediated amplification.
  • isothermal mediated amplification includes, but is not limited to, loop mediated isothermal amplification and recombinase polymerase amplification.
  • thermal mediated amplification includes, but is not limited to, polymerase chain reaction.
  • the primer pairs may comprise any forward/reverse combination of SEQ ID NO:80/SEQ ID NO:81 ; SEQ ID NO:82/SEQ ID NO: 83; SEQ ID NO: 84/SEQ ID NO:85; SEQ ID NO:86/SEQ ID NO:87; SEQ ID NO:80/SEQ ID NO:88; and SEQ ID NO:89/SEQ ID NO:81.
  • SEQ ID NO:80/SEQ ID NO:82/SEQ ID NO: 83 the primer pairs may comprise any forward/reverse combination of SEQ ID NO:82/SEQ ID NO:83; SEQ ID NO: 84/SEQ ID NO:85; SEQ ID NO:86/SEQ ID NO:87; SEQ ID NO:80/SEQ ID NO:88; and SEQ ID NO:89/SEQ ID NO:81.
  • HAT Heteroduplex Targeting
  • Heteroduplex targeting relates to the concept of enriching the assay for heteroduplex species immediately prior to the melt analysis step.
  • the ratio of homoduplex to heteroduplex species will approximate 1 : 1 (equal amounts) generated through standard denature/renature techniques.
  • the relative assay signal may be significantly increased by eliminating any background/artefact signal created by homoduplex species.
  • the HET concept according to the present invention is illustrated schematically in Figure 13.
  • the concept comprises three steps: (1) amplification, (2) exonuclease breakdown to generate single stranded DNA and (3) spike with counter-blocked wild-type probe.
  • target amplicons are generated through (e.g.) PCR (or other amplification means described herein) with forward primers comprising multiple phospohorothioate linkages in tandem, and a standard reverse primer that lacks this structural modification.
  • a single stranded probe is then added to the reaction mix.
  • the probe corresponds to the wild-type sequence, and is substantially complementary to the test sequence with the exception of any mutation(s) or genetic differences. In this way, all species will carry the heteroduplex where one or more mutation(s) is present.
  • the assay was then combined with an enzyme mediated profiling (EMP) assay to give an all-or-nothing genotyping system.
  • EMP enzyme mediated profiling
  • the present invention further contemplates assays and test kits. Accordingly, in a further aspect of the present invention there is provided an assay comprising any one or more features of the methods described herein.
  • an assay comprising any one or more features of the methods described herein in a multiplex format.
  • an assay method comprising any one or more of the features described herein configured to be performed on a microarray platform.
  • Amplification protocols may involve changes in temperature, such as a heat denaturation step, or may be isothermal processes that do not require heat denaturation.
  • the polymerase chain reaction (PCR) uses multiple cycles of denaturation, annealing of primer pairs to opposite strands, and primer extension to exponentially increase copy numbers of the target sequence. Denaturation of annealed nucleic acid strands may be achieved by the application of heat, increasing local metal ion concentrations (e.g. United States Patent No. 6,277,605), ultrasound radiation (e.g. WO/2000/049176), application of voltage (e.g. United States Patent Nos.
  • RT-PCR reverse transcriptase (RT) is used to make a complementary DNA (cDNA) from RNA, and the cDNA is then amplified by PCR to produce multiple copies of DNA (e.g. United States Patent Nos. 5,322,770 and 5,310,652, which are hereby incorporated by reference in their entirety).
  • cDNA complementary DNA
  • An example of an isothermal amplification method is strand displacement amplification, commonly referred to as SDA, which uses cycles of annealing pairs of primer sequences to opposite strands of a target sequence, primer extension in the presence of a dNTP to produce a duplex hemiphosphorothioated primer extension product, endonuclease- mediated nicking of a hemimodified restriction endonuclease recognition site, and polymerase-mediated primer extension from the 3' end of the nick to displace an existing strand and produce a strand for the next round of primer annealing, nicking and strand displacement, resulting in geometric amplification of product (e.g. United States Patent Nos.
  • SDA strand displacement amplification
  • isothermal amplification uses transcription by an RNA polymerase from a promoter sequence, such as may be incorporated into an oligonucleotide primer.
  • Transcription-based amplification methods commonly used in the art include nucleic acid sequence based amplification, also referred to as NASBA (e.g. U.S. Pat. No. 5,130,238); methods which rely on the use of an RNA replicase to amplify the probe molecule itself, commonly referred to as Q-beta replicase (e.g., Lizardi, P. et al. (1988) BioTechnol. 6, 1197-1202); self-sustained sequence replication (e.g., Guatelli, J. et al. (1990) Proc. Natl. Acad. Sci.
  • NASBA nucleic acid sequence based amplification
  • Q-beta replicase e.g., Lizardi, P. et al. (1988) BioTechnol. 6, 1197-1202
  • self-sustained sequence replication e.g., Guatelli, J. et al. (1990) Proc. Natl. Ac
  • isothermal nucleic acid amplification include the use of primers containing non-canonical nucleotides (e.g. uracil or RNA nucleotides) in combination with an enzyme that cleaves nucleic acids at the non-canonical nucleotides (e.g. DNA glycosylase or RNaseH) to expose binding sites for additional primers (e.g. United States Patent Nos. 6,251,639, 6,946,251, and 7,824,890), which are hereby incorporated by reference in their entirety.
  • isothermal amplification processes can be linear or exponential.
  • SNPs Single Nucleotide Polymorphisms
  • RAPD Randomly Amplified Polymorphic DNA
  • SSRs Simple Sequence Repeats
  • AFLP Amplified Fragment Length Polymorphisms
  • identifying sequences are known in the art, for example in US20030170705, which is incorporated herein by reference.
  • a genetic signature may consist of multiple identifying sequences of a single type (e.g. SNPs), or may comprise a combination of two or more different types of identifying sequences in any number or combination.
  • Quantitative PCR qPCR
  • Quantitative PCR can be carried out on samples comprising genetic contnet of interest (e.g.) serum, plasma using specific primers and probes.
  • genetic contnet of interest e.g.
  • the amount of product formed in a PCR reaction correlates with the amount of starting template.
  • Quantification of the PCR product can be carried out by stopping the PCR reaction when it is in log phase, before reagents become limiting.
  • PCR products are then electrophoresed in agarose or polyacrylamide gels, stained with ethidium bromide or a comparable DNA stain, and the intensity of staining measured by densitometry.
  • the progression of a PCR reaction can be measured using PCR machines such as the Applied Biosystems' Prism 7900, QX200 Droplet Digital PCR System (BioRad) or the Roche LightCycler which measure product accumulation in real-time.
  • Real-time PCR measures either the fluorescence of DNA intercalating dyes such as Sybr Green into the synthesized PCR product, or the fluorescence released by a reporter molecule when cleaved from a quencher molecule; the reporter and quencher molecules are incorporated into an oligonucleotide probe which hybridizes to the target DNA molecule following DNA strand extension from the primer oligonucleotides.
  • the oligonucleotide probe is displaced and degraded by the enzymatic action of the Taq polymerase in the next PCR cycle, releasing the reporter from the quencher molecule.
  • Scorpion® the probe is covalently linked to the primer.
  • RT-PCR Reverse Transcription PCR
  • RT-PCR can, be used to compare RNA levels in different sa mple populations, in normal and tumour tissues, with or without drug treatment, to characterize patterns of expression, to discriminate between closely related RNAs, and to analyse RNA structure.
  • the first step is the isolation of RNA from a target sample.
  • the starting material is typically total RNA isolated from a diseased tissue or sample, and corresponding normal tissues or sample, respectively.
  • RNA can be isolated from a variety of samples, such as animal, including mammal and human, plant, bacteria, virus, fungi, yeast, other unicellular eukaryote and synthetic source.
  • the first step in gene expression profiling by RT-PCR is the reverse transcription of the RNA template into cDNA, followed by its exponential amplification in a PCR reaction .
  • the two most commonly used reverse transcriptases are avian myeloblastosis virus reverse transcriptase (AMV-RT) and Moloney murine leukaemia virus reverse transcriptase (MMLV- RT) .
  • the reverse transcription step is typically primed using specific primers, random hexamers, or oligo-dT primers, depending on the circumstances and the goal of expression profiling .
  • extracted RNA can be reverse-transcribed using a GeneAmp RNA PCR kit (Perkin Elmer, Calif., USA), following the manufacturer's instructions.
  • the derived cDNA can then be used as a template in the subsequent PCR reaction.
  • the PCR step can use a variety of thermostable DNA-dependent DNA polymerases, it typically employs the Taq DNA polymerase, which has a 5'-3' nuclease activity but lacks a 3'-5' proofreading endonuclease activity.
  • TaqMan (q) PCR typically utilizes the 5' nuclease activity of Taq or Tth polymerase to hydrolyze a hybridization probe bound to its target amplicon, but any enzyme with equivalent 5' nuclease activity can be used.
  • a third oligonucleotide, or probe is designed to detect nucleotide sequence located between the two PCR primers.
  • the probe is non-extendible by Taq DNA polymerase enzyme, and is labeled with a reporter fluorescent dye and a quencher fluorescent dye. Any laser-induced emission from the reporter dye is quenched by the quenching dye when the two dyes are located close together as they are on the probe.
  • the Taq DNA polymerase enzyme cleaves the probe in a template-dependent manner.
  • the resultant probe fragments disassociate in solution, and signal from the released reporter dye is free from the quenching effect of the second fluorophore.
  • One molecule of reporter dye is liberated for each new molecule synthesized, and detection of the unquenched reporter dye provides the basis for quantitative interpretation of the data.
  • TaqMan RT-PCR can be performed using commercially available equipment, such as, for example, ABI PRISM 7700 Sequence Detection System (Perkin-Elmer-Applied Biosystems, Foster City, Calif., USA), or Lightcycler (Roche Molecular Biochemicals, Mannheim, Germany).
  • ABI PRISM 7700 Sequence Detection System Perkin-Elmer-Applied Biosystems, Foster City, Calif., USA
  • Lightcycler Roche Molecular Biochemicals, Mannheim, Germany
  • the 5' nuclease procedure is run on a real-time quantitative PCR device such as the ABI PRISM 7700tam Sequence Detection System.
  • the system consists of a thermocycler, laser, charge-coupled device (CCD), camera, and computer.
  • the system amplifies samples in a 96-, 384-, 768-, 1536- or 3072-well format on a thermocycler.
  • laser-induced fluorescent signal is collected in real-time through fibre optics cables for all wells, and detected at the CCD.
  • the system includes software for running the instrument and for analyzing the data.
  • 5' nuclease assay data are initially expressed as Ct, or the threshold cycle.
  • Ct fluorescence values are recorded during every cycle and represent the amount of product amplified to that point in the amplification reaction.
  • the Ct is the cycle number at which the fluorescence generated within a reaction crosses a threshold above basline elevation.
  • Ct values are logarithmic and are used either directly (comparative Ct method) or indirectly (interpolation to standard curves to create linear values) for quantitative analyses.
  • RT-PCR A more recent variation of the RT-PCR technique is the real time quantitative PCR, which measures PCR product accumulation through a dual-labeled fluorigenic probe (i.e., TaqMan probe).
  • Real time PCR is compatible both with quantitative competitive PCR and with quantitative comparative PCR.
  • the former uses an internal competitor for each target sequence for normalization, while the latter uses a normalization gene contained within the sample, or a housekeeping gene for RT-PCR. Further details are provided, e.g., by Held et al., Genome Research 6: 986-994 (1996).
  • PCR primers and probes are designed based upon intron sequences present in the gene to be amplified.
  • the first step in the primer/probe design is the delineation of intron sequences within the genes. This can be done using publicly available software, such as the DNA BLAT software developed by Kent, W. ]., Genome Res. 12 (4) : 656-64 (2002), or by the BLAST software including its variations. Subsequent steps follow well established methods of PCR primer and probe design.
  • PCR primer design The most important factors considered in PCR primer design include primer length, melting temperature (Tm), and G/C content, specificity, complementary primer sequences, and 3' end sequence.
  • optimal PCR primers are generally 17-30 bases in length, and contain about 20-80%, such as, for example, about 50-60% G+C bases. Melting temperatures between 50 and 80°C, e.g., about 50 to 70°C, are typically preferred.
  • LAMP is an isothermal nucleic acid amplification technique.
  • isothermal amplification is carried out at a constant temperature, and does not require a thermal cycler.
  • the target sequence is amplified at a constant temperature of 60-65 °C using either two or three sets of primers and a polymerase with high strand displacement activity in addition to a replication activity.
  • a polymerase with high strand displacement activity in addition to a replication activity.
  • 4 different primers are used to identify 6 distinct regions on the target gene, which adds highly to the specificity.
  • An additional pair of "loop primers" can further accelerate the reaction . Due to the specific nature of the action of these primers, the amount of DNA produced in LAMP is considerably higher than PCR based amplification.
  • Detection of amplification product can be determined via photometry for turbidity caused by an increasing quantity of magnesium pyrophosphate precipitate in solution as a byproduct of amplification . This allows easy visualization by the naked eye, especially for larger reaction volumes, or via simple detection approaches for smaller volumes.
  • the reaction can be followed in real-time either by measuring the turbidity or by fluorescence using intercalating dyes such as SYTO 9.
  • Dyes such as SYBR green, can be used to create a visible color change that can be seen with naked eyes without the need for expensive equipment, or a response that can more accurately be measured by instrumentation.
  • Dye molecules intercalate or directly label the DNA, and in turn can be correlated to the number of copies initially present. Hence, LAMP can also be quantitative.
  • In-tube detection of DNA amplification is possible using manganese loaded calcein which starts fluorescing upon complexation of manganese by pyrophosphate during in vitro DNA synthesis.
  • Recmobinase polymerase amplification employs three core enzymes, namely a recombinase, a single-stranded DNA-binding protein (SSB) and a strand-displacing polymerase.
  • Recombinases are capable of pairing oligonucleotide primers with homologous sequence in duplex DNA.
  • SSB bind to displaced strands of DNA and prevent primers from being displaced.
  • the strand displacing polymerase begins DNA synthesis where the primer has bound to the target DNA. By using two opposing primers, an exponential DNA amplification reaction is initiated where the target sequence is present. No other sample manipulation such as thermal or chemical melting is required to initiate amplification.
  • PAGE gels were removed from the cling film and paper towels. These were inserted in to an appropriate gel tank and sufficient running buffer (IX TBE) was added to reach approximately 80% the height of the gel. The gel combs were carefully removed and flushed with a small amount of running buffer to remove any air bubbles. Appropriate ladders were added (Low Molecular Weight DNA ladder from NEB covering 25bp-766bp and/or the Roche XIV lOObp ladder covering lOObp- 3000bp) followed by the analysed DNA samples, each with Ficoll loading dye (15% Ficoll 400, 0.25% bromophenol blue, 0.25% xylene cyanol) .
  • Ficoll loading dye (15% Ficoll 400, 0.25% bromophenol blue, 0.25% xylene cyanol
  • the electrodes were connected to the power pack, the power turned on, and the electrophoresis run started at IV/cm to 5V/cm. Higher voltages should be avoided as they can lead to gel distortions. PAGE runs typically take 1-2 hours to complete, being run until the marker dyes have migrated the desired distance. At this point the power pack was turned off, the leads disconnected and the electrophoresis running buffer transferred to a large glass bottle. The glass plates were detached from the gel tank and separated. The PAGE gel was transferred to an EtBr/lX TBE solution for staining for 10 minutes. Page gels were imaged on a UV gel imager such as a BioRad Gel Doc.
  • the Luminaris® HRM half reaction protocol was used for HRM analysis in this research. Solutions used in the reaction were vortexed and briefly centrifuged after thawing . A reaction master mix was then prepared . For an individual 10 ⁇ reaction, this required 5 ⁇ of Master Mix (2x), 0.5 ⁇ of the forward primer at 10 ⁇ , 0.5 ⁇ of the reverse primer at 10 ⁇ , and 1.5 ⁇ of nuclease-free water. This reaction master mix was scaled up to the number of samples being analysed, including controls. Template DNA was prepared by mixing equal parts template DNA (at approximately 6 ng/ ⁇ ) to 8x yellow sample buffer (commonly 7 ⁇ of template mixed with 7 ⁇ of buffer - giving enough prepared template for five reactions) .
  • Curve acquisition for the Tuberculosis assays was raised to 97 C from the standard 95°C to allow for stronger normalisation post melt as these assays have high melting temperatures. If there was contaminating DNA in any water control, the HRM analysis of all samples on the affected plate would be repeated.
  • the high resolution melt curves produced were visualized and analysed in a variety of ways. These include raw data melt curves, normalized melt curves, difference graphs and melting peaks. Each of these can be generated from available software on the LightCycler ® 480.
  • Standard PCR was carried out on the analysed sample (See Methods - PCR) at the assayed site - with an exonuclease-blocked forward primer and a normal reverse primer.
  • a wildtype sample was PCR amplified using an exonuclease- blocked reverse primer of the same sequence and a normal forward primer.
  • Exonuclease blocked primers contain 6 phosphorothioate linkages in tandem on the 5' termini. Each of these amplified products were then exposed to T7 exonuclease, generating single stranded DNAs.
  • the two ssDNAs are then combined and held at 50°C for 5 minutes to anneal correctly - the wildtype ssDNA being completely complementary to the analysed sample ssDNA unless there were mutations present in the original sample. In this case, all dsDNA molecules formed will carry heteroduplexes, giving a 100% heteroduplexed DNA sample.
  • EMP Enzyme Mediated Profiling
  • the EMP method is simply a T7 endonuclease assay followed by either a T7 exonuclease assay or Lambda exonuclease assay, with the ultimate DNA products being analysed with both PAGE and Agarose gels.
  • the 96-well plate was then removed from the LightCycler ® 480.
  • ⁇ of MgCb (0.15M)
  • 1.5 ⁇ of diluted Surveyor Enhancer 0.5 ⁇ of Surveyor Enhancer diluted 1 : 2 in one of the plates water controls
  • 1.5 ⁇ of diluted Surveyor Nuclease 0.5 ⁇ of Surveyor Nuclease diluted 1 :2 in one of the plates water controls
  • the ultimate DNA products were then analysed through the standard method of high resolution melt curve acquisition - a graduated temperature increase with fluorescent data acquisitions from 65°C to 95°C at a rate of 0.2°C/2s. Curve acquisition for the Tuberculosis assays was raised to 98°C from the standard 95°C to allow for stronger normalisation post melt as these assays have high melting temperatures.
  • the Enzymatic HRM curves produced were visualized and analysed in a variety of ways. These include raw data melt curves, normalized melt curves, difference graphs and melting peaks. Each of these can be generated from available software on the LightCycler ® 480.
  • the assays, methods and kits according to the present invention provide a clinically significant assay for the diagnosis of drug-resistant tuberculosis in infected patients by identifying mutations in the genome of Mycobacterium tuberculosis responsible for resistance to frontline antibiotics.
  • rifampicin comprises one or more polymorphisms located in the so-called 81 bp rifampicin resistance determining region (RRDR) of the ropB gene, being the target of many commercial/clinical assays.
  • RRDR rifampicin resistance determining region
  • Applicants had access to genomic DNA samples carrying a range of antibiotic resistance-causing SNPs, in this example Applicants transformed the Mycobacterium tuberculosis rpoB gene into a rapid growing bacterial strain suitable for PC2 handling. Each of the Tuberculosis assays is therefore targeting the native sequence now located on a plasmid vector.
  • the mutated rpoB gene contains a single nucleotide polymorphism at position 309 of SEQ ID NO : l (SEQ ID NO : 3; A G polymorphism conferring D435G change at the amino acid level).
  • the engineered sequence is as follows :
  • DH5 and transformed colonies were selected on the basis of growth in the presence of ampicillin (AmpR; positive growth selection) . Further, selection of those colonies carrying the non/mutated rpoB insert was made using a blue/white phenotypic colour selection based on loss of function of LacZ from the cloning cassette. Again, refer to Figure 16 which illustrates the pGEM-Teasy vector structure comprising the AmpR and LacZ genes.
  • the primer sets identified in Table I were designed using the NCBI primer designing tool at: ttj3 ; /.w ⁇
  • Amplification using the various primer pairs resulted in the generation of different sized amplicons. Specifically, amplification using the A/B primer pair yielded a 129bp amplicon (SEQ ID NO: 70); amplification using the C/D primer pair yielded a 200bp amplicon (SEQ ID NO:71); amplification using the E/F primer pair yielded a 271bp amplicon (SEQ ID NO:72); amplification using the G/H primer pair yielded a 395bp amplicon (SEQ ID NO: 73); and amplification using the I/J primer pair yielded a 604bp amplicon (SEQ ID NO:74).
  • SEQ ID NO: 70 amplification using the A/B primer pair yielded a 129bp amplicon
  • SEQ ID NO:71 amplification using the C/D primer pair yielded a 200bp amplicon
  • SEQ ID NO:71 amplification using the E/F primer pair yielde
  • reaction mix was either (i) subjected to high resolution melt analysis to determine T m (i.e. 'non-enzymatic/standard HRM') or (ii) treated with a structure specific enzyme that recognizes and cleaves at, or immediately adjacent to, a heteroduplex, and then subjected to high resolution melt analysis to determine T m (i.e. 'enzymatic HRM').
  • This enzyme treatment step yields DNA of different size(s) that can be more readily resolved using melt curve analysis. This concept is illustrated in Figure 9.
  • melt curve analysis was conducted using the Luminaris® HRM kit and the LightCycler®480 platform.
  • Figure 17 shows non-enzymatic/standard HRM melt curves (relative fluorescence as a function of temperature) for COMBINED Mycobacterium tuberculosis amplicons: namely 129bp, 200bp, 271bp, 395bp and 604bp amplicons.
  • Figures 18A-18E show non-enzymatic HRM melt curves (relative fluorescence as a function of temperature) for INDIVIDUAL Mycobacterium tuberculosis amplicons.
  • the experimental assay is therefore behaving as expected.
  • melt curve data demonstrate that non-enzymatic HRM assays were able to distinguish between homoduplex and heteroduplex DNA for the smaller rpoB amplicons (i.e. 129bp and 200bp; Figures 18A and 18B) but could not distinguish between homoduplex and heteroduplex DNA for the larger rpoB amplicons (i.e. 271bp, 395bp and 604bp). Further, improved resolution for the 129bp amplicon compared to the 200bp amplicon reinforces the observed limitation associated with the application of non-enzymatic (standard) H M to amplicons > > 100-150bp.
  • FIG. 19 shows enzymatic HRM melt curves (relative fluorescence as a function of temperature) for the 200bp Mycobacterium tuberculosis amplicon following treatment with a heteroduplex specific enzyme (refer to Figure 9).
  • the closed squares represent the average melt curve of all homoduplex DNA following the enzyme treatment step, whereas the open squares represents the average melt cu rve of all heteroduplex DNA following the enzyme treatment step.
  • the average melt transition (Tm) between double and single stranded DNA occurs at a temperature of >0.5°C lower for heteroduplex DNA compared to homoduplex DNA (compare Figure 18B with Figure 19) .
  • Figure 20 shows the relative fluorescence signal difference as a function of temperature for the 200bp Mycobacterium tuberculosis amplicon between homoduplex DNA (closed squares) and heteroduplex DNA (open squares) following enzyme treatment.
  • the enzymatic HRM assays/methods according to the present invention provide significantly improved sensitivity over non- enzymatic/standard HMR assays in terms of (i) increased resolution of amplicon T m and (ii) assay range (i.e. size) of amplicons in which genetic differences may be resolved, meaning that differences in genetic variation may be more readily identified .
  • the assays, methods and kits of the present invention provide an effective tool for point of care diagnostics in genotyping patients infected by multi-drug resistant and extensively drug resistant Mycobacterium tuberculosis. This in turn leads to improved therapeutic outcomes by providing a personalized medicine approach to the management and treatment of Tuberculosis.
  • the 1097bp K13 gene (SEQ ID NO: 75) consists in the following sequence:
  • Applicants engineered mutants form of the Plasmodium falciparum K13 gene using extension PCR mutagenesis and cloned the mutated K13 gene sequences into the pGEM-Teasy expression vector.
  • the mutated K13 genes contain a single nucleotide polymorphism at positions (SNPl), 493 (SNP2), 539 (SNP3) and 580 (SNP4) of SEQ ID NO:75 (i.e. SEQ ID NOs:76-79).
  • the engineered sequences are as follows: ⁇ 13 F446I' (SEQ ID NO:76; SNPl bold/underlined)
  • the non/mutated K13 containing vectors were then transformed into Escherichia coli DH5 and transformed colonies were selected on the basis of growth in the presence of ampicillin (AmpR; positive growth selection). Further, selection of those colonies carrying the non/mutated K13 insert was made using a blue/white phenotypic colour selection based on loss of function of LacZ from the cloning cassette.
  • Figure 22 illustrates the pGEM-Teasy vector structure comprising the AmpR and LacZ genes.
  • Vector DNA was then extracted from selected Amp R LacZ " colonies for amplification.
  • the present invention contemplates different amplification protocols (refer above), for the purpose of this working example Applicants used polymerase chain reaction.
  • primer pairs to the K13 gene of Plasmodium fulciparum were generated. This is illustrated conceptually in Figure 21, where the primer pairs A/X, Y/B, A/B, C/D, E/F and G/H were designed to generate different sized amplicons, where each amplicon comprises a genetic region comprising one or more of the SNPs (i.e.) SNP1, SNP2, SNP3 and/or SNP4.
  • primer sequences and associated amplicon properties are listed in Table II as follows: Table II: Primer pairs and amplicon information Plasmodium falciparum
  • Amplification using the various primer pairs resulted in the generation of different sized amplicons. Specifically, amplification using the A/X primer pair yielded a 140bp amplicon (SEQ ID NO:90); amplification using the Y/B primer pair yielded a 105bp amplicon (SEQ ID NO:91); amplification using the A/B primer pair yielded a 514bp amplicon (SEQ ID NO:92); amplification using the C/D primer pair yielded a 521bp amplicon (SEQ ID NO:93); amplification using the E/F primer pair yielded a 1064bp amplicon (SEQ ID NO:94); amplification using the G/H primer pair yielded a 1074bp amplicon (SEQ ID NO:95).
  • SEQ ID NO:90 amplification using the A/X primer pair yielded a 140bp amplicon
  • amplification using the Y/B primer pair yielded a 105b
  • DNA amplification was performed using parallel amplification protocols.
  • the first protocol involved amplification of vector DNA comprising the wild-type K13 gene (SEQ ID NO:75; amplification via C/D primer pair).
  • the second protocol involved amplification of vector DNA comprising the mutated K13 gene containing various single nucleotide polymorphisms (specifically SEQ ID NOs: 77, 79; amplification via C/D primer pair).
  • SEQ ID NOs: 77, 79 single nucleotide polymorphisms
  • the wild-type K13 amplicon represents the nucleic acid standard
  • the mutated K13 amplicons represents the test nucleic acid sequence.
  • the amplicons were then subjected to a denaturing/renaturing reaction to generate a reaction mix comprising homoduplexed DNA (i.e. where there is perfect stringency between complementary DNA strands) and/or heteroduplexed DNA (i.e. where there is imperfect stringency between substantially complementary DNA strands).
  • reaction mix was either (i) subjected to high resolution melt analysis to determine T m (i.e. 'non-enzymatic/standard HRM') or (ii) treated with a structure specific enzyme that recognizes and cleaves at, or immediately adjacent to, a heteroduplex, and then subjected to high resolution melt analysis to determine T m (i.e. 'enzymatic HRM').
  • This enzyme treatment step yields DNA of different size(s) that can be more readily resolved using melt curve analysis. This concept is illustrated in Figure 9.
  • melt curve analysis was conducted using the Luminaris® HRM kit and the LightCycler®480 platform.
  • Figure 23 shows non-enzymatic/standard HRM melt curves (relative fluorescence as a function of temperature) for COMBINED Plasmodium falciparum amplicons: namely 105bp, 514bp, 521bp, and 1074bp amplicons.
  • Figures 24A-24D show non-enzymatic HRM melt curves (relative fluorescence as a function of temperature) for INDIVIDUAL Plasmodium fulciparum amplicons.
  • the experimental assay is therefore behaving as expected.
  • melt curve data demonstrate that non-enzymatic HRM assays were able to distinguish between homoduplex and heteroduplex DNA for the smallest K13 amplicon (i.e. 105bp; Figures 24A) but could not distinguish between homoduplex and heteroduplex DNA for the larger K13 amplicons (i.e. 514bp, 521bp and 1074bp). This reinforces the observed limitation associated with the application of non-enzymatic (standard) HRM to amplicons > >100-150bp.
  • FIG. 25 shows enzymatic HRM melt curves (relative fluorescence as a function of temperature) for the 521bp Plasmodium falciparum amplicon following treatment with a heteroduplex specific enzyme (refer to Figure 9).
  • the closed squares represent the average melt curve of all homoduplex DNA following the enzyme treatment step, whereas the open squares represents the average melt curve of all heteroduplex DNA following the enzyme treatment step.
  • the average melt transition (T m ) between double and single stranded DNA occurs at a temperature of >0.5°C lower for heteroduplex DNA compared to homoduplex DNA.
  • Figure 26 shows the relative fluorescence signal difference as a function of temperature for the 521bp Plasmodium falciparum amplicon between homoduplex DNA (closed squares) and heteroduplex DNA (open squares) following enzyme treatment.
  • the enzymatic HRM assays/methods according to the present invention provide significantly improved sensitivity over non- enzymatic/standard HMR assays in terms of (i) increased resolution of amplicon T m and (ii) range (i.e. size) of amplicons that may be assayed, meaning that differences in genetic variation may be more readily resolved/identified.
  • the assays, methods and kits of the present invention provide an effective tool for incorporation in point of care diagnostic application for genotyping patients infected by Plasmodium falciparum. Having an ability to provide a personalized medicine approach to diagnose patients with Malaria would provide critical health care needs in the developing world where the disease is such a significant health problem.
  • the assays, methods and kits according to the present invention may be used in a non-infectious disease context (e.g .) to identify polymorphisms in crop plants that can be used to identify particular cultivars or accessions such as Arabidopsis thaliana.
  • This agricultural application is economically and environmentally significant by identifying (e.g .) a single nucleotide polymorphism between two related plant varieties that could be used for marker assisted selection and trait improvement. This method of selection has been used to increase crop yields, nutritional quality and tolerance to environmental extremes such as drought.
  • the assays, methods and kits according to the present invention were used to distinguish between to accessions of Arabidopsis thaliana, namely Landsberg erecta (LER) and Columbia (COL), by identifying a single nucleotide polymorphism in the kinesin motor protein-related gene (GI : 186491180) .
  • the equivalent sequence derived from LER genomic DNA comprises the following sequence (SEQ ID NO:97) :
  • Genomic DNA was used in this working example, with the assays being tested in the native background of Arabidopsis thaliana.
  • Arabidopsis thaliana is a diploid organism, with five chromosomes that have each been brought to homozygosity in the LER and COL accessions used in this research
  • primer pairs to the kinesin motor protein-related gene were generated. This is illustrated conceptually in Figure 27, where the primer pairs A/B, C/D, E/F, G/H, I/J and K/L were designed to generate different sized amplicons, where each amplicon comprises the single nucleotide polymorphism that can be used to distinguish between Arabidposis thaliana accessions.
  • primer sequences and associated amplicon properties are listed in Table III as follows: Table III: Primer pairs and amplicon information Arabidposis thaliana
  • the primer sets identified in Table III were designed using the NCBI primer designing tool at:
  • Amplification using the various primer pairs resulted in the generation of different sized amplicons. Specifically, amplification using the A/B primer pair yielded a 127bp amplicon (SEQ ID NO : 109); amplification using the C/D primer pair yielded a 125bp amplicon (SEQ ID NO: 110); amplification using the E/F primer pair yielded a 208bp amplicon (SEQ ID NO: 111); amplification using the G/H primer pair yielded a 361bp amplicon (SEQ ID NO: 112); amplification using the I/J primer pair yielded a 410bp amplicon (SEQ ID NO: 113); amplification using the K/L primer pair yielded a 570bp amplicon (SEQ ID NO: 114).
  • amplification using the A/B primer pair yielded a 127bp amplicon (SEQ ID NO : 109); amplification using the C/D primer pair
  • Figure 3(d') shows the results in Figure 3(d) represented as a semi-quantitative trace.
  • the signal generated from the intact DNA bands (Lanes 2, 3, and 6 in Figure 3(d)) is shown to be far greater than that of a degraded sample (Lane 5 in Figure 3(d)) or to background levels (Lane 4 in Figure 3(d)).
  • Figure 3(e) shows a summary of the results in the prime series of panels ( Figures 3(a')-(d')), with a similar average singal between all homoduplex samples before EMP activity, all heteroduplex samples before EMP activity, and all homoduplex samples after EMP activity. Significantly, the average signal of all heteroduplex samples after EMP falls markedly, being approximately 1.4% that of the other average signals.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention provides assays, methods and test kits for alternate genotyping methods, including nucleic acid sequence based diagnostics, and in particular for identifying genetic variation in a test sample.

Description

GENOTYPING METHOD
TECHNICAL FIELD
The present invention relates generally to the field of nucleic acid sequence based genotyping, including use in diagnostics. In particular, the present invention provides assays, methods and kits to identify genetic variation in a nucleic acid sample. Further, the identification of disease treatment resistant traits conferred by genetic variation in a nucleic acid sequence of interest using the assays, methods and kits of the present invention is also contemplated. For example, in determining antibiotic resistance in the treatment of infectious disease (e.g.) Tuberculosis or Malaria.
BACKGROUND OF THE INVENTION
The ability to rapidly and reliably identify the genetic sequence of a sample is now at the forefront of modern medicine and scientific research. Traditional diagnostic methods that rely on the observation of symptomatic disease, of microbial growth characteristics, or on histology, are now being replaced by molecular methods such as DNA diagnostics that are capable of determining the DNA sequence of a genetic sample. This shift has been made possible by an increased scientific understanding of the genetic causes of disease, with defined regions of both human and pathogen genomes now identified as underlying disease traits.
DNA diagnostic methods typically generate a partial genotype, resolving between a normal sequence and one that carries a mutation. A complete genotype requires sequencing, a comparatively expensive and slow process that determines the complete DNA sequence across an analysed region. The comparative speed and cost-effectiveness of DNA diagnostics have recently lead to an established and increasing global market.
In the field of DNA diagnostics, melt assays such as high resolution melt (HRM) are now considered conventional. These assays are rapid, affordable and sensitive, although with some limitations. Because of these favourable characteristics, melt assays have been applied broadly to molecular diagnostics, and remain almost entirely lab-based. This is an obstacle for the many diagnostic applications that require use outside of laboratory frameworks.
The ability for healthcare professionals to rapidly and accurately diagnose disease, and if necessary administer treatment to patients would significantly improve disease outcomes. The benefits of rapid diagnosis and adequate treatment include a reduction in ongoing transmissions and disease progression, prevention of pathogen evolution and antibiotic-resistance emergence, and more positive clinical outcomes for the patient. This has already been recognised by national and international groups including World Health Organization, Global Health Investment Fund and the British and US Governments. Additionally, other applications of genotype-based diagnostics are found outside the field of medicine. In the agricultural sector, for example, genotyping is used to expedite the introduction of valuable traits into crops or livestock, for the early detection of disease, and to provide traceability to valuable produce. Broader examples include forensics, biotechnology and genetic counseling . A shift to portable or decentralised DNA diagnostics would have many benefits here also.
The purpose of the present invention is to provide improved methodologies (e.g . improved sensitivity and range) in the field of genetic based diagnostics. SUMMARY OF THE INVENTION
The inventions described and claimed herein have many attributes and embodiments including, but not limited to, those set forth or described or referenced in this Summary of the Invention . It is not intended to be all-inclusive and the inventions described and claimed herein are not limited to or by the features or embodiments identified in this Summary of the Invention, which is included for purposes of illustration only and not restriction .
In an aspect of the present invention there is provided an assay method for identifying genetic variation in a nucleic acid sample, the method comprising the steps of:
(i) generating a test nucleic acid sequence to be tested for the genetic variation, wherein the test nucleic acid sequence is resistant to 5'-exonuclease activity;
(ii) generating a control nucleic acid sequence which does not have the genetic variation, wherein the control nucleic acid sequence is resistant to 5'- exonuclease activity;
(iii) in a test mixture, mixing the test nucleic acid sequence and the control
nucleic acid sequence for a time and under conditions that allow formation of homoduplex and/or heteroduplex nucleic acids; and
(iv) adding to the test mixture a nucleic acid-specific endonuclease and a nucleic acid-specific 5'-exonuclease for a time and under conditions that allow activity by the endonuclease and the 5'-exonuclease on the nucleic acid sequences; wherein, genetic variation in the test nucleic acid is identified where there is no detectable amount of nucleic acid present in the test mixture above a threshold minimum .
In another aspect of the present invention there is provided a method for diagnosing multidrug resistance tuberculosis in a patient suspected of being infected by a multidrug resistant Mycobacterium tuberculosis, the method comprising the steps of:
(i) obtaining a test sample from the patient; (ii) generating from the test sample, a test nucleic acid sequence to be tested for the presence of a genetic variation that correlates to multidrug resistance tuberculosis in the patient, wherein the test nucleic acid sequence is resistant to 5'-exonuclease activity;
(iii) generating a control nucleic acid sequence which does not have the genetic variation, wherein the control nucleic acid sequence is resistant to 5'- exonuclease activity;
(iv) in a test mixture, mixing the test nucleic acid sequence and the control
nucleic acid sequence for a time and under conditions that allow formation of homoduplex and/or heteroduplex nucleic acids; and
(v) adding to the test mixture a nucleic acid-specific endonuclease and a nucleic acid-specific 5'-exonuclease for a time and under conditions that allow activity by the endonuclease and 5'-exonuclease on the nucleic acid sequences; wherein, identification of a patient infected by a multidrug resistance Mycobacterium tuberculosis is achieved where there is no detectable amount of nucleic acid present in the test mixture above a threshold minimum.
In yet another aspect of the present invention there is provided a method for diagnosing multidrug resistance tuberculosis in a patient suspected of being infected by a multidrug resistant Mycobacterium tuberculosis, the method comprising the steps of:
(i) obtaining a test sample from the patient;
(ii) generating from the test sample, a test nucleic acid sequence to be tested for the presence of a genetic variation that correlates to multidrug resistance tuberculosis in the patient, wherein the test nucleic acid sequence is resistant to 5'-exonuclease activity and comprises a nucleic acid sequence defined by SEQ ID NO: 2 ;
(iii) generating a control nucleic acid sequence which does not have the genetic variation, wherein the control nucleic acid sequence is resistant to 5'- exonuclease activity;
(iv) in a test mixture, mixing the test nucleic acid sequence and the control
nucleic acid sequence for a time and under conditions that allow formation of homoduplex and/or heteroduplex nucleic acids; and
(v) adding to the test mixture a nucleic acid-specific endonuclease and a nucleic acid-specific 5'-exonuclease for a time and under conditions that allow activity by the endonuclease and 5'-exonuclease on the nucleic acid sequences; wherein, identification of a patient infected by a multidrug resistance Mycobacterium tuberculosis is achieved where there is no detectable amount of nucleic acid present in the test mixture above a threshold minimum. In yet a further aspect of the present invention there is provided a method for diagnosing antibiotic resistance in a patient suspected of being infected by antibiotic resistant Plasmodium fulciparum, the method comprising the steps of:
(i) obtaining a test sample from the patient;
(ii) generating from the test sample, a test nucleic acid sequence to be tested for the presence of a genetic variation that correlates to antibiotic resistant Plasmodium fulciparum, wherein the test nucleic acid sequence is resistant to 5'-exonuclease activity;
(iii) generating a control nucleic acid sequence which does not have the genetic variation, wherein the control nucleic acid sequence is resistant to 5'- exonuclease activity;
(iv) in a test mixture, mixing the test nucleic acid sequence and the control
nucleic acid sequence for a time and under conditions that allow formation of homoduplex and/or heteroduplex nucleic acids; and
(v) adding to the test mixture a nucleic acid-specific endonuclease and a nucleic acid-specific 5'-exonuclease for a time and under conditions that allow activity by the endonuclease and 5'-exonuclease on the nucleic acid sequences; wherein, identification of a patient infected by an antibiotic resistant Plasmodium falciparum is achieved where there is no detectable amount of nucleic acid present in the test mixture above a threshold minimum.
In yet a further aspect of the present invention there is provided a method for diagnosing antibiotic resistance in a patient suspected of being infected by antibiotic resistant Plasmodium fulciparum, the method comprising the steps of:
(i) obtaining a test sample from the patient;
(ii) generating from the test sample, a test nucleic acid sequence to be tested for the presence of a genetic variation that correlates to antibiotic resistant Plasmodium fulciparum, wherein the test nucleic acid sequence is resistant to 5'-exonuclease activity and comprises a nucleic acid sequence defined by SEQ ID NO:75;
(iii) generating a control nucleic acid sequence which does not have the genetic variation, wherein the control nucleic acid sequence is resistant to 5'- exonuclease activity;
(iv) in a test mixture, mixing the test nucleic acid sequence and the control
nucleic acid sequence for a time and under conditions that allow formation of homoduplex and/or heteroduplex nucleic acids; and
(v) adding to the test mixture a nucleic acid-specific endonuclease and a nucleic acid-specific 5'-exonuclease for a time and under conditions that allow activity by the endonuclease and 5'-exonuclease on the nucleic acid sequences; wherein, identification of a patient infected by an antibiotic resistant Plasmodium falciparum is achieved where there is no detectable amount of nucleic acid present in the test mixture above a threshold minimum.
In a further aspect of the present invention there is provided a method for identifying Arabidopsis cultivars of commercial interest, the method comprising the steps of:
(i) obtaining a test sample from an Arabidopsis plant;
(ii) generating from the test sample, a test nucleic acid sequence to be tested for the presence of a genetic variation that correlates to an Arabidopsis cultivar of commercial interest, wherein the test nucleic acid sequence is resistant to 5'- exonuclease activity;
(iii) generating a control nucleic acid sequence which does not have the genetic variation, wherein the control nucleic acid sequence is resistant to 5'- exonuclease activity;
(iv) in a test mixture, mixing the test nucleic acid sequence and the control
nucleic acid sequence for a time and under conditions that allow formation of homoduplex and/or heteroduplex nucleic acids; and
(v) adding to the test mixture a nucleic acid-specific endonuclease and a nucleic acid-specific 5'-exonuclease for a time and under conditions that allow activity by the endonuclease and 5'-exonuclease on the nucleic acid sequences; wherein, identification of an Arabidopsis cultivar of commercial interest is achieved where there is no detectable amount of nucleic acid present in the test mixture above a threshold minimum.
In yet a further aspect of the present invention there is provided a method for identifying Arabidopsis thaliana cultivars of commercial interest, the method comprising the steps of:
(i) obtaining a test sample from an Arabidopsis thaliana plant;
(ii) generating from the test sample, a test nucleic acid sequence to be tested for the presence of a genetic variation that correlates to an Arabidopsis thaliana cultivar of commercial interest, wherein the test nucleic acid sequence is resistant to 5'-exonuclease activity and comprises a nucleic acid sequence defined by SEQ ID NO: 97 or SEQ ID NO:98;
(iii) generating a control nucleic acid sequence which does not have the genetic variation, wherein the control nucleic acid sequence is resistant to 5'- exonuclease activity;
(iv) in a test mixture, mixing the test nucleic acid sequence and the control
nucleic acid sequence for a time and under conditions that allow formation of homoduplex and/or heteroduplex nucleic acids; and (v) adding to the test mixture a nucleic acid-specific endonuclease and a nucleic acid-specific 5'-exonuclease for a time and under conditions that allow activity by the endonuclease and 5'-exonuclease on the nucleic acid sequences; wherein, identification of an Arabidopsis thaliana cultivar of commercial interest is achieved where there is no detectable amount of nucleic acid present in the test mixture above a threshold minimum.
In a further aspect of the present invention there is provided an assay comprising any one or more features of the methods described herein.
In yet a further aspect of the present invention there is provided an assay comprising any one or more features of the methods described herein in a multiplex format.
In yet a further aspect of the present invention there is provided a test kit comprising reagents and instructions for use in performing the methods or assays as described herein. BRIEF DESCRIPTION OF THE FIGURES
Figure 1 shows a general schematic of the EMP assay.
Figure 1(a) schematic of the enzymatic activity used in the EMP method to target DNA molecules containing heteroduplex structures. A sample having entirely the same sequence relative to the probe DNA will not contain heteroduplex sites, and will be unchanged by the activity of a heteroduplex-specific endonuclease. A sample having a differing sequence relative to the probe DNA will contain one or more heteroduplex sites, and as a result will be sequentially degraded by the combined enzymatic activities of a heteroduplex-specific endonuclease and a 5' specific exonuclease. Initially, the heteroduplex containing DNA is cleaved through the activity of a heteroduplex-specific endonuclease. This cleavage generates newly exposed and unblocked 5' ends on the DNA, open to the nuclease activity of a 5' specific exonuclease. Together, these enzyme activities completely degrade DNA carrying one or more heteroduplex sites.
Figure 1(b) schematic of a typical EMP reaction over time. As a result of the enzyme activity, a wildtype sample remains completely stable and DNA concentration remains high, relative to a sample that contains one or more heteroduplexes. The results of the EMP method could be viewed in this manner, however are typically analysed at an end - point using an agarose gel.
Figure 1(c) EMP of a region of the Plasmodium falciparum genome that can impart artemisinin resistance. The amplicon in this assay is 1074 base pairs in length and has a GC content of 32%. Lane 1 : heteroduplex containing DNA before EMP activity; Lane 2 : wildtype DNA before EMP activity; Lane 3 : heteroduplex containing DNA after EMP activity; Lane 4: wildtype DNA After EMP activity. Figure 2 shows simplified method for genotyping a sample with the EMP method. A test nucleic acid sequence (referred to as the sample) is amplified in the presence of a probe, using a standard (unblocked) forward primer and a 5'-exonuclease-resistant (blocked) reverse primer. At this stage, double stranded DNAs could resemble both 'DNA Product A', with one strand being derived from the sample nucleic acid sequence and the other from the probe, or 'DNA Product B' where both strands are derived from the sample nucleic acid sequence. The mix is directly exposed to the EMP method following amplification. DNA resembling 'DNA Product A' will give a signal that informs the genotype of the original sample: (1) complete sequence match between the sample and probe will be stable over the course of the EMP method, and generate a double stranded DNA signal at completion of the method; and (2) incomplete sequence match between the sample and the probe, with one or more mismatched or non-matched sites, will not be stable over the course of the EMP method. Instead it will be degraded through enzymatic activity, and generate no double stranded DNA signal at completion of the method. DNA resembling 'DNA Product B' is not resistant to 5'-exonuclease activity, and so will be degraded regardless of sequence, generating no double stranded DNA signal at completion of the method.
Figure 3 shows application of the EMP method to genotyping a 1074 base pair region of the Plasmodium falciparum genome associated with artemisinin resistance.
Figure 3(a) agarose gel showing typical results of an EMP assay. Lane 1 : lkb+
Ladder bands (Invitrogen); Lane 2 : wildtype forward strand annealed to a wildtype reverse strand before exposure to the EMP methodology; Lane 3: wildtype forward strand annealed to a Y493H variant reverse strand before exposure to the EMP methodology; Lane 4: empty lane; Lane 5: wildtype forward strand annealed to a wildtype reverse strand after exposure to the EMP methodology; Lane 6: wildtype forward strand annealed to a Y493H variant reverse strand after exposure to the EMP methodology.
Figure 3(b) agarose gel showing results of an EMP assay where the sequence to be protected during the assay has been defined as that of Y493 variant, rather than the wildtype. Lane 1 : lkb+ Ladder bands (Invitrogen) ; Lane 2: Y493H variant forward strand annealed to a wildtype reverse strand before exposure to the EMP methodology; Lane 3 : Y493H variant forward strand annealed to a Y493H variant reverse strand before exposure to the EMP methodology; Lane 4: empty lane; Lane 5: Y493H variant forward strand annealed to a wildtype reverse strand after exposure to the EMP methodology; Lane 6: Y493H variant forward strand annealed to a Y493H variant reverse strand after exposure to the EMP methodology.
Figure 3(a') trace showing the relative signal intensity of the bands in Figure 3(a). Relative intensities are to that of the most intense band on the gel. Figure 3(b') trace showing the relative signal intensity of the bands in Figure 3(b) . Relative intensities are to that of the most intense band on the gel .
Figure 3(c) agarose gel showing typica l results of an EMP assay, in this case using the C580Y variant in place of the Y493H variant. Lane 1 : l kb+ Ladder bands (Invitrogen) ; Lane 2 : wildtype forward stra nd annealed to a wildtype reverse strand before exposure to the EMP methodology; Lane 3 : wildtype forward strand annealed to a C580Y variant reverse strand before exposure to the EMP methodology; Lane 4: empty lane; Lane 5 : wildtype forward strand annealed to a wildtype reverse strand after exposure to the EMP methodology; Lane 6 : wildtype forward strand annealed to a C580Y variant reverse strand after exposure to the EMP methodology
Figure 3(d) agarose gel showing results of an EMP assay where the sequence to be protected during the assay has been defined as that of Χ580Υ variant', rather than the wildtype. Lane 1 : lkb+ Ladder bands (Invitrogen) ; Lane 2 : C580Y variant forward strand annealed to a wildtype reverse strand before exposure to the EMP methodology; Lane 3 : C580Y variant forward strand annealed to a C580Y variant reverse strand before exposure to the EMP methodology; Lane 4: empty lane; Lane 5 : C580Y variant forward strand annealed to a wildtype reverse strand after exposure to the EMP methodology; Lane 6 : C580Y variant forward strand annealed to a C580Y variant reverse strand after exposure to the EMP methodology
Figure 3(c') trace showing the relative signal intensity of the bands in Figure 3(c) .
Relative intensities are to that of the most intense band on the gel .
Figure 3(d') trace showing the relative signal intensity of the bands in Figure 3(d) . Relative intensities are to that of the most intense band on the gel .
Figure 3(e) summary of the application of the EMP method to genotyping the 1074 base pair region of the Plasmodium falciparum genome associated with artemisinin resistance, including each of the variants and strand combinations used in Figures 3(a), (b), (c) and (d) .
Figure 4 shows the application of the EMP methodology to a DNA Microarray.
Figure 4(a) schematic of a DNA microarray spot in which the immobilised probe sequence has hybridised with a DNA sample that is entirely complementary; shown before (i) during (ii) and after (iii) application of the EMP methodology.
Figure 4(b) schematic of a DNA microarray spot in which the immobilised probe sequence has hybridised with a DNA sample that is not entirely complementary and therefore contains heteroduplexes; represented here as a distortion in the hybridised DNA strands. This microarray spot is shown before (i) during (ii) and after (iii) application of the EMP methodology. This double-stranded DNA is processively degraded, first by the activity of a heteroduplex-specific enzyme, and secondly by a 5' to 3' specific exonuclease. This degradation reduces the signal on the spot to background levels. Open arrows indicate the heteroduplex-specific activity has created a nick on the sample strand of the DNA duplex, and closed arrows indicate the heteroduplex-specific activity has created a nick on the probe strand of the DNA duplex. Each may occur simultaneously on a double-stranded DNA molecule, as is shown.
Figure 4(c) schematic of the output from a binary DNA microarray, with a clear signal between spots to which the sample DNA is interacting (shown as dark circles) and those to which the sample has no interaction (shown as white circles).
Figure 4(d) binary DNA microarray output. All DNA probes on the array were originally of the same sequence (SEQ ID NO:70) at 129 basepairs in length, and attached to the epoxysilane-coated glass slide through an amine modification and a C12 linker. Before exposure to the EMP method, probe spots were annealed to a single-stranded DNA sample of wildtype sequence, or one that would create a single heteroduplex site, each being 41 base pairs long. Spots were also annealed to varying concentrations of sample, to give the following : (1) : 0.5μΜ heteroduplex-generating sample; (2): ΙμΜ heteroduplex-generating sample; (3) : 2μΜ heteroduplex-generating sample; (4) negative control with no sample added; (5) : 0.5μΜ wildtype sample; (6) : ΙμΜ wildtype sample; (7) : 2μΜ wildtype sample. Once annealed, spots were exposed to the enzymatic activity shown in Figure 4(a) and Figure 4(b) for 120 minutes. The array was then imaged using PicoGreen dye.
Figure 4(e) relative intensities of DNA spots in the binary DNA microarray lane including spots 1—7 of Figure 4(d). Relative intensities are to that of the most intense of the spots in this row.
Figure 5 shows applications of the EMP method to various genotyping assays.
Figure 5(a) agarose gel showing the results of an EMP assay for genotyping a 1074bp region of the Plasmodium falciparum genome associated with artemisinin resistance. Lane 1 : lkb+ Ladder bands (Invitrogen); Lane 2: wildtype forward strand annealed to a wildtype reverse strand before exposure to the EMP methodology; Lane 3 : wildtype forward strand annealed to a Y493H variant reverse strand before exposure to the EMP methodology; Lane 4: empty lane; Lane 5: wildtype forward strand annealed to a wildtype reverse strand after exposure to the EMP methodology; Lane 6: wildtype forward strand annealed to a Y493H variant reverse strand after exposure to the EMP methodology.
Figure 5(b) agarose gel showing results of the same EMP assay for genotyping a 1074bp region of the Plasmodium falciparum genome as in Figure 5(a), with the Plasmodium falciparum variant sequence now being protected during the assay, rather than the standard wildtype sequence. Lane 1 : lkb+ Ladder bands (Invitrogen) ; Lane 2 : Y493H variant forward strand annealed to a wildtype reverse strand before exposure to the EMP methodology; Lane 3: Y493H variant forward strand annealed to a Y493H variant reverse strand before exposure to the EMP methodology; Lane 4: empty lane; Lane 5 : Y493H variant forward strand annealed to a wildtype reverse strand after exposure to the EMP methodology; Lane 6: Y493H variant forward strand annealed to a Y493H variant reverse strand after exposure to the EMP methodology.
Figure 5(c) agarose gel showing the results of an EMP assay for genotyping a 1074bp region of the Plasmodium falciparum genome associated with artemisinin resistance. Lane 1 : lkb+ Ladder bands (Invitrogen); Lane 2: wildtype forward strand annealed to a wildtype reverse strand before exposure to the EMP methodology; Lane 3 : wildtype forward strand annealed to a C580Y variant reverse strand before exposure to the EMP methodology; Lane 4: empty lane; Lane 5: wildtype forward strand annealed to a wildtype reverse strand after exposure to the EMP methodology; Lane 6: wildtype forward strand annealed to a C580Y variant reverse strand after exposure to the EMP methodology.
Figure 5(d) agarose gel showing results of the same EMP assay for genotyping a 1074bp region of the Plasmodium falciparum genome as in Figure 5(c), with the Plasmodium falciparum variant sequence now being protected during the assay, rather than the standard wildtype sequence. Lane 1 : lkb+ Ladder bands (Invitrogen); Lane 2: C580Y variant forward strand annealed to a wildtype reverse strand before exposure to the EMP methodology; Lane 3: C580Y variant forward strand annealed to a C580Y variant reverse strand before exposure to the EMP methodology; Lane 4: empty lane; Lane 5 : C580Y variant forward strand annealed to a wildtype reverse strand after exposure to the EMP methodology; Lane 6: C580Y variant forward strand annealed to a C580Y variant reverse strand after exposure to the EMP methodology.
Figure 5(e) agarose gel showing the results of an EMP assay for genotyping a 107bp region of the Pseudomonas syringae pathovar actinidiae genome associated with streptomycin resistance. Lane 1 : lkb+ Ladder bands (Invitrogen); Lane 2: wildtype forward strand annealed to a wildtype reverse strand before exposure to the EMP methodology; Lane 3: wildtype forward strand annealed to a RPSL variant reverse strand before exposure to the EMP methodology; Lane 4: empty lane; Lane 5 : wildtype forward strand annealed to a wildtype reverse strand after exposure to the EMP methodology; Lane 6: wildtype forward strand annealed to a RPSL variant reverse strand after exposure to the EMP methodology.
Figure 5(f) agarose gel showing results of the same EMP assay for genotyping a
107bp region of the Pseudomonas syringae pathovar actinidiae genome as in Figure 5(e), with the Pseudomonas syringae pathovar actinidiae variant sequence now being protected during the assay, rather than the standard wildtype sequence. Lane 1 : lkb+ Ladder bands (Invitrogen); Lane 2: RPSL variant forward strand annealed to a wildtype reverse strand before exposure to the EMP methodology; Lane 3 : RPSL variant forward strand annealed to a RPSL variant reverse strand before exposure to the EMP methodology; Lane 4: empty lane; Lane 5: RPSL variant forward strand annealed to a wildtype reverse strand after exposure to the EMP methodology; Lane 6: RPSL variant forward strand annealed to a RPSL variant reverse strand after exposure to the EMP methodology.
Figure 5(g) agarose gel showing the results of an EMP assay for genotyping a 116bp region of the Homo sapiens BRCA2 gene associated with cancer risk. Lane 1 : lkb+ Ladder bands (Invitrogen); Lane 2 : wildtype forward strand annealed to a wildtype reverse strand before exposure to the EMP methodology; Lane 3: wildtype forward strand annealed to a c.72_85delinsTTTAAATAGAT variant reverse strand before exposure to the EMP methodology; Lane 4: empty lane; Lane 5: wildtype forward strand annealed to a wildtype reverse strand after exposure to the EMP methodology; Lane 6: wildtype forward strand annealed to a c.72_85delinsTTTAAATAGAT variant reverse strand after exposure to the EMP methodology.
Figure 5(h) agarose gel showing results of the same EMP assay for genotyping a 116bp region of the Homo sapiens BRCA2 gene as in Figure 5(g), with the Homo sapiens BRCA2 gene variant sequence now being protected during the assay, rather than the standard wildtype sequence. Lane 1 : lkb+ Ladder bands (Invitrogen); Lane 2 : c.72_85delinsTTTAAATAGAT variant forward strand annealed to a wildtype reverse strand before exposure to the EMP methodology; Lane 3 : c.72_85delinsTTTAAATAGAT variant forward strand annealed to a c.72_85delinsTTTAAATAGAT variant reverse strand before exposure to the EMP methodology; Lane 4: empty lane; Lane 5 : c.72_85delinsTTTAAATAGAT variant forward strand annealed to a wildtype reverse strand after exposure to the EMP methodology; Lane 6: c.72_85delinsTTTAAATAGAT variant forward strand annealed to a c.72_85delinsTTTAAATAGAT variant reverse strand after exposure to the EMP methodology.
Figure 5(i) agarose gel showing the results of an EMP assay for genotyping a 604bp region of the Mycobacterium tuberculosis genome associated with rifampicin resistance. Lane 1 : lkb+ Ladder bands (Invitrogen); Lane 2: wildtype forward strand annealed to a wildtype reverse strand before exposure to the EMP methodology; Lane 3: wildtype forward strand annealed to a RPOB DV variant reverse strand before exposure to the EMP methodology; Lane 4: empty lane; Lane 5: wildtype forward strand annealed to a wildtype reverse strand after exposure to the EMP methodology; Lane 6: wildtype forward strand annealed to a RPOB DV variant reverse strand after exposure to the EMP methodology.
Figure 5(j) agarose gel showing results of the same EMP assay for genotyping a 604bp region of the Mycobacterium tuberculosis genome as in Figure 5(i), with the Mycobacterium tuberculosis variant sequence now being protected during the assay, rather than the standard wildtype sequence. Lane 1 : lkb+ Ladder bands (Invitrogen); Lane 2 : shows a RPOB DV variant forward strand annealed to a wildtype reverse strand before exposure to the EMP methodology; Lane 3 : RPOB DV variant forward strand annealed to a RPOB DV variant reverse strand before exposure to the EMP methodology; Lane 4: empty lane; Lane 5 : RPOB DV variant forward strand annealed to a wildtype reverse strand after exposure to the EMP methodology; Lane 6: RPOB DV variant forward strand annealed to a RPOB DV variant reverse strand after exposure to the EMP methodology.
Figure 6 shows a cartoon of a heteroduplex nucleic acid sequence. In this example, wild-type alleles include A-T at the magnified site, whereas the mutated alleles, which contain a polymorphism, include G-C at the magnified site. The genetic content of the remaining annealed/complementary nucleic acids is identical in sequence. When the wild- type and mutated molecules are allowed to anneal, a heteroduplex forms between mismatched A-C base pairs. This heteroduplex changes the conformation of the nucleic acid backbone, lowers the total number of hydrogen bonds that exist between complementary/annealed strands, which in turn affects the melt profile of the double- stranded nucleic acid molecule.
Figure 7 shows a typical nucleic acid melt profile as a function of temperature and pH.
Figure 8 shows (A) a cartoon of heteroduplex DNA that has been cleaved with (B)
Surveryor nuclease and (C) T7 endonuclease. Surveyor nuclease cleaves at sites 3' to the heteroduplex to form a double stranded break, whereas T7 endonuclease cleaves at sites 5' to the heteroduplex to form a double stranded break.
Figure 9 shows a cartoon representing the pre-melt steps associated with the enzymatic HRM concept according to the present invention. Amplification and duplex formation of target amplicons with and without a mutation (e.g. single nucleotide polymorphism) is followed by an enzyme treatment step. The enzyme recognizes and cleaves at, or immediately adjacent to, a heteroduplex, thereby generating amplicons of different size.
Figure 10 shows the melt profile as a function of temperature for different sized amplicons. Smaller amplicons will transition between double- and single-strand (represented by helicity) at lower temperature.
Figure 11 shows a cartoon representing the pre-melt steps associated with the enzyme mediated profiling concept according to the present invention. Amplification and duplex formation of target amplicons with and without a mutation (e.g. single nucleotide polymorphism; homo and heteroduplex formation) is followed by an enzyme treatment step. The enzyme recognizes and cleaves at, or immediately adjacent to, a heteroduplex, thereby generating amplicons of different size. Subsequent treatment with a 5' exonuclease (which is active against susceptible 5' termini designated by open circles) degrades the amplicon further reducing its size. Only those amplicons comprising a heteroduplex that has been cleaved by the structure specific enzyme will be susceptible to the 5'exonuclease activity. The 5' termini at either end of each amplicon are blocked/capped (designated by closed diamonds) thereby preventing degradation by the 5'-exonuclease. Figure 12 shows the relative concentration of wild-type and mutant DNA as a function of time exposed to the 5'-exonuclease. These data show that the 5'-exonuclease activity has no effect on wild-type DNA concentration.
Figure 13 shows a cartoon representing the pre-melt steps associated with the heteroduplexing enzyme treatment concept according to the present invention.
Figure 14 shows the melt profile (as a function of temperature) for amplicons having different GC content. Amplicons having a lower GC content will transition between double- and single-strand (represented by helicity) at lower temperature.
Figure 15 shows the amplicon distribution for Mycobacterium tuberculosis assays, centered on a shared single nucleotide polymorphism (SNP) and encompassing the entire 81bp rifampicin resistance determining region for rifampicin resistance.
Figure 16 shows a pGEM-Teasy vector construct carrying the Mycobacterium tuberculosis (Tuberculosis) rpoB gene sequence.
Figure 17 shows non-enzymatic HRM melt curves (relative fluorescence as a function of temperature) for COMBINED Mycobacterium tuberculosis amplicons: 129bp amplicons = open squares; 200bp amplicons = open triangles; 271bp amplicons = closed circles; 395bp amplicons = open circles; 604bp amplicons = closed squares.
Figure 18 shows non-enzymatic HRM melt curves (relative fluorescence as a function of temperature) for INDIVIDUAL Mycobacterium tuberculosis amplicons. Figure 13A: 129bp amplicons; open squares = homoduplexed DNA, closed squares = heteroduplexed DNA. Figure 13B: 200bp amplicons; open triangles = homoduplexed DNA, closed triangles = heteroduplexed DNA. Figure 13C: 271bp amplicons; open circles = homoduplexed DNA, closed circles = heteroduplexed DNA. Figure 13D: 395bp amplicons; open circles = homoduplexed DNA, closed circles = heteroduplexed DNA. Figure 13E: 604bp amplicons; open squares = homoduplexed DNA, closed squares = heteroduplexed DNA.
Figure 19 shows enzymatic HRM melt curves (relative fluorescence as a function of temperature) for the 200bp Mycobacterium tuberculosis amplicon following treatment with a heteroduplex specific enzyme (refer to Figure 4). The closed squares represent the average melt curve of all homoduplex DNA following the enzyme treatment step, whereas the open squares represents the average melt curve of all heteroduplex DNA following the enzyme treatment step. The average melt transition (Tm) between double and single stranded DNA occurs at a temperature of >0.5°C lower for heteroduplex DNA compared to homoduplex DNA.
Figure 20 shows the relative fluorescence signal difference as a function of temperature for the 200bp Mycobacterium tuberculosis amplicon between homoduplex DNA (closed squares) and heteroduplex DNA (open squares) following enzyme treatment. Figure 21 shows amplicon distribution for the Plasmodium falciparum assays, centered on a genetic region for Artemisinin resistance causing K13 mutations. Four single nucleotide polymorphisms were generated in the K13-propellar gene sequence, designated SNP1 (F446I; , SNP2 (Y493H), SNP3 (R539T) and SNP4 (C580Y).
Figure 22 shows a pGEM-Teasy vector construct carrying the Plasmodium falciparum (Malaria) K13 gene sequence.
Figure 23 shows non-enzymatic HRM melt curves (relative fluorescence as a function of temperature) for COMBINED Plasmodium falciparum amplicons: 105bp amplicons = open circles; 514bp amplicons = open triangles; 521bp amplicons = open squares; 1074bp amplicons = closed circles.
Figure 24 shows non-enzymatic HRM melt curves (relative fluorescence as a function of temperature) for INDIVIDUAL Plasmodium falciparum amplicons. Figure 19A: 105bp amplicons; open circles = homoduplexed DNA, closed circles = heteroduplexed DNA. Figure 19B: 514bp amplicons; open triangles = homoduplexed DNA, closed triangles = heteroduplexed DNA. Figure 19C: 521bp amplicons; open squares = homoduplexed DNA, closed squares = heteroduplexed DNA. Figure 19D: 1074bp amplicons; open circles = homoduplexed DNA, closed circles = heteroduplexed DNA.
Figure 25 shows enzymatic HRM melt curves (relative fluorescence as a function of temperature) for the 521bp Plasmodium falciparum amplicon following treatment with a heteroduplex specific enzyme (refer to Figure 4). The closed squares represent the average melt curve of all homoduplex DNA following the enzyme treatment step, whereas the open squares represents the average melt curve of all heteroduplex DNA following the enzyme treatment step. The average melt transition (Tm) between double and single stranded DNA occurs at a temperature of >0.5°C lower for heteroduplex DNA compared to homoduplex DNA.
Figure 26 shows the relative fluorescence signal difference as a function of temperature for the 521bp Plasmodium falciparum amplicon between homoduplex DNA (closed squares) and heteroduplex DNA (open squares) following enzyme treatment.
Figure 27 shows amplicon distribution for the Arabidopsis thaliana assays, centered on a defined single nucleotide polymorphism between two ecotypes: Landsberg erecta (LER) and Columbia (COL). The SNP is used in marker assisted selection strategies in many crop plants to identify valuable co-localised traits.
Figure 28 shows non-enzymatic HRM melt curves (relative fluorescence as a function of temperature) for COMBINED Arabidopsis thaliana amplicons: 127bp amplicons = open squares; 208bp amplicons = open triangles; 361bp amplicons = closed squares; 410bp amplicons = closed circles; 570bp amplicons = open circles.
Figure 29 shows non-enzymatic HRM melt curves (relative fluorescence as a function of temperature) for INDIVIDUAL Arabidopsis thaliana amplicons. Figure 24A: 127bp amplicons; open squares = homoduplexed DNA, closed squares = heteroduplexed DNA. Figure 24B: 208bp amplicons; open triangles = homoduplexed DNA, closed triangles = heteroduplexed DNA. Figure 24C: 361bp amplicons; open circles = homoduplexed DNA, closed circles = heteroduplexed DNA. Figure 24D: 410bp amplicons; open squares = homoduplexed DNA, closed squares = heteroduplexed DNA. Figure 24E: 570bp amplicons; open circles = homoduplexed DNA, closed circles = heteroduplexed DNA.
Figure 30 shows enzymatic H M melt curves (relative fluorescence as a function of temperature) for the 361bp Arabidopsis thaliana amplicon following treatment with a heteroduplex specific enzyme (refer to Figure 4). The closed squares represent the average melt curve of all homoduplex DNA following the enzyme treatment step, whereas the open squares represents the average melt curve of all heteroduplex DNA following the enzyme treatment step. The average melt transition (Tm) between double and single stranded DNA occurs at a temperature of > 1.0°C lower for heteroduplex DNA compared to homoduplex DNA.
Figure 31 shows the relative fluorescence signal difference as a function of temperature for the 361bp Arabidopsis thaliana amplicon between homoduplex DNA (closed squares) and heteroduplex DNA (open squares) following enzyme treatment.
Figure 32 shows activity of 5'-exonucleases (T5, T7 and Lambda) on phosphorothioate modified 570bp Arabidopsis thaliana amplicons. The phosphorothioate modifications present are indicated by the two numbers below each lane: 0-0 representing no modifications; 0-1 representing a IX reverse primer modification, 1-0 representing a IX forward primer modification ; 1-1 representing a IX reverse primer and IX forward primer modification; 0-2 representing a 2X reverse primer modification; 2-0 representing a 2X forward primer modification; 2-2 representing a 2X reverse primer and 2X forward primer modification. T5 exonuclease is able to degrade all phosphorothioate-modified DNAs, while Lambda is unable to degrade any as they lack 5' phosphates. T7 exonuclease demonstrated significantly reduced degradation with increasing phosphorothioate modifications.
Figure 33 shows activity of 5'-exonucleases (T5, T7 and Lambda) on phosphorothioate modified 604bp Mycobacterium tuberculosis amplicons. The phosphorothioate modifications present are indicated by the two numbers below each lane: 0-0 representing no modifications; 0-1 representing a IX reverse primer modification, 1-0 representing a IX forward primer modification; 1-1 representing a IX reverse primer and IX forward primer modification; 0-2 representing a 2X reverse primer modification; 2-0 representing a 2X forward primer modification; 2-2 representing a 2X reverse primer and 2X forward primer modification . T5 exonuclease is able to degrade all phosphorothioate- modified DNAs, while Lambda is unable to degrade any as they lack 5' phosphates. T7 exonuclease demonstrated significantly reduced degradation with increasing phosphorothioate modifications. Figure 34 shows the compatibility between T7 and Lambda exonucleases and 3' overhangs. Restriction enzymes that cleave DNA to give 3' overhangs (Apal, Haell and Nlalll) were selected that recognise one or more sites in the given amplicon (Tuberculosis - 604 bases). These were then applied to a 6X phosphorothioate modified version of the amplicon to generate restriction fragments with 3' overhangs. This was followed by exposure to T7, Lambda or water (control). The exonucleases degrade the restricted DNA, meaning the enzymes are compatible with 3' overhangs. Note Haell is a partial digest.
Figure 35 shows accurate identification of mutation in a 604bp Mycobacterium tuberculosis amplicon assay using enzyme mediate profiling . This was achieved using T7 endonuclease and a 6X phosphorothioate version of the amplicon followed by T7 exonuclease treatment. The original DNA molecule is stable as a homoduplex (1 and 2) but instable as a heteroduplex (3 and 4) once exposed to T7 endonuclease, where it is enzymatically cleaved to give approximately 300 base products (arrows). Once this is exposed to T7 exonuclease (5 and 6), these 300 base products are completely degraded. The remaining DNA at this stage is homoduplex, as this EMP assay was based on a denature/renature heteroduplexing treatment. Lanes 1, 2=homoduplex DNA following heteroduplex cleavage, the DNA is stable except for a low background exonuclease activity; Lanes 3, 4 = heteroduplex DNA following heteroduplex targeting, the DNA is unstable and cleaved to 2x300bp fragments; Lanes 5, 6 = heteroduplexed DNA following heteroduplex targeting and exposure to a 5'-exonuclease, the enzymatically cleaved DNA is completely degraded.
Figure 36 shows the newly created HET stage generating 100% heteroduplex DNA compatible with EMP and Enzymatic HRM assays. The 604bp Mycobacterium tuberculosis amplicon is first converted into single stranded DNA of one direction, and then combined with complementary single stranded DNA of the wild-type sequence. Lanes 1, 5 = original PCR product, only one strand of sdDNA is exonuclease resistant; Lanes 2, 3, 4, 6 = single stranded DNA generated from the original PCR product or a wild-type sequence PCR product with a 5' exonuclease; Lanes 7, 8 = stable dsDNA formed from a ssDNA from the test sample and ssDNA from the wild-type sample, both strands are exonuclease resistant.
Figure 37 shows linking HET with EMP to give an all-or-nothing genotyping system.
A HET stage was used to generate wild-type/homoduplex DNA (left panel) and 100% heteroduplex DNA (right panel), to represent a sample that had the wild-type sequence and one that had a single mutation in the 604bp Mycobacterium tuberculosis amplicon. These were then exposed to T7 endonuclease for 20 or 40 minutes, and subsequently to T7 exonuclease. Homoduplex DNA was stable throughout this experiment (1-5), while heteroduplexed DNA was completely degraded after exposure to T7 endonuclease then T7 exonuclease (8 and 10). Lane 1 = HET generated wild-type DNA; Lanes 2, 3, 7, 8 = homoduplex or heteroduplex DNA exposed to 20 min of T7 endonuclease; Lane 6 = HET generated mutant DNA; Lanes 4, 5, 9, 10 = homoduplex or heteroduplex DNA exposed to 20 min of T7 endonuclease. Arrows indicate lanes with T7 exonuclease treated DNA.
Figure 38 shows sequence alignment of the 81bp rifampicin resistance determining region (RRDR) in Mycobacterium tuberculosis and examples of various mutations that confer resistance to treatment by rifampicin.
Figure 39 shows the application of the enzymatic HRM methodology to genotyping BRCA status; (a) shows the standard HRM melt curves (relative fluorescence as a function of temperature) for a 140 base pair amplicon genotyping the BRCA1 variant c.2681_2682delAA. The line marked with closed squares represents the average melt curve of all wildtype/homoduplex samples following the enzyme treatment, while the line marked with open squares represents the average melt curve of all heteroduplex-containing samples. The average melt transition (Tm) between double and single stranded DNA for heteroduplex-containing samples is 79.3°C compared to 79.6°C for wildtype/homoduplex. (b) shows the enzymatic HRM melt curves (relative fluorescence as a function of temperature) for a 140 base pair amplicon genotyping the BRCA1 variant c.2681_2682delAA. The line marked with closed squares represents the average melt curve of all wildtype/homoduplex samples following the enzyme treatment, while the line marked with open squares represents the average melt curve of all heteroduplex-containing samples. The average melt transition (Tm) between double and single stranded DNA for heteroduplex-containing samples is 78.2°C compared to 80.2°C for wildtype/homoduplex.
SELECTED DEFINITIONS
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which the inventions belong. Although any assays, methods, devices and materials similar or equivalent to those described herein can be used in the practice or testing of the invention, various assays, methods, devices and materials are now described.
It is intended that reference to a range of numbers disclosed herein (for example 1 to 10) also incorporates reference to all related numbers within that range (for example, 1, 1.1, 2, 3, 3.9, 4, 5, 6, 6.5, 7, 8, 9 and 10) and also any range of rational numbers within that range (for example 2 to 8, 1.5 to 5.5 and 3.1 to 4.7) and, therefore, all sub-ranges of all ranges expressly disclosed herein are expressly disclosed. These are only examples of what is specifically intended and all possible combinations of numerical values between the lowest value and the highest value enumerated are to be considered to be expressly stated in this application in a similar manner.
As used in this specification, the words "comprises", "comprising", and similar words, are not to be interpreted in an exclusive or exhaustive sense. In other words, they are intended to mean "including, but not limited to". As used herein, the term "amplicon" means a defined region of DNA that is the source and/or product of amplification events. An amplicon may be specifically designed to be compatible with qPCR or HRM analyses.
As used herein, the term "anneal" or "renature" means the formation of hydrogen bonds between two complementary single stranded nucleic acid molecules to give double stranded nucleic acids. This is the opposite of denaturation, and commonly applies to short molecules such as DNA primers, amplicons and probes.
As used herein, the term "denature" means the separation of double stranded nucleic acid sequence to a single stranded nucleic acid sequence.
As used herein, the terms "mix" and "for a time and under conditions that allow for formation of homoduplex and heteroduplex nucleic acids" includes molecular reactions that allow the denature (or denaturation) and renature (or renaturation) of nucleic acid molecules. Inherently this involves the denaturation of double stranded nucleic acid molecules to single-stranded nucleic acid molecules and renaturation to form double stranded nucleic acid molecules comprised of different single stranded nucleic acid molecules. This is significant in terms of the methods described herein since the formation of homoduplex and heteroduplex nucleic acid molecules resistant to 5'-exonuclease activity is important.
As used herein, the term "endonuclease" refers to a class of enzymes capable of cleaving a nucleic acid (DNA, RNA or a DNA/RNA hybrid) at an internal position, as opposed to at an end/terminal position of the molecule. Enzyme specificity can be determined by the target DNA sequence or a sequence-independent structure such as a heteroduplex.
As used herein, the term "exonuclease" means a class of enzyme capable of cleaving a nucleic acid (DNA, RNA or a DNA/RNA hybrid) at an end/terminal position. Specificity can be determined by directionality (5' or 3'), on the single or double strandedness of the molecule, or the presence of phosphate groups.
As used herein, the term "5'-exonuclease" means a class of enzyme capable of cleaving a nucleic acid (DNA, RNA or a DNA/RNA hybrid) 5' to 3' from a 5' end/terminal position.
As used herein, the term "CEL. enzyme" means a heteroduplex specific enzyme.
These enzymes have a neutral pH optimum, have high specificity to double stranded mismatched substrates and are not inhibited by high GC content. An example of a CEL enzyme is Surveyor®.
As used herein, the term "threshold minimum" is defined as an amount of residual DNA remaining after the enzymic degradation of DNA susceptible to endonuclease and exonuclease activity.
As used herein, the term "fluorophore" means a fluorescent compound that can re- emit light upon light excitation . These are used to quantify double stranded DNA and for a range of other assays. The light wavelength used for excitation carries more energy than the light wavelength emitted by the fluorophore, allowing for sensitive quantification of fluorophore light emission
As used herein, "HRM" means high resolution melt analysis which involves identifying the presence of heteroduplexes in DNA by increasing the DNA dissociation kinetics. Any heteroduplex sites will destabilise the DNA and cause it to melt/dissociate earlier once subjected to a denaturing agent (heat or a change in pH). This shift from double stranded DNA to single stranded DNA is monitored through fluorescence or chromatography.
As used herein, the acronym "EHRM" means enzymatic high resolution melt analysis. As used herein, the term "GC content" means the percentage of bases in a genome or DNA molecule that are Guanine (G) or Cytosine (C) as opposed to Adenine (A) or Thymine (T) being the "AT content". Guanine and Cytosine form three hydrogen bonds when base paired, making them stronger and more stable than the two hydrogen bonds of Adenine and Thymine base pairs.
As used herein, the term "heteroduplex" means a DNA structure variant introduced when incompatible bases are held adjacent to each other by an otherwise compatible dsDNA. Such structures occur in biological systems, with a range of enzymes having evolved to recognise and cleave these DNA structures to prevent downstream mutation As used herein the acronym "HET" means Heteroduplexing Enzyme Treatment.
As used herein the acronym "MDR" means multi-drug resistance, where a microbe has evolved so that multiple antimicrobial agents have lost efficacy. Specifically in the context of this work, MDR tuberculosis has evolved so that the two frontline antibiotics Rifampicin and Isoniazid have lost efficacy.
The terms "melting temperature" and "Tm" refers to the temperature at which 50% of double strand DNA has either (i) denatured into single strand DNA or (ii) renatured to form double stranded DNA. The Tm corresponds to the midpoint between the minimum UV absorption and maximum UV absorption in a thermal melting profile of a DNA sample. Tm depends on the proportion of GC pairs in the DNA; G-C and C-G pairs, having three hydrogen bonds, being more stable than A-T and T-A pairs which have only two hydrogen bonds. In the presence of reagents that destabilize hydrogen bonds, the Tm is greatly reduced, and this allows strand separation to occur at much lower temperatures; under these conditions much of the damage to the DNA which may occur at high temperatures can be avoided. The Tm is affected by factors including the length of the DNA fragment, the sequence composition of the DNA fragment, salt concentration, and additive (DMSO or formamide) concentration.
As used herein, the term "melting curve peak" refers to the apex of a peak in a melting profile, thus indicating the Tm of a particular DNA fragment. Peaks result from taking the negative first derivative of fluorescence with respect to temperature. As used herein, the term "melt curve analysis" means an assessment of DNA double strandedness, and therefore DNA denaturation characteristics, over the course of a melt analysis.
As used herein, the term "melt peak" means the temperature at which a DNA molecule melts/denatures at the greatest rate. Long DNA molecules can have multiple melt peaks.
As used herein, the term "mis-match" or "mis-match" in reference to double- stranded nucleic acid sequences (e.g. DNA) refers to one or more bases in one strand of the DNA that is not properly paired with an opposing Watson-Crick base in the complementary strand. As will be appreciated, the Watson-Crick base pairs are G-C and A-T base pairs. Mismatches include mispairing, which occurs when the incorrect base appears in the opposite strand (e.g.) T has been replaced with a G, resulting in an A-G mismatch. In other examples, a mismatch occurs when an A in one strand does not have a complementary T in the opposite strand with which to form a base pair. Possible single base mispairing mismatches include A-G, A-C, A-A, T-G, T-C, T-T, G-G and C-C. Mismatches also include unpaired bases that form loops due to insertions or deletions within one strand of the double-stranded DNA. Thus, a mismatch may be one or more unpaired nucleotides that were incorrectly inserted into a sequence and that do not have a corresponding base with which to pair on the opposite strand or one or more unpaired bases for which the opposing nucleotide or nucleotides have been deleted from the opposing strand. Such unpaired mismatches result in one or more unpaired nucleotides forming a loop that projects from the paired double-stranded DNA that flanks the mismatch. An unpaired mismatch may be one or more, two or more, three or more, four or more, five or more, ten or more, 15 or more or 20 or more unpaired nucleotides within one strand of a double-stranded DNA.
As used herein, the terms "match" or "perfect match" when used in reference to double-stranded DNA refers to double-stranded DNA in which all the bases in one strand form a Watson-Crick base pair with a corresponding base in the opposite, complementary strand. Double-stranded DNA having one or more mismatches is referred to as mismatch DNA or heteroduplex DNA. Double-stranded DNA that has no mismatches is referred to as match DNA, perfect match DNA or homoduplex DNA.
As used herein, the term "multiplexed" in the context of PCR refers to the ability to amplify in tandem two or more polymorphisms of a nucleic acid sequence in a single reaction vessel. This is a highly desirable situation since the DNA amplification step of genetic analysis is costly and time consuming. In the context of genotyping, an assay where multiple positions are genotyped simultaneously greatly increases the throughput of the assay.
As used herein, the term "probe" means a synthesised DNA molecule designed to hybridise with a target DNA sequence to generate an effect or signal. These can be labelled (such as by a fluorophore or radioactive isotope) or unlabeled, and are also known as hybridisation probes.
As used herein, the term "real time PCR" or "qPCR" means a variant of polymerase chain reaction in which the amplification of DNA is quantified as the reaction proceeds. This is typically achieved through monitoring fluorescence of an intercalating fluorescent dye. Real time PCR is commonly used as the amplification method prior to HRM and similar analyses.
As used herein the acronym "RFU" means relative fluorescence units.
As used herein, the term "rpoB" means RNA polymerase beta subunit, the gene target of the tuberculosis antibiotic resistance application of the current work.
As used herein, the acronym "rtEMP" means real time enzyme mediated profiling .
As used herein, the term "SNiPerase" means a heteroduplex specific enzyme available from Frontier Genomics that currently does not appear in the scientific literature. This is marketed as "Optimised for use with labelled and unlabelled PCR primers and probes", however, the T7 endonuclease and Surveyor® nucleases used in this work are also compatible with such molecules.
As used herein, the term "polymorphism" refers to two or more different forms of the same gene.
As used herein, "SNP" means single nucleotide polymorphism, a polymorphism that results from a difference in a single nucleotide. These polymorphisms can be classed as transitions based on purine/pyrimidine status (A G and COT) or transversions (all other substitutions), and are the most frequently occurring mutations.
As used herein, the term "allele" refers generally to any of one or more alternative forms of a given gene or nucleic acid sequence; both or all alleles of a given gene are concerned with the same trait or characteristic, but the product or function coded for by a particular allele differs, qualitatively and/or quantitatively, from that coded for by other alleles of that gene. Three or more alleles of a given gene constitute an allelomorphic series. In a diploid cell or organism the members of an allelic pair (i .e., the two alleles of a given gene) occupy corresponding positions (loci) on a pair of homologous chromosomes; if these alleles are genetically identical the cell or organism is said to be homozygous. If the alleles are genetically different, the cell or organism is sa id to be heterozygous with respect to the particular gene. A wild-type allele is one which codes for particular phenotypic characteristic found in the wild-type strain of a given organism.
As used herein, the term "STOP solution" is a solution added to prevent further activity of an enzyme, typically after the desired enzyme effect has been achieved and before any undesired secondary effects occur.
As used herein, the term "Surveyor®" is a heteroduplex specific. Surveyor® is a commercially available form of the CEL II enzyme purified from a recombinant source, so has a high purity and consistent activity. Surveyor® has a neutral pH optimum and a high specificity and activity towards heteroduplex DNA. Surveyor® also has a low background 5' -> 3' exonuclease activity
As used herein, the term "T5 Exonuclease" means a 5' 3' specific exonuclease. As used herein, the term "T7 Endonuclease" means a heteroduplex specific enzyme, part of the phage resolvase family. T7 endonuclease was explored as an alterative to Surveyor® and CEL family enzymes in the work described in this specification.
As used herein, the term "T7 Exonuclease" means the primary 5' -» 3' specific exonuclease explored in the work described in this specification. T7 exonuclease has high activity towards both 5' phosphorylated (such as enzyme-generated) and 5' dephosphorylated (such as primer-generated) DNA termini.
As used herein, the term "XDR" means extensively drug -resistant turberculosis, where the bacteria is resistant to all but two classes of antibiotic.
As used herein, the term "effective amount" refers to the amount of a therapy that is sufficient to result in the prevention of the development, recurrence, or onset of a disease or condition and one or more symptoms thereof, to enhance or improve the prophylactic effect(s) of another therapy, reduce the severity, the duration of disease, ameliorate one or more symptoms of the disease or condition, prevent the advancement of the disease or condition, cause regression of the disease or condition, and/or enhance or improve the therapeutic effect(s) of another therapy.
As used herein, the terms "manage", "managing", and "management" in the context of the administration of a therapy to a subject refer to the beneficial effects that a subject derives from a therapy (e.g., a prophylactic or therapeutic agent) or a combination of therapies, while not resulting in a cure of the disease or condition. In certain examples, a subject is administered one or more therapies (e.g., one or more prophylactic or therapeutic agents) to "manage" the disease or condition so as to prevent the progression or worsening of the disease or condition.
As used herein, the terms "prevent", "preventing" and "prevention" in the context of the administration of a therapy to a subject refers to the prevention or inhibition of the recurrence, onset, and/or development of a disease or condition or a symptom thereof in a subject resulting from the administration of a therapy (e.g., a prophylactic or therapeutic agent), or a combination of therapies (e.g., a combination of prophylactic or therapeutic agents).
As used herein, the term "marker" or "biomarker" in the context of a tissue means any antigen, molecule or other chemical or biological entity that is specifically found in or on a tissue that it is desired to be identified or identified in or on a particular tissue affected by a disease or disorder, for example fibrosis. In specific examples, the marker is a cell surface antigen that is differentially or preferentially expressed by specific cell types. In specific examples, the marker is a nuclear antigen that is differentially or preferentially expressed by specific cell types. In specific examples the marker is an intracellular antigen that is differentially or preferentially expressed by specific cell types.
As used herein, the term "prophylactic agent" refers to any molecule, compound, and/or substance that is used for the purpose of preventing a disease or disorder. Examples of prophylactic agents include, but are not limited to, proteins, immunoglobulins (e.g., multi-specific Igs, single chain Igs, Ig fragments, polyclonal antibodies and their fragments, monoclonal antibodies and their fragments), antibody conjugates or antibody fragment conjugates, peptides (e.g., peptide receptors, selectins), binding proteins, proliferation based therapy, and small molecule drugs.
As used herein, the term "therapeutic agent" refers to any molecule, compound, and/or substance that is used for the purpose of treating and/or managing a disease or disorder. Examples of therapeutic agents include, but are not limited to, proteins, immunoglobulins (e.g., multi-specific Igs, single chain Igs, Ig fragments, polyclonal antibodies and their fragments, monoclonal antibodies and their fragments), peptides (e.g., peptide receptors, selectins), binding proteins, biologies, proliferation-based therapy agents, hormonal agents, radioimmunotherapies, targeted agents, epigenetic therapies, differentiation therapies, biological agents, and small molecule drugs.
As used herein, the terms "therapies" and "therapy" can refer to any method(s), composition(s), and/or agent(s) that can be used in the prevention, treatment and/or management of a disease or condition or one or more symptoms thereof.
As used herein, the terms "treat", "treatment" and "treating" in the context of the administration of a therapy to a subject refer to the reduction or inhibition of the progression and/or duration of a disease or condition, the reduction or amelioration of the severity of the disease or condition, and/or the amelioration of one or more symptoms thereof resulting from the administration of one or more therapies.
The term "sample" or "biological sample" as used herein means any sample taken or derived from a subject. Such a sample may be obtained from a subject, or may be obtained from biological materials intended to be provided to the subject. For example, a sample may be obtained from blood being assessed, for example, to investigate a disease state in a subject. Included are samples taken or derived from any subjects such as from normal healthy subjects and/or healthy subjects for whom it is useful to understand their disease status. Preferred samples are biological fluid samples. The term "biological fluid sample" as used herein refers to a sample of bodily fluid obtained for the purpose of, for example, diagnosis, prognosis, classification or evaluation of a subject of interest, such as a patient. Included are any body fluids such as a whole blood sample, plasma, serum, ovarian follicular fluid sample, seminal fluid sample, cerebrospinal fluid, saliva, sputum, urine, pleural effusions, interstitial fluid, synovial fluid, lymph, tears, for example, although whole blood sample, plasma and serum are particularly suited for use in this invention. In addition, one of skill in the art would realise that certain body fluid samples would be more readily analysed following a fractionation or purification procedure, for example, separation of whole blood into serum or plasma components.
The term "purified" as used herein does not require absolute purity. Purified refers in one embodiment to at least 90%, or 95%, or 98%, or 99% homogeneity of, to provide an example, of a polypeptide or antibody in a sample.
The term "subject" as used herein is preferably a mammal and includes human, and non-human mammals such as cats, dogs, horses, cows, sheep, deer, mice, rats, primates (including gorillas, rhesus monkeys and chimpanzees), possums and other domestic farm or zoo animals. Thus, the assays, methods and kits described herein have application to both human and non-human animals, in particular, and without limitation, humans, primates, farm animals including cattle, sheep, goats, pigs, deer, alpacas, llamas, buffalo, companion and/or pure bred animals including cats, dogs and horses. Preferred subjects are humans, and most preferably "patients" who as used herein refer to living humans who may receive or are receiving medical care or assessment for a disease or condition. Further, while a subject is preferably a living organism, the invention described herein may be used in postmortem analysis as well.
The term "oligonucleotide" refers to a polynucleotide, typically a probe or primer, including, without limitation, single-stranded deoxyribonucleotides, single- or double- stranded ribonucleotides, RNA: DNA hybrids, and double-stranded DNAs. Oligonucleotides, such as single-stranded DNA probe oligonucleotides, are often synthesized by chemical methods, for example using automated oligonucleotide synthesizers that are commercially available, or by a variety of other methods, including in vitro expression systems, recombinant techniques, and expression in cells and organisms.
The term "polynucleotide" when used in the singular or plural, generally refers to any polyribonucleotide or polydeoxribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA. This includes, without limitation, single- and double-stranded DNA, DNA including single- and double- stranded regions, single- and double-stranded RNA, and RNA including single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or include single- and double-stranded regions. Also included are triple-stranded regions comprising RNA or DNA or both RNA and DNA. Specifically included are mRNAs, cDNAs, and genomic DNAs, and any fragments thereof. The term includes DNAs and RNAs that contain one or more modified bases, such as tritiated bases, or unusual bases, such as inosine. The polynucleotides of the invention can encompass coding or non-coding sequences, or sense or antisense sequences. It will be understood that each reference to a "polynucleotide" or like term, herein, will include the full-length sequences as well as any fragments, derivatives, or variants thereof. "Stringency" of hybridization reactions is readily determinable by one of ordinary skill in the art, and generally is an empirical calculation dependent upon probe length, washing temperature, and salt concentration. In general, longer probes require higher temperatures for proper annealing, while shorter probes need lower temperatures. Hybridization generally depends on the ability of denatured DNA to reanneal when complementary strands are present in an environment below their melting temperature. The higher the degree of desired homology between the probe and hybridisable sequence, the higher the relative temperature that can be used. As a result, it follows that higher relative temperatures would tend to make the reaction conditions more stringent, while lower temperatures less so. Additional details and explanation of stringency of hybridization reactions, are found e.g., in Ausubel et al., Current Protocols in Molecular Biology, Wiley Interscience Publishers, (1995) .
DETAILED DESCRIPTION
The present invention is based on unique assays, methods and kits for genotyping nucleic acids, such as deoxyribose nucleic acid and ribose nucleic acid, obtained from any genetic source. In certain aspects, the assays, methods and kits according to the present invention have utility in determining genetic variation which may be used to correlate information concerning, for example, a disease state or identification of a particular plant cultivar.
The advent of point of care diagnostics has accelerated personalised medicine. However, many devices which incorporate genotyping assays intended to identify genetic variation (i.e. biomarkers) of interest suffer limitations associated with, for example, temperature and humidity which significantly limit their useability in the field (i.e. at point of care). For example in the determination of infection from drug resistant forms of Mycobacterium tuberculosis (Tuberculosis; Tb) and Plasmodium fulciparum (Malaria).
To address issues associated with decreased sensitivity, Applicants have successfully integrated key features of enzymatic assays with those of rapid and automated DNA diagnostic methodology (e.g. high resolution melt analysis) to achieve increased sensitivity and range of current DNA based diagnositic tests. This includes, for example, the inventive concepts of enzyme mediated profiling (EMP), enzymatic high resolution melt (EHRM) and heteroduplex targeting (HET) as described in further detail below.
Enzyme Mediated Profiling (EMP)
The present invention contemplates the concept of enzyme mediated profiling (EMP), which is best illustrated, in an example only, by Figures 1 and 2, read in conjunction with the data presented in Examples 5-7. The concept of enzyme mediated profiling involves interrogation of a test nucleic acid sequence to determine if the test sequence carries any genetic variation relative to a control nucleic acid sequence. The key features of EMP involve (i) generation of test and control nucleic acid sequences that are resistant to 5'-exonuclease activity, (ii) mixing of test and control nucleic acid sequence to form heteroduplex or homoduplex nucleic acids and (iii) 5'- exonuclease and endouclease treatment of a test mixture comprising homoduplex or heteroduplex nucleic acids resistant to degradation by 5'exonuclease.
The activity of the 5'-exonuclease is two-fold, it (a) selectively degrades any nucleic acid sequence that is sensitive (i.e. not resistant) to 5'-exonuclease activity and (b) selectively degrades, in combination with the endonuclease, any nucleic acid sequence comprising a heteroduplex. Importantly, however, the combined enzyme treatment comprising the 5'-exonuclease and endonuclease is not capable of degrading a control nucleic acid sequence. Accordingly, genetic variation in the test nucleic acid sequence is identified where there is no detectable amount of nucleic acid present above a threshold minimum. The threshold minimum is defined as an amount of residual DNA remaining after the enzymic degradation of DNA susceptible to endonuclease and exonuclease.
Accordingly, in an aspect of the present invention there is provided an assay method for identifying genetic variation in a nucleic acid sample, the method comprising the steps of:
(i) generating a test nucleic acid sequence to be tested for the genetic variation, wherein the test nucleic acid sequence is resistant to 5'-exonuclease activity;
(ii) generating a control nucleic acid sequence which does not have the genetic variation, wherein the control nucleic acid sequence is resistant to 5'- exonuclease activity;
(iii) in a test mixture, mixing the test nucleic acid sequence and the control
nucleic acid sequence for a time and under conditions that allow formation of homoduplex and/or heteroduplex nucleic acids; and
(iv) adding to the test mixture a nucleic acid-specific endonuclease and a nucleic acid-specific 5'-exonuclease for a time and under conditions that allow activity by the endonuclease and the 5'-exonuclease on the nucleic acid sequences; wherein, genetic variation in the test nucleic acid is identified where there is no detectable amount of nucleic acid present in the test mixture above a threshold minimum.
Generating test and control nucleic acid sequences that are resistant to 5'- exonuclease activity may be achieved using any technique known in the art provided that the 5'-termini (or base pairs adjacent to the 5'-termini) of the nucleic acid is blocked or protected.
In an example according to this aspect of the present invention, primers resistant to 5'-exonuclease activity may be used in an amplification reaction to generate test and control nucleic acid sequences that are resistant to 5'-exonuclease activity. In an alternative example, chemical synthesis may be used to generate test and control nucleic acid sequences that are resistant to 5'-exonuclease activity through modification with one or more protecting group.
Further information concerning means to achieve blocked and/or protected nucleic acids that are resistant to 5'-exonuclease activity is provided below.
In another example according to this aspect of the present invention, the nucleic acid-specific endonuclease and the nucleic acid-specific 5'-exonuclease may be added to the test mixture in step (iv) simultaneously (i .e. at the same time) or sequentially (i .e. one after the other at any pre-determined time interval). In terms of sequential addition of enzyme to the test mixture, the present invention contemplates addition of the endonuclease followed by addition of the 5'-exonuclease; or addition of the 5'-exonuclease followed by the endonuclease.
Examples of nucleic acid-specific endonucleases according to the present invention include, but are not limited to, bacteriophage resolvases, an enzyme of the SI family or Sl- like nuclease and a DNA repair enzyme.
In a related example, the bacteriophage resolvase includes, but is not limited to, T4E7 and T4E1.
In another related example, the enzyme of the SI family or Sl-like nuclease includes, but is not limited to, CEL1, CEL2 and ENDOl .
In a further related example, the DNA repair enzyme includes, but is not limited to, Endonuclease V, MutL and MutH .
In yet a further a related example, nucleic acid-specific endonuclease includes, but is not limited to, T7 endonuclease I.
In another example, the nucleic acid-specific endonuclease is an endonuclease from a recombinant source, has been engineered, modified and/or consists of a fusion protein.
The activity of the endonuclease is such that it degrades any nucleic acid sequence that is sensitive to degradation by an endonuclease enzyme. In accordance with the present invention, this includes any nucleic acid sequence that contains or comprises a heteroduplex. Examples of heteroduplex nucleic acids include any double stranded nucleic acid in which there is a mis-match or non-match between base pairs, and does not exclude nucleic acids comprising multiple heteroduplexes.
The endonuclease may also cleave any nucleic acid comprising a heteroduplex at the 5'-side of the heteroduplex or the 3'-side of the heteroduplex.
As such, in another example according to this aspect of the present invention, the nucleic acid-specific endonuclease recognizes and cleaves at, or adjacent to, the 5' side of the heteroduplex. In an alternative example, the nucleic acid-specific endonuclease recognizes and cleaves at, or adjacent to, the 3' side of the heteroduplex. Examples of suitable 5'-exonucleases according to the present invention include, but are not limited to, T5 exonuclease, T7 exonuclease and Lambda.
The activity of the 5'-exonuclease is such that it degrades any nucleic acid sequence that is sensitive to degradation by a 5'-exonuclease. In accordance with the present invention, this includes any nucleic acid sequence that is not blocked/protected from degradation by a 5'-exonuclease. In other words, any nucleic acid sequence that is not resistant to 5'-exonuclease activity.
Primers resistant to 5'-exonuclease activity may be used in an amplification reaction to generate test and control nucleic acid sequences that are resistant to 5'-exonuclease activity. This may be achieved by chemically modifying the primer(s) with one or more protecting/blocking groups. In an alternative example, artificial synthesis may be used to generate test and control nucleic acid sequences that are resistant to 5'-exonuclease activity, again by chemically modifying the 5'-termini of the nucleic acid with one or more protecting group.
An example of chemical modification includes, but is not limited to, modification through incorporation of Sp stereoisomer phosphorothioate linkages. The structure of Sp stereoisomer phosphorothioate linkages is as follows:
Figure imgf000030_0001
Note, the Rp stereoisomer provides incomplete protection from degradation by 5'- exonucleases.
Incorpration of Sp stereoisomer phosphorothioate linkages may be achieved during amplification via primer modification. In certain examples, IX, 2X or 6X phosphorothioate linkages may be incorporated at each termini, although 6X phosphorothioate modification is preferred. However, in order to investigate the relationship between phopsphorothioate modification and the extent to which it blocks 5'-exonuclease activity, the results presented in Figures 32-37 represent IX and 2X modifications. Specifically, the results presented in Figure 32 show the activity of 5'-exonucleases (i.e. T5, T7 and Lambda) on phosphorothioate modified 570bp amplicon from Arabidopsis thaliana. The Λ0-0', Ό-Ι', Λ1-0', ^Ι-Ι', Λ0-2', Λ2-0' and Λ2-2' terminology relates to the degree of phosphorothioate modification. For example, λ0- represents a IX reverse primer phosphorothioate modification, '1-0' represents a IX forward primer phosphorothioate modification, '2-2' represents 2X forward and reverse primer phosphorothioate modification etc. These data demonstrate that T5 exonuclease degrades all phosphorothioate modified amplicons, while T7 shows reduced degradation with increasing phosphorothioate modification. Importantly, Lambda Exonuclease is not able to degrade the DNA tested.
The results presented in Figure 33 with respect to the digestion of the 604bp amplicon from Mycobacterium tuberculosis are similar. However, modification with 6X phosphorothioate linkages results in the DNA being completely resistant to degradation from Lambda and T7 Exonucleases provided that all 5'-termini are modified and the nucleic acid molecule is not damaged in any way (data not shown).
The selective degradation of newly created internal 5'-termini requires that enzymatic products, created by the endonuclease treatment, are compatible with 5'- exonucleases.
This was first explored through the use of restriction enzymes, used in place of the heteroduplex specific enzyme, to generate an array of DNA overhang types. These included 5'-overhangs, 3'-overhangs and blunt end producing enzymes. Examples of 3'-overhang enzyme activity is shown in Figure 34. Each overhang type was readily degraded by both T7 and Lambda, indicating that the enzyme products created by a priming step involving sequence specific enzymes are compatible with these exonucleases and will degrade non- blocked/non-protected 5'-termini.
The assays, methods and kits according to the present invention involve interrogation of test and control nucleic acid sequences. The nucleic acid may be a deoxyribose nucleic acid (DNA) or ribose nucleic acid (RNA).
The genetic variation identified for a test nucleic acid sequence in accordance with the methods of the present invention may be performed using nucleic acids derived from any genetic source. This includes, but is not limited to, nucleic acids such as deoxyribose nucleic acids and ribose nucleic acids obtained or derived from bacteria, virus, fungi, yeast, other unicellular eukaryote, plant, animal, human and synthetic source.
As such, according to an example of the present invention, the test nucleic acid may be obtained or derived from any bacteria, virus, fungi, yeast, other unicellular eukaryote, plant, animal, human and synthetic source.
In a related example, the test nucleic acid may be obtained or derived from a biological fluid sample. In yet a further related example, the biological fluid sample is whole blood, plasma or serum. Further still, genetic variation identified for a test nucleic acid sequence in accordance with the methods of the present invention may involve identification of any non- matched or mis-matched double stranded nucleic acid molecules. This also includes single nucleotide polymorphisms (SNPs).
The identification of SNPs of interest may provide useful information with respect to the genetic composition of the sample being interrogated, for example, in the identification of a disease state or in the identification of a desired plant cultivar.
As such, in an example according to the present invention, genetic variation in the test nucleic acid sequence may be correlated with a disease trait.
In a related example, genetic variation in the test nucleic acid sequence correlated with a disease trait may include an infectious disease such as malaria, tuberculosis, mastitis etc.
In a further related example, genetic variation in the test nucleic acid sequence correlated with an infectious disease trait may include resistance to a particular treatment such as multi-drug resistance (MDR) and extensive drug resistance (XDR) in tuberculosis, or resistance to treatment by arteminsin in malaria.
Accordingly, in another aspect of the present invention there is provided a method for diagnosing multidrug resistance tuberculosis in a patient suspected of being infected by a multidrug resistant Mycobacterium tuberculosis, the method comprising the steps of:
(i) obtaining a test sample from the patient;
(ii) generating from the test sample, a test nucleic acid sequence to be tested for the presence of a genetic variation that correlates to multidrug resistance tuberculosis in the patient, wherein the test nucleic acid sequence is resistant to 5'-exonuclease activity;
(iii) generating a control nucleic acid sequence which does not have the genetic variation, wherein the control nucleic acid sequence is resistant to 5'- exonuclease activity;
(iv) in a test mixture, mixing the test nucleic acid sequence and the control
nucleic acid sequence for a time and under conditions that allow formation of homoduplex and/or heteroduplex nucleic acids; and
(v) adding to the test mixture a nucleic acid-specific endonuclease and a nucleic acid-specific 5'-exonuclease for a time and under conditions that allow activity by the endonuclease and 5'-exonuclease on the nucleic acid sequences; wherein, identification of a patient infected by a multidrug resistance Mycobacterium tuberculosis is achieved where there is no detectable amount of nucleic acid present in the test mixture above a threshold minimum. In yet another aspect of the present invention there is provided a method for diagnosing multidrug resistance tuberculosis in a patient suspected of being infected by a multidrug resistant Mycobacterium tuberculosis, the method comprising the steps of:
(i) obtaining a test sample from the patient;
(ii) generating from the test sample, a test nucleic acid sequence to be tested for the presence of a genetic variation that correlates to multidrug resistance tuberculosis in the patient, wherein the test nucleic acid sequence is resistant to 5'-exonuclease activity and comprises a nucleic acid sequence defined by SEQ ID NO:2;
(iii) generating a control nucleic acid sequence which does not have the genetic variation, wherein the control nucleic acid sequence is resistant to 5'- exonuclease activity;
(iv) in a test mixture, mixing the test nucleic acid sequence and the control
nucleic acid sequence for a time and under conditions that allow formation of homoduplex and/or heteroduplex nucleic acids; and
(v) adding to the test mixture a nucleic acid-specific endonuclease and a nucleic acid-specific 5'-exonuclease for a time and under conditions that allow activity by the endonuclease and 5'-exonuclease on the nucleic acid sequences; wherein, identification of a patient infected by a multidrug resistance Mycobacterium tuberculosis is achieved where there is no detectable amount of nucleic acid present in the test mixture above a threshold minimum.
In yet a further aspect of the present invention there is provided a method for diagnosing antibiotic resistance in a patient suspected of being infected by antibiotic resistant Plasmodium fulciparum, the method comprising the steps of:
(i) obtaining a test sample from the patient;
(ii) generating from the test sample, a test nucleic acid sequence to be tested for the presence of a genetic variation that correlates to antibiotic resistant Plasmodium fulciparum, wherein the test nucleic acid sequence is resistant to 5'-exonuclease activity;
(iii) generating a control nucleic acid sequence which does not have the genetic variation, wherein the control nucleic acid sequence is resistant to 5'- exonuclease activity;
(iv) in a test mixture, mixing the test nucleic acid sequence and the control
nucleic acid sequence for a time and under conditions that allow formation of homoduplex and/or heteroduplex nucleic acids; and
(v) adding to the test mixture a nucleic acid-specific endonuclease and a nucleic acid-specific 5'-exonuclease for a time and under conditions that allow activity by the endonuclease and 5'-exonuclease on the nucleic acid sequences; wherein, identification of a patient infected by an antibiotic resistant Plasmodium falciparum is achieved where there is no detectable amount of nucleic acid present in the test mixture above a threshold minimum.
In yet a further aspect of the present invention there is provided a method for diagnosing antibiotic resistance in a patient suspected of being infected by antibiotic resistant Plasmodium fulciparum, the method comprising the steps of:
(i) obtaining a test sample from the patient;
(ii) generating from the test sample, a test nucleic acid sequence to be tested for the presence of a genetic variation that correlates to antibiotic resistant Plasmodium fulciparum, wherein the test nucleic acid sequence is resistant to
5'-exonuclease activity and comprises a nucleic acid sequence defined by SEQ ID NO:75;
(iii) generating a control nucleic acid sequence which does not have the genetic variation, wherein the control nucleic acid sequence is resistant to 5'- exonuclease activity;
(iv) in a test mixture, mixing the test nucleic acid sequence and the control
nucleic acid sequence for a time and under conditions that allow formation of homoduplex and/or heteroduplex nucleic acids; and
(v) adding to the test mixture a nucleic acid-specific endonuclease and a nucleic acid-specific 5'-exonuclease for a time and under conditions that allow activity by the endonuclease and 5'-exonuclease on the nucleic acid sequences; wherein, identification of a patient infected by an antibiotic resistant Plasmodium falciparum is achieved where there is no detectable amount of nucleic acid present in the test mixture above a threshold minimum.
In a further aspect of the present invention there is provided a method for identifying Arabidopsis cultivars of commercial interest, the method comprising the steps of:
(i) obtaining a test sample from an Arabidopsis plant;
(ii) generating from the test sample, a test nucleic acid sequence to be tested for the presence of a genetic variation that correlates to an Arabidopsis cultivar of commercial interest, wherein the test nucleic acid sequence is resistant to 5'- exonuclease activity;
(iii) generating a control nucleic acid sequence which does not have the genetic variation, wherein the control nucleic acid sequence is resistant to 5'- exonuclease activity;
(iv) in a test mixture, mixing the test nucleic acid sequence and the control
nucleic acid sequence for a time and under conditions that allow formation of homoduplex and/or heteroduplex nucleic acids; and (v) adding to the test mixture a nucleic acid-specific endonuclease and a nucleic acid-specific 5'-exonuclease for a time and under conditions that allow activity by the endonuclease and 5'-exonuclease on the nucleic acid sequences; wherein, identification of an Arabidopsis cultivar of commercial interest is achieved where there is no detectable amount of nucleic acid present in the test mixture above a threshold minimum.
In yet a further aspect of the present invention there is provided a method for identifying Arabidopsis thaliana cultivars of commercial interest, the method comprising the steps of:
(i) obtaining a test sample from an Arabidopsis thaliana plant;
(ii) generating from the test sample, a test nucleic acid sequence to be tested for the presence of a genetic variation that correlates to an Arabidopsis thaliana cultivar of commercial interest, wherein the test nucleic acid sequence is resistant to 5'-exonuclease activity and comprises a nucleic acid sequence defined by SEQ ID NO: 97 or SEQ ID NO:98;
(iii) generating a control nucleic acid sequence which does not have the genetic variation, wherein the control nucleic acid sequence is resistant to 5'- exonuclease activity;
(iv) in a test mixture, mixing the test nucleic acid sequence and the control
nucleic acid sequence for a time and under conditions that allow formation of homoduplex and/or heteroduplex nucleic acids; and
(v) adding to the test mixture a nucleic acid-specific endonuclease and a nucleic acid-specific 5'-exonuclease for a time and under conditions that allow activity by the endonuclease and 5'-exonuclease on the nucleic acid sequences; wherein, identification of an Arabidopsis thaliana cultivar of commercial interest is achieved where there is no detectable amount of nucleic acid present in the test mixture above a threshold minimum.
Further schematic illustration of enzyme mediated profiling according to the present invention is depicted, by way of example only, in Figure 11. Specifically, activity by an endonuclease cleaves nucleic acid sequence strands at heteroduplexed sites thereby allowing degradation of nucleic acid molecules by fast acting 5'-exonucleases. This approach significantly enhances the sensitivity of the non/enzymatic HRM methodology by providing an all or nothing interrogation for the presence of genetic variation within a test nucleic acid sequence of interest.
In this example, initial cleavage is achieved by a heteroduplex specific enzyme.
However, a person skilled in the art will recognise that the priming step is not necessarily limited to heteroduplex specific enzymes, and that other enzymes which recognise (e.g .) a cleavage sequence created by genetic variation could also be used .
Accordingly, in certain examples the enzyme priming step may be achieved using either a structure specific enzyme (i.e.) one which specifically targets the heteroduplex or a sequence specific enzyme (i.e.) one which specifically recognises a cleavage sequence created by one or more mutations (e.g .) a single nucleotide polymorphism.
In reference again to Figure 11, the internal 5'-termini created by the heteroduplex enzyme activity, which are susceptible to degradation by fast acting 5'-exonucleases, are represented by open circles, whereas the original blocked/protected 5'-termini are represented by solid diamonds. The open arrows indicate the activity of the fast acting 5'- exonuclease activity.
Importantly, enzyme mediated profiling relies on compatibility between the enzyme used in the priming step and the fast acting 5' exonucleases. In other words, the enzymatic products created by the priming step must generate a variety of over-hangs blunt ends for the 5'-exonucleases to act.
In certain examples according to the present invention, blocking/protection of the 5'- termini is achieved via chemical modification and/or by employing an enzyme that selectively degrades 5'-termini with a phosphate group, which are present on enzymatically generated 5'-termini but absent on outer/PCR generated 5'-termini .
Next, the compatability of heteroduplex targeting with enzyme mediated profiling through exonuclease activity was also explored .
Lambda exonuclease, which demonstrates only trace/background levels of exonuclease activity when applied to intact PCR products (e.g. Figures 32 & 33), now shows significantly incresased exonuclease activity towards the newly created 5-termini . This is thought to because of the previously described specificity to DNA with a 5' phosphate; PCR products lack this structure, and enzymatically cleave DNA possessing it.
Each overhang type was readily degraded with T7 and Lambda exonucleases. This suggests that the enzyme products following heteroduplex targeting are equally compatible with these enzymes.
This concept was further explored, with the combination of 17 endonuclease and a
6X phosphorothioate version of the Tuberculosis 604 base amplicon (Figure 35) . In this experiment, 17 exonuclease was used following the enzyme mediated priming step involving a heteroduplex specific enzyme. The results demonstrate that the enzymatically produced products following priming step involving heteroduplex specific enzyme are readily degraded by exonuclease activity, giving selective degradation of the newly created 5' ends, validating enzyme mediated profiling as an assay performed on an rpoB amplicon of >600 bases in length . EMP: Massively Parallel Genotyping Applications
The ability to simultaneously interrogate multiple genetic loci has been made feasible by the advent of microarray technologies, which enable parallel processing of spatially separated, surface immobilized nucleic acid sequences. Many thousands of immobilized nucleic acid sequences can therefore be interrogated by the methods according to the present invention for the presence or absence of endonuclease and exonuclease sensitivity (i.e. heteroduplex structure created by genetic variation in test vs control nucleic acid sequence) in a massively parallel process.
Accordingly in another aspect of the present invention, the methods, assays and kits defined herein are configured to be performed on a surface including, for example, a microarray platform including a microarray chip or slide.
This is illustrated in Figure 4, with reference to Example 7. Specifically, application of the enzyme mediated profiling to a DNA Microarray.
In a further related example, the control nucleic acid sequence is immobilized to the surface or microarray platform.
In yet a further related example, the control nucleic acid sequence is a synthetic probe.
Enzymatic HRM
The integration of key features of enzyme assays allows for improved sensitivity and range in resolving genetic differences between sequences of interest. By targeting genetic sequences known to confer disease traits (e.g. antibiotic resistance in treatment of Tb; infection by Malaria causing bacteria; cancer causing mutation(s) etc), the assays, methods and kits according to the present invention provide improved diagnostic power for point of care applications. However, the present invention is not limited to the detection or identification of disease states. For example, the assays, methods and kits according to the present invention may be used to profile genetic sequences known to be associated with important plant cultivars or accessions to facilitate breeding selection and crop management etc.
According to the present invention, enzymatic high resolution melt analysis (EHRM) modifies the standard technique of high resolution melt (also referred to herein as 'non- enzymatic HRM' or 'non-enzymatic/standard HRM') by incorporating an enzyme cleavage step immediately prior to the melt step. This enzyme possesses structure specific activity, only recognising and cleaving at or adjacent to a heterod uplex formed between mis- matched or mis-paired nucleic acid sequences formed between a test nucleic acid sequnce comprising one or more mutations and a control nucleic acid sequence (also referred to herein as a "nucleic acid standard"). During the subsequent melt analysis step, there is a shift in the melt/dissociation kinetics of the nucleic acid sequence being assayed. This technique is quite distinct from standard enzymatic assays that rely on size based resolution of DNA products following enzymatic activity, such as through DNA gels or HPLC.
Accordingly, in another aspect of the present invention there is provided a method for identifying genetic variation in a nucleic acid sample, the method comprising the steps of:
(i) amplifying from a test sample, a test nucleic acid sequence suspected of comprising one or more polymorphisms to produce an amplified nucleic acid sequence;
(ii) allowing formation of a heteroduplex between the amplified test
nucleic acid sequence and a nucleic acid standard;
(iii) treating the sample with a structure specific enzyme that recognizes and cleaves at, or adjacent to, the heteroduplex; and
(iv) performing melt analysis on the amplified and enzymatically treated test sample to determine the melt transition (Tm) of the nucleic acids; wherein, genetic variation in the test nucleic acid sample occurs where there is a deviation in Tm between the test nucleic acid sample and a reference standard comprising a homoduplexed nucleic acid standard which has not been cleaved by the structure specific enzyme.
This concept is illustrated conceptually by Figures 6, 9 and 10. In Figure 6, a heteroduplex is formed where mis-matched base pairs or non-matched base pairs (including deletions) occur between substantially complementary nucleic acid sequences. Figure 9 shows that the heteroduplex is targeted by a structure specific enzyme (e.g. T7 Endonuclease, Surveyor) which cleaves the nucleic acid sequence at or immediately adjacent to the heteroduplex generating (duplex) nucleic acids of different size. Figure 10 demonstrates how the dis/association kinetics of nucleic acid sequences (measured by the degree of helicity as a function of temperature) thereby resolving genetic differences in the nucleic acid sequences being assayed.
The so-called 'enzymatic HRM' methodology according to the present invention was performed on nucleic acid sequences derived from genetically different genomes. Refer to (e.g.) Example 2 and Figures 19 & 20 with respect to the identification of multi-drug resistant Mycobacterium tuberculosis, specifically rifampicin resistance in identifying infectious Tb; Example 3 and Figures 25 & 26 with respect to the identification of antibiotic resistant Plasmodium falciparum, specifically artemisinin resistance in Malaria; Example 4 and Figures 30 & 31 with respect to the identification of Arabidopsis thaliana accessions (e.g. Landsberg erecta and Colombia).
Notwithstanding the different examples presented in this specification, the assays, methods and kits according to the present invention may be performed on test samples derived from any genetic source. For example, nucleic acids (e.g. deoxyribose nucleic acid (DNA) and ribose nucleic acid ( NA)) derived from bacteria, virus, fungi, yeast, other unicellular eukaryote, plant, animal, human and synthetic source.
In other examples, the test nucleic acid is derived from a sample such as a biological fluid sample, (e.g.) whole blood, serum or plasma.
To reinforce the general applicability of the present invention to the identification of genetic variation independent of genetic source, differences in genetic composition are often quantified as a function of 'GC content' or 'guanine-cytosine content'. GC content is the percentage of nitrogenous bases of a nucleic acid molecule that are either guanine or cytosine. This may refer to a specific fragment of deoxyribose nucleic acid (DNA) or ribose nucleic acid (RNA), or that of the whole genome. A higher GC content means the fragment or genome is more thermostable, since G-C and C-G matched base pairs are triple hydrogen bonded (as opposed to the (e.g.) thymine and adenine matched base pairs (i.e. A-T and T- A) which are double hydrogen bonded). This may be illustrated with reference to Figure 10, where an amplicon comprising 70% GC content will undergo a double-to-single-stranded transition at a temperature that is approximately 20°C higher to an equivalent sized amplicon comprising 30% GC content.
With reference to Examples 2-4 that follow, the enzymatic HRM technique according to the present invention was validated using DNA amplified from three genetically distinct genomes, namely Mycobacterium tuberculosis, Arabidopsis thaliana and Plasmodium falciparum. At the genome level, these genetic sources represent high, medium and low GC contents: Mycobacterium tuberculosis (average GC content = 67%; high); Arabidopsis thaliana (average GC content = 45%; medium); and Plasmodium falciparum (average GC content = 30%; low) . Further, the amplicons selected for these experiments possessed a GC content that substantially mirrored that of the overall genome. For example, the Mycobacterium tuberculosis amplicons contained between 65-67% GC content (Example 2; Table I); the Plasmodium falciparum amplicons contained between 30-39% GC content (Example 3; Table II); and the Arabidopsis thaliana amplicons contained between 43-49% GC content (Example 4; Table III). That the assays, methods and kits according to the present invention could resolve the melt profile of DNA amplified from all three genomes with improved sensitivity and increased range demonstrates that the enzymatic HRM technique may be successfully applied to genetically diverse genomes, irrespective of overall GC content.
The data presented in this specification shows that the enzymatic HRM methodology according to the present invention was able to resolve differences between heteroduplex and homoduplex nucleic acid sequences (thereby identifying genetic differences in the sequences being assayed) with significantly improved sensitivity and increased range (size of the amplicons being assayed). Again, refer to Examples 2-4, read in conjunction with Figures 17-31. The structure specific enzyme is any enzyme that will recognise and cleave at, immediately adjacent to, or adjacent to, the heteroduplex. This includes cleavage 5' or 3' to the heteroduplex. In certain examples according to the present invention, the heteroduplex specific enzyme is selected from the group consisting of bacteriophage resolvases, an enzyme of the SI family or Sl-like nuclease and a DNA repair enzyme. Examples of bacteriophage resolvases include, but are not limited to, T4E7 and T4E1. Examples of an enzyme of the SI family or Sl-like nuclease include, but are not limited to, CEL1, CEL2 and ENDOl. Examples of DNA repair enzymes include, but are not limited to, Endonuclease V, MutL and MutH.
In other examples according to the present invention, the structure specific enzyme may direct nuclease activity to the heteroduplex mediated through other small molecules or protein domains recruited by, or fused to, the heteroduplex specific enzyme.
The concept of enzymatic HRM is predicated on heteroduplex formation between substantially complementary nucleic acid sequences. In other words, a test nucleic acid comprising (or suspected of comprising) one or more mutations, such as a single nucleotide polymorphism, is allowed to anneal (through a denature/renature reaction) with a nucleic acid standard representing the corresponding wild-type sequence so as to form a heteroduplex. In certain examples, the heteroduplex comprises any combination of mismatched or non-matched base pairs, including deletion mutations.
In other examples, the nucleic acid standard represents the wild-type sequence (e.g. synthetic sequence) or is the wild-type sequence. In yet other examples, the nucleic acid standard is the wild-type sequence, and is amplified in the same amplification reaction as the test nucleic acid.
Amplification of the test nucleic acid sequence may be performed using any known amplification means. In certain examples, the amplification is isothermal or non-isothermal mediated amplification. Examples of isothermal mediated amplification includes, but is not limited to, loop mediated isothermal amplification and recombinase polymerase amplification. An example of thermal mediated amplification includes, but is not limited to, polymerase chain reaction.
The assays, methods and kits according to the present invention may find particular utility in the diagnosis of multi-drug resistance in patients infected by antibiotic resistant Mycobacterium tuberculosis, or in the diagnosis of arteminsin resistance in patients infected by Plasmodium falciparum.
Accordingly, in yet another aspect of the present invention there is provided a method for determining multi-drug resistance in a patient suspected of being infected by a multi-drug resistant Mycobacterium tuberculosis, the method comprising the steps of:
(i) amplifying from a test sample which has been obtained from a patient suspected of being infected by a multi-drug resistant Mycobacterium tuberculosis, a nucleic acid sequence comprising SEQ ID NO: 2 which may further comprise one or more polymorphisms that confer resistance to treatment by rifampicin ;
(ii) allowing heteroduplex formation between the amplified test nucleic acid sequence and a nucleic acid standard defined by SEQ ID NO: 2;
(iii) treating the sample with a structure specific enzyme that recognizes and cleaves at, or adjacent to, the heteroduplex; and
(iv) performing melt analysis on the amplified and enzymatically treated test sample to determine the melt transition (Tm) of the nucleic acids; wherein, the patient is infected by a multi-drug resistant Mycobacterium tuberculosis occurs where there is a deviation in Tm between the test nucleic acid sample and a reference standard comprising the nucleic acid standard which has not been cleaved by the structure specific enzyme.
In one example according to this method, where the amplification is performed using polymerase chain reaction, the primer pairs may comprise forward/reverse combination of SEQ ID NO:4/SEQ ID NO: 5; SEQ ID NO: 6/SEQ ID NO: 7; SEQ ID NO: 8/SEQ ID NO:9; SEQ ID NO: 10/SEQ ID NO: 11; and SEQ ID NO: 12/SEQ ID NO: 13. Refer to Table I in Example 2.
However, the present invention is not limited to detection of mutations in the rifampicin resistant determining region (RRDR; SEQ ID NO:2; refer to Example 2 and Figure 38) in the treatment of multi-drug resistant Tuberculosis, for the reason that the assays, methods and kits according to the present invention may be used in the identification of (e.g.) mutations that confer resistance to treatment by pyrazinamide comprising one or more polymorphisms in the pncA gene or to identify mutations that confer resistance to treatment by isoniazid comprising one or more polymorphisms in KatG gene.
In yet a further example of the present invention there is provided a method for determining antibiotic resistance in a patient suspected of being infected by an antibiotic resistant Plasmodium fulciparum, the method comprising the steps of:
(i) amplifying from a test sample which has been obtained from a patient suspected of being infected by an antibiotic resistant Plasmodium fulciparum, a nucleic acid sequence comprising SEQ ID NO:75 which may further comprise one or more polymorphisms that confer resistance to treatment by an antibiotic;
(ii) allowing heteroduplex formation between the amplified test nucleic acid sequence and a nucleic acid standard defined by SEQ ID NO: 75;
(iii) treating the sample with a structure specific enzyme that recognizes and cleaves at, or adjacent to, the heteroduplex; and
(iv) performing melt analysis on the amplified and enzymatically treated test sample to determine the melt transition (Tm) of the nucleic acids; wherein, the patient is infected by an antibiotic resistant Plasmodium falciparum occurs where there is a deviation in Tm between the test nucleic acid sample and a reference standard comprising the nucleic acid standard which has not been cleaved by the structure specific enzyme.
In one example according to this method, where the amplification is performed using polymerase chain reaction, the primer pairs may comprise any forward/reverse combination of SEQ ID NO:80/SEQ ID NO:81 ; SEQ ID NO:82/SEQ ID NO: 83; SEQ ID NO: 84/SEQ ID NO:85; SEQ ID NO:86/SEQ ID NO:87; SEQ ID NO:80/SEQ ID NO:88; and SEQ ID NO:89/SEQ ID NO:81. Refer to Table II in Example 3.
Heteroduplex Targeting (HET)
Heteroduplex targeting relates to the concept of enriching the assay for heteroduplex species immediately prior to the melt analysis step. In any given non-enzymatic/standard or enzymatic HRM assay, the ratio of homoduplex to heteroduplex species will approximate 1 : 1 (equal amounts) generated through standard denature/renature techniques. By providing a means to enrich for heteroduplex species, the relative assay signal may be significantly increased by eliminating any background/artefact signal created by homoduplex species.
The HET concept according to the present invention is illustrated schematically in Figure 13. The concept comprises three steps: (1) amplification, (2) exonuclease breakdown to generate single stranded DNA and (3) spike with counter-blocked wild-type probe.
With respect to the amplification step, target amplicons are generated through (e.g.) PCR (or other amplification means described herein) with forward primers comprising multiple phospohorothioate linkages in tandem, and a standard reverse primer that lacks this structural modification.
Next, a 5'-exonuclease is added to the reaction mix, which rapidly degrades all DNA with susceptible 5'-termini. This generates single stranded DNA carrying the original test nucleic acid sequence each carrying a phosphorothioate blocked 5'-terminus.
Finally, a single stranded probe is then added to the reaction mix. The probe corresponds to the wild-type sequence, and is substantially complementary to the test sequence with the exception of any mutation(s) or genetic differences. In this way, all species will carry the heteroduplex where one or more mutation(s) is present.
To illustrate the potential advantages conferred by HET, an all-or-nothing system was created by combining the concept of 'Heteroduplex Targeting' (or ΉΕΤ') with Enzyme Mediated Profiling. The results from these experiments are documented in Figures 36 & 37; the schematic in Figure 36 shows an initial HET step. This assay allows for 100% heteroduplex DNA to be enriched from a test sample if one or more mutations are present.
Following the initial HET steps, the assay was then combined with an enzyme mediated profiling (EMP) assay to give an all-or-nothing genotyping system. Specifically, the analysed sample will be stable if it has perfect sequence homology to the wildtype, otherwise the heteroduplexes generated through HET will cause the entire sample to be completely degraded by the enzyme combination in EMP. This is shown by the data in Figure 37. HET was first applied to the 604bp Mycobacterium tuberculosis amplicon. T7 Endonuclease was then added to the reaction mix (for 20 or 40 minutes) followed by treatment with T7 Exonuclease. Lanes 8 and 10 of Figure 37 demonstrates that heteroduplexed DNA was completely degraded by exposure to T7 Endonuclease followed by T7 Exonuclease, while homoduplex DNA remained in tact. Assays and Test Kits
The present invention further contemplates assays and test kits. Accordingly, in a further aspect of the present invention there is provided an assay comprising any one or more features of the methods described herein.
In yet a further aspect of the present invention there is provided an assay comprising any one or more features of the methods described herein in a multiplex format.
In yet a further aspect of the present invention there is provided an assay method comprising any one or more of the features described herein configured to be performed on a microarray platform.
In yet a further aspect of the present invention there is provided a test kit comprising reagents and instructions for use in performing the methods or assays as described herein.
GENERAL METHODOLOGY Nucleic Acid Amplification - Overview
Methods for the amplification of nucleic acids, including DNA and/or RNA, are known in the art. Amplification protocols may involve changes in temperature, such as a heat denaturation step, or may be isothermal processes that do not require heat denaturation. The polymerase chain reaction (PCR) uses multiple cycles of denaturation, annealing of primer pairs to opposite strands, and primer extension to exponentially increase copy numbers of the target sequence. Denaturation of annealed nucleic acid strands may be achieved by the application of heat, increasing local metal ion concentrations (e.g. United States Patent No. 6,277,605), ultrasound radiation (e.g. WO/2000/049176), application of voltage (e.g. United States Patent Nos. 5,527,670, 6,033,850, 5,939,291, and 6,333,157), and application of an electromagnetic field in combination with primers bound to a magnetically-responsive material (e.g. United States Patent No. 5,545,540), which are hereby incorporated by reference in their entirety. In a variation called RT-PCR, reverse transcriptase (RT) is used to make a complementary DNA (cDNA) from RNA, and the cDNA is then amplified by PCR to produce multiple copies of DNA (e.g. United States Patent Nos. 5,322,770 and 5,310,652, which are hereby incorporated by reference in their entirety).
An example of an isothermal amplification method is strand displacement amplification, commonly referred to as SDA, which uses cycles of annealing pairs of primer sequences to opposite strands of a target sequence, primer extension in the presence of a dNTP to produce a duplex hemiphosphorothioated primer extension product, endonuclease- mediated nicking of a hemimodified restriction endonuclease recognition site, and polymerase-mediated primer extension from the 3' end of the nick to displace an existing strand and produce a strand for the next round of primer annealing, nicking and strand displacement, resulting in geometric amplification of product (e.g. United States Patent Nos. 5,270,184 and 5,455,166, which are hereby incorporated by reference in their entirety). Thermophilic SDA (tSDA) uses thermophilic endonucleases and polymerases at higher temperatures in essentially the same method (European Pat. No. 0 684 315, which is hereby incorporated by reference in its entirety).
Other amplification methods include rolling circle amplification (RCA) (e.g., Lizardi,
"Rolling Circle Replication Reporter Systems," United States Patent No. 5,854,033); helicase dependent amplification (HDA) (e.g ., Kong et al., "Helicase Dependent Amplification Nucleic Acids," United States Patent Application Publication. No. US 2004-0058378 Al); and loop- mediated isothermal amplification (LAMP) (e.g., Notomi et al., "Process for Synthesizing Nucleic Acid," United States Patent No. 6,410,278), which are hereby incorporated by reference in their entirety. In some cases, isothermal amplification uses transcription by an RNA polymerase from a promoter sequence, such as may be incorporated into an oligonucleotide primer. Transcription-based amplification methods commonly used in the art include nucleic acid sequence based amplification, also referred to as NASBA (e.g. U.S. Pat. No. 5,130,238); methods which rely on the use of an RNA replicase to amplify the probe molecule itself, commonly referred to as Q-beta replicase (e.g., Lizardi, P. et al. (1988) BioTechnol. 6, 1197-1202); self-sustained sequence replication (e.g., Guatelli, J. et al. (1990) Proc. Natl. Acad. Sci. USA 87, 1874-1878; Landgren (1993) Trends in Genetics 9, 199-202); and methods for generating additional transcription templates (e.g. United States Patent Nos. 5,480,784 and 5,399,491), which are hereby incorporated by reference in their entirety. Further methods of isothermal nucleic acid amplification include the use of primers containing non-canonical nucleotides (e.g. uracil or RNA nucleotides) in combination with an enzyme that cleaves nucleic acids at the non-canonical nucleotides (e.g. DNA glycosylase or RNaseH) to expose binding sites for additional primers (e.g. United States Patent Nos. 6,251,639, 6,946,251, and 7,824,890), which are hereby incorporated by reference in their entirety. In different examples according to the present invention, isothermal amplification processes can be linear or exponential.
Nucleic acid amplification for subject identification may comprise sequential, parallel, or simultaneous amplification of a plurality of nucleic acid sequences, such as about or more than about 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 50, 100, or more target sequences. In some embodiments, a subjects entire genome or entire transcriptome is non-specifically amplified, the products of which are probed for one or more identifying sequence characteristics. An identifying sequence characteristic includes any feature of a nucleic acid sequence that can serve as a basis of differentiation between individuals. In some embodiments, an individual is uniquely identified to a selected statistical significance using about or more than about 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 50, 100, or more identifying sequences. In some embodiments, the statistical significance is about, or smaller than about 10"2, 10"3, 10"4, 10"5, 10"6, 10"7, 10 s, 10"9, 10 10, 10 11, 10 12, 10 13, 10 14, 10 1S, or smaller. Examples of identifying sequences include Restriction Fragment Length Polymorphisms (RFLP; Botstein, et al., Am. J. Hum. Genet. 32: 314-331, 1980; WO 90/13668), Single Nucleotide Polymorphisms (SNPs; Kwok, et al., Genomics 31 : 123-126, 1996), Randomly Amplified Polymorphic DNA (RAPD; Williams, et al., Nucl. Acids Res. 18 : 6531-6535, 1990), Simple Sequence Repeats (SSRs; Zhao & Kochert, Plant Mol. Biol. 21 : 607-614, 1993; Zietkiewicz, et al. Genomics 20: 176-183, 1989), Amplified Fragment Length Polymorphisms (AFLP; Vos, et al., Nucl. Acids Res. 21 : 4407-4414, 1995), Short Tandem Repeats (STRs), Variable Number of Tandem Repeats (VNTR), microsatellites (Tautz, Nucl. Acids. Res. 17: 6463-6471, 1989; Weber and May, Am. J. Hum. Genet. 44: 388-396, 1989), Inter-Retrotransposon Amplified Polymorphism (IRAP), Long Interspersed Elements (LINE), Long Tandem Repeats (LTR), Mobile Elements (ME), Retrotransposon Microsatellite Amplified Polymorphisms (REMAP), Retrotransposon -Based Insertion Polymorphisms (RBIP), Short Interspersed Elements (SINE), and Sequence Specific Amplified Polymorphism (SSAP). Additional examples of identifying sequences are known in the art, for example in US20030170705, which is incorporated herein by reference. A genetic signature may consist of multiple identifying sequences of a single type (e.g. SNPs), or may comprise a combination of two or more different types of identifying sequences in any number or combination. Quantitative PCR (qPCR)
Quantitative PCR (qPCR) can be carried out on samples comprising genetic contnet of interest (e.g.) serum, plasma using specific primers and probes. In controlled reactions, the amount of product formed in a PCR reaction (Sambrook, J., E Fritsch, E. and T Maniatis, Molecular Cloning : A Laboratory Manual 3rd Cold Spring Harbor Laboratory Press : Cold Spring Harbor (2001)) correlates with the amount of starting template. Quantification of the PCR product can be carried out by stopping the PCR reaction when it is in log phase, before reagents become limiting. The PCR products are then electrophoresed in agarose or polyacrylamide gels, stained with ethidium bromide or a comparable DNA stain, and the intensity of staining measured by densitometry. Alternatively, the progression of a PCR reaction can be measured using PCR machines such as the Applied Biosystems' Prism 7900, QX200 Droplet Digital PCR System (BioRad) or the Roche LightCycler which measure product accumulation in real-time. Real-time PCR measures either the fluorescence of DNA intercalating dyes such as Sybr Green into the synthesized PCR product, or the fluorescence released by a reporter molecule when cleaved from a quencher molecule; the reporter and quencher molecules are incorporated into an oligonucleotide probe which hybridizes to the target DNA molecule following DNA strand extension from the primer oligonucleotides. The oligonucleotide probe is displaced and degraded by the enzymatic action of the Taq polymerase in the next PCR cycle, releasing the reporter from the quencher molecule. In one variation, known as Scorpion®, the probe is covalently linked to the primer.
Reverse Transcription PCR (RT-PCR)
RT-PCR can, be used to compare RNA levels in different sa mple populations, in normal and tumour tissues, with or without drug treatment, to characterize patterns of expression, to discriminate between closely related RNAs, and to analyse RNA structure.
For RT-PCR, the first step is the isolation of RNA from a target sample. The starting material is typically total RNA isolated from a diseased tissue or sample, and corresponding normal tissues or sample, respectively. RNA can be isolated from a variety of samples, such as animal, including mammal and human, plant, bacteria, virus, fungi, yeast, other unicellular eukaryote and synthetic source.
The first step in gene expression profiling by RT-PCR is the reverse transcription of the RNA template into cDNA, followed by its exponential amplification in a PCR reaction . The two most commonly used reverse transcriptases are avian myeloblastosis virus reverse transcriptase (AMV-RT) and Moloney murine leukaemia virus reverse transcriptase (MMLV- RT) . The reverse transcription step is typically primed using specific primers, random hexamers, or oligo-dT primers, depending on the circumstances and the goal of expression profiling . For example, extracted RNA can be reverse-transcribed using a GeneAmp RNA PCR kit (Perkin Elmer, Calif., USA), following the manufacturer's instructions. The derived cDNA can then be used as a template in the subsequent PCR reaction.
Although the PCR step can use a variety of thermostable DNA-dependent DNA polymerases, it typically employs the Taq DNA polymerase, which has a 5'-3' nuclease activity but lacks a 3'-5' proofreading endonuclease activity. Thus, TaqMan (q) PCR typically utilizes the 5' nuclease activity of Taq or Tth polymerase to hydrolyze a hybridization probe bound to its target amplicon, but any enzyme with equivalent 5' nuclease activity can be used.
Two oligonucleotide primers are used to generate an amplicon typical of a PCR reaction. A third oligonucleotide, or probe, is designed to detect nucleotide sequence located between the two PCR primers. The probe is non-extendible by Taq DNA polymerase enzyme, and is labeled with a reporter fluorescent dye and a quencher fluorescent dye. Any laser-induced emission from the reporter dye is quenched by the quenching dye when the two dyes are located close together as they are on the probe. During the amplification reaction, the Taq DNA polymerase enzyme cleaves the probe in a template-dependent manner. The resultant probe fragments disassociate in solution, and signal from the released reporter dye is free from the quenching effect of the second fluorophore. One molecule of reporter dye is liberated for each new molecule synthesized, and detection of the unquenched reporter dye provides the basis for quantitative interpretation of the data.
TaqMan RT-PCR can be performed using commercially available equipment, such as, for example, ABI PRISM 7700 Sequence Detection System (Perkin-Elmer-Applied Biosystems, Foster City, Calif., USA), or Lightcycler (Roche Molecular Biochemicals, Mannheim, Germany). In certain examples, the 5' nuclease procedure is run on a real-time quantitative PCR device such as the ABI PRISM 7700tam Sequence Detection System.
The system consists of a thermocycler, laser, charge-coupled device (CCD), camera, and computer. The system amplifies samples in a 96-, 384-, 768-, 1536- or 3072-well format on a thermocycler. During amplification, laser-induced fluorescent signal is collected in real-time through fibre optics cables for all wells, and detected at the CCD. The system includes software for running the instrument and for analyzing the data.
5' nuclease assay data are initially expressed as Ct, or the threshold cycle. As discussed above, fluorescence values are recorded during every cycle and represent the amount of product amplified to that point in the amplification reaction. The Ct is the cycle number at which the fluorescence generated within a reaction crosses a threshold above basline elevation. Ct values are logarithmic and are used either directly (comparative Ct method) or indirectly (interpolation to standard curves to create linear values) for quantitative analyses.
Real-time Quantitative PCR (qPCR)
A more recent variation of the RT-PCR technique is the real time quantitative PCR, which measures PCR product accumulation through a dual-labeled fluorigenic probe (i.e., TaqMan probe). Real time PCR is compatible both with quantitative competitive PCR and with quantitative comparative PCR. The former uses an internal competitor for each target sequence for normalization, while the latter uses a normalization gene contained within the sample, or a housekeeping gene for RT-PCR. Further details are provided, e.g., by Held et al., Genome Research 6: 986-994 (1996).
Expression levels can be determined using fixed, paraffin-embedded tissues as the RNA source. According to certain examples of the present invention, PCR primers and probes are designed based upon intron sequences present in the gene to be amplified. In this embodiment, the first step in the primer/probe design is the delineation of intron sequences within the genes. This can be done using publicly available software, such as the DNA BLAT software developed by Kent, W. ]., Genome Res. 12 (4) : 656-64 (2002), or by the BLAST software including its variations. Subsequent steps follow well established methods of PCR primer and probe design.
In order to avoid non-specific signals, it is useful to mask repetitive sequences within the introns when designing the primers and probes. This can be easily accomplished by using the Repeat Masker program available on-line through the Baylor College of Medicine, which screens DNA sequences against a library of repetitive elements and returns a query sequence in which the repetitive elements are masked. The masked sequences can then be used to design primer and probe sequences using any commercially or otherwise publicly available primer/probe design packages, such as Primer Express (Applied Biosystems); MGB assay-by-design (Applied Biosystems); Primer3 (Steve Rozen and Helen J. Skaletsky (2000) Primer3on the WWW for general users and for biologist programmers in : Krawetz S, Misener S (eds) Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press, Totowa, N.J., pp 365-386).
The most important factors considered in PCR primer design include primer length, melting temperature (Tm), and G/C content, specificity, complementary primer sequences, and 3' end sequence. In general, optimal PCR primers are generally 17-30 bases in length, and contain about 20-80%, such as, for example, about 50-60% G+C bases. Melting temperatures between 50 and 80°C, e.g., about 50 to 70°C, are typically preferred. For further guidelines for PCR primer and probe design see, e.g., Dieffenbach, C. W. et al., General to Concepts for PCR Primer Design in : PCR Primer, A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York, 1995, pp. 133-155; Innis and Gelfand, Optimization of PCRs in : PCR Protocols, A Guide to Methods and Applications, CRC Press, London, 1994, pp. 5-11; and Plasterer, T. N. Primerselect: Primer and probe design. Methods Mol. Biol. 70 : 520-527 (1997), the entire disclosures of which are hereby expressly incorporated by reference. Loop Mediated Isothermal Amplification
LAMP is an isothermal nucleic acid amplification technique. In contrast to PCR technology, in which the reaction is carried out with a series of alternating temperature steps or cycles, isothermal amplification is carried out at a constant temperature, and does not require a thermal cycler.
With LAMP, the target sequence is amplified at a constant temperature of 60-65 °C using either two or three sets of primers and a polymerase with high strand displacement activity in addition to a replication activity. Typically, 4 different primers are used to identify 6 distinct regions on the target gene, which adds highly to the specificity. An additional pair of "loop primers" can further accelerate the reaction . Due to the specific nature of the action of these primers, the amount of DNA produced in LAMP is considerably higher than PCR based amplification.
Detection of amplification product can be determined via photometry for turbidity caused by an increasing quantity of magnesium pyrophosphate precipitate in solution as a byproduct of amplification . This allows easy visualization by the naked eye, especially for larger reaction volumes, or via simple detection approaches for smaller volumes. The reaction can be followed in real-time either by measuring the turbidity or by fluorescence using intercalating dyes such as SYTO 9. Dyes such as SYBR green, can be used to create a visible color change that can be seen with naked eyes without the need for expensive equipment, or a response that can more accurately be measured by instrumentation. Dye molecules intercalate or directly label the DNA, and in turn can be correlated to the number of copies initially present. Hence, LAMP can also be quantitative. In-tube detection of DNA amplification is possible using manganese loaded calcein which starts fluorescing upon complexation of manganese by pyrophosphate during in vitro DNA synthesis.
Recombinase Polymerase Amplification
Recombinase polymerase amplification (RPA) is a single tube, isothermal alternative to PCR. By adding a reverse transcriptase enzyme to the reaction, RPA can detect RNA as well as DNA, without the need for a separate step to produce cDNA. Because it is a isothermal process, RPA reactions do not require a thermal cycler with optimal operating temperatures of between 37-42 °C, although the reactions may be performed at room temperature, albeit slower than at the optimal temperature range. In theory, recombinase polymerase amplification may be performed by simply holding a tube, which makes it an excellent candidate for developing low-cost, rapid, point-of-care molecular tests.
Recmobinase polymerase amplification employs three core enzymes, namely a recombinase, a single-stranded DNA-binding protein (SSB) and a strand-displacing polymerase. Recombinases are capable of pairing oligonucleotide primers with homologous sequence in duplex DNA. SSB bind to displaced strands of DNA and prevent primers from being displaced. Finally, the strand displacing polymerase begins DNA synthesis where the primer has bound to the target DNA. By using two opposing primers, an exponential DNA amplification reaction is initiated where the target sequence is present. No other sample manipulation such as thermal or chemical melting is required to initiate amplification. At optimal temperatures (37-42 °C), the reaction progresses rapidly and results in specific DNA amplification from just a few target copies to detectable levels, typically within 10 minutes, for rapid detection of viral genomic DNA or RNA, pathogenic bacterial genomic DNA, as well as short length aptamer DNA.
The three core RPA enzymes can be supplemented by further enzymes to provide extra functionality. Addition of exonuclease III allows the use of an exo probe for real-time, fluorescence detection akin to real-time PCR. Addition of endonuclease IV means that a nfo probe can be used for lateral strip detection of successful amplification. If a reverse transcriptase that works at 37-42 °C is added then RNA can be reverse transcribed and the cDNA produced amplified all in one step. As with PCR, all forms of RPA reactions can be multiplexed by the addition of further primer/probe pairs, allowing the detection of multiple analytes or an internal control in the same tube. si **
Any reference to prior art documents in this specification is not to be considered an admission that such prior art is widely known or forms part of the common general knowledge in the field.
The invention is further described with reference to the following Examples. It will be appreciated that the invention as claimed is not intended to be limited in any way by these Examples.
EXAMPLE 1
MATERIALS & METHODS
Buffers
TAE buffer (50x in 500mL) : 121g Tris-HCI, 28.6 ml. glacial acetic acid, 50mL of 0.5M EDTA, adjusted to pH 8 with glacial acetic acid. Autoclaved for 15 minutes at 15psi and stored at room temperature.
TBE buffer (lOx in 2L) : 216g Tris-HCI, HOg boric acid, 14.9g EDTA, filtered through 0.45μΜ Autoclaved for 15 minutes at 15psi and stored at room temperature.
Acrylamide: bisacrylamide (29 : 1) (30% w/v) : 29g acrylamide, lg bis-acrylamide, 100ml ddH20 and a small quantity of BIO-RAD AG 501-X8 ion exchange resin (enough to cover the bottom of the bottle) and stored at 4°C.
Ammonium persulfate (APS 10%) : 200mg of APS in 2ml of ddl- O and prepared fresh each time. Agarose gels: made to 1% or 1.5% with 0.4g or 0.6g agarose (Sigma) in 40mL IX TAE, heated to boiling, cooled and poured into gel tank (with comb added) . The molecular weight marker used was Roche XIV (lOObp ladder), loaded with Ficoll loading dye (15% Ficoll 400, 0.25% bromophenol blue, 0.25% xylene cyanol) .
Agarose gel running buffer: 200mL lx TAE, lOuL EtBr (Sigma) .
PAGE gels : made to 8% with 3.2ml_ of 30% Acrylamide: bisacrylamide, 6.4ml_ of ddH20, 2.4mL of 5X TBE buffer, 200μΙ- of APS 10% and ΙΟμί. of TEMED.
PAGE gel running buffer: lx TBE. PAGE gels were stained following electrophoresis with a 10 minutes in an ethidium bromide/lX TBE solution on a mixing platform.
Plant DNA Extraction Buffer: 200mM Tris-HCI pH 8, 250mM NaCI, 25mM EDTA, 0.5%
SDS Chloroform : iso-amyl alcohol (24: 1) .
DNA extracts were quantified using the Nanodrop, ND1000 spectrophotometer (Nanodrop) or the Epoch Micro-plate spectrophotometer (Bio-Tek) . Culture Media and Bacterial Transformation
Lysogeny broth (LB) : lOg/L Bacto Tryptone, 5g/L Yeast Extract, lOg/L NaCI . Solidified with 15g/L agar if required. Autoclaved for 15min at 15psi .
Selective medium for E. coli transformations used 200mg/L ampicillin (added after autoclaving). Blue/white colony selection required 20uL of 40mg/ml_ IPTG and 20uL of 40mg/ml_ BCIG (in DMF) spread onto the medium surface prior to plating cells. Competent E. coli cells (treated with Rubidium Chloride) were sourced from frozen stocks held in the lab and transformed using a mild heat-shock protocol (2 min at 37°C) .
Small PCR products were cloned into the pGEM-T Easy vector (Promega) using the Promega ligation system kit.
PCR and HRM
Primers for these experiments were sourced from Sigma-Aldrich, Australia .
Standard PCRs were carried out in 20μΙ_ or 50μΙ reactions using ReddyMix 2X (ThermoFisher) on an Eppendorf Thermocycler.
The HRM kit used in this work was the Luminaris® HRM kit (ThermoFisher) which uses the EvaGreen® DNA intercalating dye. PCRs using this HRM kit were carried out in 10μΙ or 20μΙ reactions using a Roche LightCycler® 480 machine.
Enzymes
Each of T7 Endonuclease, T5 and T7 Exonuclease and Lambda Exonuclease were sourced from New England Biolabs (NEB).
Surveyor® was sourced from Integrated DNA Technologies (IDT) .
Restriction enzymes were sourced from Roche and New England Biolabs (NEB). DNA Isolation
Arabidopsis DNA was prepared from two ecotypes - Landsberg erecta (Ler) and Columbia (Col-0). These represent the wildtype and mutant sample respectively, as these genomes differ by approximately 350,000 SNPs.
A 5mm2 leaf sample was taken from each ecotype and placed in separate snaplock bags. These were then placed in a dry-ice: ethanol bath for 1-2 minutes to rapidly freeze the leaf samples. The snaplock bags were moved to the benchtop and the samples quickly crushed using a corex tube. 700μΙ of extraction buffer was added to each sample and aspirated to mix. This was then transferred to a 1.5ml Eppendorf tube. After incubating at room temperature for a few minutes, the lysates were centrifuged at 13,000 rpm in a benchtop centrifuge for 5 minutes. The supernatants were transferred to new eppendorf tubes and the precipitates discarded.
200μΙ of 24: 1 chloroform : iso-amyl alcohol was added to each eppendorf, then vigorously shaken. Samples were spun at 13,000 rpm for 5 minutes. The top layer in each eppendorf was then transferred to a new eppendorf, the bottom fraction being discarded . This purification step was repeated once more. 500μΙ of ice-cold isopropanol was added to each sample before being placed on ice for at least 20 minutes to precipitate DNA. The resulting precipitate was pelleted with a 13,000 rpm spin for 10 minutes and the supernatant discarded . The pellet was washed with 300μΙ of chilled 70% ethanol, followed by removal of the ethanol, with the pellet being left to air dry. The DNA was then resuspended in ΙΟΟμΙ of ddh O. Purified DNA concentrations were quantified through spectrophotometry using the Nanodrop ND1000 platform.
DNA for the cancer application was obtained from Dr Anita Dunbier of the Department of Biochemistry, University of Otago. This was prepared from an immortalised cell line, rather than directly from a clinical sample - with two cell lines being prepared, one having the normal/wildtype sequence and the other carrying PIK3Ca mutations associated with tumorigenesis. Purified DNA concentrations were quantified through spectrophotometry, using either the Nanodrop (when analysing 1 -4 DNA samples) or the Epoch (when analysing a larger number of samples) .
DNA Cloning
DNA from Mycobacterium tuberculosis was isolated from the strain H37Rv, provided by Dr Htin Aung of the Department of Microbiology of the University of Otago. A 604bp part of the rpoB gene, encompassing the 81bp RRDR region of interest, was amplified from this DNA via PCR. ReddyMix (Thermo Fisher) was used, in combination with primers synthesised by Sigma Aldrich (rpoB5-f 5' TCGTGGCCACCATCGAATATC; rpoB5-rev 5' TGGCGGTCCTCCTCGTC) . This wildtype PCR product was separated from the other PCR components using a commercial kit designed for the purpose (QIAquick PCR purification kit from QIAgen) and then ligated into the pGEM-Teasy plasmid vector (Promega). This vector construct was transformed into competent E. coli using standard procedures - the resultant colonies screened for the presence of the inserted PCR product using X-gal blue/white selection. Recombinant plasmids were extracted from appropriate colonies using the Roche High Pure Plasmid isolation kit and examined by restriction digest and Sanger DNA sequencing to confirm the presence of the M. tuberculosis rpoB gene region.
Sequencing was provided by the Otago Genetic Analysis Service (http://gas.otago.ac.nz) using ABI BigDye Terminator version 3.1 ; the samples were prepared for sequencing following the instructions at the GAS website.
Artemisinin resistance in Malaria (P. falciparum) was recently associated with multiple SNPs in a gene referred to as kelch!3 or K13. In order to have access to P. falciparum K13 sequences, a plasmid (pZFN-K13-18/20-hDHFR-Bsmut) developed by Straimer et al. (2014) was obtained from Professor David Fidock of the Columbia University Medical Center, New York. This construct contains the wild type K13 allele. A l,ll lbp region of K13, encompassing the propeller domain was amplified from the plasmid using PCR and with the primers described in Straimer et al. (2014) (K13-P1 5' GTGACGTCGATTGATATTAATGTTGGTGGAGC and K13-P2 5'
CCGCATATGGTGCAAACGGAGTGACCAAATCTGGG). PCR products were cloned into the pGEM-T-easy vector (Promega) and their sequence confirmed by Sanger sequencing at GAS Otago (http://gas.otago.ac.nz/), using ABI BigDye Terminator version 3.1 ; the samples were prepared for sequencing following the instructions at the GAS website.
Mutagenesis
Plasmids from a confirmed Mycobacterium tuberculosis rpoB-containing E.coli clone were used as templates to create mutant rpoB sequences using the overlap extension mutagenesis technique. This is an overlapping PCR protocol using primers designed to include the desired change. This change is incorporated into the amplicon during PCR, replacing the original sequence. PCR products incorporating the mutant sequences were cloned into the pGem-Teasy plasmid vector according to the manufacturer's instructions. Recombinant plasmids carrying mutant alleles were confirmed by Sanger sequencing at GAS Otago (http://gas.otago.ac.nz/).
Plasmids from a confirmed Plasmodium falciparum K13-containing E.coli clone were used to generate four different mutant K13 alleles by site-directed mutagenesis. The mutant alleles were cloned into the pGEM-T-easy vector as before. Recombinant plasmids carrying the mutant alleles were confirmed by Sanger sequencing at GAS Otago (http://gas.otago.ac.nz/).
These four K13 mutant alleles have been identified as conferring artemisinin resistance. For example, the two highest frequency mutant K13 alleles found in artemisinin resistant P. falciparum in Burma are F446I and C580Y, while F446I is the predominant K13 mutation in the Yunnan Province of China (the only region of China with artemisinin resistant P. falciparum). The C580Y, R539T and Y493H mutations are the most prevalent in Cambodia. These particular mutations were also selected to explore the effect of transitions and transversions on the assays.
Figure imgf000054_0001
Surveyor Assay
Surveyor® assays were performed on PCR products from a Luminaris® PCR reaction (ΙΟμΙ) with the original DNA template being a 1 : 1 mix of analysed sample DNA and wildtype DNA. This assay followed a denaturation (5 minutes at 95°C) and renaturation (2 minutes at 25°C) stage to allow heteroduplex DNA to form. The standard Surveyor® assay was found to be highly active, so a modified protocol was used that required half the volume of Surveyor Nuclease (0.5μΙ) and Surveyor Enhancer (0.5μΙ) thereby reducing the cost of the assay by half. The second modification made was to overcome the challenge in accurately pipetting enzyme and enhancer solutions containing glycerol. A water control from each experiment was used as a diluent for both the Surveyor Nuclease and Surveyor Enhancer at a 2 : 1 ratio (e.g. 9μΙ water control added to 4.5μΙ Surveyor Nuclease, with 1.5μΙ of the dilution being equivalent to 0.5μΙ of the original solution.
Starting with ΙΟμΙ PCR reactions, the modified Surveyor® assay involves adding 1 μ I of MgC (0.15M), 1.5μΙ of diluted Surveyor Enhancer (0.5μΙ of Surveyor Enhancer diluted 1 :2 in one of the plates water controls) and then 1.5μΙ of diluted Surveyor Nuclease (0.5μΙ of Surveyor Nuclease diluted 1 :2 in one of the plates water controls), before incubating the reaction at 37°C for 20 minutes.
T7 Endonuclease
Starting with a 50μΙ standard PCR reaction, the DNA was denatured (5 minutes at 95°C) and renatured (2 minutes at 25°C) to allow heteroduplex DNA to form. 12μΙ aliquots of the original 50μΙ were then used for T7 endonuclease assays. To this 12μΙ, 1.5μΙ of NEBuffer 2 (10X) was added followed by 1.5μΙ of T7 Endonuclease. This was then incubated at 37°C for 20 or 40 minutes. IX NEBuffer 2 is made of: 50 mM NaCI, 10 mM Tris-HCI, 10 mM MgCI2 and 1 mM DTT at pH 7.9 T7 Exonuclease
A volume of T7 Endonuclease equal to l/10th the reaction volume was added to the solution of DNA along with a volume of NEBuffer 4 (10X) equal to l/10th the reaction volume. This was then incubated at 25°C for 30 or 60 minutes. IX NEBuffer 4 is made of: 50 mM Potassium Acetate, 20 mM Tris-acetate, 10 mM Magnesium Acetate and 1 mM DTT at pH 7.9
Lambda Exonuclease
A volume of Lambda Endonuclease equal to l/10th the reaction volume was added to the solution of DNA along with a volume of Lambda Exonuclease Reaction Buffer (10X) equal to l/10th the reaction volume. This was then incubated at 25°C for 30 or 60 minutes. IX Lambda Exonuclease Reaction Buffer is made of: 67 mM Glycine-KOH, 2.5 mM MgCb and 50 pg/ml BSA at pH 9.4. PCR
Standard PCRs were carried out in 20pL using ReddyMix 2X (ThermoFisher) on an Eppendorf Thermocycler. Final primer concentration was 0.5μΜ. The PCR reaction mixture was made up of: 10μΙ Thermo Scientific Reddymix 2X PCR Master Mix, 6uL water, ΙμΙ of ΙΟμΜ forward primer, ΙμΙ of 10 μΜ reverse primer and 2μΙ of template DNA.
In some cases, standard PCRs were carried out in 50μΙ volumes, made up of 25μΙ
Thermo Scientific Reddymix 2X PCR Master Mix, 15uL water, 2.5μΙ of 10 μΜ forward primer, 2.5μΙ of 10μΜ reverse primer and 5μΙ of template DNA.'
Standard PCRs were run using the following conditions: an initial denaturation step, 95°C for 5 minutes; an annealing step at 52°C (1 minute), extension at 72°C (2 minutes) and denaturation at 95°C for 1 minute in 35 cycles.
PCRs using the Luminaris® HRM kit were generally half reactions (10μΙ) and were run using the following conditions: an initial denaturation step, 95°C for 10 minutes; an annealing and extension step at 60°C (1 minute), and denaturation at 95°C (10 seconds) for 35-45 cycles.
Polyacrylamide Gel Electrophoresis (PAGE)
Glass plates (100mm x 75mm) and spacers were washed thoroughly with hot water and detergent, before being rinsed first with ddhhO and secondly ethanol and set aside to dry. Glass plates were then assembled in a gel caster. Working quickly, 10μΙ of TEMED was added to the appropriate gel solution to make 3 or 4 8% PAGE gels (3.2mL of 30% Acrylamide: bisacrylamide, 6.4mL of ddH20, 2.4mL of 5X TBE buffer, 200pL of APS 10%) and the solution pipetted into the space between the prepared glass plates. An appropriate comb was added immediately, with care being taken not to introduce air bubbles. The acrylamide was then left to polymerize for 30-60 minutes at room temperature.
After polymerization was complete, the gels were wrapped in paper towels soaked in IX TBE (PAGE gel running buffer). These were then covered in cling film and kept at 4°C for up to a week.
Once ready to proceed with electrophoresis, PAGE gels were removed from the cling film and paper towels. These were inserted in to an appropriate gel tank and sufficient running buffer (IX TBE) was added to reach approximately 80% the height of the gel. The gel combs were carefully removed and flushed with a small amount of running buffer to remove any air bubbles. Appropriate ladders were added (Low Molecular Weight DNA ladder from NEB covering 25bp-766bp and/or the Roche XIV lOObp ladder covering lOObp- 3000bp) followed by the analysed DNA samples, each with Ficoll loading dye (15% Ficoll 400, 0.25% bromophenol blue, 0.25% xylene cyanol) .
The electrodes were connected to the power pack, the power turned on, and the electrophoresis run started at IV/cm to 5V/cm. Higher voltages should be avoided as they can lead to gel distortions. PAGE runs typically take 1-2 hours to complete, being run until the marker dyes have migrated the desired distance. At this point the power pack was turned off, the leads disconnected and the electrophoresis running buffer transferred to a large glass bottle. The glass plates were detached from the gel tank and separated. The PAGE gel was transferred to an EtBr/lX TBE solution for staining for 10 minutes. Page gels were imaged on a UV gel imager such as a BioRad Gel Doc.
Agarose
Large DNA fragments can be separated on the basis of size through submerged agarose gels. First 200ml of ddH20 was mixed with 5 ml of 50x TAE buffer and 10 μΙ of ethidium bromide. 50 ml of this buffer was then mixed with 0.4 g of agarose before being heated in the microwave to melt the agarose. This was then left to form a cool solution (10- 20 minutes at room temperature) and poured into a gel tank. A gel comb was added and the gel left to set.
Once set, the remaining 150 ml of buffer was added to submerge the gel, the gel comb was removed, and DNA samples were added. DNA ladders were prepared and loaded in an empty well. A 100 mA current was then placed across the gel until the dye front had moved approximately 80% of the way down the gel. The current was then removed and the gel imaged using a BioRad Gel Doc, with the size of resolved DNA being compared to the DNA ladder. High Resolution Melt Analysis
Selected sequences from each organism were used to design HRM suitable primers, able to be used in SNP genotyping at the analysed loci. These were uploaded into the NCBI Primer-BLAST tool . The specified forward primer range and reverse primer range were set to give a desired assay length, typically centered on the analysed SNP or SNP containing region/s. The TM difference between forward and reverse primer pairs was set at a maximum of 2.5° C. The Primer-BLAST tool also analysed the GC content of each primer and any self-complementarity, providing warnings if these features were unfavourable in a designed primer set.
The sequences from each primer were used in a BLAST with the analysed organism's genome, ideally having only one significant alignment at the intended primer binding site. Any primer set that had one or both primers aligning to an off-target site were not used . Designed primers and the predicted amplicons were exported in a FASTA file, and primers ordered through Sigma-Aldrich Australia . Each designed HRM amplicon had a predicted melt temperature (TM) computed through the uMelt web-based program (https ://www.dna . utah.edu/umelt/umelt.html), with the results exported in as text files and PNG images.
The Luminaris® HRM half reaction protocol was used for HRM analysis in this research. Solutions used in the reaction were vortexed and briefly centrifuged after thawing . A reaction master mix was then prepared . For an individual 10 μΙ reaction, this required 5 μΙ of Master Mix (2x), 0.5 μΙ of the forward primer at 10 μΜ, 0.5 μΙ of the reverse primer at 10 μΜ, and 1.5 μΙ of nuclease-free water. This reaction master mix was scaled up to the number of samples being analysed, including controls. Template DNA was prepared by mixing equal parts template DNA (at approximately 6 ng/μΙ) to 8x yellow sample buffer (commonly 7 μΙ of template mixed with 7 μΙ of buffer - giving enough prepared template for five reactions) . 2.5 μΙ of this prepared template DNA was then added to 7.5 μΙ of each reaction master mix in individual wells of a 96-well plate. This was centrifuged briefly, before being placed in the LightCycler® 480. The PCR and complete denaturation and renaturation stages are programed as follows :
Step Temperature °C Time Number of Cycles
Initial Denaturation 95 10 min 1
Denatu ration 95 10 sec 35-45
Annealing/Extension 60 60 sec
Data Acquisition 95 30 sec 1
Heteroduplex 50 30 sec 1
Formation
High Resolution Melt 65-95 Increments of 0.2°C/2s
Curve Acquisition
Curve acquisition for the Tuberculosis assays was raised to 97 C from the standard 95°C to allow for stronger normalisation post melt as these assays have high melting temperatures. If there was contaminating DNA in any water control, the HRM analysis of all samples on the affected plate would be repeated. The high resolution melt curves produced were visualized and analysed in a variety of ways. These include raw data melt curves, normalized melt curves, difference graphs and melting peaks. Each of these can be generated from available software on the LightCycler® 480.
Heteroduplexing Enzyme Treatment (MET)
Standard PCR was carried out on the analysed sample (See Methods - PCR) at the assayed site - with an exonuclease-blocked forward primer and a normal reverse primer. In a separate reaction vessel, a wildtype sample was PCR amplified using an exonuclease- blocked reverse primer of the same sequence and a normal forward primer. Exonuclease blocked primers contain 6 phosphorothioate linkages in tandem on the 5' termini. Each of these amplified products were then exposed to T7 exonuclease, generating single stranded DNAs. The two ssDNAs are then combined and held at 50°C for 5 minutes to anneal correctly - the wildtype ssDNA being completely complementary to the analysed sample ssDNA unless there were mutations present in the original sample. In this case, all dsDNA molecules formed will carry heteroduplexes, giving a 100% heteroduplexed DNA sample.
Enzyme Mediated Profiling (EMP)
EMP assays were performed on PCR products from a standard PCR reaction (50μΙ - aliquoted out to 12μ I volumes) with the original DNA template being a 1 : 1 mix of analysed sample DNA and wildtype DNA. This assay followed a denaturation (5 minutes at 95°C) and renaturation (2 minutes at 25°C) stage to allow heteroduplex DNA to form. Alternatively, the EMP assays were linked with heteroduplexing enzyme treatment (above), again aliquoted out to 12μΙ.
At this point, the EMP method is simply a T7 endonuclease assay followed by either a T7 exonuclease assay or Lambda exonuclease assay, with the ultimate DNA products being analysed with both PAGE and Agarose gels.
Enzymatic HRM
The Enzymatic HRM method follows that of a standard HRM assay, deviating before the melt curve acquisition stage. The PCR and complete denaturation and renaturation stages are programed as follows:
Figure imgf000059_0001
The 96-well plate was then removed from the LightCycler® 480. To each 10μΙ PCR reaction, ΙμΙ of MgCb (0.15M), 1.5μΙ of diluted Surveyor Enhancer (0.5μΙ of Surveyor Enhancer diluted 1 : 2 in one of the plates water controls) and then 1.5μΙ of diluted Surveyor Nuclease (0.5μΙ of Surveyor Nuclease diluted 1 :2 in one of the plates water controls) were added, before incubating the reaction at 37°C for 20 minutes.
The ultimate DNA products were then analysed through the standard method of high resolution melt curve acquisition - a graduated temperature increase with fluorescent data acquisitions from 65°C to 95°C at a rate of 0.2°C/2s. Curve acquisition for the Tuberculosis assays was raised to 98°C from the standard 95°C to allow for stronger normalisation post melt as these assays have high melting temperatures. The Enzymatic HRM curves produced were visualized and analysed in a variety of ways. These include raw data melt curves, normalized melt curves, difference graphs and melting peaks. Each of these can be generated from available software on the LightCycler® 480.
EXAMPLE 2
ENZYMATIC HRM TO IDENTIFY MULTI-DRUG RESISTANT TUBERCULOSIS The assays, methods and kits according to the present invention provide a clinically significant assay for the diagnosis of drug-resistant tuberculosis in infected patients by identifying mutations in the genome of Mycobacterium tuberculosis responsible for resistance to frontline antibiotics. For example, to identify mutations that confer resistance to treatment by rifampicin comprising one or more polymorphisms in the rpoB gene, to identify mutations that confer resistance to treatment by pyrazinamide comprising one or more polymorphisms in the pncA gene and to identify mutations that confer resistance to treatment by isoniazid comprising one or more polymorphisms in KatG gene.
It is widely known that a significant number of mutations that confer resistance to treatment by rifampicin comprise one or more polymorphisms located in the so-called 81 bp rifampicin resistance determining region (RRDR) of the ropB gene, being the target of many commercial/clinical assays.
The 604bp rpoB gene (SEQ ID NO : l) comprising the 81bp rifampicin resistance determining region (SEQ ID NO: 2; underlined) consists in the following sequence :
TCGTGGCCACCATCGAATATCTGGTCCGCTTGCACGAGGGTCAGACCACGATGACCGTTCCGGGCGGCGTCGAGGTG CCGGTGGAAACCGACGACATCGACCACTTCGGCAACCGCCGCCTGCGTACGGTCGGCGAGCTGATCCAAAACCAGAT CCGGGTCGGCATGTCGCGGATGGAGCGGGTGGTCCGGGAGCGGATGACCACCCAGGACGTGGAGGCGATCACACCGC AGACGTTGATCAACATCCGGCCGGTGGTCGCCGCGATCAAGGAGTTCTTCGGCACCAGCCAGCTGAGCCAATTCATG GACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTGGGGCCCGGCGGTCTGTCACGTGA GCGTGCCGGGCTGGAGGTCCGCGACGTGCACCCGTCGCACTACGGCCGGATGTGCCCGATCGAAACCCCTGAGGGGC CCAACATCGGTCTGATCGGCTCGCTGTCGGTGTACGCGCGGGTCAACCCGTTCGGGTTCATCGAAACGCCGTACCGC AAGGTGGTCGACGGCGTGGTTAGCGACGAGATCGTGTACCTGACCGCCGACGAGGAGGACCGCCA
By way of illustration only, Figure 38 shows the 81bp RRDR region of rpoB (SEQ ID NO: 2), including examples of known mutations which confer antibiotic resistance to treatment by rifampicin (SEQ ID NOs : 14-69) . These mutations comprise single nucleotide polymorphisms at a single locus (e.g . SEQ ID NOs: 19, 42-46), single nucleotide polymorphisms at multiple loci (e.g . SEQ ID NOs: 4-8; at one or multiple different codons) and/or deletion mutations (e.g. SEQ ID NOs: 37, 39, 41, 47, 48).
The genome of Mycobacterium tuberculosis comprises an average GC content of 65- 68%. In order to demonstrate proof-of-principle with respect to the EHRM methods/assays of the present invention in the context of identifying genetic variation in the rpoB gene of Mycobacterium tuberculosis, amplicons comprising a similar GC content were generated, namely between 65-67%.
Further, although Applicants had access to genomic DNA samples carrying a range of antibiotic resistance-causing SNPs, in this example Applicants transformed the Mycobacterium tuberculosis rpoB gene into a rapid growing bacterial strain suitable for PC2 handling. Each of the Tuberculosis assays is therefore targeting the native sequence now located on a plasmid vector. To demonstrate the utility of the assays/methods in one working example according to the present invention, Applicants engineered a mutant form of the Mycobacterium tuberculosis rpoB gene using extension PCR mutagenesis and cloned the mutated rpoB gene sequences into the pGEM-Teasy expression vector. The mutated rpoB gene contains a single nucleotide polymorphism at position 309 of SEQ ID NO : l (SEQ ID NO : 3; A G polymorphism conferring D435G change at the amino acid level). The engineered sequence is as follows :
TCGTGGCCACCATCGAATATCTGGTCCGCTTGCACGAGGGTCAGACCACGATGACCGTTCCGGGCGGCGTC GAGGTGCCGGTGGAAACCGACGACATCGACCACTTCGGCAACCGCCGCCTGCGTACGGTCGGCGAGCTGATCCAAAA CCAGATCCGGGTCGGCATGTCGCGGATGGAGCGGGTGGTCCGGGAGCGGATGACCACCCAGGACGTGGAGGCGATCA CACCGCAGACGTTGATCAACATCCGGCCGGTGGTCGCCGCGATCAAGGAGTTCTTCGGCACCAGCCAGCTGAGCCAA TTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTGGGGCCCGGCGGTCTGTC ACGTGAGCGTGCCGGGCTGGAGGTCCGCGACGTGCACCCGTCGCACTACGGCCGGATGTGCCCGATCGAAACCCCTG AGGGGCCCAACATCGGTCTGATCGGCTCGCTGTCGGTGTACGCGCGGGTCAACCCGTTCGGGTTCATCGAAACGCCG TACCGCAAGGTGGTCGACGGCGTGGTTAGCGACGAGATCGTGTACCTGACCGCCGACGAGGAGGACCGCCA
A separate vector was also engineered carrying a non-mutated form of the rpoB gene (i.e. SEQ ID NO : l) . Refer to Figure 16.
The non/mutated rpoB containing vectors were then transformed into Escherichia coli
DH5 and transformed colonies were selected on the basis of growth in the presence of ampicillin (AmpR; positive growth selection) . Further, selection of those colonies carrying the non/mutated rpoB insert was made using a blue/white phenotypic colour selection based on loss of function of LacZ from the cloning cassette. Again, refer to Figure 16 which illustrates the pGEM-Teasy vector structure comprising the AmpR and LacZ genes.
Vector DNA was then extracted from selected AmpRLacZ" colonies for amplification . Although the present invention contemplates different amplification protocols (refer above), for the purpose of this working example Applicants used polymerase chain reaction .
Specifically, primer pairs to the 81bp rifampicin resistance determining region of the rpoB gene of Mycobacterium tuberculosis were generated . This is illustrated conceptually in Figure 15, where the primer pairs A/B, C/D, E/F, G/H and 1/3 were designed to generate different sized amplicons, where each amplicon comprises the 81 bp RRDR.
The primer sequences and associated amplicon properties are listed in Table I as follows: Table I: Primer pairs and amplicon information Mycobacterium tuberculosis
Figure imgf000062_0001
The primer sets identified in Table I were designed using the NCBI primer designing tool at: ttj3 ; /.w^
Amplicon melt temperatures were generated computationally using uMelt at :
Amplification using the various primer pairs resulted in the generation of different sized amplicons. Specifically, amplification using the A/B primer pair yielded a 129bp amplicon (SEQ ID NO: 70); amplification using the C/D primer pair yielded a 200bp amplicon (SEQ ID NO:71); amplification using the E/F primer pair yielded a 271bp amplicon (SEQ ID NO:72); amplification using the G/H primer pair yielded a 395bp amplicon (SEQ ID NO: 73); and amplification using the I/J primer pair yielded a 604bp amplicon (SEQ ID NO:74). Refer to Figure 10.
DNA amplification was performed using parallel amplification protocols. The first protocol involved amplification of vector DNA comprising the wild-type rpoB gene (SEQ ID NO: l ; amplification via C/D primer pair). The second protocol involved amplification of vector DNA comprising the mutated rpoB gene containing a single nucleotide polymorphism (SEQ ID NO: 3; amplification via C/D primer pair). This resulted in the generation of 200bp rpoB amplicons with and without the single nucleotide polymorphism. According to this example, the wild-type rpoB amplicon represents the nucleic acid standard, whereas the mutated rpoB amplicon represents the test nucleic acid sequence.
The amplicons were then subjected to a denaturing/renaturing reaction to generate a reaction mix comprising homoduplexed DNA (i.e. where there is perfect stringency between complementary DNA strands) and/or heteroduplexed DNA (i.e. where there is imperfect stringency between substantially complementary DNA strands).
At this point, the reaction mix was either (i) subjected to high resolution melt analysis to determine Tm (i.e. 'non-enzymatic/standard HRM') or (ii) treated with a structure specific enzyme that recognizes and cleaves at, or immediately adjacent to, a heteroduplex, and then subjected to high resolution melt analysis to determine Tm (i.e. 'enzymatic HRM'). This enzyme treatment step yields DNA of different size(s) that can be more readily resolved using melt curve analysis. This concept is illustrated in Figure 9.
In these experiments, melt curve analysis was conducted using the Luminaris® HRM kit and the LightCycler®480 platform.
The non-enzymatic/standard HRM melt curves for ALL rpoB amplicons are presented in Figures 17 and 18. Figure 17 shows non-enzymatic/standard HRM melt curves (relative fluorescence as a function of temperature) for COMBINED Mycobacterium tuberculosis amplicons: namely 129bp, 200bp, 271bp, 395bp and 604bp amplicons.
Figures 18A-18E show non-enzymatic HRM melt curves (relative fluorescence as a function of temperature) for INDIVIDUAL Mycobacterium tuberculosis amplicons. The predicted(vs observed) Tm for each amplicon is as follows: 129bp amplicon = 89.5(89.0)°C (Figure 18A); 200bp amplicon = 91.5(90.0)°C (Figure 18B); 271bp amplicon = 92.0(91.0)°C (Figure 18C); 395bp amplicon = 92.0(91.0)°C (Figure 18D); and 604bp amplicon = 92.0(91.5)°C (Figure 18E). The experimental assay is therefore behaving as expected.
These melt curve data demonstrate that non-enzymatic HRM assays were able to distinguish between homoduplex and heteroduplex DNA for the smaller rpoB amplicons (i.e. 129bp and 200bp; Figures 18A and 18B) but could not distinguish between homoduplex and heteroduplex DNA for the larger rpoB amplicons (i.e. 271bp, 395bp and 604bp). Further, improved resolution for the 129bp amplicon compared to the 200bp amplicon reinforces the observed limitation associated with the application of non-enzymatic (standard) H M to amplicons > > 100-150bp.
In contrast, the enzymatic HMR melt curves for the 200bp rpoB amplicon are presented in Figures 19 and 20. Figure 19 shows enzymatic HRM melt curves (relative fluorescence as a function of temperature) for the 200bp Mycobacterium tuberculosis amplicon following treatment with a heteroduplex specific enzyme (refer to Figure 9). The closed squares represent the average melt curve of all homoduplex DNA following the enzyme treatment step, whereas the open squares represents the average melt cu rve of all heteroduplex DNA following the enzyme treatment step. The average melt transition (Tm) between double and single stranded DNA occurs at a temperature of >0.5°C lower for heteroduplex DNA compared to homoduplex DNA (compare Figure 18B with Figure 19) .
Further, Figure 20 shows the relative fluorescence signal difference as a function of temperature for the 200bp Mycobacterium tuberculosis amplicon between homoduplex DNA (closed squares) and heteroduplex DNA (open squares) following enzyme treatment. These data show that the relative signal difference between heteroduplex and homoduplex DNA was 27-46%, whereas non-enzymatic/standard HRM only yields at relative signal difference of 7%, based on normalized plots.
In comparison, the data presented in Figures 17 and 18 demonstrate that although the non-enzymatic/standard HRM could resolve heteroduplex and homoduplex samples for the 200bp rpoB amplicon, the resolution was low with a peak separation of 0.1 -0.2°C.
Importantly, these data clearly show that the enzymatic HRM assays/methods according to the present invention provide significantly improved sensitivity over non- enzymatic/standard HMR assays in terms of (i) increased resolution of amplicon Tm and (ii) assay range (i.e. size) of amplicons in which genetic differences may be resolved, meaning that differences in genetic variation may be more readily identified . In the context of (e.g .) the treatment of Tuberculosis, the assays, methods and kits of the present invention provide an effective tool for point of care diagnostics in genotyping patients infected by multi-drug resistant and extensively drug resistant Mycobacterium tuberculosis. This in turn leads to improved therapeutic outcomes by providing a personalized medicine approach to the management and treatment of Tuberculosis.
EXAMPLE 3
ENZYMATIC HRM TO IDENTIFY MALARIA The assays, methods and kits according to the present invention provide a clinically significant assay for the diagnosis of malaria in infected patients by identifying mutations in the genome of Plasmodium falciparum responsible for antibiotic resistance. For example, to identify mutations which confer resistance to treatment by artemisinin comprising one or more polymorphisms in the K13-propellar gene. To Applicants knowledge, there is no commercial available diagnostic assay to identify artemisinin resistance in Malaria patients.
The 1097bp K13 gene (SEQ ID NO: 75) consists in the following sequence:
TGTTGGTGGAGC ATTTTTGAAACATCTAGACATACCTTAACACAACAAAAAGATTCATT ATAGAGAAATTATTAA GTGGAAGACATCATGTAACCAGAGATAAACAAGGAAGAATATTCTTAGATAGGGATAGTGAGTTATTTAGAATTATA CTTAACTTCTTAAGAAATCCGTTAACTATACCCATACCAAAAGATTTAAGTGAAAGTGAAGCCTTGTTGAAAGAAGC AGAATTTTATGGTATTAAATTTTTACCATTCCCATTAGTATTTTGTATAGGTGGATTTGATGGTGTAGAATATTTAA ATTCGATGGAATTATTAGATATTAGTCAACAATGCTGGCGTATGTGTACACCTATGTCTACCAAAAAAGCTTATTTT GGAAGTGCTGTATTGAATAATTTCTTATACGTTTTTGGTGGTAATAACTATGATTATAAGGCTTTATTTGAAACTGA GGTGTATGATCGTTTAAGAGATGTATGGTATGTTTCAAGTAATTTAAATATACCTAGAAGAAATAATTGTGGTGTTA CGTCAAATGGTAGAATTTATTGTATTGGGGGATATGATGGCTCTTCTATTATACCGAATGTAGAAGCATATGATCAT CGTATGAAAGCATGGGTAGAGGTGGCACCTTTGAATACCCCTAGATCATCAGCTATGTGTGTTGCTTTTGATAATAA AATTTATGTCATTGGTGGAACTAATGGTGAGAGATTAAATTCTATTGAAGTATATGAAGAAAAAATGAATAAATGGG AACAATTTCCATATGCCTTATTAGAAGCTAGAAGTTCAGGAGCAGCTTTTAATTACCTTAATCAAATATATGTTGTT GGAGGTATTGATAATGAACATAACATATTAGATTCCGTTGAACAATATCAACCATTTAATAAAAGATGGCAATTTCT AAATGGTGTACCAGAGAAAAAAATGAATTTTGGAGCTGCCACATTGTCAGATTCTTATATAATTACAGGAGGAGAAA ATGGCGAAGTTCTAAATTCATGTCATTTCTTTTCACCAGATACAAATGAATGGCAGCTTGGCCCATCTTTATTAGTT CCCAGATTTGGTCACTCCG
To demonstrate the utility of the assays/methods in another working example according to the present invention, Applicants engineered mutants form of the Plasmodium falciparum K13 gene using extension PCR mutagenesis and cloned the mutated K13 gene sequences into the pGEM-Teasy expression vector. The mutated K13 genes contain a single nucleotide polymorphism at positions (SNPl), 493 (SNP2), 539 (SNP3) and 580 (SNP4) of SEQ ID NO:75 (i.e. SEQ ID NOs:76-79). The engineered sequences are as follows: Κ13 F446I' (SEQ ID NO:76; SNPl bold/underlined)
TGTTGGTGGAGCTATTTTTGAAACATCTAGACATACCTTAACACAACAAAAAGATTCATTTATAGAGAAATTATTAA GTGGAAGACATCATGTAACCAGAGATAAACAAGGAAGAATATTCTTAGATAGGGATAGTGAGTTATTTAGAATTATA CTTAACTTCTTAAGAAATCCGTTAACTATACCCATACCAAAAGATTTAAGTGAAAGTGAAGCCTTGTTGAAAGAAGC AGAATTTTATGGTATTAAATTTTTACCATTCCCATTAGTATTTTGTATAGGTGGATTTGATGGTGTAGAATATTTAA ATTCGATGGAATTATTAGATATTAGTCAACAATGCTGGCGTATGTGTACACCTATGTCTACCAAAAAAGCTTATTTT GGAAGTGCTGTATTGAATAATTTCTTATACGTTTTTGGTGGTAATAACTATGATTATAAGGCTTTATTTGAAACTGA GGTGTATGATCGTTTAAGAGATGTATGGTATGTTTCAAGTAATTTAAATATACCTAGAAGAAATAATTGTGGTGTTA CGTCAAATGGTAGAATTTATTGTATTGGGGGATATGATGGCTCTTCTATTATACCGAATGTAGAAGCATATGATCAT CGTATGAAAGCATGGGTAGAGGTGGCACCTTTGAATACCCCTAGATCATCAGCTATGTGTGTTGCTTTTGATAATAA AATTTATGTCATTGGTGGAACTAATGGTGAGAGATTAAATTCTATTGAAGTATATGAAGAAAAAATGAATAAATGGG AACAATTTCCATATGCCTTATTAGAAGCTAGAAGTTCAGGAGCAGCTTTTAATTACCTTAATCAAATATATGTTGTT GGAGGTATTGATAATGAACATAACATATTAGATTCCGTTGAACAATATCAACCATTTAATAAAAGATGGCAATTTCT AAATGGTG ACCAGAGAAAAAAATGAATTTTGGAGCTGCCACATTGTCAGATTCTTATATAATTACAGGAGGAGAAA ATGGCGAAGTTCTAAATTCATGTCATTTCTTTTCACCAGATACAAATGAATGGCAGCTTGGCCCATCTTTATTAGTT CCCAGATTTGGTCACTCCG 13 Y493H' (SEQ ID NO : 77 ; SNP2 bold/ underlined)
TGTTGGTGGAGCTATTTTTGAAACATCTAGACATACCTTAACACAACAAAAAGATTCATTTATAGAGAAATTATTAA GTGGAAGACATCATGTAACCAGAGATAAACAAGGAAGAATATTCTTAGATAGGGATAGTGAGTTATTTAGAATTATA CTTAACTTCTTAAGAAATCCGTTAACTATACCCATACCAAAAGATTTAAGTGAAAGTGAAGCCTTGTTGAAAGAAGC AGAATTTTATGGTATTAAATTTTTACCATTCCCATTAGTATTTTGTATAGGTGGATTTGATGGTGTAGAATATTTAA ATTCGATGGAATTATTAGATATTAGTCAACAATGCTGGCGTATGTGTACACCTATGTCTACCAAAAAAGCTTATTTT GGAAGTGCTGTATTGAATAATTTCTTATACGTTTTTGGTGGTAATAACTATGATTATAAGGCTTTATTTGAAACTGA GGTGTATGATCGTTTAAGAGATGTATGGTATGTTTCAAGTAATTTAAATATACCTAGAAGAAATAATTGTGGTGTTA CGTCAAATGGTAGAATTTATTGTATTGGGGGATATGATGGCTCTTCTATTATACCGAATGTAGAAGCATATGATCAT CGTATGAAAGCATGGGTAGAGGTGGCACCTTTGAATACCCCTAGATCATCAGCTATGTGTGTTGCTTTTGATAATAA AATTTATGTCATTGGTGGAACTAATGGTGAGAGATTAAATTCTATTGAAGTATATGAAGAAAAAATGAATAAATGGG AACAATTTCCATATGCCTTATTAGAAGCTAGAAGTTCAGGAGCAGCTTTTAATTACCTTAATCAAATATATGTTGTT GGAGGTATTGATAATGAACATAACATATTAGATTCCGTTGAACAATATCAACCATTTAATAAAAGATGGCAATTTCT AAATGGTGTACCAGAGAAAAAAATGAATTTTGGAGCTGCCACATTGTCAGATTCTTATATAATTACAGGAGGAGAAA ATGGCGAAGTTCTAAATTCATGTCATTTCTTTTCACCAGATACAAATGAATGGCAGCTTGGCCCATCTTTATTAGTT CCCAGATTTGGTCACTCCG
¾K13 R539T' (SEQ ID NO : 78 ; SNP3 bold/underlined)
TGTTGGTGGAGCTATTTTTGAAACATCTAGACATACCTTAACACAACAAAAAGATTCATTTATAGAGAAATTATTAA GTGGAAGACATCATGTAACCAGAGATAAACAAGGAAGAATATTCTTAGATAGGGATAGTGAGTTATTTAGAATTATA CTTAACTTCTTAAGAAATCCGTTAACTATACCCATACCAAAAGATTTAAGTGAAAGTGAAGCCTTGTTGAAAGAAGC AGAATTTTATGGTATTAAATTTTTACCATTCCCATTAGTATTTTGTATAGGTGGATTTGATGGTGTAGAATATTTAA ATTCGATGGAATTATTAGATATTAGTCAACAATGCTGGCGTATGTGTACACCTATGTCTACCAAAAAAGCTTATTTT GGAAGTGCTGTATTGAATAATTTCTTATACGTTTTTGGTGGTAATAACTATGATTATAAGGCTTTATTTGAAACTGA GGTGTATGATCGTTTAAGAGATGTATGGTATGTTTCAAGTAATTTAAATATACCTAGAAGAAATAATTGTGGTGTTA CGTCAAATGGTAGAATTTATTGTATTGGGGGATATGATGGCTCTTCTATTATACCGAATGTAGAAGCATATGATCAT CGTATGAAAGCATGGGTAGAGGTGGCACCTTTGAATACCCCTAGATCATCAGCTATGTGTGTTGCTTTTGATAATAA AATTTATGTCATTGGTGGAACTAATGGTGAGAGATTAAATTCTATTGAAGTATATGAAGAAAAAATGAATAAATGGG AACAATTTCCATATGCCTTATTAGAAGCTAGAAGTTCAGGAGCAGCTTTTAATTACCTTAATCAAATATATGTTGTT GGAGGTATTGATAATGAACATAACATATTAGATTCCGTTGAACAATATCAACCATTTAATAAAAGATGGCAATTTCT AAATGGTGTACCAGAGAAAAAAATGAATTTTGGAGCTGCCACATTGTCAGATTCTTATATAATTACAGGAGGAGAAA ATGGCGAAGTTCTAAATTCATGTCATTTCTTTTCACCAGATACAAATGAATGGCAGCTTGGCCCATCTTTATTAGTT CCCAGATTTGGTCACTCCG Κ13 C580Y' (SEQ ID NO : 79 ; SNP1 bold/underlined)
TGTTGGTGGAGCTATTTTTGAAACATCTAGACATACCTTAACACAACAAAAAGATTCATTTATAGAGAAATTATTAA GTGGAAGACATCATGTAACCAGAGATAAACAAGGAAGAATATTCTTAGATAGGGATAGTGAGTTATTTAGAATTATA CTTAACTTCTTAAGAAATCCGTTAACTATACCCATACCAAAAGATTTAAGTGAAAGTGAAGCCTTGTTGAAAGAAGC AGAAT T T TAT G GT AT T AAAT T T T T AC CAT T C C CAT T AGT AT T T T GT AT AG GT G GAT T T GAT G GT GT AGAAT AT T T AA ATTCGATGGAATTATTAGATATTAGTCAACAATGCTGGCGTATGTGTACACCTATGTCTACCAAAAAAGCTTATTTT GGAAGTGCTGTATTGAATAATTTCTTATACGTTTTTGGTGGTAATAACTATGATTATAAGGCTTTATTTGAAACTGA GGTGTATGATCGTTTAAGAGATGTATGGTATGTTTCAAGTAATTTAAATATACCTAGAAGAAATAATTGTGGTGTTA CGTCAAATGGTAGAATTTATTGTATTGGGGGATATGATGGCTCTTCTATTATACCGAATGTAGAAGCATATGATCAT CGTATGAAAGCATGGGTAGAGGTGGCACCTTTGAATACCCCTAGATCATCAGCTATGTGTGTTGCTTTTGATAATAA AATTTATGTCATTGGTGGAACTAATGGTGAGAGATTAAATTCTATTGAAGTATATGAAGAAAAAATGAATAAATGGG AACAATTTCCATATGCCTTATTAGAAGCTAGAAGTTCAGGAGCAGCTTTTAATTACCTTAATCAAATATATGTTGTT GGAG GT AT T GAT AAT GAAC AT AAC AT AT T AGAT T C C GT T GAAC AAT AT CAAC CAT T T AAT AAAAGAT G G C AAT T T C T AAAT GGT GT AC C AGAGAAAAAAAT GAAT T T T G GAG C T G C C AC AT T GT C AGAT T C T T AT AT AAT T AC AG GAG GAGAAA ATGGCGAAGTTCTAAATTCATGTCATTTCTTTTCACCAGATACAAATGAATGGCAGCTTGGCCCATCTTTATTAGTT CCCAGATTTGGTCACTCCG A separate vector was also engineered carrying a non-mutated form of the K13 gene
(i.e. SEQ ID NO:75). Refer to Figure 22.
The non/mutated K13 containing vectors were then transformed into Escherichia coli DH5 and transformed colonies were selected on the basis of growth in the presence of ampicillin (AmpR; positive growth selection). Further, selection of those colonies carrying the non/mutated K13 insert was made using a blue/white phenotypic colour selection based on loss of function of LacZ from the cloning cassette. Again, refer to Figure 22 which illustrates the pGEM-Teasy vector structure comprising the AmpR and LacZ genes.
Vector DNA was then extracted from selected AmpRLacZ" colonies for amplification. Although the present invention contemplates different amplification protocols (refer above), for the purpose of this working example Applicants used polymerase chain reaction.
Specifically, primer pairs to the K13 gene of Plasmodium fulciparum were generated. This is illustrated conceptually in Figure 21, where the primer pairs A/X, Y/B, A/B, C/D, E/F and G/H were designed to generate different sized amplicons, where each amplicon comprises a genetic region comprising one or more of the SNPs (i.e.) SNP1, SNP2, SNP3 and/or SNP4.
The primer sequences and associated amplicon properties are listed in Table II as follows: Table II: Primer pairs and amplicon information Plasmodium falciparum
Figure imgf000068_0001
The primer sets identified in Table II were designed using the NCBI primer designing tool at: http.: //ww .n bj.,nj.m
Amplicon melt temperatures were generated computationally using uMelt at :
. .¾P.s;Z v ww.dna.^
Amplification using the various primer pairs resulted in the generation of different sized amplicons. Specifically, amplification using the A/X primer pair yielded a 140bp amplicon (SEQ ID NO:90); amplification using the Y/B primer pair yielded a 105bp amplicon (SEQ ID NO:91); amplification using the A/B primer pair yielded a 514bp amplicon (SEQ ID NO:92); amplification using the C/D primer pair yielded a 521bp amplicon (SEQ ID NO:93); amplification using the E/F primer pair yielded a 1064bp amplicon (SEQ ID NO:94); amplification using the G/H primer pair yielded a 1074bp amplicon (SEQ ID NO:95). Refer to Figure 21.
DNA amplification was performed using parallel amplification protocols. The first protocol involved amplification of vector DNA comprising the wild-type K13 gene (SEQ ID NO:75; amplification via C/D primer pair). The second protocol involved amplification of vector DNA comprising the mutated K13 gene containing various single nucleotide polymorphisms (specifically SEQ ID NOs: 77, 79; amplification via C/D primer pair). This resulted in the generation of 521bp K13 amplicons with and without either the SNP2 or SNP4 single nucleotide polymorphisms. According to this example, the wild-type K13 amplicon represents the nucleic acid standard, whereas the mutated K13 amplicons represents the test nucleic acid sequence.
The amplicons were then subjected to a denaturing/renaturing reaction to generate a reaction mix comprising homoduplexed DNA (i.e. where there is perfect stringency between complementary DNA strands) and/or heteroduplexed DNA (i.e. where there is imperfect stringency between substantially complementary DNA strands).
At this point, the reaction mix was either (i) subjected to high resolution melt analysis to determine Tm (i.e. 'non-enzymatic/standard HRM') or (ii) treated with a structure specific enzyme that recognizes and cleaves at, or immediately adjacent to, a heteroduplex, and then subjected to high resolution melt analysis to determine Tm (i.e. 'enzymatic HRM'). This enzyme treatment step yields DNA of different size(s) that can be more readily resolved using melt curve analysis. This concept is illustrated in Figure 9.
In these experiments, melt curve analysis was conducted using the Luminaris® HRM kit and the LightCycler®480 platform.
The non-enzymatic/standard HRM melt curves for ALL K13 amplicons are presented in Figures 23 and 24. Figure 23 shows non-enzymatic/standard HRM melt curves (relative fluorescence as a function of temperature) for COMBINED Plasmodium falciparum amplicons: namely 105bp, 514bp, 521bp, and 1074bp amplicons.
Figures 24A-24D show non-enzymatic HRM melt curves (relative fluorescence as a function of temperature) for INDIVIDUAL Plasmodium fulciparum amplicons. The predicted(vs observed) Tm for each amplicon is as follows: 105bp amplicon = 77.0(76.0)°C (Figure 24A); 514bp amplicon = 78.0(78.5)°C (Figure 24B); 521bp amplicon = 78.0(78.5)°C (Figure 24C); and 1074bp amplicon = 78.0(78.5)°C (Figure 24D). The experimental assay is therefore behaving as expected. These melt curve data demonstrate that non-enzymatic HRM assays were able to distinguish between homoduplex and heteroduplex DNA for the smallest K13 amplicon (i.e. 105bp; Figures 24A) but could not distinguish between homoduplex and heteroduplex DNA for the larger K13 amplicons (i.e. 514bp, 521bp and 1074bp). This reinforces the observed limitation associated with the application of non-enzymatic (standard) HRM to amplicons > >100-150bp.
In contrast, the enzymatic HMR melt curves for the 521bp K13 amplicon are presented in Figures 25 and 26. Figure 25 shows enzymatic HRM melt curves (relative fluorescence as a function of temperature) for the 521bp Plasmodium falciparum amplicon following treatment with a heteroduplex specific enzyme (refer to Figure 9). The closed squares represent the average melt curve of all homoduplex DNA following the enzyme treatment step, whereas the open squares represents the average melt curve of all heteroduplex DNA following the enzyme treatment step. The average melt transition (Tm) between double and single stranded DNA occurs at a temperature of >0.5°C lower for heteroduplex DNA compared to homoduplex DNA.
Further, Figure 26 shows the relative fluorescence signal difference as a function of temperature for the 521bp Plasmodium falciparum amplicon between homoduplex DNA (closed squares) and heteroduplex DNA (open squares) following enzyme treatment. These data show that the relative signal difference between heteroduplex and homoduplex DNA was 20-28%, whereas non-enzymatic/standard HRM only yields at relative signal difference of 2.7%, based on normalized plots.
In comparison, the data presented in Figures 23 and 24 demonstrate that the non- enzymatic/standard HRM technique was not able to resolve heteroduplex from homoduplex samples at an amplicon length of 521bp.
Importantly, these data clearly show that the enzymatic HRM assays/methods according to the present invention provide significantly improved sensitivity over non- enzymatic/standard HMR assays in terms of (i) increased resolution of amplicon Tm and (ii) range (i.e. size) of amplicons that may be assayed, meaning that differences in genetic variation may be more readily resolved/identified. In the context of (e.g.) the treatment of Malaria, the assays, methods and kits of the present invention provide an effective tool for incorporation in point of care diagnostic application for genotyping patients infected by Plasmodium falciparum. Having an ability to provide a personalized medicine approach to diagnose patients with Malaria would provide critical health care needs in the developing world where the disease is such a significant health problem. EXAMPLE 4
ENZYMATIC HRM TO IDENTIFY ARABIDPOSIS CULTIVARS/ ACCESSIONS
The assays, methods and kits according to the present invention may be used in a non-infectious disease context (e.g .) to identify polymorphisms in crop plants that can be used to identify particular cultivars or accessions such as Arabidopsis thaliana. This agricultural application is economically and environmentally significant by identifying (e.g .) a single nucleotide polymorphism between two related plant varieties that could be used for marker assisted selection and trait improvement. This method of selection has been used to increase crop yields, nutritional quality and tolerance to environmental extremes such as drought.
In the working example which follows, the assays, methods and kits according to the present invention were used to distinguish between to accessions of Arabidopsis thaliana, namely Landsberg erecta (LER) and Columbia (COL), by identifying a single nucleotide polymorphism in the kinesin motor protein-related gene (GI : 186491180) .
The kinesin motor protein-related gene comprises >2700bp, and Applicants amplified a 570bp region containing the SNP. The 570bp region consists in the following sequence (SEQ ID NO :96) : C AG GAG C AGAT T T T AG C GT AAC C C CT AAT T C T T C AAGC T T CAAGT C T AGAAG GAAC T C AAT GAT AT C T GT C C GAG C T GAATCTGCGTGTCTTCCGGTGAAGAAGAAGAAGAACAGATTTGATTCTGCATGTGACTCATCAGACAGGAGCGTTTC GAAATCGACTAGCATTATGCGTCAAAATACAGCAGATGATGCAACGGTGTATAGTCAGGACATATCTGAATGTGACA TTAAGTTGGTAGTGTCTGAACACAAGCCAAAACCGCTGCAGATGGGGCCTGGTTCTGCGACAAAGTCCCGCTCCAAC ATCAGTAACTTCGAGAAAGATGTGATGCAGAAAATAGGTGGAACAGAGTTTTCAAGGATTAACAGTTGGCTTCGTTC GCAATCTGAAAACAGGAGTTACGTGCTTGACAAGACTCAACTTCCTGCGACTCATTTCCTAGAAAACCTAAACAGAT CGTTGGAGAAGTCACCAACACAGAGTTTTACAACGGAGAAGATCACTGGAAATGAACTGGAAGGTATAGAAGAGACT AAAAC AAAT GAGAC AGT G GT T AAC C C T AC AC
The equivalent sequence derived from LER genomic DNA comprises the following sequence (SEQ ID NO:97) :
C AG GAG C AGAT T T T AG C GT AAC C C CT AAT T C T T C AAGC T T CAAGT C T AGAAG GAAC T C AAT GAT AT C T GT C C GAG C T GAATCTGCGTGTCTTCCGGTGAAGAAGAAGAAGAACAGATTTGATTCTGCATGTGACTCATCAGACAGGAGCGTTTC GAAATCGACTAGCATTATGCGTCAAAATACAGCAGATGATGCAACGGTGTATAGTCAGGACATATCTGAATGTGACA TTAAGTTGGTAGTGTCTGAACACAAGCCAAAACCGCTGCAGATGGGGCCTGGTTCTGCGACAAAGTCCCGCTCCAAC ATCAGTAACTTCGAGAAAGATGTGATGCAGAAAATAGGTGGAACAGAGTTTTCAAGGATTAACAGTTGGCTTCGTTC GCAATCTGAAAACAGGAGTTACGTGCTTGACAAGACTCAACTTCCTGCGACTCATTTCCTAGAAAACCTAAACAGAT CGTTGGAGAAGTCACCAACACAGAGTTTTACAACGGAGAAGATCACTGGAAATGAACTGGAAGGTATAGAAGAGACT AAAACAAAT GAGAC AGT G GT T AAC C C T AC AC Similarly, the equivalent sequence derived from COL genomic DNA comprises the following sequence (SEQ ID NO:98) :
C AG GAG C AGAT T T T AG C GT AAC C C CT AAT T C T T C AAGC T T CAAGT C T AGAAG GAAC T C AAT GAT AT C T GT C C GAG C T GAATCTGCGTGTCTTCCGGTGAAGAAGAAGAAGAACAGATTTGATTCTGCATGTGACTCATCAGACAGGAGCGTTTC GAAATCGACTAGCATTATGCGTCAAAATACAGCAGATGATGCAACGGTGTATAGTCAGGACATATCTGAATGTGACA TTAAGTTGGTAGTGTCTGAACACAAGCCAAAACCGCTGCAGATGGGGCCTGGTTCTGCGACAAAGTCCCGCTCCAAC ATCAGTAACTTCGAGAAAGATGTGATGCAGAAAATAGGTGGAACAGAGTTTTCAAGGATTAACAGTTGGCTTCGTTC GCAATCTGAAAACAGGAGTTACGTGCTTGACAAGACTCAACTTCCTGCGACTCATTTCCTAGAAAACCTAAACAGAT CGTTGGAGAAGTCACCAACACAGAGTTTTACAACGGAGAAGATCACTGGAAATGAACTGGAAGGTATAGAAGAGACT AAAAC AAAT GAGAC AGT G GT T AAC C C T AC AC
Genomic DNA was used in this working example, with the assays being tested in the native background of Arabidopsis thaliana. Arabidopsis thaliana is a diploid organism, with five chromosomes that have each been brought to homozygosity in the LER and COL accessions used in this research
Specifically, primer pairs to the kinesin motor protein-related gene were generated. This is illustrated conceptually in Figure 27, where the primer pairs A/B, C/D, E/F, G/H, I/J and K/L were designed to generate different sized amplicons, where each amplicon comprises the single nucleotide polymorphism that can be used to distinguish between Arabidposis thaliana accessions.
The primer sequences and associated amplicon properties are listed in Table III as follows: Table III: Primer pairs and amplicon information Arabidposis thaliana
Figure imgf000072_0001
(SE Q ID NO: 102)
F r mer G / _fwd CG" rGTCTTCCGGTGA/ ^GAAG 45% 361bp 83 .ouc
(SE Q ID NO: 103)
F r mer H / tt4_ _rev AG( 3AAATGAGTCGCA GGAAGT
(SE Q ID NO: 104)
F r mer I /tl_ _fwd GC; ^ACGGTGTATAGT AGGACA 45% 410bp 83 .o"c
(SE Q ID NO: 105)
F r mer J _rev TGC ■ITGACTTCTCCAAC :GATCTG
(SE Q ID NO: 106)
F r mer K / _fwd CAC J ACJCACJA 1 1 1 1 AC JCGTAACC 43% 570bp 83 .o°c
(SE Q ID NO: 107)
Primer L Atl_ _rev CGAAGTTACTGATGTTGGAGCG
(SEQ ID NO: 108)
The primer sets identified in Table III were designed using the NCBI primer designing tool at:
http://wwwf.ncbi.nim.nih.gov/toois/primerbiast/index.cgi7LINK LOC-BSastHomeAd .
Amplicon melt temperatures were generated computationally using uMelt at :
https://www.dna. utah.edu/umeit/um.ph
Amplification using the various primer pairs resulted in the generation of different sized amplicons. Specifically, amplification using the A/B primer pair yielded a 127bp amplicon (SEQ ID NO : 109); amplification using the C/D primer pair yielded a 125bp amplicon (SEQ ID NO: 110); amplification using the E/F primer pair yielded a 208bp amplicon (SEQ ID NO: 111); amplification using the G/H primer pair yielded a 361bp amplicon (SEQ ID NO: 112); amplification using the I/J primer pair yielded a 410bp amplicon (SEQ ID NO: 113); amplification using the K/L primer pair yielded a 570bp amplicon (SEQ ID NO: 114). Refer to Figure 27.
DNA amplification was performed on genomic DNA using the G/H primer pair. Refer to Table III and Figure 27. This resulted in the generation of 361bp amplicons with and without the single nucleotide polymorphism. According to this example, the LER and COL amplicons represent the test nucleic acid sequence and the test nucleic acid standard used in the naturing/denaturing step referred to below is genomic DNA isolated from the native background of a complex Arabidposis plant.
The amplicons were then subjected to a denaturing/renaturing reaction to generate a reaction mix comprising homoduplexed DNA (i.e. where there is perfect stringency between complementary DNA strands) and/or heteroduplexed DNA (i.e. where there is imperfect stringency between substantially complementary DNA strands).
At this point, the reaction mix was either (i) subjected to high resolution melt analysis to determine Tm (i.e. 'non-enzymatic/standard HRM') or (ii) treated with a structure specific enzyme that recognizes and cleaves at, or immediately adjacent to, a heteroduplex, and then subjected to high resolution melt analysis to determine Tm (i.e. 'enzymatic HRM'). This enzyme treatment step yields DNA of different size(s) that can be more readily resolved using melt curve analysis. This concept is illustrated in Figure 9.
In these experiments, melt curve analysis was conducted using the Luminaris® HRM kit and the LightCycler®480 platform.
The non-enzymatic/standard HRM melt curves for ALL Arabidopsis amplicons are presented in Figures 28 and 29. Figure 28 shows non-enzymatic/standard HRM melt curves (relative fluorescence as a function of temperature) for COMBINED Plasmodium fulciparum amplicons: namely 127bp, 208bp, 361bp, 410bp and 570bp amplicons.
Figures 29A-29E show non-enzymatic HRM melt curves (relative fluorescence as a function of temperature) for INDIVIDUAL Plasmodium fulciparum amplicons. The predicted(vs observed) Tm for each amplicon is as follows: 127bp amplicon = 83.0(82.0)°C (Figure 29A); 208bp amplicon = 82.5(82.5)°C (Figure 29B); 361bp amplicon = 83.0(83.0)°C (Figure 29C); 410bp amplicon = 83.0(83.0)°C (Figure 29D); and 570bp amplicon = 83.0(83.0)°C (Figure 29E). The experimental assay is therefore behaving as expected.
These melt curve data demonstrate that non-enzymatic HRM assays were able to distinguish between homoduplex and heteroduplex DNA for the 127bp and 208bp amplicons, but could not distinguish between homoduplex and heteroduplex DNA for the larger Arabidopsis amplicons (i.e. 361bp, 410bp and 570bp). Further, improved resolution for the 127bp amplicon compared to the 208bp amplicon reinforces the observed limitation associated with the application of non-enzymatic (standard) HRM to amplicons > > 100- 150bp.
In contrast, the enzymatic HMR melt curves for the 361bp Arabidposis amplicon are presented in Figures 30 and 31. Figure 30 shows shows enzymatic HRM melt curves (relative fluorescence as a function of temperature) for the 361 bp Arabidopsis thaliana amplicon following treatment with a heteroduplex specific enzyme (refer to Figure 9). The closed squares represent the average melt curve of all homoduplex DNA following the enzyme treatment step, whereas the open squares represents the average melt curve of all heteroduplex DNA following the enzyme treatment step. The average melt transition (Tm) between double and single stranded DNA occurs at a temperature of >0.5-1.0°C lower for heteroduplex DNA compared to homoduplex DNA. Further, Figure 31 shows the relative fluorescence signal difference as a function of temperature for the 361bp Arabidopsis thaliana amplicon between homoduplex DNA (closed squares) and heteroduplex DNA (open squares) following enzyme treatment. These data show that the relative signal difference between heteroduplex and homoduplex DNA was 17-42%, whereas non-enzymatic/standard HRM only yields at relative signal difference of 2.9%, based on normalized plots.
In comparison, the data presented in Figures 28 and 29 demonstrate that the non- enzymatic/standard HRM technique was not able to resolve heteroduplex from homoduplex samples at an amplicon length of 361bp.
EXAMPLE 5
ENZYME MEDIATED PROFILING: ASSAY METHODOLOGY
The following methodology was used in the EMP assay validation according to certain methods described and claimed herein (refer to Example 6; Figure 3) :
1. amplify the target region from a wildtype (WT) or standard (known) sample using a 5' oligo blocked at the 5' end with 6 consecutive phosphorothioate residues, and a standard (not blocked) 3' oligo. Alternatively, this wildtype probe sequence can be synthetically made and ordered.
2. Amplify the target region from the sample being analysed, using a normal (not blocked) 5' oligo and a 3' oligo blocked at the 5' end with 6 consecutive phosphorothioate residues. These primers should be homologous to the primers used for the amplification in Step 1.
3. (Optional) Concurrently, amplify the same samples using the alternate primer pairs. This will enable you to determine whether the mutation is homozygous or heterozygous, and if heterozygous, which strand it is on.
4. (Optional) Clean up the PCR reactions to remove enzyme, buffer, and
unincorporated primers. We used DNA Clean and Concentrator™-5 (Zymo Research).
5. Digest the PCR products in a 20μΙ reaction volume with T7 Exonuclease (NEB) in CutSmart® buffer, at 25°C for 2 hours. This will remove the unblocked strand of DNA, but leave the blocked strand intact.
6. (Optional) Use DNA Clean and Concentrator™-5 (Zymo Research) to purify the ssDNA, and determine the concentration using the Epoch Microplate
Spectrophotometer (Bio Tek Instruments), or similar.
7. Anneal, in a thermocycler, equal amounts of complementary ssDNA from the two samples, e.g. lOOng of each fragment in 20μΙ of lx CutSmart® buffer, annealed at 94°C 5min to 20°C at a rate of -0.1°C/s. 8. (Optional) Put aside a portion of the reaction to serve as a control, e.g. half of the 20μΙ reaction suggested above.
9. To the remaining portion add T7 Endonuclease I (NEB) and T7 Exonuclease
(NEB), e.g. 10U of each to the above suggested reaction .
10. Incubate at 37°C for 15min, then 25°C for 105min, in a thermocycler.
11. Electrophorese the digestions next to their undigested counterparts. Where the annealed sample has been digested away by Endonuclease and Exonuclease, and is not visible on the gel, the annealed WT and analysed sample DNA contained one or more heteroduplex sites. EXAMPLE 6
ENZYME MEDIATED PROFILING: ASSAY RESULTS
To show the applicability of the EMP method to genotyping, we first explored using this method on amplicons previously used for the Enzymatic HRM work (Examples 2-4) . This included the region of the Plasmodium falciparum genome associated with artemisinin resistance, as shown in Figure 21. The results in this example were achieved using DNA probes synthesised in-house, according to the full method outlined, and using the same sample DNAs located on an immortalised plasmid as in the Enzymatic HRM work, rather than a genomic Plasmodium falciparum sample.
Figure 3(a) shows the EMP methodology is able to selectively and completely degrade DNA that contains heteroduplex sites, in this case maintaining the DNA band representative of a wildtype and non-heteroduplex sample (Lane 5) while degrading the variant and heteroduplex-containing sample (Lane 6), measured relative to the starting DNA concentrations before EMP activity (Lane 2 for the wildtype and Lane 3 for the variant) . The amplicon is also shown to be approximately 1000 base pairs in length, relative to the DNA Ladder (Lane 1) and matching the expected amplicon size of 1074 base pairs.
Figure 3(a') shows the results in Figure 3(a) represented as a semi-quantitative trace. The signal generated from the intact DNA bands (Lanes 2, 3, and 5 in Figure 3(a)) is shown to be far greater than that of a degraded sample (Lane 6 in Figure 3(a)) or to background levels (Lane 4 in Figure 3(a)) .
Figure 3(b) again shows the EMP methodology is able to selectively and completely degrade DNA that contains heteroduplex sites. In this example however, through the selection of a different probe sequence, the variant sequence has been chosen to be protected by the EMP assay and the widtype sequence will be degraded . There is now no band representative of the wildtype and heteroduplex sample (Lane 5), while the variant and non-heteroduplex sample appears as a band (Lane 6), measured relative to the starting DNA concentrations before EMP activity (Lane 2 for the wildtype; Lane 3 for the variant) . The amplicon is again shown to be approximately 1000 base pairs in length, relative to the DNA Ladder (Lane 1) and matching the expected amplicon size of 1074 base pairs. This result illustrates that the EMP methodology is structure specific, selectively degrading heteroduplex-containing DNA molecules, rather than sequence specific.
Figure 3(b) shows the results in Figure 3(b) represented as a semi-quantitative trace. The signal generated from the intact DNA bands (Lanes 2, 3, and 6 in Figure 3(b)) is shown to be far greater than that of a degraded sample (Lane 5 in Figure 3(b)) or to background levels (Lane 4 in Figure 3(b)).
Figure 3(c) shows the EMP methodology is able to selectively and completely degrade DNA that contains heteroduplex sites, in this example with a second variant sequence (C580Y instead of the Y943H variant shown in Figures 3(a) and 3(b)). The EMP activity is shown to maintain the DNA band representative of a wildtype and non- heteroduplex sample (Lane 5) while degrading the variant and heteroduplex-containing sample (Lane 6), measured relative to the starting DNA concentrations before EMP activity (Lane 2 for the wildtype; Lane 3 for the variant). The amplicon is also shown to be approximately 1000 base pairs in length, relative to the DNA Ladder (Lane 1) and matching the expected amplicon size of 1074 base pairs. This result illustrates the EMP methodology is able to perform on a range of variant sequences, acting as a scanning genotypic method.
Figure 3(c') shows the results in Figure 3(c) represented as a semi-quantitative trace. The signal generated from the intact DNA bands (Lanes 2, 3, and 5 in Figure 3(c)) is shown to be far greater than that of a degraded sample (Lane 6 in Figure 3(c)) or to background levels (Lane 4 in Figure 3(c)).
Figure 3(d) again shows the EMP methodology is able to selectively and completely degrade DNA that contains heteroduplex sites, in this example with a second variant sequence (C580Y instead of the Y943H variant shown in Figure 3(a) and 3(b)). In this example, through the selection of a different probe sequence, the variant sequence has been chosen to be protected by the EMP assay and the widtype sequence will be degraded. There is now no band representative of the wildtype and heteroduplex sample (Lane 5), while the variant and non-heteroduplex sample appears as a band (Lane 6), measured relative to the starting DNA concentrations before EMP activity (Lane 2 for the wildtype; Lane 3 for the variant). The amplicon is again shown to be approximately 1000 base pairs in length, relative to the DNA Ladder (Lane 1) and matching the expected amplicon size of 1074 base pairs. This result further illustrates that the EMP methodology is structure specific, selectively degrading heteroduplex-containing DNA molecules, rather than sequence specific.
Figure 3(d') shows the results in Figure 3(d) represented as a semi-quantitative trace. The signal generated from the intact DNA bands (Lanes 2, 3, and 6 in Figure 3(d)) is shown to be far greater than that of a degraded sample (Lane 5 in Figure 3(d)) or to background levels (Lane 4 in Figure 3(d)). Figure 3(e) shows a summary of the results in the prime series of panels (Figures 3(a')-(d')), with a similar average singal between all homoduplex samples before EMP activity, all heteroduplex samples before EMP activity, and all homoduplex samples after EMP activity. Significantly, the average signal of all heteroduplex samples after EMP falls markedly, being approximately 1.4% that of the other average signals.
EXAMPLE 7
ENZYME MEDIATED PROFILING: MICROARRAYS (i) Microarray - Overview Introduction
DNA Microarrays (e.g. from Illumina and Affymetrix) have a long established genotyping use, able to determine the presence or absence of single polynucleotide polymorphisms (SNPs) and INDELS.
These traditional microarrays have limitations, namely the:
· reliance on prior knowledge of SNP identity
• subtle differentiation between positive and negative signals
• need for optimisation, especially of the hybridisation conditions
A fast, scalable microarray methodology that enables genotyping of both known and novel SNPs and small INDELs, signalled in a clear and unambiguous output, is therefore a highly desirable advancement in microarray-based diagnostics.
(ii) Microarray - Methods
The protocol for preparation of a hand-spotted array is based on the Schott Nexterion® Slide E protocol.
A single-stranded DNA probe was first synthesised, with an amino modifier group attached to the 5' end of the 129bp oligomer (SEQ ID NO: 70) through a C12 linker (Integrated DNA Technologies).
The probe was resuspended in lx Spotting buffer A (MWG) to a concentration of 20μΜ. As part of the serial dilution experiment, this was also diluted to 10μΜ and 5μΜ in spotting buffer. Following denaturation at 94°C for 3 min, Ιμί aliquots of the probe were pipetted onto a Nexterion® Slide E.
The slide was then incubated at room temperature in high humidity for 30 min, then left to dry at room temp under a petri dish lid for 2 hours to overnight. Unbound probe was removed with the following sequence of washes at room temperature:
lx5min in 0.1% Triton® X-100
2x2min in ImM HCI
lxlOmin in lOOmM KCI lxlmin in CIH2O
Immediately after the last rinse, the slide was incubated in lx aCGH Blocking Agent (Agilent), in a hybridisation chamber, at 50°C for 15-20 mins.
The slide was then rinsed lxlmin in dhhO, and dried in a stream of compressed air. The sample oligos (having the reverse complement of the probe, except in variant samples with sites of difference that will form heteroduplex sites) were resuspended in hybridisation buffer (5xSSC) to 2μΜ, denatured at 94°C for 3 min, and 0.5pL was spotted onto the positions where the probe was bound. A negative control was included with hybridisation buffer only being placed on two spots. Annealing was performed in a hybridisation chamber, at room temperature and for 2 hours.
Unbound target was removed with the following sequence of washes at room temperature:
lxlOmin in 2xSSC and 0.2% SDS
lxlOmin in 2xSSC
lxlOmin in 0.2xSSC
The slide is then rinsed with TE.
Immediately following this, digestion with T7 Endonuclease I (NEB) and T7 Exonuclease (NEB) in SureCut buffer (NEB) was performed under a coverslip in a hybridisation chamber at 35°C for 15 mins, and then for 105 min at room temperature.
The slide was then rinsed in TE and then 0.5pL of Quant-iT™ PicoGreen® dsDNA
Reagent (Invitrogen) in 50μΙ_ ΤΕ was applied to the slide under a coverslip, and incubated at room temperature for 5 min.
Microarrays were then imaged using the Genepix 4000B Instrument from Axon. (iii) Microarray - Overview Results
To prove the concept of applying the Enzyme Mediated Profiling method on a microarray, we first designed a hand-spotted array to genotype one of the target regions previously shown to be compatible with EMP. The Mycobacterium tuberculosis rpoB region associated with resistance to the antibiotic rifampicin was chosen. The array was prepared with spots comprised of a 129 base pair single-stranded DNA probe representing the wildtype sequence. This was used to assay sample DNA molecules of 41 base pairs in length. These samples included were of wildtype sequence and of the variant 516 ASP>VAL. The standard DNA microarray analysis protocol was modified to reduce the lengthy hybridisation step, and to include the enzymatic steps required and the subsequent washes.
This method was successful in differentiating between the analysed genotypes. Refer to Figure 4. The array spots expected to contain heteroduplex DNA (1 -3 and -3') before the exposure to EMP activity, now have a signal reduced to background levels after EMP. This background flourescence is approximately equal to that of array spots containing only single-stranded DNA (4 and 4').
Array spots of a wildtype sequence that are expected to not contain heteroduplex DNA (5-7 and 5'-7') before the exposure to EMP activity, have a far greater signal than background levels after EMP. This approaches a 10 fold increase in flourescence relative to that of the background.
A dilution series of probe DNA spots was included in this experiment, to show the concentration at which the signal from wildtype samples fell to that indistinguishable from that of background levels. Each of the probe concentrations assayed (0.5 - 2.0μΜ probe DNA spots) were able to rise above background levels (refer to Figs. 4d and 4e), with a linear increase in signal with increasing concentrations of the probe DNA spots.
***
Although the invention has been described by way of example, it should be appreciated that variations and modifications may be made without departing from the scope of the invention as defined in the claims. Furthermore, where known equivalents exist to specific features, such equivalents are incorporated as if specifically referred in this specification.
REFERENCES
1. Aguirre-Lamban, J. et al., 2010. Comparison of high-resolution melting analysis with denaturing high-performance liquid chromatography for mutation scanning in the ABCA4 gene. Investigative ophthalmology & visual science, 51(5), pp.2615-9. Available at: http://www.ncbL nlrn . nih .qov/pu breed/ 19959634
2. Andriantsoanirina, V. et al., 2009. Rapid detection of point mutations in Plasmodium falciparum genes associated with antimalarial drugs resistance by using High-Resolution Melting analysis. Journal of microbiological methods, 78(2), pp.165-70. Available at: http://www.ncbi.nirn.njh.gov/pubrned/19465064
3. Ariey, F. et al., 2014. A molecular marker of artemisinin-resistant Plasmodium falciparum malaria. Nature, 505(7481), pp.50-5. Available at: http : //www . ncbi . n i m . n i h . gov/pu bmed/24352242
4. Athamanolap, P. et al., 2014. Trainable high resolution melt curve machine learning classifier for large-scale reliable genotyping of sequence variants. PloS one, 9(9), p.el09094. Available at: http://www.pu bmedcentrai.nih.qov/articlere^
rez¾rendertvpe~abstract
5. Bi, L.-J. et al., 2005. Construction and characterization of different MutS fusion proteins as recognition elements of DNA chip for detection of DNA mutations. Biosensors & bioelectronics, 21(1), pp.135-44. Available at: http://wvvw.ncbi.nirn.nih.gov/pubrned/15967361
6. Biebricher, A.S. et al., 2015. The impact of DNA intercalators on DNA and DNA- processing enzymes elucidated through force-dependent binding kinetics. Nature communications, 6, p.7304. Available at: http ://www,pub edcentral. nih. qov/attiderender.fcqi?artid~45573628dooi~pmcent
Figure imgf000081_0001
7. Bisswanger, H., 2014. Enzyme assays. Perspectives in Science, 1(1-6), pp.41-55.
Ava i I a b I e at : h tt j j j n Q g h u b . ejseyj e
8. Borras, E. et al., 2011. Clinical pharmacogenomic testing of KRAS, BRAF and EGFR mutations by high resolution melting analysis and ultra-deep pyrosequencing. BMC cancer, 11(1), p.406. Available at: rez8trendertype~abstract
9. Cade, C.E. et al., 2010. Isoniazid-resistance conferring mutations in Mycobacterium tuberculosis KatG: catalase, peroxidase, and INH-NADH adduct formation activities.
Protein science : a publication of the Protein Society, 19(3), pp.458-74. Available at:
http ://www.pubmedcentral. nih. gov/articierender.fcgi?artid=2866272¾too! = prncent !:§ ^^D^§.fiy.R§.^sbstract.
10. Cao, W. et al., 2015. Automated Microfluidic Platform for Serial Polymerase Chain
Reaction and High-Resolution Melting Analysis. Journal of laboratory automation. Available at: http://www.ncbi.nim.nih.qov/pubmed/25827436
11. Chen, D. et al., 2014. High-resolution melting analysis for accurate detection of BRAF mutations: a systematic review and meta-analysis. Scientific reports, 4, p.4168. Available at: http: //www, pubmedcentrai. nih. qov/atticierender.fcqi?artid"3933866&tooi"pmcent 12. Crews, N . et al ., 2009. Spatial DNA melting analysis for genotyping and variant scanning. Analytical chemistry, 81 (6), pp.2053-8. Available at: http:// vvww. ncbi. nlm. nih .gov/pubmed/19228Q 12.
13. Daniels, R. et al ., 2012. Rapid, field-deployable method for genotyping and discovery of single-nucleotide polymorphisms associated with drug resistance in
Plasmodium falciparum. Antimicrobial agents and chemotherapy, 56(6), pp.2976- 86. Available at:
.htt .; /.^
rez&rendertype-abstract
14. Davidson, C.J. et al ., 2012. Improving the limit of detection for Sanger sequencing :
A comparison of methodologies for KRAS variant detection . BioTechniques, 2012.
Ava i I a b I e at : h ttg.; // w w . n do L nj .01, n]h.. py / g u.b m ed/ 23.083.368
15. Deng, H ., Shen, W. & Gao, Z., 2015. Colorimetric detection of single nucleotide polymorphisms in the presence of 103-fold excess of a wild-type gene. Biosensors & bioelectronics, 68, pp.310-5. Available at:
.b.ttp.;.//..^
16. Dirican, E. et al., 2014. Detection of PIK3CA Gene Mutations with HRM Analysis and Association with IGFBP-5 Expression Levels in Breast Cancer. Asian Pacific Journal of Cancer Prevention, 15(21), pp.9327-9333. Available at: htt£://koreascience.or.kr/jo^
^9327.
17. Do, H . & Dobrovic, A., 2009. Limited copy number - high resolution melting (LCN- HRM) enables the detection and identification by sequencing of low level mutations in cancer biopsies. Molecular Cancer, 8( 1), p.82. Available at: http:// w .molecular-cancer.corn/content/8/t/82
18. Dong, C, Vincent, K. & Sharp, P., 2009. Simultaneous mutation detection of three homoeologous genes in wheat by High Resolution Melting analysis and Mutation Surveyor. BMC plant biology, 9, p.143. Available at: http://www. pubmedcentraLnih.gov/3rticlerender.fcgi?3rtid-2794869¾ool- pmcent rez&rendertype-abstract
19. Dwight, Z. L. et al., 2014. Heterozygote PCR product melting curve prediction .
Human mutation, 35(3), pp.278-82. Available at: http://www. ricbi.nlm. nih .gQv/pubrned/24375593
20. Er, T.-K. & Chang, J.-G., 2012. High-resolution melting : applications in genetic disorders. Clinica chimica acta; international journal of clinical chemistry, 414, pp.197-201. Available at: http://www. ncbi.nirn. nih .qov/pubrneci/22995429
21. Fruman, D. a & Rommel, C, 2014. PI3K and ca ncer: lessons, challenges and opportunities. Nature reviews. Drug discovery, 13(2), pp.140-56. Available at: http : //ww . ncbi . n I m . n i h . gov/pu bmed/24481312
22. Gelaye, E. et al., 2013. Development of a cost-effective method for ca pripoxvirus genotyping using snapback primer and dsDNA intercalating dye. PloS one, 8(10), p.e75971. Available at: http ://www. pubmedcentraLnih.gov/articlerender.fcgi7artid -3792 lOO&tOQl- pmcent rez¾rendertype~abstract
23. Gerasimova, Y. V. & Kolpashchikov, D. M ., 2014. Enzyme-assisted target recycling
(EATR) for nucleic acid detection. Chemical Society Reviews, 43( 17), p.6405. Available at: hap://xiink.rsc.Qro/?DQI=C4CS00083H 24. Gerstein, M.O.T., 2002. ( 19 ) United States. , 1(19).
25. Hjelms0, M.H. et al., 2014. High-resolution melt analysis for rapid comparison of bacterial community compositions. Applied and environmental microbiology, 80(12), pp.3568-75. Available at: tB .//wA w. .ubmedce
rez&rendertype-abstract
26. Hofmann, N. et al., 2015. Ultra-sensitive detection of Plasmodium falciparum by amplification of multi-copy subtelomeric targets. PLoS medicine, 12(3), p.el001788. Available at: http://vvww,pubmedcentraLnih.qov/articlerender.fcqi?3rtid-434Si98&too mcent rez&rendertype=abstract
27. Huang, M.C. et al., 2012. A simple, high sensitivity mutation screening using Ampligase mediated T7 endonuclease I and Surveyor nuclease with microfluidic capillary electrophoresis. Electrophoresis, 33(5), pp.788-96. Available at: http : //www, ncbi . n 1 m . n i h . qov/pu bmed/22437793
28. Jani, I. V et al., 2014. Accurate early infant HIV diagnosis in primary health clinics using a point-of-care nucleic acid test. Journal of acquired immune deficiency syndromes (1999), 67(1), pp.el-4. Available at: http://wvvw.ncbi.nirn.nih.gov/pubmed/24933Q96.
29. Kipanga, P.N. et al., 2014. High-resolution melting analysis reveals low Plasmodium parasitaemia infections among microscopically negative febrile patients in western Kenya. Malaria journal, 13(1), p.429. Available at: http://vvww.pubmedcentraLnih.qov/articl8rend8r.fcqi?3rtid"4246433&tool"pmcent
Figure imgf000083_0001
30. Knopkiewicz, M., Gawtowska, M. & Swie.cicki, W., 2014. The Application of High
Resolution Melting in the Analysis of Simple Sequence Repeat and Single Nucleotide Polymorphism Markers in a Pea ( Pisum sativum L . ) Population. Czech J. Genet. Plant Breed, 2014(2), pp.151-156.
31. Li, ]. et al., 2007. s-RT-MELT for rapid mutation scanning using enzymatic selection and real time DNA-melting : new potential for multiplex genetic analysis. Nucleic acids research, 35(12), p.e84. Available at: http://wvvw.pubmedcentral .nih.gov/articierender.fcq j?artid = 1919510&tooi = pmcent rez&rendertype-Bbstract
32. Li, K. et al., 2014. Melting analysis on microbeads in rapid temperature-gradient inside microchannels for single nucleotide polymorphisms detection a ).
Biomicrofluidics, 064109, pp.1-14.
33. Li, M. et al., 2014. Genotyping Accuracy of High-Resolution DNA Melting Instruments. Clinical Chemistry, 60(6), pp.864-872. Available at: http://www.clirichern.Qrg/cgi/doi/10.1373/ciinchern.2013.220160
34. Liu, L. et al., 2013. A DNA machine for sensitive and homogeneous DNA detection via lambda exonuclease assisted amplification. Talanta, 115, pp.819-22. Available at: Mt&;/ w Yw^^
35. Liu, Y. et al., 2013. Enhancing the selectivity of enzyme detection by using tailor- made nanoparticles. Analytical chemistry, 85(10), pp.4853-7. Available at: http://www.ncbi.nlm.nih.qov/pubmed/23654i99. 36. Nemcova, E. et al., 2015. Rapid identification of medically important Candida isolates using high resolution melting analysis. PloS one, 10(2), p.e0116940. Available at: http://www.pubmedcentral.nih.gov/articlerender.fcgi?
37. artid=4331273&tool = pmcentrez&rendertype=abstract
38. Radvanszky, 3. et al., 2015. Comparison of different DNA binding fluorescent dyes for applications of high-resolution melting analysis. Clinical biochemistry, 48(9), pp.609-16. Available at: ηίΐρι //www, ncbi.nim.nih.gov/pubrned/25641335
39. Reed, G.H. & Wittwer, C.T., 2004. Sensitivity and specificity of single-nucleotide polymorphism scanning by high-resolution melting analysis. Clinical chemistry, 50(10), pp.1748-54. Available at:
Figure imgf000084_0001
40. Rieber, N. et al., 2013. Coverage bias and sensitivity of variant calling for four whole-genome sequencing technologies. PloS one, 8(6), p.e66621. Available at: http://www.pubmedcerttral .nih.qov/articiererider.fcqi?articS-3679043¾.tooS-prricerit [g.?¾reD.dertyoe~ab.s ract
41. Schulze, H. et al., 2012. Enzymatic on-chip enhancement for high resolution genotyping DNA microarrays. Analytical chemistry, 84(11), pp.5080-4. Available at: http://www.ncbi, rilm.nih.gov/pubmed/225485Q4.
42. Smith, B.L., Lu, C.-P. & Alvarado Bremer, 3.R., 2010. High-resolution melting analysis (HRMA) : a highly sensitive inexpensive genotyping alternative for population studies. Molecular ecology resources, 10(1), pp.193-6. Available at: http://www.ncbi.nim.nih.qov/pubmed/21565009
43. Stefanska, B. et al., 2013. Discovery and validation of DNA hypomethylation biomarkers for liver cancer using HRM-specific probes. PloS one, 8(8), p.e68439. Available at: http:/7vvww,pubmedcentrai,nih,qov/3rticlerender.fcqi?artid"3737236&tooi"pmcent rez&rendertype=abstract
44. Tanner, N. a, Zhang, Y. & Evans, T.C., 2015. Visual detection of isothermal nucleic acid amplification using pH-sensitive dyes. BioTechniques, 58(2), pp.59-68. Available at: http : //www. ncbi . n!m . rtih .qov/pu bmed/25652028
45. Thomsen, N. et al., 2012. High resolution melt analysis (HRMA); a viable alternative to agarose gel electrophoresis for mouse genotyping. PloS one, 7(9), p.e45252. Available at: http:/7www.pubmedcentraLnih.gov/articierender.fcgi?artid~3446988&toQi~pmcent rez&rendertype=abstract
46. Tong, S.Y.C. & Giffard, P.M., 2012. Microbiological Applications of High-Resolution
Melting Analysis. Journal of Clinical Microbiology, 50(11), pp.3418-3421. Available at: http://jcm.asm.org/cgi/doi/10.1 28/3CM.01709-12
47. Tsuji, T. & Niida, Y., 2008. Development of a simple and highly sensitive mutation screening system by enzyme mismatch cleavage with optimized conditions for standard laboratories. Electrophoresis, 29(7), pp.1473-1483. Available at: http://doi.wiieY.com/IQ, lQQ2/eips, 200700729
48. Ullrich, T. et al., 2012. Competitive reporter monitored amplification (CMA) - quantification of molecular targets by real time monitoring of competitive reporter hybridization. PloS one, 7(4), p.e35438. Available at: ht p:,'7www.pubrnedcentral.riih.qov/arlicierender.fcqi?artid -3335129&tooi-prncerit rezStrendertype-abstract 49. Venables, S.J. et al., 2014. Assessment of high resolution melting analysis as a potential SNP genotyping technique in forensic casework. Electrophoresis, 35(21- 22), pp.3036-43. Available at: http://www.ncbi.njrn.riih.gov/pubmed/251422Q5
50. Vouillot, L, Thelie, A. & Poller., N., 2015. Comparison of T7E1 and Surveyor Mismatch Cleavage Assays To Detect Mutations Triggered by Engineered Nucleases.
G3 (Bethesda, Md.), 33(0). Available at: http://www.ncbLnirn.nih.qov/pubrned/25566793
51. Wu, T. et al., 2015. Enzyme-mediated single-nucleotide variation detection at room temperature with high discrimination factor. Chem. Sci., 6(2), pp.1206-1211. Available at: http://'xiink.rsc.orq/?DOI^C4SC03375B
52. Xiang, D. et al., 2014. Highly sensitive fluorescence quantitative detection of specific DNA sequences with molecular beacons and nucleic acid dye SYBR Green I. Talanta, 129, pp.249-53. Available at: h p: //www. ncbi.nirn.nih.gQv/pubmed/25i 27591
53. Xiao, X. et al., 2012. A universal mismatch -directed signal amplification platform for ultra-selective and sensitive DNA detection under mild isothermal conditions.
Chemical Science, 3(7), p.2257. Available at: http : //xi i nk.rsc.org/7DQI - c2sc20189e
54. Xiao, X., Xu, A., et al., 2013. Combination of a modified block PCR and endonuclease IV-based signal amplification system for ultra-sensitive detection of low-abundance point mutations. Methods, 64(3), pp.255-259. Available at: http: //I in kinqhub.eisevier.coro/retrieve/pii/S 1046202313002430
55. Xiao, X., Liu, Y. & Zhao, M., 2013. Endonuclease IV discriminates mismatches next to the apurinic/apyrimidinic site in DNA strands: constructing DNA sensing platforms with extremely high selectivity. Chemical communications (Cambridge,
England), 49(27), pp.2819-21. Available at: http://wvvw.ncbi.nim.nih.gov/pubmed/23443241
56. Yang, M. et al., 2014. Limitation of high-resolution melting curve analysis for genotyping simple sequence repeats in sheep. Genetics and molecular research : GMR, 13(2), pp.2645-53. Available at: http://www.ncbi.nirn.nih.qov/pubmed/24782053.
57. Zhang, Y. et al., 2013. Ultrasensitive single-nucleotide polymorphism detection using target-recycled ligation, strand displacement and enzymatic amplification. Nanoscale, 5(11), pp.5027-35. Available at: http : //www, ncbi . n i m . n i h . gov/pu bmed/23636707

Claims

1. An assay method for identifying genetic variation in a nucleic acid sample, the method comprising the steps of:
(i) generating a test nucleic acid sequence to be tested for the genetic variation, wherein the test nucleic acid sequence is resistant to 5'- exonuclease activity;
(ii) generating a control nucleic acid sequence which does not have the genetic variation, wherein the control nucleic acid sequence is resistant to 5'-exonuclease activity;
(iii) in a test mixture, mixing the test nucleic acid sequence and the control nucleic acid sequence for a time and under conditions that allow formation of homoduplex and/or heteroduplex nucleic acids; and
(iv) adding to the test mixture a nucleic acid-specific endonuclease and a nucleic acid-specific 5'-exonuclease for a time and under conditions that allow activity on the nucleic acid sequences; wherein, genetic variation in the test nucleic acid is identified where there is no detectable amount of nucleic acid present in the test mixture above a threshold minimum.
2. A method according to claim 1, wherein the test or control nucleic acid sequence is generated using an amplification technique in the presence of a primer that is resistant to 5'-exonuclease activity or is generated by chemical synthesis incorporating a moiety that is resistant to 5'-exonuclease activity.
3. A method according to claim 1 or claim 2, wherein the nucleic acid-specific endonuclease and the nucleic acid-specific 5'-exonuclease are added to the test mixture simultaneously or sequentially.
4. A method according to any one of claims 1 to 3 wherein the nucleic acid specific 5'-exonuclease degrades any nucleic acid sequence that is sensitive to 5' exonuclease activity.
5. A method according to any one of claims 1 to 4 wherein the nucleic acid- specific endonuclease cleaves any nucleic acid that is sensitive to the nucleic acid-specific endonuclease activity.
6. A method according to claim 5, wherein the nucleic acid that is sensitive to the nucleic acid-specific endonuclease activity is a nucleic acid sequence comprising a heteroduplex.
7. A method according to any one of claims 1 to 6, wherein the assay method is configured to be performed on a surface including a microarray platform.
8. A method according to any one of claims 1 to 7, wherein the control nucleic acid sequence is a synthetic probe.
9. A method according to any one of claims 1 to 8, wherein the nucleic acid- specific endonuclease is T7 Endonuclease I.
10. A method according to any one of claims 1 to 9, wherein the nucleic acid- specific 5'-exonuclease is T7 Exonuclease.
11. A method according to any one of claims 1 to 10, wherein resistance to the nucleic acid-specific 5'-exonuclease activity is conferred by chemical modification including phosphorothioate modification.
12. A method according to any one of claims 1 to 11, wherein the test nucleic acid sequence is derived from a source selected from the group consisting of bacteria, virus, fungi, yeast, other unicellular eukaryote, plant, animal, human and synthetic source.
13. A method according to any one of claims 1 to 12, wherein the genetic variation in the test nucleic acid sample may be correlated with a disease trait.
14. A method according to claim 13, wherein the disease trait is selected from tuberculosis including multi-drug resistance (MDR) tuberculosis and extensively drug resistant (XDR) tuberculosis, malaria and cancer.
15. A test kit comprising reagents and instructions for use in performing an assay method according to any one of claims 1 to 14.
PCT/NZ2017/050023 2016-03-08 2017-03-08 Genotyping method WO2017155416A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201662305319P 2016-03-08 2016-03-08
US62/305,319 2016-03-08

Publications (1)

Publication Number Publication Date
WO2017155416A1 true WO2017155416A1 (en) 2017-09-14

Family

ID=59790750

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/NZ2017/050023 WO2017155416A1 (en) 2016-03-08 2017-03-08 Genotyping method

Country Status (1)

Country Link
WO (1) WO2017155416A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111065747A (en) * 2018-02-06 2020-04-24 株式会社金希科 Kit for separating mutant cell-free gene and method for separating mutant cell-free gene using same

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5376526A (en) * 1992-05-06 1994-12-27 The Board Of Trustees Of The Leland Stanford Junior University Genomic mismatch scanning
WO2000046402A1 (en) * 1999-02-05 2000-08-10 Amersham Pharmacia Biotech Uk Limited Genomic analysis method
FR2920159A1 (en) * 2007-08-20 2009-02-27 Serial Genetics Sas Soc Par Ac Identifying, analyzing and/or quantifying alleles of polymorphisms in nucleic acid sample, comprises amplifying double strand of nucleic acid sequence, eliminating heteroduplexes, hybridizing products, and determining and comparing signal
WO2011102802A1 (en) * 2010-02-18 2011-08-25 Agency For Science, Technology And Research Method for reducing mismatches in double-stranded dna molecules

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5376526A (en) * 1992-05-06 1994-12-27 The Board Of Trustees Of The Leland Stanford Junior University Genomic mismatch scanning
WO2000046402A1 (en) * 1999-02-05 2000-08-10 Amersham Pharmacia Biotech Uk Limited Genomic analysis method
FR2920159A1 (en) * 2007-08-20 2009-02-27 Serial Genetics Sas Soc Par Ac Identifying, analyzing and/or quantifying alleles of polymorphisms in nucleic acid sample, comprises amplifying double strand of nucleic acid sequence, eliminating heteroduplexes, hybridizing products, and determining and comparing signal
WO2011102802A1 (en) * 2010-02-18 2011-08-25 Agency For Science, Technology And Research Method for reducing mismatches in double-stranded dna molecules

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
QIU, P. ET AL.: "Mutation detection using Surveyor? nuclease", BIOTECHNIQUES, vol. 36, 2004, pages 702 - 707, XP008090053 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111065747A (en) * 2018-02-06 2020-04-24 株式会社金希科 Kit for separating mutant cell-free gene and method for separating mutant cell-free gene using same
JP2020534863A (en) * 2018-02-06 2020-12-03 ジェネッカー カンパニー リミテッド Mutant cell free gene separation kit and mutant cell free gene separation method using it
EP3653730A4 (en) * 2018-02-06 2021-04-07 Genecker Co., Ltd Mutant cell-free dna isolation kit and mutant cell-free dna isolation method using same
JP7006873B2 (en) 2018-02-06 2022-02-10 ジェネッカー カンパニー リミテッド Mutant cell free gene separation kit and mutant cell free gene separation method using it
CN111065747B (en) * 2018-02-06 2023-10-31 株式会社金希科 Mutant cell episome separation kit and mutant cell episome separation method using same

Similar Documents

Publication Publication Date Title
JP6698708B2 (en) Methods, systems, compositions, kits, devices, and computer-readable media for molecular tagging
EP3172321B2 (en) Polynucleotide enrichment using crispr-cas systems
US9932576B2 (en) Methods for targeted genomic analysis
WO2017087555A1 (en) Method for controlled dna fragmentation
CN110719957B (en) Methods and kits for targeted enrichment of nucleic acids
KR102592367B1 (en) Systems and methods for clonal replication and amplification of nucleic acid molecules for genomic and therapeutic applications
JP2008538496A (en) Method for determining sequence variants using ultra-deep sequencing
JP6767870B2 (en) Error-free DNA sequencing
WO2015178978A2 (en) Strand exchange hairpin primers that give high allelic discrimination
JP2009511042A (en) Nucleic acid isothermal amplification method and nucleic acid detection method using simultaneous isothermal amplification of nucleic acid and signal probe
JP2017501737A (en) Nucleic acid detection method using asymmetric isothermal amplification of nucleic acid and signal probe
JP2015516814A (en) Enrichment and sequencing of targeted DNA
JP2016520330A (en) Improved NGS workflow
JP6007652B2 (en) Primers and probes for detecting methicillin-resistant Staphylococcus aureus, and methods for detecting methicillin-resistant Staphylococcus aureus using them
US20230374574A1 (en) Compositions and methods for highly sensitive detection of target sequences in multiplex reactions
EP3155130A2 (en) Improved ngs workflow
US11174511B2 (en) Methods and compositions for selecting and amplifying DNA targets in a single reaction mixture
WO2017155416A1 (en) Genotyping method
EP4074840A1 (en) Pcr method and pcr kit for increasing allelic discrimination
US20210115503A1 (en) Nucleic acid capture method
WO2003097828A1 (en) Method of identifying nucleic acid
JP7335871B2 (en) Multiplex detection of short nucleic acids
KR101136008B1 (en) A ligase-based SNP analysis method using oxanine base-containing ligation fragment and a system for analyzing SNP comprising the fragment
KR102237248B1 (en) SNP marker set for individual identification and population genetic analysis of Pinus densiflora and their use
Liu et al. A-Star, an Argonaute-directed System for Rare SNV Enrichment and Detection

Legal Events

Date Code Title Description
NENP Non-entry into the national phase

Ref country code: DE

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17763639

Country of ref document: EP

Kind code of ref document: A1

122 Ep: pct application non-entry in european phase

Ref document number: 17763639

Country of ref document: EP

Kind code of ref document: A1