WO2017153606A1 - Nucleic acid constructs and vectors for oncoselective expression of a transgene - Google Patents
Nucleic acid constructs and vectors for oncoselective expression of a transgene Download PDFInfo
- Publication number
- WO2017153606A1 WO2017153606A1 PCT/EP2017/055836 EP2017055836W WO2017153606A1 WO 2017153606 A1 WO2017153606 A1 WO 2017153606A1 EP 2017055836 W EP2017055836 W EP 2017055836W WO 2017153606 A1 WO2017153606 A1 WO 2017153606A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nucleic acid
- vector
- acid construct
- cell
- polynucleotide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/66—Microorganisms or materials therefrom
- A61K35/76—Viruses; Subviral particles; Bacteriophages
- A61K35/761—Adenovirus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/10011—Adenoviridae
- C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
- C12N2710/10332—Use of virus as therapeutic agent, other than vaccine, e.g. as cytolytic agent
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/10011—Adenoviridae
- C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
- C12N2710/10341—Use of virus, viral particle or viral elements as a vector
- C12N2710/10343—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/10011—Adenoviridae
- C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
- C12N2710/10341—Use of virus, viral particle or viral elements as a vector
- C12N2710/10345—Special targeting system for viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/24—Vectors characterised by the absence of particular element, e.g. selectable marker, viral origin of replication
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2840/00—Vectors comprising a special translation-regulating system
- C12N2840/007—Vectors comprising a special translation-regulating system cell or tissue specific
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2840/00—Vectors comprising a special translation-regulating system
- C12N2840/10—Vectors comprising a special translation-regulating system regulates levels of translation
- C12N2840/102—Vectors comprising a special translation-regulating system regulates levels of translation inhibiting translation
Definitions
- the invention relates to the field of nucleic acid constructs for the selective expression of a gene in a tumor cell.
- transgene and viral protein expression is required to increase the safety and efficacy of gene and viral therapies. Delivery and expression of transgenes with anti-cancer activity or the use of conditionally replicating viruses for cancer therapy must be specific for tumors to avoid side effects on healthy tissues. Most efforts to achieve such selective control have been based on the use of tumor- specific promoters and more recently by the engineering of target sites recognizing tissue- specific miRNA. Although both strategies highly contribute to tumor selectivity, it is becoming evident that the post-transcriptional regulation of specific mRNA subpopulations contributes substantially to the broad expression changes of genes responsible for the cancer phenotype. Thus, the translational reprogramming of tumor cells has been proposed as a potential target for tumor specific drugs. These tumor specific translational profiles could, therefore, be used to generate tumor specificity to transgene and viral protein expression.
- the inventors of the present invention have developed a system for the selective expression of a transgene in tumor cells using the tumor reprogramming of CPE- mediated translational regulation.
- the inventors have engineered a particular CPE arrangement that activates translation in tumor cells while promotes translational repression in non-transformed cells ( Figure 1).
- the inventors have generated a modified adenovirus where the expression of the El A protein is regulated by CPEBs to obtain oncoselectivity and attenuated toxicity in non-transformed tissues ( Figure 2).
- This novel targeting modality increases the therapeutic index of oncolytic adenovirus and provides a new paradigm for its applicability to gene-transfer based therapeutic approaches.
- polynucleotides generated in the present invention also show extensive stability along successive replication cycles (as shown in figure 9). This extreme stability, which was also unexpected, is also advantageous as it overcomes the limitations of other methods known in the art for tissue-specific expression of target genes using viruses, such as those methods based on tissue-specific destabilization of viral genomes by miRNA target insertion as these methods often accumulate errors over successive replication cycles and generate escape mutants
- the invention relates to a nucleic acid construct comprising i. a polynucleotide of interest and
- an untranslated sequence in 3' position with respect to the polynucleotide of interest wherein said untranslated sequence is heterologous with respect to the polynucleotide of interest and wherein said untranslated region a. comprises at least two cytoplasmic polyadenylation elements which are separated by less than 50 nucleotides,
- b. comprises a cytoplasmic polyadenylation signal which is separated by less than 100 nucleotides from the first or second cytoplasmic polyadenylation element and
- c. does not include an adenylate-uridylate-rich element, wherein the polynucleotide of interest is not a gene encoding the protein luciferin-4-monooxygenase from Photinus pyralis or a gene encoding a fluorescent protein.
- the invention in a second aspect, relates to a vector comprising the nucleic acid construct according to the first aspect.
- the invention relates to a viral particle comprising a lentiviral vector or an adenoviral vector according to the second aspect.
- the invention relates to an in vitro method for inducing selective expression of a polynucleotide of interest in a tumor cell comprising
- the tumor cell i. contacting the tumor cell with the nucleic acid construct according to the first aspect, the vector according to the second aspect or the viral particle according to the third aspect under suitable conditions for the entry of the nucleic acid construct, vector or viral particle into the tumor cell and ii. maintaining the tumor cell under conditions suitable for the expression of the polynucleotide of interest.
- the invention relates to the nucleic acid construct according to the first aspect, the vector according to the second aspect or the viral particle according to the third aspect for use in medicine.
- the invention relates to the nucleic acid construct according to the first aspect, the vector according to the second aspect or the viral particle according to the third aspect for use in the treatment of cancer.
- FIG. 1 CPEs containing 3'-UTR confer in vitro oncoselectivity to engineered transgenes.
- the upper panel shows representative western blots showing CPEB1 and CPEB4 expression in pancreatic primary fibroblasts, normal cells (HPDE) and tumor cells (RWP-1, MIA PaCa-2 and PANC-1).
- the lower panel shows quantification of CPEB1 and CPEB4 signals normalized to GAPDH.
- FIG. 1 (a) Experimental workflow of the d2EGFP/dRFP expression analysis from the different 3 * UTRs in HPDE, RWP-1, PANC-1 and MIA PaCa-2 cells, (b) cBl 3 * UTR reduces d2EGFP mRNA in HPDE cells but not in tumoral cells. Quantification of relative d2EGFP/dRFP mRNA levels in the indicated cell lines transduced with the indicated lentiviruses and relative to the mRNA content of d2EGFP/dRFP from Lv-WT 3'UTR transduced cells. Data is shown as mean ⁇ SEM of three independent experiments, * p ⁇ 0.05.
- Adwt C- and AdCPE C- correspond to an RNA mix from non-infected cells amplified with specific primers for Adwt and AdCPE, respectively,
- qPCR Data is shown as mean ⁇ SEM of five independent experiments. ** P ⁇ 0.01 and *** P ⁇ 0.001.
- IC50 Half-growth inhibitory concentration
- FIG. 4 CPEB4 regulates AdCPE E1A expression and viral fitness,
- (b) Representative western blot of El A expression in RWP-1 shNT and RWP-1 sh4, infected with Adwt and AdCPE 72 h PI. Quantification of the El A signal was normalized to GAPDH and expressed as relative values of AdCPE/Adwt (n 4). * ⁇ 0.05.
- the left panel shows a representative western blot of the E1A protein in non-tumor HPDE cells transduced with a lentivirus expressing CPEB4 (Lv-CPEB4) or a control lentivirus (Lv-empty) and infected with Adwt or AdCPE. E1A content was evaluated 72 h PI.
- *** p ⁇ 0.001 Tukey contrast test on the lineal mixed model fitted by REML).
- AdCPE replication is attenuated in mouse tissue and displays reduced toxicity.
- Adwt and AdCPE were intravenously delivered to wild-type C57BL/6 mice at
- FIG. 8 AdCPE replication is attenuated in primary human hepatocytes.
- (a) Representative western blot of human hepatocytes infected with Adwt or AdCPE at 72 h PI. El A signal has been normalized to GAPDH and expressed relative to Adwt values. (n 5). *p ⁇ 0.05.
- FIG. 1 CPE elements in the El A 3'UTR of AdCPE remain stable after 20 consecutive viral replicative cycles. Sanger sequencing representation and sequence alignment of the El A 3'UTR of AdCPE, between the purified virus and AdCPE isolated after 20 consecutive replicative cycles in HPDE (H) and RWP-1 (R) cells.
- FIG. 10 AdDUC dual ElA-regulated virus with the uPAR promoter and the CPE elements display an oncoselective additive effect. qPCR quantification of viral particles in the supernatant of tumoral RWP-1 and non-tumoral HPDE cells at 72 h PI. Data is shown as mean ⁇ SEM of five independent biological replicates. ** p ⁇ 0.01 (one sample t-test).
- the invention in a first aspect, relates to a nucleic acid construct comprising i. a polynucleotide of interest and ii. an untranslated sequence in 3' position with respect to the polynucleotide of interest, wherein said untranslated sequence is heterologous with respect to the polynucleotide of interest and wherein said untranslated region a. comprises at least two cytoplasmic polyadenylation elements which are separated by less than 50 nucleotides,
- b. comprises a cytoplasmic polyadenylation signal which is separated by less than 100 nucleotides from the first or second cytoplasmic polyadenylation element and
- c. does not include an adenylate-uridylate-rich element, wherein the polynucleotide of interest is not a gene encoding the protein luciferin-4-monooxygenase from Photinus pyralis or a gene encoding a fluorescent protein.
- nucleic acid construct refers to a man-made nucleic acid molecule resulting from the use of recombinant DNA technology.
- a nucleic acid construct is a nucleic acid molecule, either single- or double-stranded, which has been modified to contain segments of nucleic acids, which are combined and juxtaposed in a manner, which would not otherwise exist in nature.
- a nucleic acid construct usually is a "vector", i.e. a nucleic acid molecule which is used to deliver exogenously created DNA into a host cell.
- untranslated sequence in 3' position with respect to the polynucleotide of interest refers to an untranslated region which appears after the stop codon.
- heterologous with respect to the polynucleotide of interest means that the 3'UTR sequence is not naturally found in association with said polynucleotide.
- the 3'UTR of the nucleic acid construct of the first aspect is the 3'UTR of the nucleic acid construct of the first aspect:
- a. comprises at least two cytoplasmic polyadenylation elements which are separated by less than 50 nucleotides
- b. comprises a citoplasmic polyadenylation signal which is separated by less than 100 nucleotides from the second cytoplasmic polyadenylation element and
- CPE cytoplasmic polyadenylation element
- CPE cytoplasmic polyadenylation element
- CPE refers to a sequence which is found in the 3'UTR of messenger RNAs. CPEs usually have the sequence 5'-UUUUAi_ 2 U-3' (also called consensus sequence), although other variants are possible, for example, non-consensus sequences: UUUUACU, UUUCAU and UUUUCCU.
- CPE are bound by CPE binding proteins (CPEBs), which promotes the extension of the existing polyadenylation tail and, in general, the translation of the mRNA.
- CPEBs CPE binding proteins
- the first CPE has the consensus sequence 5'- UUUUAi_ 2 U-3' when the nucleic acid construct is an RNA molecule.
- the CPE comprises a sequence which, when transcribed, results in the above sequence.
- the second CPE has the consensus sequence 5'- UUUUAi_ 2 U-3' when the nucleic acid construct is an RNA molecule.
- the CPE comprises the sequence which, when transcribed, results in the above sequence.
- the first and second CPE has the consensus sequences 5'-UUUUAi_ 2 U-3' when the nucleic acid construct is a RNA molecule.
- the CPE comprises the sequence which, when transcribed, results in the above sequence.
- the first CPE has the consensus sequence 5'- UUUUUAA-3 * .
- the second CPE has the consensus sequence 5 * -UUUUAAU-3 * .
- the first CPE has the consensus sequence 5'-UUUUUAA-3' and the second CPE has the consensus sequence 5'- UUUUAAU-3' when the nucleic acid construct is a RNA molecule or, when the nucleic acid construct is a DNA molecule, a sequence that, when transcribed, results in the above sequence.
- the 3'UTR of the polynucleotide of the invention further comprises a third CPE.
- the third CPE has a non-consensus sequence.
- the third CPE has the non-consensus sequence 5'-UUUUACU-3' when the nucleic acid construct is a R A molecule or, when the nucleic acid construct is a DNA molecule, a sequence that, when transcribed, results in the above sequence.
- the third CPE is located in a 3' position with respect to the first CPE but in a 5' position with respect to the cytoplasmic polyadenylation signal. In another particular embodiment, the third CPE is located in a 5' position with respect to the first CPE and to the cytoplasmic polyadenylation signal. In another particular embodiment, the third CPE is located between the first and second CPE and in a 3' position with respect to the cytoplasmic polyadenylation signal.
- the first CPE has the consensus sequence 5'-
- the second CPE has the consensus sequence 5'-UUUUAAU-3' and the 3'UTR further comprises a third CPE with the non-consensus sequence 5'-UUUUACU- 3' when the nucleic acid construct is a RNA molecule or, when the nucleic acid construct is a DNA molecule, a sequence that, when transcribed, results in the above sequence.
- nucleic acid construct When the nucleic acid construct is a RNA molecule, said nucleic acid construct further comprises a polyadenine tail.
- the 3'UTR of the nucleic acid construct of the first aspect comprises a cytoplasmic polyadenylation signal which is separated by less than 100 nucleotides from the second CPE.
- cytoplasmic polyadenylation signal refers to a nucleic acid sequence which is present in the 3'UTR of mRNA and promotes the cytoplasmic polyadenlylation of the mRNA.
- the cytoplasmic polyadenylation signal is the hexanucleotide AAUAAA.
- the expression "separated by less than 100 nucleotides from the first or second CPE” means that the number of nucleotides between the last nucleotide of the first or second CPE and the first nucleotide of the cytoplasmic polyadenylation signal is less than 100 nucleotides. In a particular embodiment, the number of nucleotides between the first or second CPE and the cytoplasmic polyadenylation signal is less than 90, less than 80, less than 70, less than 60, less than 50, less than 40, less than 30, less than 20, less than 10, less than 5 nucleotides. In a more particular embodiment, the distance between the first or second CPE and the cytoplasmic polyadenylation signal is 25 nucleotides. In particular embodiment, there is no nucleotide between the second CPE and the cytoplasmic polyadenylation signal. In another particular embodiment, the second CPE and the cytoplasmic polyadenylation signal partially overlap.
- the cytoplasmic polyadenylation signal is located in a 3' position with respect to the first and second CPE.
- the second cytoplasmic polyadenylation element can overlap with the cytoplasmic polyadenylation signal.
- the second CPE overlaps at least one, at least 2, at least 3, at least 4, at least 5, or at least 6 nucleotides with the cytoplasmic polyadenylation signal.
- the cytoplasmic polyadenlylation signal is located in a 3' position with respect to the third CPE.
- the 3'UTR of the nucleic acid construct of the first aspect does not include an adenylate-urydilate-rich element.
- adenylate-uridyl ate-rich element or "AU- rich element” or "ARE”, as used herein, refers to a nucleic acid sequence found in the 3' UTR regions of many messenger RNAs which is rich in adenine and uridine bases and which opposes CPE-mediated polyadenylation. AREs can be divided in three classes:
- Class I AREs have a core sequence of AUUUA within or near uridine rich regions.
- Example of class I AREs is the ARE of the c-fos gene.
- Class II AREs have overlapping AUUUA motifs within or near uridine rich regions.
- Example of class II AREs is the ARE of the GM-CSF gene.
- Class III AREs have uridine rich regions but no AUUUA motifs.
- Example of class III AREs is the ARE of the c-jun gene.
- the AU-rich element is not 5' with respect to the first CPE. In another embodiment, the AU-rich element is not between the first and second CPE. In another embodiment, the AU-rich element is not between the second CPE and the cytoplasmic polyadenylation signal. In another element, the AU-rich element is not 3' with respect to the cytoplasmic polyadenylation signal.
- the 3'UTR of the nucleic acid construct of the first aspect does not include the ARE of the 3'UTR from the TNF-a gene.
- the 3'UTR of the nucleic acid construct of the firs aspect does not include the ARE of the 3'UTR of the tissue plasminogen activator (tPA).
- the 3'UTR of the nucleic acid construct of the invention comprises, from 5' to 3': a first CPE, a third CPE, a second CEP and a cytoplasmic polyadenylation signal.
- the 3'UTR of the nucleic acid construct of the invention has the nucleotide sequence of SEQ ID NO: 1 when said nucleic acid is a RNA molecule or, if the nucleic acid construct is a DNA molecule, a sequence that, once transcribed, results in SEQ ID NO: 1, or a functionally equivalent variant thereof.
- the term "functionally equivalent variant”, as used herein, refers to a nucleic acid sequence which derives from the sequence of SEQ ID NO: 1 by insertion, deletion or substitution of one or more nucleotides and which substantially preserves the functional activity of the original sequence.
- Suitable variants encompassed within the present invention include those nucleic acid sequences showing at least 99%, at least 98%>, at least 97%, at least 96%, at least 95%, at least 94%, at least 93%, at least 92%, at least 92%, at least 91%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 65%o, at least 60%> or less identity with the sequence of SEQ ID NO: 1.
- Suitable methods for determining the identity of two nucleic acid sequences are known by the skilled person, for example those methods that use computer algorithms well known to persons having ordinary skill in the art. Such algorithms include Align or the BLAST algorithm (see, e.g., Altschul, J. Mol. Biol.
- nucleic acid sequences which are capable of promoting both translational repression by unphosphorylated CPEBl and translational activation by CPEB4, as described in the examples below.
- a nucleic acid sequence is considered as a functionally equivalent to sequence of SEQ ID NO: 1 if it shows at least 100%, at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%>, at least 65%, at least 60%> or at least 50%> of the activity of the sequence of SEQ ID NO: 1.
- polynucleotide of interest refers to any polynucleotide whose expression in a cell is desirable.
- the polynucleotide of interest of the nucleic acid construct of the first aspect is not a gene encoding luciferin-4- monooxygenase from Photinus pyralis or a gene encoding a fluorescent protein.
- luciferin-4-monooxygenase from Photinus pyralis refers to a protein with the sequence identified by the UniProtKB/Swiss-Prot accession number P08659 (Uniprot version 101 as of 14 October 2015).
- fluorescent protein refers to a polypeptide with the capacity to emit light in response to the absorption of light or other electromagnetic radiation.
- fluorescent proteins include green fluorescent protein (GFP or wtGFP), GFP variants for different emission wavelengths, emission intensity and/or protein stability such as Superfolder GFP, EGFP variants for different emission wavelengths (colors) such as blue fluorescent protein (EBFP), cyan fluorescent protein (ECFP), and yellow fluorescent protein (YFP), GFPuv (characterized by having mutations F99S, M153T and V163A in the GFP sequence), Emerald, mPlum, mCherry, tdTomato, mStrawberry, J-Red, mOrange, mKO, YFP, EYFP, mCitrine, Venus, YPet, CyPet, CFP, ECFP, mCFPm, Cerulean, and T-Sapphire.
- Other fluorescent polypeptides include red
- green fluorescent protein refers to a protein consisting of 239 amino acids with a molecular weight of 26.9 kDa and showing bright green fluorescence when exposed to blue ultraviolet light.
- GFP traditionally refers to the first protein isolated from jellyfish A. victoria.
- A. victoria GFP has a major excitation maximum at a wavelength of 395 nm and a minor one at 475 nm. The emission maximum thereof is at 509 nm. The fluorescence quantum yield of GFP is 0.79.
- GFP transduces blue chemiluminescence of aequorin to green fluorescent light by means of energy transfer.
- the polynucleotide of interest is not a gene encoding the 2dEGF, a EGFP protein modified by destabilizaton with 422-461 residues of mouse ornithine decarboxylase giving an in vivo half-life of 2 hours.
- polynucleotide of interest is selected from the group consisting of:
- cytotoxic polypeptide refers to an agent that is capable of inhibiting cell function.
- the agent may inhibit proliferation or may be toxic to cells.
- Any polypeptide that when internalized by a cell interfere with or detrimentally alter cellular metabolism or in any manner inhibit cell growth or proliferation are included within the ambit of this term, including, but are not limited to, agents whose toxic effects are mediated when transported into the cell and also those whose toxic effects are mediated at the cell surface.
- Useful cytotoxic polypeptides include proteinaceous toxins and bacterial toxins.
- Useful type one plant RIPs include, but are not limited to, dianthin 30, dianthin 32, lychnin, saporins 1-9, pokeweed activated protein (PAP), PAP II, PAP-R, PAP-S, PAP-C, mapalmin, dodecandrin, bryodin-L, bryodin, Colicin 1 and 2, luffin-A, luffin-B, luffin-S, 19K-protein synthesis inhibitory protein (PSI), 15K-PSI, 9K-PSI, alpha-kirilowin, beta-kirilowin, gelonin, momordin, momordin-II, momordin-Ic, MAP-30, alpha-momorcharin, beta-momorcharin, trichosanthin, TAP-29
- Useful type two RIPs include, but are not limited to, volkensin, ricin, nigrin-b, CIP-29, abrin, modeccin, ebulitin- [alpha], ebulitin-[beta], ebultin- [gamma], vircumin, porrectin, as well as the biologically active enzymatic subunits thereof (Stirpe et al, Bio/Technology 10:405-12, 1992; Pastan et al, Annu. Rev. Biochem. 61 :331-54; Brinkmann and Pastan, Biochim. et Biophys. Acta 1198:27-45, 1994; and Sandvig and Van Deurs, Physiol. Rev. 76:949-66, 1996).
- bacterial toxins useful as cell toxins include, but are not limited to, shiga toxin and shiga-like toxins (i.e., toxins that have the same activity or structure), as well as the catalytic subunits and biologically functional fragments thereof. These bacterial toxins are also type two RIPs (Sandvig and Van Deurs, Physiol. Rev. 76:949- 66, 1996; Armstrong, J. Infect. Dis., 171 : 1042-5, 1995; Kim et al, Microbiol. Immunol. 41 :805-8, 1997, and Skinner et al, Microb. Pathog. 24: 117-22, 1998).
- useful bacterial toxins include, but are not limited to, Pseudomonas exotoxin and Diphtheria toxin (Pastan et al, Annu. Rev. Biochem. 61 :331-54; and Brinkmann and Pastan, Biochim. et Biophys. Acta 1198:27-45, 1994). Truncated forms and mutants of the toxin enzymatic subunits also can be used as a cell toxin moiety (Pastan et al., Annu. Rev. Biochem. 61 :331-54; Brinkmann and Pastan, Biochim. et Biophys. Acta 1198:27-45, 1994; Mesri et al, J.
- Targets include, but are not limited to the more than 34 described Colicin family of RNase toxins which include colicins A, B, D, El -9, cloacin DF13 and the fungal RNase, [alpha] -sarcin (Ogawa et al. Science 283: 2097-100, 1999; Smarda et al, Folia Microbiol (Praha) 43:563-82, 1998; Wool et al, Trends Biochem. Sci., 17: 266-69, 1992).
- RNase toxins include colicins A, B, D, El -9, cloacin DF13 and the fungal RNase, [alpha] -sarcin (Ogawa et al. Science 283: 2097-100, 1999; Smarda et al, Folia Microbiol (Praha) 43:563-82, 1998; Wool et al, Trends Biochem. Sci., 17: 266-69, 1992).
- antiangiogenic polypeptide denotes a polypeptide capable of inhibiting angiogenesis.
- Suitable antiangiogenic polypeptides include, without limitation, angiostatin, endostatin, anti-angiogenic anti-thrombin III, sFRP- 4 as described in WO2007115376, an anti-VEGF antibody such as anibizumab, bevacizumab (avastin), Fab IMC 1121 and F200 Fab.
- tumor suppressor is a gene or gene product that has a normal biological role of restraining unregulated growth of a cell.
- the functional counterpart to a tumor suppressor is an oncogene.
- Genes that promote normal cell growth may be known as “protooncogenes”.
- a mutation that activates such a gene or gene product further converts it to an "oncogene", which continues the cell growth activity, but in a dysregulated manner.
- tumor suppressor genes and gene products are well known in the literature and may include PTC, BRCA1, BRCA2, pi 6, APC, RB, WT1, EXT1, p53, NF1, TSC2, NF2, VHL, ST7, ST14, PTEN, APC, CD95 or SPARC.
- polypeptide which is capable of activating the immune response towards the cell expressing said polypeptide include any immunostimulatory polypeptide agent such as flagellin, muramyl dipeptide), cytokines including interleukins (e.g., IL-2, IL-7, IL- 15 (or superagonist/mutant forms of these cytokines), IL-12, IFN-gamma, IFN-alpha, GM-CSF, FLT3-ligand, etc.), immunostimulatory antibodies (e.g., anti-CTLA-4, anti-CD28, anti-CD3, or single chain/antibody fragments of these molecules), and the like.
- immunostimulatory polypeptide agent such as flagellin, muramyl dipeptide
- cytokines including interleukins e.g., IL-2, IL-7, IL- 15 (or superagonist/mutant forms of these cytokines)
- IL-12 e.g., IFN-gamma, IFN-alpha,
- a polypeptide which is capable of activating the production of a cytopathic virus refers to a polypeptide which promotes the production of a virus which upon infection of a cell causes the lysis of the cell or the death of the cell due to an inability to reproduce.
- Illustrative non limitative examples of polypeptides that are capable activating the production of a cytopathic virus are the polypeptides encoded by the EIA and E4 transcription units from adenovirus, the B5R glycoprotein of vaccinia virus and the ICP4 protein from Herpes simplex virus- 1.
- the polypeptide which is capable of activating the production of a cytopathic virus is the polypeptide encoded by the EIA gene from an adenovirus.
- EIA gene from an adenovirus or adenovirus early region 1 A
- the 289R protein can transcriptionally activate all of the early viral genes, as well as several host genes, and this activity requires its unique 46-amino-acid domain.
- the 243R protein can induce transcription of certain host cell genes, and in cooperation with cyclic AMP, it can efficiently induce both viral and cellular transcription units.
- adenovirus refers to any virus pertaining to the Adenoviridae family characterized by being a non-enveloped virus with an pseudo-icosahedral nucleocapsid containing a double stranded DNA genome. This term includes any adenovirus capable of infecting a human or an animal, including all groups, subgroups, and serotypes that use CAR, CD46 or desmoglein-2 as receptor for infection of target cells.
- the term adenovirus includes, without limitation, avian, canine, equine, bovine, ovine, porcine, human or frog adenovirus.
- the adenovirus is a human adenovirus, i.e. an adenovirus capable of infecting humans.
- a "serotype" is each of the immunologically different types of adenovirus. There are at least 57 serotypes of human adenovirus that are classified into several subgroups (A to G).
- the adenovirus is a type 5 adenovirus or serotype 5 adenovirus.
- the El A protein from a type 5 adenovirus is the protein identified by the UniProtKB/Swiss-Prot accession number P03255 (Uniprot version 112 as of 20 January 2016).
- the polynucleotide of interest is a polynucleotide that once transcribed gives rise to a RNA capable of modulating the expression of a target gene.
- RNA capable of modulating the expression of a target gene examples of said polynucleotides are polynucleotides that once transcribed generate an RNA which is capable of inhibiting the expression of a target gene, such us a microRNA (miRNA), a small interfering (siRNA) or a short hairpin RNA (shRNA).
- miRNA microRNA
- siRNA small interfering
- shRNA short hairpin RNA
- the invention relates to nucleic acid construct comprising i. a polynucleotide of interest and
- a. comprises at least two cytoplasmic polyadenylation elements which are separated by less than 50 nucleotides
- b. comprises a cytoplasmic polyadenylation signal which is separated by less than 100 nucleotides from the first or second cytoplasmic polyadenylation element
- polynucleotide of interest is not a gene encoding the protein luciferin-4- monooxygenase from Photinus pyralis or a gene encoding a fluorescent protein and wherein the polynucleotide of interest is a reporter gene.
- reporter gene refers to a gene which allows identifying those cells that have been incorporated the nucleic acid construct after having been put in contact with it.
- useful reporter genes in the context of the present invention include lacZ, thymidine kinase, and the like.
- the invention in a third aspect, relates to a vector comprising the nucleic acid construct of the first or second aspect.
- vector refers to a construct capable of delivering, and preferably additionally expressing, one or more polynucleotides of interest into a host cell.
- vectors include, but are not limited to, viral vectors, naked DNA or RNA expression vectors, plasmid, cosmid or phage vectors, DNA or RNA expression vectors associated with cationic condensing agents, DNA or RNA expression vectors encapsulated in liposomes, and certain eukaryotic cells, such as producer cells.
- This term also relates to targeting constructs which allow for random or site-directed integration of the targeting construct into genomic DNA.
- targeting constructs preferably, comprise DNA of sufficient length for either homologous recombination or heterologous integration.
- the vector is an expression vector.
- expression vector refers to a replicative DNA construct used for expressing the nucleic acid construct of the invention in a cell, preferably a eukaryotic cell, more preferably a mammalian cell.
- the expression vector also preferably contains an origin of replication in prokaryotes, necessary for vector propagation in bacteria.
- the expression vector can also contain a selection gene for bacteria, for example, a gene encoding a protein conferring resistance to an antibiotic, for example, ampicillin, kanamycin, chloramphenicol, etc.
- the expression vector can also contain one or more multiple cloning sites.
- the expression vector is a lentiviral vector or an adenoviral vector.
- lentiviral vector refers to a vector based on a group (or scientific genus) of retroviruses that in nature give rise to slowly developing disease due to their ability to incorporate into a host genome. Modified lentiviral genomes are useful as viral vectors for the delivery of a nucleic acid sequence to a cell. An advantage of lentiviruses for infection of cells is the ability for sustained transgene expression.
- viruses include in particular Human Immunodeficiency Virus type 1 (HIV-1), Human Immunodeficiency Virus type 2 (HIV-2), Simian Immunodeficiency Virus (SIV), Feline Immunodeficiency Virus (FIV), Equine Infectious Anaemia Virus (EIAV), Bovine Immunodeficiency Virus (BIV), Visna Virus of sheep (VISNA) and Caprine Arthritis-Encephalitis Virus (CAEV).
- Recombinant lentiviral vectors are capable of infecting non-dividing cells and can be used for both in vivo and ex vivo gene transfer and expression of nucleic acid sequences.
- lentivirus capable of infecting a non-dividing cell wherein a suitable host cell is transfected with two or more vectors carrying the packaging functions, namely gag, pol and env, as well as rev and tat is described in U.S. Pat. No. 5,994,136, incorporated herein by reference.
- One may target the recombinant virus by linkage of the envelope protein with an antibody or a particular ligand for targeting to a receptor of a particular cell-type.
- a sequence (including a regulatory region) of interest into the viral vector, along with another gene which encodes the ligand for a receptor on a specific target cell, for example, the vector is now target-specific.
- the lentiviral vectors according to the invention may be genetically modified in such a way that certain genes constituting the native infectious virus are eliminated and replaced with a nucleic acid sequence of interest to be introduced into the target cells.
- adenoviral vector refers to a vector based on an adenovirus, which has been previously defined.
- the viral vector is a vector based on a virus or the Parvoviridae family, preferably from the Parvovirinae subfamily, more preferably from the Dependoparvovirus genus, and yet even more preferably an adeno-associated virus.
- AAV adeno-associated virus
- AAV serotypes have genomic sequences of significant homology at the amino acid and the nucleic acid levels, provide an identical set of genetic functions, produce virions which are essentially physically and functionally equivalent, and can be engineered to express transgenes that require tissue-specific regulation.
- the invention may be carried out using to AAV serotype 1 (AAV1), AAV2, AAV3 (including types 3 A and 3B), AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, and any other AAV now known or later discovered.
- AAV serotype 1 AAV1
- AAV2 AAV3 (including types 3 A and 3B)
- AAV4 AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, and any other AAV now known or later discovered.
- the genomic sequences of the various serotypes of AAV and the autonomous parvoviruses, as well as the sequences of the terminal repeats, Rep proteins, and capsid subunits are known in the art. Such sequences may be found in the literature or in public databases such as GenBank.
- NC_002077 See, e.g., GenBank Accession Numbers NC_002077, NC_001401, NC_001729, NC_001863, NC_001829, NC_001862, NC_000883, NC 001701, NC 001510, NC 006152, NC 006261, AF063497, U89790, AF043303, AF028705, AF028704, J02275, J01901, J02275, X01457, AF288061, AH009962, AY028226, AY028223, NC_001358, NC_001540, AF513851, AF513852, AY530579; the disclosures of which are incorporated by reference herein for teaching parvovirus and AAV nucleic acid and amino acid sequences.
- the viral vector is a vector based on a virus of the Reoviridae family. In yet another embodiment, the viral vector is a vector based on a virus of the Picornaviridae family, preferably from the enterovirus genus, more preferably a Coxsackievirus and even more preferably on a Coxsackievirus A21 virus. In a fourth aspect, the invention relates to a viral particle comprising the lentiviral vector or adenoviral vector of the third aspect.
- viral particle refers to a whole viral particle and not to a protein subunit or peptide.
- Viral particles consist of two or three parts: the genetic material of the virus made from either DNA or RNA; a protein coat that protects these genes; and, in some cases, an envelope of lipids that surrounds the protein coat when they are outside a cell.
- the shape of the viral particle ranges from simple helical and icosahedral forms to more complex structures, depending on the virus.
- the invention in a fifth aspect, relates to a cell comprising the nucleic acid construct of the first or second aspect or the vector of the third aspect.
- the cell can be of any origin.
- the cell is a eukaryotic cell.
- the cell is a mammal cell.
- the cell is a human cell.
- the invention in a sixth aspect, relates to a pharmaceutical composition
- a pharmaceutical composition comprising the nucleic acid construct of the first aspect, or a vector, viral particle or cell comprising said nucleic acid construct and a pharmaceutically acceptable carrier.
- composition refers to a composition comprising a therapeutically effective amount of the nucleic acid construct according to the present invention (or the vector, viral particle or cell comprising said nucleic acid construct) and at least one pharmaceutically acceptable excipient.
- Pharmaceutical compositions according to the invention can be prepared, for instance, as injectables such as liquid solutions, suspensions, and emulsions.
- pharmaceutically acceptable excipient or “pharmaceutically acceptable carrier,” “pharmaceutically acceptable diluent,”, or “pharmaceutically acceptable vehicle,” used interchangeably herein, refer to a non-toxic solid, semisolid or liquid filler, diluent, encapsulating material or formulation auxiliary of any conventional type.
- a pharmaceutically acceptable carrier is essentially non-toxic to recipients at the dosages and concentrations employed, and is compatible with other ingredients of the formulation. Suitable carriers include, but are not limited to water, dextrose, glycerol, saline, ethanol, and combinations thereof.
- the carrier can contain additional agents such as wetting or emulsifying agents, pH buffering agents, or adjuvants which enhance the effectiveness of the formulation.
- Adjuvants could be selected from the group consisting of sterile liquids, such as water and oils, including those of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, and similars.
- Water or saline aqueous solutions and aqueous dextrose and glycerol solutions, particularly for injectable solutions, are preferably used as vehicles.
- Suitable pharmaceutical vehicles are described in "Remington's Pharmaceutical Sciences” by E.W. Martin, 21st Edition, 2005.
- nucleic acid construct according to the present invention or the vector, viral particle or cell comprising said nucleic acid construct
- pharmaceutical composition of the invention relates to the sufficient amount of nucleic acid construct according to the present invention (or the vector, viral particle or cell comprising said nucleic acid construct) to provide the desired effect, i.e. to achieve an appreciable prevention, cure, delay, reduction of severity or amelioration of one or more symptoms derived from a disease, and will generally be determined by, among other causes, the characteristics of the agent itself and the therapeutic effect to be achieved. It will also depend on the subject to be treated, the severity of the disease suffered by said subject, the chosen dosage form, etc. For this reason, the doses mentioned in this invention must be considered only as guides for the person skilled in the art, who must adjust the doses depending on the aforementioned variables.
- the effective amount produces the amelioration of one or more symptoms of the disease that is being treated.
- compositions for intravenous or intraventricular administration are solutions in sterile isotonic aqueous buffer.
- compositions containing the compounds according to the invention can occur at any pharmaceutical form of administration considered appropriate for the selected administration route, for example, by systemic, oral, parenteral, intradermal, subcutaneous, intramuscular, intravenous or topical administration, for which it will include the pharmaceutically acceptable excipients necessary for formulation of the desired method of administration.
- the effective quantity of the compounds of the invention can vary within a wide range and, in general, will vary depending on the particular circumstances of application, duration of the exposure and other considerations.
- Injectable preparations for example, aqueous or oleaginous suspensions
- sterile injectable may be formulated according with the technique known using suitable dispersing agents, wetting agents and/or suspending agents.
- suitable dispersing agents wetting agents and/or suspending agents.
- suitable vehicles and solvents water, Ringer's solution and isotonic sodium chloride solution.
- Sterile oils are also conventionally used as solvents or suspending media.
- Several drug delivery systems are known and can be used to administer the compounds or compositions of the invention, including, for example, encapsulation in liposomes, microbubbles, emulsions, microparticles, microcapsules and similars.
- the required dosage can be administered as a single unit or in a sustained release form.
- the dosage needed to provide an effective amount of such compound which can be adjusted by one expert in the art will vary depending on age, health, fitness, sex, diet, weight, degree of alteration of the receptor, frequency of treatment and the nature and extent of impairment or illness, medical condition of the patient, route of administration, pharmacological considerations such as activity, efficacy, pharmacokinetic and toxicology profile of the particular compound used, if using a system drug delivery, and if the compound is administered as part of a combination of drugs.
- the invention in a seventh aspect, relates to an in vitro method for inducing selective expression of a polynucleotide of interest in a tumor cell comprising i. contacting the tumor cell with the nucleic acid construct according to the first or second aspect, the vector according to any the third aspect or the viral particle according to the fourth aspect under suitable conditions for the entry of the nucleic acid construct, vector or viral particle into the tumor cell and
- in vitro refers to the fact that the method is not carried out on the body of a human or animal subject, but rather on cells isolated from said subject.
- tumor cell refers to a cell that can grow and divide at an unregulated, quick pace. Tumor cells can be identified by methods well known by the person skilled in the art, for example by using specific antibodies able to recognize specific tumoral markers such as EpCAM, Her 2, CK19 or PSA.
- the tumor cell expresses increased levels of CPEB4 and decreased levels of non-phosphorylated CPEB1 compared to a reference sample.
- CPEB4 or cytoplasmic polyadenylation element binding protein 4" refers to a RNA binding protein which in humans has the sequence identified by the UniProtKB/Swiss-Prot accession number Q17RY0 (Uniprot version 85 as of 20 January 2016).
- CPEB1 or "cytoplasmic polyadenylation element binding protein 1" refers to a RNA binding protein which in humans has the sequence identified by the UniProtKB/Swiss-Prot accession number Q9BZB8 (Uniprot version 119 as of 20 January 2016).
- the expression "level of CPEB4" refers to the level of the protein.
- the level of a protein can be determined by any method known in the art suitable for the determination and quantification of a protein in a sample.
- the level of a protein can be determined by means of a technique which comprises the use of antibodies with the capacity for binding specifically to the assayed protein (or to fragments thereof containing the antigenic determinants) and subsequent quantification of the resulting antigen-antibody complexes, or alternatively by means of a technique which does not comprise the use of antibodies such as, for example, by techniques based on mass spectroscopy.
- the antibodies can be monoclonal, polyclonal or fragment thereof, Fv, Fab, Fab' and F(ab') 2 , scFv, diabodies, triabodies, tetrabodies and humanized antibodies. Similarly, the antibodies may be labeled. Illustrative, but non-exclusive, examples of markers that can be herein used include radioactive isotopes, enzymes, fluorophores, chemo luminescent reagents, enzyme cofactors or substrates, enzyme inhibitors, particles, or dyes.
- test there is a wide variety of known test that can be used according to the present invention, such as combined application of non-labeled antibodies (primary antibodies) and labeled antibodies (secondary antibodies), Western blot or immunoblot, ELISA (enzyme- linked immunosorbent assay), RIA (radioimmunoassay), competitive EIA (enzyme immunoassay), DAS- ELISA (double antibody sandwich ELISA), two-dimensional gel electrophoresis, capillary electrophoresis, immunocytochemical and immunohistochemical techniques, immunoturbidimetry, immunofluorescence, techniques based on the use of biochips or protein microarrays including specific antibodies or assays based on the colloidal precipitation in formats such as reagent strips and assays based on antibody-linked quantum dots.
- Non-phosphorylated CPEBl refers to the quantity of non-phosphorylated CPEBl .
- Non-phosphorylated levels of CPEBl can be determined directly by any suitable technique known in the art or indirectly by comparing the total amount of CPEBl to the amount of phosphorylated CPEBl .
- Phosphorylated CPEBl can be determined by techniques using unlabeled antibodies (primary antibody) that recognize the phosphorylated CPEBl (phospho- CPEBl) and labeled antibodies (secondary antibodies) or, alternatively, primary antibodies recognizing phospho- CPEB1 and are marked.
- reference value relates to a predetermined criteria used as a reference for evaluating the values or data obtained from the samples collected from a subject.
- the reference value or reference level can be an absolute value, a relative value, a value that has an upper or a lower limit, a range of values, an average value, a median value, a mean value, or a value as compared to a particular control or baseline value.
- a reference value can be based on an individual sample value, such as for example, a value obtained from a sample from the subject being tested, but at an earlier point in time.
- the reference value can be based on a large number of samples, such as from population of subjects of the chronological age matched group, or based on a pool of samples including or excluding the sample to be tested.
- the reference value is obtained from a sample which does not comprise tumor cells.
- the reference value is obtained from a sample containing, consisting or substantially consisting of pancreatic normal HPDE cells.
- the level of CPEB4 is considered "increased" when said level in a sample is higher than its reference value.
- the level of CPEB4 is considered to be higher than its reference value when it is at least 1.5%, at least 2%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 100%, at least 110%, at least 120%, at least 130%, at least 140%, at least 150%, or more higher than its reference value.
- the level of non-phosphorylated CPEB1 is considered "decreased" when said level in a sample is lower than its reference value.
- the level of non-phosphorylated CPEB1 is considered to be lower than its reference value when it is at least 1.5%, at least 2%, at least 5%, at least 10%>, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 100%, at least 110%, at least 120%, at least 130%, at least 140%, at least 150%, or more lower than its reference value.
- the suitable conditions for the entry of the nucleic acid construct, vector or viral particle in the tumor cell are known by the skilled person and include, for example, known conditions for transfection, transduction or transformation of the cell.
- the suitable conditions for the expression of the polynucleotide of interest are also known by the skilled person.
- the skilled person can determine if a cell is expressing a polynucleotide of interest by any known method for detecting expression of a particular protein by a cell, such as Western blot or immunoblot, ELISA (enzyme- linked immunosorbent assay), RIA (radioimmunoassay), competitive EIA (enzyme immunoassay), DAS-ELISA (double antibody sandwich ELISA), two-dimensional gel electrophoresis, capillary electrophoresis, immunocytochemical and immunohistochemical techniques, immunoturbidimetry, immunofluorescence, etc.
- the invention relates to the nucleic acid construct according to the first aspect, or the viral particle, cell or pharmaceutical composition comprising said nucleic acid construct for use in medicine. Alternatively, the invention relates to the use of the nucleic acid construct according to the first aspect, or the viral particle, cell or pharmaceutical composition comprising said nucleic acid construct for the manufacture of a medicament. In a ninth aspect, the invention relates to the nucleic acid construct according to the first aspect, the viral particle, cell or pharmaceutical composition comprising said nucleic acid construct for use in the treatment of cancer. Alternatively, the invention relates to the use of the nucleic acid construct according to the first aspect, the viral particle, cell or pharmaceutical composition comprising said nucleic acid construct for the manufacture of a medicament for treating cancer. Alternatively, the invention relates to a method of treating cancer comprising administering to a subject a therapeutically effective amount of the nucleic acid construct according to the first aspect or the viral particle, cell or pharmaceutical composition comprising said nucleic acid construct.
- treatment refers to any process, action, application, therapy, or the like, wherein a subject (or patient), including a human being, is provided medical aid with the object of improving the subject's condition, directly or indirectly, or slowing the progression of a condition or disorder in the subject, or ameliorating at least one symptom of the disease or disorder under treatment.
- patient refers to any animal, preferably a mammal and includes, but is not limited to, domestic and farm animals, primates and humans, for example, human beings, non-human primates, cows, horses, pigs, sheep, goats, dogs, cats, or rodents.
- the subject is a human being of any age or race.
- the subject suffers from cancer.
- cancer refers to a disease characterized by uncontrolled cell division (or by an increase of survival or apoptosis resistance) and by the ability of said cells to invade other neighboring tissues (invasion) and spread to other areas of the body where the cells are not normally located (metastasis) through the lymphatic and blood vessels, circulate through the bloodstream, and then invade normal tissues elsewhere in the body.
- tumors are classified as being either benign or malignant: benign tumors are tumors that cannot spread by invasion or metastasis, i.e., they only grow locally; whereas malignant tumors are tumors that are capable of spreading by invasion and metastasis.
- cancer includes, without limitation, lung cancer, sarcoma, malignant melanoma, pleural mesothelioma, bladder carcinoma, prostate cancer, pancreas carcinoma, gastric carcinoma, ovarian cancer, hepatoma, breast cancer, colorectal cancer, kidney cancer, esophageal cancer, suprarenal cancer, parotid gland cancer, head and neck carcinoma, cervix cancer, endometrial cancer, liver cancer, mesothelioma, multiple myeloma, leukaemia, and lymphoma.
- the cancer is renal cell carcinoma (RCC), breast cancer, or colorectal cancer.
- RCC renal cell carcinoma
- breast cancer or colorectal cancer.
- the cancer is selected from pancreatic cancer, glioblastoma, glioma colorectal cancer, ductal breast carcinoma, astrocytic tumor.
- pancreatic cancer refers to refers to abnormal or unregulated cell growth affecting the pancreas.
- pancreatic carcinoma includes exocrine carcinoma, endocrine carcinoma and neuroendocrine carcinoma.
- Illustrative non- limitative examples of pancreatic carcinoma are pancreatic adenocarcinoma, acinar cell carcinoma, cystadenocarcinomas and pancreatic mucinous cystic neoplasms.
- the pancreatic cancer is pancreatic ductal adenocarcinoma.
- PDAC pancreatic ductal adenocarcinoma
- PDAC refers to a pancreatic cancer that displays a ductal-like morphology.
- glioma refers to a type of cancer that starts in the brain or spine and which arises from glial cells and/or its precursors including Ependymomas (gliomas derived from ependymal cells), astrocytomas (also known as astrocytic tumours, which are gliomas derived from astrocytes and which includes glioblastoma multiforme), oligodendrogliomas (gliomas derived from oligodendrocytes) and mixed gliomas, such as oligoastrocytomas (derived from cells from different types of glia).
- the glioma is a glioblastoma or an astrocytic tumor.
- glioblastoma also known as “glioblastoma multiforme” or “GBM” as used, herein, refers to a type of primary brain tumor.
- GBM is an anaplastic, highly cellular tumor with poorly differentiated, round, or pleomorphic cells, occasional multinucleated ceils, nuclear atypia, and anaplasia. Variants of the tumor include gliosarcoma, mult ifocal GBM, or gliomatosis cerebri (in which the entire brain may be infiltrated with tumor ceils).
- GBM seldom I y metastasizes to the spinal cord or outside the nervous system.
- GBM is graded by their microscopic and histological appearance. Generally, grade I (pilocytic astrocytomas) and grade 11 (benign astrocytomas) tumors grow slowly over many years while grade IV (GBM) grows rapidly, invading and altering brain function.
- colon cancer also called “colorectal cancer” or "bowel cancer,” refers to a malignancy that arises in the large intestine (colon) or the rectum (end of the colon), and includes cancerous growths in the colon, rectum, and appendix, including adenocarcinoma.
- breast cancer relates to any malignant proliferative disorder of breast cells, most commonly from the inner lining of milk ducts or the lobules that supply the ducts with milk. Cancers originating from ducts are known as ductal carcinomas, while those originating from lobules are known as lobular carcinomas.
- the cancer contains cells that expressed increased levels of CPEB4 and decreased levels of non-phosphorylated CPEB1 compared to a reference sample.
- the expressions "increased levels of CPEB4", "decreased levels of CPEB1" and reference sample” as well as preferred and particular embodiments have been previously defined and apply to the eighth and ninth aspects.
- the nucleic acid construct, vector, viral particle, cell or pharmaceutical composition can be administered by any suitable route, for example, by systemic, oral, parenteral, intradermal, subcutaneous, intramuscular, intravenous or topical administration.
- nucleic acid construct, vector, viral particle, cell or pharmaceutical composition is administered intravenously.
- the invention relates to the use of the nucleic acid construct according to the second aspect, or the viral particle, cell or pharmaceutical composition comprising said nucleic acid construct in a diagnostic method of cancer or to aid in cancer surgery.
- diagnosis method refers to a method wherein the properties of selective expression of the construct of the invention are used to confirm the presence of cancer in a subject or in a sample taken from said subject.
- the selective expression of the gene of the construct in the tumour cells serves to confirm their cancerous nature, therefore helping to diagnose the subject as a patient of cancer.
- the method would be suitable in vivo to identify and locate masses of cancerous cells, helping the surgeon to determine the tissue/s to be removed or the amount thereof.
- Non-limiting examples of genes suitable to be used in the diagnostic method of the invention comprise reporter genes which transform substrates into colored reactives such as the gene lacZ, which encodes the enzyme ⁇ -galactosidase, or the GUS reporter system, enconding ⁇ -glucuronidase.
- reporter genes suitable are those encoding proteins which can be detected through the use of Positron Emission Tomography, such as the gene encoding the protein Herpes Simplex Virus 1 Thymidine Kinase (HSV1-TK), the gene encoding the hypoxanthine phosphoribosil transferase, and the gene of L-amino acid decarboxylase.
- Pancreatic cell lines PANC-1 and MIA PaCa-2, and embryonic kidney cell lines HEK293 and 293 T, were obtained from the American Type Culture Collection (ATCC, Manasas, VA).
- RWP-1 cells were derived from human pancreatic adenocarcinoma biopsies perpetuated as xenograft in nude mice 37 .
- Non-tumor fibroblasts were kindly provided by Dr. Eva Vaquero (Institut d'investigacions Biomediques Atust Pi i Sunyer, Barcelona, Spain). All cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (Gibco BRL, Carlsbad, CA).
- Immortal human pancreatic duct epithelial HPDE cells kindly provided by Dr. F.X. Real (CNIO, Madrid, Spain), were cultured and maintained as reported (Ouyang, H., et al. Immortal human pancreatic duct epithelial cell lines with near normal genotype and phenotype. Am J Pathol 157, 1623-1631 (2000)).
- Human hepatocytes were obtained form Biopredic International (St Gregoire, France) and maintained according to the provider instructions RWP-1 shNT, Sh2 and Sh4 were previously described Ortiz-Zapater, E., et al. Key contribution of CPEB4-mediated translational control to cancer progression. Nat Med 18, 83-90 (2011).
- HPDE-CPEB4- expressing cells were established by transducing parental cells with CPEB4 recombinant lentivirus.
- Lentiviral constructs with a modified 3' UTR Lentiviral constructs with a modified 3' UTR.
- the polyadenylation sequences (4193- 4199 and 4423-4429) from the pLS-CG lentiviral vector (Addgene, #12161) were mutagenized with the help of the QuickChange II Site-Directed Mutagenesis Kit (Stratagene, Wilmington, NC) according to the manufacturer's instructions (see Table 1 for primers). Mutagenized sequences were verified by DNA sequencing.
- Table 1 Primer sequences d2EGFP and d2RFP genes were cloned by PCR with specific primers incorporating the Agel and Xhol restriction sites.
- the 3'-UTR of tPA was PCR amplified using specific primers with sequences for the Xhol restriction enzyme at both ends.
- the 3'-UTR of cBl was designed in the reverse primer of d2EGFP gene with a sequence for the Xhol restriction enzyme.
- the 3 '-UTR with the TNF-a ARE sequences was generated by amplifying the previously generated cBl 3'-UTR with a primer containing the TNF- a main ARE sequence upstream of the CPE sites.
- Lentiviral production Lentiviral particles were generated by cotransfection of plasmids pCMVAR8.91, pVSV-G and the pLS-CG-derived constructs, or a lenitiviral plasmid expressing CPEB4, in 293T cells by the calcium/phosphate DNA precipitation method (Clontech, Mountain View, CA). Supernatants from 293T-transfected cells were collected at 24 h and 48 h, filtered and processed for purification by ultracentrifugation for 2 h at 12°C at 20,200 r.p.m. After ultracentrifugation, the pellet was resuspended in PBS for 16 h at 4°C under constant agitation, aliquoted and frozen at -80°C for later use.
- Flow cytometry assays were performed in HPDE, RWP-1, PANC-1 and MIA PaCa-2 cells. Forty thousand cells were plated per well in 12-multiwell plates and, 24 h post- seeding, cells were transduced with the indicated lentiviruses at 12 MOI per virus. Transduction was facilitated by spinning for 2 h at 12,000 r.p.m. Two days post- transduction, d2EGFP and dRFP levels were analyzed by flow cytometry using BD LSR II (Becton Dickinson). Flow cytometry results were analyzed using FlowJo 8.7 for Macintosh. Adenovirus generation.
- the AdCPE genome was generated by the following steps: First, the El A polyA sequence of the pEND-K plasmid was mutated from AATAAA to ACTCGA, generating a new Xhol restriction site with the primer 5'-GCTGAATGAGATTGATGTAAGTTTACTCGAGGGTGAGATAATGTTTAACT TGC-3'
- AduPAR was previously described (Huch, M., et al. Urokinase-type plasminogen activator receptor transcriptionally controlled adenoviruses eradicate pancreatic tumors and liver metastasis in mouse models. Neoplasia 11, 518-528, 514 p following 528 (2009)).
- AdDUC genome was generated by incorporating the CPE containing 3'UTR of E1A into the Boxl and Aflll restriction sites of the pSH-DM-UPAR-ElA plasmid followed by recombination of the resulting plasmid with the Adwt genome in BJ5183 cells.
- Adwt was obtained from ATCC (Manasas, VA).
- Adwt, AdCPE, AduPAR and AdDUC were propagated in A549 cells and purified by cesium chloride banding.
- concentration of viral particles vp/mL was determined by means of optical density; and infectious particles (pfu/mL) by hexon immunostaining in HEK293 cells (Cascante, A., et al.
- GCV modulates the antitumoural efficacy of a replicative adenovirus expressing the Tat8-TK as a late gene in a pancreatic tumour model. Gene Ther 14, 1471-1480 (2007)). Both viruses presented equal vp/pfu ratio.
- Protein extracts were obtained with lysis buffer (50 mM Tris- HC1 at pH 6.8, 2% SDS) containing 1% Complete Mini Protease Inhibitor (Roche Diagnostics GmbH, Basel, Switzerland).
- BCA Protein Assay Kit (Pierce-Thermo Fisher Scientific, Waltham, MA) was used to determine the protein concentration, and total proteins (35 ⁇ g) were resolved by electrophoresis on 7.5% gels and transferred to nitrocellulose membranes by standard methods.
- Membranes were immunoblotted with rabbit anti-adenovirus-2/5 El A polyclonal antibody (1 :200; clone 13 S-5; Santa Cruz Biotechnology, Dallas, TX) or anti-CPEB4 antibody (1 :200; Abeam, Cambridge, UK) or anti-CPEBl (1 :200; 13274-1-AP, ProteinTech, IL, USA) 1 h at room temperature (RT). Blots were rinsed with TBS-T and incubated for 45 min at RT with HRP- conjugated goat anti-rabbit IgG (DakoCytomation, Glostrup, Denmark). Antibody labeling was detected by the enhanced chemiluminescent method (Amersham Biosciences, Amersham, UK).
- Quantitative expression data were normalized to Gdx Fw 5 '-GGCAGCTGATCTCCAAAGTCCTGG-3 '(SEQ ID NO: 24) and Gdx Rev 5 '-AACGTTCGATGTCATCCAGTGTTA-3 '(SEQ ID NO: 25).
- d2EGFP and dRFP were detected with the primers: d2EGFP Fw 5'- CAACAGCCACAACGTCTATATCAT-3 '(SEQ ID NO: 26) and d2EGFP Rv: 5 '- ATGTTGTGGCGGATCTTGAAG-3 '(SEQ ID NO: 27); and dRFP Fw 5 '- GCCCTTCGCCTGGGACAT-3 '(SEQ ID NO: 28) and dRFP Rv 5 '- GGTGCTTCACGTACACCTTGGA-3 '(SEQ ID NO: 29).
- Quantitative expression data were normalized using the primers ACTB Fw 5 '-CTGGAACGGTGAAGGTGACA- 3 '(SEQ ID NO: 30) and ACTB Rv 5 '-GGGAGAGGACTGGGCCATT-3'(SEQ ID NO: 31).
- Viral genome quantification Viral DNA was obtained from supernatants, cellular extracts or frozen tissues using the UltraClean BloodSpin DNA Isolation Kit (Mo Bio Laboratories, Carlsbad, CA) according to the manufacturer's instructions.
- Viral genomes were determined by real-time qPCR using the SYBER Green I Master plus mix (Roche Diagnostics, Basel, Switzerland) and the primers hexon Fw 5 '- GCCGCAGTGGTCTTACATGCACATC-3 ' (SEQ ID NO: 32) and hexon Rv 5 '- CAGCACGCCGCGGATGTCAAAG-3 ' (SEQ ID NO: 33).
- Adenoviral copy number was relativized to the cellular DNA content using the albumin intron 12 primers of Fw 5 '-CTGTCATCTCTTGTGGGCTGT-3 ' (SEQ ID NO: 34) and Rv 5'- GGCTATCCAAACTCATGGGAG-3 ' (SEQ ID NO: 35).
- Polyadenylation Assays Polyadenylation patterns were evaluated using a modified version of the RNA ligation-coupled RT-PCR presented previously (Rassa, J.C., Wilson, G.M., Brewer, G.A. & Parks, G.D. Spacing constraints on reinitiation of paramyxovirus transcription: the gene end U tract acts as a spacer to separate gene end from gene start sites. Virology 274, 438-449 (2000).
- RNA was ligated to 0 ⁇ of PI anchor primer (5'-P-GGTCACCTTGATCTCAAGC-NH2-3') (SEQ ID NO: 36) in 10 ⁇ reaction using T4 RNA ligase I (New England Biolabs, Ipswich, MA) according to manufacturer's instructions.
- Half of the reaction product was used in a 50 ⁇ reverse transcription reaction with PrimeScript RT-PCR (Takara Bio, Mountain View, CA) according to manufacturer's instructions, using 0.1 ⁇ g of ⁇ as a reverse primer (5 '-GCTTCAGATCAAGGTGACCTTTTT-3 ') (SEQ ID NO: 37).
- CPEs provide oncoselectivity to replication-competent adenoviruses.
- chimeric mRNAs with three combinations of 3 ' UTRs fused to the d2EGFP open reading frame were tested. These mRNAs were expressed in a battery of pancreatic normal (HPDE) and tumor (RWP-1, PANC-1 and MIA PaCa-2) cells expressing variable levels of CPEBl and CPEB4 (Fig. la).
- the first UTR was derived from Xenopus cyclin Bl (cBl) 3' UTR mRNA and contained two consensus CPEs and one nonconsensus CPE.
- This CPE arrangement promotes both translational repression by unphosphorylated CPEBl and translational activation by CPEB4 (Igea, A. & Mendez, R. EMBO J 29, 2182-2193 (2010); Novoa, I. et al, Nat Cell Biol 12, 447-456 (2010), Belloc, E. et al. Biochem Soc Trans 36, 665-670 (2008).
- the second UTR was synthetized by combining cBl CPEs with an ARE sequence that opposes CPE-mediated polyadenylation and translational activation from the TNF-a 3 ' UTR mRNA (TNF-a- CB1).
- the third UTR was generated from a fragment of the tissue plasminogen activator (tPA) 3' -UTR mRNA that contains two CPEs and two ARE sequences (Ortiz- Zapater, E., et al.. Nat Med 18, 83-90 (2011)).
- tPA tissue plasminogen activator
- Fig. lb Table 1
- Lentiviruses expressing the d2EGFP with the indicated 3'-UTRs or a control WT 3'- UTR (without CPEs) and a lentivirus with a destabilized dRFP bearing a control 3 '- UTR (WT) were used to co-infect the non-tumor HPDE cells and the pancreatic cancer cell lines (Fig. 2a).
- the resulting d2EGFP- to-dRFP expression ratio indicated that cBl was the only 3'-UTR promoting a differential translational control in normal cells compared to cancer cells.
- CB1-3'- UTR repressed the expression of d2EGFP in HPDE cells as compared to the dRFP control 3 ' -UTR, whereas it promoted activation in the cancer cells, with a stronger effect in PANC-1 (Fig. lc).
- the d2EGFP/dRFP ratio was proportional to the CPEB4/CPEB1 ratio (Fig. la).
- the specific regulation promoted by the CBl-3'-UTR was used to generate an oncoselective replication-competent adenovirus Ad5.
- viral replication was target by designing a virus in which the translation of El A mRNA was regulated by CPEBs.
- the adenoviral immediate early E1A gene was selected because it is the first gene transcribed after an adenoviral infection and thus acts as a master transcriptional regulator of further early viral genes and modifies several cell host functions required for viral DNA replication.
- the WT 3'-UTR of the viral E1A coding sequence was replaced with the cBl 3 '-UTR to give us AdCPE (Fig. 3a).
- the poly(A) tail length of the different E1A transcripts was measured in the four cell lines by RNA ligation-coupled RT-PCR analysis (Fig. 3c). It was found that the CPE-mediated destabilization of the ElA-cBl mRNA in HPDE cells was associated with a shorter poly(A) tail (Fig. 3d), which resulted in reduced El A protein expression from the cBl 3 '-UTR mRNA as compared with the WT 3'-UTR (Fig. 3e).
- AdCPE-infected non-transformed cells showed a strong reduction in viral genome copy numbers (Fig. 3f) and decreased cytotoxicity (increased IC50; Fig. 3g) as compared to the control virus Adwt.
- the lowest performance of AdCPE was also observed in human primary fibroblasts.
- cBl 3'-UTR was as efficient as the WT 3'-UTR in supporting optimum levels of viral driven El A expression (Fig. 3e), which in turn resulted in equal viral genome copy numbers and IC50 from both 3'-UTRs (Fig. 3f,g).
- the similar effects of Adwt and AdCPE in cancer cells also highlight that the small size of the cBl 3'-UTR did not compromise virus fitness and packaging efficiency.
- CPE-mediated oncoselectivity is provided by CPEB4.
- AdCPE activity is highly impaired in normal tissues when compared to Adwt.
- liver damage-associated toxicity which is one of the major side effects of Ad-expressing El A
- body weight, macroscopic liver appearance and serum parameters were analyzed in mice after intravenous delivery of Adwt or AdCPE.
- Adwt caused a progressive loss of weight, whereas AdCPE led to a decrease in body weight by day 1 that then remained stable for the following days (Fig. 6d).
- Livers injected with Adwt showed a steatotic appearance that was not observed in AdCPE livers (Fig. 6e).
- Oncolytic viruses are advancing to clinical trials and are envisioned as important agents in oncology in the near future. Accordingly, optimized engineered viruses are under development to maximize their anticancer effects. However as their potency increases potential associated toxicities grow proportionally, pointing the need to develop highly tumor-specific viruses. It is shown that engineering adenoviruses with CPE regulatory elements, to control El A expression post transcriptionally, result in attenuated viral activity in normal cells while maintaining, or even increasing, potency in cancer cells. The specificity of the antitumoral response is directly derived from the ectopic expression of CPEB4 in tumors. Thus, depletion of CPEB4 attenuates viral activity in tumoral cells while overexpression of CPEB4 in non-transformed cells increases viral replication.
- the levels of CPE-mediated expression may be further increased by reduced levels of CPEBl .
- CPEBl levels are reduced while CPEB4 levels increase promoting cytoplasmic polyadenylation, with the result of increased mR A stability and translation of CPE regulated transcripts.
- viral genome replication dependent on CPEB4 activity, is restricted to tumoral cells, resulting in an attenuated virus in healthy tissues but a full competent virus in cancer cells.
- the CPE regulated virus maintains its oncolytic capacity while significantly reducing damage to non-tumoral tissues, mainly in the liver since it is the target organ of adenovirus sequestration upon intravascular delivery.
- This increased selectivity allows for enhanced therapeutic index since increased antitumoral capacity is obtained after AdcBl treatment at viral doses that Adwt injection compromises mice survival.
- the alternative post-entry strategy to regulate viral replication is a negative targeting approach based on the miRNA expression in normal tissues to restrict viral replication of miRNA-target sites engineered viruses. Indeed, this is a very versatile approach for many different viruses and highly efficient. However, the evolution of escape mutants in miRNA targeted viruses or the potential off-target effects on the host miRNA machinery have been proposed as potential caveats. Interestingly, no mutations were found in the CPE-regulated adenovirus under evolutionary pressure (Fig. 9). To achieve a tight restriction of replication to tumor cells, it should be possible to combine different targeting strategies such as regulation by more than one viral gene(Bofill-De Ros, X., et al.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Virology (AREA)
- Plant Pathology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Epidemiology (AREA)
- Pharmacology & Pharmacy (AREA)
- Medicinal Chemistry (AREA)
- Veterinary Medicine (AREA)
- Mycology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention relates to a nucleic acid construct comprising polynucleotide of interest and an untranslated 3' sequence including at least two cytoplasmic polyadenylation elements. The invention also relates to vectors, viral particles, cells and pharmaceutical compositions comprising said nucleic acid construct, and to their use for inducing selective expression of a polynucleotide in a tumor cell, and said nucleic acid construct for use in medicine and in the treatment of cancer.
Description
NUCLEIC ACID CONSTRUCTS AND VECTORS FOR ONCOSELECTIVE EXPRESSION OF A TRANSGENE
FIELD OF THE INVENTION
The invention relates to the field of nucleic acid constructs for the selective expression of a gene in a tumor cell.
BACKGROUND OF THE INVENTION
Regulation of transgene and viral protein expression is required to increase the safety and efficacy of gene and viral therapies. Delivery and expression of transgenes with anti-cancer activity or the use of conditionally replicating viruses for cancer therapy must be specific for tumors to avoid side effects on healthy tissues. Most efforts to achieve such selective control have been based on the use of tumor- specific promoters and more recently by the engineering of target sites recognizing tissue- specific miRNA. Although both strategies highly contribute to tumor selectivity, it is becoming evident that the post-transcriptional regulation of specific mRNA subpopulations contributes substantially to the broad expression changes of genes responsible for the cancer phenotype. Thus, the translational reprogramming of tumor cells has been proposed as a potential target for tumor specific drugs. These tumor specific translational profiles could, therefore, be used to generate tumor specificity to transgene and viral protein expression.
There is a need for new systems for the selective expression of desired gene in tumor cells. BRIEF DESCRIPTION OF THE INVENTION
The inventors of the present invention have developed a system for the selective expression of a transgene in tumor cells using the tumor reprogramming of CPE- mediated translational regulation. The inventors have engineered a particular CPE arrangement that activates translation in tumor cells while promotes translational repression in non-transformed cells (Figure 1). Additionally, the inventors have generated a modified adenovirus where the expression of the El A protein is regulated by CPEBs to obtain oncoselectivity and attenuated toxicity in non-transformed tissues
(Figure 2). This novel targeting modality increases the therapeutic index of oncolytic adenovirus and provides a new paradigm for its applicability to gene-transfer based therapeutic approaches.
In addition, the polynucleotides generated in the present invention also show extensive stability along successive replication cycles (as shown in figure 9). This extreme stability, which was also unexpected, is also advantageous as it overcomes the limitations of other methods known in the art for tissue-specific expression of target genes using viruses, such as those methods based on tissue-specific destabilization of viral genomes by miRNA target insertion as these methods often accumulate errors over successive replication cycles and generate escape mutants
Thus, in an aspect the invention relates to a nucleic acid construct comprising i. a polynucleotide of interest and
ii. an untranslated sequence in 3' position with respect to the polynucleotide of interest, wherein said untranslated sequence is heterologous with respect to the polynucleotide of interest and wherein said untranslated region a. comprises at least two cytoplasmic polyadenylation elements which are separated by less than 50 nucleotides,
b. comprises a cytoplasmic polyadenylation signal which is separated by less than 100 nucleotides from the first or second cytoplasmic polyadenylation element and
c. does not include an adenylate-uridylate-rich element, wherein the polynucleotide of interest is not a gene encoding the protein luciferin-4-monooxygenase from Photinus pyralis or a gene encoding a fluorescent protein.
In a second aspect, the invention relates to a vector comprising the nucleic acid construct according to the first aspect.
In a third aspect, the invention relates to a viral particle comprising a lentiviral vector or an adenoviral vector according to the second aspect.
In a fourth aspect, the invention relates to an in vitro method for inducing selective expression of a polynucleotide of interest in a tumor cell comprising
i. contacting the tumor cell with the nucleic acid construct according to the first aspect, the vector according to the second aspect or the viral particle
according to the third aspect under suitable conditions for the entry of the nucleic acid construct, vector or viral particle into the tumor cell and ii. maintaining the tumor cell under conditions suitable for the expression of the polynucleotide of interest.
In a fifth aspect, the invention relates to the nucleic acid construct according to the first aspect, the vector according to the second aspect or the viral particle according to the third aspect for use in medicine.
In a sixth aspect, the invention relates to the nucleic acid construct according to the first aspect, the vector according to the second aspect or the viral particle according to the third aspect for use in the treatment of cancer.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1. CPEs containing 3'-UTR confer in vitro oncoselectivity to engineered transgenes. (a) The upper panel shows representative western blots showing CPEB1 and CPEB4 expression in pancreatic primary fibroblasts, normal cells (HPDE) and tumor cells (RWP-1, MIA PaCa-2 and PANC-1). The lower panel shows quantification of CPEB1 and CPEB4 signals normalized to GAPDH. (b) Schematic representation of the assessed 3 '-UTR. Regulatory sequences are indicated. cCPE, consensus CPE; ncPCE, nonconsensus CPE; ARE, AU-rich element, (c) Quantification of relative d2EGFP/dRFP fluorescence intensity levels in cell lines transduced with the indicated lentiviruses and relative to the mean intensity/content of the d2EGFP/dRFP from cells transduced with Lv-WT 3'UTR. Data are shown as mean ± SEM from three independent experiments and were analyzed by a lineal mixed model fit by REML and a Tukey contrast test to assess the significance of the differences. ** < 0.01, *** P < 0.001.
Figure 2. (a) Experimental workflow of the d2EGFP/dRFP expression analysis from the different 3*UTRs in HPDE, RWP-1, PANC-1 and MIA PaCa-2 cells, (b) cBl 3*UTR reduces d2EGFP mRNA in HPDE cells but not in tumoral cells. Quantification of relative d2EGFP/dRFP mRNA levels in the indicated cell lines transduced with the indicated lentiviruses and relative to the mRNA content of d2EGFP/dRFP from Lv-WT
3'UTR transduced cells. Data is shown as mean ± SEM of three independent experiments, * p<0.05.
Figure 3. CPEs in the 3 "-UTR of El A confers in vitro oncoselectivity to adenoviruses. (a) Schematic representation of the whole adenoviral genome with the CPE engineered sites in the El A viral gene, (b) Quantification of El A pre-mRNA and mature mRNA 4 h post-infection (PI) in the indicated cell lines. qPCR data is shown as the mean ± SEM of four independent experiments. * P < 0.05. (c) Schematic representation of the RNA ligation-coupled RT-PCR technique used to assess poly(A) tail lengths, (d) Polyadenylation of El A mRNA 4 h PI in tumor RWP-1, PANC-1 and MIA PaCa-2 cells or in non-tumor HPDE. Retarded migration indicates longer polyadenylation. Adwt C- and AdCPE C- correspond to an RNA mix from non-infected cells amplified with specific primers for Adwt and AdCPE, respectively, (e) Representative El A western blots of pancreatic tumor cells (RWP-1, MIA PaCa-2 and PANC-1) and non- tumor cells (HPDE and fibroblasts) infected with Adwt and AdCPE at 72 h PI. (f) Quantification of viral production in supernatant 72 h PI in tumor (RWP-1, MIA PaCa- 2 and PANC-1) and non-tumor cells (HPDE and pancreatic fibroblasts) infected with Adwt and AdCPE 72h PI. qPCR Data is shown as mean ± SEM of five independent experiments. ** P < 0.01 and *** P < 0.001. (g) Cytotoxicity assay in the indicated cell lines. Half-growth inhibitory concentration (IC50) was calculated for each cell line from dose-response curves. Data are shown as mean ± SEM from five independent experiments. * P < 0.05.
Figure 4. CPEB4 regulates AdCPE E1A expression and viral fitness, (a) Representative western blot of CPEB4 protein downregulation in RWP-1 tumor cells. shNT, non-targeted; sh2 and sh4, two different sh sequences against CPEB-4. (b) Representative western blot of El A expression in RWP-1 shNT and RWP-1 sh4, infected with Adwt and AdCPE 72 h PI. Quantification of the El A signal was normalized to GAPDH and expressed as relative values of AdCPE/Adwt (n = 4). * < 0.05. (c) Quantification of relative viral production (AdCPE/Adwt) in the supernatant of sh4 and shNT RWP-1 infected cells 72 h PI. Data are shown as mean ± SEM from five independent experiments. ** < 0.01. (D) Cytotoxicity assay in sh4
and shNT RWP-1 cells infected with Adwt or AdCPE for 72 h. IC50 was calculated for each cell line from dose-response curves. Data are shown as mean ± SEM from four independent experiments. * P < 0.05. (e) The left panel shows a representative western blot of the E1A protein in non-tumor HPDE cells transduced with a lentivirus expressing CPEB4 (Lv-CPEB4) or a control lentivirus (Lv-empty) and infected with Adwt or AdCPE. E1A content was evaluated 72 h PI. The right panel shows quantification of the El A signal that was normalized to GAPDH and expressed as relative values of AdCPE/Adwt (n = 5). * P < 0.05. (f) Quantification of relative viral genome release in HPDE supernatants from cells transduced with Lv-CPEB4 or Lv- empty and infected with Ad-WT or Ad-cBl for 72 h. Data are shown as mean ± SEM of five independent experiments. *** P < 0.001.
Figure 5. AdCPE triggers strong antitumor activity, (a) Follow-up of tumor volumes in mice bearing RWP-1 xenografts intravenously treated with saline (n = 8) or with a single injection of 2 x 1010 vp/mouse Adwt (n = 8) or of 2 x 1010 vp/mouse AdCPE (n = 8). (b) Follow-up of tumor growth in mice bearing RWP-1 xenografts intravenously treated with saline (n=8) or a single injection of 5 · 1010vp/mouse AdCPE (n=8). (c) AdCPE antitumor activity is similar or slightly superior than that of Adwt. Follow-up of tumor volumes in mice bearing MIA PaCa-2 or PANC-1 xenografts intravenously treated with saline (n=8) or with a single injection of 2 x lOlOvp/mouse Adwt (n=8) or of 2x lOlOvp/mouse AdCPE (n=8). *** p<0.001 (Tukey contrast test on the lineal mixed model fitted by REML).
Figure 6. AdCPE replication is attenuated in mouse tissue and displays reduced toxicity. Adwt and AdCPE were intravenously delivered to wild-type C57BL/6 mice at
2 x 1010 vp/mouse (n = 6 per group). Three days later, animals were sacrificed, and organs were isolated, (b) Representative El A western blot from livers of infected mice.
(c) Quantification of early (El A) and late (hexon and fiber) viral mRNA content in liver, pancreas and kidneys of infected mice by qPCR (n = 6). * P < 0.05; ** P < 0.01. (d) Viral DNA quantification by qPCR in the indicated mice tissues. Data are shown as mean ± SEM (n = 6). * < 0.05. (e) Body weight variation of infected mice.
Differences between slopes were significant (P = 0.036). (f) Representative
macroscopic images of livers from infected mice, (g) Serum transaminases AST and ALT levels. Normal AST and ALT levels in C57BL/6 mice are indicated in dashed lines and correspond to 313.5 IU/L and 69.5 IU/L, respectively. Figure 7. AdCPE and Adwt El A mRNA and viral particles quantification in mice livers, (a) Quantification of El A pre-mRNA and mature mRNA in mice livers 4h post- viral administration. qPCR data is shown as mean ± SEM of four independent experiments * p<0.05. (b) Viral DNA quantification by qPCR in mice livers 4h post- viral administration.
Figure 8. AdCPE replication is attenuated in primary human hepatocytes. (a) Representative western blot of human hepatocytes infected with Adwt or AdCPE at 72 h PI. El A signal has been normalized to GAPDH and expressed relative to Adwt values. (n=5). *p<0.05. (b) Quantification of relative viral production (AdCPE / Adwt) in the supernatant of human hepatocytes at 72 h PI. Data is shown as mean ± SEM of five independent biological replicates. * p<0.01 (2-tailed Mann- Whitney test).
Figure 9. CPE elements in the El A 3'UTR of AdCPE remain stable after 20 consecutive viral replicative cycles. Sanger sequencing representation and sequence alignment of the El A 3'UTR of AdCPE, between the purified virus and AdCPE isolated after 20 consecutive replicative cycles in HPDE (H) and RWP-1 (R) cells.
Figure 10. AdDUC dual ElA-regulated virus with the uPAR promoter and the CPE elements display an oncoselective additive effect. qPCR quantification of viral particles in the supernatant of tumoral RWP-1 and non-tumoral HPDE cells at 72 h PI. Data is shown as mean ± SEM of five independent biological replicates. ** p<0.01 (one sample t-test).
DETAILED DESCRIPTION OF THE INVENTION
Nucleic acid constructs of the invention
In a first aspect, the invention relates to a nucleic acid construct comprising i. a polynucleotide of interest and
ii. an untranslated sequence in 3' position with respect to the polynucleotide of interest, wherein said untranslated sequence is heterologous with respect to the polynucleotide of interest and wherein said untranslated region a. comprises at least two cytoplasmic polyadenylation elements which are separated by less than 50 nucleotides,
b. comprises a cytoplasmic polyadenylation signal which is separated by less than 100 nucleotides from the first or second cytoplasmic polyadenylation element and
c. does not include an adenylate-uridylate-rich element, wherein the polynucleotide of interest is not a gene encoding the protein luciferin-4-monooxygenase from Photinus pyralis or a gene encoding a fluorescent protein.
The term "nucleic acid construct" refers to a man-made nucleic acid molecule resulting from the use of recombinant DNA technology. A nucleic acid construct is a nucleic acid molecule, either single- or double-stranded, which has been modified to contain segments of nucleic acids, which are combined and juxtaposed in a manner, which would not otherwise exist in nature. A nucleic acid construct usually is a "vector", i.e. a nucleic acid molecule which is used to deliver exogenously created DNA into a host cell.
The term "untranslated sequence in 3' position with respect to the polynucleotide of interest" or "3' UTR" refers to an untranslated region which appears after the stop codon.
The term "heterologous with respect to the polynucleotide of interest" means that the 3'UTR sequence is not naturally found in association with said polynucleotide.
The 3'UTR of the nucleic acid construct of the first aspect:
a. comprises at least two cytoplasmic polyadenylation elements which are separated by less than 50 nucleotides,
b. comprises a citoplasmic polyadenylation signal which is separated by less than 100 nucleotides from the second cytoplasmic polyadenylation element and
c. does not include an adenylate-uridylate-rich element.
The term "cytoplasmic polyadenylation element" or "CPE", as used herein, refers to a sequence which is found in the 3'UTR of messenger RNAs. CPEs usually have the sequence 5'-UUUUAi_2U-3' (also called consensus sequence), although other variants are possible, for example, non-consensus sequences: UUUUACU, UUUCAU and UUUUCCU. CPE are bound by CPE binding proteins (CPEBs), which promotes the extension of the existing polyadenylation tail and, in general, the translation of the mRNA. The skilled person can determine if a particular sequence is a CPE by the method described by Pique et al (Cell 2008, 132(3): 434-48).
In a particular embodiment, the first CPE has the consensus sequence 5'- UUUUAi_2U-3' when the nucleic acid construct is an RNA molecule. When the nucleic acid construct is a DNA molecule, then the CPE comprises a sequence which, when transcribed, results in the above sequence".
In a particular embodiment, the second CPE has the consensus sequence 5'- UUUUAi_2U-3' when the nucleic acid construct is an RNA molecule. When the nucleic acid construct is a DNA molecule, then the CPE comprises the sequence which, when transcribed, results in the above sequence.
In a particular embodiment, the first and second CPE has the consensus sequences 5'-UUUUAi_2U-3' when the nucleic acid construct is a RNA molecule. When the nucleic acid construct is a DNA molecule, then the CPE comprises the sequence which, when transcribed, results in the above sequence.
In a more particular embodiment, the first CPE has the consensus sequence 5'- UUUUUAA-3*.
In a more particular embodiment, the second CPE has the consensus sequence 5*-UUUUAAU-3*.
In an even more particular embodiment, the first CPE has the consensus sequence 5'-UUUUUAA-3' and the second CPE has the consensus sequence 5'- UUUUAAU-3' when the nucleic acid construct is a RNA molecule or, when the nucleic acid construct is a DNA molecule, a sequence that, when transcribed, results in the above sequence.
In a particular embodiment, the 3'UTR of the polynucleotide of the invention further comprises a third CPE. In a more particular embodiment, the third CPE has a non-consensus sequence. In an even more particular embodiment, the third CPE has the
non-consensus sequence 5'-UUUUACU-3' when the nucleic acid construct is a R A molecule or, when the nucleic acid construct is a DNA molecule, a sequence that, when transcribed, results in the above sequence.
In a particular embodiment, the third CPE is located in a 3' position with respect to the first CPE but in a 5' position with respect to the cytoplasmic polyadenylation signal. In another particular embodiment, the third CPE is located in a 5' position with respect to the first CPE and to the cytoplasmic polyadenylation signal. In another particular embodiment, the third CPE is located between the first and second CPE and in a 3' position with respect to the cytoplasmic polyadenylation signal.
In a particular embodiment, the first CPE has the consensus sequence 5'-
UUUUUAA-3', the second CPE has the consensus sequence 5'-UUUUAAU-3' and the 3'UTR further comprises a third CPE with the non-consensus sequence 5'-UUUUACU- 3' when the nucleic acid construct is a RNA molecule or, when the nucleic acid construct is a DNA molecule, a sequence that, when transcribed, results in the above sequence.
When the nucleic acid construct is a RNA molecule, said nucleic acid construct further comprises a polyadenine tail.
The 3'UTR of the nucleic acid construct of the first aspect comprises a cytoplasmic polyadenylation signal which is separated by less than 100 nucleotides from the second CPE. The term "cytoplasmic polyadenylation signal", as used herein, refers to a nucleic acid sequence which is present in the 3'UTR of mRNA and promotes the cytoplasmic polyadenlylation of the mRNA. In a particular embodiment, the cytoplasmic polyadenylation signal is the hexanucleotide AAUAAA.
The expression "separated by less than 100 nucleotides from the first or second CPE" means that the number of nucleotides between the last nucleotide of the first or second CPE and the first nucleotide of the cytoplasmic polyadenylation signal is less than 100 nucleotides. In a particular embodiment, the number of nucleotides between the first or second CPE and the cytoplasmic polyadenylation signal is less than 90, less than 80, less than 70, less than 60, less than 50, less than 40, less than 30, less than 20, less than 10, less than 5 nucleotides. In a more particular embodiment, the distance between the first or second CPE and the cytoplasmic polyadenylation signal is 25 nucleotides. In particular embodiment, there is no nucleotide between the second CPE
and the cytoplasmic polyadenylation signal. In another particular embodiment, the second CPE and the cytoplasmic polyadenylation signal partially overlap.
In a particular embodiment, the cytoplasmic polyadenylation signal is located in a 3' position with respect to the first and second CPE.
In another embodiment, the second cytoplasmic polyadenylation element can overlap with the cytoplasmic polyadenylation signal. In a particular embodiment, the second CPE overlaps at least one, at least 2, at least 3, at least 4, at least 5, or at least 6 nucleotides with the cytoplasmic polyadenylation signal.
In another particular embodiment, when the 3 'UTR comprises a third CPE, the cytoplasmic polyadenlylation signal is located in a 3' position with respect to the third CPE.
The 3'UTR of the nucleic acid construct of the first aspect does not include an adenylate-urydilate-rich element. The term " adenylate-uridyl ate-rich element" or "AU- rich element" or "ARE", as used herein, refers to a nucleic acid sequence found in the 3' UTR regions of many messenger RNAs which is rich in adenine and uridine bases and which opposes CPE-mediated polyadenylation. AREs can be divided in three classes:
• Class I AREs have a core sequence of AUUUA within or near uridine rich regions. Example of class I AREs is the ARE of the c-fos gene.
• Class II AREs have overlapping AUUUA motifs within or near uridine rich regions. Example of class II AREs is the ARE of the GM-CSF gene.
• Class III AREs have uridine rich regions but no AUUUA motifs. Example of class III AREs is the ARE of the c-jun gene.
The skilled person can determine if a particular nucleic acid sequence is an ARE by means of the assay described by Patrucco et al, RNA Biology 2015, 12 (12): 1289- 300.
In a particular embodiment, the AU-rich element is not 5' with respect to the first CPE. In another embodiment, the AU-rich element is not between the first and second CPE. In another embodiment, the AU-rich element is not between the second CPE and the cytoplasmic polyadenylation signal. In another element, the AU-rich element is not 3' with respect to the cytoplasmic polyadenylation signal.
In a particular embodiment, the 3'UTR of the nucleic acid construct of the first aspect does not include the ARE of the 3'UTR from the TNF-a gene. In another
particular embodiment, the 3'UTR of the nucleic acid construct of the firs aspect does not include the ARE of the 3'UTR of the tissue plasminogen activator (tPA).
In a particular embodiment, the 3'UTR of the nucleic acid construct of the invention comprises, from 5' to 3': a first CPE, a third CPE, a second CEP and a cytoplasmic polyadenylation signal.
In a particular embodiment, the 3'UTR of the nucleic acid construct of the invention has the nucleotide sequence of SEQ ID NO: 1 when said nucleic acid is a RNA molecule or, if the nucleic acid construct is a DNA molecule, a sequence that, once transcribed, results in SEQ ID NO: 1, or a functionally equivalent variant thereof. The term "functionally equivalent variant", as used herein, refers to a nucleic acid sequence which derives from the sequence of SEQ ID NO: 1 by insertion, deletion or substitution of one or more nucleotides and which substantially preserves the functional activity of the original sequence. Suitable variants encompassed within the present invention include those nucleic acid sequences showing at least 99%, at least 98%>, at least 97%, at least 96%, at least 95%, at least 94%, at least 93%, at least 92%, at least 92%, at least 91%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 65%o, at least 60%> or less identity with the sequence of SEQ ID NO: 1. Suitable methods for determining the identity of two nucleic acid sequences are known by the skilled person, for example those methods that use computer algorithms well known to persons having ordinary skill in the art. Such algorithms include Align or the BLAST algorithm (see, e.g., Altschul, J. Mol. Biol. 219:555-565, 1991; Henikoff and Henikoff, Proc. Natl. Acad. Sci. USA 89: 10915-10919, 1992), which are available at the NCBI website (see [online] Internet at ncbi.nlm.nih.gov/cgi-bin/BLAST). Default parameters may be used. In addition, standard software programs are available, such as those included in the LASERGENE bio informatics computing suite (DNASTAR, Inc., Madison, Wis.); CLUSTALW program (Thompson et al, Nucleic Acids Res. 22:4673- 80 (1991)); and "GeneDoc" (Nicholas et al, EMBNEW News 4: 14 (1991)). Other methods for comparing two nucleic acid sequences by determining optimal alignment are practiced by persons having skill in the art (see, for example, Peruski and Peruski, The Internet and the New Biology: Tools for Genomic and Molecular Research (ASM Press, Inc. 1997); Wu et al. (eds.), "Information Superhighway and Computer Databases of Nucleic Acids and Proteins," in Methods in Gene Biotechnology, pages 123-151
(CRC Press, Inc. 1997); and Bishop (ed.), Guide to Human Genome Computing, 2nd Ed. (Academic Press, Inc. 1998)).
The expression "substantially preserves the functional activity of the original sequence", as used herein, refers to nucleic acid sequences which are capable of promoting both translational repression by unphosphorylated CPEBl and translational activation by CPEB4, as described in the examples below. Thus, a nucleic acid sequence is considered as a functionally equivalent to sequence of SEQ ID NO: 1 if it shows at least 100%, at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%>, at least 65%, at least 60%> or at least 50%> of the activity of the sequence of SEQ ID NO: 1.
The term "polynucleotide of interest", as used herein, refers to any polynucleotide whose expression in a cell is desirable. The polynucleotide of interest of the nucleic acid construct of the first aspect is not a gene encoding luciferin-4- monooxygenase from Photinus pyralis or a gene encoding a fluorescent protein.
The term "luciferin-4-monooxygenase from Photinus pyralis" refers to a protein with the sequence identified by the UniProtKB/Swiss-Prot accession number P08659 (Uniprot version 101 as of 14 October 2015).
The term "fluorescent protein" refers to a polypeptide with the capacity to emit light in response to the absorption of light or other electromagnetic radiation. Non- limiting illustrative examples of fluorescent proteins are green fluorescent protein (GFP or wtGFP), GFP variants for different emission wavelengths, emission intensity and/or protein stability such as Superfolder GFP, EGFP variants for different emission wavelengths (colors) such as blue fluorescent protein (EBFP), cyan fluorescent protein (ECFP), and yellow fluorescent protein (YFP), GFPuv (characterized by having mutations F99S, M153T and V163A in the GFP sequence), Emerald, mPlum, mCherry, tdTomato, mStrawberry, J-Red, mOrange, mKO, YFP, EYFP, mCitrine, Venus, YPet, CyPet, CFP, ECFP, mCFPm, Cerulean, and T-Sapphire. Other fluorescent polypeptides include red fluorescent protein (RFP), DsRed and variants thereof, DsRed2, DsRed- Express, RedStar, HcRedl, Kaede, EosFP, and Kindling fluorescent protein (KFP).
As it is used herein, the term "green fluorescent protein" or "GFP" refers to a protein consisting of 239 amino acids with a molecular weight of 26.9 kDa and showing bright green fluorescence when exposed to blue ultraviolet light. Although many other
marine organisms have similar green fluorescent proteins, GFP traditionally refers to the first protein isolated from jellyfish A. victoria. A. victoria GFP has a major excitation maximum at a wavelength of 395 nm and a minor one at 475 nm. The emission maximum thereof is at 509 nm. The fluorescence quantum yield of GFP is 0.79. In A. victoria, GFP transduces blue chemiluminescence of aequorin to green fluorescent light by means of energy transfer.
In a particular embodiment, the polynucleotide of interest is not a gene encoding the 2dEGF, a EGFP protein modified by destabilizaton with 422-461 residues of mouse ornithine decarboxylase giving an in vivo half-life of 2 hours.
In a particular embodiment, the polynucleotide of interest is selected from the group consisting of:
• a gene encoding a polypeptide selected from the group consisting of a cytotoxic polypeptide, an antiangiogenic polypeptide, a polypeptide encoded by a tumor suppressor gene, a polypeptide which is capable of activating the immune response towards the cell expressing said polypeptide, a polypeptide which is capable of activating the production of a cytopathic virus; and
• a polynucleotide which once transcribed gives rise to a R A capable of modulating the expression of a target gene.
As used herein, the term "cytotoxic polypeptide" refers to an agent that is capable of inhibiting cell function. The agent may inhibit proliferation or may be toxic to cells. Any polypeptide that when internalized by a cell interfere with or detrimentally alter cellular metabolism or in any manner inhibit cell growth or proliferation are included within the ambit of this term, including, but are not limited to, agents whose toxic effects are mediated when transported into the cell and also those whose toxic effects are mediated at the cell surface. Useful cytotoxic polypeptides include proteinaceous toxins and bacterial toxins.
Examples of proteinaceous cell toxins useful for incorporation into the conjugates according to the invention include, but are not limited to, type one and type two ribosome inactivating proteins (RIP). Useful type one plant RIPs include, but are not limited to, dianthin 30, dianthin 32, lychnin, saporins 1-9, pokeweed activated protein (PAP), PAP II, PAP-R, PAP-S, PAP-C, mapalmin, dodecandrin, bryodin-L, bryodin, Colicin 1 and 2, luffin-A, luffin-B, luffin-S, 19K-protein synthesis inhibitory
protein (PSI), 15K-PSI, 9K-PSI, alpha-kirilowin, beta-kirilowin, gelonin, momordin, momordin-II, momordin-Ic, MAP-30, alpha-momorcharin, beta-momorcharin, trichosanthin, TAP-29, trichokirin; barley RIP; flax RIP, tritin, corn RIP, Asparin 1 and 2 (Stirpe et al, Bio/Technology 10:405-12, 1992). Useful type two RIPs include, but are not limited to, volkensin, ricin, nigrin-b, CIP-29, abrin, modeccin, ebulitin- [alpha], ebulitin-[beta], ebultin- [gamma], vircumin, porrectin, as well as the biologically active enzymatic subunits thereof (Stirpe et al, Bio/Technology 10:405-12, 1992; Pastan et al, Annu. Rev. Biochem. 61 :331-54; Brinkmann and Pastan, Biochim. et Biophys. Acta 1198:27-45, 1994; and Sandvig and Van Deurs, Physiol. Rev. 76:949-66, 1996).
Examples of bacterial toxins useful as cell toxins include, but are not limited to, shiga toxin and shiga-like toxins (i.e., toxins that have the same activity or structure), as well as the catalytic subunits and biologically functional fragments thereof. These bacterial toxins are also type two RIPs (Sandvig and Van Deurs, Physiol. Rev. 76:949- 66, 1996; Armstrong, J. Infect. Dis., 171 : 1042-5, 1995; Kim et al, Microbiol. Immunol. 41 :805-8, 1997, and Skinner et al, Microb. Pathog. 24: 117-22, 1998). Additional examples of useful bacterial toxins include, but are not limited to, Pseudomonas exotoxin and Diphtheria toxin (Pastan et al, Annu. Rev. Biochem. 61 :331-54; and Brinkmann and Pastan, Biochim. et Biophys. Acta 1198:27-45, 1994). Truncated forms and mutants of the toxin enzymatic subunits also can be used as a cell toxin moiety (Pastan et al., Annu. Rev. Biochem. 61 :331-54; Brinkmann and Pastan, Biochim. et Biophys. Acta 1198:27-45, 1994; Mesri et al, J. Biol. Chem. 268:4852-62, 1993; Skinner et al, Microb. Pathog. 24: 117-22, 1998; and U.S. Pat. No. 5,082,927). Other targeted agents include, but are not limited to the more than 34 described Colicin family of RNase toxins which include colicins A, B, D, El -9, cloacin DF13 and the fungal RNase, [alpha] -sarcin (Ogawa et al. Science 283: 2097-100, 1999; Smarda et al, Folia Microbiol (Praha) 43:563-82, 1998; Wool et al, Trends Biochem. Sci., 17: 266-69, 1992).
Proliferation of tumor cells relies heavily on extensive tumor vascularization, which accompanies cancer progression. Thus, inhibition of new blood vessel formation with anti-angiogenic agents and targeted destruction of existing blood vessels have been introduced as an effective and relatively non-toxic approach to tumor treatment.
The term "antiangiogenic polypeptide", as used herein, denotes a polypeptide capable of inhibiting angiogenesis. Suitable antiangiogenic polypeptides include, without limitation, angiostatin, endostatin, anti-angiogenic anti-thrombin III, sFRP- 4 as described in WO2007115376, an anti-VEGF antibody such as anibizumab, bevacizumab (avastin), Fab IMC 1121 and F200 Fab.
As used herein, a "tumor suppressor" is a gene or gene product that has a normal biological role of restraining unregulated growth of a cell. The functional counterpart to a tumor suppressor is an oncogene. Genes that promote normal cell growth may be known as "protooncogenes". A mutation that activates such a gene or gene product further converts it to an "oncogene", which continues the cell growth activity, but in a dysregulated manner. Examples of tumor suppressor genes and gene products are well known in the literature and may include PTC, BRCA1, BRCA2, pi 6, APC, RB, WT1, EXT1, p53, NF1, TSC2, NF2, VHL, ST7, ST14, PTEN, APC, CD95 or SPARC.
The term "polypeptide which is capable of activating the immune response towards the cell expressing said polypeptide" include any immunostimulatory polypeptide agent such as flagellin, muramyl dipeptide), cytokines including interleukins (e.g., IL-2, IL-7, IL- 15 (or superagonist/mutant forms of these cytokines), IL-12, IFN-gamma, IFN-alpha, GM-CSF, FLT3-ligand, etc.), immunostimulatory antibodies (e.g., anti-CTLA-4, anti-CD28, anti-CD3, or single chain/antibody fragments of these molecules), and the like.
The term "a polypeptide which is capable of activating the production of a cytopathic virus" refers to a polypeptide which promotes the production of a virus which upon infection of a cell causes the lysis of the cell or the death of the cell due to an inability to reproduce. Illustrative non limitative examples of polypeptides that are capable activating the production of a cytopathic virus are the polypeptides encoded by the EIA and E4 transcription units from adenovirus, the B5R glycoprotein of vaccinia virus and the ICP4 protein from Herpes simplex virus- 1. In a particular embodiment, the polypeptide which is capable of activating the production of a cytopathic virus is the polypeptide encoded by the EIA gene from an adenovirus. The term "EIA gene from an adenovirus", or adenovirus early region 1 A", as used herein, refers to a gene expressed during adenovirus replication to produce five protein products translated from its two major, differentially spliced mRNAs, being the most relevant: the 289R protein,
encoded by the 13S mRNA, and the 243R protein, translated from the 12S mRNA, which lacks 46 amino acids present in the larger protein. The 289R protein can transcriptionally activate all of the early viral genes, as well as several host genes, and this activity requires its unique 46-amino-acid domain. The 243R protein can induce transcription of certain host cell genes, and in cooperation with cyclic AMP, it can efficiently induce both viral and cellular transcription units.
The term "adenovirus" refers to any virus pertaining to the Adenoviridae family characterized by being a non-enveloped virus with an pseudo-icosahedral nucleocapsid containing a double stranded DNA genome. This term includes any adenovirus capable of infecting a human or an animal, including all groups, subgroups, and serotypes that use CAR, CD46 or desmoglein-2 as receptor for infection of target cells. The term adenovirus includes, without limitation, avian, canine, equine, bovine, ovine, porcine, human or frog adenovirus. In a particular embodiment, the adenovirus is a human adenovirus, i.e. an adenovirus capable of infecting humans. A "serotype" is each of the immunologically different types of adenovirus. There are at least 57 serotypes of human adenovirus that are classified into several subgroups (A to G). In a more particular embodiment, the adenovirus is a type 5 adenovirus or serotype 5 adenovirus. The El A protein from a type 5 adenovirus is the protein identified by the UniProtKB/Swiss-Prot accession number P03255 (Uniprot version 112 as of 20 January 2016).
In another particular embodiment, the polynucleotide of interest is a polynucleotide that once transcribed gives rise to a RNA capable of modulating the expression of a target gene. Examples of said polynucleotides are polynucleotides that once transcribed generate an RNA which is capable of inhibiting the expression of a target gene, such us a microRNA (miRNA), a small interfering (siRNA) or a short hairpin RNA (shRNA).
In a second aspect, the invention relates to nucleic acid construct comprising i. a polynucleotide of interest and
ii. an untranslated sequence in 3' position with respect to the polynucleotide of interest, wherein said untranslated sequence
a. comprises at least two cytoplasmic polyadenylation elements which are separated by less than 50 nucleotides,
b. comprises a cytoplasmic polyadenylation signal which is separated by less than 100 nucleotides from the first or second cytoplasmic polyadenylation element and
c. wherein the untranslated sequence does not include an adenylate- uridylate-rich element,
wherein the polynucleotide of interest is not a gene encoding the protein luciferin-4- monooxygenase from Photinus pyralis or a gene encoding a fluorescent protein and wherein the polynucleotide of interest is a reporter gene.
The term "reporter gene", as used herein, refers to a gene which allows identifying those cells that have been incorporated the nucleic acid construct after having been put in contact with it. Useful reporter genes in the context of the present invention include lacZ, thymidine kinase, and the like.
All the definitions, particulars and preferred embodiments of the first aspect apply to the second aspect.
Vector, viral particle, cell and pharmaceutical composition of the invention
In a third aspect, the invention relates to a vector comprising the nucleic acid construct of the first or second aspect.
The term "vector", as used herein, refers to a construct capable of delivering, and preferably additionally expressing, one or more polynucleotides of interest into a host cell. Examples of vectors include, but are not limited to, viral vectors, naked DNA or RNA expression vectors, plasmid, cosmid or phage vectors, DNA or RNA expression vectors associated with cationic condensing agents, DNA or RNA expression vectors encapsulated in liposomes, and certain eukaryotic cells, such as producer cells. This term also relates to targeting constructs which allow for random or site-directed integration of the targeting construct into genomic DNA. Such targeting constructs, preferably, comprise DNA of sufficient length for either homologous recombination or heterologous integration.
In a particular embodiment, the vector is an expression vector. The term "expression vector" refers to a replicative DNA construct used for expressing the nucleic acid construct of the invention in a cell, preferably a eukaryotic cell, more preferably a mammalian cell. The expression vector also preferably contains an origin
of replication in prokaryotes, necessary for vector propagation in bacteria. Additionally, the expression vector can also contain a selection gene for bacteria, for example, a gene encoding a protein conferring resistance to an antibiotic, for example, ampicillin, kanamycin, chloramphenicol, etc. The expression vector can also contain one or more multiple cloning sites.
In a more particular embodiment, the expression vector is a lentiviral vector or an adenoviral vector.
The term "lentiviral vector", as used herein, refers to a vector based on a group (or scientific genus) of retroviruses that in nature give rise to slowly developing disease due to their ability to incorporate into a host genome. Modified lentiviral genomes are useful as viral vectors for the delivery of a nucleic acid sequence to a cell. An advantage of lentiviruses for infection of cells is the ability for sustained transgene expression. These viruses include in particular Human Immunodeficiency Virus type 1 (HIV-1), Human Immunodeficiency Virus type 2 (HIV-2), Simian Immunodeficiency Virus (SIV), Feline Immunodeficiency Virus (FIV), Equine Infectious Anaemia Virus (EIAV), Bovine Immunodeficiency Virus (BIV), Visna Virus of sheep (VISNA) and Caprine Arthritis-Encephalitis Virus (CAEV). Recombinant lentiviral vectors are capable of infecting non-dividing cells and can be used for both in vivo and ex vivo gene transfer and expression of nucleic acid sequences. For example, recombinant lentivirus capable of infecting a non-dividing cell wherein a suitable host cell is transfected with two or more vectors carrying the packaging functions, namely gag, pol and env, as well as rev and tat is described in U.S. Pat. No. 5,994,136, incorporated herein by reference. One may target the recombinant virus by linkage of the envelope protein with an antibody or a particular ligand for targeting to a receptor of a particular cell-type. By inserting a sequence (including a regulatory region) of interest into the viral vector, along with another gene which encodes the ligand for a receptor on a specific target cell, for example, the vector is now target-specific. The lentiviral vectors according to the invention may be genetically modified in such a way that certain genes constituting the native infectious virus are eliminated and replaced with a nucleic acid sequence of interest to be introduced into the target cells.
The term "adenoviral vector", as used herein, refers to a vector based on an adenovirus, which has been previously defined.
In another embodiment, the viral vector is a vector based on a virus or the Parvoviridae family, preferably from the Parvovirinae subfamily, more preferably from the Dependoparvovirus genus, and yet even more preferably an adeno-associated virus.
As used herein, the term "adeno-associated virus" (AAV) includes any AAV serotype. Generally, the AAV serotypes have genomic sequences of significant homology at the amino acid and the nucleic acid levels, provide an identical set of genetic functions, produce virions which are essentially physically and functionally equivalent, and can be engineered to express transgenes that require tissue-specific regulation. In particular, the invention may be carried out using to AAV serotype 1 (AAV1), AAV2, AAV3 (including types 3 A and 3B), AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, and any other AAV now known or later discovered. See, e.g., Fields et al, Virology, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers). Recently, a number of putative new AAV serotypes and clades have been identified (see, e.g., Gao et al, (2004) J. Virology 78:6381-6388; Moris et al, (2004) Virology 33-:375-383; and Table 1). The genomic sequences of the various serotypes of AAV and the autonomous parvoviruses, as well as the sequences of the terminal repeats, Rep proteins, and capsid subunits are known in the art. Such sequences may be found in the literature or in public databases such as GenBank. See, e.g., GenBank Accession Numbers NC_002077, NC_001401, NC_001729, NC_001863, NC_001829, NC_001862, NC_000883, NC 001701, NC 001510, NC 006152, NC 006261, AF063497, U89790, AF043303, AF028705, AF028704, J02275, J01901, J02275, X01457, AF288061, AH009962, AY028226, AY028223, NC_001358, NC_001540, AF513851, AF513852, AY530579; the disclosures of which are incorporated by reference herein for teaching parvovirus and AAV nucleic acid and amino acid sequences. See also, e.g., Srivistava et al, (1983) J. Virology 45:555; Chiorini et al, (1998) J. Virology 71 :6823; Chiorini et al„ (1999) J. Virology 73: 1309; Bantel-Schaal et al, (1999) J. Virology 73:939; Xiao et al, (1999) J. Virology 73:3994; Muramatsu et al, (1996) Virology 221 : 208; Shade et al, (1986) J. Virol. 58:921; Gao et al, (2002) Proc. Nat. Acad. Sci. USA 99: 11854; Moris et al, (2004) Virology 33-: 375-383; international patent publications WO 00/28061, WO 99/61601, WO 98/11244; and U.S. Patent No. 6,156,303; the disclosures of which are
incorporated by reference herein for teaching parvovirus and AAV nucleic acid and amino acid sequences.
In yet another embodiment, the viral vector is a vector based on a virus of the Reoviridae family. In yet another embodiment, the viral vector is a vector based on a virus of the Picornaviridae family, preferably from the enterovirus genus, more preferably a Coxsackievirus and even more preferably on a Coxsackievirus A21 virus. In a fourth aspect, the invention relates to a viral particle comprising the lentiviral vector or adenoviral vector of the third aspect.
The term "viral particle", or "virion" as used herein, refers to a whole viral particle and not to a protein subunit or peptide. Viral particles consist of two or three parts: the genetic material of the virus made from either DNA or RNA; a protein coat that protects these genes; and, in some cases, an envelope of lipids that surrounds the protein coat when they are outside a cell. The shape of the viral particle ranges from simple helical and icosahedral forms to more complex structures, depending on the virus.
In a fifth aspect, the invention relates to a cell comprising the nucleic acid construct of the first or second aspect or the vector of the third aspect.
The cell can be of any origin. In a particular embodiment, the cell is a eukaryotic cell. In a more particular embodiment, the cell is a mammal cell. In an even more particular embodiment, the cell is a human cell.
In a sixth aspect, the invention relates to a pharmaceutical composition comprising the nucleic acid construct of the first aspect, or a vector, viral particle or cell comprising said nucleic acid construct and a pharmaceutically acceptable carrier.
The term "pharmaceutical composition", as used herein, refers to a composition comprising a therapeutically effective amount of the nucleic acid construct according to the present invention (or the vector, viral particle or cell comprising said nucleic acid construct) and at least one pharmaceutically acceptable excipient. Pharmaceutical compositions according to the invention can be prepared, for instance, as injectables such as liquid solutions, suspensions, and emulsions.
The terms "pharmaceutically acceptable excipient", or "pharmaceutically acceptable carrier," "pharmaceutically acceptable diluent,", or "pharmaceutically acceptable vehicle," used interchangeably herein, refer to a non-toxic solid, semisolid or
liquid filler, diluent, encapsulating material or formulation auxiliary of any conventional type. A pharmaceutically acceptable carrier is essentially non-toxic to recipients at the dosages and concentrations employed, and is compatible with other ingredients of the formulation. Suitable carriers include, but are not limited to water, dextrose, glycerol, saline, ethanol, and combinations thereof. The carrier can contain additional agents such as wetting or emulsifying agents, pH buffering agents, or adjuvants which enhance the effectiveness of the formulation. Adjuvants could be selected from the group consisting of sterile liquids, such as water and oils, including those of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, and similars. Water or saline aqueous solutions and aqueous dextrose and glycerol solutions, particularly for injectable solutions, are preferably used as vehicles. Suitable pharmaceutical vehicles are described in "Remington's Pharmaceutical Sciences" by E.W. Martin, 21st Edition, 2005.
The term "therapeutically effective amount", as used herein in relation to the nucleic acid construct according to the present invention (or the vector, viral particle or cell comprising said nucleic acid construct) comprised by the pharmaceutical composition of the invention, relates to the sufficient amount of nucleic acid construct according to the present invention (or the vector, viral particle or cell comprising said nucleic acid construct) to provide the desired effect, i.e. to achieve an appreciable prevention, cure, delay, reduction of severity or amelioration of one or more symptoms derived from a disease, and will generally be determined by, among other causes, the characteristics of the agent itself and the therapeutic effect to be achieved. It will also depend on the subject to be treated, the severity of the disease suffered by said subject, the chosen dosage form, etc. For this reason, the doses mentioned in this invention must be considered only as guides for the person skilled in the art, who must adjust the doses depending on the aforementioned variables. In an embodiment, the effective amount produces the amelioration of one or more symptoms of the disease that is being treated.
Those skilled in the art are familiar with the principles and procedures discussed in widely known and available sources as Remington's Pharmaceutical Science (17th Ed., Mack Publishing Co., Easton, Pa., 1985) and Goodman and Gilman's The Pharmaceutical Basis of Therapeutics (8th Ed., Pergamon Press, Elmsford, N.Y., 1990).
In a preferred embodiment of the present invention, the compounds of the composition of the invention are formulated in accordance with standard procedure as a pharmaceutical composition adapted for delivered administration to human beings and other mammals. Typically, compositions for intravenous or intraventricular administration are solutions in sterile isotonic aqueous buffer.
The pharmaceutical compositions containing the compounds according to the invention can occur at any pharmaceutical form of administration considered appropriate for the selected administration route, for example, by systemic, oral, parenteral, intradermal, subcutaneous, intramuscular, intravenous or topical administration, for which it will include the pharmaceutically acceptable excipients necessary for formulation of the desired method of administration.
The effective quantity of the compounds of the invention can vary within a wide range and, in general, will vary depending on the particular circumstances of application, duration of the exposure and other considerations.
Injectable preparations, for example, aqueous or oleaginous suspensions, sterile injectable may be formulated according with the technique known using suitable dispersing agents, wetting agents and/or suspending agents. Among the acceptable vehicles and solvents that can be used are water, Ringer's solution and isotonic sodium chloride solution. Sterile oils are also conventionally used as solvents or suspending media.
Several drug delivery systems are known and can be used to administer the compounds or compositions of the invention, including, for example, encapsulation in liposomes, microbubbles, emulsions, microparticles, microcapsules and similars. The required dosage can be administered as a single unit or in a sustained release form.
Sustainable-release forms and appropriate materials and methods for their preparation are described in, for example, "Modified-Release Drug Delivery Technology", Rathbone, M. J. Hadgraft, J. and Roberts, M. S. (eds.), Marcel Dekker, Inc., New York (2002), "Handbook of Pharmaceutical Controlled Release Technology", Wise, D. L. (ed.), Marcel Dekker, Inc. New York, (2000).
Even though individual needs vary, determination of optimal ranges for effective amounts of the compound of the invention belongs to the common experience of those experts in the art. In general, the dosage needed to provide an effective amount of such
compound, which can be adjusted by one expert in the art will vary depending on age, health, fitness, sex, diet, weight, degree of alteration of the receptor, frequency of treatment and the nature and extent of impairment or illness, medical condition of the patient, route of administration, pharmacological considerations such as activity, efficacy, pharmacokinetic and toxicology profile of the particular compound used, if using a system drug delivery, and if the compound is administered as part of a combination of drugs.
In vitro method for inducing selective expression of a polynucleotide of interest in a tumor cell
In a seventh aspect, the invention relates to an in vitro method for inducing selective expression of a polynucleotide of interest in a tumor cell comprising i. contacting the tumor cell with the nucleic acid construct according to the first or second aspect, the vector according to any the third aspect or the viral particle according to the fourth aspect under suitable conditions for the entry of the nucleic acid construct, vector or viral particle into the tumor cell and
ii. maintaining the tumor cell under conditions suitable for the expression of the polynucleotide of interest.
All the definitions and preferred and particular embodiments of the first, second, third, and fourth aspects of the invention apply to the seventh aspect of the invention.
As it is used herein, the term "in vitro" refers to the fact that the method is not carried out on the body of a human or animal subject, but rather on cells isolated from said subject.
The term "tumor cell", as used herein, refers to a cell that can grow and divide at an unregulated, quick pace. Tumor cells can be identified by methods well known by the person skilled in the art, for example by using specific antibodies able to recognize specific tumoral markers such as EpCAM, Her 2, CK19 or PSA.
In a particular embodiment, the tumor cell expresses increased levels of CPEB4 and decreased levels of non-phosphorylated CPEB1 compared to a reference sample.
The term "CPEB4" or "cytoplasmic polyadenylation element binding protein 4" refers to a RNA binding protein which in humans has the sequence identified by the
UniProtKB/Swiss-Prot accession number Q17RY0 (Uniprot version 85 as of 20 January 2016).
The term "CPEB1 " or "cytoplasmic polyadenylation element binding protein 1" refers to a RNA binding protein which in humans has the sequence identified by the UniProtKB/Swiss-Prot accession number Q9BZB8 (Uniprot version 119 as of 20 January 2016).
The expression "level of CPEB4" refers to the level of the protein. The level of a protein can be determined by any method known in the art suitable for the determination and quantification of a protein in a sample. By way of a non-limiting illustration, the level of a protein can be determined by means of a technique which comprises the use of antibodies with the capacity for binding specifically to the assayed protein (or to fragments thereof containing the antigenic determinants) and subsequent quantification of the resulting antigen-antibody complexes, or alternatively by means of a technique which does not comprise the use of antibodies such as, for example, by techniques based on mass spectroscopy. The antibodies can be monoclonal, polyclonal or fragment thereof, Fv, Fab, Fab' and F(ab')2, scFv, diabodies, triabodies, tetrabodies and humanized antibodies. Similarly, the antibodies may be labeled. Illustrative, but non-exclusive, examples of markers that can be herein used include radioactive isotopes, enzymes, fluorophores, chemo luminescent reagents, enzyme cofactors or substrates, enzyme inhibitors, particles, or dyes. There is a wide variety of known test that can be used according to the present invention, such as combined application of non-labeled antibodies (primary antibodies) and labeled antibodies (secondary antibodies), Western blot or immunoblot, ELISA (enzyme- linked immunosorbent assay), RIA (radioimmunoassay), competitive EIA (enzyme immunoassay), DAS- ELISA (double antibody sandwich ELISA), two-dimensional gel electrophoresis, capillary electrophoresis, immunocytochemical and immunohistochemical techniques, immunoturbidimetry, immunofluorescence, techniques based on the use of biochips or protein microarrays including specific antibodies or assays based on the colloidal precipitation in formats such as reagent strips and assays based on antibody-linked quantum dots. Other forms of detecting and quantifying proteins include, for instance, affinity chromatography techniques or ligand-binding assays.
The expression "level of non-phosphorylated CPEBl" refers to the quantity of non-phosphorylated CPEBl . Non-phosphorylated levels of CPEBl can be determined directly by any suitable technique known in the art or indirectly by comparing the total amount of CPEBl to the amount of phosphorylated CPEBl . Phosphorylated CPEBl can be determined by techniques using unlabeled antibodies (primary antibody) that recognize the phosphorylated CPEBl (phospho- CPEBl) and labeled antibodies (secondary antibodies) or, alternatively, primary antibodies recognizing phospho- CPEB1 and are marked. These techniques include Western-blot or immunoblot, ELISA (linked immunosorbent assay enzyme), RIA (radioimmunoassay), EIA (enzyme immunoassay) competitive, DAS-ELISA (ELISA sandwich double antibody), immunohistochemical assays, immuno fluorescent assays, immunoprecipitation, etc. Other suitable techniques for detecting the phosphorylation of a protein include two- dimensional; mass spectrometry phospho-peptide analysis involving the separation in two dimensions of a phosphorylated protein after digestion by trypsin.
The expression "reference value", as used herein, relates to a predetermined criteria used as a reference for evaluating the values or data obtained from the samples collected from a subject. The reference value or reference level can be an absolute value, a relative value, a value that has an upper or a lower limit, a range of values, an average value, a median value, a mean value, or a value as compared to a particular control or baseline value. A reference value can be based on an individual sample value, such as for example, a value obtained from a sample from the subject being tested, but at an earlier point in time. The reference value can be based on a large number of samples, such as from population of subjects of the chronological age matched group, or based on a pool of samples including or excluding the sample to be tested.
In a particular embodiment, the reference value is obtained from a sample which does not comprise tumor cells. In another embodiment, the reference value is obtained from a sample containing, consisting or substantially consisting of pancreatic normal HPDE cells. In the context of present invention, the level of CPEB4 is considered "increased" when said level in a sample is higher than its reference value. The level of CPEB4 is considered to be higher than its reference value when it is at least 1.5%, at least 2%, at
least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 100%, at least 110%, at least 120%, at least 130%, at least 140%, at least 150%, or more higher than its reference value.
In the context of present invention, the level of non-phosphorylated CPEB1 is considered "decreased" when said level in a sample is lower than its reference value. The level of non-phosphorylated CPEB1 is considered to be lower than its reference value when it is at least 1.5%, at least 2%, at least 5%, at least 10%>, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 100%, at least 110%, at least 120%, at least 130%, at least 140%, at least 150%, or more lower than its reference value.
The suitable conditions for the entry of the nucleic acid construct, vector or viral particle in the tumor cell are known by the skilled person and include, for example, known conditions for transfection, transduction or transformation of the cell.
The suitable conditions for the expression of the polynucleotide of interest are also known by the skilled person. The skilled person can determine if a cell is expressing a polynucleotide of interest by any known method for detecting expression of a particular protein by a cell, such as Western blot or immunoblot, ELISA (enzyme- linked immunosorbent assay), RIA (radioimmunoassay), competitive EIA (enzyme immunoassay), DAS-ELISA (double antibody sandwich ELISA), two-dimensional gel electrophoresis, capillary electrophoresis, immunocytochemical and immunohistochemical techniques, immunoturbidimetry, immunofluorescence, etc.
Medical uses of the invention
In an eighth aspect, the invention relates to the nucleic acid construct according to the first aspect, or the viral particle, cell or pharmaceutical composition comprising said nucleic acid construct for use in medicine. Alternatively, the invention relates to the use of the nucleic acid construct according to the first aspect, or the viral particle, cell or pharmaceutical composition comprising said nucleic acid construct for the manufacture of a medicament.
In a ninth aspect, the invention relates to the nucleic acid construct according to the first aspect, the viral particle, cell or pharmaceutical composition comprising said nucleic acid construct for use in the treatment of cancer. Alternatively, the invention relates to the use of the nucleic acid construct according to the first aspect, the viral particle, cell or pharmaceutical composition comprising said nucleic acid construct for the manufacture of a medicament for treating cancer. Alternatively, the invention relates to a method of treating cancer comprising administering to a subject a therapeutically effective amount of the nucleic acid construct according to the first aspect or the viral particle, cell or pharmaceutical composition comprising said nucleic acid construct.
All the definitions and particular and preferred embodiments of the previous aspects apply to the eighth and ninth aspect.
The term "treatment", as used herein, refers to any process, action, application, therapy, or the like, wherein a subject (or patient), including a human being, is provided medical aid with the object of improving the subject's condition, directly or indirectly, or slowing the progression of a condition or disorder in the subject, or ameliorating at least one symptom of the disease or disorder under treatment.
The term "patient" or "subject", as used herein, refers to any animal, preferably a mammal and includes, but is not limited to, domestic and farm animals, primates and humans, for example, human beings, non-human primates, cows, horses, pigs, sheep, goats, dogs, cats, or rodents. In a preferred embodiment, the subject is a human being of any age or race. In a particular embodiment, the subject suffers from cancer.
The term "therapeutically effective amount" has been previously defined.
The term "cancer", as used herein, refers to a disease characterized by uncontrolled cell division (or by an increase of survival or apoptosis resistance) and by the ability of said cells to invade other neighboring tissues (invasion) and spread to other areas of the body where the cells are not normally located (metastasis) through the lymphatic and blood vessels, circulate through the bloodstream, and then invade normal tissues elsewhere in the body. Depending on whether or not they can spread by invasion and metastasis, tumors are classified as being either benign or malignant: benign tumors are tumors that cannot spread by invasion or metastasis, i.e., they only grow locally; whereas malignant tumors are tumors that are capable of spreading by invasion and metastasis. Biological processes known to be related to cancer include angiogenesis,
immune cell infiltration, cell migration and metastasis. The term cancer includes, without limitation, lung cancer, sarcoma, malignant melanoma, pleural mesothelioma, bladder carcinoma, prostate cancer, pancreas carcinoma, gastric carcinoma, ovarian cancer, hepatoma, breast cancer, colorectal cancer, kidney cancer, esophageal cancer, suprarenal cancer, parotid gland cancer, head and neck carcinoma, cervix cancer, endometrial cancer, liver cancer, mesothelioma, multiple myeloma, leukaemia, and lymphoma. In a particular embodiment of the invention, the cancer is renal cell carcinoma (RCC), breast cancer, or colorectal cancer. In a particular embodiment, the cancer is selected from pancreatic cancer, glioblastoma, glioma colorectal cancer, ductal breast carcinoma, astrocytic tumor.
The term "pancreatic cancer", as used herein, refers to refers to abnormal or unregulated cell growth affecting the pancreas. The term "pancreatic carcinoma" includes exocrine carcinoma, endocrine carcinoma and neuroendocrine carcinoma. Illustrative non- limitative examples of pancreatic carcinoma are pancreatic adenocarcinoma, acinar cell carcinoma, cystadenocarcinomas and pancreatic mucinous cystic neoplasms. In a particular embodiment the pancreatic cancer is pancreatic ductal adenocarcinoma. "Pancreatic ductal adenocarcinoma", PDAC, as used herein, refers to a pancreatic cancer that displays a ductal-like morphology.
The term "glioma", as used herein, refers to a type of cancer that starts in the brain or spine and which arises from glial cells and/or its precursors including Ependymomas (gliomas derived from ependymal cells), astrocytomas (also known as astrocytic tumours, which are gliomas derived from astrocytes and which includes glioblastoma multiforme), oligodendrogliomas (gliomas derived from oligodendrocytes) and mixed gliomas, such as oligoastrocytomas (derived from cells from different types of glia). In a particular embodiment, the glioma is a glioblastoma or an astrocytic tumor. The term "glioblastoma", also known as "glioblastoma multiforme" or "GBM" as used, herein, refers to a type of primary brain tumor. GBM is an anaplastic, highly cellular tumor with poorly differentiated, round, or pleomorphic cells, occasional multinucleated ceils, nuclear atypia, and anaplasia. Variants of the tumor include gliosarcoma, mult ifocal GBM, or gliomatosis cerebri (in which the entire brain may be infiltrated with tumor ceils). GBM seldom I y metastasizes to the spinal cord or outside the nervous system. GBM is graded by their microscopic and histological appearance. Generally,
grade I (pilocytic astrocytomas) and grade 11 (benign astrocytomas) tumors grow slowly over many years while grade IV (GBM) grows rapidly, invading and altering brain function.
The term "colon cancer" also called "colorectal cancer" or "bowel cancer," refers to a malignancy that arises in the large intestine (colon) or the rectum (end of the colon), and includes cancerous growths in the colon, rectum, and appendix, including adenocarcinoma.
The term "breast cancer" relates to any malignant proliferative disorder of breast cells, most commonly from the inner lining of milk ducts or the lobules that supply the ducts with milk. Cancers originating from ducts are known as ductal carcinomas, while those originating from lobules are known as lobular carcinomas.
In particular embodiment, the cancer contains cells that expressed increased levels of CPEB4 and decreased levels of non-phosphorylated CPEB1 compared to a reference sample. The expressions "increased levels of CPEB4", "decreased levels of CPEB1" and reference sample" as well as preferred and particular embodiments have been previously defined and apply to the eighth and ninth aspects.
The nucleic acid construct, vector, viral particle, cell or pharmaceutical composition can be administered by any suitable route, for example, by systemic, oral, parenteral, intradermal, subcutaneous, intramuscular, intravenous or topical administration.
In a particular embodiment, the nucleic acid construct, vector, viral particle, cell or pharmaceutical composition is administered intravenously.
Diagnostic method of the invention
In a tenth aspect, the invention relates to the use of the nucleic acid construct according to the second aspect, or the viral particle, cell or pharmaceutical composition comprising said nucleic acid construct in a diagnostic method of cancer or to aid in cancer surgery.
The term "diagnostic method", as used herein, refers to a method wherein the properties of selective expression of the construct of the invention are used to confirm the presence of cancer in a subject or in a sample taken from said subject. According to the method, the selective expression of the gene of the construct in the tumour cells
serves to confirm their cancerous nature, therefore helping to diagnose the subject as a patient of cancer. Also, the method would be suitable in vivo to identify and locate masses of cancerous cells, helping the surgeon to determine the tissue/s to be removed or the amount thereof. Non-limiting examples of genes suitable to be used in the diagnostic method of the invention comprise reporter genes which transform substrates into colored reactives such as the gene lacZ, which encodes the enzyme β-galactosidase, or the GUS reporter system, enconding β-glucuronidase. Additional non-limiting examples of reporter genes suitable are those encoding proteins which can be detected through the use of Positron Emission Tomography, such as the gene encoding the protein Herpes Simplex Virus 1 Thymidine Kinase (HSV1-TK), the gene encoding the hypoxanthine phosphoribosil transferase, and the gene of L-amino acid decarboxylase.
The term "subject" has been previously defined. In a particular embodiment, the subject is suspected of suffering from cancer. EXAMPLES
Methods
Cells lines. Pancreatic cell lines PANC-1 and MIA PaCa-2, and embryonic kidney cell lines HEK293 and 293 T, were obtained from the American Type Culture Collection (ATCC, Manasas, VA). RWP-1 cells were derived from human pancreatic adenocarcinoma biopsies perpetuated as xenograft in nude mice37. Non-tumor fibroblasts were kindly provided by Dr. Eva Vaquero (Institut d'investigacions Biomediques Atust Pi i Sunyer, Barcelona, Spain). All cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (Gibco BRL, Carlsbad, CA). Immortal human pancreatic duct epithelial HPDE cells, kindly provided by Dr. F.X. Real (CNIO, Madrid, Spain), were cultured and maintained as reported (Ouyang, H., et al. Immortal human pancreatic duct epithelial cell lines with near normal genotype and phenotype. Am J Pathol 157, 1623-1631 (2000)). Human hepatocytes were obtained form Biopredic International (St Gregoire, France) and maintained according to the provider instructions RWP-1 shNT, Sh2 and Sh4 were previously described Ortiz-Zapater, E., et al. Key contribution of CPEB4-mediated translational control to cancer progression. Nat Med 18, 83-90 (2011). HPDE-CPEB4-
expressing cells were established by transducing parental cells with CPEB4 recombinant lentivirus.
Lentiviral constructs with a modified 3' UTR. The polyadenylation sequences (4193- 4199 and 4423-4429) from the pLS-CG lentiviral vector (Addgene, #12161) were mutagenized with the help of the QuickChange II Site-Directed Mutagenesis Kit (Stratagene, Wilmington, NC) according to the manufacturer's instructions (see Table 1 for primers). Mutagenized sequences were verified by DNA sequencing.
Table 1 : Primer sequences d2EGFP and d2RFP genes were cloned by PCR with specific primers incorporating the Agel and Xhol restriction sites. The 3'-UTR of tPA was PCR amplified using specific primers with sequences for the Xhol restriction enzyme at both ends. The 3'-UTR of cBl was designed in the reverse primer of d2EGFP gene with a sequence for the Xhol
restriction enzyme. The 3 '-UTR with the TNF-a ARE sequences was generated by amplifying the previously generated cBl 3'-UTR with a primer containing the TNF- a main ARE sequence upstream of the CPE sites.
All primer sequences are listed in Table 1. The indicated sequences were cloned into the pLS-CG lentiviral vector. The newly generated vectors were sequenced to confirm the DNA sequence.
Lentiviral production. Lentiviral particles were generated by cotransfection of plasmids pCMVAR8.91, pVSV-G and the pLS-CG-derived constructs, or a lenitiviral plasmid expressing CPEB4, in 293T cells by the calcium/phosphate DNA precipitation method (Clontech, Mountain View, CA). Supernatants from 293T-transfected cells were collected at 24 h and 48 h, filtered and processed for purification by ultracentrifugation for 2 h at 12°C at 20,200 r.p.m. After ultracentrifugation, the pellet was resuspended in PBS for 16 h at 4°C under constant agitation, aliquoted and frozen at -80°C for later use.
Viral titration was performed by quantitative PCR with specific primers against the PBC-Psi region of the pLS-CG vector (listed in Supplementary Table 1). A standard curve was generated using serial dilutions of pLS-CG-d2EGFP-3'-UTR_tPA construct mixed with genomic DNA. The number of molecules was calculated using the formula: M = (C-6.02- 1023)/(660-bp), where C is the concentration of the plasmid, bp is the number of base pairs and M is the number of vector molecules.
Flow cytometry assay
Flow cytometry assays were performed in HPDE, RWP-1, PANC-1 and MIA PaCa-2 cells. Forty thousand cells were plated per well in 12-multiwell plates and, 24 h post- seeding, cells were transduced with the indicated lentiviruses at 12 MOI per virus. Transduction was facilitated by spinning for 2 h at 12,000 r.p.m. Two days post- transduction, d2EGFP and dRFP levels were analyzed by flow cytometry using BD LSR II (Becton Dickinson). Flow cytometry results were analyzed using FlowJo 8.7 for Macintosh.
Adenovirus generation. The AdCPE genome was generated by the following steps: First, the El A polyA sequence of the pEND-K plasmid was mutated from AATAAA to ACTCGA, generating a new Xhol restriction site with the primer 5'-GCTGAATGAGATTGATGTAAGTTTACTCGAGGGTGAGATAATGTTTAACT TGC-3'
(SEQ ID NO: 15) using the QuickChange Multi Site-Directed Mutagenesis kit (Stratagene, Wilmington, NC). Second, the construct containing El A and the 3 '-UTR of cBl with the 3 CPE sequences was generated directly by PCR, by amplifying Adwt E1A with the primers 5 '-CCTTGGGTCCGGTTTCTATGCC-3 ' (SEQ ID NO: 16) and 5 ' -CGTCTCGAGGCTTTATT AAAACC AGTAAAAC ATTAAAAAC AC AATAC ACT ATTTACAGAAGCACATGGTGCAACACTTATGGCCTGGGGCGTTTAC AGC-3 ' ; (SEQ ID NO: 17). Third, the E1A from the pEND-K with the mutated polyA sequence was replaced by the PCR product, using Agel and Xhol restriction sites, to generate pEND-K-ElA-cBl . Finally, AdCPE was generated by homologous recombination of pEND-K-ElA-cBl with the genome of the serotype 5 wild-type adenovirus in E. coli BJ5183 cells as described (Huch, M., et al. Urokinase-type plasminogen activator receptor transcriptionally controlled adenoviruses eradicate pancreatic tumors and liver metastasis in mouse models. Neoplasia 11, 518-528, 514 p following 528 (2009)). AduPAR was previously described (Huch, M., et al. Urokinase-type plasminogen activator receptor transcriptionally controlled adenoviruses eradicate pancreatic tumors and liver metastasis in mouse models. Neoplasia 11, 518-528, 514 p following 528 (2009)). AdDUC genome was generated by incorporating the CPE containing 3'UTR of E1A into the Boxl and Aflll restriction sites of the pSH-DM-UPAR-ElA plasmid followed by recombination of the resulting plasmid with the Adwt genome in BJ5183 cells.
Adwt was obtained from ATCC (Manasas, VA). Adwt, AdCPE, AduPAR and AdDUC were propagated in A549 cells and purified by cesium chloride banding. The concentration of viral particles (vp/mL) was determined by means of optical density; and infectious particles (pfu/mL) by hexon immunostaining in HEK293 cells (Cascante, A., et al. GCV modulates the antitumoural efficacy of a replicative adenovirus
expressing the Tat8-TK as a late gene in a pancreatic tumour model. Gene Ther 14, 1471-1480 (2007)). Both viruses presented equal vp/pfu ratio.
Western blot analysis. Protein extracts were obtained with lysis buffer (50 mM Tris- HC1 at pH 6.8, 2% SDS) containing 1% Complete Mini Protease Inhibitor (Roche Diagnostics GmbH, Basel, Switzerland). BCA Protein Assay Kit (Pierce-Thermo Fisher Scientific, Waltham, MA) was used to determine the protein concentration, and total proteins (35 μg) were resolved by electrophoresis on 7.5% gels and transferred to nitrocellulose membranes by standard methods. Membranes were immunoblotted with rabbit anti-adenovirus-2/5 El A polyclonal antibody (1 :200; clone 13 S-5; Santa Cruz Biotechnology, Dallas, TX) or anti-CPEB4 antibody (1 :200; Abeam, Cambridge, UK) or anti-CPEBl (1 :200; 13274-1-AP, ProteinTech, IL, USA) 1 h at room temperature (RT). Blots were rinsed with TBS-T and incubated for 45 min at RT with HRP- conjugated goat anti-rabbit IgG (DakoCytomation, Glostrup, Denmark). Antibody labeling was detected by the enhanced chemiluminescent method (Amersham Biosciences, Amersham, UK). Western blot expression data for El A, CPEB1 and CPEB4 were normalized to GAPDH. cDNA synthesis and real-time quantitative PCR. RNA was obtained and isolated using RNeasy Mini Kit (Qiagen, Venlo, Netherlands). A total of 1 μ was reverse transcribed using Moloney Murine Leukemia Virus reverse transcriptase and random decamers (Ambion, Carlsbad, CA). One microliter of the reaction was used as a template for the qPCR amplification reaction (LightCycler 480SYBER Green I Master Mix, Roche) in a thermocycler (ViiA 7 Real-Time PCR system, Applied Biosystems), using the following set of primers: El A Fw, 5 '-CGGCCATTTCTTCGGTAATA-3' (SEQ ID NO: 18) and El A Rev, 5 '-CCTCCGGTGATAATGACAAG-3 '(SEQ ID NO: 19); Hexon Fw 5 '- GTCTACTTCGTCTTCGTTGTC-3 '(SEQ ID NO: 20) and Hexon Rev 5 '-TGGCTTCCACGTACTTTG-3 '(SEQ ID NO: 21); and Fiber Fw 5'- CTCCAACTGTGCCTTTTC-3 '(SEQ ID NO: 22) and Fiber Rv 5'- GGCTCACAGTGGTTACATT-3 '(SEQ ID NO : 23). Quantitative expression data were normalized to Gdx Fw 5 '-GGCAGCTGATCTCCAAAGTCCTGG-3 '(SEQ ID NO: 24) and Gdx Rev 5 '-AACGTTCGATGTCATCCAGTGTTA-3 '(SEQ ID NO: 25). d2EGFP
and dRFP were detected with the primers: d2EGFP Fw 5'- CAACAGCCACAACGTCTATATCAT-3 '(SEQ ID NO: 26) and d2EGFP Rv: 5 '- ATGTTGTGGCGGATCTTGAAG-3 '(SEQ ID NO: 27); and dRFP Fw 5 '- GCCCTTCGCCTGGGACAT-3 '(SEQ ID NO: 28) and dRFP Rv 5 '- GGTGCTTCACGTACACCTTGGA-3 '(SEQ ID NO: 29). Quantitative expression data were normalized using the primers ACTB Fw 5 '-CTGGAACGGTGAAGGTGACA- 3 '(SEQ ID NO: 30) and ACTB Rv 5 '-GGGAGAGGACTGGGCCATT-3'(SEQ ID NO: 31). Viral genome quantification. Viral DNA was obtained from supernatants, cellular extracts or frozen tissues using the UltraClean BloodSpin DNA Isolation Kit (Mo Bio Laboratories, Carlsbad, CA) according to the manufacturer's instructions. Viral genomes were determined by real-time qPCR using the SYBER Green I Master plus mix (Roche Diagnostics, Basel, Switzerland) and the primers hexon Fw 5 '- GCCGCAGTGGTCTTACATGCACATC-3 ' (SEQ ID NO: 32) and hexon Rv 5 '- CAGCACGCCGCGGATGTCAAAG-3 ' (SEQ ID NO: 33). Adenoviral copy number was relativized to the cellular DNA content using the albumin intron 12 primers of Fw 5 '-CTGTCATCTCTTGTGGGCTGT-3 ' (SEQ ID NO: 34) and Rv 5'- GGCTATCCAAACTCATGGGAG-3 ' (SEQ ID NO: 35).
In vitro cell survival studies. Dose-response curves were constructed for all assessed cells transduced with doses ranging from 0.001 vp/cell to 10,000 vp/cell of Adwt or AdCPE. Cell viability was measured 3 days post-infection by a colorimetric assay following manufacturer's instructions (MTT Ultrapure, USB Corporation, Cleveland, OH).
Polyadenylation Assays. Polyadenylation patterns were evaluated using a modified version of the RNA ligation-coupled RT-PCR presented previously (Rassa, J.C., Wilson, G.M., Brewer, G.A. & Parks, G.D. Spacing constraints on reinitiation of paramyxovirus transcription: the gene end U tract acts as a spacer to separate gene end from gene start sites. Virology 274, 438-449 (2000). One μg of total RNA was ligated to 0Λμ of PI anchor primer (5'-P-GGTCACCTTGATCTCAAGC-NH2-3') (SEQ ID
NO: 36) in 10 μΐ reaction using T4 RNA ligase I (New England Biolabs, Ipswich, MA) according to manufacturer's instructions. Half of the reaction product was used in a 50 μΐ reverse transcription reaction with PrimeScript RT-PCR (Takara Bio, Mountain View, CA) according to manufacturer's instructions, using 0.1 μg of Ρ as a reverse primer (5 '-GCTTCAGATCAAGGTGACCTTTTT-3 ') (SEQ ID NO: 37). An aliquot (2.5 μΐ) of this cDNA preparation was used for a first pre-PCR step with Fw-EIA- PolyA primer (5 '-GGTGTAAACCTGTGATTGCG-3 ') (SEQ ID NO: 38). One μΐ of this reaction was later used in each 25 μΐ PCR with the primers Fw-ElA-PolyA and PI '.
Toxicity analysis. PBS or 2 x 1010 vp of Adwt or AdCPE were injected intravenously into the tail vein of 6- to 8-week-old immunocompetent C57BL/6 mice. Animals were weighed and examined daily for any clinical signs of toxicity. Three days later, mice were sacrificed, organs were isolated and blood samples were collected by intracardiac puncture. Serum AST and ALT were determined on an Olympus AU400 Analyzer (Olympus, Tokyo, Japan) at the Clinical Biochemistry Service, School of Veterinary Medicine, Autonomous University of Barcelona. All animal procedures met the guidelines of European Community Directive 86/609/EEC and were previously approved by the local ethical committee.
Mouse xenografts. RWP-1, MIA PaCa-2 and PANC-1 cells (2.5 x 106), embedded in Matrigel 1 : 1 (BD Biosciences, San Jose, CA), were subcutaneously injected into each flank of male, 7- to 8-week-old, athymic nu/nu mice (Harlan, Sant Feliu de Codines, Spain). Tumors were measured at least three times weekly, and their volumes were calculated using the formula V = larger diameter x (smaller diameter)2 x pi ÷ 6. Viral treatment was administered once tumors achieved a median volume of 100 mm3.
Statistical analyses. The descriptive statistical analysis was performed on GraphPad Prism v5.0a (GraphPad Software, La Jolla, CA). If not specified, statistical differences were evaluated using non-parametric 2-tailed Mann- Whitney test. P < 0.05 was taken as the level of significance.
Statistical analyses for the d2EGFP/dRFP quantification were performed using R (version 2.10.0) and the ARM package, to perform the mixed model by REML and multcomp package for multiple comparison analysis of means by the Tukey-Kramer test.
The in vivo tumor growth statistical analysis was evaluated using R v2.14.1 software (R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria) with a linear mixed-effect model using the lme4 package. Random effects term were associated with the day of measurement (Heitjan, D.F., Manni, A. & Santen, R.J. Statistical analysis of in vivo tumor growth experiments. Cancer Res 53, 6042-6050 (1993)). Statistical differences were evaluated using a multiple comparison of means by Tukey contrast.
Results
CPEs provide oncoselectivity to replication-competent adenoviruses.
To identify the optimal sequences required for CPEB-dependent tumor selectivity, chimeric mRNAs with three combinations of 3 ' UTRs fused to the d2EGFP open reading frame were tested. These mRNAs were expressed in a battery of pancreatic normal (HPDE) and tumor (RWP-1, PANC-1 and MIA PaCa-2) cells expressing variable levels of CPEBl and CPEB4 (Fig. la). The first UTR was derived from Xenopus cyclin Bl (cBl) 3' UTR mRNA and contained two consensus CPEs and one nonconsensus CPE. This CPE arrangement promotes both translational repression by unphosphorylated CPEBl and translational activation by CPEB4 (Igea, A. & Mendez, R. EMBO J 29, 2182-2193 (2010); Novoa, I. et al, Nat Cell Biol 12, 447-456 (2010), Belloc, E. et al. Biochem Soc Trans 36, 665-670 (2008). The second UTR was synthetized by combining cBl CPEs with an ARE sequence that opposes CPE-mediated polyadenylation and translational activation from the TNF-a 3 ' UTR mRNA (TNF-a- CB1). The third UTR was generated from a fragment of the tissue plasminogen activator (tPA) 3' -UTR mRNA that contains two CPEs and two ARE sequences (Ortiz- Zapater, E., et al.. Nat Med 18, 83-90 (2011)). (Fig. lb; Table 1).
Lentiviruses expressing the d2EGFP with the indicated 3'-UTRs or a control WT 3'- UTR (without CPEs) and a lentivirus with a destabilized dRFP bearing a control 3 '- UTR (WT) were used to co-infect the non-tumor HPDE cells and the pancreatic cancer cell lines (Fig. 2a). For each combination of UTR and cell line, the resulting d2EGFP- to-dRFP expression ratio indicated that cBl was the only 3'-UTR promoting a differential translational control in normal cells compared to cancer cells. Thus, CB1-3'- UTR repressed the expression of d2EGFP in HPDE cells as compared to the dRFP control 3 ' -UTR, whereas it promoted activation in the cancer cells, with a stronger effect in PANC-1 (Fig. lc). Interestingly, for the four cell lines, the d2EGFP/dRFP ratio was proportional to the CPEB4/CPEB1 ratio (Fig. la). As expected from the role that the poly(A) tail has on mRNA stability, reduced mRNA levels of d2EGFP-CBl-3 '- UTR were detected in HPDE cells as compared to tumor cells (Fig. 2b). On the other hand, the two 3'-UTRs with ARE sequences led to reduced d2EGFP expression in all the cell lines, indicating that the destabilization effect of the ARE dominates over the effects of CPE regulation (Fig. lc).
Next, the specific regulation promoted by the CBl-3'-UTR was used to generate an oncoselective replication-competent adenovirus Ad5. For this, viral replication was target by designing a virus in which the translation of El A mRNA was regulated by CPEBs. The adenoviral immediate early E1A gene was selected because it is the first gene transcribed after an adenoviral infection and thus acts as a master transcriptional regulator of further early viral genes and modifies several cell host functions required for viral DNA replication. Then the WT 3'-UTR of the viral E1A coding sequence was replaced with the cBl 3 '-UTR to give us AdCPE (Fig. 3a). Substitution of El A WT 3'- UTR by cBl 3' -UTR had no effect on the transcription of this gene, as shown by the equal levels of pre-mRNA for both 3'-UTRs in normal and cancer cell lines (Fig. 3b). However, when the steady state levels of mature transcripts were compared, ElA-cBl 3' -UTR mRNA was found to be significantly lower in HPDE cells as compared to E1A- WT 3' -UTR mRNA as well as reduced with respect to El A- cBl 3' -UTR mRNA in tumor cells (Fig. 3b). This suggests a specific destabilization of the mRNA containing CPEs in the non-tumor cells. Because the destabilization of the CPE-containing c-myc mRNA in non-transformed cells has been directly associated with its cytoplasmic
deadenylation, the poly(A) tail length of the different E1A transcripts was measured in the four cell lines by RNA ligation-coupled RT-PCR analysis (Fig. 3c). It was found that the CPE-mediated destabilization of the ElA-cBl mRNA in HPDE cells was associated with a shorter poly(A) tail (Fig. 3d), which resulted in reduced El A protein expression from the cBl 3 '-UTR mRNA as compared with the WT 3'-UTR (Fig. 3e). Accordingly, AdCPE-infected non-transformed cells (HPDE) showed a strong reduction in viral genome copy numbers (Fig. 3f) and decreased cytotoxicity (increased IC50; Fig. 3g) as compared to the control virus Adwt. The lowest performance of AdCPE was also observed in human primary fibroblasts. However, in the tumor cells, cBl 3'-UTR was as efficient as the WT 3'-UTR in supporting optimum levels of viral driven El A expression (Fig. 3e), which in turn resulted in equal viral genome copy numbers and IC50 from both 3'-UTRs (Fig. 3f,g). The similar effects of Adwt and AdCPE in cancer cells also highlight that the small size of the cBl 3'-UTR did not compromise virus fitness and packaging efficiency.
CPE-mediated oncoselectivity is provided by CPEB4.
To determine whether the higher CPEB4 levels in tumor cells caused the specificity of cBl 3'-UTR regulation of mRNA translation it was knocked down in RWP-1 cells (Fig. 4a). When compared with a control non-target shRNA (RWP-l-shNT), depletion of CPEB4 (RWP-1 -sh4) caused a significant reduction of El A protein levels expressed from AdCPE (Fig. 4b), with the subsequent reduction of viral replication (Fig. 4c) and increased IC50 values (Fig. 4d). On the other hand, Adwt was unaffected by a CPEB4 knock down (Fig. 4b,c,d). A reverse approach, of overexpressing CPEB4 in non-tumor cells (HPDE), partially rescued the expression of El A from AdCPE (Fig. 4e) and viral replication (Fig. 4f), as compared to Adwt. Therefore, high levels of CPEB4 seem to be required for the oncoselective behavior of the engineered virus and to prevent the CPE- mediated translational repression observed in non-tumor cells.
Oncoselectivity of AdCPE in vivo.
To investigate whether AdCPE provides oncolytic specificity in vivo, nude mice carrying RWP-1, PANC-1 or MIA PaCa-2 subcutaneous tumors were intravenously injected with Adwt or AdCPE viral particles, and tumor growth was monitored. In
consonance with the results obtained in cell culture models, it was found that AdCPE produced a significant inhibition of tumor growth that was similar or greater than that of Adwt (Fig. 5). Interestingly, at high viral doses at which Adwt compromises mice survival, the antitumor effect of AdCPE was very strong (Fig. 5b). While the efficiency of an equal dose of AdCPE and Adwt in targeting tumor cells was similar or even slightly increased in AdCPE, the in vitro results with HPDE cells indicate that AdCPE should have a much reduced adenovirus-associated toxicity. To test the AdCPE effects on healthy tissues in vivo, immunocompetent mice were intravenously injected with Adwt and AdCPE, at the same viral dose used in the xenograft experiments. Three days later, viral proteins were quantified and viral genomes in liver, pancreas and kidney. El A protein levels were significantly reduced in the liver of AdCPE-treated mice, as compared to Adwt (Fig. 6a). Quantification of mRNA of El A, hexon and fiber in liver, pancreas and kidney revealed significantly reduced levels of the three mR As in AdCPE-injected mice as compared to Adwt (Fig. 6b). Consistent with in vitro data, El A pre-mR A levels in liver extracts from AdCPE and Adwt were similar, whereas the mature mRNA was reduced in AdCPE mice (Fig. 7a). These results indicate that the CPE-dependent destabilization of viral mRNA is recapitulated in vivo. Despite the impairment of human Ad5 to productively replicate in mice, a low level of replication has been proposed to occur, which is sufficient to detect differences between AdCPE and Adwt. Analyzing viral genomes in liver, pancreas and kidney showed, as expected, that most of the virus was retained in the liver, but that viral genomes were also present in the other organs. Interestingly, animals injected with AdCPE had a reduced viral content (of 18-fold in liver, 7-fold in pancreas and 6-fold in kidney) as compared to Adwt (Fig. 6c). This effect was not associated to differences in viral titers, since the number of viral genomes that reached the liver at 4 h after injection, previous to any replication event, was similar between AdCPE- and Adwt-injected mice (Figure 7b). The attenuated activity of AdCPE in murine healthy tissues was further confirmed in human primary hepatocytes, a model fully permissive for adenoviral replication (Fig. 8). Thus, AdCPE activity is highly impaired in normal tissues when compared to Adwt.
Finally, to study liver damage-associated toxicity, which is one of the major side effects of Ad-expressing El A, body weight, macroscopic liver appearance and serum
parameters were analyzed in mice after intravenous delivery of Adwt or AdCPE. Adwt caused a progressive loss of weight, whereas AdCPE led to a decrease in body weight by day 1 that then remained stable for the following days (Fig. 6d). Livers injected with Adwt showed a steatotic appearance that was not observed in AdCPE livers (Fig. 6e). Aspartate aminotransferase (AST) and alanine aminotransferase (ALT) enzyme activities showed a remarkable increase in Adwt-injected animals with respect to the saline group, whereas a 4-fold lower induction was detected in AdCPE-injected mice (Fig. 6f). Altogether, these results indicate a reduced toxic profile of the AdCPE virus as compared to Adwt, while maintaining its oncolytic potential.
Discussion
Oncolytic viruses are advancing to clinical trials and are envisioned as important agents in oncology in the near future. Accordingly, optimized engineered viruses are under development to maximize their anticancer effects. However as their potency increases potential associated toxicities grow proportionally, pointing the need to develop highly tumor-specific viruses. It is shown that engineering adenoviruses with CPE regulatory elements, to control El A expression post transcriptionally, result in attenuated viral activity in normal cells while maintaining, or even increasing, potency in cancer cells. The specificity of the antitumoral response is directly derived from the ectopic expression of CPEB4 in tumors. Thus, depletion of CPEB4 attenuates viral activity in tumoral cells while overexpression of CPEB4 in non-transformed cells increases viral replication. In turn, the levels of CPE-mediated expression may be further increased by reduced levels of CPEBl . These results are consistent with a scenario where, in non- transformed cells, which display high CPEBl levels, CPE-containing mR As are repressed by CPEBl . On the other hand, in tumoral cells, CPEBl levels are reduced while CPEB4 levels increase promoting cytoplasmic polyadenylation, with the result of increased mR A stability and translation of CPE regulated transcripts. As a consequence viral genome replication, dependent on CPEB4 activity, is restricted to tumoral cells, resulting in an attenuated virus in healthy tissues but a full competent virus in cancer cells. Accordingly, the CPE regulated virus maintains its oncolytic capacity while significantly reducing damage to non-tumoral tissues, mainly in the liver since it is the target organ of adenovirus sequestration upon intravascular delivery. This
increased selectivity, in turn, allows for enhanced therapeutic index since increased antitumoral capacity is obtained after AdcBl treatment at viral doses that Adwt injection compromises mice survival. Thus, these results constitute a novel approach to fine-tune protein expression in a tumor selective manner exploiting the posttranscriptional reprogramming of gene expression in tumoral cells applied to control selectivity of an oncolytic virus. Even though our data was generated in pancreatic cancer models, since CPEB4 overexpression has been reported in several tumors such as gliomas and colorectal cancers it is worth to speculate that could be a valid strategy for many solid tumors. This approach may overcome some of the limitations associated to other commonly used post-entry viral targeting approaches. The tumor selective control by tumor specific promoters is confronted with the fact that most of the genome is constantly transcribed at low levels, and is a strategy restricted to viruses that rely on the cellular transcription machinery but not for viruses that use virally encoded polymerases for replication in the cytoplasm, such as measles virus and vaccinia virus. The alternative post-entry strategy to regulate viral replication is a negative targeting approach based on the miRNA expression in normal tissues to restrict viral replication of miRNA-target sites engineered viruses. Indeed, this is a very versatile approach for many different viruses and highly efficient. However, the evolution of escape mutants in miRNA targeted viruses or the potential off-target effects on the host miRNA machinery have been proposed as potential caveats. Interestingly, no mutations were found in the CPE-regulated adenovirus under evolutionary pressure (Fig. 9). To achieve a tight restriction of replication to tumor cells, it should be possible to combine different targeting strategies such as regulation by more than one viral gene(Bofill-De Ros, X., et al. Oncotarget 6, 6179-6190 (2015)) or the introduction of transcriptional and posttranscriptional control in the same viral gene (Sugio, K., et al. Clin Cancer Res 17, 2807-2818 (2011). In this line, a double-ElA engineered virus, with the uPAR promoter and the CPE-posttranscriptional control, displayed additivity in a non-tumoral context (Fig. 10).
Nevertheless for tight restriction of replication to tumor cells it will be possible to combine all the different targeting strategies, by introducing transcriptional and posttranscriptional regulation in the same viral gene or potentially by regulating more than one viral gene by independent strategies. Furthermore, this novel tropism-modified
strategy provides a framework for exploiting CPE-regulated transgenes to achieve cancer cell specific expression in therapeutic gene-transfer based strategies, or to attenuate viruses for vaccine purposes. This technology could also extend to other viruses of interest in virotherapy that require attenuation in particular tissues, such as reo viruses in heart, Coxsackievirus A21 in muscle,
Altogether our data provides a novel paradigm for the development of tumor- specific viruses and provides the proof-of-principle that CPEB-dependent regulation can be exploited to attenuate viral toxicity, by preventing the spread of the virus in normal tissues without perturbation of the antitumor efficacy.
Claims
A nucleic acid construct comprising
i. a polynucleotide of interest and
ii. an untranslated sequence in 3' position with respect to the polynucleotide of interest, wherein said untranslated sequence is heterologous with respect to the polynucleotide of interest and wherein said untranslated region
a. comprises at least two cytoplasmic polyadenylation elements which are separated by less than 50 nucleotides,
b. comprises a cytoplasmic polyadenylation signal which is separated by less than 100 nucleotides from the first or second cytoplasmic polyadenylation element and
c. does not include an adenylate-uridylate-rich element,
wherein the polynucleotide of interest is not a gene encoding the protein luciferin-4-monooxygenase from Photinus pyralis or a gene encoding a fluorescent protein.
The nucleic acid construct of claim 1 wherein the distance between the first and second CPE is of 12 nucleotides.
The nucleic acid construct according to claims 1 or 2 wherein the distance between the first or second cytoplasmic polyadenylation element and the polyadenylation signal is of 25 nucleotides.
The nucleic acid construct according to any of claims 1 to 3, wherein the untranslated sequence in 3' position with respect to the polynucleotide of interest further comprises a third cytoplasmic polyadenylation element.
The nucleic acid construct according to any of claims 1 to 4, wherein the untranslated sequence has the nucleotide sequence of SEQ ID NO: 1 or a functionally equivalent variant thereof.
The nucleic acid construct according to any of claims 1 to 5, wherein the polynucleotide of interest is selected from the group consisting of:
- a gene encoding a polypeptide selected from the group consisting of a cytotoxic polypeptide, an antiangiogenic polypeptide, a polypeptide encoded by a tumor suppressor gene, a polypeptide which is capable of activating the
immune response towards the cell expressing said polypeptide, a polypeptide which is capable of activating the production of a cytopathic virus; and - a polynucleotide which once transcribed gives rise to a R A capable of modulating the expression of a target gene.
7. The nucleic acid construct according to claim 6, wherein the polypeptide which is capable of activating the production of a cytopathic virus is the polypeptide encoded by the El A gene from an adenovirus.
8. The nucleic acid construct according to claim 7, wherein the adenovirus is a type 5 adenovirus.
9. A vector comprising the nucleic acid construct according to any of claims 1 to 8.
10. The vector according to claim 9, wherein the vector is an expression vector.
11. The vector according to claim 10, wherein the expression vector is a lentiviral vector, an adenoviral vector or an AAV vector.
12. A viral particle comprising a lentiviral vector or an adenoviral vector according to claim 11.
13. A cell comprising the nucleic acid construct according to any of claims 1 to 7 or the vector according to any of claims 9 to 11.
14. A pharmaceutical composition comprising the nucleic acid construct according to any of claims 1 to 8, the vector according to any of claims 9 to 11, the viral particle according to claim 12 or the cell according to claim 13 and a pharmaceutically acceptable carrier.
15. The nucleic acid construct according to any of claims 1 to 5, wherein the polynucleotide of interest is a reporter gene.
16. A vector comprising the nucleic acid of claim 15.
17. The vector according to claim 16, wherein the vector is an expression vector.
18. The vector according to claim 17, wherein the expression vector is a lentiviral vector or an adenoviral vector.
19. A viral particle comprising a lentiviral vector or an adenoviral vector according to claim 18.
20. An in vitro method for inducing selective expression of a polynucleotide of interest in a tumor cell comprising
i. contacting the tumor cell with the nucleic acid construct according to any of claims 1 to 8 or 15, the vector according to any of claims 9 to 1 1 or 14 to 18 or the viral particle according to any of claims 12 or 19 under suitable conditions for the entry of the nucleic acid construct, vector or viral particle into the tumor cell and
ii. maintaining the tumor cell under conditions suitable for the expression of the polynucleotide of interest.
21. The in vitro method according to claim 20, wherein the tumor cell expresses increased levels of CPEB4 and decreased levels of non-phosphorylated CPEB1 compared to a reference value.
22. The nucleic acid construct according to any of claims 1 to 8, the vector according to any of claim 9 to 11, the viral particle according to claim 12, the cell according to claim 13 or the pharmaceutical composition according to claim 14 for use in medicine.
23. The nucleic acid construct according to any of claims 1 to 8, the vector according to any of claims 9 to 11, the viral particle according to claim 12, the cell according to claim 13 or the pharmaceutical composition according to claim 14 for use in the treatment of cancer.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP16382108 | 2016-03-11 | ||
| EP16382108.5 | 2016-03-11 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2017153606A1 true WO2017153606A1 (en) | 2017-09-14 |
Family
ID=55699589
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2017/055836 Ceased WO2017153606A1 (en) | 2016-03-11 | 2017-03-13 | Nucleic acid constructs and vectors for oncoselective expression of a transgene |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2017153606A1 (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114081966A (en) * | 2021-11-26 | 2022-02-25 | 中山大学附属第一医院 | Application of AAV9-CPEB3 in the preparation of drugs for the treatment of gastric cancer |
| WO2023025275A1 (en) * | 2021-08-26 | 2023-03-02 | The Hong Kong University Of Science And Technology | Compositions and methods for assessing and treating age-related conditions |
| WO2023081885A1 (en) * | 2021-11-08 | 2023-05-11 | Kernal Biologics, Inc. | Oncoselective cancer therapy |
| EP4273243A1 (en) | 2022-05-02 | 2023-11-08 | Fundació Hospital Universitari Vall d'Hebron - Institut de Recerca | Nucleic acid constructs and vectors for podocyte specific expression |
| WO2024233835A1 (en) * | 2023-05-10 | 2024-11-14 | Kernal Biologics, Inc. | Oncoselective therapy |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050095632A1 (en) * | 2002-01-23 | 2005-05-05 | Macnicol Angus M. | Human cytoplasmic polyadenylation element binding protein and uses thereof |
-
2017
- 2017-03-13 WO PCT/EP2017/055836 patent/WO2017153606A1/en not_active Ceased
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050095632A1 (en) * | 2002-01-23 | 2005-05-05 | Macnicol Angus M. | Human cytoplasmic polyadenylation element binding protein and uses thereof |
Non-Patent Citations (4)
| Title |
|---|
| AHMED A ET AL: "A conditionally replicating adenovirus targeted to tumor cells through activated RAS/P- MAPK-selective mRNA stabilization", NATURE BIOTECHNOLOGY, GALE GROUP INC, US, vol. 21, no. 7, 1 July 2003 (2003-07-01), pages 771 - 777, XP002977838, ISSN: 1087-0156, DOI: 10.1038/NBT835 * |
| D. M. KOCHANEK ET AL: "CPEB1 Regulates the Expression of MTDH/AEG-1 and Glioblastoma Cell Migration", MOLECULAR CANCER RESEARCH, vol. 11, no. 2, 29 January 2013 (2013-01-29), US, pages 149 - 160, XP055295452, ISSN: 1541-7786, DOI: 10.1158/1541-7786.MCR-12-0498 * |
| ELENA ORTIZ-ZAPATER ET AL: "Key contribution of CPEB4-mediated translational control to cancer progression", NATURE MEDICINE., vol. 18, no. 1, 1 January 2012 (2012-01-01), US, pages 83 - 90, XP055295464, ISSN: 1078-8956, DOI: 10.1038/nm.2540 * |
| MARIA PIQUÉ ET AL: "A Combinatorial Code for CPE-Mediated Translational Control", CELL, vol. 132, no. 3, 1 February 2008 (2008-02-01), pages 434 - 448, XP055000279, ISSN: 0092-8674, DOI: 10.1016/j.cell.2007.12.038 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2023025275A1 (en) * | 2021-08-26 | 2023-03-02 | The Hong Kong University Of Science And Technology | Compositions and methods for assessing and treating age-related conditions |
| WO2023081885A1 (en) * | 2021-11-08 | 2023-05-11 | Kernal Biologics, Inc. | Oncoselective cancer therapy |
| CN114081966A (en) * | 2021-11-26 | 2022-02-25 | 中山大学附属第一医院 | Application of AAV9-CPEB3 in the preparation of drugs for the treatment of gastric cancer |
| CN114081966B (en) * | 2021-11-26 | 2023-09-08 | 中山大学附属第一医院 | Application of AAV9-CPEB3 in the preparation of drugs for the treatment of gastric cancer |
| EP4273243A1 (en) | 2022-05-02 | 2023-11-08 | Fundació Hospital Universitari Vall d'Hebron - Institut de Recerca | Nucleic acid constructs and vectors for podocyte specific expression |
| WO2023213738A1 (en) | 2022-05-02 | 2023-11-09 | Fundació Hospital Universitari Vall D’Hebron – Institut De Recerca | Nucleic acid constructs and vectors for podocyte specific expression |
| WO2024233835A1 (en) * | 2023-05-10 | 2024-11-14 | Kernal Biologics, Inc. | Oncoselective therapy |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20240263192A1 (en) | Therapeutic compositions comprising transcription factors and methods of making and using the same | |
| Frentzen et al. | Anti-VEGF single-chain antibody GLAF-1 encoded by oncolytic vaccinia virus significantly enhances antitumor therapy | |
| WO2017153606A1 (en) | Nucleic acid constructs and vectors for oncoselective expression of a transgene | |
| Han et al. | Targeted suicide gene therapy for liver cancer based on ribozyme-mediated RNA replacement through post-transcriptional regulation | |
| AU2018272095A1 (en) | Recombinant adenoviruses carrying transgenes | |
| EP3692157A2 (en) | Vectors with promoter and enhancer combinations for treating phenylketonuria | |
| Bello et al. | Novel adeno-associated viruses derived from pig tissues transduce most major organs in mice | |
| Chao et al. | Gene therapy for human lung adenocarcinoma using a suicide gene driven by a lung-specific promoter delivered by JC virus-like particles | |
| Luo et al. | A triple-regulated oncolytic adenovirus carrying microRNA-143 exhibits potent antitumor efficacy in colorectal cancer | |
| JP2026067861A (en) | Modified virus | |
| Budzik et al. | Oncolytic foamy virus: generation and properties of a nonpathogenic replicating retroviral vector system that targets chronically proliferating cancer cells | |
| Lopez et al. | Tumor associated stromal cells play a critical role on the outcome of the oncolytic efficacy of conditionally replicative adenoviruses | |
| Huch et al. | Urokinase-type plasminogen activator receptor transcriptionally controlled adenoviruses eradicate pancreatic tumors and liver metastasis in mouse models | |
| Cao et al. | Redirecting anti-Vaccinia virus T cell immunity for cancer treatment by AAV-mediated delivery of the VV B8R gene | |
| Wang et al. | Engineered TCR T-cell therapy targeting mass spectrometry-identified natural epitope in PDAC | |
| US5968735A (en) | Vector for the expression of therapy-relevant genes | |
| WO2023196550A2 (en) | Adenovirus constructs and methods of use | |
| JP4660486B2 (en) | Anti-cancer therapeutic agent containing human apolipoprotein (a) kringle LK68 or LK8 gene as an active ingredient, and cancer treatment method using the same | |
| Shiau et al. | Development of a conditionally replicating pseudorabies virus for HER-2/neu-overexpressing bladder cancer therapy | |
| JP2023529319A (en) | Mesenchymal stem cells capable of improved tumor targeting and large-scale virus production | |
| Lee et al. | Enhanced oncolytic adenoviral production by downregulation of death-domain associated protein and overexpression of precursor terminal protein | |
| US20190367944A1 (en) | Recombinant virus vectors for the treatment of glycogen storage disease | |
| EP2421542A1 (en) | Foamyvirus vectors and methods of use | |
| Liu et al. | Novel strategies to augment genetically delivered immunotoxin molecular therapy for cancer therapy | |
| EP3743094B1 (en) | Mda-7/il-24 secretory variants and methods of use |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 17710273 Country of ref document: EP Kind code of ref document: A1 |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 17710273 Country of ref document: EP Kind code of ref document: A1 |
