WO2017132235A1 - METHODS FOR TREATING BRAIN METASTASES USING COMBINATIONS OF ANTI-P13K AND ANTI-mTOR AGENTS - Google Patents
METHODS FOR TREATING BRAIN METASTASES USING COMBINATIONS OF ANTI-P13K AND ANTI-mTOR AGENTS Download PDFInfo
- Publication number
- WO2017132235A1 WO2017132235A1 PCT/US2017/014896 US2017014896W WO2017132235A1 WO 2017132235 A1 WO2017132235 A1 WO 2017132235A1 US 2017014896 W US2017014896 W US 2017014896W WO 2017132235 A1 WO2017132235 A1 WO 2017132235A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cancer
- agent
- mtor
- pi3k
- biomarker
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/535—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines
- A61K31/5375—1,4-Oxazines, e.g. morpholine
- A61K31/5377—1,4-Oxazines, e.g. morpholine not condensed and containing further heterocyclic rings, e.g. timolol
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
- A61K31/4164—1,3-Diazoles
- A61K31/4184—1,3-Diazoles condensed with carbocyclic rings, e.g. benzimidazoles
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/4353—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems
- A61K31/436—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a six-membered ring having oxygen as a ring hetero atom, e.g. rapamycin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/55—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having seven-membered rings, e.g. azelastine, pentylenetetrazole
- A61K31/551—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having seven-membered rings, e.g. azelastine, pentylenetetrazole having two nitrogen atoms, e.g. dilazep
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/713—Double-stranded nucleic acids or oligonucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
- A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
- A61K39/3955—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
- A61K47/6835—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
- A61K47/6871—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting an enzyme
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/04—Antineoplastic agents specific for metastasis
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/40—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/52—Constant or Fc region; Isotype
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/72—Increased effector function due to an Fc-modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/12—Type of nucleic acid catalytic nucleic acids, e.g. ribozymes
- C12N2310/122—Hairpin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
- C12N2310/141—MicroRNAs, miRNAs
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/16—Aptamers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/50—Physical structure
- C12N2310/53—Physical structure partially self-complementary or closed
- C12N2310/531—Stem-loop; Hairpin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
- C12N2320/31—Combination therapy
Definitions
- the present invention is based, at least in part, on the discovery that inhibiting or blocking both PI3K and mTOR results in a synergistic therapeutic benefit for treating brain metastases that is unexpected given the lack of such benefit observed for inhibiting or blocking other points of the PI3K-mTOR signaling pathway either alone or in combination. It has also been determined herein that brain metastases having an ultra-hypermutation phenotype characterized by an overall enrichment of genomic mutations and particularly in loss-of-function mutations within DNA repair genes are less responsive or non-responsive to the combination of PI3K and mTOR inhibition.
- a method of treating a subject afflicted with a brain metastasis from an extracranial cancer comprising administering to the subject a therapeutically effective amount of at least one agent that inhibits or blocks both PI3K and mTOR, is provided.
- the at least one agent is a small molecule inhibitor for both PI3K and mTOR.
- the at least one agent is a synergistic
- the at least one agent comprises an RNA interfering agent which inhibits expression of PI3K and/or mTOR (e.g., wherein the RNA interfering agent is a small interfering RNA (siRNA), small hairpin RNA (shRNA), or a microRNA (miRNA)).
- the at least one agent comprises an antisense oligonucleotide complementary to PI3K and/or mTOR.
- the at least one agent comprises a peptide or peptidomimetic that inhibits or blocks PI3K and/or mTOR. In still another embodiment, the at least one agent comprises an aptamer that inhibits or blocks PI3K and/or mTOR. In yet another embodiment, the at least one agent is an intrabody, or an antigen binding fragment thereof, which specifically binds to PI3K protein and/or mTOR protein.
- the intrabody, or antigen binding fragment thereof is murine, chimeric, humanized, composite, or human.
- the intrabody, or antigen binding fragment thereof is detectably labeled, comprises an effector domain, comprises an Fc domain, and/or is selected from the group consisting of Fv, Fav, F(ab')2), Fab', dsFv, scFv, sc(Fv)2, and diabodies fragments.
- the intrabody, or antigen binding fragment thereof is conjugated to a cytotoxic agent.
- the cytotoxic agent is selected from the group consisting of a chemotherapeutic agent, a biologic agent, a toxin, and a radioactive isotope.
- the PI3K is a class I PI3K.
- the PI3K is a class I PI3K.
- the class I PI3K is selected from the group consisting of PIK3CA, PIK3CB, PIK3CG, and PIK3CD. In another embodiment, the class I PI3K is PIK3CA, PIK3CB, PIK3CG, and PIK3CD. In still another embodiment, the mTOR is inhibited or blocked within both an mTORCl complex and an mTORC2 complex.
- the at least one agent comprises 5-(2,6-dimorpholin-4-ylpyrimidin-4-yl)-4- (trifluoromethyl)pyridin-2-amine (BKM120) and dihydroxy-12-[(2R)-l-[(l S,3R,4R)-4-(2- hydroxyethoxy)-3 -methoxycyclohexyl]propan-2-yl]- 19,30-dimethoxy- 15,17,21 ,23,29,35- hexamethyl-1 l,36-dioxa-4-azatricyclo[30.3.1.0 hexatriaconta-16,24,26,28-tetraene- 2,3,10, 14,20-pentone (RAD001).
- the at least one agent inhibits phosphorylation of S6RP and/or 4EBP1.
- the at least one agent reduces the number of proliferating cells in the brain metastasis and/or increases the number of apoptotic cells in the brain metastasis.
- the at least one agent reduces the number of cells expressing KI67 in the brain metastasis and/or increases the number of cells expressing cleaved caspase-3 in the brain metastasis.
- the at least one agent is administered in a pharmaceutically acceptable formulation.
- the method further comprises administering to the subject a therapeutic agent or regimen for treating the brain metastasis.
- the brain metastasis and/or extracranial cancer has significantly increased expression of at least 1 AKT-mTOR-dependent gene relative to a cancer whose proliferating cells are not reduced or whose apoptotic cells are not increased with a combination treatment of BKM120 and RAD001, wherein the AKT-mTOR- dependent gene is selected from the group consisting of AKTl, BIK, BSG, DDRl, CDC34, CLDN3, CYB561, GPX4, HNRPAB, LASP1, MMP15, MVK, EDD8, EU1, PCTK1, POR, PRKCD, PVRL2, SPINT1, UBE2M, TMED10, DUSP10, CLSTN1, PMPCA, BRMS1, TJP3, ARHGEF16, ADIPORl, SLC37A1, KCTD5, TOLLIP, SYNJ2BP, R F126, and COROIB.
- AKT-mTOR-dependent gene is selected from the group consisting of AKTl, BIK, B
- the brain metastasis and/or extracranial cancer has an increased expression of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, or 34 AKT-mTOR- dependent genes.
- the brain metastasis and/or extracranial cancer has a mutation in at least 1 DNA repair protein gene that encodes a non-functrional DNA repair protein, or express at least 1 DNA repair protein that is nonfunctional.
- the at least 1 DNA repair protein gene or protein is selected from the group consisting of DNA repair protein genes or proteins in Table 2, APEXl, ATM, ATR, BRCA1, BRCA2, BRIP1, ERCC2, ERCC4, ERCC6, KLC3, LIG1, LIG3, MPG, MSH3, MSH5, MSH6, EIL3, PRL3, NTHL1, PARP2, PGBD3, PRKDC, PMS2, POLL, PRKDC, RAD18, RAD23B, RAD54L, RPA1, SLK, TMEM55B, TOP3B, XRCC3, and XRCC6BP1.
- the brain metastasis and/or extracranial cancer has about 20 synonymous or non-synonymous somatic mutations or fewer per megabase of genomic DNA. In still another embodiment, the brain metastasis and/or extracranial cancer has about 10 synonymous or non-synonymous somatic mutations or fewer per megabase of genomic DNA. In yet another embodiment, the extracranial cancer is not a central nervous system (CNS) or a peripheral nervous system (PNS) cancer. In another embodiment, the extracranial cancer is selected from the group consisting of breast, lung, colorectal carcinoma, melanoma, kidney, bladder, ovarian, and urethral cancers.
- the extracranial cancer is breast cancer, such as a HER2-positive breast cancer.
- the subject is an animal model of a brain metastasis from an extracranial cancer, such as an orthotopic xenograft animal model of a human- derived brain metastasis from a human extracranial cancer and/or a mouse model.
- the subject is a mammal, such as a mouse or a human.
- the mammal is a human.
- Figure 1 includes 4 panels, identified as panels A, B, C, and D, which show the establishment of orthotopic HER2 -positive (HER2+) breast cancer brain metastases
- BCBM patient-derived xenografts
- Panel A shows a schematic diagram depicting the process of generating PDX BCBM models for use in pre-clinical studies.
- Panel C shows a summary of the established HER2+ BCBM PDX models.
- Panel D shows the compiled result of PTEN
- a score of 0 indicates no staining in > 90% of tumor cells, a score of 1+ indicates weak staining in > 75% of tumor cells, and a score of 2+ indicates strong staining in > 75% of tumor cells.
- Figure 2 includes 8 panels, identified as panels A, B, C, D, E, F, G, and H, which show the selective response of HER2+ BCBM PDX DF-BM355 to targeted therapies.
- Panel A shows the results of bioluminescence imaging analyses of mice bearing DF- BM355 tumors at week 0 and week 5 after treatment with vehicle control, lapatinib (LAP), BKM120, or a combination of lapatinib and BKM120 (LAP+BKM120).
- Panel B shows the results of Kaplan-Meier survival analyses of mice bearing DF-BM355 treated with vehicle control, BKM120 (PO, 30 mg/kg, QD), lapatinib (PO, 100 mg/kg), and the combination of lapatinib and BKM120.
- Panel C shows Kaplan-Meier survival analyses of mice bearing DF-BM355 treated with vehicle control, RAD001 (PO 7.5 mg/kg, QD), or the combination of lapatinib and RAD.
- Panel D shows the results of bioluminescence imaging analyses of mice bearing DF-BM355 before (week -1, week 0) and after (week 1, week 2) treatment with the indicated compounds.
- Panel E shows the results of MRI of DF-BM355-bearing mice treated with vehicle control or a combination of RAD001 and BKM120.
- Panel F shows the results of quantification of the regions of interest (ROI) in each animal determined at each indicated imaging time point.
- ROI regions of interest
- Panel G shows Kaplan-Meier survival curves of DF-BM355-bearing mice treated with a combination of BKM120 and RAD001 compared to vehicle control.
- Panel H shows the results of IHC analyses of p4EBPl, pS6RP, Ki67, and cleaved caspase-3 on DF-BM355 tumors treated for 4 days with vehicle, BKM120 (PO 30 mg/kg, QD), RAD001 (PO 7.5 mg/kg, QD), or a combination of
- Bar graphs represent the mean ⁇ SEM of quantification of Ki67 and cleaved caspase-3 in DF-BM355 tumors; * p ⁇ 0.05; **p ⁇ 0.01.
- Figure 3 includes 3 panels, identified as panels A, B, and C, which show the in vivo effects of monotherapy with the PI3K inhibitor, BKM120, on DF-BM355.
- Panel B shows the results of Western blot analyses of lysates from vehicle-treated or BKM120-treated DF-BM355 in vivo.
- Figure 4 includes 4 panels, identified as panels A, B, C, and D, which show that the combination of BKM120/MEK162 has little effect on DF-BM354 tumor growth.
- Panel A shows the results of Western blot analysis of PI3K/mTOR/MAPK signaling in DF-BM354 compared to DF-BM355.
- Panel B shows the results of bioluminescence imaging analysis of DF-BM354 before (week 0) and after (week4) treatment with the indicated compounds.
- Panel C shows the results of Kaplan-Meier survival analysis of mice treated with BKM120 (PO, 30 mg/kg, QD), MEK162 (PO, 15 mg/kg), BKM120+MEK162, or vehicle control.
- Panel D shows the results of Western blot analysis of lysates from vehicle-treated,
- mice bearing DF-BM355 tumors were treated with JQ1 (IP, 100 mg/kg, QD) (large squares), JQ1+BKM120 (triangles), or vehicle control (small squares).
- JQ1 IP, 100 mg/kg, QD
- JQ1+BKM120 triangles
- vehicle control small squares
- the tumor burden is represented by quantification of bioluminescence induction for the brain region of interest (ROI).
- Figure 6 includes 8 panels, identified as panels A, B, C, D, E, F, G, and H, which show the differential responses of FIER2+ BCBM PDXs to the combination treatment of BKM120 and RAD001.
- Panel A shows the results of bioluminescence imaging analyses of DF-BM354 before (wk -2 and wk 0) and after (wk 2 and wk 4) treatment with a
- Panel B shows Kaplan-Meier survival curves of mice bearing DF-BM354 treated with vehicle control, BKM120 (PO 30 mg/kg, QD), RADOOl (PO 7.5 mg/kg, QD), or the combination of BKM120 and RADOOl .
- Panel D shows Kaplan-Meier survival curves of mice bearing DF-BM463 treated with vehicle control or the combination of BKM120 and RADOOl (BKM120, PO 30 mg/kg, QD; RADOOl, PO 7.5mg/kg, QD).
- Panel F shows Kaplan-Meier survival curves of DF-BM590 treated with vehicle control or the combination of BKM120 and RADOOl (BKM120, PO 30 mg/kg, QD;
- Figure 8 includes 5 panels, identified as panels A, B, C, D, and E, which show the results of next-generation sequencing analyses identifying associations of genetic and genomic alternations with therapeutic responses in HER2-positive BCBMs.
- Panle A shows the results of transcriptome analyses revealing an increased expression of AKT/mTOR- dependent signature genes in sensitive models as compared to resistant ones. Boxplots correspond to the first and third quartiles (the 25th and 75th percentiles) with upper/lower whisker extending to the highest value that is within 1.5 times the interquartile range.
- Panel B shows genome-wide DNA CNVs in HER2+ BCBM PDXs analyzed by WES.
- Panel C shows the number of somatic mutations in HER2+ BCBM PDXs identified by WES.
- Panel D shows the results of mutational profiling of a panel of DNA repair genes.
- Panel E shows a schematic of differential responses of HER2+ BCBM PDXs to combined inhibition of PI3K and mTOR.
- Figure 9 includes 2 panels, identified as panels A and B, which show conservation of genetic alternations after the transfer of tissue from patient to mouse.
- Panel A shows patterns of genome-wide DNA copy number variations in DFBM463, DF-BM507 and DF- BM590 PDXs and their matched patient tumors.
- Panel B shows mutational profiling of a panel of DNA repair genes in DF-BM463, DF-BM507, and DF-BM590 PDXs and their matched patient tumors.
- Figure 10 shows a list of mutations in DNA repair genes found in DF-BM507 and DF-BM590.
- Figure 11 shows a list of mutations in DNA repair genes found in patient brain metastatic tumors of DF-BM507 and DF-BM590.
- Figure 12 shows the treatment histories of HER2+ BCBM patients who contributed specimesnt ot he derivation of PDXs.
- Figure 13 shows the results of bioluminescence imaging of DF-BM354 before (day -14, day 0) and after (day 9) treatment with G E-317 (PO 40 mg/kg, QD).
- HER2- positive breast cancer patients are usually treated with HER2-directed therapies (e.g., lapatinib, trastuzumab, pertuzumab, and the like) in combination with chemotherapy or endocrine therapy.
- HER2-directed therapies e.g., lapatinib, trastuzumab, pertuzumab, and the like
- lapatinib, MEK inhibitors, BET bromodomain protein inhibitors, and other combinations of rational therapies were ineffective.
- the present invention relates, in part, to methods for treating brain metastases with a combination of PI3K and mTOR inhibitors.
- the present invention provides methods of stratifying patients and predicting response of a brain metastasis to treatment with a combination of PI3K and mTOR inhibitors based upon a determination and analysis of biomarkers described herein, such as overall enrichment of genomic mutations and particularly in loss-of-function mutations within DNA repair genes.
- an element means one element or more than one element.
- altered amount refers to increased or decreased copy number (e.g., germline and/or somatic) of a biomarker nucleic acid, e.g., increased or decreased expression level in a cancer sample, as compared to the expression level or copy number of the biomarker nucleic acid in a control sample.
- altered amount of a biomarker also includes an increased or decreased protein level of a biomarker protein in a sample, e.g., a cancer sample, as compared to the corresponding protein level in a normal, control sample.
- an altered amount of a biomarker protein may be determined by detecting posttranslational modification such as methylation status of the marker, which may affect the expression or activity of the biomarker protein.
- the amount of a biomarker in a subject is "significantly" higher or lower than the normal amount of the biomarker, if the amount of the biomarker is greater or less, respectively, than the normal level by an amount greater than the standard error of the assay employed to assess amount, and preferably at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 300%, 350%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or than that amount.
- the amount of the biomarker in the subject can be considered “significantly” higher or lower than the normal amount if the amount is at least about two, and preferably at least about three, four, or five times, higher or lower, respectively, than the normal amount of the biomarker.
- Such "significance” can also be applied to any other measured parameter described herein, such as for expression, inhibition, cytotoxicity, cell growth, and the like.
- altered level of expression of a biomarker refers to an expression level or copy number of the biomarker in a test sample, e.g., a sample derived from a patient suffering from cancer, that is greater or less than the standard error of the assay employed to assess expression or copy number, and is preferably at least twice, and more preferably three, four, five or ten or more times the expression level or copy number of the biomarker in a control sample (e.g., sample from a healthy subjects not having the associated disease) and preferably, the average expression level or copy number of the biomarker in several control samples.
- a test sample e.g., a sample derived from a patient suffering from cancer
- a control sample e.g., sample from a healthy subjects not having the associated disease
- the altered level of expression is greater or less than the standard error of the assay employed to assess expression or copy number, and is preferably at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 300%, 350%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or more times the expression level or copy number of the biomarker in a control sample (e.g., sample from a healthy subjects not having the associated disease) and preferably, the average expression level or copy number of the biomarker in several control samples.
- a control sample e.g., sample from a healthy subjects not having the associated disease
- the level of the biomarker refers to the level of the biomarker itself, the level of a modified biomarker (e.g., phosphorylated biomarker), or to the level of a biomarker relative to another measured variable, such as a control (e.g., phosphorylated biomarker relative to an unphosphorylated biomarker).
- a modified biomarker e.g., phosphorylated biomarker
- a control e.g., phosphorylated biomarker relative to an unphosphorylated biomarker.
- altered activity of a biomarker refers to an activity of the biomarker which is increased or decreased in a disease state, e.g., in a cancer sample, as compared to the activity of the biomarker in a normal, control sample.
- Altered activity of the biomarker may be the result of, for example, altered expression of the biomarker, altered protein level of the biomarker, altered structure of the biomarker, or, e.g., an altered interaction with other proteins involved in the same or different pathway as the biomarker or altered interaction with transcriptional activators or inhibitors.
- altered structure of a biomarker refers to the presence of mutations or allelic variants within a biomarker nucleic acid or protein, e.g., mutations which affect expression or activity of the biomarker nucleic acid or protein, as compared to the normal or wild-type gene or protein.
- mutations include, but are not limited to substitutions, deletions, or addition mutations. Mutations may be present in the coding or non-coding region of the biomarker nucleic acid.
- antibody broadly encompass naturally-occurring forms of antibodies (e.g. IgG, IgA, IgM, IgE) and recombinant antibodies such as single-chain antibodies, chimeric and humanized antibodies and multi-specific antibodies, as well as fragments and derivatives of all of the foregoing, which fragments and derivatives have at least an antigenic binding site.
- Antibody derivatives may comprise a protein or chemical moiety conjugated to an antibody.
- antibody as used herein also includes an "antigen-binding portion" of an antibody (or simply “antibody portion”).
- antigen-binding portion refers to one or more fragments of an antibody that retain the ability to specifically bind to an antigen (e.g., a biomarker polypeptide or fragment thereof). It has been shown that the antigen-binding function of an antibody can be performed by fragments of a full- length antibody.
- binding fragments encompassed within the term "antigen- binding portion" of an antibody include (i) a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CHI domains; (ii) a F(ab')2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a Fd fragment consisting of the VH and CHI domains; (iv) a Fv fragment consisting of the VL and VH domains of a single arm of an antibody, (v) a dAb fragment (Ward et al, (1989) Nature 341 :544-546), which consists of a VH domain; and (vi) an isolated complementarity determining region (CDR).
- a Fab fragment a monovalent fragment consisting of the VL, VH, CL and CHI domains
- F(ab')2 fragment a bivalent fragment comprising two Fab fragments linked by a disul
- the two domains of the Fv fragment, VL and VH are coded for by separate genes, they can be joined, using recombinant methods, by a synthetic linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent polypeptides (known as single chain Fv (scFv); see e.g., Bird et al. (1988) Science 242:423-426; and Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85:5879-5883; and Osbourn et al. 1998, Nature
- scFv single chain Fv
- Such single chain antibodies are also intended to be encompassed within the term "antigen-binding portion" of an antibody.
- Any VH and VL sequences of specific scFv can be linked to human immunoglobulin constant region cDNA or genomic sequences, in order to generate expression vectors encoding complete IgG polypeptides or other isotypes.
- VH and VL can also be used in the generation of Fab, Fv or other fragments of immunoglobulins using either protein chemistry or recombinant DNA technology.
- Other forms of single chain antibodies, such as diabodies are also encompassed.
- Diabodies are bivalent, bispecific antibodies in which VH and VL domains are expressed on a single polypeptide chain, but using a linker that is too short to allow for pairing between the two domains on the same chain, thereby forcing the domains to pair with complementary domains of another chain and creating two antigen binding sites (see e.g., Holliger, P., et al. (1993) Proc. Natl. Acad. Sci. USA 90:6444-6448; Poljak, R. J., et al. (1994) Structure 2: 1121-1123).
- an antibody or antigen-binding portion thereof may be part of larger immunoadhesion polypeptides, formed by covalent or noncovalent association of the antibody or antibody portion with one or more other proteins or peptides.
- immunoadhesion polypeptides include use of the streptavidin core region to make a tetrameric scFv polypeptide (Kipriyanov, S.M., et al.
- Antibody portions such as Fab and F(ab')2 fragments, can be prepared from whole antibodies using conventional techniques, such as papain or pepsin digestion, respectively, of whole antibodies.
- antibodies, antibody portions and immunoadhesion polypeptides can be obtained using standard recombinant DNA techniques, as described herein.
- antigen-binding portions can be adapted to be expressed within cells as
- Intracellular antibodies (Chen et al. (1994) Human Gene Ther. 5:595-601). Methods are well-known in the art for adapting antibodies to target (e.g., inhibit) intracellular moieties, such as the use of single-chain antibodies (scFvs), modification of immunoglobulin VL domains for hyperstability, modification of antibodies to resist the reducing intracellular environment, generating fusion proteins that increase intracellular stability and/or modulate intracellular localization, and the like. Intracellular antibodies can also be introduced and expressed in one or more cells, tissues or organs of a multicellular organism, for example for prophylactic and/or therapeutic purposes (e.g., as a gene therapy) (see, at least PCT Pubis.
- Antibodies may be polyclonal or monoclonal; xenogeneic, allogeneic, or syngeneic; or modified forms thereof (e.g. humanized, chimeric, etc.). Antibodies may also be fully human. Preferably, antibodies of the present invention bind specifically or substantially specifically to a biomarker polypeptide or fragment thereof.
- monoclonal antibodies and “monoclonal antibody composition”, as used herein, refer to a population of antibody polypeptides that contain only one species of an antigen binding site capable of immunoreacting with a particular epitope of an antigen
- polyclonal antibodies and “polyclonal antibody composition” refer to a population of antibody polypeptides that contain multiple species of antigen binding sites capable of interacting with a particular antigen.
- a monoclonal antibody composition typically displays a single binding affinity for a particular antigen with which it immunoreacts.
- Antibodies may also be "humanized", which is intended to include antibodies made by a non-human cell having variable and constant regions which have been altered to more closely resemble antibodies that would be made by a human cell. For example, by altering the non-human antibody amino acid sequence to incorporate amino acids found in human germline immunoglobulin sequences.
- the humanized antibodies of the present invention may include amino acid residues not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo), for example in the CDRs.
- humanized antibody also includes antibodies in which CDR sequences derived from the germline of another mammalian species, such as a mouse, have been grafted onto human framework sequences.
- assigned score refers to the numerical value designated for each of the biomarkers after being measured in a patient sample. The assigned score correlates to the absence, presence or inferred amount of the biomarker in the sample. The assigned score can be generated manually (e.g., by visual inspection) or with the aid of instrumentation for image acquisition and analysis. In certain embodiments, the assigned score is determined by a qualitative assessment, for example, detection of a fluorescent readout on a graded scale, or quantitative assessment.
- the aggregate score is a summation of assigned scores.
- combination of assigned scores involves performing mathematical operations on the assigned scores before combining them into an aggregate score.
- the aggregate score is also referred to herein as the "predictive score.”
- biomarker refers to a measurable entity of the present invention that has been determined to be predictive of PI3K and mTOR combinatorial inhibitor therapy effects on a cancer.
- Biomarkers can include, without limitation, nucleic acids and proteins, including those shown in the Tables, the Examples, the Figures, and otherwise described herein. As described herein, any relevant characteristic of a biomarker can be used, such as the copy number, amount, activity, location, modification (e.g., phosphorylation), and the like.
- blocking antibody or an antibody “antagonist” is one which inhibits or reduces at least one biological activity of the antigen(s) it binds.
- the blocking antibodies or antagonist antibodies or fragments thereof described herein substantially or completely inhibit a given biological activity of the antigen(s).
- the "blood-brain barrier” or “BBB” refers to the physiological barrier between the peripheral circulation and the brain and spinal cord (i.e., the CNS) which is formed by tight junctions within the brain capillary endothelial plasma membranes, creating a tight barrier that restricts the transport of molecules into the brain, even very small molecules such as urea (60 Daltons).
- the blood-brain barrier within the brain, the blood-spinal cord barrier within the spinal cord, and the blood-retinal barrier within the retina are contiguous capillary barriers within the CNS, and are herein collectively referred to as the blood-brain barrier or BBB.
- the BBB also encompasses the blood-CSF barrier (i.e., choroid plexus) where the barrier is comprised of ependymal cells rather than capillary endothelial cells.
- the blood-CSF barrier i.e., choroid plexus
- Methods for modifying therapeutic agents and for transporting same across the blood-brain barrier are well-known in the art (see, for example, PCT Pubis. WO 2004/060403, WO 2000/074658, WO 2009/0079790; U.S. Pat. Pubis. US 2013/0177499 and US
- body fluid refers to fluids that are excreted or secreted from the body as well as fluids that are normally not (e.g. amniotic fluid, aqueous humor, bile, blood and blood plasma, cerebrospinal fluid, cerumen and earwax, cowper's fluid or pre-ejaculatory fluid, chyle, chyme, stool, female ejaculate, interstitial fluid, intracellular fluid, lymph, menses, breast milk, mucus, pleural fluid, pus, saliva, sebum, semen, serum, sweat, synovial fluid, tears, urine, vaginal lubrication, vitreous humor, vomit).
- fluids that are excreted or secreted from the body as well as fluids that are normally not (e.g. amniotic fluid, aqueous humor, bile, blood and blood plasma, cerebrospinal fluid, cerumen and earwax, cowper's fluid or pre-ejaculatory fluid, chyle,
- cancer or “tumor” or “hyperproliferative” refer to the presence of cells possessing characteristics typical of cancer-causing cells, such as uncontrolled proliferation, immortality, metastatic potential, rapid growth and proliferation rate, and certain
- cancer cells are often in the form of a tumor, but such cells may exist alone within an animal, or may be a non-tumorigenic cancer cell, such as a leukemia cell.
- cancer includes premalignant as well as malignant cancers.
- Cancers include, but are not limited to, B cell cancer, e.g., multiple myeloma, Waldenstrom's macroglobulinemia, the heavy chain diseases, such as, for example, alpha chain disease, gamma chain disease, and mu chain disease, benign monoclonal gammopathy, and immunocytic amyloidosis, melanomas, breast cancer, lung cancer, bronchus cancer, colorectal cancer, prostate cancer, pancreatic cancer, stomach cancer, ovarian cancer, urinary bladder cancer, brain or central nervous system cancer, peripheral nervous system cancer, esophageal cancer, cervical cancer, uterine or endometrial cancer, cancer of the oral cavity or pharynx, liver cancer, kidney cancer, testicular cancer, biliary tract cancer, small bowel or appendix cancer, salivary gland cancer, thyroid gland cancer, adrenal gland cancer, osteosarcoma, chondrosarcoma, cancer of hematologic tissues, and the like.
- the heavy chain diseases such as, for
- human sarcomas and carcinomas e.g., fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's tumor,
- craniopharyngioma ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, melanoma, neuroblastoma, retinoblastoma; leukemias, e.g., acute lymphocytic leukemia and acute myelocytic leukemia (myeloblastic,
- lymphoma Hodgkin's disease and non-Hodgkin's disease
- multiple myeloma Waldenstrom's macroglobulinemia, and heavy chain disease.
- cancers are epithlelial in nature and include but are not limited to, bladder cancer, breast cancer, cervical cancer, colon cancer, gynecologic cancers, renal cancer, laryngeal cancer, lung cancer, oral cancer, head and neck cancer, ovarian cancer, pancreatic cancer, prostate cancer, or skin cancer.
- the cancer is breast cancer, prostate cancer, lung cancer, or colon cancer.
- the epithelial cancer is non-small-cell lung cancer, nonpapillary renal cell carcinoma, cervical carcinoma, ovarian carcinoma (e.g., serous ovarian carcinoma), or breast carcinoma.
- the epithelial cancers may be characterized in various other ways including, but not limited to, serous, endometrioid, mucinous, clear cell, Brenner, or undifferentiated.
- the cancer encompasses a brain metastasis of an extra- cranial cancer.
- the term refers to cancers originating outside of the brain, which metastasizes before, during, or after progression in the extracranial location to the brain.
- the treatments for brain metastasis are primarily whole brain and focused radiotherapy, with surgical resection of tumors in a minority of cases.
- Most chemotherapy regimens involve 2-3 agents such as cisplatin, cyclophosphamide, etoposide, teniposide, mitomycin, irinotecan, vinorelbine, etoposide, ifosfamide, temozolomide and fluorouracil (5-FU). These are administered in combination with radiotherapy.
- the effect of these agents such as cisplatin, cyclophosphamide, etoposide, teniposide, mitomycin, irinotecan, vinorelbine, etoposide, ifosfamide, tem
- the extracranial cancer can have its primary origination from within the central nervous system (CNS), peripheral nervous system (PNS), or outside the nervous system.
- the extracranial cancer can refer to both the primary and a metastatic cancer thereof, the primary cancer alone, or the metastatic cancer thereof alone.
- Cancer cells forming brain metastases commonly originate from lung, breast, colorectal carcinoma, melanoma, kidney, bladder, and urethral cancers (U.S. Pat. Publ. 2015/0314010).
- the metastasized primary cancer can exist in the brain in a number of forms. It can be a brain tumor surrounded by and infiltrated with GFAP-positive astrocytes (Yoshimine et al.
- J. Neurosurg. 62:414-418 are not derived from glia ⁇ e.g., not glioblastomas).
- It can be a micrometastatic tumor, wherein the tumor is too small to be visualized by radiological means.
- It can be a visible metastatic tumor, wherein the tumor is large enough to be discernable by clinical radiological means, such as magnetic resonance imaging, computerized tomography, or positron emission tomography.
- the metastatic lesions are distinct from metastatic cancer cells in the systemic circulation and single cancer cells extravasating into brain tissue or quiescently residing therein (see generally Joyce and Pollard (2009) Nat. Rev. Cancer 9:239-252).
- the brain metastases can be progressive or stable, as assessed by a method, such as MRI, CT, proliferation marker expression, and the like.
- micrometastasis as used herein is preferably defined as a group of confluent cancer cells measuring from greater than 0.2 mm and/or having greater than 200 cells to 2 mm in maximum width. More preferably “micrometastasis” is defined as a group of confluent cancer cells from 0.2 mm to 2 mm in maximum width (see Edge et al. (2010) AJCC Cancer Staging Manual and Handbook (7th ed.)).
- An alternative preferred definition of "micrometastasis” is a confluent group of at least 1000 cancer cells and at least 0.1 mm in widest dimension up to 1 mm in widest dimension. Micrometastasis is generally not visible in standard contrast MRI imaging or other clinical imaging techniques.
- radioactive antibodies directed to tumor selective antigens ⁇ e.g., Her2 for breast cancer metastasis
- Other indirect detection methods include contrast media leakage at brain micrometastasis sites due to VEGF induced vascular leakage (Yano et al. (2000) Cancer Res. 60:4959-49067; U.S. Pat. Publ. 2015/0352113).
- More sensitive imaging techniques may also be applied to detect micrometastases. For example, blood volume may be imaged by MRI using the alternative contrast agent, USPIO (Molday Iron, Biopal, Worcester, Mass.) to detect micrometastasis (Yin et al. (2009) Clin. Exp. Metastasis. 26:403-414).
- coding region refers to regions of a nucleotide sequence comprising codons which are translated into amino acid residues
- noncoding region refers to regions of a nucleotide sequence that are not translated into amino acids ⁇ e.g., 5' and 3' untranslated regions
- an adenine residue of a first nucleic acid region is capable of forming specific hydrogen bonds ("base pairing") with a residue of a second nucleic acid region which is antiparallel to the first region if the residue is thymine or uracil.
- base pairing specific hydrogen bonds
- a cytosine residue of a first nucleic acid strand is capable of base pairing with a residue of a second nucleic acid strand which is antiparallel to the first strand if the residue is guanine.
- a first region of a nucleic acid is complementary to a second region of the same or a different nucleic acid if, when the two regions are arranged in an antiparallel fashion, at least one nucleotide residue of the first region is capable of base pairing with a residue of the second region.
- the first region comprises a first portion and the second region comprises a second portion, whereby, when the first and second portions are arranged in an antiparallel fashion, at least about 50%, and preferably at least about 75%, at least about 90%, or at least about 95% of the nucleotide residues of the first portion are capable of base pairing with nucleotide residues in the second portion. More preferably, all nucleotide residues of the first portion are capable of base pairing with nucleotide residues in the second portion.
- control refers to any reference standard suitable to provide a comparison to the expression products in the test sample.
- the control comprises obtaining a "control sample” from which expression product levels are detected and compared to the expression product levels from the test sample.
- a control sample may comprise any suitable sample, including but not limited to a sample from a control cancer patient (can be stored sample or previous sample measurement) with a known outcome; normal tissue or cells isolated from a subject, such as a normal patient or the cancer patient, cultured primary cells/tissues isolated from a subject such as a normal subject or the cancer patient, adjacent normal cells/tissues obtained from the same organ or body location of the cancer patient, a tissue or cell sample isolated from a normal subject, or a primary cells/tissues obtained from a depository.
- control may comprise a reference standard expression product level from any suitable source, including but not limited to housekeeping genes, an expression product level range from normal tissue (or other previously analyzed control sample), a previously determined expression product level range within a test sample from a group of patients, or a set of patients with a certain outcome (for example, survival for one, two, three, four years, etc.) or receiving a certain treatment (for example, standard of care cancer therapy).
- a certain outcome for example, survival for one, two, three, four years, etc.
- a certain treatment for example, standard of care cancer therapy
- control samples and reference standard expression product levels can be used in combination as controls in the methods of the present invention.
- control may comprise normal or non-cancerous cell/tissue sample.
- control may comprise an expression level for a set of patients, such as a set of cancer patients, or for a set of cancer patients receiving a certain treatment, or for a set of patients with one outcome versus another outcome.
- the specific expression product level of each patient can be assigned to a percentile level of expression, or expressed as either higher or lower than the mean or average of the reference standard expression level.
- control may comprise normal cells, cells from patients treated with combination chemotherapy, and cells from patients having benign cancer.
- control may also comprise a measured value for example, average level of expression of a particular gene in a population compared to the level of expression of a housekeeping gene in the same population.
- control comprises a ratio transformation of expression product levels, including but not limited to determining a ratio of expression product levels of two genes in the test sample and comparing it to any suitable ratio of the same two genes in a reference standard;
- control comprises a control sample which is of the same lineage and/or type as the test sample.
- control may comprise expression product levels grouped as percentiles within or based on a set of patient samples, such as all patients with cancer.
- a control expression product level is established wherein higher or lower levels of expression product relative to, for instance, a particular percentile, are used as the basis for predicting outcome.
- a control expression product level is established using expression product levels from cancer control patients with a known outcome, and the expression product levels from the test sample are compared to the control expression product level as the basis for predicting outcome.
- the methods of the present invention are not limited to use of a specific cut-point in comparing the level of expression product in the test sample to the control.
- the "copy number" of a biomarker nucleic acid refers to the number of DNA sequences in a cell (e.g., germline and/or somatic) encoding a particular gene product. Generally, for a given gene, a mammal has two copies of each gene. The copy number can be increased, however, by gene amplification or duplication, or reduced by deletion. For example, germline copy number changes include changes at one or more genomic loci, wherein said one or more genomic loci are not accounted for by the number of copies in the normal complement of germline copies in a control (e.g., the normal copy number in germline DNA for the same species as that from which the specific germline DNA and corresponding copy number were determined).
- Somatic copy number changes include changes at one or more genomic loci, wherein said one or more genomic loci are not accounted for by the number of copies in germline DNA of a control (e.g., copy number in germline DNA for the same subject as that from which the somatic DNA and corresponding copy number were determined).
- the "normal" copy number (e.g., germline and/or somatic) of a biomarker nucleic acid or "normal” level of expression of a biomarker nucleic acid or protein is the activity /level of expression or copy number in a biological sample, e.g., a sample containing tissue, whole blood, serum, plasma, buccal scrape, saliva, cerebrospinal fluid, urine, stool, and bone marrow, from a subject, e.g., a human, not afflicted with cancer, or from a corresponding non-cancerous tissue in the same subject who has cancer.
- a biological sample e.g., a sample containing tissue, whole blood, serum, plasma, buccal scrape, saliva, cerebrospinal fluid, urine, stool, and bone marrow
- costimulate with reference to activated immune cells includes the ability of a costimulatory molecule to provide a second, non-activating receptor mediated signal (a "costimulatory signal") that induces proliferation or effector function.
- a costimulatory signal can result in cytokine secretion, e.g., in a T cell that has received a T cell-receptor-mediated signal.
- Immune cells that have received a cell-receptor mediated signal, e.g., via an activating receptor are referred to herein as "activated immune cells.”
- determining a suitable treatment regimen for the subject is taken to mean the determination of a treatment regimen (i.e., a single therapy or a combination of different therapies that are used for the prevention and/or treatment of the cancer in the subject) for a subject that is started, modified and/or ended based or essentially based or at least partially based on the results of the analysis according to the present invention.
- a treatment regimen i.e., a single therapy or a combination of different therapies that are used for the prevention and/or treatment of the cancer in the subject
- a subject that is started, modified and/or ended based or essentially based or at least partially based on the results of the analysis according to the present invention.
- a treatment regimen i.e., a single therapy or a combination of different therapies that are used for the prevention and/or treatment of the cancer in the subject
- the determination can, in addition to the results of the analysis according to the present invention, be based on personal characteristics of the subject to be treated. In most cases, the actual determination of the suitable treatment
- diagnosing cancer includes the use of the methods, systems, and code of the present invention to determine the presence or absence of a cancer or subtype thereof in an individual.
- the term also includes methods, systems, and code for assessing the level of disease activity in an individual.
- a molecule is "fixed” or "affixed” to a substrate if it is covalently or non-covalently associated with the substrate such that the substrate can be rinsed with a fluid (e.g. standard saline citrate, pH 7.4) without a substantial fraction of the molecule dissociating from the substrate.
- a fluid e.g. standard saline citrate, pH 7.4
- expression signature refers to a group of one or more coordinately expressed biomarkers related to a measured phenotype.
- the genes, proteins, metabolites, and the like making up this signature may be expressed in a specific cell lineage, stage of differentiation, or during a particular biological response.
- the biomarkers can reflect biological aspects of the tumors in which they are expressed, such as the cell of origin of the cancer, the nature of the non-malignant cells in the biopsy, and the oncogenic mechanisms responsible for the cancer.
- Expression data and gene expression levels can be stored on computer readable media, e.g., the computer readable medium used in conjunction with a microarray or chip reading device. Such expression data can be manipulated to generate expression signatures.
- “Homologous” as used herein refers to nucleotide sequence similarity between two regions of the same nucleic acid strand or between regions of two different nucleic acid strands. When a nucleotide residue position in both regions is occupied by the same nucleotide residue, then the regions are homologous at that position. A first region is homologous to a second region if at least one nucleotide residue position of each region is occupied by the same residue. Homology between two regions is expressed in terms of the proportion of nucleotide residue positions of the two regions that are occupied by the same nucleotide residue.
- a region having the nucleotide sequence 5'- ATTGCC-3' and a region having the nucleotide sequence 5'-TATGGC-3' share 50% homology.
- the first region comprises a first portion and the second region comprises a second portion, whereby, at least about 50%, and preferably at least about 75%, at least about 90%, or at least about 95% of the nucleotide residue positions of each of the portions are occupied by the same nucleotide residue. More preferably, all nucleotide residue positions of each of the portions are occupied by the same nucleotide residue.
- immune cell refers to cells that play a role in the immune response.
- Immune cells are of hematopoietic origin, and include lymphocytes, such as B cells and T cells; natural killer cells; myeloid cells, such as monocytes, macrophages, eosinophils, mast cells, basophils, and granulocytes.
- lymphocytes such as B cells and T cells
- natural killer cells such as myeloid cells, such as monocytes, macrophages, eosinophils, mast cells, basophils, and granulocytes.
- Immune checkpoint refers to a group of molecules on the cell surface of CD4+ and/or CD8+ T cells that fine-tune immune responses by down-modulating or inhibiting an anti-tumor immune response.
- Immune checkpoint proteins are well known in the art and include, without limitation, CTLA-4, PD-1, VISTA, B7-H2, B7-H3, PD-Ll, B7- H4, B7-H6, 2B4, ICOS, HVEM, PD-L2, CD160, gp49B, PIR-B, KIR family receptors, ⁇ -1, TIM-3, TIM-4, LAG-3, BTLA, SIRPalpha (CD47), CD48, 2B4 (CD244), B7.1, B7.2, ILT-2, ILT-4, TIGIT, and A2aR (see, for example, WO 2012/177624).
- the term further encompasses biologically active protein fragment, as well as nucleic acids encoding full-length immune checkpoint proteins and biological
- Anti-immune checkpoint therapy refers to the use of agents that inhibit immune checkpoint nucleic acids and/or proteins. Inhibition of one or more immune checkpoints can block or otherwise neutralize inhibitory signaling to thereby upregulate an immune response in order to more efficaciously treat cancer.
- agents useful for inhibiting immune checkpoints include antibodies, small molecules, peptides, peptidomimetics, natural ligands, and derivatives of natural ligands, that can either bind and/or inactivate or inhibit immune checkpoint proteins, or fragments thereof; as well as RNA interference, antisense, nucleic acid aptamers, etc. that can downregulate the expression and/or activity of immune checkpoint nucleic acids, or fragments thereof.
- agents for upregulating an immune response include antibodies against one or more immune checkpoint proteins block the interaction between the proteins and its natural receptor(s); a non-activating form of one or more immune checkpoint proteins (e.g. , a dominant negative polypeptide); small molecules or peptides that block the interaction between one or more immune checkpoint proteins and its natural receptor(s); fusion proteins (e.g. the
- agents can directly block the interaction between the one or more immune checkpoints and its natural receptor(s) (e.g., antibodies) to prevent inhibitory signaling and upregulate an immune response.
- agents can indirectly block the interaction between one or more immune checkpoint proteins and its natural receptor(s) to prevent inhibitory signaling and upregulate an immune response.
- an immune checkpoint protein ligand such as a stabilized extracellular domain can binding to its receptor to indirectly reduce the effective concentration of the receptor to bind to an appropriate ligand.
- anti-PD-1 antibodies, anti-PD-Ll antibodies, and/or anti-PD-L2 antibodies are used to inhibit immune checkpoints. These embodiments are also applicable to specific therapy against particular immune checkpoints, such as the PD-1 pathway (e.g., anti-PD-1 pathway therapy, otherwise known as PD-1 pathway inhibitor therapy).
- immune response includes T cell mediated and/or B cell mediated immune responses.
- exemplary immune responses include T cell responses, e.g., cytokine production and cellular cytotoxicity.
- immune response includes immune responses that are indirectly effected by T cell activation, e.g., antibody production (humoral responses) and activation of cytokine responsive cells, e.g., macrophages.
- immunotherapeutic agent can include any molecule, peptide, antibody or other agent which can stimulate a host immune system to generate an immune response to a tumor or cancer in the subject.
- Various immunotherapeutic agents are useful in the compositions and methods described herein.
- cancer includes the decrease, limitation, or blockage, of, for example a particular action, function, or interaction.
- cancer is "inhibited” if at least one symptom of the cancer is alleviated, terminated, slowed, or prevented.
- cancer is also “inhibited” if recurrence or metastasis of the cancer is reduced, slowed, delayed, or prevented.
- interaction when referring to an interaction between two molecules, refers to the physical contact (e.g., binding) of the molecules with one another. Generally, such an interaction results in an activity (which produces a biological effect) of one or both of said molecules.
- isolated protein refers to a protein that is substantially free of other proteins, cellular material, separation medium, and culture medium when isolated from cells or produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized.
- isolated or purified protein or biologically active portion thereof is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which the antibody, polypeptide, peptide or fusion protein is derived, or substantially free from chemical precursors or other chemicals when chemically synthesized.
- substantially free of cellular material includes preparations of a biomarker polypeptide or fragment thereof, in which the protein is separated from cellular components of the cells from which it is isolated or recombinantly produced.
- the language "substantially free of cellular material” includes preparations of a biomarker protein or fragment thereof, having less than about 30% (by dry weight) of non-biomarker protein (also referred to herein as a "contaminating protein”), more preferably less than about 20% of non-biomarker protein, still more preferably less than about 10%) of non-biomarker protein, and most preferably less than about 5% non- biomarker protein.
- non-biomarker protein also referred to herein as a "contaminating protein”
- polypeptide, peptide or fusion protein or fragment thereof e.g., a biologically active fragment thereof
- it is also preferably substantially free of culture medium, i.e., culture medium represents less than about 20%, more preferably less than about 10%>, and most preferably less than about 5% of the volume of the protein preparation.
- kits is any manufacture (e.g. a package or container) comprising at least one reagent, e.g. a probe or small molecule, for specifically detecting and/or affecting the expression of a marker of the present invention.
- the kit may be promoted, distributed, or sold as a unit for performing the methods of the present invention.
- the kit may comprise one or more reagents necessary to express a composition useful in the methods of the present invention.
- the kit may further comprise a reference standard, e.g., a nucleic acid encoding a protein that does not affect or regulate signaling pathways controlling cell growth, division, migration, survival or apoptosis.
- control proteins including, but not limited to, common molecular tags (e.g., green fluorescent protein and beta-galactosidase), proteins not classified in any of pathway encompassing cell growth, division, migration, survival or apoptosis by GeneOntology reference, or ubiquitous housekeeping proteins.
- Reagents in the kit may be provided in individual containers or as mixtures of two or more reagents in a single container.
- instructional materials which describe the use of the compositions within the kit can be included.
- neoadjuvant therapy refers to a treatment given before the primary treatment.
- neoadjuvant therapy can include chemotherapy, radiation therapy, and hormone therapy.
- chemotherapy for example, in treating breast cancer, neoadjuvant therapy can allows patients with large breast cancer to undergo breast-conserving surgery.
- the "normal" level of expression of a biomarker is the level of expression of the biomarker in cells of a subject, e.g., a human patient, not afflicted with a cancer.
- An “over- expression” or “significantly higher level of expression” of a biomarker refers to an expression level in a test sample that is greater than the standard error of the assay employed to assess expression, and is preferably at least 10%, and more preferably 1.2, 1.3,
- a control sample e.g., sample from a healthy subject not having the biomarker associated disease
- a control sample e.g., sample from a healthy subject not having the biomarker associated disease
- the average expression level of the biomarker in several control samples e.g., the average expression level of the biomarker in several control samples.
- a "significantly lower level of expression" of a biomarker refers to an expression level in a test sample that is at least 10%, and more preferably 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20 times or more lower than the expression level of the biomarker in a control sample (e.g., sample from a healthy subject not having the biomarker associated disease) and preferably, the average expression level of the biomarker in several control samples.
- a control sample e.g., sample from a healthy subject not having the biomarker associated disease
- an "over-expression” or “significantly higher level of expression” of a biomarker refers to an expression level in a test sample that is greater than the standard error of the assay employed to assess expression, and is preferably at least 10%, and more preferably 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20 times or more higher than the expression activity or level of the biomarker in a control sample (e.g., sample from a healthy subject not having the biomarker associated disease) and preferably, the average expression level of the biomarker in several control samples.
- a control sample e.g., sample from a healthy subject not having the biomarker associated disease
- a "significantly lower level of expression" of a biomarker refers to an expression level in a test sample that is at least 10%, and more preferably 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20 times or more lower than the expression level of the biomarker in a control sample (e.g., sample from a healthy subject not having the biomarker associated disease) and preferably, the average expression level of the biomarker in several control samples.
- a control sample e.g., sample from a healthy subject not having the biomarker associated disease
- PI3K-mTOR signaling pathway refers to one of the intracellular signaling pathways activated by the binding of growth factors to receptor tyrosine kinases.
- PIP3 phosphatidylinositol-4,5-bisphosphate
- PIP3 phsophatidylinositol-3,4,5-triphosphate
- AKT kinase AKT
- Akt kinase is a serine/threonine kinase which is a downstream effector molecule of phosphoinositide 3-kinase and is involved in protecting a cell from apoptosis.
- Akt kinase is thought to be involved in the progression of cancer because it stimulates cell proliferation and suppresses apoptosis.
- Aktl is involved in cellular survival pathways, by inhibiting apoptotic processes. Aktl is also able to induce protein synthesis pathways, and is therefore a key signaling protein in the cellular pathways that lead to skeletal muscle hypertrophy, and general tissue growth.
- Aktl Since it can block apoptosis, and thereby promote cell survival, Aktl has been implicated as a major factor in many types of cancer. Akt is known to play a role in the cell cycle. Under various circumstances, activation of Akt was shown to overcome cell cycle arrest in Gl and G2 phases. Moreover, activated Akt may enable proliferation and survival of cells that have sustained a potentially mutagenic impact and, therefore, may contribute to acquisition of mutations in other genes. AKT (activation, amplification) and PTEN (mutation, deletion, epigenetic inactivation) are deregulated in many human cancers (Altomare et al. (2003) J. Cell Biochem. 88:470-476; Ruggeri et al. (1998) Mo/. Carcin. 21 :81-86; Cheng et al.
- PI3K pathway activation can be assessed by immunohistochemical analysis of PTEN or phosphorylated AKT levels in clinical samples (Slipicevic et al. (2005) Am. J. Clin. Pathol. 124:528-536).
- Molecular targets of such inhibitors include, but are not limited to, PI3K, AKT, S6K1, mTORCl, PDK1, MYC, cMET, FGFR2, growth factors (EGF, b-FGF, IGF1, Insulin, or Heregulin) and the like.
- mTOR exists in at least 2 distinct multiprotein complexes described as raptor-mTOR complex (mTORCl) and rictor-mTOR complex (mTORC2) in mammalian cells (sometimes referred to as just TORC1 and TORC2).
- mTORCl is composed of mTOR, GPL and raptor proteins and it binds to FKBP12-rapamycin.
- mTORCl is a rapamycin-sensitive complex as its kinase activity is inhibited by FKB12-rapamycin in vitro and the mTORCl complex positively regulates cell growth.
- the raptor branch of the mTOR pathway modulates number of processes, including mRNA translation, ribosome biogenesis, nutrient metabolism and autophagy.
- S6K1 S6 Kinase 1
- 4E-BP1 S6 Kinase 1
- S6K1 also phosphorylates S6RP, which is the S6 component of the 40S ribosomal subunit involved in regulating translation, cell size, cell proliferation, and glucose homeostasis (Magnuson et al. (2012) Biochem. J. 441 : 1- 21).
- mTORCl has been shown to phosphorylate S6K1 at T389 and is inhibited by
- the PI3K-mTOR signaling pathway is limited to subsets of biomolecules within the pathway, such as PI3K, mTORCl, S6RP, and 4E-BP1, or individual biomolecules within the pathway, such as PI3K, mTORCl, S6RP, or 4E-BP1.
- embodiments of the methods of the present invention can inhibit or block mTOR within an mTORCl complex, within an mTORC2 complex, and/or within both the mTORCl and mTORC2 complexes.
- PI3K refers to a family of intracellular signal transducer enzymes capable of phosphorylating the 3 position hydroxyl group of the inositol ring of phosphatidylinositol (Ptdlns).
- PBKs are divided into four different classes, known as class I, class II, class III, and class IV, based on the enzyme primary structure, enzymatic regulation, and lipid substrate specificity (Leevers et al. (1999) Curr. Opin. Cell Biol.
- Class I PBKs are heterodimeric molecules composed of a regulatory and a catalytic subunit, are activated by G protein-coupled receptors (GPCRs) and tyrosine kinase receptors, and are responsible for the production of the following phosphatidylinositols: PI(3)P, PI(3,4)P 2 , and PI(3,4,5)P 3 .
- GPCRs G protein-coupled receptors
- tyrosine kinase receptors tyrosine kinase receptors
- Class II PBKs do not contain a regulatory subunit, lack a critical Asp residue in the C-terminal C2 domain required for coordinate binding of calcium ions, can comprise one of three catalytic isoforms (C2alpha, C2beta, or C2gamma), and catalyze the production of PI(3)P from PI and PI(3,4)P 2 from PIP.
- Class III PBKs are similar to class II PBKs in structure, but only produce PI(3)P from PI.
- class IV PBKs is a more distantly related set of enzymes that are protein serine/threonine kinases and include the members, mTOR, DNA-PK, ATM, and ATR.
- the four class I catalytic PBKs are known as PIK3C alpha, PIK3C beta, PIK3C gamma, and PIK3C delta.
- the term “pan-PBK” refers to the group of PIK3C alpha, PIK3C beta, PIK3C gamma, and PIK3C delta.
- a “pan-PBK inhibitor” inhibits PIK3C alpha, PIK3C beta, PIK3C gamma, and PIK3C delta.
- PIK3C alpha (PIK3CA) nucleic acid and amino acid sequences are well-known and include, for example, human PIK3CA (NM_006218.2 and NP_006209.2), monkey PIK3CA (NM_001260668.1 and NP_001247597.1), mouse PIK3CA (XM_006535409.2, XP_006535472.1,
- PIK3C beta (PIK3CB) nucleic acid and amino acid sequences are well- known and include, for example, human PIK3CB (NM_006219.2, NP_006210.1,
- NM_001256045.1, and NP_001242974.1 monkey PIK3CB (XM_015132082.1 and XP_014987568.1), mouse PIK3CB (NM_029094.3 and NP_083370.2), and rat PIK3CB (XM_008766567.1, XP_008764789.1, XM_006243642.2, and XP_006243704.1).
- PIK3C gamma nucleic acid and amino acid sequences are well-known and include, for example, human PIK3CG (NM_002649.3, NP_002640.2, NM_001282426.1, ⁇ _001269355.1, NM_001282427.1, and P_001269356.1), monkey PIK3CG
- mouse PIK3CG M_020272.2, P_064668.2, M_001146201.1 , P_001139673.1, NM_001146200.1 , and P_001139672.1
- rat PIK3CG XM_006240004.2, XP_006240066.1, XM_006240005.2, XP_006240067.1, XM 006240003.2, and XP 006240065.
- PIK3C delta (PIK3CD) nucleic acid and amino acid sequences are well-known and include, for example, human PIK3CD ( M 005026.3 and P_005017.3), chimpanzee PIK3CD (XM 009447951.1, XP_009446226.1,
- mouse PIK3CD M_008840.3, P_032866.2, M_001164052.1 , P_001157524.1 , NM_001164051.1 , NP_001157523.1,
- Anti-PI3K agents including intrabodies, nucleic acids, and the like are well-known in the art and include, for example, pan-PI3K inhibitors having broad inhibitory activity against all catalytic PI3Ks (e.g., pan-Class I PI3K inhibitors) are known and include BKM120 (5-(2,6-dimorpholin-4-ylpyrimidin-4-yl)-4-(trifluoromethyl)pyridin- 2-amine; Maira et al. (2011) Mol. Cancer Ther. 11 :317-348), BEZ235 (Maira et al. (2011) Mol. Cancer Ther. 11 :317-348), wortmannin (Wymann et al. (1996) Mol. Cell. Biol.
- LY294002 Vlahos et al. (1994) J. Biol. Chem. 269:5241-5248; Wetzker and Rommel (2004) Curr. Pharm. Des. 10: 1915-1922
- BAY 80-80-6946 copanlisib
- PI3K isoform-specific small molecule inhibitors are known.
- AZD6482 selectively inhibits PI3KB
- AS-252424 and AS-604850 selectively inhibit PI3KG
- IC87114 selectively inhibits PI3KD
- GDC0941 selectively inhibits PI3KA and PI3KD (Finan and Thomas (2004) Biochem. Soc. Trans. 32:378-382; PCT Publ.
- PI3Ks e.g., other small molecules that are organic chemical molecules that are not peptides or nucleic acids
- antibodies that bind PI3Ks such as, TA802118, TA801482, and TA303167 (PIK3CA; OriGene Technol., Inc.); TA308795, TA330901, and TA329903 (PIK3CB; OriGene Technol., Inc.); TA505226, TA505228, and TA505227 (PIK3CG1 OriGene Technol., Inc.); and OTI2H3, TA325015, and TA307256 (PIK3CD; OriGene Technol., Inc.), and nucleic acids, such as SR303520, TF310428, SR421939, and TL501641 (PIK3CA-specific, OriGene Technol., Inc.); SR303521,
- PDKs can further be used to refer to any combination of features described herein regarding PDKs.
- any combination of class, sequence composition, percentage identify, sequence length, domain structure, functional activity, etc. can be used to describe a PI3K of the present invention.
- mTOR refers to an atypical serine/threonine kinase known as "mammalian target of rapamycin” that is present in two distinct complexes (Dowling et al. (2010) Biochim. Biophys. Acta 1804:433-439; Dunlop et al. (2009) Cell. Signal. 21 : 827-8735 ; Hoeffer et al. (2010) Trends Neurosci. 33 : 67-75 ; Laplante et al. (2012) Cell 149:274-293; Laplante et al. (2013) J. Cell. Sci. 126: 1713-1719; Neufeld (2010) Curr. Opin. Cell Biol.
- the mTOR complex 1 (mTORCl) is a complex of mTOR along with Raptor, GPL, and DEPTOR that acts as a master growth regulator by phosphorylating substrates that potentiate anabolic processes. This complex is inhibited by the small molecule, rapamycin.
- the mTOR complex 2 (mTORC2) is a complex of mTOR along with Rictor, GPL, Sinl, PRR5/Protor-l, and DEPTOR that promotes cellular survival by activating Akt, regulates cytoskeletal dynamics by activating PKCalpha, and regulates ion transport and growth by modulating SGK1 phosphorylation.
- Nucleic acid and amino acid sequences for mTOR are known in the art and are publicly available in the GenBank database maintained by the U.S. National Center for Biotechnology Information.
- mTOR nucleic acid and amino acid sequences are well-known and include, for example, human mTOR (NM_004958.3 and NP_004949.1), chimpanzee mTOR (XM_009448144.1 and
- XP_009446419.1 mouse mTOR (NM_020009.2 and NP_064393.2), rat mTOR
- Anti-mTOR agents including intrabodies, nucleic acids, and the like are well-known in the art and include, for example, small molecule inhibitors, such as RADOOl (also known as dihydroxy-12-[(2R)-l- [(l S,3R,4R)-4-(2 -hydroxy ethoxy)-3-methoxycyclohexyl]propan-2-yl]-19,30-dimethoxy- 15, 17,21, 23,29,35-hexamethyl- 1 l,36-dioxa-4-azatricyclo[30.3.1.0 hexatriaconta-
- RADOOl also known as dihydroxy-12-[(2R)-l- [(l S,3R,4R)-4-(2 -hydroxy ethoxy)-3-methoxycyclohexyl]propan-2-yl]-19,30-dimethoxy- 15, 17,21, 23,29,35-hexamethyl- 1 l,36-dioxa-4
- antibodies that bind mTOR such as, TA590835, TA307262, TA300537, TA322695, and TA322694 (OriGene Technol., Inc.), and nucleic acids, such as SR301656, TL320364, SR423527, TL503251, SR504090, and TL710387 (OriGene Technol., Inc.).
- nucleic acids such as SR301656, TL320364, SR423527, TL503251, SR504090, and TL710387 (OriGene Technol., Inc.).
- the term can further be used to refer to any combination of features described herein regarding mTOR.
- any combination of class, sequence composition, percentage identify, sequence length, domain structure, functional activity, etc. can be used to describe an mTOR of the present invention.
- S6RP refers to the cytoplasmic ribosomal protein that is a component of the 40S subunit of the ribosome and is a major substrate of protein kinases in the ribosome since it has five C-terminal serine residues that are phosphorylatable by different protein kinases. Nucleic acid and amino acid sequences for S6RP are known in the art and are publicly available in the GenBank database maintained by the U.S. National Center for Biotechnology Information.
- S6RP nucleic acid and amino acid sequences are well-known and include, for example, human S6RP (NM 001010.2 and NP_001001.2), chimpanzee S6RP (XM_003312012.3 and XP_003312060.1), monkey S6RP (XM_015117628.1 and XP_014973114.1), dog S6RP (NM_001252170.1 and NP_001239099.1), cow S6RP (NM_001015548.2 and NP_001015548.1), mouse S6RP (NM_009096.3 and NP_033122.1), rat S6RP (NM_017160.1 and NP_058856.1), and chicken S6RP (NM_205225.2 and NP_990556.1).
- human S6RP NM 001010.2 and NP_001001.2
- chimpanzee S6RP XM_003312012.3 and XP_003312060.1
- S6RP S6RP
- any combination of class, sequence composition, percentage identify, sequence length, domain structure, functional activity, etc. can be used to describe an S6RP of the present invention.
- 4EBP1 refers to the eukaryotic translation inhibition factor 4E binding protein ltranslation repressor protein that directly interacts with eukaryotic translation initiation factor 4E (eIF4E), which is a limiting component of the multisubunit complex that recruits 40S ribosomal subunits to the 4'end of mRNAs.
- eIF4E eukaryotic translation initiation factor 4E
- Nucleic acid and amino acid sequences for 4EBP1 are known in the art and are publicly available in the GenBank database maintained by the U.S. National Center for Biotechnology
- 4EBP1 nucleic acid and amino acid sequences are well-known and include, for example, human 4EBP1 ( M_004095.3 and P_004086.1), chimpanzee 4EBP1 (XM_531121.4 and XP_531121.2), monkey 4EBP1 (XM_015145167.1 and
- rat 4EBP1 M_053857.2 and P_446309.1. It is to be noted that the term can further be used to refer to any combination of features described herein regarding 4EBP1. For example, any combination of class, sequence composition, percentage identify, sequence length, domain structure, functional activity, etc. can be used to describe a 4EBP1 of the present invention.
- agents useful for inhibiting PI3K-mTORC signaling pathway include antibodies, small molecules, peptides,
- RNA molecules peptidomimetics, natural ligands, and derivatives of natural ligands, that can either bind and/or inactivate or inhibit target proteins, or fragments thereof; as well as RNA
- inhibitors of the PI3K-mTORC signaling pathway include, but are not limited to: S6K1 inhibitors, such as PF-4708671 (Pearce et al. (2010) Biochem. J. 431 :245-255) and DG2 (3-bromo-4-)4-)2- methoxyphenyl)piperazine-l-yl)-lH-pyrazolo[3,4-d]-pyrimidine (Axon Medchem.); AKT antibodies (Shin et al. (2005) Cancer Res. 65:2815-2824) (see also Cheng et al. (2005)
- Oncogene 24:7482-7492 for review of AKT pathway inhibitors PDK1 inhibitors, such as AR-12, BX-795, staurosporine, OSU-03012, celecoxib, and others described in U.S. Pat. Nos. 6,124,272; 7,344,870; and 7,041,687); and IGF 1R inhibitors (such as monoclonal antibody MK-0646, U.S. Pat. No. 7,241,444).
- pre-determined biomarker amount and/or activity measurement(s) may be a biomarker amount and/or activity measurement(s) used to, by way of example only, evaluate a subject that may be selected for a particular treatment, evaluate a response to a treatment such as PI3K and mTOR combination inhibitor therapy, and/or evaluate the disease state.
- a pre-determined biomarker amount and/or activity measurement(s) may be determined in populations of patients with or without cancer.
- the pre-determined biomarker amount and/or activity measurement(s) can be a single number, equally applicable to every patient, or the pre-determined biomarker amount and/or activity measurement(s) can vary according to specific subpopulations of patients.
- Age, weight, height, and other factors of a subject may affect the pre-determined biomarker amount and/or activity measurement(s) of the individual.
- the pre-determined biomarker amount and/or activity can be determined for each subject individually.
- the amounts determined and/or compared in a method described herein are based on absolute measurements.
- the amounts determined and/or compared in a method described herein are based on relative measurements, such as ratios (e.g., serum biomarker normalized to the expression of housekeeping or otherwise generally constant biomarker).
- ratios e.g., serum biomarker normalized to the expression of housekeeping or otherwise generally constant biomarker.
- the pre-determined biomarker amount and/or activity measurement(s) can be obtained from the same or a different human for whom a patient selection is being assessed.
- the pre-determined biomarker amount and/or activity measurement(s) can be obtained from a previous assessment of the same patient. In such a manner, the progress of the selection of the patient can be monitored over time.
- the control can be obtained from an assessment of another human or multiple humans, e.g., selected groups of humans, if the subject is a human.
- the extent of the selection of the human for whom selection is being assessed can be compared to suitable other humans, e.g., other humans who are in a similar situation to the human of interest, such as those suffering from similar or the same condition(s) and/or of the same ethnic group.
- predictive includes the use of a biomarker nucleic acid and/or protein status, e.g., over- or under- activity, emergence, expression, growth, remission, recurrence or resistance of tumors before, during or after therapy, for determining the likelihood of response of a cancer to PI3K and mTOR combination inhibitor treatment (e.g., treatment with a combination of a pan-class I PI3K inhibitor, such as BKM120, and an mTOR inhibitor, such as RAD001).
- a biomarker nucleic acid and/or protein status e.g., over- or under- activity, emergence, expression, growth, remission, recurrence or resistance of tumors before, during or after therapy, for determining the likelihood of response of a cancer to PI3K and mTOR combination inhibitor treatment (e.g., treatment with a combination of a pan-class I PI3K inhibitor, such as BKM120, and an mTOR inhibitor, such as RAD001).
- Such predictive use of the biomarker may be confirmed by, e.g., (1) increased or decreased copy number (e.g., by FISH, FISH plus SKY, single- molecule sequencing, e.g., as described in the art at least at J.
- Biotechnol., 86:289-301, or qPCR overexpression or underexpression of a biomarker nucleic acid (e.g., by ISH, Northern Blot, or qPCR), increased or decreased biomarker protein (e.g., by IHC), or increased or decreased activity, e.g., in more than about 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 100%, or more of assayed human cancers types or cancer samples; (2) its absolute or relatively modulated presence or absence in a biological sample, e.g., a sample containing tissue, whole blood, serum, plasma, buccal scrape, saliva, cerebrospinal fluid, urine, stool, or bone marrow, from a subject, e.g. a human, afflicted with cancer; (3) its absolute or relatively modulated presence or absence in clinical subset of patients with
- pre-malignant lesions refers to a lesion that, while not cancerous, has potential for becoming cancerous. It also includes the term "pre- malignant disorders” or “potentially malignant disorders.” In particular this refers to a benign, morphologically and/or histologically altered tissue that has a greater than normal risk of malignant transformation, and a disease or a patient's habit that does not necessarily alter the clinical appearance of local tissue but is associated with a greater than normal risk of precancerous lesion or cancer development in that tissue (leukoplakia, erythroplakia, erytroleukoplakia lichen planus (lichenoid reaction) and any lesion or an area which histological examination showed atypia of cells or dysplasia.
- a metaplasia is a pre-malignant lesion.
- prevent refers to reducing the probability of developing a disease, disorder, or condition in a subject, who does not have, but is at risk of or susceptible to developing a disease, disorder, or condition.
- probe refers to any molecule which is capable of selectively binding to a specifically intended target molecule, for example, a nucleotide transcript or protein encoded by or corresponding to a biomarker nucleic acid. Probes can be either synthesized by one skilled in the art, or derived from appropriate biological preparations. For purposes of detection of the target molecule, probes may be specifically designed to be labeled, as described herein. Examples of molecules that can be utilized as probes include, but are not limited to, RNA, DNA, proteins, antibodies, and organic molecules.
- prognosis includes a prediction of the probable course and outcome of cancer or the likelihood of recovery from the disease.
- use of statistical algorithms provides a prognosis of cancer in an individual.
- the prognosis can be surgery, development of a clinical subtype of cancer (e.g., solid tumors, such as esophageal cancer and gastric cancer), development of one or more clinical factors, or recovery from the disease.
- response to anti-cancer therapy or “response to anti-PI3K/mTOR pathway therapy” relates to any response of the hyperproliferative disorder (e.g., cancer) to an anti-cancer agent such as an anti-PI3K/mTOR pathway agent, preferably to a change in tumor mass and/or volume after initiation of neoadjuvant or adjuvant therapy.
- an anti-cancer agent such as an anti-PI3K/mTOR pathway agent
- Hyperproliferative disorder response may be assessed, for example for efficacy or in a neoadjuvant or adjuvant situation, where the size of a tumor after systemic intervention can be compared to the initial size and dimensions as measured by CT, PET, mammogram, ultrasound or palpation. Responses may also be assessed by caliper measurement or pathological examination of the tumor after biopsy or surgical resection. Response may be recorded in a quantitative fashion like percentage change in tumor volume or in a qualitative fashion like "pathological complete response" (pCR), "clinical complete remission” (cCR), “clinical partial remission” (cPR), “clinical stable disease” (cSD), “clinical progressive disease” (cPD) or other qualitative criteria. Assessment of
- hyperproliferative disorder response may be done early after the onset of neoadjuvant or adjuvant therapy, e.g., after a few hours, days, weeks or preferably after a few months.
- a typical endpoint for response assessment is upon termination of neoadjuvant chemotherapy or upon surgical removal of residual tumor cells and/or the tumor bed. This is typically three months after initiation of neoadjuvant therapy.
- clinical efficacy of the therapeutic treatments described herein may be determined by measuring the clinical benefit rate (CBR).
- CBR clinical benefit rate
- the clinical benefit rate is measured by determining the sum of the percentage of patients who are in complete remission (CR), the number of patients who are in partial remission (PR) and the number of patients having stable disease (SD) at a time point at least 6 months out from the end of therapy.
- the CBR for a particular cancer therapeutic regimen is at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%), 80%), 85%), or more.
- Additional criteria for evaluating the response to cancer therapies are related to "survival,” which includes all of the following: survival until mortality, also known as overall survival (wherein said mortality may be either irrespective of cause or tumor related); "recurrence-free survival” (wherein the term recurrence shall include both localized and distant recurrence); metastasis free survival; disease free survival (wherein the term disease shall include cancer and diseases associated therewith).
- the length of said survival may be calculated by reference to a defined start point (e.g., time of diagnosis or start of treatment) and end point (e.g., death, recurrence or metastasis).
- criteria for efficacy of treatment can be expanded to include response to chemotherapy, probability of survival, probability of metastasis within a given time period, and probability of tumor recurrence.
- a particular cancer therapeutic regimen can be administered to a population of subjects and the outcome can be correlated to biomarker measurements that were determined prior to administration of any cancer therapy.
- the outcome measurement may be pathologic response to therapy given in the neoadjuvant setting.
- outcome measures such as overall survival and disease-free survival can be monitored over a period of time for subjects following cancer therapy for which biomarker measurement values are known.
- the doses administered are standard doses known in the art for cancer therapeutic agents. The period of time for which subjects are monitored can vary.
- Biomarker measurement threshold values that correlate to outcome of a cancer therapy can be determined using well-known methods in the art, such as those described in the Examples section.
- resistance refers to an acquired or natural resistance of a cancer sample or a mammal to a cancer therapy (i.e., being nonresponsive to or having reduced or limited response to the therapeutic treatment), such as having a reduced response to a therapeutic treatment by 25% or more, for example, 30%, 40%, 50%, 60%, 70%, 80%, or more, to 2- fold, 3-fold, 4-fold, 5-fold, 10-fold, 15-fold, 20-fold or more.
- the reduction in response can be measured by comparing with the same cancer sample or mammal before the resistance is acquired, or by comparing with a different cancer sample or a mammal that is known to have no resistance to the therapeutic treatment.
- multidrug resistance A typical acquired resistance to chemotherapy is called "multidrug resistance.”
- the multidrug resistance can be mediated by P-glycoprotein or can be mediated by other mechanisms, or it can occur when a mammal is infected with a multi-drug-resistant microorganism or a combination of microorganisms.
- the term "reverses resistance” means that the use of a second agent in combination with a primary cancer therapy ⁇ e.g., chemotherapeutic or radiation therapy) is able to produce a significant decrease in tumor volume at a level of statistical significance ⁇ e.g., p ⁇ 0.05) when compared to tumor volume of untreated tumor in the circumstance where the primary cancer therapy (e.g., chemotherapeutic or radiation therapy) alone is unable to produce a statistically significant decrease in tumor volume compared to tumor volume of untreated tumor. This generally applies to tumor volume measurements made at a time when the untreated tumor is growing log rhythmically.
- a primary cancer therapy e.g., chemotherapeutic or radiation therapy
- response refers to an anti-cancer response, e.g. in the sense of reduction of tumor size or inhibiting tumor growth.
- the terms can also refer to an improved prognosis, for example, as reflected by an increased time to recurrence, which is the period to first recurrence censoring for second primary cancer as a first event or death without evidence of recurrence, or an increased overall survival, which is the period from treatment to death from any cause.
- To respond or to have a response means there is a beneficial endpoint attained when exposed to a stimulus. Alternatively, a negative or detrimental symptom is minimized, mitigated or attenuated on exposure to a stimulus. It will be appreciated that evaluating the likelihood that a tumor or subject will exhibit a favorable response is equivalent to evaluating the likelihood that the tumor or subject will not exhibit favorable response (i.e., will exhibit a lack of response or be non-responsive).
- RNA interfering agent is defined as any agent which interferes with or inhibits expression of a target biomarker gene by RNA interference (RNAi).
- RNA interfering agents include, but are not limited to, nucleic acid molecules including RNA molecules which are homologous to the target biomarker gene of the present invention, or a fragment thereof, short interfering RNA (siRNA), and small molecules which interfere with or inhibit expression of a target biomarker nucleic acid by RNA interference (RNAi).
- RNA interference is an evolutionally conserved process whereby the expression or introduction of RNA of a sequence that is identical or highly similar to a target biomarker nucleic acid results in the sequence specific degradation or specific post- transcriptional gene silencing (PTGS) of messenger RNA (mRNA) transcribed from that targeted gene (see Coburn and Cullen (2002) J. Virol. 76:9225), thereby inhibiting expression of the target biomarker nucleic acid.
- mRNA messenger RNA
- dsRNA double stranded RNA
- RNAi is initiated by the dsRNA-specific endonuclease Dicer, which promotes processive cleavage of long dsRNA into double-stranded fragments termed siRNAs.
- siRNAs are incorporated into a protein complex that recognizes and cleaves target mRNAs.
- RNAi can also be initiated by introducing nucleic acid molecules, e.g., synthetic siRNAs or RNA interfering agents, to inhibit or silence the expression of target biomarker nucleic acids.
- inhibiting target biomarker nucleic acid expression includes any decrease in expression or protein activity or level of the target biomarker nucleic acid or protein encoded by the target biomarker nucleic acid.
- the decrease may be of at least 30%, 40%, 50%, 60%, 70%, 80%, 90%), 95%) or 99%) or more as compared to the expression of a target biomarker nucleic acid or the activity or level of the protein encoded by a target biomarker nucleic acid which has not been targeted by an RNA interfering agent.
- sample used for detecting or determining the presence or level of at least one biomarker is typically brain tissue, cerebrospinal fluid, whole blood, plasma, serum, saliva, urine, stool (e.g., feces), tears, and any other bodily fluid (e.g., as described above under the definition of "body fluids"), or a tissue sample (e.g., biopsy) such as a small intestine, colon sample, or surgical resection tissue.
- the method of the present invention further comprises obtaining the sample from the individual prior to detecting or determining the presence or level of at least one marker in the sample.
- cancer means to alter cancer cells or tumor cells in a way that allows for more effective treatment of the associated cancer with a cancer therapy (e.g., anti- immune checkpoint, chemotherapeutic, and/or radiation therapy).
- a cancer therapy e.g., anti- immune checkpoint, chemotherapeutic, and/or radiation therapy.
- normal cells are not affected to an extent that causes the normal cells to be unduly injured by the anti-immune checkpoint therapy.
- An increased sensitivity or a reduced sensitivity to a therapeutic treatment is measured according to a known method in the art for the particular treatment and methods described herein below, including, but not limited to, cell proliferative assays (Tanigawa N, Kern D H, Kikasa Y, Morton D L, Cancer Res 1982; 42: 2159-2164), cell death assays (Weisenthal L M, Shoemaker R H, Marsden J A, Dill P L, Baker J A, Moran E M, Cancer Res 1984; 94: 161-173; Weisenthal L M, Lippman M E, Cancer Treat Rep 1985; 69: 615-632; Weisenthal L M, In: Kaspers G J L, Pieters R, Twentyman P R, Weisenthal L M, Veerman A J P, eds.
- the sensitivity or resistance may also be measured in animal by measuring the tumor size reduction over a period of time, for example, 6 month for human and 4-6 weeks for mouse.
- a composition or a method sensitizes response to a therapeutic treatment if the increase in treatment sensitivity or the reduction in resistance is 25% or more, for example, 30%, 40%, 50%, 60%, 70%, 80%, or more, to 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 15-fold, 20-fold or more, compared to treatment sensitivity or resistance in the absence of such composition or method.
- sensitivity or resistance to a therapeutic treatment is routine in the art and within the skill of an ordinarily skilled clinician. It is to be understood that any method described herein for enhancing the efficacy of a cancer therapy can be equally applied to methods for sensitizing hyperproliferative or otherwise cancerous cells (e.g., resistant cells) to the cancer therapy.
- the term “synergistic effect” refers to the combined effect of two or more anticancer agents (e.g., two or more PI3K/mTOR pathway inhibitors) can be greater than the sum of the separate effects of the anticancer agents alone.
- siRNA Short interfering RNA
- small interfering RNA is defined as an agent which functions to inhibit expression of a target biomarker nucleic acid, e.g., by RNAi.
- An siRNA may be chemically synthesized, may be produced by in vitro transcription, or may be produced within a host cell.
- siRNA is a double stranded RNA (dsRNA) molecule of about 15 to about 40 nucleotides in length, preferably about 15 to about 28 nucleotides, more preferably about 19 to about 25 nucleotides in length, and more preferably about 19, 20, 21, or 22 nucleotides in length, and may contain a 3' and/or 5' overhang on each strand having a length of about 0, 1, 2, 3, 4, or 5 nucleotides.
- the length of the overhang is independent between the two strands, i.e., the length of the overhang on one strand is not dependent on the length of the overhang on the second strand.
- the siRNA is capable of promoting RNA interference through degradation or specific post-transcriptional gene silencing (PTGS) of the target messenger RNA (mRNA).
- PTGS post-transcriptional gene silencing
- an siRNA is a small hairpin (also called stem loop) RNA (shRNA).
- shRNAs are composed of a short (e.g., 19-25 nucleotide) antisense strand, followed by a 5-9 nucleotide loop, and the analogous sense strand.
- the sense strand may precede the nucleotide loop structure and the antisense strand may follow.
- shRNAs may be contained in plasmids, retroviruses, and lentiviruses and expressed from, for example, the pol III U6 promoter, or another promoter (see, e.g., Stewart, et al. (2003) RNA Apr;9(4):493-501 incorporated by reference herein).
- RNA interfering agents e.g., siRNA molecules, may be administered to a patient having or at risk for having cancer, to inhibit expression of a biomarker gene which is overexpressed in cancer and thereby treat, prevent, or inhibit cancer in the subject.
- subject refers to any healthy animal, mammal or human, or any animal, mammal or human afflicted with a cancer, e.g., brain metastasis, lung, ovarian, pancreatic, liver, breast, prostate, colon carcinomas, melanoma, multiple myeloma, and the like.
- a cancer e.g., brain metastasis, lung, ovarian, pancreatic, liver, breast, prostate, colon carcinomas, melanoma, multiple myeloma, and the like.
- subject is interchangeable with “patient.”
- survival includes all of the following: survival until mortality, also known as overall survival (wherein said mortality may be either irrespective of cause or tumor related); "recurrence-free survival” (wherein the term recurrence shall include both localized and distant recurrence); metastasis free survival; disease free survival (wherein the term disease shall include cancer and diseases associated therewith).
- the length of said survival may be calculated by reference to a defined start point (e.g. time of diagnosis or start of treatment) and end point (e.g. death, recurrence or metastasis).
- criteria for efficacy of treatment can be expanded to include response to chemotherapy, probability of survival, probability of metastasis within a given time period, and probability of tumor recurrence.
- therapeutic effect refers to a local or systemic effect in animals, particularly mammals, and more particularly humans, caused by a pharmacologically active substance.
- the term thus means any substance intended for use in the diagnosis, cure, mitigation, treatment or prevention of disease or in the enhancement of desirable physical or mental development and conditions in an animal or human.
- therapeutically- effective amount means that amount of such a substance that produces some desired local or systemic effect at a reasonable benefit/risk ratio applicable to any treatment.
- a therapeutically effective amount of a compound will depend on its therapeutic index, solubility, and the like.
- certain compounds discovered by the methods of the present invention may be administered in a sufficient amount to produce a reasonable benefit/risk ratio applicable to such treatment.
- terapéuticaally-effective amount and “effective amount” as used herein means that amount of a compound, material, or composition comprising a compound of the present invention which is effective for producing some desired therapeutic effect in at least a sub-population of cells in an animal at a reasonable benefit/risk ratio applicable to any medical treatment.
- Toxicity and therapeutic efficacy of subject compounds may be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 and the ED50. Compositions that exhibit large therapeutic indices are preferred.
- the LD50 lethal dosage
- the LD50 can be measured and can be, for example, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or more reduced for the agent relative to no administration of the agent.
- the ED50 i.e., the concentration which achieves a half-maximal inhibition of symptoms
- the ED50 can be measured and can be, for example, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or more increased for the agent relative to no administration of the agent.
- the IC50 i.e., the concentration which achieves half-maximal cytotoxic or cytostatic effect on cancer cells
- the IC50 can be measured and can be, for example, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or more increased for the agent relative to no administration of the agent.
- cancer cell growth in an assay can be inhibited by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or even 100%.
- At least about a 10% , 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or even 100% decrease in a solid malignancy can be achieved.
- a “transcribed polynucleotide” or “nucleotide transcript” is a polynucleotide (e.g. an mRNA, hnRNA, a cDNA, or an analog of such RNA or cDNA) which is complementary to or homologous with all or a portion of a mature mRNA made by transcription of a biomarker nucleic acid and normal post-transcriptional processing (e.g. splicing), if any, of the RNA transcript, and reverse transcription of the RNA transcript.
- a polynucleotide e.g. an mRNA, hnRNA, a cDNA, or an analog of such RNA or cDNA
- the term "unresponsiveness” includes refractivity of cancer cells to therapy or refractivity of therapeutic cells, such as immune cells, to stimulation, e.g., stimulation via an activating receptor or a cytokine. Unresponsiveness can occur, e.g., because of exposure to immunosuppressants or exposure to high doses of antigen.
- the term “anergy” or “tolerance” includes refractivity to activating receptor- mediated stimulation. Such refractivity is generally antigen-specific and persists after exposure to the tolerizing antigen has ceased. For example, anergy in T cells (as opposed to unresponsiveness) is characterized by lack of cytokine production, e.g., IL-2.
- T cell anergy occurs when T cells are exposed to antigen and receive a first signal (a T cell receptor or CD-3 mediated signal) in the absence of a second signal (a costimulatory signal). Under these conditions, reexposure of the cells to the same antigen (even if reexposure occurs in the presence of a costimulatory polypeptide) results in failure to produce cytokines and, thus, failure to proliferate.
- Anergic T cells can, however, proliferate if cultured with cytokines (e.g., IL-2).
- cytokines e.g., IL-2
- T cell anergy can also be observed by the lack of IL-2 production by T lymphocytes as measured by ELISA or by a proliferation assay using an indicator cell line.
- a reporter gene construct can be used.
- anergic T cells fail to initiate IL-2 gene transcription induced by a heterologous promoter under the control of the 5' IL-2 gene enhancer or by a multimer of the API sequence that can be found within the enhancer (Kang et al. (1992) Science 257: 1134).
- Arginine AGA, ACG, CGA, CGC, CGG, CGT
- Glycine Gly, G
- GGC GGG, GGT
- Serine (Ser, S) AGC, AGT, TCA, TCC, TCG, TCT
- Termination signal (end) TAA, TAG, TGA An important and well known feature of the genetic code is its redundancy, whereby, for most of the amino acids used to make proteins, more than one coding nucleotide triplet may be employed (illustrated above). Therefore, a number of different nucleotide sequences may code for a given amino acid sequence. Such nucleotide sequences are considered functionally equivalent since they result in the production of the same amino acid sequence in all organisms (although certain organisms may translate some sequences more efficiently than they do others). Moreover, occasionally, a methylated variant of a purine or pyrimidine may be found in a given nucleotide sequence. Such methylations do not affect the coding relationship between the trinucleotide codon and the corresponding amino acid.
- nucleotide sequence of a DNA or RNA encoding a biomarker nucleic acid can be used to derive the polypeptide amino acid sequence, using the genetic code to translate the DNA or RNA into an amino acid sequence.
- polypeptide amino acid sequence corresponding nucleotide sequences that can encode the polypeptide can be deduced from the genetic code (which, because of its redundancy, will produce multiple nucleic acid sequences for any given amino acid sequence).
- description and/or disclosure herein of a nucleotide sequence which encodes a polypeptide should be considered to also include description and/or disclosure of the amino acid sequence encoded by the nucleotide sequence.
- description and/or disclosure of a polypeptide amino acid sequence herein should be considered to also include description and/or disclosure of all possible nucleotide sequences that can encode the amino acid sequence.
- nucleic acid and amino acid sequence information for the loci and biomarkers of the present invention are well known in the art and readily available on publicly available databases, such as the National Center for Biotechnology Information (NCBI).
- NCBI National Center for Biotechnology Information
- exemplary nucleic acid and amino acid sequences derived from publicly available sequence databases are provided below and include, for example, PCT Publ. WO 2014/022759, which is incorporated herein in its entirety by this reference. Table 1
- RNA nucleic acid molecules e.g., thymines replaced with uredines
- nucleic acid molecules encoding orthologs of the encoded proteins as well as DNA or RNA nucleic acid sequences comprising a nucleic acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or more identity across their full length with the nucleic acid sequence of any SEQ ID NO listed in Table 1, or a portion thereof.
- nucleic acid molecules can have a function of the full-length nucleic acid as described further herein.
- polypeptide molecules comprising an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or more identity across their full length with an amino acid sequence of any SEQ ID NO listed in Table 1, or a portion thereof.
- polypeptides can have a function of the full-length polypeptide as described further herein.
- the subject for whom predicted likelihood of efficacy of a PI3K and mTOR inhibitor combination therapy is determined is a mammal (e.g., mouse, rat, primate, non-human mammal, domestic animal, such as a dog, cat, cow, horse, and the like), and is preferably a human.
- the subject is an animal model of a brain metastasis from an extracranial cancer.
- the animal model can be an orthotopic xenograft animal model of a human-derived brain metastasis from a human extracranial cancer.
- the subject has not undergone treatment, such as chemotherapy, radiation therapy, targeted therapy, and/or anti-immune checkpoint therapy.
- the subject has undergone treatment, such as chemotherapy, radiation therapy, targeted therapy, and/or anti-immune checkpoint therapy.
- the subject has had surgery to remove cancerous or precancerous tissue.
- the cancerous tissue has not been removed, e.g., the cancerous tissue may be located in an inoperable region of the body, such as in a tissue that is essential for life, or in a region where a surgical procedure would cause considerable risk of harm to the patient.
- the methods of the present invention can be used to determine the responsiveness to PI3K and mTOR inhibitor combination therapies of many different brain metastases in subjects such as those described herein.
- biomarker amount and/or activity measurement(s) in a sample from a subject is compared to a predetermined control (standard) sample.
- the sample from the subject is typically from a diseased tissue, such as cancer cells or tissues.
- the control sample can be from the same subject or from a different subject.
- the control sample is typically a normal, non-diseased sample.
- the control sample can be from a diseased tissue.
- the control sample can be a combination of samples from several different subjects.
- the biomarker amount and/or activity measurement(s) from a subject is compared to a pre-determined level. This pre-determined level is typically obtained from normal samples.
- a "pre-determined" biomarker amount and/or activity measurement(s) may be a biomarker amount and/or activity measurement(s) used to, by way of example only, evaluate a subject that may be selected for treatment (e.g., based on the number of genomic mutations and/or the number of genomic mutations causing non-functional proteins for DNA repair genes), evaluate a response to a PI3K/mTOR combination inhibitor therapy, and/or evaluate a response to a PI3K/mTOR combination inhibitor therapy with one or more additional anti-cancer therapies.
- a pre-determined biomarker amount and/or activity measurement(s) may be determined in populations of patients with or without cancer.
- the pre-determined biomarker amount and/or activity measurement(s) can be a single number, equally applicable to every patient, or the pre-determined biomarker amount and/or activity measurement(s) can vary according to specific subpopulations of patients. Age, weight, height, and other factors of a subject may affect the pre-determined biomarker amount and/or activity measurement(s) of the individual. Furthermore, the pre-determined biomarker amount and/or activity can be determined for each subject individually. In one embodiment, the amounts determined and/or compared in a method described herein are based on absolute measurements.
- the amounts determined and/or compared in a method described herein are based on relative measurements, such as ratios (e.g., biomarker copy numbers, level, and/or activity before a treatment vs. after a treatment, such biomarker measurements relative to a spiked or man-made control, such biomarker measurements relative to the expression of a housekeeping gene, and the like).
- the relative analysis can be based on the ratio of pre-treatment biomarker measurement as compared to post-treatment biomarker measurement.
- Pre-treatment biomarker measurement can be made at any time prior to initiation of anti-cancer therapy.
- Post-treatment biomarker measurement can be made at any time after initiation of anti-cancer therapy.
- post-treatment biomarker measurements are made 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 weeks or more after initiation of anti-cancer therapy, and even longer toward indefinitely for continued monitoring.
- Treatment can comprise anti-cancer therapy, such as a therapeutic regimen comprising one or more PBK/mTOR combination inhibitors alone or in combination with other anti-cancer agents, such as with immune checkpoint inhibitors.
- the pre-determined biomarker amount and/or activity measurement(s) can be any suitable standard.
- the pre-determined biomarker amount and/or activity measurement(s) can be obtained from the same or a different human for whom a patient selection is being assessed.
- the pre-determined biomarker amount and/or activity measurement s) can be obtained from a previous assessment of the same patient. In such a manner, the progress of the selection of the patient can be monitored over time.
- the control can be obtained from an assessment of another human or multiple humans, e.g., selected groups of humans, if the subject is a human.
- the extent of the selection of the human for whom selection is being assessed can be compared to suitable other humans, e.g., other humans who are in a similar situation to the human of interest, such as those suffering from similar or the same condition(s) and/or of the same ethnic group.
- the change of biomarker amount and/or activity measurement s) from the pre-determined level is about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, or 5.0 fold or greater, or any range in between, inclusive.
- cutoff values apply equally when the measurement is based on relative changes, such as based on the ratio of pre-treatment biomarker measurement as compared to post-treatment biomarker measurement.
- Body fluids refer to fluids that are excreted or secreted from the body as well as fluids that are normally not (e.g., amniotic fluid, aqueous humor, bile, blood and blood plasma, cerebrospinal fluid, cerumen and earwax, cowper's fluid or pre-ejaculatory fluid, chyle, chyme, stool, female ejaculate, interstitial fluid, intracellular fluid, lymph, menses, breast milk, mucus, pleural fluid, pus, saliva, sebum, semen, serum, sweat, synovial fluid, tears, urine, vaginal lubrication, vitreous humor, vomit).
- the subject and/or control sample is selected from the group consisting of cells, cell lines, histological slides, paraffin embedded tissues, biopsies, whole blood, nipple aspirate, serum, plasma, buccal scrape, saliva, cerebrospinal fluid, urine, stool, and bone marrow.
- the sample is serum, plasma, or urine.
- the sample is serum.
- the samples can be collected from individuals repeatedly over a longitudinal period of time (e.g., once or more on the order of days, weeks, months, annually, biannually, etc.). Obtaining numerous samples from an individual over a period of time can be used to verify results from earlier detections and/or to identify an alteration in biological pattern as a result of, for example, disease progression, drug treatment, etc. For example, subject samples can be taken and monitored every month, every two months, or combinations of one, two, or three month intervals according to the present invention.
- biomarker amount and/or activity measurements of the subject obtained over time can be conveniently compared with each other, as well as with those of normal controls during the monitoring period, thereby providing the subject's own values, as an internal, or personal, control for long-term monitoring.
- Sample preparation and separation can involve any of the procedures, depending on the type of sample collected and/or analysis of biomarker measurement(s).
- Such procedures include, by way of example only, concentration, dilution, adjustment of pH, removal of high abundance polypeptides (e.g., albumin, gamma globulin, and transferrin, etc.), addition of preservatives and calibrants, addition of protease inhibitors, addition of denaturants, desalting of samples, concentration of sample proteins, extraction and purification of lipids.
- the sample preparation can also isolate molecules that are bound in non-covalent complexes to other protein (e.g., carrier proteins).
- carrier proteins e.g., albumin
- This process may isolate those molecules bound to a specific carrier protein (e.g., albumin), or use a more general process, such as the release of bound molecules from all carrier proteins via protein denaturation, for example using an acid, followed by removal of the carrier proteins.
- undetectable proteins from a sample can be achieved using high affinity reagents, high molecular weight filters, ultracentrifugation and/or electrodialysis.
- High affinity reagents include antibodies or other reagents (e.g., aptamers) that selectively bind to high abundance proteins.
- Sample preparation could also include ion exchange chromatography, metal ion affinity chromatography, gel filtration, hydrophobic chromatography, chromatofocusing, adsorption chromatography, isoelectric focusing and related techniques.
- Molecular weight filters include membranes that separate molecules on the basis of size and molecular weight. Such filters may further employ reverse osmosis, nanofiltration, ultrafiltration and microfiltration.
- Ultracentrifugation is a method for removing undesired polypeptides from a sample. Ultracentrifugation is the centrifugation of a sample at about 15,000-60,000 rpm while monitoring with an optical system the sedimentation (or lack thereof) of particles.
- Electrodialysis is a procedure which uses an electromembrane or semipermable membrane in a process in which ions are transported through semi-permeable membranes from one solution to another under the influence of a potential gradient. Since the membranes used in electrodialysis may have the ability to selectively transport ions having positive or negative charge, reject ions of the opposite charge, or to allow species to migrate through a semipermable membrane based on size and charge, it renders electrodialysis useful for concentration, removal, or separation of electrolytes.
- Separation and purification in the present invention may include any procedure known in the art, such as capillary electrophoresis (e.g., in capillary or on-chip) or chromatography (e.g., in capillary, column or on a chip).
- Electrophoresis is a method which can be used to separate ionic molecules under the influence of an electric field.
- Electrophoresis can be conducted in a gel, capillary, or in a microchannel on a chip.
- gels used for electrophoresis include starch, acrylamide, polyethylene oxides, agarose, or combinations thereof.
- a gel can be modified by its cross-linking, addition of detergents, or denaturants, immobilization of enzymes or antibodies (affinity
- capillaries used for electrophoresis include capillaries that interface with an electrospray.
- CE Capillary electrophoresis
- CZE capillary zone electrophoresis
- CIEF capillary isoelectric focusing
- cITP capillary isotachophoresis
- CEC capillary electrochromatography
- Capillary isotachophoresis is a technique in which the analytes move through the capillary at a constant speed but are nevertheless separated by their respective mobilities.
- Capillary zone electrophoresis also known as free-solution CE (FSCE)
- FSCE free-solution CE
- CIEF Capillary isoelectric focusing
- CEC is a hybrid technique between traditional high performance liquid chromatography (FIPLC) and CE.
- Chromatography can be based on the differential adsorption and elution of certain analytes or partitioning of analytes between mobile and stationary phases.
- Different examples of chromatography include, but not limited to, liquid chromatography (LC), gas chromatography (GC), high performance liquid chromatography (FIPLC), etc.
- nucleic acid molecule is intended to include DNA molecules (e.g., cDNA or genomic DNA) and RNA molecules (e.g., mPvNA) and analogs of the DNA or RNA generated using nucleotide analogs.
- the nucleic acid molecule can be single-stranded or double-stranded, but preferably is double- stranded DNA.
- nucleic acid molecule is one which is separated from other nucleic acid molecules which are present in the natural source of the nucleic acid molecule.
- an "isolated" nucleic acid molecule is free of sequences (preferably protein- encoding sequences) which naturally flank the nucleic acid (i.e., sequences located at the 5' and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived.
- the isolated nucleic acid molecule can contain less than about 5 kB, 4 kB, 3 kB, 2 kB, 1 kB, 0.5 kB or 0.1 kB of nucleotide sequences which naturally flank the nucleic acid molecule in genomic DNA of the cell from which the nucleic acid is derived.
- an "isolated" nucleic acid molecule such as a cDNA molecule, can be substantially free of other cellular material or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.
- a biomarker nucleic acid molecule of the present invention can be isolated using standard molecular biology techniques and the sequence information in the database records described herein. Using all or a portion of such nucleic acid sequences, nucleic acid molecules of the present invention can be isolated using standard hybridization and cloning techniques (e.g., as described in Sambrook et al, ed., Molecular Cloning: A
- a nucleic acid molecule of the present invention can be amplified using cDNA, mRNA, or genomic DNA as a template and appropriate oligonucleotide primers according to standard PCR amplification techniques.
- the nucleic acid molecules so amplified can be cloned into an appropriate vector and characterized by DNA sequence analysis.
- oligonucleotides corresponding to all or a portion of a nucleic acid molecule of the present invention can be prepared by standard synthetic techniques, e.g., using an automated DNA synthesizer.
- nucleic acid molecule of the present invention can comprise only a portion of a nucleic acid sequence, wherein the full length nucleic acid sequence comprises a marker of the present invention or which encodes a polypeptide corresponding to a marker of the present invention.
- nucleic acid molecules can be used, for example, as a probe or primer.
- the probe/primer typically is used as one or more substantially purified oligonucleotides.
- the oligonucleotide typically comprises a region of nucleotide sequence that hybridizes under stringent conditions to at least about 7, preferably about 15, more preferably about 25, 50, 75, 100, 125, 150, 175, 200, 250, 300, 350, or 400 or more consecutive nucleotides of a biomarker nucleic acid sequence.
- Probes based on the sequence of a biomarker nucleic acid molecule can be used to detect transcripts or genomic sequences corresponding to one or more markers of the present invention.
- the probe comprises a label group attached thereto, e.g., a radioisotope, a fluorescent compound, an enzyme, or an enzyme co-factor.
- a biomarker nucleic acid molecules that differ, due to degeneracy of the genetic code, from the nucleotide sequence of nucleic acid molecules encoding a protein which corresponds to the biomarker, and thus encode the same protein, are also contemplated.
- DNA sequence polymorphisms that lead to changes in the amino acid sequence can exist within a population (e.g., the human population). Such genetic polymorphisms can exist among individuals within a population due to natural allelic variation. An allele is one of a group of genes which occur alternatively at a given genetic locus.
- DNA polymorphisms that affect RNA expression levels can also exist that may affect the overall expression level of that gene (e.g., by affecting regulation or degradation).
- allele refers to alternative forms of a gene or portions thereof. Alleles occupy the same locus or position on homologous chromosomes. When a subject has two identical alleles of a gene, the subject is said to be homozygous for the gene or allele. When a subject has two different alleles of a gene, the subject is said to be heterozygous for the gene or allele.
- biomarker alleles can differ from each other in a single nucleotide, or several nucleotides, and can include substitutions, deletions, and insertions of nucleotides.
- An allele of a gene can also be a form of a gene containing one or more mutations.
- allelic variant of a polymorphic region of gene refers to an alternative form of a gene having one of several possible nucleotide sequences found in that region of the gene in the population.
- allelic variant is meant to encompass functional allelic variants, non-functional allelic variants, SNPs, mutations and polymorphisms.
- single nucleotide polymorphism refers to a polymorphic site occupied by a single nucleotide, which is the site of variation between allelic sequences.
- the site is usually preceded by and followed by highly conserved sequences of the allele (e.g., sequences that vary in less than 1/100 or 1/1000 members of a population).
- a SNP usually arises due to substitution of one nucleotide for another at the polymorphic site.
- SNPs can also arise from a deletion of a nucleotide or an insertion of a nucleotide relative to a reference allele.
- the polymorphic site is occupied by a base other than the reference base.
- the altered allele can contain a "C” (cytidine), “G” (guanine), or "A” (adenine) at the polymorphic site.
- S P's may occur in protein-coding nucleic acid sequences, in which case they may give rise to a defective or otherwise variant protein, or genetic disease. Such a S P may alter the coding sequence of the gene and therefore specify another amino acid (a "missense” SNP) or a SNP may introduce a stop codon (a "nonsense” SNP).
- SNP When a SNP does not alter the amino acid sequence of a protein, the SNP is called "silent.” SNP's may also occur in noncoding regions of the nucleotide sequence. This may result in defective protein expression, e.g., as a result of alternative spicing, or it may have no effect on the function of the protein.
- the terms "gene” and “recombinant gene” refer to nucleic acid molecules comprising an open reading frame encoding a polypeptide corresponding to a marker of the present invention. Such natural allelic variations can typically result in 1-5% variance in the nucleotide sequence of a given gene. Alternative alleles can be identified by sequencing the gene of interest in a number of different individuals. This can be readily carried out by using hybridization probes to identify the same genetic locus in a variety of individuals. Any and all such nucleotide variations and resulting amino acid
- polymorphisms or variations that are the result of natural allelic variation and that do not alter the functional activity are intended to be within the scope of the present invention.
- a biomarker nucleic acid molecule is at least 7, 15, 20, 25, 30, 40, 60, 80, 100, 150, 200, 250, 300, 350, 400, 450, 550, 650, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2200, 2400, 2600, 2800, 3000,
- hybridizes under stringent conditions is intended to describe conditions for hybridization and washing under which nucleotide sequences at least 60% (65%), 70%), 75%o, 80%), preferably 85%>) identical to each other typically remain hybridized to each other.
- stringent conditions are known to those skilled in the art and can be found in sections 6.3.1-6.3.6 of Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989).
- a preferred, non-limiting example of stringent hybridization conditions are hybridization in 6X sodium chloride/sodium citrate (SSC) at about 45°C, followed by one or more washes in 0.2X SSC, 0.1% SDS at 50-65°C.
- SSC sodium chloride/sodium citrate
- allelic variants of a nucleic acid molecule of the present invention that can exist in the population, the skilled artisan will further appreciate that sequence changes can be introduced by mutation thereby leading to changes in the amino acid sequence of the encoded protein, without altering the biological activity of the protein encoded thereby.
- sequence changes can be introduced by mutation thereby leading to changes in the amino acid sequence of the encoded protein, without altering the biological activity of the protein encoded thereby.
- a "non-essential" amino acid residue is a residue that can be altered from the wild-type sequence without altering the biological activity, whereas an "essential" amino acid residue is required for biological activity.
- amino acid residues that are not conserved or only semi-conserved among homologs of various species may be non-essential for activity and thus would be likely targets for alteration.
- amino acid residues that are conserved among the homologs of various species e.g., murine and human
- amino acid residues that are conserved among the homologs of various species may be essential for activity and thus would not be likely targets for alteration.
- nucleic acid molecules encoding a polypeptide of the present invention that contain changes in amino acid residues that are not essential for activity.
- polypeptides differ in amino acid sequence from the naturally-occurring proteins which correspond to the markers of the present invention, yet retain biological activity.
- a biomarker protein has an amino acid sequence that is at least about 40% identical, 50%, 60%, 70%, 75%, 80%, 83%, 85%, 87.5%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or identical to the amino acid sequence of a biomarker protein described herein.
- An isolated nucleic acid molecule encoding a variant protein can be created by introducing one or more nucleotide substitutions, additions or deletions into the nucleotide sequence of nucleic acids of the present invention, such that one or more amino acid residue substitutions, additions, or deletions are introduced into the encoded protein. Mutations can be introduced by standard techniques, such as site-directed mutagenesis and PCR-mediated mutagenesis. Preferably, conservative amino acid substitutions are made at one or more predicted non-essential amino acid residues.
- a "conservative amino acid substitution” is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art.
- amino acids with basic side chains e.g., lysine, arginine, histidine
- acidic side chains e.g., aspartic acid, glutamic acid
- uncharged polar side chains e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine
- non-polar side chains e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan
- beta-branched side chains e.g., threonine, valine, isoleucine
- aromatic side chains e.g., tyrosine, phenylalanine, tryptophan, histidine
- mutations can be introduced randomly along all or part of the coding sequence, such as by saturation mutagenesis, and the resultant mutants can be screened for biological activity to identify mutants that retain activity.
- the encoded protein can be expressed recombinantly and the activity of the protein can be determined.
- the present invention further contemplates the use of anti- biomarker antisense nucleic acid molecules, i.e., molecules which are complementary to a sense nucleic acid of the present invention, e.g., complementary to the coding strand of a double-stranded cDNA molecule corresponding to a marker of the present invention or complementary to an mRNA sequence corresponding to a marker of the present invention.
- an antisense nucleic acid molecule of the present invention can hydrogen bond to (i.e. anneal with) a sense nucleic acid of the present invention.
- the antisense nucleic acid can be complementary to an entire coding strand, or to only a portion thereof, e.g., all or part of the protein coding region (or open reading frame).
- An antisense nucleic acid molecule can also be antisense to all or part of a non-coding region of the coding strand of a nucleotide sequence encoding a polypeptide of the present invention.
- the non- coding regions (“5' and 3' untranslated regions") are the 5' and 3' sequences which flank the coding region and are not translated into amino acids.
- An antisense oligonucleotide can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 or more nucleotides in length.
- An antisense nucleic acid can be constructed using chemical synthesis and enzymatic ligation reactions using procedures known in the art.
- an antisense nucleic acid e.g., an antisense oligonucleotide
- an antisense nucleic acid e.g., an antisense oligonucleotide
- modified nucleotides which can be used to generate the antisense nucleic acid include 5- fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4- acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2- thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2- methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7- methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D- mannosylqueosine, 5'-
- the antisense nucleic acid can be produced biologically using an expression vector into which a nucleic acid has been sub-cloned in an antisense orientation (i.e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest, described further in the following subsection).
- the antisense nucleic acid molecules of the present invention are typically administered to a subject or generated in situ such that they hybridize with or bind to cellular mRNA and/or genomic DNA encoding a polypeptide corresponding to a selected marker of the present invention to thereby inhibit expression of the marker, e.g., by inhibiting transcription and/or translation.
- the hybridization can be by conventional nucleotide complementarity to form a stable duplex, or, for example, in the case of an antisense nucleic acid molecule which binds to DNA duplexes, through specific interactions in the major groove of the double helix.
- antisense nucleic acid molecules of the present invention examples include direct injection at a tissue site or infusion of the antisense nucleic acid into a blood- or bone marrow-associated body fluid.
- antisense nucleic acid molecules can be modified to target selected cells and then administered systemically.
- antisense molecules can be modified such that they specifically bind to receptors or antigens expressed on a selected cell surface, e.g., by linking the antisense nucleic acid molecules to peptides or antibodies which bind to cell surface receptors or antigens.
- the antisense nucleic acid molecules can also be delivered to cells using the vectors described herein. To achieve sufficient intracellular concentrations of the antisense molecules, vector constructs in which the antisense nucleic acid molecule is placed under the control of a strong pol II or pol III promoter are preferred.
- An antisense nucleic acid molecule of the present invention can be an a-anomeric nucleic acid molecule.
- An a-anomeric nucleic acid molecule forms specific double- stranded hybrids with complementary RNA in which, contrary to the usual a-units, the strands run parallel to each other (Gaultier et al, 1987, Nucleic Acids Res. 15:6625-6641).
- the antisense nucleic acid molecule can also comprise a 2'-o-methylribonucleotide (Inoue et al, 1987, Nucleic Acids Res. 15:6131-6148) or a chimeric RNA-DNA analogue (Inoue et al, 1987, FEBSLett. 215:327-330).
- Ribozymes are catalytic RNA molecules with ribonuclease activity which are capable of cleaving a single-stranded nucleic acid, such as an mRNA, to which they have a complementary region.
- ribozymes e.g., hammerhead ribozymes as described in Haselhoff and Gerlach, 1988, Nature 334:585-591
- a ribozyme having specificity for a nucleic acid molecule encoding a polypeptide corresponding to a marker of the present invention can be designed based upon the nucleotide sequence of a cDNA corresponding to the marker.
- a derivative of a Tetrahymena L-19 IVS RNA can be constructed in which the nucleotide sequence of the active site is complementary to the nucleotide sequence to be cleaved (see Cech et al. U.S. Patent No. 4,987,071; and Cech et al. U.S. Patent No. 5,116,742).
- an mRNA encoding a polypeptide of the present invention can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules (see, e.g., Bartel and Szostak, 1993, Science 261 : 1411-1418).
- the present invention also encompasses nucleic acid molecules which form triple helical structures.
- expression of a biomarker protein can be inhibited by targeting nucleotide sequences complementary to the regulatory region of the gene encoding the polypeptide (e.g., the promoter and/or enhancer) to form triple helical structures that prevent transcription of the gene in target cells.
- nucleotide sequences complementary to the regulatory region of the gene encoding the polypeptide e.g., the promoter and/or enhancer
- the polypeptide e.g., the promoter and/or enhancer
- the nucleic acid molecules of the present invention can be modified at the base moiety, sugar moiety or phosphate backbone to improve, e.g., the stability, hybridization, or solubility of the molecule.
- the deoxyribose phosphate backbone of the nucleic acid molecules can be modified to generate peptide nucleic acid molecules (see Hyrup et al, 1996, Bioorganic & Medicinal Chemistry 4(1): 5- 23).
- peptide nucleic acids refer to nucleic acid mimics, e.g., DNA mimics, in which the deoxyribose phosphate backbone is replaced by a pseudopeptide backbone and only the four natural nucleobases are retained.
- the neutral backbone of PNAs has been shown to allow for specific hybridization to DNA and RNA under conditions of low ionic strength.
- the synthesis of PNA oligomers can be performed using standard solid phase peptide synthesis protocols as described in Hyrup et al. (1996), supra; Perry-O'Keefe et al. (1996) Proc. Natl. Acad. Sci. USA 93 : 14670-675.
- PNAs can be used in therapeutic and diagnostic applications.
- PNAs can be used as antisense or antigene agents for sequence-specific modulation of gene expression by, e.g., inducing transcription or translation arrest or inhibiting replication.
- PNAs can also be used, e.g., in the analysis of single base pair mutations in a gene by, e.g., PNA directed PCR clamping; as artificial restriction enzymes when used in combination with other enzymes, e.g., SI nucleases (Hyrup (1996), supra; or as probes or primers for DNA sequence and hybridization (Hyrup, 1996, supra; Perry-O'Keefe et al, 1996, Proc. Natl. Acad. Sci. USA 93 : 14670-675).
- PNAs can be modified, e.g., to enhance their stability or cellular uptake, by attaching lipophilic or other helper groups to PNA, by the formation of PNA-DNA chimeras, or by the use of liposomes or other techniques of drug delivery known in the art.
- PNA-DNA chimeras can be generated which can combine the advantageous properties of PNA and DNA.
- Such chimeras allow DNA recognition enzymes, e.g., RNASE H and DNA polymerases, to interact with the DNA portion while the PNA portion would provide high binding affinity and specificity.
- PNA-DNA chimeras can be linked using linkers of appropriate lengths selected in terms of base stacking, number of bonds between the nucleobases, and orientation (Hyrup, 1996, supra).
- the synthesis of PNA-DNA chimeras can be performed as described in Hyrup (1996), supra, and Finn et al. (1996) Nucleic Acids Res. 24(17):3357-63.
- a DNA chain can be synthesized on a solid support using standard phosphoramidite coupling chemistry and modified nucleoside analogs.
- the oligonucleotide can include other appended groups such as peptides ⁇ e.g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane (see, e.g., Letsinger et al, 1989, Proc. Natl. Acad. Sci. USA 86:6553-6556; Lemaitre et al, 1987, Proc. Natl. Acad. Sci. USA 84:648-652; PCT Publication No. WO 88/09810) or the blood-brain barrier (see, e.g., PCT Publication No. WO 89/10134).
- other appended groups such as peptides ⁇ e.g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane (see, e.g., Letsinger et al, 1989, Proc. Natl. Acad. Sci. USA 86:6553-6556; Lemaitre et al, 1987, Pro
- oligonucleotides can be modified with hybridization-triggered cleavage agents (see, e.g., Krol et al, 1988, Bio/Techniques 6:958-976) or intercalating agents (see, e.g., Zon, 1988, Pharm. Res. 5:539-549).
- the oligonucleotide can be conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking agent, transport agent, hybridization-triggered cleavage agent, etc.
- Another aspect of the present invention pertains to the use of biomarker proteins and biologically active portions thereof.
- the native polypeptide in one embodiment, the native polypeptide
- polypeptides corresponding to a marker can be isolated from cells or tissue sources by an appropriate purification scheme using standard protein purification techniques.
- polypeptides corresponding to a marker of the present invention are produced by
- a polypeptide corresponding to a marker of the present invention can be synthesized chemically using standard peptide synthesis techniques.
- an “isolated” or “purified” protein or biologically active portion thereof is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which the protein is derived, or substantially free of chemical precursors or other chemicals when chemically synthesized.
- the language “substantially free of cellular material” includes preparations of protein in which the protein is separated from cellular components of the cells from which it is isolated or recombinantly produced.
- protein that is substantially free of cellular material includes preparations of protein having less than about 30%, 20%, 10%, or 5% (by dry weight) of heterologous protein (also referred to herein as a "contaminating protein").
- the protein or biologically active portion thereof is recombinantly produced, it is also preferably substantially free of culture medium, i.e., culture medium represents less than about 20%, 10%, or 5% of the volume of the protein preparation.
- culture medium represents less than about 20%, 10%, or 5% of the volume of the protein preparation.
- the protein is produced by chemical synthesis, it is preferably substantially free of chemical precursors or other chemicals, i.e., it is separated from chemical precursors or other chemicals which are involved in the synthesis of the protein. Accordingly such preparations of the protein have less than about 30%, 20%, 10%, 5% (by dry weight) of chemical precursors or compounds other than the polypeptide of interest.
- Biomarker polypeptides include polypeptides comprising amino acid sequences sufficiently identical to or derived from a biomarker protein amino acid sequence described herein, but which includes fewer amino acids than the full length protein, and exhibit at least one activity of the corresponding full-length protein.
- biologically active portions comprise a domain or motif with at least one activity of the corresponding protein.
- a biologically active portion of a protein of the present invention can be a polypeptide which is, for example, 10, 25, 50, 100 or more amino acids in length.
- other biologically active portions, in which other regions of the protein are deleted can be prepared by recombinant techniques and evaluated for one or more of the functional activities of the native form of a polypeptide of the present invention.
- Preferred polypeptides have an amino acid sequence of a biomarker protein encoded by a nucleic acid molecule described herein.
- Other useful proteins are substantially identical (e.g., at least about 40%, preferably 50%, 60%, 70%, 75%, 80%, 83%, 85%, 88%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) to one of these sequences and retain the functional activity of the protein of the corresponding naturally-occurring protein yet differ in amino acid sequence due to natural allelic variation or mutagenesis.
- the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the sequence of a first amino acid or nucleic acid sequence for optimal alignment with a second amino or nucleic acid sequence).
- the amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position.
- the determination of percent identity between two sequences can be accomplished using a mathematical algorithm.
- a preferred, non-limiting example of a mathematical algorithm utilized for the comparison of two sequences is the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264-2268, modified as in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5877.
- Such an algorithm is incorporated into the BLAST and XBLAST programs of Altschul, et al. (1990) J. Mol. Biol. 215:403-410.
- Gapped BLAST can be utilized as described in Altschul et al. (1997) Nucleic Acids Res. 25:3389-3402.
- PSI-Blast can be used to perform an iterated search which detects distant relationships between molecules.
- a PAM120 weight residue table can, for example, be used with a &-tuple value of 2.
- the percent identity between two sequences can be determined using techniques similar to those described above, with or without allowing gaps. In calculating percent identity, only exact matches are counted.
- the present invention also provides chimeric or fusion proteins corresponding to a biomarker protein.
- a "chimeric protein” or “fusion protein” comprises all or part (preferably a biologically active part) of a polypeptide corresponding to a marker of the present invention operably linked to a heterologous polypeptide (i.e., a polypeptide other than the polypeptide corresponding to the marker).
- a heterologous polypeptide i.e., a polypeptide other than the polypeptide corresponding to the marker.
- the term "operably linked” is intended to indicate that the polypeptide of the present invention and the heterologous polypeptide are fused in-frame to each other.
- the heterologous polypeptide can be fused to the amino-terminus or the carboxyl-terminus of the polypeptide of the present invention.
- One useful fusion protein is a GST fusion protein in which a polypeptide corresponding to a marker of the present invention is fused to the carboxyl terminus of GST sequences. Such fusion proteins can facilitate the purification of a recombinant polypeptide of the present invention.
- the fusion protein contains a heterologous signal sequence, immunoglobulin fusion protein, toxin, or other useful protein sequence.
- Chimeric and fusion proteins of the present invention can be produced by standard recombinant DNA techniques.
- the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers. Alternatively, PCR amplification of gene fragments can be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed and re-amplified to generate a chimeric gene sequence (see, e.g., Ausubel et al, supra).
- fusion moiety ⁇ e.g., a GST polypeptide.
- a nucleic acid encoding a polypeptide of the present invention can be cloned into such an expression vector such that the fusion moiety is linked in-frame to the polypeptide of the present invention.
- a signal sequence can be used to facilitate secretion and isolation of the secreted protein or other proteins of interest.
- Signal sequences are typically characterized by a core of hydrophobic amino acids which are generally cleaved from the mature protein during secretion in one or more cleavage events.
- Such signal peptides contain processing sites that allow cleavage of the signal sequence from the mature proteins as they pass through the secretory pathway.
- the present invention pertains to the described polypeptides having a signal sequence, as well as to polypeptides from which the signal sequence has been proteolytically cleaved ⁇ i.e., the cleavage products).
- a nucleic acid sequence encoding a signal sequence can be operably linked in an expression vector to a protein of interest, such as a protein which is ordinarily not secreted or is otherwise difficult to isolate.
- the signal sequence directs secretion of the protein, such as from a eukaryotic host into which the expression vector is transformed, and the signal sequence is subsequently or concurrently cleaved.
- the protein can then be readily purified from the extracellular medium by art recognized methods.
- the signal sequence can be linked to the protein of interest using a sequence which facilitates purification, such as with a GST domain.
- the present invention also pertains to variants of the biomarker polypeptides described herein.
- Such variants have an altered amino acid sequence which can function as either agonists (mimetics) or as antagonists.
- Variants can be generated by mutagenesis, e.g., discrete point mutation or truncation.
- An agonist can retain substantially the same, or a subset, of the biological activities of the naturally occurring form of the protein.
- An antagonist of a protein can inhibit one or more of the activities of the naturally occurring form of the protein by, for example, competitively binding to a downstream or upstream member of a cellular signaling cascade which includes the protein of interest.
- specific biological effects can be elicited by treatment with a variant of limited function. Treatment of a subject with a variant having a subset of the biological activities of the naturally occurring form of the protein can have fewer side effects in a subject relative to treatment with the naturally occurring form of the protein.
- Variants of a biomarker protein which function as either agonists (mimetics) or as antagonists can be identified by screening combinatorial libraries of mutants, e.g., truncation mutants, of the protein of the present invention for agonist or antagonist activity.
- a variegated library of variants is generated by combinatorial mutagenesis at the nucleic acid level and is encoded by a variegated gene library.
- a variegated library of variants can be produced by, for example, enzymatically ligating a mixture of synthetic oligonucleotides into gene sequences such that a degenerate set of potential protein sequences is expressible as individual polypeptides, or alternatively, as a set of larger fusion proteins (e.g., for phage display).
- a degenerate set of potential protein sequences is expressible as individual polypeptides, or alternatively, as a set of larger fusion proteins (e.g., for phage display).
- libraries of fragments of the coding sequence of a polypeptide corresponding to a marker of the present invention can be used to generate a variegated population of polypeptides for screening and subsequent selection of variants.
- a library of coding sequence fragments can be generated by treating a double stranded PCR fragment of the coding sequence of interest with a nuclease under conditions wherein nicking occurs only about once per molecule, denaturing the double stranded DNA, renaturing the DNA to form double stranded DNA which can include sense/antisense pairs from different nicked products, removing single stranded portions from reformed duplexes by treatment with SI nuclease, and ligating the resulting fragment library into an expression vector.
- an expression library can be derived which encodes amino terminal and internal fragments of various sizes of the protein of interest.
- combinatorial libraries made by point mutations or truncation, and for screening cDNA libraries for gene products having a selected property typically include cloning the gene library into replicable expression vectors, transforming appropriate cells with the resulting library of vectors, and expressing the combinatorial genes under conditions in which detection of a desired activity facilitates isolation of the vector encoding the gene whose product was detected.
- Recursive ensemble mutagenesis (REM) a technique which enhances the frequency of functional mutants in the libraries, can be used in combination with the screening assays to identify variants of a protein of the present invention (Arkin and Yourvan, 1992, Proc. Natl. Acad. Sci. USA 59:7811-7815; Delgrave et al, 1993, Protein Engineering 6(3):327- 331).
- biomarker nucleic acid and/or biomarker polypeptide molecules described herein can be facilitated by using standard recombinant techniques.
- such techniques use vectors, preferably expression vectors, containing a nucleic acid encoding a biomarker polypeptide or a portion of such a polypeptide.
- vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
- plasmid refers to a circular double stranded DNA loop into which additional DNA segments can be ligated.
- viral vector Another type of vector, wherein additional DNA segments can be ligated into the viral genome.
- vectors are capable of autonomous replication in a host cell into which they are introduced ⁇ e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors).
- Other vectors ⁇ e.g., non-episomal mammalian vectors
- certain vectors namely expression vectors, are capable of directing the expression of genes to which they are operably linked.
- expression vectors of utility in recombinant DNA techniques are often in the form of plasmids (vectors).
- the present invention is intended to include such other forms of expression vectors, such as viral vectors ⁇ e.g., replication defective retroviruses, adenoviruses and adeno-associated viruses), which serve equivalent functions.
- the recombinant expression vectors of the present invention comprise a nucleic acid of the present invention in a form suitable for expression of the nucleic acid in a host cell.
- the recombinant expression vectors include one or more regulatory sequences, selected on the basis of the host cells to be used for expression, which is operably linked to the nucleic acid sequence to be expressed.
- operably linked is intended to mean that the nucleotide sequence of interest is linked to the regulatory sequence(s) in a manner which allows for expression of the nucleotide sequence (e.g., in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell).
- regulatory sequence is intended to include promoters, enhancers and other expression control elements ⁇ e.g., polyadenylation signals). Such regulatory sequences are described, for example, in
- Regulatory sequences include those which direct constitutive expression of a nucleotide sequence in many types of host cell and those which direct expression of the nucleotide sequence only in certain host cells ⁇ e.g., tissue-specific regulatory sequences). It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, and the like.
- the expression vectors of the present invention can be introduced into host cells to thereby produce proteins or peptides, including fusion proteins or peptides, encoded by nucleic acids as described herein.
- the recombinant expression vectors for use in the present invention can be designed for expression of a polypeptide corresponding to a marker of the present invention in prokaryotic ⁇ e.g., E. coli) or eukaryotic cells ⁇ e.g., insect cells ⁇ using baculovirus expression vectors ⁇ , yeast cells or mammalian cells). Suitable host cells are discussed further in Goeddel, supra.
- the recombinant expression vector can be transcribed and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase.
- Fusion vectors add a number of amino acids to a protein encoded therein, usually to the amino terminus of the recombinant protein.
- Such fusion vectors typically serve three purposes: 1) to increase expression of recombinant protein; 2) to increase the solubility of the recombinant protein; and 3) to aid in the purification of the recombinant protein by acting as a ligand in affinity purification.
- a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant protein to enable separation of the recombinant protein from the fusion moiety subsequent to purification of the fusion protein.
- enzymes, and their cognate recognition sequences include Factor Xa, thrombin and enterokinase.
- Typical fusion expression vectors include pGEX (Pharmacia Biotech Inc; Smith and Johnson, 1988, Gene 67:31-40), pMAL (New England Biolabs, Beverly, MA) and pRIT5 (Pharmacia, Piscataway, NJ) which fuse glutathione S-transferase (GST), maltose E binding protein, or protein A, respectively, to the target recombinant protein.
- GST glutathione S-transferase
- maltose E binding protein or protein A, respectively, to the target recombinant protein.
- Suitable inducible non-fusion E. coli expression vectors include pTrc (Amann et a/., 1988, Gene 69:301-315) and pET l id (Studier et al., p. 60-89, In Gene Expression Technology: Methods in Enzymology vol.185, Academic Press, San Diego, CA, 1991).
- Target biomarker nucleic acid expression from the pTrc vector relies on host RNA polymerase transcription from a hybrid trp-lac fusion promoter.
- Target biomarker nucleic acid expression from the pET l id vector relies on transcription from a T7 gnlO-lac fusion promoter mediated by a co-expressed viral RNA polymerase (T7 gnl).
- This viral polymerase is supplied by host strains BL21 (DE3) or HMS174(DE3) from a resident prophage harboring a T7 gnl gene under the transcriptional control of the lacUV 5 promoter.
- One strategy to maximize recombinant protein expression in E. coli is to express the protein in a host bacterium with an impaired capacity to proteolytically cleave the recombinant protein (Gottesman, p. 119-128, In Gene Expression Technology: Methods in Enzymology vol. 185, Academic Press, San Diego, CA, 1990.
- Another strategy is to alter the nucleic acid sequence of the nucleic acid to be inserted into an expression vector so that the individual codons for each amino acid are those preferentially utilized in E. coli (Wada et al, 1992, Nucleic Acids Res. 20:2111-2118). Such alteration of nucleic acid sequences of the present invention can be carried out by standard DNA synthesis techniques.
- the expression vector is a yeast expression vector.
- yeast S. cerevisiae examples include pYepSecl (Baldari et al, 1987, EMBO J. 6:229-234), pMFa (Kurjan and Herskowitz, 1982, Cell 30:933-943), pJRY88 (Schultz et al, 1987, Gene 54: 113-123), pYES2 (Invitrogen Corporation, San Diego, CA), and pPicZ (Invitrogen Corp, San Diego, CA).
- the expression vector is a baculovirus expression vector.
- Baculovirus vectors available for expression of proteins in cultured insect cells include the pAc series (Smith et al, 1983, Mol. Cell Biol. 3 :2156-2165) and the pVL series (Lucklow and Summers, 1989, Virology 170:31-39).
- a nucleic acid of the present invention is expressed in mammalian cells using a mammalian expression vector.
- mammalian expression vectors include pCDM8 (Seed, 1987, Nature 329:840) and pMT2PC (Kaufman et al, 1987, EMBO J. 6: 187-195).
- the expression vector's control functions are often provided by viral regulatory elements.
- commonly used promoters are derived from polyoma, Adenovirus 2, cytomegalovirus and Simian Virus 40.
- suitable expression systems for both prokaryotic and eukaryotic cells see chapters 16 and 17 of Sambrook et al, supra.
- the recombinant mammalian expression vector is capable of directing expression of the nucleic acid preferentially in a particular cell type (e.g., tissue-specific regulatory elements are used to express the nucleic acid).
- tissue-specific regulatory elements are known in the art.
- suitable tissue-specific promoters include the albumin promoter (liver-specific; Pinkert et al, 1987, Genes Dev. 1 :268-277), lymphoid-specific promoters (Calame and Eaton, 1988, Adv. Immunol. 43 :235- 275), in particular promoters of T cell receptors (Winoto and Baltimore, 1989, EMBO J.
- promoters are also encompassed, for example the murine hox promoters (Kessel and Gruss, 1990, Science 249:374-379) and the a-fetoprotein promoter (Camper and Tilghman, 1989, Genes Dev. 3 :537-546).
- the present invention further provides a recombinant expression vector comprising a DNA molecule cloned into the expression vector in an antisense orientation. That is, the DNA molecule is operably linked to a regulatory sequence in a manner which allows for expression (by transcription of the DNA molecule) of an RNA molecule which is antisense to the mRNA encoding a polypeptide of the present invention.
- Regulatory sequences operably linked to a nucleic acid cloned in the antisense orientation can be chosen which direct the continuous expression of the antisense RNA molecule in a variety of cell types, for instance viral promoters and/or enhancers, or regulatory sequences can be chosen which direct constitutive, tissue-specific or cell type specific expression of antisense RNA.
- the antisense expression vector can be in the form of a recombinant plasmid, phagemid, or attenuated virus in which antisense nucleic acids are produced under the control of a high efficiency regulatory region, the activity of which can be determined by the cell type into which the vector is introduced.
- host cell and "recombinant host cell” are used interchangeably herein. It is understood that such terms refer not only to the particular subject cell but to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.
- a host cell can be any prokaryotic ⁇ e.g., E. coli) or eukaryotic cell ⁇ e.g., insect cells, yeast or mammalian cells).
- Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques.
- transformation and “transfection” are intended to refer to a variety of art-recognized techniques for introducing foreign nucleic acid into a host cell, including calcium phosphate or calcium chloride co- precipitation, DEAE-dextran-mediated transfection, lipofection, or electroporation.
- Suitable methods for transforming or transfecting host cells can be found in Sambrook, et al. ⁇ supra), and other laboratory manuals.
- a gene that encodes a selectable marker ⁇ e.g., for resistance to antibiotics is generally introduced into the host cells along with the gene of interest.
- selectable markers include those which confer resistance to drugs, such as G418, hygromycin and methotrexate.
- Cells stably transfected with the introduced nucleic acid can be identified by drug selection (e.g., cells that have incorporated the selectable marker gene will survive, while the other cells die).
- Biomarker nucleic acids and/or biomarker polypeptides can be analyzed according to the methods described herein and techniques known to the skilled artisan to identify such genetic or expression alterations useful for the present invention including, but not limited to, 1) an alteration in the level of a biomarker transcript or polypeptide, 2) a deletion or addition of one or more nucleotides from a biomarker gene, 4) a substitution of one or more nucleotides of a biomarker gene, 5) aberrant modification of a biomarker gene, such as an expression regulatory region, and the like.
- a biological sample is tested for the presence of copy number changes in genomic loci containing the genomic marker.
- a copy number of at least 3, 4, 5, 6, 7, 8, 9, or 10 is predictive of poorer outcome of PBK/mTOR combination inhibitor treatment.
- Methods of evaluating the copy number of a biomarker locus include, but are not limited to, hybridization-based assays.
- Hybridization-based assays include, but are not limited to, traditional "direct probe” methods, such as Southern blots, in situ hybridization ⁇ e.g., FISH and FISH plus SKY) methods, and "comparative probe” methods, such as comparative genomic hybridization (CGH), e.g., cDNA-based or oligonucleotide-based CGH.
- CGH comparative genomic hybridization
- the methods can be used in a wide variety of formats including, but not limited to, substrate ⁇ e.g. membrane or glass) bound methods or array-based approaches.
- evaluating the biomarker gene copy number in a sample involves a Southern Blot.
- a Southern Blot the genomic DNA (typically fragmented and separated on an electrophoretic gel) is hybridized to a probe specific for the target region. Comparison of the intensity of the hybridization signal from the probe for the target region with control probe signal from analysis of normal genomic DNA ⁇ e.g., a non-amplified portion of the same or related cell, tissue, organ, etc) provides an estimate of the relative copy number of the target nucleic acid.
- a Northern blot may be utilized for evaluating the copy number of encoding nucleic acid in a sample.
- mRNA is hybridized to a probe specific for the target region.
- Comparison of the intensity of the hybridization signal from the probe for the target region with control probe signal from analysis of normal RNA provides an estimate of the relative copy number of the target nucleic acid.
- RNA e.g., a non-amplified portion of the same or related cell, tissue, organ, etc.
- other methods well known in the art to detect RNA can be used, such that higher or lower expression relative to an appropriate control (e.g., a non-amplified portion of the same or related cell tissue, organ, etc.) provides an estimate of the relative copy number of the target nucleic acid.
- in situ hybridization comprises the following steps: (1) fixation of tissue or biological structure to be analyzed; (2) prehybridization treatment of the biological structure to increase accessibility of target DNA, and to reduce nonspecific binding; (3) hybridization of the mixture of nucleic acids to the nucleic acid in the biological structure or tissue; (4) post-hybridization washes to remove nucleic acid fragments not bound in the hybridization and (5) detection of the hybridized nucleic acid fragments.
- the reagent used in each of these steps and the conditions for use vary depending on the particular application.
- a nucleic acid In a typical in situ hybridization assay, cells are fixed to a solid support, typically a glass slide. If a nucleic acid is to be probed, the cells are typically denatured with heat or alkali. The cells are then contacted with a hybridization solution at a moderate temperature to permit annealing of labeled probes specific to the nucleic acid sequence encoding the protein. The targets (e.g., cells) are then typically washed at a predetermined stringency or at an increasing stringency until an appropriate signal to noise ratio is obtained. The probes are typically labeled, e.g., with radioisotopes or fluorescent reporters. In one embodiment, probes are sufficiently long so as to specifically hybridize with the target nucleic acid(s) under stringent conditions. Probes generally range in length from about 200 bases to about 1000 bases. In some applications it is necessary to block the hybridization capacity of repetitive sequences. Thus, in some embodiments, tRNA, human genomic DNA, or Cot-I DNA is used to block
- genomic DNA is isolated from normal reference cells, as well as from test cells (e.g., tumor cells) and amplified, if necessary.
- the two nucleic acids are differentially labeled and then hybridized in situ to metaphase chromosomes of a reference cell.
- the repetitive sequences in both the reference and test DNAs are either removed or their hybridization capacity is reduced by some means, for example by prehybridization with appropriate blocking nucleic acids and/or including such blocking nucleic acid sequences for said repetitive sequences during said hybridization.
- the bound, labeled DNA sequences are then rendered in a visualizable form, if necessary.
- Chromosomal regions in the test cells which are at increased or decreased copy number can be identified by detecting regions where the ratio of signal from the two DNAs is altered. For example, those regions that have decreased in copy number in the test cells will show relatively lower signal from the test DNA than the reference compared to other regions of the genome. Regions that have been increased in copy number in the test cells will show relatively higher signal from the test DNA. Where there are chromosomal deletions or multiplications, differences in the ratio of the signals from the two labels will be detected and the ratio will provide a measure of the copy number.
- array CGH array CGH
- the immobilized chromosome element is replaced with a collection of solid support bound target nucleic acids on an array, allowing for a large or complete percentage of the genome to be represented in the collection of solid support bound targets.
- Target nucleic acids may comprise cDNAs, genomic DNAs, oligonucleotides ⁇ e.g., to detect single nucleotide polymorphisms) and the like.
- Array-based CGH may also be performed with single-color labeling (as opposed to labeling the control and the possible tumor sample with two different dyes and mixing them prior to hybridization, which will yield a ratio due to competitive hybridization of probes on the arrays).
- amplification-based assays can be used to measure copy number.
- the nucleic acid sequences act as a template in an amplification reaction ⁇ e.g., Polymerase Chain Reaction (PCR).
- PCR Polymerase Chain Reaction
- the amount of amplification product will be proportional to the amount of template in the original sample. Comparison to appropriate controls, e.g. healthy tissue, provides a measure of the copy number.
- Quantitative amplification involves simultaneously co-amplifying a known quantity of a control sequence using the same primers. This provides an internal standard that may be used to calibrate the PCR reaction.
- Detailed protocols for quantitative PCR are provided in Innis, et al. (1990) PCR Protocols, A Guide to Methods and Applications, Academic Press, Inc. N.Y.). Measurement of DNA copy number at microsatellite loci using quantitative PCR analysis is described in Ginzonger, et al. (2000) Cancer Research 60:5405-5409.
- the known nucleic acid sequence for the genes is sufficient to enable one of skill in the art to routinely select primers to amplify any portion of the gene.
- Fluorogenic quantitative PCR may also be used in the methods of the present invention. In fluorogenic quantitative PCR, quantitation is based on amount of fluorescence signals, e.g., TaqMan and SYBR green.
- ligase chain reaction (LCR) (see Wu and Wallace (1989) Genomics 4: 560, Landegren, et al. (1988) Science 241 : 1077, and Barringer et al. (1990) Gene 89: 117), transcription amplification (Kwoh, et al. (1989) Proc. Natl. Acad. Sci. USA 86: 1173), self-sustained sequence replication (Guatelli, et al. (1990) Proc. Nat. Acad. Sci. USA 87: 1874), dot PCR, and linker adapter PCR, etc.
- LCR ligase chain reaction
- Loss of heterozygosity (LOH) and major copy proportion (MCP) mapping may also be used to identify regions of amplification or deletion.
- Biomarker expression may be assessed by any of a wide variety of well-known methods for detecting expression of a transcribed molecule or protein.
- Non-limiting examples of such methods include immunological methods for detection of secreted, cell- surface, cytoplasmic, or nuclear proteins, protein purification methods, protein function or activity assays, nucleic acid hybridization methods, nucleic acid reverse transcription methods, and nucleic acid amplification methods.
- activity of a particular gene is characterized by a measure of gene transcript (e.g. mRNA), by a measure of the quantity of translated protein, or by a measure of gene product activity.
- Marker expression can be monitored in a variety of ways, including by detecting mRNA levels, protein levels, or protein activity, any of which can be measured using standard techniques. Detection can involve quantification of the level of gene expression (e.g., genomic DNA, cDNA, mRNA, protein, or enzyme activity), or, alternatively, can be a qualitative assessment of the level of gene expression, in particular in comparison with a control level. The type of level being detected will be clear from the context.
- detecting or determining expression levels of a biomarker and functionally similar homologs thereof, including a fragment or genetic alteration thereof (e.g., in regulatory or promoter regions thereof) comprises detecting or determining RNA levels for the marker of interest.
- one or more cells from the subject to be tested are obtained and RNA is isolated from the cells.
- a sample of breast tissue cells is obtained from the subject.
- RNA is obtained from a single cell.
- a cell can be isolated from a tissue sample by laser capture microdissection (LCM).
- LCM laser capture microdissection
- a cell can be isolated from a tissue section, including a stained tissue section, thereby assuring that the desired cell is isolated (see, e.g., Bonner et al. (1997) Science 278: 1481; Emmert-Buck et al. (1996) Science 274:998; Fend et al. (1999) Am. J. Path. 154: 61 and Murakami et al. (2000) Kidney Int. 58: 1346).
- Murakami et al., supra describe isolation of a cell from a previously immunostained tissue section.
- RNA can be extracted.
- Methods for establishing cultures of non-transformed cells, i.e., primary cell cultures, are known in the art.
- RNA in the tissue and cells may quickly become degraded. Accordingly, in a preferred embodiment, the tissue or cells obtained from a subject is snap frozen as soon as possible.
- RNA can be extracted from the tissue sample by a variety of methods, e.g., the guanidium thiocyanate lysis followed by CsCl centrifugation (Chirgwin et al., 1979, Biochemistry 18:5294-5299).
- RNA from single cells can be obtained as described in methods for preparing cDNA libraries from single cells, such as those described in Dulac, C. (1998) Curr. Top. Dev. Biol. 36, 245 and Jena et al. (1996) J. Immunol. Methods 190: 199. Care to avoid RNA degradation must be taken, e.g., by inclusion of RNAsin.
- RNA sample can then be enriched in particular species.
- poly(A)+ RNA is isolated from the RNA sample.
- such purification takes advantage of the poly-A tails on mRNA.
- poly-T oligonucleotides may be immobilized within on a solid support to serve as affinity ligands for mRNA. Kits for this purpose are commercially available, e.g., the MessageMaker kit (Life Technologies, Grand Island, NY).
- the RNA population is enriched in marker sequences. Enrichment can be undertaken, e.g., by primer-specific cDNA synthesis, or multiple rounds of linear amplification based on cDNA synthesis and template-directed in vitro
- RNA enriched or not in particular species or sequences
- an "amplification process" is designed to strengthen, increase, or augment a molecule within the RNA.
- an amplification process such as RT-PCR can be utilized to amplify the mRNA, such that a signal is detectable or detection is enhanced.
- Such an amplification process is beneficial particularly when the biological, tissue, or tumor sample is of a small size or volume.
- RNAscribe mRNA into cDNA followed by polymerase chain reaction RT-PCR
- RT-AGLCR reverse transcribe mRNA into cDNA followed by symmetric gap ligase chain reaction
- Northern analysis involves running a preparation of RNA on a denaturing agarose gel, and transferring it to a suitable support, such as activated cellulose, nitrocellulose or glass or nylon membranes. Radiolabeled cDNA or RNA is then hybridized to the preparation, washed and analyzed by autoradiography.
- In situ hybridization visualization may also be employed, wherein a radioactively labeled antisense RNA probe is hybridized with a thin section of a biopsy sample, washed, cleaved with RNase and exposed to a sensitive emulsion for autoradiography.
- the samples may be stained with hematoxylin to demonstrate the histological composition of the sample, and dark field imaging with a suitable light filter shows the developed emulsion.
- Non-radioactive labels such as digoxigenin may also be used.
- mRNA expression can be detected on a DNA array, chip or a microarray.
- Labeled nucleic acids of a test sample obtained from a subject may be hybridized to a solid surface comprising biomarker DNA. Positive hybridization signal is obtained with the sample containing biomarker transcripts.
- mRNA is extracted from the biological sample to be tested, reverse transcribed, and fluorescently-labeled cDNA probes are generated.
- the microarrays capable of hybridizing to marker cDNA are then probed with the labeled cDNA probes, the slides scanned and fluorescence intensity measured. This intensity correlates with the hybridization intensity and expression levels.
- probes that can be used in the methods described herein include cDNA, riboprobes, synthetic oligonucleotides and genomic probes.
- the type of probe used will generally be dictated by the particular situation, such as riboprobes for in situ hybridization, and cDNA for Northern blotting, for example.
- the probe is directed to nucleotide regions unique to the RNA.
- the probes may be as short as is required to differentially recognize marker mRNA transcripts, and may be as short as, for example, 15 bases; however, probes of at least 17, 18, 19 or 20 or more bases can be used.
- the primers and probes hybridize specifically under stringent conditions to a DNA fragment having the nucleotide sequence corresponding to the marker.
- stringent conditions means hybridization will occur only if there is at least 95% identity in nucleotide sequences.
- hybridization under stringent conditions means hybridization will occur only if there is at least 95% identity in nucleotide sequences.
- stringent conditions occurs when there is at least 97% identity between the sequences.
- the form of labeling of the probes may be any that is appropriate, such as the use of radioisotopes, for example, 32 P and 35 S. Labeling with radioisotopes may be achieved, whether the probe is synthesized chemically or biologically, by the use of suitably labeled bases.
- the biological sample contains polypeptide molecules from the test subject.
- the biological sample can contain mRNA molecules from the test subject or genomic DNA molecules from the test subject.
- the methods further involve obtaining a control biological sample from a control subject, contacting the control sample with a compound or agent capable of detecting marker polypeptide, mRNA, genomic DNA, or fragments thereof, such that the presence of the marker polypeptide, mRNA, genomic DNA, or fragments thereof, is detected in the biological sample, and comparing the presence of the marker polypeptide, mRNA, genomic DNA, or fragments thereof, in the control sample with the presence of the marker polypeptide, mRNA, genomic DNA, or fragments thereof in the test sample,
- the activity or level of a biomarker protein can be detected and/or quantified by detecting or quantifying the expressed polypeptide.
- the polypeptide can be detected and quantified by any of a number of means well known to those of skill in the art. Aberrant levels of polypeptide expression of the polypeptides encoded by a biomarker nucleic acid and functionally similar homologs thereof, including a fragment or genetic alteration thereof (e.g., in regulatory or promoter regions thereof) are associated with the likelihood of response of a cancer to PI3K/mTOR combination inhibitor therapy. Any method known in the art for detecting polypeptides can be used.
- Such methods include, but are not limited to, immunodiffusion, Immunoelectrophoresis, radioimmunoassay (RIA), enzyme-linked immunosorbent assays (ELISAs), immunofluorescent assays, Western blotting, binder- ligand assays, immunohistochemical techniques, agglutination, complement assays, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography, and the like (e.g., Basic and Clinical Immunology, Sites and Terr, eds., Appleton and Lange, Norwalk, Conn, pp 217-262, 1991 which is
- binder-ligand immunoassay methods including reacting antibodies with an epitope or epitopes and competitively displacing a labeled polypeptide or derivative thereof.
- ELISA and RIA procedures may be conducted such that a desired biomarker protein standard is labeled (with a radioisotope such as 125 I or 35 S, or an assayable enzyme, such as horseradish peroxidase or alkaline phosphatase), and, together with the unlabeled sample, brought into contact with the corresponding antibody, whereon a second antibody is used to bind the first, and radioactivity or the immobilized enzyme assayed (competitive assay).
- a radioisotope such as 125 I or 35 S, or an assayable enzyme, such as horseradish peroxidase or alkaline phosphatase
- the biomarker protein in the sample is allowed to react with the corresponding immobilized antibody, radioisotope- or enzyme-labeled anti-biomarker protein antibody is allowed to react with the system, and radioactivity or the enzyme assayed (ELISA-sandwich assay).
- radioactivity or the enzyme assayed ELISA-sandwich assay.
- Other conventional methods may also be employed as suitable.
- a “one-step” assay involves contacting antigen with immobilized antibody and, without washing, contacting the mixture with labeled antibody.
- a “two-step” assay involves washing before contacting, the mixture with labeled antibody.
- Other conventional methods may also be employed as suitable.
- a method for measuring biomarker protein levels comprises the steps of: contacting a biological specimen with an antibody or variant (e.g., fragment) thereof which selectively binds the biomarker protein, and detecting whether said antibody or variant thereof is bound to said sample and thereby measuring the levels of the biomarker protein.
- an antibody or variant e.g., fragment
- Enzymatic and radiolabeling of biomarker protein and/or the antibodies may be effected by conventional means.
- Such means will generally include covalent linking of the enzyme to the antigen or the antibody in question, such as by glutaraldehyde, specifically so as not to adversely affect the activity of the enzyme, by which is meant that the enzyme must still be capable of interacting with its substrate, although it is not necessary for all of the enzyme to be active, provided that enough remains active to permit the assay to be effected.
- some techniques for binding enzyme are non-specific (such as using formaldehyde), and will only yield a proportion of active enzyme.
- Enzymes employable for labeling are not particularly limited, but may be selected from the members of the oxidase group, for example. These catalyze production of hydrogen peroxide by reaction with their substrates, and glucose oxidase is often used for its good stability, ease of availability and cheapness, as well as the ready availability of its substrate (glucose). Activity of the oxidase may be assayed by measuring the concentration of hydrogen peroxide formed after reaction of the enzyme-labeled antibody with the substrate under controlled conditions well-known in the art.
- biomarker protein may be detected according to a practitioner's preference based upon the present disclosure.
- One such technique is Western blotting (Towbin et at., Proc. Nat. Acad. Sci. 76:4350 (1979)), wherein a suitably treated sample is run on an SDS-PAGE gel before being transferred to a solid support, such as a nitrocellulose filter.
- Anti-biomarker protein antibodies (unlabeled) are then brought into contact with the support and assayed by a secondary immunological reagent, such as labeled protein A or anti-immunoglobulin (suitable labels including 125 I, horseradish peroxidase and alkaline phosphatase). Chromatographic detection may also be used.
- Immunohistochemistry may be used to detect expression of biomarker protein, e.g., in a biopsy sample.
- a suitable antibody is brought into contact with, for example, a thin layer of cells, washed, and then contacted with a second, labeled antibody.
- Labeling may be by fluorescent markers, enzymes, such as peroxidase, avidin, or radiolabeling.
- the assay is scored visually, using microscopy.
- Anti-biomarker protein antibodies may also be used for imaging purposes, for example, to detect the presence of biomarker protein in cells and tissues of a subject.
- Suitable labels include radioisotopes, iodine ( 125 I, 121 I), carbon ( 14 C), sulphur ( 35 S), tritium ( 3 H), indium ( 112 In), and technetium ( 99 mTc), fluorescent labels, such as fluorescein and rhodamine, and biotin.
- antibodies are not detectable, as such, from outside the body, and so must be labeled, or otherwise modified, to permit detection.
- Markers for this purpose may be any that do not substantially interfere with the antibody binding, but which allow external detection.
- Suitable markers may include those that may be detected by X-radiography, NMR or MRI.
- suitable markers include any radioisotope that emits detectable radiation but that is not overtly harmful to the subject, such as barium or cesium, for example.
- Suitable markers for NMR and MRI generally include those with a detectable characteristic spin, such as deuterium, which may be incorporated into the antibody by suitable labeling of nutrients for the relevant hybridoma, for example.
- the size of the subject, and the imaging system used, will determine the quantity of imaging moiety needed to produce diagnostic images.
- the quantity of radioactivity injected will normally range from about 5 to 20 millicuries of technetium-99.
- the labeled antibody or antibody fragment will then preferentially accumulate at the location of cells which contain biomarker protein.
- the labeled antibody or antibody fragment can then be detected using known techniques.
- Antibodies that may be used to detect biomarker protein include any antibody, whether natural or synthetic, full length or a fragment thereof, monoclonal or polyclonal, that binds sufficiently strongly and specifically to the biomarker protein to be detected.
- An antibody may have a Kd of at most about 10 "6 M, 10 "7 M, 10 "8 M, 10 "9 M, 10- 10 M, 10- U M, 10 " 12 M.
- the phrase "specifically binds” refers to binding of, for example, an antibody to an epitope or antigen or antigenic determinant in such a manner that binding can be displaced or competed with a second preparation of identical or similar epitope, antigen or antigenic determinant.
- An antibody may bind preferentially to the biomarker protein relative to other proteins, such as related proteins.
- Antibodies are commercially available or may be prepared according to methods known in the art.
- Antibodies and derivatives thereof that may be used encompass polyclonal or monoclonal antibodies, chimeric, human, humanized, primatized (CDR-grafted), veneered or single-chain antibodies as well as functional fragments, i.e., biomarker protein binding fragments, of antibodies.
- antibody fragments capable of binding to a biomarker protein or portions thereof including, but not limited to, Fv, Fab, Fab' and F(ab') 2 fragments can be used.
- Such fragments can be produced by enzymatic cleavage or by recombinant techniques. For example, papain or pepsin cleavage can generate Fab or F(ab') 2 fragments, respectively.
- Fab or F(ab') 2 fragments can also be used to generate Fab or F(ab') 2 fragments.
- Antibodies can also be produced in a variety of truncated forms using antibody genes in which one or more stop codons have been introduced upstream of the natural stop site.
- a chimeric gene encoding a F(ab') 2 heavy chain portion can be designed to include DNA sequences encoding the CH, domain and hinge region of the heavy chain.
- Synthetic and engineered antibodies are described in, e.g. , Cabilly et al., U.S. Pat.
- Antibodies produced from a library may also be used.
- agents that specifically bind to a biomarker protein other than antibodies are used, such as peptides.
- Peptides that specifically bind to a biomarker protein can be identified by any means known in the art. For example, specific peptide binders of a biomarker protein can be screened for using peptide phage display libraries, d. Methods for Detection of Biomarker Structural Alterations
- biomarker nucleic acid and/or biomarker polypeptide molecule can be used to identify the presence of a structural alteration in a biomarker nucleic acid and/or biomarker polypeptide molecule in order to, for example, identify PBK/mTOR pathway proteins that are overexpressed, overfunctional, and the like.
- detection of the alteration involves the use of a
- PCR polymerase chain reaction
- LCR ligation chain reaction
- This method can include the steps of collecting a sample of cells from a subject, isolating nucleic acid ⁇ e.g., genomic, mRNA or both) from the cells of the sample, contacting the nucleic acid sample with one or more primers which specifically hybridize to a biomarker gene under conditions such that hybridization and amplification of the biomarker gene (if present) occurs, and detecting the presence or absence of an amplification product, or detecting the size of the amplification product and comparing the length to a control sample. It is anticipated that PCR and/or LCR may be desirable to use as a preliminary amplification step in conjunction with any of the techniques used for detecting mutations described herein.
- nucleic acid e.g., genomic, mRNA or both
- Alternative amplification methods include: self-sustained sequence replication (Guatelli, J. C. et al. (1990) Proc. Natl. Acad. Sci. USA 87: 1874-1878), transcriptional amplification system (Kwoh, D. Y. et al. (1989) Proc. Natl. Acad. Sci. USA 86: 1173-1177), Q-Beta Replicase (Lizardi, P. M. et al. (1988) Bio-Technology 6: 1197), or any other nucleic acid amplification method, followed by the detection of the amplified molecules using techniques well known to those of skill in the art.
- mutations in a biomarker nucleic acid from a sample cell can be identified by alterations in restriction enzyme cleavage patterns. For example, sample and control DNA is isolated, amplified (optionally), digested with one or more restriction endonucleases, and fragment length sizes are determined by gel electrophoresis and compared. Differences in fragment length sizes between sample and control DNA indicates mutations in the sample DNA.
- sequence specific ribozymes see, for example, U.S. Pat. No. 5,498,531 can be used to score for the presence of specific mutations by development or loss of a ribozyme cleavage site.
- biomarker nucleic acid can be identified by hybridizing a sample and control nucleic acids, e.g., DNA or RNA, to high density arrays containing hundreds or thousands of oligonucleotide probes (Cronin, M. T. et al. (1996) Hum. Mutat. 7:244-255; Kozal, M. J. et al. (1996) Nat. Med. 2:753-759).
- biomarker genetic mutations can be identified in two dimensional arrays containing light-generated DNA probes as described in Cronin et al. (1996) supra.
- a first hybridization array of probes can be used to scan through long stretches of DNA in a sample and control to identify base changes between the sequences by making linear arrays of sequential, overlapping probes. This step allows the identification of point mutations. This step is followed by a second hybridization array that allows the characterization of specific mutations by using smaller, specialized probe arrays complementary to all variants or mutations detected. Each mutation array is composed of parallel probe sets, one complementary to the wild-type gene and the other complementary to the mutant gene.
- biomarker genetic mutations can be identified in a variety of contexts, including, for example, germline and somatic mutations.
- any of a variety of sequencing reactions known in the art can be used to directly sequence a biomarker gene and detect mutations by comparing the sequence of the sample biomarker with the corresponding wild-type (control) sequence.
- Examples of sequencing reactions include those based on techniques developed by Maxam and Gilbert (1977) Proc. Natl. Acad. Sci. USA 74:560 or Sanger (1977) Proc. Natl. Acad Sci. USA 74:5463. It is also contemplated that any of a variety of automated sequencing procedures can be utilized when performing the diagnostic assays (Naeve (1995)
- Biotechniques 19:448-53 including sequencing by mass spectrometry (see, e.g., PCT International Publication No. WO 94/16101; Cohen et al. (1996) Adv. Chromatogr. 36: 127- 162; and Griffin et al. (1993) Appl. Biochem. Biotechnol. 38: 147-159).
- RNA/DNA duplexes can be treated with RNase and DNA/DNA hybrids treated with SI nuclease to enzymatically digest the mismatched regions.
- DNA/DNA or RNA/DNA duplexes can be treated with hydroxylamine or osmium tetroxide and with piperidine in order to digest mismatched regions.
- control DNA or RNA can be labeled for detection.
- the mismatch cleavage reaction employs one or more proteins that recognize mismatched base pairs in double-stranded DNA (so called "DNA mismatch repair" enzymes) in defined systems for detecting and mapping point mutations in biomarker cDNAs obtained from samples of cells.
- DNA mismatch repair enzymes
- the mutY enzyme of E. coli cleaves A at G/A mismatches and the thymidine DNA glycosylase from HeLa cells cleaves T at G/T mismatches (Hsu et al. (1994) Carcinogenesis 15: 1657-1662).
- a probe based on a biomarker sequence e.g., a wild-type biomarker treated with a DNA mismatch repair enzyme, and the cleavage products, if any, can be detected from electrophoresis protocols or the like (e.g., U.S. Pat. No. 5,459,039.)
- alterations in electrophoretic mobility can be used to identify mutations in biomarker genes.
- SSCP single strand conformation polymorphism
- SSCP single strand conformation polymorphism
- the movement of mutant or wild-type fragments in polyacrylamide gels containing a gradient of denaturant is assayed using denaturing gradient gel electrophoresis (DGGE) (Myers et al. (1985) Nature 313 :495).
- DGGE denaturing gradient gel electrophoresis
- DNA will be modified to ensure that it does not completely denature, for example by adding a GC clamp of approximately 40 bp of high- melting GC-rich DNA by PCR.
- a temperature gradient is used in place of a denaturing gradient to identify differences in the mobility of control and sample DNA (Rosenbaum and Reissner (1987) Biophys. Chem. 265: 12753).
- oligonucleotide primers may be prepared in which the known mutation is placed centrally and then hybridized to target DNA under conditions which permit hybridization only if a perfect match is found (Saiki et al. (1986) Nature 324: 163; Saiki et al. (1989) Proc. Natl. Acad. Sci. USA 86:6230).
- Such allele specific oligonucleotides are hybridized to PCR amplified target DNA or a number of different mutations when the oligonucleotides are attached to the hybridizing membrane and hybridized with labeled target DNA.
- PCR amplification may be used in conjunction with the instant invention.
- Oligonucleotides used as primers for specific amplification may carry the mutation of interest in the center of the molecule (so that amplification depends on differential hybridization) (Gibbs et al. (1989) Nucleic Acids Res. 17:2437-2448) or at the extreme 3' end of one primer where, under appropriate conditions, mismatch can prevent, or reduce polymerase extension (Prossner (1993) Tibtech 11 :238).
- it may be desirable to introduce a novel restriction site in the region of the mutation to create cleavage-based detection (Gasparini et al. (1992) Mol. Cell Probes 6: 1).
- amplification may also be performed using Taq ligase for amplification (Barany (1991) Proc. Natl. Acad. Sci USA 88: 189). In such cases, ligation will occur only if there is a perfect match at the 3' end of the 5' sequence making it possible to detect the presence of a known mutation at a specific site by looking for the presence or absence of amplification.
- PI3K/mTOR combination inhibitor therapy is predicted according to biomarker amount and/or activity associated with a brain metastasis in a subject according to the methods described herein.
- PI3K/mTOR combination inhibitor therapy or combinations of therapies e.g., one or more PI3K/mTOR combination inhibitors in combination with one or more additional anti-cancer therapies, such as an immune checkpoint inhibitor
- additional anti-cancer therapies such as an immune checkpoint inhibitor
- such PI3K/mTOR combination inhibitor therapy can be avoided once a subject is indicated as not being a likely responder to PI3K/mTOR combination inhibitor therapy and an alternative treatment regimen, such as targeted and/or untargeted anti-cancer therapies can be administered.
- Combination therapies are also contemplated and can comprise, for example, one or more chemotherapeutic agents and radiation, one or more chemotherapeutic agents and immunotherapy, or one or more chemotherapeutic agents, radiation and chemotherapy, each combination of which can be with anti-immune checkpoint therapy.
- targeted therapy refers to administration of agents that selectively interact with a chosen biomolecule to thereby treat cancer.
- agents that selectively interact with a chosen biomolecule include immune checkpoint inhibitors, which are well-known in the art.
- immune checkpoint inhibitors which are well-known in the art.
- anti-PD-1 pathway agents such as therapeutic monoclonal blocking antibodies, which are well-known in the art and described above, can be used to target tumor microenvironments and cells expressing unwanted components of the PD-1 pathway, such as PD-1, PD-L1, and/or PD- L2.
- PD-1 pathway refers to the PD-1 receptor and its ligands, PD-L1 and PD-L2.
- PI3K/mTOR combination inhibitors block or otherwise reduce the interaction between PD-1 and one or both of its ligands such that the immunoinhibitory signaling otherwise generated by the interaction is blocked or otherwise reduced.
- Anti- immune checkpoint inhibitors can be direct or indirect. Direct anti-immune checkpoint inhibitors block or otherwise reduce the interaction between an immune checkpoint and at least one of its ligands.
- PD-1 inhibitors can block PD-1 binding with one or both of its ligands.
- Direct PD-1 combination inhibitors are well known in the art, especially since the natural binding partners of PD-1 (e.g., PD-Ll and PD-L2), PD-Ll (e.g., PD-1 and B7-1), and PD-L2 (e.g., PD-1 and RGMb) are known.
- PD-1 e.g., PD-Ll and PD-L2
- PD-Ll e.g., PD-1 and B7-1
- PD-L2 e.g., PD-1 and RGMb
- agents which directly block the interaction between PD-1 and PD-Ll, PD-1 and PD-L2, PD-1 and both PD-Ll and PD-L2, such as a bispecific antibody can prevent inhibitory signaling and upregulate an immune response (i.e., as a PD-1 pathway inhibitor).
- agents that indirectly block the interaction between PD-1 and one or both of its ligands can prevent inhibitory signaling and upregulate an immune response.
- B7-1 or a soluble form thereof, by binding to a PD-Ll polypeptide indirectly reduces the effective concentration of PD-Ll polypeptide available to bind to PD-1.
- Exemplary agents include monospecific or bispecific blocking antibodies against PD-1, PD-Ll, and/or PD-L2 that block the interaction between the receptor and ligand(s); a non- activating form of PD-1, PD-Ll, and/or PD-L2 (e.g., a dominant negative or soluble polypeptide), small molecules or peptides that block the interaction between PD-1, PD-Ll, and/or PD-L2; fusion proteins (e.g.
- Indirect anti-immune checkpoint inhibitors block or otherwise reduce the immunoinhibitory signaling generated by the interaction between the immune checkpoint and at least one of its ligands.
- an inhibitor can block the interaction between PD-1 and one or both of its ligands without necessarily directly blocking the interaction between PD-1 and one or both of its ligands.
- indirect inhibitors include intrabodies that bind the intracellular portion of PD-1 and/or PD-Ll required to signal to block or otherwise reduce the immunoinhibitory signaling.
- nucleic acids that reduce the expression of PD-1, PD-Ll, and/or PD-L2 can indirectly inhibit the interaction between PD-1 and one or both of its ligands by removing the availability of components for interaction.
- Such nucleic acid molecules can block PD-Ll, PD-L2, and/or PD-L2 transcription or translation.
- immunotherapy is one form of targeted therapy that may comprise, for example, the use of cancer vaccines and/or sensitized antigen presenting cells.
- an oncolytic virus is a virus that is able to infect and lyse cancer cells, while leaving normal cells unharmed, making them potentially useful in cancer therapy.
- oncolytic viruses both facilitates tumor cell destruction and also produces dose amplification at the tumor site. They may also act as vectors for anticancer genes, allowing them to be specifically delivered to the tumor site.
- the immunotherapy can involve passive immunity for short-term protection of a host, achieved by the
- Immunotherapy can also focus on using the cytotoxic lymphocyte-recognized epitopes of cancer cell lines.
- anti sense can also focus on using the cytotoxic lymphocyte-recognized epitopes of cancer cell lines.
- polynucleotides can be used to selectively modulate biomolecules that are linked to the initiation, progression, and/or pathology of a tumor or cancer.
- untargeted therapy refers to administration of agents that do not selectively interact with a chosen biomolecule yet treat cancer.
- Representative examples of untargeted therapies include, without limitation, chemotherapy, gene therapy, and radiation therapy.
- Chemotherapy includes the
- chemotherapeutic agent may be, but is not limited to, those selected from among the following groups of compounds: platinum compounds, cytotoxic antibiotics, antimetabolites, anti-mitotic agents, alkylating agents, arsenic compounds, DNA topoisomerase inhibitors, taxanes, nucleoside analogues, plant alkaloids, and toxins; and synthetic derivatives thereof.
- Exemplary compounds include, but are not limited to, alkylating agents: cisplatin, treosulfan, and trofosfamide; plant alkaloids: vinblastine, paclitaxel, docetaxol; DNA topoisomerase inhibitors: teniposide, crisnatol, and mitomycin; anti -folates: methotrexate, mycophenolic acid, and hydroxyurea; pyrimidine analogs: 5-fluorouracil, doxifluridine, and cytosine arabinoside; purine analogs:
- compositions comprising one or more chemotherapeutic agents (e.g., FLAG, CHOP) may also be used.
- FLAG comprises fludarabine, cytosine arabinoside (Ara-C) and G-CSF.
- CHOP comprises cyclophosphamide, vincristine, doxorubicin, and prednisone.
- PARP e.g., PARP-1 and/or PARP-2
- inhibitors are well known in the art (e.g., Olaparib, ABT-888, BSI-201, BGP-15 (N-Gene Research Laboratories, Inc.); INO-1001 (Inotek Pharmaceuticals Inc.); PJ34 (Soriano et al., 2001; Pacher et al., 2002b); 3-aminobenzamide (Trevigen); 4-amino- 1,8-naphthalimide; (Trevigen); 6(5H)-phenanthridinone (Trevigen); benzamide (U.S. Pat. Re.
- the mechanism of action is generally related to the ability of PARP inhibitors to bind PARP and decrease its activity.
- PARP catalyzes the conversion of .beta. -nicotinamide adenine dinucleotide (NAD+) into nicotinamide and poly- ADP-ribose (PAR). Both poly (ADP-ribose) and PARP have been linked to regulation of transcription, cell proliferation, genomic stability, and carcinogenesis
- Poly(ADP-ribose) polymerase 1 is a key molecule in the repair of DNA single- strand breaks (SSBs) (de Murcia J. et al. 1997. Proc Natl Acad Sci USA 94:7303-7307; Schreiber V, Dantzer F, Ame J C, de Murcia G (2006) Nat Rev Mol Cell Biol 7:517-528; Wang Z Q, et al. (1997) Genes Dev 11 :2347-2358). Knockout of SSB repair by inhibition of PARPl function induces DNA double-strand breaks (DSBs) that can trigger synthetic lethality in cancer cells with defective homology-directed DSB repair (Bryant H E, et al. (2005) Nature 434:913-917; Farmer H, et al. (2005) Nature 434:917-921).
- DSBs DNA double-strand breaks
- radiation therapy is used.
- the radiation used in radiation therapy can be ionizing radiation.
- Radiation therapy can also be gamma rays, X-rays, or proton beams.
- Examples of radiation therapy include, but are not limited to, external-beam radiation therapy, interstitial implantation of radioisotopes (1-125, palladium, iridium), radioisotopes such as strontium-89, thoracic radiation therapy, intraperitoneal P-32 radiation therapy, and/or total abdominal and pelvic radiation therapy.
- the radiation therapy can be administered as external beam radiation or teletherapy wherein the radiation is directed from a remote source.
- the radiation treatment can also be administered as internal therapy or brachytherapy wherein a radioactive source is placed inside the body close to cancer cells or a tumor mass.
- photodynamic therapy comprising the administration of photosensitizers, such as hematoporphyrin and its derivatives, Vertoporfin (BPD-MA), phthalocyanine,
- photosensitizer Pc4 demethoxy-hypocrellin A; and 2B A-2-DMHA.
- surgical intervention can occur to physically remove cancerous cells and/or tissues.
- hormone therapy is used.
- Hormonal therapeutic treatments can comprise, for example, hormonal agonists, hormonal antagonists (e.g., flutamide, bicalutamide, tamoxifen, raloxifene, leuprolide acetate (LUPRON), LH-RH antagonists), inhibitors of hormone biosynthesis and processing, and steroids (e.g., dexamethasone, retinoids, deltoids, betamethasone, Cortisol, cortisone, prednisone, dehydrotestosterone, glucocorticoids, mineralocorticoids, estrogen, testosterone, progestins), vitamin A derivatives (e.g., all-trans retinoic acid (ATRA)); vitamin D3 analogs; antigestagens (e.g., mifepristone, onapristone), or antiandrogens (e.g., cyproterone acetate).
- hormonal antagonists e.g., flutamide, bicalu
- hyperthermia a procedure in which body tissue is exposed to high temperatures (up to 106°F.) is used. Heat may help shrink tumors by damaging cells or depriving them of substances they need to live.
- Hyperthermia therapy can be local, regional, and whole-body hyperthermia, using external and internal heating devices. Hyperthermia is almost always used with other forms of therapy (e.g., radiation therapy, chemotherapy, and biological therapy) to try to increase their effectiveness.
- Local hyperthermia refers to heat that is applied to a very small area, such as a tumor. The area may be heated externally with high-frequency waves aimed at a tumor from a device outside the body.
- sterile probes may be used, including thin, heated wires or hollow tubes filled with warm water; implanted microwave antennae; and radiofrequency electrodes.
- regional hyperthermia an organ or a limb is heated. Magnets and devices that produce high energy are placed over the region to be heated.
- perfusion some of the patient's blood is removed, heated, and then pumped (perfused) into the region that is to be heated internally.
- Whole- body heating is used to treat metastatic cancer that has spread throughout the body. It can be accomplished using warm-water blankets, hot wax, inductive coils (like those in electric blankets), or thermal chambers (similar to large incubators). Hyperthermia does not cause any marked increase in radiation side effects or complications. Heat applied directly to the skin, however, can cause discomfort or even significant local pain in about half the patients treated. It can also cause blisters, which generally heal rapidly.
- photodynamic therapy also called PDT, photoradiation therapy, phototherapy, or photochemotherapy
- PDT photoradiation therapy
- phototherapy phototherapy
- photochemotherapy is used for the treatment of some types of cancer. It is based on the discovery that certain chemicals known as photosensitizing agents can kill one-celled organisms when the organisms are exposed to a particular type of light.
- PDT destroys cancer cells through the use of a fixed-frequency laser light in combination with a photosensitizing agent.
- the photosensitizing agent is injected into the bloodstream and absorbed by cells all over the body. The agent remains in cancer cells for a longer time than it does in normal cells.
- the photosensitizing agent absorbs the light and produces an active form of oxygen that destroys the treated cancer cells.
- the laser light used in PDT can be directed through a fiber- optic (a very thin glass strand).
- the fiber-optic is placed close to the cancer to deliver the proper amount of light.
- the fiber-optic can be directed through a bronchoscope into the lungs for the treatment of lung cancer or through an endoscope into the esophagus for the treatment of esophageal cancer.
- An advantage of PDT is that it causes minimal damage to healthy tissue.
- PDT is mainly used to treat tumors on or just under the skin or on the lining of internal organs.
- Photodynamic therapy makes the skin and eyes sensitive to light for 6 weeks or more after treatment. Patients are advised to avoid direct sunlight and bright indoor light for at least 6 weeks. If patients must go outdoors, they need to wear protective clothing, including sunglasses. Other temporary side effects of PDT are related to the treatment of specific areas and can include coughing, trouble swallowing, abdominal pain, and painful breathing or shortness of breath.
- FDA U.S. Food and Drug Administration
- a photosensitizing agent called porfimer sodium, or Photofrin®, to relieve symptoms of esophageal cancer that is causing an obstruction and for esophageal cancer that cannot be satisfactorily treated with lasers alone.
- laser therapy is used to harness high-intensity light to destroy cancer cells.
- This technique is often used to relieve symptoms of cancer such as bleeding or obstruction, especially when the cancer cannot be cured by other treatments. It may also be used to treat cancer by shrinking or destroying tumors.
- the term "laser” stands for light amplification by stimulated emission of radiation. Ordinary light, such as that from a light bulb, has many wavelengths and spreads in all directions. Laser light, on the other hand, has a specific wavelength and is focused in a narrow beam. This type of high- intensity light contains a lot of energy. Lasers are very powerful and may be used to cut through steel or to shape diamonds.
- CO2 laser Carbon dioxide
- This type of laser can remove thin layers from the skin's surface without penetrating the deeper layers. This technique is particularly useful in treating tumors that have not spread deep into the skin and certain precancerous conditions.
- the CO2 laser is also able to cut the skin. The laser is used in this way to remove skin cancers.
- Neodymium:yttrium-aluminum-garnet (Nd:YAG) laser Light from this laser can penetrate deeper into tissue than light from the other types of lasers, and it can cause blood to clot quickly. It can be carried through optical fibers to less accessible parts of the body. This type of laser is sometimes used to treat throat cancers.
- Argon laser This laser can pass through only superficial layers of tissue and is therefore useful in dermatology and in eye surgery. It also is used with light-sensitive dyes to treat tumors in a procedure known as photodynamic therapy (PDT). Lasers have several advantages over standard surgical tools, including: Lasers are more precise than scalpels. Tissue near an incision is protected, since there is little contact with surrounding skin or other tissue.
- Lasers sterilizes the surgery site, thus reducing the risk of infection. Less operating time may be needed because the precision of the laser allows for a smaller incision. Healing time is often shortened; since laser heat seals blood vessels, there is less bleeding, swelling, or scarring. Laser surgery may be less complicated. For example, with fiber optics, laser light can be directed to parts of the body without making a large incision. More procedures may be done on an outpatient basis. Lasers can be used in two ways to treat cancer: by shrinking or destroying a tumor with heat, or by activating a chemical—known as a photosensitizing agent—that destroys cancer cells.
- a photosensitizing agent that destroys cancer cells.
- CO2 and Nd:YAG lasers are used to shrink or destroy tumors. They may be used with endoscopes, tubes that allow physicians to see into certain areas of the body, such as the bladder. The light from some lasers can be transmitted through a flexible endoscope fitted with fiber optics. This allows physicians to see and work in parts of the body that could not otherwise be reached except by surgery and therefore allows very precise aiming of the laser beam. Lasers also may be used with low-power microscopes, giving the doctor a clear view of the site being treated.
- Lasers Used with other instruments, laser systems can produce a cutting area as small as 200 microns in diameter— less than the width of a very fine thread.
- Lasers are used to treat many types of cancer.
- Laser surgery is a standard treatment for certain stages of glottis (vocal cord), cervical, skin, lung, vaginal, vulvar, and penile cancers.
- laser surgery is also used to help relieve symptoms caused by cancer (palliative care).
- lasers may be used to shrink or destroy a tumor that is blocking a patient's trachea (windpipe), making it easier to breathe. It is also sometimes used for palliation in colorectal and anal cancer.
- LITT Laser- induced interstitial thermotherapy
- hyperthermia a cancer treatment
- heat may help shrink tumors by damaging cells or depriving them of substances they need to live.
- lasers are directed to interstitial areas (areas between organs) in the body. The laser light then raises the temperature of the tumor, which damages or destroys cancer cells.
- the duration and/or dose of treatment with therapies may vary according to the particular therapeutic agent or combination thereof.
- An appropriate treatment time for a particular cancer therapeutic agent will be appreciated by the skilled artisan.
- the present invention contemplates the continued assessment of optimal treatment schedules for each cancer therapeutic agent, where the phenotype of the cancer of the subject as determined by the methods of the present invention is a factor in determining optimal treatment doses and schedules.
- any means for the introduction of a polynucleotide into mammals, human or non- human, or cells thereof may be adapted to the practice of this invention for the delivery of the various constructs of the present invention into the intended recipient.
- the DNA constructs are delivered to cells by transfection, i.e., by delivery of "naked" DNA or in a complex with a colloidal dispersion system.
- a colloidal system includes macromolecule complexes, nanocapsules,
- the preferred colloidal system of this invention is a lipid- complexed or liposome-formulated DNA.
- a plasmid containing a transgene bearing the desired DNA constructs may first be experimentally optimized for expression ⁇ e.g., inclusion of an intron in the 5' untranslated region and elimination of unnecessary sequences (Feigner, et al., Ann NY Acad Sci 126-139, 1995). Formulation of DNA, e.g.
- lipid or liposome materials may then be effected using known methods and materials and delivered to the recipient mammal. See, e.g., Canonico et al, Am J Respir Cell Mol Biol 10:24-29, 1994; Tsan et al, Am J Physiol 268; Alton et al., Nat Genet. 5: 135-142, 1993 and U.S. patent No. 5,679,647 by Carson et al.
- the targeting of liposomes can be classified based on anatomical and mechanistic factors.
- Anatomical classification is based on the level of selectivity, for example, organ- specific, cell-specific, and organelle-specific.
- Mechanistic targeting can be distinguished based upon whether it is passive or active. Passive targeting utilizes the natural tendency of liposomes to distribute to cells of the reticulo-endothelial system (RES) in organs, which contain sinusoidal capillaries.
- RES reticulo-endothelial system
- Active targeting involves alteration of the liposome by coupling the liposome to a specific ligand such as a monoclonal antibody, sugar, glycolipid, or protein, or by changing the composition or size of the liposome in order to achieve targeting to organs and cell types other than the naturally occurring sites of localization.
- a specific ligand such as a monoclonal antibody, sugar, glycolipid, or protein
- the surface of the targeted delivery system may be modified in a variety of ways.
- lipid groups can be incorporated into the lipid bilayer of the liposome in order to maintain the targeting ligand in stable association with the liposomal bilayer.
- Various linking groups can be used for joining the lipid chains to the targeting ligand. Naked DNA or DNA associated with a delivery vehicle, e.g., liposomes, can be administered to several sites in a subject (see below).
- Nucleic acids can be delivered in any desired vector. These include viral or non- viral vectors, including adenovirus vectors, adeno-associated virus vectors, retrovirus vectors, lentivirus vectors, and plasmid vectors. Exemplary types of viruses include HSV (herpes simplex virus), AAV (adeno associated virus), HIV (human immunodeficiency virus), BIV (bovine immunodeficiency virus), and MLV (murine leukemia virus). Nucleic acids can be administered in any desired format that provides sufficiently efficient delivery levels, including in virus particles, in liposomes, in nanoparticles, and complexed to polymers.
- the nucleic acids encoding a protein or nucleic acid of interest may be in a plasmid or viral vector, or other vector as is known in the art. Such vectors are well known and any can be selected for a particular application.
- the gene delivery vehicle comprises a promoter and a demethylase coding sequence.
- Preferred promoters are tissue-specific promoters and promoters which are activated by cellular proliferation, such as the thymidine kinase and thymidylate synthase promoters.
- Other preferred promoters include promoters which are activatable by infection with a virus, such as the a- and ⁇ -interferon promoters, and promoters which are activatable by a hormone, such as estrogen.
- Other promoters which can be used include the Moloney virus LTR, the CMV promoter, and the mouse albumin promoter.
- a promoter may be constitutive or inducible.
- naked polynucleotide molecules are used as gene delivery vehicles, as described in WO 90/11092 and U.S. Patent 5,580,859.
- gene delivery vehicles can be either growth factor DNA or RNA and, in certain embodiments, are linked to killed adenovirus. Curiel et al., Hum. Gene. Ther. 3 : 147-154, 1992.
- Other vehicles which can optionally be used include DNA-ligand (Wu et al., J. Biol. Chem.
- a gene delivery vehicle can optionally comprise viral sequences such as a viral origin of replication or packaging signal. These viral sequences can be selected from viruses such as astrovirus, coronavirus, orthomyxovirus, papovavirus, paramyxovirus, parvovirus, picornavirus, poxvirus, retrovirus, togavirus or adenovirus.
- the growth factor gene delivery vehicle is a recombinant retroviral vector. Recombinant retroviruses and various uses thereof have been described in numerous references including, for example, Mann et al., Cell 33 : 153, 1983, Cane and Mulligan, Proc. Nat'l. Acad. Sci.
- Herpes virus e.g., Herpes Simplex Virus (U.S. Patent No. 5,631,236 by Woo et al., issued May 20, 1997 and WO 00/08191 by Neurovex), vaccinia virus (Ridgeway (1988) Ridgeway, "Mammalian expression vectors," In: Rodriguez R L, Denhardt D T, ed.
- Vectors A survey of molecular cloning vectors and their uses.
- viruses include an alphavirus, a poxivirus, an arena virus, a vaccinia virus, a polio virus, and the like. They offer several attractive features for various mammalian cells (Friedmann (1989) Science, 244: 1275-1281;
- target DNA in the genome can be manipulated using well- known methods in the art.
- the target DNA in the genome can be manipulated by deletion, insertion, and/or mutation are retroviral insertion, artificial chromosome techniques, gene insertion, random insertion with tissue specific promoters, gene targeting, transposable elements and/or any other method for introducing foreign DNA or producing modified DNA/modified nuclear DNA.
- Other modification techniques include deleting DNA sequences from a genome and/or altering nuclear DNA sequences. Nuclear DNA sequences, for example, may be altered by site-directed mutagenesis.
- biomarker polypeptides, and fragments thereof can be administered to subjects.
- fusion proteins can be constructed and administered which have enhanced biological properties.
- biomarker polypeptides, and fragment thereof can be modified according to well-known pharmacological methods in the art (e.g., pegylation, glycosylation, oligomerization, etc.) in order to further enhance desirable biological activities, such as increased bioavailability and decreased proteolytic degradation. 4. Clincal Efficacy
- the response to a therapy relates to any response of the cancer, e.g., a tumor, to the therapy, preferably to a change in tumor mass and/or volume after initiation of neoadjuvant or adjuvant chemotherapy.
- Tumor response may be assessed in a neoadjuvant or adjuvant situation where the size of a tumor after systemic intervention can be compared to the initial size and dimensions as measured by CT, PET, mammogram, ultrasound or palpation and the cellularity of a tumor can be estimated histologically and compared to the cellularity of a tumor biopsy taken before initiation of treatment.
- Response may also be assessed by caliper measurement or pathological examination of the tumor after biopsy or surgical resection.
- Response may be recorded in a quantitative fashion like percentage change in tumor volume or cellularity or using a semi -quantitative scoring system such as residual cancer burden (Symmans et al, J. Clin. Oncol. (2007) 25:4414-4422) or Miller-Payne score (Ogston et al, (2003) Breast (Edinburgh, Scotland) 12:320-327) in a qualitative fashion like "pathological complete response” (pCR), “clinical complete remission” (cCR), “clinical partial remission” (cPR), “clinical stable disease” (cSD), “clinical progressive disease” (cPD) or other qualitative criteria.
- Assessment of tumor response may be performed early after the onset of neoadjuvant or adjuvant therapy, e.g., after a few hours, days, weeks or preferably after a few months.
- a typical endpoint for response assessment is upon termination of
- neoadjuvant chemotherapy or upon surgical removal of residual tumor cells and/or the tumor bed.
- clinical efficacy of the therapeutic treatments described herein may be determined by measuring the clinical benefit rate (CBR).
- CBR clinical benefit rate
- the clinical benefit rate is measured by determining the sum of the percentage of patients who are in complete remission (CR), the number of patients who are in partial remission (PR) and the number of patients having stable disease (SD) at a time point at least 6 months out from the end of therapy.
- the CBR for a particular anti-immune checkpoint therapeutic regimen is at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or more.
- Additional criteria for evaluating the response to anti-immune checkpoint therapies are related to "survival,” which includes all of the following: survival until mortality, also known as overall survival (wherein said mortality may be either irrespective of cause or tumor related); "recurrence-free survival” (wherein the term recurrence shall include both localized and distant recurrence); metastasis free survival; disease free survival (wherein the term disease shall include cancer and diseases associated therewith).
- the length of said survival may be calculated by reference to a defined start point (e.g., time of diagnosis or start of treatment) and end point (e.g., death, recurrence or metastasis).
- criteria for efficacy of treatment can be expanded to include response to chemotherapy, probability of survival, probability of metastasis within a given time period, and probability of tumor recurrence.
- a particular anti- cancer therapeutic regimen can be administered to a population of subjects and the outcome can be correlated to biomarker measurements that were determined prior to administration of any anti-immune checkpoint therapy.
- the outcome measurement may be pathologic response to therapy given in the neoadjuvant setting.
- outcome measures such as overall survival and disease-free survival can be monitored over a period of time for subjects following anti-immune checkpoint therapy for whom biomarker measurement values are known.
- the same doses of anti-immune checkpoint agents are administered to each subject.
- the doses administered are standard doses known in the art for anti-immune checkpoint agents. The period of time for which subjects are monitored can vary.
- Biomarker measurement threshold values that correlate to outcome of an anti-immune checkpoint therapy can be determined using methods such as those described in the Examples section.
- compositions described herein can be used in a variety of diagnostic, prognostic, and therapeutic applications.
- any method described herein such as a diagnostic method, prognostic method, therapeutic method, or combination thereof, all steps of the method can be performed by a single actor or, alternatively, by more than one actor.
- diagnosis can be performed directly by the actor providing therapeutic treatment.
- a person providing a therapeutic agent can request that a diagnostic assay be performed.
- the diagnostician and/or the therapeutic interventionist can interpret the diagnostic assay results to determine a therapeutic strategy.
- such alternative processes can apply to other assays, such as prognostic assays,
- One aspect of the present invention relates to screening assays, including non-cell based assays and xenograft animal model assays.
- the assays provide a method for identifying whether a cancer is likely to respond to PI3K/mTOR combination inhibitor therapy, such as in a human by using a xenograft animal model assay, and/or whether an agent can inhibit the growth of or kill a cancer cell that is unlikely to respond to PI3K/mTOR combination inhibitor therapy.
- the present invention relates to assays for screening test agents which bind to, or modulate the biological activity of, at least one biomarker described herein (e.g., in the tables, figures, examples, or otherwise in the specification).
- a method for identifying such an agent entails determining the ability of the agent to modulate, e.g. inhibit, the at least one biomarker described herein.
- an assay is a cell-free or cell-based assay, comprising contacting at least one biomarker described herein, with a test agent, and determining the ability of the test agent to modulate (e.g., inhibit) the enzymatic activity of the biomarker, such as by measuring direct binding of substrates or by measuring indirect parameters as described below.
- biomarker protein in a direct binding assay, can be coupled with a radioisotope or enzymatic label such that binding can be determined by detecting the labeled protein or molecule in a complex.
- the targets can be labeled with 125 1, 35 S, 14 C, or 3 H, either directly or indirectly, and the radioisotope detected by direct counting of radioemmission or by scintillation counting.
- the targets can be enzymatically labeled with, for example, horseradish peroxidase, alkaline phosphatase, or luciferase, and the enzymatic label detected by determination of conversion of an appropriate substrate to product.
- Determining the interaction between biomarker and substrate can also be accomplished using standard binding or enzymatic analysis assays.
- Binding of a test agent to a target can be accomplished in any vessel suitable for containing the reactants.
- vessels include microtiter plates, test tubes, and micro-centrifuge tubes.
- Immobilized forms of the antibodies described herein can also include antibodies bound to a solid phase like a porous, microporous (with an average pore diameter less than about one micron) or macroporous (with an average pore diameter of more than about 10 microns) material, such as a membrane, cellulose, nitrocellulose, or glass fibers; a bead, such as that made of agarose or polyacrylamide or latex; or a surface of a dish, plate, or well, such as one made of polystyrene.
- a solid phase like a porous, microporous (with an average pore diameter less than about one micron) or macroporous (with an average pore diameter of more than about 10 microns) material, such as a membrane, cellulose, nitrocellulose, or glass fibers;
- determining the ability of the agent to modulate the interaction between the biomarker and a substrate or a biomarker and its natural binding partner can be accomplished by determining the ability of the test agent to modulate the activity of a polypeptide or other product that functions downstream or upstream of its position within the signaling pathway (e.g., feedback loops).
- feedback loops are well- known in the art (see, for example, Chen and Guillemin (2009) Int. J. Tryptophan Res. 2: 1- 19).
- the present invention further pertains to novel agents identified by the above- described screening assays. Accordingly, it is within the scope of this invention to further use an agent identified as described herein, such as in an appropriate animal model.
- an agent identified as described herein can be used in an animal model to determine the efficacy, toxicity, or side effects of treatment with such an agent.
- an antibody identified as described herein can be used in an animal model to determine the mechanism of action of such an agent.
- the present invention also pertains to the field of predictive medicine in which diagnostic assays, prognostic assays, and monitoring clinical trials are used for prognostic (predictive) purposes to thereby treat an individual prophylactically. Accordingly, one aspect of the present invention relates to diagnostic assays for determining the amount and/or activity level of a biomarker described herein in the context of a biological sample (e.g., blood, serum, cells, or tissue) to thereby determine whether an individual afflicted with a cancer is likely to respond to PI3K/mTOR combination inhibitor therapy, such as in a brain metastasis.
- a biological sample e.g., blood, serum, cells, or tissue
- Such assays can be used for prognostic or predictive purpose alone, or can be coupled with a therapeutic intervention to thereby prophylactically treat an individual prior to the onset or after recurrence of a disorder characterized by or associated with biomarker polypeptide, nucleic acid expression or activity.
- biomarker polypeptide nucleic acid expression or activity.
- any method can use one or more (e.g., combinations) of biomarkers described herein, such as those in the tables, figures, examples, and otherwise described in the specification.
- Another aspect of the present invention pertains to monitoring the influence of agents (e.g., drugs, compounds, and small nucleic acid-based molecules) on the expression or activity of a biomarker described herein.
- agents e.g., drugs, compounds, and small nucleic acid-based molecules
- the methods of the present invention implement a computer program and computer system.
- a computer program can be used to perform the algorithms described herein.
- a computer system can also store and manipulate data generated by the methods of the present invention which comprises a plurality of biomarker signal changes/profiles which can be used by a computer system in implementing the methods of this invention.
- a computer system receives biomarker expression data; (ii) stores the data; and (iii) compares the data in any number of ways described herein (e.g., analysis relative to appropriate controls) to determine the state of informative biomarkers from cancerous or pre-cancerous tissue.
- a computer system (i) compares the determined expression biomarker level to a threshold value; and (ii) outputs an indication of whether said biomarker level is significantly modulated (e.g., above or below) the threshold value, or a phenotype based on said indication.
- such computer systems are also considered part of the present invention.
- Numerous types of computer systems can be used to implement the analytic methods of this invention according to knowledge possessed by a skilled artisan in the bioinformatics and/or computer arts.
- Several software components can be loaded into memory during operation of such a computer system.
- the software components can comprise both software components that are standard in the art and components that are special to the present invention (e.g., dCHIP software described in Lin et al. (2004)
- RBM radial basis machine learning algorithms
- the methods of the present invention can also be programmed or modeled in mathematical software packages that allow symbolic entry of equations and high-level specification of processing, including specific algorithms to be used, thereby freeing a user of the need to procedurally program individual equations and algorithms.
- Such packages include, e.g., Matlab from Mathworks (Natick, Mass.), Mathematica from Wolfram
- the computer comprises a database for storage of biomarker data.
- biomarker data can be accessed and used to perform comparisons of interest at a later point in time.
- biomarker expression profiles of a sample derived from the non-cancerous tissue of a subject and/or profiles generated from population-based distributions of informative loci of interest in relevant populations of the same species can be stored and later compared to that of a sample derived from the cancerous tissue of the subject or tissue suspected of being cancerous of the subject.
- the present invention provides, in part, methods, systems, and code for accurately classifying whether a biological sample is associated with a cancer that is likely to respond to PI3K/mTOR combination inhibitor therapy.
- the present invention is useful for classifying a sample (e.g., from a subject) as associated with or at risk for responding to or not responding to PI3K/mTOR combination inhibitor therapy using a statistical algorithm and/or empirical data (e.g., the amount or activity of a biomarker described herein, such as in the tables, figures, examples, and otherwise described in the specification).
- An exemplary method for detecting the amount or activity of a biomarker described herein, and thus useful for classifying whether a sample is likely or unlikely to respond to PI3K/mTOR combination inhibitor therapy involves obtaining a biological sample from a test subject and contacting the biological sample with an agent, such as a protein-binding agent like an antibody or antigen-binding fragment thereof, or a nucleic acid-binding agent like an oligonucleotide, capable of detecting the amount or activity of the biomarker in the biological sample.
- an agent such as a protein-binding agent like an antibody or antigen-binding fragment thereof, or a nucleic acid-binding agent like an oligonucleotide, capable of detecting the amount or activity of the biomarker in the biological sample.
- the statistical algorithm is a single learning statistical classifier system.
- a single learning statistical classifier system can be used to classify a sample as a based upon a prediction or probability value and the presence or level of the biomarker.
- a single learning statistical classifier system typically classifies the sample as, for example, a likely anti-immune checkpoint therapy responder or progressor sample with a sensitivity, specificity, positive predictive value, negative predictive value, and/or overall accuracy of at least about 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.
- learning statistical classifier systems include a machine learning algorithmic technique capable of adapting to complex data sets (e.g., panel of markers of interest) and making decisions based upon such data sets.
- a single learning statistical classifier system such as a classification tree (e.g., random forest) is used.
- a combination of 2, 3, 4, 5, 6, 7, 8, 9, 10, or more learning statistical classifier systems are used, preferably in tandem.
- Examples of learning statistical classifier systems include, but are not limited to, those using inductive learning (e.g.,
- decision/classification trees such as random forests, classification and regression trees (C&RT), boosted trees, etc.), Probably Approximately Correct (PAC) learning,
- connectionist learning e.g., neural networks (NN), artificial neural networks (ANN), neuro fuzzy networks (NFN), network structures, perceptrons such as multi-layer perceptrons, multi-layer feed-forward networks, applications of neural networks, Bayesian learning in belief networks, etc.
- reinforcement learning e.g., passive learning in a known
- the method of the present invention further comprises sending the sample classification results to a clinician, e.g., an oncologist.
- a clinician e.g., an oncologist.
- diagnosis of a subject is followed by administering to the individual a therapeutically effective amount of a defined treatment based upon the diagnosis.
- the methods further involve obtaining a control biological sample (e.g., biological sample from a subject who does not have a cancer or whose cancer is susceptible to PBK/mTOR combination inhibitor therapy), a biological sample from the subject during remission, or a biological sample from the subject during treatment for developing a cancer progressing despite PBK/mTOR combination inhibitor therapy.
- a control biological sample e.g., biological sample from a subject who does not have a cancer or whose cancer is susceptible to PBK/mTOR combination inhibitor therapy
- the diagnostic methods described herein can furthermore be utilized to identify subjects having or at risk of developing a cancer that is likely or unlikely to be responsive to PBK/mTOR combination inhibitor therapy.
- the assays described herein such as the preceding diagnostic assays or the following assays, can be utilized to identify a subject having or at risk of developing a disorder associated with a misregulation of the amount or activity of at least one biomarker described herein, such as in cancer.
- the prognostic assays can be utilized to identify a subject having or at risk for developing a disorder associated with a misregulation of the at least one biomarker described herein, such as in cancer.
- the prognostic assays described herein can be used to determine whether a subject can be administered an agent (e.g., an agonist, antagonist, peptidomimetic, polypeptide, peptide, nucleic acid, small molecule, or other drug candidate) to treat a disease or disorder associated with the aberrant biomarker expression or activity.
- an agent e.g., an agonist, antagonist, peptidomimetic, polypeptide, peptide, nucleic acid, small molecule, or other drug candidate
- the therapeutic compositions described herein can be used in a variety of in vitro and in vivo therapeutic applications using the formulations and/or combinations described herein.
- the therapeutic agents can be used to treat cancers determined to be responsive thereto.
- single or multiple agents that inhibit or block both PBK and mTOR can be used to treat brain metastases in subjects identified as likely responders thereto. 6.
- the present invention provides pharmaceutically acceptable compositions which comprise a therapeutically-effective amount of an agent that modulates (e.g., decreases) biomarker expression and/or activity, formulated together with one or more pharmaceutically acceptable carriers (additives) and/or diluents.
- compositions of the present invention may be specially formulated for administration in solid or liquid form, including those adapted for the following: (1) oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, boluses, powders, granules, pastes; (2) parenteral administration, for example, by subcutaneous, intramuscular or intravenous injection as, for example, a sterile solution or suspension; (3) topical application, for example, as a cream, ointment or spray applied to the skin; (4) intravaginally or intrarectally, for example, as a pessary, cream or foam; or (5) aerosol, for example, as an aqueous aerosol, liposomal preparation or solid particles containing the compound.
- oral administration for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, boluses, powders, granules, pastes
- parenteral administration for example, by subcutaneous, intramuscular or intravenous injection
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- Immunology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Oncology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Mycology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Virology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Endocrinology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The present invention relates to methods of treating brain metastases using synergistic combinations of anti-PI3K and anti-mTOR therapies. It has also been determined that blocking PI3K and mTOR provides therapeutic benefit for treating brain metastases.
Description
METHODS FOR TREATING BRAIN METASTASES USING COMBINATIONS OF ANTI-PI3K AND ANTI-mTOR AGENTS
Cross-Reference to Related Applications
This application claims the benefit of U.S. Provisional Application No. 62/287,211, filed on 26 January 2016; the entire contents of said application are incorporated herein in their entirety by this reference.
Statement of Rights
This invention was made with government support under Grant R01 CA187918,
R01 CA172461-01, 1K08 NS087118, P50 CA165962, P01 CA142536, and 1P50
CA168504 awarded by the National Institutes of Health. The U.S. government has certain rights in the invention. This statement is included solely to comply with 37 C.F.R. § 401.14(a)(f)(4) and should not be taken as an assertion or admission that the application discloses and/or claims only one invention.
Background of the Invention
Although great progress has been made in recent decades to both suppress hyperproliferative growth of and eliminate primary cancer cells, it is known that a large percentage of cancer patients will develop metastatic cancer. For example, between 30- 50% of patients with HER2-positive breast cancer will develop brain metastases during their illness (Ramakrishna et al. (2014) J. Clin. Oncol. 32:2100-2108). Therapeutically intervening in brain metastases in particular has been a particular challenge for oncologists since metastatic tumors are generally resistant to many chemotherapy agents and surgical resection options that preserve brain function are limited (Carden et al. (2008) Lancet Oncol. 9: 1012-1017). Accordingly, a great need exists in the art to identify therapeutic interventions to treat brain metastases.
Summary of the Invention
The present invention is based, at least in part, on the discovery that inhibiting or blocking both PI3K and mTOR results in a synergistic therapeutic benefit for treating brain metastases that is unexpected given the lack of such benefit observed for inhibiting or blocking other points of the PI3K-mTOR signaling pathway either alone or in combination. It has also been determined herein that brain metastases having an ultra-hypermutation
phenotype characterized by an overall enrichment of genomic mutations and particularly in loss-of-function mutations within DNA repair genes are less responsive or non-responsive to the combination of PI3K and mTOR inhibition.
In one aspect, a method of treating a subject afflicted with a brain metastasis from an extracranial cancer comprising administering to the subject a therapeutically effective amount of at least one agent that inhibits or blocks both PI3K and mTOR, is provided.
Numerous embodiments are further provided that can be applied to any aspect of the present invention and/or combined with any other embodiment described herein. For example, in one embodiment, the at least one agent is a small molecule inhibitor for both PI3K and mTOR. In another embodiment, the at least one agent is a synergistic
combination of agents comprising a first agent that selectively inhibits or blocks PI3K and a second agent that selectively inhibits or blocks mTOR (e.g., said first agent and said second agent comprise a small molecule that inhibits or blocks PI3K and/or mTOR). In still another embodiment, the at least one agent comprises an RNA interfering agent which inhibits expression of PI3K and/or mTOR (e.g., wherein the RNA interfering agent is a small interfering RNA (siRNA), small hairpin RNA (shRNA), or a microRNA (miRNA)). In yet another embodiment, the at least one agent comprises an antisense oligonucleotide complementary to PI3K and/or mTOR. In another embodiment, the at least one agent comprises a peptide or peptidomimetic that inhibits or blocks PI3K and/or mTOR. In still another embodiment, the at least one agent comprises an aptamer that inhibits or blocks PI3K and/or mTOR. In yet another embodiment, the at least one agent is an intrabody, or an antigen binding fragment thereof, which specifically binds to PI3K protein and/or mTOR protein.
In another embodiment, the intrabody, or antigen binding fragment thereof, is murine, chimeric, humanized, composite, or human. In still another embodiment, the intrabody, or antigen binding fragment thereof, is detectably labeled, comprises an effector domain, comprises an Fc domain, and/or is selected from the group consisting of Fv, Fav, F(ab')2), Fab', dsFv, scFv, sc(Fv)2, and diabodies fragments. In yet another embodiment, the intrabody, or antigen binding fragment thereof, is conjugated to a cytotoxic agent. In another ermbodiment, the cytotoxic agent is selected from the group consisting of a chemotherapeutic agent, a biologic agent, a toxin, and a radioactive isotope.
In another embodiment, the PI3K is a class I PI3K. For example, in one
embodiment, the class I PI3K is selected from the group consisting of PIK3CA, PIK3CB,
PIK3CG, and PIK3CD. In another embodiment, the class I PI3K is PIK3CA, PIK3CB, PIK3CG, and PIK3CD. In still another embodiment, the mTOR is inhibited or blocked within both an mTORCl complex and an mTORC2 complex. In yet another embodiment, the at least one agent comprises 5-(2,6-dimorpholin-4-ylpyrimidin-4-yl)-4- (trifluoromethyl)pyridin-2-amine (BKM120) and dihydroxy-12-[(2R)-l-[(l S,3R,4R)-4-(2- hydroxyethoxy)-3 -methoxycyclohexyl]propan-2-yl]- 19,30-dimethoxy- 15,17,21 ,23,29,35- hexamethyl-1 l,36-dioxa-4-azatricyclo[30.3.1.0 hexatriaconta-16,24,26,28-tetraene- 2,3,10, 14,20-pentone (RAD001). In another embodiment, the at least one agent inhibits phosphorylation of S6RP and/or 4EBP1. In still another embodiment, the at least one agent reduces the number of proliferating cells in the brain metastasis and/or increases the number of apoptotic cells in the brain metastasis. In yet another embodiment, the at least one agent reduces the number of cells expressing KI67 in the brain metastasis and/or increases the number of cells expressing cleaved caspase-3 in the brain metastasis. In another embodiment, the at least one agent is administered in a pharmaceutically acceptable formulation. In still another embodiment, the method further comprises administering to the subject a therapeutic agent or regimen for treating the brain metastasis.
In other embodiment, the brain metastasis and/or extracranial cancer has significantly increased expression of at least 1 AKT-mTOR-dependent gene relative to a cancer whose proliferating cells are not reduced or whose apoptotic cells are not increased with a combination treatment of BKM120 and RAD001, wherein the AKT-mTOR- dependent gene is selected from the group consisting of AKTl, BIK, BSG, DDRl, CDC34, CLDN3, CYB561, GPX4, HNRPAB, LASP1, MMP15, MVK, EDD8, EU1, PCTK1, POR, PRKCD, PVRL2, SPINT1, UBE2M, TMED10, DUSP10, CLSTN1, PMPCA, BRMS1, TJP3, ARHGEF16, ADIPORl, SLC37A1, KCTD5, TOLLIP, SYNJ2BP, R F126, and COROIB. In another embodiment, the brain metastasis and/or extracranial cancer has an increased expression of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, or 34 AKT-mTOR- dependent genes. In still another embodiment, the brain metastasis and/or extracranial cancer has a mutation in at least 1 DNA repair protein gene that encodes a non-functrional DNA repair protein, or express at least 1 DNA repair protein that is nonfunctional. In yet another embodiment, the at least 1 DNA repair protein gene or protein is selected from the group consisting of DNA repair protein genes or proteins in Table 2, APEXl, ATM, ATR, BRCA1, BRCA2, BRIP1, ERCC2, ERCC4, ERCC6, KLC3, LIG1, LIG3, MPG, MSH3,
MSH5, MSH6, EIL3, PRL3, NTHL1, PARP2, PGBD3, PRKDC, PMS2, POLL, PRKDC, RAD18, RAD23B, RAD54L, RPA1, SLK, TMEM55B, TOP3B, XRCC3, and XRCC6BP1. In another embodiment, the brain metastasis and/or extracranial cancer has about 20 synonymous or non-synonymous somatic mutations or fewer per megabase of genomic DNA. In still another embodiment, the brain metastasis and/or extracranial cancer has about 10 synonymous or non-synonymous somatic mutations or fewer per megabase of genomic DNA. In yet another embodiment, the extracranial cancer is not a central nervous system (CNS) or a peripheral nervous system (PNS) cancer. In another embodiment, the extracranial cancer is selected from the group consisting of breast, lung, colorectal carcinoma, melanoma, kidney, bladder, ovarian, and urethral cancers. In still another embodiment, the extracranial cancer is breast cancer, such as a HER2-positive breast cancer. In yet another embodiment, the subject is an animal model of a brain metastasis from an extracranial cancer, such as an orthotopic xenograft animal model of a human- derived brain metastasis from a human extracranial cancer and/or a mouse model. In another embodiment, the subject is a mammal, such as a mouse or a human. In still another embodiment, the mammal is a human.
Brief Description of the Drawings
Figure 1 includes 4 panels, identified as panels A, B, C, and D, which show the establishment of orthotopic HER2 -positive (HER2+) breast cancer brain metastases
(BCBM) patient-derived xenografts (PDXs). Panel A shows a schematic diagram depicting the process of generating PDX BCBM models for use in pre-clinical studies. Panel B shows the results of histologic and immunophenotypic analyses on a patient surgical biopsy and corresponding PDXs of HER2, hormone receptors, epithelial and glial markers, and PTEN expression profiles; scale bar = 25 μπι. Panel C shows a summary of the established HER2+ BCBM PDX models. Panel D shows the compiled result of PTEN
immunohistochemistry performed on 27 human HER2+ BCBM samples. A score of 0 indicates no staining in > 90% of tumor cells, a score of 1+ indicates weak staining in > 75% of tumor cells, and a score of 2+ indicates strong staining in > 75% of tumor cells.
Figure 2 includes 8 panels, identified as panels A, B, C, D, E, F, G, and H, which show the selective response of HER2+ BCBM PDX DF-BM355 to targeted therapies. Panel A shows the results of bioluminescence imaging analyses of mice bearing DF- BM355 tumors at week 0 and week 5 after treatment with vehicle control, lapatinib (LAP),
BKM120, or a combination of lapatinib and BKM120 (LAP+BKM120). Panel B shows the results of Kaplan-Meier survival analyses of mice bearing DF-BM355 treated with vehicle control, BKM120 (PO, 30 mg/kg, QD), lapatinib (PO, 100 mg/kg), and the combination of lapatinib and BKM120. Panel C shows Kaplan-Meier survival analyses of mice bearing DF-BM355 treated with vehicle control, RAD001 (PO 7.5 mg/kg, QD), or the combination of lapatinib and RAD. Panel D shows the results of bioluminescence imaging analyses of mice bearing DF-BM355 before (week -1, week 0) and after (week 1, week 2) treatment with the indicated compounds. Panel E shows the results of MRI of DF-BM355-bearing mice treated with vehicle control or a combination of RAD001 and BKM120. Panel F shows the results of quantification of the regions of interest (ROI) in each animal determined at each indicated imaging time point. Panel G shows Kaplan-Meier survival curves of DF-BM355-bearing mice treated with a combination of BKM120 and RAD001 compared to vehicle control. Panel H shows the results of IHC analyses of p4EBPl, pS6RP, Ki67, and cleaved caspase-3 on DF-BM355 tumors treated for 4 days with vehicle, BKM120 (PO 30 mg/kg, QD), RAD001 (PO 7.5 mg/kg, QD), or a combination of
BKM120 and RAD001; scale bars = 25 μπι. Bar graphs represent the mean ± SEM of quantification of Ki67 and cleaved caspase-3 in DF-BM355 tumors; * p < 0.05; **p < 0.01.
Figure 3 includes 3 panels, identified as panels A, B, and C, which show the in vivo effects of monotherapy with the PI3K inhibitor, BKM120, on DF-BM355. Panel A shows the results of IHC analyses of Ki67 after 4 days of treatment with BKM120 versus treatment with a control. Tumors were collected two hours after the last dosing, fixed, and subjected to IHC analysis; scale bars = 25 μπι. Bar graphs represent the mean ± SEM of quantification of Ki67 positive cells; **p < 0.01. Panel B shows the results of Western blot analyses of lysates from vehicle-treated or BKM120-treated DF-BM355 in vivo. Bar graphs represent the mean ± SD of Western blot quantification of pAKTS473/AKT; n = 4; **p < 0.01; Student's t-test. Panel C shows the results of IHC analyses of pS6RP and p4EBPl on DF-BM355 tumors with vehicle, BKM120 (PO 30 mg/kg, QD), LAP (PO 100 mg/kg, QD), or a combination of BKM120 and LAP (left panel: scale bar = 25 μπι; right panel: scale bar = 100 μπι).
Figure 4 includes 4 panels, identified as panels A, B, C, and D, which show that the combination of BKM120/MEK162 has little effect on DF-BM354 tumor growth. Panel A shows the results of Western blot analysis of PI3K/mTOR/MAPK signaling in DF-BM354 compared to DF-BM355. Panel B shows the results of bioluminescence imaging analysis
of DF-BM354 before (week 0) and after (week4) treatment with the indicated compounds. Panel C shows the results of Kaplan-Meier survival analysis of mice treated with BKM120 (PO, 30 mg/kg, QD), MEK162 (PO, 15 mg/kg), BKM120+MEK162, or vehicle control. Panel D shows the results of Western blot analysis of lysates from vehicle-treated,
BKM120-treated, MEK162-treated, or BKM120/MEK162-treated DF-BM354 in vivo.
Figure 5 shows that the combination of BKM120/JQ1 has little effect on DF-
BM355
tumor growth. Mice bearing DF-BM355 tumors were treated with JQ1 (IP, 100 mg/kg, QD) (large squares), JQ1+BKM120 (triangles), or vehicle control (small squares). The tumor burden is represented by quantification of bioluminescence induction for the brain region of interest (ROI).
Figure 6 includes 8 panels, identified as panels A, B, C, D, E, F, G, and H, which show the differential responses of FIER2+ BCBM PDXs to the combination treatment of BKM120 and RAD001. Panel A shows the results of bioluminescence imaging analyses of DF-BM354 before (wk -2 and wk 0) and after (wk 2 and wk 4) treatment with a
combination of BKM120 and RAD001 (BKM120, PO 30 mg/kg, QD; RADOOl, PO 7.5mg/kg, QD). Panel B shows Kaplan-Meier survival curves of mice bearing DF-BM354 treated with vehicle control, BKM120 (PO 30 mg/kg, QD), RADOOl (PO 7.5 mg/kg, QD), or the combination of BKM120 and RADOOl . Panel C shows the results of IHC analyses of DF-BM354 tumors harvested from tumor bearing mice treated for 4 days with vehicle or the combination of BKM120 and RADOOl with the indicated antibodies; scale bars = 25 μπι. Quantification of Ki67 and cleaved caspase-3 in DF-BM354 tumors is shown; **p < 0.01. Panel D shows Kaplan-Meier survival curves of mice bearing DF-BM463 treated with vehicle control or the combination of BKM120 and RADOOl (BKM120, PO 30 mg/kg, QD; RADOOl, PO 7.5mg/kg, QD). Panel E shows the results of IHC analyses of DF-BM463 tumors harvested from tumor bearing mice treated for 4 days with vehicle or the combination of BKM120 and RADOOl with the indicated antibodies; scale bars = 50 μπι. Panel F shows Kaplan-Meier survival curves of DF-BM590 treated with vehicle control or the combination of BKM120 and RADOOl (BKM120, PO 30 mg/kg, QD;
RADOOl, PO 7.5mg/kg, QD). Panel G shows the results of IHC analyses of DF-BM590 tumors harvested from tumor bearing mice treated 4 days with vehicle or the combination of BKM120 and RADOOl with the indicated antibodies; scale bars = 100 μιη. Panel H
shows the results of IHC analyses of DF-BM507 tumors treated with vehicle or the combination of BKM120 and RAD001 with the indicated antibodies; scale bars = 100 μιη.
Figure 7 shows the in vivo effect of the combination of BKM120 and RAD001 on DF-BM463. Results from IHC analyses with the indicated antibodies after 4 days of treatment with BKM120 versus a control are shown. Tumors were collected two hours after the last dosing, and were fixed and subjected to IHC analysis; scale bar = 25 μπι. The bar graphs represent the mean ± SEM of quantification of Ki67 and cleaved caspase-3 positive; **p < 0.01.
Figure 8 includes 5 panels, identified as panels A, B, C, D, and E, which show the results of next-generation sequencing analyses identifying associations of genetic and genomic alternations with therapeutic responses in HER2-positive BCBMs. Panle A shows the results of transcriptome analyses revealing an increased expression of AKT/mTOR- dependent signature genes in sensitive models as compared to resistant ones. Boxplots correspond to the first and third quartiles (the 25th and 75th percentiles) with upper/lower whisker extending to the highest value that is within 1.5 times the interquartile range. Panel B shows genome-wide DNA CNVs in HER2+ BCBM PDXs analyzed by WES. Panel C shows the number of somatic mutations in HER2+ BCBM PDXs identified by WES. Panel D shows the results of mutational profiling of a panel of DNA repair genes. Panel E shows a schematic of differential responses of HER2+ BCBM PDXs to combined inhibition of PI3K and mTOR.
Figure 9 includes 2 panels, identified as panels A and B, which show conservation of genetic alternations after the transfer of tissue from patient to mouse. Panel A shows patterns of genome-wide DNA copy number variations in DFBM463, DF-BM507 and DF- BM590 PDXs and their matched patient tumors. Panel B shows mutational profiling of a panel of DNA repair genes in DF-BM463, DF-BM507, and DF-BM590 PDXs and their matched patient tumors.
Figure 10 shows a list of mutations in DNA repair genes found in DF-BM507 and DF-BM590.
Figure 11 shows a list of mutations in DNA repair genes found in patient brain metastatic tumors of DF-BM507 and DF-BM590.
Figure 12 shows the treatment histories of HER2+ BCBM patients who contributed specimesnt ot he derivation of PDXs.
Figure 13 shows the results of bioluminescence imaging of DF-BM354 before (day -14, day 0) and after (day 9) treatment with G E-317 (PO 40 mg/kg, QD).
Detailed Description of the Invention
It has been determined herein based on orthotopic patient-derived xenograft (PDX) models that brain metastases, such as HER2 -positive breast cancer brain metastases (BCBM), do not therapeutically respond to a number of expected rational combinations of targeted therapeutics, but instead, therapeutically respond to an unexpected combination of PI3K and mTOR inhibition with durable regression in tumor sizes. For example, HER2- positive breast cancer patients are usually treated with HER2-directed therapies (e.g., lapatinib, trastuzumab, pertuzumab, and the like) in combination with chemotherapy or endocrine therapy. However, lapatinib, MEK inhibitors, BET bromodomain protein inhibitors, and other combinations of rational therapies were ineffective. In addition, it was determined that brain metastases having an ultra-hypermutation phenotype characterized by an overall enrichment of genomic mutations and particularly in loss-of-function mutations within DNA repair genes are less responsive or non-responsive to the combination of PI3K and mTOR inhibition. Accordingly, the present invention relates, in part, to methods for treating brain metastases with a combination of PI3K and mTOR inhibitors. In another aspect, the present invention provides methods of stratifying patients and predicting response of a brain metastasis to treatment with a combination of PI3K and mTOR inhibitors based upon a determination and analysis of biomarkers described herein, such as overall enrichment of genomic mutations and particularly in loss-of-function mutations within DNA repair genes. I. Definitions
The articles "a" and "an" are used herein to refer to one or to more than one (i.e. to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.
The term "altered amount" or "altered level" refers to increased or decreased copy number (e.g., germline and/or somatic) of a biomarker nucleic acid, e.g., increased or decreased expression level in a cancer sample, as compared to the expression level or copy number of the biomarker nucleic acid in a control sample. The term "altered amount" of a biomarker also includes an increased or decreased protein level of a biomarker protein in a sample, e.g., a cancer sample, as compared to the corresponding protein level in a normal,
control sample. Furthermore, an altered amount of a biomarker protein may be determined by detecting posttranslational modification such as methylation status of the marker, which may affect the expression or activity of the biomarker protein.
The amount of a biomarker in a subject is "significantly" higher or lower than the normal amount of the biomarker, if the amount of the biomarker is greater or less, respectively, than the normal level by an amount greater than the standard error of the assay employed to assess amount, and preferably at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 300%, 350%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or than that amount. Alternately, the amount of the biomarker in the subject can be considered "significantly" higher or lower than the normal amount if the amount is at least about two, and preferably at least about three, four, or five times, higher or lower, respectively, than the normal amount of the biomarker. Such "significance" can also be applied to any other measured parameter described herein, such as for expression, inhibition, cytotoxicity, cell growth, and the like.
The term "altered level of expression" of a biomarker refers to an expression level or copy number of the biomarker in a test sample, e.g., a sample derived from a patient suffering from cancer, that is greater or less than the standard error of the assay employed to assess expression or copy number, and is preferably at least twice, and more preferably three, four, five or ten or more times the expression level or copy number of the biomarker in a control sample (e.g., sample from a healthy subjects not having the associated disease) and preferably, the average expression level or copy number of the biomarker in several control samples. The altered level of expression is greater or less than the standard error of the assay employed to assess expression or copy number, and is preferably at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 300%, 350%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or more times the expression level or copy number of the biomarker in a control sample (e.g., sample from a healthy subjects not having the associated disease) and preferably, the average expression level or copy number of the biomarker in several control samples. In some embodiments, the level of the biomarker refers to the level of the biomarker itself, the level of a modified biomarker (e.g., phosphorylated biomarker), or to the level of a biomarker relative to another measured variable, such as a control (e.g., phosphorylated biomarker relative to an unphosphorylated biomarker).
The term "altered activity" of a biomarker refers to an activity of the biomarker which is increased or decreased in a disease state, e.g., in a cancer sample, as compared to the activity of the biomarker in a normal, control sample. Altered activity of the biomarker may be the result of, for example, altered expression of the biomarker, altered protein level of the biomarker, altered structure of the biomarker, or, e.g., an altered interaction with other proteins involved in the same or different pathway as the biomarker or altered interaction with transcriptional activators or inhibitors.
The term "altered structure" of a biomarker refers to the presence of mutations or allelic variants within a biomarker nucleic acid or protein, e.g., mutations which affect expression or activity of the biomarker nucleic acid or protein, as compared to the normal or wild-type gene or protein. For example, mutations include, but are not limited to substitutions, deletions, or addition mutations. Mutations may be present in the coding or non-coding region of the biomarker nucleic acid.
Unless otherwise specified here within, the terms "antibody" and "antibodies" broadly encompass naturally-occurring forms of antibodies (e.g. IgG, IgA, IgM, IgE) and recombinant antibodies such as single-chain antibodies, chimeric and humanized antibodies and multi-specific antibodies, as well as fragments and derivatives of all of the foregoing, which fragments and derivatives have at least an antigenic binding site. Antibody derivatives may comprise a protein or chemical moiety conjugated to an antibody.
The term "antibody" as used herein also includes an "antigen-binding portion" of an antibody (or simply "antibody portion"). The term "antigen-binding portion", as used herein, refers to one or more fragments of an antibody that retain the ability to specifically bind to an antigen (e.g., a biomarker polypeptide or fragment thereof). It has been shown that the antigen-binding function of an antibody can be performed by fragments of a full- length antibody. Examples of binding fragments encompassed within the term "antigen- binding portion" of an antibody include (i) a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CHI domains; (ii) a F(ab')2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a Fd fragment consisting of the VH and CHI domains; (iv) a Fv fragment consisting of the VL and VH domains of a single arm of an antibody, (v) a dAb fragment (Ward et al, (1989) Nature 341 :544-546), which consists of a VH domain; and (vi) an isolated complementarity determining region (CDR). Furthermore, although the two domains of the Fv fragment, VL and VH, are coded for by separate genes, they can be joined, using
recombinant methods, by a synthetic linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent polypeptides (known as single chain Fv (scFv); see e.g., Bird et al. (1988) Science 242:423-426; and Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85:5879-5883; and Osbourn et al. 1998, Nature
Biotechnology 16: 778). Such single chain antibodies are also intended to be encompassed within the term "antigen-binding portion" of an antibody. Any VH and VL sequences of specific scFv can be linked to human immunoglobulin constant region cDNA or genomic sequences, in order to generate expression vectors encoding complete IgG polypeptides or other isotypes. VH and VL can also be used in the generation of Fab, Fv or other fragments of immunoglobulins using either protein chemistry or recombinant DNA technology. Other forms of single chain antibodies, such as diabodies are also encompassed. Diabodies are bivalent, bispecific antibodies in which VH and VL domains are expressed on a single polypeptide chain, but using a linker that is too short to allow for pairing between the two domains on the same chain, thereby forcing the domains to pair with complementary domains of another chain and creating two antigen binding sites (see e.g., Holliger, P., et al. (1993) Proc. Natl. Acad. Sci. USA 90:6444-6448; Poljak, R. J., et al. (1994) Structure 2: 1121-1123).
Still further, an antibody or antigen-binding portion thereof may be part of larger immunoadhesion polypeptides, formed by covalent or noncovalent association of the antibody or antibody portion with one or more other proteins or peptides. Examples of such immunoadhesion polypeptides include use of the streptavidin core region to make a tetrameric scFv polypeptide (Kipriyanov, S.M., et al. (1995) Human Antibodies and Hybridomas 6:93-101) and use of a cysteine residue, biomarker peptide and a C-terminal polyhistidine tag to make bivalent and biotinylated scFv polypeptides (Kipriyanov, S.M., et al. (1994) Mol. Immunol. 31 : 1047-1058). Antibody portions, such as Fab and F(ab')2 fragments, can be prepared from whole antibodies using conventional techniques, such as papain or pepsin digestion, respectively, of whole antibodies. Moreover, antibodies, antibody portions and immunoadhesion polypeptides can be obtained using standard recombinant DNA techniques, as described herein.
By contrast, antigen-binding portions can be adapted to be expressed within cells as
"intracellular antibodies." (Chen et al. (1994) Human Gene Ther. 5:595-601). Methods are well-known in the art for adapting antibodies to target (e.g., inhibit) intracellular moieties, such as the use of single-chain antibodies (scFvs), modification of immunoglobulin VL
domains for hyperstability, modification of antibodies to resist the reducing intracellular environment, generating fusion proteins that increase intracellular stability and/or modulate intracellular localization, and the like. Intracellular antibodies can also be introduced and expressed in one or more cells, tissues or organs of a multicellular organism, for example for prophylactic and/or therapeutic purposes (e.g., as a gene therapy) (see, at least PCT Pubis. WO 08/020079, WO 94/02610, WO 95/22618, and WO 03/014960; U.S. Pat. No. 7,004,940; Cattaneo and Biocca (1997) Intracellular Antibodies: Development and
Applications (Landes and Springer- Verlag pubis.); Kontermann (2004) Methods 34: 163- 170; Cohen et al. (1998) Oncogene 17:2445-2456; Auf der Maur et al. (2001) FEBS Lett. 508:407-412; Shaki-Loewenstein et al. (2005) J. Immunol. Meth. 303 : 19-39).
Antibodies may be polyclonal or monoclonal; xenogeneic, allogeneic, or syngeneic; or modified forms thereof (e.g. humanized, chimeric, etc.). Antibodies may also be fully human. Preferably, antibodies of the present invention bind specifically or substantially specifically to a biomarker polypeptide or fragment thereof. The terms "monoclonal antibodies" and "monoclonal antibody composition", as used herein, refer to a population of antibody polypeptides that contain only one species of an antigen binding site capable of immunoreacting with a particular epitope of an antigen, whereas the term "polyclonal antibodies" and "polyclonal antibody composition" refer to a population of antibody polypeptides that contain multiple species of antigen binding sites capable of interacting with a particular antigen. A monoclonal antibody composition typically displays a single binding affinity for a particular antigen with which it immunoreacts.
Antibodies may also be "humanized", which is intended to include antibodies made by a non-human cell having variable and constant regions which have been altered to more closely resemble antibodies that would be made by a human cell. For example, by altering the non-human antibody amino acid sequence to incorporate amino acids found in human germline immunoglobulin sequences. The humanized antibodies of the present invention may include amino acid residues not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo), for example in the CDRs. The term "humanized antibody", as used herein, also includes antibodies in which CDR sequences derived from the germline of another mammalian species, such as a mouse, have been grafted onto human framework sequences.
The term "assigned score" refers to the numerical value designated for each of the biomarkers after being measured in a patient sample. The assigned score correlates to the absence, presence or inferred amount of the biomarker in the sample. The assigned score can be generated manually (e.g., by visual inspection) or with the aid of instrumentation for image acquisition and analysis. In certain embodiments, the assigned score is determined by a qualitative assessment, for example, detection of a fluorescent readout on a graded scale, or quantitative assessment. In one embodiment, an "aggregate score," which refers to the combination of assigned scores from a plurality of measured biomarkers, is determined. In one embodiment the aggregate score is a summation of assigned scores. In another embodiment, combination of assigned scores involves performing mathematical operations on the assigned scores before combining them into an aggregate score. In certain, embodiments, the aggregate score is also referred to herein as the "predictive score."
The term "biomarker" refers to a measurable entity of the present invention that has been determined to be predictive of PI3K and mTOR combinatorial inhibitor therapy effects on a cancer. Biomarkers can include, without limitation, nucleic acids and proteins, including those shown in the Tables, the Examples, the Figures, and otherwise described herein. As described herein, any relevant characteristic of a biomarker can be used, such as the copy number, amount, activity, location, modification (e.g., phosphorylation), and the like.
A "blocking" antibody or an antibody "antagonist" is one which inhibits or reduces at least one biological activity of the antigen(s) it binds. In certain embodiments, the blocking antibodies or antagonist antibodies or fragments thereof described herein substantially or completely inhibit a given biological activity of the antigen(s).
The "blood-brain barrier" or "BBB" refers to the physiological barrier between the peripheral circulation and the brain and spinal cord (i.e., the CNS) which is formed by tight junctions within the brain capillary endothelial plasma membranes, creating a tight barrier that restricts the transport of molecules into the brain, even very small molecules such as urea (60 Daltons). The blood-brain barrier within the brain, the blood-spinal cord barrier within the spinal cord, and the blood-retinal barrier within the retina are contiguous capillary barriers within the CNS, and are herein collectively referred to as the blood-brain barrier or BBB. The BBB also encompasses the blood-CSF barrier (i.e., choroid plexus) where the barrier is comprised of ependymal cells rather than capillary endothelial cells. Methods for modifying therapeutic agents and for transporting same across the blood-brain
barrier are well-known in the art (see, for example, PCT Pubis. WO 2004/060403, WO 2000/074658, WO 2009/0079790; U.S. Pat. Pubis. US 2013/0177499 and US
2010/0261647; and U.S. Pat. Nos. 5,124, 146 and 6,419,949).
The term "body fluid" refers to fluids that are excreted or secreted from the body as well as fluids that are normally not (e.g. amniotic fluid, aqueous humor, bile, blood and blood plasma, cerebrospinal fluid, cerumen and earwax, cowper's fluid or pre-ejaculatory fluid, chyle, chyme, stool, female ejaculate, interstitial fluid, intracellular fluid, lymph, menses, breast milk, mucus, pleural fluid, pus, saliva, sebum, semen, serum, sweat, synovial fluid, tears, urine, vaginal lubrication, vitreous humor, vomit).
The terms "cancer" or "tumor" or "hyperproliferative" refer to the presence of cells possessing characteristics typical of cancer-causing cells, such as uncontrolled proliferation, immortality, metastatic potential, rapid growth and proliferation rate, and certain
characteristic morphological features. Unless otherwise stated, the terms include metaplasias. In some embodiments, such cells exhibit such characteristics in part or in full due to the expression and activity of the PI3K-mTOR signaling pathway. Cancer cells are often in the form of a tumor, but such cells may exist alone within an animal, or may be a non-tumorigenic cancer cell, such as a leukemia cell. As used herein, the term "cancer" includes premalignant as well as malignant cancers. Cancers include, but are not limited to, B cell cancer, e.g., multiple myeloma, Waldenstrom's macroglobulinemia, the heavy chain diseases, such as, for example, alpha chain disease, gamma chain disease, and mu chain disease, benign monoclonal gammopathy, and immunocytic amyloidosis, melanomas, breast cancer, lung cancer, bronchus cancer, colorectal cancer, prostate cancer, pancreatic cancer, stomach cancer, ovarian cancer, urinary bladder cancer, brain or central nervous system cancer, peripheral nervous system cancer, esophageal cancer, cervical cancer, uterine or endometrial cancer, cancer of the oral cavity or pharynx, liver cancer, kidney cancer, testicular cancer, biliary tract cancer, small bowel or appendix cancer, salivary gland cancer, thyroid gland cancer, adrenal gland cancer, osteosarcoma, chondrosarcoma, cancer of hematologic tissues, and the like. Other non-limiting examples of types of cancers applicable to the methods encompassed by the present invention include human sarcomas and carcinomas, e.g., fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's tumor,
leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, colorectal cancer, pancreatic
cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, liver cancer, choriocarcinoma, seminoma, embryonal carcinoma, Wilms' tumor, cervical cancer, bone cancer, brain tumor, testicular cancer, lung carcinoma, small cell lung carcinoma, bladder carcinoma, epithelial carcinoma, glioma, astrocytoma, medulloblastoma,
craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, melanoma, neuroblastoma, retinoblastoma; leukemias, e.g., acute lymphocytic leukemia and acute myelocytic leukemia (myeloblastic,
promyelocytic, myelomonocytic, monocytic and erythroleukemia); chronic leukemia (chronic myelocytic (granulocytic) leukemia and chronic lymphocytic leukemia); and polycythemia vera, lymphoma (Hodgkin's disease and non-Hodgkin's disease), multiple myeloma, Waldenstrom's macroglobulinemia, and heavy chain disease. In some embodiments, cancers are epithlelial in nature and include but are not limited to, bladder cancer, breast cancer, cervical cancer, colon cancer, gynecologic cancers, renal cancer, laryngeal cancer, lung cancer, oral cancer, head and neck cancer, ovarian cancer, pancreatic cancer, prostate cancer, or skin cancer. In other embodiments, the cancer is breast cancer, prostate cancer, lung cancer, or colon cancer. In still other embodiments, the epithelial cancer is non-small-cell lung cancer, nonpapillary renal cell carcinoma, cervical carcinoma, ovarian carcinoma (e.g., serous ovarian carcinoma), or breast carcinoma. The epithelial cancers may be characterized in various other ways including, but not limited to, serous, endometrioid, mucinous, clear cell, Brenner, or undifferentiated.
In certain embodiments, the cancer encompasses a brain metastasis of an extra- cranial cancer. The term refers to cancers originating outside of the brain, which metastasizes before, during, or after progression in the extracranial location to the brain. The treatments for brain metastasis are primarily whole brain and focused radiotherapy, with surgical resection of tumors in a minority of cases. Most chemotherapy regimens involve 2-3 agents such as cisplatin, cyclophosphamide, etoposide, teniposide, mitomycin, irinotecan, vinorelbine, etoposide, ifosfamide, temozolomide and fluorouracil (5-FU). These are administered in combination with radiotherapy. The effect of these
chemotherapies on prolonging survival is generally less than a year (see U.S. Pat. Publ. 2015/03521133).
The extracranial cancer can have its primary origination from within the central nervous system (CNS), peripheral nervous system (PNS), or outside the nervous system. In addition, the extracranial cancer can refer to both the primary and a metastatic cancer thereof, the primary cancer alone, or the metastatic cancer thereof alone. Cancer cells forming brain metastases commonly originate from lung, breast, colorectal carcinoma, melanoma, kidney, bladder, and urethral cancers (U.S. Pat. Publ. 2015/0314010). The metastasized primary cancer can exist in the brain in a number of forms. It can be a brain tumor surrounded by and infiltrated with GFAP-positive astrocytes (Yoshimine et al.
(1985) J. Neurosurg. 62:414-418) and are not derived from glia {e.g., not glioblastomas). It can be a micrometastatic tumor, wherein the tumor is too small to be visualized by radiological means. It can be a visible metastatic tumor, wherein the tumor is large enough to be discernable by clinical radiological means, such as magnetic resonance imaging, computerized tomography, or positron emission tomography. The metastatic lesions are distinct from metastatic cancer cells in the systemic circulation and single cancer cells extravasating into brain tissue or quiescently residing therein (see generally Joyce and Pollard (2009) Nat. Rev. Cancer 9:239-252). The brain metastases can be progressive or stable, as assessed by a method, such as MRI, CT, proliferation marker expression, and the like.
The term "micrometastasis" as used herein is preferably defined as a group of confluent cancer cells measuring from greater than 0.2 mm and/or having greater than 200 cells to 2 mm in maximum width. More preferably "micrometastasis" is defined as a group of confluent cancer cells from 0.2 mm to 2 mm in maximum width (see Edge et al. (2010) AJCC Cancer Staging Manual and Handbook (7th ed.)). An alternative preferred definition of "micrometastasis" is a confluent group of at least 1000 cancer cells and at least 0.1 mm in widest dimension up to 1 mm in widest dimension. Micrometastasis is generally not visible in standard contrast MRI imaging or other clinical imaging techniques. However, in certain cancers, radioactive antibodies directed to tumor selective antigens {e.g., Her2 for breast cancer metastasis) allows for visualization of micrometastasis. Other indirect detection methods include contrast media leakage at brain micrometastasis sites due to VEGF induced vascular leakage (Yano et al. (2000) Cancer Res. 60:4959-49067; U.S. Pat. Publ. 2015/0352113). More sensitive imaging techniques may also be applied to detect micrometastases. For example, blood volume may be imaged by MRI using the alternative
contrast agent, USPIO (Molday Iron, Biopal, Worcester, Mass.) to detect micrometastasis (Yin et al. (2009) Clin. Exp. Metastasis. 26:403-414).
The term "coding region" refers to regions of a nucleotide sequence comprising codons which are translated into amino acid residues, whereas the term "noncoding region" refers to regions of a nucleotide sequence that are not translated into amino acids {e.g., 5' and 3' untranslated regions).
The term "complementary" refers to the broad concept of sequence
complementarity between regions of two nucleic acid strands or between two regions of the same nucleic acid strand. It is known that an adenine residue of a first nucleic acid region is capable of forming specific hydrogen bonds ("base pairing") with a residue of a second nucleic acid region which is antiparallel to the first region if the residue is thymine or uracil. Similarly, it is known that a cytosine residue of a first nucleic acid strand is capable of base pairing with a residue of a second nucleic acid strand which is antiparallel to the first strand if the residue is guanine. A first region of a nucleic acid is complementary to a second region of the same or a different nucleic acid if, when the two regions are arranged in an antiparallel fashion, at least one nucleotide residue of the first region is capable of base pairing with a residue of the second region. Preferably, the first region comprises a first portion and the second region comprises a second portion, whereby, when the first and second portions are arranged in an antiparallel fashion, at least about 50%, and preferably at least about 75%, at least about 90%, or at least about 95% of the nucleotide residues of the first portion are capable of base pairing with nucleotide residues in the second portion. More preferably, all nucleotide residues of the first portion are capable of base pairing with nucleotide residues in the second portion.
The term "control" refers to any reference standard suitable to provide a comparison to the expression products in the test sample. In one embodiment, the control comprises obtaining a "control sample" from which expression product levels are detected and compared to the expression product levels from the test sample. Such a control sample may comprise any suitable sample, including but not limited to a sample from a control cancer patient (can be stored sample or previous sample measurement) with a known outcome; normal tissue or cells isolated from a subject, such as a normal patient or the cancer patient, cultured primary cells/tissues isolated from a subject such as a normal subject or the cancer patient, adjacent normal cells/tissues obtained from the same organ or body location of the cancer patient, a tissue or cell sample isolated from a normal subject, or a primary
cells/tissues obtained from a depository. In another preferred embodiment, the control may comprise a reference standard expression product level from any suitable source, including but not limited to housekeeping genes, an expression product level range from normal tissue (or other previously analyzed control sample), a previously determined expression product level range within a test sample from a group of patients, or a set of patients with a certain outcome (for example, survival for one, two, three, four years, etc.) or receiving a certain treatment (for example, standard of care cancer therapy). It will be understood by those of skill in the art that such control samples and reference standard expression product levels can be used in combination as controls in the methods of the present invention. In one embodiment, the control may comprise normal or non-cancerous cell/tissue sample. In another preferred embodiment, the control may comprise an expression level for a set of patients, such as a set of cancer patients, or for a set of cancer patients receiving a certain treatment, or for a set of patients with one outcome versus another outcome. In the former case, the specific expression product level of each patient can be assigned to a percentile level of expression, or expressed as either higher or lower than the mean or average of the reference standard expression level. In another preferred embodiment, the control may comprise normal cells, cells from patients treated with combination chemotherapy, and cells from patients having benign cancer. In another embodiment, the control may also comprise a measured value for example, average level of expression of a particular gene in a population compared to the level of expression of a housekeeping gene in the same population. Such a population may comprise normal subjects, cancer patients who have not undergone any treatment (i.e., treatment naive), cancer patients undergoing standard of care therapy, or patients having benign cancer. In another preferred embodiment, the control comprises a ratio transformation of expression product levels, including but not limited to determining a ratio of expression product levels of two genes in the test sample and comparing it to any suitable ratio of the same two genes in a reference standard;
determining expression product levels of the two or more genes in the test sample and determining a difference in expression product levels in any suitable control; and determining expression product levels of the two or more genes in the test sample, normalizing their expression to expression of housekeeping genes in the test sample, and comparing to any suitable control. In particularly preferred embodiments, the control comprises a control sample which is of the same lineage and/or type as the test sample. In another embodiment, the control may comprise expression product levels grouped as
percentiles within or based on a set of patient samples, such as all patients with cancer. In one embodiment a control expression product level is established wherein higher or lower levels of expression product relative to, for instance, a particular percentile, are used as the basis for predicting outcome. In another preferred embodiment, a control expression product level is established using expression product levels from cancer control patients with a known outcome, and the expression product levels from the test sample are compared to the control expression product level as the basis for predicting outcome. As demonstrated by the data below, the methods of the present invention are not limited to use of a specific cut-point in comparing the level of expression product in the test sample to the control.
The "copy number" of a biomarker nucleic acid refers to the number of DNA sequences in a cell (e.g., germline and/or somatic) encoding a particular gene product. Generally, for a given gene, a mammal has two copies of each gene. The copy number can be increased, however, by gene amplification or duplication, or reduced by deletion. For example, germline copy number changes include changes at one or more genomic loci, wherein said one or more genomic loci are not accounted for by the number of copies in the normal complement of germline copies in a control (e.g., the normal copy number in germline DNA for the same species as that from which the specific germline DNA and corresponding copy number were determined). Somatic copy number changes include changes at one or more genomic loci, wherein said one or more genomic loci are not accounted for by the number of copies in germline DNA of a control (e.g., copy number in germline DNA for the same subject as that from which the somatic DNA and corresponding copy number were determined).
The "normal" copy number (e.g., germline and/or somatic) of a biomarker nucleic acid or "normal" level of expression of a biomarker nucleic acid or protein is the activity /level of expression or copy number in a biological sample, e.g., a sample containing tissue, whole blood, serum, plasma, buccal scrape, saliva, cerebrospinal fluid, urine, stool, and bone marrow, from a subject, e.g., a human, not afflicted with cancer, or from a corresponding non-cancerous tissue in the same subject who has cancer.
As used herein, the term "costimulate" with reference to activated immune cells includes the ability of a costimulatory molecule to provide a second, non-activating receptor mediated signal (a "costimulatory signal") that induces proliferation or effector function. For example, a costimulatory signal can result in cytokine secretion, e.g., in a T
cell that has received a T cell-receptor-mediated signal. Immune cells that have received a cell-receptor mediated signal, e.g., via an activating receptor are referred to herein as "activated immune cells."
The term "determining a suitable treatment regimen for the subject" is taken to mean the determination of a treatment regimen (i.e., a single therapy or a combination of different therapies that are used for the prevention and/or treatment of the cancer in the subject) for a subject that is started, modified and/or ended based or essentially based or at least partially based on the results of the analysis according to the present invention. One example is starting an adjuvant therapy after surgery whose purpose is to decrease the risk of recurrence, another would be to modify the dosage of a particular chemotherapy. The determination can, in addition to the results of the analysis according to the present invention, be based on personal characteristics of the subject to be treated. In most cases, the actual determination of the suitable treatment regimen for the subject will be performed by the attending physician or doctor.
The term "diagnosing cancer" includes the use of the methods, systems, and code of the present invention to determine the presence or absence of a cancer or subtype thereof in an individual. The term also includes methods, systems, and code for assessing the level of disease activity in an individual.
A molecule is "fixed" or "affixed" to a substrate if it is covalently or non-covalently associated with the substrate such that the substrate can be rinsed with a fluid (e.g. standard saline citrate, pH 7.4) without a substantial fraction of the molecule dissociating from the substrate.
The term "expression signature" or "signature" refers to a group of one or more coordinately expressed biomarkers related to a measured phenotype. For example, the genes, proteins, metabolites, and the like making up this signature may be expressed in a specific cell lineage, stage of differentiation, or during a particular biological response. The biomarkers can reflect biological aspects of the tumors in which they are expressed, such as the cell of origin of the cancer, the nature of the non-malignant cells in the biopsy, and the oncogenic mechanisms responsible for the cancer. Expression data and gene expression levels can be stored on computer readable media, e.g., the computer readable medium used in conjunction with a microarray or chip reading device. Such expression data can be manipulated to generate expression signatures.
"Homologous" as used herein, refers to nucleotide sequence similarity between two regions of the same nucleic acid strand or between regions of two different nucleic acid strands. When a nucleotide residue position in both regions is occupied by the same nucleotide residue, then the regions are homologous at that position. A first region is homologous to a second region if at least one nucleotide residue position of each region is occupied by the same residue. Homology between two regions is expressed in terms of the proportion of nucleotide residue positions of the two regions that are occupied by the same nucleotide residue. By way of example, a region having the nucleotide sequence 5'- ATTGCC-3' and a region having the nucleotide sequence 5'-TATGGC-3' share 50% homology. Preferably, the first region comprises a first portion and the second region comprises a second portion, whereby, at least about 50%, and preferably at least about 75%, at least about 90%, or at least about 95% of the nucleotide residue positions of each of the portions are occupied by the same nucleotide residue. More preferably, all nucleotide residue positions of each of the portions are occupied by the same nucleotide residue.
The term "immune cell" refers to cells that play a role in the immune response.
Immune cells are of hematopoietic origin, and include lymphocytes, such as B cells and T cells; natural killer cells; myeloid cells, such as monocytes, macrophages, eosinophils, mast cells, basophils, and granulocytes.
The term "immune checkpoint" refers to a group of molecules on the cell surface of CD4+ and/or CD8+ T cells that fine-tune immune responses by down-modulating or inhibiting an anti-tumor immune response. Immune checkpoint proteins are well known in the art and include, without limitation, CTLA-4, PD-1, VISTA, B7-H2, B7-H3, PD-Ll, B7- H4, B7-H6, 2B4, ICOS, HVEM, PD-L2, CD160, gp49B, PIR-B, KIR family receptors, ΊΊΜ-1, TIM-3, TIM-4, LAG-3, BTLA, SIRPalpha (CD47), CD48, 2B4 (CD244), B7.1, B7.2, ILT-2, ILT-4, TIGIT, and A2aR (see, for example, WO 2012/177624). The term further encompasses biologically active protein fragment, as well as nucleic acids encoding full-length immune checkpoint proteins and biologically active protein fragments thereof. In some embodiment, the term further encompasses any fragment according to homology descriptions provided herein.
"Anti-immune checkpoint therapy" refers to the use of agents that inhibit immune checkpoint nucleic acids and/or proteins. Inhibition of one or more immune checkpoints can block or otherwise neutralize inhibitory signaling to thereby upregulate an immune response in order to more efficaciously treat cancer. Exemplary agents useful for inhibiting
immune checkpoints include antibodies, small molecules, peptides, peptidomimetics, natural ligands, and derivatives of natural ligands, that can either bind and/or inactivate or inhibit immune checkpoint proteins, or fragments thereof; as well as RNA interference, antisense, nucleic acid aptamers, etc. that can downregulate the expression and/or activity of immune checkpoint nucleic acids, or fragments thereof. Exemplary agents for upregulating an immune response include antibodies against one or more immune checkpoint proteins block the interaction between the proteins and its natural receptor(s); a non-activating form of one or more immune checkpoint proteins (e.g. , a dominant negative polypeptide); small molecules or peptides that block the interaction between one or more immune checkpoint proteins and its natural receptor(s); fusion proteins (e.g. the
extracellular portion of an immune checkpoint inhibition protein fused to the Fc portion of an antibody or immunoglobulin) that bind to its natural receptor(s); nucleic acid molecules that block immune checkpoint nucleic acid transcription or translation; and the like. Such agents can directly block the interaction between the one or more immune checkpoints and its natural receptor(s) (e.g., antibodies) to prevent inhibitory signaling and upregulate an immune response. Alternatively, agents can indirectly block the interaction between one or more immune checkpoint proteins and its natural receptor(s) to prevent inhibitory signaling and upregulate an immune response. For example, a soluble version of an immune checkpoint protein ligand such as a stabilized extracellular domain can binding to its receptor to indirectly reduce the effective concentration of the receptor to bind to an appropriate ligand. In one embodiment, anti-PD-1 antibodies, anti-PD-Ll antibodies, and/or anti-PD-L2 antibodies, either alone or in combination, are used to inhibit immune checkpoints. These embodiments are also applicable to specific therapy against particular immune checkpoints, such as the PD-1 pathway (e.g., anti-PD-1 pathway therapy, otherwise known as PD-1 pathway inhibitor therapy).
The term "immune response" includes T cell mediated and/or B cell mediated immune responses. Exemplary immune responses include T cell responses, e.g., cytokine production and cellular cytotoxicity. In addition, the term immune response includes immune responses that are indirectly effected by T cell activation, e.g., antibody production (humoral responses) and activation of cytokine responsive cells, e.g., macrophages.
The term "immunotherapeutic agent" can include any molecule, peptide, antibody or other agent which can stimulate a host immune system to generate an immune response
to a tumor or cancer in the subject. Various immunotherapeutic agents are useful in the compositions and methods described herein.
The term "inhibit" includes the decrease, limitation, or blockage, of, for example a particular action, function, or interaction. In some embodiments, cancer is "inhibited" if at least one symptom of the cancer is alleviated, terminated, slowed, or prevented. As used herein, cancer is also "inhibited" if recurrence or metastasis of the cancer is reduced, slowed, delayed, or prevented.
The term "interaction", when referring to an interaction between two molecules, refers to the physical contact (e.g., binding) of the molecules with one another. Generally, such an interaction results in an activity (which produces a biological effect) of one or both of said molecules.
An "isolated protein" refers to a protein that is substantially free of other proteins, cellular material, separation medium, and culture medium when isolated from cells or produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized. An "isolated" or "purified" protein or biologically active portion thereof is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which the antibody, polypeptide, peptide or fusion protein is derived, or substantially free from chemical precursors or other chemicals when chemically synthesized. The language "substantially free of cellular material" includes preparations of a biomarker polypeptide or fragment thereof, in which the protein is separated from cellular components of the cells from which it is isolated or recombinantly produced. In one embodiment, the language "substantially free of cellular material" includes preparations of a biomarker protein or fragment thereof, having less than about 30% (by dry weight) of non-biomarker protein (also referred to herein as a "contaminating protein"), more preferably less than about 20% of non-biomarker protein, still more preferably less than about 10%) of non-biomarker protein, and most preferably less than about 5% non- biomarker protein. When antibody, polypeptide, peptide or fusion protein or fragment thereof, e.g., a biologically active fragment thereof, is recombinantly produced, it is also preferably substantially free of culture medium, i.e., culture medium represents less than about 20%, more preferably less than about 10%>, and most preferably less than about 5% of the volume of the protein preparation.
A "kit" is any manufacture (e.g. a package or container) comprising at least one reagent, e.g. a probe or small molecule, for specifically detecting and/or affecting the
expression of a marker of the present invention. The kit may be promoted, distributed, or sold as a unit for performing the methods of the present invention. The kit may comprise one or more reagents necessary to express a composition useful in the methods of the present invention. In certain embodiments, the kit may further comprise a reference standard, e.g., a nucleic acid encoding a protein that does not affect or regulate signaling pathways controlling cell growth, division, migration, survival or apoptosis. One skilled in the art can envision many such control proteins, including, but not limited to, common molecular tags (e.g., green fluorescent protein and beta-galactosidase), proteins not classified in any of pathway encompassing cell growth, division, migration, survival or apoptosis by GeneOntology reference, or ubiquitous housekeeping proteins. Reagents in the kit may be provided in individual containers or as mixtures of two or more reagents in a single container. In addition, instructional materials which describe the use of the compositions within the kit can be included.
The term "neoadjuvant therapy" refers to a treatment given before the primary treatment. Examples of neoadjuvant therapy can include chemotherapy, radiation therapy, and hormone therapy. For example, in treating breast cancer, neoadjuvant therapy can allows patients with large breast cancer to undergo breast-conserving surgery.
The "normal" level of expression of a biomarker is the level of expression of the biomarker in cells of a subject, e.g., a human patient, not afflicted with a cancer. An "over- expression" or "significantly higher level of expression" of a biomarker refers to an expression level in a test sample that is greater than the standard error of the assay employed to assess expression, and is preferably at least 10%, and more preferably 1.2, 1.3,
1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.5, 4, 4.5, 5,
5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20 times or more higher than the expression activity or level of the biomarker in a control sample (e.g., sample from a healthy subject not having the biomarker associated disease) and preferably, the average expression level of the biomarker in several control samples. A "significantly lower level of expression" of a biomarker refers to an expression level in a test sample that is at least 10%, and more preferably 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20 times or more lower than the expression level of the biomarker in a control sample (e.g., sample from a healthy subject not having the biomarker
associated disease) and preferably, the average expression level of the biomarker in several control samples.
An "over-expression" or "significantly higher level of expression" of a biomarker refers to an expression level in a test sample that is greater than the standard error of the assay employed to assess expression, and is preferably at least 10%, and more preferably 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20 times or more higher than the expression activity or level of the biomarker in a control sample (e.g., sample from a healthy subject not having the biomarker associated disease) and preferably, the average expression level of the biomarker in several control samples. A "significantly lower level of expression" of a biomarker refers to an expression level in a test sample that is at least 10%, and more preferably 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20 times or more lower than the expression level of the biomarker in a control sample (e.g., sample from a healthy subject not having the biomarker associated disease) and preferably, the average expression level of the biomarker in several control samples.
The term "PI3K-mTOR signaling pathway" refers to one of the intracellular signaling pathways activated by the binding of growth factors to receptor tyrosine kinases. On activation, PI3K phosphorylates phosphatidylinositol-4,5-bisphosphate (PIP2) to phsophatidylinositol-3,4,5-triphosphate (PIP3), a process that is reversed by PTEN. PIP3 signals activate the kinase PDK1, which in turn activates the kinase AKT. The AKT protein family, which members are also called protein kinases B (PKB) plays an important role in mammalian cellular signaling. Akt kinase is a serine/threonine kinase which is a downstream effector molecule of phosphoinositide 3-kinase and is involved in protecting a cell from apoptosis. Akt kinase is thought to be involved in the progression of cancer because it stimulates cell proliferation and suppresses apoptosis. Aktl is involved in cellular survival pathways, by inhibiting apoptotic processes. Aktl is also able to induce protein synthesis pathways, and is therefore a key signaling protein in the cellular pathways that lead to skeletal muscle hypertrophy, and general tissue growth. Since it can block apoptosis, and thereby promote cell survival, Aktl has been implicated as a major factor in many types of cancer. Akt is known to play a role in the cell cycle. Under various circumstances, activation of Akt was shown to overcome cell cycle arrest in Gl and G2
phases. Moreover, activated Akt may enable proliferation and survival of cells that have sustained a potentially mutagenic impact and, therefore, may contribute to acquisition of mutations in other genes. AKT (activation, amplification) and PTEN (mutation, deletion, epigenetic inactivation) are deregulated in many human cancers (Altomare et al. (2003) J. Cell Biochem. 88:470-476; Ruggeri et al. (1998) Mo/. Carcin. 21 :81-86; Cheng et al.
(1996) Proc. Natl. Acad. Sci. U.S.A. 93 :3636-3641; Staal et al. (1987) Proc. Natl. Acad. Sci. U.S.A. 84:5034-5037; Li et al. (2005) World J. Gastroenterol. 11 :285-288; Li et al.
(1997) Science 275: 1943-1947; Goel et al. (2004) Cancer Res. 64:3014-3021). PI3K pathway activation can be assessed by immunohistochemical analysis of PTEN or phosphorylated AKT levels in clinical samples (Slipicevic et al. (2005) Am. J. Clin. Pathol. 124:528-536). Molecular targets of such inhibitors include, but are not limited to, PI3K, AKT, S6K1, mTORCl, PDK1, MYC, cMET, FGFR2, growth factors (EGF, b-FGF, IGF1, Insulin, or Heregulin) and the like. For example, mTOR exists in at least 2 distinct multiprotein complexes described as raptor-mTOR complex (mTORCl) and rictor-mTOR complex (mTORC2) in mammalian cells (sometimes referred to as just TORC1 and TORC2). mTORCl is composed of mTOR, GPL and raptor proteins and it binds to FKBP12-rapamycin. mTORCl is a rapamycin-sensitive complex as its kinase activity is inhibited by FKB12-rapamycin in vitro and the mTORCl complex positively regulates cell growth. The raptor branch of the mTOR pathway modulates number of processes, including mRNA translation, ribosome biogenesis, nutrient metabolism and autophagy.
The two mammalian proteins, S6 Kinase 1 (S6K1) and 4E-BP1, which are linked to protein synthesis, are downstream targets of mTORCl . S6K1 also phosphorylates S6RP, which is the S6 component of the 40S ribosomal subunit involved in regulating translation, cell size, cell proliferation, and glucose homeostasis (Magnuson et al. (2012) Biochem. J. 441 : 1- 21). mTORCl has been shown to phosphorylate S6K1 at T389 and is inhibited by
FKBP12-rapamycin in vitro and by rapamycin in vivo. mTORCl can also phosphorylate 4E-BP1 at T37/46 in vitro and in vivo. Other molecular targets are well known in the art and are described, for example, in U.S. Pat. Publ. 2011/0015869. In some embodiments, the PI3K-mTOR signaling pathway is limited to subsets of biomolecules within the pathway, such as PI3K, mTORCl, S6RP, and 4E-BP1, or individual biomolecules within the pathway, such as PI3K, mTORCl, S6RP, or 4E-BP1. In addition, embodiments of the methods of the present invention can inhibit or block mTOR within an mTORCl complex, within an mTORC2 complex, and/or within both the mTORCl and mTORC2 complexes.
As used herein, the term "PI3K" refers to a family of intracellular signal transducer enzymes capable of phosphorylating the 3 position hydroxyl group of the inositol ring of phosphatidylinositol (Ptdlns). PBKs are divided into four different classes, known as class I, class II, class III, and class IV, based on the enzyme primary structure, enzymatic regulation, and lipid substrate specificity (Leevers et al. (1999) Curr. Opin. Cell Biol.
11 :219-225). Class I PBKs are heterodimeric molecules composed of a regulatory and a catalytic subunit, are activated by G protein-coupled receptors (GPCRs) and tyrosine kinase receptors, and are responsible for the production of the following phosphatidylinositols: PI(3)P, PI(3,4)P2, and PI(3,4,5)P3. Class II PBKs do not contain a regulatory subunit, lack a critical Asp residue in the C-terminal C2 domain required for coordinate binding of calcium ions, can comprise one of three catalytic isoforms (C2alpha, C2beta, or C2gamma), and catalyze the production of PI(3)P from PI and PI(3,4)P2 from PIP. Class III PBKs are similar to class II PBKs in structure, but only produce PI(3)P from PI. Finally, class IV PBKs is a more distantly related set of enzymes that are protein serine/threonine kinases and include the members, mTOR, DNA-PK, ATM, and ATR. In humans, the four class I catalytic PBKs are known as PIK3C alpha, PIK3C beta, PIK3C gamma, and PIK3C delta. The term "pan-PBK" refers to the group of PIK3C alpha, PIK3C beta, PIK3C gamma, and PIK3C delta. For example, a "pan-PBK inhibitor" inhibits PIK3C alpha, PIK3C beta, PIK3C gamma, and PIK3C delta.
Nucleic acid and amino acid sequences for each PBK, including catalytic PBKs, are known in the art and are publicly available in the GenBank database maintained by the U.S. National Center for Biotechnology Information. For example, PIK3C alpha (PIK3CA) nucleic acid and amino acid sequences are well-known and include, for example, human PIK3CA (NM_006218.2 and NP_006209.2), monkey PIK3CA (NM_001260668.1 and NP_001247597.1), mouse PIK3CA (XM_006535409.2, XP_006535472.1,
XM_006535410.2, and XP_006535473.1), and rat PIK3CA (NM_133399.2 and
NP 596890.2). PIK3C beta (PIK3CB) nucleic acid and amino acid sequences are well- known and include, for example, human PIK3CB (NM_006219.2, NP_006210.1,
NM_001256045.1, and NP_001242974.1), monkey PIK3CB (XM_015132082.1 and XP_014987568.1), mouse PIK3CB (NM_029094.3 and NP_083370.2), and rat PIK3CB (XM_008766567.1, XP_008764789.1, XM_006243642.2, and XP_006243704.1). PIK3C gamma (PIK3CG) nucleic acid and amino acid sequences are well-known and include, for example, human PIK3CG (NM_002649.3, NP_002640.2, NM_001282426.1,
ΝΡ_001269355.1, NM_001282427.1, and P_001269356.1), monkey PIK3CG
( M_001266758.1 and P_001253687.1), mouse PIK3CG ( M_020272.2, P_064668.2, M_001146201.1 , P_001139673.1, NM_001146200.1 , and P_001139672.1 ), and rat PIK3CG (XM_006240004.2, XP_006240066.1, XM_006240005.2, XP_006240067.1, XM 006240003.2, and XP 006240065.1). PIK3C delta (PIK3CD) nucleic acid and amino acid sequences are well-known and include, for example, human PIK3CD ( M 005026.3 and P_005017.3), chimpanzee PIK3CD (XM 009447951.1, XP_009446226.1,
XM_009447957.1, and XP_009446232.1), mouse PIK3CD ( M_008840.3, P_032866.2, M_001164052.1 , P_001157524.1 , NM_001164051.1 , NP_001157523.1,
M_001164050.1, P_001157522.1, NM_001164049.1, NP_001157521.1,
M_001029837.2, and P_001025008.2), and rat PIK3CD ( M_0011089078.1 and P 001102448.1). Anti-PI3K agents, including intrabodies, nucleic acids, and the like are well-known in the art and include, for example, pan-PI3K inhibitors having broad inhibitory activity against all catalytic PI3Ks (e.g., pan-Class I PI3K inhibitors) are known and include BKM120 (5-(2,6-dimorpholin-4-ylpyrimidin-4-yl)-4-(trifluoromethyl)pyridin- 2-amine; Maira et al. (2011) Mol. Cancer Ther. 11 :317-348), BEZ235 (Maira et al. (2011) Mol. Cancer Ther. 11 :317-348), wortmannin (Wymann et al. (1996) Mol. Cell. Biol.
16: 1722-1733), LY294002 (Vlahos et al. (1994) J. Biol. Chem. 269:5241-5248; Wetzker and Rommel (2004) Curr. Pharm. Des. 10: 1915-1922), and BAY 80-80-6946 (copanlisib). In addition, PI3K isoform-specific small molecule inhibitors are known. For example, AZD6482 selectively inhibits PI3KB, AS-252424 and AS-604850 selectively inhibit PI3KG, IC87114 selectively inhibits PI3KD, and GDC0941 selectively inhibits PI3KA and PI3KD (Finan and Thomas (2004) Biochem. Soc. Trans. 32:378-382; PCT Publ.
WO01/81346; PCT Publ. WO01/372557; U.S. Pat. No. 6,403,588; and PCT Publ.
WOO 1/43266). Other inhibitors of PI3Ks (e.g., other small molecules that are organic chemical molecules that are not peptides or nucleic acids) are known. In addition, antibodies that bind PI3Ks, such as, TA802118, TA801482, and TA303167 (PIK3CA; OriGene Technol., Inc.); TA308795, TA330901, and TA329903 (PIK3CB; OriGene Technol., Inc.); TA505226, TA505228, and TA505227 (PIK3CG1 OriGene Technol., Inc.); and OTI2H3, TA325015, and TA307256 (PIK3CD; OriGene Technol., Inc.), and nucleic acids, such as SR303520, TF310428, SR421939, and TL501641 (PIK3CA-specific, OriGene Technol., Inc.); SR303521, TL310427, SR421863, TL515159, SR512202, and TL711892 (PIK3CB-specific, OriGene Technol., Inc.); SR303524, TL310425, SR422070,
TL502804, TR705298 (PIK3CG-specific, OriGene Technol., Inc.); and SR303523, TL310426, SR421859, TL515984, SR500333, and TL707500 (PIK3 CD-specific, OriGene Technol., Inc.), are well-known in the art. It is to be noted that the term can further be used to refer to any combination of features described herein regarding PDKs. For example, any combination of class, sequence composition, percentage identify, sequence length, domain structure, functional activity, etc. can be used to describe a PI3K of the present invention.
As used herein, the term "mTOR" refers to an atypical serine/threonine kinase known as "mammalian target of rapamycin" that is present in two distinct complexes (Dowling et al. (2010) Biochim. Biophys. Acta 1804:433-439; Dunlop et al. (2009) Cell. Signal. 21 : 827-8735 ; Hoeffer et al. (2010) Trends Neurosci. 33 : 67-75 ; Laplante et al. (2012) Cell 149:274-293; Laplante et al. (2013) J. Cell. Sci. 126: 1713-1719; Neufeld (2010) Curr. Opin. Cell Biol. 22: 157-168; Zoncu et al. (2011) Nat. Rev. Mol. Cell Biol. 12:21-35). The mTOR complex 1 (mTORCl) is a complex of mTOR along with Raptor, GPL, and DEPTOR that acts as a master growth regulator by phosphorylating substrates that potentiate anabolic processes. This complex is inhibited by the small molecule, rapamycin. The mTOR complex 2 (mTORC2) is a complex of mTOR along with Rictor, GPL, Sinl, PRR5/Protor-l, and DEPTOR that promotes cellular survival by activating Akt, regulates cytoskeletal dynamics by activating PKCalpha, and regulates ion transport and growth by modulating SGK1 phosphorylation. Nucleic acid and amino acid sequences for mTOR are known in the art and are publicly available in the GenBank database maintained by the U.S. National Center for Biotechnology Information. For example, mTOR nucleic acid and amino acid sequences are well-known and include, for example, human mTOR (NM_004958.3 and NP_004949.1), chimpanzee mTOR (XM_009448144.1 and
XP_009446419.1), mouse mTOR (NM_020009.2 and NP_064393.2), rat mTOR
(NM_019906.1 and NP_063971.1), cow mTOR (XM_002694043.4 and XP_002694089.2), and chicken mTOR (XM 417614.4 and XP 417614.3). Anti-mTOR agents, including intrabodies, nucleic acids, and the like are well-known in the art and include, for example, small molecule inhibitors, such as RADOOl (also known as dihydroxy-12-[(2R)-l- [(l S,3R,4R)-4-(2 -hydroxy ethoxy)-3-methoxycyclohexyl]propan-2-yl]-19,30-dimethoxy- 15, 17,21, 23,29,35-hexamethyl- 1 l,36-dioxa-4-azatricyclo[30.3.1.0 hexatriaconta-
16,24,26,28-tetraene-2,3,10, 14,20-pentone or Everolimus, which is at least an oral allosteric mTORCl inhibitor having demonstrated blood-brain barrier penetrance in human and animal studies; Novartis), CCI-779 (also known as Temsirolimus; Pfizer), AP23573 (Ariad
Pharmaceuticals), and KU-0059475 (Kudus Pharmaceuticals; Mita et al. (2003) Cancer Biol. Ther. 2:S169-S177). Other inhibitors of mTOR (e.g., other small molecules that are organic chemical molecules that are not peptides or nucleic acids) are known. In addition, antibodies that bind mTOR, such as, TA590835, TA307262, TA300537, TA322695, and TA322694 (OriGene Technol., Inc.), and nucleic acids, such as SR301656, TL320364, SR423527, TL503251, SR504090, and TL710387 (OriGene Technol., Inc.). It is to be noted that the term can further be used to refer to any combination of features described herein regarding mTOR. For example, any combination of class, sequence composition, percentage identify, sequence length, domain structure, functional activity, etc. can be used to describe an mTOR of the present invention.
As used herein, the term "S6RP" refers to the cytoplasmic ribosomal protein that is a component of the 40S subunit of the ribosome and is a major substrate of protein kinases in the ribosome since it has five C-terminal serine residues that are phosphorylatable by different protein kinases. Nucleic acid and amino acid sequences for S6RP are known in the art and are publicly available in the GenBank database maintained by the U.S. National Center for Biotechnology Information. For example, S6RP nucleic acid and amino acid sequences are well-known and include, for example, human S6RP (NM 001010.2 and NP_001001.2), chimpanzee S6RP (XM_003312012.3 and XP_003312060.1), monkey S6RP (XM_015117628.1 and XP_014973114.1), dog S6RP (NM_001252170.1 and NP_001239099.1), cow S6RP (NM_001015548.2 and NP_001015548.1), mouse S6RP (NM_009096.3 and NP_033122.1), rat S6RP (NM_017160.1 and NP_058856.1), and chicken S6RP (NM_205225.2 and NP_990556.1). It is to be noted that the term can further be used to refer to any combination of features described herein regarding S6RP. For example, any combination of class, sequence composition, percentage identify, sequence length, domain structure, functional activity, etc. can be used to describe an S6RP of the present invention.
As used herein, the term "4EBP1" refers to the eukaryotic translation inhibition factor 4E binding protein ltranslation repressor protein that directly interacts with eukaryotic translation initiation factor 4E (eIF4E), which is a limiting component of the multisubunit complex that recruits 40S ribosomal subunits to the 4'end of mRNAs. Nucleic acid and amino acid sequences for 4EBP1 are known in the art and are publicly available in the GenBank database maintained by the U.S. National Center for Biotechnology
Information. For example, 4EBP1 nucleic acid and amino acid sequences are well-known
and include, for example, human 4EBP1 ( M_004095.3 and P_004086.1), chimpanzee 4EBP1 (XM_531121.4 and XP_531121.2), monkey 4EBP1 (XM_015145167.1 and
XP_015000653.1), dog 4EBP1 (XM_549448.4 and XP_549448.2), cow 4EBP1
( M_001077893.2 and NP_001071361.1), mouse 4EBP1 ( M_007918.3 and
P_031944.3), and rat 4EBP1 ( M_053857.2 and P_446309.1). It is to be noted that the term can further be used to refer to any combination of features described herein regarding 4EBP1. For example, any combination of class, sequence composition, percentage identify, sequence length, domain structure, functional activity, etc. can be used to describe a 4EBP1 of the present invention.
Other agents useful for inhibiting PI3K-mTORC signaling pathway, or other biomarkers described herein, include antibodies, small molecules, peptides,
peptidomimetics, natural ligands, and derivatives of natural ligands, that can either bind and/or inactivate or inhibit target proteins, or fragments thereof; as well as RNA
interference, antisense, nucleic acid aptamers, etc. that can downregulate the expression and/or activity of target nucleic acids, or fragments thereof, are contemplated and described further herein. Exemplary inhibitors of the PI3K-mTORC signaling pathway are also well known in the art and include, but are not limited to: S6K1 inhibitors, such as PF-4708671 (Pearce et al. (2010) Biochem. J. 431 :245-255) and DG2 (3-bromo-4-)4-)2- methoxyphenyl)piperazine-l-yl)-lH-pyrazolo[3,4-d]-pyrimidine (Axon Medchem.); AKT antibodies (Shin et al. (2005) Cancer Res. 65:2815-2824) (see also Cheng et al. (2005)
Oncogene 24:7482-7492 for review of AKT pathway inhibitors); PDK1 inhibitors, such as AR-12, BX-795, staurosporine, OSU-03012, celecoxib, and others described in U.S. Pat. Nos. 6,124,272; 7,344,870; and 7,041,687); and IGF 1R inhibitors (such as monoclonal antibody MK-0646, U.S. Pat. No. 7,241,444).
The term "pre-determined" biomarker amount and/or activity measurement(s) may be a biomarker amount and/or activity measurement(s) used to, by way of example only, evaluate a subject that may be selected for a particular treatment, evaluate a response to a treatment such as PI3K and mTOR combination inhibitor therapy, and/or evaluate the disease state. A pre-determined biomarker amount and/or activity measurement(s) may be determined in populations of patients with or without cancer. The pre-determined biomarker amount and/or activity measurement(s) can be a single number, equally applicable to every patient, or the pre-determined biomarker amount and/or activity measurement(s) can vary according to specific subpopulations of patients. Age, weight,
height, and other factors of a subject may affect the pre-determined biomarker amount and/or activity measurement(s) of the individual. Furthermore, the pre-determined biomarker amount and/or activity can be determined for each subject individually. In one embodiment, the amounts determined and/or compared in a method described herein are based on absolute measurements. In another embodiment, the amounts determined and/or compared in a method described herein are based on relative measurements, such as ratios (e.g., serum biomarker normalized to the expression of housekeeping or otherwise generally constant biomarker). The pre-determined biomarker amount and/or activity
measurement s) can be any suitable standard. For example, the pre-determined biomarker amount and/or activity measurement(s) can be obtained from the same or a different human for whom a patient selection is being assessed. In one embodiment, the pre-determined biomarker amount and/or activity measurement(s) can be obtained from a previous assessment of the same patient. In such a manner, the progress of the selection of the patient can be monitored over time. In addition, the control can be obtained from an assessment of another human or multiple humans, e.g., selected groups of humans, if the subject is a human. In such a manner, the extent of the selection of the human for whom selection is being assessed can be compared to suitable other humans, e.g., other humans who are in a similar situation to the human of interest, such as those suffering from similar or the same condition(s) and/or of the same ethnic group.
The term "predictive" includes the use of a biomarker nucleic acid and/or protein status, e.g., over- or under- activity, emergence, expression, growth, remission, recurrence or resistance of tumors before, during or after therapy, for determining the likelihood of response of a cancer to PI3K and mTOR combination inhibitor treatment (e.g., treatment with a combination of a pan-class I PI3K inhibitor, such as BKM120, and an mTOR inhibitor, such as RAD001). Such predictive use of the biomarker may be confirmed by, e.g., (1) increased or decreased copy number (e.g., by FISH, FISH plus SKY, single- molecule sequencing, e.g., as described in the art at least at J. Biotechnol., 86:289-301, or qPCR), overexpression or underexpression of a biomarker nucleic acid (e.g., by ISH, Northern Blot, or qPCR), increased or decreased biomarker protein (e.g., by IHC), or increased or decreased activity, e.g., in more than about 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 100%, or more of assayed human cancers types or cancer samples; (2) its absolute or relatively modulated presence or absence in a biological sample, e.g., a sample containing tissue,
whole blood, serum, plasma, buccal scrape, saliva, cerebrospinal fluid, urine, stool, or bone marrow, from a subject, e.g. a human, afflicted with cancer; (3) its absolute or relatively modulated presence or absence in clinical subset of patients with cancer (e.g., those responding to a particular PI3K and mTOR combination inhibitor therapy or those developing resistance thereto).
The term "pre-malignant lesions" as described herein refers to a lesion that, while not cancerous, has potential for becoming cancerous. It also includes the term "pre- malignant disorders" or "potentially malignant disorders." In particular this refers to a benign, morphologically and/or histologically altered tissue that has a greater than normal risk of malignant transformation, and a disease or a patient's habit that does not necessarily alter the clinical appearance of local tissue but is associated with a greater than normal risk of precancerous lesion or cancer development in that tissue (leukoplakia, erythroplakia, erytroleukoplakia lichen planus (lichenoid reaction) and any lesion or an area which histological examination showed atypia of cells or dysplasia. In one embodiment, a metaplasia is a pre-malignant lesion.
The terms "prevent," "preventing," "prevention," "prophylactic treatment," and the like refer to reducing the probability of developing a disease, disorder, or condition in a subject, who does not have, but is at risk of or susceptible to developing a disease, disorder, or condition.
The term "probe" refers to any molecule which is capable of selectively binding to a specifically intended target molecule, for example, a nucleotide transcript or protein encoded by or corresponding to a biomarker nucleic acid. Probes can be either synthesized by one skilled in the art, or derived from appropriate biological preparations. For purposes of detection of the target molecule, probes may be specifically designed to be labeled, as described herein. Examples of molecules that can be utilized as probes include, but are not limited to, RNA, DNA, proteins, antibodies, and organic molecules.
The term "prognosis" includes a prediction of the probable course and outcome of cancer or the likelihood of recovery from the disease. In some embodiments, the use of statistical algorithms provides a prognosis of cancer in an individual. For example, the prognosis can be surgery, development of a clinical subtype of cancer (e.g., solid tumors, such as esophageal cancer and gastric cancer), development of one or more clinical factors, or recovery from the disease.
The term "response to anti-cancer therapy" or "response to anti-PI3K/mTOR pathway therapy" relates to any response of the hyperproliferative disorder (e.g., cancer) to an anti-cancer agent such as an anti-PI3K/mTOR pathway agent, preferably to a change in tumor mass and/or volume after initiation of neoadjuvant or adjuvant therapy.
Hyperproliferative disorder response may be assessed, for example for efficacy or in a neoadjuvant or adjuvant situation, where the size of a tumor after systemic intervention can be compared to the initial size and dimensions as measured by CT, PET, mammogram, ultrasound or palpation. Responses may also be assessed by caliper measurement or pathological examination of the tumor after biopsy or surgical resection. Response may be recorded in a quantitative fashion like percentage change in tumor volume or in a qualitative fashion like "pathological complete response" (pCR), "clinical complete remission" (cCR), "clinical partial remission" (cPR), "clinical stable disease" (cSD), "clinical progressive disease" (cPD) or other qualitative criteria. Assessment of
hyperproliferative disorder response may be done early after the onset of neoadjuvant or adjuvant therapy, e.g., after a few hours, days, weeks or preferably after a few months. A typical endpoint for response assessment is upon termination of neoadjuvant chemotherapy or upon surgical removal of residual tumor cells and/or the tumor bed. This is typically three months after initiation of neoadjuvant therapy. In some embodiments, clinical efficacy of the therapeutic treatments described herein may be determined by measuring the clinical benefit rate (CBR). The clinical benefit rate is measured by determining the sum of the percentage of patients who are in complete remission (CR), the number of patients who are in partial remission (PR) and the number of patients having stable disease (SD) at a time point at least 6 months out from the end of therapy. The shorthand for this formula is CBR=CR+PR+SD over 6 months. In some embodiments, the CBR for a particular cancer therapeutic regimen is at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%), 80%), 85%), or more. Additional criteria for evaluating the response to cancer therapies are related to "survival," which includes all of the following: survival until mortality, also known as overall survival (wherein said mortality may be either irrespective of cause or tumor related); "recurrence-free survival" (wherein the term recurrence shall include both localized and distant recurrence); metastasis free survival; disease free survival (wherein the term disease shall include cancer and diseases associated therewith). The length of said survival may be calculated by reference to a defined start point (e.g., time of diagnosis or start of treatment) and end point (e.g., death, recurrence or metastasis). In
addition, criteria for efficacy of treatment can be expanded to include response to chemotherapy, probability of survival, probability of metastasis within a given time period, and probability of tumor recurrence. For example, in order to determine appropriate threshold values, a particular cancer therapeutic regimen can be administered to a population of subjects and the outcome can be correlated to biomarker measurements that were determined prior to administration of any cancer therapy. The outcome measurement may be pathologic response to therapy given in the neoadjuvant setting. Alternatively, outcome measures, such as overall survival and disease-free survival can be monitored over a period of time for subjects following cancer therapy for which biomarker measurement values are known. In certain embodiments, the doses administered are standard doses known in the art for cancer therapeutic agents. The period of time for which subjects are monitored can vary. For example, subjects may be monitored for at least 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 25, 30, 35, 40, 45, 50, 55, or 60 months. Biomarker measurement threshold values that correlate to outcome of a cancer therapy can be determined using well-known methods in the art, such as those described in the Examples section.
The term "resistance" refers to an acquired or natural resistance of a cancer sample or a mammal to a cancer therapy ( i.e., being nonresponsive to or having reduced or limited response to the therapeutic treatment), such as having a reduced response to a therapeutic treatment by 25% or more, for example, 30%, 40%, 50%, 60%, 70%, 80%, or more, to 2- fold, 3-fold, 4-fold, 5-fold, 10-fold, 15-fold, 20-fold or more. The reduction in response can be measured by comparing with the same cancer sample or mammal before the resistance is acquired, or by comparing with a different cancer sample or a mammal that is known to have no resistance to the therapeutic treatment. A typical acquired resistance to chemotherapy is called "multidrug resistance." The multidrug resistance can be mediated by P-glycoprotein or can be mediated by other mechanisms, or it can occur when a mammal is infected with a multi-drug-resistant microorganism or a combination of microorganisms. The determination of resistance to a therapeutic treatment is routine in the art and within the skill of an ordinarily skilled clinician, for example, can be measured by cell proliferative assays and cell death assays as described herein as "sensitizing." In some embodiments, the term "reverses resistance" means that the use of a second agent in combination with a primary cancer therapy {e.g., chemotherapeutic or radiation therapy) is able to produce a significant decrease in tumor volume at a level of statistical significance {e.g., p<0.05) when compared to tumor volume of untreated tumor in the circumstance where the primary
cancer therapy (e.g., chemotherapeutic or radiation therapy) alone is unable to produce a statistically significant decrease in tumor volume compared to tumor volume of untreated tumor. This generally applies to tumor volume measurements made at a time when the untreated tumor is growing log rhythmically.
The terms "response" or "responsiveness" refers to an anti-cancer response, e.g. in the sense of reduction of tumor size or inhibiting tumor growth. The terms can also refer to an improved prognosis, for example, as reflected by an increased time to recurrence, which is the period to first recurrence censoring for second primary cancer as a first event or death without evidence of recurrence, or an increased overall survival, which is the period from treatment to death from any cause. To respond or to have a response means there is a beneficial endpoint attained when exposed to a stimulus. Alternatively, a negative or detrimental symptom is minimized, mitigated or attenuated on exposure to a stimulus. It will be appreciated that evaluating the likelihood that a tumor or subject will exhibit a favorable response is equivalent to evaluating the likelihood that the tumor or subject will not exhibit favorable response (i.e., will exhibit a lack of response or be non-responsive).
An "RNA interfering agent" as used herein, is defined as any agent which interferes with or inhibits expression of a target biomarker gene by RNA interference (RNAi). Such RNA interfering agents include, but are not limited to, nucleic acid molecules including RNA molecules which are homologous to the target biomarker gene of the present invention, or a fragment thereof, short interfering RNA (siRNA), and small molecules which interfere with or inhibit expression of a target biomarker nucleic acid by RNA interference (RNAi).
"RNA interference (RNAi)" is an evolutionally conserved process whereby the expression or introduction of RNA of a sequence that is identical or highly similar to a target biomarker nucleic acid results in the sequence specific degradation or specific post- transcriptional gene silencing (PTGS) of messenger RNA (mRNA) transcribed from that targeted gene (see Coburn and Cullen (2002) J. Virol. 76:9225), thereby inhibiting expression of the target biomarker nucleic acid. In one embodiment, the RNA is double stranded RNA (dsRNA). This process has been described in plants, invertebrates, and mammalian cells. In nature, RNAi is initiated by the dsRNA-specific endonuclease Dicer, which promotes processive cleavage of long dsRNA into double-stranded fragments termed siRNAs. siRNAs are incorporated into a protein complex that recognizes and cleaves target mRNAs. RNAi can also be initiated by introducing nucleic acid molecules, e.g., synthetic
siRNAs or RNA interfering agents, to inhibit or silence the expression of target biomarker nucleic acids. As used herein, "inhibition of target biomarker nucleic acid expression" or "inhibition of marker gene expression" includes any decrease in expression or protein activity or level of the target biomarker nucleic acid or protein encoded by the target biomarker nucleic acid. The decrease may be of at least 30%, 40%, 50%, 60%, 70%, 80%, 90%), 95%) or 99%) or more as compared to the expression of a target biomarker nucleic acid or the activity or level of the protein encoded by a target biomarker nucleic acid which has not been targeted by an RNA interfering agent.
The term "sample" used for detecting or determining the presence or level of at least one biomarker is typically brain tissue, cerebrospinal fluid, whole blood, plasma, serum, saliva, urine, stool (e.g., feces), tears, and any other bodily fluid (e.g., as described above under the definition of "body fluids"), or a tissue sample (e.g., biopsy) such as a small intestine, colon sample, or surgical resection tissue. In certain instances, the method of the present invention further comprises obtaining the sample from the individual prior to detecting or determining the presence or level of at least one marker in the sample.
The term "sensitize" means to alter cancer cells or tumor cells in a way that allows for more effective treatment of the associated cancer with a cancer therapy (e.g., anti- immune checkpoint, chemotherapeutic, and/or radiation therapy). In some embodiments, normal cells are not affected to an extent that causes the normal cells to be unduly injured by the anti-immune checkpoint therapy. An increased sensitivity or a reduced sensitivity to a therapeutic treatment is measured according to a known method in the art for the particular treatment and methods described herein below, including, but not limited to, cell proliferative assays (Tanigawa N, Kern D H, Kikasa Y, Morton D L, Cancer Res 1982; 42: 2159-2164), cell death assays (Weisenthal L M, Shoemaker R H, Marsden J A, Dill P L, Baker J A, Moran E M, Cancer Res 1984; 94: 161-173; Weisenthal L M, Lippman M E, Cancer Treat Rep 1985; 69: 615-632; Weisenthal L M, In: Kaspers G J L, Pieters R, Twentyman P R, Weisenthal L M, Veerman A J P, eds. Drug Resistance in Leukemia and Lymphoma. Langhorne, P A: Harwood Academic Publishers, 1993 : 415-432; Weisenthal L M, Contrib Gynecol Obstet 1994; 19: 82-90). The sensitivity or resistance may also be measured in animal by measuring the tumor size reduction over a period of time, for example, 6 month for human and 4-6 weeks for mouse. A composition or a method sensitizes response to a therapeutic treatment if the increase in treatment sensitivity or the reduction in resistance is 25% or more, for example, 30%, 40%, 50%, 60%, 70%, 80%, or
more, to 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 15-fold, 20-fold or more, compared to treatment sensitivity or resistance in the absence of such composition or method. The determination of sensitivity or resistance to a therapeutic treatment is routine in the art and within the skill of an ordinarily skilled clinician. It is to be understood that any method described herein for enhancing the efficacy of a cancer therapy can be equally applied to methods for sensitizing hyperproliferative or otherwise cancerous cells (e.g., resistant cells) to the cancer therapy.
The term "synergistic effect" refers to the combined effect of two or more anticancer agents (e.g., two or more PI3K/mTOR pathway inhibitors) can be greater than the sum of the separate effects of the anticancer agents alone.
"Short interfering RNA" (siRNA), also referred to herein as "small interfering RNA" is defined as an agent which functions to inhibit expression of a target biomarker nucleic acid, e.g., by RNAi. An siRNA may be chemically synthesized, may be produced by in vitro transcription, or may be produced within a host cell. In one embodiment, siRNA is a double stranded RNA (dsRNA) molecule of about 15 to about 40 nucleotides in length, preferably about 15 to about 28 nucleotides, more preferably about 19 to about 25 nucleotides in length, and more preferably about 19, 20, 21, or 22 nucleotides in length, and may contain a 3' and/or 5' overhang on each strand having a length of about 0, 1, 2, 3, 4, or 5 nucleotides. The length of the overhang is independent between the two strands, i.e., the length of the overhang on one strand is not dependent on the length of the overhang on the second strand. Preferably the siRNA is capable of promoting RNA interference through degradation or specific post-transcriptional gene silencing (PTGS) of the target messenger RNA (mRNA).
In another embodiment, an siRNA is a small hairpin (also called stem loop) RNA (shRNA). In one embodiment, these shRNAs are composed of a short (e.g., 19-25 nucleotide) antisense strand, followed by a 5-9 nucleotide loop, and the analogous sense strand. Alternatively, the sense strand may precede the nucleotide loop structure and the antisense strand may follow. These shRNAs may be contained in plasmids, retroviruses, and lentiviruses and expressed from, for example, the pol III U6 promoter, or another promoter (see, e.g., Stewart, et al. (2003) RNA Apr;9(4):493-501 incorporated by reference herein).
RNA interfering agents, e.g., siRNA molecules, may be administered to a patient having or at risk for having cancer, to inhibit expression of a biomarker gene which is overexpressed in cancer and thereby treat, prevent, or inhibit cancer in the subject.
The term "subject" refers to any healthy animal, mammal or human, or any animal, mammal or human afflicted with a cancer, e.g., brain metastasis, lung, ovarian, pancreatic, liver, breast, prostate, colon carcinomas, melanoma, multiple myeloma, and the like. The term "subject" is interchangeable with "patient."
The term "survival" includes all of the following: survival until mortality, also known as overall survival (wherein said mortality may be either irrespective of cause or tumor related); "recurrence-free survival" (wherein the term recurrence shall include both localized and distant recurrence); metastasis free survival; disease free survival (wherein the term disease shall include cancer and diseases associated therewith). The length of said survival may be calculated by reference to a defined start point (e.g. time of diagnosis or start of treatment) and end point (e.g. death, recurrence or metastasis). In addition, criteria for efficacy of treatment can be expanded to include response to chemotherapy, probability of survival, probability of metastasis within a given time period, and probability of tumor recurrence.
The term "therapeutic effect" refers to a local or systemic effect in animals, particularly mammals, and more particularly humans, caused by a pharmacologically active substance. The term thus means any substance intended for use in the diagnosis, cure, mitigation, treatment or prevention of disease or in the enhancement of desirable physical or mental development and conditions in an animal or human. The phrase "therapeutically- effective amount" means that amount of such a substance that produces some desired local or systemic effect at a reasonable benefit/risk ratio applicable to any treatment. In certain embodiments, a therapeutically effective amount of a compound will depend on its therapeutic index, solubility, and the like. For example, certain compounds discovered by the methods of the present invention may be administered in a sufficient amount to produce a reasonable benefit/risk ratio applicable to such treatment.
The terms "therapeutically-effective amount" and "effective amount" as used herein means that amount of a compound, material, or composition comprising a compound of the present invention which is effective for producing some desired therapeutic effect in at least a sub-population of cells in an animal at a reasonable benefit/risk ratio applicable to any medical treatment. Toxicity and therapeutic efficacy of subject compounds may be
determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 and the ED50. Compositions that exhibit large therapeutic indices are preferred. In some embodiments, the LD50 (lethal dosage) can be measured and can be, for example, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or more reduced for the agent relative to no administration of the agent. Similarly, the ED50 (i.e., the concentration which achieves a half-maximal inhibition of symptoms) can be measured and can be, for example, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or more increased for the agent relative to no administration of the agent. Also, Similarly, the IC50 (i.e., the concentration which achieves half-maximal cytotoxic or cytostatic effect on cancer cells) can be measured and can be, for example, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or more increased for the agent relative to no administration of the agent. In some embodiments, cancer cell growth in an assay can be inhibited by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or even 100%. In another embodiment, at least about a 10% , 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or even 100% decrease in a solid malignancy can be achieved.
A "transcribed polynucleotide" or "nucleotide transcript" is a polynucleotide (e.g. an mRNA, hnRNA, a cDNA, or an analog of such RNA or cDNA) which is complementary to or homologous with all or a portion of a mature mRNA made by transcription of a biomarker nucleic acid and normal post-transcriptional processing (e.g. splicing), if any, of the RNA transcript, and reverse transcription of the RNA transcript.
As used herein, the term "unresponsiveness" includes refractivity of cancer cells to therapy or refractivity of therapeutic cells, such as immune cells, to stimulation, e.g., stimulation via an activating receptor or a cytokine. Unresponsiveness can occur, e.g., because of exposure to immunosuppressants or exposure to high doses of antigen. As used herein, the term "anergy" or "tolerance" includes refractivity to activating receptor- mediated stimulation. Such refractivity is generally antigen-specific and persists after exposure to the tolerizing antigen has ceased. For example, anergy in T cells (as opposed to unresponsiveness) is characterized by lack of cytokine production, e.g., IL-2. T cell anergy occurs when T cells are exposed to antigen and receive a first signal (a T cell receptor or
CD-3 mediated signal) in the absence of a second signal (a costimulatory signal). Under these conditions, reexposure of the cells to the same antigen (even if reexposure occurs in the presence of a costimulatory polypeptide) results in failure to produce cytokines and, thus, failure to proliferate. Anergic T cells can, however, proliferate if cultured with cytokines (e.g., IL-2). For example, T cell anergy can also be observed by the lack of IL-2 production by T lymphocytes as measured by ELISA or by a proliferation assay using an indicator cell line. Alternatively, a reporter gene construct can be used. For example, anergic T cells fail to initiate IL-2 gene transcription induced by a heterologous promoter under the control of the 5' IL-2 gene enhancer or by a multimer of the API sequence that can be found within the enhancer (Kang et al. (1992) Science 257: 1134).
There is a known and definite correspondence between the amino acid sequence of a particular protein and the nucleotide sequences that can code for the protein, as defined by the genetic code (shown below). Likewise, there is a known and definite correspondence between the nucleotide sequence of a particular nucleic acid and the amino acid sequence encoded by that nucleic acid, as defined by the genetic code.
GENETIC CODE
Alanine (Ala, A) GCA, GCC, GCG, GCT
Arginine (Arg, R) AGA, ACG, CGA, CGC, CGG, CGT
Asparagine (Asn, N) AAC, AAT
Aspartic acid (Asp, D) GAC, GAT
Cysteine (Cys, C) TGC, TGT
Glutamic acid (Glu, E) GAA, GAG
Glutamine (Gin, Q) CAA, CAG
Glycine (Gly, G) GGA, GGC, GGG, GGT
Histidine (His, H) CAC, CAT
Isoleucine (He, I) ATA, ATC, ATT
Leucine (Leu, L) CTA, CTC, CTG, CTT, TTA, TTG
Lysine (Lys, K) AAA, AAG
Methionine (Met, M) ATG
Phenylalanine (Phe, Έ) TTC, TTT
Proline (Pro, P) CCA, CCC, CCG, CCT
Serine (Ser, S) AGC, AGT, TCA, TCC, TCG, TCT
Threonine (Thr, T) ACA, ACC, ACG, ACT
Tryptophan (Trp, W) TGG
Tyrosine (Tyr, Y) TAC, TAT
Valine (Val, V) GTA, GTC, GTG, GTT
Termination signal (end) TAA, TAG, TGA An important and well known feature of the genetic code is its redundancy, whereby, for most of the amino acids used to make proteins, more than one coding nucleotide triplet may be employed (illustrated above). Therefore, a number of different nucleotide sequences may code for a given amino acid sequence. Such nucleotide sequences are considered functionally equivalent since they result in the production of the same amino acid sequence in all organisms (although certain organisms may translate some sequences more efficiently than they do others). Moreover, occasionally, a methylated variant of a purine or pyrimidine may be found in a given nucleotide sequence. Such methylations do not affect the coding relationship between the trinucleotide codon and the corresponding amino acid.
In view of the foregoing, the nucleotide sequence of a DNA or RNA encoding a biomarker nucleic acid (or any portion thereof) can be used to derive the polypeptide amino acid sequence, using the genetic code to translate the DNA or RNA into an amino acid sequence. Likewise, for polypeptide amino acid sequence, corresponding nucleotide sequences that can encode the polypeptide can be deduced from the genetic code (which, because of its redundancy, will produce multiple nucleic acid sequences for any given amino acid sequence). Thus, description and/or disclosure herein of a nucleotide sequence which encodes a polypeptide should be considered to also include description and/or disclosure of the amino acid sequence encoded by the nucleotide sequence. Similarly, description and/or disclosure of a polypeptide amino acid sequence herein should be considered to also include description and/or disclosure of all possible nucleotide sequences that can encode the amino acid sequence.
Finally, nucleic acid and amino acid sequence information for the loci and biomarkers of the present invention (e.g., biomarkers listed in Tables 1 and 2) are well known in the art and readily available on publicly available databases, such as the National Center for Biotechnology Information (NCBI). For example, exemplary nucleic acid and amino acid sequences derived from publicly available sequence databases are provided below and include, for example, PCT Publ. WO 2014/022759, which is incorporated herein in its entirety by this reference.
Table 1
SEP ID NO: 1 Human PIK3CA cDNA Acid Sequence
1 atgcctccac gaccatcatc aggtgaactg tggggcatcc acttgatgcc cccaagaatc
61 ctagtagaat gtttactacc aaatggaatg atagtgactt tagaatgcct ccgtgaggct
121 acattaataa ccataaagca tgaactattt aaagaagcaa gaaaataccc cctccatcaa
181 cttcttcaag atgaatcttc ttacattttc gtaagtgtta ctcaagaagc agaaagggaa
241 gaattttttg atgaaacaag acgactttgt gaccttcggc tttttcaacc ctttttaaaa 301 gtaattgaac cagtaggcaa ccgtgaagaa aagatcctca atcgagaaat tggttttgct
361 atcggcatgc cagtgtgtga atttgatatg gttaaagatc cagaagtaca ggacttccga
421 agaaatattc tgaacgtttg taaagaagct gtggatctta gggacctcaa ttcacctcat
481 agtagagcaa tgtatgtcta tcctccaaat gtagaatctt caccagaatt gccaaagcac
541 atatataata aattagataa agggcaaata atagtggtga tctgggtaat agtttctcca 601 aataatgaca agcagaagta tactctgaaa atcaaccatg actgtgtacc agaacaagta
661 attgctgaag caatcaggaa aaaaactcga agtatgttgc tatcctctga acaactaaaa
721 ctctgtgttt tagaatatca gggcaagtat attttaaaag tgtgtggatg tgatgaatac
781 ttcctagaaa aatatcctct gagtcagtat aagtatataa gaagctgtat aatgcttggg
841 aggatgccca atttgatgtt gatggctaaa gaaagccttt attctcaact gccaatggac 901 tgttttacaa tgccatctta ttccagacgc atttccacag ctacaccata tatgaatgga
961 gaaacatcta caaaatccct ttgggttata aatagtgcac tcagaataaa aattctttgt
1021 gcaacctacg tgaatgtaaa tattcgagac attgataaga tctatgttcg aacaggtatc
1081 taccatggag gagaaccctt atgtgacaat gtgaacactc aaagagtacc ttgttccaat
1141 cccaggtgga atgaatggct gaattatgat atatacattc ctgatcttcc tcgtgctgct 1201 cgactttgcc tttccatttg ctctgttaaa ggccgaaagg gtgctaaaga ggaacactgt
1261 ccattggcat ggggaaatat aaacttgttt gattacacag acactctagt atctggaaaa
1321 atggctttga atctttggcc agtacctcat ggattagaag atttgctgaa ccctattggt
1381 gttactggat caaatccaaa taaagaaact ccatgcttag agttggagtt tgactggttc
1441 agcagtgtgg taaagttccc agatatgtca gtgattgaag agcatgccaa ttggtctgta 1501 tcccgagaag caggatttag ctattcccac gcaggactga gtaacagact agctagagac
1561 aatgaattaa gggaaaatga caaagaacag ctcaaagcaa tttctacacg agatcctctc
1621 tctgaaatca ctgagcagga gaaagatttt ctatggagtc acagacacta ttgtgtaact
1681 atccccgaaa ttctacccaa attgcttctg tctgttaaat ggaattctag agatgaagta
1741 gcccagatgt attgcttggt aaaagattgg cctccaatca aacctgaaca ggctatggaa 1801 cttctggact gtaattaccc agatcctatg gttcgaggtt ttgctgttcg gtgcttggaa
1861 aaatatttaa cagatgacaa actttctcag tatttaattc agctagtaca ggtcctaaaa
1921 tatgaacaat atttggataa cttgcttgtg agatttttac tgaagaaagc attgactaat
1981 caaaggattg ggcacttttt cttttggcat ttaaaatctg agatgcacaa taaaacagtt
2041 agccagaggt ttggcctgct tttggagtcc tattgtcgtg catgtgggat gtatttgaag 2101 cacctgaata ggcaagtcga ggcaatggaa aagctcatta acttaactga cattctcaaa
2161 caggagaaga aggatgaaac acaaaaggta cagatgaagt ttttagttga gcaaatgagg
2221 cgaccagatt tcatggatgc tctacagggc tttctgtctc ctctaaaccc tgctcatcaa
2281 ctaggaaacc tcaggcttga agagtgtcga attatgtcct ctgcaaaaag gccactgtgg
2341 ttgaattggg agaacccaga catcatgtca gagttactgt ttcagaacaa tgagatcatc 2401 tttaaaaatg gggatgattt acggcaagat atgctaacac ttcaaattat tcgtattatg
2461 gaaaatatct ggcaaaatca aggtcttgat cttcgaatgt taccttatgg ttgtctgtca
2521 atcggtgact gtgtgggact tattgaggtg gtgcgaaatt ctcacactat tatgcaaatt
2581 cagtgcaaag gcggcttgaa aggtgcactg cagttcaaca gccacacact acatcagtgg
2641 ctcaaagaca agaacaaagg agaaatatat gatgcagcca ttgacctgtt tacacgttca 2701 tgtgctggat actgtgtagc taccttcatt ttgggaattg gagatcgtca caatagtaac
2761 atcatggtga aagacgatgg acaactgttt catatagatt ttggacactt tttggatcac
2821 aagaagaaaa aatttggtta taaacgagaa cgtgtgccat ttgttttgac acaggatttc
2881 ttaatagtga ttagtaaagg agcccaagaa tgcacaaaga caagagaatt tgagaggttt
2941 caggagatgt gttacaaggc ttatctagct attcgacagc atgccaatct cttcataaat 3001 cttttctcaa tgatgcttgg ctctggaatg ccagaactac aatcttttga tgacattgca
3061 tacattcgaa agaccctagc cttagataaa actgagcaag aggctttgga gtatttcatg
3121 aaacaaatga atgatgcaca tcatggtggc tggacaacaa aaatggattg gatcttccac 3181 acaattaaac agcatgcatt gaactga
SEP ID NO: 2 Human PIK3CA Amino Acid Sequence
1 mpprpssgel wgihlmppri lvecllpngm ivtleclrea tlitikhelf kearkyplhq 61 llqdessyif vsvtqeaere effdetrrlc dlrlfqpflk viepvgnree kilnreigfa 121 igmpvcefdm vkdpevqdfr rnilnvckea vdlrdlnsph sramyvyppn vesspelpkh 181 iynkldkgqi ivviwvivsp nndkqkytlk inhdcvpeqv iaeairkktr smllsseqlk 241 lcvleyqgky ilkvcgcdey flekyplsqy kyirscimlg rmpnlmlmak eslysqlpmd 301 cftmpsysrr istatpymng etstkslwvi nsalrikilc atyvnvnird idkiyvrtgi 361 yhggeplcdn vntqrvpcsn prwnewlnyd iyipdlpraa rlclsicsvk grkgakeehc 421 plawgninlf dytdtlvsgk malnlwpvph gledllnpig vtgsnpnket pclelefdwf 481 ssvvkfpdms vieehanwsv sreagfsysh aglsnrlard nelrendkeq lkaistrdpl 541 seiteqekdf lwshrhycvt ipeilpklll svkwnsrdev aqmyclvkdw ppikpeqame 601 lldcnypdpm vrgfavrcle kyltddklsq yliqlvqvlk yeqyldnllv rfllkkaltn 661 qrighfffwh lksemhnktv sqrfgllles ycracgmylk hlnrqveame klinltdilk 721 qekkdetqkv qmkflveqmr rpdfmdalqg flsplnpahq lgnlrleecr imssakrplw 781 lnwenpdims ellfqnneii fkngddlrqd mltlqiirim eniwqnqgld lrmlpygcls 841 igdcvgliev vrnshtimqi qckgglkgal qfnshtlhqw lkdknkgeiy daaidlftrs 901 cagycvatfi lgigdrhnsn imvkddgqlf hidfghfldh kkkkfgykre rvpfvltqdf 961 liviskgaqe ctktreferf qemcykayla irqhanlfin lfsmmlgsgm pelqsfddia 1021 yirktlaldk teqealeyfm kqmndahhgg wttkmdwifh tikqhaln
SEP ID NO: 3 Mouse PIK3CA (Transcript 1) cDNA Acid Sequence
1 atgcctccac gaccatcttc gggtgaactg tggggcatcc acttgatgcc cccacgaatc 61 ctagtggaat gtttactccc caatggaatg atagtgactt tagaatgcct ccgtgaggcc 121 acactcgtca ccatcaaaca tgaactgttc agagaggcca ggaaataccc tctccatcag 181 cttctgcaag acgaaacttc ttacattttc gtaagtgtca cccaagaagc agaaagggaa 241 gaattttttg atgaaacaag acgactttgt gaccttcggc tttttcaacc ctttttaaaa 301 gttattgaac cagtaggcaa ccgtgaagaa aagatcctca atcgagaaat tggttttgtt 361 attggcatgc cagtgtgtga atttgatatg gttaaagatc cagaagtcca agactttcga 421 aggaacattc tgaatgtttg caaagaagct gtggacctgc gggatctcaa ctcgcctcat 481 agcagagcaa tgtatgtcta ccctccaaat gtcgagtctt ccccagaact gccaaagcac 541 atctacaaca agttagataa aggacaaatc atagtggtga tttgggtaat agtctctcca 601 aacaacgaca agcagaagta cactctgaag atcaatcatg actgtgtgcc agagcaagtc 661 attgctgaag ccatcaggaa aaagactcgg agcatgttgt tgtcctctga gcagctgaaa 721 ctctgtgtct tagaatatca gggcaagtat attctgaaag tgtgtggctg tgacgaatac 781 ttcctggaaa agtaccctct gagtcagtac aagtacataa gaagctgtat aatgctgggg 841 aggatgccca acttgatgct gatggccaaa gaaagcctat actctcagct gccgattgat 901 agcttcacca tgccgtcata ctccaggcgc atctccacag ccacacccta catgaatgga 961 gagacatcta cgaaatccct ctgggtcata aatagtgcgc tcagaataaa aaaattttccttttttggtt 1021 gcaacctatg taaatgtaaa tattcgagac attgataaga tctatgttcg aacaggtatc 1081 taccatggag gagaaccctt atgtgacaat gtgaacactc aaagagtacc ttgttccaat 1141 cctaggtgga atgaatggct gaattatgat atatacattc ctgatcttcc tcgtgctgcg 1201 cgcctttgcc tttcaatctg ctctgttaaa ggccgaaagg gtgctaagga ggagcactgt 1261 ccgttggcct ggggaaacat aaacttgttt gattatacag acaccctagt gtccgggaaa 1321 atggctttga atctctggcc tgtaccgcat gggttagaag atctgctgaa ccctattggt 1381 gttactgggt caaatccaaa taaagaaact ccatgcttag agttggagtt tgattggttc 1441 agcagtgtgg tgaagtttcc agacatgtct gtgatcgaag aacatgccaa ttggtccgtg 1501 tcccgagaag ctggattcag ttactcccat acaggactga gtaacagact agccagagac 1561 aatgagttaa gagaaaatga caaggaacag ctccgagcac tttgcacccg ggacccacta 1621 tctgaaatca ctgaacaaga gaaagacttc ctatggagcc acagacacta ctgcgtaact 1681 attcctgaaa tcctacccaa attgcttctg tctgtcaagt ggaattccag agacgaagtg 1741 gcccagatgt actgcttagt aaaagattgg cctccaatca aaccagagca agccatggaa 1801 ctcctggact gtaactatcc agatcctatg gttcggagtt ttgctgttcg gtgcttagaa 1861 aaatatttaa cagatgacaa actttctcag tacctcattc aacttgtaca ggtcttaaaa 1921 tatgaacagt atttggataa cctgcttgtg agatttttac tcaagaaagc attgacaaat 1981 caaaggattg gccatttttt cttttggcat ttaaaatctg agatgcacaa taagactgtc 2041 agtcagaggt ttggcctgct attggagtcc tactgccgtg cctgtgggat gtatctgaag 2101 cacctgaaca gacaagtaga ggccatggag aagctcatca acctaacgga catccttaag 2161 caggagaaga aggatgagac acaaaaggta cagatgaagt ttttggttga acagatgaga 2221 cagccagact tcatggatgc tttgcagggt tttctgtccc ctctgaatcc tgctcaccaa 2281 ctaggaaacc tcaggcttga agagtgtcga attatgtcct ctgcaaaaag gccactgtgg
2341 ttgaattggg agaacccaga catcatgtca gagctactgt ttcagaacaa tgagatcatc 2401 tttaaaaatg gcgacgactt acggcaagat atgttaaccc ttcagatcat ccgaatcatg 2461 gagaacatct ggcaaaacca aggccttgac cttcgcatgc taccttatgg ctgtctatcc 2521 attggggact gtgtgggtct catcgaggtg gtgagaaact ctcacaccat catgcaaatc 2581 cagtgcaaag gaggcctgaa gggggcgctg cagttcaaca gccacacact gcatcaatgg 2641 ctcaaggaca agaacaaggg cgagatatat gatgcagcca ttgacctgtt cactcggtcc 2701 tgcgctgggt actgcgtggc aacctttatc ttgggaattg gagaccggca caacagcaac 2761 atcatggtga aagatgacgg acagctgttt catatagatt ttgggcactt tttggatcac 2821 aagaagaaaa aatttggcta taagcgggaa cgtgtgccat ttgtgttgac acaggatttc 2881 ttgattgtga ttagtaaggg agcacaagag tacaccaaga ccagagagtt tgagaggttt 2941 caggagatgt gttacaaggc ttacctagca attcggcagc atgccaatct cttcatcaac 3001 cttttttcaa tgatgcttgg ctctggaatg ccagaactac aatcttttga tgacattgca 3061 tatatccgaa agactctagc cttggacaaa actgagcaag aagctttgga atatttcaca 3121 aagcaaatga atgatgcaca tcatggtgga tggacgacaa aaatggattg gatcttccac 3181 accatcaagc agcatgcttt gaactga
SEP ID NO: 4 Mouse PIK3CA (Isoform 1) Amino Acid Sequence
1 mpprpssgel wgihlmppri lvecllpngm ivtleclrea tlvtikhelf rearkyplhq 61 llqdetsyif vsvtqeaere effdetrrlc dlrlfqpflk viepvgnree kilnreigfv 121 igmpvcefdm vkdpevqdfr rnilnvckea vdlrdlnsph sramyvyppn vesspelpkh 181 iynkldkgqi ivviwvivsp nndkqkytlk inhdcvpeqv iaeairkktr smllsseqlk 241 lcvleyqgky ilkvcgcdey flekyplsqy kyirscimlg rmpnlmlmak eslysqlpid 301 sftmpsysrr istatpymng etstkslwvi nsalrikilc atyvnvnird idkiyvrtgi 361 yhggeplcdn vntqrvpcsn prwnewlnyd iyipdlpraa rlclsicsvk grkgakeehc 421 plawgninlf dytdtlvsgk malnlwpvph gledllnpig vtgsnpnket pclelefdwf 481 ssvvkfpdms vieehanwsv sreagfsysh tglsnrlard nelrendkeq lralctrdpl 541 seiteqekdf lwshrhycvt ipeilpklll svkwnsrdev aqmyclvkdw ppikpeqame 601 lldcnypdpm vrsfavrcle kyltddklsq yliqlvqvlk yeqyldnllv rfllkkaltn 661 qrighfffwh lksemhnktv sqrfgllles ycracgmylk hlnrqveame klinltdilk 721 qekkdetqkv qmkflveqmr qpdfmdalqg flsplnpahq lgnlrleecr imssakrplw 781 lnwenpdims ellfqnneii fkngddlrqd mltlqiirim eniwqnqgld lrmlpygcls 841 igdcvgliev vrnshtimqi qckgglkgal qfnshtlhqw lkdknkgeiy daaidlftrs 901 cagycvatfi lgigdrhnsn imvkddgqlf hidfghfldh kkkkfgykre rvpfvltqdf 961 liviskgaqe ytktreferf qemcykayla irqhanlfin lfsmmlgsgm pelqsfddia 1021 yirktlaldk teqealeyft kqmndahhgg wttkmdwifh tikqhaln
SEP ID NO: 5 Mouse PIK3CA ( Transcript 2) cDNA Acid Sequence
1 atgcctccac gaccatcttc gggtgaactg tggggcatcc acttgatgcc cccacgaatc 61 ctagtggaat gtttactccc caatggaatg atagtgactt tagaatgcct ccgtgaggcc 121 acactcgtca ccatcaaaca tgaactgttc agagaggcca ggaaataccc tctccatcag 181 cttctgcaag acgaaacttc ttacattttc gtaagtgtca cccaagaagc agaaagggaa 241 gaattttttg atgaaacaag acgactttgt gaccttcggc tttttcaacc ctttttaaaa 301 gttattgaac cagtaggcaa ccgtgaagaa aagatcctca atcgagaaat tggttttgtt 361 attggcatgc cagtgtgtga atttgatatg gttaaagatc cagaagtcca agactttcga 421 aggaacattc tgaatgtttg caaagaagct gtggacctgc gggatctcaa ctcgcctcat 481 agcagagcaa tgtatgtcta ccctccaaat gtcgagtctt ccccagaact gccaaagcac 541 atctacaaca agttagataa aggacaaatc atagtggtga tttgggtaat agtctctcca 601 aacaacgaca agcagaagta cactctgaag atcaatcatg actgtgtgcc agagcaagtc 661 attgctgaag ccatcaggaa aaagactcgg agcatgttgt tgtcctctga gcagctgaaa 721 ctctgtgtct tagaatatca gggcaagtat attctgaaag tgtgtggctg tgacgaatac 781 ttcctggaaa agtaccctct gagtcagtac aagtacataa gaagctgtat aatgctgggg 841 aggatgccca acttgatgct gatggccaaa gaaagcctat actctcagct gccgattgat 901 agcttcacca tgccgtcata ctccaggcgc atctccacag ccacacccta catgaatgga 961 gagacatcta cgaaatccct ctgggtcata aatagtgcgc tcagaataaa aattctttgt 1021 gcaacctatg taaatgtaaa tattcgagac attgataaga tctatgttcg aacaggtatc 1081 taccatggag gagaaccctt atgtgacaat gtgaacactc aaagagtacc ttgttccaat 1141 cctaggtgga atgaatggct gaattatgat atatacattc ctgatcttcc tcgtgctgcg 1201 cgcctttgcc tttcaatctg ctctgttaaa ggccgaaagg gtgctaagga ggagcactgt 1261 ccgttggcct ggggaaacat aaacttgttt gattatacag acaccctagt gtccgggaaa 1321 atggctttga atctctggcc tgtaccgcat gggttagaag atctgctgaa ccctattggt
1381 gttactgggt caaatccaaa taaagaaact ccatgcttag agttggagtt tgattggttc 1441 agcagtgtgg tgaagtttcc agacatgtct gtgatcgaag aacatgccaa ttggtccgtg 1501 tcccgagaag ctggattcag ttactcccat acaggactga gtaacagact agccagagac 1561 aatgagttaa gagaaaatga caaggaacag ctccgagcac tttgcacccg ggacccacta 1621 tctgaaatca ctgaacaaga gaaagacttc ctatggagcc acagacacta ctgcgtaact 1681 attcctgaaa tcctacccaa attgcttctg tctgtcaagt ggaattccag agacgaagtg 1741 gcccagatgt actgcttagt aaaagattgg cctccaatca aaccagagca agccatggaa 1801 ctcctggact gtaactatcc agatcctatg gttcggagtt ttgctgttcg gtgcttagaa 1861 aaatatttaa cagatgacaa actttctcag tacctcattc aacttgtaca ggtcttaaaa 1921 tatgaacagt atttggataa cctgcttgtg agatttttac tcaagaaagc attgacaaat 1981 caaaggattg gccatttttt cttttggcat ttaaaatctg agatgcacaa taagactgtc 2041 agtcagaggt ttggcctgct attggagtcc tactgccgtg cctgtgggat gtatctgaag 2101 cacctgaaca gacaagtaga ggccatggag aagctcatca acctaacgga catccttaag 2161 caggagaaga aggatgagac acaaaaggta cagatgaagt ttttggttga acagatgaga 2221 cagccagact tcatggatgc tttgcagggt tttctgtccc ctctgaatcc tgctcaccaa 2281 ctaggaaacc tcaggcttga agagtgtcga attatgtcct ctgcaaaaag gccactgtgg 2341 ttgaattggg agaacccaga catcatgtca gagctactgt ttcagaacaa tgagatcatc 2401 tttaaaaatg gcgacgactt acggcaagat atgttaaccc ttcagatcat ccgaatcatg 2461 gagaacatct ggcaaaacca aggccttgac cttcgcatgc taccttatgg ctgtctatcc 2521 attggggact gtgtgggtct catcgaggtg gtgagaaact ctcacaccat catgcaaatc 2581 cagtgcaaag gaggcctgaa gggggcgctg cagttcaaca gccacacact gcatcaatgg 2641 ctcaaggaca agaacaaggg cgagatatat gatgcagcca ttgacctgtt cactcggtcc 2701 tgcgctgggt actgcgtggc aacctttatc ttgggaattg gagaccggca caacagcaac 2761 atcatggtga aagatgacgg acagctgttt catatagatt ttgggcactt tttggatcac 2821 aagaagaaaa aatttggcta taagcgggaa cgtgtgccat ttgtgttgac acaggatttc 2881 ttgattgtga ttagtaaggg agcacaagag tacaccaaga ccagagagtt tgagaggttt 2941 caggagatgt gttacaaggc ttacctagca attcggcagc atgccaatct cttcatcaac 3001 cttttttcaa tgatgcttgg ctctggaatg ccagaactac aatcttttga tgacattgca 3061 tatatccgaa agactctagc cttggacaaa actgagcaag aagctttgga atatttcaca 3121 aagcaaatga atgatgcaca tcatggtgga tggacgacaa aaatggattg gatcttccac 3181 accatcaagc agcatgcttt gaactga
SEP ID NO: 6 Mouse PIK3CA (Isoform 2) Amino Acid Sequence
1 mpprpssgel wgihlmppri lvecllpngm ivtleclrea tlvtikhelf rearkyplhq 61 llqdetsyif vsvtqeaere effdetrrlc dlrlfqpflk viepvgnree kilnreigfv 121 igmpvcefdm vkdpevqdfr rnilnvckea vdlrdlnsph sramyvyppn vesspelpkh 181 iynkldkgqi ivviwvivsp nndkqkytlk inhdcvpeqv iaeairkktr smllsseqlk 241 lcvleyqgky ilkvcgcdey flekyplsqy kyirscimlg rmpnlmlmak eslysqlpid 301 sftmpsysrr istatpymng etstkslwvi nsalrikilc atyvnvnird idkiyvrtgi 361 yhggeplcdn vntqrvpcsn prwnewlnyd iyipdlpraa rlclsicsvk grkgakeehc 421 plawgninlf dytdtlvsgk malnlwpvph gledllnpig vtgsnpnket pclelefdwf 481 ssvvkfpdms vieehanwsv sreagfsysh tglsnrlard nelrendkeq lralctrdpl 541 seiteqekdf lwshrhycvt ipeilpklll svkwnsrdev aqmyclvkdw ppikpeqame 601 lldcnypdpm vrsfavrcle kyltddklsq yliqlvqvlk yeqyldnllv rfllkkaltn 661 qrighfffwh lksemhnktv sqrfgllles ycracgmylk hlnrqveame klinltdilk 721 qekkdetqkv qmkflveqmr qpdfmdalqg flsplnpahq lgnlrleecr imssakrplw 781 lnwenpdims ellfqnneii fkngddlrqd mltlqiirim eniwqnqgld lrmlpygcls 841 igdcvgliev vrnshtimqi qckgglkgal qfnshtlhqw lkdknkgeiy daaidlftrs 901 cagycvatfi lgigdrhnsn imvkddgqlf hidfghfldh kkkkfgykre rvpfvltqdf 961 liviskgaqe ytktreferf qemcykayla irqhanlfin lfsmmlgsgm pelqsfddia 1021 yirktlaldk teqealeyft kqmndahhgg wttkmdwifh tikqhaln
SEP ID NO: 7 Human PIK3CB (Transcript 1) cDNA Acid Sequence
1 atgtgcttca gtttcataat gcctcctgct atggcagaca tccttgacat ctgggcggtg
61 gattcacaga tagcatctga tggctccata cctgtggatt tccttttgcc cactgggatt
121 tatatccagt tggaggtacc tcgggaagct accatttctt atattaagca gatgttatgg
181 aagcaagttc acaattaccc aatgttcaac ctccttatgg atattgactc ctatatgttt
241 gcatgtgtga atcagactgc tgtatatgag gagcttgaag atgaaacacg aagactctgt
301 gatgtcagac cttttcttcc agttctcaaa ttagtgacaa gaagttgtga cccaggggaa
361 aaattagact caaaaattgg agtccttata ggaaaaggtc tgcatgaatt tgattccttg
421 aaggatcctg aagtaaatga atttcgaaga aaaatgcgca aattcagcga ggaaaaaatc 481 ctgtcacttg tgggattgtc ttggatggac tggctaaaac aaacatatcc accagagcat 541 gaaccatcca tccctgaaaa cttagaagat aaactttatg ggggaaagct catcgtagct 601 gttcattttg aaaactgcca ggacgtgttt agctttcaag tgtctcctaa tatgaatcct 661 atcaaagtaa atgaattggc aatccaaaaa cgtttgacta ttcatgggaa ggaagatgaa 721 gttagcccct atgattatgt gttgcaagtc agcgggagag tagaatatgt ttttggtgat 781 catccactaa ttcagttcca gtatatccgg aactgtgtga tgaacagagc cctgccccat 841 tttatacttg tggaatgctg caagatcaag aaaatgtatg aacaagaaat gattgccata 901 gaggctgcca taaatcgaaa ttcatctaat cttcctcttc cattaccacc aaagaaaaca 961 cgaattattt ctcatgtttg ggaaaataac aaccctttcc aaattgtctt ggttaaggga 1021 aataaactta acacagagga aactgtaaaa gttcatgtca gggctggtct ttttcatggt 1081 actgagctcc tgtgtaaaac catcgtaagc tcagaggtat cagggaaaaa tgatcatatt 1141 tggaatgaac cactggaatt tgatattaat atttgtgact taccaagaat ggctcgatta 1201 tgttttgctg tttatgcagt tttggataaa gtaaaaacga agaaatcaac gaaaactatt 1261 aatccctcta aatatcagac catcaggaaa gctggaaaag tgcattatcc tgtagcgtgg 1321 gtaaatacga tggtttttga ctttaaagga caattgagaa ctggagacat aatattacac 1381 agctggtctt catttcctga tgaactcgaa gaaatgttga atccaatggg aactgttcaa 1441 acaaatccat atactgaaaa tgcaacagct ttgcatgtta aatttccaga gaataaaaaa 1501 caaccttatt attaccctcc cttcgataag attattgaaa aggcagctga gattgcaagc 1561 agtgatagtg ctaatgtgtc aagtcgaggt ggaaaaaagt ttcttcctgt attgaaagaa 1621 atcttggaca gggatccctt gtctcaactg tgtgaaaatg aaatggatct tatttggact 1681 ttgcgacaag actgccgaga gattttccca caatcactgc caaaattact gctgtcaatc 1741 aagtggaata aacttgagga tgttgctcag cttcaggcgc tgcttcagat ttggcctaaa 1801 ctgccccccc gggaggccct agagcttctg gatttcaact atccagacca gtacgttcga 1861 gaatatgctg taggctgcct gcgacagatg agtgatgaag aactttctca atatctttta 1921 caactggtgc aagtgttaaa atatgagcct tttcttgatt gtgccctctc tagattccta 1981 ttagaaagag cacttggtaa tcggaggata gggcagtttc tattttggca tcttaggtca 2041 gaagtgcaca ttcctgctgt ctcagtacaa tttggtgtca tccttgaagc atactgccgg 2101 ggaagtgtgg ggcacatgaa agtgctttct aagcaggttg aagcactcaa taagttaaaa 2161 actttaaata gtttaatcaa actgaatgcc gtgaagttaa acagagccaa agggaaggag 2221 gccatgcata cctgtttaaa acagagtgct taccgggaag ccctctctga cctgcagtca 2281 cccctgaacc catgtgttat cctctcagaa ctctatgttg aaaagtgcaa atacatggat 2341 tccaaaatga agcctttgtg gctggtatac aataacaagg tatttggtga ggattcagtt 2401 ggagtgattt ttaaaaatgg tgatgattta cgacaggata tgttgacact ccaaatgttg 2461 cgcttgatgg atttactctg gaaagaagct ggtttggatc ttcggatgtt gccttatggc 2521 tgtttagcaa caggagatcg ctctggcctc attgaagttg tgagcacctc tgaaacaatt 2581 gctgacattc agctgaacag tagcaatgtg gctgctgcag cagccttcaa caaagatgcc 2641 cttctgaact ggcttaaaga atacaactct ggggatgacc tggaccgagc cattgaggaa 2701 tttacactgt cctgtgctgg ctactgtgta gcttcttatg tccttgggat tggtgacaga 2761 catagtgaca acatcatggt caaaaaaact ggccagctct tccacattga ctttggacat 2821 attcttggaa atttcaaatc taagtttggc attaaaaggg agcgagtgcc ttttattctt 2881 acctatgatt tcatccatgt cattcaacaa ggaaaaacag gaaatacaga aaagtttggc 2941 cggttccgcc agtgttgtga ggatgcatat ctgattttac gacggcatgg gaatctcttc 3001 atcactctct ttgcgctgat gttgactgca gggcttcctg aactcacatc agtcaaagat 3061 atacagtatc ttaaggactc tcttgcatta gggaagagtg aagaagaagc actcaaacag 3121 tttaagcaaa aatttgatga ggcgctcagg gaaagctgga ctactaaagt gaactggatg 3181 gcccacacag ttcggaaaga ctacagatct taa
SEP ID NO: 8 Human PIK3CB (Isoform 1) Amino Acid Sequence
1 mcfs fimppa madildiwav dsqiasdgsi pvdfllptgi yiqlevprea tisyikqmlw 61 kqvhnypmfn llmdidsymf acvnqtavye eledetrrlc dvrpflpvlk lvtrscdpge 121 kldskigvli gkglhefdsl kdpevnefrr kmrkfseeki lslvglswmd wlkqtyppeh 181 epsipenled klyggkliva vhfencqdvf s fqvspnmnp ikvnelaiqk rltihgkede 241 vspydyvlqv sgrveyvfgd hpliqfqyir ncvmnralph filvecckik kmyeqemiai 301 eaainrnssn lplplppkkt riishvwenn npfqivlvkg nklnteetvk vhvraglfhg 361 tellcktivs sevsgkndhi wneplefdin icdlprmarl cfavyavldk vktkkstkti 421 npskyqtirk agkvhypvaw vntmvfdfkg qlrtgdiilh swssfpdele emlnpmgtvq 481 tnpytenata lhvkfpenkk qpyyyppfdk iiekaaeias sdsanvssrg gkkflpvlke 541 ildrdplsql cenemdliwt lrqdcreifp qslpklllsi kwnkledvaq lqallqiwpk 601 lpprealell dfnypdqyvr eyavgclrqm sdeelsqyll qlvqvlkyep fldcalsrfl
661 leralgnrri gqfIfwhirs evhipavsvq fgvileaycr gsvghmkvls kqvealnklk 721 tlnsliklna vklnrakgke amhtclkqsa yrealsdlqs plnpcvilse lyvekckymd
781 skmkplwlvy nnkvfgedsv gvifkngddl rqdmltlqml rlmdllwkea gldlrmlpyg
841 clatgdrsgl ievvstseti adiqlnssnv aaaaafnkda llnwlkeyns gddldraiee
901 ftlscagycv asyvlgigdr hsdnimvkkt gqlfhidfgh ilgnfkskfg ikrervpfil
961 tydfihviqq gktgntekfg rfrqcceday lilrrhgnlf itlfalmlta glpeltsvkd
1021 iqylkdslal gkseeealkq fkqkfdealr eswttkvnwm ahtvrkdyrs
SEP ID NO: 9 Human PIK3CB (Transcript 2) cDNA Acid Sequence
1 atgttgaatc caatgggaac tgttcaaaca aatccatata ctgaaaatgc aacagctttg 61 catgttaaat ttccagagaa taaaaaacaa ccttattatt accctccctt cgataagagt 121 cgaggtggaa aaaagtttct tcctgtattg aaagaaatct tggacaggga tcccttgtct 181 caactgtgtg aaaatgaaat ggatcttatt tggactttgc gacaagactg ccgagagatt 241 ttcccacaat cactgccaaa attactgctg tcaatcaagt ggaataaact tgaggatgtt 301 gctcagcttc aggcgctgct tcagatttgg cctaaactgc ccccccggga ggccctagag 361 cttctggatt tcaactatcc agaccagtac gttcgagaat atgctgtagg ctgcctgcga 421 cagatgagtg atgaagaact ttctcaatat cttttacaac tggtgcaagt gttaaaatat 481 gagccttttc ttgattgtgc cctctctaga ttcctattag aaagagcact tggtaatcgg 541 aggatagggc agtttctatt ttggcatctt aggtcagaag tgcacattcc tgctgtctca 601 gtacaatttg gtgtcatcct tgaagcatac tgccggggaa gtgtggggca catgaaagtg 661 ctttctaagc aggttgaagc actcaataag ttaaaaactt taaatagttt aatcaaactg 721 aatgccgtga agttaaacag agccaaaggg aaggaggcca tgcatacctg tttaaaacag 781 agtgcttacc gggaagccct ctctgacctg cagtcacccc tgaacccatg tgttatcctc 841 tcagaactct atgttgaaaa gtgcaaatac atggattcca aaatgaagcc tttgtggctg 901 gtatacaata acaaggtatt tggtgaggat tcagttggag tgatttttaa aaatggtgat 961 gatttacgac aggatatgtt gacactccaa atgttgcgct tgatggattt actctggaaa 1021 gaagctggtt tggatcttcg gatgttgcct tatggctgtt tagcaacagg agatcgctct 1081 ggcctcattg aagttgtgag cacctctgaa acaattgctg acattcagct gaacagtagc 1141 aatgtggctg ctgcagcagc cttcaacaaa gatgcccttc tgaactggct taaagaatac 1201 aactctgggg atgacctgga ccgagccatt gaggaattta cactgtcctg tgctggctac 1261 tgtgtagctt cttatgtcct tgggattggt gacagacata gtgacaacat catggtcaaa 1321 aaaactggcc agctcttcca cattgacttt ggacatattc ttggaaattt caaatctaag 1381 tttggcatta aaagggagcg agtgcctttt attcttacct atgatttcat ccatgtcatt 1441 caacaaggaa aaacaggaaa tacagaaaag tttggccggt tccgccagtg ttgtgaggat 1501 gcatatctga ttttacgacg gcatgggaat ctcttcatca ctctctttgc gctgatgttg 1561 actgcagggc ttcctgaact cacatcagtc aaagatatac agtatcttaa ggactctctt 1621 gcattaggga agagtgaaga agaagcactc aaacagttta agcaaaaatt tgatgaggcg 1681 ctcagggaaa gctggactac taaagtgaac tggatggccc acacagttcg gaaagactac 1741 agatcttaa
SEP ID NO: 10 Human PIK3CB (Isoform 2) Amino Acid Sequence
1 mlnpmgtvqt npytenatal hvkfpenkkq pyyyppfdks rggkkflpvl keildrdpls
61 qlcenemdli wtlrqdcrei fpqslpklll sikwnkledv aqlqallqiw pklppreale
121 lldfnypdqy vreyavgclr qmsdeelsqy llqlvqvlky epfldcalsr flleralgnr
181 rigqflfwhl rsevhipavs vqfgvileay crgsvghmkv lskqvealnk lktlnslikl
241 navklnrakg keamhtclkq sayrealsdl qsplnpcvil selyvekcky mdskmkplwl
301 vynnkvfged svgvifkngd dlrqdmltlq mlrlmdllwk eagldlrmlp ygclatgdrs
361 glievvstse tiadiqlnss nvaaaaafnk dallnwlkey nsgddldrai eeftlscagy
421 cvasyvlgig drhsdnimvk ktgqlfhidf ghilgnfksk fgikrervpf iltydfihvi
481 qqgktgntek fgrfrqcced aylilrrhgn lfitlfalml taglpeltsv kdiqylkdsl
541 algkseeeal kqfkqkfdea lreswttkvn wmahtvrkdy rs
SEP ID NP: 11 Mouse PIK3CB cDNA Acid Sequence
1 atgcctcctg ctatggcaga caaccttgac atctgggcag tggactcaca gattgcatcc
61 gatggcgcca tatccgtcga tttccttctg cccaccggga tttatatcca gttggaagta
121 cctcgggaag ctaccatttc ttatattaaa cagatgttat ggaagcaagt tcacaactac
181 ccgatgttta acctcctcat ggacattgac tcgtatatgt ttgcatgtgt gaatcaaact
241 gctgtatatg aggaactgga agacgaaaca cgaagacttt gtgatgtcag accttttctt
301 ccagttctca aactagtgac tagaagctgt gaccccgcag aaaaattgga ctcaaaaatt
361 ggggttctta taggaaaagg tcttcatgag tttgatgcct tgaaggatcc cgaagtgaat
421 gaatttagaa gaaaaatgcg caaattcagt gaggccaaga ttcagtctct ggtagggttg 481 tcttggatcg actggctaaa gcacacgtat ccgcctgagc acgagccgtc cgtcctggag 541 aacttggaag ataaacttta tggaggaaag ctggttgtgg ctgtgcactt tgaaaatagc 601 caggatgtat ttagttttca agtgtctccc aatttgaatc ctataaaaat aaatgaattg 661 gcaatccaga aacgcctcac tattcgtgga aaggaagatg aagctagccc ctgtgactat 721 gtgttacagg tcagtgggag agtggagtat gtgtttggcg atcatccact aattcagttc 781 cagtacatcc ggaattgtgt gatgaataga accctgcccc acttcatcct tgtggaatgt 841 tgtaagatca agaaaatgta tgaacaagaa atgattgcca tagaggctgc catcaaccga 901 aactcatcca accttcctct ccctttacca ccaaagaaaa cgcgagttat ttctcatatc 961 tgggacaaca acaacccttt ccaaattacc ttggttaaag gaaataagct taatacagaa 1021 gaaactgtga aagttcatgt ccgagctggg ctttttcacg gaaccgagct cctgtgtaaa 1081 accgtcgtaa gctcagagat atcaggaaag aacgaccata tttggaatga acaactggaa 1141 tttgatatta atatttgtga cttaccaaga atggctcgat tatgttttgc tgtttatgca 1201 gttttggata aagtaaaaac gaagaaatca acaaagacta ttaatccctc taagtatcag 1261 accatcagga aagccgggaa agtgcattat cctgtcgcat gggtaaatac catggttttt 1321 gacttcaaag gacagctgag gtctggagac gtcatattgc atagctggtc ttcgtttcct 1381 gatgagctgg aagaaatgct gaatcccatg gggactgtgc agacgaaccc atatgctgag 1441 aacgccaccg ccttgcacat tacgttccca gagaataaga agcagccgtg ttattatccc 1501 cccttcgata agatcattga gaaggcagct gagcttgcca gcggagacag tgctaatgtg 1561 tcaagtcgtg gtggaaaaaa atttcttgct gtgctgaaag aaatcttgga cagggacccc 1621 ctgtctcagc tgtgtgagaa cgaaatggac cttatttgga ctctacggca agactgccga 1681 gaaaatttcc ctcagtcact gccaaaacta ctcttgtcaa tcaagtggaa taaacttgaa 1741 gatgttgctc agcttcaggc gctcctgcag atatggccca aactgccccc cagggaagcc 1801 ctggaactcc tggatttcaa ctatccagac cagtatgtcc gggaatacgc tgtaggctgc 1861 cttcgacaga tgagtgatga agaactctct cagtatcttt tacaattggt gcaagttttg 1921 aaatatgagc cttttctcga ttgtgccctc tccagattcc tattagaaag agcacttgat 1981 aatcggagga ttgggcagtt tctgttttgg catcttaggt cagaggtgca cactcctgct 2041 gtgtccgtac agtttggtgt catcctggaa gcatactgtc gaggaagcgt ggggcacatg 2101 aaagtgcttt ccaaacaggt ggaagcactc aataagttaa aaactttaaa tagcttaatc 2161 aaactgaatg cggtgaagct gagcagagct aagggaaagg aggccatgca cacgtgcctg 2221 aaacagagtg cttaccggga ggcgctctct gacctgcagt cgccgctgaa cccctgcgtc 2281 atcctctcag agctctatgt tgaaaagtgc aaatacatgg actccaagat gaagcccctg 2341 tggctggtct acagcagcag agcctttgga gaggactcgg ttggagtgat ctttaaaaat 2401 ggtgacgatt tgcggcagga catgctgacg ctgcagatgt tgcgcctgat ggatctgctt 2461 tggaaagaag ctggcttgga cctgcggatg ctcccctatg gctgcttagc aacaggagat 2521 cgctctggcc tcattgaggt tgtgagcacc tctgagacaa tcgctgacat tcagctgaac 2581 agtagtaacg tggctgccac ggcagccttc aacaaagacg cactcctgaa ctggctcaag 2641 gagtacaact ctggggatga cctggaccga gcgattgagg agtttacctt gtcctgtgct 2701 ggctactgtg tagcctctta tgtcctcggc attggtgaca ggcacagtga caacatcatg 2761 gtgaagaaaa ccggccagct cttccacata gattttgggc atattcttgg aaatttcaaa 2821 tctaaatttg gcattaaaag ggagcgagta ccttttattc ttacttatga cttcattcat 2881 gtcattcaac aaggaaaaac gggaaacact gaaaaatttg gcagattccg ccagtgctgt 2941 gaagatgcgt atctgatttt acggcggcat gggaatctct tcatcaccct gtttgccctg 3001 atgttgactg cagggctgcc tgagctcaca tcggtcaaag atatacagta tcttaaggac 3061 tcgcttgcct tagggaagag cgaggaggaa gcactgaagc agttcaagca gaagtttgac 3121 gaggccctca gggaaagctg gactactaaa gtgaactgga tggctcacac agtacggaaa 3181 gactacaggt cctag
SEP ID NO: 12 Mouse PIK3CB Amino Acid Sequence
1 mppamadnld iwavdsqias dgaisvdfll ptgiyiqlev preatisyik qmlwkqvhny
61 pmfnllmdid symfacvnqt avyeeledet rrlcdvrpfl pvlklvtrsc dpaekldski
121 gvligkglhe fdalkdpevn efrrkmrkfs eakiqslvgl swidwlkhty ppehepsvle
181 nledklyggk lvvavhfens qdvfsfqvsp nlnpikinel aiqkrltirg kedeaspcdy
241 vlqvsgrvey vfgdhpliqf qyirncvmnr tlphfilvec ckikkmyeqe miaieaainr
301 nssnlplplp pkktrvishi wdnnnpfqit lvkgnklnte etvkvhvrag lfhgtellck
361 tvvsseisgk ndhiwneqle fdinicdlpr marlcfavya vldkvktkks tktinpskyq
421 tirkagkvhy pvawvntmvf dfkgqlrsgd vilhswssfp deleemlnpm gtvqtnpyae
481 natalhitfp enkkqpcyyp pfdkiiekaa elasgdsanv ssrggkkfla vlkeildrdp
541 lsqlcenemd liwtlrqdcr enfpqslpkl llsikwnkle dvaqlqallq iwpklpprea
601 lelldfnypd qyvreyavgc lrqmsdeels qyllqlvqvl kyepfldcal srfllerald
661 nrrigqflfw hlrsevhtpa vsvqfgvile aycrgsvghm kvlskqveal nklktlnsli 721 klnavklsra kgkeamhtcl kqsayreals dlqsplnpcv ilselyvekc kymdskmkpl 781 wlvyssrafg edsvgvifkn gddlrqdmlt Iqmlrlmdll wkeagldlrm Ipygclatgd 841 rsglievvst setiadiqln ssnvaataaf nkdallnwlk eynsgddldr aieeftlsca 901 gycvasyvlg igdrhsdnim vkktgqlfhi dfghilgnfk skfgikrerv pfiltydfih 961 viqqgktgnt ekfgrfrqcc edaylilrrh gnlfitlfal mltaglpelt svkdiqylkd 1021 slalgkseee alkqfkqkfd ealreswttk vnwmahtvrk dyrs
SEP ID NO: 13 Human PIK3CG (Transcript 1) cDNA Acid Sequence
1 atggagctgg agaactataa acagcccgtg gtgctgagag aggacaactg ccgaaggcgc
61 cggaggatga agccgcgcag tgctgcggcc agcctgtcct ccatggagct catccccatc 121 gagttcgtgc tgcccaccag ccagcgcaaa tgcaagagcc ccgaaacggc gctgctgcac 181 gtggccggcc acggcaacgt ggagcagatg aaggcccagg tgtggctgcg agcgctggag 241 accagcgtgg cggcggactt ctaccaccgg ctgggaccgc atcacttcct cctgctctat 301 cagaagaagg ggcagtggta cgagatctac gacaagtacc aggtggtgca gactctggac 361 tgcctgcgct actggaaggc cacgcaccgg agcccgggcc agatccacct ggtgcagcgg 421 cacccgccct ccgaggagtc ccaagccttc cagcggcagc tcacggcgct gattggctat 481 gacgtcactg acgtcagcaa cgtgcacgac gatgagctgg agttcacgcg ccgtggcttg 541 gtgaccccgc gcatggcgga ggtggccagc cgcgacccca agctctacgc catgcacccg 601 tgggtgacgt ccaagcccct cccggagtac ctgtggaaga agattgccaa caactgcatc 661 ttcatcgtca ttcaccgcag caccaccagc cagaccatta aggtctcacc cgacgacacc 721 cccggcgcca tcctgcagag cttcttcacc aagatggcca agaagaaatc tctgatggat 781 attcccgaaa gccaaagcga acaggatttt gtgctgcgcg tctgtggccg ggatgagtac 841 ctggtgggcg aaacgcccat caaaaacttc cagtgggtga ggcactgcct caagaacgga 901 gaagagattc acgtggtact ggacacgcct ccagacccgg ccctagacga ggtgaggaag 961 gaagagtggc cactggtgga tgactgcacg ggagtcaccg gctaccatga gcagcttacc 1021 atccacggca aggaccacga gagtgtgttc accgtgtccc tgtgggactg cgaccgcaag 1081 ttcagggtca agatcagagg cattgatatc cccgtcctgc ctcggaacac cgacctcaca 1141 gtttttgtag aggcaaacat ccagcatggg caacaagtcc tttgccaaag gagaaccagc 1201 cccaaaccct tcacagagga ggtgctgtgg aatgtgtggc ttgagttcag tatcaaaatc 1261 aaagacttgc ccaaaggggc tctactgaac ctccagatct actgcggtaa agctccagca 1321 ctgtccagca aggcctctgc agagtccccc agttctgagt ccaagggcaa agttcagctt 1381 ctctattatg tgaacctgct gctgatagac caccgtttcc tcctgcgccg tggagaatac 1441 gtcctccaca tgtggcagat atctgggaag ggagaagacc aaggaagctt caatgctgac 1501 aaactcacgt ctgcaactaa cccagacaag gagaactcaa tgtccatctc cattcttctg 1561 gacaattact gccacccgat agccctgcct aagcatcagc ccacccctga cccggaaggg 1621 gaccgggttc gagcagaaat gcccaaccag cttcgcaagc aattggaggc gatcatagcc 1681 actgatccac ttaaccctct cacagcagag gacaaagaat tgctctggca ttttagatac 1741 gaaagcctta agcacccaaa agcatatcct aagctattta gttcagtgaa atggggacag 1801 caagaaattg tggccaaaac ataccaattg ttggccagaa gggaagtctg ggatcaaagt 1861 gctttggatg ttgggttaac aatgcagctc ctggactgca acttctcaga tgaaaatgta 1921 agagccattg cagttcagaa actggagagc ttggaggacg atgatgttct gcattacctt 1981 ctacaattgg tccaggctgt gaaatttgaa ccataccatg atagcgccct tgccagattt 2041 ctgctgaagc gtggtttaag aaacaaaaga attggtcact ttttgttttg gttcttgaga 2101 agtgagatag cccagtccag acactatcag cagaggttcg ctgtgattct ggaagcctat 2161 ctgaggggct gtggcacagc catgctgcac gactttaccc aacaagtcca agtaatcgag 2221 atgttacaaa aagtcaccct tgatattaaa tcgctctctg ctgaaaagta tgacgtcagt 2281 tcccaagtta tttcacaact taaacaaaag cttgaaaacc tgcagaattc tcaactcccc 2341 gaaagcttta gagttccata tgatcctgga ctgaaagcag gagcgctggc aattgaaaaa 2401 tgtaaagtaa tggcctccaa gaaaaaacca ctatggcttg agtttaaatg tgccgatcct 2461 acagccctat caaatgaaac aattggaatt atctttaaac atggtgatga tctgcgccaa 2521 gacatgctta ttttacagat tctacgaatc atggagtcta tttgggagac tgaatctttg 2581 gatctatgcc tcctgccata tggttgcatt tcaactggtg acaaaatagg aatgatcgag 2641 attgtgaaag acgccacgac aattgccaaa attcagcaaa gcacagtggg caacacggga 2701 gcatttaaag atgaagtcct gaatcactgg ctcaaagaaa aatcccctac tgaagaaaag 2761 tttcaggcag cagtggagag atttgtttat tcctgtgcag gctactgtgt ggcaaccttt 2821 gttcttggaa taggcgacag acacaatgac aatattatga tcaccgagac aggaaaccta 2881 tttcatattg acttcgggca cattcttggg aattacaaaa gtttcctggg cattaataaa 2941 gagagagtgc catttgtgct aacccctgac ttcctctttg tgatgggaac ttctggaaag 3001 aagacaagcc cacacttcca gaaatttcag gacatctgtg ttaaggctta tctagccctt
3061 cgtcatcaca caaacctact gatcatcctg ttctccatga tgctgatgac aggaatgccc
3121 cagttaacaa gcaaagaaga cattgaatat atccgggatg ccctcacagt ggggaaaaat
3181 gaggaggatg ctaaaaagta ttttcttgat cagatcgaag tttgcagaga caaaggatgg
3241 actgtgcagt ttaattggtt tctacatctt gttcttggca tcaaacaagg agagaaacat
3301 tcagcctaa
SEP ID NO: 14 Human PIK3CG (Isoform 1) Amino Acid Sequence
1 melenykqpv vlredncrrr rrmkprsaaa slssmelipi efvlptsqrk ckspetallh
61 vaghgnveqm kaqvwlrale tsvaadfyhr lgphhfllly qkkgqwyeiy dkyqvvqtld
121 clrywkathr spgqihlvqr hppseesqaf qrqltaligy dvtdvsnvhd deleftrrgl
181 vtprmaevas rdpklyamhp wvtskplpey lwkkiannci fivihrstts qtikvspddt
241 pgailqsfft kmakkkslmd ipesqseqdf vlrvcgrdey Ivgetpiknf qwvrhclkng
301 eeihvvldtp pdpaldevrk eewplvddct gvtgyheqlt ihgkdhesvf tvslwdcdrk
361 frvkirgidi pvlprntdlt vfveaniqhg qqvlcqrrts pkpfteevlw nvwlefsiki
421 kdlpkgalln Iqiycgkapa Isskasaesp sseskgkvql lyyvnlllid hrfllrrgey
481 vlhmwqisgk gedqgsfnad kltsatnpdk ensmsisill dnychpialp khqptpdpeg
541 drvraempnq lrkqleaiia tdplnpltae dkellwhfry eslkhpkayp klfssvkwgq
601 qeivaktyql larrevwdqs aldvgltmql ldcnfsdenv raiavqkles ledddvlhyl
661 lqlvqavkfe pyhdsalarf llkrglrnkr ighflfwflr seiaqsrhyq qrfavileay
721 lrgcgtamlh dftqqvqvie mlqkvtldik slsaekydvs sqvisqlkqk lenlqnsqlp
781 esfrvpydpg lkagalaiek ckvmaskkkp lwlefkcadp talsnetigi ifkhgddlrq
841 dmlilqilri mesiwetesl dlcllpygci stgdkigmie ivkdattiak iqqstvgntg
901 afkdevlnhw lkekspteek fqaaverfvy scagycvatf vlgigdrhnd nimitetgnl
961 fhidfghilg nyksflgink ervpfvltpd flfvmgtsgk ktsphfqkfq dicvkaylal
1021 rhhtnlliil fsmmlmtgmp qltskediey irdaltvgkn eedakkyfld qievcrdkgw
1081 tvqfnwflhl vlgikqgekh sa
SEP ID NO: 15 Human PIK3CG (Transcript 2) cDNA Acid Sequence
1 atggagctgg agaactataa acagcccgtg gtgctgagag aggacaactg ccgaaggcgc 61 cggaggatga agccgcgcag tgctgcggcc agcctgtcct ccatggagct catccccatc 121 gagttcgtgc tgcccaccag ccagcgcaaa tgcaagagcc ccgaaacggc gctgctgcac 181 gtggccggcc acggcaacgt ggagcagatg aaggcccagg tgtggctgcg agcgctggag 241 accagcgtgg cggcggactt ctaccaccgg ctgggaccgc atcacttcct cctgctctat 301 cagaagaagg ggcagtggta cgagatctac gacaagtacc aggtggtgca gactctggac 361 tgcctgcgct actggaaggc cacgcaccgg agcccgggcc agatccacct ggtgcagcgg 421 cacccgccct ccgaggagtc ccaagccttc cagcggcagc tcacggcgct gattggctat 481 gacgtcactg acgtcagcaa cgtgcacgac gatgagctgg agttcacgcg ccgtggcttg 541 gtgaccccgc gcatggcgga ggtggccagc cgcgacccca agctctacgc catgcacccg 601 tgggtgacgt ccaagcccct cccggagtac ctgtggaaga agattgccaa caactgcatc 661 ttcatcgtca ttcaccgcag caccaccagc cagaccatta aggtctcacc cgacgacacc 721 cccggcgcca tcctgcagag cttcttcacc aagatggcca agaagaaatc tctgatggat 781 attcccgaaa gccaaagcga acaggatttt gtgctgcgcg tctgtggccg ggatgagtac 841 ctggtgggcg aaacgcccat caaaaacttc cagtgggtga ggcactgcct caagaacgga 901 gaagagattc acgtggtact ggacacgcct ccagacccgg ccctagacga ggtgaggaag 961 gaagagtggc cactggtgga tgactgcacg ggagtcaccg gctaccatga gcagcttacc 1021 atccacggca aggaccacga gagtgtgttc accgtgtccc tgtgggactg cgaccgcaag 1081 ttcagggtca agatcagagg cattgatatc cccgtcctgc ctcggaacac cgacctcaca 1141 gtttttgtag aggcaaacat ccagcatggg caacaagtcc tttgccaaag gagaaccagc 1201 cccaaaccct tcacagagga ggtgctgtgg aatgtgtggc ttgagttcag tatcaaaatc 1261 aaagacttgc ccaaaggggc tctactgaac ctccagatct actgcggtaa agctccagca 1321 ctgtccagca aggcctctgc agagtccccc agttctgagt ccaagggcaa agttcagctt 1381 ctctattatg tgaacctgct gctgatagac caccgtttcc tcctgcgccg tggagaatac 1441 gtcctccaca tgtggcagat atctgggaag ggagaagacc aaggaagctt caatgctgac 1501 aaactcacgt ctgcaactaa cccagacaag gagaactcaa tgtccatctc cattcttctg 1561 gacaattact gccacccgat agccctgcct aagcatcagc ccacccctga cccggaaggg 1621 gaccgggttc gagcagaaat gcccaaccag cttcgcaagc aattggaggc gatcatagcc 1681 actgatccac ttaaccctct cacagcagag gacaaagaat tgctctggca ttttagatac 1741 gaaagcctta agcacccaaa agcatatcct aagctattta gttcagtgaa atggggacag 1801 caagaaattg tggccaaaac ataccaattg ttggccagaa gggaagtctg ggatcaaagt 1861 gctttggatg ttgggttaac aatgcagctc ctggactgca acttctcaga tgaaaatgta
1921 agagccattg cagttcagaa actggagagc ttggaggacg atgatgttct gcattacctt 1981 ctacaattgg tccaggctgt gaaatttgaa ccataccatg atagcgccct tgccagattt 2041 ctgctgaagc gtggtttaag aaacaaaaga attggtcact ttttgttttg gttcttgaga 2101 agtgagatag cccagtccag acactatcag cagaggttcg ctgtgattct ggaagcctat 2161 ctgaggggct gtggcacagc catgctgcac gactttaccc aacaagtcca agtaatcgag 2221 atgttacaaa aagtcaccct tgatattaaa tcgctctctg ctgaaaagta tgacgtcagt 2281 tcccaagtta tttcacaact taaacaaaag cttgaaaacc tgcagaattc tcaactcccc 2341 gaaagcttta gagttccata tgatcctgga ctgaaagcag gagcgctggc aattgaaaaa 2401 tgtaaagtaa tggcctccaa gaaaaaacca ctatggcttg agtttaaatg tgccgatcct 2461 acagccctat caaatgaaac aattggaatt atctttaaac atggtgatga tctgcgccaa 2521 gacatgctta ttttacagat tctacgaatc atggagtcta tttgggagac tgaatctttg 2581 gatctatgcc tcctgccata tggttgcatt tcaactggtg acaaaatagg aatgatcgag 2641 attgtgaaag acgccacgac aattgccaaa attcagcaaa gcacagtggg caacacggga 2701 gcatttaaag atgaagtcct gaatcactgg ctcaaagaaa aatcccctac tgaagaaaag 2761 tttcaggcag cagtggagag atttgtttat tcctgtgcag gctactgtgt ggcaaccttt 2821 gttcttggaa taggcgacag acacaatgac aatattatga tcaccgagac aggaaaccta 2881 tttcatattg acttcgggca cattcttggg aattacaaaa gtttcctggg cattaataaa 2941 gagagagtgc catttgtgct aacccctgac ttcctctttg tgatgggaac ttctggaaag 3001 aagacaagcc cacacttcca gaaatttcag gacatctgtg ttaaggctta tctagccctt 3061 cgtcatcaca caaacctact gatcatcctg ttctccatga tgctgatgac aggaatgccc 3121 cagttaacaa gcaaagaaga cattgaatat atccgggatg ccctcacagt ggggaaaaat 3181 gaggaggatg ctaaaaagta ttttcttgat cagatcgaag tttgcagaga caaaggatgg 3241 actgtgcagt ttaattggtt tctacatctt gttcttggca tcaaacaagg agagaaacat 3301 tcagcctaa
SEP ID NO: 16 Human PIK3CG (Isoform 2) Amino Acid Sequence
1 melenykqpv vlredncrrr rrmkprsaaa slssmelipi efvlptsqrk ckspetallh
61 vaghgnveqm kaqvwlrale tsvaadfyhr lgphhfllly qkkgqwyeiy dkyqvvqtld
121 clrywkathr spgqihlvqr hppseesqaf qrqltaligy dvtdvsnvhd deleftrrgl
181 vtprmaevas rdpklyamhp wvtskplpey lwkkiannci fivihrstts qtikvspddt
241 pgailqsfft kmakkkslmd ipesqseqdf vlrvcgrdey lvgetpiknf qwvrhclkng
301 eeihvvldtp pdpaldevrk eewplvddct gvtgyheqlt ihgkdhesvf tvslwdcdrk
361 frvkirgidi pvlprntdlt vfveaniqhg qqvlcqrrts pkpfteevlw nvwlefsiki
421 kdlpkgalln lqiycgkapa lsskasaesp sseskgkvql lyyvnlllid hrfllrrgey
481 vlhmwqisgk gedqgsfnad kltsatnpdk ensmsisill dnychpialp khqptpdpeg
541 drvraempnq lrkqleaiia tdplnpltae dkellwhfry eslkhpkayp klfssvkwgq
601 qeivaktyql larrevwdqs aldvgltmql ldcnfsdenv raiavqkles ledddvlhyl
661 lqlvqavkfe pyhdsalarf llkrglrnkr ighflfwflr seiaqsrhyq qrfavileay
721 lrgcgtamlh dftqqvqvie mlqkvtldik slsaekydvs sqvisqlkqk lenlqnsqlp
781 esfrvpydpg lkagalaiek ckvmaskkkp lwlefkcadp talsnetigi ifkhgddlrq
841 dmlilqilri mesiwetesl dlcllpygci stgdkigmie ivkdattiak iqqstvgntg
901 afkdevlnhw lkekspteek fqaaverfvy scagycvatf vlgigdrhnd nimitetgnl
961 fhidfghilg nyksflgink ervpfvltpd flfvmgtsgk ktsphfqkfq dicvkaylal
1021 rhhtnlliil fsmmlmtgmp qltskediey irdaltvgkn eedakkyfld qievcrdkgw
1081 tvqfnwflhl vlgikqgekh sa
SEP ID NO: 17 Human PIK3CG (Transcript 3) cDNA Acid Sequence
1 atggagctgg agaactataa acagcccgtg gtgctgagag aggacaactg ccgaaggcgc 61 cggaggatga agccgcgcag tgctgcggcc agcctgtcct ccatggagct catccccatc 121 gagttcgtgc tgcccaccag ccagcgcaaa tgcaagagcc ccgaaacggc gctgctgcac 181 gtggccggcc acggcaacgt ggagcagatg aaggcccagg tgtggctgcg agcgctggag 241 accagcgtgg cggcggactt ctaccaccgg ctgggaccgc atcacttcct cctgctctat 301 cagaagaagg ggcagtggta cgagatctac gacaagtacc aggtggtgca gactctggac 361 tgcctgcgct actggaaggc cacgcaccgg agcccgggcc agatccacct ggtgcagcgg 421 cacccgccct ccgaggagtc ccaagccttc cagcggcagc tcacggcgct gattggctat 481 gacgtcactg acgtcagcaa cgtgcacgac gatgagctgg agttcacgcg ccgtggcttg 541 gtgaccccgc gcatggcgga ggtggccagc cgcgacccca agctctacgc catgcacccg 601 tgggtgacgt ccaagcccct cccggagtac ctgtggaaga agattgccaa caactgcatc 661 ttcatcgtca ttcaccgcag caccaccagc cagaccatta aggtctcacc cgacgacacc 721 cccggcgcca tcctgcagag cttcttcacc aagatggcca agaagaaatc tctgatggat
781 attcccgaaa gccaaagcga acaggatttt gtgctgcgcg tctgtggccg ggatgagtac 841 ctggtgggcg aaacgcccat caaaaacttc cagtgggtga ggcactgcct caagaacgga 901 gaagagattc acgtggtact ggacacgcct ccagacccgg ccctagacga ggtgaggaag 961 gaagagtggc cactggtgga tgactgcacg ggagtcaccg gctaccatga gcagcttacc 1021 atccacggca aggaccacga gagtgtgttc accgtgtccc tgtgggactg cgaccgcaag 1081 ttcagggtca agatcagagg cattgatatc cccgtcctgc ctcggaacac cgacctcaca 1141 gtttttgtag aggcaaacat ccagcatggg caacaagtcc tttgccaaag gagaaccagc 1201 cccaaaccct tcacagagga ggtgctgtgg aatgtgtggc ttgagttcag tatcaaaatc 1261 aaagacttgc ccaaaggggc tctactgaac ctccagatct actgcggtaa agctccagca 1321 ctgtccagca aggcctctgc agagtccccc agttctgagt ccaagggcaa agttcagctt 1381 ctctattatg tgaacctgct gctgatagac caccgtttcc tcctgcgccg tggagaatac 1441 gtcctccaca tgtggcagat atctgggaag ggagaagacc aaggaagctt caatgctgac 1501 aaactcacgt ctgcaactaa cccagacaag gagaactcaa tgtccatctc cattcttctg 1561 gacaattact gccacccgat agccctgcct aagcatcagc ccacccctga cccggaaggg 1621 gaccgggttc gagcagaaat gcccaaccag cttcgcaagc aattggaggc gatcatagcc 1681 actgatccac ttaaccctct cacagcagag gacaaagaat tgctctggca ttttagatac 1741 gaaagcctta agcacccaaa agcatatcct aagctattta gttcagtgaa atggggacag 1801 caagaaattg tggccaaaac ataccaattg ttggccagaa gggaagtctg ggatcaaagt 1861 gctttggatg ttgggttaac aatgcagctc ctggactgca acttctcaga tgaaaatgta 1921 agagccattg cagttcagaa actggagagc ttggaggacg atgatgttct gcattacctt 1981 ctacaattgg tccaggctgt gaaatttgaa ccataccatg atagcgccct tgccagattt 2041 ctgctgaagc gtggtttaag aaacaaaaga attggtcact ttttgttttg gttcttgaga 2101 agtgagatag cccagtccag acactatcag cagaggttcg ctgtgattct ggaagcctat 2161 ctgaggggct gtggcacagc catgctgcac gactttaccc aacaagtcca agtaatcgag 2221 atgttacaaa aagtcaccct tgatattaaa tcgctctctg ctgaaaagta tgacgtcagt 2281 tcccaagtta tttcacaact taaacaaaag cttgaaaacc tgcagaattc tcaactcccc 2341 gaaagcttta gagttccata tgatcctgga ctgaaagcag gagcgctggc aattgaaaaa 2401 tgtaaagtaa tggcctccaa gaaaaaacca ctatggcttg agtttaaatg tgccgatcct 2461 acagccctat caaatgaaac aattggaatt atctttaaac atggtgatga tctgcgccaa 2521 gacatgctta ttttacagat tctacgaatc atggagtcta tttgggagac tgaatctttg 2581 gatctatgcc tcctgccata tggttgcatt tcaactggtg acaaaatagg aatgatcgag 2641 attgtgaaag acgccacgac aattgccaaa attcagcaaa gcacagtggg caacacggga 2701 gcatttaaag atgaagtcct gaatcactgg ctcaaagaaa aatcccctac tgaagaaaag 2761 tttcaggcag cagtggagag atttgtttat tcctgtgcag gctactgtgt ggcaaccttt 2821 gttcttggaa taggcgacag acacaatgac aatattatga tcaccgagac aggaaaccta 2881 tttcatattg acttcgggca cattcttggg aattacaaaa gtttcctggg cattaataaa 2941 gagagagtgc catttgtgct aacccctgac ttcctctttg tgatgggaac ttctggaaag 3001 aagacaagcc cacacttcca gaaatttcag gacatctgtg ttaaggctta tctagccctt 3061 cgtcatcaca caaacctact gatcatcctg ttctccatga tgctgatgac aggaatgccc 3121 cagttaacaa gcaaagaaga cattgaatat atccgggatg ccctcacagt ggggaaaaat 3181 gaggaggatg ctaaaaagta ttttcttgat cagatcgaag tttgcagaga caaaggatgg 3241 actgtgcagt ttaattggtt tctacatctt gttcttggca tcaaacaagg agagaaacat 3301 tcagcctaa
SEP ID NO: 18 Human PIK3CG (Isoform 3) Amino Acid Sequence
1 melenykqpv vlredncrrr rrmkprsaaa slssmelipi efvlptsqrk ckspetallh
61 vaghgnveqm kaqvwlrale tsvaadfyhr lgphhfllly qkkgqwyeiy dkyqvvqtld
121 clrywkathr spgqihlvqr hppseesqaf qrqltaligy dvtdvsnvhd deleftrrgl
181 vtprmaevas rdpklyamhp wvtskplpey lwkkiannci fivihrstts qtikvspddt
241 pgailqsfft kmakkkslmd ipesqseqdf vlrvcgrdey lvgetpiknf qwvrhclkng
301 eeihvvldtp pdpaldevrk eewplvddct gvtgyheqlt ihgkdhesvf tvslwdcdrk
361 frvkirgidi pvlprntdlt vfveaniqhg qqvlcqrrts pkpfteevlw nvwlefsiki
421 kdlpkgalln lqiycgkapa lsskasaesp sseskgkvql lyyvnlllid hrfllrrgey
481 vlhmwqisgk gedqgsfnad kltsatnpdk ensmsisill dnychpialp khqptpdpeg
541 drvraempnq lrkqleaiia tdplnpltae dkellwhfry eslkhpkayp klfssvkwgq
601 qeivaktyql larrevwdqs aldvgltmql ldcnfsdenv raiavqkles ledddvlhyl
661 lqlvqavkfe pyhdsalarf llkrglrnkr ighflfwflr seiaqsrhyq qrfavileay
721 lrgcgtamlh dftqqvqvie mlqkvtldik slsaekydvs sqvisqlkqk lenlqnsqlp
781 esfrvpydpg lkagalaiek ckvmaskkkp lwlefkcadp talsnetigi ifkhgddlrq
841 dmlilqilri mesiwetesl dlcllpygci stgdkigmie ivkdattiak iqqstvgntg 901 afkdevlnhw lkekspteek fqaaverfvy scagycvatf vlgigdrhnd nimitetgnl 961 fhidfghilg nyksflgink ervpfvltpd flfvmgtsgk ktsphfqkfq dicvkaylal 1021 rhhtnlliil fsmmlmtgmp qltskediey irdaltvgkn eedakkyfld qievcrdkgw 1081 tvqfnwflhl vlgikqgekh sa
SEP ID NO: 19 Mouse PIK3CG (Transcript 1) cDNA Acid Sequence
1 atggagctgg agaactatga acaaccggtg gttctaagag aggacaacct ccgccggcgc 61 cggaggatga agccacgcag cgcagcaggc agcctgtctt ccatggagct catccccatt 121 gagttcgtac tgcccaccag ccagcgcatc agcaagactc cagaaacagc gctgctgcat 181 gtggctggcc atggcaatgt ggaacagatg aaagctcagg tgtggctgcg cgcactggag 241 accagtgtgg ctgcggagtt ctaccaccga ttgggcccgg accaattcct cctgctctac 301 cagaagaaag gacaatggta tgagatctat gacaggtacc aagtggtgca gaccctagac 361 tgcctgcatt actggaagtt gatgcacaag agccctggcc agatccacgt ggtacagcga 421 cacgtacctt ctgaggagac cttggctttc cagaagcagc tcacctccct gattggctat 481 gacgtcactg acatcagcaa tgtgcacgat gatgagctag agttcactcg ccgccgtctg 541 gttacgcccc gcatggctga agtggctggc cgggatgcca aactctatgc tatgcaccct 601 tgggtaacgt ccaaacctct cccagactac ctgtcaaaaa agattgccaa caactgcatc 661 ttcatcgtca tccaccgcgg taccaccagc caaaccatca aggtctccgc agatgatact 721 cctggtacca tcctccagag cttcttcacc aagatggcca agaagaagtc cctaatgaat 781 atctcagaaa gtcaaagtga gcaggatttt gtattgcggg tttgtggccg cgatgagtac 841 ctggtgggtg aaacacccct caaaaatttc cagtgggtga ggcagtgcct caagaacgga 901 gatgaaatac acctggtgct cgacacgcct ccagacccag cccttgatga ggtgaggaag 961 gaagaatggc cgctggtgga tgactgcact ggagtcaccg gctaccacga gcagctgacc 1021 atccatggca aggaccacga gagtgtgttc acagtgtctt tgtgggactg cgaccgaaag 1081 ttcagggtca agatcagagg cattgatatc cctgtcctgc ctcggaacac cgacctcact 1141 gtgtttgtgg aagcgaacat ccagcacggg caacaagtcc tctgccaaag gagaaccagc 1201 cctaagccct tcgcagaaga ggtactctgg aatgtgtggc tggagtttgg catcaaaatc 1261 aaagacttgc ccaaaggggc tctattgaac ctacagatct actgctgcaa aaccccatca 1321 ctgtccagca aggcttctgc agagactcca ggctccgagt ccaagggcaa agcccagctt 1381 ctctattacg tgaacttgct gttaatagac caccgtttcc tcctccgcca cggggactat 1441 gtgctccaca tgtggcagat atctggcaag gcagaggagc agggcagctt caatgctgac 1501 aagctcacat ccgcaaccaa tcctgacaag gagaactcaa tgtccatttc catcctgctg 1561 gacaattact gtcaccccat agctttgcct aagcaccggc ccacccctga cccagaggga 1621 gacagggttc gggctgaaat gcccaatcag cttcgaaagc aattggaggc gatcatagcc 1681 acagatccac ttaaccccct cacagcagag gacaaagaat tgctctggca ttttcgatat 1741 gaaagcctga agcatccgaa ggcttaccct aagctattca gctcagtgaa atgggggcag 1801 caagaaattg ttgccaaaac gtaccagctg ttagccagaa gggagatctg ggatcaaagt 1861 gctttggacg ttggcttaac catgcagctc ctggactgca acttttcaga cgagaatgtc 1921 cgggccattg cagttcagaa actggagagc ttagaggacg atgacgtttt acattacctt 1981 ctccagctgg tacaggctgt gaaatttgaa ccgtaccacg acagtgcgct ggccagattc 2041 ctgctgaagc gtggcttgag gaacaaaaga atcggtcact tcttgttctg gttcctgcga 2101 agtgagatcg cacagtccag acactatcag cagaggttcg ctgtgatcct ggaggcgtac 2161 ctgcgaggct gtggcacagc catgttgcag gacttcacac agcaggtcca tgtgattgag 2221 atgttacaga aagtcaccat tgatattaaa tcgctctcgg cagagaagta tgacgtcagt 2281 tcccaagtta tttcacagct taagcaaaag cttgaaagcc ttcagaactc caatctcccc 2341 gagagcttta gagttcccta tgatcctgga ctaaaagccg gtaccctggt gatcgagaaa 2401 tgcaaagtga tggcctccaa gaagaagccc ctgtggcttg agtttaagtg tgctgatccc 2461 acagtcctat ccaacgaaac cattggaatc atctttaaac atggtgatga tctgcgccaa 2521 gacatgttga tcttgcagat tctacgcatc atggagtcca tttgggagac tgaatctctg 2581 gacctgtgcc ttctgcctta cggttgcatc tcaactggtg acaaaatagg aatgatcgag 2641 attgtaaagg atgccacaac gatcgctcaa attcagcaaa gcacagtggg taacacgggg 2701 gcattcaaag atgaagtcct gaatcactgg ctcaaggaaa aatgtcctat tgaagaaaag 2761 tttcaggccg cagtggaaag gtttgtttac tcctgtgcag gctactgtgt ggccacattt 2821 gttcttggga tcggtgacag gcacaacgac aacattatga tctcagagac aggaaaccta 2881 tttcatatag acttcggaca cattcttggg aattacaaga gtttcctggg catcaataaa 2941 gagagagtgc ccttcgtcct aaccccagac ttcttgtttg tgatgggatc ttctggaaaa
3001 aagacaagtc cacacttcca gaaattccag gatgtctgtg ttagagctta cctagctctt
3061 cgccatcaca caaacctgtt gatcatcttg ttctccatga tgctgatgac aggaatgccc
3121 cagctgacaa gcaaagagga cattgaatat atccgggatg ccctcaccgt gggaaaaagc
3181 gaggaggacg ctaagaaata tttccttgat cagatcgaag tctgcagaga caaaggatgg
3241 actgtgcagt ttaactggtt cctacatctt gttcttggca tcaaacaagg agaaaagcac
3301 tccgcttga
SEP ID NO: 20 Mouse PIK3CG (Isoform 1) Amino Acid Sequence
1 melenyeqpv vlrednlrrr rrmkprsaag slssmelipi efvlptsqri sktpetallh
61 vaghgnveqm kaqvwlrale tsvaaefyhr lgpdqfllly qkkgqwyeiy dryqvvqtld
121 clhywklmhk spgqihvvqr hvpseetlaf qkqltsligy dvtdisnvhd deleftrrrl
181 vtprmaevag rdaklyamhp wvtskplpdy lskkiannci fivihrgtts qtikvsaddt
241 pgtilqsfft kmakkkslmn isesqseqdf vlrvcgrdey Ivgetplknf qwvrqclkng
301 deihlvldtp pdpaldevrk eewplvddct gvtgyheqlt ihgkdhesvf tvslwdcdrk
361 frvkirgidi pvlprntdlt vfveaniqhg qqvlcqrrts pkpfaeevlw nvwlefgiki
421 kdlpkgalln Iqiyccktps Isskasaetp gseskgkaql lyyvnlllid hrfllrhgdy
481 vlhmwqisgk aeeqgsfnad kltsatnpdk ensmsisill dnychpialp khrptpdpeg
541 drvraempnq lrkqleaiia tdplnpltae dkellwhfry eslkhpkayp klfssvkwgq
601 qeivaktyql larreiwdqs aldvgltmql ldcnfsdenv raiavqkles ledddvlhyl
661 lqlvqavkfe pyhdsalarf llkrglrnkr ighflfwflr seiaqsrhyq qrfavileay
721 lrgcgtamlq dftqqvhvie mlqkvtidik slsaekydvs sqvisqlkqk leslqnsnlp
781 esfrvpydpg lkagtlviek ckvmaskkkp lwlefkcadp tvlsnetigi ifkhgddlrq
841 dmlilqilri mesiwetesl dlcllpygci stgdkigmie ivkdattiaq iqqstvgntg
901 afkdevlnhw lkekcpieek fqaaverfvy scagycvatf vlgigdrhnd nimisetgnl
961 fhidfghilg nyksflgink ervpfvltpd flfvmgssgk ktsphfqkfq dvcvraylal
1021 rhhtnlliil fsmmlmtgmp qltskediey irdaltvgks eedakkyfld qievcrdkgw
1081 tvqfnwflhl vlgikqgekh sa
SEP ID NO: 21 Mouse PIK3CG (Transcript 2) cDNA Acid Sequence
1 atggagctgg agaactatga acaaccggtg gttctaagag aggacaacct ccgccggcgc 61 cggaggatga agccacgcag cgcagcaggc agcctgtctt ccatggagct catccccatt 121 gagttcgtac tgcccaccag ccagcgcatc agcaagactc cagaaacagc gctgctgcat 181 gtggctggcc atggcaatgt ggaacagatg aaagctcagg tgtggctgcg cgcactggag 241 accagtgtgg ctgcggagtt ctaccaccga ttgggcccgg accaattcct cctgctctac 301 cagaagaaag gacaatggta tgagatctat gacaggtacc aagtggtgca gaccctagac 361 tgcctgcatt actggaagtt gatgcacaag agccctggcc agatccacgt ggtacagcga 421 cacgtacctt ctgaggagac cttggctttc cagaagcagc tcacctccct gattggctat 481 gacgtcactg acatcagcaa tgtgcacgat gatgagctag agttcactcg ccgccgtctg 541 gttacgcccc gcatggctga agtggctggc cgggatgcca aactctatgc tatgcaccct 601 tgggtaacgt ccaaacctct cccagactac ctgtcaaaaa agattgccaa caactgcatc 661 ttcatcgtca tccaccgcgg taccaccagc caaaccatca aggtctccgc agatgatact 721 cctggtacca tcctccagag cttcttcacc aagatggcca agaagaagtc cctaatgaat 781 atctcagaaa gtcaaagtga gcaggatttt gtattgcggg tttgtggccg cgatgagtac 841 ctggtgggtg aaacacccct caaaaatttc cagtgggtga ggcagtgcct caagaacgga 901 gatgaaatac acctggtgct cgacacgcct ccagacccag cccttgatga ggtgaggaag 961 gaagaatggc cgctggtgga tgactgcact ggagtcaccg gctaccacga gcagctgacc 1021 atccatggca aggaccacga gagtgtgttc acagtgtctt tgtgggactg cgaccgaaag 1081 ttcagggtca agatcagagg cattgatatc cctgtcctgc ctcggaacac cgacctcact 1141 gtgtttgtgg aagcgaacat ccagcacggg caacaagtcc tctgccaaag gagaaccagc 1201 cctaagccct tcgcagaaga ggtactctgg aatgtgtggc tggagtttgg catcaaaatc 1261 aaagacttgc ccaaaggggc tctattgaac ctacagatct actgctgcaa aaccccatca 1321 ctgtccagca aggcttctgc agagactcca ggctccgagt ccaagggcaa agcccagctt 1381 ctctattacg tgaacttgct gttaatagac caccgtttcc tcctccgcca cggggactat 1441 gtgctccaca tgtggcagat atctggcaag gcagaggagc agggcagctt caatgctgac 1501 aagctcacat ccgcaaccaa tcctgacaag gagaactcaa tgtccatttc catcctgctg 1561 gacaattact gtcaccccat agctttgcct aagcaccggc ccacccctga cccagaggga 1621 gacagggttc gggctgaaat gcccaatcag cttcgaaagc aattggaggc gatcatagcc 1681 acagatccac ttaaccccct cacagcagag gacaaagaat tgctctggca ttttcgatat 1741 gaaagcctga agcatccgaa ggcttaccct aagctattca gctcagtgaa atgggggcag 1801 caagaaattg ttgccaaaac gtaccagctg ttagccagaa gggagatctg ggatcaaagt
1861 gctttggacg ttggcttaac catgcagctc ctggactgca acttttcaga cgagaatgtc 1921 cgggccattg cagttcagaa actggagagc ttagaggacg atgacgtttt acattacctt 1981 ctccagctgg tacaggctgt gaaatttgaa ccgtaccacg acagtgcgct ggccagattc 2041 ctgctgaagc gtggcttgag gaacaaaaga atcggtcact tcttgttctg gttcctgcga 2101 agtgagatcg cacagtccag acactatcag cagaggttcg ctgtgatcct ggaggcgtac 2161 ctgcgaggct gtggcacagc catgttgcag gacttcacac agcaggtcca tgtgattgag 2221 atgttacaga aagtcaccat tgatattaaa tcgctctcgg cagagaagta tgacgtcagt 2281 tcccaagtta tttcacagct taagcaaaag cttgaaagcc ttcagaactc caatctcccc 2341 gagagcttta gagttcccta tgatcctgga ctaaaagccg gtaccctggt gatcgagaaa 2401 tgcaaagtga tggcctccaa gaagaagccc ctgtggcttg agtttaagtg tgctgatccc 2461 acagtcctat ccaacgaaac cattggaatc atctttaaac atggtgatga tctgcgccaa 2521 gacatgttga tcttgcagat tctacgcatc atggagtcca tttgggagac tgaatctctg 2581 gacctgtgcc ttctgcctta cggttgcatc tcaactggtg acaaaatagg aatgatcgag 2641 attgtaaagg atgccacaac gatcgctcaa attcagcaaa gcacagtggg taacacgggg 2701 gcattcaaag atgaagtcct gaatcactgg ctcaaggaaa aatgtcctat tgaagaaaag 2761 tttcaggccg cagtggaaag gtttgtttac tcctgtgcag gctactgtgt ggccacattt 2821 gttcttggga tcggtgacag gcacaacgac aacattatga tctcagagac aggaaaccta 2881 tttcatatag acttcggaca cattcttggg aattacaaga gtttcctggg catcaataaa 2941 gagagagtgc ccttcgtcct aaccccagac ttcttgtttg tgatgggatc ttctggaaaa 3001 aagacaagtc cacacttcca gaaattccag gatgtctgtg ttagagctta cctagctctt 3061 cgccatcaca caaacctgtt gatcatcttg ttctccatga tgctgatgac aggaatgccc 3121 cagctgacaa gcaaagagga cattgaatat atccgggatg ccctcaccgt gggaaaaagc 3181 gaggaggacg ctaagaaata tttccttgat cagatcgaag tctgcagaga caaaggatgg 3241 actgtgcagt ttaactggtt cctacatctt gttcttggca tcaaacaagg agaaaagcac 3301 tccgcttga
SEP ID NO: 22 Mouse PIK3CG (Isoform 2) Amino Acid Sequence
1 melenyeqpv vlrednlrrr rrmkprsaag slssmelipi efvlptsqri sktpetallh
61 vaghgnveqm kaqvwlrale tsvaaefyhr lgpdqfllly qkkgqwyeiy dryqvvqtld
121 clhywklmhk spgqihvvqr hvpseetlaf qkqltsligy dvtdisnvhd deleftrrrl
181 vtprmaevag rdaklyamhp wvtskplpdy lskkiannci fivihrgtts qtikvsaddt
241 pgtilqsfft kmakkkslmn isesqseqdf vlrvcgrdey Ivgetplknf qwvrqclkng
301 deihlvldtp pdpaldevrk eewplvddct gvtgyheqlt ihgkdhesvf tvslwdcdrk
361 frvkirgidi pvlprntdlt vfveaniqhg qqvlcqrrts pkpfaeevlw nvwlefgiki
421 kdlpkgalln lqiyccktps lsskasaetp gseskgkaql lyyvnlllid hrfllrhgdy
481 vlhmwqisgk aeeqgsfnad kltsatnpdk ensmsisill dnychpialp khrptpdpeg
541 drvraempnq lrkqleaiia tdplnpltae dkellwhfry eslkhpkayp klfssvkwgq
601 qeivaktyql larreiwdqs aldvgltmql ldcnfsdenv raiavqkles ledddvlhyl
661 lqlvqavkfe pyhdsalarf llkrglrnkr ighflfwflr seiaqsrhyq qrfavileay
721 lrgcgtamlq dftqqvhvie mlqkvtidik slsaekydvs sqvisqlkqk leslqnsnlp
781 esfrvpydpg lkagtlviek ckvmaskkkp lwlefkcadp tvlsnetigi ifkhgddlrq
841 dmlilqilri mesiwetesl dlcllpygci stgdkigmie ivkdattiaq iqqstvgntg
901 afkdevlnhw lkekcpieek fqaaverfvy scagycvatf vlgigdrhnd nimisetgnl
961 fhidfghilg nyksflgink ervpfvltpd flfvmgssgk ktsphfqkfq dvcvraylal
1021 rhhtnlliil fsmmlmtgmp qltskediey irdaltvgks eedakkyfld qievcrdkgw
1081 tvqfnwflhl vlgikqgekh sa
SEP ID NO: 23 Mouse PIK3CG (Transcript 3) cDNA Acid Sequence
1 atggagctgg agaactatga acaaccggtg gttctaagag aggacaacct ccgccggcgc 61 cggaggatga agccacgcag cgcagcaggc agcctgtctt ccatggagct catccccatt 121 gagttcgtac tgcccaccag ccagcgcatc agcaagactc cagaaacagc gctgctgcat 181 gtggctggcc atggcaatgt ggaacagatg aaagctcagg tgtggctgcg cgcactggag 241 accagtgtgg ctgcggagtt ctaccaccga ttgggcccgg accaattcct cctgctctac 301 cagaagaaag gacaatggta tgagatctat gacaggtacc aagtggtgca gaccctagac 361 tgcctgcatt actggaagtt gatgcacaag agccctggcc agatccacgt ggtacagcga 421 cacgtacctt ctgaggagac cttggctttc cagaagcagc tcacctccct gattggctat 481 gacgtcactg acatcagcaa tgtgcacgat gatgagctag agttcactcg ccgccgtctg 541 gttacgcccc gcatggctga agtggctggc cgggatgcca aactctatgc tatgcaccct 601 tgggtaacgt ccaaacctct cccagactac ctgtcaaaaa agattgccaa caactgcatc 661 ttcatcgtca tccaccgcgg taccaccagc caaaccatca aggtctccgc agatgatact
721 cctggtacca tcctccagag cttcttcacc aagatggcca agaagaagtc cctaatgaat 781 atctcagaaa gtcaaagtga gcaggatttt gtattgcggg tttgtggccg cgatgagtac 841 ctggtgggtg aaacacccct caaaaatttc cagtgggtga ggcagtgcct caagaacgga 901 gatgaaatac acctggtgct cgacacgcct ccagacccag cccttgatga ggtgaggaag 961 gaagaatggc cgctggtgga tgactgcact ggagtcaccg gctaccacga gcagctgacc 1021 atccatggca aggaccacga gagtgtgttc acagtgtctt tgtgggactg cgaccgaaag 1081 ttcagggtca agatcagagg cattgatatc cctgtcctgc ctcggaacac cgacctcact 1141 gtgtttgtgg aagcgaacat ccagcacggg caacaagtcc tctgccaaag gagaaccagc 1201 cctaagccct tcgcagaaga ggtactctgg aatgtgtggc tggagtttgg catcaaaatc 1261 aaagacttgc ccaaaggggc tctattgaac ctacagatct actgctgcaa aaccccatca 1321 ctgtccagca aggcttctgc agagactcca ggctccgagt ccaagggcaa agcccagctt 1381 ctctattacg tgaacttgct gttaatagac caccgtttcc tcctccgcca cggggactat 1441 gtgctccaca tgtggcagat atctggcaag gcagaggagc agggcagctt caatgctgac 1501 aagctcacat ccgcaaccaa tcctgacaag gagaactcaa tgtccatttc catcctgctg 1561 gacaattact gtcaccccat agctttgcct aagcaccggc ccacccctga cccagaggga 1621 gacagggttc gggctgaaat gcccaatcag cttcgaaagc aattggaggc gatcatagcc 1681 acagatccac ttaaccccct cacagcagag gacaaagaat tgctctggca ttttcgatat 1741 gaaagcctga agcatccgaa ggcttaccct aagctattca gctcagtgaa atgggggcag 1801 caagaaattg ttgccaaaac gtaccagctg ttagccagaa gggagatctg ggatcaaagt 1861 gctttggacg ttggcttaac catgcagctc ctggactgca acttttcaga cgagaatgtc 1921 cgggccattg cagttcagaa actggagagc ttagaggacg atgacgtttt acattacctt 1981 ctccagctgg tacaggctgt gaaatttgaa ccgtaccacg acagtgcgct ggccagattc 2041 ctgctgaagc gtggcttgag gaacaaaaga atcggtcact tcttgttctg gttcctgcga 2101 agtgagatcg cacagtccag acactatcag cagaggttcg ctgtgatcct ggaggcgtac 2161 ctgcgaggct gtggcacagc catgttgcag gacttcacac agcaggtcca tgtgattgag 2221 atgttacaga aagtcaccat tgatattaaa tcgctctcgg cagagaagta tgacgtcagt 2281 tcccaagtta tttcacagct taagcaaaag cttgaaagcc ttcagaactc caatctcccc 2341 gagagcttta gagttcccta tgatcctgga ctaaaagccg gtaccctggt gatcgagaaa 2401 tgcaaagtga tggcctccaa gaagaagccc ctgtggcttg agtttaagtg tgctgatccc 2461 acagtcctat ccaacgaaac cattggaatc atctttaaac atggtgatga tctgcgccaa 2521 gacatgttga tcttgcagat tctacgcatc atggagtcca tttgggagac tgaatctctg 2581 gacctgtgcc ttctgcctta cggttgcatc tcaactggtg acaaaatagg aatgatcgag 2641 attgtaaagg atgccacaac gatcgctcaa attcagcaaa gcacagtggg taacacgggg 2701 gcattcaaag atgaagtcct gaatcactgg ctcaaggaaa aatgtcctat tgaagaaaag 2761 tttcaggccg cagtggaaag gtttgtttac tcctgtgcag gctactgtgt ggccacattt 2821 gttcttggga tcggtgacag gcacaacgac aacattatga tctcagagac aggaaaccta 2881 tttcatatag acttcggaca cattcttggg aattacaaga gtttcctggg catcaataaa 2941 gagagagtgc ccttcgtcct aaccccagac ttcttgtttg tgatgggatc ttctggaaaa 3001 aagacaagtc cacacttcca gaaattccag gatgtctgtg ttagagctta cctagctctt 3061 cgccatcaca caaacctgtt gatcatcttg ttctccatga tgctgatgac aggaatgccc 3121 cagctgacaa gcaaagagga cattgaatat atccgggatg ccctcaccgt gggaaaaagc 3181 gaggaggacg ctaagaaata tttccttgat cagatcgaag tctgcagaga caaaggatgg 3241 actgtgcagt ttaactggtt cctacatctt gttcttggca tcaaacaagg agaaaagcac 3301 tccgcttga
SEP ID NO: 24 Mouse PIK3CG (Isoform 3) Amino Acid Sequence
1 melenyeqpv vlrednlrrr rrmkprsaag slssmelipi efvlptsqri sktpetallh
61 vaghgnveqm kaqvwlrale tsvaaefyhr lgpdqfllly qkkgqwyeiy dryqvvqtld
121 clhywklmhk spgqihvvqr hvpseetlaf qkqltsligy dvtdisnvhd deleftrrrl
181 vtprmaevag rdaklyamhp wvtskplpdy lskkiannci fivihrgtts qtikvsaddt
241 pgtilqsfft kmakkkslmn isesqseqdf vlrvcgrdey lvgetplknf qwvrqclkng
301 deihlvldtp pdpaldevrk eewplvddct gvtgyheqlt ihgkdhesvf tvslwdcdrk
361 frvkirgidi pvlprntdlt vfveaniqhg qqvlcqrrts pkpfaeevlw nvwlefgiki
421 kdlpkgalln Iqiyccktps Isskasaetp gseskgkaql lyyvnlllid hrfllrhgdy
481 vlhmwqisgk aeeqgsfnad kltsatnpdk ensmsisill dnychpialp khrptpdpeg
541 drvraempnq lrkqleaiia tdplnpltae dkellwhfry eslkhpkayp klfssvkwgq
601 qeivaktyql larreiwdqs aldvgltmql ldcnfsdenv raiavqkles ledddvlhyl
661 lqlvqavkfe pyhdsalarf llkrglrnkr ighflfwflr seiaqsrhyq qrfavileay
721 lrgcgtamlq dftqqvhvie mlqkvtidik slsaekydvs sqvisqlkqk leslqnsnlp
781 esfrvpydpg lkagtlviek ckvmaskkkp lwlefkcadp tvlsnetigi ifkhgddlrq
841 dmlilqilri mesiwetesl dlcllpygci stgdkigmie ivkdattiaq iqqstvgntg 901 afkdevlnhw lkekcpieek fqaaverfvy scagycvatf vlgigdrhnd nimisetgnl 961 fhidfghilg nyksflgink ervpfvltpd flfvmgssgk ktsphfqkfq dvcvraylal 1021 rhhtnlliil fsmmlmtgmp qltskediey irdaltvgks eedakkyfld qievcrdkgw 1081 tvqfnwflhl vlgikqgekh sa
SEP ID NO: 25 Human PIK3CD cDNA Acid Sequence
1 atgccccctg gggtggactg ccccatggaa ttctggacca aggaggagaa tcagagcgtt 61 gtggttgact tcctgctgcc cacaggggtc tacctgaact tccctgtgtc ccgcaatgcc 121 aacctcagca ccatcaagca gctgctgtgg caccgcgccc agtatgagcc gctcttccac 181 atgctcagtg gccccgaggc ctatgtgttc acctgcatca accagacagc ggagcagcaa 241 gagctggagg acgagcaacg gcgtctgtgt gacgtgcagc ccttcctgcc cgtcctgcgc 301 ctggtggccc gtgagggcga ccgcgtgaag aagctcatca actcacagat cagcctcctc 361 atcggcaaag gcctccacga gtttgactcc ttgtgcgacc cagaagtgaa cgactttcgc 421 gccaagatgt gccaattctg cgaggaggcg gccgcccgcc ggcagcagct gggctgggag 481 gcctggctgc agtacagttt ccccctgcag ctggagccct cggctcaaac ctgggggcct 541 ggtaccctgc ggctcccgaa ccgggccctt ctggtcaacg ttaagtttga gggcagcgag 601 gagagcttca ccttccaggt gtccaccaag gacgtgccgc tggcgctgat ggcctgtgcc 661 ctgcggaaga aggccacagt gttccggcag ccgctggtgg agcagccgga agactacacg 721 ctgcaggtga acggcaggca tgagtacctg tatggcagct acccgctctg ccagttccag 781 tacatctgca gctgcctgca cagtgggttg acccctcacc tgaccatggt ccattcctcc 841 tccatcctcg ccatgcggga tgagcagagc aaccctgccc cccaggtcca gaaaccgcgt 901 gccaaaccac ctcccattcc tgcgaagaag ccttcctctg tgtccctgtg gtccctggag 961 cagccgttcc gcatcgagct catccagggc agcaaagtga acgccgacga gcggatgaag 1021 ctggtggtgc aggccgggct tttccacggc aacgagatgc tgtgcaagac ggtgtccagc 1081 tcggaggtga gcgtgtgctc ggagcccgtg tggaagcagc ggctggagtt cgacatcaac 1141 atctgcgacc tgccccgcat ggcccgtctc tgctttgcgc tgtacgccgt gatcgagaaa 1201 gccaagaagg ctcgctccac caagaagaag tccaagaagg cggactgccc cattgcctgg 1261 gccaacctca tgctgtttga ctacaaggac cagcttaaga ccggggaacg ctgcctctac 1321 atgtggccct ccgtcccaga tgagaagggc gagctgctga accccacggg cactgtgcgc 1381 agtaacccca acacggatag cgccgctgcc ctgctcatct gcctgcccga ggtggccccg 1441 caccccgtgt actaccccgc cctggagaag atcttggagc tggggcgaca cagcgagtgt 1501 gtgcatgtca ccgaggagga gcagctgcag ctgcgggaaa tcctggagcg gcgggggtct 1561 ggggagctgt atgagcacga gaaggacctg gtgtggaagc tgcggcatga agtccaggag 1621 cacttcccgg aggcgctagc ccggctgctg ctggtcacca agtggaacaa gcatgaggat 1681 gtggcccaga tgctctacct gctgtgctcc tggccggagc tgcccgtcct gagcgccctg 1741 gagctgctag acttcagctt ccccgattgc cacgtaggct ccttcgccat caagtcgctg 1801 cggaaactga cggacgatga gctgttccag tacctgctgc agctggtgca ggtgctcaag 1861 tacgagtcct acctggactg cgagctgacc aaattcctgc tggaccgggc cctggccaac 1921 cgcaagatcg gccacttcct tttctggcac ctccgctccg agatgcacgt gccgtcggtg 1981 gccctgcgct tcggcctcat cctggaggcc tactgcaggg gcagcaccca ccacatgaag 2041 gtgctgatga agcaggggga agcactgagc aaactgaagg ccctgaatga cttcgtcaag 2101 ctgagctctc agaagacccc caagccccag accaaggagc tgatgcactt gtgcatgcgg 2161 caggaggcct acctagaggc cctctcccac ctgcagtccc cactcgaccc cagcaccctg 2221 ctggctgaag tctgcgtgga gcagtgcacc ttcatggact ccaagatgaa gcccctgtgg 2281 atcatgtaca gcaacgagga ggcaggcagc ggcggcagcg tgggcatcat ctttaagaac 2341 ggggatgacc tccggcagga catgctgacc ctgcagatga tccagctcat ggacgtcctg 2401 tggaagcagg aggggctgga cctgaggatg accccctatg gctgcctccc caccggggac 2461 cgcacaggcc tcattgaggt ggtactccgt tcagacacca tcgccaacat ccaactcaac 2521 aagagcaaca tggcagccac agccgccttc aacaaggatg ccctgctcaa ctggctgaag 2581 tccaagaacc cgggggaggc cctggatcga gccattgagg agttcaccct ctcctgtgct 2641 ggctattgtg tggccacata tgtgctgggc attggcgatc ggcacagcga caacatcatg 2701 atccgagaga gtgggcagct gttccacatt gattttggcc actttctggg gaatttcaag 2761 accaagtttg gaatcaaccg cgagcgtgtc ccattcatcc tcacctacga ctttgtccat 2821 gtgattcagc aggggaagac taataatagt gagaaatttg aacggttccg gggctactgt 2881 gaaagggcct acaccatcct gcggcgccac gggcttctct tcctccacct ctttgccctg 2941 atgcgggcgg caggcctgcc tgagctcagc tgctccaaag acatccagta tctcaaggac 3001 tccctggcac tggggaaaac agaggaggag gcactgaagc acttccgagt gaagtttaac 3061 gaagccctcc gtgagagctg gaaaaccaaa gtgaactggc tggcccacaa cgtgtccaaa 3121 gacaacaggc agtag
SEP ID NO: 26 Human PIK3CD Amino Acid Sequence
1 mppgvdcpme fwtkeenqsv vvdfllptgv ylnfpvsrna nlstikqllw hraqyeplfh 61 mlsgpeayvf tcinqtaeqq eledeqrrlc dvqpflpvlr lvaregdrvk klinsqisll 121 igkglhefds lcdpevndfr akmcqfceea aarrqqlgwe awlqys fplq lepsaqtwgp 181 gtlrlpnral lvnvkfegse es ftfqvstk dvplalmaca lrkkatvfrq plveqpedyt 241 lqvngrheyl ygsyplcqfq yicsclhsgl tphltmvhss silamrdeqs npapqvqkpr 301 akpppipakk pssvslwsle qpfrieliqg skvnadermk lvvqaglfhg nemlcktvss 361 sevsvcsepv wkqrlefdin icdlprmarl cfalyaviek akkarstkkk skkadcpiaw 421 anlmlfdykd qlktgercly mwpsvpdekg ellnptgtvr snpntdsaaa lliclpevap 481 hpvyypalek ilelgrhsec vhvteeeqlq lreilerrgs gelyehekdl vwklrhevqe 541 hfpealarll lvtkwnkhed vaqmlyllcs wpelpvlsal elldfs fpdc hvgs faiksl 601 rkltddelfq yllqlvqvlk yesyldcelt kflldralan rkighflfwh lrsemhvpsv 661 alrfglilea ycrgsthhmk vlmkqgeals klkalndfvk lssqktpkpq tkelmhlcmr 721 qeaylealsh Iqspldpstl laevcveqct fmdskmkplw imysneeags ggsvgiifkn 781 gddlrqdmlt lqmiqlmdvl wkqegldlrm tpygclptgd rtglievvlr sdtianiqln 841 ksnmaataaf nkdallnwlk sknpgealdr aieeftlsca gycvatyvlg igdrhsdnim 901 iresgqlfhi dfghflgnfk tkfginrerv pfiltydfvh viqqgktnns ekferfrgyc 961 eraytilrrh gllflhlfal mraaglpels cskdiqylkd slalgkteee alkhfrvkfn 1021 ealreswktk vnwlahnvsk dnrq
SEP ID NO: 27 Mouse PIK3CD (Transcript 1) cDNA Acid Sequence
1 atgccccctg gggtggactg ccccatggag ttctggacca aagaggagag ccagagcgtg 61 gttgttgact tcttgctgcc cacaggggtc tacttgaact tccccgtgtc ccgcaatgcc 121 aacctcagca ccatcaagca ggtgctgtgg caccgtgcac agtatgagcc actcttccac 181 atgctcagtg accccgaggc ctatgtgttc acctgtgtga accagacggc ggagcagcag 241 gagttggagg atgagcagcg gaggctgtgc gacatccagc ccttcctgcc cgtgctgcgc 301 ctcgtggccc gagaggggga ccgcgtgaag aagctcatta actcccagat cagcctcctc 361 attggcaaag gtctccatga gtttgattcc ctgcgggacc cggaagtaaa cgacttccgc 421 actaagatgc gccagttttg tgaagaggct gctgctcacc gccagcagct gggctgggtg 481 gaatggctgc agtacagctt ccccctgcag ctggagccct cagcaagggg ttggcgggcc 541 ggcttattgc gtgtcagcaa ccgagccctg ctggtcaacg tgaagttcga gggcagtgag 601 gagagcttca ccttccaggt atccaccaag gacatgcccc tggcactgat ggcctgtgcc 661 ctccgaaaaa aggccacagt gttccggcag cctctggtgg agcagcctga ggaatatgcc 721 ctgcaggtga acgggaggca cgaatacctc tacggcaact acccgctctg ccactttcag 781 tacatctgca gctgcctaca cagcgggctg acccctcatc tgaccatggt ccactcctcc 841 tccatccttg ctatgcggga tgagcagagc aatcctgccc cccaagtaca gaaaccacgt 901 gccaaacctc ccccgatccc tgccaagaag ccctcctctg tgtccctgtg gtccctggaa 961 cagccattct ccattgagct gatcgagggc ccggaaaaaaaaggttggaa atgctgacga gcggatgaag 1021 ctggttgttc aggccgggct cttccatggc aatgagatgc tgtgcaagac tgtgtcaagc 1081 tcggaggtga atgtatgctc agagcccgtg tggaagcagc gactggagtt cgatatcagc 1141 gtctgtgacc tcccgcgcat ggctcgactc tgttttgctc tctatgccgt cgtggagaag 1201 gctaagaagg cacgctccac aaagaagaag tctaagaagg cggactgccc catcgcttgg 1261 gccaacctca tgctattcga ctacaaagat cagctcaaga cgggggagcg ctgcctctac 1321 atgtggccct ctgtcccaga tgagaaggga gagctgctga atcctgcggg tacagtgcgc 1381 gggaacccca acacggagag tgccgctgcc ctggtcatct acctgcctga ggtggccccc 1441 caccctgtgt acttccccgc tctggagaag atcctggagc tggggcgtca cggggagcgt 1501 gggcgcatca cggaggagga gctgcagctg cgggagatcc tggaacggcg gggatccggg 1561 gaactgtacg aacatgagaa ggacctggtg tggaagatgc gccacgaagt ccaggagcat 1621 ttcccagagg cgctggcccg cctgctgctg gtcaccaagt ggaataaaca cgaggatgtg 1681 gcccagatgc tctatttgct gtgctcctgg cccgagctgc ctgtgctgag cgccctggaa 1741 cttctggact ttagctttcc cgactgctac gtgggctcct tcgccatcaa gtcccttcgg 1801 aagctgacgg acgatgagct cttccagtac cttctgcagc tggtgcaagt gctcaaatat 1861 gagtcctacc tggactgcga gctgaccaaa ttcttgctgg gccgagccct ggctaaccgc 1921 aagatcggac acttcctgtt ctggcacctc cgctctgaga tgcacgtacc atcagtggct 1981 ctgcggtttg gtctcatcat ggaagcctac tgcagaggca gcacccacca catgaaggtg 2041 ctgatgaagc agggggaagc actgagcaag cttaaggcac tgaatgactt tgtgaaggtg 2101 agttcccaga agaccaccaa gccccaaacc aaggagatga tgcatatgtg catgcgccag 2161 gagacctaca tggaggccct gtcccacctg cagtctccac tcgaccccag caccctgctg 2221 gaggaagtct gtgtggagca gtgcaccttc atggactcca aaatgaagcc cctgtggatc
2281 atgtacagca gcgaggaggc gggcagtgct ggcaacgtgg gcatcatctt taagaacggg 2341 gatgacctcc gccaggacat gctgactctg cagatgatcc agctcatgga cgtcctgtgg 2401 aagcaggagg gcctggacct gaggatgacg ccctacggct gcctccccac cggggaccgc 2461 acaggtctca tcgaggtggt cctccactcg gacaccatcg ccaacatcca gctgaacaaa 2521 agcaacatgg cggccacagc tgccttcaac aaggacgccc tgctcaactg gctcaagtcc 2581 aagaaccctg gggaggccct ggatcgggcc attgaggaat tcaccctctc ctgtgctggc 2641 tactgtgtgg ccacatatgt tctgggcatc ggtgaccggc acagcgacaa catcatgatc 2701 agagagagtg ggcagctctt ccacattgat tttggccact ttctggggaa cttcaagacc 2761 aagtttggaa tcaaccgaga gcgcgtcccc ttcattctca cctacgactt tgtccacgtg 2821 atccagcagg ggaagactaa caacagtgag aagtttgaaa ggttccgcgg ctactgtgaa 2881 cgagcctata ccatcctgcg gcgccacggg ctgcttttcc tccatctctt cgccctgatg 2941 cgggccgcag gtctgcctga gcttagctgc tccaaagata tccagtatct caaggactct 3001 ctggcactgg ggaagacgga ggaagaggcg ctaaagcact tccgggtgaa gttcaacgaa 3061 gctctccgag aaagctggaa aaccaaagtc aactggctgg cgcacaatgt gtccaaggat 3121 aaccgacagt ag
SEP ID NO: 28 Mouse PIK3CD (Isoform 1) Amino Acid Sequence
1 mppgvdcpme fwtkeesqsv vvdfllptgv ylnfpvsrna nlstikqvlw hraqyeplfh
61 mlsdpeayvf tcvnqtaeqq eledeqrrlc diqpflpvlr lvaregdrvk klinsqisll
121 igkglhefds lrdpevndfr tkmrqfceea aahrqqlgwv ewlqys fplq lepsargwra
181 gllrvsnral lvnvkfegse esftfqvstk dmplalmaca lrkkatvfrq plveqpeeya
241 lqvngrheyl ygnyplchfq yicsclhsgl tphltmvhss silamrdeqs npapqvqkpr
301 akpppipakk pssvslwsle qpfsielieg rkvnadermk lvvqaglfhg nemlcktvss
361 sevnvcsepv wkqrlefdis vcdlprmarl cfalyavvek akkarstkkk skkadcpiaw
421 anlmlfdykd qlktgercly mwpsvpdekg ellnpagtvr gnpntesaaa lviylpevap
481 hpvyfpalek ilelgrhger griteeelql reilerrgsg elyehekdlv wkmrhevqeh
541 fpealarlll vtkwnkhedv aqmlyllcsw pelpvlsale lldfs fpdcy vgs faikslr
601 kltddelfqy llqlvqvlky esyldceltk fllgralanr kighflfwhl rsemhvpsva
661 Irfglimeay crgsthhmkv Imkqgealsk Ikalndfvkv ssqkttkpqt kemmhmcmrq
721 etymealshl qspldpstll eevcveqctf mdskmkplwi mysseeagsa gnvgiifkng
781 ddlrqdmltl qmiqlmdvlw kqegldlrmt pygclptgdr tglievvlhs dtianiqlnk
841 snmaataafn kdallnwlks knpgealdra ieeftlscag ycvatyvlgi gdrhsdnimi
901 resgqlfhid fghflgnfkt kfginrervp filtydfvhv iqqgktnnse kferfrgyce
961 raytilrrhg llflhlfalm raaglpelsc skdiqylkds lalgkteeea lkhfrvkfne
1021 alreswktkv nwlahnvskd nrq
SEP ID NO: 29 Mouse PIK3CD (Transcript 2) cDNA Acid Sequence
1 atgccccctg gggtggactg ccccatggag ttctggacca aagaggagag ccagagcgtg 61 gttgttgact tcttgctgcc cacaggggtc tacttgaact tccccgtgtc ccgcaatgcc 121 aacctcagca ccatcaagca ggtgctgtgg caccgtgcac agtatgagcc actcttccac 181 atgctcagtg accccgaggc ctatgtgttc acctgtgtga accagacggc ggagcagcag 241 gagttggagg atgagcagcg gaggctgtgc gacatccagc ccttcctgcc cgtgctgcgc 301 ctcgtggccc gagaggggga ccgcgtgaag aagctcatta actcccagat cagcctcctc 361 attggcaaag gtctccatga gtttgattcc ctgcgggacc cggaagtaaa cgacttccgc 421 actaagatgc gccagttttg tgaagaggct gctgctcacc gccagcagct gggctgggtg 481 gaatggctgc agtacagctt ccccctgcag ctggagccct cagcaagggg ttggcgggcc 541 ggcttattgc gtgtcagcaa ccgagccctg ctggtcaacg tgaagttcga gggcagtgag 601 gagagcttca ccttccaggt atccaccaag gacatgcccc tggcactgat ggcctgtgcc 661 ctccgaaaaa aggccacagt gttccggcag cctctggtgg agcagcctga ggaatatgcc 721 ctgcaggtga acgggaggca cgaatacctc tacggcaact acccgctctg ccactttcag 781 tacatctgca gctgcctaca cagcgggctg acccctcatc tgaccatggt ccactcctcc 841 tccatccttg ctatgcggga tgagcagagc aatcctgccc cccaagtaca gaaaccacgt 901 gccaaacctc ccccgatccc tgccaagaag ccctcctctg tgtccctgtg gtccctggaa 961 cagccattct ccattgagct gatcgagggc ccggaaaaaaaaggttggaa atgctgacga gcggatgaag 1021 ctggttgttc aggccgggct cttccatggc aatgagatgc tgtgcaagac tgtgtcaagc 1081 tcggaggtga atgtatgctc agagcccgtg tggaagcagc gactggagtt cgatatcagc 1141 gtctgtgacc tcccgcgcat ggctcgactc tgttttgctc tctatgccgt cgtggagaag 1201 gctaagaagg cacgctccac aaagaagaag tctaagaagg cggactgccc catcgcttgg 1261 gccaacctca tgctattcga ctacaaagat cagctcaaga cgggggagcg ctgcctctac 1321 atgtggccct ctgtcccaga tgagaaggga gagctgctga atcctgcggg tacagtgcgc
1381 gggaacccca acacggagag tgccgctgcc ctggtcatct acctgcctga ggtggccccc 1441 caccctgtgt acttccccgc tctggagaag atcctggagc tggggcgtca cggggagcgt 1501 gggcgcatca cggaggagga gcagctgcag ctgcgggaga tcctggaacg gcggggatcc 1561 ggggaactgt acgaacatga gaaggacctg gtgtggaaga tgcgccacga agtccaggag 1621 catttcccag aggcgctggc ccgcctgctg ctggtcacca agtggaataa acacgaggat 1681 gtggcccagc tgtcccagat gctctatttg ctgtgctcct ggcccgagct gcctgtgctg 1741 agcgccctgg aacttctgga ctttagcttt cccgactgct acgtgggctc cttcgccatc 1801 aagtcccttc ggaagctgac ggacgatgag ctcttccagt accttctgca gctggtgcaa 1861 gtgctcaaat atgagtccta cctggactgc gagctgacca aattcttgct gggccgagcc 1921 ctggctaacc gcaagatcgg acacttcctg ttctggcacc tccgctctga gatgcacgta 1981 ccatcagtgg ctctgcggtt tggtctcatc atggaagcct actgcagagg cagcacccac 2041 cacatgaagg tgctgatgaa gcagggggaa gcactgagca agcttaaggc actgaatgac 2101 tttgtgaagg tgagttccca gaagaccacc aagccccaaa ccaaggagat gatgcatatg 2161 tgcatgcgcc aggagaccta catggaggcc ctgtcccacc tgcagtctcc actcgacccc 2221 agcaccctgc tggaggaagt ctgtgtggag cagtgcacct tcatggactc caaaatgaag 2281 cccctgtgga tcatgtacag cagcgaggag gcgggcagtg ctggcaacgt gggcatcatc 2341 tttaagaacg gggatgacct ccgccaggac atgctgactc tgcagatgat ccagctcatg 2401 gacgtcctgt ggaagcagga gggcctggac ctgaggatga cgccctacgg ctgcctcccc 2461 accggggacc gcacaggtct catcgaggtg gtcctccact cggacaccat cgccaacatc 2521 cagctgaaca aaagcaacat ggcggccaca gctgccttca acaaggacgc cctgctcaac 2581 tggctcaagt ccaagaaccc tggggaggcc ctggatcggg ccattgagga attcaccctc 2641 tcctgtgctg gctactgtgt ggccacatat gttctgggca tcggtgaccg gcacagcgac 2701 aacatcatga tcagagagag tgggcagctc ttccacattg attttggcca ctttctgggg 2761 aacttcaaga ccaagtttgg aatcaaccga gagcgcgtcc ccttcattct cacctacgac 2821 tttgtccacg tgatccagca ggggaagact aacaacagtg agaagtttga aaggttccgc 2881 ggctactgtg aacgagccta taccatcctg cggcgccacg ggctgctttt cctccatctc 2941 ttcgccctga tgcgggccgc aggtctgcct gagcttagct gctccaaaga tatccagtat 3001 ctcaaggact ctctggcact ggggaagacg gaggaagagg cgctaaagca cttccgggtg 3061 aagttcaacg aagctctccg agaaagctgg aaaaccaaag tcaactggct ggcgcacaat 3121 gtgtccaagg ataaccgaca gtag
SEP ID NO: 30 Mouse PIK3CD (Isoform 2) Amino Acid Sequence
1 mppgvdcpme fwtkeesqsv vvdfllptgv ylnfpvsrna nlstikqvlw hraqyeplfh
61 mlsdpeayvf tcvnqtaeqq eledeqrrlc diqpflpvlr lvaregdrvk klinsqisll
121 igkglhefds lrdpevndfr tkmrqfceea aahrqqlgwv ewlqys fplq lepsargwra
181 gllrvsnral lvnvkfegse esftfqvstk dmplalmaca lrkkatvfrq plveqpeeya
241 lqvngrheyl ygnyplchfq yicsclhsgl tphltmvhss silamrdeqs npapqvqkpr
301 akpppipakk pssvslwsle qpfsielieg rkvnadermk lvvqaglfhg nemlcktvss
361 sevnvcsepv wkqrlefdis vcdlprmarl cfalyavvek akkarstkkk skkadcpiaw
421 anlmlfdykd qlktgercly mwpsvpdekg ellnpagtvr gnpntesaaa lviylpevap
481 hpvyfpalek ilelgrhger griteeeqlq lreilerrgs gelyehekdl vwkmrhevqe
541 hfpealarll lvtkwnkhed vaqlsqmlyl lcswpelpvl salelldfs f pdcyvgs fai
601 kslrkltdde Ifqyllqlvq vlkyesyldc eltkfllgra lanrkighfl fwhlrsemhv
661 psvalrfgli meaycrgsth hmkvlmkqge alsklkalnd fvkvssqktt kpqtkemmhm
721 cmrqetymea lshlqspldp stlleevcve qctfmdskmk plwimyssee agsagnvgii
781 fkngddlrqd mltlqmiqlm dvlwkqegld lrmtpygclp tgdrtgliev vlhsdtiani
841 qlnksnmaat aafnkdalln wlksknpgea ldraieeftl scagycvaty vlgigdrhsd
901 nimiresgql fhidfghflg nfktkfginr ervpfiltyd fvhviqqgkt nnsekferfr
961 gyceraytil rrhgllflhl falmraaglp elscskdiqy lkdslalgkt eeealkhfrv
1021 kfnealresw ktkvnwlahn vskdnrq
SEP ID NO: 31 Mouse PIK3CD (Transcript 3) cDNA Acid Sequence
1 atgccccctg gggtggactg ccccatggag ttctggacca aagaggagag ccagagcgtg
61 gttgttgact tcttgctgcc cacaggggtc tacttgaact tccccgtgtc ccgcaatgcc
121 aacctcagca ccatcaagca ggtgctgtgg caccgtgcac agtatgagcc actcttccac
181 atgctcagtg accccgaggc ctatgtgttc acctgtgtga accagacggc ggagcagcag
241 gagttggagg atgagcagcg gaggctgtgc gacatccagc ccttcctgcc cgtgctgcgc
301 ctcgtggccc gagaggggga ccgcgtgaag aagctcatta actcccagat cagcctcctc
361 attggcaaag gtctccatga gtttgattcc ctgcgggacc cggaagtaaa cgacttccgc
421 actaagatgc gccagttttg tgaagaggct gctgctcacc gccagcagct gggctgggtg
481 gaatggctgc agtacagctt ccccctgcag ctggagccct cagcaagggg ttggcgggcc 541 ggcttattgc gtgtcagcaa ccgagccctg ctggtcaacg tgaagttcga gggcagtgag 601 gagagcttca ccttccaggt atccaccaag gacatgcccc tggcactgat ggcctgtgcc 661 ctccgaaaaa aggccacagt gttccggcag cctctggtgg agcagcctga ggaatatgcc 721 ctgcaggtga acgggaggca cgaatacctc tacggcaact acccgctctg ccactttcag 781 tacatctgca gctgcctaca cagcgggctg acccctcatc tgaccatggt ccactcctcc 841 tccatccttg ctatgcggga tgagcagagc aatcctgccc cccaagtaca gaaaccacgt 901 gccaaacctc ccccgatccc tgccaagaag ccctcctctg tgtccctgtg gtccctggaa 961 cagccattct ccattgagct gatcgagggc cgaaaagtga atgctgacga gcggatgaag 1021 ctggttgttc aggccgggct cttccatggc aatgagatgc tgtgcaagac tgtgtcaagc 1081 tcggaggtga atgtatgctc agagcccgtg tggaagcagc gactggagtt cgatatcagc 1141 gtctgtgacc tcccgcgcat ggctcgactc tgttttgctc tctatgccgt cgtggagaag 1201 gctaagaagg cacgctccac aaagaagaag tctaagaagg cggactgccc catcgcttgg 1261 gccaacctca tgctattcga ctacaaagat cagctcaaga cgggggagcg ctgcctctac 1321 atgtggccct ctgtcccaga tgagaaggga gagctgctga atcctgcggg tacagtgcgc 1381 gggaacccca acacggagag tgccgctgcc ctggtcatct acctgcctga ggtggccccc 1441 caccctgtgt acttccccgc tctggagaag atcctggagc tggggcgtca cggggagcgt 1501 gggcgcatca cggaggagga gcagctgcag ctgcgggaga tcctggaacg gcggggatcc 1561 ggggaactgt acgaacatga gaaggacctg gtgtggaaga tgcgccacga agtccaggag 1621 catttcccag aggcgctggc ccgcctgctg ctggtcacca agtggaataa acacgaggat 1681 gtggcccagc tgtcccagat gctctatttg ctgtgctcct ggcccgagct gcctgtgctg 1741 agcgccctgg aacttctgga ctttagcttt cccgactgct acgtgggctc cttcgccatc 1801 aagtcccttc ggaagctgac ggacgatgag ctcttccagt accttctgca gctggtgcaa 1861 gtgctcaaat atgagtccta cctggactgc gagctgacca aattcttgct gggccgagcc 1921 ctggctaacc gcaagatcgg acacttcctg ttctggcacc tccgctctga gatgcacgta 1981 ccatcagtgg ctctgcggtt tggtctcatc atggaagcct actgcagagg cagcacccac 2041 cacatgaagg tgctgatgaa gcagggggaa gcactgagca agcttaaggc actgaatgac 2101 tttgtgaagg tgagttccca gaagaccacc aagccccaaa ccaaggagat gatgcatatg 2161 tgcatgcgcc aggagaccta catggaggcc ctgtcccacc tgcagtctcc actcgacccc 2221 agcaccctgc tggaggaagt ctgtgtggag cagtgcacct tcatggactc caaaatgaag 2281 cccctgtgga tcatgtacag cagcgaggag gcgggcagtg ctggcaacgt gggcatcatc 2341 tttaagaacg gggatgacct ccgccaggac atgctgactc tgcagatgat ccagctcatg 2401 gacgtcctgt ggaagcagga gggcctggac ctgaggatga cgccctacgg ctgcctcccc 2461 accggggacc gcacaggtct catcgaggtg gtcctccact cggacaccat cgccaacatc 2521 cagctgaaca aaagcaacat ggcggccaca gctgccttca acaaggacgc cctgctcaac 2581 tggctcaagt ccaagaaccc tggggaggcc ctggatcggg ccattgagga attcaccctc 2641 tcctgtgctg gctactgtgt ggccacatat gttctgggca tcggtgaccg gcacagcgac 2701 aacatcatga tcagagagag tgggcagctc ttccacattg attttggcca ctttctgggg 2761 aacttcaaga ccaagtttgg aatcaaccga gagcgcgtcc ccttcattct cacctacgac 2821 tttgtccacg tgatccagca ggggaagact aacaacagtg agaagtttga aaggttccgc 2881 ggctactgtg aacgagccta taccatcctg cggcgccacg ggctgctttt cctccatctc 2941 ttcgccctga tgcgggccgc aggtctgcct gagcttagct gctccaaaga tatccagtat 3001 ctcaaggact ctctggcact ggggaagacg gaggaagagg cgctaaagca cttccgggtg 3061 aagttcaacg aagctctccg agaaagctgg aaaaccaaag tcaactggct ggcgcacaat 3121 gtgtccaagg ataaccgaca gtag
SEP ID NO: 32 Mouse PIK3CD (Isoform 3) Amino Acid Sequence
1 mppgvdcpme fwtkeesqsv vvdfllptgv ylnfpvsrna nlstikqvlw hraqyeplfh
61 mlsdpeayvf tcvnqtaeqq eledeqrrlc diqpflpvlr lvaregdrvk klinsqisll
121 igkglhefds lrdpevndfr tkmrqfceea aahrqqlgwv ewlqys fplq lepsargwra
181 gllrvsnral lvnvkfegse esftfqvstk dmplalmaca lrkkatvfrq plveqpeeya
241 lqvngrheyl ygnyplchfq yicsclhsgl tphltmvhss silamrdeqs npapqvqkpr
301 akpppipakk pssvslwsle qpfsielieg rkvnadermk lvvqaglfhg nemlcktvss
361 sevnvcsepv wkqrlefdis vcdlprmarl cfalyavvek akkarstkkk skkadcpiaw
421 anlmlfdykd qlktgercly mwpsvpdekg ellnpagtvr gnpntesaaa lviylpevap
481 hpvyfpalek ilelgrhger griteeeqlq lreilerrgs gelyehekdl vwkmrhevqe
541 hfpealarll lvtkwnkhed vaqlsqmlyl lcswpelpvl salelldfs f pdcyvgs fai
601 kslrkltdde Ifqyllqlvq vlkyesyldc eltkfllgra lanrkighfl fwhlrsemhv
661 psvalrfgli meaycrgsth hmkvlmkqge alsklkalnd fvkvssqktt kpqtkemmhm
721 cmrqetymea lshlqspldp stlleevcve qctfmdskmk plwimyssee agsagnvgii
781 fkngddlrqd mltlqmiqlm dvlwkqegld lrmtpygclp tgdrtgliev vlhsdtiani 841 qlnksnmaat aafnkdalln wlksknpgea ldraieeftl scagycvaty vlgigdrhsd 901 nimiresgql fhidfghflg nfktkfginr ervpfiltyd fvhviqqgkt nnsekferfr 961 gyceraytil rrhgllflhl falmraaglp elscskdiqy lkdslalgkt eeealkhfrv 1021 kfnealresw ktkvnwlahn vskdnrq
SEP ID NO: 33 Mouse PIK3CD (Transcript 4) cDNA Acid Sequence
1 atgccccctg gggtggactg ccccatggag ttctggacca aagaggagag ccagagcgtg 61 gttgttgact tcttgctgcc cacaggggtc tacttgaact tccccgtgtc ccgcaatgcc 121 aacctcagca ccatcaagca ggtgctgtgg caccgtgcac agtatgagcc actcttccac 181 atgctcagtg accccgaggc ctatgtgttc acctgtgtga accagacggc ggagcagcag 241 gagttggagg atgagcagcg gaggctgtgc gacatccagc ccttcctgcc cgtgctgcgc 301 ctcgtggccc gagaggggga ccgcgtgaag aagctcatta actcccagat cagcctcctc 361 attggcaaag gtctccatga gtttgattcc ctgcgggacc cggaagtaaa cgacttccgc 421 actaagatgc gccagttttg tgaagaggct gctgctcacc gccagcagct gggctgggtg 481 gaatggctgc agtacagctt ccccctgcag ctggagccct cagcaagggg ttggcgggcc 541 ggcttattgc gtgtcagcaa ccgagccctg ctggtcaacg tgaagttcga gggcagtgag 601 gagagcttca ccttccaggt atccaccaag gacatgcccc tggcactgat ggcctgtgcc 661 ctccgaaaaa aggccacagt gttccggcag cctctggtgg agcagcctga ggaatatgcc 721 ctgcaggtga acgggaggca cgaatacctc tacggcaact acccgctctg ccactttcag 781 tacatctgca gctgcctaca cagcgggctg acccctcatc tgaccatggt ccactcctcc 841 tccatccttg ctatgcggga tgagcagagc aatcctgccc cccaagtaca gaaaccacgt 901 gccaaacctc ccccgatccc tgccaagaag ccctcctctg tgtccctgtg gtccctggaa 961 cagccattct ccattgagct gatcgagggc cgaaaagtga atgctgacga gcggatgaag 1021 ctggttgttc aggccgggct cttccatggc aatgagatgc tgtgcaagac tgtgtcaagc 1081 tcggaggtga atgtatgctc agagcccgtg tggaagcagc gactggagtt cgatatcagc 1141 gtctgtgacc tcccgcgcat ggctcgactc tgttttgctc tctatgccgt cgtggagaag 1201 gctaagaagg cacgctccac aaagaagaag tctaagaagg cggactgccc catcgcttgg 1261 gccaacctca tgctattcga ctacaaagat cagctcaaga cgggggagcg ctgcctctac 1321 atgtggccct ctgtcccaga tgagaaggga gagctgctga atcctgcggg tacagtgcgc 1381 gggaacccca acacggagag tgccgctgcc ctggtcatct acctgcctga ggtggccccc 1441 caccctgtgt acttccccgc tctggagaag atcctggagc tggggcgtca cggggagcgt 1501 gggcgcatca cggaggagga gcagctgcag ctgcgggaga tcctggaacg gcggggatcc 1561 ggggaactgt acgaacatga gaaggacctg gtgtggaaga tgcgccacga agtccaggag 1621 catttcccag aggcgctggc ccgcctgctg ctggtcacca agtggaataa acacgaggat 1681 gtggcccaga tgctctattt gctgtgctcc tggcccgagc tgcctgtgct gagcgccctg 1741 gaacttctgg actttagctt tcccgactgc tacgtgggct ccttcgccat caagtccctt 1801 cggaagctga cggacgatga gctcttccag taccttctgc agctggtgca agtgctcaaa 1861 tatgagtcct acctggactg cgagctgacc aaattcttgc tgggccgagc cctggctaac 1921 cgcaagatcg gacacttcct gttctggcac ctccgctctg agatgcacgt accatcagtg 1981 gctctgcggt ttggtctcat catggaagcc tactgcagag gcagcaccca ccacatgaag 2041 gtgctgatga agcaggggga agcactgagc aagcttaagg cactgaatga ctttgtgaag 2101 gtgagttccc agaagaccac caagccccaa accaaggaga tgatgcatat gtgcatgcgc 2161 caggagacct acatggaggc cctgtcccac ctgcagtctc cactcgaccc cagcaccctg 2221 ctggaggaag tctgtgtgga gcagtgcacc ttcatggact ccaaaatgaa gcccctgtgg 2281 atcatgtaca gcagcgagga ggcgggcagt gctggcaacg tgggcatcat ctttaagaac 2341 ggggatgacc tccgccagga catgctgact ctgcagatga tccagctcat ggacgtcctg 2401 tggaagcagg agggcctgga cctgaggatg acgccctacg gctgcctccc caccggggac 2461 cgcacaggtc tcatcgaggt ggtcctccac tcggacacca tcgccaacat ccagctgaac 2521 aaaagcaaca tggcggccac agctgccttc aacaaggacg ccctgctcaa ctggctcaag 2581 tccaagaacc ctggggaggc cctggatcgg gccattgagg aattcaccct ctcctgtgct 2641 ggctactgtg tggccacata tgttctgggc atcggtgacc ggcacagcga caacatcatg 2701 atcagagaga gtgggcagct cttccacatt gattttggcc actttctggg gaacttcaag 2761 accaagtttg gaatcaaccg agagcgcgtc cccttcattc tcacctacga ctttgtccac 2821 gtgatccagc aggggaagac taacaacagt gagaagtttg aaaggttccg cggctactgt 2881 gaacgagcct ataccatcct gcggcgccac gggctgcttt tcctccatct cttcgccctg 2941 atgcgggccg caggtctgcc tgagcttagc tgctccaaag atatccagta tctcaaggac 3001 tctctggcac tggggaagac ggaggaagag gcgctaaagc acttccgggt gaagttcaac 3061 gaagctctcc gagaaagctg gaaaaccaaa gtcaactggc tggcgcacaa tgtgtccaag 3121 gataaccgac agtag
SEP ID NO: 34 Mouse PIK3CD (Isoform 4) Amino Acid Sequence
1 mppgvdcpme fwtkeesqsv vvdfllptgv ylnfpvsrna nlstikqvlw hraqyeplfh 61 mlsdpeayvf tcvnqtaeqq eledeqrrlc diqpflpvlr lvaregdrvk klinsqisll 121 igkglhefds lrdpevndfr tkmrqfceea aahrqqlgwv ewlqys fplq lepsargwra 181 gllrvsnral lvnvkfegse es ftfqvstk dmplalmaca lrkkatvfrq plveqpeeya 241 lqvngrheyl ygnyplchfq yicsclhsgl tphltmvhss silamrdeqs npapqvqkpr 301 akpppipakk pssvslwsle qpfsielieg rkvnadermk lvvqaglfhg nemlcktvss 361 sevnvcsepv wkqrlefdis vcdlprmarl cfalyavvek akkarstkkk skkadcpiaw 421 anlmlfdykd qlktgercly mwpsvpdekg ellnpagtvr gnpntesaaa lviylpevap 481 hpvyfpalek ilelgrhger griteeeqlq lreilerrgs gelyehekdl vwkmrhevqe 541 hfpealarll lvtkwnkhed vaqmlyllcs wpelpvlsal elldfs fpdc yvgs faiksl 601 rkltddelfq yllqlvqvlk yesyldcelt kfllgralan rkighflfwh lrsemhvpsv 661 alrfglimea ycrgsthhmk vlmkqgeals klkalndfvk vssqkttkpq tkemmhmcmr 721 qetymealsh Iqspldpstl leevcveqct fmdskmkplw imysseeags agnvgiifkn 781 gddlrqdmlt lqmiqlmdvl wkqegldlrm tpygclptgd rtglievvlh sdtianiqln 841 ksnmaataaf nkdallnwlk sknpgealdr aieeftlsca gycvatyvlg igdrhsdnim 901 iresgqlfhi dfghflgnfk tkfginrerv pfiltydfvh viqqgktnns ekferfrgyc 961 eraytilrrh gllflhlfal mraaglpels cskdiqylkd slalgkteee alkhfrvkfn 1021 ealreswktk vnwlahnvsk dnrq
SEP ID NO: 35 Mouse PIK3CD (Transcript 5) cDNA Acid Sequence
1 atgccccctg gggtggactg ccccatggag ttctggacca aagaggagag ccagagcgtg 61 gttgttgact tcttgctgcc cacaggggtc tacttgaact tccccgtgtc ccgcaatgcc 121 aacctcagca ccatcaagca ggtgctgtgg caccgtgcac agtatgagcc actcttccac 181 atgctcagtg accccgaggc ctatgtgttc acctgtgtga accagacggc ggagcagcag 241 gagttggagg atgagcagcg gaggctgtgc gacatccagc ccttcctgcc cgtgctgcgc 301 ctcgtggccc gagaggggga ccgcgtgaag aagctcatta actcccagat cagcctcctc 361 attggcaaag gtctccatga gtttgattcc ctgcgggacc cggaagtaaa cgacttccgc 421 actaagatgc gccagttttg tgaagaggct gctgctcacc gccagcagct gggctgggtg 481 gaatggctgc agtacagctt ccccctgcag ctggagccct cagcaagggg ttggcgggcc 541 ggcttattgc gtgtcagcaa ccgagccctg ctggtcaacg tgaagttcga gggcagtgag 601 gagagcttca ccttccaggt atccaccaag gacatgcccc tggcactgat ggcctgtgcc 661 ctccgaaaaa aggccacagt gttccggcag cctctggtgg agcagcctga ggaatatgcc 721 ctgcaggtga acgggaggca cgaatacctc tacggcaact acccgctctg ccactttcag 781 tacatctgca gctgcctaca cagcgggctg acccctcatc tgaccatggt ccactcctcc 841 tccatccttg ctatgcggga tgagcagagc aatcctgccc cccaagtaca gaaaccacgt 901 gccaaacctc ccccgatccc tgccaagaag ccctcctctg tgtccctgtg gtccctggaa 961 cagccattct ccattgagct gatcgagggc ccggaaaaaaaaggttggaa atgctgacga gcggatgaag 1021 ctggttgttc aggccgggct cttccatggc aatgagatgc tgtgcaagac tgtgtcaagc 1081 tcggaggtga atgtatgctc agagcccgtg tggaagcagc gactggagtt cgatatcagc 1141 gtctgtgacc tcccgcgcat ggctcgactc tgttttgctc tctatgccgt cgtggagaag 1201 gctaagaagg cacgctccac aaagaagaag tctaagaagg cggactgccc catcgcttgg 1261 gccaacctca tgctattcga ctacaaagat cagctcaaga cgggggagcg ctgcctctac 1321 atgtggccct ctgtcccaga tgagaaggga gagctgctga atcctgcggg tacagtgcgc 1381 gggaacccca acacggagag tgccgctgcc ctggtcatct acctgcctga ggtggccccc 1441 caccctgtgt acttccccgc tctggagaag atcctggagc tggggcgtca cggggagcgt 1501 gggcgcatca cggaggagga gcagctgcag ctgcgggaga tcctggaacg gcggggatcc 1561 ggggaactgt acgaacatga gaaggacctg gtgtggaaga tgcgccacga agtccaggag 1621 catttcccag aggcgctggc ccgcctgctg ctggtcacca agtggaataa acacgaggat 1681 gtggcccaga tgctctattt gctgtgctcc tggcccgagc tgcctgtgct gagcgccctg 1741 gaacttctgg actttagctt tcccgactgc tacgtgggct ccttcgccat caagtccctt 1801 cggaagctga cggacgatga gctcttccag taccttctgc agctggtgca agtgctcaaa 1861 tatgagtcct acctggactg cgagctgacc aaattcttgc tgggccgagc cctggctaac 1921 cgcaagatcg gacacttcct gttctggcac ctccgctctg agatgcacgt accatcagtg 1981 gctctgcggt ttggtctcat catggaagcc tactgcagag gcagcaccca ccacatgaag 2041 gtgctgatga agcaggggga agcactgagc aagcttaagg cactgaatga ctttgtgaag 2101 gtgagttccc agaagaccac caagccccaa accaaggaga tgatgcatat gtgcatgcgc 2161 caggagacct acatggaggc cctgtcccac ctgcagtctc cactcgaccc cagcaccctg 2221 ctggaggaag tctgcagtgt ggagcagtgc accttcatgg actccaaaat gaagcccctg
2281 tggatcatgt acagcagcga ggaggcgggc agtgctggca acgtgggcat catctttaag 2341 aacggggatg acctccgcca ggacatgctg actctgcaga tgatccagct catggacgtc 2401 ctgtggaagc aggagggcct ggacctgagg atgacgccct acggctgcct ccccaccggg 2461 gaccgcacag gtctcatcga ggtggtcctc cactcggaca ccatcgccaa catccagctg 2521 aacaaaagca acatggcggc cacagctgcc ttcaacaagg acgccctgct caactggctc 2581 aagtccaaga accctgggga ggccctggat cgggccattg aggaattcac cctctcctgt 2641 gctggctact gtgtggccac atatgttctg ggcatcggtg accggcacag cgacaacatc 2701 atgatcagag agagtgggca gctcttccac attgattttg gccactttct ggggaacttc 2761 aagaccaagt ttggaatcaa ccgagagcgc gtccccttca ttctcaccta cgactttgtc 2821 cacgtgatcc agcaggggaa gactaacaac agtgagaagt ttgaaaggtt ccgcggctac 2881 tgtgaacgag cctataccat cctgcggcgc cacgggctgc ttttcctcca tctcttcgcc 2941 ctgatgcggg ccgcaggtct gcctgagctt agctgctcca aagatatcca gtatctcaag 3001 gactctctgg cactggggaa gacggaggaa gaggcgctaa agcacttccg ggtgaagttc 3061 aacgaagctc tccgagaaag ctggaaaacc aaagtcaact ggctggcgca caatgtgtcc 3121 aaggataacc gacagtag
SEP ID NO: 36 Mouse PIK3CD (Isoform 5) Amino Acid Sequence
1 mppgvdcpme fwtkeesqsv vvdfllptgv ylnfpvsrna nlstikqvlw hraqyeplfh 61 mlsdpeayvf tcvnqtaeqq eledeqrrlc diqpflpvlr lvaregdrvk klinsqisll 121 igkglhefds lrdpevndfr tkmrqfceea aahrqqlgwv ewlqys fplq lepsargwra 181 gllrvsnral lvnvkfegse es ftfqvstk dmplalmaca lrkkatvfrq plveqpeeya 241 lqvngrheyl ygnyplchfq yicsclhsgl tphltmvhss silamrdeqs npapqvqkpr 301 akpppipakk pssvslwsle qpfsielieg rkvnadermk lvvqaglfhg nemlcktvss 361 sevnvcsepv wkqrlefdis vcdlprmarl cfalyavvek akkarstkkk skkadcpiaw 421 anlmlfdykd qlktgercly mwpsvpdekg ellnpagtvr gnpntesaaa lviylpevap 481 hpvyfpalek ilelgrhger griteeeqlq lreilerrgs gelyehekdl vwkmrhevqe 541 hfpealarll lvtkwnkhed vaqmlyllcs wpelpvlsal elldfs fpdc yvgs faiksl 601 rkltddelfq yllqlvqvlk yesyldcelt kfllgralan rkighflfwh lrsemhvpsv 661 alrfglimea ycrgsthhmk vlmkqgeals klkalndfvk vssqkttkpq tkemmhmcmr 721 qetymealsh Iqspldpstl leevcsveqc tfmdskmkpl wimysseeag sagnvgiifk 781 ngddlrqdml tlqmiqlmdv lwkqegldlr mtpygclptg drtglievvl hsdtianiql 841 nksnmaataa fnkdallnwl ksknpgeald raieeftlsc agycvatyvl gigdrhsdni 901 miresgqlfh idfghflgnf ktkfginrer vpfiltydfv hviqqgktnn sekferfrgy 961 ceraytilrr hgllflhlfa lmraaglpel scskdiqylk dslalgktee ealkhfrvkf 1021 nealreswkt kvnwlahnvs kdnrq
SEP ID NO: 37 Mouse PIK3CD (Transcript 6) cDNA Acid Sequence
1 atgccccctg gggtggactg ccccatggag ttctggacca aagaggagag ccagagcgtg 61 gttgttgact tcttgctgcc cacaggggtc tacttgaact tccccgtgtc ccgcaatgcc 121 aacctcagca ccatcaagca ggtgctgtgg caccgtgcac agtatgagcc actcttccac 181 atgctcagtg accccgaggc ctatgtgttc acctgtgtga accagacggc ggagcagcag 241 gagttggagg atgagcagcg gaggctgtgc gacatccagc ccttcctgcc cgtgctgcgc 301 ctcgtggccc gagaggggga ccgcgtgaag aagctcatta actcccagat cagcctcctc 361 attggcaaag gtctccatga gtttgattcc ctgcgggacc cggaagtaaa cgacttccgc 421 actaagatgc gccagttttg tgaagaggct gctgctcacc gccagcagct gggctgggtg 481 gaatggctgc agtacagctt ccccctgcag ctggagccct cagcaagggg ttggcgggcc 541 ggcttattgc gtgtcagcaa ccgagccctg ctggtcaacg tgaagttcga gggcagtgag 601 gagagcttca ccttccaggt atccaccaag gacatgcccc tggcactgat ggcctgtgcc 661 ctccgaaaaa aggccacagt gttccggcag cctctggtgg agcagcctga ggaatatgcc 721 ctgcaggtga acgggaggca cgaatacctc tacggcaact acccgctctg ccactttcag 781 tacatctgca gctgcctaca cagcgggctg acccctcatc tgaccatggt ccactcctcc 841 tccatccttg ctatgcggga tgagcagagc aatcctgccc cccaagtaca gaaaccacgt 901 gccaaacctc ccccgatccc tgccaagaag ccctcctctg tgtccctgtg gtccctggaa 961 cagccattct ccattgagct gatcgagggc ccggaaaaaaaaggttggaa atgctgacga gcggatgaag 1021 ctggttgttc aggccgggct cttccatggc aatgagatgc tgtgcaagac tgtgtcaagc 1081 tcggaggtga atgtatgctc agagcccgtg tggaagcagc gactggagtt cgatatcagc 1141 gtctgtgacc tcccgcgcat ggctcgactc tgttttgctc tctatgccgt cgtggagaag 1201 gctaagaagg cacgctccac aaagaagaag tctaagaagg cggactgccc catcgcttgg 1261 gccaacctca tgctattcga ctacaaagat cagctcaaga cgggggagcg ctgcctctac 1321 atgtggccct ctgtcccaga tgagaaggga gagctgctga atcctgcggg tacagtgcgc
1381 gggaacccca acacggagag tgccgctgcc ctggtcatct acctgcctga ggtggccccc 1441 caccctgtgt acttccccgc tctggagaag atcctggagc tggggcgtca cggggagcgt 1501 gggcgcatca cggaggagga gctgcagctg cgggagatcc tggaacggcg gggatccggg 1561 gaactgtacg aacatgagaa ggacctggtg tggaagatgc gccacgaagt ccaggagcat 1621 ttcccagagg cgctggcccg cctgctgctg gtcaccaagt ggaataaaca cgaggatgtg 1681 gcccagctgt cccagatgct ctatttgctg tgctcctggc ccgagctgcc tgtgctgagc 1741 gccctggaac ttctggactt tagctttccc gactgctacg tgggctcctt cgccatcaag 1801 tcccttcgga agctgacgga cgatgagctc ttccagtacc ttctgcagct ggtgcaagtg 1861 ctcaaatatg agtcctacct ggactgcgag ctgaccaaat tcttgctggg ccgagccctg 1921 gctaaccgca agatcggaca cttcctgttc tggcacctcc gctctgagat gcacgtacca 1981 tcagtggctc tgcggtttgg tctcatcatg gaagcctact gcagaggcag cacccaccac 2041 atgaaggtgc tgatgaagca gggggaagca ctgagcaagc ttaaggcact gaatgacttt 2101 gtgaaggtga gttcccagaa gaccaccaag ccccaaacca aggagatgat gcatatgtgc 2161 atgcgccagg agacctacat ggaggccctg tcccacctgc agtctccact cgaccccagc 2221 accctgctgg aggaagtctg tgtggagcag tgcaccttca tggactccaa aatgaagccc 2281 ctgtggatca tgtacagcag cgaggaggcg ggcagtgctg gcaacgtggg catcatcttt 2341 aagaacgggg atgacctccg ccaggacatg ctgactctgc agatgatcca gctcatggac 2401 gtcctgtgga agcaggaggg cctggacctg aggatgacgc cctacggctg cctccccacc 2461 ggggaccgca caggtctcat cgaggtggtc ctccactcgg acaccatcgc caacatccag 2521 ctgaacaaaa gcaacatggc ggccacagct gccttcaaca aggacgccct gctcaactgg 2581 ctcaagtcca agaaccctgg ggaggccctg gatcgggcca ttgaggaatt caccctctcc 2641 tgtgctggct actgtgtggc cacatatgtt ctgggcatcg gtgaccggca cagcgacaac 2701 atcatgatca gagagagtgg gcagctcttc cacattgatt ttggccactt tctggggaac 2761 ttcaagacca agtttggaat caaccgagag cgcgtcccct tcattctcac ctacgacttt 2821 gtccacgtga tccagcaggg gaagactaac aacagtgaga agtttgaaag gttccgcggc 2881 tactgtgaac gagcctatac catcctgcgg cgccacgggc tgcttttcct ccatctcttc 2941 gccctgatgc gggccgcagg tctgcctgag cttagctgct ccaaagatat ccagtatctc 3001 aaggactctc tggcactggg gaagacggag gaagaggcgc taaagcactt ccgggtgaag 3061 ttcaacgaag ctctccgaga aagctggaaa accaaagtca actggctggc gcacaatgtg 3121 tccaaggata accgacagta g
SEP ID NO: 38 Mouse PIK3CD (Isoform 6) Amino Acid Sequence
1 mppgvdcpme fwtkeesqsv vvdfllptgv ylnfpvsrna nlstikqvlw hraqyeplfh 61 mlsdpeayvf tcvnqtaeqq eledeqrrlc diqpflpvlr lvaregdrvk klinsqisll 121 igkglhefds lrdpevndfr tkmrqfceea aahrqqlgwv ewlqysfplq lepsargwra 181 gllrvsnral lvnvkfegse es ftfqvstk dmplalmaca lrkkatvfrq plveqpeeya 241 lqvngrheyl ygnyplchfq yicsclhsgl tphltmvhss silamrdeqs npapqvqkpr 301 akpppipakk pssvslwsle qpfsielieg rkvnadermk lvvqaglfhg nemlcktvss 361 sevnvcsepv wkqrlefdis vcdlprmarl cfalyavvek akkarstkkk skkadcpiaw 421 anlmlfdykd qlktgercly mwpsvpdekg ellnpagtvr gnpntesaaa Iviylpevap 481 hpvyfpalek ilelgrhger griteeelql reilerrgsg elyehekdlv wkmrhevqeh 541 fpealarlll vtkwnkhedv aqlsqmlyll cswpelpvls alelldfsfp dcyvgsfaik 601 slrkltddel fqyllqlvqv lkyesyldce ltkfllgral anrkighflf whlrsemhvp 661 svalrfglim eaycrgsthh mkvlmkqgea lsklkalndf vkvssqkttk pqtkemmhmc 721 mrqetymeal shlqspldps tlleevcveq ctfmdskmkp Iwimysseea gsagnvgiif 781 kngddlrqdm Itlqmiqlmd vlwkqegldl rmtpygclpt gdrtglievv Ihsdtianiq 841 lnksnmaata afnkdallnw lksknpgeal draieeftls cagycvatyv lgigdrhsdn 901 imiresgqlf hidfghflgn fktkfginre rvpfiltydf vhviqqgktn nsekferfrg 961 yceraytilr rhgllflhlf almraaglpe lscskdiqyl kdslalgkte eealkhfrvk 1021 fnealreswk tkvnwlahnv skdnrq
SEP ID NO: 39 Human niTOR cDNA Acid Sequence
1 atgcttggaa ccggacctgc cgccgccacc accgctgcca ccacatctag caatgtgagc
61 gtcctgcagc agtttgccag tggcctaaag agccggaatg aggaaaccag ggccaaagcc
121 gccaaggagc tccagcacta tgtcaccatg gaactccgag agatgagtca agaggagtct
181 actcgcttct atgaccaact gaaccatcac atttttgaat tggtttccag ctcagatgcc
241 aatgagagga aaggtggcat cttggccata gctagcctca taggagtgga aggtgggaat
301 gccacccgaa ttggcagatt tgccaactat cttcggaacc tcctcccctc caatgaccca
361 gttgtcatgg aaatggcatc caaggccatt ggccgtcttg ccatggcagg ggacactttt
421 accgctgagt acgtggaatt tgaggtgaag cgagccctgg aatggctggg tgctgaccgc
481 aatgagggcc ggagacatgc agctgtcctg gttctccgtg agctggccat cagcgtccct 541 accttcttct tccagcaagt gcaacccttc tttgacaaca tttttgtggc cgtgtgggac 601 cccaaacagg ccatccgtga gggagctgta gccgcccttc gtgcctgtct gattctcaca 661 acccagcgtg agccgaagga gatgcagaag cctcagtggt acaggcacac atttgaagaa 721 gcagagaagg gatttgatga gaccttggcc aaagagaagg gcatgaatcg ggatgatcgg 781 atccatggag ccttgttgat ccttaacgag ctggtccgaa tcagcagcat ggagggagag 841 cgtctgagag aagaaatgga agaaatcaca cagcagcagc tggtacacga caagtactgc 901 aaagatctca tgggcttcgg aacaaaacct cgtcacatta cccccttcac cagtttccag 961 gctgtacagc cccagcagtc aaatgccttg gtggggctgc tggggtacag ctctcaccaa 1021 ggcctcatgg gatttgggac ctcccccagt ccagctaagt ccaccctggt ggagagccgg 1081 tgttgcagag acttgatgga ggagaaattt gatcaggtgt gccagtgggt gctgaaatgc 1141 aggaatagca agaactcgct gatccaaatg acaatcctta atttgttgcc ccgcttggct 1201 gcattccgac cttctgcctt cacagatacc cagtatctcc aagataccat gaaccatgtc 1261 ctaagctgtg tcaagaagga gaaggaacgt acagcggcct tccaagccct ggggctactt 1321 tctgtggctg tgaggtctga gtttaaggtc tatttgcctc gcgtgctgga catcatccga 1381 gcggccctgc ccccaaagga cttcgcccat aagaggcaga aggcaatgca ggtggatgcc 1441 acagtcttca cttgcatcag catgctggct cgagcaatgg ggccaggcat ccagcaggat 1501 atcaaggagc tgctggagcc catgctggca gtgggactaa gccctgccct cactgcagtg 1561 ctctacgacc tgagccgtca gattccacag ctaaagaagg acattcaaga tgggctactg 1621 aaaatgctgt ccctggtcct tatgcacaaa ccccttcgcc acccaggcat gcccaagggc 1681 ctggcccatc agctggcctc tcctggcctc acgaccctcc ctgaggccag cgatgtgggc 1741 agcatcactc ttgccctccg aacgcttggc agctttgaat ttgaaggcca ctctctgacc 1801 caatttgttc gccactgtgc ggatcatttc ctgaacagtg agcacaagga gatccgcatg 1861 gaggctgccc gcacctgctc ccgcctgctc acaccctcca tccacctcat cagtggccat 1921 gctcatgtgg ttagccagac cgcagtgcaa gtggtggcag atgtgcttag caaactgctc 1981 gtagttggga taacagatcc tgaccctgac attcgctact gtgtcttggc gtccctggac 2041 gagcgctttg atgcacacct ggcccaggcg gagaacttgc aggccttgtt tgtggctctg 2101 aatgaccagg tgtttgagat ccgggagctg gccatctgca ctgtgggccg actcagtagc 2161 atgaaccctg cctttgtcat gcctttcctg cgcaagatgc tcatccagat tttgacagag 2221 ttggagcaca gtgggattgg aagaatcaaa gagcagagtg cccgcatgct ggggcacctg 2281 gtctccaatg ccccccgact catccgcccc tacatggagc ctattctgaa ggcattaatt 2341 ttgaaactga aagatccaga ccctgatcca aacccaggtg tgatcaataa tgtcctggca 2401 acaataggag aattggcaca ggttagtggc ctggaaatga ggaaatgggt tgatgaactt 2461 tttattatca tcatggacat gctccaggat tcctctttgt tggccaaaag gcaggtggct 2521 ctgtggaccc tgggacagtt ggtggccagc actggctatg tagtagagcc ctacaggaag 2581 taccctactt tgcttgaggt gctactgaat tttctgaaga ctgagcagaa ccagggtaca 2641 cgcagagagg ccatccgtgt gttagggctt ttaggggctt tggatcctta caagcacaaa 2701 gtgaacattg gcatgataga ccagtcccgg gatgcctctg ctgtcagcct gtcagaatcc 2761 aagtcaagtc aggattcctc tgactatagc actagtgaaa tgctggtcaa catgggaaac 2821 ttgcctctgg atgagttcta cccagctgtg tccatggtgg ccctgatgcg gatcttccga 2881 gaccagtcac tctctcatca tcacaccatg gttgtccagg ccatcacctt catcttcaag 2941 tccctgggac tcaaatgtgt gcagttcctg ccccaggtca tgcccacgtt ccttaacgtc 3001 attcgagtct gtgatggggc catccgggaa tttttgttcc agcagctggg aatgttggtg 3061 tcctttgtga agagccacat cagaccttat atggatgaaa tagtcaccct catgagagaa 3121 ttctgggtca tgaacacctc aattcagagc acgatcattc ttctcattga gcaaattgtg 3181 gtagctcttg ggggtgaatt taagctctac ctgccccagc tgatcccaca catgctgcgt 3241 gtcttcatgc atgacaacag cccaggccgc attgtctcta tcaagttact ggctgcaatc 3301 cagctgtttg gcgccaacct ggatgactac ctgcatttac tgctgcctcc tattgttaag 3361 ttgtttgatg cccctgaagc tccactgcca tctcgaaagg cagcgctaga gactgtggac 3421 cgcctgacgg agtccctgga tttcactgac tatgcctccc ggatcattca ccctattgtt 3481 cgaacactgg accagagccc agaactgcgc tccacagcca tggacacgct gtcttcactt 3541 gtttttcagc tggggaagaa gtaccaaatt ttcattccaa tggtgaataa agttctggtg 3601 cgacaccgaa tcaatcatca gcgctatgat gtgctcatct gcagaattgt caagggatac 3661 acacttgctg atgaagagga ggatcctttg atttaccagc atcggatgct taggagtggc 3721 caaggggatg cattggctag tggaccagtg gaaacaggac ccatgaagaa actgcacgtc 3781 agcaccatca acctccaaaa ggcctggggc gctgccagga gggtctccaa agatgactgg 3841 ctggaatggc tgagacggct gagcctggag ctgctgaagg actcatcatc gccctccctg 3901 cgctcctgct gggccctggc acaggcctac aacccgatgg ccagggatct cttcaatgct 3961 gcatttgtgt cctgctggtc tgaactgaat gaagatcaac aggatgagct catcagaagc 4021 atcgagttgg ccctcacctc acaagacatc gctgaagtca cacagaccct cttaaacttg 4081 gctgaattca tggaacacag tgacaagggc cccctgccac tgagagatga caatggcatt
4141 gttctgctgg gtgagagagc tgccaagtgc cgagcatatg ccaaagcact acactacaaa 4201 gaactggagt tccagaaagg ccccacccct gccattctag aatctctcat cagcattaat 4261 aataagctac agcagccgga ggcagcggcc ggagtgttag aatatgccat gaaacacttt 4321 ggagagctgg agatccaggc tacctggtat gagaaactgc acgagtggga ggatgccctt 4381 gtggcctatg acaagaaaat ggacaccaac aaggacgacc cagagctgat gctgggccgc 4441 atgcgctgcc tcgaggcctt gggggaatgg ggtcaactcc accagcagtg ctgtgaaaag 4501 tggaccctgg ttaatgatga gacccaagcc aagatggccc ggatggctgc tgcagctgca 4561 tggggtttag gtcagtggga cagcatggaa gaatacacct gtatgatccc tcgggacacc 4621 catgatgggg cattttatag agctgtgctg gcactgcatc aggacctctt ctccttggca 4681 caacagtgca ttgacaaggc cagggacctg ctggatgctg aattaactgc gatggcagga 4741 gagagttaca gtcgggcata tggggccatg gtttcttgcc acatgctgtc cgagctggag 4801 gaggttatcc agtacaaact tgtccccgag cgacgagaga tcatccgcca gatctggtgg 4861 gagagactgc agggctgcca gcgtatcgta gaggactggc agaaaatcct tatggtgcgg 4921 tcccttgtgg tcagccctca tgaagacatg agaacctggc tcaagtatgc aagcctgtgc 4981 ggcaagagtg gcaggctggc tcttgctcat aaaactttag tgttgctcct gggagttgat 5041 ccgtctcggc aacttgacca tcctctgcca acagttcacc ctcaggtgac ctatgcctac 5101 atgaaaaaca tgtggaagag tgcccgcaag atcgatgcct tccagcacat gcagcatttt 5161 gtccagacca tgcagcaaca ggcccagcat gccatcgcta ctgaggacca gcagcataag 5221 caggaactgc acaagctcat ggcccgatgc ttcctgaaac ttggagagtg gcagctgaat 5281 ctacagggca tcaatgagag cacaatcccc aaagtgctgc agtactacag cgccgccaca 5341 gagcacgacc gcagctggta caaggcctgg catgcgtggg cagtgatgaa cttcgaagct 5401 gtgctacact acaaacatca gaaccaagcc cgcgatgaga agaagaaact gcgtcatgcc 5461 agcggggcca acatcaccaa cgccaccact gccgccacca cggccgccac tgccaccacc 5521 actgccagca ccgagggcag caacagtgag agcgaggccg agagcaccga gaacagcccc 5581 accccatcgc cgctgcagaa gaaggtcact gaggatctgt ccaaaaccct cctgatgtac 5641 acggtgcctg ccgtccaggg cttcttccgt tccatctcct tgtcacgagg caacaacctc 5701 caggatacac tcagagttct caccttatgg tttgattatg gtcactggcc agatgtcaat 5761 gaggccttag tggagggggt gaaagccatc cagattgata cctggctaca ggttatacct 5821 cagctcattg caagaattga tacgcccaga cccttggtgg gacgtctcat tcaccagctt 5881 ctcacagaca ttggtcggta ccacccccag gccctcatct acccactgac agtggcttct 5941 aagtctacca cgacagcccg gcacaatgca gccaacaaga ttctgaagaa catgtgtgag 6001 cacagcaaca ccctggtcca gcaggccatg atggtgagcg aggagctgat ccgagtggcc 6061 atcctctggc atgagatgtg gcatgaaggc ctggaagagg catctcgttt gtactttggg 6121 gaaaggaacg tgaaaggcat gtttgaggtg ctggagccct tgcatgctat gatggaacgg 6181 ggcccccaga ctctgaagga aacatccttt aatcaggcct atggtcgaga tttaatggag 6241 gcccaagagt ggtgcaggaa gtacatgaaa tcagggaatg tcaaggacct cacccaagcc 6301 tgggacctct attatcatgt gttccgacga atctcaaagc agctgcctca gctcacatcc 6361 ttagagctgc aatatgtttc cccaaaactt ctgatgtgcc gggaccttga attggctgtg 6421 ccaggaacat atgaccccaa ccagccaatc attcgcattc agtccatagc accgtctttg 6481 caagtcatca catccaagca gaggccccgg aaattgacac ttatgggcag caacggacat 6541 gagtttgttt tccttctaaa aggccatgaa gatctgcgcc aggatgagcg tgtgatgcag 6601 ctcttcggcc tggttaacac ccttctggcc aatgacccaa catctcttcg gaaaaacctc 6661 agcatccaga gatacgctgt catcccttta tcgaccaact cgggcctcat tggctgggtt 6721 ccccactgtg acacactgca cgccctcatc cgggactaca gggagaagaa gaagatcctt 6781 ctcaacatcg agcatcgcat catgttgcgg atggctccgg actatgacca cttgactctg 6841 atgcagaagg tggaggtgtt tgagcatgcc gtcaataata cagctgggga cgacctggcc 6901 aagctgctgt ggctgaaaag ccccagctcc gaggtgtggt ttgaccgaag aaccaattat 6961 acccgttctt tagcggtcat gtcaatggtt gggtatattt taggcctggg agatagacac 7021 ccatccaacc tgatgctgga ccgtctgagt gggaagatcc tgcacattga ctttggggac 7081 tgctttgagg ttgctatgac ccgagagaag tttccagaga agattccatt tagactaaca 7141 agaatgttga ccaatgctat ggaggttaca ggcctggatg gcaactacag aatcacatgc 7201 cacacagtga tggaggtgct gcgagagcac aaggacagtg tcatggccgt gctggaagcc 7261 tttgtctatg accccttgct gaactggagg ctgatggaca caaataccaa aggcaacaag 7321 cgatcccgaa cgaggacgga ttcctactct gctggccagt cagtcgaaat tttggacggt 7381 gtggaacttg gagagccagc ccataagaaa acggggacca cagtgccaga atctattcat 7441 tctttcattg gagacggttt ggtgaaacca gaggccctaa ataagaaagc tatccagatt 7501 attaacaggg ttcgagataa gctcactggt cgggacttct ctcatgatga cactttggat 7561 gttccaacgc aagttgagct gctcatcaaa caagcgacat cccatgaaaa cctctgccag 7621 tgctatattg gctggtgccc tttctggtaa
SEP ID NO: 40 Human mTOR Amino Acid Sequence
1 mlgtgpaaat taattssnvs vlqqfasglk srneetraka akelqhyvtm elremsqees
61 trfydqlnhh ifelvsssda nerkggilai asligveggn atrigrfany lrnllpsndp
121 vvmemaskai grlamagdtf taeyvefevk ralewlgadr negrrhaavl vlrelaisvp
181 tfffqqvqpf fdnifvavwd pkqairegav aalraclilt tqrepkemqk pqwyrhtfee
241 aekgfdetla kekgmnrddr ihgallilne lvrissmege rlreemeeit qqqlvhdkyc
301 kdlmgfgtkp rhitpftsfq avqpqqsnal vgllgysshq glmgfgtsps pakstlvesr
361 ccrdlmeekf dqvcqwvlkc rnsknsliqm tilnllprla afrpsaftdt qylqdtmnhv
421 lscvkkeker taafqalgll svavrsefkv ylprvldiir aalppkdfah krqkamqvda
481 tvftcismla ramgpgiqqd ikellepmla vglspaltav lydlsrqipq lkkdiqdgll
541 kmlslvlmhk plrhpgmpkg lahqlaspgl ttlpeasdvg sitlalrtlg s fefeghslt
601 qfvrhcadhf lnsehkeirm eaartcsrll tpsihlisgh ahvvsqtavq vvadvlskll
661 vvgitdpdpd irycvlasld erfdahlaqa enlqalfval ndqvfeirel aictvgrlss
721 mnpafvmpfl rkmliqilte lehsgigrik eqsarmlghl vsnaprlirp ymepilkali
781 lklkdpdpdp npgvinnvla tigelaqvsg lemrkwvdel fiiimdmlqd ssllakrqva
841 lwtlgqlvas tgyvvepyrk yptllevlln flkteqnqgt rreairvlgl lgaldpykhk
901 vnigmidqsr dasavslses kssqdssdys tsemlvnmgn lpldefypav smvalmrifr
961 dqslshhhtm vvqaitfifk slglkcvqfl pqvmptflnv irvcdgaire fIfqqlgmlv
1021 sfvkshirpy mdeivtlmre fwvmntsiqs tiillieqiv valggefkly lpqliphmlr
1081 vfmhdnspgr ivsikllaai qlfganlddy lhlllppivk lfdapeaplp srkaaletvd
1141 rltesldftd yasriihpiv rtldqspelr stamdtlssl vfqlgkkyqi fipmvnkvlv
1201 rhrinhqryd vlicrivkgy tladeeedpl iyqhrmlrsg qgdalasgpv etgpmkklhv
1261 stinlqkawg aarrvskddw lewlrrlsle llkdssspsl rscwalaqay npmardlfna
1321 afvscwseln edqqdelirs ielaltsqdi aevtqtllnl aefmehsdkg plplrddngi
1381 vllgeraakc rayakalhyk elefqkgptp aileslisin nklqqpeaaa gvleyamkhf
1441 geleiqatwy eklhewedal vaydkkmdtn kddpelmlgr mrclealgew gqlhqqccek
1501 wtlvndetqa kmarmaaaaa wglgqwdsme eytcmiprdt hdgafyravl alhqdlfsla
1561 qqcidkardl ldaeltamag esysraygam vschmlsele eviqyklvpe rreiirqiww
1621 erlqgcqriv edwqkilmvr slvvsphedm rtwlkyaslc gksgrlalah ktlvlllgvd
1681 psrqldhplp tvhpqvtyay mknmwksark idafqhmqhf vqtmqqqaqh aiatedqqhk
1741 qelhklmarc flklgewqln lqginestip kvlqyysaat ehdrswykaw hawavmnfea
1801 vlhykhqnqa rdekkklrha sganitnatt aattaatatt tastegsnse seaestensp
1861 tpsplqkkvt edlsktllmy tvpavqgffr sislsrgnnl qdtlrvltlw fdyghwpdvn
1921 ealvegvkai qidtwlqvip qliaridtpr plvgrlihql ltdigryhpq aliypltvas
1981 kstttarhna ankilknmce hsntlvqqam mvseelirva ilwhemwheg leeasrlyfg
2041 ernvkgmfev leplhammer gpqtlketsf nqaygrdlme aqewcrkymk sgnvkdltqa
2101 wdlyyhvfrr iskqlpqlts lelqyvspkl lmcrdlelav pgtydpnqpi iriqsiapsl
2161 qvitskqrpr kltlmgsngh efvfllkghe dlrqdervmq Ifglvntlla ndptslrknl
2221 siqryavipl stnsgligwv phcdtlhali rdyrekkkil lniehrimlr mapdydhltl
2281 mqkvevfeha vnntagddla kllwlkspss evwfdrrtny trslavmsmv gyilglgdrh
2341 psnlmldrls gkilhidfgd cfevamtrek fpekipfrlt rmltnamevt gldgnyritc
2401 htvmevlreh kdsvmavlea fvydpllnwr lmdtntkgnk rsrtrtdsys agqsveildg
2461 velgepahkk tgttvpesih sfigdglvkp ealnkkaiqi inrvrdkltg rdfshddtld
2521 vptqvellik qatshenlcq cyigwcpfw
SEP ID NO: 41 Mouse mTOR cDNA Acid Sequence
1 atgcttggga cgggtcctgc cgtggccacc gccagtgccg ccacatctag caacgtgagc
61 gtcctgcagc agttcgccag tggactgaag agccggaatg aggagaccag ggccaaagca
121 gccaaggagc tccagcacta cgtcaccatg gagcttcgag agatgagtca ggaggagtct
181 actcgcttct atgaccagct gaaccatcac atttttgaac tggtttccag ctcagatgcc
241 aatgagagga agggtggcat cttggccatc gccagcctca taggagtgga aggtgggaat
301 tccaccagaa ttggcagatt tgccaactac cttcgaaacc tcctcccctc aagcgatcca
361 gttgtcatgg aaatggcgtc caaggccatt ggccgcctgg cgatggcagg ggacactttc
421 actgctgaat atgtggagtt tgaagtgaag cgagccttgg agtggctggg tgctgaccga
481 aatgagggcc ggagacatgc cgctgtcctc gttctccgtg agctggccat cagtgtcccc
541 accttcttct tccagcaagt tcagcccttc tttgacaaca tttttgtggc tgtgtgggac
601 cccaagcagg ccatccggga aggcgctgta gcggcccttc gtgcctgtct gattctcacc
661 acgcagcggg aaccaaagga aatgcagaag cctcagtggt accggcacac atttgaagaa
721 gcagagaaag gttttgatga gaccctggcc aaagagaagg gtatgaatcg agatgatcga
781 atccacggag ccttgctgat cctcaacgag ctagttcgta tcagcagcat ggagggagag
841 cgtctgagag aagagatgga ggagatcacc cagcagcagc tggtgcatga caagtactgc 901 aaagacctca tgggcttcgg gaccaagcct cggcacatca cgcccttcac cagtttccag 961 gctgtgcagc cccagcagcc gaacgccttg gtgggactgc tggggtacag ctcccctcaa 1021 ggcctgatgg gatttgggac gtcccccagc cctgccaagt ccactctggt ggaaagccgc 1081 tgttgcagag acttgatgga agagaaattt gatcaggtgt gccagtgggt gctgaagtgc 1141 aggagcagca agaactcgct gatccagatg acaatcctta acctgctgcc ccgcctggct 1201 gcattccgac cgtccgcctt cacagatacc cagtacctcc aggacaccat gaaccatgtc 1261 ctgagctgtg tcaagaagga gaaggaacgg actgcggcgt tccaggccct ggggctgctt 1321 tctgtggccg tgaggtcgga gtttaaggtc tacttgcccc gtgtacttga catcatccga 1381 gcagcgcttc ctccaaagga ctttgcccac aagaggcaga aaaccgtgca ggtggatgcc 1441 accgtattca cgtgcatcag catgttggca cgagcaatgg ggccgggcat ccagcaggac 1501 atcaaggagc tgctggagcc catgttggca gtgggcctga gccccgcgct cactgctgtg 1561 ctctatgacc tgagccggca gattccacag ctgaagaaag atattcagga cggccttctg 1621 aagatgctgt ccctggtcct tatgcacaaa cccctccggc acccaggcat gcccaaaggc 1681 ctggctcacc agctggcttc ccctggtctc accaccctcc ctgaggccag cgacgtggcc 1741 agcatcactc ttgcccttcg aacccttggc agctttgaat ttgaaggcca ctctctgacc 1801 cagttcgtcc gacactgcgc agatcacttc ctgaacagcg agcacaagga gatccgcatg 1861 gaagctgctc gcacctgctc ccgcctgctc acaccctcca tccacctcat cagcggccat 1921 gcccacgtgg ttagccagac tgcagtgcag gtggtggcag atgtgctcag caagctgctt 1981 gtggttggca taacagatcc tgaccctgat atccgctact gtgtcttggc atccctggac 2041 gagcgctttg atgcccacct ggcccaggca gaaaacttac aagctctgtt tgtggctctg 2101 aatgaccagg tctttgagat ccgcgagctg gccatctgca ctgtgggccg actaagcagc 2161 atgaacccag ccttcgtcat gcctttcctg cgcaagatgc tcatccagat cctgacagag 2221 ctggagcaca gcggcattgg gagaatcaag gagcagagcg cccgcatgct ggggcacctg 2281 gtgtccaacg ccccccggct catccgcccc tacatggagc ctatcctgaa ggctttaatt 2341 ttgaaactga aagatccaga ccctgaccca aacccgggcg tgatcaataa cgtgttggcc 2401 actataggag aactggctca ggtgagcggc ctggaaatgc ggaagtgggt ggacgagctc 2461 tttatcatca tcatggacat gctgcaggac tcctccctgc tggccaaaag gcaggtggct 2521 ttgtggaccc tgggacagtt ggtggccagc actggctatg tggtggagcc ctacaggaag 2581 taccccactt tgcttgaagt gctgctgaat ttcctgaaga cggagcagaa ccagggcact 2641 cggagagagg ctatccgagt gttggggctc cttggggctt tggatcccta caagcacaaa 2701 gtgaacatcg gcatgatcga ccagtcccgg gacgcttccg ctgtcagcct gtcagagtcc 2761 aagtcaagtc aggattcctc tgactacagc accagtgaaa tgctggtcaa catgggaaac 2821 ctgcccctgg acgagttcta ccccgctgtg tccatggtgg ccttgatgcg gatcttccga 2881 gatcaatccc tctctcacca ccacaccatg gtggtgcagg ccatcacctt catcttcaag 2941 tccctggggc tcaagtgtgt gcagttcctg ccccaggtca tgcccacatt ccttaatgtc 3001 atccgagtct gtgatggggc catccgggaa tttctgttcc agcagctggg gatgctggtg 3061 tcctttgtga agagccacat ccgtccctac atggatgaaa tagtcactct catgagagag 3121 ttttgggtca tgaacacgtc aatccagagc acaatcattc ttctcattga gcagattgtg 3181 gtggctctcg gaggggaatt taagctttat ctgccccagt tgatcccaca catgctgcgg 3241 gtcttcatgc atgacaacag ccaaggccga atcgtctcca tcaagctgtt agccgcgatc 3301 cagctgtttg gcgccaacct ggatgactat ctgcacttgt tgttgcctcc gattgtgaaa 3361 ttgtttgatg cccctgaagt cccgctgcca tcaagaaagg cagcgctgga gacggtggac 3421 cgcctgacag agtccctaga cttcactgac tacgcctccc gcatcattca cccaatagtt 3481 cgtacgctag accagagccc agagctgcgc tccacagcca tggacactct gtcttcgctt 3541 gtctttcaac tggggaagaa gtaccagatc ttcattccaa tggtgaataa agtcctcgtg 3601 cgacaccgga tcaaccacca gcgctatgat gtgcttatct gcagaatcgt caaggggtac 3661 acacttgctg atgaggaaga agaccctttg atttaccagc atcgaatgct aaggagcagc 3721 cagggagatg ccctggccag tggaccagtt gagacaggac ccatgaagaa actgcatgtc 3781 agcaccatca acctccaaaa ggcctgggga gctgccagaa gggtctccaa ggacgactgg 3841 ctggagtggc tgaggcgctt gagtctggag cttctgaagg actcctcatc gccctccctg 3901 cgctcatgct gggccctggc gcaggcctac aaccccatgg ccagggatct cttcaatgct 3961 gcctttgtgt cctgctggtc tgagctgaat gaagaccagc aagatgagct catcaggagt 4021 attgagttgg ctctcacttc tcaagacatt gctgaagtca cacaaaccct cctgaacttg 4081 gctgagttca tggaacacag tgacaagggc cccctgccgc tgagagatga caatggcatc 4141 gtgctcctgg gtgagagagc tgccaagtgc cgggcatatg ccaaagcact gcactacaaa 4201 gaactggagt tccagaaagg gcccacgcct gccatacttg agtccctcat cagcattaac 4261 aacaagctcc agcagcctga ggcagcttct ggggtgttgg aatacgccat gaaacacttc 4321 ggagagctgg agatccaggc cacctggtat gagaagctgc atgagtggga ggatgctctc 4381 gtggcctacg acaagaagat ggacacaaac aaggaagacc cggagctgat gctgggccga 4441 atgcgctgcc tcgaggcctt gggggaatgg ggccagcttc atcagcagtg ctgtgaaaag
4501 tggactctgg ttaatgatga gacccaggct aagatggccc ggatggctgc tgctgcagcg 4561 tggggtttag gtcagtggga cagcatggag gagtacacct gcatgatccc acgggacacc 4621 cacgatggag ccttttacag ggcagtgttg gctctacatc aggatctctt ctccttggcc 4681 cagcagtgca ttgacaaggc cagggacctg ctggatgcag agctgactgc catggcagga 4741 gagagctaca gccgagccta tggggccatg gtttcttgcc acatgctgtc cgagctggaa 4801 gaggttatcc agtacaaact tgtccctgag cgtcgggaga tcatccggca gatctggtgg 4861 gagagactgc agggctgcca gcgtattgtt gaggactggc agaaaatcct catggtccgg 4921 tcccttgtgg tcagccctca tgaggacatg agaacctggc tcaagtacgc aagcctgtgt 4981 ggcaagagtg gcagactggc tcttgctcat aaaaccttag tgttgctctt gggagttgat 5041 ccatctcggc aacttgacca tcctctgcca accgctcacc ctcaagtgac ctatgcctac 5101 atgaagaaca tgtggaaaag tgctcggaag attgacgcct tccagcacat gcaacacttt 5161 gtgcagacca tgcagcagca ggcccagcat gccatcgcca cagaggacca gcagcacaag 5221 caggagctgc ataagctcat ggccaggtgt tttctgaaac ttggggagtg gcagctgaac 5281 ctccagggca tcaacgagag caccatcccc aaggtgctac agtactacag tgccgccaca 5341 gagcatgacc gcagctggta caaggcttgg catgcatggg cagtgatgaa cttcgaagca 5401 gtgctacact acaaacatca gaaccaagcc cgtgatgaga agaagaagct gcgtcatgcc 5461 agcggggcca acatcaccaa tgccaccact gcagccacca ctgcagcctc tgctgctgct 5521 gccaccagca cagagggcag caacagtgag agtgaagctg agagcaatga gaacagcccc 5581 accccgtccc ctctgcagaa gaaggtcact gaggatttat ccaaaactct cttgttgtac 5641 actgtccctg ctgttcaagg cttcttccgt tctatctcct tgtcaagagg caacaacctc 5701 caggatacac taagagtcct caccctgtgg tttgattatg gtcactggcc agatgtcaat 5761 gaagccttgg tggaaggggt gaaggccata cagattgaca cttggttaca ggttatacct 5821 cagctcattg caagaattga cacacccaga cccttggtgg gccggctcat tcaccagctt 5881 ctcacagata ttggtcggta ccacccacag gccctcatct accccctgac ggtggcttct 5941 aagtctacca ccacagcccg tcacaatgca gccaacaaga tcttgaagaa catgtgtgaa 6001 cacagcaaca cgctggtcca gcaggccatg atggtgagtg aagagctgat tcgggtagcc 6061 atcctctggc atgagatgtg gcatgaaggc ctggaagagg catctcgctt gtactttggg 6121 gagaggaacg tgaaaggcat gtttgaggtg ctggagcccc tgcatgctat gatggaacgg 6181 ggtccccaga ctctgaagga aacatccttt aatcaggcat atggccgaga tttaatggag 6241 gcacaagaat ggtgtcgaaa gtacatgaag tcggggaacg tcaaggacct cacgcaagcc 6301 tgggacctct actatcacgt gttcagacgg atctcaaagc agctacccca gctcacatcc 6361 ctggagctgc agtatgtgtc ccccaaactt ctgatgtgcc gagaccttga gttggctgtg 6421 ccaggaacat acgaccccaa ccagccaatc attcgcattc aatccatagc cccgtctttg 6481 caagtcatca catccaagca gaggcctcgg aagctgactc tgatgggcag caatgggcat 6541 gagtttgttt tcctcctgaa aggccatgaa gatctgcggc aggatgaacg agtgatgcag 6601 ctctttggcc tggtgaacac actcctagcc aatgacccca cttctcttcg caagaacctc 6661 agcatccaga gatacgctgt catccctctg tccaccaact cgggcctcat tggctgggtg 6721 ccccactgtg acacactgca tgccctcatc cgggactaca gagagaagaa gaagatcctg 6781 ttgaacatcg agcatcgcat catgctgcgg atggctcctg actatgacca cctgacgttg 6841 atgcagaagg tagaggtgtt tgagcatgct gtcaacaaca cagctgggga cgacctggcc 6901 aagctactgt ggctaaaaag ccccagctcg gaggtgtggt ttgaccgaag aaccaactat 6961 acccgctccc tggccgttat gtcgatggtc ggatacattt taggccttgg agacaggcac 7021 ccatccaatc tgatgctgga ccggctgagt gggaagatcc tgcacattga ctttggggac 7081 tgctttgagg tcgctatgac cagagagaaa tttccagaaa agattccatt tagactaaca 7141 agaatgttga ccaatgctat ggaggttacg ggtctggatg gcaactacag aaccacatgc 7201 cacaccgtga tggaagtgct ccgggaacac aaggacagtg tcatggctgt gctggaagcc 7261 tttgtctatg acccactgct caactggagg ctgatggaca caaataccaa aggcaataag 7321 cggtcccgga caaggacaga ctcctactct gccggccagt cagtagaaat tttggacggt 7381 gtagaacttg gagaaccagc ccataagaaa gcagggacca ctgtgccaga atccatccat 7441 tcattcattg gagacggttt ggtgaaacca gaagccttaa acaagaaagc tattcagatt 7501 attaacaggg ttcgagataa gctcactggt cgggatttct ctcatgatga cactttggat 7561 gttccaaccc aagtggagct gcttatcaag caggcaacat ctcacgagaa cctctgccag 7621 tgctacattg gctggtgtcc cttctggtaa
SEP ID NO: 42 Mouse mTOR Amino Acid Sequence
1 mlgtgpavat asaatssnvs vlqqfasglk srneetraka akelqhyvtm elremsqees
61 trfydqlnhh ifelvsssda nerkggilai asligveggn strigrfany lrnllpssdp
121 vvmemaskai grlamagdtf taeyvefevk ralewlgadr negrrhaavl vlrelaisvp
181 tfffqqvqpf fdnifvavwd pkqairegav aalraclilt tqrepkemqk pqwyrhtfee
241 aekgfdetla kekgmnrddr ihgallilne lvrissmege rlreemeeit qqqlvhdkyc
301 kdlmgfgtkp rhitpftsfq avqpqqpnal vgllgysspq glmgfgtsps pakstlvesr
361 ccrdlmeekf dqvcqwvlkc rssknsliqm tilnllprla afrpsaftdt qylqdtmnhv 421 lscvkkeker taafqalgll svavrsefkv ylprvldiir aalppkdfah krqktvqvda 481 tvftcismla ramgpgiqqd ikellepmla vglspaltav lydlsrqipq lkkdiqdgll 541 kmlslvlmhk plrhpgmpkg lahqlaspgl ttlpeasdva sitlalrtlg s fefeghslt 601 qfvrhcadhf lnsehkeirm eaartcsrll tpsihlisgh ahvvsqtavq vvadvlskll 661 vvgitdpdpd irycvlasld erfdahlaqa enlqalfval ndqvfeirel aictvgrlss 721 mnpafvmpf1 rkmliqilte lehsgigrik eqsarmlghl vsnaprlirp ymepilkali 781 lklkdpdpdp npgvinnvla tigelaqvsg lemrkwvdel fiiimdmlqd ssllakrqva 841 lwtlgqlvas tgyvvepyrk yptllevlln flkteqnqgt rreairvlgl lgaldpykhk 901 vnigmidqsr dasavslses kssqdssdys tsemlvnmgn lpldefypav smvalmrifr 961 dqslshhhtm vvqaitfifk slglkcvqf1 pqvmptflnv irvcdgaire fIfqqlgmlv 1021 s fvkshirpy mdeivtlmre fwvmntsiqs tiillieqiv valggefkly lpqliphmlr 1081 vfmhdnsqgr ivsikllaai qlfganlddy lhlllppivk lfdapevplp srkaaletvd 1141 rltesldftd yasriihpiv rtldqspelr stamdtlssl vfqlgkkyqi fipmvnkvlv 1201 rhrinhqryd vlicrivkgy tladeeedpl iyqhrmlrss qgdalasgpv etgpmkklhv 1261 stinlqkawg aarrvskddw lewlrrlsle llkdssspsl rscwalaqay npmardlfna 1321 afvscwseln edqqdelirs ielaltsqdi aevtqtllnl aefmehsdkg plplrddngi 1381 vllgeraakc rayakalhyk elefqkgptp aileslisin nklqqpeaas gvleyamkhf 1441 geleiqatwy eklhewedal vaydkkmdtn kedpelmlgr mrclealgew gqlhqqccek 1501 wtlvndetqa kmarmaaaaa wglgqwdsme eytcmiprdt hdgafyravl alhqdlfsla 1561 qqcidkardl ldaeltamag esysraygam vschmlsele eviqyklvpe rreiirqiww 1621 erlqgcqriv edwqkilmvr slvvsphedm rtwlkyaslc gksgrlalah ktlvlllgvd 1681 psrqldhplp tahpqvtyay mknmwksark idafqhmqhf vqtmqqqaqh aiatedqqhk 1741 qelhklmarc flklgewqln lqginestip kvlqyysaat ehdrswykaw hawavmnfea 1801 vlhykhqnqa rdekkklrha sganitnatt aattaasaaa atstegsnse seaesnensp 1861 tpsplqkkvt edlsktllly tvpavqgffr sislsrgnnl qdtlrvltlw fdyghwpdvn 1921 ealvegvkai qidtwlqvip qliaridtpr plvgrlihql ltdigryhpq aliypltvas 1981 kstttarhna ankilknmce hsntlvqqam mvseelirva ilwhemwheg leeasrlyfg 2041 ernvkgmfev leplhammer gpqtlkets f nqaygrdlme aqewcrkymk sgnvkdltqa 2101 wdlyyhvfrr iskqlpqlts lelqyvspkl lmcrdlelav pgtydpnqpi iriqsiapsl 2161 qvitskqrpr kltlmgsngh efvfllkghe dlrqdervmq Ifglvntlla ndptslrknl 2221 siqryavipl stnsgligwv phcdtlhali rdyrekkkil lniehrimlr mapdydhltl 2281 mqkvevfeha vnntagddla kllwlkspss evwfdrrtny trslavmsmv gyilglgdrh 2341 psnlmldrls gkilhidfgd cfevamtrek fpekipfrlt rmltnamevt gldgnyrttc 2401 htvmevlreh kdsvmavlea fvydpllnwr lmdtntkgnk rsrtrtdsys agqsveildg 2461 velgepahkk agttvpesih s figdglvkp ealnkkaiqi inrvrdkltg rdfshddtld 2521 vptqvellik qatshenlcq cyigwcpfw
SEP ID NO: 43 Human S6RP cDNA Acid Sequence
1 atgaagctga acatctcctt cccagccact ggctgccaga aactcattga agtggacgat 61 gaacgcaaac ttcgtacttt ctatgagaag cgtatggcca cagaagttgc tgctgacgct 121 ctgggtgaag aatggaaggg ttatgtggtc cgaatcagtg gtgggaacga caaacaaggt 181 ttccccatga agcagggtgt cttgacccat ggccgtgtcc gcctgctact gagtaagggg 241 cattcctgtt acagaccaag gagaactgga gaaagaaaga gaaaatcagt tcgtggttgc 301 attgtggatg caaatctgag cgttctcaac ttggttattg taaaaaaagg agagaaggat 361 attcctggac tgactgatac tacagtgcct cgccgcctgg gccccaaaag agctagcaga 421 atccgcaaac ttttcaatct ctctaaagaa gatgatgtcc gccagtatgt tgtaagaaag 481 cccttaaata aagaaggtaa gaaacctagg accaaagcac ccaagattca gcgtcttgtt 541 actccacgtg tcctgcagca caaacggcgg cgtattgctc tgaagaagca gcgtaccaag 601 aaaaataaag aagaggctgc agaatatgct aaacttttgg ccaagagaat gaaggaggct 661 aaggagaagc gccaggaaca aattgcgaag agacgcagac tttcctctct gcgagcttct 721 acttctaagt ctgaatccag tcagaaataa
SEP ID NO: 44 Human S6RP Amino Acid Sequence
1 mklnisfpat gcqklievdd erklrtfyek rmatevaada lgeewkgyvv risggndkqg
61 fpmkqgvlth grvrlllskg hscyrprrtg erkrksvrgc ivdanlsvln lvivkkgekd
121 ipgltdttvp rrlgpkrasr irklfnlske ddvrqyvvrk plnkegkkpr tkapkiqrlv
181 tprvlqhkrr rialkkqrtk knkeeaaeya kllakrmkea kekrqeqiak rrrlsslras 241 tsksessqk
SEP ID NO: 45 Mouse S6RP cDNA Acid Sequence
1 atgaagctga acatctcctt ccccgccacc ggctgtcaga agctcatcga ggtggatgac
61 gagcgcaagc tccgcacctt ctatgagaag cgcatggcca cggaagtagc cgctgatgct
121 cttggtgaag agtggaaggg ttatgtggtc cggatcagcg gtgggaatga caagcaaggt
181 tttcccatga agcaaggtgt tctgacccat ggcagagtgc gcctgctgtt gagtaagggg
241 cattcctgtt acaggccaag gagaactgga gagaggaagc gcaagtctgt tcgtggatgc
301 attgtggacg ctaatctcag tgttctcaac ttggtcattg taaagaaagg agagaaggat
361 attcctggac tgacagacac tactgtgcct cgtcggttgg gacctaaaag ggctagtaga
421 atccgcaagc tttttaatct ctccaaagaa gatgatgtcc gccagtatgt tgtcaggaag
481 cccttaaaca aagaaggtaa gaagcccagg accaaagcac ccaagattca gcgacttgtt
541 actcctcgtg tcctgcaaca caaacgccga cgtattgctc tgaagaagca acgcactaag
601 aagaacaagg aggaggctgc agaatacgct aaacttttgg ccaagagaat gaaggaagcc
661 aaagaaaagc gccaggaaca gattgccaag agacgtaggc tgtcctcact gagagcttct
721 acttctaagt ctgagtccag tcaaaaatga
SEP ID NO: 46 Mouse S6RP Amino Acid Sequence
1 mklnisfpat gcqklievdd erklrtfyek rmatevaada lgeewkgyvv risggndkqg
61 fpmkqgvlth grvrlllskg hscyrprrtg erkrksvrgc ivdanlsvln lvivkkgekd
121 ipgltdttvp rrlgpkrasr irklfnlske ddvrqyvvrk plnkegkkpr tkapkiqrlv
181 tprvlqhkrr rialkkqrtk knkeeaaeya kllakrmkea kekrqeqiak rrrlsslras 241 tsksessqk
SEP ID NP: 47 Human 4EBP1 cDNA Acid Sequence
1 atgtccgggg gcagcagctg cagccagacc ccaagccggg ccatccccgc cactcgccgg
61 gtggtgctcg gcgacggcgt gcagctcccg cccggggact acagcacgac ccccggcggc
121 acgctcttca gcaccacccc gggaggtacc aggatcatct atgaccggaa attcctgatg
181 gagtgtcgga actcacctgt gaccaaaaca cccccaaggg atctgcccac cattccgggg
241 gtcaccagcc cttccagtga tgagcccccc atggaagcca gccagagcca cctgcgcaat
301 agcccagaag ataagcgggc gggcggtgaa gagtcacagt ttgagatgga catttaa
SEP ID NP: 48 Human 4EBP1 Amino Acid Sequence
1 msggsscsqt psraipatrr vvlgdgvqlp pgdysttpgg tlfsttpggt riiydrkflm
61 ecrnspvtkt pprdlptipg vtspssdepp measqshlrn spedkragge esqfemdi
SEP ID NP: 49 Mouse 4EBP1 cDNA Acid Sequence
1 atgtcggcgg gcagcagctg cagccagact cccagccggg ccatccccac tcgccgcgta
61 gccctcggcg atggcgtgca gctcccgccc ggggactaca gcaccactcc gggcggcacg
121 ctcttcagca ccaccccggg aggaaccagg attatctatg accggaaatt tctgatggag
181 tgtcggaact cacctgtggc caaaacaccc ccaaaggacc tgccagccat tcctggggtc
241 actagcccta ccagcgatga gcctcccatg caagccagcc agagccaact gcccagcagc
301 ccggaagata agcgggcagg cggtgaagag tcacaatttg agatggacat ttaa
SEP ID NP: 50 Mouse 4EBP1 Amino Acid Sequence
1 msagsscsqt psraiptrrv algdgvqlpp gdysttpggt lfsttpggtr iiydrkflme 61 crnspvaktp pkdlpaipgv tsptsdeppm qasqsqlpss pedkraggee sqfemdi
* Included in Table 1 are RNA nucleic acid molecules (e.g., thymines replaced with uredines), nucleic acid molecules encoding orthologs of the encoded proteins, as well as DNA or RNA nucleic acid sequences comprising a nucleic acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or more identity across their full length with the nucleic acid sequence of any SEQ ID NO listed in Table 1, or a portion thereof. Such
nucleic acid molecules can have a function of the full-length nucleic acid as described further herein.
* Included in Table 1 are orthologs of the proteins, as well as polypeptide molecules comprising an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or more identity across their full length with an amino acid sequence of any SEQ ID NO listed in Table 1, or a portion thereof. Such polypeptides can have a function of the full-length polypeptide as described further herein.
II. Subjects
In one embodiment, the subject for whom predicted likelihood of efficacy of a PI3K and mTOR inhibitor combination therapy is determined, is a mammal (e.g., mouse, rat, primate, non-human mammal, domestic animal, such as a dog, cat, cow, horse, and the like), and is preferably a human. In another embodiment, the subject is an animal model of a brain metastasis from an extracranial cancer. For example, the animal model can be an orthotopic xenograft animal model of a human-derived brain metastasis from a human extracranial cancer.
In another embodiment of the methods of the present invention, the subject has not undergone treatment, such as chemotherapy, radiation therapy, targeted therapy, and/or anti-immune checkpoint therapy. In still another embodiment, the subject has undergone treatment, such as chemotherapy, radiation therapy, targeted therapy, and/or anti-immune checkpoint therapy.
In certain embodiments, the subject has had surgery to remove cancerous or precancerous tissue. In other embodiments, the cancerous tissue has not been removed, e.g., the cancerous tissue may be located in an inoperable region of the body, such as in a tissue that is essential for life, or in a region where a surgical procedure would cause considerable risk of harm to the patient.
The methods of the present invention can be used to determine the responsiveness to PI3K and mTOR inhibitor combination therapies of many different brain metastases in subjects such as those described herein.
III. Sample Collection, Preparation and Separation
In some embodiments, biomarker amount and/or activity measurement(s) in a sample from a subject is compared to a predetermined control (standard) sample. The sample from the subject is typically from a diseased tissue, such as cancer cells or tissues. The control sample can be from the same subject or from a different subject. The control sample is typically a normal, non-diseased sample. However, in some embodiments, such as for staging of disease or for evaluating the efficacy of treatment, the control sample can be from a diseased tissue. The control sample can be a combination of samples from several different subjects. In some embodiments, the biomarker amount and/or activity measurement(s) from a subject is compared to a pre-determined level. This pre-determined level is typically obtained from normal samples. As described herein, a "pre-determined" biomarker amount and/or activity measurement(s) may be a biomarker amount and/or activity measurement(s) used to, by way of example only, evaluate a subject that may be selected for treatment (e.g., based on the number of genomic mutations and/or the number of genomic mutations causing non-functional proteins for DNA repair genes), evaluate a response to a PI3K/mTOR combination inhibitor therapy, and/or evaluate a response to a PI3K/mTOR combination inhibitor therapy with one or more additional anti-cancer therapies. A pre-determined biomarker amount and/or activity measurement(s) may be determined in populations of patients with or without cancer. The pre-determined biomarker amount and/or activity measurement(s) can be a single number, equally applicable to every patient, or the pre-determined biomarker amount and/or activity measurement(s) can vary according to specific subpopulations of patients. Age, weight, height, and other factors of a subject may affect the pre-determined biomarker amount and/or activity measurement(s) of the individual. Furthermore, the pre-determined biomarker amount and/or activity can be determined for each subject individually. In one embodiment, the amounts determined and/or compared in a method described herein are based on absolute measurements.
In another embodiment, the amounts determined and/or compared in a method described herein are based on relative measurements, such as ratios (e.g., biomarker copy numbers, level, and/or activity before a treatment vs. after a treatment, such biomarker measurements relative to a spiked or man-made control, such biomarker measurements relative to the expression of a housekeeping gene, and the like). For example, the relative analysis can be based on the ratio of pre-treatment biomarker measurement as compared to
post-treatment biomarker measurement. Pre-treatment biomarker measurement can be made at any time prior to initiation of anti-cancer therapy. Post-treatment biomarker measurement can be made at any time after initiation of anti-cancer therapy. In some embodiments, post-treatment biomarker measurements are made 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 weeks or more after initiation of anti-cancer therapy, and even longer toward indefinitely for continued monitoring. Treatment can comprise anti-cancer therapy, such as a therapeutic regimen comprising one or more PBK/mTOR combination inhibitors alone or in combination with other anti-cancer agents, such as with immune checkpoint inhibitors.
The pre-determined biomarker amount and/or activity measurement(s) can be any suitable standard. For example, the pre-determined biomarker amount and/or activity measurement(s) can be obtained from the same or a different human for whom a patient selection is being assessed. In one embodiment, the pre-determined biomarker amount and/or activity measurement s) can be obtained from a previous assessment of the same patient. In such a manner, the progress of the selection of the patient can be monitored over time. In addition, the control can be obtained from an assessment of another human or multiple humans, e.g., selected groups of humans, if the subject is a human. In such a manner, the extent of the selection of the human for whom selection is being assessed can be compared to suitable other humans, e.g., other humans who are in a similar situation to the human of interest, such as those suffering from similar or the same condition(s) and/or of the same ethnic group.
In some embodiments of the present invention the change of biomarker amount and/or activity measurement s) from the pre-determined level is about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, or 5.0 fold or greater, or any range in between, inclusive. Such cutoff values apply equally when the measurement is based on relative changes, such as based on the ratio of pre-treatment biomarker measurement as compared to post-treatment biomarker measurement.
Biological samples can be collected from a variety of sources from a patient including a body fluid sample, cell sample, or a tissue sample comprising nucleic acids and/or proteins. "Body fluids" refer to fluids that are excreted or secreted from the body as well as fluids that are normally not (e.g., amniotic fluid, aqueous humor, bile, blood and blood plasma, cerebrospinal fluid, cerumen and earwax, cowper's fluid or pre-ejaculatory fluid, chyle, chyme, stool, female ejaculate, interstitial fluid, intracellular fluid, lymph,
menses, breast milk, mucus, pleural fluid, pus, saliva, sebum, semen, serum, sweat, synovial fluid, tears, urine, vaginal lubrication, vitreous humor, vomit). In a preferred embodiment, the subject and/or control sample is selected from the group consisting of cells, cell lines, histological slides, paraffin embedded tissues, biopsies, whole blood, nipple aspirate, serum, plasma, buccal scrape, saliva, cerebrospinal fluid, urine, stool, and bone marrow. In one embodiment, the sample is serum, plasma, or urine. In another
embodiment, the sample is serum.
The samples can be collected from individuals repeatedly over a longitudinal period of time (e.g., once or more on the order of days, weeks, months, annually, biannually, etc.). Obtaining numerous samples from an individual over a period of time can be used to verify results from earlier detections and/or to identify an alteration in biological pattern as a result of, for example, disease progression, drug treatment, etc. For example, subject samples can be taken and monitored every month, every two months, or combinations of one, two, or three month intervals according to the present invention. In addition, the biomarker amount and/or activity measurements of the subject obtained over time can be conveniently compared with each other, as well as with those of normal controls during the monitoring period, thereby providing the subject's own values, as an internal, or personal, control for long-term monitoring.
Sample preparation and separation can involve any of the procedures, depending on the type of sample collected and/or analysis of biomarker measurement(s). Such procedures include, by way of example only, concentration, dilution, adjustment of pH, removal of high abundance polypeptides (e.g., albumin, gamma globulin, and transferrin, etc.), addition of preservatives and calibrants, addition of protease inhibitors, addition of denaturants, desalting of samples, concentration of sample proteins, extraction and purification of lipids.
The sample preparation can also isolate molecules that are bound in non-covalent complexes to other protein (e.g., carrier proteins). This process may isolate those molecules bound to a specific carrier protein (e.g., albumin), or use a more general process, such as the release of bound molecules from all carrier proteins via protein denaturation, for example using an acid, followed by removal of the carrier proteins.
Removal of undesired proteins (e.g. , high abundance, uninformative, or
undetectable proteins) from a sample can be achieved using high affinity reagents, high molecular weight filters, ultracentrifugation and/or electrodialysis. High affinity reagents
include antibodies or other reagents (e.g., aptamers) that selectively bind to high abundance proteins. Sample preparation could also include ion exchange chromatography, metal ion affinity chromatography, gel filtration, hydrophobic chromatography, chromatofocusing, adsorption chromatography, isoelectric focusing and related techniques. Molecular weight filters include membranes that separate molecules on the basis of size and molecular weight. Such filters may further employ reverse osmosis, nanofiltration, ultrafiltration and microfiltration.
Ultracentrifugation is a method for removing undesired polypeptides from a sample. Ultracentrifugation is the centrifugation of a sample at about 15,000-60,000 rpm while monitoring with an optical system the sedimentation (or lack thereof) of particles.
Electrodialysis is a procedure which uses an electromembrane or semipermable membrane in a process in which ions are transported through semi-permeable membranes from one solution to another under the influence of a potential gradient. Since the membranes used in electrodialysis may have the ability to selectively transport ions having positive or negative charge, reject ions of the opposite charge, or to allow species to migrate through a semipermable membrane based on size and charge, it renders electrodialysis useful for concentration, removal, or separation of electrolytes.
Separation and purification in the present invention may include any procedure known in the art, such as capillary electrophoresis (e.g., in capillary or on-chip) or chromatography (e.g., in capillary, column or on a chip). Electrophoresis is a method which can be used to separate ionic molecules under the influence of an electric field.
Electrophoresis can be conducted in a gel, capillary, or in a microchannel on a chip.
Examples of gels used for electrophoresis include starch, acrylamide, polyethylene oxides, agarose, or combinations thereof. A gel can be modified by its cross-linking, addition of detergents, or denaturants, immobilization of enzymes or antibodies (affinity
electrophoresis) or substrates (zymography) and incorporation of a pH gradient. Examples of capillaries used for electrophoresis include capillaries that interface with an electrospray.
Capillary electrophoresis (CE) is preferred for separating complex hydrophilic molecules and highly charged solutes. CE technology can also be implemented on microfluidic chips. Depending on the types of capillary and buffers used, CE can be further segmented into separation techniques such as capillary zone electrophoresis (CZE), capillary isoelectric focusing (CIEF), capillary isotachophoresis (cITP) and capillary electrochromatography (CEC). An embodiment to couple CE techniques to electrospray
ionization involves the use of volatile solutions, for example, aqueous mixtures containing a volatile acid and/or base and an organic such as an alcohol or acetonitrile.
Capillary isotachophoresis (cITP) is a technique in which the analytes move through the capillary at a constant speed but are nevertheless separated by their respective mobilities. Capillary zone electrophoresis (CZE), also known as free-solution CE (FSCE), is based on differences in the electrophoretic mobility of the species, determined by the charge on the molecule, and the frictional resistance the molecule encounters during migration which is often directly proportional to the size of the molecule. Capillary isoelectric focusing (CIEF) allows weakly-ionizable amphoteric molecules, to be separated by electrophoresis in a pH gradient. CEC is a hybrid technique between traditional high performance liquid chromatography (FIPLC) and CE.
Separation and purification techniques used in the present invention include any chromatography procedures known in the art. Chromatography can be based on the differential adsorption and elution of certain analytes or partitioning of analytes between mobile and stationary phases. Different examples of chromatography include, but not limited to, liquid chromatography (LC), gas chromatography (GC), high performance liquid chromatography (FIPLC), etc.
IV. Biomarker Nucleic Acids and Polypeptides
One aspect of the present invention pertains to the use of isolated nucleic acid molecules that correspond to biomarker nucleic acids that encode a biomarker polypeptide or a portion of such a polypeptide. As used herein, the term "nucleic acid molecule" is intended to include DNA molecules (e.g., cDNA or genomic DNA) and RNA molecules (e.g., mPvNA) and analogs of the DNA or RNA generated using nucleotide analogs. The nucleic acid molecule can be single-stranded or double-stranded, but preferably is double- stranded DNA.
An "isolated" nucleic acid molecule is one which is separated from other nucleic acid molecules which are present in the natural source of the nucleic acid molecule.
Preferably, an "isolated" nucleic acid molecule is free of sequences (preferably protein- encoding sequences) which naturally flank the nucleic acid (i.e., sequences located at the 5' and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. For example, in various embodiments, the isolated nucleic acid molecule can contain less than about 5 kB, 4 kB, 3 kB, 2 kB, 1 kB, 0.5 kB or 0.1 kB of
nucleotide sequences which naturally flank the nucleic acid molecule in genomic DNA of the cell from which the nucleic acid is derived. Moreover, an "isolated" nucleic acid molecule, such as a cDNA molecule, can be substantially free of other cellular material or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.
A biomarker nucleic acid molecule of the present invention can be isolated using standard molecular biology techniques and the sequence information in the database records described herein. Using all or a portion of such nucleic acid sequences, nucleic acid molecules of the present invention can be isolated using standard hybridization and cloning techniques (e.g., as described in Sambrook et al, ed., Molecular Cloning: A
Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989).
A nucleic acid molecule of the present invention can be amplified using cDNA, mRNA, or genomic DNA as a template and appropriate oligonucleotide primers according to standard PCR amplification techniques. The nucleic acid molecules so amplified can be cloned into an appropriate vector and characterized by DNA sequence analysis.
Furthermore, oligonucleotides corresponding to all or a portion of a nucleic acid molecule of the present invention can be prepared by standard synthetic techniques, e.g., using an automated DNA synthesizer.
Moreover, a nucleic acid molecule of the present invention can comprise only a portion of a nucleic acid sequence, wherein the full length nucleic acid sequence comprises a marker of the present invention or which encodes a polypeptide corresponding to a marker of the present invention. Such nucleic acid molecules can be used, for example, as a probe or primer. The probe/primer typically is used as one or more substantially purified oligonucleotides. The oligonucleotide typically comprises a region of nucleotide sequence that hybridizes under stringent conditions to at least about 7, preferably about 15, more preferably about 25, 50, 75, 100, 125, 150, 175, 200, 250, 300, 350, or 400 or more consecutive nucleotides of a biomarker nucleic acid sequence. Probes based on the sequence of a biomarker nucleic acid molecule can be used to detect transcripts or genomic sequences corresponding to one or more markers of the present invention. The probe comprises a label group attached thereto, e.g., a radioisotope, a fluorescent compound, an enzyme, or an enzyme co-factor.
A biomarker nucleic acid molecules that differ, due to degeneracy of the genetic code, from the nucleotide sequence of nucleic acid molecules encoding a protein which corresponds to the biomarker, and thus encode the same protein, are also contemplated.
In addition, it will be appreciated by those skilled in the art that DNA sequence polymorphisms that lead to changes in the amino acid sequence can exist within a population (e.g., the human population). Such genetic polymorphisms can exist among individuals within a population due to natural allelic variation. An allele is one of a group of genes which occur alternatively at a given genetic locus. In addition, it will be appreciated that DNA polymorphisms that affect RNA expression levels can also exist that may affect the overall expression level of that gene (e.g., by affecting regulation or degradation).
The term "allele," which is used interchangeably herein with "allelic variant," refers to alternative forms of a gene or portions thereof. Alleles occupy the same locus or position on homologous chromosomes. When a subject has two identical alleles of a gene, the subject is said to be homozygous for the gene or allele. When a subject has two different alleles of a gene, the subject is said to be heterozygous for the gene or allele. For example, biomarker alleles can differ from each other in a single nucleotide, or several nucleotides, and can include substitutions, deletions, and insertions of nucleotides. An allele of a gene can also be a form of a gene containing one or more mutations.
The term "allelic variant of a polymorphic region of gene" or "allelic variant", used interchangeably herein, refers to an alternative form of a gene having one of several possible nucleotide sequences found in that region of the gene in the population. As used herein, allelic variant is meant to encompass functional allelic variants, non-functional allelic variants, SNPs, mutations and polymorphisms.
The term "single nucleotide polymorphism" (SNP) refers to a polymorphic site occupied by a single nucleotide, which is the site of variation between allelic sequences. The site is usually preceded by and followed by highly conserved sequences of the allele (e.g., sequences that vary in less than 1/100 or 1/1000 members of a population). A SNP usually arises due to substitution of one nucleotide for another at the polymorphic site. SNPs can also arise from a deletion of a nucleotide or an insertion of a nucleotide relative to a reference allele. Typically the polymorphic site is occupied by a base other than the reference base. For example, where the reference allele contains the base "T" (thymidine) at the polymorphic site, the altered allele can contain a "C" (cytidine), "G" (guanine), or
"A" (adenine) at the polymorphic site. S P's may occur in protein-coding nucleic acid sequences, in which case they may give rise to a defective or otherwise variant protein, or genetic disease. Such a S P may alter the coding sequence of the gene and therefore specify another amino acid (a "missense" SNP) or a SNP may introduce a stop codon (a "nonsense" SNP). When a SNP does not alter the amino acid sequence of a protein, the SNP is called "silent." SNP's may also occur in noncoding regions of the nucleotide sequence. This may result in defective protein expression, e.g., as a result of alternative spicing, or it may have no effect on the function of the protein.
As used herein, the terms "gene" and "recombinant gene" refer to nucleic acid molecules comprising an open reading frame encoding a polypeptide corresponding to a marker of the present invention. Such natural allelic variations can typically result in 1-5% variance in the nucleotide sequence of a given gene. Alternative alleles can be identified by sequencing the gene of interest in a number of different individuals. This can be readily carried out by using hybridization probes to identify the same genetic locus in a variety of individuals. Any and all such nucleotide variations and resulting amino acid
polymorphisms or variations that are the result of natural allelic variation and that do not alter the functional activity are intended to be within the scope of the present invention.
In another embodiment, a biomarker nucleic acid molecule is at least 7, 15, 20, 25, 30, 40, 60, 80, 100, 150, 200, 250, 300, 350, 400, 450, 550, 650, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2200, 2400, 2600, 2800, 3000,
3500, 4000, 4500, or more nucleotides in length and hybridizes under stringent conditions to a nucleic acid molecule corresponding to a marker of the present invention or to a nucleic acid molecule encoding a protein corresponding to a marker of the present invention. As used herein, the term "hybridizes under stringent conditions" is intended to describe conditions for hybridization and washing under which nucleotide sequences at least 60% (65%), 70%), 75%o, 80%), preferably 85%>) identical to each other typically remain hybridized to each other. Such stringent conditions are known to those skilled in the art and can be found in sections 6.3.1-6.3.6 of Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989). A preferred, non-limiting example of stringent hybridization conditions are hybridization in 6X sodium chloride/sodium citrate (SSC) at about 45°C, followed by one or more washes in 0.2X SSC, 0.1% SDS at 50-65°C.
In addition to naturally-occurring allelic variants of a nucleic acid molecule of the present invention that can exist in the population, the skilled artisan will further appreciate
that sequence changes can be introduced by mutation thereby leading to changes in the amino acid sequence of the encoded protein, without altering the biological activity of the protein encoded thereby. For example, one can make nucleotide substitutions leading to amino acid substitutions at "non-essential" amino acid residues. A "non-essential" amino acid residue is a residue that can be altered from the wild-type sequence without altering the biological activity, whereas an "essential" amino acid residue is required for biological activity. For example, amino acid residues that are not conserved or only semi-conserved among homologs of various species may be non-essential for activity and thus would be likely targets for alteration. Alternatively, amino acid residues that are conserved among the homologs of various species (e.g., murine and human) may be essential for activity and thus would not be likely targets for alteration.
Accordingly, another aspect of the present invention pertains to nucleic acid molecules encoding a polypeptide of the present invention that contain changes in amino acid residues that are not essential for activity. Such polypeptides differ in amino acid sequence from the naturally-occurring proteins which correspond to the markers of the present invention, yet retain biological activity. In one embodiment, a biomarker protein has an amino acid sequence that is at least about 40% identical, 50%, 60%, 70%, 75%, 80%, 83%, 85%, 87.5%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or identical to the amino acid sequence of a biomarker protein described herein.
An isolated nucleic acid molecule encoding a variant protein can be created by introducing one or more nucleotide substitutions, additions or deletions into the nucleotide sequence of nucleic acids of the present invention, such that one or more amino acid residue substitutions, additions, or deletions are introduced into the encoded protein. Mutations can be introduced by standard techniques, such as site-directed mutagenesis and PCR-mediated mutagenesis. Preferably, conservative amino acid substitutions are made at one or more predicted non-essential amino acid residues. A "conservative amino acid substitution" is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), non-polar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic
side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Alternatively, mutations can be introduced randomly along all or part of the coding sequence, such as by saturation mutagenesis, and the resultant mutants can be screened for biological activity to identify mutants that retain activity. Following mutagenesis, the encoded protein can be expressed recombinantly and the activity of the protein can be determined.
In some embodiments, the present invention further contemplates the use of anti- biomarker antisense nucleic acid molecules, i.e., molecules which are complementary to a sense nucleic acid of the present invention, e.g., complementary to the coding strand of a double-stranded cDNA molecule corresponding to a marker of the present invention or complementary to an mRNA sequence corresponding to a marker of the present invention. Accordingly, an antisense nucleic acid molecule of the present invention can hydrogen bond to (i.e. anneal with) a sense nucleic acid of the present invention. The antisense nucleic acid can be complementary to an entire coding strand, or to only a portion thereof, e.g., all or part of the protein coding region (or open reading frame). An antisense nucleic acid molecule can also be antisense to all or part of a non-coding region of the coding strand of a nucleotide sequence encoding a polypeptide of the present invention. The non- coding regions ("5' and 3' untranslated regions") are the 5' and 3' sequences which flank the coding region and are not translated into amino acids.
An antisense oligonucleotide can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 or more nucleotides in length. An antisense nucleic acid can be constructed using chemical synthesis and enzymatic ligation reactions using procedures known in the art. For example, an antisense nucleic acid (e.g., an antisense oligonucleotide) can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, e.g., phosphorothioate derivatives and acridine substituted nucleotides can be used. Examples of modified nucleotides which can be used to generate the antisense nucleic acid include 5- fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4- acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2- thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2- methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7- methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-
mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6- isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2- thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5- oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino- 3-N-2-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine. Alternatively, the antisense nucleic acid can be produced biologically using an expression vector into which a nucleic acid has been sub-cloned in an antisense orientation (i.e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest, described further in the following subsection).
The antisense nucleic acid molecules of the present invention are typically administered to a subject or generated in situ such that they hybridize with or bind to cellular mRNA and/or genomic DNA encoding a polypeptide corresponding to a selected marker of the present invention to thereby inhibit expression of the marker, e.g., by inhibiting transcription and/or translation. The hybridization can be by conventional nucleotide complementarity to form a stable duplex, or, for example, in the case of an antisense nucleic acid molecule which binds to DNA duplexes, through specific interactions in the major groove of the double helix. Examples of a route of administration of antisense nucleic acid molecules of the present invention includes direct injection at a tissue site or infusion of the antisense nucleic acid into a blood- or bone marrow-associated body fluid. Alternatively, antisense nucleic acid molecules can be modified to target selected cells and then administered systemically. For example, for systemic administration, antisense molecules can be modified such that they specifically bind to receptors or antigens expressed on a selected cell surface, e.g., by linking the antisense nucleic acid molecules to peptides or antibodies which bind to cell surface receptors or antigens. The antisense nucleic acid molecules can also be delivered to cells using the vectors described herein. To achieve sufficient intracellular concentrations of the antisense molecules, vector constructs in which the antisense nucleic acid molecule is placed under the control of a strong pol II or pol III promoter are preferred.
An antisense nucleic acid molecule of the present invention can be an a-anomeric nucleic acid molecule. An a-anomeric nucleic acid molecule forms specific double- stranded hybrids with complementary RNA in which, contrary to the usual a-units, the strands run parallel to each other (Gaultier et al, 1987, Nucleic Acids Res. 15:6625-6641). The antisense nucleic acid molecule can also comprise a 2'-o-methylribonucleotide (Inoue
et al, 1987, Nucleic Acids Res. 15:6131-6148) or a chimeric RNA-DNA analogue (Inoue et al, 1987, FEBSLett. 215:327-330).
The present invention also encompasses ribozymes. Ribozymes are catalytic RNA molecules with ribonuclease activity which are capable of cleaving a single-stranded nucleic acid, such as an mRNA, to which they have a complementary region. Thus, ribozymes (e.g., hammerhead ribozymes as described in Haselhoff and Gerlach, 1988, Nature 334:585-591) can be used to catalytically cleave mRNA transcripts to thereby inhibit translation of the protein encoded by the mRNA. A ribozyme having specificity for a nucleic acid molecule encoding a polypeptide corresponding to a marker of the present invention can be designed based upon the nucleotide sequence of a cDNA corresponding to the marker. For example, a derivative of a Tetrahymena L-19 IVS RNA can be constructed in which the nucleotide sequence of the active site is complementary to the nucleotide sequence to be cleaved (see Cech et al. U.S. Patent No. 4,987,071; and Cech et al. U.S. Patent No. 5,116,742). Alternatively, an mRNA encoding a polypeptide of the present invention can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules (see, e.g., Bartel and Szostak, 1993, Science 261 : 1411-1418).
The present invention also encompasses nucleic acid molecules which form triple helical structures. For example, expression of a biomarker protein can be inhibited by targeting nucleotide sequences complementary to the regulatory region of the gene encoding the polypeptide (e.g., the promoter and/or enhancer) to form triple helical structures that prevent transcription of the gene in target cells. See generally Helene (1991) Anticancer Drug Des. 6(6):569-84; Helene (1992) Ann. NY. Acad. Sci. 660:27-36; and Maher ( 1992) Bioassays 14( 12) : 807- 15.
In various embodiments, the nucleic acid molecules of the present invention can be modified at the base moiety, sugar moiety or phosphate backbone to improve, e.g., the stability, hybridization, or solubility of the molecule. For example, the deoxyribose phosphate backbone of the nucleic acid molecules can be modified to generate peptide nucleic acid molecules (see Hyrup et al, 1996, Bioorganic & Medicinal Chemistry 4(1): 5- 23). As used herein, the terms "peptide nucleic acids" or "PNAs" refer to nucleic acid mimics, e.g., DNA mimics, in which the deoxyribose phosphate backbone is replaced by a pseudopeptide backbone and only the four natural nucleobases are retained. The neutral backbone of PNAs has been shown to allow for specific hybridization to DNA and RNA under conditions of low ionic strength. The synthesis of PNA oligomers can be performed
using standard solid phase peptide synthesis protocols as described in Hyrup et al. (1996), supra; Perry-O'Keefe et al. (1996) Proc. Natl. Acad. Sci. USA 93 : 14670-675.
PNAs can be used in therapeutic and diagnostic applications. For example, PNAs can be used as antisense or antigene agents for sequence-specific modulation of gene expression by, e.g., inducing transcription or translation arrest or inhibiting replication. PNAs can also be used, e.g., in the analysis of single base pair mutations in a gene by, e.g., PNA directed PCR clamping; as artificial restriction enzymes when used in combination with other enzymes, e.g., SI nucleases (Hyrup (1996), supra; or as probes or primers for DNA sequence and hybridization (Hyrup, 1996, supra; Perry-O'Keefe et al, 1996, Proc. Natl. Acad. Sci. USA 93 : 14670-675).
In another embodiment, PNAs can be modified, e.g., to enhance their stability or cellular uptake, by attaching lipophilic or other helper groups to PNA, by the formation of PNA-DNA chimeras, or by the use of liposomes or other techniques of drug delivery known in the art. For example, PNA-DNA chimeras can be generated which can combine the advantageous properties of PNA and DNA. Such chimeras allow DNA recognition enzymes, e.g., RNASE H and DNA polymerases, to interact with the DNA portion while the PNA portion would provide high binding affinity and specificity. PNA-DNA chimeras can be linked using linkers of appropriate lengths selected in terms of base stacking, number of bonds between the nucleobases, and orientation (Hyrup, 1996, supra). The synthesis of PNA-DNA chimeras can be performed as described in Hyrup (1996), supra, and Finn et al. (1996) Nucleic Acids Res. 24(17):3357-63. For example, a DNA chain can be synthesized on a solid support using standard phosphoramidite coupling chemistry and modified nucleoside analogs. Compounds such as 5'-(4-methoxytrityl)amino-5'-deoxy- thymidine phosphoramidite can be used as a link between the PNA and the 5' end of DNA (Mag et al, 1989, Nucleic Acids Res. 17:5973-88). PNA monomers are then coupled in a step-wise manner to produce a chimeric molecule with a 5' PNA segment and a 3' DNA segment (Finn et al, 1996, Nucleic Acids Res. 24(17):3357-63). Alternatively, chimeric molecules can be synthesized with a 5' DNA segment and a 3' PNA segment (Peterser et al, 1975, Bioorganic Med. Chem. Lett. 5: 1119-11124).
In other embodiments, the oligonucleotide can include other appended groups such as peptides {e.g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane (see, e.g., Letsinger et al, 1989, Proc. Natl. Acad. Sci. USA 86:6553-6556; Lemaitre et al, 1987, Proc. Natl. Acad. Sci. USA 84:648-652; PCT
Publication No. WO 88/09810) or the blood-brain barrier (see, e.g., PCT Publication No. WO 89/10134). In addition, oligonucleotides can be modified with hybridization-triggered cleavage agents (see, e.g., Krol et al, 1988, Bio/Techniques 6:958-976) or intercalating agents (see, e.g., Zon, 1988, Pharm. Res. 5:539-549). To this end, the oligonucleotide can be conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking agent, transport agent, hybridization-triggered cleavage agent, etc.
Another aspect of the present invention pertains to the use of biomarker proteins and biologically active portions thereof. In one embodiment, the native polypeptide
corresponding to a marker can be isolated from cells or tissue sources by an appropriate purification scheme using standard protein purification techniques. In another embodiment, polypeptides corresponding to a marker of the present invention are produced by
recombinant DNA techniques. Alternative to recombinant expression, a polypeptide corresponding to a marker of the present invention can be synthesized chemically using standard peptide synthesis techniques.
An "isolated" or "purified" protein or biologically active portion thereof is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which the protein is derived, or substantially free of chemical precursors or other chemicals when chemically synthesized. The language "substantially free of cellular material" includes preparations of protein in which the protein is separated from cellular components of the cells from which it is isolated or recombinantly produced. Thus, protein that is substantially free of cellular material includes preparations of protein having less than about 30%, 20%, 10%, or 5% (by dry weight) of heterologous protein (also referred to herein as a "contaminating protein"). When the protein or biologically active portion thereof is recombinantly produced, it is also preferably substantially free of culture medium, i.e., culture medium represents less than about 20%, 10%, or 5% of the volume of the protein preparation. When the protein is produced by chemical synthesis, it is preferably substantially free of chemical precursors or other chemicals, i.e., it is separated from chemical precursors or other chemicals which are involved in the synthesis of the protein. Accordingly such preparations of the protein have less than about 30%, 20%, 10%, 5% (by dry weight) of chemical precursors or compounds other than the polypeptide of interest.
Biologically active portions of a biomarker polypeptide include polypeptides comprising amino acid sequences sufficiently identical to or derived from a biomarker
protein amino acid sequence described herein, but which includes fewer amino acids than the full length protein, and exhibit at least one activity of the corresponding full-length protein. Typically, biologically active portions comprise a domain or motif with at least one activity of the corresponding protein. A biologically active portion of a protein of the present invention can be a polypeptide which is, for example, 10, 25, 50, 100 or more amino acids in length. Moreover, other biologically active portions, in which other regions of the protein are deleted, can be prepared by recombinant techniques and evaluated for one or more of the functional activities of the native form of a polypeptide of the present invention.
Preferred polypeptides have an amino acid sequence of a biomarker protein encoded by a nucleic acid molecule described herein. Other useful proteins are substantially identical (e.g., at least about 40%, preferably 50%, 60%, 70%, 75%, 80%, 83%, 85%, 88%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) to one of these sequences and retain the functional activity of the protein of the corresponding naturally-occurring protein yet differ in amino acid sequence due to natural allelic variation or mutagenesis.
To determine the percent identity of two amino acid sequences or of two nucleic acids, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the sequence of a first amino acid or nucleic acid sequence for optimal alignment with a second amino or nucleic acid sequence). The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % identity = # of identical positions/total # of positions (e.g., overlapping positions) xlOO). In one embodiment the two sequences are the same length.
The determination of percent identity between two sequences can be accomplished using a mathematical algorithm. A preferred, non-limiting example of a mathematical algorithm utilized for the comparison of two sequences is the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264-2268, modified as in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5877. Such an algorithm is incorporated into the BLAST and XBLAST programs of Altschul, et al. (1990) J. Mol. Biol. 215:403-410. BLAST nucleotide searches can be performed with the NBLAST
program, score = 100, wordlength = 12 to obtain nucleotide sequences homologous to a nucleic acid molecules of the present invention. BLAST protein searches can be performed with the XBLAST program, score = 50, wordlength = 3 to obtain amino acid sequences homologous to a protein molecules of the present invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al. (1997) Nucleic Acids Res. 25:3389-3402. Alternatively, PSI-Blast can be used to perform an iterated search which detects distant relationships between molecules. When utilizing BLAST, Gapped BLAST, and PSI-Blast programs, the default parameters of the respective programs {e.g., XBLAST and BLAST) can be used. See http://www.ncbi.nlm.nih.gov. Another preferred, non-limiting example of a mathematical algorithm utilized for the comparison of sequences is the algorithm of Myers and Miller, (1988) Comput Appl Biosci, 4: 11-7. Such an algorithm is incorporated into the ALIGN program (version 2.0) which is part of the GCG sequence alignment software package. When utilizing the ALIGN program for comparing amino acid sequences, a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used. Yet another useful algorithm for identifying regions of local sequence similarity and alignment is the FASTA algorithm as described in Pearson and Lipman (1988) Proc. Natl. Acad. Sci. USA 85:2444-2448. When using the FASTA algorithm for comparing nucleotide or amino acid sequences, a PAM120 weight residue table can, for example, be used with a &-tuple value of 2.
The percent identity between two sequences can be determined using techniques similar to those described above, with or without allowing gaps. In calculating percent identity, only exact matches are counted.
The present invention also provides chimeric or fusion proteins corresponding to a biomarker protein. As used herein, a "chimeric protein" or "fusion protein" comprises all or part (preferably a biologically active part) of a polypeptide corresponding to a marker of the present invention operably linked to a heterologous polypeptide (i.e., a polypeptide other than the polypeptide corresponding to the marker). Within the fusion protein, the term "operably linked" is intended to indicate that the polypeptide of the present invention and the heterologous polypeptide are fused in-frame to each other. The heterologous polypeptide can be fused to the amino-terminus or the carboxyl-terminus of the polypeptide of the present invention.
One useful fusion protein is a GST fusion protein in which a polypeptide corresponding to a marker of the present invention is fused to the carboxyl terminus of GST
sequences. Such fusion proteins can facilitate the purification of a recombinant polypeptide of the present invention.
In another embodiment, the fusion protein contains a heterologous signal sequence, immunoglobulin fusion protein, toxin, or other useful protein sequence. Chimeric and fusion proteins of the present invention can be produced by standard recombinant DNA techniques. In another embodiment, the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers. Alternatively, PCR amplification of gene fragments can be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed and re-amplified to generate a chimeric gene sequence (see, e.g., Ausubel et al, supra). Moreover, many expression vectors are commercially available that already encode a fusion moiety {e.g., a GST polypeptide). A nucleic acid encoding a polypeptide of the present invention can be cloned into such an expression vector such that the fusion moiety is linked in-frame to the polypeptide of the present invention.
A signal sequence can be used to facilitate secretion and isolation of the secreted protein or other proteins of interest. Signal sequences are typically characterized by a core of hydrophobic amino acids which are generally cleaved from the mature protein during secretion in one or more cleavage events. Such signal peptides contain processing sites that allow cleavage of the signal sequence from the mature proteins as they pass through the secretory pathway. Thus, the present invention pertains to the described polypeptides having a signal sequence, as well as to polypeptides from which the signal sequence has been proteolytically cleaved {i.e., the cleavage products). In one embodiment, a nucleic acid sequence encoding a signal sequence can be operably linked in an expression vector to a protein of interest, such as a protein which is ordinarily not secreted or is otherwise difficult to isolate. The signal sequence directs secretion of the protein, such as from a eukaryotic host into which the expression vector is transformed, and the signal sequence is subsequently or concurrently cleaved. The protein can then be readily purified from the extracellular medium by art recognized methods. Alternatively, the signal sequence can be linked to the protein of interest using a sequence which facilitates purification, such as with a GST domain.
The present invention also pertains to variants of the biomarker polypeptides described herein. Such variants have an altered amino acid sequence which can function as either agonists (mimetics) or as antagonists. Variants can be generated by mutagenesis,
e.g., discrete point mutation or truncation. An agonist can retain substantially the same, or a subset, of the biological activities of the naturally occurring form of the protein. An antagonist of a protein can inhibit one or more of the activities of the naturally occurring form of the protein by, for example, competitively binding to a downstream or upstream member of a cellular signaling cascade which includes the protein of interest. Thus, specific biological effects can be elicited by treatment with a variant of limited function. Treatment of a subject with a variant having a subset of the biological activities of the naturally occurring form of the protein can have fewer side effects in a subject relative to treatment with the naturally occurring form of the protein.
Variants of a biomarker protein which function as either agonists (mimetics) or as antagonists can be identified by screening combinatorial libraries of mutants, e.g., truncation mutants, of the protein of the present invention for agonist or antagonist activity. In one embodiment, a variegated library of variants is generated by combinatorial mutagenesis at the nucleic acid level and is encoded by a variegated gene library. A variegated library of variants can be produced by, for example, enzymatically ligating a mixture of synthetic oligonucleotides into gene sequences such that a degenerate set of potential protein sequences is expressible as individual polypeptides, or alternatively, as a set of larger fusion proteins (e.g., for phage display). There are a variety of methods which can be used to produce libraries of potential variants of the polypeptides of the present invention from a degenerate oligonucleotide sequence. Methods for synthesizing degenerate oligonucleotides are known in the art (see, e.g., Narang, 1983, Tetrahedron 39:3; Itakura et al, 1984, Annu. Rev. Biochem. 53 :323; Itakura et al, 1984, Science 198: 1056; Ike et al, 1983 Nucleic Acid Res. 11 :477).
In addition, libraries of fragments of the coding sequence of a polypeptide corresponding to a marker of the present invention can be used to generate a variegated population of polypeptides for screening and subsequent selection of variants. For example, a library of coding sequence fragments can be generated by treating a double stranded PCR fragment of the coding sequence of interest with a nuclease under conditions wherein nicking occurs only about once per molecule, denaturing the double stranded DNA, renaturing the DNA to form double stranded DNA which can include sense/antisense pairs from different nicked products, removing single stranded portions from reformed duplexes by treatment with SI nuclease, and ligating the resulting fragment library into an
expression vector. By this method, an expression library can be derived which encodes amino terminal and internal fragments of various sizes of the protein of interest.
Several techniques are known in the art for screening gene products of
combinatorial libraries made by point mutations or truncation, and for screening cDNA libraries for gene products having a selected property. The most widely used techniques, which are amenable to high throughput analysis, for screening large gene libraries typically include cloning the gene library into replicable expression vectors, transforming appropriate cells with the resulting library of vectors, and expressing the combinatorial genes under conditions in which detection of a desired activity facilitates isolation of the vector encoding the gene whose product was detected. Recursive ensemble mutagenesis (REM), a technique which enhances the frequency of functional mutants in the libraries, can be used in combination with the screening assays to identify variants of a protein of the present invention (Arkin and Yourvan, 1992, Proc. Natl. Acad. Sci. USA 59:7811-7815; Delgrave et al, 1993, Protein Engineering 6(3):327- 331).
The production and use of biomarker nucleic acid and/or biomarker polypeptide molecules described herein can be facilitated by using standard recombinant techniques. In some embodiments, such techniques use vectors, preferably expression vectors, containing a nucleic acid encoding a biomarker polypeptide or a portion of such a polypeptide. As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a "plasmid", which refers to a circular double stranded DNA loop into which additional DNA segments can be ligated. Another type of vector is a viral vector, wherein additional DNA segments can be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced {e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors {e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors, namely expression vectors, are capable of directing the expression of genes to which they are operably linked. In general, expression vectors of utility in recombinant DNA techniques are often in the form of plasmids (vectors). However, the present invention is intended to include such other forms of expression vectors, such as viral vectors {e.g., replication defective retroviruses, adenoviruses and adeno-associated viruses), which serve equivalent functions.
The recombinant expression vectors of the present invention comprise a nucleic acid of the present invention in a form suitable for expression of the nucleic acid in a host cell. This means that the recombinant expression vectors include one or more regulatory sequences, selected on the basis of the host cells to be used for expression, which is operably linked to the nucleic acid sequence to be expressed. Within a recombinant expression vector, "operably linked" is intended to mean that the nucleotide sequence of interest is linked to the regulatory sequence(s) in a manner which allows for expression of the nucleotide sequence (e.g., in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell). The term "regulatory sequence" is intended to include promoters, enhancers and other expression control elements {e.g., polyadenylation signals). Such regulatory sequences are described, for example, in
Goeddel, Methods in Enzymology: Gene Expression Technology vol.185, Academic Press, San Diego, CA (1991). Regulatory sequences include those which direct constitutive expression of a nucleotide sequence in many types of host cell and those which direct expression of the nucleotide sequence only in certain host cells {e.g., tissue-specific regulatory sequences). It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, and the like. The expression vectors of the present invention can be introduced into host cells to thereby produce proteins or peptides, including fusion proteins or peptides, encoded by nucleic acids as described herein.
The recombinant expression vectors for use in the present invention can be designed for expression of a polypeptide corresponding to a marker of the present invention in prokaryotic {e.g., E. coli) or eukaryotic cells {e.g., insect cells {using baculovirus expression vectors}, yeast cells or mammalian cells). Suitable host cells are discussed further in Goeddel, supra. Alternatively, the recombinant expression vector can be transcribed and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase.
Expression of proteins in prokaryotes is most often carried out in E. coli with vectors containing constitutive or inducible promoters directing the expression of either fusion or non-fusion proteins. Fusion vectors add a number of amino acids to a protein encoded therein, usually to the amino terminus of the recombinant protein. Such fusion vectors typically serve three purposes: 1) to increase expression of recombinant protein; 2)
to increase the solubility of the recombinant protein; and 3) to aid in the purification of the recombinant protein by acting as a ligand in affinity purification. Often, in fusion expression vectors, a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant protein to enable separation of the recombinant protein from the fusion moiety subsequent to purification of the fusion protein. Such enzymes, and their cognate recognition sequences, include Factor Xa, thrombin and enterokinase. Typical fusion expression vectors include pGEX (Pharmacia Biotech Inc; Smith and Johnson, 1988, Gene 67:31-40), pMAL (New England Biolabs, Beverly, MA) and pRIT5 (Pharmacia, Piscataway, NJ) which fuse glutathione S-transferase (GST), maltose E binding protein, or protein A, respectively, to the target recombinant protein.
Examples of suitable inducible non-fusion E. coli expression vectors include pTrc (Amann et a/., 1988, Gene 69:301-315) and pET l id (Studier et al., p. 60-89, In Gene Expression Technology: Methods in Enzymology vol.185, Academic Press, San Diego, CA, 1991). Target biomarker nucleic acid expression from the pTrc vector relies on host RNA polymerase transcription from a hybrid trp-lac fusion promoter. Target biomarker nucleic acid expression from the pET l id vector relies on transcription from a T7 gnlO-lac fusion promoter mediated by a co-expressed viral RNA polymerase (T7 gnl). This viral polymerase is supplied by host strains BL21 (DE3) or HMS174(DE3) from a resident prophage harboring a T7 gnl gene under the transcriptional control of the lacUV 5 promoter.
One strategy to maximize recombinant protein expression in E. coli is to express the protein in a host bacterium with an impaired capacity to proteolytically cleave the recombinant protein (Gottesman, p. 119-128, In Gene Expression Technology: Methods in Enzymology vol. 185, Academic Press, San Diego, CA, 1990. Another strategy is to alter the nucleic acid sequence of the nucleic acid to be inserted into an expression vector so that the individual codons for each amino acid are those preferentially utilized in E. coli (Wada et al, 1992, Nucleic Acids Res. 20:2111-2118). Such alteration of nucleic acid sequences of the present invention can be carried out by standard DNA synthesis techniques.
In another embodiment, the expression vector is a yeast expression vector.
Examples of vectors for expression in yeast S. cerevisiae include pYepSecl (Baldari et al, 1987, EMBO J. 6:229-234), pMFa (Kurjan and Herskowitz, 1982, Cell 30:933-943), pJRY88 (Schultz et al, 1987, Gene 54: 113-123), pYES2 (Invitrogen Corporation, San Diego, CA), and pPicZ (Invitrogen Corp, San Diego, CA).
Alternatively, the expression vector is a baculovirus expression vector. Baculovirus vectors available for expression of proteins in cultured insect cells (e.g., Sf 9 cells) include the pAc series (Smith et al, 1983, Mol. Cell Biol. 3 :2156-2165) and the pVL series (Lucklow and Summers, 1989, Virology 170:31-39).
In yet another embodiment, a nucleic acid of the present invention is expressed in mammalian cells using a mammalian expression vector. Examples of mammalian expression vectors include pCDM8 (Seed, 1987, Nature 329:840) and pMT2PC (Kaufman et al, 1987, EMBO J. 6: 187-195). When used in mammalian cells, the expression vector's control functions are often provided by viral regulatory elements. For example, commonly used promoters are derived from polyoma, Adenovirus 2, cytomegalovirus and Simian Virus 40. For other suitable expression systems for both prokaryotic and eukaryotic cells see chapters 16 and 17 of Sambrook et al, supra.
In another embodiment, the recombinant mammalian expression vector is capable of directing expression of the nucleic acid preferentially in a particular cell type (e.g., tissue- specific regulatory elements are used to express the nucleic acid). Tissue-specific regulatory elements are known in the art. Non-limiting examples of suitable tissue-specific promoters include the albumin promoter (liver-specific; Pinkert et al, 1987, Genes Dev. 1 :268-277), lymphoid-specific promoters (Calame and Eaton, 1988, Adv. Immunol. 43 :235- 275), in particular promoters of T cell receptors (Winoto and Baltimore, 1989, EMBO J. 8:729-733) and immunoglobulins (Banerji et al, 1983, Cell 33 :729-740; Queen and Baltimore, 1983, Cell 33 :741-748), neuron-specific promoters (e.g., the neurofilament promoter; Byrne and Ruddle, 1989, Proc. Natl. Acad. Sci. USA 86:5473-5477), pancreas- specific promoters (Edlund et al, 1985, Science 230:912-916), and mammary gland- specific promoters (e.g., milk whey promoter; U.S. Patent No. 4,873,316 and European Application Publication No. 264,166). Developmentally-regulated promoters are also encompassed, for example the murine hox promoters (Kessel and Gruss, 1990, Science 249:374-379) and the a-fetoprotein promoter (Camper and Tilghman, 1989, Genes Dev. 3 :537-546).
The present invention further provides a recombinant expression vector comprising a DNA molecule cloned into the expression vector in an antisense orientation. That is, the DNA molecule is operably linked to a regulatory sequence in a manner which allows for expression (by transcription of the DNA molecule) of an RNA molecule which is antisense to the mRNA encoding a polypeptide of the present invention. Regulatory sequences
operably linked to a nucleic acid cloned in the antisense orientation can be chosen which direct the continuous expression of the antisense RNA molecule in a variety of cell types, for instance viral promoters and/or enhancers, or regulatory sequences can be chosen which direct constitutive, tissue-specific or cell type specific expression of antisense RNA. The antisense expression vector can be in the form of a recombinant plasmid, phagemid, or attenuated virus in which antisense nucleic acids are produced under the control of a high efficiency regulatory region, the activity of which can be determined by the cell type into which the vector is introduced. For a discussion of the regulation of gene expression using antisense genes (see Weintraub et al, 1986, Trends in Genetics, Vol. 1(1)).
Another aspect of the present invention pertains to host cells into which a recombinant expression vector of the present invention has been introduced. The terms "host cell" and "recombinant host cell" are used interchangeably herein. It is understood that such terms refer not only to the particular subject cell but to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.
A host cell can be any prokaryotic {e.g., E. coli) or eukaryotic cell {e.g., insect cells, yeast or mammalian cells).
Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques. As used herein, the terms "transformation" and "transfection" are intended to refer to a variety of art-recognized techniques for introducing foreign nucleic acid into a host cell, including calcium phosphate or calcium chloride co- precipitation, DEAE-dextran-mediated transfection, lipofection, or electroporation.
Suitable methods for transforming or transfecting host cells can be found in Sambrook, et al. {supra), and other laboratory manuals.
For stable transfection of mammalian cells, it is known that, depending upon the expression vector and transfection technique used, only a small fraction of cells may integrate the foreign DNA into their genome. In order to identify and select these integrants, a gene that encodes a selectable marker {e.g., for resistance to antibiotics) is generally introduced into the host cells along with the gene of interest. Preferred selectable markers include those which confer resistance to drugs, such as G418, hygromycin and methotrexate. Cells stably transfected with the introduced nucleic acid can be identified by
drug selection (e.g., cells that have incorporated the selectable marker gene will survive, while the other cells die).
V. Analyzing Biomarker Nucleic Acids and Polypeptides
Biomarker nucleic acids and/or biomarker polypeptides can be analyzed according to the methods described herein and techniques known to the skilled artisan to identify such genetic or expression alterations useful for the present invention including, but not limited to, 1) an alteration in the level of a biomarker transcript or polypeptide, 2) a deletion or addition of one or more nucleotides from a biomarker gene, 4) a substitution of one or more nucleotides of a biomarker gene, 5) aberrant modification of a biomarker gene, such as an expression regulatory region, and the like.
a. Methods for Detection of Copy Number
Methods of evaluating the copy number of a biomarker nucleic acid are well known to those of skill in the art. The presence or absence of chromosomal gain or loss can be evaluated simply by a determination of copy number of the regions or markers identified herein.
In one embodiment, a biological sample is tested for the presence of copy number changes in genomic loci containing the genomic marker. A copy number of at least 3, 4, 5, 6, 7, 8, 9, or 10 is predictive of poorer outcome of PBK/mTOR combination inhibitor treatment.
Methods of evaluating the copy number of a biomarker locus include, but are not limited to, hybridization-based assays. Hybridization-based assays include, but are not limited to, traditional "direct probe" methods, such as Southern blots, in situ hybridization {e.g., FISH and FISH plus SKY) methods, and "comparative probe" methods, such as comparative genomic hybridization (CGH), e.g., cDNA-based or oligonucleotide-based CGH. The methods can be used in a wide variety of formats including, but not limited to, substrate {e.g. membrane or glass) bound methods or array-based approaches.
In one embodiment, evaluating the biomarker gene copy number in a sample involves a Southern Blot. In a Southern Blot, the genomic DNA (typically fragmented and separated on an electrophoretic gel) is hybridized to a probe specific for the target region. Comparison of the intensity of the hybridization signal from the probe for the target region with control probe signal from analysis of normal genomic DNA {e.g., a non-amplified portion of the same or related cell, tissue, organ, etc) provides an estimate of the relative
copy number of the target nucleic acid. Alternatively, a Northern blot may be utilized for evaluating the copy number of encoding nucleic acid in a sample. In a Northern blot, mRNA is hybridized to a probe specific for the target region. Comparison of the intensity of the hybridization signal from the probe for the target region with control probe signal from analysis of normal RNA (e.g., a non-amplified portion of the same or related cell, tissue, organ, etc.) provides an estimate of the relative copy number of the target nucleic acid. Alternatively, other methods well known in the art to detect RNA can be used, such that higher or lower expression relative to an appropriate control (e.g., a non-amplified portion of the same or related cell tissue, organ, etc.) provides an estimate of the relative copy number of the target nucleic acid.
An alternative means for determining genomic copy number is in situ hybridization (e.g., Angerer (1987) et/z. Enzymol 152: 649). Generally, in situ hybridization comprises the following steps: (1) fixation of tissue or biological structure to be analyzed; (2) prehybridization treatment of the biological structure to increase accessibility of target DNA, and to reduce nonspecific binding; (3) hybridization of the mixture of nucleic acids to the nucleic acid in the biological structure or tissue; (4) post-hybridization washes to remove nucleic acid fragments not bound in the hybridization and (5) detection of the hybridized nucleic acid fragments. The reagent used in each of these steps and the conditions for use vary depending on the particular application. In a typical in situ hybridization assay, cells are fixed to a solid support, typically a glass slide. If a nucleic acid is to be probed, the cells are typically denatured with heat or alkali. The cells are then contacted with a hybridization solution at a moderate temperature to permit annealing of labeled probes specific to the nucleic acid sequence encoding the protein. The targets (e.g., cells) are then typically washed at a predetermined stringency or at an increasing stringency until an appropriate signal to noise ratio is obtained. The probes are typically labeled, e.g., with radioisotopes or fluorescent reporters. In one embodiment, probes are sufficiently long so as to specifically hybridize with the target nucleic acid(s) under stringent conditions. Probes generally range in length from about 200 bases to about 1000 bases. In some applications it is necessary to block the hybridization capacity of repetitive sequences. Thus, in some embodiments, tRNA, human genomic DNA, or Cot-I DNA is used to block non-specific hybridization.
An alternative means for determining genomic copy number is comparative genomic hybridization. In general, genomic DNA is isolated from normal reference cells,
as well as from test cells (e.g., tumor cells) and amplified, if necessary. The two nucleic acids are differentially labeled and then hybridized in situ to metaphase chromosomes of a reference cell. The repetitive sequences in both the reference and test DNAs are either removed or their hybridization capacity is reduced by some means, for example by prehybridization with appropriate blocking nucleic acids and/or including such blocking nucleic acid sequences for said repetitive sequences during said hybridization. The bound, labeled DNA sequences are then rendered in a visualizable form, if necessary.
Chromosomal regions in the test cells which are at increased or decreased copy number can be identified by detecting regions where the ratio of signal from the two DNAs is altered. For example, those regions that have decreased in copy number in the test cells will show relatively lower signal from the test DNA than the reference compared to other regions of the genome. Regions that have been increased in copy number in the test cells will show relatively higher signal from the test DNA. Where there are chromosomal deletions or multiplications, differences in the ratio of the signals from the two labels will be detected and the ratio will provide a measure of the copy number. In another embodiment of CGH, array CGH (aCGH), the immobilized chromosome element is replaced with a collection of solid support bound target nucleic acids on an array, allowing for a large or complete percentage of the genome to be represented in the collection of solid support bound targets. Target nucleic acids may comprise cDNAs, genomic DNAs, oligonucleotides {e.g., to detect single nucleotide polymorphisms) and the like. Array-based CGH may also be performed with single-color labeling (as opposed to labeling the control and the possible tumor sample with two different dyes and mixing them prior to hybridization, which will yield a ratio due to competitive hybridization of probes on the arrays). In single color CGH, the control is labeled and hybridized to one array and absolute signals are read, and the possible tumor sample is labeled and hybridized to a second array (with identical content) and absolute signals are read. Copy number difference is calculated based on absolute signals from the two arrays. Methods of preparing immobilized chromosomes or arrays and performing comparative genomic hybridization are well known in the art (see, e.g., U.S. Pat. Nos: 6,335,167; 6,197,501; 5,830,645; and 5,665,549 and Albertson (1984) EMBO J. 3 : 1227-1234; Pinkel (1988) roc. Natl. Acad. Sci. USA 85: 9138-9142; EPO
Pub. No. 430,402; Methods in Molecular Biology, Vol. 33 : In situ Hybridization Protocols, Choo, ed., Humana Press, Totowa, N.J. (1994), etc.) In another embodiment, the
hybridization protocol of Pinkel, et al. (1998) Nature Genetics 20: 207-211, or of
Kallioniemi (1992) Proc. Natl Acad Sci USA 89:5321-5325 (1992) is used.
In still another embodiment, amplification-based assays can be used to measure copy number. In such amplification-based assays, the nucleic acid sequences act as a template in an amplification reaction {e.g., Polymerase Chain Reaction (PCR). In a quantitative amplification, the amount of amplification product will be proportional to the amount of template in the original sample. Comparison to appropriate controls, e.g. healthy tissue, provides a measure of the copy number.
Methods of "quantitative" amplification are well known to those of skill in the art. For example, quantitative PCR involves simultaneously co-amplifying a known quantity of a control sequence using the same primers. This provides an internal standard that may be used to calibrate the PCR reaction. Detailed protocols for quantitative PCR are provided in Innis, et al. (1990) PCR Protocols, A Guide to Methods and Applications, Academic Press, Inc. N.Y.). Measurement of DNA copy number at microsatellite loci using quantitative PCR analysis is described in Ginzonger, et al. (2000) Cancer Research 60:5405-5409. The known nucleic acid sequence for the genes is sufficient to enable one of skill in the art to routinely select primers to amplify any portion of the gene. Fluorogenic quantitative PCR may also be used in the methods of the present invention. In fluorogenic quantitative PCR, quantitation is based on amount of fluorescence signals, e.g., TaqMan and SYBR green.
Other suitable amplification methods include, but are not limited to, ligase chain reaction (LCR) (see Wu and Wallace (1989) Genomics 4: 560, Landegren, et al. (1988) Science 241 : 1077, and Barringer et al. (1990) Gene 89: 117), transcription amplification (Kwoh, et al. (1989) Proc. Natl. Acad. Sci. USA 86: 1173), self-sustained sequence replication (Guatelli, et al. (1990) Proc. Nat. Acad. Sci. USA 87: 1874), dot PCR, and linker adapter PCR, etc.
Loss of heterozygosity (LOH) and major copy proportion (MCP) mapping (Wang, Z.C., et al. (2004) Cancer Res 64(1):64-71; Seymour, A. B., et al. (1994) Cancer Res 54, 2761-4; Hahn, S. A., et al. (1995) Cancer Res 55, 4670-5; Kimura, M., et al. (1996) Genes Chromosomes Cancer 17, 88-93; Li et al., (2008) MBC Bioinform. 9, 204-219) may also be used to identify regions of amplification or deletion.
b. Methods for Detection of Biomarker Nucleic Acid Expression
Biomarker expression may be assessed by any of a wide variety of well-known methods for detecting expression of a transcribed molecule or protein. Non-limiting
examples of such methods include immunological methods for detection of secreted, cell- surface, cytoplasmic, or nuclear proteins, protein purification methods, protein function or activity assays, nucleic acid hybridization methods, nucleic acid reverse transcription methods, and nucleic acid amplification methods.
In preferred embodiments, activity of a particular gene is characterized by a measure of gene transcript (e.g. mRNA), by a measure of the quantity of translated protein, or by a measure of gene product activity. Marker expression can be monitored in a variety of ways, including by detecting mRNA levels, protein levels, or protein activity, any of which can be measured using standard techniques. Detection can involve quantification of the level of gene expression (e.g., genomic DNA, cDNA, mRNA, protein, or enzyme activity), or, alternatively, can be a qualitative assessment of the level of gene expression, in particular in comparison with a control level. The type of level being detected will be clear from the context.
In another embodiment, detecting or determining expression levels of a biomarker and functionally similar homologs thereof, including a fragment or genetic alteration thereof (e.g., in regulatory or promoter regions thereof) comprises detecting or determining RNA levels for the marker of interest. In one embodiment, one or more cells from the subject to be tested are obtained and RNA is isolated from the cells. In a preferred embodiment, a sample of breast tissue cells is obtained from the subject.
In one embodiment, RNA is obtained from a single cell. For example, a cell can be isolated from a tissue sample by laser capture microdissection (LCM). Using this technique, a cell can be isolated from a tissue section, including a stained tissue section, thereby assuring that the desired cell is isolated (see, e.g., Bonner et al. (1997) Science 278: 1481; Emmert-Buck et al. (1996) Science 274:998; Fend et al. (1999) Am. J. Path. 154: 61 and Murakami et al. (2000) Kidney Int. 58: 1346). For example, Murakami et al., supra, describe isolation of a cell from a previously immunostained tissue section.
It is also be possible to obtain cells from a subject and culture the cells in vitro, such as to obtain a larger population of cells from which RNA can be extracted. Methods for establishing cultures of non-transformed cells, i.e., primary cell cultures, are known in the art.
When isolating RNA from tissue samples or cells from individuals, it may be important to prevent any further changes in gene expression after the tissue or cells has been removed from the subject. Changes in expression levels are known to change rapidly
following perturbations, e.g., heat shock or activation with lipopolysaccharide (LPS) or other reagents. In addition, the RNA in the tissue and cells may quickly become degraded. Accordingly, in a preferred embodiment, the tissue or cells obtained from a subject is snap frozen as soon as possible.
RNA can be extracted from the tissue sample by a variety of methods, e.g., the guanidium thiocyanate lysis followed by CsCl centrifugation (Chirgwin et al., 1979, Biochemistry 18:5294-5299). RNA from single cells can be obtained as described in methods for preparing cDNA libraries from single cells, such as those described in Dulac, C. (1998) Curr. Top. Dev. Biol. 36, 245 and Jena et al. (1996) J. Immunol. Methods 190: 199. Care to avoid RNA degradation must be taken, e.g., by inclusion of RNAsin.
The RNA sample can then be enriched in particular species. In one embodiment, poly(A)+ RNA is isolated from the RNA sample. In general, such purification takes advantage of the poly-A tails on mRNA. In particular and as noted above, poly-T oligonucleotides may be immobilized within on a solid support to serve as affinity ligands for mRNA. Kits for this purpose are commercially available, e.g., the MessageMaker kit (Life Technologies, Grand Island, NY).
In a preferred embodiment, the RNA population is enriched in marker sequences. Enrichment can be undertaken, e.g., by primer-specific cDNA synthesis, or multiple rounds of linear amplification based on cDNA synthesis and template-directed in vitro
transcription {see, e.g., Wang et al. (1989) PNAS 86, 9717; Dulac et al., supra, and Jena et al., supra).
The population of RNA, enriched or not in particular species or sequences, can further be amplified. As defined herein, an "amplification process" is designed to strengthen, increase, or augment a molecule within the RNA. For example, where RNA is mRNA, an amplification process such as RT-PCR can be utilized to amplify the mRNA, such that a signal is detectable or detection is enhanced. Such an amplification process is beneficial particularly when the biological, tissue, or tumor sample is of a small size or volume.
Various amplification and detection methods can be used. For example, it is within the scope of the present invention to reverse transcribe mRNA into cDNA followed by polymerase chain reaction (RT-PCR); or, to use a single enzyme for both steps as described in U.S. Pat. No. 5,322,770, or reverse transcribe mRNA into cDNA followed by symmetric
gap ligase chain reaction (RT-AGLCR) as described by R. L. Marshall, et al., PCR
Methods and Applications 4: 80-84 (1994). Real time PCR may also be used.
Other known amplification methods which can be utilized herein include but are not limited to the so-called "NASBA" or "3SR" technique described in PNAS USA 87: 1874- 1878 (1990) and also described in Nature 350 (No. 6313): 91-92 (1991); Q-beta
amplification as described in published European Patent Application (EPA) No. 4544610; strand displacement amplification (as described in G. T. Walker et al., Clin. Chem. 42: 9-13 (1996) and European Patent Application No. 684315; target mediated amplification, as described by PCT Publication W09322461; PCR; ligase chain reaction (LCR) (see, e.g., Wu and Wallace, Genomics 4, 560 (1989), Landegren et al., Science 241, 1077 (1988)); self-sustained sequence replication (SSR) (see, e.g., Guatelli et al., Proc. Nat. Acad. Sci. USA, 87, 1874 (1990)); and transcription amplification (see, e.g., Kwoh et al., Proc. Natl. Acad. Sci. USA 86, 1173 (1989)).
Many techniques are known in the state of the art for determining absolute and relative levels of gene expression, commonly used techniques suitable for use in the present invention include Northern analysis, RNase protection assays (RPA), microarrays and PCR- based techniques, such as quantitative PCR and differential display PCR. For example, Northern blotting involves running a preparation of RNA on a denaturing agarose gel, and transferring it to a suitable support, such as activated cellulose, nitrocellulose or glass or nylon membranes. Radiolabeled cDNA or RNA is then hybridized to the preparation, washed and analyzed by autoradiography.
In situ hybridization visualization may also be employed, wherein a radioactively labeled antisense RNA probe is hybridized with a thin section of a biopsy sample, washed, cleaved with RNase and exposed to a sensitive emulsion for autoradiography. The samples may be stained with hematoxylin to demonstrate the histological composition of the sample, and dark field imaging with a suitable light filter shows the developed emulsion. Non-radioactive labels such as digoxigenin may also be used.
Alternatively, mRNA expression can be detected on a DNA array, chip or a microarray. Labeled nucleic acids of a test sample obtained from a subject may be hybridized to a solid surface comprising biomarker DNA. Positive hybridization signal is obtained with the sample containing biomarker transcripts. Methods of preparing DNA arrays and their use are well known in the art (see, e.g., U.S. Pat. Nos: 6,618,6796;
6,379,897; 6,664,377; 6,451,536; 548,257; U.S. 20030157485 and Schena et al. (1995)
Science 20, 467-470; Gerhold et al. (1999) Trends In Biochem. Sci. 24, 168-173; and Lennon et al. (2000) Drug Discovery Today 5, 59-65, which are herein incorporated by reference in their entirety). Serial Analysis of Gene Expression (SAGE) can also be performed (See for example U.S. Patent Application 20030215858).
To monitor mRNA levels, for example, mRNA is extracted from the biological sample to be tested, reverse transcribed, and fluorescently-labeled cDNA probes are generated. The microarrays capable of hybridizing to marker cDNA are then probed with the labeled cDNA probes, the slides scanned and fluorescence intensity measured. This intensity correlates with the hybridization intensity and expression levels.
Types of probes that can be used in the methods described herein include cDNA, riboprobes, synthetic oligonucleotides and genomic probes. The type of probe used will generally be dictated by the particular situation, such as riboprobes for in situ hybridization, and cDNA for Northern blotting, for example. In one embodiment, the probe is directed to nucleotide regions unique to the RNA. The probes may be as short as is required to differentially recognize marker mRNA transcripts, and may be as short as, for example, 15 bases; however, probes of at least 17, 18, 19 or 20 or more bases can be used. In one embodiment, the primers and probes hybridize specifically under stringent conditions to a DNA fragment having the nucleotide sequence corresponding to the marker. As herein used, the term "stringent conditions" means hybridization will occur only if there is at least 95% identity in nucleotide sequences. In another embodiment, hybridization under
"stringent conditions" occurs when there is at least 97% identity between the sequences.
The form of labeling of the probes may be any that is appropriate, such as the use of radioisotopes, for example, 32P and 35S. Labeling with radioisotopes may be achieved, whether the probe is synthesized chemically or biologically, by the use of suitably labeled bases.
In one embodiment, the biological sample contains polypeptide molecules from the test subject. Alternatively, the biological sample can contain mRNA molecules from the test subject or genomic DNA molecules from the test subject.
In another embodiment, the methods further involve obtaining a control biological sample from a control subject, contacting the control sample with a compound or agent capable of detecting marker polypeptide, mRNA, genomic DNA, or fragments thereof, such that the presence of the marker polypeptide, mRNA, genomic DNA, or fragments thereof, is detected in the biological sample, and comparing the presence of the marker polypeptide,
mRNA, genomic DNA, or fragments thereof, in the control sample with the presence of the marker polypeptide, mRNA, genomic DNA, or fragments thereof in the test sample,
c. Methods for Detection of Biomarker Protein Expression
The activity or level of a biomarker protein can be detected and/or quantified by detecting or quantifying the expressed polypeptide. The polypeptide can be detected and quantified by any of a number of means well known to those of skill in the art. Aberrant levels of polypeptide expression of the polypeptides encoded by a biomarker nucleic acid and functionally similar homologs thereof, including a fragment or genetic alteration thereof (e.g., in regulatory or promoter regions thereof) are associated with the likelihood of response of a cancer to PI3K/mTOR combination inhibitor therapy. Any method known in the art for detecting polypeptides can be used. Such methods include, but are not limited to, immunodiffusion, Immunoelectrophoresis, radioimmunoassay (RIA), enzyme-linked immunosorbent assays (ELISAs), immunofluorescent assays, Western blotting, binder- ligand assays, immunohistochemical techniques, agglutination, complement assays, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography, and the like (e.g., Basic and Clinical Immunology, Sites and Terr, eds., Appleton and Lange, Norwalk, Conn, pp 217-262, 1991 which is
incorporated by reference). Preferred are binder-ligand immunoassay methods including reacting antibodies with an epitope or epitopes and competitively displacing a labeled polypeptide or derivative thereof.
For example, ELISA and RIA procedures may be conducted such that a desired biomarker protein standard is labeled (with a radioisotope such as 125I or 35S, or an assayable enzyme, such as horseradish peroxidase or alkaline phosphatase), and, together with the unlabeled sample, brought into contact with the corresponding antibody, whereon a second antibody is used to bind the first, and radioactivity or the immobilized enzyme assayed (competitive assay). Alternatively, the biomarker protein in the sample is allowed to react with the corresponding immobilized antibody, radioisotope- or enzyme-labeled anti-biomarker protein antibody is allowed to react with the system, and radioactivity or the enzyme assayed (ELISA-sandwich assay). Other conventional methods may also be employed as suitable.
The above techniques may be conducted essentially as a "one-step" or "two-step" assay. A "one-step" assay involves contacting antigen with immobilized antibody and, without washing, contacting the mixture with labeled antibody. A "two-step" assay
involves washing before contacting, the mixture with labeled antibody. Other conventional methods may also be employed as suitable.
In one embodiment, a method for measuring biomarker protein levels comprises the steps of: contacting a biological specimen with an antibody or variant (e.g., fragment) thereof which selectively binds the biomarker protein, and detecting whether said antibody or variant thereof is bound to said sample and thereby measuring the levels of the biomarker protein.
Enzymatic and radiolabeling of biomarker protein and/or the antibodies may be effected by conventional means. Such means will generally include covalent linking of the enzyme to the antigen or the antibody in question, such as by glutaraldehyde, specifically so as not to adversely affect the activity of the enzyme, by which is meant that the enzyme must still be capable of interacting with its substrate, although it is not necessary for all of the enzyme to be active, provided that enough remains active to permit the assay to be effected. Indeed, some techniques for binding enzyme are non-specific (such as using formaldehyde), and will only yield a proportion of active enzyme.
It is usually desirable to immobilize one component of the assay system on a support, thereby allowing other components of the system to be brought into contact with the component and readily removed without laborious and time-consuming labor. It is possible for a second phase to be immobilized away from the first, but one phase is usually sufficient.
It is possible to immobilize the enzyme itself on a support, but if solid-phase enzyme is required, then this is generally best achieved by binding to antibody and affixing the antibody to a support, models and systems for which are well-known in the art. Simple polyethylene may provide a suitable support.
Enzymes employable for labeling are not particularly limited, but may be selected from the members of the oxidase group, for example. These catalyze production of hydrogen peroxide by reaction with their substrates, and glucose oxidase is often used for its good stability, ease of availability and cheapness, as well as the ready availability of its substrate (glucose). Activity of the oxidase may be assayed by measuring the concentration of hydrogen peroxide formed after reaction of the enzyme-labeled antibody with the substrate under controlled conditions well-known in the art.
Other techniques may be used to detect biomarker protein according to a practitioner's preference based upon the present disclosure. One such technique is Western
blotting (Towbin et at., Proc. Nat. Acad. Sci. 76:4350 (1979)), wherein a suitably treated sample is run on an SDS-PAGE gel before being transferred to a solid support, such as a nitrocellulose filter. Anti-biomarker protein antibodies (unlabeled) are then brought into contact with the support and assayed by a secondary immunological reagent, such as labeled protein A or anti-immunoglobulin (suitable labels including 125I, horseradish peroxidase and alkaline phosphatase). Chromatographic detection may also be used.
Immunohistochemistry may be used to detect expression of biomarker protein, e.g., in a biopsy sample. A suitable antibody is brought into contact with, for example, a thin layer of cells, washed, and then contacted with a second, labeled antibody. Labeling may be by fluorescent markers, enzymes, such as peroxidase, avidin, or radiolabeling. The assay is scored visually, using microscopy.
Anti-biomarker protein antibodies, such as intrabodies, may also be used for imaging purposes, for example, to detect the presence of biomarker protein in cells and tissues of a subject. Suitable labels include radioisotopes, iodine (125I, 121I), carbon (14C), sulphur (35S), tritium (3H), indium (112In), and technetium (99mTc), fluorescent labels, such as fluorescein and rhodamine, and biotin.
For in vivo imaging purposes, antibodies are not detectable, as such, from outside the body, and so must be labeled, or otherwise modified, to permit detection. Markers for this purpose may be any that do not substantially interfere with the antibody binding, but which allow external detection. Suitable markers may include those that may be detected by X-radiography, NMR or MRI. For X-radiographic techniques, suitable markers include any radioisotope that emits detectable radiation but that is not overtly harmful to the subject, such as barium or cesium, for example. Suitable markers for NMR and MRI generally include those with a detectable characteristic spin, such as deuterium, which may be incorporated into the antibody by suitable labeling of nutrients for the relevant hybridoma, for example.
The size of the subject, and the imaging system used, will determine the quantity of imaging moiety needed to produce diagnostic images. In the case of a radioisotope moiety, for a human subject, the quantity of radioactivity injected will normally range from about 5 to 20 millicuries of technetium-99. The labeled antibody or antibody fragment will then preferentially accumulate at the location of cells which contain biomarker protein. The labeled antibody or antibody fragment can then be detected using known techniques.
Antibodies that may be used to detect biomarker protein include any antibody, whether natural or synthetic, full length or a fragment thereof, monoclonal or polyclonal, that binds sufficiently strongly and specifically to the biomarker protein to be detected. An antibody may have a Kd of at most about 10"6M, 10"7M, 10"8M, 10"9M, 10-10M, 10-UM, 10" 12M. The phrase "specifically binds" refers to binding of, for example, an antibody to an epitope or antigen or antigenic determinant in such a manner that binding can be displaced or competed with a second preparation of identical or similar epitope, antigen or antigenic determinant. An antibody may bind preferentially to the biomarker protein relative to other proteins, such as related proteins.
Antibodies are commercially available or may be prepared according to methods known in the art.
Antibodies and derivatives thereof that may be used encompass polyclonal or monoclonal antibodies, chimeric, human, humanized, primatized (CDR-grafted), veneered or single-chain antibodies as well as functional fragments, i.e., biomarker protein binding fragments, of antibodies. For example, antibody fragments capable of binding to a biomarker protein or portions thereof, including, but not limited to, Fv, Fab, Fab' and F(ab') 2 fragments can be used. Such fragments can be produced by enzymatic cleavage or by recombinant techniques. For example, papain or pepsin cleavage can generate Fab or F(ab') 2 fragments, respectively. Other proteases with the requisite substrate specificity can also be used to generate Fab or F(ab') 2 fragments. Antibodies can also be produced in a variety of truncated forms using antibody genes in which one or more stop codons have been introduced upstream of the natural stop site. For example, a chimeric gene encoding a F(ab') 2 heavy chain portion can be designed to include DNA sequences encoding the CH, domain and hinge region of the heavy chain.
Synthetic and engineered antibodies are described in, e.g. , Cabilly et al., U.S. Pat.
No. 4,816,567 Cabilly et al., European Patent No. 0, 125,023 B l ; Boss et al., U. S. Pat. No. 4,816,397; Boss et al., European Patent No. 0, 120,694 B l ; Neuberger, M. S. et al., WO 86/01533; Neuberger, M. S. et al., European Patent No. 0, 194,276 B l ; Winter, U. S. Pat. No. 5,225,539; Winter, European Patent No. 0,239,400 B l ; Queen et al., European Patent No. 0451216 B l ; and Padlan, E. A. et al., EP 0519596 Al . See also, Newman, R. et al., BioTechnology, 10: 1455-1460 (1992), regarding primatized antibody, and Ladner et al., U. S. Pat. No. 4,946,778 and Bird, R. E. et al., Science, 242: 423-426 (1988)) regarding single-chain antibodies. Antibodies produced from a library, e.g. , phage display library,
may also be used.
In some embodiments, agents that specifically bind to a biomarker protein other than antibodies are used, such as peptides. Peptides that specifically bind to a biomarker protein can be identified by any means known in the art. For example, specific peptide binders of a biomarker protein can be screened for using peptide phage display libraries, d. Methods for Detection of Biomarker Structural Alterations
The following illustrative methods can be used to identify the presence of a structural alteration in a biomarker nucleic acid and/or biomarker polypeptide molecule in order to, for example, identify PBK/mTOR pathway proteins that are overexpressed, overfunctional, and the like.
In certain embodiments, detection of the alteration involves the use of a
probe/primer in a polymerase chain reaction (PCR) (see, e.g., U.S. Pat. Nos. 4,683, 195 and 4,683,202), such as anchor PCR or RACE PCR, or, alternatively, in a ligation chain reaction (LCR) (see, e.g., Landegran et al. (1988) Science 241 : 1077-1080; and Nakazawa et al. (1994) Proc. Natl. Acad. Sci. USA 91 :360-364), the latter of which can be particularly useful for detecting point mutations in a biomarker nucleic acid such as a biomarker gene (see Abravaya et al. (1995) Nucleic Acids Res. 23 :675-682). This method can include the steps of collecting a sample of cells from a subject, isolating nucleic acid {e.g., genomic, mRNA or both) from the cells of the sample, contacting the nucleic acid sample with one or more primers which specifically hybridize to a biomarker gene under conditions such that hybridization and amplification of the biomarker gene (if present) occurs, and detecting the presence or absence of an amplification product, or detecting the size of the amplification product and comparing the length to a control sample. It is anticipated that PCR and/or LCR may be desirable to use as a preliminary amplification step in conjunction with any of the techniques used for detecting mutations described herein.
Alternative amplification methods include: self-sustained sequence replication (Guatelli, J. C. et al. (1990) Proc. Natl. Acad. Sci. USA 87: 1874-1878), transcriptional amplification system (Kwoh, D. Y. et al. (1989) Proc. Natl. Acad. Sci. USA 86: 1173-1177), Q-Beta Replicase (Lizardi, P. M. et al. (1988) Bio-Technology 6: 1197), or any other nucleic acid amplification method, followed by the detection of the amplified molecules using techniques well known to those of skill in the art. These detection schemes are especially useful for the detection of nucleic acid molecules if such molecules are present in very low numbers.
In an alternative embodiment, mutations in a biomarker nucleic acid from a sample cell can be identified by alterations in restriction enzyme cleavage patterns. For example, sample and control DNA is isolated, amplified (optionally), digested with one or more restriction endonucleases, and fragment length sizes are determined by gel electrophoresis and compared. Differences in fragment length sizes between sample and control DNA indicates mutations in the sample DNA. Moreover, the use of sequence specific ribozymes (see, for example, U.S. Pat. No. 5,498,531) can be used to score for the presence of specific mutations by development or loss of a ribozyme cleavage site.
In other embodiments, genetic mutations in biomarker nucleic acid can be identified by hybridizing a sample and control nucleic acids, e.g., DNA or RNA, to high density arrays containing hundreds or thousands of oligonucleotide probes (Cronin, M. T. et al. (1996) Hum. Mutat. 7:244-255; Kozal, M. J. et al. (1996) Nat. Med. 2:753-759). For example, biomarker genetic mutations can be identified in two dimensional arrays containing light-generated DNA probes as described in Cronin et al. (1996) supra. Briefly, a first hybridization array of probes can be used to scan through long stretches of DNA in a sample and control to identify base changes between the sequences by making linear arrays of sequential, overlapping probes. This step allows the identification of point mutations. This step is followed by a second hybridization array that allows the characterization of specific mutations by using smaller, specialized probe arrays complementary to all variants or mutations detected. Each mutation array is composed of parallel probe sets, one complementary to the wild-type gene and the other complementary to the mutant gene. Such biomarker genetic mutations can be identified in a variety of contexts, including, for example, germline and somatic mutations.
In yet another embodiment, any of a variety of sequencing reactions known in the art can be used to directly sequence a biomarker gene and detect mutations by comparing the sequence of the sample biomarker with the corresponding wild-type (control) sequence. Examples of sequencing reactions include those based on techniques developed by Maxam and Gilbert (1977) Proc. Natl. Acad. Sci. USA 74:560 or Sanger (1977) Proc. Natl. Acad Sci. USA 74:5463. It is also contemplated that any of a variety of automated sequencing procedures can be utilized when performing the diagnostic assays (Naeve (1995)
Biotechniques 19:448-53), including sequencing by mass spectrometry (see, e.g., PCT International Publication No. WO 94/16101; Cohen et al. (1996) Adv. Chromatogr. 36: 127- 162; and Griffin et al. (1993) Appl. Biochem. Biotechnol. 38: 147-159).
- I l l -
Other methods for detecting mutations in a biomarker gene include methods in which protection from cleavage agents is used to detect mismatched bases in RNA/RNA or RNA/DNA heteroduplexes (Myers et al. (1985) Science 230: 1242). In general, the art technique of "mismatch cleavage" starts by providing heteroduplexes formed by
hybridizing (labeled) RNA or DNA containing the wild-type biomarker sequence with potentially mutant RNA or DNA obtained from a tissue sample. The double-stranded duplexes are treated with an agent which cleaves single-stranded regions of the duplex such as which will exist due to base pair mismatches between the control and sample strands. For instance, RNA/DNA duplexes can be treated with RNase and DNA/DNA hybrids treated with SI nuclease to enzymatically digest the mismatched regions. In other embodiments, either DNA/DNA or RNA/DNA duplexes can be treated with hydroxylamine or osmium tetroxide and with piperidine in order to digest mismatched regions. After digestion of the mismatched regions, the resulting material is then separated by size on denaturing polyacrylamide gels to determine the site of mutation. See, for example, Cotton et al. (1988) Proc. Natl. Acad. Sci. USA 85:4397 and Saleeba et al. (1992) Methods Enzymol. 217:286-295. In a preferred embodiment, the control DNA or RNA can be labeled for detection.
In still another embodiment, the mismatch cleavage reaction employs one or more proteins that recognize mismatched base pairs in double-stranded DNA (so called "DNA mismatch repair" enzymes) in defined systems for detecting and mapping point mutations in biomarker cDNAs obtained from samples of cells. For example, the mutY enzyme of E. coli cleaves A at G/A mismatches and the thymidine DNA glycosylase from HeLa cells cleaves T at G/T mismatches (Hsu et al. (1994) Carcinogenesis 15: 1657-1662). According to an exemplary embodiment, a probe based on a biomarker sequence, e.g., a wild-type biomarker treated with a DNA mismatch repair enzyme, and the cleavage products, if any, can be detected from electrophoresis protocols or the like (e.g., U.S. Pat. No. 5,459,039.)
In other embodiments, alterations in electrophoretic mobility can be used to identify mutations in biomarker genes. For example, single strand conformation polymorphism (SSCP) may be used to detect differences in electrophoretic mobility between mutant and wild type nucleic acids (Orita et al. (1989) Proc Natl. Acad. Sci USA 86:2766; see also
Cotton (1993) Mutat. Res. 285: 125-144 and Hayashi (1992) Genet. Anal. Tech. Appl. 9:73- 79). Single-stranded DNA fragments of sample and control biomarker nucleic acids will be denatured and allowed to renature. The secondary structure of single-stranded nucleic acids
varies according to sequence, the resulting alteration in electrophoretic mobility enables the detection of even a single base change. The DNA fragments may be labeled or detected with labeled probes. The sensitivity of the assay may be enhanced by using RNA (rather than DNA), in which the secondary structure is more sensitive to a change in sequence. In a preferred embodiment, the subject method utilizes heteroduplex analysis to separate double stranded heteroduplex molecules on the basis of changes in electrophoretic mobility (Keen et al. (1991) Trends Genet. 7:5).
In yet another embodiment the movement of mutant or wild-type fragments in polyacrylamide gels containing a gradient of denaturant is assayed using denaturing gradient gel electrophoresis (DGGE) (Myers et al. (1985) Nature 313 :495). When DGGE is used as the method of analysis, DNA will be modified to ensure that it does not completely denature, for example by adding a GC clamp of approximately 40 bp of high- melting GC-rich DNA by PCR. In a further embodiment, a temperature gradient is used in place of a denaturing gradient to identify differences in the mobility of control and sample DNA (Rosenbaum and Reissner (1987) Biophys. Chem. 265: 12753).
Examples of other techniques for detecting point mutations include, but are not limited to, selective oligonucleotide hybridization, selective amplification, or selective primer extension. For example, oligonucleotide primers may be prepared in which the known mutation is placed centrally and then hybridized to target DNA under conditions which permit hybridization only if a perfect match is found (Saiki et al. (1986) Nature 324: 163; Saiki et al. (1989) Proc. Natl. Acad. Sci. USA 86:6230). Such allele specific oligonucleotides are hybridized to PCR amplified target DNA or a number of different mutations when the oligonucleotides are attached to the hybridizing membrane and hybridized with labeled target DNA.
Alternatively, allele specific amplification technology which depends on selective
PCR amplification may be used in conjunction with the instant invention. Oligonucleotides used as primers for specific amplification may carry the mutation of interest in the center of the molecule (so that amplification depends on differential hybridization) (Gibbs et al. (1989) Nucleic Acids Res. 17:2437-2448) or at the extreme 3' end of one primer where, under appropriate conditions, mismatch can prevent, or reduce polymerase extension (Prossner (1993) Tibtech 11 :238). In addition it may be desirable to introduce a novel restriction site in the region of the mutation to create cleavage-based detection (Gasparini et al. (1992) Mol. Cell Probes 6: 1). It is anticipated that in certain embodiments amplification
may also be performed using Taq ligase for amplification (Barany (1991) Proc. Natl. Acad. Sci USA 88: 189). In such cases, ligation will occur only if there is a perfect match at the 3' end of the 5' sequence making it possible to detect the presence of a known mutation at a specific site by looking for the presence or absence of amplification.
3. Anti-Cancer Therapies
The efficacy of PI3K/mTOR combination inhibitor therapy is predicted according to biomarker amount and/or activity associated with a brain metastasis in a subject according to the methods described herein. In one embodiment, such PI3K/mTOR combination inhibitor therapy or combinations of therapies (e.g., one or more PI3K/mTOR combination inhibitors in combination with one or more additional anti-cancer therapies, such as an immune checkpoint inhibitor) can be administered, particularly if a subject has first been indicated as being a likely responder to PI3K/mTOR combination inhibitor therapy. In another embodiment, such PI3K/mTOR combination inhibitor therapy can be avoided once a subject is indicated as not being a likely responder to PI3K/mTOR combination inhibitor therapy and an alternative treatment regimen, such as targeted and/or untargeted anti-cancer therapies can be administered. Combination therapies are also contemplated and can comprise, for example, one or more chemotherapeutic agents and radiation, one or more chemotherapeutic agents and immunotherapy, or one or more chemotherapeutic agents, radiation and chemotherapy, each combination of which can be with anti-immune checkpoint therapy.
The term "targeted therapy" refers to administration of agents that selectively interact with a chosen biomolecule to thereby treat cancer. One example includes immune checkpoint inhibitors, which are well-known in the art. For example, anti-PD-1 pathway agents, such as therapeutic monoclonal blocking antibodies, which are well-known in the art and described above, can be used to target tumor microenvironments and cells expressing unwanted components of the PD-1 pathway, such as PD-1, PD-L1, and/or PD- L2.
For example, the term "PD-1 pathway" refers to the PD-1 receptor and its ligands, PD-L1 and PD-L2. "PI3K/mTOR combination inhibitors" block or otherwise reduce the interaction between PD-1 and one or both of its ligands such that the immunoinhibitory signaling otherwise generated by the interaction is blocked or otherwise reduced. Anti- immune checkpoint inhibitors can be direct or indirect. Direct anti-immune checkpoint
inhibitors block or otherwise reduce the interaction between an immune checkpoint and at least one of its ligands. For example, PD-1 inhibitors can block PD-1 binding with one or both of its ligands. Direct PD-1 combination inhibitors are well known in the art, especially since the natural binding partners of PD-1 (e.g., PD-Ll and PD-L2), PD-Ll (e.g., PD-1 and B7-1), and PD-L2 (e.g., PD-1 and RGMb) are known.
For example, agents which directly block the interaction between PD-1 and PD-Ll, PD-1 and PD-L2, PD-1 and both PD-Ll and PD-L2, such as a bispecific antibody, can prevent inhibitory signaling and upregulate an immune response (i.e., as a PD-1 pathway inhibitor). Alternatively, agents that indirectly block the interaction between PD-1 and one or both of its ligands can prevent inhibitory signaling and upregulate an immune response. For example, B7-1 or a soluble form thereof, by binding to a PD-Ll polypeptide indirectly reduces the effective concentration of PD-Ll polypeptide available to bind to PD-1.
Exemplary agents include monospecific or bispecific blocking antibodies against PD-1, PD-Ll, and/or PD-L2 that block the interaction between the receptor and ligand(s); a non- activating form of PD-1, PD-Ll, and/or PD-L2 (e.g., a dominant negative or soluble polypeptide), small molecules or peptides that block the interaction between PD-1, PD-Ll, and/or PD-L2; fusion proteins (e.g. the extracellular portion of PD-1, PD-Ll, and/or PD-L2, fused to the Fc portion of an antibody or immunoglobulin) that bind to PD-1, PD-Ll, and/or PD-L2 and inhibit the interaction between the receptor and ligand(s); a non-activating form of a natural PD- 1 , PD-L2, and/or PD-L2 ligand, and a soluble form of a natural PD- 1 , PD- L2, and/or PD-L2 ligand.
Indirect anti-immune checkpoint inhibitors block or otherwise reduce the immunoinhibitory signaling generated by the interaction between the immune checkpoint and at least one of its ligands. For example, an inhibitor can block the interaction between PD-1 and one or both of its ligands without necessarily directly blocking the interaction between PD-1 and one or both of its ligands. For example, indirect inhibitors include intrabodies that bind the intracellular portion of PD-1 and/or PD-Ll required to signal to block or otherwise reduce the immunoinhibitory signaling. Similarly, nucleic acids that reduce the expression of PD-1, PD-Ll, and/or PD-L2 can indirectly inhibit the interaction between PD-1 and one or both of its ligands by removing the availability of components for interaction. Such nucleic acid molecules can block PD-Ll, PD-L2, and/or PD-L2 transcription or translation.
Alternatively, immunotherapy is one form of targeted therapy that may comprise, for example, the use of cancer vaccines and/or sensitized antigen presenting cells. For example, an oncolytic virus is a virus that is able to infect and lyse cancer cells, while leaving normal cells unharmed, making them potentially useful in cancer therapy.
Replication of oncolytic viruses both facilitates tumor cell destruction and also produces dose amplification at the tumor site. They may also act as vectors for anticancer genes, allowing them to be specifically delivered to the tumor site. The immunotherapy can involve passive immunity for short-term protection of a host, achieved by the
administration of pre-formed antibody directed against a cancer antigen or disease antigen (e.g., administration of a monoclonal antibody, optionally linked to a chemotherapeutic agent or toxin, to a tumor antigen). Immunotherapy can also focus on using the cytotoxic lymphocyte-recognized epitopes of cancer cell lines. Alternatively, anti sense
polynucleotides, ribozymes, RNA interference molecules, triple helix polynucleotides and the like, can be used to selectively modulate biomolecules that are linked to the initiation, progression, and/or pathology of a tumor or cancer.
The term "untargeted therapy" refers to administration of agents that do not selectively interact with a chosen biomolecule yet treat cancer. Representative examples of untargeted therapies include, without limitation, chemotherapy, gene therapy, and radiation therapy.
In one embodiment, chemotherapy is used. Chemotherapy includes the
administration of a chemotherapeutic agent. Such a chemotherapeutic agent may be, but is not limited to, those selected from among the following groups of compounds: platinum compounds, cytotoxic antibiotics, antimetabolites, anti-mitotic agents, alkylating agents, arsenic compounds, DNA topoisomerase inhibitors, taxanes, nucleoside analogues, plant alkaloids, and toxins; and synthetic derivatives thereof. Exemplary compounds include, but are not limited to, alkylating agents: cisplatin, treosulfan, and trofosfamide; plant alkaloids: vinblastine, paclitaxel, docetaxol; DNA topoisomerase inhibitors: teniposide, crisnatol, and mitomycin; anti -folates: methotrexate, mycophenolic acid, and hydroxyurea; pyrimidine analogs: 5-fluorouracil, doxifluridine, and cytosine arabinoside; purine analogs:
mercaptopurine and thioguanine; DNA antimetabolites: 2'-deoxy-5-fluorouridine, aphidicolin glycinate, and pyrazoloimidazole; and antimitotic agents: halichondrin, colchicine, and rhizoxin. Compositions comprising one or more chemotherapeutic agents (e.g., FLAG, CHOP) may also be used. FLAG comprises fludarabine, cytosine arabinoside
(Ara-C) and G-CSF. CHOP comprises cyclophosphamide, vincristine, doxorubicin, and prednisone. In another embodiments, PARP (e.g., PARP-1 and/or PARP-2) inhibitors are used and such inhibitors are well known in the art (e.g., Olaparib, ABT-888, BSI-201, BGP-15 (N-Gene Research Laboratories, Inc.); INO-1001 (Inotek Pharmaceuticals Inc.); PJ34 (Soriano et al., 2001; Pacher et al., 2002b); 3-aminobenzamide (Trevigen); 4-amino- 1,8-naphthalimide; (Trevigen); 6(5H)-phenanthridinone (Trevigen); benzamide (U.S. Pat. Re. 36,397); and NU1025 (Bowman et al.). The mechanism of action is generally related to the ability of PARP inhibitors to bind PARP and decrease its activity. PARP catalyzes the conversion of .beta. -nicotinamide adenine dinucleotide (NAD+) into nicotinamide and poly- ADP-ribose (PAR). Both poly (ADP-ribose) and PARP have been linked to regulation of transcription, cell proliferation, genomic stability, and carcinogenesis
(Bouchard V. J. et.al. Experimental Hematology, Volume 31, Number 6, June 2003, pp. 446-454(9); Herceg Z.; Wang Z.-Q. Mutation Research/Fundamental and Molecular Mechanisms of Mutagenesis, Volume 477, Number 1, 2 Jun. 2001, pp. 97-110(14)).
Poly(ADP-ribose) polymerase 1 (PARPl) is a key molecule in the repair of DNA single- strand breaks (SSBs) (de Murcia J. et al. 1997. Proc Natl Acad Sci USA 94:7303-7307; Schreiber V, Dantzer F, Ame J C, de Murcia G (2006) Nat Rev Mol Cell Biol 7:517-528; Wang Z Q, et al. (1997) Genes Dev 11 :2347-2358). Knockout of SSB repair by inhibition of PARPl function induces DNA double-strand breaks (DSBs) that can trigger synthetic lethality in cancer cells with defective homology-directed DSB repair (Bryant H E, et al. (2005) Nature 434:913-917; Farmer H, et al. (2005) Nature 434:917-921). The foregoing examples of chemotherapeutic agents are illustrative, and are not intended to be limiting.
In another embodiment, radiation therapy is used. The radiation used in radiation therapy can be ionizing radiation. Radiation therapy can also be gamma rays, X-rays, or proton beams. Examples of radiation therapy include, but are not limited to, external-beam radiation therapy, interstitial implantation of radioisotopes (1-125, palladium, iridium), radioisotopes such as strontium-89, thoracic radiation therapy, intraperitoneal P-32 radiation therapy, and/or total abdominal and pelvic radiation therapy. For a general overview of radiation therapy, see Hellman, Chapter 16: Principles of Cancer Management: Radiation Therapy, 6th edition, 2001, DeVita et al., eds., J. B. Lippencott Company, Philadelphia. The radiation therapy can be administered as external beam radiation or teletherapy wherein the radiation is directed from a remote source. The radiation treatment can also be administered as internal therapy or brachytherapy wherein a radioactive source
is placed inside the body close to cancer cells or a tumor mass. Also encompassed is the use of photodynamic therapy comprising the administration of photosensitizers, such as hematoporphyrin and its derivatives, Vertoporfin (BPD-MA), phthalocyanine,
photosensitizer Pc4, demethoxy-hypocrellin A; and 2B A-2-DMHA.
In another embodiment, surgical intervention can occur to physically remove cancerous cells and/or tissues.
In still another embodiment, hormone therapy is used. Hormonal therapeutic treatments can comprise, for example, hormonal agonists, hormonal antagonists (e.g., flutamide, bicalutamide, tamoxifen, raloxifene, leuprolide acetate (LUPRON), LH-RH antagonists), inhibitors of hormone biosynthesis and processing, and steroids (e.g., dexamethasone, retinoids, deltoids, betamethasone, Cortisol, cortisone, prednisone, dehydrotestosterone, glucocorticoids, mineralocorticoids, estrogen, testosterone, progestins), vitamin A derivatives (e.g., all-trans retinoic acid (ATRA)); vitamin D3 analogs; antigestagens (e.g., mifepristone, onapristone), or antiandrogens (e.g., cyproterone acetate).
In yet another embodiment, hyperthermia, a procedure in which body tissue is exposed to high temperatures (up to 106°F.) is used. Heat may help shrink tumors by damaging cells or depriving them of substances they need to live. Hyperthermia therapy can be local, regional, and whole-body hyperthermia, using external and internal heating devices. Hyperthermia is almost always used with other forms of therapy (e.g., radiation therapy, chemotherapy, and biological therapy) to try to increase their effectiveness. Local hyperthermia refers to heat that is applied to a very small area, such as a tumor. The area may be heated externally with high-frequency waves aimed at a tumor from a device outside the body. To achieve internal heating, one of several types of sterile probes may be used, including thin, heated wires or hollow tubes filled with warm water; implanted microwave antennae; and radiofrequency electrodes. In regional hyperthermia, an organ or a limb is heated. Magnets and devices that produce high energy are placed over the region to be heated. In another approach, called perfusion, some of the patient's blood is removed, heated, and then pumped (perfused) into the region that is to be heated internally. Whole- body heating is used to treat metastatic cancer that has spread throughout the body. It can be accomplished using warm-water blankets, hot wax, inductive coils (like those in electric blankets), or thermal chambers (similar to large incubators). Hyperthermia does not cause any marked increase in radiation side effects or complications. Heat applied directly to the
skin, however, can cause discomfort or even significant local pain in about half the patients treated. It can also cause blisters, which generally heal rapidly.
In still another embodiment, photodynamic therapy (also called PDT, photoradiation therapy, phototherapy, or photochemotherapy) is used for the treatment of some types of cancer. It is based on the discovery that certain chemicals known as photosensitizing agents can kill one-celled organisms when the organisms are exposed to a particular type of light. PDT destroys cancer cells through the use of a fixed-frequency laser light in combination with a photosensitizing agent. In PDT, the photosensitizing agent is injected into the bloodstream and absorbed by cells all over the body. The agent remains in cancer cells for a longer time than it does in normal cells. When the treated cancer cells are exposed to laser light, the photosensitizing agent absorbs the light and produces an active form of oxygen that destroys the treated cancer cells. Light exposure must be timed carefully so that it occurs when most of the photosensitizing agent has left healthy cells but is still present in the cancer cells. The laser light used in PDT can be directed through a fiber- optic (a very thin glass strand). The fiber-optic is placed close to the cancer to deliver the proper amount of light. The fiber-optic can be directed through a bronchoscope into the lungs for the treatment of lung cancer or through an endoscope into the esophagus for the treatment of esophageal cancer. An advantage of PDT is that it causes minimal damage to healthy tissue. However, because the laser light currently in use cannot pass through more than about 3 centimeters of tissue (a little more than one and an eighth inch), PDT is mainly used to treat tumors on or just under the skin or on the lining of internal organs.
Photodynamic therapy makes the skin and eyes sensitive to light for 6 weeks or more after treatment. Patients are advised to avoid direct sunlight and bright indoor light for at least 6 weeks. If patients must go outdoors, they need to wear protective clothing, including sunglasses. Other temporary side effects of PDT are related to the treatment of specific areas and can include coughing, trouble swallowing, abdominal pain, and painful breathing or shortness of breath. In December 1995, the U.S. Food and Drug Administration (FDA) approved a photosensitizing agent called porfimer sodium, or Photofrin®, to relieve symptoms of esophageal cancer that is causing an obstruction and for esophageal cancer that cannot be satisfactorily treated with lasers alone. In January 1998, the FDA approved porfimer sodium for the treatment of early non-small cell lung cancer in patients for whom the usual treatments for lung cancer are not appropriate. The National Cancer Institute and other institutions are supporting clinical trials (research studies) to evaluate the use of
photodynamic therapy for several types of cancer, including cancers of the bladder, brain, larynx, and oral cavity.
In yet another embodiment, laser therapy is used to harness high-intensity light to destroy cancer cells. This technique is often used to relieve symptoms of cancer such as bleeding or obstruction, especially when the cancer cannot be cured by other treatments. It may also be used to treat cancer by shrinking or destroying tumors. The term "laser" stands for light amplification by stimulated emission of radiation. Ordinary light, such as that from a light bulb, has many wavelengths and spreads in all directions. Laser light, on the other hand, has a specific wavelength and is focused in a narrow beam. This type of high- intensity light contains a lot of energy. Lasers are very powerful and may be used to cut through steel or to shape diamonds. Lasers also can be used for very precise surgical work, such as repairing a damaged retina in the eye or cutting through tissue (in place of a scalpel). Although there are several different kinds of lasers, only three kinds have gained wide use in medicine: Carbon dioxide (CO2) laser—This type of laser can remove thin layers from the skin's surface without penetrating the deeper layers. This technique is particularly useful in treating tumors that have not spread deep into the skin and certain precancerous conditions. As an alternative to traditional scalpel surgery, the CO2 laser is also able to cut the skin. The laser is used in this way to remove skin cancers.
Neodymium:yttrium-aluminum-garnet (Nd:YAG) laser— Light from this laser can penetrate deeper into tissue than light from the other types of lasers, and it can cause blood to clot quickly. It can be carried through optical fibers to less accessible parts of the body. This type of laser is sometimes used to treat throat cancers. Argon laser— This laser can pass through only superficial layers of tissue and is therefore useful in dermatology and in eye surgery. It also is used with light-sensitive dyes to treat tumors in a procedure known as photodynamic therapy (PDT). Lasers have several advantages over standard surgical tools, including: Lasers are more precise than scalpels. Tissue near an incision is protected, since there is little contact with surrounding skin or other tissue. The heat produced by lasers sterilizes the surgery site, thus reducing the risk of infection. Less operating time may be needed because the precision of the laser allows for a smaller incision. Healing time is often shortened; since laser heat seals blood vessels, there is less bleeding, swelling, or scarring. Laser surgery may be less complicated. For example, with fiber optics, laser light can be directed to parts of the body without making a large incision. More procedures may be done on an outpatient basis. Lasers can be used in two ways to treat cancer: by
shrinking or destroying a tumor with heat, or by activating a chemical—known as a photosensitizing agent—that destroys cancer cells. In PDT, a photosensitizing agent is retained in cancer cells and can be stimulated by light to cause a reaction that kills cancer cells. CO2 and Nd:YAG lasers are used to shrink or destroy tumors. They may be used with endoscopes, tubes that allow physicians to see into certain areas of the body, such as the bladder. The light from some lasers can be transmitted through a flexible endoscope fitted with fiber optics. This allows physicians to see and work in parts of the body that could not otherwise be reached except by surgery and therefore allows very precise aiming of the laser beam. Lasers also may be used with low-power microscopes, giving the doctor a clear view of the site being treated. Used with other instruments, laser systems can produce a cutting area as small as 200 microns in diameter— less than the width of a very fine thread. Lasers are used to treat many types of cancer. Laser surgery is a standard treatment for certain stages of glottis (vocal cord), cervical, skin, lung, vaginal, vulvar, and penile cancers. In addition to its use to destroy the cancer, laser surgery is also used to help relieve symptoms caused by cancer (palliative care). For example, lasers may be used to shrink or destroy a tumor that is blocking a patient's trachea (windpipe), making it easier to breathe. It is also sometimes used for palliation in colorectal and anal cancer. Laser- induced interstitial thermotherapy (LITT) is one of the most recent developments in laser therapy. LITT uses the same idea as a cancer treatment called hyperthermia; that heat may help shrink tumors by damaging cells or depriving them of substances they need to live. In this treatment, lasers are directed to interstitial areas (areas between organs) in the body. The laser light then raises the temperature of the tumor, which damages or destroys cancer cells.
The duration and/or dose of treatment with therapies may vary according to the particular therapeutic agent or combination thereof. An appropriate treatment time for a particular cancer therapeutic agent will be appreciated by the skilled artisan. The present invention contemplates the continued assessment of optimal treatment schedules for each cancer therapeutic agent, where the phenotype of the cancer of the subject as determined by the methods of the present invention is a factor in determining optimal treatment doses and schedules.
Any means for the introduction of a polynucleotide into mammals, human or non- human, or cells thereof may be adapted to the practice of this invention for the delivery of the various constructs of the present invention into the intended recipient. In one
embodiment of the present invention, the DNA constructs are delivered to cells by transfection, i.e., by delivery of "naked" DNA or in a complex with a colloidal dispersion system. A colloidal system includes macromolecule complexes, nanocapsules,
microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. The preferred colloidal system of this invention is a lipid- complexed or liposome-formulated DNA. In the former approach, prior to formulation of DNA, e.g., with lipid, a plasmid containing a transgene bearing the desired DNA constructs may first be experimentally optimized for expression {e.g., inclusion of an intron in the 5' untranslated region and elimination of unnecessary sequences (Feigner, et al., Ann NY Acad Sci 126-139, 1995). Formulation of DNA, e.g. with various lipid or liposome materials, may then be effected using known methods and materials and delivered to the recipient mammal. See, e.g., Canonico et al, Am J Respir Cell Mol Biol 10:24-29, 1994; Tsan et al, Am J Physiol 268; Alton et al., Nat Genet. 5: 135-142, 1993 and U.S. patent No. 5,679,647 by Carson et al.
The targeting of liposomes can be classified based on anatomical and mechanistic factors. Anatomical classification is based on the level of selectivity, for example, organ- specific, cell-specific, and organelle-specific. Mechanistic targeting can be distinguished based upon whether it is passive or active. Passive targeting utilizes the natural tendency of liposomes to distribute to cells of the reticulo-endothelial system (RES) in organs, which contain sinusoidal capillaries. Active targeting, on the other hand, involves alteration of the liposome by coupling the liposome to a specific ligand such as a monoclonal antibody, sugar, glycolipid, or protein, or by changing the composition or size of the liposome in order to achieve targeting to organs and cell types other than the naturally occurring sites of localization.
The surface of the targeted delivery system may be modified in a variety of ways.
In the case of a liposomal targeted delivery system, lipid groups can be incorporated into the lipid bilayer of the liposome in order to maintain the targeting ligand in stable association with the liposomal bilayer. Various linking groups can be used for joining the lipid chains to the targeting ligand. Naked DNA or DNA associated with a delivery vehicle, e.g., liposomes, can be administered to several sites in a subject (see below).
Nucleic acids can be delivered in any desired vector. These include viral or non- viral vectors, including adenovirus vectors, adeno-associated virus vectors, retrovirus vectors, lentivirus vectors, and plasmid vectors. Exemplary types of viruses include HSV
(herpes simplex virus), AAV (adeno associated virus), HIV (human immunodeficiency virus), BIV (bovine immunodeficiency virus), and MLV (murine leukemia virus). Nucleic acids can be administered in any desired format that provides sufficiently efficient delivery levels, including in virus particles, in liposomes, in nanoparticles, and complexed to polymers.
The nucleic acids encoding a protein or nucleic acid of interest may be in a plasmid or viral vector, or other vector as is known in the art. Such vectors are well known and any can be selected for a particular application. In one embodiment of the present invention, the gene delivery vehicle comprises a promoter and a demethylase coding sequence.
Preferred promoters are tissue-specific promoters and promoters which are activated by cellular proliferation, such as the thymidine kinase and thymidylate synthase promoters. Other preferred promoters include promoters which are activatable by infection with a virus, such as the a- and β-interferon promoters, and promoters which are activatable by a hormone, such as estrogen. Other promoters which can be used include the Moloney virus LTR, the CMV promoter, and the mouse albumin promoter. A promoter may be constitutive or inducible.
In another embodiment, naked polynucleotide molecules are used as gene delivery vehicles, as described in WO 90/11092 and U.S. Patent 5,580,859. Such gene delivery vehicles can be either growth factor DNA or RNA and, in certain embodiments, are linked to killed adenovirus. Curiel et al., Hum. Gene. Ther. 3 : 147-154, 1992. Other vehicles which can optionally be used include DNA-ligand (Wu et al., J. Biol. Chem.
264: 16985-16987, 1989), lipid-DNA combinations (Feigner et al., Proc. Natl. Acad. Sci. USA 84:7413 7417, 1989), liposomes (Wang et al., Proc. Natl. Acad. Sci. 84:7851-7855, 1987) and microprojectiles (Williams et al., Proc. Natl. Acad. Sci. 88:2726-2730, 1991).
A gene delivery vehicle can optionally comprise viral sequences such as a viral origin of replication or packaging signal. These viral sequences can be selected from viruses such as astrovirus, coronavirus, orthomyxovirus, papovavirus, paramyxovirus, parvovirus, picornavirus, poxvirus, retrovirus, togavirus or adenovirus. In a preferred embodiment, the growth factor gene delivery vehicle is a recombinant retroviral vector. Recombinant retroviruses and various uses thereof have been described in numerous references including, for example, Mann et al., Cell 33 : 153, 1983, Cane and Mulligan, Proc. Nat'l. Acad. Sci. USA 81 :6349, 1984, Miller et al., Human Gene Therapy 1 :5-14, 1990, U.S. Patent Nos. 4,405,712, 4,861,719, and 4,980,289, and PCT Application Nos.
WO 89/02,468, WO 89/05,349, and WO 90/02,806. Numerous retroviral gene delivery vehicles can be utilized in the present invention, including for example those described in EP 0,415,731; WO 90/07936; WO 94/03622; WO 93/25698; WO 93/25234; U.S. Patent No. 5,219,740; WO 9311230; WO 9310218; Vile and Hart, Cancer Res. 53 :3860-3864, 1993; Vile and Hart, Cancer Res. 53 :962-967, 1993; Ram et al., Cancer Res. 53 :83-88, 1993; Takamiya et al., J. Neurosci. Res. 33 :493-503, 1992; Baba et al., J. Neurosurg.
79:729-735, 1993 (U.S. Patent No. 4,777,127, GB 2,200,651, EP 0,345,242 and
WO91/02805).
Other viral vector systems that can be used to deliver a polynucleotide of the present invention have been derived from herpes virus, e.g., Herpes Simplex Virus (U.S. Patent No. 5,631,236 by Woo et al., issued May 20, 1997 and WO 00/08191 by Neurovex), vaccinia virus (Ridgeway (1988) Ridgeway, "Mammalian expression vectors," In: Rodriguez R L, Denhardt D T, ed. Vectors: A survey of molecular cloning vectors and their uses.
Stoneham: Butterworth,; Baichwal and Sugden (1986) "Vectors for gene transfer derived from animal DNA viruses: Transient and stable expression of transferred genes," In:
Kucherlapati R, ed. Gene transfer. New York: Plenum Press; Coupar et al. (1988) Gene, 68: 1-10), and several RNA viruses. Preferred viruses include an alphavirus, a poxivirus, an arena virus, a vaccinia virus, a polio virus, and the like. They offer several attractive features for various mammalian cells (Friedmann (1989) Science, 244: 1275-1281;
Ridgeway, 1988, supra; Baichwal and Sugden, 1986, supra; Coupar et al., 1988; Horwich et al.(1990) J.Virol., 64:642-650).
In other embodiments, target DNA in the genome can be manipulated using well- known methods in the art. For example, the target DNA in the genome can be manipulated by deletion, insertion, and/or mutation are retroviral insertion, artificial chromosome techniques, gene insertion, random insertion with tissue specific promoters, gene targeting, transposable elements and/or any other method for introducing foreign DNA or producing modified DNA/modified nuclear DNA. Other modification techniques include deleting DNA sequences from a genome and/or altering nuclear DNA sequences. Nuclear DNA sequences, for example, may be altered by site-directed mutagenesis.
In other embodiments, recombinant biomarker polypeptides, and fragments thereof, can be administered to subjects. In some embodiments, fusion proteins can be constructed and administered which have enhanced biological properties. In addition, the biomarker polypeptides, and fragment thereof, can be modified according to well-known
pharmacological methods in the art (e.g., pegylation, glycosylation, oligomerization, etc.) in order to further enhance desirable biological activities, such as increased bioavailability and decreased proteolytic degradation. 4. Clincal Efficacy
Clinical efficacy can be measured by any method known in the art. For example, the response to a therapy, such as PBK/mTOR combination inhibitor therapies, relates to any response of the cancer, e.g., a tumor, to the therapy, preferably to a change in tumor mass and/or volume after initiation of neoadjuvant or adjuvant chemotherapy. Tumor response may be assessed in a neoadjuvant or adjuvant situation where the size of a tumor after systemic intervention can be compared to the initial size and dimensions as measured by CT, PET, mammogram, ultrasound or palpation and the cellularity of a tumor can be estimated histologically and compared to the cellularity of a tumor biopsy taken before initiation of treatment. Response may also be assessed by caliper measurement or pathological examination of the tumor after biopsy or surgical resection. Response may be recorded in a quantitative fashion like percentage change in tumor volume or cellularity or using a semi -quantitative scoring system such as residual cancer burden (Symmans et al, J. Clin. Oncol. (2007) 25:4414-4422) or Miller-Payne score (Ogston et al, (2003) Breast (Edinburgh, Scotland) 12:320-327) in a qualitative fashion like "pathological complete response" (pCR), "clinical complete remission" (cCR), "clinical partial remission" (cPR), "clinical stable disease" (cSD), "clinical progressive disease" (cPD) or other qualitative criteria. Assessment of tumor response may be performed early after the onset of neoadjuvant or adjuvant therapy, e.g., after a few hours, days, weeks or preferably after a few months. A typical endpoint for response assessment is upon termination of
neoadjuvant chemotherapy or upon surgical removal of residual tumor cells and/or the tumor bed.
In some embodiments, clinical efficacy of the therapeutic treatments described herein may be determined by measuring the clinical benefit rate (CBR). The clinical benefit rate is measured by determining the sum of the percentage of patients who are in complete remission (CR), the number of patients who are in partial remission (PR) and the number of patients having stable disease (SD) at a time point at least 6 months out from the end of therapy. The shorthand for this formula is CBR=CR+PR+SD over 6 months. In some embodiments, the CBR for a particular anti-immune checkpoint therapeutic regimen
is at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or more.
Additional criteria for evaluating the response to anti-immune checkpoint therapies are related to "survival," which includes all of the following: survival until mortality, also known as overall survival (wherein said mortality may be either irrespective of cause or tumor related); "recurrence-free survival" (wherein the term recurrence shall include both localized and distant recurrence); metastasis free survival; disease free survival (wherein the term disease shall include cancer and diseases associated therewith). The length of said survival may be calculated by reference to a defined start point (e.g., time of diagnosis or start of treatment) and end point (e.g., death, recurrence or metastasis). In addition, criteria for efficacy of treatment can be expanded to include response to chemotherapy, probability of survival, probability of metastasis within a given time period, and probability of tumor recurrence.
For example, in order to determine appropriate threshold values, a particular anti- cancer therapeutic regimen can be administered to a population of subjects and the outcome can be correlated to biomarker measurements that were determined prior to administration of any anti-immune checkpoint therapy. The outcome measurement may be pathologic response to therapy given in the neoadjuvant setting. Alternatively, outcome measures, such as overall survival and disease-free survival can be monitored over a period of time for subjects following anti-immune checkpoint therapy for whom biomarker measurement values are known. In certain embodiments, the same doses of anti-immune checkpoint agents are administered to each subject. In related embodiments, the doses administered are standard doses known in the art for anti-immune checkpoint agents. The period of time for which subjects are monitored can vary. For example, subjects may be monitored for at least 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 25, 30, 35, 40, 45, 50, 55, or 60 months. Biomarker measurement threshold values that correlate to outcome of an anti-immune checkpoint therapy can be determined using methods such as those described in the Examples section.
5. Further Uses and Methods of the Present Invention
The compositions described herein can be used in a variety of diagnostic, prognostic, and therapeutic applications. In any method described herein, such as a diagnostic method, prognostic method, therapeutic method, or combination thereof, all steps of the method can be performed by a single actor or, alternatively, by more than one
actor. For example, diagnosis can be performed directly by the actor providing therapeutic treatment. Alternatively, a person providing a therapeutic agent can request that a diagnostic assay be performed. The diagnostician and/or the therapeutic interventionist can interpret the diagnostic assay results to determine a therapeutic strategy. Similarly, such alternative processes can apply to other assays, such as prognostic assays,
a. Screening Methods
One aspect of the present invention relates to screening assays, including non-cell based assays and xenograft animal model assays. In one embodiment, the assays provide a method for identifying whether a cancer is likely to respond to PI3K/mTOR combination inhibitor therapy, such as in a human by using a xenograft animal model assay, and/or whether an agent can inhibit the growth of or kill a cancer cell that is unlikely to respond to PI3K/mTOR combination inhibitor therapy.
In one embodiment, the present invention relates to assays for screening test agents which bind to, or modulate the biological activity of, at least one biomarker described herein (e.g., in the tables, figures, examples, or otherwise in the specification). In one embodiment, a method for identifying such an agent entails determining the ability of the agent to modulate, e.g. inhibit, the at least one biomarker described herein.
In one embodiment, an assay is a cell-free or cell-based assay, comprising contacting at least one biomarker described herein, with a test agent, and determining the ability of the test agent to modulate (e.g., inhibit) the enzymatic activity of the biomarker, such as by measuring direct binding of substrates or by measuring indirect parameters as described below.
For example, in a direct binding assay, biomarker protein (or their respective target polypeptides or molecules) can be coupled with a radioisotope or enzymatic label such that binding can be determined by detecting the labeled protein or molecule in a complex. For example, the targets can be labeled with 1251, 35 S, 14C, or 3H, either directly or indirectly, and the radioisotope detected by direct counting of radioemmission or by scintillation counting. Alternatively, the targets can be enzymatically labeled with, for example, horseradish peroxidase, alkaline phosphatase, or luciferase, and the enzymatic label detected by determination of conversion of an appropriate substrate to product.
Determining the interaction between biomarker and substrate can also be accomplished using standard binding or enzymatic analysis assays. In one or more embodiments of the above described assay methods, it may be desirable to immobilize polypeptides or
molecules to facilitate separation of complexed from uncomplexed forms of one or both of the proteins or molecules, as well as to accommodate automation of the assay.
Binding of a test agent to a target can be accomplished in any vessel suitable for containing the reactants. Non-limiting examples of such vessels include microtiter plates, test tubes, and micro-centrifuge tubes. Immobilized forms of the antibodies described herein can also include antibodies bound to a solid phase like a porous, microporous (with an average pore diameter less than about one micron) or macroporous (with an average pore diameter of more than about 10 microns) material, such as a membrane, cellulose, nitrocellulose, or glass fibers; a bead, such as that made of agarose or polyacrylamide or latex; or a surface of a dish, plate, or well, such as one made of polystyrene.
In an alternative embodiment, determining the ability of the agent to modulate the interaction between the biomarker and a substrate or a biomarker and its natural binding partner can be accomplished by determining the ability of the test agent to modulate the activity of a polypeptide or other product that functions downstream or upstream of its position within the signaling pathway (e.g., feedback loops). Such feedback loops are well- known in the art (see, for example, Chen and Guillemin (2009) Int. J. Tryptophan Res. 2: 1- 19).
The present invention further pertains to novel agents identified by the above- described screening assays. Accordingly, it is within the scope of this invention to further use an agent identified as described herein, such as in an appropriate animal model. For example, an agent identified as described herein can be used in an animal model to determine the efficacy, toxicity, or side effects of treatment with such an agent.
Alternatively, an antibody identified as described herein can be used in an animal model to determine the mechanism of action of such an agent.
b. Predictive Medicine
The present invention also pertains to the field of predictive medicine in which diagnostic assays, prognostic assays, and monitoring clinical trials are used for prognostic (predictive) purposes to thereby treat an individual prophylactically. Accordingly, one aspect of the present invention relates to diagnostic assays for determining the amount and/or activity level of a biomarker described herein in the context of a biological sample (e.g., blood, serum, cells, or tissue) to thereby determine whether an individual afflicted with a cancer is likely to respond to PI3K/mTOR combination inhibitor therapy, such as in a brain metastasis. Such assays can be used for prognostic or predictive purpose alone, or
can be coupled with a therapeutic intervention to thereby prophylactically treat an individual prior to the onset or after recurrence of a disorder characterized by or associated with biomarker polypeptide, nucleic acid expression or activity. The skilled artisan will appreciate that any method can use one or more (e.g., combinations) of biomarkers described herein, such as those in the tables, figures, examples, and otherwise described in the specification.
Another aspect of the present invention pertains to monitoring the influence of agents (e.g., drugs, compounds, and small nucleic acid-based molecules) on the expression or activity of a biomarker described herein. These and other agents are described in further detail in the following sections.
The skilled artisan will also appreciated that, in certain embodiments, the methods of the present invention implement a computer program and computer system. For example, a computer program can be used to perform the algorithms described herein. A computer system can also store and manipulate data generated by the methods of the present invention which comprises a plurality of biomarker signal changes/profiles which can be used by a computer system in implementing the methods of this invention. In certain embodiments, a computer system receives biomarker expression data; (ii) stores the data; and (iii) compares the data in any number of ways described herein (e.g., analysis relative to appropriate controls) to determine the state of informative biomarkers from cancerous or pre-cancerous tissue. In other embodiments, a computer system (i) compares the determined expression biomarker level to a threshold value; and (ii) outputs an indication of whether said biomarker level is significantly modulated (e.g., above or below) the threshold value, or a phenotype based on said indication.
In certain embodiments, such computer systems are also considered part of the present invention. Numerous types of computer systems can be used to implement the analytic methods of this invention according to knowledge possessed by a skilled artisan in the bioinformatics and/or computer arts. Several software components can be loaded into memory during operation of such a computer system. The software components can comprise both software components that are standard in the art and components that are special to the present invention (e.g., dCHIP software described in Lin et al. (2004)
Bioinformatics 20, 1233-1240; radial basis machine learning algorithms (RBM) known in the art).
The methods of the present invention can also be programmed or modeled in mathematical software packages that allow symbolic entry of equations and high-level specification of processing, including specific algorithms to be used, thereby freeing a user of the need to procedurally program individual equations and algorithms. Such packages include, e.g., Matlab from Mathworks (Natick, Mass.), Mathematica from Wolfram
Research (Champaign, 111.) or S-Plus from MathSoft (Seattle, Wash.).
In certain embodiments, the computer comprises a database for storage of biomarker data. Such stored profiles can be accessed and used to perform comparisons of interest at a later point in time. For example, biomarker expression profiles of a sample derived from the non-cancerous tissue of a subject and/or profiles generated from population-based distributions of informative loci of interest in relevant populations of the same species can be stored and later compared to that of a sample derived from the cancerous tissue of the subject or tissue suspected of being cancerous of the subject.
In addition to the exemplary program structures and computer systems described herein, other, alternative program structures and computer systems will be readily apparent to the skilled artisan. Such alternative systems, which do not depart from the above described computer system and programs structures either in spirit or in scope, are therefore intended to be comprehended within the accompanying claims.
c. Diagnostic Assays
The present invention provides, in part, methods, systems, and code for accurately classifying whether a biological sample is associated with a cancer that is likely to respond to PI3K/mTOR combination inhibitor therapy. In some embodiments, the present invention is useful for classifying a sample (e.g., from a subject) as associated with or at risk for responding to or not responding to PI3K/mTOR combination inhibitor therapy using a statistical algorithm and/or empirical data (e.g., the amount or activity of a biomarker described herein, such as in the tables, figures, examples, and otherwise described in the specification).
An exemplary method for detecting the amount or activity of a biomarker described herein, and thus useful for classifying whether a sample is likely or unlikely to respond to PI3K/mTOR combination inhibitor therapy involves obtaining a biological sample from a test subject and contacting the biological sample with an agent, such as a protein-binding agent like an antibody or antigen-binding fragment thereof, or a nucleic acid-binding agent like an oligonucleotide, capable of detecting the amount or activity of
the biomarker in the biological sample. In some embodiments, at least one antibody or antigen-binding fragment thereof is used, wherein two, three, four, five, six, seven, eight, nine, ten, or more such antibodies or antibody fragments can be used in combination (e.g., in sandwich ELISAs) or in serial. In certain instances, the statistical algorithm is a single learning statistical classifier system. For example, a single learning statistical classifier system can be used to classify a sample as a based upon a prediction or probability value and the presence or level of the biomarker. The use of a single learning statistical classifier system typically classifies the sample as, for example, a likely anti-immune checkpoint therapy responder or progressor sample with a sensitivity, specificity, positive predictive value, negative predictive value, and/or overall accuracy of at least about 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.
Other suitable statistical algorithms are well known to those of skill in the art. For example, learning statistical classifier systems include a machine learning algorithmic technique capable of adapting to complex data sets (e.g., panel of markers of interest) and making decisions based upon such data sets. In some embodiments, a single learning statistical classifier system such as a classification tree (e.g., random forest) is used. In other embodiments, a combination of 2, 3, 4, 5, 6, 7, 8, 9, 10, or more learning statistical classifier systems are used, preferably in tandem. Examples of learning statistical classifier systems include, but are not limited to, those using inductive learning (e.g.,
decision/classification trees such as random forests, classification and regression trees (C&RT), boosted trees, etc.), Probably Approximately Correct (PAC) learning,
connectionist learning (e.g., neural networks (NN), artificial neural networks (ANN), neuro fuzzy networks (NFN), network structures, perceptrons such as multi-layer perceptrons, multi-layer feed-forward networks, applications of neural networks, Bayesian learning in belief networks, etc.), reinforcement learning (e.g., passive learning in a known
environment such as naive learning, adaptive dynamic learning, and temporal difference learning, passive learning in an unknown environment, active learning in an unknown environment, learning action-value functions, applications of reinforcement learning, etc.), and genetic algorithms and evolutionary programming. Other learning statistical classifier systems include support vector machines (e.g., Kernel methods), multivariate adaptive regression splines (MARS), Levenberg-Marquardt algorithms, Gauss-Newton algorithms, mixtures of Gaussians, gradient descent algorithms, and learning vector quantization
(LVQ). In certain embodiments, the method of the present invention further comprises sending the sample classification results to a clinician, e.g., an oncologist.
In another embodiment, the diagnosis of a subject is followed by administering to the individual a therapeutically effective amount of a defined treatment based upon the diagnosis.
In one embodiment, the methods further involve obtaining a control biological sample (e.g., biological sample from a subject who does not have a cancer or whose cancer is susceptible to PBK/mTOR combination inhibitor therapy), a biological sample from the subject during remission, or a biological sample from the subject during treatment for developing a cancer progressing despite PBK/mTOR combination inhibitor therapy.
d. Prognostic Assays
The diagnostic methods described herein can furthermore be utilized to identify subjects having or at risk of developing a cancer that is likely or unlikely to be responsive to PBK/mTOR combination inhibitor therapy. The assays described herein, such as the preceding diagnostic assays or the following assays, can be utilized to identify a subject having or at risk of developing a disorder associated with a misregulation of the amount or activity of at least one biomarker described herein, such as in cancer. Alternatively, the prognostic assays can be utilized to identify a subject having or at risk for developing a disorder associated with a misregulation of the at least one biomarker described herein, such as in cancer. Furthermore, the prognostic assays described herein can be used to determine whether a subject can be administered an agent (e.g., an agonist, antagonist, peptidomimetic, polypeptide, peptide, nucleic acid, small molecule, or other drug candidate) to treat a disease or disorder associated with the aberrant biomarker expression or activity.
e. Treatment Methods
The therapeutic compositions described herein, such as the combination of PI3K inhibitors and mTOR inhibitors, can be used in a variety of in vitro and in vivo therapeutic applications using the formulations and/or combinations described herein. In one embodiment, the therapeutic agents can be used to treat cancers determined to be responsive thereto. For example, single or multiple agents that inhibit or block both PBK and mTOR can be used to treat brain metastases in subjects identified as likely responders thereto.
6. Pharmaceutical Compositions
In another aspect, the present invention provides pharmaceutically acceptable compositions which comprise a therapeutically-effective amount of an agent that modulates (e.g., decreases) biomarker expression and/or activity, formulated together with one or more pharmaceutically acceptable carriers (additives) and/or diluents. As described in detail below, the pharmaceutical compositions of the present invention may be specially formulated for administration in solid or liquid form, including those adapted for the following: (1) oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, boluses, powders, granules, pastes; (2) parenteral administration, for example, by subcutaneous, intramuscular or intravenous injection as, for example, a sterile solution or suspension; (3) topical application, for example, as a cream, ointment or spray applied to the skin; (4) intravaginally or intrarectally, for example, as a pessary, cream or foam; or (5) aerosol, for example, as an aqueous aerosol, liposomal preparation or solid particles containing the compound.
The phrase "therapeutically-effective amount" as used herein means that amount of an agent that modulates (e.g., inhibits) biomarker expression and/or activity, or expression and/or activity of the complex, or composition comprising an agent that modulates (e.g., inhibits) biomarker expression and/or activity, or expression and/or activity of the complex, which is effective for producing some desired therapeutic effect, e.g., cancer treatment, at a reasonable benefit/risk ratio.
The phrase "pharmaceutically acceptable" is employed herein to refer to those agents, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
The phrase "pharmaceutically-acceptable carrier" as used herein means a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting the subject chemical from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject. Some examples of materials which can serve as pharmaceutically-acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato
starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and
polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) phosphate buffer solutions; and (21) other non-toxic compatible substances employed in pharmaceutical formulations.
The term "pharmaceutically-acceptable salts" refers to the relatively non-toxic, inorganic and organic acid addition salts of the agents that modulates (e.g., inhibits) biomarker expression and/or activity, or expression and/or activity of the complex encompassed by the present invention. These salts can be prepared in situ during the final isolation and purification of the therapeutic agents, or by separately reacting a purified therapeutic agent in its free base form with a suitable organic or inorganic acid, and isolating the salt thus formed. Representative salts include the hydrobromide,
hydrochloride, sulfate, bisulfate, phosphate, nitrate, acetate, valerate, oleate, palmitate, stearate, laurate, benzoate, lactate, phosphate, tosylate, citrate, maleate, fumarate, succinate, tartrate, napthylate, mesylate, glucoheptonate, lactobionate, and laurylsulphonate salts and the like (See, for example, Berge et al. (1977) "Pharmaceutical Salts", J. Pharm. Sci. 66: 1- 19).
In other cases, the agents useful in the methods of the present invention may contain one or more acidic functional groups and, thus, are capable of forming pharmaceutically- acceptable salts with pharmaceutically-acceptable bases. The term "pharmaceutically- acceptable salts" in these instances refers to the relatively non-toxic, inorganic and organic base addition salts of agents that modulates (e.g., inhibits) biomarker expression and/or activity, or expression and/or activity of the complex. These salts can likewise be prepared in situ during the final isolation and purification of the therapeutic agents, or by separately reacting the purified therapeutic agent in its free acid form with a suitable base, such as the hydroxide, carbonate or bicarbonate of a pharmaceutically-acceptable metal cation, with ammonia, or with a pharmaceutically-acceptable organic primary, secondary or tertiary amine. Representative alkali or alkaline earth salts include the lithium, sodium, potassium,
calcium, magnesium, and aluminum salts and the like. Representative organic amines useful for the formation of base addition salts include ethylamine, diethylamine, ethylenediamine, ethanolamine, diethanolamine, piperazine and the like (see, for example, Berge et al., supra).
Wetting agents, emulsifiers and lubricants, such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, release agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants can also be present in the compositions.
Examples of pharmaceutically-acceptable antioxidants include: (1) water soluble antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabi sulfite, sodium sulfite and the like; (2) oil-soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, alpha-tocopherol, and the like; and (3) metal chelating agents, such as citric acid, ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like.
Formulations useful in the methods of the present invention include those suitable for oral, nasal, topical (including buccal and sublingual), rectal, vaginal, aerosol and/or parenteral administration. The formulations may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy. The amount of active ingredient which can be combined with a carrier material to produce a single dosage form will vary depending upon the host being treated, the particular mode of administration. The amount of active ingredient, which can be combined with a carrier material to produce a single dosage form will generally be that amount of the compound which produces a therapeutic effect. Generally, out of one hundred per cent, this amount will range from about 1 per cent to about ninety-nine percent of active ingredient, preferably from about 5 per cent to about 70 per cent, most preferably from about 10 per cent to about 30 per cent.
Methods of preparing these formulations or compositions include the step of bringing into association an agent that modulates {e.g., inhibits) biomarker expression and/or activity, with the carrier and, optionally, one or more accessory ingredients. In general, the formulations are prepared by uniformly and intimately bringing into association a therapeutic agent with liquid carriers, or finely divided solid carriers, or both, and then, if necessary, shaping the product.
Formulations suitable for oral administration may be in the form of capsules, cachets, pills, tablets, lozenges (using a flavored basis, usually sucrose and acacia or tragacanth), powders, granules, or as a solution or a suspension in an aqueous or nonaqueous liquid, or as an oil-in-water or water-in-oil liquid emulsion, or as an elixir or syrup, or as pastilles (using an inert base, such as gelatin and glycerin, or sucrose and acacia) and/or as mouth washes and the like, each containing a predetermined amount of a therapeutic agent as an active ingredient. A compound may also be administered as a bolus, electuary or paste.
In solid dosage forms for oral administration (capsules, tablets, pills, dragees, powders, granules and the like), the active ingredient is mixed with one or more
pharmaceutically-acceptable carriers, such as sodium citrate or dicalcium phosphate, and/or any of the following: (1) fillers or extenders, such as starches, lactose, sucrose, glucose, mannitol, and/or silicic acid; (2) binders, such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinyl pyrrolidone, sucrose and/or acacia; (3) humectants, such as glycerol; (4) disintegrating agents, such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate; (5) solution retarding agents, such as paraffin; (6) absorption accelerators, such as quaternary ammonium compounds; (7) wetting agents, such as, for example, acetyl alcohol and glycerol monostearate; (8) absorbents, such as kaolin and bentonite clay; (9) lubricants, such a talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof; and (10) coloring agents. In the case of capsules, tablets and pills, the
pharmaceutical compositions may also comprise buffering agents. Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugars, as well as high molecular weight polyethylene glycols and the like.
A tablet may be made by compression or molding, optionally with one or more accessory ingredients. Compressed tablets may be prepared using binder (for example, gelatin or hydroxypropylmethyl cellulose), lubricant, inert diluent, preservative,
disintegrant (for example, sodium starch glycolate or cross-linked sodium carboxymethyl cellulose), surface-active or dispersing agent. Molded tablets may be made by molding in a suitable machine a mixture of the powdered peptide or peptidomimetic moistened with an inert liquid diluent.
Tablets, and other solid dosage forms, such as dragees, capsules, pills and granules, may optionally be scored or prepared with coatings and shells, such as enteric coatings and other coatings well known in the pharmaceutical-formulating art. They may also be formulated so as to provide slow or controlled release of the active ingredient therein using, for example, hydroxypropylmethyl cellulose in varying proportions to provide the desired release profile, other polymer matrices, liposomes and/or microspheres. They may be sterilized by, for example, filtration through a bacteria-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions, which can be dissolved in sterile water, or some other sterile injectable medium immediately before use. These compositions may also optionally contain opacifying agents and may be of a composition that they release the active ingredient(s) only, or preferentially, in a certain portion of the
gastrointestinal tract, optionally, in a delayed manner. Examples of embedding
compositions, which can be used include polymeric substances and waxes. The active ingredient can also be in micro-encapsulated form, if appropriate, with one or more of the above-described excipients.
Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups and elixirs. In addition to the active ingredient, the liquid dosage forms may contain inert diluents commonly used in the art, such as, for example, water or other solvents, solubilizing agents and emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor and sesame oils), glycerol, tetrahydrofuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof.
Besides inert diluents, the oral compositions can also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, coloring, perfuming and preservative agents.
Suspensions, in addition to the active agent may contain suspending agents as, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, and mixtures thereof.
Formulations for rectal or vaginal administration may be presented as a suppository, which may be prepared by mixing one or more therapeutic agents with one or more suitable nonirritating excipients or carriers comprising, for example, cocoa butter, polyethylene
glycol, a suppository wax or a salicylate, and which is solid at room temperature, but liquid at body temperature and, therefore, will melt in the rectum or vaginal cavity and release the active agent.
Formulations which are suitable for vaginal administration also include pessaries, tampons, creams, gels, pastes, foams or spray formulations containing such carriers as are known in the art to be appropriate.
Dosage forms for the topical or transdermal administration of an agent that modulates (e.g., inhibits) biomarker expression and/or activity include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches and inhalants. The active component may be mixed under sterile conditions with a pharmaceutically-acceptable carrier, and with any preservatives, buffers, or propellants which may be required.
The ointments, pastes, creams and gels may contain, in addition to a therapeutic agent, excipients, such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc and zinc oxide, or mixtures thereof.
Powders and sprays can contain, in addition to an agent that modulates (e.g., inhibits) biomarker expression and/or activity, excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicates and polyamide powder, or mixtures of these substances. Sprays can additionally contain customary propellants, such as
chlorofluorohydrocarbons and volatile unsubstituted hydrocarbons, such as butane and propane.
The agent that modulates (e.g., inhibits) biomarker expression and/or activity, can be alternatively administered by aerosol. This is accomplished by preparing an aqueous aerosol, liposomal preparation or solid particles containing the compound. A nonaqueous (e.g., fluorocarbon propellant) suspension could be used. Sonic nebulizers are preferred because they minimize exposing the agent to shear, which can result in degradation of the compound.
Ordinarily, an aqueous aerosol is made by formulating an aqueous solution or suspension of the agent together with conventional pharmaceutically acceptable carriers and stabilizers. The carriers and stabilizers vary with the requirements of the particular compound, but typically include nonionic surfactants (Tweens, Pluronics, or polyethylene glycol), innocuous proteins like serum albumin, sorbitan esters, oleic acid, lecithin, amino
acids such as glycine, buffers, salts, sugars or sugar alcohols. Aerosols generally are prepared from isotonic solutions.
Transdermal patches have the added advantage of providing controlled delivery of a therapeutic agent to the body. Such dosage forms can be made by dissolving or dispersing the agent in the proper medium. Absorption enhancers can also be used to increase the flux of the peptidomimetic across the skin. The rate of such flux can be controlled by either providing a rate controlling membrane or dispersing the peptidomimetic in a polymer matrix or gel.
Ophthalmic formulations, eye ointments, powders, solutions and the like, are also contemplated as being within the scope of this invention.
Pharmaceutical compositions of this invention suitable for parenteral administration comprise one or more therapeutic agents in combination with one or more
pharmaceutically-acceptable sterile isotonic aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, or sterile powders which may be reconstituted into sterile injectable solutions or dispersions just prior to use, which may contain antioxidants, buffers, bacteriostats, solutes which render the formulation isotonic with the blood of the intended recipient or suspending or thickening agents.
Examples of suitable aqueous and nonaqueous carriers which may be employed in the pharmaceutical compositions of the present invention include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.
These compositions may also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of the action of
microorganisms may be ensured by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol sorbic acid, and the like. It may also be desirable to include isotonic agents, such as sugars, sodium chloride, and the like into the compositions. In addition, prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption such as aluminum monostearate and gelatin.
In some cases, in order to prolong the effect of a drug, it is desirable to slow the absorption of the drug from subcutaneous or intramuscular injection. This may be accomplished by the use of a liquid suspension of crystalline or amorphous material having poor water solubility. The rate of absorption of the drug then depends upon its rate of dissolution, which, in turn, may depend upon crystal size and crystalline form.
Alternatively, delayed absorption of a parenterally-administered drug form is accomplished by dissolving or suspending the drug in an oil vehicle.
Injectable depot forms are made by forming microencapsule matrices of an agent that modulates (e.g., inhibits) biomarker expression and/or activity, in biodegradable polymers such as polylactide-polyglycolide. Depending on the ratio of drug to polymer, and the nature of the particular polymer employed, the rate of drug release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations are also prepared by entrapping the drug in liposomes or microemulsions, which are compatible with body tissue.
When the therapeutic agents of the present invention are administered as pharmaceuticals, to humans and animals, they can be given per se or as a pharmaceutical composition containing, for example, 0.1 to 99.5% (more preferably, 0.5 to 90%) of active ingredient in combination with a pharmaceutically acceptable carrier.
Actual dosage levels of the active ingredients in the pharmaceutical compositions of this invention may be determined by the methods of the present invention so as to obtain an amount of the active ingredient, which is effective to achieve the desired therapeutic response for a particular subject, composition, and mode of administration, without being toxic to the subject.
The nucleic acid molecules of the present invention can be inserted into vectors and used as gene therapy vectors. Gene therapy vectors can be delivered to a subject by, for example, intravenous injection, local administration (see U.S. Pat. No. 5,328,470) or by stereotactic injection (see e.g., Chen et al. (1994) Proc. Natl. Acad. Sci. USA 91 :3054 3057). The pharmaceutical preparation of the gene therapy vector can include the gene therapy vector in an acceptable diluent, or can comprise a slow release matrix in which the gene delivery vehicle is imbedded. Alternatively, where the complete gene delivery vector can be produced intact from recombinant cells, e.g., retroviral vectors, the pharmaceutical preparation can include one or more cells which produce the gene delivery system.
The present invention also encompasses kits for detecting and/or modulating biomarkers described herein. A kit of the present invention may also include instructional materials disclosing or describing the use of the kit or an antibody of the disclosed invention in a method of the disclosed invention as provided herein. A kit may also include additional components to facilitate the particular application for which the kit is designed. For example, a kit may additionally contain means of detecting the label (e.g., enzyme substrates for enzymatic labels, filter sets to detect fluorescent labels, appropriate secondary labels such as a sheep anti-mouse-HRP, etc.) and reagents necessary for controls (e.g., control biological samples or standards). A kit may additionally include buffers and other reagents recognized for use in a method of the disclosed invention. Non-limiting examples include agents to reduce non-specific binding, such as a carrier protein or a detergent.
EXAMPLES
Example 1: Combined PI3K and mTOR Blockade Durably Regresses Brain Tumors From Metastatic Cancers
a. Materials and Methods
Patient-derived xenografts
Fresh brain metastases were acquired from patients with breast cancer undergoing neurosurgery at the Brigham and Women's Hospital as part of an Institutional Review Board (IRB) approved protocol within the Dana-Farber/Harvard Cancer Center (DF/HCC) Living Tissue Bank program. In order to establish patient-derived metastatic breast models, fresh tumor tissue was dissociated in gentleMACS™ C Tubes using mechanical and enzymatic methods (Miltenyi Biotech). A suspension of metastatic breast cells was prepared at a concentration of 100,000 viable cells per microliter and temporarily incubated on ice prior to intracranial injections. Approximately six-week-old severe combined immunodeficiency (SCID) mice acquired from Taconic Biosciences (IcrTacTCR- Prkdcscid) were anesthetized with oxygen-diluted isoflurane or ketamine/xylazine and positioned into a stereotactic frame, whereby the head was secured by gentle pressure from ear bars while maintaining deep anesthesia. A one centimeter scalp incision was made to identify the bregma which served as the zero coordinates (x = 0 mm, y = 0 mm, and z = 0 mm). A burr hole was created in the skull in the right hemisphere at coordinates x = 0 mm, y = 2 mm, and z = 0 mm, and each animal was injected with 100,000 viable tumor cells into the right striatum (z = 2 mm). The scalp was closed with 9 mm Autoclips® (BD Diagnostic
Systems). Xenografts were aged under standard conditions and monitored for development of neurologic symptoms necessitating euthanasia. Following euthanasia, brain tumors from symptomatic animals were collected by dissection, dissociated, and re-injected
intracranially into additional animals (i.e., serial passaging in vivo). Alternatively for neuropathologic evaluation of brain tumors, euthanized xenografts were perfused by intracardiac injection of 4% paraformaldehyde (PFA) in phosphate-buffered saline (PBS, pH 7.0) and processed by standard methods for paraffin embedding. Hematoxylin and Eosin (H&E) stained sections were generated and evaluated tumors. All the animal experiments were performed according to protocols approved by the Dana-Farber Cancer Institute Animal Care and Use Committee in compliance with NIH animal guidelines.
Immunohi stochemi stry
Diaminobenzidine (DAB), brightfield staining was performed according to standard protocols using DAB EnVision+™ System (Dako) on paraffin sections. Briefly five micron thick sections were deparaffinized with xylene, followed by gradation washes in 100%, 95%, 80% ethyl alcohol before performing heat antigen retrieval in 10 mM sodium citrate buffer (pH 6.0) for 20 minutes. Subsequently, sections were treated with peroxidase block (Dako) for ten minutes followed by overnight incubation at 4°C with the following primary antibodies: polyclonal PTEN (Cell Signaling #9559), pS6RP-Ser235/236 (Cell Signaling #2211), p4EBPl-Thr37/46 (Cell Signaling #2855), or cleaved caspase-3 (Cell Signaling #9664) from Cell Signaling; estrogen receptor (ER) (Thermo Scientific SP1) or FIER2 (ThermoScientific SP3) from ThermoScientific; or progesterone receptor (PR) (Dako PgR 636), CK7 (Dako), GFAP (Dako #z0334), OLIG2 (Dako), or monoclonal mouse anti-Ki67 (Dako MIB-1 or Vector lab # VP K-451) from Dako or Vector lab. After multiple washes with IX Tris-buffered saline and TWEEN® 20 (TBST) solution, slides were incubated at room temperature for two hours with corresponding species-specific horseradish peroxidase (FIRP)-conjugated secondary antibody from the EnVision+™ System (Dako). Signal was visualized by the FIRP-DAB reaction. Counterstaining for nuclei was performed using Mayer's hematoxylin stain followed by graded dehydration and xylene washes. Coverslips were mounted with Permount™ (Fisher Scientific).
Ki67 and cleaved caspase-3 indexes were calculated as a percentage of positive cells in 4-5 random areas of each sample. Images were captured at 40x or 60x magnification and quantifications of Ki67 and cleaved caspase-3 immunoreactivity were performed using the ImmunoRatio plugin provided in the Image J software.
Lentiviral production and transduction
Plasmid pLenti-blastidin-Luciferase were co-transfected with pCMV-delta8.9 and pMD.G at the ratio of 4:3 : 1 into HEK293T cells using polyethylenimine (PEI) (1 μg/ml) (4: 1 to DNA). The culture medium was replaced 1 day after transfection and the viral supernatants were collected 1 day and 2 days later. The viral supernatants were filtered through a 0.45 μπι filter and were then concentrated by ultracentrifugation (26,600 rpm for 2 hours). Viral pellets were resuspended into PBS and aliquoted and stored at -80 °C for future use. Viral titers were determined using the qPCR lentivirus titration kit (Applied Biological Materials Inc.)
PDX tumor cells were isolated, transduced with a lentivirus encoding luciferase
(pLenti-blastidin-Luciferase) at a multiplicity of infection (MOI) of approximately 5 in suspension overnight with polybrene 8 μg/ml, and then subjected to a 3 -day antibiotic selection with blasticidin 2 μg/ml in NeuroCult™ NS-A media (Stemcell Technologies) supplemented with heparin sulfate (2 mg/mL), epidermal growth factor (EGF, 20 ng/ml), basic fibroblast growth factor (bFGF, 20 ng/ml), and hydrocortisone (0.5 μg/ml).
Luciferase-expressing tumors were then propagated in mice.
Bioluminescence imaging
For imaging, mice were injected intraperitoneally (i.p.) with D-luciferin (Promega) together with anesthetic reagents, ketamine (100 mg/kg) and xylazine (7 mg/kg). Ten minutes later, luciferase gene expression was recorded and images were obtained using the Kodak Image Station 4000MM for 20 minutes (DF-BM355) or 5 minutes (DF-BM354). The signals were analyzed with CareStream MI Software.
In vivo treatment
BKM120 was dissolved in 10% MP with 90% PEG400 and given orally once/day at 30 mg/kg. RAD001 was freshly prepared from microemulsion pre-concentrate with 5% glucose dilution or dissolved in 10% NMP with 90% PEG300 and daily oral delivery to mice at 7.5 mg/kg. Lapatinib was dissolved in 0.5% hydroxypropyl methylcellulose (HPMC) with 0.1% TWEEN® 80 and administered at 100 mg/kg body weight once a day by oral gavage. All compounds were purchased from Haoyuan ChemExpress Co.
MRI imaging
MRI experiments were performed on a Bruker BioSpec 7T/30 cm USR horizontal bore Superconducting Magnet System, equipped with the B-GA12S2 gradient and integrated with an up to 2nd order room temperature shim system, which provides a
maximum gradient amplitude of 440 mT/ra and slew rate of 3440 T/m/s. The Bruker-made 23 mm ID birdcage volume radiofrenquancy (RF) coil was used for both RF excitation and receiving. Auto-Pac™ with laser was used for precise animal positioning.
Animals were anesthetized throughout the imaging procedure through inhalation of a mixture of 1.5% Isoflurane into medical supplied air. Animal respiration and temperature were monitored and regulated using the SAII (Stony Brook, NY) monitoring and gating system model 1025T.
Bruker Paravision 5.1 was used for MRI data acquisition. Once animals were positioned in the magnet, a three orthogonal scout imaging protocol was loaded and run with the traffic light meaning it would run the automatic center frequency, automatic shim, reference RF gain, and receive gain, and then acquire the reference images. T2-weighted images were obtained from fast spin echo (RARE) with fat suppression sequence and the following parameters: TE = 33 ms, TR = 2,500 ms, rare factor = 8, number of averages = 2, total acquisition time = 2 min. 40 sec, FOV = 20 x 20 mm2, matrix size = 256 x 256, spatial resolution = 78 x 78 μπι2, slice thickness = 1.0 mm, and number of slices = 12. 3D volume reconstructions were obtained using OsiriX software.
Whole-exome sequencing
The exome was sequenced on the Ion Proton™ platform (Life Technologies, Thermo Fisher) according to the manufacturer's instructions. Briefly, genomic DNAs (gDNAs) were extracted from the patient peripheral blood or PDX tumors using a
DNeasy® blood & tissue kit (Qiagen). DNA libraries were constructed from 100 ng gDNA using the Ion AmpliSeq™ Exome kit (Life Technologies, Thermo Fisher) that provides targeted regions of greater than 97% of the coding exons of the human genome. The final exome libraries were quantitated using the Ion Library™ Quantitation Kit (Life
Technologies, Thermo Fisher). Two to three libraries were multiplexed and clonally amplified to obtain template-positive ion sphere particles by using the Ion OneTouch™ 2 System (Life Technologies, Thermo Fisher), followed by sequencing on an Ion Torrent Proton™ using one Ion PI™ chip kit V2 (Life Technologies, Thermo Fisher). Alignment of sequencing reads was performed using Torrent Suite™ Software and Torrent Server. Further data analysis, variant calling, and annotation of variants were carried out using the Ion AmpliSeq™ Exome single sample (Somatic) workflow and Tumor-Normal pair workflow using Ion Reporter™ software (Life Technologies, Thermo Fisher). Calls with fewer than 10 reads for normal samples and 20 reads for tumor samples were removed.
The R and Bioconductor software packages (Gentleman et al. (2004) Genome Biol. 5, R80) were used to prioritize and visualize the sequencing data. The segment plotting tool from the readDepth package for R was further modified to visualize CNV alterations (Miller et al. (2011) PloS One 6:el6327).
Transcriptome analysis
AmpliSeq™ human transcriptome libraries were constructed and sequenced using the Ion Proton platform according to manufacturer instructions, as described above, and as previously described (Wang et al. (2015) Cell 163 : 174-186). Briefly, 10 ng of total RNA samples each were used for cDNA library preparation. Eight libraries were
multiplexed and clonally amplified by using the Ion OneTouch™ 2 System (Life
Technologies, Thermo Fisher), then were sequenced on an Ion Torrent Proton™ machine. Data were first analyzed using Torrent Suite™ software and Ion AmpliSeq™ RNA analysis plugin (Life Technologies, Thermo Fisher) software was used to generate count data.
Count data were transformed using the R-bioconductor packages DESeq2 (Love et al. (2014) Genome Biol. 15:550), log2 transformed, and then mean-normalized by gene to allow comparison. The AKT-mTOR signature score represents the mean of the 34 upregulated genes induced by Akt in a transgenic mouse model and sensitive to mammalian target of rapamycin (mTOR) inhibitor RAD001 in a previously published study (AKT1, BIK, BSG, DDR1, CDC34, CLDN3, CYB561, GPX4, HNRPAB, LASP1, MMP15, MVK, NEDD8, NEU1, PCTK1, POR, PRKCD, PVRL2, SPINT1, UBE2M, TMED10, DUSP10, CLSTN1, PMPCA, BRMS1, TJP3, ARHGEF16, ADIPOR1, SLC37A1, KCTD5, TOLLIP, SYNJ2BP, RNF126, and COROIB) (Creighton et al. (2007) Oncogene 26:4648-4655. These 34 upregulated genes are well-known in the art and nucleotide and amino acid sequences are available for each, in order of appearance, according to EntrezGene identification number 207, 638, 682, 780, 997, 1365, 1534, 2879, 3182, 3927, 4324, 4598, 4738, 4758, 5127, 5447, 5580, 5819, 6692, 9040, 10972, 11221, 22883, 23203, 25855, 27134, 27237, 51094, 54020, 54442, 54472, 55333, 55658, and 57175 available at the NCBI website. Boxplots correspond to the first and third quartiles (the 25th and 75th percentiles) with upper/lower whisker extending to the highest value that is within 1.5 times the interquartile range.
Western blot
Tumor samples were lysed and Western blot analysis was performed as previously described in Ni et al. (2012) Cancer Disc. 2:425-433. Antibodies against pAKT (S473) and
AKT were purchased from Cell Signaling Technology. a-Tubulin antibody was purchased from Sigma.
Statistical analysis
Statistical significance was determined using the unpaired Student's t-test or ANOVA by GraphPad Prism 6 (GraphPad Software). Data were considered significant when p values were < 0.05.
In vivo treatment
JQ1 (James Bradner, DFCI/Harvard, (S)-tert-butyl 2-(4-(4-chlorophenyl)-2,3,9- trimethyl-6H-thieno[3,2-f][l,2,4]triazolo[4,3-a][l,4]diazepin-6-yl)acetate) was dissolved in DMSO and then diluted with 10% cyclodextran. JQ1 was given at a final dose of 100 mg/kg body weight by i.p. injection once/day. MEK162 (binimetinib; fluoro-N-(2- hydroxyethoxy)-3-methylbenzimidazole-5-carboxamide) was formulated in 1%
carboxymethyl cellulose with 0.5% Tween™80 and daily oral delivery to mice at 15 mg/kg. b. Results
Between 30 to 50 percent of patients with metastatic HER2-positive breast cancer will develop brain metastases during their illness (Ramakrishna et al. (2014) J. Clin. Oncol. 32:2100-2108). Although advances in systemic therapy control extracranial disease and prolong survival, they are relatively ineffective against breast cancer brain metastases (BCBM), which thus present a major clinical challenge (Lin et al. (2013) Clin. Cancer Res. 19:6404-6418; Kodack et al. (2015) Cancer Cell 27: 163-175). Understanding the biology of HER2-positive BCBM has been significantly hindered by a lack of clinically relevant disease models, resulting in a dearth of active systemic therapies.
In order to develop clinically relevant therapeutic strategies for HER2-positive BCBM, a protocol to establish orthotopic patient-derived xenografts (PDXs) was constructed (Figure 1A). Fresh brain metastatic tissue from two initial patients (DF-BM354 and DF-BM355) with HER2+ BCBM was grafted directly into the brains of
immunodeficient mice. The median survival of mice engrafted with either DF-BM354 or DF-BM355 was approximately 2-3 months. At this time, the BCBM xenografts were explanted, dissociated, transduced with a luciferase gene, and then re-injected into additional cohorts of animals (Figure 1 A). Notably, although tumors were successfully propagated through serial in vivo passage, they did not form stable primary cell lines in vitro. Both DF-BM354 and DF-BM355 xenografts phenocopied their parental metastatic lesions histologically, as well as in tumor cell expression of estrogen receptor (ER),
progesterone receptor (PR) and HER2 (Figure IB). In addition, their expression of the epithelial marker cytokeratin 7 (CK7) and the absence of glial marker expression (GFAP and OLIG2) was confirmed (Figure IB). Both PDXs and their parental patient tumors did not express the PTEN protein (Figure IB). Moreover, three additional PDX models of F£ER2-positive BCBM were established and a uniform lack of PTEN protein expression was determined, indicating that PTEN loss is a common event in BCBM (Figure 1C).
In order to further evaluate the prevalence of PTEN-deficiency in BCBM, PTEN immunohistochemistry was performed on paraffin-embedded tissues from 27 clinical specimens of HER2-positive BCBMs. Notably, two-thirds of these metastatic lesions (66.7%) showed no PTEN staining (Figure ID). This result is consistent with results reported earlier that PTEN-loss is significantly more frequent in BCBMs (Wikman et al. (2012) Breast Cancer Res. 14:R49). It has also recently been reported that the brain microenvironment specifically induces the loss of PTEN expression in tumor cells (Zhang et al. (2015) Nature 527: 100-104). These data indicate that PTEN-loss is a widespread phenomenon in brain metastases.
In order to assess the therapeutic response of HER2-positive BCBM to clinically relevant targeted therapies, DF-BM355 was first treated with the EGFR/HER2 kinase inhibitor, lapatinib (Xia et al. (2002) Oncogene 21 :6255-6263). Consistent with the clinical progression of the donor patient on HER2-directed therapy, DF-BM355 showed no response to lapatinib (Figures 2A-2B). Given that DF-BM355 has also lost the ewxpression of PTEN (a key regulatory of the phosphatidylinositol 3 -kinase, PI3K, pathway) (Berns et al. (2007) Cancer Cell 12:395-402; Nagata et al. (2004) Cancer Cell 6: 117-127), the combination of lapatinib with BKM120, a pan-PI3K inhibitor that permeates the blood- brain barrier (BBB), was tested (Filbin et al. (2013) Nat. Med. 19: 1518-1523; Maire et al. (2014) Stem Cells 32:313-326; Thorpe et al. (2015) Nat. Rev. Cancer 15:7-24). This combination is currently in clinical trials for metastatic HER2+ disease (see clinical trial NCT01589861). Again, DF-BM355 failed to respond to therapy, as assessed by both bioluminescent imaging and animal survival (Figures 2A-2B). Furthermore, although a pharmacodynamic effect of treatment (i.e., suppression of AKT phosphorylation) was observed, the number of Ki67-positive cells, which is a marker for cellular proliferation, in treated tumors did not decrease (Figures 3 A-3B).
In order to understand the lack of response in DF-BM355 to combined HER2/PI3K inhibition, tumor PI3K pathway signaling in response to lapatinib alone or in combination
with BKM120 was assessed. While these treatments reduced both AKT and S6RP phosphorylation, little change was observed in the phosphorylation of 4EBP1, a
downstream effector of mTORCl (Figure 3C). This result indicated that even combined HER2/PI3K inhibition has an incomplete capacity to inhibit mTORCl activity in this model. Interestingly, a persistence of mTOR signaling despite PI3K blockade has recently been shown to mediate resistance to PI3K inhibition in breast cancer, and this can be overcome by pharmacologic mTORCl inhibition (Elkabets et al. (2013) Science Transl. Med. 5: 196ral99). It was asked whether such an approach might be effective in the unique microenvironment of the brain, by combining either lapatinib or BKM120 with RAD001, which is an oral allosteric mTORCl inhibitor that has demonstrated blood-brain barrier (BBB) penetrance in human and animal studies (Krueger et al. (2010) New Engl. J. Med. 363 : 1801-1811; O'Reilly et al. (2010) Cancer Chemother. Pharmacol. 65:625-639).
Notably, this combination is also in clinical trials for metastatic HER2-positive disease (see clinical trial, NCT01283789).
Unexpectedly, while the combination of lapatinib and RAD001 had limited effect on the growth of DF-BM355 (Figure 2C), BKM120 plus RAD001 resulted in marked tumor regression (Figure 2D). Due to the unprecedented nature of this response, a number of mice were removed from the control group at the time when they had developed much larger tumors, and BKM120/RAD001 treatment was initiated in this mice. These larger tumors also regressed over time (Figure 2D). MRI performed before and two weeks after treatment initiation confirmed the reduction in tumor volume (Figure 2E). Furthermore, mice receiving combination treatment maintained normal body weight and appearance, whereas control mice rapidly deteriorated. The magnitude of the response was
unexpectedly significant. While mice in the control group quickly reached the endpoint with large tumors, the luciferase signal from treated tumors continued to decline to a nearly undetectable level over the treatment period of 14 weeks, and mice remained signal free for several additional weeks after treatment cessation (Figure 2F). Consistent with these observations, none of the mice treated with combination therapy died during 210 days of observation, whereas all mice in the control group died after approximately 90 days (Figure 2G).
It was surprising that the BKM120/RAD001 combination resulted in near complete remission of HER2-positive brain metastases in mice, while neither lapatinib/BKM120 nor lapatinib/RADOOl showed any significant therapeutic efficacy. The unique efficacy of this
combination is also underscored by results from additional experiments performed: neither a BKM120/MEK162 combination {i.e., MEK162 is a MEK inhibitor chosen due to high p- ERK levels) (Figure 4) nor a BKM120/JQ1 combination {i.e., JQ1 is an inhibitor of the BET family of bromodomain proteins chosen due to MFC amplifications) showed efficacy (Figure 5).
In order to understand the mechanism behind the robust synergy between BKM120 and RADOOl, tumors from mice 4 days after treatment were harvested for
pharmacodynamic assessment. While both BKM120 and RADOOl monotherapy reduced S6RP phosphorylation, neither suppressed 4EBP1 phosphorylation to a significant degree (Figure 2H), indicating that mTORCl was not completely inhibited. Indeed, the findings with respect to RADOOl treatment are consistent with reports that rapamycin (an mTORCl inhibitor) also has differential effects on S6RP and 4EBP1; while rapamycin stably inhibits S6RP phosphorylation, its effect on 4EBP1 phosphorylation is short lived, and the rapid re- emergence of p4EBPl explains, in part, rapamycin resistance (Choo et al. (2008) Proc. Natl. Acad. Sci. U.S.A. 105: 17414-17419). In contrast, combined BKM120/RAD001 treatment potently suppressed p4EBPl levels, accompanied by significantly decreased cell proliferation (Ki67) and increased apoptosis (cleaved caspase-3) (Figure 2H). Collectively, these data show that combined PI3K-mTOR inhibition is required to adequately suppress mTORCl activity in the DF-BM355 model.
It was next determined whether the results were replicatable in other HER2 -positive
BCBM PDX models. Four different models (DF-BM354, DF-BM463, DF-BM507, and DF-BM590) were propagated in cohorts of mice and the effects of combined
BKM120/RAD001 therapy were studied. Consistent with the results described above, neither BKM120 nor RADOOl monotherapy had meaningful effects in the DF-BM354 model, whereas, their combination led to durable tumor regression with consistent changes in pS6RP, p4EBPl, and Ki67 (Figures 6A-6C). Notably, while both DF-BM354 and DF- BM355 are HER2 -positive and PTEN-deficient, they have disparate estrogen receptor status (Figure IB), indicating that the BMK120/RAD001 combination might be effective for HER2-positive BCBM regardless of hormone receptor status. A third model (DF- BM463) also exhibited durable responses and consistent biomarker changes in response to the BKM120/RAD001 combination (Figures 6D-6E and Figure 7).
By contrast, however, the BKM120/RAD001 combination had little effects on DF- BM507 and DF-BM590, as shown by the lack of survival benefit. Notably, pS6RP and
p4EBPl levels were not suppressed in these models (Figures 6F-6H). Together, these results suggest heterogeneity among models, despite the fact that they all belong to the same breast cancer subtype (FIER2 -positive) and share a key molecular alteration (lack of PTEN expression). In order to gain insights into the differential therapeutic responses of these models, transcriptome analyses were performed. Strikingly, all three responders had significantly higher expression levels of AKT-mTOR-dependent signature genes as compared to the two non-responders (Figure 8 A), indicating that the majority of HER2- positive BCBMs depend on the AKT-mTOR pathway.
In order to investigate whether genomic determinants could explain the distinct responses of HER2-positive BCBM to dual PBK-mTOR inhibition, whole exome sequencing (WES) of all five PDX tumors and their matched patients' blood samples (patient blood unavailable for DF-BM355 and thus excluded from analysis of mutation rates) was performed. Copy number variations were highly frequent in all five models (Figure 8A). Notably, each PDX and its matched patient tumor share almost identical patterns of CNVs (Figure 9A), suggesting conservation of genetic alternations in these PDXs. The rate of somatic mutations (non-synonymous) in responding tumors was ~7- 8/Mb (Figure 8C). This is in line with recently reported data that the mutation rate in HER2-positive BCBMs is approximately 10 mutations/Mb (Brastianos et al. (2015) Cancer Disc. 5: 1164-1177). By contrast, the mutation rate in non-responsive BCBMs was -60-70 mutations/Mb (Figure 8C), demonstrating hyper-mutation genotypes that are close to the mutation burden seen in melanoma and lung cancer (Lawrence et al. (2013) Nature
499:214-218). In some embodiments, the cancers described herein can have at least, less than or equal to, less than, or about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, or more mutations per megabase, or any range inclusive, such as 5-50 mutations/Mb. The terms "synonymous mutation" or "silent mutation" refer to changesh in the sequence of a gene without altering the sequence of the encoded protein directly. Most amino acids found in proteins are coded by several DNA codons. Therefore, mutation of gene sequences may still result in coding for the same amino acid. By contrast, a "non-synonymous mutation" changes both the sequence of a gene and sequence of the encoded protein directly. The data refer to non- synonymous mutations and the method is consistent with those described in Lawrence et al. (20\3) Nature 499:214-218 and Brastianos et al. (2015) Cancer Disc. 5: 1164-1177. The hyper-mutation genotype has been previously linked to mutations in DNA repair genes
(Shlien et al. (2015) Nat. Genet. 47:257-262), and indeed multiple mutations were found in a panel of DNA repair gene only in resistant PDXs and their matched patient specimens (Figures 8D, 9B, and 10-11). These DNA repair genes included APEX1, ATM, ATR, BRCA1, BRCA2, BRIP1, ERCC2, ERCC4, ERCC6, KLC3, LIG1, LIG3, MPG, MSH3, MSH5, MSH6, NEIL3, NPRL3, NTHLl, PARP2, PGBD3, PRKDC, PMS2, POLL, PRKDC, RAD18, RAD23B, RAD54L, RPA1, SLK, TMEM55B, TOP3B, XRCC3, and XRCC6BP1. In certain embodiments of the methods of the present invention, the brain metastasis and/or extracranial cancer can have at least, less than or equal to, less than, or about, one or more mutations in at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41,
42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65,
66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, or 84, or any range inclusive, such as 1-5, and selected from within a class or among classes {e.g., BER, NER, MMR, DSB, and/or other) of, DNA repair protein genes that encode a non-functional DNA repair protein, or expresses at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42,
43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66,
67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, or 84, or any range inclusive, such as 1-5, and selected from within a class or among classes {e.g., BER, NER, MMR, DSB, and/or other) of, DNA repair proteins that is non-functional, wherein the DNA repair protein is selected from Table 2 below and/or the group consisting of APEXl, ATM, ATR, BRCA1, BRCA2, BRIP1, ERCC2, ERCC4, ERCC6, KLC3, LIG1, LIG3, MPG, MSH3, MSH5, MSH6, NEIL3, NPRL3, NTHLl, PARP2, PGBD3, PRKDC, PMS2, POLL, PRKDC, RAD18, RAD23B, RAD54L, RPA1, SLK, TMEM55B, TOP3B, XRCC3, and XRCC6BP1.
Table 2
APEX2 ID 27301, NM 001271748.1, ID 77622, NM 029943.2, NP 001258677.1, NM 014481.3, NP_084219.1
NP 055296.2
CCNO ID 10309, NM 021147.4, ID 218630, NM 001081062.1,
NP 066970.3 NP 001074531.1
LIG3 ID 3980, NM 002311.4, ID 16882, NM 001291245.1,
NP 002302.2, NM 013975.3, NP 001278174.1,
NP_039269.2 NM 001291246.1,
NP 001278175.1,
NM 001291247.1,
NP 001278176.1,
NM 010716.3, NP 034846.2
MPG ID 4350, NM 001015052.2, ID 268395, NM 010822.3,
NP 001015052.1, NM 002434.3, NP_034952.2
NP 002425.2, NM 001015054.2,
NP_001015054.1
MUTYH ID 4595, NM 001048171.1, ID 70603, NM 001159581.1,
NP 001041636.1, NM 001048172.1, NP 001153053.1, NP 001041637.1, NM 001048173.1, NM 001316747.1,
NP 001041638.1, NM 001048174.1, NP 001303676.1, NP 001041639.1, NM 001128425.1, NM_133250.2, NP_573513.2 NP 001121897.1, NM 001293190.1,
NP 001280119.1, NM 001293191.1,
NP 001280120.1, NM 001293192.1,
NP 001280121.1, NM 001293195.1,
NP 001280124.1, NM 001293196.1,
NP 001280125.1, NM 012222.2,
NP 036354.1
NEIL 1 ID 79661, NM 024608.3, ID 72774, NM 028347.2,
NP 078884.2, NM 001256552.1, NP_082623.1
NP_001243481.1
NEIL2 ID 252969, NM 001135746.1, ID 382913, NM 201610.2,
NP 001129218.1, NM 001135747.1, NP_963904.2
NP 001129219.1, NM 001135748.1,
NP 001129220.1, NM 145043.2,
NP_659480.1
NEIL3 ID 55247, NM 018248.2, ID 234258, NM 146208.2,
NP 060718.2 NP 666320.1
NTHL1 ID 4913, NM 001318193.1, ID 18207, NM 008743.2,
NP 001305122.1, NM 001318194.1, NP_032769.2
NP 001305123.1, NM 002528.6,
NP 002519.1
OGG1 ID 4968, NM 016820.3, ID 18294, NM 010957.4,
NP 058213.1, NM 002542.5, NP_035087.3
NP 002533.1, NM 016821.2,
NP 058214.1, NM 016819.3,
NP 058212.1, NM 016829.2,
NP 058438.1, NM 016828.2,
NP 058437.1, NM 016827.2,
NP 058436.1, NM 016826.2,
NP_058434.1
PARP 1 ID 142, NM 001618.3, ID 11545, NM 007415.2,
NP 001609.2 NP 031441.2
PARP2 ID 10038, NM 001042618.1, ID 11546, NM 009632.2,
NP 001036083.1, NM 005484.3, NP_033762.1
NP 005475.2
PARP3 ID 10039, NM 001003931.3, ID 235587, NM 001311150.1,
NP 001003931.3, NM 005485.5, NP 001298079.1, NP 005476.4 NM 145619.3, NP 663594.2
POLB ID 5423, NM 002690.2, ID 18970, NM 011130.2,
NP 002681.1 NP 035260.1
SMUGl ID 23583, NM 001243787.1, ID 71726, NM 027885.3,
NP 001230716.1, NM 014311.2, NP_082161.2
NP 055126.1, NM 001243789.1,
NP 001230718.1, NM 001243788.1,
NP 001230717.1, NM 001243790.1,
NP 001230719.1, NM 001243791.1,
NP_001230720.1
TDG ID 6996, NM 003211.4, ID 21665, NM 011561.2,
NP_003202.3 NP 035691.2, NM 172552.3,
NP 766140.2
UNG ID 7374, NM 003362.3, ID 22256, NM 001040691.1,
NP 003353.1, NM 080911.2, NP 001035781.1,
NP 550433.1 NM 011677.2, NP 035807.2
XRCC1 ID 7515, 006297.2, NP 006288.2 ID 22594, NM 009532.4,
NP 033558.3
Nucleotide Excision Repair (NER)
ATXN3 ID 4287, NM 004993.5, ID 110616, NM 001167914.1,
NP 004984.2, NM 001164780.1, NP 001161386.1, NP 001158252.1, NM 001127696.1, NM_029705.3, NP_083981.2 NP 001121168.1, NM 030660.4,
NP 109376.1, NM 001164779.1,
NP 001158251.1, NM 001164781.1,
NP 001158253.1, NM 001127697.2,
NP 001121169.2, NM 001164774.1,
NP 001158246.1, NM 001164776.1,
NP 001158248.1, NM 001164777.1,
NP 001158249.1, NM 001164778.1,
NP 001158250.1. NM 001164782.1,
NP 001158254.1
BRIP1 ID 83990, NM 032043.2, ID 237911, NM 178309.2,
NP 114432.2 NP 840094.1
CCNH ID 902, NM 001199189.1, ID 66671, NM 023243.5,
NP 001186118.1, NM 001239.3, NP_075732.1
NP 001230.1
CDK7 ID 1022, NM 001799.3, ID 12572, NM 009874.3,
NP 001790.1 NP 034004.2
DDB 1 ID 1642, NM 001923.4, ID 13194, NM 015735.1,
NP 001914.3 NP 056550.1
DDB2 ID 1643, NM 000107.2, ID 107986, NM 028119.5,
NP 000098.1, NM 001300734.1, NP_082395.2
NP 001287663.1
ERCC1 ID 2067, NM 001166049.1, ID 13870, NM 001127324.1,
NP 001159521.1, NM 001983.3, NP 001120796.1, NP 001974.1, NM 202001.2, NM_007948.2, NP_031974.2 NP 973730.1
ERCC2 ID 2068, NM 000400.3, ID 13871, NM 007949.4,
NP 000391.1, NM 001130867.1, NP_031975.2
NP 001124339.1
ERCC3 ID 2071, NM 000122.1, ID 13872, NM 133658.1,
NP 000113.1, NM 001303416.1, NP_598419.1
NP 001290345.1, NM 001303418.1,
NP 001290347.1
ERCC4 ID 2072, NM 005236.2, ID 50505, NM 015769.2,
NP 005227.1 NP 056584.2
ERCC5 ID 2073, NM 000123.3, ID 22592, NM 011729.2,
NP 000114.2 NP 035859.2
ERCC6 ID 2074, NM 000124.3, ID 319955, NM 001081221.1,
NP 000115.1 NP 001074690.1
ERCC8 ID 1161 ID 71991
NM 000082.3→NP 000073.1 NM_028042.3→NP_082318.2
NM 001007233.2→
NP 001007234.1
NM 001007234.2→
NP 001007235.1
NM 001290285.1→
NP 001277214.1
LIG1 ID: 3978 ID: 16881
NM 000234.2, NP 000225.1 NM 001083188.1,
NM 001289063.1, NP 001275992.1 NP 001076657.1 NM 001289064.1, NP_001275993.1 NM 001199310.1,
NP 001186239.1
NM 010715.2,NP 034845.2
MMS19 ID 64210 ID 72199
NM 001289403.1→ NM 028152.3→NP 082428.1
NP 001276332.1
NM 001289404.1→
NP 001276333.1
NM 001289405.1→
NP 001276334.1
NM 022362.4→NP 071757.4
PNKP ID 11284 ID 59047
NM_007254.3→NP_009185.2 NM 001290764.1→
NP 001277693.1
NM 001290766.1→
NP 001277695.1
NM 001290767.1→
NP 001277696.1
NM 021549.3→NP 067524.2
POLL ID 27343 ID 56626
NM 001174084.1→ NM_020032.2→ NP_064416.1
NP 001167555.1
NM 001174085.1→
NP 001167556.1
NM 001308382.1→
NP 001295311.1
NM 013274.3→NP 037406.1
RAD23A ID 5886 ID 19358
NM 001270362.1→ NM 001297606.1→
NP 001257291.1 NP 001284535.1
NM 001270363.1→ NM 001297607.1→
NP 001257292.1 NP 001284536.1
NM 005053.3→NP 005044.1 NM 009010.5→NP 033036.2
RAD23B ID 5887 ID 19359
NM 001244713.1→ NM 009011.4→NP_033037.2
NP 001231642.1
NM 001244724.1→
NP 001231653.1
NM 002874.4→NP 002865.1
RPA1 ID: 6117 ID: 68275
NM_002945.3, NP_002936.1 NM_011728.2, NP_035858.2
RPA3 ID 6119 ID 68240
NM 002947.4→NP 002938.1 NM 026632.4→NP 080908.1
SLK ID 9748 ID 20874
NM 001304743.1→ NM 001164639.1→
NP 001291672.1 NP 001158111.1
NM 014720.3→NP 055535.2 NM 009289.3→NP 033315.2
XAB2 ID 56949 ID 67439
NM 020196.2→NP 064581.2 NM 026156.2→NP 080432.1
XPA ID: 7507 ID: 22590, NM 011728.2,
NM 000380.3, NP 000371.1 NP 035858.2
XPC ID: 7508 ID: 22591
NM 004628.4, NP 004619.3 NM 009531.2, NP 033557.2
Mismatch Repair (MMR)
ML H I ID: 4292 ID: 17350
NM 000249.3→NP 000240.1 NM_026810.2→NP_081086.2 NM 001167617.1→
NP 001161089.1
NM 001167618.1→
NP 001161090.1
NM 001167619.1→
NP 001161091.1
NM 001258271.1→
NP 001245200.1
NM 001258273.1→
NP 001245202.1
NM 001258274.1→
NP 001245203.1
MLH3 ID: 27030 ID: 217716
NM 001040108.1→ NM 001304475.1→
NP 001035197.1 NP 001291404.1
NM 014381.2→NP 055196.2 NM 175337.2→NP 780546.1
MSH2 ID: 4436 ID: 17685
NM 000251.2→NP 000242.1 NM_008628.2→ NP_032654.1 NM 001258281.1→
NP 001245210.1
MSH3 ID: 4437 ID: 17686, NM 001311120.1→
NM_002439.4→ NP_002430.3 NP 001298049.1
NM 010829.2→NP 034959.2
MSH4 ID 4438 ID 55993
NM_002440.3→ NP_002431.2 NM 001282054.1→
NP 001268983.1
NM 031870.3→NP 114076.1
MSH5 ID 4439 ID 17687
NM 002441.4→NP 002432.1 NM 001146215.2→
NM 025259.5→NP 079535.4 NP 001139687.1 NM 172165.3→NP 751897.1 NM_013600.3→NP_038628.2 NM 172166.3→NP 751898.1
MSH6 ID 2956 ID 17688
NM 000179.2→NP 000170.1 NM_010830.2→NP_034960.1
NM 001281492.1→
NP 001268421.1
NM 001281493.1→
NP 001268422.1
NM 001281494.1→
NP 001268423.1
PMS1 ID 5378 ID 227099
NM 000534.4→NP 000525.1 NM_153556.2→NP_705784.1
NM 001128143.1→
NP 001121615.1
NM 001128144.1→
NP 001121616.1
NM 001289408.1→
NP 001276337.1
NM 001289409.1→
NP 001276338.1
NP 001157742.1
NM 002875.4→NP 002866.2
NM 133487.3→NP 597994.3
RAD51C ID 5889 ID 114714
NM 002876.3→NP 002867.1 NM 001291440.1→
NM_058216.2→NP_478123.1 NP 001278369.1
NM 053269.3→NP 444499.1
RAD51B ID 5890 ID 19363
NM 002877.5→NP 002868.1 NM 001252562.1→
NM 133509.3→NP 598193.2 NP 001239491.1 NM 133510.3→NP 598194.1 NM 009014.3→NP 033040.2
RAD51D ID 5892 ID 19364
NM 001142571.1→ NM 001277938.1→
NP 001136043.1 NP 001264867.1
NM 002878.3→NP 002869.3 NM 001277939.1→
NM_133629.2→NP_598332.1 NP 001264868.1
NM 001277941.1→
NP 001264870.1
NM 001277942.1→
NP 001264871.1
NM 011235.4→NP 035365.1
RAD52 ID 5893 ID 19365
NM 001297419.1→ NM 001166381.1→
NP 001284348.1 NP 001159853.1
NM 001297420.1→ NM 001166382.1→
NP 001284349.1 NP 001159854.1
NM 001297421.1→ NM 001166383.1→
NP 001284350.1 NP 001159855.1
NM 001297422.1→ NM_011236.2→ NP_035366.2
NP 001284351.1
NM 134424.3→NP 602296.2
RAD54L ID 8438 ID 19366
NM 001142548.1→ NM 001122958.1→
NP 001136020.1 NP 001116430.1 NM_003579.3→NP_003570.2 NM 001122959.1→
NP 001116431.1
NM 009015.3→NP 033041.3
XRCC2 ID 7516 ID 57434
NM 005431.1→NP 005422.1 NM 020570.2→NP 065595.2
XRCC3 ID 7517 ID 74335
NM 001100118.1→ NM_028875.3→NP_083151.1
NP 001093588.1
NM 001100119.1→
NP 001093589.1
NM 005432.3→NP 005423.1
XRCC4 ID 7518 ID 108138
NM 001318012.1→ NM_028012.4→NP_082288.1 NP 001304941.1
M_001318013.1→
P_001304942.1
NM_003401.4→NP_003392.1
M_022406.3→NP_071801.1
NM 022550.3→NP 072044.1
XRCC5 ID 7520 ID 22596
NM 021141.3 NP 066964.1 NM 009533.2 NP 033559.2
XRCC6 ID 2547 ID 14375
NM_001288976.1→ NM 010247.2 NP 034377.2
NP_001275905.1
NM_001288977.1→
NP_001275906.1
NM_001288978.1→
NP_001275907.1
NM 001469.4→NP 001460.1
Other DNA Repair Genes
ATM ID 472 ID 11920
NM 000051.3 NP 000042.3 NM 007499.2 NP 031525.2
ATR ID 545 ID 245000
NM 001184.3 NP 001175.2 NM 019864.1 NP 063917.1
EXOl ID 9156 ID 26909
NM_003686.4 NP_003677.4 NM 012012.4 NP 036142.2 NM_006027.4 NP_006018.4
NM 130398.3 NP 569082.2
MGMT ID 4255 ID 17314
NM 002412.4 NP 002403.2 NM 008598.2 NP 032624.1
RAD 1 8 ID 56852 ID 58186
NM 020165.3 NP 064550.3 NM_001167730.1→
NP_001161202.1
NM 021385.2→NP 067360.2
RFC 1 ID 5981 ID 19687
NM_001204747.1→ NM 011258.2 NP 035388.2
NP_001191676.1
NM 002913.4→NP 002904.3
TOP3A ID 7156 ID 21975
NM 004618.3 NP 004609.1 NM 009410.2 NP 033436.1
TOP3B ID 8940 ID 21976
NM_001282112.1→ NM 011624.2 NP 035754.1
NP_001269041.1
NM_001282113.1→
NP_001269042.1
NM 003935.4→NP 003926.1
XRCC6BP1 ID 91419 ID 68876
NM 033276.2 NP 150592.1 NM_001159559.1→
NP_001153031.1
NM 026858.3→NP 081134.2
Interestingly, the two non-responsive BCBMs were derived from patients who had more cycles of chemotherapy and/or radiation therapy than other BCBM patients (Figure 12), which might have contributed to the high mutation burdens in their tumors.
In addition, G E-317 (also known as 5-(6-(3-methoxyoxetan-3-yl)-7-methyl-4- morpholinothieno[3,2-d]pyrimidin-2-yl)pyrimidin-2-amine), a GDC-0980 analog that inhibits both PI3K and mTOR while effectively crossing the blood brain barrier (Salphati et al. (2012) Clin. Cancer Res. 18:6239-6248), caused marked regression of DF-BM354 after treatment (40 mg/kg). G E-317 obtained from Genetcch was dissolved in 0.5%
methylcellulose/0.2% Tween 80 and given oral once/day at 40 mg/kg.
Thus, a variety of patient-derived xenograft models of HER2 -positive breast cancer brain metastases were established and used to determine that combined PI3K/mTOR inhibition leads to an unexpectedly durable remission in three of these five models, which share an increased expression level of AKT-mTOR pathway-dependent signature genes (Figure 8A). Whole exome sequencing (WES) revealed hypermutation genotypes in two non-responders with multiple mutations in DNA repair genes (Figure 8D). These DNA repair genes are important for protecting the genomic integrity, and mutations in these genes are likely to be associated with genomic instability (GIN) (Shiloh (2003) Nature Rev. Cancer 3 : 155-168; Aguilera and Garcia-Muse (2013) Annu. Rev. Genet. 47: 1-32; see also the Qiagen DNA repair gene list available at qiagen.com/us/shop/pcr/primer-sets/rt2- profiler-pcr-arrays?catno=PAHS-042Z-geneglobe). GIN has been associated with poor treatment response in cancer (Loeb (2011) Nat. Rev. Cancer 11 :450-457; Schlesner and Eils (2015) Genome Med. 7:31). The result described herein that GIN and resistance to mTOR inhibition are correlated does not stand in isolation: a recent analysis of metastatic breast cancer samples from the BOLERO-2 trial has also shown that higher GIN correlates with resistance to everolimus therapy (Hortobagyi et al. (2015) J. Clin. Oncol.
JCO.2014.60.1971 [epub ahead of print]). Since the combination of BKM120 and RADOOl is already under clinical evaluation in advanced solid malignancies (see clinical trial NCT01470209), the translation of our preclinical findings could be fast-tracked into a clinical trial for HER2-positive BCBM patients. More broadly, the results demonstrated herein indicate that the use of brain metastasis-specific PDX models facilitates the integration of phenotypic and genotypic analyses, and the personalized preclinical testing of targeted therapies. This is believed to shorten timelines for development of clinical trials and potentially improve patient outcomes.
Incorporation by Reference
All publications, patents, and patent applications mentioned herein are hereby incorporated by reference in their entirety as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference. In case of conflict, the present application, including any definitions herein, will control.
Also incorporated by reference in their entirety are any polynucleotide and polypeptide sequences which reference an accession number correlating to an entry in a public database, such as those maintained by The Institute for Genomic Research (TIGR) on the world wide web at tigr.org and/or the National Center for Biotechnology Information (NCBI) on the World Wide Web at ncbi.nlm.nih.gov.
Equivalents
Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.
Claims
1. A method of treating a subject afflicted with a brain metastasis from an extracranial cancer comprising administering to the subject a therapeutically effective amount of at least one agent that inhibits or blocks both PI3K and mTOR.
2. The method of claim 1, wherein the at least one agent is a small molecule inhibitor for both PI3K and mTOR.
3. The method of claim 1, wherein the at least one agent is a synergistic combination of agents comprising a first agent that selectively inhibits or blocks PI3K and a second agent that selectively inhibits or blocks mTOR.
4. The method of claim 3, wherein said first agent and said second agent comprise a small molecule that inhibits or blocks PI3K and/or mTOR.
5. The method of claim 1 or 3, wherein the at least one agent comprises an RNA interfering agent which inhibits expression of PI3K and/or mTOR.
6. The method of claim 5, wherein the RNA interfering agent is a small interfering RNA (siRNA), small hairpin RNA (shRNA), or a microRNA (miRNA).
7. The method of claim 1 or 3, wherein the at least one agent comprises an antisense oligonucleotide complementary to PI3K and/or mTOR.
8. The method of claim 1 or 3, wherein the at least one agent comprises a peptide or peptidomimetic that inhibits or blocks PI3K and/or mTOR.
9. The method of claim 1 or 3, wherein the at least one agent comprises an aptamer that inhibits or blocks PI3K and/or mTOR.
10. The method of claim 1 or 3, wherein the at least one agent is an intrabody, or an antigen binding fragment thereof, which specifically binds to PI3K protein and/or mTOR protein.
11. The method of claim 10, wherein the intrabody, or antigen binding fragment thereof, is murine, chimeric, humanized, composite, or human.
12. The method of claim 10 or 11, wherein the intrabody, or antigen binding fragment thereof, is detectably labeled, comprises an effector domain, comprises an Fc domain, and/or is selected from the group consisting of Fv, Fav, F(ab')2), Fab', dsFv, scFv, sc(Fv)2, and diabodies fragments.
13. The method of any one of claims 10-12, wherein the intrabody, or antigen binding fragment thereof, is conjugated to a cytotoxic agent.
14. The method of claim 13, wherein the cytotoxic agent is selected from the group consisting of a chemotherapeutic agent, a biologic agent, a toxin, and a radioactive isotope.
15. The method of any one of claims 1-14, wherein the PI3K is a class I PI3K.
16. The method of claim 15, wherein the class I PI3K is selected from the group consisting of PIK3CA, PIK3CB, PIK3CG, and PIK3CD.
17. The method of claim 16, wherein the class I PI3K is PIK3CA, PIK3CB, PIK3CG, and PIK3CD.
18. The method of any one of claims 1-17, wherein the mTOR is inhibited or blocked within both an mTORCl complex and an mTORC2 complex.
19. The method of any one of claims 1-18, wherein the at least one agent comprises 5-(2,6-dimorpholin-4-ylpyrimidin-4-yl)-4-(trifluoromethyl)pyridin-2-amine (BKM120) and dihydroxy-12-[(2R)-l-[(l S,3R,4R)-4-(2-hydroxyethoxy)-3- methoxycyclohexyl]propan-2-yl]- 19,30-dimethoxy- 15,17,21 ,23 ,29,35-hexamethyl- 11,36- dioxa-4-azatricyclo[30.3.1.0 hexatriaconta-16,24,26,28-tetraene-2,3,10, 14,20-pentone (RAD001).
20. The method of any one of claims 1-19, wherein the at least one agent inhibits phosphorylation of S6RP and/or 4EBP1.
21. The method of any one of claims 1-20, wherein the at least one agent reduces the number of proliferating cells in the brain metastasis and/or increases the number of apoptotic cells in the brain metastasis.
22. The method of claim 21, wherein the at least one agent reduces the number of cells expressing KI67 in the brain metastasis and/or increases the number of cells expressing cleaved caspase-3 in the brain metastasis.
23. The method of any one of claims 1-22, wherein the at least one agent is administered in a pharmaceutically acceptable formulation.
24. The method of any one of claims 1-23, further comprising administering to the subject a therapeutic agent or regimen for treating the brain metastasis.
25. The method of any one of claims 1-24, wherein the brain metastasis and/or extracranial cancer has significantly increased expression of at least 1 AKT-mTOR- dependent gene relative to a cancer whose proliferating cells are not reduced or whose apoptotic cells are not increased with a combination treatment of BKM120 and RAD001, wherein the AKT-mTOR-dependent gene is selected from the group consisting of AKT1, BIK, BSG, DDRl, CDC34, CLDN3, CYB561, GPX4, HNRPAB, LASPl, MMP15, MVK, NEDD8, NEU1, PCTK1, POR, PRKCD, PVRL2, SPINT1, UBE2M, TMED10, DUSP10, CLSTNl, PMPCA, BRMSl, TJP3, ARHGEF16, ADIPORl, SLC37A1, KCTD5, TOLLIP, SYNJ2BP, RNF126, and COROIB.
26. The method of claim 25, wherein the brain metastasis and/or extracranial cancer has an increased expression of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, or 34 AKT-mTOR- dependent genes.
27. The method of any one of claims 1-26, wherein the brain metastasis and/or extracranial cancer has a mutation in at least 1 DNA repair protein gene that encodes a nonfunctional DNA repair protein, or express at least 1 DNA repair protein that is
nonfunctional.
28. The method of claim 27, wherein the at least 1 DNA repair protein gene or protein is selected from the group consisting of DNA repair protein genes or proteins in Table 2, APEXl, ATM, ATR, BRCAl, BRCA2, BRIPl, ERCC2, ERCC4, ERCC6, KLC3, LIG1, LIG3, MPG, MSH3, MSH5, MSH6, NEIL3, NPRL3, NTHL1, PARP2, PGBD3, PRKDC, PMS2, POLL, PRKDC, RAD 18, RAD23B, RAD54L, RPAl, SLK, TMEM55B, TOP3B, XRCC3, and XRCC6BP1.
29. The method of any one of claims 1-28, wherein the brain metastasis and/or extracranial cancer has about 20 synonymous or non-synonymous somatic mutations or fewer per megabase of genomic DNA.
30. The method of claim 29, wherein the brain metastasis and/or extracranial cancer has about 10 synonymous or non-synonymous somatic mutations or fewer per megabase of genomic DNA.
31. The method of any one of claims 1-30, wherein the extracranial cancer is not a central nervous system (CNS) or a peripheral nervous system (PNS) cancer.
32. The method of any one of claims 1-31, wherein the extracranial cancer is selected from the group consisting of breast, lung, colorectal carcinoma, melanoma, kidney, bladder, ovarian, and urethral cancers.
33. The method of claim 32, wherein the extracranial cancer is breast cancer.
34. The method of claim 33, wherein the breast cancer is HER2-positive.
35. The method of any one of claims 1-34, wherein the subject is an animal model of a brain metastasis from an extracranial cancer.
36. The method of claim 35, wherein the animal model is an orthotopic xenograft animal model of a human-derived brain metastasis from a human extracranial cancer.
37. The method of claim 36, wherein the animal model is a mouse model.
38. The method of any one of claims 1-34, wherein the subject is a mammal.
39. The method of claim 38, wherein the mammal is a mouse or a human.
40. The method of claim 39, wherein the mammal is a human.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US16/070,980 US11318139B2 (en) | 2016-01-26 | 2017-01-25 | Methods for treating brain metastases using combinations of anti-P13K and anti-mTOR agents |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201662287211P | 2016-01-26 | 2016-01-26 | |
| US62/287,211 | 2016-01-26 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2017132235A1 true WO2017132235A1 (en) | 2017-08-03 |
Family
ID=59398600
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2017/014896 Ceased WO2017132235A1 (en) | 2016-01-26 | 2017-01-25 | METHODS FOR TREATING BRAIN METASTASES USING COMBINATIONS OF ANTI-P13K AND ANTI-mTOR AGENTS |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US11318139B2 (en) |
| WO (1) | WO2017132235A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112813046A (en) * | 2021-01-08 | 2021-05-18 | 北京大学 | PTEN subtype protein and application thereof |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114292895A (en) * | 2022-02-10 | 2022-04-08 | 上海交通大学医学院附属第九人民医院 | Application of substance for detecting PARP inhibitor tolerance in preparation of product for evaluating sensitivity of lung cancer patient to proton radiotherapy |
| WO2024119148A1 (en) * | 2022-12-02 | 2024-06-06 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Topoisomerase iii (top3) inhibitors and antiviral compounds based on bisacridines |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20130245028A1 (en) * | 2012-03-15 | 2013-09-19 | Signal Pharmaceuticals, Llc | Treatment of cancer with tor kinase inhibitors |
| CA2906542A1 (en) * | 2013-03-15 | 2014-09-25 | Intellikine, Llc | Combination of kinase inhibitors and uses thereof |
| US20150266939A1 (en) * | 2012-03-15 | 2015-09-24 | Permeon Biologics, Inc. | Cell penetrating compositions for delivery of intracellular antibodies and antibody-like moieties and methods of use |
| US20150374692A1 (en) * | 2013-02-19 | 2015-12-31 | The Brigham And Women's Hospital, Inc. | Methods and compositions relating to the treatment of cancer |
-
2017
- 2017-01-25 US US16/070,980 patent/US11318139B2/en active Active
- 2017-01-25 WO PCT/US2017/014896 patent/WO2017132235A1/en not_active Ceased
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20130245028A1 (en) * | 2012-03-15 | 2013-09-19 | Signal Pharmaceuticals, Llc | Treatment of cancer with tor kinase inhibitors |
| US20150266939A1 (en) * | 2012-03-15 | 2015-09-24 | Permeon Biologics, Inc. | Cell penetrating compositions for delivery of intracellular antibodies and antibody-like moieties and methods of use |
| US20150374692A1 (en) * | 2013-02-19 | 2015-12-31 | The Brigham And Women's Hospital, Inc. | Methods and compositions relating to the treatment of cancer |
| CA2906542A1 (en) * | 2013-03-15 | 2014-09-25 | Intellikine, Llc | Combination of kinase inhibitors and uses thereof |
Non-Patent Citations (1)
| Title |
|---|
| MCNAMARA ET AL.: "Small-molecule inhibitors of the PI3K signaling network", FUTURE MED CHEM, vol. 3, 1 April 2011 (2011-04-01), pages 549 - 565 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112813046A (en) * | 2021-01-08 | 2021-05-18 | 北京大学 | PTEN subtype protein and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| US11318139B2 (en) | 2022-05-03 |
| US20190015422A1 (en) | 2019-01-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20160299146A1 (en) | Kynurenine Pathway Biomarkers Predictive of Anti-Immune Checkpoint Inhibitor Response | |
| US20210267991A1 (en) | Methods for treating pten deficient epithelial cancers using a combination of anti-pi3kbeta and anti-immune checkpoint agents | |
| AU2016229238B2 (en) | PD-L2 biomarkers predictive of PD-1 pathway inhibitor responses in esophagogastric cancers | |
| US11377696B2 (en) | PBRM1 biomarkers predictive of anti-immune checkpoint response | |
| JP7466308B2 (en) | Compositions and methods for identifying, evaluating, preventing, and treating AML using USP10 biomarkers and modulators - Patents.com | |
| US11674950B2 (en) | Methods determining and treating cellular resistance to ADP-rtbosylating toxin | |
| EP3204516B1 (en) | Angiopoietin-2 biomarkers predictive of anti-immune checkpoint response | |
| AU2015267008A1 (en) | Activating JAK kinase biomarkers predictive of anti-immune checkpoint inhibitor response | |
| US20190071668A1 (en) | Compositions and methods for identification, assessment, prevention, and treatment of cancer using slncr isoforms | |
| US11852631B2 (en) | Biomarkers predictive of anti-immune checkpoint response | |
| WO2019014664A1 (en) | Modulating biomarkers to increase tumor immunity and improve the efficacy of cancer immunotherapy | |
| US11366100B2 (en) | P13K-MTORC1-S6K1 signaling pathway biomarkers predictive of anti-cancer responses | |
| US10947596B2 (en) | Compositions and methods for identification, assessment, prevention, and treatment of cancer using NFS1 biomarkers and modulators | |
| US11318139B2 (en) | Methods for treating brain metastases using combinations of anti-P13K and anti-mTOR agents | |
| US12050219B2 (en) | Modulating biomarkers such as SPP to increase tumor immunity and improve the efficacy of cancer immunotherapy | |
| US12560609B2 (en) | Biomarkers predictive of cancer cell response to ML329 or a derivative thereof | |
| US10378060B2 (en) | ZNF365/ZFP365 biomarker predictive of anti-cancer response | |
| CA2977532C (en) | Pd-l2 biomarkers predictive of pd-1 pathway inhibitor responses in esophagogastric cancers | |
| HK40006303B (en) | Methods for treating pten deficient epithelial cancers using a combination of anti-pi3kbeta and anti-immune checkpoint agents |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 17744821 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 17744821 Country of ref document: EP Kind code of ref document: A1 |
