WO2017127357A1 - Dna aptamers targeting the cholecystokinin b receptor and methods of using same - Google Patents

Abstract

A DNA aptamer is provided that binds to a cholecystokinin B receptor (CCBKR), allowing for delivery of therapeutic agents or imaging agents to cells having the CCBKR. Compositions and methods of use are provided where the aptamer binds to CCBKR and the agent is delivered such that it may be detected within the cytoplasm of the cell. Further provided are sequences of the nucleic acid molecules that bind to the amino acid residues 5-21 and/or 40-57 of the CCBKR polypeptide, and methods of delivery of a therapeutic agent to pancreatic adenocarcinoma cells.

Description

DNA APTAMERS TARGETING THE CHOLECYSTOKININ B RECEPTOR AND METHODS OF USING SAME

REFERENCE TO RELATED APPLICATION

This application claims priority to previously filed and co-pending provisional application USSN 62/279,947, filed January 18, 2016, the contents of which are incorporated herein by reference in its entirety.

GRANT REFERENCE

This invention was made with government support under Grant Nos. CA167535 and CA170121, awarded by the National Institutes of Health. The Government has certain rights in the invention.

SEQUENCE LISTING

The instant application contains a Sequence Listing which has been submitted in ASCII format via EFS-Web and is hereby incorporated by reference in its entirety. Said ASCII copy, created on January 16, 2017, is named Clawson - P11610US01 Sequence Listing_ST25.txt and is 23,314 bytes in size.

FIELD OF THE INVENTION

The present disclosure relates to DNA aptamers and aptamer conjugates that selectively bind CCKBR expressed on cells, their use in diagnosis, prevention and treatment of pancreatic adenocarcinoma and other CCKBR associated disorders.

BACKGROUND OF THE INVENTION

Pancreatic ductal adenocarcinoma (PDAC) is the fourth-leading cause of cancer- related deaths in the USA ^l, and by 2030 PDAC is predicted to be the 2^nd leading cause of cancer-related deaths ² . Most PDAC patients are not candidates for surgery and systemic chemotherapy shows little benefit . The dense stroma and hypovascularization of PDAC tumors decreases the bioavailability of systemically delivered drugs and contributes to chemoresistance. Since passive, non-targeted delivery of therapeutic agents has been ineffective, designing new targeting modalities that engage with specific molecules on the surface of tumor and/or stromal cells is essential. Delivery of conventional chemotherapeutic drugs such as 5-fiuorouracil and gemcitabine is hampered by issues of rapid clearance, metabolic inactivation of drug and a lack of selectivity. Furthermore, these properties result in systemic toxicities toward normal cells and a poor drug dose at the tumor site ⁴. By engineering delivery systems to safely and efficiently deliver cargos to tumors through the use of tumor cell targeting agents, off-target drugs effects could be avoided and the tumor-specific concentrations of cargo constituents should be increased ⁵.

Most pancreatic ductal adenocarcinoma (PDAC) patients survive less than six months from their time of diagnosis, due to the inability to diagnose PDAC at an early stage coupled with lack of effective treatment modalities. Targeted nanoparticles (NPs) that deliver improved doses of chemotherapeutic drugs specifically to PDACs could improve chemotherapic efficacy while avoiding toxicities typically associated with systemic drug administration. Identification of biomolecules that enhance the uptake of NP-encapsulated drugs by PDAC cells is required to achieve this outcome. SUMMARY

A DNA aptamer, referred to as AP 1 153 is provided which selectively binds to the cholecystokinin type B receptor (CCKBR). CCKBR is a plasma membrane receptor expressed on certain carcinoma cells. The aptamer binds to the amino acid region of residues 5 - 21 and/or 40 - 57 of the CCKBR polypeptide. The aptamer provides for selective binding and delivery to the CCKBR cell of a therapeutic and/or imaging agent coupled with the aptamer and demon strates a higher affinity for CCKBR than the native gastrin ligand. The aptamer is useful in imaging or delivery of a therapeutic agent to disorders caused by CCKBR cells, such as pancreatic adenocarcinoma cells. BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 is a graphic of sequences (A); sequence comparisons(B); a graph (C); and gels (D) showing the selection of CCKBR-binding DNA aptamers. A. Peptide sequences of the two regions of the CCKBR N- terminus (amino acids 5-21 (SEQ ID NO: 2) and 40-57 (SEQ ID NO: 3)) used for initial aptamer selection, and the sequence of the corresponding regions from the CCKAR. Residues underlined are identical between the human and mouse CCKBR proteins. B. Dendrogram comparison of the DNA sequence for selected CCKBR aptamers. Aptamers boxed were identified for further individual characterization. C. Proliferation of PANC-1 human pancreatic cancer cells in the presence of CCKBR- selected aptamers or human recombinant EGF, a pro-proliferative control. Bars represent the standard error of the mean of three experimental replicates. None of the selected aptamers significantly stimulated pancreatic cancer cell proliferation compared to vehicle treated cells. *=p<0.05, **=p<0.01 compared to vehicle. D. Western blots of vehicle (V), gastrin- 17 (G), or AP 1153 (A) treated PANC-1 cells demonstrated than although gastrin- 17 stimulates Akt phosphorylation, AP 1153 did not.

Figure 2 is a graphic (A) and graphs (B), (C) showing CCKBR-selected Aptamer 1153 characterization. A. Mfold predicted secondary structure of Aptamer 1153 (AP 1153), which was selected as having the most stable secondary structure. B. Dissociation constant (Kd) determination for AP 1153 against CCBR peptide. The 66-nucleotide version of the AP 1153 (upper panel) and 49-nucleotide version of AP 1153, which lacks the 3' region that was fixed in all aptamers in the original library (lower panel), had slightly different Kd values (15.5 pM vs 206.2 pM).

Figure 3 are confocal images (A) - (K) and graphs (L), (M) showing AP 1153 uptake by PANC-1 cells is medicated through the CCKB Receptor. Representative 3D confocal images showing AP 1153 distributions in cultured PANC1 cells which over- express CCKBR (A-C), PANC-1 wild-type cells (D) and PANC-1 cells where the CCKBR has been knocked down by stable shRNA transfection (E). The aptamer distributions are shown in green while quantified voxels are shown yellow. Blue represents cell nuclei. Uptake of a non-specific aptamer, AP 38, by PANC-1 cells overexpressing CCKBR (F), wild- type (G) and CCKBR knock-down cells (H) is significantly less than AP 1153 (L). All PANC-1 cells treated only with vehicle (I-K), show minimal background fluorescence. Integrated signal intensities from cell volumes (M) show that the CCKBR overexpressing cells take up significantly more AP 1153 than do either wild-type cells (WT) or CCKBR knock-down cells (KO) [* = P values < 0.05].

Figure 4 is a graphic showing bioconjugation strategies for targeted CPSNPs. A. Schematic of the steps used to bioconjugate either G16 peptide or API 153 to the surface of CPSNPSs. After activation of the nanoparticle surface with PEG derivatives,

functionalization with either the 1153 aptamer or G16 peptide was done as outlined.

Figure 5 is a graph showing Zeta Potential of CPSNPs synthesized with various surface functionalization. CPSNP surface functionalization with G16 peptide slightly decreases nanoparticle zeta potential, while bioconjugation with AP 1153 results in a significantly less negative zeta potential. Bars represent the 95% confidence interval of the mean of four independent measurements.

Figure 6 is a TEM micrograph of AP1153-PEG-ICG-CPSNPS with inset highlighting the bimodal particle size distribution. The majority of CPSNPs are 30 +/- 12 nm whereas the tail distribution consists of larger particles, representing approximately 20% of the population, that are 121 +/- 5 nm in diameter.

Figure 7 are photos of near-infrared imaging showing CCKBR-aptamer enhances CPSNP up-take by PANC-1 tumors in vivo. Athymic mice with established PANC-1 orthotopic tumors were treated with a single injection of ICG-loaded CPSNPs,

bioconjugated with targeting agents as indicated, with unloaded, empty particles (Methoxy- PEG-ghost-CPSNPs), or with free ICG. ICG up-take by tumors was assessed by whole body near-infrared imaging 15 hours post-tail vein injection of particles. False-color scale used to indicate ICG fluorescence intensity is shown at the right. AP 1153 targeted particles are more concentrated in the orthotopic tumors than

Figure 8 are microscopy images showing enhanced delivery of API 153- bioconjugated CPSNPs to Orthotopic PDACs. Ex vivo imaging of whole tumor cross sections with multiphoton microscopy demonstrated the location of ICG-loaded CPSNPs (false colored in red) relative to collagenous fibrotic regions of the tumor (blue). (A) Mice bearing tumors and injected with CPSNPs without ICG (ghost particles) showed little background fluorescence. (B) Tumors from mice injected with untargeted ICG-CPSNPs (with no aptamer bioconjugation) had some minimal tumoral uptake over background. (C, D) Tumors from two separate mice injected with API 153-targeted ICG-CPSNPs showed increased ICG signal throughout the tumor sections. A 50 μιτι scale bar is shown in the lower left corner of panel A. PDAC, pancreatic ductal adenocarcinoma.

Figure 9 are 3D multiphoton images representing thick sections of orthotopic PDACs. Images show the spatial distributions of collagen (blue) along with ICG-loaded CPSNPs (red). (A) Ghost-CPSNPs; (B) untargeted-CPSNP; (C) AP-CPSNPs.

Figure 10 is a graph showing CCKBR-targeted CPSNPs deliver active FdUMP to PDAC tumors in vivo. Levels of active thymidylate synthase (unbound TS) was determined by immunoblotting, and reflects that amount of the TS inhibitor FdUMP taken up by PANC-1 tumors in mice treated with various CPSNP formulations (n= 5 mice/treatment group). Tumors from mice treated with empty (non-drug containing) CPSNPs (#1 , black bar) or untargeted mPEG-FdUMP-CPSNPs (#2, grey bar) had equivalent amounts of unbound, active TS, suggesting that untargeted particles were not efficiently taken up by tumor cells in vivo. Although the mean TS levels in tumors from gastrin-16 peptide targeted-mPEG-FdUMP-CPSNPs treated mice was decreased (#4, light hatched), only tumors in mice treated with CCKBR aptamer targeted mPEG-FdUMP- CPSNPs (#3, dark hatched) had significantly reduced TS levels (*p<0.05) compared to empty CPSNP or untargeted mPEG-FdUMP-CPSNP controls. Bars represent ± SEM of 2 independent experiments.

DETAILED DESCRIPTION

The present invention now will be described more fully hereinafter with reference to the accompanying examples, in which some, but not all embodiments of the invention are shown. Indeed, the invention may be embodied in many different forms and should not be construed as limited to the embodiments set forth herein; rather, these embodiments are provided so that this disclosure will satisfy applicable legal requirements. Like numbers refer to like elements throughout. References referred to herein are incorporated by reference in their entirety.

Many modifications and other embodiments of the invention set forth herein will come to mind to one skilled in the art to which this invention pertains, having the benefit of the teachings presented in the descriptions and the drawings herein. Therefore, it is to be understood that the invention is not to be limited to the specific embodiments disclosed and that modifications and other embodiments are intended to be included within the scope of the appended claims. Although specific terms are employed herein, they are used in a generic and descriptive sense only and not for purposes of limitation.

The articles "a" and "an" are used herein to refer to one or more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one or more than one element.

The methods described herein can be utilized with any convenient drug or imaging agent. When referring to a drug is meant a substance or compound that can be used in the diagnosis, treatment or prevention of a disease or as a component of a medication. Imaging agents are compounds designed to allow improved imaging of specific organs, tissues, tumors, diseases or physiological functions within a mammalian body.

Additionally, other agents may be included in compositions described, and in an embodiment include those useful in the treatment of tumors. Exemplary agents include apoptosis inducers such as bioactive lipids, including ceramide or dihydroceramide, DNA, plasmids, shRNA, siRNA, antineoplastic chemotherapeutics, other agents that useful in inhibiting or treating tumors.

Nanoparticle (NP) targeting often employs ligands such as peptides or antibodies which recognize molecules specifically expressed or overexpressed on tumor cells. NP targeting often does not impact extravasation of particles from the vasculature, which generally occurs via EPR (Enhanced Permeability and Retention - a combination of tissue features related to tumor oncotic pressure, pH, and disorganization of vascular

endothelium). Rather, it is hypothesized that tumor-cell targeting agents directly enhance the cellular uptake of the particles following their exit from the leaky tumor vasculature. Transferrin and folate, ligands which bind to their cognate receptors on tumor cells, are two examples of commonly used active targeting agents^{7 8}. Many actively targeted

nanomedicines are antibody-drug conjugates such as a humanized anti-CD33 monoclonal antibody attached to the calicheamicin, a drug used in the treatment of leukemia and lymphoma ⁹. However, targeting NPs with peptides or antibodies has limitations, including potential immunogenicity, relatively high cost, and serum instability.

Alternate approaches utilizing non-peptide targeting biomolecules, such as RNA or DNA aptamers (APs) that specifically recognize surface proteins on cancer cells, are being explored¹⁰. An AP is a single-stranded, structured RNA or DNA molecule that can bind to protein targets with affinities comparable to or better than antibodies with low

immunogenicity and better tumor penetration due to their smaller size¹¹. APs for specific targets can be generated a using selection strategy known as systematic evolution of ligands by exponential enrichment (SELEX), an approach in which randomly -generated libraries of ssDNA are incubated with the binding target. DNAs that bind to the target are partitioned away from non-binders, amplified to generate a new pool, and the process is repeated until a stable pool of sequences is achieved. SELEX-generated APs against the prostate tumor marker PMSA have been used to safely and effectively direct

chemotherapeutic drugs to prostate tumor cells^{12 13}. More recently, EGF-receptor targeted APs conjugated to a gemcitabine-containing polymer inhibit in vitro proliferation of PDAC cells ¹⁴. Several therapeutic APs and AP -targeted delivery systems have moved into clinical trials^{15 16}.

Amorphous calcium-phosphosilicate nanoparticles (CPSNPs), biocompatible and biodegradable composite particles of less than 100 nm, are attractive candidates for bioimaging and therapeutic delivery applications. CPSNPs are relatively insoluble at physiological pH but have increasing solubility below pH 6.5. Thus particles remain intact in the blood stream but, when taken up by receptor-mediated endocytosis, will dissolve in the low pH of endocytic vesicles resulting in the intracellular release of the CPSNP cargo ⁶.

The cell surface G protein coupled receptor cholecystokinin B receptor, CCKBR, which is over-expressed in many types of cancers, plays a role in tumor cell proliferation¹⁷. Natural CCKBR ligands gastrin and CCK, as well as CCKBR antagonists such as lorglumide, have been attached to nanocarriers, radionuclides and imaging agents to improve their up-take by tumor cells^{18 19}'²⁰'^{21 22 23}. Recent studies demonstrate that gastrin attachment to iron oxide NPs enabled the NPs to undergo CCKBR-mediated

internalization²⁴.

Our previous work has shown that the CCKBR ligand gastrin attached to CPSNPs can actively target an imaging agent cargo (indocyanin green, ICG) to PDAC tumors in vivo ²⁵. However like most peptide targeting agents, the use of gastrin (or CCK) to direct cargo specifically to tumor cells has been hampered by off-target binding, especially in the brain in the case of gastrin, as well as relatively high cost and serum instability/proteolytic degradation⁵ . Moreover, peptide targeting agents such as gastrin can stimulate the CCKB receptor, actually leading to proliferative signaling. Here we describe selection and characterization of high-affinity DNA APs to the CCKBR. We demonstrate that compared to gastrin, a high-affinity CCKBR AP bioconjugated to the NP surface can improve CPSNP uptake into PDAC tumor cells in vivo.

Here we describe selection, characterization and targeting efficacy of a DNA aptamer (AP) that binds to a cell surface G-protein coupled receptor found on PDAC cells, the cholecystokinin B receptor (CCKBR). The CCKBR)is a plasma membrane receptor, which is expressed specifically on the surface of pancreatic ductal adenocarcinoma

(PDAC) cells, with little or no expression on other adult cell types. The CCKBR has some short regions of amino acids which are exposed on the surface of the PDAC cells. The cholecystokinin type B receptor of Homo sapiens is one such CCKBR, and is found at NCBI Reference No. NP_795344.1 (2015) and is SEQ ID NO: 1. Here we synthesized two of these regions, specifically amino acid residues 5-21 (SEQ ID NO: 2) and residues 40-57 (SEQ ID NO: 3) of the CCKBR sequence), and coupled them onto glass beads. Using dual SELEX selection against an "exposed" CCKBR peptide and CCKBR- expressing PDAC cells, a pool of a few thousand DNA APs was identified. Further down- selection was based on binding affinity of AP, predicted secondary structure, and confirmation that the AP does not activate CCKBR signaling or stimulate tumor cell proliferation. These characteristics resulted in the choice of API 153 (SEQ ID NO: 4) for further studies. 3D Confocal microscopy showed that API 153 is internalized by PDAC cells in a receptor-mediated fashion. Compared to non-targeted or gastrin peptide-targeted NPs, bioconjugation of API 153 to the surface of fluorescent NPs substantially improved the delivery of NP cargos to PDAC tumors in vivo. The selectivity of this AP -targeted NP delivery system for PDAC cells holds considerable promise for enhanced early detection of PDAC lesions, as well as improving chemotherapic treatments for PDAC patients with fewer side-effects.

In accordance with the invention, a nucleic acid molecule capable of binding CCKBR is provided. In some embodiments, the nucleic acid molecule capable of binding CCKBR prevents interactions between CCKBR and its natural ligands. In some embodiments, the nucleic acid molecule binds CCKBR with pM affinity. In further embodiments, a nucleic acid molecule that selectively binds CCKBR with pM affinity. In some embodiments, a nucleic acid molecule that selectively binds CCKBR comprises a nucleic acid sequence selected from the group of SEQ ID NOs in Table 1 below. In some embodiments, a nucleic acid molecule that comprises modified nucleotides. In some embodiments, a nucleic acid molecule capable of selectively binding CCKBR is an aptamer. In some embodiments, the aptamer is a thioaptamer. In some embodiments, a nucleic acid molecule capable of selectively binding CCKBR consists of SEQ ID NO: 4. In some embodiments, a nucleic acid molecule capable of selectively binding CCKBR comprises one or more pharmaceutically acceptable salts. In some embodiments, an isolated nucleic acid molecule is provided that selectively binds to a CCKBR protein and comprises a contiguous nucleotide sequence that binds to amino acids regions 5-21 and/or 40-57 of a CCKBR protein. According to some embodiments, an isolated nucleic acid molecule contains double-stranded stem structures at the 5' and 3' ends. The composition can comprise an above-described nucleic acid molecule and one or more therapeutic compounds, and/or one or more imaging agents. In some embodiments, the nucleic acid molecule may be coupled to a therapeutic agent or an imaging agent, or both. The composition can comprise a conjugate containing a particle coupled to the nucleic acid molecule. In some

embodiments, the imaging agent is attached to the particle or to the nucleic acid molecule, or is attached to both. In some embodiments, a pharmaceutical composition comprises a nucleic acid molecule that selectively binds CCKBR, to target one or more compounds to a tissue expressing CCKBR, wherein binding of the nucleic acid molecule to CCKBR on the target tissue enhances therapeutic activity of the compounds and/or reduces adverse reactions associated with toxicity of the compounds.

In some embodiments, a composition for imaging a target tissue bearing CCKBR, comprises a liposome or liposomal nanoparticle and a nucleic acid molecule coupled to the liposomes or liposomal nanoparticles to form a conjugate wherein the nucleic acid molecule is capable of selectively binding CCKBR on target tissue. An imaging agent may be associated with the liposome or liposomal nanoparticle or the nucleic acid molecule. In some embodiments, a composition for imaging target tissue bearing CCKBR comprises at least one imaging agent; liposomes or liposomal nanoparticles coupled to a imaging agent; and a nucleic acid molecule coupled to each liposomal nanoparticle to form a conjugate, wherein the nucleic acid molecule selectively binds CCKBR, and targets the composition to tissue bearing CCKBR.

In further embodiments, a composition for imaging target tissue bearing CCKBR comprises at least one imaging agent; calcium phosphosilicate nanoparticles; and nucleic acid molecules capable of selectively binding CCKBR to target the composition to tissue bearing CCKBR, wherein each nucleic acid molecule is coupled to a nanoparticle, and a imaging agent is coupled to either the nanoparticles or the nucleic acid molecules, to form a conjugate.

In still further embodiments, a composition is provided that delivers a therapeutic agent to pancreatic adenocarcinoma cells in a patient. Such method can comprise administering intravenously a composition according wherein liposomal nanoparticles contain therapeutic agent; causing conjugate to selectively bind to CCKBR on pancreatic adenocarcinoma cells; and causing therapeutic agent to be released from liposomal nanoparticles of conjugate bound to CCKBR on the same. In some embodiments, the nucleic acid molecule is an aptamer, and, in some cases, it is a thioaptamer comprising the nucleotide sequence selected from the group of SEQ ID NOs: Table 1. Note that 3 '-SH- jjjjj _woui(j ¾e added to the 3 ' end of the aptamer sequences shown in Table 1. In some embodiments, the nucleic acid molecule comprises an aptamer having the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5 and to which at the 3 ' end is added 3 '-SH- TTTTT, thus forming a thioaptamer.

According to other aspects of the invention a composition for imaging pancreatic adenocarcinoma cells or other CCKBR associated diseases comprises at least one imaging agent; liposomal nanoparticles; and aptamers coupled to liposomes or liposomal nanoparticles to form a conjugate, wherein the aptamers comprise the nucleotide sequence selected from the group of sequences in Table 1 and a imaging agent is associated with either the liposomes or liposomal nanoparticles or the thioaptamers, to form a conjugate wherein the aptamers are capable of selectively binding to CCKBR on pancreatic adenocarcinoma cells. In certain embodiments, the thioaptamer has the nucleotide sequence of SEQ ID NO: 5, the sequence depicted in Figure 2A.

In some embodiments, a method of making an imaging agent for locating pancreatic adenocarcinoma cells and/or other CCKBR associated disease states in an individual comprises associating one or more imaging agents with a liposomal nanoparticle and/or with an aptamer that selectively binds CCKBR; and coupling the liposomal nanoparticle with the aptamer to form an aptamer-liposomal nanoparticle conjugate associated with at least one imaging agent. In some embodiments, a method of imaging pancreatic adenocarcinoma cells and other CCKBR disease states comprises administering intravenously to an individual an aptamer-liposomal nanoparticle conjugate associated with at least one imaging agent; causing the conjugate to selectively bind to CCKBR on pancreatic adenocarcinoma cells and other diseases in which CCKBR is aberrantly expressed; and visualizing at last one imaging agent associated with the conjugate to identify a location of pancreatic adenocarcinoma cells and other CCKBR-expressing lesions in an individual. In some embodiments, the aptamer is a thioaptamer comprising an above-described contiguous nucleotide sequence. In certain embodiments, the nucleotide sequence is selected from the group of SEQ ID NOs: Table 1. In some embodiments, the aptamer has the nucleotide sequence of SEQ ID NO: 5 the sequence depicted in Figure 2A.

In some embodiments, a method of treating an individual having pancreatic adenocarcinoma or a CCKBR associated disorder includes administering a composition comprising an above-described nucleic acid molecule that selectively binds CCKBR. In some embodiments, the method of treating further comprises administering one or more anti-cancer therapeutics to the individual. In some embodiments, a method of treating an individual with a CCKBR associated disorder comprises injecting a composition comprising a nucleic acid molecule that selectively binds CCKBR, and one or more therapeutic agents. In some embodiments, the composition comprises one or more nanoparticles containing a therapeutic agent.

Accordingly, the compositions and methods of the present invention can be used to treat a variety of cancer cells of mammalian tumors. As used herein, the term "treating" refers to: (i) preventing a disease, disorder or condition from occurring in a mammal, animal or human that may be predisposed to the disease, disorder and/or condition but has not yet been diagnosed as having it; (ii) inhibiting the disease, disorder or condition, i.e., arresting its development; and/or (iii) relieving the disease, disorder or condition, i.e., causing regression of the disease, disorder and/or condition. For example, with respect to cancer, treatment may be measured quantitatively or qualitatively to determine the presence/absence of the disease, or its progression or regression using, for example, reduction in tumor size, a reduction in the rate of metastasis, and/or a slowing of tumor growth, and/or no worsening in disease over a specified period of time or other symptoms associated with the disease or clinical indications associated with the pathology of the cancer.

In some embodiments, a method of imaging pancreatic adenocarcinoma cells and other CCKBR-expressing lesions is provided that comprises administering intravenously (or by other routes) to an individual considered to be in need of such imaging, an above- described composition containing an imaging agent conjugated to a nucleic acid molecule that selective binds CCKBR; causing the conjugate to selectively bind to CCKBR on the pancreatic adenocarcinoma; and visualizing the imaging agent bound to CCKBR on the pancreatic adenocarcinoma, to identify a location of pancreatic adenocarcinoma cells, including potential metastases, in the individual. The methods are further directed to use of "functional variants" of the sequence disclosed. Functional variants include, for example, sequences having one or more nucleotide substitutions, deletions or insertions and wherein the variant retains the CCKBR binding activity. Functional variants can be created by any of a number of methods available to one skilled in the art, such as by site-directed mutagenesis, induced mutation, identified as allelic variants, cleaving through use of restriction enzymes, or the like.

Activity can likewise be measured by any variety of techniques, including measurement of reporter activity, Northern blot analysis, or similar techniques.

The methods further encompass use of a "functional fragment", that is, a sequence fragment formed by one or more deletions from a larger sequence and which retain CCKBR binding activity described herein. Activity can be measured by Northern blot analysis, reporter activity measurements when using transcriptional fusions, and the like.

Methods of alignment of sequences for comparison are well known in the art. Thus, the determination of percent identity between any two sequences can be accomplished using a mathematical algorithm.

Optimal alignment of sequences for comparison can use any means to analyze sequence identity (homology) known in the art, e.g., by the progressive alignment method of termed "PILEUP" (Morrison, (1997) Mol. Biol. Evol. 14:428-441, as an example of the use of PILEUP); by the local homology algorithm of Smith & Waterman (Adv. Appl. Math. 2: 482 (1981)); by the homology alignment algorithm of Needleman & Wunsch (J. Mol. Biol. 48:443-453 (1970)); by the search for similarity method of Pearson (Proc. Natl. Acad. Sci. USA 85: 2444 (1988)); by computerized implementations of these algorithms (e.g., GAP, BEST FIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.); ClustalW

(CLUSTAL in the PC/Gene program by Intelligenetics, Mountain View, Calif, described by, e.g., Higgins(1988), Gene 73 : 237-244; Corpet (1988), Nucleic Acids Res. 16: 10881- 10890; Huang, Computer Applications in the Biosciences 8: 155-165 (1992); and Pearson (1994), Methods in Mol. Biol. 24:307-331); Pfam (Sonnhammer (1998), Nucleic Acids Res. 26:322-325); TreeAlign (Hein (1994), Methods Mol. Biol. 25 :349-364); MEG- ALIGN, and SAM sequence alignment computer programs; or, by manual visual inspection. Another example of algorithm that is suitable for determining sequence similarity is the BLAST algorithm, which is described in Altschul et al, (1990)J. Mol. Biol. 215 : 403- 410. The BLAST programs (Basic Local Alignment Search Tool) of Altschul, S. F., et al, searches under default parameters for identity to sequences contained in the BLAST "GENEMBL" database. A sequence can be analyzed for identity to all publicly available DNA sequences contained in the GENEMBL database using the BLASTN algorithm under the default parameters.

Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information, www.ncbi.nlm.nih.gov/; see also Zhang (1997), Genome Res. 7:649-656 for the "PowerBLAST" variation. This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence that either match or satisfy some positive valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al (1990), J. Mol. Biol. 215 : 403-410). These initial neighborhood word hits act as seeds for initiating searches to find longer

HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T and X determine the sensitivity and speed of the alignment. The BLAST program uses as defaults a wordlength (W) of 1 1 , the BLOSUM62 scoring matrix (see Henikoff (1992), Proc. Natl. Acad. Sci. USA 89: 10915-10919) alignments (B) of 50, expectation (E) of 10, M=5, N=-4, and a comparison of both strands. The term BLAST refers to the BLAST algorithm which performs a statistical analysis of the similarity between two sequences; see, e.g., Karlin (1993), Proc. Natl. Acad. Sci. USA 90:5873-5787. One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.

In an embodiment, GAP (Global Alignment Program) can be used. GAP uses the algorithm of Needleman and Wunsch (J. Mol. Biol. 48:443-453, 1970) to find the alignment of two complete sequences that maximizes the number of matches and minimizes the number of gaps. Default gap creation penalty values and gap extension penalty values in the commonly used Version 10 of the Wisconsin Package® (Accelrys, Inc., San Diego, CA) for protein sequences are 8 and 2, respectively. For nucleotide sequences the default gap creation penalty is 50 while the default gap extension penalty is 3. Percent Similarity is the percent of the symbols that are similar. Symbols that are across from gaps are ignored. A similarity is scored when the scoring matrix value for a pair of symbols is greater than or equal to 0.50, the similarity threshold. A general purpose scoring system is the BLOSUM62 matrix (Henikoff and Henikoff (1993), Proteins 17: 49- 61), which is currently the default choice for BLAST programs. BLOSUM62 uses a combination of three matrices to cover all contingencies. Altschul, J. Mol. Biol. 36: 290- 300 (1993), herein incorporated by reference in its entirety and is the scoring matrix used in Version 10 of the Wisconsin Package® (Accelrys, Inc., San Diego, CA) (see Henikoff & Henikoff (1989) Proc. Natl. Acad. Sci. USA 89: 10915).

(c) As used herein, "sequence identity" or "identity" in the context of two nucleic acid sequences makes reference to the residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window.

(d) As used herein, "percentage of sequence identity" means the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity.

Identity to the sequence of described would mean a polynucleotide sequence having at least 65% sequence identity, more preferably at least 70% sequence identity, more preferably at least 75% sequence identity, more preferably at least 80% identity, more preferably at least 85% 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity.

Hybridization of such sequences may be carried out under stringent conditions. By "stringent conditions" or "stringent hybridization conditions" is intended conditions under which a probe will hybridize to its target sequence to a detectably greater degree than to other sequences (e.g., at least 2-fold over background). Stringent conditions are sequence- dependent and will be different in different circumstances. By controlling the stringency of the hybridization and/or washing conditions, target sequences that are 100%

complementary to the probe can be identified (homologous probing). Alternatively, stringency conditions can be adjusted to allow some mismatching in sequences so that lower degrees of similarity are detected (heterologous probing). Generally, a probe is less than about 1000 nucleotides in length, preferably less than 500 nucleotides in length.

Typically, stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes (e.g., 10 to 50 nucleotides) and at least about 60 DC for long probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Exemplary low stringency conditions include hybridization with a buffer solution of 30 to 35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulphate) at 37°C, and a wash in IX to 2X SSC (20X SSC = 3.0 M NaCl/0.3 M trisodium citrate) at 50 to 55°C. Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1 M NaCl, l% SDS at 37 DC, and a wash in 0.5X to IX SSC at 55 to 50D C. Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 0.1% SDS at 37°C, and a wash in 0.1X SSC at 60 to 65°C.

Specificity is typically the function of post-hybridization washes, the critical factors being the ionic strength and temperature of the final wash solution. For DNA-DNA hybrids, the Tm can be approximated from the equation of Meinkoth and Wahl, Anal. Biochem, 138:267-284 (1984): Tm=81.5°C + 16.6 (log M) + 0.41 (%GC) -0.61 (% form) - 500/L; where M is the molarity of monovalent cations, %GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs. The Tm is the temperature (under defined ionic strength and pH) at which 50% of the complementary target sequence hybridizes to a perfectly matched probe. Tm is reduced by about 1°C for each 1% of mismatching; thus, Tm, hybridization and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with -90% identity are sought, the Tm can be decreased 10°C. Generally, stringent conditions are selected to be about 5 D C lower than the thermal melting point (Tm) for the specific sequence and its complement at a defined ionic strength and pH. However, severely stringent conditions can utilize a hybridization and/or wash at 1, 2, 3, or 4°C lower than the thermal melting point (Tm); moderately stringent conditions can utilize a hybridization and/or wash at 6, 7, 8, 9, or 10°C lower than the thermal melting point (Tm); low stringency conditions can utilize a hybridization and/or wash at 11, 12, 13, 14, 15, or 20D C lower than the thermal melting point (Tm). Using the equation, hybridization and wash compositions, and desired Tm, those of ordinary skill will understand that variations in the stringency of hybridization and/or wash solutions are inherently described. If the desired degree of mismatching results in a Tm of less than 45°C (aqueous solution) or 32°C (formamide solution) it is preferred to increase the SSC concentration so that a higher temperature can be used. An extensive guide to the hybridization of nucleic acids is found in Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology- Hybridization with Nucleic Acid Probes, Part I, Chapter 2 (Elsevier, New York); and Ausubel et al, eds. (1995) Current Protocols in Molecular Biology, Chapter 2 (Greene Publishing and Wiley-Interscience, New York). See Sambrook et al. (2001) Molecular Cloning: A Laboratory Manual (3rd ed., Cold Spring Harbor Laboratory Press, Plainview, N.Y.) and Haymes et al. (1985) In: Nucleic Acid Hybridization, a Practical Approach, IRL Press, Washington, D.C.

The following is provided by way of exemplification and is not intended to limit the scope of the invention.

EXAMPLES

We have demonstrated technology and protocols for selection of DNA "aptamers" (APs) which bind to various target moieties, using SELEX technology (systematic evolution of ligands by exponential enrichment). In this case, we were targeting the cholecystokinin type B receptor (CCKBR). This is a plasma membrane receptor, which is expressed specifically on the surface of pancreatic ductal adenocarcinoma (PDAC) cells, with little or no expression on other adult cell types. The CCKBR has some short regions of amino acids which are exposed on the surface of the PDAC cells.

We synthesized two of these regions (specifically aa5-21 (SEQ ID NO: 2) and 40- 57 (SEQ ID NO: 3) of the CCKBR sequence), and coupled them onto glass beads. We also used PDAC PANC-1 cells which expressed high levels of the CCKBR, as well as COS-1 cells which did not express CCKBR (as negative control).

Our starting AP library was a random sequence of 45mers (diversity 45⁴).

The initial 8 "rounds" of SELEX consisted of a negative selection (non-binding) to glass beads, and then a positive selection with binding to glass beads functionalized with either the aa5 -21 or aa40-57 peptide regions. Subsequent rounds of SELEX selection consisted of both peptide binding and cell binding. A round consisted of sequential binding as follows: a) binding to unmodified glass beads; b) The unbound fraction was collected and bound to glass beads containing the specific peptide region; c) The bound fraction was eluted and bound to COS-1 cells lacking the receptor; and d) The unbound fraction was then bound to PANC-1 cells. After an additional 14 "rounds", we cloned and sequenced 93 APs, and aligned them. We then selected 8 APs for initial characterizations, based on predicted secondary structures. The Kd for the AP we have started

characterizations with is 15 pM, compared with about 4 nM for the real ligand gastrin.

We have shown CCKBR-specific binding of the AP (termed PXT1153), both in vivo and in vitro, and that the AP does not activate CCKBR signaling pathways. We have bioconjuated the AP to nanoliposomes, and determined that we get - 100 conjugated to the surface. This number can easily be increased by precoupling the AP to the PEG moiety before formation of nanoliposomes. We have also bioconjugated the AP to calcium phosphate nanoparticles (CPNPs), and tested them in vivo both for imaging purposes (use an infrared dye, ICG) as well as therapeutic purposes (using a chemotherapeutic derived from 5FU), so we have preliminary pre-clinical data.

Results and Discussion

Selection of human CCKBR-specific DNA APs Using an iterative SELEX approach, a pool of high-affinity DNA APs which recognize and bind to the N-terminal extracellular portion of human CCKBR were identified. The CCKBR peptides against which the AP selection was applied were chosen based on three criteria: The peptide should 1) be on an extracellular portion of the receptor, 2) not be in a region known to participate in receptor activation, based on previous functional studies^{26 27}, and 3) be without sequence similarity to the corresponding region of the related receptor, the cholecystokinin A receptor (CCKAR). Two peptides met these criteria: human CCKBR amino acids 5-21 and 40-57 (Figure 1A). Both peptides are found on the extracellular portion of the N-terminus of the human CCKBR protein and participate in ligand recognition by this receptor. There was 76.5% amino acid identity between the human and mouse sequences for the amino acid 5-21 peptide, and 83.3% identity between human and mouse for the amino acid 40-57 peptide (Figure 1 A). No conserved amino acid identity was noted between these two CCKBR peptides and the corresponding regions of the CCKAR from either human or mouse, suggesting that APs selected against these two peptides would not recognize CCKAR.

After eight initial rounds of AP selection, using the respective peptides coupled to glass beads separately, binding characteristics of these peptide-selected APs disclosed pools of APs with KD'S of -100 pM and relatively stable Mfold-predicted secondary structures. However, these first generation APs showed relatively poor binding to PANC-1 cell line, which expresses the CCKBR²⁸. The SELEX protocol was then modified to include sequential peptide and cell-based selections, coupled with a negative-positive selection cycle strategy²⁹, and the separate peptide AP pools were combined. AP pools which did not bind to COS-1 cells (negative control cells which do not express the CCKBR) were then bound to PANC-1 cells. Using this strategy, a pool of APs which bound to CCKBR-expressing PANC-1 cells, but not to COS-1 cells, was selected. After a total of 22 rounds of positive/negative selection were performed, the resulting pool of "second generation" APs were then cloned and sequenced. Clustal W alignment showed a family tree with 3 subfamilies based on sequence alone (Figure IB). Interestingly, there was no strong sequence homology among APs to indicate a unique AP motif that would predict CCKBR binding. All APs were again modeled for secondary structure using the Mfold program ⁰. Based on the Clustal alignment and predicted secondary structure, a panel of eight CCK-B receptor APs representing different clusters, 4 from each peptide group (Figure IB, highlighted boxes) were selected for further characterization. Four of the eight APs shared stretches of sequence similarity, comparable AG values and areas of folded structure near the 3' region that suggested they could adopt similar conformations. CCKBR APs do not stimulate pancreatic cancer cell growth

Activation of CCKBR signaling by CCK or gastrin requires interactions of the ligand with both the N-terminus of the receptor (including the AP target sites, residues 5-21 and 40- 57) and several additional residues on the extracellular receptor loops and transmembrane pocket of the receptor ³¹. Others have shown that these complex receptor-ligand interactions result in a conformational change in the receptor that triggers the intracellular G-protein coupled signaling cascade ². The CCKBR ligand gastrin, which is also highly expressed by PDAC cells, can stimulate growth of pancreatic, colon and gastric cancer ³, and gastrin stimulated PDAC cell growth can be blocked with a CCKBR-specific antagonist ⁴. Since the selected DNA APs are quite different in structure from the native CCKBR ligands and were selected only for binding to one of 2 subregions the N-terminal domain of the CCKBR, it is unlikely that these APs could activate the receptor and/or induce intracellular signaling. To confirm this, cell proliferation assays were used to assess whether CCKBR AP binding affected growth of PANC-1 cells compared with a known PANC-1 growth factor, epidermal growth factor (EGF). The selected APs were used to treat PDAC cells at concentrations of 100 nM, 100 times the concentration of gastrin required for optimal CCKBR activation. PANC-1 proliferation was not affected by any of the AP treatments, while both 15 and 30 ng/mL EGF stimulated PANC-1 growth (Figure 1C). Several of the APs (i.e, 1098, 1152, 1153, and 1163) produced significant growth inhibition at 96 h (P values ranging from P < 0.05 to 0.001). In addition, when the individual APs were considered as a pool, significant growth inhibition was observed (P < 0.0008).

AP 1153 does not activate CCKBR receptor signaling

Because the CCKBR-selected DNA APs did not stimulate PDAC cell proliferation, it would follow that unlike the native ligand gastrin, these APs do not activate this G-protein coupled receptor. Further confirmation that the selected AP 1153 did not activate the CCKBR signaling was done by assessing the phosphorylation state of Akt, a downstream signaling intermediate known to be associated with CCKBR activation by gastrin. Using western blots, the levels of phospho-Akt, total Akt and beta-actin were assessed in PANC- 1 cells treated with AP 1153, gastrin-17, or vehicle (Figure ID). While gastrin treatment did increase Akt phosphorylation, indicative of CCKBR activation, no increase in phospho-Akt was noted in the AP treated cells or vehicle controls. Total Akt levels were unchanged by any of the treatments. Thus unlike the native CCKBR ligand gastrin, AP 1153 binding does not activate receptor associated signaling pathways and appears to reduce Akt signaling. CCKBR AP 1153 characterization

Of the eight APs selected from the final pool, API 153 had the most stable predicted secondary structure (Figure 2A), with an estimated Tm of 54°C and a AG of -6.38 kcal/mol at 37°C. Dissociation constant (KD) measurements for AP against the BR5-21 peptide, revealed a Kd of 15.5 pM (Figure 2B). Since the KD of gastrin for CCKBR is ~ 1 nM, API 153 has at least a 300-fold higher affinity for CCKBR than the native ligand. To further characterize this AP, the peptide-binding affinity of the full length, 66 nucleotide AP was compared with a truncated version of API 153 AP that lacked 16 nucleotides which are constant to the SELEX library vector. The truncated API 153, 49 nucleotides in length, thus represented the DNA sequence unique to API 153. The KD for the shorter version of API 153 was 206.4 pM, and the Mfold predicted secondary structure was predicted to be less stable, with a AG value of -1.94 kcal/mol (Figure 2C). Although the KD for the shorter form of the AP was still much lower than that of gastrin, it was significantly higher than the Kd for the full-length 1153 AP. The Kd values for both APs were equal to or better than those recently reported for cell-SELEX identified APs that recognize hepatocellular carcinoma cells ⁵, and an AP selected for binding to the EGF-receptor ⁶. The anti-EGFR AP was as effective as anti-EGFR antibody for directing bioconjugated gold NPs to breast tumors. Because of its higher affinity for the CCKBR and a more stable predicted secondary structure, subsequent experiments reported herein were done with the full- length, 66 nucleotide version of API 153.

CCKBR AP is internalized by a CCKBR-dependent process In order to effectively use an AP to direct cargo to CCKBR-expressing PDAC cells, the AP should be taken up by receptor-mediated binding and internalization. To demonstrate that AP 1153 was internalized by PDAC cells, and that the internalization was CCKBR- mediated, up take of AlexaFluor488-tagged APs was assessed using wild-type PANC-1 cells, PANC-1 cells that have been engineered to constitutively over-express the CCKBR (OE; these cells show increased expression of CCKBR of ~2-3 ^χ vs. WT), and PANC-1 cells that have been stably transfected with a CCKBR shRNA and have substantially reduced receptor expression ³⁷. Fluorescent AP 1 153 was readily taken up by Panc-1 cells that over-express the CCKBR (Figure 3 A-C). Both DIC image and three dimensional image reconstructions confirmed that the AP 1 153 molecules do not simply remain at the cell surface, but are internalized and are present throughout the cytoplasm in multiple cells. To demonstrate that AP up-take was not a general non-specific phenomenon, one of the "first-generation" selected aptamer, AP 38, was also assessed for cellular internalization. During the SELEX process, AP 38 bound to the BR5 -21 -peptide but did not bind to CCKBR-expressing cells, suggesting that AP 38 did not recognize the native receptor on PANC-1 cells. In thePANC-1 live-cell up-take experiments, AP 38 was poorly taken up compared to AP1153 by PANC-1 cells, regardless of CCKBR status (Figure 3 F-H).

Vehicle treated cells showed little or no background fluorescence (Figure 3 I-K).

Quantitation of cell-associated fluorescence confirmed that AP 1 153 internalization was at least 5-fold higher than internalization of AP 38, and both were significantly higher than the background fluorescence in vehicle-treated cells (Figure 3 L).

Wild-type PANC-1 cells also demonstrated AP 1 153 up-take and internalization, but to a lesser degree (as expected) than CCKBR over-expressing cells (Figure 3 D). As an additional control, PANC-1 KO cells which were stably transfected with a human CCKBR shRNA(resulting in a ~80% reduction in CCKBR protein ), had less cell-associated fluorescence than either the CCKBR overexpressing cells or wild-type PANC-1 cells (Figure 3 E). The differences in AP 1 153 up-take by PANC-1 CCKBR overexpressing, wild-type, and CCKBR knock-down cells clearly suggests that AP internalization is CCKBR- mediated (Figure 3 M). Finally, since PDAC cells secrete the CCKBR ligand gastrin, effective targeting APs must efficiently compete with gastrin for CCKBR binding. The up-take of the CCKBR AP 1153 by PDAC cells, which continuously secrete gastrin, indicates that binding and internalization of this AP by CCKBR can occur even in the presence of the native CCKBR ligand. This suggests that the AP 1153 should effectively targeted, and be taken up by, PDAC cells in vivo.

Bioconjugation of CPSNPs with a CCKBR AP or a gastrin G16 peptide

Using previously optimized methods for bioconjugation of targeting agents onto

CPSNPs ²⁵ , two CCKBR-targeting agents, gastrin 16 peptide (G16) and the AP 1 153, were attached to ICG-loaded CPSNPs (Figure 4). G16 was attached through a maleimide-PEG linkage, while AP 1153 was attached through a carboxy-PEG linkage. ICG encapsulation efficiency was determined by comparing the amount of ICG released from CPSNPs to the initial fluorophore amount added during synthesis. The average ICG concentration for a standard double-laundered CPSNP suspension was about 5 x 10^"6 M and the average fluorophore encapsulation efficiency was approximately 0.8%. The fluorescent intensity of ICG-CPSNPs was at least 5 times of that of free ICG as a result of the matrix shielding effect of CPSNPs and multiple fluorophores encapsulated within each NP.

Because NP surface is altered by PEGylation and bioconjugation, overall CPSNP surface charge was determined by zeta potential analysis. Initially, CPSNPs displayed a negative average zeta potential value of -29 ± 3 mV at physiological pH due to the carboxyl groups from citrate on the particle surface (Figure 5). After full surface coverage of CPSNPs with methoxy-PEG- Amine or maleimide-PEG-Amine, which have no net charge at pH 7, and the zeta potentials shifted to -3 ± 4 mV and -4 ± 3 mV, respectively. Bioconjugation with G16 (Gastrin 16-PEG-ICG-CPSNPs) resulted in a more negative zeta potential of -21 ±2 mV. In contrast, the initial zeta potential of carboxy-PEG-ICG- CPSNPs was -26 ± 4 mV but shifted to -13 ± 3 mV after bioconjugation with AP 1 153 (Figure 5).

Others have demonstrated that NPs with a near neutral or slight negative charge have improved pharmacokinetic characteristics over NPs with either a positive charge or highly negative charge^{38 39}. In addition, NPs with protein decoration can have non-specific interactions with serum proteins which mask targeting agents and eliminate specificity ⁴⁰. The fact that AP 1 153-conjugated nanoparticles are less negatively charged compared to G16 particles or non-targeted particles suggests that the AP-modified particles should be less likely to aggregate with serum proteins in vivo. This would give AP-functionalized CPSNPs prolonged circulation time in blood with less non-specific cellular uptake, characteristics which should allow more effective delivery of cargo to target cells.

Finally, there was a bimodal particle size distribution of representative AP 1153-PEG-ICG- CPSNPs as determined by TEM (Figure 6). The lognormal average diameter of approximately 80% of the CPSNPs was 30 ±12 nm, which is within the optimum particle size range for cellular uptake (Figure 6, inset). Approximately 20% of the particles were larger, with an average diameter of 121 ± 5 nm.

In vivo pancreatic tumor targeting with CCKBR AP

To directly compare the effect of targeting agents on NP uptake by PDACs in vivo,

CPSNPs surface bioconjugated with the either G16 or AP 1 153 were injected into nude mice bearing orthotopic PANC-1 tumors. Four weeks after PANC-1 orthotopic tumors were established, mice were given a single dose of methoxy-PEG untargeted, G16- targeted, or AP 1 153-targeted CPSNPs containing the near infrared fluorophore ICG. Free ICG and CPSNPs without ICG served as negative controls to assess background fluorescence. Beginning at 12 hours after injection, ICG fluorescence was noted in the PDAC tumors. Peak tumor fluorescent was seen at 15 hours after injection and was highest in the AP -targeted nanoparticles (Figure 7). By 48 hours after injection, ICG (which is broken down once released from the particles intracellularly) was no longer detected in any of the tumors (data not shown). Background fluorescence in mice injected with empty particles was low to moderate and was mainly due to tissue auto-fluorescence in the GI and urinary tracts, or to the previously described entero-hepatic biliary recirculation mechanism by which intact particles are cleared into the feces (Figure 7)⁴¹. Free ICG, which is also cleared through the biliary tree and gastrointestinal tract⁴², showed no accumulation in the PDAC tumors. Because ICG accumulation in orthotopic tumors of mice treated with AP targeted CPSNPs was markedly higher than the ICG signal from either the untargeted or G16- targeted particles, this suggests that the CCKBR AP targeted NPs nanoparticles are taken up by tumors more effectively.

We also performed ex vivo imaging of the orthotopic pancreatic tumors using multiphoton and harmonic generation microscopy methods. The overall localizations of ICG-loaded particles were analogous to those observed in the in vivo imaging studies. Ex vivo imaging of cross sections of whole tumors showed that cellular uptake of the API 153- targeted ICG-CPSNPs was clearly enhanced compared with untargeted ICG-loaded CPSNPs and was distributed throughout the cytoplasm (Figure 8). The 3D reconstructions showed accumulation of ICG in tumor cells within the surrounding fibrotic stroma (Figure 9).

CCKBR-Targeted FdUMP-CPSNPS Deliver Active Drug to PDA C Tumor Cells in vivo. In this study, either CCKBR aptamer or the endogenous CCKBR peptide ligand gastrin, were attached to amorphous calcium phosphosilicate nanoparticles (CPSNPs) that were engineered to encapsulate 5-fluoro-2'-deoxyuridine monophosphate (FdUMP), a 5- fluorouracil (5-FU) metabolite used to treat pancreatic adenocarcinoma and in which the CPSNPs was PEGylated with methoxy terminated polyethylene glycol (mPEG-FdUMP- CPSNPs) using established protocols. Barth, et al. "Bioconjugation of calcium phosphosilicate composite nanoparticles for selective targeting of human breast and pancreatic cancers in vivo" ACS Nano. 2010, 4 (3), 1279-87 The ability of these targeted nanoparticles to deliver active FdUMP to PDAC tumor cells in vivo was assessed by thymidylate synthase (TS) immunoblotting of tumor tissues. Active TS protein levels in tumors from mice treated with empty-CPSNPs and untargeted-FdUMP-CPSNPS were not significantly different from each other (Figure 10). This indicated that CPSNPs without tumor-specific targeting are poorly taken up by PDAC tumors in vivo. Tumors from mice treated with FdUMP-CPSNPs surface bioconjugated with gastrin-16 peptide, which also binds to CCKBR on PDAC tumor cells, had reduced TS protein levels compared to untargeted-FdUMP-CPSNPs. This is consistent with previous studies which showed that fluorescent CPSNPS targeted with gastrin had enhanced PDAC tumor uptake in vivo {Id.). Tumors from mice treated with aptamer targeted-FdUMP-CPSNPs had the lowest active TS levels of all treatment groups - a 60% reduction versus both empty CPSNPS and untargeted FdUMP-CPSNP controls, *p<0.05. This suggests that significantly more FdUMP cargo was internalized by PDAC tumors from mice treated with aptamer-FdUMP-CPSNPs. This result is again consistent with our data showing that this CCKBR aptamer enhanced fluorescent CPSNP accumulation in PANC-1 tumors in vivo compared to untargeted or gastrin-targeted particles. However, the previous studies with aptamer-targeted fluorescent-CPSNPs did not specifically address cellular internalization of these nanoparticles, as the fluorescent CPSNPS could have been on the tumor cell surface (i.e. associated with CCKBR at the plasma membrane) rather than inside of the tumor cells. These studies clearly demonstrate that targeted-FdUMP-CPSNPs were internalized by PDAC tumor cells. Intracellular accumulation of the TS inhibitor FdUMP by PDAC tumor cells in vivo was also most effective when the FdUMP was delivered by aptamer-targeted mPEG-FdUMP-CPSNPs.

Development of reagents that can direct chemotherapeutic drugs or imaging agents specifically to cancer cells is a critical but poorly-met need in the field of cancer biology. The selection and characterization DNA APs with high affinity for the CCK-B receptor, a cell surface protein found on human PDAC cells, is a significant step toward that goal. Because APs were selected to conserved sites on the N-terminus of the CCK-B receptor, which is extracellular, they can bind to the CCKBR and target CPSNPs to PDAC cells without activating pro-proliferative, anti-apoptotic receptor signaling. Such tumor cell- specific targeting agents can assist in delivering cargos such as chemotherapeutics to pancreatic tumors with little uptake by normal cells, reducing drug side-effects and off- target toxicities. Because we have selected a targeting AP that bind to the CCKBR with higher affinity than the native ligand gastrin, the AP conjugated CPSNPs should effectively out compete gastrin for CCKBR binding, achieving cargo internalization even in the presence of gastrin secreted by the tumor cells.

The in vivo experiments herein demonstrated that CCKBR- AP -targeted NPs are taken up by orthotopic PDAC tumors to a greater degree than were non-targeted or gastrin- targeted nanoparticles. Importantly, NPs bioconjugated with CCKBR APs did not demonstrate up-take in the brain, a tissue with high CCBR expression. Previous studies had shown that although gastrin-10 targeted CPSNPs were taken up by PDAC tumors, there was significant NP uptake in the brain ²⁵. AP targeted CPSNPs do not appear to be present in brain tissues, possibly because they are not able to cross the blood-brain barrier. The lack of blood-brain barrier penetration is additional evidence that tumor targeting with a CCKBR offers significant advantages over gastrintargeting. In addition, it is possible that gastrin peptides on the NP surface could activate the CCKBR, stimulating the proliferation of tumor cells. Since CCKBR APs do not activate receptor-associated signaling pathways, APs represent both a safer and more efficacious targeting agent for PDAC cells. These data are in agreement with another recent paper demonstrating that an anti-EpCAM aptamer was taken up in vivo by colon tumor xenografts more effectively than was an anti-EpCAM antibody⁴³. The identification of an AP which enhances the delivery of NPs to PDAC cells could have multiple applications. First and foremost, they should allow early identification of pancreatic lesions. Since we have recently demonstrated that CCKBRs are also present on precursor PanIN lesions, these APs should improve early detection of PDAC tumors. Because surgery can be curative if lesions are detected early, the ability to identify precursor lesions before they progress to full-blown PDAC and metastasize could improve patient outcomes. Using tumor targeted ICG CPSNPs, near-infrared imaging during surgery could improve identification of tumor cells and permit surgeons to locate microscopic lesions and identify surgical margins in real time⁴² or detect minimal residual disease post-operatively. Currently, ICG is the only near-infrared contrast dye which is FDA approved for such clinical usage. By both encapsulating the ICG into CPSNPs and targeting the NPs for tumor specific uptake, the amount of ICG required to visualize tumors in this study (30 μg/kg) was substantially less than the free ICG (up to 10 mg/kg) required to visualize subcutaneous murine tumors over an identical timeframe (up to 24 hours post-injection)⁴².

Co-delivery of theranostic agents to both tumor and stellate cells, both of which express CCKBR, could further enhance treatment options for cancer patients. By incorporating agents into CPSNPs which reduce stellate cell activity, one could potentially decrease the fibrotic tumor stroma that results from activated stellate cells in the tumor microenvironment. Since we have recently demonstrated that CCK-B receptors are present on precursor PanIN lesions ⁴⁴, these APs could also be used to improve very early detection of PDAC tumors. The ability to detect small precursor lesions would be valuable in families with an inherited disposition to pancreatic cancer or in other high risk individuals. As surgery can be curative if lesions are detected early, the ability to identify precursor lesions, before they progress to full-blown PDAC and metastasize, would be essential to improving patient outcomes. We anticipate that new CCKBR AP -targeted nanocarriers will have a broad capability to deliver imaging agents or therapeutic cargos specifically to PDAC tumor cells with minimal off-target effects. Materials and Methods

All chemicals used in this work were purchased as described: calcium chloride dihydrate (CaC12 2H20, ACS reagent, >99%), sodium phosphate dibasic (Na2HP04, BioXtra, >99.0%), sodium metasilicate (Na2Si03), sodium citrate tribasic dihydrate

(HOC(COOH)(CH2COONa)2 · 2H20, ACS reagent, >99.0%), ethylenediaminetetraacetic acid disodium salt dihydrate (EDTA, reagent grade, 98.5-101.5%), chloric acid (HC1, ACS reagent, 37%) and N-(3-Dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride (EDC, commercial grade) from Sigma-Aldrich; indocyanin green (ICG) from TCI America; N- hydroxysulfosuccinimide (Sulfo-NHS) from Thermo Scientific; cyclohexane (ACS reagent, 99+ %) from Alfa Aesar; methoxy (polyethylene glycol) amine hydrochloride salt (Methoxy -PEG- Amine, Mw 2kDa), amine (polyethylene glycol) carboxyl hydrochloride salt (Carboxy -PEG- Amine, Mw 2kDa), and maleimide (polyethylene glycol) amine trifluoroacetic acid salt (Maleimide-PEG- Amine, Mw 2kDa) from JenKem Technology USA; polyoxy ethylene (5) nonylphenylether (Igepal® CO-520) from Rhodia; Dulbecco's phosphate-buffered saline (DPBS, lx) from Corning Cellgro. All solutions were prepared with CC -free deionized water to avoid calcium carbonate formation in the CPSNPs. Water was filtered and deionized using a High-Q water purification system, boiled, and then flushed with argon to remove CO2. Purified water was tested for endotoxins (<0.100 EU/mL) using a Charles River Limulus Amebocyte Lysate Endochrome kit.

Cultured human pancreatic cell lines

PANC-1 cells were obtained from ATCC and were cultured in Dulbecco's modified Eagle medium with 10% FBS .

Systematic Evolution of Ligands by Exponential Enrichment - SELEX:

Two peptides corresponding to the N-terminal domains of the human CCKBR (amino acids 5-21 ; BR5-21 and amino acids 40-57; BR40-57, see Figure 1 for the amino acid sequences) were synthesized with an added C-terminal cysteine residue to permit covalent coupling of the peptide to glass beads (GenScript) ⁴⁵. A random 45 nucleotide library (45 nt library, N45), coupled to a fixed 3 '-region, was added to the to the CCKBR peptide- conjugated beads, and DNA APs bound to the peptide were harvested ^45"46. The fixed 3'- region was used here, rather than our primer-free approach, because for unknown reasons results with just the 3 '-fixed region attached were superior to screens with the minimal- primer or primer-free approaches. APs were re-amplified following our standard protocols and the screen was repeated for 8 rounds. The selected CCKBR peptide-bound AP "first generation" pools were then cloned and sequenced. Two selection protocols were done in parallel against the CCKBR peptides BR5-21 and BR40-57 (Figure 1), to identify two pools of CCKBR-specific APs.

Peptide-based AP selection was then coupled with a cell-based selection procedure. For cell based selections, the same AP first generation libraries were directly selected against PDAC cells to assure that the APs bound to CCKBR in its native, cellular conformation. PANC-1 human pancreatic cancer cells, which express higher levels of CCKBR compared with other human PDAC cell lines, were used for positive AP selection and COS-1 cells, which do not express CCKBR, were used as a negative selection step for each round. These selections used a library with the random nucleotide region and 3 '-fixed region (66 nucleotides in total) but without the 19 nucleotide 5 '-fixed region ⁴⁶. With the independently selected anti-CCKBR peptide and anti-PDAC cell AP pools, a number of additional rounds of selection that combined both peptide and cell-based selection were performed as: glass beads only (background); glass bead with specific BR peptide; COS-1 cells (negative for CCKBR); and PANC-1 cells (positive for CCKBR). After 22 rounds of positive and negative selection, clones from this final ("second generation") pool were sequenced and aligned using Clustal W software. Sequences were then modeled using the Mfold program ⁰, and APs with predicted stable secondary structure and low free energies were chosen for further testing.

AP characterization

After Clustal W sequence alignments, AP subgroups were defined based on sequence similarity and a representative AP from each subgroup was chosen for further analysis. AP dissociation constants against the CCKBR selection peptide were determined as previously described ⁴⁷. Briefly, APs were labeled at the 5'-end with [γ- ²Ρ] ATP using T4

Polynucleotide Kinase (Promega). The dissociation constant (Kd) was determined by incubating various concentrations of unlabeled and labelled AP with CCKBR-peptide conjugated glass beads. After incubation, unbound complexes were removed by washing and bound complexes were then eluted from the beads. Radioactivity in the peptide-bound fraction was determined by liquid scintillation counting. To determine non-specific binding, the same concentrations of APs were incubated with non-peptide conjugated glass beads, and this value was subtracted from the total counts. Cell proliferation assays

PANC-1 cells (5,000 cells/well) were seeded into a 96-well plate and grown overnight. 24 hours after plating, cells were transferred to fresh media containing 1% fetal bovine serum and 100 nM of each AP, or an equal volume of the PBS vehicle, was added. Treatment with human recombinant epidermal growth factor (EGF, Lonza, 15 and 30 ng/mL) served as a positive control for cell proliferation. Following a 72 hour incubation, alamarBlue reagent (Life Technologies) was added and the absorbance at 570 nm was measured. AP uptake by 3D confocal microscopy

For cell-based AP uptake studies, two previously characterized PANC-1 clones were utilized in addition to the parental PANC-1 cell line ⁷: a PANC-1 subline that over- expresses the human CCKBR, and a PANC-1 subline in which CCKBR expression has been knocked down through stable shRNA transfection. Cells were grown on glass coverslips for 72 hours. Following an overnight incubation in serum-free media

(OptiMEM), cells were then treated with the AlexaFluor 647-labeled AP (IDT) at a concentration of 10 nM for 24 hrs. Aptamer 1153, which was positively selected for binding to both CCKBR peptide and CCKBR-expressing cells, was compared to a first generation AP 38 (tagged with AlexaFluor-488), which bound to CCKBR peptide but not to CCKBR-expressing cells, and presumably would not recognize the native receptor, and to vehicle (IXPBS) control treated cells. After two PBS washes to remove unabsorbed AP, cells were fixed in 2% paraformaldehyde in PBS for 30 minutes, washed twice in PBS and then twice in dFhO, and nuclei counterstained for 5 minutes with Hoechst 33342 (0.5 μg/mL in PBS). Following brief rinses with PBS and dFhO, coverslips were mounted on slides with ProLong Gold (Life Technologies). Images were acquired with a Leica AOBS SP8 laser scanning confocal microscope using a high resolution Leica 40X/1.3 Plan- Apochromat oil immersion objective. All images were generated using the highly sensitive HyD detector. The 3D stack images with optical section thickness (z-axis) of

approximately 0.3 um were captured from cell volumes, z-section images were compiled and final 3-dimensional image restoration was performed using VOLOCITY 6.3 software (Perkin Elmer). The computation of aptamer voxel intensities was performed on the 3D image data sets recorded from at least three different areas of each cell line: PANC-1 CCKBR over-expressing cells (OE), PANC-1 wild-type cells (WT) and PANC-1 cells with reduced CCKBR expression (KO). A 2X2 kernel noise removal filter was used to remove the noise. The lower threshold level in the histogram was set appropriately to exclude all possible background voxel values. Sum of all the voxel intensities above this threshold level was determined and was considered as the Aptamer content. The same quantitation protocol was applied to all 3D image volume datasets generated from OE, WT and KO samples and obtained using similar instrument setting parameters.

Protein extraction and Immunoblotting

Cellular proteins were extracted 24 h after treatment with CCKBR APs (ΙΟΟηΜ). Protein concentration was determined using a MicroBCA assay (Pierce/Thermo Fisher Scientific), and cell ly sates (60 Dg of protein) resolved by SDS-PAGE, using Bis-Tris gels

(Invitrogen). Proteins were transferred to nitrocellulose membranes, blocked in 5% BSA and incubated overnight (4°C) with primary antibodies. Antibodies used were:

phosphorylated-Akt (Ser473) (#4060; Cell Signaling Technology, 1 : 1,000), total Akt (4691 ; Cell Signaling Technology, 1 :2,000), and beta-actin (#A2228; Sigma, 1 : 10,000). The blots were washed and probed with secondary antibody coupled to horseradish peroxidase (HRP, Amersham), and HRP activity was detected using an enhanced chemiluminescent substrate (Pierce).

Synthesis of AP coupled nanocarriers

Spherical CPSNPs doped with ICG were synthesized using aqueous precipitation of calcium chloride and disodium hydrogen phosphate in the presence of disodium silicate within water-in-oil microemulsions as described ²⁵. ICG doping was accomplished through the addition of the fluorophore into the microemulsion phase such that the ICG molecules are trapped and internalized within the particle ⁴⁸. CPSNPs were laundered using van der Waals high performance liquid chromatography (vdW-HPLC) ⁴⁸. The fluorophore encapsulation yield was determined by comparing the concentration of ICG encapsulated within the CPSNPs to the initial concentration of the fluorophore added. After the particles were dissolved to release the dye, ICG content was quantified by the optical absorption at 785 nm and compared to a standard curve. A 3'-NH₂-TTTTT version of the CCKBR AP 1153 (TriLink BioTechnologies) was covalently coupled to CPSNPs ²⁵. The resulting AP-conjugated CPSNPs were dialyzed to separate unreacted APs and sterilized by filtration through a 0.2 um cellulose membrane. To substantiate the surface functionalization of CPSNPs, zeta potential distributions were collected with a Brookhaven ZetaPALS zeta potential analyzer (Brookhaven Instruments Corp.) using Zeta PLUS mode. The samples were prepared with dilution of 1 :5 in pH- adjusted 70/30 ethanol/H20 (V/V). Four replicate measurements (five data points / run) were conducted to calculate the average zeta potential and 95% confidence interval. All pH measurements were performed using an ISFET pH probe (HACH) calibrated using aqueous standards. To conduct particle size analysis, a drop of the 70/30 ethanol-water

CPSNP suspension was diluted 1 :3 and transferred onto a copper TEM grid for imaging at 120kV on the FEI Tecnai G2 Spirit BioTWIN TEM (Materials Characterization Lab, Pennsylvania State University). Images were processed on Image J (NIH) and the size histogram (n=300) was generated and analyzed with the Gaussian multi-peak function on Origin (OriginLab).

In vivo tumor imaging

All animal procedures were approved by the Perm State Hershey Institutional Animal Care and Use Committee. Orthotopic PDAC xenografts were established by injecting 5xl0⁶ PANC-1 cells in a 50 μ L volume (in Hank's balanced salt solution) into the pancreas of athymic male nude (nu/nu) mice (Charles River). Orthotopic tumors were grown for 4 weeks prior to imaging. ICG-loaded CPSNPs, including non-targeted CPSNPs and CPSNPs bioconjugated with either G16 peptide or the AP 1153, or empty, non-ICG containing CPSNPs were resuspended in sterile IX DPBS (without Ca or Mg, MediaTech). Particles were concentrated to an equivalent ICG concentration (lO^-5 M) as determined by absorption spectroscopy. Each mouse received a single ICG dose of 30 μg /kg, in a 100 volume, injected into the tail vein. At various timepoints from 30 minutes to 72 hours post-injection, mice were sedated and whole animal imaging was performed ²⁵. Near- infrared transillumination images (755 nm excitation, 830 nm emission, 10 min exposure) and corresponding X-ray images were obtained with an In vivo FX whole animal imaging station (Carestream Health). Signal distribution relative to anatomy was illustrated by merging false-colored near-infrared and X-ray images. Statistical analysis

Results were expressed as means ± standard error. Student t-tests were used to evaluate statistical significance with a p < 0.05 considered to be statistically significant.

Sequences

SEQ ID NO: 1 is the amino acid sequence of a cholecystokinin type B receptor of Homo sapiens NCBI Ref No. NP_795344.1

SEQ ID NO: 2 is the residues 5-21 of SEQ ID NO: 1

SEQ ID NO: 3 is the residues 40-57 of SEQ ID NO: 1

SEQ ID NO: 4 is the nucleotide sequences, also listed in Table 1 of API 153 (there referred to as PXT1153)

SEQ ID NO: 5 is the aptamer shown in Figure 2A

TABLE 1 BR/PANC 14.2 Selected Sequences from L7-N45 (BR/PANC 14.2; 9-5-13)

5'-sequence: CGCTCTAGAGTCGAATCA (18nt) (SEQ ID NO: 6) 3'-sequence: GCGGCCGCTAATCCTGTTC (19nt) (SEQ ID NO: 7) 45N-sequences: >PXT1092

CACTTAGTATGCCGAGCCTTCTTGTGATAGTGTTGTCCCCCCCAC (SEQ ID NO: 8)

>PXT1093

CAACCGGGGGGACCTTTACGATGTCTGCGCAAACCTGTCGCATGG (SEQ ID NO: 9)

>PXT1094 CCACCCGTGTATAAGTTGGATGTGGCTGTGCGTTCGATGTGTCTG (SEQ ID NO: 10

>PXT1095

TGAGGCGTTCGTGCGTACCATACAGCCCCCTCCTTAGTCGTTGGT (SEQ ID NO: 11)

>PXT1096

TGGAGCAACAACCACGTTACCCATCTGTACCTCCACCTGCATATC (SEQ ID NO: 12)

>PXT1097 CAAACCCGAGATGGGCCTGTCCGGTGTCGCCGCTTGCTGGATTCT (SEQ ID NO: 13)

>PXT1098

TAGCGGTTGGGGTATTGTAGTGTGTATTCCGAGGTTCAAATGTCG (SEQ ID NO: 14) >PXT1100

CTGGGATACGTGCTAGTCAATTGGTGTGTCTGACCGTTCTGCTAT (SEQ ID NO: 15)

>PXT1101

TACCACACTAGTCATCGAGGGGGGCACAAACCCAGTTCAACACAT (SEQ ID NO: 16)

>PXT1102

CATCGGAAATCACGGCTCGCCCCAATCACGTCCCCCACTCGAGGA (SEQ ID NO: 17)

>PXT1103 TGCAGCGAAGGCGGGGATCACTGTGTCGGTATTTTGTCTGGGTGT (SEQ ID NO: 18)

>PXT1104

CAGGTGTCTCGTCAATCGATTTAGTGTTACTCGCGCGATGTCTTA (SEQ ID NO: 19)

>PXT1105

TGAGTGCGCTTTGAAGATACCCCACCGCCGCGTCCCAGGGTGATA (SEQ ID NO: 20)

>PXT1106 CGT AGT AC GACGC AC AC AC AGC C AC GGC AC AAAC CCTCTTTC GCTC (SEQ ID NO: 21)

>PXT1107

TGGCGAGATTGGTGATGGTGTCTGTATGAATGCTATTGTCAGTGT (SEQ ID NO: 22) >PXT1108

TGAAGCCTGCATCCCTTCCGTCATCGTCCCATGGCTACAGCTCCG (SEQ ID NO: 23)

>PXT1109

TCACACGACACAGTGGTATTAACCCATCGACTGCTCGCCCCTACC (SEQ ID NO: 24)

>PXT1110

TGACGGCATAATCGGCACCATGTTTTCAGACCCTCGCCCAACCAC (SEQ ID NO: 25)

>PXT1111 TGCAGTGCGAAGACTGACTGGGGGGCCTCAGTCATAGCGATTGTT (SEQ ID NO: 26)

>PXT1112

CAACCGATCCCACAATGCCCCTCTTTGGGTTGACTCACACGCACC (SEQ ID NO: 27)

>PXT1113

AGAATAACTAAAATCCATCCAGAGCTCGCGGTCTGGTCCCCCCGG (SEQ ID NO: 28)

>PXT1115 CGTACCCTTTGTTTTGGCCCTCAGGTGTGATGGGTGCTTAGTTCG (SEQ ID NO: 29)

>PXT1116

ACAAGTCGATCATTTCCAATTGTCAACGTCACACCGCACCCCCCC (SEQ ID NO: 30) >PXT1117

CAACGGAAACAAAAACGCGTCCCACACAGGGGTACAATCTGCTGCT (SEQ ID NO: 31)

>PXT1118

CGGGGGTGAATTATACCGAATATAATTGTAGTACATGCTTGATCT (SEQ ID NO: 32)

>PXT1119

GACCAGTGACGCAGTGTATTCACTCTGGGGGTACATGTTTCCCT (SEQ ID NO: 33)

>PXT1120 TACGGGGGCGTATTGGGGAGCATCATGCCGGTGTCCTTAGCGCGG (SEQ ID NO: 34)

>PXT1121

CGACAATCGCCCCTCATGGTCCCTGTGTTCTCCGTTGTCGACCTT (SEQ ID NO: 35)

>PXT1122

CTGGGACCAGCATACACCGATAACTTACGTCGCGATTGATTTCGA (SEQ ID NO: 36)

>PXT1123 AGACGGGGGTCAGTAGCGTGGGAACATAATCGTCCGGGGGTGCTC (SEQ ID NO: 37)

>PXT1124

TAGAACGTAAAGCTACACAACAGACCGACTCACGCGACCCCGATT (SEQ ID NO: 38) >PXT1125

TGTGCAGTGTGTACCGATACGTTGTGAAGTTTATCCTGTTCCCGA (SEQ ID NO: 39)

>PXT1126

AGCCCAGGTGTGTGTGCGTGGTTATTCCCTATCTATGGTGTTGCT (SEQ ID NO: 40)

>PXT1127

TGGGGGGATAGCCTGTCTATGTGCGTATTGCTGGGTGCTCCGTCT (SEQ ID NO: 41)

>PXT1128 GCAGGTTGAGTAGGGTCGGGTTTTGGTTGCTTCGACGGTAGTGTG (SEQ ID NO: 42)

>PXT1129

TGAGACTGGAACCTATGTCAAACCACGTAAATCCGCTCATAGTCT (SEQ ID NO: 43)

>PXT1130

TACGACGCATTAGAGAGAGTACCCCCGCTGTTACGTGGTCTTTTA (SEQ ID NO: 44)

>PXT1131 TTACACGACACAGTGGTATTAACCCATCGACTGCTCGCCCCTACC (SEQ ID NO: 45)

>PXT1132

CAGATATATTTCAGGACCCATCATGCTGCACCTTCTATACCTACT (SEQ ID NO: 46) >PXT1133

GAACGTATCCCGACATTTGCCACCGCCACACTGAGATGGAACTCT (SEQ ID NO: 47)

>PXT1134

TGCAGTGCGAAGGCTGACTGGGGGGCCTCAGTCATAGTGATTGTT (SEQ ID NO: 48)

>PXT1135

GCACAGTTGACGTATAAACGATGGGGATCACTCTTCTACGCACTG (SEQ ID NO: 49)

>PXT1136 AAACCGGTTAATTCGTGATGCCCTGTTCCTACCGTGTTACTTCCT (SEQ ID NO: 50)

>PXT1137

TGGGCTGATTATTGCGCGCTGGTCATCCGTTTGTGGTGTCGTCGT (SEQ ID NO: 51)

>PXT1138

TGGGGGGGGTAGGATTATTTGATGTTGCAATGGTGTTGTATGTAT (SEQ ID NO: 52)

>PXT1139 TGCAGGATTGGCCCCCACTCTCTTCTAACGTTCCTGGCCTCTAC (SEQ ID NO: 53)

>PXT1140

TGACGGTAGGCTAGTGGTATGGCAGTTGTTTGTGGTGTGTTGCAT (SEQ ID NO: 54) >PXT1141

TTACTTGTTCGCGCGTGGGGTACATTTACTTGGGATTCGTCCGTA (SEQ ID NO: 55)

>PXT1142

CAGGCTTGAGGCGTACGCGGTGGAGTATCGTGCGGGGAGGGGGGA (SEQ ID NO: 56)

>PXT1143

TGGGGTGTGTGGTGTTCATGGGGATCGCGTATGTGTGCGTGTGGT (SEQ ID NO: 57)

>PXT1144 GCATGACCGGGTACACACAGCCTTATGCACCCTACGCGTCCCCAG (SEQ ID NO: 58)

>PXT1145

CATTGCTCATGATCGATTATCAGTACAACGCTCACCTGGGTTCTG (SEQ ID NO: 59)

>PXT1146

CGGGTCCCACAACATACTTGACCGCAGTACGTCCGGGCTCCGCAA (SEQ ID NO: 60)

>PXT1147 TCGCGCATGGCTCATCGACGAACTCCCAACGATCGCGCGTCCACT (SEQ ID NO: 61)

>PXT1148

CAAGCATATCAGATAGATCTCGGTTGTATCCGACCCTTGTATTAC (SEQ ID NO: 62) >PXT1149

AGACGCCTGCAGCATAACGCTACTAAATTCGACGCGCTCCTTATA (SEQ ID NO: 63)

>PXT1150

CGGGTAGCCATCGCATCATACGACGTACCTGACTCTGTCCTGTG (SEQ ID NO: 64)

>PXT1151

TTAACGGGGTCCAATTGTATGATCGCCTCACCCGGTTGACTCCCT (SEQ ID NO: 65)

>PXT1152 GGGATAAGCGACCAAGAGTAAGCTAACGGGGCACACACAAGCTAA (SEQ ID NO: 66)

>PXT1153

TGGTGCAGGTGTGGCTGGGATTCATTTGCCGGTGCTGGTGCGTCC (SEQ ID NO: 4)

>PXT1154

GAACACGAAACATTGTGGCGCACTACTGACTGTTCCCCCCCTGCC (SEQ ID NO: 67)

>PXT1155 CGTCTACTGTCTCCATAACTACCTGGGGCCTGGTTGTTTCGGTAT (SEQ ID NO: 68)

>PXT1156

GGAACATTGTTACATAAGAAGGGAAAGGATAGTGTTGGAATACCC (SEQ ID NO: 69) >PXT1157

TGTCTTAAGGGAGGTCAGGGTTGTAGTCAGCGTTTGCTCTGTTGT (SEQ ID NO: 70)

>PXT1158

CAGGATCTGACTGGGTATGCGTTAGGTTCGCGCGTGGTCCTGGTT (SEQ ID NO: 71)

>PXT1159

CATTGCTCACGATTGATACTACGTCATGGACAATGCACACACATAT (SEQ ID NO: 72)

>PXT1160 TGTGTGTGTCGCGGGGGGGATACTTGGCATATTGGTTGCTGCGT (SEQ ID NO: 73)

>PXT1161

TGGTGCGATCTGGGTCTGTCCGTCGGTTCAGGTAATTCCTAGTTT (SEQ ID NO: 74)

>PXT1162

CGACGTTCAGCTCCATGTCGCCCCGTACAGTTGCATCTTACCAAT (SEQ ID NO: 75)

>PXT1163 CGGTGGATCGTTTCTATGCGTTGATGTCACTCCGCGCACGATTAG (SEQ ID NO: 76)

>PXT1164

CGTACACAGACCCGCTATGTATGCAGAAGTCACCTCTTTTCCCTG (SEQ ID NO: 77) >PXT1165

AGGACATGTCTCGCTACGTATCGCTGGTTACTCGTCATTCGGTGT (SEQ ID NO: 78)

>PXT1167

CAAACCACGGTGAATTTGCCCCCGACCCATATGATTACTGACGCG (SEQ ID NO: 79)

>PXT1168

CGACGGGTGGTCATCGCCTGGTGGTCCTGTTTCACCGTCCTTTAT (SEQ ID NO: 80)

>PXT1169 TCGCGAGTGAACTAGAATATTACGATTATCCATCCCAGTGTCGTC (SEQ ID NO: 81)

>PXT1170

GGGCGGATTGTTGTTGCTATTATGTGTGAGGGGGGGGTCCCGTGC (SEQ ID NO: 82)

>PXT1171

TGCACCCGAGGTTGGTATGTTATAGGTGCTAAGACCCCACGCCTA (SEQ ID NO: 83)

>PXT1172 TGGTGCACGTGATCGCCAACTCGCCTCCGCATCGTACACTACCG (SEQ ID NO: 84)

>PXT1173

CAATGTTTGTCTTTGCTATGACCTTGACCCTACGCATGTCCCCTA (SEQ ID NO: 85) >PXT1174

CGGAGGCGATCATCATAACATGTCACTGGGCTCTGGTAGTTTGT (SEQ ID NO: 86)

>PXT1175

TAATGTGTTAGGTGGATCCGTGTTTACGACCCGTGCCTTCCCCT (SEQ ID NO: 87)

>PXT1176

ACCAACACGGTACGCAGACAGCACACAACATCCAATGAGACCCCT (SEQ ID NO: 88)

>PXT1177 CGGAATTACCGTATGCAGACATATTCACTGTACCTGTACTCCCTT (SEQ ID NO: 89)

>PXT1178

CGAATCGCCAAGGAGTTTCGAAGCCCGACCCGATGCCCCTGTACT (SEQ ID NO: 90)

>PXT1179

ACCGGGGGGTCCTTGCCATATTGCGGTCTACTCTAATCGCGTCTT (SEQ ID NO: 91)

>PXT1180 CTGGGGGGTTATACTGTATGGACCCTATATTGCGTTATGTCCCTA (SEQ ID NO : 92)

>PXT1181

TGGGGTGTCCCGCGCCAATCTTCCCCTGTTGTTCCTGAACGTCAT (SEQ ID NO: 93) >PXT1182

TAGCACGGTCGGTCTATTTTGTTGCAGTATCGCGAGGATAGTTT (SEQ ID NO: 94)

>PXT1183

TAGCACGGCCATAATTGTACTCTCGCATGTGCCCTTCAACGTCCA (SEQ ID NO: 95)

>PXT1184

CGGTATCAGTGTCCGTTAAACTCCCCTACCACATGCAAACCCAC (SEQ ID NO: 96)

>PXT1185 CTGGGGGGTTATACTGTATGGACCCTATATTGCGTTATGTCCCTA (SEQ ID NO: 97)

>PXT1186

CAGCACGAGTGTTACCGTCGTTGTCCTCGCCGAATTAGCAACTTA (SEQ ID NO: 98)

>PXT1187

CGACACCCATATCAGCCAGCCGTGTCGCACAACGTATCTTTATCA (SEQ ID NO: 99)

References

1. Ryan, D. P.; Hong, T. S.; Bardeesy, N., Pancreatic adenocarcinoma. New

Eng.J.Med. 2014, 371, 1039-49.

2. Rahib, L.; Smith, B. D.; Aizenberg, R.; Rosenzweig, A. B.; Fleshman, J.; Matrisian, L. M., Projecting cancer incidence and deaths to 2030: the unexpected burden of thyroid, liver, and pancreas cancers in the United States. Cancer Res 2014, 74 (11), 2913-21.

3. Klemm, F.; Joyce, J. A., Microenvironmental regulation of therapeutic response in cancer. Trends Cell Biol 2015, 25, 198-213.

4. Byrne, J. D.; Betancourt, T.; Brannon-Peppas, L., Active targeting schemes for nanoparticle systems in cancer therapeutics. Adv Drug Del Reviews 2008, 60, 1615-26.

5. Yu, M. K.; Park, J.; Jon, S., Targeting strategies for multifunctional nanoparticles in cancer imaging and therapy. Theranostics 2012, 2, 3-44.

6. Panyam, J.; Labhasetwar, V., Biodegradable nanoparticles for drug and gene delivery to cells and tissues. Adv Drug Del Reviews 2003, 55, 329-47.

7. Daniels, T. R.; Bernabeu, E.; Rodriguez, J. A.; Patel, S.; Kozman, M.; Chiappetta, D. A.; Holler, E.; Ljubimova, J. Y.; Helguera, G; Penichet, M. L., The transferrin receptor and the targeted delivery of therapeutic agents against cancer. Biochimica et biophysica acta 2012, 1820 (3), 291-317. 8. Basile, L. ; Pignatello, R. ; Passirani, C, Active targeting strategies for anticancer drug nanocarriers. Current drug delivery 2012, 9 (3), 255-68.

9. Casi, G. ; Neri, D., Antibody-drug conjugates: basic concepts, examples and future perspectives. J Control Release 2012, 161, 422-8.

10. Wu, X. ; CHen, J.; WU, M.; Zhao, J. X., Aptamers: active targeting ligands for cancer diagnosis and therapy. Theranostics 2015, 5, 322-44.

11. Sun, H. ; Zu, Y., Aptamers and their applications in nanomedicine. Small 2015, 11, 2352-64.

12. Dhar, S. ; Gu, F. X. ; Langer, R. ; Farokhzad, O. C ; Lippard, S. J., Targeted delivery of cisplatin to prostate cancer cells by aptamer functionalized Pt(IV) prodrug-PLGA-PEG nanoparticles. Proceedings of the National Academy of Sciences of the United States of America 2008, 105 (45), 17356-61.

13. Dhar, S. ; Kolishetti, N. ; Lippard, S. J. ; Farokhzad, O. C, Targeted delivery of a cisplatin prodrug for safer and more effective prostate cancer therapy in vivo. Proceedings of the National Academy of Sciences of the United States of America 2011, 108 (5), 1850-5.

14. Ray, P.; Cheek, M. A. ; Sharaf, M. L. ; Li, N.; Ellington, A. D.; Sullenger, B. A. ; Shaw, B. R. ; White, R. R., Aptamer-mediated delivery of chemotherapy to pancreatic cancer cells. Nucl Acid Ther. 2012, 22, 295-305.

15. Pei, X.; Zhang, J. ; Liu, J., Clinical applications of nucleic acid aptamers in cancer. Molecular and clinical oncology 2014, 2 (3), 341 -348.

16. Sun, H. ; Zhu, X.; Lu, P. Y. ; Rosato, R. R ; Tan, W. ; Zu, Y., Oligonucleotide aptamers: new tools for targeted cancer therapy. Molecular therapy. Nucleic acids 2014, 3, el 82.

17. Goetze, J. P. ; Nielsen, F. C, Closing the gastrin loop in pancreatic carcinoma: coexpression of gastrin and its receptor in solid human pancreatic adenocarcinoma. Cancer 2000, 88 (11), 2487-94.

18. Nock, B. A. ; Maina, T. ; Behe, M. ; Nikolopoulou, A.; Gotthardt, M.; Schmitt, J. S. ; Behr, T. M.; Macke, H. R., CCK-2/gastrin receptor-targeted tumor imaging with (99m)Tc- labeled minigastrin analogs. Journal of nuclear medicine : official publication, Society of Nuclear Medicine 2005, 46 (10), 1727-36.

19. Laverman, P. ; Joosten, L. ; Eek, A. ; Roosenburg, S. ; Peitl, P. K. ; Maina, T. ; Macke, H. ; Aloj, L. ; von Guggenberg, E. ; Sosabowski, J. K. ; de Jong, M. ; Reubi, J. C ; Oyen, W. J.; Boerman, O. C, Comparative biodistribution of 12 (l)(l)(l)In-labelled gastrin/CCK2 receptor-targeting peptides. European journal of nuclear medicine and molecular imaging 2011, 38 (8), 1410-6.

20. Kossatz, S.; Behe, M.; Mansi, R; Saur, D.; Czerney, P.; Kaiser, W. A.; Hilger, I., Multifactorial diagnostic NIR imaging of CCK2R expressing tumors. Biomaterials 2013,

34 (21), 5172-80.

21. Xu, L.; Josan, J. S.; Vagner, I; Caplan, M. R; Hruby, V. J.; Mash, E. A.; Lynch, R. M.; Morse, D. L.; Gillies, R. J., Heterobivalent ligands target cell-surface receptor combinations in vivo. Proceedings of the National Academy of Sciences of the United States of America 2012, 109 (52), 21295-300.

22. Wayua, C; Low, P. S., Evaluation of a nonpeptidic ligand for imaging of cholecystokinin 2 receptor-expressing cancers. Journal of nuclear medicine : official publication, Society of Nuclear Medicine 2015, 56 (1), 113-9.

23. Sturzu, A.; Sheikh, S.; Klose, U.; Echner, H.; Kalbacher, H.; Deeg, M.; Nagele, T.; Horger, M.; Schwentner, C; Ernemann, U.; Heckl, S., Potential of the gastric motility drug lorglumide in prostate cancer imaging. European journal of pharmaceutical sciences : official journal of the European Federation for Pharmaceutical Sciences 2012, 45 (5), 575- 80.

24. Sanchez, C; El Hajj Diab, D.; Connord, V.; Clerc, P.; Meunier, E.; Pipy, B.; Payre, B.; Tan, R. P.; Gougeon, M.; Carrey, J.; Gigoux, V.; Fourmy, D., Targeting a G-protein- coupled receptor overexpressed in endocrine tumors by magnetic nanoparticles to induce cell death. ACSNano 2014, 8, 1350-63.

25. Barth, B. M.; Sharma, R; Altinoglu, E. I.; Morgan, T. T.; Shanmugavelandy, S. S.; Kaiser, J. M.; McGovem, C. O.; Matters, G. L.; Smith, J. P.; Kester, M.; Adair, J. H., Bioconjugation of calcium phosphosilicate composite nanoparticles for selective targeting of huan breast and pancreatic cancers in vivo. ACSNano 2010, 4, 1279-87.

26. Dufresne, M.; Seva, C; Fourmy, D., Cholecystokinin and gastrin receptors.

Physiological reviews 2006, 86 (3), 805-47.

27. Magnan, R; Escrieut, C; Gigoux, V.; De, K.; Clerc, P.; Niu, F.; Azema, J.; Masri, B.; Cordomi, A.; Baltas, M.; Tikhonova, I. G.; Fourmy, D., Distinct CCK-2 receptor conformations associated with beta-arrestin-2 recruitment or phospholipase-C activation revealed by a biased antagonist. Journal of the American Chemical Society 2013, 135 (7), 2560-73.

28. Smith, J. P.; Liu, G.; Soundararajan, V.; McLaughlin, P. J.; Zagon, I. S.,

Identification and characterization of CCK-B/gastrin receptors in human pancreatic cancer cell lines. The American journal of physiology 1994, 266 (1 Pt 2), R277-83.

29. Yan, A. C; Levy, M., Aptamers and aptamer targeted delivery. RNA Biol. 2009, 6, 316-20.

30. Zucker, M., Mfold web server for nucleic acid folding and hybridization prediction. Nucl Acids Res. 2003, 31, 3406-15/.

31. Miller, L. J.; Gao, F., Structural basis of cholecystokinin receptor binding and regulation. Pharmacol Ther. 2008, 119, 83-95.

32. Foucaud, M.; Archer-Lahlou, E.; Marco, E.; Tikhonova, I. G.; Maigret, B.;

Escrieut, C; Langer, I.; Fourmy, D., Insights into the binding and activation sites of the receptors for cholecystokinin and gastrin. Regul Pept. 2008, 145, 17-23.

33. Smith, J. P.; Fantaskey, A. P.; Liu, G; Zagon, I. S., Identification of gastrin as a growth peptide in human pancreatic cancer. Am J Physiol. 1995, 268 (37), R135-R141.

34. Smith, J. P.; Shih, A; Wu, Y.; McLaughlin, P. J.; Zagon, I. S., Gastrin regulates growth of human pancreatic cancer in a tonic and autocrine fashion. Am J Physiol. 1996,

270 (5 Pt. 2), R1078-R1084.

35. Xu, J.; Teng, I. T.; Zhang, L.; Delgado, S.; Champanhac, C; Cansiz, S.; Wu, C;

Shan, H.; Tan, W., Molecualr recognition of human liver cancer cells using DNA aptamers generated via cell-SELEX. PLoS One 2015, 10, el25863.

36. Melacon, M. P.; Zhou, M.; Zhang, R.; Xiong, C; Allen, P.; Wen, X.; Huang, Q.; Wallace, M.; Myers, J. N.; Stafford, R. J.; Liang, D.; Ellington, A. D.; Li, C, Selective uptake and imaging of aptamer- and antibody-conjugated hollow nanospheres targeted to epidermal growth factor receptors overexpressed in head and neck cancer. ACS Nano 2014, 8, 4530-8.

37. Fino, K. K.; Matters, G. L.; McGovern, C. O.; Gilius, E. L.; Smith, J. P.,

Downregulation of the CCK-B receptor in pancreatic cancer cells blocks proliferation and promotes apoptosis. Am J Physiol Gastrointest Liver Physiol. 2012, 302, G1244-52.

38. Li, S. D.; Huang, L., Pharmacokinetics and biodistribution of nanoparticles.

Molecular pharmaceutics 2008, 5 (4), 496-504. 39. Ernsting, M. J.; Murakami, M.; Roy, A.; Li, S. D., Factors controlling the pharmacokinetics, biodistribution and intratumoral penetration of nanoparticles. Journal of controlled release : official journal of the Controlled Release Society 2013, 172 (3), 782- 94.

40. Salvati, A.; Pitek, A. S.; Monopoli, M. P.; Bombelli, F. B.; Hristov, D. R; Kelly, P. M.; Aberg, C; Mahon, E.; Dawson, K. A., Transferrin-functinalized nanoparticles lose their targeting capabilities when a biomolecule corona adsorbs on the surface. Nature Nanotech. 2013, 8, 137-43.

41. Tabakovic, A.; Kester, M.; Adair, J. H., Calcium phosphate-based composite nanoparticles in bioimaging and therapeutic delivery applications. Wiley interdisciplinary reviews. Nanomedicine and nanobiotechnology 2012, 4 (1), 96-112.

42. Jiang, J. X.; Keating, J. J.; Jesus, E. M.; Judy, R. P.; Madajewski, B.; Venegas, O.; Okusanya, O. T.; Singhal, S., Optimization of the enhanced permeability and retention effect for near-infrared imaging of solid tumors with indocyanine green. American journal of nuclear medicine and molecular imaging 2015, 5 (4), 390-400.

43. Xiang, D.; Zheng, C; Zhou, S. F.; Qiao, S.; Tran, P. H.; Pu, C; Li, Y.; Kong, L.; Kouzani, A. Z.; Lin, J.; Liu, K; Li, L.; Shigdar, S.; Duan, W., Superior Performance of Aptamer in Tumor Penetration over Antibody: Implication of Aptamer-Based Theranostics in Solid Tumors. Theranostics 2015, 5 (10), 1083-97.

44. Smith, J. P.; Cooper, T. K; McGovern, C. O.; Gilius, E. L.; Zhong, Q.; Liao, J. C; Molinolo, A. A.; Gutkind, J. S.; Matters, G. L., Cholecystokinin receptor antagonist halts progression of pancreatic cancer precursor lesions and fibrosis in mice. Pancreas 2014, 43, 1050-9.

45. Pan, W. H.; Clawson, G. A., Primer-free aptamer selection using a random DNA library. Methods Mol Biol 2009, In press.

46. Pan, W.; Clawson, G. A., The Shorter the Better: Reducing Fixed Primer Regions of Oligonucleotide Libraries for Aptamer Selection Molecules 2009, 14, 1353-69.

47. Pan, W.; Xin, P.; Patrick, S.; Dean, S.; Keating, C, Primer-free DNA Aptamer Selection: A Sandwich Binding Format. J Vis Exp. (JoVE) 2010, 41 (Cellular Biology), doi: 10.2791/2039. 48. Altinoglu, E. I.; Russin, T. J.; Kaiser, J. M.; Barth, B. M; Eklund, P. C; Kester, M.; Adair, J. H., Near-infrared emitting fluorophore-doped calcium phosphate nanoparticles for in vivo imaging of human breast cancer. ACSNano 2008, 2, 2075-84.

Claims

What is claimed is:

1. A method of targeting a molecule to a cell comprising a cholecystokinin B receptor (CCBKR), the method comprising,

a) providing a composition comprising a nucleic acid molecule that selectively binds to a sequence selected from SEQ ID NO: 2, a sequence having at least 77% identity to SEQ ID NO: 2, SEQ ID NO: 3, a sequence having at least 84% identity to SEQ ID NO: 3, or binds to any combination thereof, and a therapeutic or imaging agent; and

b) contacting said cell with said composition such that said nucleic acid molecule binds said cell and said therapeutic agent or imaging agent or both is delivered to said cell.

2. The method of claim 1, wherein said nucleic acid molecule selectively binds to a sequence selected from SEQ ID NO: 2, SEQ ID NO: 3, or to both SEQ ID NO: 2 and 3.

3. The method of claim 1, wherein said nucleic acid molecule comprises SEQ ID NO: 5 or a functional fragment thereof.

4. The method of claim 1, wherein said nucleic acid molecule comprises SEQ ID NO: 4.

5. The method of claim 1, wherein said nucleic acid molecule is selected from SEQ ID NO: 4, 5 or 8 - 99.

6. The method of claim 1, wherein said therapeutic agent decreases proliferation of a cancer cell having a cholecystokinin B receptor.

7. The method of claim 1, wherein said nucleic acid molecule is bioconjugated to said therapeutic agent or imaging agent.

8. The method of claim 1 wherein said nucleic acid molecule comprises SEQ ID NO: 5 bioconjugated to a therapeutic agent to pancreatic adenocarcinoma wherein said nucleic acid molecule binds to at least one pancreatic adenocarcinoma cell such that said therapeutic agent is delivered to said cell.

9. The method of claim 1, wherein said therapeutic agent or imaging agent is deliver to said cell such that said agent is detected in the cytoplasm of said cell.

10. The method of claim 1, wherein said nucleic acid molecule has at least 300 fold higher affinity for said CCKBR of said cell than gastrin.

11. A method of imaging cells of or treating an individual having a disorder in which cholecystokinin type B receptor cells (CCBK) are present in said individual, the method comprising administering to said individual a composition comprising a nucleic acid molecule that selectively binds to a sequence selected from SEQ ID NO: 2, a sequence having at least 77% identity to SEQ ID NO: 2, SEQ ID NO: 3, a sequence having at least 84% identity to SEQ ID NO: 3, or binds to any combination thereof, and a therapeutic or imaging agent wherein said nucleic acid molecule selectively binds to at least one of said CCBK cells and said therapeutic or imaging agent is delivered to at least one of said cells.

12. The method of claim 11 , wherein said cells comprise pancreatic adenocarcinoma cells.

13. The method of claim 1 1, wherein said therapeutic or imaging agent is detected in the cytoplasm of said cells.

14. A composition comprising a nucleic acid molecule that selectively binds to a sequence selected from SEQ ID NO: 2, or a sequence having at least 77% identity thereto, SEQ ID NO: 3 or a sequence having at least 84% identity thereto, or both, and a therapeutic or imaging agent.

15. The composition of claim 14, wherein said nucleic acid molecule selectively binds to a sequence selected from SEQ ID NO: 2, SEQ ID NO: 3, or both SEQ ID NO: 2 or 3.

16. The composition of claim 14, wherein said nucleic acid molecule comprises SEQ ID NO: 5 or a functional fragment thereof.

17. The composition of claim 1, wherein said nucleic acid molecule comprises SEQ ID NO: 4.

18. The composition of claim 14, wherein said nucleic acid molecule is selected from SEQ ID NO: 4, 5, or 8 - 99.

19. The composition of claim 41, wherein said therapeutic agent decreases proliferation of a cancer cell having a cholecystokinin B receptor.

20. The composition of claim 14, wherein said nucleic acid molecule comprises SEQ ID NO: 5 bioconjugated to a therapeutic agent to pancreatic adenocarcinoma, said nucleic acid molecule is capable of binding to at least one pancreatic adenocarcinoma cell such that said therapeutic agent is delivered to said cell.