WO2017126638A1

WO2017126638A1 - Composite of undifferentiated osteoblasts derived from alveolar bone and carrier for undifferentiated osteoblasts derived from alveolar bone, and use thereof

Info

Publication number: WO2017126638A1
Application number: PCT/JP2017/001827
Authority: WO
Inventors: 正寛齋藤; 慶介半田; 雅彦稲垣; 全北川
Original assignee: 国立大学法人東北大学; 国立研究開発法人産業技術総合研究所
Priority date: 2016-01-19
Filing date: 2017-01-19
Publication date: 2017-07-27
Also published as: JPWO2017126638A1; JP6901727B2

Abstract

The main purpose of the invention is to provide a composite or the like of undifferentiated osteoblasts derived from alveolar bone and a carrier useful in bone tissue regeneration in which undifferentiated osteoblasts derived from alveolar bone are used. A composite of a carried and undifferentiated osteoblasts derived from alveolar bone, wherein the carrier is a fiber molded article having a three-dimensional network structure, the bulk density of the fiber molded article is 0.0001-0.25 g/cm³, and the fibers that constitute the fiber molded article include a biocompatible polymer.

Description

Compound of undifferentiated osteoblasts derived from alveolar bone and carrier for undifferentiated osteoblasts derived from alveolar bone and use thereof

The present invention relates to a composite of undifferentiated osteoblasts derived from alveolar bone and a carrier for undifferentiated osteoblasts derived from alveolar bone and use thereof.

Periodontal disease is an infection that causes tooth loss due to inflammatory disruption of periodontal tissue, and it is said that there are 50 million patients in Japan. Periodontal disease is said to be the largest cause of decreased oral function, and periodontal bacteria and inflammatory substances that cause periodontal disease are the onset of diseases such as cardiovascular disease, diabetes, and respiratory disease. It has also been reported to cause progress. For this reason, treatment for periodontal disease, which has been shown to be one of the causes of harming not only the oral cavity but also the whole body, and recovery from periodontal disease are regarded as important.

Periodontal disease is an infectious disease that should be noted regardless of age, and those in their 40s or older, especially those in their 50s or older, are high-risk populations of severely advanced invasive periodontal disease. It has been known. As a countermeasure against such a serious periodontal disease, development of a regenerative medical technique for recovering periodontal tissue is required.

As a conventional periodontal tissue regenerative medical technique, artificial fixation to a damaged part of bone tissue, transplantation of a bone filling material or autologous bone has been adopted. However, these methods have a problem that the bone tissue cannot be sufficiently recovered to a normal state and it takes a long time. In order to overcome these problems, a cell transplant technique using mesenchymal stem cells having bone regeneration ability has been developed. However, mesenchymal stem cells are not useful techniques because there are individual differences in bone regeneration ability and it is difficult to obtain them from middle-aged and older groups. In addition, there are known methods for transplanting beef bone incineration products or human decalcified freeze-dried bone at about 300 ° C., but these are feared to be used due to the risk of prion-derived mad cow disease and unknown virus infection. ing.

In regenerative medicine, a method is known in which cells are supported on a carrier such as a polymer gel or a ceramic material, and the obtained support is transplanted. However, there are problems that the cells do not grow sufficiently, do not differentiate in the carrier, and the adaptability to the complicated form of the transplant destination is poor, and a technique that is sufficiently useful for clinical use has been constructed. It's hard to say.

On the other hand, the present inventors have succeeded in obtaining alveolar bone-derived undifferentiated osteoblasts (Patent Document 1).

International Publication No. 2010/021162

Accordingly, the present invention provides a composite of undifferentiated osteoblasts derived from alveolar bone and a carrier useful for bone tissue regeneration using the undifferentiated osteoblasts derived from the alveolar bone, and bone tissue using the composite. The main purpose is to provide a method of reproduction.

As a result of intensive studies by the present inventors in view of the above problems, it has been found that undifferentiated osteoblasts derived from alveolar bone can be efficiently proliferated and / or differentiated by using a specific carrier described later. Further, the present inventors have found that bone tissue can be regenerated to a practically practical level by using the carrier in combination with undifferentiated osteoblasts derived from alveolar bone. The present invention has been completed as a result of further studies based on the above findings, and is as follows.
Item 1. Complex of undifferentiated osteoblasts derived from alveolar bone and carrier:
Here, the carrier is a fiber molded product having a three-dimensional network structure, the bulk density of the fiber molded product is 0.0001 to 0.25 g / cm ³ , and the fibers constituting the fiber molded product are biocompatible. A functional polymer.
Item 2. Item 2. The composite according to Item 1, wherein the fiber constituting the fiber molded article contains a biocompatible hydrophobic polymer.
Item 3. Item 3. The composite according to any one of

Items

1 and 2, wherein the fiber constituting the fiber molded article includes a composite fiber containing a biocompatible hydrophobic polymer and a biocompatible hydrophilic polymer.
Item 4. Item 4. The composite according to Item 3, wherein the composite fiber has a structure in which the hydrophilic polymer fiber is formed inside the hydrophobic polymer fiber.
Item 5. The hydrophilic polymer fibers form a three-dimensional network structure inside the composite fiber, and the hydrophilic polymer fibers are bonded to each other to form a twisted structure in the composite fiber, thereby bringing the composite fibers into contact with each other. Item 5. The composite according to Item 4, which is controlled.
Item 6. Item 6. The composite according to Item 1-5, wherein the fiber constituting the fiber molded product has an average diameter of 0.05 to 30 μm.
Item 7. Item 7. The composite according to any one of Items 1 to 6, wherein the fiber molded product has a coating layer at least partially.
Item 8. Item 8. The composite according to Item 7, wherein the coating layer has a thickness of 1000 µm or less.
Item 9. Item 9. The composite according to

Item

7 or 8, wherein the coating layer comprises a plurality of through-holes having an average pore diameter of 10 μm or more.
Item 10. Item 10. The composite according to Item 9, wherein the area of the opening formed by the plurality of through holes is 50% or more of the surface area of the coating layer.
Item 11. Item 11. The composite according to any one of Items 1 to 10, wherein the carrier has a thickness of 0.05 to 500 mm.
Item 12. Item 1. The fiber constituting the fiber molded article contains at least one hydrophobic polymer selected from the group consisting of polylactic acid, polycaprolactone, polyglycolic acid, and a copolymer composed of two or more thereof. 12. The composite according to any one of 11 to 11.
Item 13. Differentiation of undifferentiated osteoblasts derived from alveolar bone into osteoblasts compared to the case where the carrier is the carrier 2 (bulk density 0.21 g / cm ³ , fiber forming body having a thickness of about 80 μm) shown in the examples. The composite according to any one of Items 1 to 12, wherein differentiation of undifferentiated osteoblasts into osteoblasts is evaluated using alkaline phosphatase staining as an index, and alkaline phosphatase staining Is cultured in an MF medium (Toyobo Co., Ltd.) containing 10 mmol / l β-glycerophosphate, 50 μg / ml ascorbic acid, 100 nmol / l dexamethasone at 37 ° C. in the presence of 5

% CO

2 and 10 wt% formaldehyde. Fix for 30 minutes and stain with alkaline phosphatase stain for 5 minutes.
Item 14. Item 1 to Item 1, wherein the carrier can promote calcification in the composite as compared with the case of using the carrier 2 shown in the examples (a fiber forming body having a bulk density of 0.21 g / cm ³ and a thickness of about 80 μm). 14. The composite according to any one of 13; wherein calcification is evaluated using alizarin red staining as an indicator, and alizarin red staining is performed using 10 mmol / l β-glycerophosphate, 50 μg / ml ascorbic acid, 100 nmol / l Cultured in MF medium (manufactured by Toyobo Co., Ltd.) containing dexamethasone at 37 ° C. in the presence of 5% CO ₂ , fixed with 10 wt% formaldehyde for 30 minutes, and stained with alizarin red for 5 minutes.
Item 15. Item 15. The composite according to any one of Items 1 to 14, wherein at least some of the alveolar bone-derived undifferentiated osteoblasts are differentiated into alveolar bone-derived osteoblasts.
Item 16. Item 15. The composite according to any one of Items 1 to 14, wherein at least a part of the undifferentiated osteoblasts derived from the alveolar bone is in a calcified state.

According to the present invention, undifferentiated osteoblasts derived from alveolar bone can be efficiently proliferated and / or differentiated in a carrier. Furthermore, according to the present invention, bone tissue derived from alveolar bone-derived undifferentiated osteoblasts can be produced simply and efficiently. According to the present invention, bone tissue can be regenerated to a practical level.

FIG. 1 is an example of a composite fiber including a hydrophobic polymer and a hydrophilic polymer in which a twisted structure is formed. FIG. 2 shows an example of visualizing the structure of the hydrophilic polymer in the composite fiber by etching only the hydrophobic polymer of the composite fiber containing the hydrophobic polymer and the hydrophilic polymer using a solvent. FIG. 3 is an example of a composite fiber including a hydrophobic polymer and a hydrophilic polymer in which a twisted structure is formed. FIG. 4 is a model diagram in which the carrier of the present invention includes a coating layer. It is a model figure of the fiber molding by which the coating layer (shape stabilization layer) was formed on the surface of the cotton-like fiber molding. FIG. 5 is an enlarged photograph of the coating layer surface. FIG. 6 is a model diagram of a fiber molded body in which a coating layer and a high-density layer are formed on the surface of a cotton-like fiber molded body. FIG. 7 is a model diagram of a fiber molded body in which a high-density layer is formed inside a cotton-like fiber molded body and a coating layer is formed on the surface. FIG. 8 is a model diagram of a fiber molded body in which a high-density layer is formed inside and on the surface of a cotton-like fiber molded body, and a coating layer is formed on the surface. FIG. 9 is a model diagram of a cotton-like fiber molded body containing different optional components, or having different polymer compositions, or features of both, and having a coating layer formed on the surface. FIG. 10 shows different optional components contained in a cotton-like fiber molded article containing different optional components, or having different polymer compositions, or both characteristics, or having different polymer compositions. Or it is a model figure of the fiber molded object in which the high-density layer which has those characteristics of both was formed, and the coating layer was formed in the surface. FIG. 11 is a model diagram of a fiber molded body in which a plurality of carriers having different compositions or internal structures are joined. FIG. 12A) shows the results of measuring PD of HAOB obtained from alveolar bone of each age group. FIG. 12B) shows the results of karyotyping of HAOB3 (PD35) induced in the interphase by the G-band method (top) and the SKY method (bottom). FIG. 13 shows the results of culturing HAOB3 in a medium supplemented with various growth factors and evaluating the cell growth activity. In the figure, the vertical axis represents the relative value of the cell proliferation activity calculated with 1 as the number of cells when cultured using serum-free DMEM. In the figure, “MF” is MF medium, “20% FCS” is DMEM medium containing 20% FCS, “PDGFAA” is DMDM medium supplemented with 10 ng / ml PDGFAA, “PDGFAB” is 10 ng / ml Of DGF medium added with PDGFAB, “PDGFBB” indicates DMEM medium added with 10 ng / ml PDGFBB, and “bFGF” indicates DMEM medium added with 10 ng / ml bFGF. FIG. 14A shows the results of alizarin red staining (left) and the results of measurement of alkaline phosphatase activity (right) after HAOB3 was cultured in hBMP-2 supplemented medium or MF medium. 14B shows the results of measuring the expression levels of RUNX2, OSTERIX, OCN, and BSP in cells after culturing HAOB3 in a medium supplemented with hBMP-2 or MF medium. The vertical axis in B) shows the relative value of the expression level of each differentiation marker calculated with the expression level of β-Actin being 100. FIG. 14-2 shows the result of staining HAOB3 with an antibody against OPN and an antibody against OCN after culturing in a medium supplemented with hBMP-2 or MF medium. FIG. 15A) shows the result of alizarin red staining after culturing 6PD-29PD HAOB3. FIG. 15B) shows the results of measuring intracellular OCN expression levels after culturing HAOB3 such as 6PD in a medium supplemented with hBMP-2. FIG. 15C) shows the results of measuring the expression levels of RUNX2, OSTERIX and BSP in cells after culturing HAOB3 such as 6PD in a medium supplemented with hBMP-2. The vertical axis in B) and C) shows the relative value of the expression level of each differentiation marker calculated with the expression level of β-Actin being 100. In FIG. 16A), HAOB3 and NHOst were cultured in a medium containing hBMP-2 at a concentration of 50 to 1000 ng / ml, and then the result of staining with alizarin red (left) and the result of measuring alkaline phosphatase activity (right) Indicates. FIG. 16B) shows the results of measuring the expression levels of RUNX2, OSTERIX, OCN and BSP in cells after culturing HAOB3 and NHOst in a medium containing hBMP-2 at a concentration of 100 ng / ml. The vertical axis in B) shows the relative value of the expression level of each differentiation marker calculated with the expression level of β-Actin being 100. 17a shows the result of staining OPN of differentiation-induced HAOB3, b shows the result of staining OCN of differentiation-induced HAOB3, c shows an image of a and b superimposed, and d shows differentiation-induced NHOst. As a result of staining OPN, e shows the result of staining the differentiation-induced NHOst OCN, and f shows an image in which d and e are superimposed. FIG. 18 shows the results of measuring the expression level of BMP-2 after culturing HAOB3 and NHOst in a medium containing hBMP-2 at a concentration of 100 ng / ml. The vertical axis shows the relative value of the expression level of hBMP- calculated with the expression level of β-Actin being 100. FIG. 19A) shows the results of measuring the expression levels of MGP, STMN2, and NEBL in HAOB3 (6PD and 35PD). The vertical axis in A) shows the relative value of the expression level of each gene, calculated with the expression level of β-Actin being 100. B) shows the results of measuring the expression levels of RUNX2, OSTERIX, OCN, BSP, MGP, STMN2, and NEBL in HAOB3 (6PD). The vertical axis in B) of FIG. 19 shows the relative value of the expression level of each gene calculated with the expression level of β-Actin being 100. FIG. 19C) shows the gene expression change rate (%) of RUNX2, OSTERIX, OCN, BSP, MGP, STMN2 and NEBL in 6PD and 35PD of HAOB3. This gene expression change rate is calculated by multiplying 100 by the value obtained by dividing the gene expression level of HAOB3 in 6PD by the gene expression level of HAOB3 in 35PD. FIG. 20 shows the results of measuring the expression levels of STMN2, NEBL and MGP in HAOB1 to 4, human epidermis-derived fibroblasts (HFF), human osteosarcoma cells (MG63), and femur-derived osteoblasts (NHOst). Show. The vertical axis in each figure shows the relative value of the expression level of each gene, calculated with the expression level of β-Actin being 100. FIG. 21 shows proliferation of undifferentiated osteoblasts derived from alveolar bone on a carrier. FIG. 22 shows the results showing changes in alkaline phosphatase activity. FIG. 23 shows the time course of calcium deposition by alizarin red staining. FIG. 24 shows the results showing changes in the expression of calcification-related genes in the composite. FIG. 25 shows proliferation of undifferentiated osteoblasts derived from alveolar bone on a carrier. FIG. 26 shows changes in alkaline phosphatase activity and changes in calcium deposition due to alizarin red staining. FIG. 27 shows the formation of a bone-like structure in vivo.

The present invention will be described below.
TECHNICAL FIELD The present invention relates to a composite of an alveolar bone-derived undifferentiated osteoblast and a carrier.

Undifferentiated osteoblasts derived from alveolar bone In the present invention, undifferentiated osteoblasts derived from alveolar bone are described as follows.

In the present invention, an undifferentiated osteoblast means a pre-osteoblast that has not yet differentiated into an osteoblast, has a proliferative ability, and has a capacity to differentiate into an osteoblast. Here, “having proliferative ability” indicates that the cells can be proliferated by cell division in a medium in which undifferentiated osteoblasts described later can grow. Further, “having the ability to differentiate into osteoblasts” means having the property of differentiating into osteoblasts in the presence of an osteoblast-inducing factor such as BMP2 or in a state of being supported on a carrier described later. Indicates that When differentiated into osteoblasts, for example, increased alkaline phosphatase activity, increased staining intensity of cells due to alizarin red staining, and osteoblast differentiation markers (RUNX2, OSTERIX, OSTEOCALCIN (OCN), BONE SIALOPROTEIN (BSP), Increase in the expression level of OSTEOPONTIN (OPN) is recognized, so whether or not it has differentiated into osteoblasts is determined using these as indicators.

The method for obtaining the alveolar bone can be easily understood by those skilled in the art. For example, the alveolar bone can be collected by a normal surgical technique, and the alveolar bone removed at the time of extraction can be used conveniently.

The alveolar bone-derived undifferentiated osteoblasts used in the present invention are obtained by cultivating alveolar bone-derived cells after enzymatic treatment to obtain alveolar bone-derived cells, and then culturing them in a medium in which undifferentiated osteoblasts can grow. Obtainable.

Here, in order to obtain alveolar bone-derived cells by enzymatic treatment of the alveolar bone, the enzyme may be allowed to act on the alveolar bone in a buffer solution such as a phosphate buffer. As an enzyme used for obtaining cells derived from alveolar bone from alveolar bone, an enzyme generally used in separating cells from biological tissue pieces may be used. Specifically, collagenase, Examples include proteases such as pepsin and trypsin. Among these enzymes, collagenase is preferable from the viewpoint of efficiently recovering cells from the alveolar bone.

Also, in order to increase the enzyme treatment efficiency, the collected alveolar bone may be cut into 5 to 10 mm pieces prior to the enzyme treatment.

The conditions for causing the enzyme to act on the alveolar bone are not particularly limited as long as the cells derived from the alveolar bone can be released, but examples thereof include the following conditions.
Alveolar bone concentration: The alveolar bone concentration is set to 1 ml for three alveolar bone fragments, preferably 0.5 to 1.5 ml for one alveolar bone fragment.
Enzyme concentration: For example, when collagenase (> 1.5 U / mg) is used, the enzyme concentration is set to 1 to 4 mg / ml, preferably 1.5 to 3 mg / ml. In the present specification, collagenase 1U means 1 μm from 4-phenyl-azobenxyl-oxycarbonyl-L-prolyl-L-leucyl-L-glycyl-L-prolyl-D-arginine at 25 ° C. for 1 minute. Represents the enzyme titer capable of releasing molar 4-phenyl-azobenxyl-oxycarbonyl-L-prolyl-L-leucine.
Process temperature: Set to 37 ° C. ± 2 ° C.
Treatment time: 10 to 40 minutes, preferably 15 to 25 minutes.

The enzyme treatment for alveolar bone may be repeated a plurality of times as necessary in order to increase the recovery rate of alveolar bone-derived cells, preferably 4 to 12 times.

By carrying out the enzyme treatment in this way, alveolar bone-derived cells are released from the alveolar bone. For this reason, after the enzyme treatment, the cells can be obtained by performing known means such as centrifugation of alveolar bone-derived cells.

The alveolar bone-derived cells can be obtained by culturing the cells derived from the alveolar bone in a medium in which undifferentiated osteoblasts can grow, whereby an alveolar bone-derived undifferentiated osteoblast group can be obtained.

A medium capable of growing undifferentiated osteoblasts is a growth factor required for growth of undifferentiated osteoblasts in a basic medium containing inorganic salts, amino acids, vitamins and the like, which are essential components for growing animal cells. And those with added components. Examples of such a basal medium include Eagle basal medium (MEM), α Eagle basal medium (αMEM), Dulbecco's modified Eagle medium (DMEM), and Ham's F-12 medium. Although there is no limitation as long as undifferentiated osteoblasts derived from alveolar bone are obtained, a preferable example of a medium in which the undifferentiated osteoblasts can grow is a medium containing PDGF (platelet-derived growth factor) as a growth factor. . Presence of PDGF makes it possible to efficiently proliferate undifferentiated osteoblasts excellent in bone tissue regeneration ability from alveolar bone-derived cells. PDGF may be contained in the medium or may be added to the medium by external addition.

PDGF is divided into PDGFAA, PDGFAB, PDGFBB, etc. depending on the combination of subunits, but any of them may be used in the present invention. Also, the origin of PDGF is not particularly limited, and may be any of those derived from animal tissues, those produced by gene recombination techniques, and the like. Examples of the concentration of PDGF in the medium include 1 to 100 ng / ml, preferably 10 to 30 ng / ml.

In addition to the PDGF, monoethanolamine is preferably included as a medium in which undifferentiated osteoblasts can grow. When monoethanolamine is contained, the concentration of monoethanolamine in the medium is 0.1 to 100 μg / ml, preferably 6 μg / ml.

Further, the medium may contain one or more of insulin, transferrin, and bFGF (basic fibroblast growth factor). When insulin is added to the medium, the concentration of insulin in the medium is 1 to 100 μg / ml, preferably 10 μg / ml. When transferrin is added to the medium, the concentration of transferrin in the medium is 1 to 100 μg / ml, preferably 5 to 15 μg / ml. When bFGF is added to the medium, the concentration of bFGF in the medium is 1 to 100 ng / ml, preferably 5 to 15 ng / ml.

The medium in which undifferentiated osteoblasts can grow may contain antibiotics such as streptomycin, kanamycin, and penicillin.

From the viewpoint of easily proliferating undifferentiated osteoblasts, MF medium (manufactured by Toyobo Co., Ltd.) is exemplified as a preferred specific example of a medium in which undifferentiated osteoblasts can grow.

To obtain undifferentiated osteoblasts derived alveolar bone, with the addition of cells from the alveolar bone to a possible medium growth undifferentiated osteoblasts, for example 37 ° C., under 5% CO _2, 1-7 The culture may be performed for 1 day, preferably 4 days.

By culturing in this way, the proliferated undifferentiated osteoblasts are present in a state of adhering to the base of the culture container. Therefore, by recovering the cells attached to the base of the culture container, the alveoli used in the present invention Bone-derived undifferentiated osteoblasts can be obtained. In particular, since the proliferated undifferentiated osteoblasts are present in a state of being attached to the base of the culture container in this way, by recovering the cell group attached to the base of the culture container, the alveolar bone used in the present invention is derived. The undifferentiated osteoblast can be efficiently obtained.

The method for recovering the cells attached to the base of the culture vessel may be a known method. For example, 0.25% trypsin and 1 mM EDTA (ethylenediaminetetraacetic acid) can be allowed to act on the cells attached to the base of the culture vessel. That's fine. From this, according to this invention, the cell group which has bone tissue regeneration ability obtained by culture | cultivating the undifferentiated osteoblast extract | collected from the alveolar bone can be obtained.

In the above description, the collected alveolar bone tissue is treated with an enzyme to obtain undifferentiated cells derived from alveolar bone, and the undifferentiated cells derived from alveolar bone obtained in the first step are undifferentiated. A second step of culturing in a medium in which osteoblasts can grow, and undifferentiated osteoblasts and / or cells derived from the alveolar bone grown in the second step (that is, undifferentiated osteoblasts derived from alveolar bone (cells) It can be said that the method for producing undifferentiated osteoblasts (cell group) derived from alveolar bone having the ability to regenerate bone tissue, including the third step of collecting group)).

The alveolar bone-derived undifferentiated osteoblast used in the present invention has a remarkably superior ability to regenerate bone tissue as compared with conventionally known osteoblasts. Therefore, by using undifferentiated osteoblasts (cell group) derived from alveolar bone, particularly by using the undifferentiated osteoblasts (cell group) together with a carrier described later, clinically practical bone tissue regeneration can be achieved. It becomes possible.

In addition, the undifferentiated osteoblast has a special feature in that it can be subcultured for a long period of time (for example, up to 30 Doubling Doubling). The subculture may be performed by culturing the cells according to a conventionally known procedure using a medium capable of growing the above-mentioned undifferentiated osteoblasts. For example, as described in the examples below, the above-mentioned undifferentiated osteoblasts are grown. What is necessary is just to replace | exchange a culture medium every 3 days in the possible culture medium.

Further, alveolar bone-derived undifferentiated osteoblasts used in the present invention include MGP (matrix gla protein: NM_000900.3 (National center for biotechnology (NCBI)), STMN2 (stathmin-like 2: NM_007029.3 (NCBI)). )) And NEBL (nebulette: NM_006393.2 (NCBI)) These genes are rarely expressed in femur-derived osteoblasts or expressed in a small amount. It is highly expressed in alveolar bone-derived undifferentiated osteoblasts used in, and can be used as a novel marker peculiar to alveolar bone-derived undifferentiated osteoblasts. A relative value with an amount of 100, which expresses MGP of 70 or more, NEBL of 50 or more, and STMN2 of 50 or more is identified as an undifferentiated osteoblast derived from alveolar bone used in the present invention. The expression level of these genes is It is measured by a conventionally known method such as gene chip analysis, RT-PCR method, real-time PCR method, etc. Gene chip analysis and real-time PCR method are preferred as methods for measuring the expression levels of these genes. The gene chip used for the analysis may be a commercially available one (eg, HT Human Genome U133 Array Plate Set (Gene Chip; Affymetrix, CA, USA)) or a known method (Lipshutz, R. J Et al., (1999) Nature genet. 21, Suppliment, 20-24) may be used.

Furthermore, the undifferentiated osteoblasts are also characterized in that they are induced to differentiate into osteoblasts in the presence of BMP-2 (bone morphogenetic protein-2) in vitro. In this case, in order to differentiate the undifferentiated osteoblasts into osteoblasts, specifically, the undifferentiated osteoblasts in a medium containing BMP-2, dexamethasone, ascorbic acid, and β-glycerophosphate. May be cultured. Further, the undifferentiated osteoblasts are also characterized by secreting BMP-2 by inducing differentiation in the presence of BMP-2. Such a feature is one proof that the undifferentiated osteoblasts derived from alveolar bone are different from the conventionally known osteoblasts. Further, when the undifferentiated osteoblasts differentiate into osteoblasts, for example, increased alkaline phosphatase activity, increased cell staining intensity due to alizarin red staining, and osteoblast differentiation markers (RUNX2, OSTERIX, OSTEOCALCIN ( OCN), BONE SIALOPROTEIN (BSP), and OSTEOPONTIN (OPN)) are increased. These expression levels can be known according to a conventionally known procedure.

Alveolar bone-derived undifferentiated osteoblast carrier In the present invention, the alveolar bone-derived undifferentiated osteoblast carrier is described as follows.

In the present invention, the carrier is a fiber molded product having a three-dimensional network structure, the bulk density of the fiber molded product is 0.0001 to 0.25 g / cm ³ , and the fibers constituting the fiber molded product are biocompatible. A functional polymer.

In the present invention, the fiber molded product having a three-dimensional network structure means an aggregate of fibers, and one or a plurality of fibers are laminated, woven, knitted, or formed by other methods. This is a porous molded body. As long as the present invention is not limited to this, the form of the fiber molding includes, for example, any form such as a cotton-like fiber molding, a non-woven fiber molding, and a mixed fiber molding thereof. . The shape of the fiber molded product is not limited to the present invention, and examples thereof include any shape such as a block shape, a columnar shape, a plate shape, a tube shape, a spherical shape, and a regular bulk shape.

In the present invention, the bulk density of the fiber molded product is 0.0001 to 0.25 g / cm ³ , preferably 0.001 to 0.1 g / cm ³ , and the three-dimensional shape is well maintained. from the viewpoint of the efficiency of differentiation proliferation efficiency and / or the undifferentiated osteoblasts blasts, more preferably 0.001 ~ 0.05 g / cm ^3, more preferably exemplified 0.002 ~ 0.03 g / cm ³ Is done. Here, the bulk density is calculated using the volume and weight of the carrier (fiber molded product) measured at room temperature (25 ° C.). Here, the volume is calculated by cutting the fiber molded product into a rectangular parallelepiped (about 8 cm ³ ), directly measuring its outer shape using a ruler, caliper, etc., and multiplying the height, width, and height, or photographing. The outer shape obtained from the obtained image or the like is obtained by measuring and calculating by image analysis. In the present invention, the bulk density means an average value of three or more points of the bulk density measured as described above.

The fiber constituting the fiber molded product is not limited as long as it contains a biocompatible polymer. In the present invention, the biocompatible polymer means a polymer that has no or little adverse effect on a living body when applied to a living body and can be used in a living body for a long period of time. Examples thereof include polymers.

Examples of the polymer include lactides and lactones (eg, β-propiolactone, β-butyrolactone, β-pivalolactone, γ-butyrolactone, δ-valerolactone, β-methyl-δ-valerolactone, ε-caprolactone, etc.) Glycolic acid containing glycolide, ethylene oxalate (1,4-dioxane-2,3-dione), carbonates (for example, trimethyline carbonate), ethers (for example, 1,3-dioxane), ether esters ( Cyclic monomers such as dioxanone) and lactams (e.g. ε-caprolactam); hydroxycarboxylic acids such as lactic acid, glycolic acid, 3-hydroxypropanoic acid, 3-hydroxybutanoic acid, 4-hydroxybutanoic acid, 6-hydroxycaproic acid Or its alkyl ester; A substantially equimolar mixture of an aliphatic diol such as cole, 1,4-butanediol and an aliphatic dicarboxylic acid such as succinic acid or adipic acid or an alkyl ester thereof; an aliphatic ester monomer alone or Examples thereof include aliphatic polyester resins such as copolymers and block copolymers. These can be referred to as biocompatible hydrophobic polymers. The polymer is preferably exemplified by polylactic acid, polycaprolactone, polyglycolic acid, a copolymer composed of two or more thereof, and more preferably poly L-lactic acid, poly DL-lactic acid, poly D-lactic acid, Examples include poly-p-dioxanone, poly L-lactic acid / ε-caprolactone copolymer, poly L-lactic acid / glycolic acid copolymer, poly DL-lactic acid / glycolic acid copolymer, and the like. These may be used alone or in combination of two or more.

Furthermore, the fibers constituting the fiber molded product may further contain a biocompatible hydrophilic polymer. Examples of hydrophilic polymers include polysaccharides such as cellulose, agarose, alginic acid, and gums, derivatives of polysaccharides such as methylcellulose, propylcellulose, and benzylcellulose, acetate fibers such as cellulose diacetate and cellulose triacetate, heparin or derivatives thereof, chondroitin Or derivatives thereof, glycosaminoglycans such as hyaluronic acid, mucopolysaccharides such as chitin and chitosan or derivatives thereof, collagen or derivatives thereof such as atelopeptide collagen and reconstituted fiber collagen, gelatin, fibroin, keratin, polyglutamic acid or Examples thereof include a polypeptide such as a salt thereof, or a mixture, a crosslinked product, a complex, etc. composed of two or more of these polymers. For naturally-derived polymers, properties such as molecular weight distribution and isoionic point vary depending on the production method. However, if the polymer solution can be prepared so as to have a predetermined viscosity in obtaining the fiber molded product, it can be adapted to the purpose. May be used as appropriate. Preferred examples of the polymer include gelatin, collagen, polyglutamic acid and its salt, and agarose, and more preferred examples include gelatin, collagen, polyglutamic acid, and sodium polyglutamate. These may be used alone or in combination of two or more.

When a hydrophilic polymer is contained in the fiber constituting the fiber molded product, a fiber in which the hydrophilic polymer and the hydrophobic polymer are mixed randomly or uniformly may be formed. The hydrophilic polymer and the hydrophobic polymer may be formed. The fiber may be formed without substantially mixing the polymer, and the hydrophilic polymer may be present on at least a part of the surface of the hydrophobic polymer to form the fiber. The fibers constituting the fiber molding may be any mixture of these fibers. For example, the fiber molded product includes both fibers formed by randomly or uniformly mixing a hydrophilic polymer and a hydrophobic polymer, and fibers formed without substantially mixing the hydrophilic polymer and the hydrophobic polymer. The fiber molded article may include one or both of the fibers described above, and a hydrophilic polymer may be further present in at least a part thereof.

Although the present invention is not limited, in order to regenerate the bone tissue of the affected part in the present invention, undifferentiated osteoblasts derived from alveolar bone (at least a part may be differentiated into osteoblasts and calcified). It is desirable that the artificial bone material including the composite of the above-mentioned carrier and the carrier has a three-dimensional shape. From this viewpoint, the carrier is three-dimensionally shaped and can be used during cell culture and differentiation. More preferably, the three-dimensional shape can be stably maintained. From the viewpoint of more stably maintaining the three-dimensional shape of the carrier, the fibers of the fiber molded body constituting the carrier should form a composite fiber in which a hydrophilic polymer fiber is formed inside the hydrophobic polymer fiber. More preferably, the hydrophilic polymer fibers form a three-dimensional network structure inside the composite fiber, and the hydrophilic polymer fibers are bonded to each other to form a twisted structure in the composite fiber, thereby bringing the composite fibers into contact with each other. More preferably, it is controlled to stabilize the three-dimensional shape of the carrier. In this case, in order to form a twisted structure in the composite fiber, the fiber diameter of the hydrophilic polymer fiber is preferably 10 to 1000 nm.

Although not limiting the present invention, such fibers are illustrated in FIGS. FIG. 1 is a composite fiber including a hydrophobic polymer and a hydrophilic polymer in which a twisted structure is formed. The twist of the fibers limits the contact between the composite fibers, which contributes to stabilizing the three-dimensional shape of the carrier. FIG. 2 shows the structure of the hydrophilic polymer in the composite fiber visualized by etching only the hydrophobic polymer in the composite fiber containing the hydrophobic polymer and the hydrophilic polymer. The hydrophilic polymer fibers form a three-dimensional network structure inside the composite fiber, and the hydrophilic polymer fibers are bonded to each other. FIG. 3 is an example of a model diagram of such a composite fiber. In addition, although this invention is not restrict | limited, FIG. 3 is the illustration by which a part of surface of the composite fiber was coat | covered with the hydrophilic polymer.

Although not limited as long as the effect of the present invention is obtained, the content of the biocompatible polymer (total amount of hydrophobic polymer and hydrophilic polymer) in the fibers constituting the fiber molded product is preferably 50% by weight or more, more preferably Is exemplified by 70 to 100% by weight, more preferably 90 to 100% by weight, particularly preferably substantially 100% by weight.

Further, the fiber is not limited as long as the effect of the present invention is obtained, but in the fiber constituting the fiber molded article, the composite fiber containing a hydrophobic polymer of a biocompatible polymer and a hydrophilic polymer is preferably 50% by weight of the hydrophobic polymer. As described above, the hydrophobic polymer is more preferably 70% by weight or more, particularly preferably the hydrophobic polymer is 80 to 99.5% by weight.

The fiber may contain an optional component such as a polymer other than the biocompatible polymer as necessary within the range in which the effect of the present invention is obtained. Examples of the component include surfactants, drugs, and fillers (polymer particles, metal particles, ceramic particles, etc.).

Of the optional components, the surfactant is not intended to limit the present invention, but examples include anionic properties such as sodium fatty acid, monoalkyl sulfate, alkyl polyoxyethylene sulfate, alkyl benzene sulfonate, and monoalkyl phosphate. Surfactant, cationic surfactant such as alkyltrimethylammonium salt, dialkyldimethylammonium salt, alkylbenzyldimethylammonium salt, amphoteric surfactant such as alkyldimethylamine oxide, alkylcarboxybetaine, polyoxyethylene alkyl ether, fatty acid sorbitan Nonionic surfactants such as esters, alkylpolyglucosides, fatty acid diethanolamides, alkyl monoglyceryl ethers; glycerophospholipids (phosphatidylcholine and phosphatidylethanol) Min etc. or a hydrogenated product thereof), phospholipids such as sphingolipids such as phospholipids (sphingomyelin) and glycosphingolipid, a derivative thereof or mixtures thereof and the like. Of these, preferred are phospholipids, derivatives thereof, and mixtures thereof. These may be used individually by 1 type, may use 2 or more types, and those skilled in the art should just select according to the intended purpose.

For drugs, the invention is not limited but includes, for example, anti-inflammatory agents, fibronectin, albumin, laminin, clotting or anticoagulant factors (antithrombin, plasmin, urokinase, streptokinase, fibrinogen activator, thrombin, etc.) Kallikrein, kinin, radikinin antagonists, enzymes that do not act on blood, hormones, growth factors such as bone morphogenetic and cell growth factors, proteinaceous bone growth factors, coagulation or anticoagulants, hemolysis inhibitors, osteoporosis treatments, etc. Can be mentioned. These may be used individually by 1 type, may use 2 or more types, and those skilled in the art should just select according to the intended purpose.

Although the present invention is not limited to the filler, examples thereof include polymers, ceramics, metals, granules of any composites thereof, hydrogels, dried products thereof, and the like. Moreover, the filling may hold | maintain a chemical | medical agent etc. inside, The above-mentioned thing is illustrated as a chemical | medical agent. The filler for retaining the drug is not limited to the present invention, but for example, one or more of polyvinyl alcohol, collagen, gelatin, agar, hyaluronic acid, chitin / chitosan, polyvinyl acetate Preferable examples include hydrogels comprising the above, dried products thereof, biodegradable polymers such as polylactic acid-based polymers and polyethylene glycol-based polymers, and composites thereof with calcium phosphate-based ceramics. These may be used individually by 1 type, may use 2 or more types, and those skilled in the art should just select according to the intended purpose.

The content of the optional component in the fiber is not limited as long as the effect of the present invention is not hindered. However, when the optional component is contained, the optional component is preferably 50% by weight or less in the fiber. A preferred example is 0.05 to 5% by weight.

In the present invention, the average fiber diameter of the fibers of the fiber molded product is not limited as long as the effects of the present invention can be obtained, but from the viewpoint of the strength and surface area of the fiber molded product, it is preferably 0.05 to 30 μm. Here, the fiber diameter means a diameter of a fiber cross section, and is determined from an average value of at least three positions measured by an electron beam microscope image or a confocal laser microscope image of the fiber. When the fiber cross section is elliptical, the average of the length in the major axis direction and the length in the minor axis direction of the ellipse is calculated as the fiber diameter. When the fiber cross section is neither circular nor elliptical, the fiber diameter is calculated by approximating a circle or ellipse.

The fiber molded object is manufactured by an electrospinning method. The electrospinning method is a known method, and is a technique in which a polymer solution discharged from a discharge unit such as a syringe is charged by applying a high voltage, and a micro-level or nano-level fiber is attached to a collector. A three-dimensional fiber structure can be produced by molding the obtained fiber.

In the present invention, by using an electrospinning method, a fiber containing the biocompatible polymer may be produced by discharging a solution containing the biocompatible polymer from a discharge unit, and a fiber structure may be formed. Here, in producing a fiber from a biocompatible polymer, the fiber used in the present invention is not limited as long as the fiber can be produced, but an electric field used for electrospinning is exemplified to be 500 to 5000 V / cm. The fiber molded product, that is, the carrier can be produced by laminating, compressing, joining, and / or cutting the obtained fiber as necessary. The size and thickness of the carrier may be appropriately set by those skilled in the art depending on the purpose of use and application site. Although not limiting the present invention, examples of the thickness of the carrier include 0.05 to 500 mm. Although not limited to this, the thickness of the carrier is preferably 0.5 to 100 mm, more preferably 0.5 to 50 mm, from the viewpoint of facilitating the production of the carrier. The thickness of the carrier can be measured by directly measuring the height of the fiber molded product using a ruler or caliper without applying pressure to the carrier, or by measuring and calculating the outer shape obtained from the photographed image etc. Ask for. In the present invention, the thickness means an average value of three or more values measured in this way. In the present invention, the thickness usually refers to the shortest side among the three sides (vertical, horizontal, and height) constituting the carrier.

The solution containing the biocompatible polymer is not limited as long as a desired fiber can be produced. However, a mixture of the biocompatible polymer and a solvent capable of dissolving the biocompatible polymer, and the optional components are required. The liquid mixture which contains further according to it is illustrated. The solvent is not limited as long as the desired fiber can be produced. Examples of the solvent include chloroform, dichloromethane, N, N-dimethylformamide, formamide, water, formic acid, acetic acid, trifluoroacetic acid, trichloroacetic acid, trifluoroethanol, 1, Examples include 1,1,3,3,3-hexafluoro-2-propanol and acetone. These may be used alone or in combination of two or more.

In the solution (polymer solution) containing the polymer used for producing the carrier of the present invention, the content of the biocompatible polymer is 2% by weight or more, more preferably 2.5 to 25% by weight, still more preferably 5%. ˜15 wt% is exemplified. A person skilled in the art may appropriately set the solvent and arbitrary components in the solution according to the target fiber molded body.

Further, the carrier of the present invention may have a hole penetrating the carrier and / or a hole not penetrating as necessary. The pore diameter may be appropriately determined according to the purpose. For example, from the viewpoint of allowing cells to penetrate more efficiently into the carrier, pores with an average pore diameter of preferably larger than 10 μm are exemplified, and more preferably, the average pore diameter is larger than 10 μm and larger than 1000 μm. The following are exemplified. The method for forming the hole is not particularly limited, and may be appropriately formed by those skilled in the art. For example, the hole is exemplified, and more specifically, the hole using the processing laser is exemplified. The same applies to the case where the carrier of the present invention includes a coating layer and / or a high-density layer described later. Here, the average hole diameter is a value calculated as a diameter of a circle having the same area by measuring the projected area of the hole by image analysis or the like.

The carrier of the present invention may have a coating layer on at least a part of the fiber molded product. Without limiting the present invention, a model in which the carrier of the present invention is provided with a coating layer is illustrated briefly in FIG. The coating layer bridges fibers on at least a part of the surface of the fiber molded product.

The thickness of the coating layer is not limited as long as the effect of the present invention is obtained, but is preferably 1000 μm or less, more preferably 0.5 to 10 μm, still more preferably 1 to 5 μm. Here, the thickness of the coating layer is a value obtained by averaging the heights of the coating layers, and is calculated by image analysis of a microscopic image of the cross section. The height of the coating layer refers to a direction substantially perpendicular to the fiber molding in the coating layer. When the coating layer is thin and measurement is difficult, the coating layer is formed on a smooth metal substrate and then calculated by analysis using a step meter or a confocal laser microscope. In the carrier of the present invention, even when the fiber molded product has a coating layer, the bulk density including the coating layer is preferably 0.0001 to 0.25 g / cm ³ . In the carrier of the present invention, when the fiber molded product has a coating layer, it is preferable that the thickness of the carrier including the coating layer is 0.05 to 500 mm.

The coating layer preferably has pores having an average pore diameter of 10 μm or more penetrating through the coating layer, and more preferably an average pore diameter of 10 to 1000 μm is exemplified. Here, the average hole diameter is a value calculated as a diameter of a circle having the same area by measuring the projected area of the through hole of the coating layer by image analysis or the like.

In addition, it is exemplified that the coating layer preferably has an opening of 50% or more of the surface area of the coating layer. Here, the opening portion refers to a portion that is present in the coating layer but penetrates the coating layer and the covered fiber molded product is exposed. The surface area of the coating layer is the surface area of the outer shape of the carrier covered by the coating layer. The surface area of the outer shape of the carrier is imaged from the image of the carrier directly measured using a ruler, caliper, etc. It may be calculated by analysis.

By providing a covering layer on the fiber molded product, the shape of the fiber molded product can be more stably maintained. In particular, the lower the bulk density of the fiber molded product, the less stable the fiber molded product. By providing a coating layer, the shape of the fiber molded product can be maintained more stably. It becomes possible to efficiently carry the undifferentiated osteoblasts derived from the cells, and in particular, the cells can be efficiently introduced into the fiber molded body. From this viewpoint, more preferably, the fiber molded article includes a coating layer. From the viewpoint of further improving the stability, the coating layer is more preferably one having a thickness of 1000 μm or less and the average pore diameter of the holes penetrating the coating layer being 10 μm or more, more preferably 0.5 to 10 μm. And the average pore diameter of the holes penetrating the coating layer is 10 to 1000 μm. From this point of view, the coating layer is preferably composed of an aggregate of fibers. An example of a coating layer having such characteristics is shown in FIG. FIG. 5 is an enlarged photograph of the coating layer surface.

The method for forming the coating layer on the fiber molded product is not limited as long as the coating layer can be obtained, but the outermost fibers are fused to each other using a laser or the like on part or all of the outer surface of the fiber molded body. The sealing process etc. by performing are illustrated, By this, the coating layer which consists of a fiber layer fuse | melted to the fiber molding can be formed.

In the case where the coating layer is composed of an aggregate of fibers, a method of forming a non-woven fiber forming body on the surface of the carrier by electrospinning is preferable. In the electrospinning method, a support layer is formed on the surface of the carrier by placing the carrier between a discharge portion of a polymer solution such as a syringe to which a high voltage is applied and a counter electrode that collects fibers. In order to make the formation of the coating layer easier, the carrier may be irradiated with an ion wind having a polarity opposite to the polarity applied to the discharge portion of the polymer solution. Further, as a preferable example, from the viewpoint of maintaining the three-dimensional shape of the carrier more stably, in the fibers of the fiber molded body constituting the carrier, a cotton-like fiber in which hydrophilic polymer fibers are formed inside the hydrophobic polymer fibers When the composite fiber is formed by electrospinning, the coating layer is made of nonwoven composite fiber by switching from the polymer solution to a polymer solution in which the hydrophilic polymer component is removed or by appropriately changing the electric field conditions of electrospinning. Can be formed on the outermost surface of the cotton-like fiber molded body, whereby a coating layer can be provided on the surface of the fiber molded body.

The average fiber diameter of the fibers constituting the coating layer is not limited as long as the effects of the present invention can be obtained, but preferably 0.05 to 30 μm. The fiber diameter is described in the same manner as described above.

In addition, the carrier of the present invention may have one or more porous high-density layers on at least a part of the fiber molded product. In other words, the carrier of the present invention may have a layer having a low bulk density (low density layer) and a layer having a high bulk density (high density layer) in the fiber molded product. In this case, the carrier of the present invention Can be said to have a dense structure.

The bulk density of each of the low density layer and the high density layer is in the range of the bulk density of 0.0001 to 0.25 g / cm ³ . Although not limiting the present invention, in the carrier of the present invention, preferably, the bulk density of the high-density layer has a bulk density that is at least twice that of the low-density layer adjacent to the high-density layer. More preferably, the bulk density is 5 times or more larger. The high-density layer may be present on at least a part of the surface of the fiber molded article, may be present on at least a part of the inside, or may be present on both.

In the carrier of the present invention, even when the fiber molded product has a high-density layer, the bulk density including the high-density layer and the low-density layer may satisfy 0.0001 to 0.25 g / cm ^3. preferable. In the carrier of the present invention, even when the fiber molded product has the coating layer, the high-density layer, and the low-density layer, the bulk density including the coating layer and the high-density layer is 0.0001 to 0.00. It is preferable to satisfy 25 g / cm ³ .

The thickness of the high-density layer is not limited, but is preferably 1000 μm or less, more preferably 5 to 30 μm. Of course, the thickness of the high-density layer and the thickness of the low-density layer do not exceed the thickness of the fiber molded product. In the carrier of the present invention, when the fiber molded product has a high-density layer, the thickness of the carrier including the high-density layer is preferably 0.05 to 500 mm.

From the viewpoint of efficiently proliferating and / or differentiating undifferentiated osteoblasts derived from alveolar bone, the high-density layer is composed of an aggregate of fibers.

Further, holes having an average pore diameter larger than 10 μm may be perforated in the high-density layer to form a passage through which cells pass. The method for forming the hole is not particularly limited, and examples thereof include drilling using a processing laser. The average pore diameter is measured as described above.

In the present invention, the fiber molded product having a high-density layer is useful in terms of more efficiently proliferating and differentiating undifferentiated osteoblasts derived from alveolar bone in the high-density layer.

The method for forming the high density layer on the fiber molded product is not limited as long as the high density layer is obtained. In the case where the high-density layer is composed of an aggregate of fibers, a method of forming a non-woven fiber forming body on the surface of the fiber molded article by electrospinning is preferable. In the electrospinning method, a high-density layer is formed on the surface of the fiber molded article by placing the fiber molded article between a discharge portion of a polymer solution such as a syringe to which a high voltage is applied and a counter electrode that collects the fibers. In order to make the formation of the high-density layer easier, the carrier may be irradiated with an ion wind having a polarity opposite to the polarity applied to the discharge portion of the polymer solution. Further, as a preferable example, from the viewpoint of maintaining the three-dimensional shape of the carrier more stably, in the fibers of the fiber molded body constituting the carrier, a cotton-like fiber in which hydrophilic polymer fibers are formed inside the hydrophobic polymer fibers If the composite fiber is formed by electrospinning, it is possible to switch to a polymer solution that removes the hydrophilic polymer component from the polymer solution, or by changing the electric field conditions of electrospinning, the density of non-woven composite fibers A layer can be formed on the outermost surface of a cotton-like shaped body.

The method for forming the high-density layer in the fiber molded product is not limited as long as the high-density layer can be obtained. From the viewpoint of maintaining the three-dimensional shape of the carrier more stably, the fiber molded body constituting the carrier is not limited. In the fiber, a cotton-like composite fiber molded body in which a hydrophilic polymer fiber is formed inside a hydrophobic polymer fiber is formed by electrospinning of a polymer solution in which a hydrophobic polymer and a hydrophilic polymer component are mixed. The high-density layer composed of the non-woven composite fiber can be formed on the outermost surface of the cotton-like molded body (low-density layer) by switching to the polymer solution from which the hydrophilic polymer component is removed from the polymer solution. it can. Subsequently, by switching to a polymer solution in which a hydrophobic polymer and a hydrophilic polymer component are mixed, a cotton-like composite fiber can be formed on the high-density layer.

Another method for forming a high density layer inside the fiber molding is to electrospin a polymer solution in which a hydrophobic polymer and a hydrophilic polymer component are mixed, so that the hydrophilic polymer is formed inside the fiber of the hydrophobic polymer. When forming a formed body of a cotton-like composite fiber in which fibers are formed, a high-density layer made of a nonwoven-like composite fiber is formed by increasing the electric field of electrospinning (the low-density layer). ) On the outermost surface. A cotton-like composite fiber can be formed on the high-density layer by continuously returning the electric field.

By performing this operation a plurality of times, it is possible to form a carrier having a coarse-dense structure in which a plurality of high-density layers are formed in an arbitrary thickness within the above-mentioned range within the cotton-like molded body. The thicknesses of the high-density layer and the low-density layer can be easily controlled, for example, by changing the time during which the layers are integrated by electrospinning. In addition, by forming a carrier by performing electrospinning while switching a polymer solution having a different polymer composition or a polymer solution containing a different arbitrary component, drug removal, different cellular responses, and the like are different for each layer inside the carrier. Functions such as biodegradation rate can be imparted.

The method for forming the high-density layer on both the inside and the surface of the fiber molding is not limited to the present invention. For example, the method for forming the high-density layer in the fiber molding and the fiber molding What is necessary is just to combine the method of producing | generating a high-density layer on the surface of an object.

The average fiber diameter of the fibers constituting the high-density layer is not limited as long as the effect of the present invention can be obtained, but is preferably 0.05 to 30 μm. The fiber diameter is described in the same manner as described above.

In the present invention, the carrier is not limited to this, but in the complex described later, the complex is formed from the viewpoint of more efficiently inducing differentiation of the supported undifferentiated osteoblasts derived from alveolar bone into osteoblasts. More preferably, as the carrier to be used, in the evaluation using alkaline phosphatase staining as an index, which will be described later, as an index, the alveolus is more than the case where the carrier 2 (fiber forming body having a bulk density of 0.21 g / cm ³ and a thickness of about 80 μm) is used Examples are carriers that can efficiently induce differentiation of bone-derived undifferentiated osteoblasts into osteoblasts (that can promote differentiation induction).

Here, the evaluation using alkaline phosphatase staining as an index shown in Examples described later follows the following procedure. That is, a complex of undifferentiated osteoblasts and a carrier was present in MF medium (Toyobo Co., Ltd.) containing 10 mmol / l β-glycerophosphoric acid, 50 μg / ml ascorbic acid, 100 nmol / l dexamethasone at 37 ° C. and 5% CO 2. Cultivate under, fix with 10 wt% formaldehyde for 30 minutes, stain with alkaline phosphatase stain for 5 minutes, and measure alkaline phosphatase activity. That differentiation into osteoblasts can be efficiently induced means that alkaline phosphatase positive time is earlier than when carrier 2 is used as a carrier constituting the complex.

Further, in the present invention, the carrier is not limited to this, but from the viewpoint of more efficiently inducing calcification in the complex, the carrier constituting the complex is preferably an alizarin red staining shown in the examples described later as an index. In the calcification evaluation to be performed, a carrier that can induce calcification more efficiently than the case of using the carrier 2 (can promote calcification) is exemplified.

Here, the evaluation using alizarin red staining as an index shown in the examples described later follows the following procedure. That is, a complex of undifferentiated osteoblasts and a carrier was present in an MF medium (Toyobo Co., Ltd.) containing 10 mmol / l β-glycerophosphate, 50 μg / ml ascorbic acid, 100 nmol / l dexamethasone at 37 ° C. and 5% CO _2. Incubate under, fix with 10 wt% formaldehyde for 30 minutes and stain with alizarin red for 5 minutes. Efficient calcification means that the time for calcification is earlier in the dyeing than when the carrier 2 is used as the carrier constituting the complex.

The form, size and the like of the carrier thus obtained are not particularly limited, and may be appropriately designed according to the damaged site of the bone tissue to be applied.

Although not limiting the present invention, model diagrams of the carrier obtained as described above are illustrated in FIGS.

Complex In the present invention, the complex of undifferentiated osteoblasts derived from alveolar bone and a carrier is limited as long as undifferentiated osteoblasts derived from alveolar bone are carried on at least a part of the carrier. Not.

The loading method is not limited as long as the cells come into contact with the carrier. For example, the carrier is impregnated, coated, sprayed, injected with a solution containing the cells (including liquid and semi-solid) and / or solid matter. The cells may be in the state of a cell spheroid. In addition, for example, there is a method in which cells are attached to the carrier by culturing while covering at least a part of the carrier with a cell sheet or a sheet-like material carrying cells.

Further, the amount of the cells supported on the carrier is not limited as long as the effect of the present invention can be obtained. For example, the undifferentiated osteoblasts derived from the alveolar bone are preferably 1 × 10 ³ to 1 cm ^{3 of} the carrier. Examples of the supported amount are 5 × 10 ⁶ cells, more preferably 1 × 10 ⁴ to 4 × 10 ⁶ cells.

Although it does not limit the present invention, for example, by temporarily holding the solution containing the cells in the fiber molded body, and then discharging the solution such as the cell culture solution held inside by compression, Cells can be easily concentrated in the carrier. The density of the fiber molded body after compression may be suitably used as the composite of the present invention as a preferable range for use as a carrier.

Since the composite of the present invention has an excellent ability to regenerate bone tissue, it can be used to regenerate the bone tissue and restore it to a normal state in a disease involving damage to the bone tissue. The composite of the present invention can be applied to any bone tissue damage such as alveolar bone damaged by periodontal disease, bone damaged by osteosarcoma, bone damaged by bone metastasized cancer, fracture, etc. The target is not restricted. In the composite of the present invention, an alveolar bone damaged by periodontal disease is a suitable application target from the viewpoint of achieving a remarkably excellent treatment (regeneration) effect.

The composite of the present invention is used by being administered (implanted) to a damaged site of bone tissue. In addition, the composite of the present invention may be directly administered (transplanted) to a damaged site of bone tissue, and after growing at least a part of the undifferentiated osteoblasts carried in vitro with a carrier, Administration (transplantation) may be performed at the site of tissue damage. Further, the composite of the present invention may be administered (transplanted) to a damaged site of bone tissue after at least a part of the undifferentiated osteoblasts are differentiated into osteoblasts in vitro. Accordingly, the present invention also provides a composite in which at least a part of the alveolar bone-derived undifferentiated osteoblasts are differentiated into alveolar bone-derived osteoblasts, It can also be called a cell differentiation complex. The composite of the present invention may be administered (implanted) to a damaged site of bone tissue after bone tissue is formed on at least a part of the carrier in vitro. Therefore, the present invention also provides a composite in which at least a part of the undifferentiated osteoblasts derived from the alveolar bone is calcified, which can also be referred to as a calcified composite.

As a method for administering (transplanting) the composite of the present invention to a damaged site of bone tissue, a conventionally known method may be followed in this field, and depending on the type of bone tissue to be treated, the degree of damage, etc. May be set as appropriate.

In the regeneration of bone tissue in the present invention, the dose of the composite of the present invention may be appropriately set according to the degree of disease symptoms, the sex and age of the patient, etc. , the applied dose ^{^{1 × 10 5 ~ 1 × 10}} 7 cells of undifferentiated osteoblasts derived from the alveolar bone, preferably ^{^{2 × 10 6 ~ 4 × 10}} 6 cells, more preferably 2.5 × ¹⁰ 6 ~ 3 What is necessary is just to set so that it may become 5 * 10 < ⁶ > cells.

In addition, the composite of the present invention may be used as a composite for autologous transplantation or may be used as a composite for autologous transplantation. From the viewpoint of further suppressing rejection, the composite of the present invention is preferably used for autologous transplantation.

By administering (transplanting) the composite of the present invention in this way, the engraftment rate of the undifferentiated osteoblasts derived from the alveolar bone at the damaged site of the bone tissue is further increased, and clinically useful, which has been difficult in the past. It becomes possible to further promote the bone tissue regeneration.

The composite of the present invention may coexist with a pharmaceutically acceptable diluent carrier as necessary. Here, examples of the pharmaceutically acceptable carrier for dilution include a buffer solution such as physiological saline. The composite of the present invention may further coexist with a pharmacologically active ingredient as necessary. From these facts, the composite of the present invention can be used as a cell preparation for bone tissue regeneration. Further, the composite of the present invention may be used together with optional components such as pharmaceutically acceptable buffers and pharmacologically active components as necessary, and these optional components may be appropriately selected by those skilled in the art. .

Further, the composite of the present invention may be used in combination with a conventionally known scaffold as long as it does not interfere with the effects of the present invention and is pharmaceutically acceptable. For example, a biocompatible material such as a gel or porous material can be used. Specific examples of such scaffolds include fibrin gel (fibrin glue), hydroxyapatite, PGLA (poly DL-lactic-co-glycolic acid) -collagen sponge and the like. The composite of the present invention may be administered (implanted) together with such a scaffold to the site of bone tissue injury.

Therefore, it can be said that the present invention provides a cell preparation for bone tissue regeneration containing the composite. The cell preparation may contain any of the above-described optional components as necessary, and may contain the above-described conventionally known scaffold. Selection of each component and scaffold, the content thereof, and the like can be determined by those skilled in the art. What is necessary is just to select suitably.

Bone tissue regeneration method using the composite The present invention also provides a method for treating bone tissue damage, comprising the step of administering the composite to the bone tissue site of a patient with bone tissue damage. . In the treatment method, the bone tissue to be treated is damaged, the composite used, the dose of the composite, the administration method, etc. are as described above.

By administering (transplanting) the composite of the present invention in this way, the survival rate of undifferentiated osteoblasts derived from alveolar bone at the damaged site of bone tissue is further increased, and bone tissue regeneration has been difficult in the past. Can be further promoted.

EXAMPLES Hereinafter, although an Example is given and this invention is demonstrated, this invention is not limited to these Examples.
Example 1 Preparation of Undifferentiated Osteoblasts Derived from Alveolar Bone Four patients who obtained informed consent based on the code of ethics committee (4 patients, 66, 53, 52, 27) The alveolar bone-derived undifferentiated osteoblasts were prepared using the alveolar bone removed from the patient) during tooth extraction.

The obtained alveolar bone was placed in 4 ml of PBS (Phosphate buffered saline, pH 7.2) containing 2 mg / ml bacterial collagenase (> 1.5 U / mg; Collagenase P, Roche) at 37 ° C. The enzyme reaction was performed for 20 minutes. After the reaction, the same amount of bovine serum as the enzyme solution was added, and the cells released by centrifugation were collected. The remaining alveolar bone was again subjected to the enzyme treatment under the same conditions as described above. This operation was repeated, and finally the enzyme treatment was performed 8 times. Of the 8 cell fractions collected after each enzyme treatment, the cell fractions collected after the 1st and 2nd enzyme treatments are discarded, and the remaining 6 cell fractions are reconstituted with MF start medium (Toyobo). , Tokyo, Japan) was placed in a 35 mm culture dish containing 4 ml, and cultured under conditions of 5% CO ₂ and 37 ° C.

When the cells reached 80% confluence in the culture dish, the cells were released with PBS containing 0.25% trypsin / 1 mM EDTA, and undifferentiated osteoblasts (HAOB) derived from human alveolar bone were collected. In the following tests, HAOB obtained from the cell fraction collected after the fifth enzyme treatment was used. Also, HAOB1 derived from alveolar bone obtained from a 66-year-old patient HAOB1; HAOB derived from alveolar bone obtained from a 53-year-old patient; HAOB2; HAOB derived from alveolar bone obtained from a 52-year-old patient HAOB3; and HAOB derived from the alveolar bone obtained from a 27-year-old patient, respectively, are denoted as HAOB4.

Example 2: Evaluation of proliferation ability of undifferentiated osteoblasts derived from alveolar bone The HAOB obtained in Example 1 was added to MF medium (Toyobo, Tokyo, Japan) at 3 × 10 ⁴ cells / ml. Inoculated and subcultured for 70 days by changing the medium every 3 days. Meanwhile, population doubling (PD) of HAOB was measured.

Also, 35PD of HAOB3 was induced in the interphase by performing Colcemid® (Karyo® Max; “Gibco® BRL; 100 ng / ml” for 6 h). Thus, the chromosome structure of HAOB3 was analyzed by the G-band method for HAOB3 (about 50 cells) induced in the interphase. Furthermore, the chromosome structure of HAOB3 was analyzed by SKY (Spectral Karyotyping) method for HAOB3 thus induced in the interphase.

The results are shown in FIG. From the results of A) in FIG. 12, it was confirmed that HAOB (HAOB1-3) obtained from the middle-aged alveolar bone showed the same growth rate as HAOB (HAOB4) obtained from the young alveolar bone. It was. Moreover, from the result of analyzing the chromosomal structure of interphase HAOB3 shown in FIG. 12B), a normal diploid image was confirmed, indicating that HAOB has normal and stable proliferation ability. It was. Similar results were observed in other HAOBs.

Example 3: Evaluation of proliferation characteristics of alveolar bone-derived undifferentiated osteoblasts HAOB3 obtained in Example 1 was seeded in a 96-well plate at 2 × 10 ⁴ cells / well and serum-free Dulbecco's modified Eagle's medium After culturing in (DMEM) for 24 hours, the cells were cultured in DMEM medium containing 10 ng / ml bFGF, PDGFAA, PDGFAB or PDGFBB for 96 hours, and the cell proliferation activity was evaluated. As a control, similarly, HAOB3 after culturing in DMEM medium was cultured for 96 hours using DMEM without serum and DMEM or MF medium containing 20% by volume FCS to evaluate cell proliferation activity. Cell proliferation activity was measured using Celltiter-Gloluminesescent cell viability assay (promega) according to the method specified by the manufacturer.

The results are shown in FIG. The vertical axis of FIG. 13 shows the relative value calculated as 1 as the cell proliferation activity when cultured using DMEM without addition of serum. From this result, it is clear that the growth of HAOB is markedly improved when PDGFAA, PDGFAB, or PDGFBB is added, and culturing in the presence of these growth factors is effective for the growth of HAOB. It was.

Example 4: Evaluation of differentiation ability of undifferentiated osteoblasts derived from alveolar bone (In vitro) -1
After seeding ² ml of the HAOB3 obtained in Example 1 at a concentration of 3 × 10 ⁴ cells / ml / cm ^{2 in} a culture dish, 100 nM dexamethasone, 50 μg / ml ascorbic acid, 10 mM β-glycerophosphate, and 100 ng / ml MF medium containing rhBMP-2 (Recombinant human bone morphogenetic protein-2) (hereinafter referred to as rhBMP-2 supplemented medium) is changed to 1 ml / cm ² and cultured for 9 days while changing the medium every 3 days. The differentiation characteristics of HAOB3 were evaluated. For comparison, instead of the rhBMP-2 supplemented medium, culture was performed under the same conditions as described above using a medium having the same composition as the rhBMP-2 supplemented medium except that rhBMP-2 was not included, and the differentiation characteristics of HAOB3 Evaluated.

Furthermore, for comparison, human epidermal fibroblasts (HFF) (Takara Bio Inc.) were cultured in hBMP-2 supplemented medium or MF medium under the same conditions as described above, and the differentiation characteristics of HFF were evaluated.

In this study, the differentiation characteristics were measured for alkaline phosphatase activity, alizarin red staining, osteoblast differentiation markers (RUNX2, OSTERIX, OSTEOCALCIN (OCN), BONE SIALOPROTEIN (BSP)), and OSTEOPONTIN. Evaluation was carried out by immunostaining with antibodies against (OPN) and OCN. The specific measurement conditions for this are as follows.

<Measurement of alkaline phosphatase activity>
After fixing the cells with 4% paraformaldehyde for 20 minutes, 0.1 mg / ml naphthol AS-MX phosphate (Sigma), 0.5% NN dimethyl formamide (Sigma), 2 mM MgCl2, 0.6 mg / ml Fast Blue BB salt (Sigma) Alkaline phosphatase activity was measured by reacting at room temperature with a 0.1 M TRIS-HCl (pH 8.5) solution containing.

<Alizarin red staining>
Cells were fixed with 4% paraformaldehyde for 20 minutes, then stained with 2% alizarin red S (pH 6.4) (Sigma) and detected.

<Measurement of expression level of osteoblast differentiation marker>
Total RNA was extracted from the cells, and the expression levels of RUNX2, OSTERIX, OCN, and BSP were measured by PCR. Total RNA was extracted from the cells using Isogen (Nippon Gene, Tokyo, Japan) according to the method specified by the manufacturer. cDNA was prepared using 1 μg) of total RNA and reverse transcriptase (M-MLV reverse transcriptase, Invitrogen Corporation). Moreover, the expression level of mRNA was analyzed by AB 7300 Real-Time PCR System (Applied Biosystems) using Power SYBR Green PCR Master Mix (Applied Biosystems). The primer sequences used are as follows.
OSTERIX (Forward primer: CTGAAGAATGGGTGGGGAAGG (SEQ ID NO: 1), reverse primer: GGCCTCTGTCCTCCTAGCTC (SEQ ID NO: 2))
RUNX2 (Forward primer: GAAACTCAACAGATTAACTATCGTTTGC (SEQ ID NO: 3), Reverse primer: GAATTTATCACAGATGGTCCCTAATGG (SEQ ID NO: 4))
OSTEOCALCIN (Forward primer: CACACTCCTCGCCCTATTGG (SEQ ID NO: 5), Reverse primer: TGCACCTTTGCTGGACTCTG (SEQ ID NO: 6))
BONE SIALOPROTEIN (Forward primer: CGAATACACGGGCGTCAATG (SEQ ID NO: 7), Reverse primer: GTAGCTGTACTCATCTTCATAGGC (SEQ ID NO: 8))
BMP2 (Forward primer: CCAGAAACGAGTGGGAAAAC (SEQ ID NO: 9), Reverse primer: AATTCGGTGATGGAAACTGC (SEQ ID NO: 10))
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Forward primer: AAGAGCACAAGAGGAAGAGAGAGAC (SEQ ID NO: 11), Reverse primer: TTATTGATGGTACATGACAAGGTG (SEQ ID NO: 12)).

<Immunostaining using antibodies against OPN and OCN>
The cells were fixed with 4% paraformaldehyde, immunostained with an antibody against OPN and an antibody against OCN, and the expression levels of OPN and OCN were measured.

The results are shown in Figs. 14-1 and 14-2. FIG. 14-1 A) shows the results of alizarin red staining (left) and the measurement results of alkaline phosphatase activity (right). As is clear from the left figure of A) in FIG. 14-1, since HAOB3 was cultured in a medium containing hBMP-2 (+ in the figure), staining with alizarin red was remarkably observed. It turned out that ability was expressed. In addition, as shown in the right figure of A) in FIG. 14-1, it was also confirmed that HAOB3 was significantly improved in alkaline phosphatase activity, which is an index of bone formation, when cultured in a medium containing hBMP-2. It was. On the other hand, HFF was not stained with alizarin red and no alkaline phosphatase activity was observed even when cultured in a medium containing hBMP-2.

Furthermore, B) in FIG. 14-1 shows the results of measuring the expression levels of RUNX2, OSTERIX, OCN and BSP. In FIG. 14-1, B) shows the relative value of the expression level of each differentiation marker, where the expression level of β-Actin is 100. From these results, it was confirmed that the expression level of RUNX2, OSTERIX, OCN and BSP was increased when HAOB3 was cultured in a medium supplemented with hBMP-2, and the bone forming ability was expressed. On the other hand, in HFF, the expression of the differentiation marker was not observed when cultured in either hBMP-2 supplemented medium or MF medium.

FIG. 14-2 shows the result of immunostaining using antibodies against OPN and OCN. As can be seen from FIG. 14-2, HAOB3 not stimulated with rhBMP-2 expressed OPN and OCN slightly, but HAOB3 stimulated with rhBMP-2 showed a strong positive response to OPN and OCN antibodies. It was. From these results, it was confirmed that HAOB showed the properties of undifferentiated osteoblasts before differentiation induction and differentiated into OPN-positive and OCN-positive osteoblasts by rhBMP-2 stimulation.

From these, it was found that HAOB can be well differentiated from undifferentiated osteoblasts to osteoblasts.

Example 5: Evaluation of differentiation potential of undifferentiated osteoblasts derived from alveolar bone (In vitro) -2
HAOB3 obtained in Example 1 is seeded in MF medium (Toyobo, Tokyo, Japan) at 3 × 10 ⁴ cells / ml, and cultured until 29 PD while changing the medium every 3 days. It was. 6PD, 11PD, 16PD, 21PD, 24PD, and 29PD HAOB3 were cultured in rhBMP-2-added medium under the same conditions as in Example 4 above, followed by alizarin red staining and osteoblast differentiation markers (RUNX2, OSTERIX, OCN , BSP) expression levels were measured.

The results are shown in FIG. FIG. 15A) shows the results of staining with alizarin red, B) the results of measuring the expression level of OCN, and C) the results of measuring the expression levels of RUNX2, OSTERIX, and BSP. FIG. 15B) and C) show the relative values with respect to the expression level of each differentiation marker, where the expression level of β-Actin is 100. As is clear from FIG. 15, even with 16PD HAOB3, the ability to form bone was sufficiently expressed and the ability to differentiate osteoblasts was retained.

From this, it was confirmed that HAOB has sufficient osteoblast differentiation ability and bone formation ability.

Example 6: Evaluation of differentiation ability of undifferentiated osteoblasts derived from alveolar bone into bone cells (in vitro) -3
After seeding the culture dish with HAOB3 obtained in Example 1 at a concentration of 3 × 10 ⁴ cells / ml / cm ² , 100 nM dexamethasone, 50 μg / ml ascorbic acid, 10 mM β-glycerophosphate, and 50, 100, The medium was replaced with MF medium containing 200, 500 or 1000 ng / ml rhBMP-2, and cultured for 9 days while changing the medium every 3 days, and the differentiation characteristics of HAOB3 were evaluated. Differentiation characteristics were determined by measuring alkaline phosphatase activity, alizarin red staining, and expression level of osteoblast differentiation markers (RUNX2, OSTERIX, OCN, BSP) in the same manner as in Example 4 above. evaluated.

For comparison, femoral bone-derived osteoblasts (NHOst) (Lonza Walkersville Inc., MD, USA) were used for culturing under the same conditions as described above, and differentiation characteristics were similarly evaluated.

Results are shown in FIG. FIG. 16A) shows the results of alizarin red staining (left) and the measurement results of alkaline phosphatase activity (right). From these results, HAOB3 was observed to have the same level of alkaline phosphatase activity compared to NHOst, but with regard to calcification ability, a low level of rhBMP-2 and a positive calcification of alizarin red staining were formed. It was confirmed that the bone forming ability can be strongly expressed.

FIG. 16B) shows the results of measuring the expression levels of HAOB3 and NHOst RUNX2, OSTERIX, and BSP induced by differentiation with 100 ng / ml rhBMP-2. FIG. 16B) shows the relative values with respect to the expression level of each differentiation marker, where the expression level of β-Actin is 100. From these results, it was confirmed that with 100 ng / ml rhBMP-2, HAOB3 was strongly induced to differentiate compared to NHOst, and the bone forming ability could be strongly expressed.

Example 7: Evaluation of differentiation potential of undifferentiated osteoblasts derived from alveolar bone (In vitro) -4
HAOB3 or NHOst was mixed with MF medium containing 100 nM dexamethasone, 50 μg / ml ascorbic acid, 10 mM β-glycerophosphate, and 100 ng / ml rhBMP-2 at a concentration of 3 × 10 ⁴ cells / ml / cm ² 0.5 ml was added on the cover glass. This was cultured for 72 hours under conditions of 5% CO ₂ and 37 ° C. Next, the culture supernatant was removed from the cover glass, fixed with 50% acetone / methanol solution for 2 minutes, and then blocked with PBS containing 1 mg / ml bovine albumin. Anti-OCN monoclonal antibody (clone GluOC4-5, Takara, Tokyo, Japan) is allowed to act on the cells on the cover glass thus blocked, and then reacted with anti-mouse alexa 488 secondary antibody (Invitrogen Corporation). To stain OCN. In addition, anti-OSTEOPONTIN (OPN) polyclonal antibody (O-17, IBL, Gunnma, Japan) is allowed to act on the cells on the covered cover glass, and then reacted with anti-rabbit alexa 555 secondary antibody (Invitrogen Corporation). To stain OPN. Furthermore, nuclear staining was performed with DAPI (4 ′, 6-diamino-2-phenylindole) on the cells on the blocking cover glass.

The cells thus stained were observed with a confocal laser microscope (LSM510; Carl Zeiss MicroImaging, Jena, Germany) using laser beams of 403 nm, 488 nm and 543 nm.

Results are shown in FIG. In FIG. 17, as a result of staining with OPN of HAOB3 that has been induced to differentiate, OC is stained with OCN of HAOB3 that has been induced to differentiate, c is an image in which a and b are superimposed, and d is induced to differentiate. As a result of staining the NHOst OPN, e shows the result of staining the differentiation-induced NHOst OCN, and f shows an image in which d and e are superimposed. Also from this result, all of the differentiation-induced HAOB3 showed a positive reaction with the anti-OPN antibody and the anti-OCN antibody, and the expression levels of OPN and OCN were significantly higher than those of NHOst.

Example 8: Evaluation of differentiation characteristics of undifferentiated osteoblasts derived from alveolar bone After seeding HAOB3 or NHOst obtained in Example 1 at a concentration of 3 × 10 ⁴ cells / ml / cm ^{2 in} a culture dish, The medium was changed to 1 ml / cm ^{2 of} MF medium containing 100 nM dexamethasone, 50 μg / ml ascorbic acid, 10 mM β-glycerophosphate, and 100 ng / ml rhBMP-2, and cultured for 9 days while changing the medium every 3 days. For the cells after 9 days in culture, the expression level of BMP-2 was measured by Real-Time PCR method. In addition, RNA collection from cells and cDNA synthesis were performed in the same manner as in Example 4 above. RT-PCR was performed using Takara EX taq (Takara, Tokyo, Japan) according to the method specified by the supplier.

Results are shown in FIG. As shown in FIG. 18, cells induced to differentiate from HAOB3 expressed BMP-2 more than 200 times as compared to cells induced to differentiate from NHOst. This result also supported that HAOB has distinctly different characteristics from NHOst.

Example 9: The following tests were carried out in order to analyze the expression of specific genes undifferentiated osteoblasts derived from analysis alveolar bone specific genes undifferentiated osteoblasts derived from the alveolar bone.

Inoculate HAOB1 ~ 4 obtained in Example 1 in MF medium (Toyobo, Tokyo, Japan) to 3 × 10 ⁴ cells / ml, and culture up to 35PD while changing the medium every 3 days Went.

Next, total RNA was extracted from HAPD of 6PD, 11PD, 16PD, 21PD, 24PD, 29PD, and 35PD, and the intensity of the expressed gene in HAOB of 6PD and 35PD was analyzed. The strength of the expressed gene was determined by using the HT Human Genome U133 Array Plate Set (Gene Chip; Affymetrix, CA, USA) containing full-length probes of about 33,000 genes, and the Affymetrix manual [http: // www .affymetrix.com / support / technical / index.affx]. Data analysis was performed using Gene Chip Operation System (Affymetrix CA, U.S.A.) and GeneSpringGX software (Silicon Genetics). In order to standardize the change in staining between chips, the average of the median values of all genes on the chip was adopted. In addition, eigenvectors in raw data and logarithmically transformed data were created by principal component analysis (PCA method) using singular value decomposition (SVD). (References: Kami D, Shiojima I, Makino H, Matsumoto K, Takahashi Y, Ishii R, Naito AT, Toyoda M, Saito H, Watanabe M, Komuro I, Umezawa A: Gremlin enhances the de , 3: e2407.2008)

For comparison, human epidermal fibroblasts (HFF) (Takara Bio Inc.), human osteosarcoma cells (MG63) (RIKEN BioResource Center), and femur-derived osteoblasts (NHOst) (Lonza WalkersvilleersInc) , MD, USA), the intensity of the expressed gene was similarly analyzed.

As a result of PCA analysis, it was found that there is a gene group whose expression decreases as PD increases. From these genes, genes that were highly expressed particularly in HAOB were screened, and the expression level of the genes was measured by real-time PCR. The result is shown in FIG. FIG. 19A) shows the relative values with respect to the expression level of each gene, where the expression level of β-Actin is 100. As shown in FIG. 19A), it was confirmed that STMN2, NEBL, and MGP were highly expressed in 6PD HAOB but hardly expressed in 35PD HAOB3.

In 6PD of HAOB3, the expression of these genes and the gene expression levels of bone marker genes RUNX2, OSTERIX, OSTEOCALCIN and BSP were measured by real-time PCR. The result is shown in FIG. FIG. 19B) shows the relative values with respect to the expression level of each gene, where the expression level of β-Actin is 100. As shown in FIG. 19B), the expression levels of STMN2, NEBL and MGP were clearly high. Further, as shown in FIG. 19C), as a result of analyzing the gene change rate in 6PD and 35PD of HAOB3, OCN showed the highest change rate. However, OCN is not suitable as a marker for HAOB because of its low expression in 6PD.

Next, real-time PCR measures the expression levels of STMN2, NEBL and MGP in human epidermis-derived fibroblasts (HFF), human osteosarcoma cells (MG63), femur-derived osteoblasts (NHOst) and PD6 HAOB1-4 did. The primer sequences used in real-time PCR are as follows.

STMN2 (Forward primer: acgtctgcaggaaaaggaga (SEQ ID NO: 13), Reverse primer: acgatgtagtcgccgtctct (SEQ ID NO: 14))
NEBL (Forward primer: cattcccaaggctatggcta (SEQ ID NO: 15), Reverse primer: acgatgtagtcgccgtctct (SEQ ID NO: 16))
MGP (Forward primer: cgcttcctgaagtagcgatt (SEQ ID NO: 17), Reverse primer: ccctcagcagagatggagag (SEQ ID NO: 18))
The obtained result is shown in FIG. FIG. 20 shows relative values with respect to the expression level of each gene, where the expression level of β-Actin is 100. As can be seen from FIG. 20, clearly high STMN2, NEBL and MGP expression was observed in HAOB.

From the above results, it was confirmed that the expression of STMN2, NEBL and MGP could be a specific marker for HAOB.

Example 10: Preparation of carrier
Example 10-1
A carrier was produced according to the following procedure. Poly-L-lactic acid (PLLA) (trade name RESIMER L206s, manufactured by Evonik Rohm GmbH) was dissolved in chloroform so as to be 10 wt%, and then the resulting solution had a weight of 0.5 to 13 wt% with respect to PLLA. A polymer solution was prepared by adding a formamide solution in which gelatin (trade name Medi Gelatin, manufactured by Nippi Co., Ltd.) was dissolved to 5 to 25 vol% and mixing. While the prepared polymer solution was discharged from the syringe, an electric field of 1000 V / cm was applied, and the spinning was performed by electrospinning and collected on a collector (counter electrode) to form a cotton-like molded body.

In addition, when the addition amount of the formamide solution of gelatin was less than 5 vol% and when the addition amount of gelatin was less than 1.3 wt%, a cotton-like molded product could not be obtained. On the other hand, when the amount of gelatin formamide solution added is too large, the viscosity of the polymer solution obtained by mixing becomes too high, making it difficult to perform electrospinning. If the amount of gelatine formamide solution added was approximately 25 vol% or less under the above conditions, electrospinning could be carried out satisfactorily and a cotton-like formed body could be produced.

Next, the electric field condition is changed from 1000 V / cm to 2000 V / cm without changing the composition of the polymer solution, or the polymer solution is mixed with chloroform at 10 wt% without changing the electric field condition. After being dissolved, the polymer solution obtained by adding and mixing N, N-dimethylformamide so as to be 1.1 vol% is switched, and electrospinning is performed on the obtained cotton-like molded body. Thus, a coating layer (shape stabilizing layer) was formed on the cotton-like molded body. The coating layer was formed on the surface (upper surface and lower surface) of the cotton-like molded body so that the thickness of the coating layer was 2 to 3 μm. The cotton-like fiber molded body provided with the coating layer was adjusted so that the bulk density was approximately 0.003 g / cm ^3, and subjected to a molding treatment to obtain a cell culture carrier for regenerative medicine. This was designated as Carrier 1 (cotton carrier). A model diagram of the carrier 1 is represented in FIG.

The bulk density of the fiber molded body with the coating layer after the molding treatment is substantially a rectangular parallelepiped as a whole, and the volume is calculated by measuring the length, width, and thickness of the molded body. The weight was weighed and calculated by dividing the weight by the volume.
Example 10-2
In Example 10-1, after PLLA was dissolved in chloroform so as to be 10 wt%, N, N-dimethylformamide solution in which gelatin was dissolved was added so that N, N-dimethylformamide was 1.1 vol%. Except for using a mixed polymer solution, spinning and collecting in the same manner form fibers in a cloth shape to form a fiber formed body of a predetermined thickness (about 80 μm), and the bulk density of the fiber formed body Was adjusted to 0.21 g / cm ³ . This was designated as Carrier 2 (nonwoven fabric carrier). The bulk density of the carrier 2 was calculated in the same manner as described above.

Example 10-3
In Example 10-1, PLLA was dissolved in chloroform so that the concentration was 10 wt%, and then the electrospinning conditions were changed to an electric field of 2000 V / cm. Then, a fiber formed body having a predetermined thickness (about 80 μm) was formed, and the bulk density of the fiber formed body was adjusted to 0.21 g / cm ³ . This was designated as Carrier 3 (nonwoven fabric carrier). The bulk density of the carrier 3 was calculated in the same manner as described above.

Example 10-4
In the course of forming a cotton-like molded product (low density layer) in the same procedure as in Example 10-1, the polymer solution was adjusted to 1.1 vol% of N, N-dimethylformamide used in Example 10-2. By switching to a polymer solution added and mixed so as to be spun and collected in the same manner as in Example 10-2, a cloth-like high-density layer was formed (thickness of the high-density layer is 5 to 20 μm). Then, by switching to the polymer solution used in Example 10-1 and spinning and collecting in the same manner as in Example 10-1, a structure having a close-packed structure of a cotton-like formed body and a cloth-like formed body is obtained. Formed body. A coating layer was formed on the resulting structure in the same manner as in Example 10-1, and then the bulk density was adjusted to 0.0035 g / cm ³ to perform a molding treatment to obtain a carrier. This was designated as carrier 4 (roughly dense carrier). The bulk density of the dense layer after adjustment 0.21 g / cm ^3, the bulk density of the low density layer was 0.003 g / cm ^3.

In addition, the polymer solution used in Example 10-1 and the polymer solution used in Example 10-2 are laminated while being alternately switched, so that the compact body includes a plurality of low-density layers and high-density layers. It was also possible to form a carrier having a structure. For example, after forming three high-density layers (thickness of the high-density layer is 5 to 20 μm) and forming a coating layer in the same manner as in Example 10-1, the low-density layer is 5 mm in height. by performing the molding process with a high density layer at intervals of about 1.25mm formed therein, the bulk density was possible to produce a carrier in 0.0043 g / cm ^3. The bulk density of the adjusted high-density layer and low-density layer was in the range of 0.0001 to 0.25 g / cm ^{3 in} the same manner as described above.

In this case, the fibers constituting the cotton-like formed body (low density layer) form fibers containing a hydrophilic polymer of 10 to 1000 nm inside fibers containing a hydrophobic polymer having an average diameter of 0.5 to 20 μm. In this state, at least a part of the surface of the fiber containing the hydrophobic polymer was covered with the hydrophilic polymer, and the high-density layer was not in such a state.

Example 10-5
In the middle of forming a cotton-like molded body (low density layer) in the same procedure as in Example 10-1, the electrospinning condition was changed from 1000 V / cm to an electric field of 2000 V / cm, and spinning and trapping were performed in the same manner. Form a cloth-like high-density layer by collecting, then change again to the condition of 1000 V / cm, and spin and collect in the same way, forming a cotton-like shaped body (low-density layer) and cloth-like A structure having a dense structure with the body (high-density layer) was formed. A coating layer was formed on the obtained structural body in the same manner as in Example 10-1, and then the bulk density was adjusted to 0.0035 g / cm ³ to perform a molding treatment to obtain a carrier having a thickness of about 10 mm. This was designated as Carrier 5 (roughly dense carrier). The bulk density of the adjusted high-density layer and low-density layer was in the range of 0.0001 to 0.25 g / cm ^{3 in} the same manner as described above.

It was also possible to form a carrier having a plurality of dense structures inside the compact by laminating while alternately switching the electrospinning conditions to an electric field of 1000 V / cm and 2000 V / cm. For example, after forming three high-density layers (thickness of the high-density layer 0.5 to 20 μm) and forming a coating layer in the same manner as in Example 10-1, together with the low-density layer so that the height is 5 mm. By carrying out the molding treatment, it was possible to produce a carrier having a high density layer formed at intervals of about 1.25 mm inside and a bulk density of 0.0043 g / cm ³ . The bulk density of the adjusted high-density layer and low-density layer was in the range of 0.0001 to 0.25 g / cm ^{3 in} the same manner as described above.

In this case, a fiber containing a hydrophilic polymer having an average diameter of 10 to 1000 nm is formed inside a fiber containing a hydrophobic polymer having an average diameter of 0.5 to 20 μm, and at least a part of the surface of the fiber containing the hydrophobic polymer is formed. The fiber covered with the hydrophilic polymer was formed on the entire molded body including the high-density layer.

Example 11: Cell culture in a carrier
Cell culture The above-mentioned carrier 5 (Example 10-5, a carrier having a dense structure) is cut into 1 × 1 cm ² (ie, 1 cm in length, 1 cm in width, 1 cm in height (thickness)) and immersed in 70 wt% ethanol for sterilization. After the treatment, it was allowed to stand in each well of a 24-well plate, immediately washed with PBS (−), and then replaced with MF medium. Thereafter, HAOB3 was seeded at 1 × 10 ⁵ cells / carrier (ie, on top of the excised carrier) and incubated for 14 days at 37 ° C. in a CO ₂ incubator. WST8 method (tetrazolium salt WST-8 is intracellular dehydrated) The number of cells and the amount of formazan produced are linearly proportional, so the number of living cells can be determined by directly measuring the absorbance of this formazan at 450 nm. The absorbance was measured over time using VERSAMax (Molecular devices), and cell proliferation was examined. An experiment was conducted in the same manner except that the carrier 2 (Example 10-2, ie, vertical and horizontal 1 × 1 cm ² , height of about 80 μm) was used instead of the carrier 5. As a comparative example, HAOB was seeded and incubated in the same manner as the carrier 5 except that a collagen sponge (trade name collagen sponge, manufactured by Nitta Gelatin Co., Ltd.) used as a carrier in conventional regenerative medicine was used.

The result is shown in FIG. As is clear from FIG. 21, cell proliferation in the collagen sponge was remarkable after 1 to 4 days after the culture. However, after 7 days of culture, the carrier 5 showed a significant growth tendency, and after 14 days of culture, significant cell growth was observed in the carrier 5, while no significant cell growth was observed in the collagen sponge. With carrier 2, cell proliferation was remarkable after 1 to 4 days after culture, and significant cell proliferation was observed even after 14 days of culture.

From this, it was confirmed that the carrier 5 is a carrier suitable for proliferation of undifferentiated osteoblasts derived from alveolar bone. Carrier 2 was also confirmed to be useful for proliferation of undifferentiated osteoblasts derived from alveolar bone.

Example 12: Osteoblast differentiation in a carrier
In the same manner as in differentiation example 11, HAOB3 was seeded on carrier ⁵ at 1 × 10 ⁵ cells / carrier to prepare a composite of HAOB and carrier. Regarding the differentiation of HAOB into osteoblasts in the obtained composite, the activity of alkaline phosphatase was evaluated by staining as an index of osteoblast differentiation. Specifically, the obtained composite was subjected to MF medium (Toyobo Co., Ltd.) containing 10 mmol / l β-glycerophosphate, 50 μg / ml ascorbic acid, 100 nmol / l dexamethasone at 37 ° C. in the presence of 5% CO ₂ . The cells were cultured, fixed with 10 wt% formaldehyde for 30 minutes over time, and stained with an alkaline phosphatase stain for 5 minutes.

Further, an experiment was conducted in the same manner except that the carrier 2 (Example 10-2) was used instead of the carrier 5.
Results The results showing changes in alkaline phosphatase activity are shown in FIG. As is clear from FIG. 22, it was confirmed that carrier 5 became positive for alkaline phosphatase from the third day of culture and increased on

days

7, 14 and 21 of culture. On the other hand, with carrier 2, alkaline phosphatase staining became positive after 7 days of culture. For this reason, in any case, it was confirmed that undifferentiated osteoblasts derived from alveolar bone can be differentiated into osteoblasts. Since the differentiation rate was higher in carrier 5 than carrier 2, it was confirmed that carrier 5 can differentiate undifferentiated osteoblasts derived from alveolar bone into osteoblasts more efficiently.

Example 13: Induction of calcification in carrier In the same manner as in Example 11, HAOB was seeded on

carriers

2 and 5 at 1 × 10 ⁵ cells / carrier to prepare composites of HAOB and carrier, respectively. Alizarin red staining was performed to evaluate the production of calcified HAOB in the resulting composite. Specifically, the obtained composite was subjected to MF medium (Toyobo Co., Ltd.) containing 10 mmol / l β-glycerophosphate, 50 μg / ml ascorbic acid, 100 nmol / l dexamethasone at 37 ° C. in the presence of 5% CO ₂ . The cells were cultured, fixed with 10 wt% formaldehyde over 30 minutes, and stained with 2% Alizarin red S (Alizarin red S, manufactured by Wako Pure Chemical Industries, Ltd.) for 5 minutes.

Results The time course of calcium deposition by alizarin red staining is shown in FIG. Calcified deposits were observed in both

carriers

2 and 4. In particular, as is apparent from FIG. 23, calcified deposits were observed on carrier 2 after the 14th day of culture, but calcified deposits were observed earlier on carrier 5. From this, it was confirmed that carrier 5 can efficiently induce calcified deposits by forming a complex with undifferentiated osteoblasts derived from alveolar bone.

From this, it was confirmed that the composite of carrier 5 and alveolar bone-derived undifferentiated osteoblasts was a composite that can efficiently improve the bone defect by transplanting to the bone defect part.

Example 14: Gene analysis After culturing in Example 13, in order to examine gene expression in the complex, it was quantified by Real time PCR. Specifically, after culturing for each period according to Example 13 described above, total RNA was extracted from the complex using Isogen according to the method recommended by the manufacturer. CDNA was synthesized from 1 μg of total RNA using reverse transcriptase M-MLV. Subsequently, mRNA expression levels of osteoxin, type I collagen, Runt-related transcription factor 2 (Runx2), osteocalcin, and bone sialoprotein, which are genes related to hard tissue formation, were quantified by Real time PCR. In addition, GAPDH (Glyceraldehyde 3-phosphate dehydrogenase) was used as an internal standard to correct quantitative analysis. The reaction conditions were 95 ° C. for 3 minutes, followed by 45 cycles of 95 ° C. for 15 seconds, 55 ° C., 30 seconds, 72 ° C. and 30 seconds. The change in each mRNA expression level was calculated by correcting the expression level of GAPDH mRNA in the sample by the ΔΔCT method recommended by the manufacturer.

The result which showed the expression change of the calcification related gene of a result composite is shown in FIG. As is clear from FIG. 24, no significant difference was observed in the expression of each gene group in the

carriers

2 and 5 until the 14th day of culture. On the other hand, after the 21st day of the culture, it was observed that the carrier 5 predominantly highly expressed hard tissue-related genes, such as osteox, osteocalcin and bone sialoprotein, which induce calcification.

Also from this, it was confirmed that the composite of carrier 5 and alveolar bone-derived undifferentiated osteoblast is a composite that can efficiently improve the bone defect by transplanting to the bone defect part.

From these facts, the carrier of the present invention has sufficient performance to withstand cell culture operations, etc., but efficiently proliferates undifferentiated osteoblasts derived from alveolar bone, differentiates into osteoblasts, and mineralizes efficiently. It was confirmed that it could be implemented. As a result, it is possible to efficiently regenerate bone tissue that could not be achieved by conventional techniques including the regeneration of severe periodontal disease with large bone defects.

Example 15: Preparation of carrier
Example 15-1
In the same manner as in Example 10-1, a cotton-like molded body (low density layer) and a coating layer were formed. The molded body thus obtained was compressed to a bulk density of about 0.0032 g / cm ³ (thickness of about 2 mm) and heated at 45 ° C. or higher to perform a molding process to obtain a carrier. This was designated as Carrier 6.

The fiber constituting the carrier 6 has a structure in which a hydrophilic polymer fiber is formed inside a hydrophobic polymer fiber, and the hydrophilic polymer fiber has a three-dimensional network structure inside the composite fiber having the structure. Was forming. In the carrier 6, the fibers of the hydrophilic polymer are bonded to each other in this manner, whereby a twisted structure is formed in the composite fiber, and the contact between the composite fibers is controlled. Further, the carrier 6 had the same coating layer as in FIG.

Example 15-2
A cotton-like molded body (low density layer) was formed in the same manner as in Example 15-1, except that the spinning time was twice that of Example 15-1, and then a coating layer was formed in the same manner. The molded body thus obtained was subjected to a molding treatment by adjusting the bulk density to be about 0.0048 g / cm ³ (thickness of about 2 mm) to obtain a carrier. This was designated as Carrier 7. The carrier 7 also formed the three-dimensional network structure observed in the carrier 6. The carrier 7 also had a coating layer similar to that shown in FIG.

Example 15-3
A cotton-like molded body (low density layer) was formed in the same manner as in Example 15-1, except that the spinning time was 3 times that in Example 15-1, and then a coating layer was formed in the same manner. The molded body thus obtained was subjected to a molding treatment by adjusting the bulk density to be about 0.0064 g / cm ³ (thickness of about 2 mm) to obtain a carrier. This was designated as Carrier 8. The carrier 8 also formed the three-dimensional network structure found in the carrier 6. The carrier 8 also had a coating layer similar to that shown in FIG.

Example 15-4
The carrier 7 ′ obtained in the same manner as in Example 15-2 except that only one side of the coating layer is formed is 2 so that the coating layer is on the outside (one coating layer is the upper surface and the other coating layer is the lower surface). After being stacked one above the other, it was molded in the same manner as described above to obtain a carrier having a bulk density of 0.0096 g / cm ³ and a thickness of about 2 mm. This was designated as Carrier 9. The carrier 9 also formed the three-dimensional network structure observed in the carrier 6. The carrier 9 also had a coating layer similar to that shown in FIG.

Example 15-5
Except that the coating layer is formed only on one side, the carrier 8 ′ obtained in Example 15-3 was stacked two layers up and down in the same manner as described above so that the coating layer was on the outside, and then molded in the same manner as described above. A carrier having a bulk density of 0.0192 g / cm ³ and a thickness of 2 mm was obtained. This was designated as carrier 10. The carrier 10 also formed the three-dimensional network structure found in the carrier 6. The carrier 10 also had a coating layer similar to that shown in FIG.

Example 16: Cell culture in a carrier
Cell culture The carrier 6 to 10 and the carrier 2 were cut into a length of 1 cm ² × width 1 cm ² (thickness is the above-mentioned values) and immersed in 70 wt% ethanol and sterilized as in Example 11. The plate was allowed to stand in each well of a 24-well plate, immediately washed with PBS (−), and then replaced with MF medium. Thereafter, HAOB3 was seeded at 1 × 10 ³ cells / carrier to prepare composites, and cultured in a CO ₂ incubator at 37 ° C. for 1, 4 and 7 days. Subsequently, the absorbance was measured over time by the WST8 method (Cell Counting Kit-8, manufactured by Dojindo Laboratories) in the same manner as in Example 11 to examine cell proliferation.

The result is shown in FIG. 25 (the vertical axis indicates the absorbance). As is clear from FIG. 25, cell growth was observed in any of the carriers. In comparison with carrier 2, cell growth was suppressed in carriers 6 to 10 at the beginning of the culture period of 7 days.

Example 17: Osteoblast differentiation and mineralization in carriers
Differentiation The above carriers 6 to 10 and carrier 2 were cut into 1 cm ² × 1 cm ² in length and seeded at 1 × 10 ⁴ cells / carrier using MF medium in the same manner as in Example 16, and HAOB and carrier Each composite was prepared. Regarding the differentiation of HAOB into osteoblasts in the obtained composite, the activity of alkaline phosphatase was evaluated by staining as an index of osteoblast differentiation. Specifically, the obtained composite was subjected to MF medium (Toyobo Co., Ltd.) containing 10 mmol / l β-glycerophosphate, 50 μg / ml ascorbic acid, 100 nmol / l dexamethasone at 37 ° C. in the presence of 5% CO ₂ . Cultivate for 1, 2 or 3 weeks, fix with 10wt% formaldehyde over time for 30 minutes, alkaline phosphatase stain (NN dimethl formamid, Naphthol AS-MX phosphate, Fast blue BB salt, 1M tris-HCl containing MgCl ₂ ) For 5 minutes.

Calcification In the same procedure as in Example 17, HAOB3 was seeded at 1 × 10 ⁴ cells / carrier using MF medium to prepare a composite of HAOB and carrier, respectively. Alizarin red staining was performed to evaluate the production of calcified HAOB in the resulting composite. Specifically, the obtained composite was cultured for 1, 2 or 3 weeks in the same manner as in Example 13, fixed with 10 wt% formaldehyde over time for 30 minutes, and stained with 2% Alizarin red S. did. As a control, the test was performed in the same manner as described above except that each carrier not seeded with HAOB3 was used.

The result is shown in FIG.
As is clear from FIG. 26, alkaline phosphatase was positive and differentiation was observed in any of the carriers. Among these, the carrier 6 to 10 had a higher differentiation rate than the carrier 2. From this, it was confirmed that according to Carriers 6 to 10, undifferentiated osteoblasts derived from alveolar bone can be differentiated into osteoblasts more efficiently than Carrier 2. In particular, it was confirmed that undifferentiated osteoblasts derived from alveolar bone can be differentiated into osteoblasts more efficiently with the carriers 8 to 10, and further with the

carriers

9 and 10.

Further, as is clear from FIG. 26, calcified deposits were observed in any of the carriers. Of these, desirable calcified deposits were observed earlier in the carriers 6 to 10 than in the carrier 2. In addition, when the support | carrier which induced | guided | derived calcification was dye | stained without seed | inoculating a cell, compared with the support | carrier which seed | inoculated the cell, the significant dyeing | staining was not recognized (each photograph of the 2nd step from the bottom of FIG. 26). From this, it was confirmed that the calcification observed in the carrier seeded with cells was derived from cells (that is, derived from a complex).

From this, it was confirmed that carriers 6 to 10 can induce calcified deposits more efficiently by forming a composite with undifferentiated osteoblasts derived from alveolar bone. In particular, it was confirmed that calcified deposits can be induced more efficiently in the carriers 8 to 10, and further in the

carriers

9 and 10. .

Thus, it was suggested that such a composite of carrier and alveolar bone-derived undifferentiated osteoblast is a composite that can efficiently improve the bone defect by transplanting to the bone defect part.

Example 18: Bone regeneration in vivo
The bone regeneration carrier 10 was cut into a length of 1 cm ² × width 1 cm ² , and HAOB3 was seeded at 1 × ⁴ cells in the same manner as in Example 17 to prepare a composite. Subsequently, the cells were cultured for 1 week in a bone differentiation induction medium (MF medium containing vitamin C, dexamethasone, β-glycerophosphate, and BMP2). After culturing, the cells were transplanted subcutaneously to immunodeficient mice (SCID mice). Tissue pieces (tissue containing the transplanted carrier) removed 4 weeks after transplantation were stained with hematoxylin and eosin (HE staining), and the morphology was observed.
Specifically, the tissue piece was fixed with 10 wt% formaldehyde for 24 hours and degreased with 80 wt% methanol and chloroform. Next, the mixture was decalcified with 10 wt% formic acid for 24 hours, washed with water, dehydrated with ethanol according to a conventional method, substituted with remozole, and permeated with paraffin. 5 μm slices of the sample obtained by embedding were prepared and HE-stained. HE staining was performed by deparaffinization with remosol and ethanol, staining the cell nucleus with hematoxylene and staining the cytoplasm with eosin, dehydrating with ethanol, encapsulating with remosol, and observing the tissue.
As a control, bone regeneration was observed in the same manner as described above except that the carrier 10 not seeded with HAOB3 was used.

Results FIG. 27 shows the results. As is clear from the figure, compared to the carrier 10 not seeded with HAOB3 (right photo in FIG. 27), when the carrier 10 seeded with HAOB3 is used (left photo in FIG. 27), blood vessels to the carrier Invasion and formation of bone-like structures with osteoblast-like cells around the carrier (arrow part in the photograph) were observed. From this, it was confirmed that the composite in which bone formation was observed was useful for bone regeneration in vivo.
From the results of these examples, it was found that long-term culture of undifferentiated osteoblasts was possible with the carrier.
In addition, compared with the case of using carrier 2, in the case of using carriers 5 to 10, the proliferation of undifferentiated osteoblasts was suppressed when the composite was cultured for 7 days, that is, at the beginning of the culture. . In addition, in the case of using the carriers 5 to 10 as compared with the case of using the carrier 2, the induction of differentiation and calcification induction of undifferentiated osteoblasts into bone cells was promoted in the composite. From this, it was confirmed that the carriers 5 to 10 can promote the differentiation induction and the calcification induction of undifferentiated osteoblasts into osteoblasts more efficiently than the carrier 2. Among these, the carriers 8 to 10, and the

carriers

9 and 10, particularly the carrier 10, were able to promote the induction of differentiation and calcification of undifferentiated osteoblasts derived from alveolar bone into osteoblasts more efficiently. From these facts, it can be seen that the carriers 5 to 10, particularly the carriers 8 to 10, and further the

carriers

9 and 10, and more particularly the carrier 10, are more useful for bone regeneration from undifferentiated osteoblasts derived from alveolar bone. It was.

According to the present invention, undifferentiated osteoblasts derived from alveolar bone can be efficiently proliferated and / or differentiated in a carrier. Moreover, according to the present invention, bone tissue derived from alveolar bone-derived undifferentiated osteoblasts can be produced simply and efficiently. According to the present invention, bone tissue can be regenerated to a practical level.

1: Cotton-like low-density layer 1 ': Cotton-like low-density layer 1 "containing an optional component: Cotton-like low-density layer 2 having a different polymer composition 2: Coating layer (shape stabilization layer)
3: High-density layer 3 ′: High-

density layers

4 and 4 ′ containing optional components or having different polymer composition or both characteristics: Carriers having different internal structures and compositions

Claims

Complex of undifferentiated osteoblasts derived from alveolar bone and carrier:
Here, the carrier is a fiber molded product having a three-dimensional network structure, the bulk density of the fiber molded product is 0.0001 to 0.25 g / cm 3 , and the fibers constituting the fiber molded product are biocompatible. A functional polymer.
The composite according to claim 1, wherein the fibers constituting the fiber molded article include a biocompatible hydrophobic polymer.
The composite according to any one of claims 1 and 2, wherein the fiber constituting the fiber molding includes a composite fiber containing a biocompatible hydrophobic polymer and a biocompatible hydrophilic polymer.
4. The composite according to claim 3, wherein the composite fiber has a structure in which the hydrophilic polymer fiber is formed inside the hydrophobic polymer fiber.
The hydrophilic polymer fibers form a three-dimensional network structure inside the composite fiber, and the hydrophilic polymer fibers are bonded to each other to form a twisted structure in the composite fiber, thereby bringing the composite fibers into contact with each other. 5. A composite according to claim 4 which is controlled.
The composite according to any one of claims 1 to 5, wherein the fiber molded article has a coating layer at least partially.
The composite according to claim 6, wherein the coating layer has a thickness of 1000 μm or less.
The composite according to claim 6 or 7, wherein the coating layer includes a plurality of through holes having an average pore diameter of 10 µm or more.
The composite according to claim 8, wherein an area of the opening formed by the plurality of through holes is 50% or more of a surface area of the coating layer.
The composite according to any one of claims 1 to 9, wherein the carrier has a thickness of 0.05 to 500 mm.
The composite according to any one of claims 1 to 10, wherein at least a part of the undifferentiated osteoblasts derived from alveolar bone is differentiated into alveolar bone-derived osteoblasts.
The composite according to any one of claims 1 to 10, wherein at least a part of the undifferentiated osteoblasts derived from the alveolar bone is in a calcified state.