WO2017125042A1

WO2017125042A1 - Dsrna for silencing saliva toxic protein gene vtp of varroa destructor mite and application thereof

Info

Publication number: WO2017125042A1
Application number: PCT/CN2017/071717
Authority: WO
Inventors: 张祎; 韩日畴
Original assignee: 广东省生物资源应用研究所
Priority date: 2016-01-22
Filing date: 2017-01-19
Publication date: 2017-07-27
Also published as: CN105483131A

Abstract

Provided is a dsRNA for silencing a salivary toxic protein gene Vtp of a Varroa destructor mite and an application thereof. The dsRNA for silencing the salivary toxic protein gene Vtp of the Varroa destructor mite is a double-stranded RNA consisting of a nucleotide sequence represented by SEQ ID NO. 1 and a reverse complement thereof. Using the dsRNA to silence the toxic protein gene of the Varroa destructor mite, reduces the damage caused to a bee by the Varroa destructor mite.

Description

A dsRNA for silencing the divava saliva toxic protein gene VTP and application thereof

Technical field:

The invention belongs to the field of biochemistry and molecular biology, and particularly relates to a dsRNA for silencing the disesa salivary toxic protein gene VTP and application thereof.

Background technique:

Varroa destructor (Anderson & Trueman, 2000) is an important ectoparasite that harms the world's beekeeping industry, causing enormous losses to beekeeping and agriculture worldwide (Martin et al., 2004). Deswax can harm bees to cover larvae, mites and adult bees, while carrying and spreading bee viruses, co-infected with Tropilaelaps mercedesae (Luo et al., 2011), resulting in severe bee colony productivity Falling, or even destroying the whole group. Deswart feeds on the hemolymph of bees, which are perforated on the epidermis of the bee sting to feed their offspring. Salivary proteins inhibit blood cell agglutination, prevent bee wound healing and reduce the corresponding host response (Richards Et al., 2011).

The laboratory isolated and purified from a viscera saliva to a venomous venom venom protein VTP which is toxic to honeybees, and its nucleotide sequence of the gene - Desva sputum venom protein gene VTP, such as SEQ ID Shown in NO.2.

Summary of the invention:

A first object of the present invention is to provide a dsRNA having a very good silencing effect on the Desva sputum venom protein gene.

The dsRNA of the silden lysin virulence protein gene VTP of the present invention, characterized in that the double strand consisting of the nucleotide sequence shown by SEQ ID NO. 1 and the nucleotide sequence shown by the reverse complement thereof RNA.

A second object of the present invention is to provide the use of the above dsRNA for silencing the Disuvana saliva virulence protein gene VTP.

A preparation for silencing the disesa salivary toxic protein gene VTP, which comprises the above dsRNA as an active ingredient.

A third object of the present invention is to provide the above dsRNA for enhancing honey in the case of Deswax infected bees Application in bee survival rate.

A preparation for preventing and controlling the survival rate of a bee under infection by a divava, which is characterized in that the above dsRNA is contained as an active ingredient.

The present inventors have found through experiments that the dsRNA of the silencing visceral virulence protein gene VTP of the present invention can silence the dissova sputum venom protein gene VTP, and is immersed in the silent dissiva salivary toxic protein gene VTP compared with the control. In the dsRNA, the mRNA content of the Visva sputum virulence protein gene VTP in the dsRNA is significantly reduced, and continues until the bee pre-epidation, silencing the Desva 后 after the Desva sputum venom protein gene VTP The toxicity was significantly reduced. Compared with the control, the survival rate of the bee was significantly increased after infection, while the mortality of the Chinese honeybee was also significantly reduced. Therefore, the dsRNA of the present invention can be silenced by the toxic protein gene of Desva, thereby reducing the harm of the divasova to the bees.

BRIEF DESCRIPTION OF THE DRAWINGS:

Figure 1 is a graph showing the determination of the silencing effect, in which Vd-CK represents Dissova without any treatment; Vd-0.9% NaCl represents Deswax soaked with a mass fraction of 0.9% NaCl solution; Vd-dsGFP represents Divaswad soaking Passing dsRNA-GFP; Vd-dsVTP indicates that the bees were infested with a dicevalin soaked in a dsRNA-VTP solution.

Figure 2 is a graph showing the toxicity of Deswax to bees after silencing. Figure A is the determination of the pre-tanning of the Italian honeybee, and Figure B is the toxicity test of the pre-tanning of the Chinese honeybee. The dsVTP in the figure indicates that the dsRNA has been soaked in the dsRNA. -VTP; dsGFP indicates that Desva has been soaked with dsRNA-GFP; 0.9% NaCl indicates that Divasova has been soaked with a mass fraction of 0.9% NaCl solution; Vd indicates that Desva has not been treated; No Vd: bee pre-dip There was no blank control added to the corrugated infestation.

detailed description:

The following examples are intended to further illustrate the invention and not to limit the invention.

Example 1:

1. Collection of Deswar and bees: The adult females of Diswal are collected in the beekeeping hive, removed and placed in a sterile Petri dish with 9 cm filter paper. The bee pre-twist is placed in a 48-well culture plate with sterile filter paper, and one pre-twist is placed in each well for use.

2. Cloning of the visceral virulence protein gene VTP of Desva

About 60 heads of Divaswa were used to extract total RNA using TriZolReagent (Invitrogen, product number: 15590026), and the purity and amount of total RNA were detected by agarose gel electrophoresis and ultraviolet spectrophotometer, and 1 μg of total RNA was taken. initial reverse transcription reaction using as a reverse transcription kit ^{SMARTer TM RACE cDNA Amplification kit (Clontech} , NO: 634923), the step of referring to the reverse transcription reaction kit instructions, to obtain reverse transcription products.

Design specific primers for the VTP gene using the reverse transcription product as a template:

PCR was carried out using a high-fidelity Taq enzyme. The PCR reaction system consisted of 1 μL of reverse transcription product, 5 μL of 10×Buffer, 4 μL of dNTP (each 2.5 mM), 1 μL of VTPF1 (10 μM), 1 μL of VTPR1 (10 μM), 1 μL of Taq enzyme (5 U/μL), ddH. ₂ O 37 μL. Mix on ice and add. The PCR reaction conditions were: 94 ° C for 5 min; 94 ° C for 30 sec, 44.5 ° C for 30 sec, 72 ° C for 45 sec, 30 cycles; 72 ° C for 5 min. A 405 bp fragment was obtained by PCR amplification. With the recovered fragment to agarose gel electrophoresis, linked to pEASY ^TM -T1Simple vector (Kim's full Beijing Biological Technology Co., Ltd., which is item number: CT111-01), the step of referring to the specific vector instructions. The ligation vector was sequenced and analyzed. The sequence indicated that the sequence contained an open reading frame of 405 bases, and the sequence thereof was as shown in SEQ ID NO. 1, and was named as the Disshua salivary toxic protein gene VTP. Varroa destructor mites get inserted toxic saliva protein gene of VTP pEASY ^TM -T1Simple vector designated pEASY-T-VTP.

3. dsRNA synthesis

(1) Primers:

The area underlined is the T7 promoter sequence;

(2) Negative control primers:

The area underlined is the T7 promoter sequence;

(3) Template preparation: using pEASY-T-VTP (or the reverse transcription product in the above step 2) and pEASY-T-GFP (the GFP gene is inserted into the pEASY ^TM -T1Simple vector) as templates, respectively, using the above The primers were amplified separately, and the corresponding PCR products were obtained. After the gel was purified, the concentration was 0.5-1.0 μg/μL.

(4) DsRNA synthesis and purification According to the kit instructions (MEGAscript Kit, AM1330, Ambion), a dsRNA (dsVTP) that silences the Disuvana salivary virulence protein gene VTP and a dsRNA (dsGFP) that silences the GFP gene are obtained, respectively. The dsRNA in which the Dissiva salivary virulence protein gene VTP was silenced was sequenced, and it was shown that it was a double consisting of the nucleotide sequence shown by SEQ ID NO. 1 and the nucleotide sequence shown by its reverse complement. Strand RNA.

4, import dsRNA

References Campbell et al., 2010, introduce dsRNA (dsVTP or dsGFP) into adult females by soaking, as follows:

(1) DsRNA was prepared into 2.5 μg/μL with a mass fraction of 0.9% NaCl, and 10 μL was placed in a 500 μL centrifuge tube, and 10 adult females were placed;

(2) 16 ° C overnight (about 15 h), removed and placed on sterile filter paper, to be rejuvenated. The resurrection corrugated was used for subsequent experimental processing.

(3) Treatment: Diswarva adult females are soaked in

A.dsVTP;

B.dsGFP;

C.0.9% NaCl;

D. not soaking;

(4) For each treatment, 3 replicates, 20 females per replicate.

5, the determination of the silent effect:

(1) Determination of the silencing effect of VTP in the live sputum after gene silencing: The cockroaches of each of the above treatments were taken out and placed on the stalk of the bee worker bee, and two cockroaches were placed on each larva, and then sealed with a sealing film, and sealed. Ten wells were placed on the membrane and placed in an artificial incubator (34 ° C, RH 75%) until the mites were pre-sputumed to adults. After the interval of 0d, 3d, 7d and 13d, the total RNA was extracted from 8 live cockroaches, and the gene silencing effect was examined by qRT-PCR. The experiment was repeated twice. The specific steps are as follows: the total RNA of the corrugated rice is extracted by Trizol, then the genomic DNA is digested with DNaseI, and then the cDNA is reverse transcribed, and the mRNA of the viscous vaginal protein gene VTP in the corresponding treatment is detected by using the cDNA as a template. content. qPCR primers: VdVTP-qF (AACGCATTCAAGACTACATCACCAA) and VdVTP-qR (CTTTGACAACGTTCTCCTTCTGCT), the internal reference gene is the actin gene of Desva, and its primers are: VdActinF: CATCACCATTGGTAACGAG and VdActinR: CGATCCAG ACGGAATACTT. Amplification conditions: 95 ° C, 5 min; 95 ° C, 15 s, 58 ° C, 30 s, 72 ° C, 30 s, amplification for 40 cycles.

The results are shown in Fig. 1. As can be seen from Fig. 1, compared with the control, the mRNA of the target gene in the dsRNA-dsVTP was significantly decreased in the dsRNA-dsVTP, and the saliva toxicity in the corrugated body was 0. The relative content of mRNA of protein gene VTP was only 0.9% of the control, 1.3% after 3d, and 20.8% after 7d, and continued until the bee pre-epidation, which was 32.4% after 13d.

(2) Toxicity measurement of live cockroaches after gene silencing: After the above-mentioned treatment, the live cockroaches were taken out and placed on the bee or the bee worker bee, and each larva was placed with two cockroaches, and then sealed with a sealing film. Ten holes were placed on the parafilm and placed in an artificial incubator (34 ° C, RH 75%) until the mites were pre-sputed to adults. 3 replicates per treatment, 6 replicates per repeat. The survival rate and residual wing rate of the bee, the mortality and survival rate of the bee were calculated separately.

The results are shown in Fig. 2. As can be seen from Fig. 2, the pre-existence of the infected bee was silenced after the Dissova sputum salivary toxic protein gene VTP was silenced, and the survival rate of the bee was significantly improved (72.2). %), but the residual wing rate was not significantly different from the control, and the mortality rate of the Chinese honeybee pre-dip was also significantly reduced (41.1%).

Claims

A dsRNA silencing a dissiva salivary venom protein gene VTP, characterized by a double-stranded RNA consisting of the nucleotide sequence shown by SEQ ID NO. 1 and the nucleotide sequence shown by its reverse complement .
The use of the dsRNA of the Dissiva sputum salivary toxic protein gene VTP of claim 1 for silencing the Desva sputum salivary toxic protein gene VTP.
A preparation for silencing a disesa salivary toxic protein gene VTP, which comprises the dsRNA of the silden-dissolved salivary toxic protein gene VTP of claim 1 as an active ingredient.
The use of the dsRNA of the Dissiva salivary venom protein gene VTP of claim 1 for improving the survival rate of bees in the case of Divasian infection of honeybees.
A preparation for preventing and controlling the survival rate of a honeybee by the infection of a honeysuckle infection, characterized in that the dsRNA containing the Silva's salivary venom protein gene VTP of claim 1 is used as an active ingredient.