WO2017121319A1

WO2017121319A1 - Activation of t cells with increased plasma membrane cholesterol levels

Info

Publication number: WO2017121319A1
Application number: PCT/CN2017/070817
Authority: WO
Inventors: Chenqi XU; Boliang Li; Wei Yang; Yibing BAI; Ying Xiong
Original assignee: Shanghai Institutes For Biological Sciences, Chinese Academy Of Sciences
Priority date: 2016-01-11
Filing date: 2017-01-11
Publication date: 2017-07-20

Abstract

The present invention provides methods and compositions for activating a CD8+ T cell which is useful for cancer immunotherapy and treating infections. The CD8+ T cell can be activated by contacting with an agent that increases the plasma membrane cholesterol level of the cell. Also provided are methods and agents for screening for agents useful for inhibiting CD8+ T cells.

Description

ACTIVATION OF T CELLS WITH INCREASED PLASMA MEMBRANE CHOLESTEROL LEVELS

CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims the benefit to Chinese Patent Application No. : 201610015550. X, filed January 11, 2016； and to Chinese Patent Application No. : 201610015227.2, filed January 11, 2016. The entire contents of each of these applications are hereby incorporated herein by reference.

BACKGROUND

T cell is a type of lymphocyte that plays a central role in cell-mediated immunity. T cells can be distinguished from other lymphocytes, such as B cells and natural killer cells, by the presence of a T-cell receptor on the cell surface. The majority of human T cells rearrange their alpha and beta chains on the cell receptor and are termed alpha beta T cells (αβ T cells) and are part of the adaptive immune system. Specialized gamma delta T cells have invariant T cell receptors with limited diversity, that can effectively present antigens to other T cells and are considered to be part of the innate immune system.

A cytotoxic T cell (also known as T-killer cell, CD8+ T-cell or killer T cell) is a T cell that kills cancer cells, cells that are infected (particularly with viruses) , or cells that are damaged in other ways. Most cytotoxic T cells express T-cell receptors (TCRs) that can recognize a specific antigen. An antigen is a molecule capable of stimulating an immune response, and is often produced by cancer cells or viruses. Antigens inside a cell are bound to class I MHC molecules, and brought to the surface of the cell by the class I MHC molecule, where they can be recognized by the T cell. If the TCR is specific for that antigen, it binds to the complex of the class I MHC molecule and the antigen, and the T cell destroys the cell.

In order for the TCR to bind to the class I MHC molecule, the former must be accompanied by a glycoprotein called CD8, which binds to the constant portion of the class I MHC molecule； hence these T cells are called CD8+ T cells.

CD8+ T cells play a central role in antitumor immunity, but their activity is suppressed in the tumor microenvironment. Reactivating the cytotoxicity of CD8+ T cells is of great clinical interest in cancer immunotherapy. Activation or increased activity of CD8+T cells can also be beneficial for treating infection in particular viral infections.

SUMMARY

It is discovered herein that the activity of CD8+ T cells can be potentiated by modulating cholesterol metabolism. Inhibiting cholesterol esterification in T cells by genetic ablation or pharmacological inhibition a cholesterol esterification enzyme led to potentiated effector function and enhanced proliferation of CD8+ T cells. This is attributed to the elevation of the plasma membrane cholesterol level of CD8+ T cells that causes enhanced T-cell receptor clustering and signaling as well as more efficient formation of immunological synapse. This discovery, therefore, demonstrates that T cell activity can be modulated by cholesterol metabolism in the T cell. As T cell activation has broad clinical use, such as in cancer immunotherapy and treating infectious diseases, the present technology has immense applications.

In accordance with one embodiment of the present disclosure, provided is a method for activating a CD8+ T cell, comprising contacting the cell with an agent that increases the plasma membrane cholesterol level of the cell. The contacting can be in vitro or in vivo. When the contacting is made in vivo, the agent can be useful for treating a patient suffering from a disease characterized with a suppressed CD8+ T cell. The disease may be cancer or microbial infection.

In some embodiments, the agent that increases the plasma membrane cholesterol level of the cell is one that (a) decreases esterification of free cholesterol in a cell, (b) increases hydrolysis of cholesterol ester in a cell, (c) increases cholesterol biosynthesis in a cell, (d) increases cholesterol update into a cell, (e) inhibits efflux of cholesterol ester from a cell, (f) increases cholesterol trafficking from late endosome to cell membrane, (g) inhibits cholesterol degradation, or (h) inhibits cholesterol conversion to another molecule.

In some embodiments, the agent is an acyl-coenzyme A: cholesterol acyltransferases 1 (ACAT1) inhibitor, or a proprotein convertase subtilisin/kexin type 9 (PCSK-9) inhibitor. In some embodiments, the ACAT1 inhibitor is selected from a group consisting of a small inhibitory RNA (siRNA) , a small hairpin RNA (shRNA) , a microRNA (miRNA) , or an anti-sense nucleic acid, (B) an ACAT1 inhibitory antibody or fragment thereof, (C) a small molecule inhibitor, and combinations thereof.

In some embodiments, the ACAT1 inhibitor is selected from a group consisting of avasimibe (CI-1011) , pactimibe, purpactins, manassantin A, diphenylpyridazine derivatives, glisoprenin A, CP113, 818, K604, beauveriolide I, beauveriolide III, U18666A, TMP-153, YM750, GERI-BP002-A, Sandoz Sah 58-035, VULM 1457, Lovastatin, CI976, CL-283, 546, CI-999, E5324, YM17E, FR182980, ATR-101 (PD132301 or PD132301-2) , F-1394, HL-004, F-12511 (eflucimibe) , cinnamic acid derivatives, cinnamic derivative, Dup 128, RP-73163, pyripyropene C, FO-1289, AS-183, SPC-15549, FO-6979, Angekica, ginseng, Decursin, terpendole C, beauvericin, spylidone, pentacecilides, CL-283, 546, betulinic acid, shikonin derivatives, esculeogenin A, Wu-V-23, pyripyropene derivatives A, B, and D, glisoprenin B-D, saucerneol B, sespendole, diethyl pyrocarbonate, beauveriolide analogues, Acaterin, DL-melinamide, PD 138142-15, CL277, 082, EAB-309, Enniatin antibiotics, Epi-cochlioquinone A, FCE-27677, FR186485, FR190809, NTE-122, obovatol, panaxadiols, protopanaxadiols, polyacetylenes, SaH 57-118, AS-186, BW-447A, 447C88, T-2591, TEI-6522, TEI-6620, XP 767, XR 920, GERI-BP001, gomisin N, gypsetin, helminthosporol, TS-962, isochromophilones, kudingosides, lateritin, naringenin, and combinations thereof. In one embodiment, the ACAT1 inhibitor is avasimibe.

In some embodiments, the PCSK-9 inhibitor is selected from the group consisting of alirocumab, evolocumab, 1D05-IgG2, RG-7652, LY3015014, and ALN-PCS02.

Also provided, in some embodiments, is a method of treating cancer or microbial infection. The method entails, in one embodiment, (a) treating a CD8+ T cell, in vitro, with an agent that increases the plasma membrane cholesterol level of the cell； (b) administering the treated cell to a patient suffering from cancer or microbial infection. In some embodiments, the method further comprises, prior to step (a) , isolating the CD8+ T cell. In some embodiments, the CD8+ cell is isolated from the patient. In some embodiments, the CD8+ cell is isolated from a donor individual different from the patient.

In some embodiments, the agent is an acyl-coenzyme A: cholesterol acyltransferases 1 (ACAT1) inhibitor, or a proprotein convertase subtilisin/kexin type 9 (PCSK-9) inhibitor. In some embodiments, the administration is infection. In some embodiments, the injection is local injection.

In some embodiments, provided is a method of screening for a cancer immunotherapeutic agent, comprising: (a) contacting a candidate agent with a cell expressing acyl-coenzyme A: cholesterol acyltransferases 1 (ACAT1) ； (b) detecting an ACAT1 inhibitory activity of the candidate agent； (c) contacting the candidate agent, if exhibiting the inhibitory activity, with a CD8+ T cell； and (d) measuring the plasma membrane cholesterol level of the cell, wherein an increase of plasma membrane cholesterol level indicates that the candidate agent has cancer immunotherapeutic activity.

The measurement can further comprise measuring a killing effect, cell proliferation, survival, cytokine or granule production, activity of acyl-coenzyme A: cholesterol acyltransferases 1 (ACAT1) , or TCR clustering.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 shows potentiated effector function of CD8+ T cells in response to ACAT1 inhibitors；

FIG. 2 shows enhanced cytokine/granule productions in ACAT1-deficient CD8+ T cells；

FIG. 3 shows inhibited tumor growth and prolonged survival time in ACAT1 conditional knockout (CKO) mice compared with wild type (WT) in a melanoma model；

FIG. 4 shows stronger antitumor activity of transferred CKO OT-I cytotoxic T lymphocyte (CTLs) in melanoma mouse model；

FIG. 5 shows enhanced T-cell receptor (TCR) clustering in ACAT1-deficient CD8+ T cells；

FIG. 6 shows augmented synapse formation on stimulatory planar lipid bilayer of ACAT1-deficient CD8+ T cells；

FIG. 7 shows augmented cytolytic granule polarization and degranulation in ACAT1-deficient CD8+ T cells；

FIG. 8 shows inhibited tumor growth and prolonged survival time in melanoma bearing mice treated with an ACAT1 inhibitor, avasimibe；

FIG. 9 shows a better antitumor efficacy of a combined therapy of avasimibe and anti-PD-1 than monotherapies；

FIG. 10 shows antitumor effect of avasimibe in Lewis lung carcinoma (LLC) ；

FIG. 11 shows enhanced cytokine production of human CD8+ T cells in response to ACAT1 inhibitors；

FIG. 12 shows enhanced effector function of mouse CD8+ T cells ex vivo in response to avasimibe； and

FIG. 13 shows synergistic effect of a combined therapy of avasimibe and dacarbazine in treatment of melanoma.

DETAILED DESCRIPTION

The following description sets forth exemplary embodiments of the present technology. It should be recognized, however, that such description is not intended as a limitation on the scope of the present disclosure but is instead provided as a description of exemplary embodiments.

Definitions

As used in the present specification, the following words, phrases and symbols are generally intended to have the meanings as set forth below, except to the extent that the context in which they are used indicates otherwise. The fact that a particular term or phrase is not specifically defined should not be correlated to indefiniteness or lacking clarity, but rather terms herein are used within their ordinary meaning. When trade names are used herein, applicants intend to independently include the trade name product and the active pharmaceutical ingredient (s) of the trade name product.

Recitation of numeric ranges of values throughout the specification is intended to serve as a shorthand notation of referring individually to each separate value falling within the range inclusive of the values defining the range, and each separate value is incorporated in the specification as it were individually recited herein.

Reference to the word “comprise” and variations thereof, such as, “comprises” and “comprising” are to be construed in an open, inclusive sense, that is, as “including, but not limited to. ” Further, the singular forms “a, ” “an, ” and “the” include plural references unless the context clearly dictates otherwise. Thus, reference to “the compound” includes a plurality of such compounds, and reference to “the assay” includes reference to one or more assays and equivalents thereof known to those skilled in the art.

Reference to “about” a value or parameter herein includes (and describes) embodiments that are directed to that value or parameter per se. The term “about X” thus includes description of “X” . In one embodiment, the term “about” includes the indicated amount ± 10％. In other embodiments, the term “about” includes the indicated amount ± 5％. In certain other embodiments, the term “about” includes the indicated amount ± 1％.

As used herein, the terms “subject” and “subjects” refers to humans, domestic animals (e.g., dogs and cats) , farm animals (e.g., cattle, horses, sheep, goats and pigs) , laboratory animals (e.g., mice, rats, hamsters, guinea pigs, pigs, rabbits, dogs, and monkeys) , and the like. In one embodiment, the subject is a mammal. In one embodiment, the subject is a human.

As used herein, the terms “treating” and “treatment” of a disease include the following: (1) preventing or reducing the risk of developing the disease, i.e., causing the clinical symptoms of the disease not to develop in a subject that may be exposed to or predisposed to the disease but does not yet experience or display symptoms of the disease, (2) inhibiting the disease, i.e., arresting or reducing the development of the disease or its clinical symptoms, and (3) relieving the disease, i.e., causing regression of the disease or its clinical symptoms.

As used herein, the term “administration” or “administer” may refer to administration of an active compound or composition by any route known to one of ordinary skill in the art. Administration can be local or systemic. Examples of “local administration” include, but are not limited to, topical administration, subcutaneous administration, intramuscular administration, intrathecal administration, intrapericardial administration, intra-ocular administration, topical ophthalmic administration, or administration to the nasal mucosa or lungs by inhalational administration. In addition, local administration includes routes of administration typically used for systemic administration, for example by directing intravascular administration to the arterial supply for a particular organ. Thus, in particular embodiments, local administration includes intra-arterial administration and intravenous administration when such administration is targeted to the vasculature supplying a particular organ. Local administration also includes the incorporation of active agents and compounds into implantable devices or constructs, such as vascular stents or other reservoirs, which release the active agents and compounds over extended time intervals for sustained treatment effects. “Systemic administration” includes any route of administration designed to distribute an active compound or composition widely throughout the body via the circulatory system. Thus, systemic administration includes, but is not limited to intra-arterial and intravenous administration. Systemic administration also includes, but is not limited to, oral administration, topical administration, subcutaneous administration, intramuscular administration, transdermal administration, or administration by inhalation, when such administration is directed at absorption and distribution throughout the body by the circulatory system.

As used herein, the term “composition” is intended to mean a combination of active agent and another compound or composition, inert (for example, a detectable agent or label) or active, such as an adjuvant.

As used herein, the term “pharmaceutical composition” is intended to include the combination of an active agent with a carrier, inert or active, making the composition suitable for diagnostic or therapeutic use in vitro, in vivo, or ex vivo.

As used herein, the term “unit dosage forms” refers to physically discrete units suitable as unitary dosages for human subjects and other mammals, each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect, in association with a suitable pharmaceutical excipient.

As used herein, the term “effective amount” or “therapeutically effective amount” means the amount of an active agent or compound described herein that may be effective to elicit the desired biological or medical response. These terms include the amount of an active agent or compound that, when administered to a subject for treating a disease, is sufficient to effect such treatment for the disease. The effective amount will vary depending on the active agent, the disease and its severity and the age, weight, etc., of the subject to be treated.

As used herein, the term “pharmaceutically acceptable” indicates that the indicated material does not have properties that would cause a reasonably prudent medical practitioner to avoid administration of the material to a patient, taking into consideration the disease or conditions to be treated and the respective route of administration. For example, it is commonly required that such a material be essentially sterile.

As used herein, the term “pharmaceutically acceptable carrier” refers to pharmaceutically acceptable materials, compositions or vehicles, such as a liquid or solid filler, diluent, adjuvants, excipient, solvent or encapsulating material, involved in carrying or transporting any supplement or composition, or component thereof, from one organ, or portion of the body, to another organ, or portion of the body, or to deliver an agent to the cancerous tissue or a tissue adjacent to the cancerous tissue.

As used herein, the term “formulated” or “formulation” refers to the process in which different chemical substances, including one or more pharmaceutically active ingredients, are combined to produce a dosage form. In one embodiment, two or more pharmaceutically active ingredients can be coformulated into a single dosage form or combined dosage unit, or formulated separately and subsequently combined into a combined dosage unit. A sustained release formulation is a formulation which is designed to slowly release a therapeutic agent in the body over an extended period of time, whereas an immediate release formulation is a formulation which is designed to quickly release a therapeutic agent in the body over a shortened period of time.

As used herein, the term “solution” refers to solutions, suspensions, emulsions, drops, ointments, liquid wash, sprays, liposomes which are well known in the art. In one embodiment, the liquid solution contains an aqueous pH buffering agent which resists changes in pH when small quantities of acid or base are added.

As used herein, the term “solvate” refers to an association or complex of one or more solvent molecules and a compound of the disclosure. Examples of solvents that form solvates may include water, isopropanol, ethanol, methanol, dimethylsulfoxide, ethylacetate, acetic acid and ethanolamine.

As used herein, the term “hydrate” refers to the complex formed by the combining of a compound described herein and water.

As used herein, the term “prodrug” refers to compounds disclosed herein that include chemical groups which, in vivo, can be converted and/or can be split off from the remainder of the molecule to provide for the active drug, a pharmaceutically acceptable salt thereof, or a biologically active metabolite thereof.

As used herein, the term “stereoisomer” or “stereoisomers” refer to compounds that differ in the chirality of one or more stereocenters. Stereoisomers include enantiomers and diastereomers. The compounds may exist in stereoisomeric form if they possess one or more asymmetric centers or a double bond with asymmetric substitution and, therefore, can be produced as individual stereoisomers or as mixtures. Unless otherwise indicated, the description is intended to include individual stereoisomers as well as mixtures. The methods for the determination of stereochemistry and the separation of stereoisomers are well-known in the art (see, e.g., Chapter 4 of Advanced Organic Chemistry, 4th ed., J. March, John Wiley and Sons, New York, 1992) .

As used herein, the term “tautomer” refers to alternate forms of a compound that differ in the position of a proton, such as enol-keto and imine-enamine tautomers, or the tautomeric forms of heteroaryl groups containing a ring atom attached to both a ring -NH-moiety and a ring ＝N-moiety such as pyrazoles, imidazoles, benzimidazoles, triazoles, and tetrazoles.

Compounds of a given formula described herein encompass the compound disclosed and all pharmaceutically acceptable salts, esters, stereoisomers, tautomers, prodrugs, hydrate, solvates, and deuterated forms thereof, unless otherwise specified.

The compound names provided herein are named using ChemBioDraw Ultra 12.0. One skilled in the art understands that the compound may be named or identified using various commonly recognized nomenclature systems and symbols. By way of example, the compound may be named or identified with common names, systematic or non-systematic names. The nomenclature systems and symbols that are commonly recognized in the art of chemistry include, for example, Chemical Abstract Service (CAS) , ChemBioDraw Ultra, and International Union of Pure and Applied Chemistry (IUPAC) .

As used herein, the term “antibody” includes intact immunoglobulins as well as a number of well-characterized fragments produced by digestion with various peptidases, or genetically engineered artificial antibodies. While various antibody fragments are defined in terms of the digestion of an intact antibody, it will be appreciated that Fab′ fragments may be synthesized de novo either chemically or by utilizing recombinant DNA methodology. Thus, the term antibody as used herein also includes antibody fragments either produced by the modification of whole antibodies or synthesized de novo using recombinant DNA methodologies.

As used herein, the term “chemotherapeutic agent” or “chemotherapeutic” (or “chemotherapy” in the case of treatment with a chemotherapeutic agent) is meant to encompass any non-proteinaceous (i.e., non-peptidic) chemical compound useful in the treatment of cancer.

As used herein, the terms “response” or “responsiveness” refers to an anti-cancer response, e.g., in the sense of reduction of tumor size or inhibiting tumor growth. The terms can also refer to an improved prognosis, for example, as reflected by an increased time to recurrence, which is the period to first recurrence censoring for second primary cancer as a first event or death without evidence of recurrence, or an increased overall survival, which is the period from treatment to death from any cause. To respond or to have a response means there is a beneficial endpoint attained when exposed to a stimulus. Alternatively, a negative or detrimental symptom is minimized, mitigated or attenuated on exposure to a stimulus. It will be appreciated that evaluating the likelihood that a tumor or subject will exhibit a favorable response is equivalent to evaluating the likelihood that the tumor or subject will not exhibit favorable response (i.e., will exhibit a lack of response or be non-responsive) .

As used herein, the term “resistance” or “resistant” refers to an acquired or natural resistance of a cancer sample or a mammal to a cancer therapy (i.e., being nonresponsive to or having reduced or limited response to the therapeutic treatment) , such as having a reduced response to a therapeutic treatment by 25％or more, for example, 30％, 40％, 50％, 60％, 70％, 80％, or more, to 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 15-fold, 20-fold or more. The reduction in response can be measured by comparing with the same cancer sample or mammal before the resistance is acquired, or by comparing with a different cancer sample or a mammal who is known to have no resistance to the therapeutic treatment. A typical acquired resistance to chemotherapy is called “multidrug resistance. ” The multidrug resistance can be mediated by P-glycoprotein or can be mediated by other mechanisms, or it can occur when a mammal is infected with a multi-drug-resistant microorganism or a combination of microorganisms. The determination of resistance to a therapeutic treatment is routine in the art and within the skill of an ordinarily skilled clinician, for example, can be measured by cell proliferative assays and cell death assays as described herein as “sensitizing. ” In one embodiment, the term “reverses resistance” means that the use of a second agent in combination with a primary cancer therapy (e.g., chemotherapeutic or radiation therapy) is able to produce a significant decrease in tumor volume at a level of statistical significance (e.g., p<0.05) when compared to tumor volume of untreated tumor in the circumstance where the primary cancer therapy (e.g., chemotherapeutic or radiation therapy) alone is unable to produce a statistically significant decrease in tumor volume compared to tumor volume of untreated tumor. This generally applies to tumor volume measurements made at a time when the untreated tumor is growing log rhythmically.

The methods described herein may be applied to cell populations in vivo or ex vivo. “In vivo” means within a living individual, as within an animal or human. In this context, the methods described herein may be used therapeutically in an individual. “Ex vivo” means outside of a living individual. Examples of ex vivo cell populations include in vitro cell cultures and biological samples including fluid or tissue samples obtained from individuals. Such samples may be obtained by methods well known in the art. Exemplary biological fluid samples include blood, cerebrospinal fluid, urine, and saliva. In this context, the compounds and compositions described herein may be used for a variety of purposes, including therapeutic and experimental purposes. For example, the compounds and compositions described herein may be used ex vivo to determine the optimal schedule and/or dosing of administration of a compound or composition of the present disclosure for a given indication, cell type, individual, and other parameters. Information gleaned from such use may be used for experimental purposes or in the clinic to set protocols for in vivo treatment. Other ex vivo uses for which the compounds and compositions described herein may be suited are described below or will become apparent to those skilled in the art. The selected compounds and compositions may be further characterized to examine the safety or tolerance dosage in human or non-human subjects. Such properties may be examined using commonly known methods to those skilled in the art.

As used herein, the term “monotherapy” refers to administering a single active agent for treating a condition, such as cancer.

As used herein, the term “combined therapy” refers to treatment of a disease or symptom thereof or a method for achieving a desired physiological change, including administering to an animal, such as a mammal, especially a human being, an effective amount of two or more chemical agents or components to treat the disease or symptom thereof, or to produce the physiological change. In one embodiment, the chemical agents or components disclosed herein are administered together, such as part of the same composition. In another embodiment, the chemical agents or components disclosed herein are administered separately and independently at the same time or at different times (e.g., administration of each agent or component is separated by a finite period of time from each other) .

As used herein, the terms “synergy” and “synergistic effect” encompass a more than additive effect of two or more agents compared to their individual effects. In one embodiment, synergy or synergistic effect refers to an advantageous effect of using two or more agents in combination, e.g., in a pharmaceutical composition, or in a method of treatment. A synergistic effect may be attained when the active ingredients are: (1) co-formulated and administered or delivered simultaneously in a combined formulation； (2) delivered by alternation or in parallel as separate formulations； or (3) by some other regimen. When delivered in alternation therapy, a synergistic effect may be attained when the active agents or compounds are administered or delivered sequentially, e.g., in separate tablets, pills or capsules, or by different injections in separate syringes. In general, during alternation therapy, an effective dosage of each active ingredient is administered sequentially, i.e. serially, whereas in combination therapy, effective dosages of two or more active ingredients may be administered together.

As used herein, the term “immune cell therapy” or “adoptive cell therapy” refers to the passive transfer of ex vivo grown cells, most commonly immune-derived cells, into a host with the goal of transferring the immunologic functionality and characteristics of the transplant. Adoptive cell transfer can be autologous and/or allogenic T cells. Adoptive T cell transfer therapy refers to a form of transfusion therapy comprising the infusion of various mature T cell subsets with the goal of eliminating a tumor and preventing its recurrence, for example. There are many forms of adoptive T cell therapy being used for cancer treatment, including: culturing tumor infiltrating lymphocytes (TIL) , isolating and expanding one particular T cell or clone, and even using T cells that have been engineered to potently recognize and attack tumors.

Activation of T Cells by Modulating Cellular Cholesterol Metabolism

The experimental examples of the present disclosure demonstrate that when the plasma membrane cholesterol level of CD8⁺ T cells is increased, T-cell receptor (TCR) clustering and signaling as well as immunological synapse formation were significantly enhanced. Tumor growth in animals (with melanoma) with such CD8+ cells was inhibited and survival time was prolonged. Also, the number of tumor-infiltrating CD8⁺ T cells in such animals increased, and these cells showed potentiated effector function and enhanced proliferation. Besides melanoma, increased plasma membrane cholesterol level also exhibited good antitumor effect in Lewis lung carcinoma. It is contemplated that activated CD8⁺ T cells reprogram the cholesterol metabolism and synthesize more free cholesterol to support rapid cell proliferation.

This discovery, therefore, presents a new technology of immunotherapy through the modulation of T cell cholesterol metabolism. The therapy can be for treating cancer or for treating infections, in particular viral infections.

In accordance with one embodiment of the disclosure, provided is method for activating a T cell, comprising contacting the cell with an agent that increases the plasma membrane cholesterol level of the cell. The T cell may be an effector T cell, a helper T cell, a memory T cell or a cytotoxic (killer) T cell. Cytotoxic T cells are also known as CD8+ T cell as they express the CD8 glycoprotein at the surfaces. The contacting can be in vitro or in vivo. When the contacting is in vitro, the method can prepare an activated T cell which can then be used for other purposes, such as implant into a patient. When the contacting is in vivo, the resulting activated T cell can be therapeutic useful in the host body.

Agents for Modulating Cellular Cholesterol Metabolism

Cholesterol metabolism in a T cell consists of few main pathways, including esterification of free cholesterol (FC) , hydrolysis of cholesterol ester (CE) , cholesterol biosynthesis, uptake, efflux, trafficking, degradation, and conversion. Any agent that is able to increase or decrease the activity of each of these pathways may be able to modulate the cell’s cholesterol metabolism.

Esterification of free cholesterol in a cell to cholesterol ester reduces the amount of cholesterol in the cell, leading to reduced plasma membrane cholesterol level. Acyl-coenzyme A: cholesterol acyltransferases 1 (ACAT1) is a gene in this pathway, and the present data shows that inhibition of ACAT1 leads to increased plasma membrane cholesterol level. For certain cells, the plasma membrane cholesterol level may be increased by inhibiting the acyl-coenzyme A: cholesterol acyltransferases 2 (ACAT2) gene.

By contrast, the CE hydrolysis pathway converts CE to FC and thus its activation leads to elevated plasma membrane cholesterol levels. The enzymes, such as CEH (cholesterol ester hydrolase) or NCEH (neutral cholesterol ester hydrolase known as AADACL1 or KIAA1363) , are located in the ER and hydrolyze 2-acetyl monoalkylglycerol ether. In this respect, a suitable agent is able to increase the expression or activity of CEH and/or NCEH.

Cholesterol biosynthesis results in production of more cholesterol in the cell. Genes involved in this pathway include, without limitation, Srebp (sterol regulatory element-binding protein) 1 and 2, Hmgcr (HMG-CoA reductase) , Hmgcs (HMG-CoA synthase) , Fasn (fatty acid synthase) , Acaca (acety-CoA Carboxylase Alpha) , and Sqle (squalene epoxidase) .

Srebp is transcription factor that, when activated, binds to the sterol regulatory element DNA sequence and upregulate the synthesis of enzymes involved in sterol biosynthesis. Hmgcr is a rate-controlling enzyme of the mevalonate pathway, the metabolic pathway that produces cholesterol and other isoprenoids. Hmgcs catalyzes the reaction in which Acetyl-CoA condenses with acetoacetyl-CoA to form 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) . HMG-CoA is an intermediate in both cholesterol synthesis and ketogenesis. Fasn is a multi-enzyme protein that catalyzes fatty acid synthesis. Acaca is an enzyme that catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. Sqle is an enzyme that catalyzes the first oxygenation step in sterol biosynthesis and is thought to be one of the rate-limiting enzymes in this pathway. Increased expression or activity of any of these genes can increase the plasma membrane cholesterol level of a T cell. Non-limiting examples include fibrate which increases the activity of Hmgcr. Known fibrate compounds include, without limitation, bezafibrate, ciprofibrate, clofibrate, gemfibrozil, fenofibrate, and clinofibrate.

Cholesterol update from the extracellular environment can also contribute to increased level of plasma membrane cholesterol. Ldlr (LDL receptor) is a cell-surface receptor that mediates the endocytosis of cholesterol-rich LDL. An agent that increases the expression of activity of Ldlr can increase the plasma membrane cholesterol level. Proprotein convertase subtilisin/kexin type 9 (PCSK9) binds to the receptor for low-density lipoprotein particles (LDL) , which typically transport 3,000 to 6,000 fat molecules (including cholesterol) per particle, within extracellular water. Therefore, PCSK-9 inhibitors, such as alirocumab (Praluent) and evolocumab (Repatha) , can also achieve the goal of increasing plasma membrane cholesterol level on T cells. Likewise, inhibitors of Idol (E3 ubiquitin ligase) , a sterol-dependent regulator of the LDLR can have similar results.

Increase of plasma membrane cholesterol levels can also be achieved by inhibiting cholesterol efflux (out of the cell) or increasing trafficking (from late endosomes and lysosomes to cell membrane or ER) . LCAT (Lecithin–cholesterol acyltransferase) and ApoA1 promote cholesterol efflux and thus their inhibitors may be suitable for the purpose of increasing plasma membrane cholesterol levels. NPC (Niemann-Pick C) 1 and 2 are intracellular cholesterol transporters and Rab transports cholesterol from endosomal structures, either to the endoplasmic reticulum and/or to the cell membrane. An agent that increases the expression or activity of NPC or Rab, therefore, can increase the plasma membrane cholesterol levels of T cells.

In some embodiments, therefore, the agent is one that (a) decreases esterification of free cholesterol in a cell, (b) increases hydrolysis of cholesterol ester in a cell, (c) increases cholesterol biosynthesis in a cell, (d) increases cholesterol update into a cell, (e) inhibits efflux of cholesterol ester from a cell, (f) increases cholesterol trafficking from late endosome to cell membrane, (g) inhibits cholesterol degradation, and/or (h) inhibits cholesterol conversion to another molecule. In one embodiment, the agent decreases esterification of free cholesterol in a cell. In one embodiment, the agent is an ACAT1 inhibitor. In one embodiment, the agent is a proprotein convertase subtilisin/kexin type 9 (PCSK-9) inhibitor.

As used herein, the term “ACAT1 inhibitor” may refer to any agent that inhibits activity or expression of ACAT1. In an embodiment, ACAT1 inhibitor may demonstrate in vitro or in vivo binding affinity for ACAT1 such that the normal activity of the ACAT1 enzyme is reduced or eliminated. In one embodiment, an ACAT1 inhibitor disclosed herein can inhibit ACAT1 selectively. In one embodiment, an ACAT1 inhibitor can inhibit both isoforms of the ACAT enzyme, ACAT1 and ACAT2. In one embodiment, an ACAT1 inhibitor disclosed herein can have affinity for other targets (enzymes or receptors) besides ACAT1. In one embodiment, ACAT1 inhibitors disclosed herein may inhibit enzymatic activity of ACAT1 by at least 10％, at least 30％, at least 50％, at least 70％, or at least 90％. In one embodiment, ACAT1 inhibitors disclosed herein may inhibit gene expression or translation of ACAT1. In one embodiment, the ACAT1 inhibitor is selected from a group consisting of a small inhibitory RNA (siRNA) , a small hairpin RNA (shRNA) , a microRNA (miRNA) , or an anti-sense nucleic acid, (B) an ACAT1 inhibitory antibody or fragment thereof, (C) a small molecule inhibitor, and combinations thereof.

Regulation of the expression or activity of a gene can be done with methods and agents known in the art. To decrease the expression or activity of a gene, such as with a small inhibitory RNA (siRNA) , a small hairpin RNA (shRNA) , a microRNA (miRNA) , an anti-sense nucleic acid, an inhibitory antibody or fragment thereof, or a small molecule inhibitor. To increase the expression or activity of a gene, one can introduce a copy of the gene in a construct into a cell, without limitation.

Non-limiting examples of ACAT1 inhibitors avasimibe (CI-1011) , pactimibe, purpactins, manassantin A, diphenylpyridazine derivatives, glisoprenin A, CP113, 818, K604, beauveriolide I, beauveriolide III, U18666A, TMP-153, YM750, GERI-BP002-A, Sandoz Sah 58-035, VULM 1457, Lovastatin, CI976, CL-283, 546, CI-999, E5324, YM17E, FR182980, ATR-101 (PD132301 or PD132301-2) , F-1394, HL-004, F-12511 (eflucimibe) , cinnamic acid derivatives, cinnamic derivative, Dup 128, RP-73163, pyripyropene C, FO-1289, AS-183, SPC-15549, FO-6979, Angekica, ginseng, Decursin, terpendole C, beauvericin, spylidone, pentacecilides, CL-283, 546, betulinic acid, shikonin derivatives, esculeogenin A, Wu-V-23, pyripyropene derivatives A, B, and D, glisoprenin B-D, saucerneol B, sespendole, diethyl pyrocarbonate, beauveriolide analogues, Acaterin, DL-melinamide, PD 138142-15, CL277, 082, EAB-309, Enniatin antibiotics, Epi-cochlioquinone A, FCE-27677, FR186485, FR190809, NTE-122, obovatol, panaxadiols, protopanaxadiols, polyacetylenes, SaH 57-118, AS-186, BW-447A, 447C88, T-2591, TEI-6522, TEI-6620, XP 767, XR 920, GERI-BP001, gomisin N, gypsetin, helminthosporol, TS-962, isochromophilones, kudingosides, lateritin, naringenin, and combinations thereof. In one example, the ACAT1 inhibitor is avasimibe. In one example, the ACAT1 inhibitor is K604. In one example, the ACAT1 inhibitor is CP113, 818.

For example, the ACAT1 inhibitor can be avasimibe:

or a pharmaceutically acceptable salt, solvate, prodrug, stereoisomer, mixture of stereoisomers or hydrate thereof.

In addition to the chemical structure, avasimibe may also be referred to or identified as [2, 6-di (propan-2-yl) phenyl] N- [2- [2, 4, 6-tri (propan-2-yl) phenyl] acetyl] sulfamate, or CI-1011. Avasimibe is an ACAT inhibitor that was tested in clinical trials for treating atherosclerosis and showed good human safety profile. This compound was discontinued in Phase III clinical trials for treatment of atherosclerosis. Avasimibe has been shown to be well tolerated by adult human subjects at doses at least up to 750 mg four times daily (i.e., 3000 mg/day) . See Kharbanda et al (2005) Circulation 111 : 804-807.

In one embodiment, the ACAT1 inhibitor can be K604:

In addition to the chemical structure, K604 may also be referred to or identified as 2- [4- [2- (benzimidazol-2-ylthio) ethyl] piperazin-1yl] -N- [2, 4-bis (methylthio) -6-methyl-3-pyridyl] acetamide.

In one embodiment, the ACAT1 inhibitor can be CP-113, 818:

In addition to the chemical structure, CP-113, 818 may also be referred to or identified as 2- (hexylthio) -N- (6- (methyl-2, 4-bis (methylthio) -3-pyridinyl) -, (S) -N- (2, 4-Bis (methylthio) -6-methylpyridin-3-yl) -2- (hexylthio) decanoic acid amide, or decanamide.

In one embodiment, the ACAT1 inhibitor can be CI 976:

In addition to the chemical structure, CI 976 may also be referred to or identified as 2, 2-dimethyl-n- (2, 4, 6-trimethoxyphenyl) -dodecanamid, CI 976, PD 128042, or N- (2, 4, 6-Trimethoxyphenyl) -2, 2-dimethyldodecanamide.

In one embodiment, the ACAT1 inhibitor can be TMP-153:

In addition to the chemical structure, TMP-153 may also be referred to or identified as N- [4- (2-chlorophenyl) -6, 7-dimethyl-3-quinolinyl] -N'- (2, 4-difluorophenyl) -urea.

In one embodiment, the ACAT1 inhibitor can be YM 750:

In addition to the chemical structure, YM 750 may also be referred to or identified as N-Cycloheptyl-N- (9H-fluoren-2-ylmethyl) -N'- (2, 4, 6-trimethylphenyl) urea.

In one embodiment, the ACAT1 inhibitor can be GERI-BP002-A:

In addition to the chemical structure, GERI-BP002-Amay also be referred to or identified as 2, 2'-methylenebis (6-tert-butyl-4-methylphenol) .

In one embodiment, the ACAT1 inhibitor can be Sandoz 58-035:

In addition to the chemical structure, Sandoz 58-035 may also be referred to or identified as 3- [decyldimethylsilyl] -n- [2- (4-methylphenyl) -1-phenethyl] propanamide or SA 58-035.

In one embodiment, the ACAT1 inhibitor can be VULM 1457:

In addition to the chemical structure, VUML 1457 may also be referred to or identified as n- [2, 6-bis (1-methylethyl) phenyl] -n'- [4- [ (4-nitrophenyl) thio] phenyl] urea.

In one embodiment, the ACAT1 inhibitor can be ATR-101:

In addition to the chemical structure, ATR-101 may also be referred to or identified as N- (2, 6-bis (isopropyl) phenyl) -N'- ( (1- (4- (dimethylaminomethyl) phenyl) cyclopentyl) methyl) urea.

In one embodiment, the ACAT1 inhibitor can be beauveriolide I:

In addition to the chemical structure, beauveriolide I may also be referred to or identified as (3R, 6S, 9S, 13S) -9-benzyl-13- [ (2S) -hexan-2-yl] -6-methyl-3- (2-methylpropyl) -1-oxa-4, 7, 10-triazacyclotridecane-2, 5, 8, 11-tetrone.

In one embodiment, the ACAT1 inhibitor can be beauveriolide III:

In addition to the chemical structure, beauveriolide III may also be referred to or identified as (3R, 6S, 9S, 13S) -9-benzyl-3- [ (2S) -butan-2-yl] -13- [ (2S) -hexan-2-yl] -6-methyl-1-oxa-4, 7, 10-triazacyclotridecane-2, 5, 8, 11-tetrone.

In one embodiment, the ACAT1 inhibitor can be pactimibe:

In addition to the chemical structure, pactimibe may also be referred to or identified as 2- [7- (2, 2-dimethylpropanoylamino) -4, 6-dimethyl-1-octyl-2, 3-dihydroindol-5-yl] acetic acid.

In one embodiment, the ACAT1 inhibitor can be eflucimibe:

In addition to the chemical structure, eflucimibe may also be referred to or identified as (2S) -2-dodecylsulfanyl-N- (4-hydroxy-2, 3, 5-trimethylphenyl) -2-phenylacetamide, F 12511, or F-12511.

In vivo Use

The present technology, in some embodiment, relates to a method of activating a T cell by contacting the cell with an agent that increases the plasma membrane cholesterol level of the cell. In some embodiments, the contacting is in vivo, such as in a patient in need of a therapy. The patient may be one with an infection such as viral infection, or a cancer patient.

Infection is the invasion of an organism’s body tissues by disease-causing agents, their multiplication, and the reaction of host tissues to these organisms and the toxins they produce. An infection can be caused by infectious agents such as viruses, viroids, prions, bacteria, nematodes such as parasitic roundworms and pinworms, arthropods such as ticks, mites, fleas, and lice, fungi such as ringworm, and other macroparasites such as tapeworms and other helminths. In one aspect, the infectious agent is a bacterium, such as Gram negative bacterium. In one aspect, the infectious agent is virus, such as DNA viruses, RNA viruses, and reverse transcribing viruses. Non-limiting examples of viruses include Adenovirus, Coxsackievirus, Epstein–Barr virus, Hepatitis A virus, Hepatitis B virus, Hepatitis C virus, Herpes simplex virus, type 1, Herpes simplex virus, type 2, Cytomegalovirus, Human herpesvirus, type 8, HIV, Influenza virus, Measles virus, Mumps virus, Human papillomavirus, Parainfluenza virus, Poliovirus, Rabies virus, Respiratory syncytial virus, Rubella virus, Varicella-zoster virus.

In one embodiment, the patient is a cancer patient. The cancer can be carcinoma, sarcoma, melanoma, lymphoma or leukemia. In some variations, the cancer is cancers of the rhinal, nasal sinuses, nasopharynx, tongue, mouth, pharynx, throat, sialisterium, and oral cavity, esophageal cancer, stomach cancer, cardia cancer, mediastinum cancer, gastrointestinal stromal tumor, cancer of the small intestine, anal cancer, cancer of the anal canal, anorectal cancer, liver cancer, intrahepatic bile duct cancer, gallbladder cancer, biliary cancer, pancreatic cancer, cancer of other digestive organs, cancer of the larynx, osteosarcoma, bone and joint cancer, rhabdomyosarcoma, synovial sarcoma, Ewing’s sarcoma, fibrous histiocytoma, uterine cancer, cervical cancer, uterine corpus cancer, cancer of the vulva, vaginal cancer, endometrial cancer, ovarian cancer, testicular cancer, penile cancer, prostate cancer, urinary bladder cancer, kidney cancer, renal cancer, cancer of the ureter and other urinary organs, ocular cancer, brain and nervous system cancer, (central nervous system) CNS cancers, thyroid cancer, leukemia, myeloma, melanoma, soft tissue sarcoma, or lymphoma. In one embodiment, the cancer is melanoma or lung cancer.

In some embodiments, the cancer is selected from the group consisting of melanoma, lymphoma, esophageal cancer, liver cancer, head and neck cancer, bladder cancer, endometrial cancer, kidney cancer, thyroid cancer, breast cancer, colorectal cancer, leukemia, lung cancer, pancreatic cancer, and prostate cancer.

In some embodiments, the cancer is selected from the group consisting of melanoma, lymphoma, esophageal cancer, liver cancer, head and neck cancer, bladder cancer, endometrial cancer, kidney cancer and thyroid cancer.

In some embodiments, the cancer is melanoma. In some embodiments, the melanoma is selected from the group consisting of Lentigo maligna, Lentigo maligna melanoma, superficial spreading melanoma, acral lentiginous melanoma, mucosal melanoma, nodular melanoma, polypoid melanoma, desmoplastic melanoma, amelanotic melanoma, and soft-tissue melanoma.

In some embodiments, the ACAT1 inhibitor is not cytotoxic against the cancer cells directly. Rather, the ACAT1 can activate a CD8+ T cell which exhibits antitumor activity. The responsiveness of the cancer to the ACAT1 inhibitor can be tested with methods known in the art, such as in vitro cytotoxicity assays, in the absence of immune cells, such as CD8+ cell. Examples of such cancers include, without limitation, some or all of melanoma, lymphoma, esophageal cancer, liver cancer, head and neck cancer, bladder cancer, endometrial cancer, kidney cancer and thyroid cancer.

In some embodiments, the cancer patient that has a suppressed CD8+ T cell in a tumor microenvironment. As used herein, the term “CD8⁺ T cells” refer to CD8 positive cells. CD8⁺ T cells express CD8 on the cells’s urface, and are also referred to as cytotoxic T cells. As used herein, the term “cytotoxic T lymphocyte” or “CTL” may refer to cytotoxic T cells that express T-cell receptors (TCRs) that can recognize a specific antigen capable of stimulating an immune response. Such antigen may be produced by cancer cells or viruses.

The term “suppressed CD8+ T cell” refers to a CD8+ T cell in a subject or a tissue (a tumor tissue) in a subject that has reduced immune response as compared to a control subject (e.g., a healthy individual) or a control tissue (e.g., a normal tissue) .

As used herein, the term “immune response” includes T cell mediated and/or B cell mediated immune responses. Exemplary immune responses include T cell responses, e.g., cytokine production and cellular cytotoxicity. In addition, the term immune response includes immune responses that are indirectly effected by T cell activation, e.g., antibody production (humoral responses) and activation of cytokine responsive cells, e.g., macrophages.

In some embodiments, the suppressed CD8+ T cell has reduced cytotoxic activity, reduced proliferative activity or reduced infiltration activity as compared to a CD8+ T cell not in the tumor microenvironment.

The treatment can be suitable for cancer of different stages. In some embodiments, the cancer patient has a stage I, II, III, or IV cancer. In one embodiment, the cancer patient has a stage I cancer. Stage 1 usually means that a cancer is relatively small and contained within the organ it started in. Stage 2 usually means the cancer has not started to spread into surrounding tissue but the tumor is larger than in stage 1. Sometimes stage 2 means that cancer cells have spread into lymph nodes close to the tumor. This depends on the particular type of cancer. Stage 3 usually means the cancer is larger. It may have started to spread into surrounding tissues and there are cancer cells in the lymph nodes in the area. Stage 4 means the cancer has spread from where it started to another body organ. This is also called secondary or metastatic cancer.

In some embodiments, the patient does not have a tumor tissue having a diameter of at least 2 cm, or alternatively 1.9 cm, 1.8 cm, 1.7 cm, 1.6 cm, 1.5 cm, 1.4 cm, 1.3 cm, 1.2 cm, 1.1 cm, 1 cm, 0.9 cm, 0.8 cm, 0.7 cm, 0.6 cm, 0.5 cm, 0.4 cm, 0.3 cm, 0.2 cm or 0.1 cm.

In some embodiments, the cancer patient does not have a tumor tissue with activated angiogenesis. Cancer cells are cells that have lost their ability to divide in a controlled fashion. A malignant tumor consists of a population of rapidly dividing and growing cancer cells that progressively accrues mutations. However, tumors need a dedicated blood supply to provide the oxygen and other essential nutrients they require in order to grow beyond a certain size (generally 1–2 mm³) .

In one embodiment, provided herein is a method for treating a human who exhibits one or more symptoms associated with cancer. In one embodiment, the human is at an early stage of cancer. In other embodiments, the human is at an advanced stage of cancer.

In one embodiment, provided herein is a method for treating a human who is undergoing one or more standard therapies for treating cancer, such as chemotherapy, radiotherapy, immunotherapy, and/or surgery. Thus, in some foregoing embodiments, the ACAT1 inhibitor, as disclosed herein, may be administered before, during, or after administration of chemotherapy, radiotherapy, immunotherapy, and/or surgery.

In another aspect, provided herein is a method for treating a human who is “refractory” to a cancer treatment or who is in “relapse” after treatment for cancer. A subject “refractory” to an anti-cancer therapy means they do not respond to the particular treatment, also referred to as resistant. The cancer may be resistant to treatment from the beginning of treatment, or may become resistant during the course of treatment, for example after the treatment has shown some effect on the cancer, but not enough to be considered a remission or partial remission. A subject in “relapse” means that the cancer has returned or the signs and symptoms of cancer have returned after a period of improvement, e.g., after a treatment has shown effective reduction in the cancer, such as after a subject is in remission or partial remission.

In some variations, the human is (i) refractory to at least one anti-cancer therapy, or (ii) in relapse after treatment with at least one anti-cancer therapy, or both (i) and (ii) . In one embodiment, the human is refractory to at least two, at least three, or at least four anti-cancer therapies (including, for example, standard or experimental chemotherapies) .

In another aspect, provided is a method for sensitizing a human who is (i) refractory to at least one chemotherapy treatment, or (ii) in relapse after treatment with chemotherapy, or both (i) and (ii) , wherein the method comprises administering an ACAT1 inhibitor, with or without an antitumor agent, as disclosed herein, to the human in need thereof. A human who is sensitized is a human who is responsive to the treatment involving administration of an ACAT1 inhibitor with or without an antitumor agent, as disclosed herein, or who has not developed resistance to such treatment.

In another aspect, provided herein is a methods for treating a human for a cancer, with comorbidity, wherein the treatment is also effective in treating the comorbidity. A “comorbidity” to cancer is a disease that occurs at the same time as the cancer.

In vitro Use

The present technology can also be used in vitro, where the contacting of the T cell with the agent that increases the plasma membrane cholesterol level of the cell takes place in an in vitro environment. Once the T cell is activated, however, the activated T cell can be introduced a patient in need thereof. In this aspect, any of the in vivo uses described above is applicable here. For instance, the patient may be one suffering from an infection or cancer.

The T cell being treated in vitro may be taken from the patient itself or from a donor. In one embodiment, the T cell is isolated from the patient, incubated with an agent that increases the plasma membrane cholesterol level, and then reintroduced to the patient. In some aspects, prior to the reintroduction, the T cell is activated. In some aspects, so long as the T cell is in contact with the agent, or preferably the agent is attached to the cell or has been taken up by the cell, the cell is ready for the reintroduction.

Isolation of a T cell, such as a CD8+ T cell, from a subject can be done with methods known in the art. The amount needed can also be determined depending on the disease, the status of the T cells, and the incubation conditions.

Screening for Agents Capable of Activating T Cells

The present discovery also provides an effective and convenient means to screen for agents that can be used to activate T cells, such as CD8+ T cells. In one embodiment, a candidate agent can be placed in contact with a CD8+ cell under conditions to allow the agent to interact with the cell. At an appropriate time, the cell is examined for its plasma membrane cholesterol level. An increase of plasma membrane cholesterol level indicates that the candidate agent has cancer immunotherapeutic activity.

In some embodiments, before testing the candidate agent with the CD8+ cells, the agent can be pre-screened with a cell that expresses ACAT1 (such as recombinant CHO cells engineered to express ACAT-1) , which can be in vitro. The screening can be done with an enzymatic assay or via measuring certain characteristic of the cell, such as by measuring the production of chelsteryl [¹⁴C] oleast. See, Ikenoya et al., “Aselective ACAT-1 inhibitor, K-604, suppresses fatty streak lesions in fat-fed hamsters without affecting plasma cholesterol levels, ” Atherosclerosis 191: 290-7, 2007. Accordingly, in one embodiment, the method comprises (a) contacting a candidate agent with a cell expressing acyl-coenzyme A: cholesterol acyltransferases 1 (ACAT1) ； (b) detecting an ACAT1 inhibitory activity of the candidate agent； (c) contacting the candidate agent, if exhibiting the inhibitory activity, with a CD8+ T cell； and (d) measuring the plasma membrane cholesterol level of the cell, wherein an increase of plasma membrane cholesterol level indicates that the candidate agent has cancer immunotherapeutic activity.

Alternatively, the cell can be examined for killing effect, cell proliferation, survival, cytokine or granule production, activity of acyl-coenzyme A: cholesterol acyltransferases 1 (ACAT1) , or TCR clustering, and optionally effector function, cell proliferation, survival, IFNγ production, cytokine or granule production. Any increase of them indicates the efficiency of the agent in activating/increasing the activity of the cell. Methods of checking effector function, cell proliferation, survival, IFNγ production, cytokine or granule production, expression or activity of ACAT1, and TCR clustering have been exemplified in the experimental examples.

In another embodiment, no cells are needed. Instead, the candidate agent can be placed in contact with a ACAT1 protein and tested for its ability to inhibit the enzymatic activity of ACAT1. An agent that inhibits the enzymatic activity of ACAT1 is a useful agent to increase the plasma membrane cholesterol level on a T cell and thus is useful for treating the diseases as discussed herein.

Pharmaceutical Compositions and Modes of Administration

Any effective regimen for administering the pharmaceutical compositions and/or co-formulations can be used. For example, the pharmaceutical compositions and/or co-formulations may be administered in either single or multiple doses by any of the accepted modes of administration of agents having similar utilities, including rectal, buccal, intranasal and transdermal routes, by intra-arterial injection, intravenously, intraperitoneally, parenterally, intramuscularly, subcutaneously, orally, topically, as an inhalant, or via an impregnated or coated device such as a stent, for example, or an artery-inserted cylindrical polymer. The route of administration may also depend on the type of cancer. For example, for cancers such as lymphoma or leukemia, the administration may be systemic, whereas a localized delivery may be used for treating a tumor. Further, a staggered regimen, for example, one to five days per week can be used as an alternative to daily treatment.

For preparing solid compositions such as tablets, the principal active ingredient may be mixed with a pharmaceutical carrier or excipient to form a solid preformulation composition containing a homogeneous mixture of an agent. When referring to these preformulation compositions as homogeneous, the active ingredient may be dispersed evenly throughout the composition so that the composition may be readily subdivided into equally effective unit dosage forms such as tablets, pills and capsules. In one embodiment, the tablets or pills disclosed herein may be coated or otherwise compounded to provide a dosage form affording the advantage of prolonged action, or to protect from the acid conditions of the stomach. For example, the tablet or pill can comprise an inner dosage and an outer dosage component, the latter being in the form of an envelope over the former. The two components can be separated by an enteric layer that serves to resist disintegration in the stomach and permit the inner component to pass intact into the duodenum or to be delayed in release. A variety of materials can be used for such enteric layers or coatings, such materials including a number of polymeric acids and mixtures of polymeric acids with such materials as shellac, cetyl alcohol, and cellulose acetate.

Some examples of suitable carriers or excipients include lactose, dextrose, sucrose, sorbitol, mannitol, starches, gum acacia, calcium phosphate, alginates, tragacanth, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, sterile water, syrup, and methyl cellulose. The formulations can additionally include: lubricating agents such as talc, magnesium stearate, and mineral oil； wetting agents； emulsifying and suspending agents； preserving agents such as methyl and propylhydroxy-benzoates； sweetening agents； and flavoring agents.

The compositions can be formulated so as to provide quick, sustained or delayed release of the active ingredient after administration to the subject by employing procedures known in the art. Controlled release drug delivery systems for oral administration include osmotic pump systems and dissolutional systems containing polymer-coated reservoirs or drug-polymer matrix formulations. Another formulation for use in the methods disclosed herein employs transdermal delivery devices ( “patches” ) . Such transdermal patches may be used to provide continuous or discontinuous infusion of the compounds and compositions disclosed herein in controlled amounts. The construction and use of transdermal patches for the delivery of pharmaceutical agents is well known in the art. Such patches may be constructed for continuous, pulsatile, or on demand delivery of pharmaceutical agents.

In one embodiment, the compositions provided are formulated as a solution for delivery into a patient for treating cancer. Diluent or carriers employed in the compositions can be selected so that they do not diminish the desired effects of the ACAT1 inhibitor and/or antitumor agents. Examples of suitable compositions include aqueous solutions, for example, a solution in isotonic saline, 5％glucose. Other well-known pharmaceutically acceptable liquid carriers such as alcohols, glycols, esters and amides, may be employed. In one embodiment, the composition further comprises one or more excipients, such as, but not limited to ionic strength modifying agents, solubility enhancing agents, sugars such as mannitol or sorbitol, pH buffering agent, surfactants, stabilizing polymer, preservatives, and/or co-solvents.

In one embodiment, the compositions disclosed herein can be combined with minerals, amino acids, sugars, peptides, proteins, vitamins (such as ascorbic acid) , or laminin, collagen, fibronectin, hyaluronic acid, fibrin, elastin, or aggrecan, or growth factors such as epidermal growth factor, platelet-derived growth factor, transforming growth factor beta, or fibroblast growth factor, and glucocorticoids such as dexamethasone or viscoelastic altering agents, such as ionic and non-ionic water soluble polymers； acrylic acid polymers； hydrophilic polymers such as polyethylene oxides, polyoxyethylene-polyoxypropylene copolymers, and polyvinylalcohol； cellulosic polymers and cellulosic polymer derivatives such as hydroxypropyl cellulose, hydroxyethyl cellulose, hydroxypropyl methylcellulose, hydroxypropyl methylcellulose phthalate, methyl cellulose, carboxymethyl cellulose, and etherified cellulose； poly (lactic acid) , poly (glycolic acid) , copolymers of lactic and glycolic acids, or other polymeric agents both natural and synthetic.

Dosing

The dosing regimen of an agent (e.g., avasimibe) in the methods provided herein may vary depending upon the indication, route of administration, and severity of the condition. For instance, depending on the route of administration, a suitable dose can be calculated according to body weight, body surface area, or organ size. The final dosing regimen is determined by the attending physician in view of good medical practice, considering various factors that modify the action of drugs, e.g., the specific activity of the agent/compound, the identity and severity of the disease state, the responsiveness of the subject, the age, condition, body weight, sex, and diet of the subject, and the severity of any infection. Additional factors that can be taken into account include time and frequency of administration, drug combinations, reaction sensitivities, and tolerance/response to therapy. Further refinement of the doses appropriate for treatment involving any of the formulations mentioned herein is done routinely by the skilled practitioner without undue experimentation, especially in light of the dosing information and assays disclosed, as well as the pharmacokinetic data observed in human clinical trials. Appropriate doses can be ascertained through use of established assays for determining concentration of the agent in a body fluid or other sample together with dose response data.

As indicated above, the dose and frequency of dosing may depend on pharmacokinetic and pharmacodynamic, as well as toxicity and therapeutic efficiency data. For example, pharmacokinetic and pharmacodynamic information about the agents can be collected through preclinical in vitro and in vivo studies, later confirmed in humans during the course of clinical trials. Thus, for the agents disclosed herein, a therapeutically effective dose can be estimated initially from biochemical and/or cell-based assays. The dosage can then be formulated in animal models to achieve a desirable circulating concentration range. As human studies are conducted, further information will emerge regarding the appropriate dosage levels and duration of treatment for various diseases and conditions.

Toxicity and therapeutic efficacy of an agent, can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD₅₀ (the dose lethal to 50％of the population) and the ED₅₀ (the dose therapeutically effective in 50％of the population) . The dose ratio between toxic and therapeutic effects is the “therapeutic index” , which typically is expressed as the ratio LD₅₀/ED₅₀. Compounds and compositions that exhibit large therapeutic indices, i.e., the toxic dose is substantially higher than the effective dose, are preferred. The data obtained from such cell culture assays and additional animal studies can be used in formulating a range of dosage for human use. The doses of such compounds and compositions lies preferably within a range of circulating concentrations that include the ED₅₀ with little or no toxicity.

Moreover, administration or treatment with the compositions disclosed herein may be continued for a number of days； for example, treatment may continue for at least 7 days, 14 days, or 28 days, for one cycle of treatment. Treatment cycles are well known, and are frequently alternated with resting periods of about 1 to 28 days, commonly about 7 days or about 14 days, between cycles. The treatment cycles, in other embodiments, may also be continuous.

It will be understood, however, that the amount of the compound and compositions actually administered usually will be determined by a physician, in the light of the relevant circumstances, including the condition to be treated, the chosen route of administration, the actual compound/composition administered and its relative activity, the age, weight, and response of the individual subject, and the severity of the subject’s symptoms.

Example 1. Methods for Testing ACAT1 inhibitor Monotherapy and Combined Therapy

This example provides materials and methods for evaluating the activity of an ACAT1 inhibitor (e.g., avasimibe) and the combination of ACAT1 inhibitor and an antitumor agent (e.g., anti-PD-1 inhibitor or dacarbazine) as shown in Examples 2-5.

Reagents and mice

DMEM and FBS was from Life Technologies. Filipin, Lovastatin, MβCD-cholesterol, and MβCD were from Sigma. Amplex Red cholesterol assay kit was from Invitrogen. IL-2 was from Promega. For the flow cytometric analysis, α-mCD4 (RM4-5) , α-mCD8 (53-6.7) , α-mCD3ε (145-2C11) , α-IFN-γ (XMG1.2) , α-TNF-α (MP6-XT22) , α-Granzyme B (NGZB) , α-CD44 (IM7) , α-CD69 (H1.2F3) PD-1 (J43) , CTLA-4 (UC10-4B9) , Ki67 (16A8) , Foxp3 (FJK-16s) , Gr1 (RB6-8C5) , CD11b (M1/70) and CD45 (30-F11) were purchased from eBioscience. For western blots, α-pCD3ζ, α-CD3ζ, α-pZAP70, α-ZAP70, α-pLAT, α-LAT, α-pErk1/2, α-Erk1/2 were purchased from Cell Signaling Technology. Avasimibe was from Selleck. U18666A was from Merck. K604 was chemically synthesized in Fa-Jun Nan’s laboratory, Shanghai Institute of Materia Medica, Chinese Academy of Sciences. CP113, 818 was a research gift from Pierre Fabre. MTS (3- (4, 5-dimethylthiazol-2-yl) -5- (3-carboxymethoxyphenyl) -2- (4-sulfophenyl) -2H-tetrazolium) was from Promega. B16F10, Lewis lung carcinoma (LLC) and EL-4 cell lines were originally obtained from the American Type Culture Collection, and proved mycoplasma-free. Listeria monocytogenes was generously provided by Dr. Qibing Leng, Institute Pasteur of Shanghai, Chinese Academy of Sciences.

C57BL/6 mice were purchased from SLAC (Shanghai, China) . OT-I TCR transgenic mice were from the Jackson Laboratory. CD4^Cre transgenic mice was obtained. InGeneious Labs (Stony Brook, NY, USA) produced homozygous Acat1^flox/flox mouse. To produce this mouse, the Acat1LoxP construct was made by inserting two LoxP sites covering Acat1 exon 14, which includes His460 known to be essential for the enzymatic activity. The construct was injected into ES cells. The correctly-targeted clones as determined by Southern blot and diagnostic PCR were injected into C57BL/6 blastocysts. In order to remove Neo marker, the mice were further backcrossed to the C57BL/6 Frt mice. Through mouse crossing, the WT Acat1 allele (Acat1^+/+) , heterozygous Acat1 LoxP allele (Acat1^flox/+) and homozygous Acat1 LoxP allele (Acat1^flox/flox) were obtained and confirmed by using diagnostic PCR. Acat1^flox/flox mice were crossed with CD4^cre transgenic mice to get Acat1^CKO mice with ACAT1 deficiency in T cells. Acat1^CKO mice were further crossed with OT-I TCR transgenic mice to get Acat1^CKO-OT-I mice. Animal experiments using Acat1^CKO mice were controlled by their littermates with normal ACAT1 expression (Acat1^flox/flox) . Animal experiments using Acat1^CKO-OT-I mice were controlled by their littermate with normal ACAT1 and OT-I TCR expression (Acat1^flox/flox-OT-I) . Acat2^-/-mice were purchased from Jackson Laboratory. All mice were maintained in pathogen-free facilities at the Shanghai Laboratory Animal Center. All animal experiments used mice with matched age and sex. Animals were randomly allocated to experimental groups. The animal experiments performed with a blinded manner were described below. All animal experiments were approved by The Institutional Animal Use Committee of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. All human studies have been approved by the Research Ethical Committee from ChangZheng Hospital, Shanghai, China. Informed consent was obtained from all study subjects.

Quantitative reverse trancriptase-PCR

Total RNA was extracted with Trizol (Life techonology) from the indicated cells and subjected to qRT-PCR using gene specific primers (5’ -3’ ) : Acat1 (Forward,

GAAACCGGCTGTCAAAATCTGG； Reverse, TGTGACCATTTCTGTATGTGTCC) ；

Acat2 (Forward, ACAAGACAGACCTCTTCCCTC； Reverse,

ATGGTTCGGAAATGTTCACC) ； Nceh (Forward, TTGAATACAGGCTAGTCCCACA；

Reverse, CAACGTAGGTAAACTGTTGTCCC) ； Srebp1 (Forward,

GCAGCCACCATCTAGCCTG； Reverse, CAGCAGTGAGTCTGCCTTGAT) ； Srebp2

(Forward, GCAGCAACGGGACCATTCT； Reverse, CCCCATGACTAAGTCCTTCAACT) ；

Acaca (Forward, ATGGGCGGAATGGTCTCTTTC； Reverse,

TGGGGACCTTGTCTTCATCAT) ； Fasn (Forward, GGAGGTGGTGATAGCCGGTAT；

Reverse, TGGGTAATCCATAGAGCCCAG) ； Hmgcs (Forward,

AACTGGTGCAGAAATCTCTAGC； Reverse, GGTTGAATAGCTCAGAACTAGCC) ；

Hmgcr (Forward, AGCTTGCCCGAATTGTATGTG； Reverse,

TCTGTTGTGAACCATGTGACTTC) ； Sqle (Forward,

ATAAGAAATGCGGGGATGTCAC； Reverse, ATATCCGAGAAGGCAGCGAAC) ； Ldlr

(Forward, TGACTCAGACGAACAAGGCTG, Reverse, ATCTAGGCAATCTCGGTCTCC) ；

Idol (Forward, TGCAGGCGTCTAGGGATCAT； Reverse,

GTTTAAGGCGGTAAGGTGCCA) ； Abca1 (Forward, AAAACCGCAGACATCCTTCAG；

Reverse, CATACCGAAACTCGTTCACCC) ； Abcg1 (Forward,

CTTTCCTACTCTGTACCCGAGG； Reverse, CGGGGCATTCCATTGATAAGG) ； Ifng

(Forward, ATGAACGCTACACACTGCATC； Reverse, CCATCCTTTTGCCAGTTCCTC) .

Measurement of the cholesterol level of T cells

Three methods were used to measure the cholesterol level of T cells as shown below.

Filipin staining: Filipin III was dissolved in ethanol to reach the final concentration of 5 mg/ml. Cells were fixed with 4％PFA and stained with 50 μg/ml filipin III for 30 minutes at 4 ℃. Images were collected using a Leica SP8 confocal microscope and analyzed using a Leica LAS AF software.

PM cholesterol oxidation-based assay: The total cellular cholesterol was quantified using the Amplex Red cholesterol assay kit (Invitrogen) . To quantify the intracellular cholesterol, CD8⁺ T cells were fixed with 0.1％glutaraldehyde and then treated with 2 U/ml cholesterol oxidase for 15minutes to oxidise the plasma membrane cholesterol. The intracellular cholesterol was then extracted with methanol/chloroform (vol/vol, 1: 2) , and quantified using the Amplex Red cholesterol assay kit. The value of the plasma membrane cholesterol was obtained by subtracting the intracellular cholesterol from the total cellular cholesterol.

Biotinylation-based PM lipid purification and quantitation: The plasma membrane of CD8⁺ T cells was biotinylated by 1 mg/ml sulfo-NHS-S-Biotin, and then the cells were lysed by passing 13 times through a ball-bearing homogenizer. Plasma membrane was isolated from the supernatant of homogenate by streptavidin magnetic beads. Lipids were extracted with hexane/isopropanol (vol/vol, 3: 2) , and then were used for measurement of unesterified cholesterol with Amplex Red Cholesterol Assay Kit and choline-containing phospholipids with EnzyChrom Phospholipid Assay Kit. The relative cholesterol level was normalized by the total phospholipids.

Modulation of the plasma membrane cholesterol level by MβCD and MβCD-coated cholesterol

To deplete cholesterol from the plasma membrane, CD8⁺ T cells were treated with 0.1 -1 mM MβCD for 5 minutes at 37 ℃, and then washed three times with PBS. To add cholesterol to the plasma membrane, CD8⁺ T cells were incubated with the culture medium supplied with 1-20 μg/ml MβCD-coated cholesterol at 37 ℃ for 15 minutes. The cells were then washed three times with PBS.

T cell isolation and effector function analysis

Peripheral T cells were isolated from mouse spleen and draining lymph nodes by a CD8⁺ or CD4⁺ T cell negative selection kit (Stem cell) . To analyse the tumour-infiltrating T cells, tumours were first digested by collagenase IV (sigma) , and tumour-infiltrating leukocytes were isolated by 40-70％percoll (GE) gradient centrifugation. To measure the effector function of CD8⁺ T cells, the isolated cells were first stimulated with 1 μM ionomycin and 50 ng/ml PMA for 4 hours in the presence of 5 μg/ml BFA, and then stained with PERCP-α-CD8a. Next, cells were fixed with 4％PFA and stained with FITC-α-Granzyme B, APC-α-IFNγ and PE-α-TNFα. In general, to gate the cytokine or granule producing cells, T cells without stimulation or stained with isotype control antibody were used as negative controls. This gating strategy is applicable for most of the flow cytometric analyses. To detect the MDSCs (myeloid-derived suppressor cells) in the tumour, the percoll isolated leukocyte were stained with α-CD45, α-CD11b and α-Ly6G (Gr1) , the CD45⁺ population was gated, after which the MDSC population (CD11b⁺ Gr1⁺) in CD45⁺ were gated.

Antigen Stimulation of CD8⁺ T cells

A pan T cell isolation kit (Miltenyi biotech) was used to deplete T cells from splenocytes isolated from C57BL/6 mice. The T cell-depleted splenocytes were pulsed with antigenic peptides for 2 hours and washed three times. SIINFEKL (OVA_257-264 or N4) , SAINFEKL (A2) , SIITFEKL (T4) , SIIGFEKL (G4) are four types of agonist antigens with strong to weak TCR affinities. RTYTYEKL (Catnb) is a self-antigen of OT-I TCR. SIIRFEKL (R4) supports the positive selection of OT-I T cells and thus mimics a self-antigen. The T cell-depleted and antigen-pulsed splenocytes were co-incubated with Acat1^CKO-OT-I T cells or WT OT-I T cells for 24 hours. Cytokine production of CD8⁺ T cells was measured by intracellular staining and flow cytometric analysis.

Measurement of CD8⁺ T-cell cytotoxicity

To generate mature Cytotoxic T lymphocytes (CTLs) , splenocytes isolated from Acat1^CKO-OT-I mice or WT OT-I mice were stimulated with OVA_257-264 (N4) for 3 days in the presence of 10 ng/ml IL-2. Cells were centrifuged and cultured in fresh medium containing 10 ng/ml IL-2 for 2 more days, after which most of the cells in the culture were CTLs. To measure CD8⁺ T-cell cytotoxicity, EL-4 cells were pulsed with 2 nM antigenic peptide (N4, A2, T4, G4, R4 or Catnb) for 30minutes. After washing EL-4 cells and CTLs three times with PBS, we mixed CTLs and antigen-pulsed EL-4 cells (1 ×10⁵) in the killing medium (phenol free-RPMI 1640, 2％FBS) , at the ratio of 1: 1, 1: 2 and 1: 5, respectively. After 4 hours, the cytotoxic efficiency was measured by quantifying the release of endogenous lactate dehydrogenase (LDH) from EL-4 cells using a CytoTox 96 Non-Radioactive Cytotoxicity kit (Promega) .

Measurement of human CD8⁺ T-cell cytokine production

Human peripheral blood mononuclear cells (PBMCs) from healthy donators were stimulated with 5 μg/ml PHA (Sigma) for 2 days and then rested for 1 day. Cells were pretreated with vehicle (DMSO) , CP113, 818 or avasimibe for 12 hours and then stimulated with plate-bound α-CD3 (5 μg/ml) and α-CD28 (5 μg/ml) antibodies for 24 hours. Intracellular staining and flow cytometry were used to assess cytokines production of CD8⁺ T cells.

T cell metabolism

Oxygen consumption rates (OCR) and extracellular acidification rates (ECAR) were measured in nonbuffered DMEM (sigma) containing either 25 mM or 10 mM glucose, 2 mM L-glutamine, and 1 mM sodium pyruvate, under basal conditions and in response to 1 μM oligomycin (to block ATP synthesis) , 1.5 μM FCCP (to uncouple ATP synthesis from the electron transport chain, ETC) , 0.5 μM rotenone and antimycin A (to block complex I and III of the ETC, respectively) , and 200 μM etomoxir (to block mitochondrial FAO) on the XF-24 or XF-96 Extracellular Flux Analyzers (Seahorse Bioscience) according to the manufacturer’s recommendations.

Measurement of cell viability with MTS assay

B16F10 cells (5 × 10³) in 100 μl media containing avasimibe or DMSO were cultured for 24, 48 or 72hours. 20 μl of MTS reagent (CellTiter

AQueous One Solution Cell Proliferation Assay, Promega) was added into each well. After 2-3 hour incubation, the absorbance at 490nm was measured. The effect of avasimibe on cell viability was obtained by normalizing the absorbance of avasimibe-treated cells with that of the DMSO-treated cells. The viability value of DMSO-treated cells was set as 1.

Listeria monocytogenes infection

L. monocytogenes (2 -7 × 10⁴ CFU) expressing a truncated OVA protein were intravenously injected into Acat1^CKO and littermate WT mice at age of 8-10 weeks. On Day 6, T cells isolated from spleens were stimulated with 50 ng/ml PMA and 1 μM Ionomycin for 4 hours in the presence of Brefeldin A and then assessed by flow cytometry to detect IFNγ production. At the same time, the serum IFNγ level was assessed by ELISA. To detect the antigen specific response of CD8⁺ T cells, the splenocytes were stimulated with 1 μM OVA257-264 peptide for 24 hours. IFNγ production was analyzed as mentioned above. To detect the L. monocytogens titer in the livers of infected mice, the livers were homogenized in 10 ml 0.2％ (vol/vol) Nonidet P-40 in PBS, and the organ homogenates were diluted and plated on agar plates to determine the CFU of L. monocytogenes. Investigator was blinded to group allocation during the experiment and when assessing the outcome.

Melanoma mouse models

B16F10 cells were washed three times with PBS, filtered by a 40 μm strainer. In a skin melanoma model, B16F10 cells (2 × 10⁵) were subcutaneously injected into the dorsal part of mice (age of 8 -10 weeks) . From Day 10, tumour size was measured every 2 days, and animal survival rate was recorded every day. Tumour size was calculated as length ×width. Mice with tumour size larger than 20mm at the longest axis were euthanized for ethical consideration. To analyse effector function of tumour-infiltrating T cells, mice were euthanized on Day 16. In the avasimibe therapy, on Day 10 mice bearing tumour of similar size were randomly divided into two groups. From Day 10, avasimibe was injected intraperitoneally to the mice at the dose of 15 mg/kg every 2 days.

In a lung-metastatic melanoma model, B16F10 cells (2 × 10⁵) were intravenously injected into mice (age of 8 -10 weeks) . Animal survival rate was recorded every day. One Day 20, mice were euthanized and tumour number on lungs was counted. Next, lung-infiltrating T cells were isolated and analyzed as mentioned above. In the lung-metastatic melanoma model, investigator was blinded to group allocation during the experiment and when assessing the outcome.

T cell homing

B16F10-OVA cells (2 ×10⁵) were injected subcutaneously into C57BL/6 mice at the age of 8 -10 weeks. On day 16, the

WT or Acat1^CKO OT-I CD8⁺ T cells were isolated and labeled with live cell dye CFSE or CTDR (Cell Tracker Deep Red, Life technologies) , respectively. The labeled WT and CKO cells were mixed together at 1 : 1 ratio and 1 × 10⁷ mixed cells per mouse were injected intravenously into the B16F10-OVA bearing mice. After 12 hours, blood, spleens, inguinal lymph nodes (draining) and mesenteric lymph nodes (non-draining) of the mice were collected. Single cell suspensions from these tissues were stained with the α-CD8a antibody, and the ratio of transferred cells in CD8⁺ populations was analyzed using flow cytometry.

Lewis Lung Carcinoma (LLC) model

The LLC cells were washed twice with PBS and filtered by a 40 μm strainer. After which, the LLC cells (2 × 10⁶) were intravenously injected into WT or Acat1^CKO mice at the age of 8 –10 weeks. To detect the tumour multiplicity in the lung, the mice were euthanized at Day 35 post tumour inoculation and tumour numbers in the lung were counted. In the avasimibe therapy, on Day 10 mice were randomly divided into two groups. From Day 10 to Day 35 post tumour inoculation, avasimibe was injected intraperitoneally to the mice at the dose of 15 mg/kg every 3 days.

Treatment of melanoma by adoptive T cell transfer

B16F10-OVA cells (2 ×10⁵) were injected subcutaneously into C57BL/6 mice at the age of 8 -10 weeks. On Day 10, melanoma-bearing mice with similar tumour size were randomly divided into three groups (n ＝ 9 -10) and respectively received PBS, WT OT-I CTLs (1.5 ×10⁶) or Acat1^CKO OT-I CTLs (1.5 ×10⁶) by intravenous injection. From Day 13, the tumour size was measured every 2 days, and the animal survival rate was recorded every day. Tumour size was calculated as length × width. Mice with tumour size larger than 20mm at the longest axis were euthanized for ethical consideration.

Treatment of melanoma with avasimibe, α-PD-1 antibody or avasimibe + α-PD-1 antibody

B16F10 cells (2×10⁵) were injected subcutaneously into C57BL/6 mice at age of 8-12 weeks. On Day 10, melanoma-bearing mice with similar tumour size were randomly divided into four groups (n ＝ 8 -10) and received PBS, avasimibe, α-PD-1 antibody or avasimibe + α-PD-1 antibody respectively. Avasimibe was delivered every 2 days at the dose of 15mg/kg by intragastric administration. α-PD-1 antibody (RMP1-14, Bio X Cell, 200 μg/injection) was injected intraperitoneally every 3 days. The tumour size and survival were measured as mentioned above.

Treatment of melanoma with avasimibe, dacarbazine, or avasimibe + dacarbazine

B16F10 cells (2×10⁵) were injected subcutaneously into C57BL/6 mice at age of 8-12 weeks. On Day 10, melanoma-bearing mice with similar tumour size were randomly divided into four groups (n ＝ 9 -13) and received PBS, avasimibe, dacarbazine, or avasimibe + dacarbazine respectively. Avasimibe was delivered every 2 days at the dose of 15mg/kg by intragastric administration. Dacarbazine was injected intraperitoneally at the dose of 5mg/kg. The tumour size and survival were measured as mentioned above.

Super-resolution Stochastic Optical Reconstruction Microscopy (STORM) imaging and data analysis

Super-resolution STORM imaging was performed on a custom modified Nikon N-STORM microscope equipped with a motorized inverted microscope ECLIPSE Ti-E, an Apochromat TIRF 100 × oil immersion lens with a numerical aperture of 1.49 (Nikon) , an electron multiplying charge-coupled device (EMCCD) camera (iXon3 DU-897E, Andor Technology) , a quad band filter composed of a quad line beam splitter (zt405/488/561/640rpc TIRF, Chroma Technology Corporation) and a quad line emission filter (brightline HC 446, 523, 600, 677, Semrock, Inc. ) .

The TIRF angle was adjusted to oblique incidence excitation at the value of 3950 -4000, allowing the capture of images at about 1 μm depth of samples. The focus was kept stable during acquisition using Nikon focus system. For the excitation of Alexa647, the 647 nm continuous wave visible fiber laser was used, and the 405 nm diode laser (CUBE 405-100C, Coherent Inc. ) was used for switching back the fluorophores from dark to the fluorescent state. The integration time of the EMCCD camera was 90 -95 frames per second. To image TCR distribution in the plasma membrane,

CD8⁺ T cells or activated CD8⁺ T cells (stimulated with 10 μg/ml α-CD3 for 10 minutes at 37 ℃) were fixed with 4％PFA, followed by surface staining with 2 μg/ml Alexa 647-α-CD3 for 2 hours at 4 ℃. Cells were placed in Ibidi 35 mm μ-Dish and the imaging buffer contained 100 mM β-Mercaptoethanolamin (MEA) for a sufficient blinking of fluorophores.

Super-resolution images were reconstructed from a series of 20,000 -25,000 frames using the N-STORM analysis module of NIS Elements AR (Laboratory imaging s. r. o. ) . Molecule distribution and cluster position were analyzed with MATLAB (MathWorks) based on Ripley’s K function. L (r) -r represents the efficiency of molecule clustering, and r value represents cluster radius. The r value at the maximum L (r) -r value represents the cluster size with the highest probability.

Imaging of immunological synapse by total internal reflection fluorescence microscopy (TIRFM)

Planar lipid bilayers (PLBs) containing biotinylated lipids were prepared to bind biotin-conjugated antigen by streptavidin. Biotinylated liposomes were prepared by sonicating 1, 2-dioleoyl-sn-glycero-3-phosphocholine and 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine-cap-biotin (25: 1 molar ratio, Avanti Polar Lipids) in PBS at a total lipid concentration of 5mM. PLBs were formed in Lab-Tek chambers (NalgeNunc) in which the cover glasses were replaced with nanostrip-washed coverslips. Coverslips were incubated with 0.1 mM biotinylated liposomes in PBS for 20 minutes. After washing with 10 ml PBS, PLBs were incubated with 20 nM streptavidin for 20 minutes, and excessive streptavidin was removed by washing with 10 ml PBS. Streptavidin-containing PLBs were incubated with 20nMbionylatedα-mCD3ε (145-2C11) (Biolegend) . Excessive antibody was removed by washing with PBS. Next, PLBs were treated with 5％FBS in PBS for 30 minutes at 37 ℃ and washed thoroughly for TIRFM of T cells. Adhesion ligands necessary for immunological synapse formation were provided by treating the bilayer with serum.

Freshly isolated mouse splenocytes were stained with Alexa 568-α-mTCRβ Fab and FITC-α-mCD8 and washed twice. α-mTCRβ antibody was labeled with Alexa568-NHS ester (Molecular probes) and digested to get Fab fragments with Pierce Fab Micro Preparation Kit (Thermo) . Cells were then placed on α-mCD3ε-containing PLBs to crosslink TCR. Time-lapse TIRF images were acquired on a heated stage with a 3-second interval time at 37 ℃, 5 ％CO₂, using a Zeiss Axio Observer SD microscopy equipped with a TIRF port, Evolve 512 EMCCD camera and Zeiss Alpha Plan-Apochromat 100 × oil lens. The acquisition was controlled by ZEN system 2012 software. An OPSL laser 488nm and a DPSS laser 561nm were used. Field of 512 × 512 pixels was used to capture 6-8 CD8⁺ T cells per image. Results of synapse formation and TCR movements were the population averages of all CD8⁺ T cells from 2-3 individual images. The movements of TCR microclusters were splitted into directed, confined and random movement using the method described. To sort the three movements, the MSD plot of each TCR microcluster was fitted with three functions as described. The ones with good fit (square of correlation coefficients (R²) ≥ 0.33 ) were selected for further classification. For a certain TCR microcluter, the movement is defined as random if SD <0.010. The distinction of directed and confined movement depends on which function fit better in the population of those SD ≥ 0.010. Images were analyzed with Image Pro Plus software (Media Cybernetics) , ImageJ (NIH) and MATLAB (MathWorks) .

Polarised secretion of cytolytic granules

In the granule polarization imaging, CTLs stained with Alexa568-α-mTCRβ Fab were placed on α-mCD3ε-containing PLBs for indicated time and fixed with 4％PFA. After the permabilization, cells were stained with Alexa488-α-mCD107a (1D4B) antibody. Three-dimensional spinning-disc confocal microscopy was used to image the granules polarized at 0 –2 μm distance from the synapse. The total granule volumes were quantified with Imaris software.

The degranulation level was measured. OT-I CTLs were mixed with OVA_257-264 pulsed EL4 cells at 1: 1 ratio. The mixed cells were then cultured in the medium supplemented with 1 μg/ml Alexa 488-α-CD107a antibody and 2 μM Monensin for 1, 2 and 4 hours. After which, cells were washed with PBS and further stained with PE-Cy7-α-CD8a antibody. Flow cytometry was used for assessing the surface and internalized CD107a levels.

Statistical analysis

All sample sizes are large enough to ensure proper statistical analysis. Statistical analyses were performed using GraphPad Prism (GraphPad Software, Inc. ) . Statistical significance was determined. The P values less than 0.05 were considered significant, the level of significance was indicated as *P < 0.05, **P < 0.01 and ***P < 0.001. ns meant no significant difference. All of the t-test analysis in the experiments are two-tailed unpaired t-test.

The practice of the present disclosure will employ, unless otherwise indicated, conventional techniques of tissue culture, immunology, molecular biology, microbiology, cell biology and recombinant DNA, which are within the skill of the art. See, e.g., Sambrook et al., (1989) Molecular Cloning: A Laboratory Manual, 2nd edition； Ausubel et al., eds. (1987) Current Protocols In Molecular Biology； MacPherson, B. D. Hames and G. R. Taylor eds., (1995) PCR 2: A Practical Approach； Harlow and Lane, eds. (1988) Antibodies, A Laboratory Manual； Harlow and Lane, eds. (1999) Using Antibodies, a Laboratory Manual； and R. I. Freshney, ed. (1987) Animal Cell Culture.

Example 2. Potentiated effector function of CD8⁺ T cells by ACAT1 inhibitors

A potent ACAT1/ACAT2 inhibitor (CP-113, 818) and a less potent but specific ACAT1 inhibitor (K604) were used in this study. CD8⁺ T cells were pretreated with vehicle (dimethylsulfoxide, DMSO) , CP-113, 818 or K604. Then the cells were stimulated with 5 μg ml^-1 plate-bound anti-CD3/CD28, and cytokine and cytolytic granule production was studied. Cytotoxicity of OT-I CTLs pretreated with CP-113, 818 or K604 or vehicle was also studied.

Inhibiting cholesterol esterification by CP-113, 818 or K604 augmented cytolytic granule and cytokine productions (FIG. 1, panels a and b) as well as cytotoxicity of CD8⁺ T cells (FIG. 1, panels c and d) . The results showed that inhibiting the activity of ACAT1 can significantly potentiate the effector function of the CD8⁺ T cells.

In contrast, inhibiting cholesterol biosynthesis (e.g., using Lovastatin) or cholesterol transport (e.g.， using U18666A) significantly decreased granule and cytokine productions of CD8⁺ T cells.

Example 3. ACAT1-deficient CD8⁺ T cells

Acat1^flox/flox mice were crossed with CD4^cre mice to generate conditional knockout (CKO) mice, in which Acat1 was conditionally knocked out in T cells. The transcriptional level of Acat2 in T cells was not changed in the Acat1^CKO mice. ACAT1 deficiency did not affect thymocyte development or peripheral T-cell homeostasis. The T cells were isolated from wild-type (WT) and Acat1^CKO (CKO) mice and were stimulated as described above. Acat1^CKO mice were crossed with OT-I TCR transgenic mice (mice named Acat1^CKO OT-I) . Cytokine/granule productions of antibody stimulated WT and CKO CD8⁺ T cells were studied. A skin melanoma model and a lung metastasis melanoma model were used to study the activity of Acat1^CKO CD8⁺ T cells in controlling tumour progression and metastasis. To study the TCR clustering and synapses formation on the plasma membrane, Ripley’s K-function analysis of TCR molecules was performed. The r (radius) value at the maximal L (r) –r value of Ripley’s K-function curves was studied. Total internal reflection fluorescence microscopy (TIRFM) analysis was used to study immunological synapse of CD8⁺ T cells on stimulatory planar lipid bilayer. Cytolytic granule polarization and degranulation of OT-I CTLs was also studied.

Upon activation, the effector function of Acat1^CKO CD8⁺ T cells was significantly enhanced, as compared with WT CD8⁺ T cells (FIG. 2, panels a and b) . In the skin melanoma model, Acat1^CKO mice had smaller tumour size (FIG. 3, panel a) and longer survival time (FIG. 3, panel b) . Compared with WT, the transferred Acat1^CKO OT-I Cytotoxic T lymphocytes (CTLs) showed stronger antitumor activity, evidenced by smaller tumour size (FIG. 4, panel a) and longer survival time (FIG. 4, panel b) of recipient mice. TCR microclusters of both

and activated Acat1^CKO CD8⁺ T cells were significantly larger than those of WT cells (FIG. 5, panels a and b) . ACAT1 deficiency led to faster directed movement of TCR microclusters toward the centre of the synapse (FIG. 6, panels a and b) . The mature immunological synapse of Acat1^CKO CD8⁺ T cells had more compact structure formed at a faster rate. The cytolytic granule polarization and the degranulation level were augmented in Acat1^CKO CD8⁺ T cells (FIG. 7) .

Example 4. Combination of avasimibe and anti-PD-1

To study ACAT1 inhibitors in cancer immunotherapies in mice, melanoma-bearing mice were treated with a potent ACAT-1 inhibitor, avasimibe (Ava) , or DMSO control, and tumour size and survival were studied. A combined therapy (avasimibe and anti-PD-1) or monotherapies (avasimibe or anti-PD-1) were also studied and compared in treating melanoma. In a lung cancer model, Lewis lung carcinoma-bearing mice were treated with avasimibe or DMSO control, and tumour multiplicity and survival were studied. Cytokine productions of stimulated human (h) CD8⁺ T cells pretreated with avasimibe, CP-113, 818, or DMSO. CTL cytotoxicity after avasimibe treatment was measured by the LDH assay. OT-I CTLs were pretreated with avasimibe or vehicle for 6 h and then incubated with EL-4 cells pulsed with OVA_257–264 peptide for 4 h.

The phenotypes of avasimibe-treated mice were consistent with those of Acat1^CKO mice. Tumour growth was inhibited and survival time was prolonged in the avasimibe-treated mice (FIG. 8) . The combined therapy had a better efficacy than monotherapies in inhibiting tumour progression and in increasing survival (FIG. 9) . Besides melanoma, avasimibe also showed good antitumor effect in Lewis lung carcinoma (FIG. 10) . Moreover, avasimibe enhanced the cytokine production of human CD8⁺ T cells (FIG. 11) . Like other ACAT1 inhibitors, avasimibe can enhance the effector function of mouse CD8⁺ T cells ex vivo (FIG. 12) .

Example 5. Combination of avasimibe and dacarbazine

A chemotherapeutic agent, dacarbazine, was used in this study. Melanoma-bearing mice were treated with a combined therapy (avasimibe and dacarbazine) or monotherapies (avasimibe or dacarbazine) , and tumour size and survival were studied.

The combined therapy of avasimibe and dacarbazine had a better efficacy than monotherapies in inhibiting tumour progression and in increasing survival in a melanoma mouse model (FIG. 13, panels a and b) .

* * *

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

The inventions illustratively described herein may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Thus, for example, the terms “comprising” , “including, ” “containing” , etc. shall be read expansively and without limitation. Additionally, the terms and expressions employed herein have been used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed.

Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification, improvement and variation of the inventions embodied therein herein disclosed may be resorted to by those skilled in the art, and that such modifications, improvements and variations are considered to be within the scope of this invention. The materials, methods, and examples provided here are representative of preferred embodiments, are exemplary, and are not intended as limitations on the scope of the invention.

The invention has been described broadly and generically herein. Each of the narrower species and subgeneric groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein.

In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group.

All publications, patent applications, patents, and other references mentioned herein are expressly incorporated by reference in their entirety, to the same extent as if each were incorporated by reference individually. In case of conflict, the present specification, including definitions, will control.

It is to be understood that while the disclosure has been described in conjunction with the above embodiments, that the foregoing description and examples are intended to illustrate and not limit the scope of the disclosure. Other aspects, advantages and modifications within the scope of the disclosure will be apparent to those skilled in the art to which the disclosure pertains.

Claims

A method for activating a CD8+ T cell, comprising contacting the cell with an agent that increases the plasma membrane cholesterol level of the cell.
The method of claim 1, wherein the contacting is in vitro.
The method of claim 1, wherein the contacting is in a patient suffering from a disease characterized with a suppressed CD8+ T cell.
The method of claim 3, wherein the contacting is in a cancer patient.
The method of claim 1, wherein the contacting is in a patient suffering from a microbial infection.
The method of any one of claims 1-5, wherein the agent:

(a) decreases esterification of free cholesterol in a cell,

(b) increases hydrolysis of cholesterol ester in a cell,

(c) increases cholesterol biosynthesis in a cell,

(d) increases cholesterol update into a cell,

(e) inhibits efflux of cholesterol ester from a cell,

(f) increases cholesterol trafficking from late endosome to cell membrane,

(g) inhibits cholesterol degradation, or

(h) inhibits cholesterol conversion to another molecule.
The method of claim 6, wherein the agent is an acyl-coenzyme A: cholesterol acyltransferases 1 (ACAT1) inhibitor, or a proprotein convertase subtilisin/kexin type 9 (PCSK-9) inhibitor.
The method of claim 7, wherein the ACAT1 inhibitor is selected from a group consisting of a small inhibitory RNA (siRNA) , a small hairpin RNA (shRNA) , a microRNA (miRNA) , or an anti-sense nucleic acid, (B) an ACAT1 inhibitory antibody or fragment thereof, (C) a small molecule inhibitor, and combinations thereof.
The method of claim 7, wherein the ACAT1 inhibitor is selected from a group consisting of avasimibe (CI-1011) , pactimibe, purpactins, manassantin A, diphenylpyridazine derivatives, glisoprenin A, CP113, 818, K604, beauveriolide I, beauveriolide III, U18666A, TMP-153, YM750, GERI-BP002-A, Sandoz Sah 58-035, VULM 1457, Lovastatin, CI976, CL-283, 546, CI-999, E5324, YM17E, FR182980, ATR-101 (PD132301 or PD132301-2) , F-1394, HL-004, F-12511 (eflucimibe) , cinnamic acid derivatives, cinnamic derivative, Dup 128, RP-73163, pyripyropene C, FO-1289, AS-183, SPC-15549, FO-6979, Angekica, ginseng, Decursin, terpendole C, beauvericin, spylidone, pentacecilides, CL-283, 546, betulinic acid, shikonin derivatives, esculeogenin A, Wu-V-23, pyripyropene derivatives A, B, and D, glisoprenin B-D, saucerneol B, sespendole, diethyl pyrocarbonate, beauveriolide analogues, Acaterin, DL-melinamide, PD 138142-15, CL277, 082, EAB-309, Enniatin antibiotics, Epi-cochlioquinone A, FCE-27677, FR186485, FR190809, NTE-122, obovatol, panaxadiols, protopanaxadiols, polyacetylenes, SaH 57-118, AS-186, BW-447A, 447C88, T-2591, TEI-6522, TEI-6620, XP 767, XR 920, GERI-BP001, gomisin N, gypsetin, helminthosporol, TS-962, isochromophilones, kudingosides, lateritin, naringenin, and combinations thereof.
The method of claim 7, wherein the ACAT1 inhibitor is avasimibe.
The method of claim 7, wherein the PCSK-9 inhibitor is selected from the group consisting of alirocumab, evolocumab, 1D05-IgG2, RG-7652, LY3015014, and ALN-PCS02.
A method of treating cancer or microbial infection, comprising:

(a) treating a CD8+ T cell, in vitro, with an agent that increases the plasma membrane cholesterol level of the cell； and

(b) administering the treated cell to a patient suffering from cancer or microbial infection.
The method of claim 12, further comprising, prior to step (a) , isolating the CD8+ T cell.
The method of claim 13, wherein the CD8+ cell is isolated from the patient.
The method of claim 13, wherein the CD8+ cell is isolated from a donor individual different from the patient.
The method of any one of claims 12-15, wherein the agent is an acyl-coenzyme A: cholesterol acyltransferases 1 (ACAT1) inhibitor, or a proprotein convertase subtilisin/kexin type 9 (PCSK-9) inhibitor.
The method of any one of claims 12-16, wherein the administration is infection.
The method of claim 17, wherein the injection is local injection.
A method of screening for a cancer immunotherapeutic agent, comprising:

(a) contacting a candidate agent with a cell expressing acyl-coenzyme A: cholesterol acyltransferases 1 (ACAT1) ；

(b) detecting an ACAT1 inhibitory activity of the candidate agent；

(c) contacting the candidate agent, if exhibiting the inhibitory activity, with a CD8+ T cell； and

(d) measuring the plasma membrane cholesterol level of the cell, wherein an increase of plasma membrane cholesterol level indicates that the candidate agent has cancer immunotherapeutic activity.
The method of claim 19, further comprising measuring a killing effect, cell proliferation, survival, cytokine or granule production, activity of acyl-coenzyme A: cholesterol acyltransferases 1 (ACAT1) , or TCR clustering.