WO2017116064A1

WO2017116064A1 - Biomarker dkk for predicting efficacy of c-met inhibitor

Info

Publication number: WO2017116064A1
Application number: PCT/KR2016/015043
Authority: WO
Inventors: 김보규; 이은진; 김경아; 이지민; 안태진; 남도현
Original assignee: 삼성전자 주식회사; 사회복지법인 삼성생명공익재단
Priority date: 2015-12-28
Filing date: 2016-12-21
Publication date: 2017-07-06
Also published as: KR102553879B1; KR20170077727A

Abstract

Provided are: a biomarker DKK1 for predicting efficacy of a c-Met inhibitor; and a composition for predicting efficacy of a C-Met inhibitor and/or selecting a subject to which the c-Met inhibitor is applied, the composition containing a material for detecting DKK1.

Description

Biomarker DKK for Predicting Efficacy of C-MET Inhibitor

Provided are compositions for predicting the efficacy of a c-Met inhibitor comprising biomarkers DKK (Dickkopf-related protein) for detecting the efficacy of a c-Met inhibitor and / or for selecting a subject for application of a c-Met inhibitor. .

Biomarker is an indicator that can identify changes caused inside the living body due to external influences, and is used to diagnose various diseases such as cancer, stroke, and dementia, or to predict or monitor the efficacy of certain therapeutic agents. Is getting active. Biomarkers related to drug development include pharmacodynamic markers (PD markers) for confirming the in vivo activity of drugs, and predictive efficacy markers for predicting drug reactivity prior to in vivo administration. markers). The use of these markers helps to establish the clinical strategy of the drug. For example, the efficacy predictive markers, which are expected to be effective through the action of the drug, can be used in the patient selection process to enable more effective drug treatment. In this case, more effective treatment strategies can be established by monitoring whether the drug is working well in individual patients and / or whether resistance is achieved. In addition, even in the absence of efficacy predictive markers, the presence of efficacy assay markers allows for early monitoring of individual patient responses to drugs in drug treatment, so that early screening of groups with and without drug efficacy is indicated. To enable a more effective and successful drug treatment. In addition, the effect verification marker can be used as an index for estimating the appropriate dose of drug by monitoring the degree of drug reactivity according to the concentration of administration.

Cancer is one of the leading causes of death to date. Advances in medical technology are bringing notable changes in cancer treatment technology, but the five-year survival rate has only improved by 10% over the past 20 years. This is because the rapid growth and metastasis of cancer is difficult to diagnose and treat at the proper time. By incorporating appropriate biomarkers into cancer treatments, the success of cancer treatments can be greatly increased by increasing the chance of identifying the characteristics of the cancer and using the appropriate treatment in a timely manner. For example, even in the same lung cancer patients, the characteristics of lung cancer classification, gene, and secreted protein are different, and accordingly, appropriate treatment is also different. Therefore, in chemotherapy using a specific therapeutic agent, if a biomarker corresponding to the therapeutic agent is present, trial and error can be reduced and the probability of success can be increased. For this purpose, the search for biomarkers for predicting or testing efficacy of anticancer drugs is very important, and if a suitable biomarker is successfully derived, the efficacy and value of anticancer drugs and the success rate of treatment using the same may be greatly increased.

Meanwhile, c-Met is a receptor for hepatocyte growth factor (HGF), and HGF binds to the extracellular site of c-Met receptor tyrosine kinase, resulting in division, movement, morphogenesis, and blood vessels in various normal and tumor cells. It is a type of cytokine that causes formation. c-Met is a representative receptor tyrosine kinase on the surface of the cell, which itself is a cancer-causing gene and sometimes cancer development, cancer metastasis, cancer cell migration, cancer cell invasion, neovascularization, regardless of the ligand HGF. Since it is involved in various mechanisms related to tumors, etc., it is a protein recently attracting attention as a target of anticancer treatment, and development of a target therapeutic agent such as an antibody that inhibits the action of c-Met is in progress.

In order to further enhance the efficacy of the treatment with the developed c-Met targeted therapeutic agent and increase the probability of success, the efficacy of the therapeutic agent is predicted or assayed to select patients who are suitable for application of the therapeutic agent to establish a more effective treatment strategy. There is a need for the development of applicable biomarkers.

One example is to predict the efficacy of a c-Met inhibitor comprising one or more selected from the group consisting of a DKK protein (Dickkopf-related protein) and genes encoding them and / or to select and / or apply c-Met inhibitors. Biomarkers for efficacy monitoring following Met inhibitor administration are provided.

Another example is for use in predicting the efficacy of one or more c-Met inhibitors selected from the group consisting of DKK proteins and genes encoding them and / or selecting subjects for application of c-Met inhibitors and / or monitoring efficacy after administration of c-Met inhibitors. Provides a use for

Other examples include predicting the efficacy of c-Met inhibitors and / or screening subjects for c-Met inhibitors and / or c-Met comprising a substance that interacts with one or more selected from the group consisting of DKK proteins and genes encoding them. Compositions, and kits, for monitoring efficacy after administration of an inhibitor are provided.

Other examples include predicting the efficacy of a c-Met inhibitor of a substance interacting with one or more selected from the group consisting of DKK proteins and genes encoding them and / or screening for and / or administering a c-Met inhibitor. Provides use for use in later efficacy monitoring.

Another example includes measuring the presence and / or level of one or more selected from the group consisting of DKK proteins and genes encoding them in a biological sample, and / or c-Met inhibitors. Screening methods for applying and / or monitoring efficacy after administration of c-Met inhibitors, or predicting efficacy of c-Met inhibitors and / or screening for application of c-Met inhibitors and / or monitoring efficacy after administration of c-Met inhibitors Provide a way to provide information.

Another example provides a composition for the prevention or treatment of cancer comprising a c-Met inhibitor and a Wnt signaling inhibitor. Another example provides the use of a pharmaceutical composition comprising a c-Met inhibitor and a Wnt signaling inhibitor for the prevention or treatment of cancer, or for the manufacture of a pharmaceutical composition for the prevention or treatment of cancer. The cancer may be a cancer having resistance to c-Met inhibitors.

Another example provides a method for the prevention or treatment of cancer comprising administering a c-Met inhibitor to the selected patient.

Another example provides a method of preventing or treating cancer, comprising administering a c-Met inhibitor and a Wnt signaling inhibitor. The cancer may be a cancer having resistance to c-Met inhibitors.

Another example provides a pharmaceutical composition for reducing resistance to a c-Met inhibitor including a c-Met inhibitor and a Wnt inhibitor. Another example provides the use of the pharmaceutical composition comprising a c-Met inhibitor and a Wnt inhibitor for use in reducing resistance to a c-Met inhibitor. Another example provides a method of reducing resistance to a c-Met inhibitor, comprising administering a c-Met inhibitor and a Wnt inhibitor.

DKK proteins (Dickkopf-related proteins such as DKK1) and / or genes encoding them are provided as markers that can predict the efficacy of c-Met inhibitors. Patients who are highly responsive to c-Met inhibitors, such as anti-c-Met antibodies, i.e. patients who are well efficacious of c-Met inhibitors, express c-Met and express DKK protein (eg, DKK1) levels and / or It was confirmed that the expression level of the gene encoding this is high. Such levels of DKK (eg, DKK1) can be measured not only at the level of coding genes but also at the level of protein secreted into the serum.

In one example, it was confirmed that the amount of DKK1 is increased in gastric cancer cells to which the anti-c-Met antibody acts, and if the amount of DKK1 is lowered through siRNA in gastric cancer cell lines with high DKK1 and anti-c-Met antibody efficacy It has been shown that anti-c-Met antibody efficacy is reduced. As such, it was confirmed that DKK protein level or gene expression level affected anti-c-Met antibody potency, thereby confirming the applicability of DKK1 as a c-Met inhibitor potency marker.

Thus, predicting the efficacy of one or more c-Met inhibitors selected from the group consisting of DKK proteins and genes encoding them, and / or selecting patients for whom the application of c-Met inhibitors is appropriate, and / or c-Met Use is provided as a marker for monitoring efficacy after administration of an inhibitor.

In the present specification, the efficacy of the c-Met inhibitors includes the effects of c-Met inhibition (such as intracellular migration and / or degradation of c-Met) of c-Met inhibitors, prevention, improvement of c-Met related diseases such as cancer, Means to alleviate, and / or therapeutic effects, and in the case of cancer, may mean effects such as reduction of cancer cells or cancer tissues, death of cancer cells or cancer tissues, inhibition of migration and / or penetration of cancer cells associated with cancer metastasis. Can be.

As used herein, 'efficacy monitoring after administration of a c-Met inhibitor' refers to a desired efficacy in a patient administered a c-Met inhibitor, such as c-Met inhibition (such as intracellular migration and / or degradation of c-Met). Efficacy, prevention, amelioration, alleviation, and / or treatment efficacy of c-Met related diseases such as cancer (eg, in the case of cancer, reduction of cancer cells or cancer tissues, death of cancer cells or cancer tissues, migration of cancer cells associated with cancer metastasis) And / or efficacy such as inhibition of penetration) and / or assay (or confirmation) of resistance to administered c-Met inhibitor.

DKK protein (Dickkopf-related protein) is a protein that acts as an antagonist (inhibitor) of the Wnt signaling pathway, DKK1 (Dickkopf-related protein 1), DKK2 (Dickkopf-related protein 2), DKK3 (Dickkopf-related protein 3) And the like. The DKK protein is human ( Homo sapiens ), monkey ( Macaca Primates, including murat ), mice ( Mus musculus ), rats ( Rattus) mammals such as rodents including norvegicus ), fish such as zebrafish ( Danio rerio ), frogs ( Xenopus) laevis ) may be derived from amphibians and the like. For example, DKK1 may be a human DKK1 (eg NP_036374.1 (gene: NM_012242.2), etc.), monkey DKK1 (eg, NP_001247454.1 (gene: NM_001260525.1), etc.), mouse DKK1 (eg, NP_034181.2 (gene) : NM_010051.3), etc.), rat DKK1 (eg, NP_001099820.1 (gene: NM_001106350.1); XP_003749137.1 (gene: XM_003749089.3), etc.), zebrafish DKK1 (eg, XP_005173020.1 (gene: XM_005172963 .1), NP_571078.1 (gene: NM_131003.1), etc.), frog DKK1 (eg, NP_001079061.1 (gene: NM_001085592.1), etc.) and the like, but is not limited thereto. DKK2 includes human DKK2 (eg, NP_055236.1 (gene: NM_014421.2), etc.), monkey DKK2 (eg, XP_001085254.1 (gene: XM_001085254.2), etc.), mouse DKK2 (eg, NP_064661.2 (gene: NM_020265) .4) and the like), rat DKK2 (eg, NP_001099942.1 (gene: NM_001106472.1), etc.), zebrafish DKK2 (eg, NP_001104679.1 (gene: NM_001111209.1), etc.), frog DKK2 (eg, NP_001079319. 1 (gene: NM_001085850.1), etc.) but may be selected from the group consisting of, but is not limited thereto. DKK3 includes human DKK3 (eg, NP_001018067.1 (gene: NM_001018057.1), etc.), monkey DKK3 (eg, NP_001252678.1 (gene: NM_001265749.1), etc.), mouse DKK3 (eg, NP_056629.1 (gene: NM_015814) .2), etc.), rat DKK3 (e.g. NP_612528.2 (gene: NM_138519.2), XP_006230071.1 (gene: XM_006230009.2), etc.), zebrafish DKK3 (eg, NP_001083014.1 (gene: NM_001089545.1 ), NP_001152755.1 (gene: NM_001159283.1), etc., frog DKK3 (eg, NP_001121290.1 (gene: NM_001127818.1), etc.) and the like, but are not limited thereto.

One embodiment provides a biomarker for predicting the efficacy of a c-Met inhibitor comprising one or more selected from the group consisting of a DKK protein and a gene encoding the same and / or selecting a subject (or patient) for applying the c-Met inhibitor. do.

Another example provides a biomarker for efficacy monitoring after administration of a c-Met inhibitor comprising one or more selected from the group consisting of DKK proteins and genes encoding them.

Another example provides a use for predicting the efficacy of a c-Met inhibitor comprising one or more selected from the group consisting of a DKK protein and a gene encoding the same and / or for selecting a subject (or patient) for applying the c-Met inhibitor. .

Another example provides a use for monitoring efficacy after administration of one or more c-Met inhibitors selected from the group consisting of DKK proteins and genes encoding them.

Another example is a composition for predicting the efficacy of a c-Met inhibitor and / or for selecting a subject (patient) to apply a c-Met inhibitor comprising a substance that interacts with one or more selected from the group consisting of a DKK protein and a gene encoding the same. And kits.

Another example provides compositions and kits for monitoring efficacy after administration of a c-Met inhibitor comprising a substance that interacts with one or more selected from the group consisting of DKK proteins and genes encoding them.

Another example is for use in predicting the efficacy of a c-Met inhibitor of a substance interacting with at least one selected from the group consisting of a DKK protein and a gene encoding the same and / or selecting a subject (patient) to apply the c-Met inhibitor. To provide.

Another example provides a method for predicting the efficacy of a c-Met inhibitor, and providing information for predicting the efficacy of a c-Met inhibitor, the method comprising measuring at least one level selected from the group consisting of DKK protein and a gene encoding the same in a biological sample. The present invention provides a method for screening a subject (patient) to be applied to a c-Met inhibitor, or a method for providing information for selecting a subject (patient) to be applied to a c-Met inhibitor.

As described above, when the level of one or more selected from the group consisting of DKK protein in the biological sample and the gene encoding the same is high, DKK necessary for the c-Met inhibitor to act in the biological sample, so that the c-Met inhibitor It may mean that it can work well. Therefore, in the method for predicting the efficacy of the c-Met inhibitor or the screening method of applying the c-Met inhibitor, when the level of one or more selected from the group consisting of DKK protein and gene encoding the biological sample, the biological sample or The c-Met inhibitor may be determined (predicted) to be effective in the patient from which the biological sample is derived, or the biological sample or the patient from which the biological sample is derived may be judged as an application target of the c-Met inhibitor. Therefore, the method of providing information for predicting the efficacy or predicting the efficacy of the c-Met inhibitor, after the step of measuring at least one level selected from the group consisting of the DKK protein and the gene encoding the same, in the biological sample If the level of one or more selected from the group consisting of DKK protein and the gene encoding it is high, the step of determining (predicting) the c-Met inhibitor will be effective in the biological sample or the patient from which the biological sample is derived. It can be included as. In addition, the method of selecting a target of the application of c-Met inhibitor or the method of providing information for the selection of the target of application of c-Met inhibitor, the level of one or more selected from the group consisting of the DKK protein and the gene encoding the same. After the measuring step, if the level of one or more selected from the group consisting of DKK protein and the gene encoding the biological sample in the biological sample, applying the c-Met inhibitor to the biological sample or the patient from which the biological sample is derived The method may further include determining an appropriate target.

Another example is a method for monitoring efficacy after administration of a c-Met inhibitor or information for monitoring efficacy after administration of a c-Met inhibitor comprising measuring at least one level selected from the group consisting of DKK protein and a gene encoding the same in a biological sample. Provides a way to provide.

If the level of one or more selected from the group consisting of DKK protein in the biological sample and the gene encoding the same is high, DKK necessary for the c-Met inhibitor to act in the biological sample, the c-Met inhibitor may work well It may be meant. Therefore, in the method for monitoring efficacy after administration of the c-Met inhibitor, when one or more levels selected from the group consisting of DKK protein in a biological sample and a gene encoding the same are high, the biological sample or a patient from which the biological sample is derived It can be judged (assay) that the c-Met inhibitor is exhibiting efficacy. Therefore, the method for monitoring efficacy after administration of the c-Met inhibitor, after measuring at least one level selected from the group consisting of the DKK protein and the gene encoding the same, the DKK protein in the biological sample and the gene encoding the same When the level of one or more selected from the group consisting of high, the biological sample or the patient from which the biological sample may further comprise determining (testing) that the c-Met inhibitor is effective.

In the markers, compositions, kits, and methods, the DKK protein may be DKK1, eg, human DKK1, and the gene encoding it may be a DKK1 gene, eg, a human DKK1 gene.

As used herein, "at least one level selected from the group consisting of DKK proteins (such as DKK1) and / or genes encoding them" may be determined based on the following criteria.

(1) A biological sample isolated from a patient in which a DKK protein and / or a gene encoding the same is present or the c-Met inhibitor to be applied is ineffective, or a biological sample in which the c-Met inhibitor is ineffective (comparison) Reference samples; for example, MKN74 (JCRB0255, JCRB) gastric cancer cell line, NUGC4 (JCRB0834, JCRB) gastric cancer cell line, NCI-N87 (CRL-5822, ATCC) gastric cancer cell line, SNU668 (00668, KCLB) gastric cancer cell line, H1373 (ATCC, CRL Lung cancer cell line, HCC1806 (ATCC, CRL-2335) breast cancer cell line, Caki-1 (ATCC, HTB-46) kidney cancer cell line, SKBR3 (ATCC, HTB-30) breast cancer cell line, BT474 (ATCC, HTB-20) Breast Cancer Cell Line, HT-29 (ATCC, HTB-38) Colon Cancer Cell Line, LoVo (ATCC, CCL-229) Colon Cancer Cell Line, HCT116 (ATCC, CCL-247) Colon Cancer Cell Line, SW620 (ATCC, CCL-227) Colon Resistance to cancer cells, Ls174T (ATCC, CL-188) colorectal cancer cell lines, or by repeated or continuous administration of c-Met inhibitors In comparison with the cell line, and so on) may be to the amount of the gene (DNA, cDNA or mRNA) encoding DKK of protein and / or it means the number of cases. The comparative reference sample may be a cell, tissue, or a culture thereof, isolated from a living body or artificially cultured. In this case, the efficacy prediction method, subject screening method, and / or efficacy monitoring method may further comprise the step of measuring the level of DKK protein and / or gene encoding the comparative reference sample prior to the determining step. have. In addition, the determining of the methods may include one or more levels selected from the group consisting of DKK protein of a biological sample and a gene encoding the same, and one or more levels selected from the group consisting of DKK protein of a comparative reference sample and a gene encoding the same. The step of comparing and i) at least one level selected from the group consisting of a DKK protein in the biological sample and a gene encoding the same, the c-Met inhibitor in the biological sample or in the patient from which the biological sample is derived. Judging efficacy (prediction), judging the patient as a subject suitable for applying a c-Met inhibitor, or judging that the c-Met inhibitor is efficacious (testing), or ii) in a biological sample One or more levels selected from the group consisting of DKK proteins and genes encoding them are compared If it is lower than the sample, it is determined that the c-Met inhibitor will not be effective in the biological sample or the patient from which the biological sample is derived (predicted), and the patient is determined to be not suitable for applying the c-Met inhibitor. Or, determining that the c-Met inhibitor is not effective.

(2) alternatively, "-" to "+1", e.g., "-", as measured by conventional immunohistochemistry (IHC) using conventional antibodies against DKK proteins (ab61034, Abcam); Negative can be determined as a case where a value of "0" or "+1" is obtained, and a case where a higher value (greater than "+1"), for example, +2 or +3 is obtained, can be determined as positive. High levels of DKK protein in biological samples. Therefore, when +2 or +3 is obtained by conventional immunohistochemistry (IHC) using a conventional antibody against DKK protein, it can be judged that the level of DKK protein is high. In this case, the step of measuring the DKK protein level of the biological sample of the efficacy prediction method, subject screening method, and / or efficacy monitoring method may be performed by immunohistochemistry using conventional antibodies to the DKK protein, In the determining step, i) when a value of +2 or +3 is obtained as a result of the immunohistochemistry, it is determined that the c-Met inhibitor will be effective in the biological sample or the patient from which the biological sample is derived (prediction). Judging the patient as a suitable subject to apply the c-Met inhibitor, or determining (testing) that the c-Met inhibitor is effective, or ii) the result of the immunohistochemistry-, 0 or + If a value of 1 is obtained, it is determined that the c-Met inhibitor will not be effective in the biological sample or the patient from which the biological sample is derived (prediction), the patient c-Met Determining that the subject is not suitable for applying the inhibitor, or determining (testing) that the c-Met inhibitor is not effective.

(3) Alternatively, when the mRNA expression of the DKK1 gene is measured in an Affymetrix U133 Plus 2.0 array and the mRNA expression level is about 9.61 or more, the c-Met inhibitor is effective in the biological sample or the patient from which the biological sample is derived. It can be predicted that.

(4) In addition, the mRNA expression level of the DKK1 gene is expressed relative to the mRNA expression level of other genes, thereby predicting the effect of the c-Met inhibitor. for example,

i) If the mRNA expression level of the DKK1 gene (the mRNA expression level of the DKK1 gene / the average mRNA expression level of the GAPDH gene) is greater than or equal to about 0.66, the c-Met inhibitor may be used in the biological sample or the biological sample. Predicted to be effective in patients from which is derived;

ii) if the mRNA expression level of the DKK1 gene (the mRNA expression level of the DKK1 gene / the average mRNA expression level of the HPRT1 gene) is greater than about 0.78, the c-Met inhibitor may be used in the biological sample or the biological sample. Predicted to be effective in patients from which is derived;

iii) mRNA expression level of DKK1 gene (mRNA expression level of DKK1 gene / 10 above the mean of mRNA expression levels of 10 genes (EEF1A1, RPL23, TPT1, HUWE1, MATR3, SRSF3, HNRNPC, SMARCA4, WDR90, and TUT1) An average of dog gene mRNA expression levels) is greater than or equal to about 1.05 and it can be predicted that the c-Met inhibitor may be effective in the biological sample or in the patient from which the biological sample is derived.

The level of the DKK protein (eg, DKK1 protein) or gene encoding it (eg, DKK1 gene) can be measured by any conventional protein or gene analysis method using a substance that interacts with the protein or gene. A substance that interacts with the DKK protein (eg, DKK1 protein) or a gene encoding it (eg, DKK1 gene) binds specifically to the DKK protein (eg, DKK1 protein) or DKK gene (eg, DKK1 gene). It may be at least one selected from the group consisting of chemical (small) molecules, proteins, peptides, nucleic acid molecules (polynucleotides, oligonucleotides, etc.). For example, a substance that interacts with the DKK protein (eg, DKK1 protein) or a gene encoding it (eg, DKK1 gene) may be a compound, antibody, aptamer, and the like that specifically binds to the DKK protein (eg, DKK1 protein). It may be one or more selected from the group consisting of nucleic acid molecules (eg, primers, probes, aptamers, etc.) that bind to all or part of the DKK gene (eg, DKK1 gene).

For example, the level of the DKK protein (eg, DKK1 protein) can be determined by conventional enzymatic reactions, fluorescence, luminescence and / or radiation using compounds, antibodies, aptamers, etc. that specifically bind to the DKK protein (eg, DKK1 protein). It can be measured by detection, and specifically, immunochromatography, immunohistochemical staining, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), enzyme immunoassay (RIA). enzyme immunoassay (EIA), fluorescence immunoassay (FIA), luminescence immunoassay (LIA), Western blotting, microarray, and the like. However, it is not limited thereto.

In addition, the level of the DKK gene (eg, DKK1 gene) (DNA, cDNA or mRNA) can be measured using conventional genetic analysis methods, for example using a primer, probe, or aptamer that is hybridizable with the gene. Phosphorus gene analysis methods, such as polymerase chain reaction method (PCR; such as qPCR, real-time PCR, etc.), fluorescent in situ hybridization (FISH), microarray method, etc. can be measured, but is not limited thereto. no. In one embodiment, the primer is a gene fragment of consecutive 5 to 1000 bp, such as 10 to 500 bp, 20 to 200 bp, or 50 to 200 bp in the sequence of the DKK gene (eg, DKK1 gene) (full length DNA, cDNA, or mRNA). Is capable of detecting (eg, complementary to) the contiguous 5-100 bp, eg, 5-50 bp, 5-30 bp, or 10-25 bp region of each of the 3'- and 5'-ends of the gene fragment. Primer pairs), including the base sequence. The probe or aptamer may have a total length of 5 to 100 bp, 5 to 50 bp, 5 to 30 bp, or 5 to 25 bp, and is continuous in the base sequence of a gene (full length DNA, cDNA, or mRNA) encoding DKK1. 5 to 100 bp, 5 to 50 bp, 5 to 30 bp, or 5 to 25 bp gene fragment may be one having a sequence capable of binding or hybridizing (eg, complementary). The term 'combinable' may mean that the gene may be bound to the gene site by chemical and / or physical bonds such as covalent bonds, and the term “hybridization possible” may refer to the nucleotide sequence of the gene site. By complementary binding may be achieved by having at least%, such as at least 90%, at least 95%, at least 98%, at least 99%, or at least 100% of sequence complementarity.

A method for predicting the efficacy of the c-Met inhibitor and / or a method for selecting a target of the c-Met inhibitor and / or a method for monitoring the efficacy after administration of the c-Met inhibitor, wherein the DKK protein (eg, DKK1 protein) in the biological sample and Measuring one or more levels selected from the group consisting of genes encoding them may optionally include: i) preparing a biological sample; ii) reacting the biological sample by treating (adding) and reacting a substance interacting with at least one selected from the group consisting of DKK protein (eg, DKK1 protein) and a gene encoding the same; And iii) analyzing the obtained reactant to quantify one or more selected from the group consisting of DKK protein (eg, DKK1 protein) and genes encoding the same. Preparing the biological sample of step i) may include obtaining (separating) a biological sample from the patient or obtaining a biological sample separated from the patient. In step ii) the interacting substance is a chemical, small molecule, protein, peptide, nucleic acid molecule (poly) that specifically binds to a DKK protein (such as DKK1 protein) and / or a DKK (such as DKK1) gene. Nucleotides, oligonucleotides, etc.), and the like. For example, the interacting agent binds to some or all of a small molecule, antibody, aptamer, or gene encoding a DKK protein (such as DKK1 protein) that specifically binds to a DKK protein (such as DKK1 protein). Polynucleotides (eg, primers, probes, aptamers, etc.), and the like, which may or may not be labeled with a labeling material such as a fluorescent material or a coloring material. In step iii), the reactant interacts (binds) with at least one selected from the group consisting of DKK protein (such as DKK1 protein) and / or DKK (such as DKK1) gene obtained in step ii) and a substance interacting with it. And the quantifying step may be performed by quantifying the generated complex, measuring a labeled substance labeled on the complex, or separating the complex from a sample, and then extracting the DKK protein (eg, And re-isolating the DKK1 protein) and / or the DKK (eg DKK1) gene to quantify the isolated DKK protein (eg DKK1 protein) and / or DKK (eg DKK1) gene. Quantification of the DKK protein is conventional protein quantification methods, such as immunochromatography, immunohistochemical staining, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), enzyme By immunoassay (EIA), fluorescence immunoassay (FIA), luminescence immunoassay (LIA), Western blotting, microarray, etc. It may be performed, but is not limited thereto. Quantification of the DKK gene is carried out in a conventional gene quantification method such as polymerase chain reaction (PCR; such as qPCR, real-time PCR, etc.), FISH (fluorescent in situ hybridization), microarray method, etc. It may be performed by, but is not limited thereto.

In addition, the method for predicting efficacy and / or subject selection may be performed after the step of judging to a patient judged (predicted) that the c-Met inhibitor will exhibit efficacy or to a patient determined to be suitable for applying the c-Met inhibitor. The method may further comprise administering a pharmaceutically effective amount of a c-Met inhibitor. In addition, the monitoring method is a step of administering a pharmaceutically effective amount of a c-Met inhibitor to a patient judged (tested) that the c-Met inhibitor is effective after the step of determining, or the c-Met inhibitor is Discontinuing administration of the c-Met inhibitor to the patient judged (black) to be ineffective.

In the present specification, the subject of application of the c-Met inhibitor refers to a patient suitable for applying a therapy using the c-Met inhibitor, and all mammals, such as primates such as humans and monkeys, rodents such as mice and rats. Can be, for example, cancer patients. The biological sample is isolated or artificially cultured from all patients (e.g., mammals including primates such as humans, monkeys, rodents, mice, rats, etc.), such as cancer patients, or the patient to which the c-Met inhibitor is to be applied. Cells, tissues, body fluids (eg, blood, serum, urine, saliva, etc.), and the like, for example, blood or serum.

On the other hand, in order for the c-Met inhibitor to be effective, it may be assumed that the target material, c-Met high expression conditions (present a certain level or more) is satisfied.

Accordingly, the composition (or kit) for predicting the efficacy of the c-Met inhibitor, the composition (or kit) for monitoring the efficacy, or the composition (or kit) for selecting a target to be applied is c-Met and a gene encoding the same (eg, full-length DNA). , cDNA, mRNA, etc.) may further include a substance that interacts with one or more selected from the group consisting of. Substances that interact with the c-Met and / or genes encoding the same may include chemical, small molecules, proteins, peptides, nucleic acid molecules (specifically binding to the c-Met and / or genes encoding the same). Polynucleotides, oligonucleotides, and the like), and the like. For example, a substance that interacts with the c-Met and / or a gene encoding the c-Met may include a compound, an antibody, an aptamer, and a nucleic acid molecule that binds to all or part of a c-Met gene. For example, it may be one or more selected from the group consisting of primers, probes, aptamers, and the like.

In addition, the method for predicting the efficacy of the c-Met inhibitor, the method for monitoring the efficacy, or the method for screening an application may include c-Met protein levels and / or genes encoding the same (eg, full-length DNA, cDNA, mRNA, etc.) in a biological sample obtained from a patient. The method may further include measuring the level of c). Determining the c-Met protein level of the sample or the level of genes encoding the same (eg, full-length DNA, cDNA, mRNA, etc.) is the same as the step of measuring the level of the DKK protein and / or the gene encoding the same as described above There is no limitation in order, and the two measuring steps may be performed simultaneously or sequentially in any order. The specific measuring method is the same as the method of measuring the level of the DKK protein described above and / or the gene encoding the same. For example, using a conventional western blotting method, a certain amount of total intracellular protein (e.g., 10 ug (microgram)) obtained from the biological sample (e.g., cancer cells or cancer tissues) is loaded, and the film is elapsed for a certain time (e.g., 30). When bands are detected upon exposure, c-Met high expression is recognized, indicating that treatment with c-Met inhibitors has met the prerequisites for efficacy. In another embodiment, mRNA levels are measured according to manufacturer's instructions using an Affymetrix U133 Plus 2.0 array and c-Met in the biological sample has an mRNA level of at least about 13.5, at least about 13.6, or at least about 13.78, Met high expression is recognized, and it can be determined that treatment with c-Met inhibitors has met the prerequisites for efficacy. The cancer cells having high expression characteristics of c-Met may be cancer cells such as lung cancer, breast cancer, brain cancer, stomach cancer, liver cancer, kidney cancer, etc., but c-Met expression according to the characteristics of individual patients may be other types of cancer cells. High doses can also be included in the treatment target using c-Met inhibitors.

In another embodiment, the biological sample used in the method for predicting or monitoring the efficacy of the c-Met inhibitor or the screening method for applying the c-Met inhibitor is a tissue, cell, or body fluid (blood, serum, urine, saliva, etc.) obtained from a patient. Tissue, cells, or body fluids (blood, blood, or the like) that have a high c-Met expression level, such as, for example, a c-Met level of at least about 13.5, at least about 13.6, or at least about 13.78, as measured using an Affymetrix U133 Plus 2.0 array. Serum, urine, saliva, etc.).

Another example is a method of inhibiting c-Met (or degradation) comprising administering a c-Met inhibitor to at least one high level subject selected from the group consisting of DKK proteins (such as DKK1) and / or genes encoding the same. to provide.

Another example provides a method of treating cancer comprising administering a c-Met inhibitor to one or more high-level subjects selected from the group consisting of DKK proteins (such as DKK1) and / or genes encoding them.

One or more levels selected from the group consisting of DKK proteins (eg DKK1) and / or genes encoding them may be determined as described above.

One or more high-level patients selected from the group consisting of the DKK protein (eg, DKK1) and genes encoding the same may be subjects selected by the selected compositions, kits and / or methods to which the c-Met inhibitor described above is applied. . Therefore, the c-Met inhibition method or the method of treating cancer may further comprise the step of selecting the anti-c-Met antibody application target prior to the administering step, the specific methods and steps as described above.

More specifically, the c-Met inhibition method or a method for preventing and / or treating cancer,

identifying a target of the c-Met inhibitor; And

Administering a pharmaceutically effective amount of a c-Met inhibitor to a subject to which the c-Met inhibitor is applied

It may include.

In another embodiment, the method of inhibiting c-Met or the method of preventing and / or treating cancer,

Selecting at least one level of c-Met inhibitor by measuring one or more levels selected from the group consisting of DKK proteins (eg, DKK1) and / or genes encoding them in a biological sample;

Administering a pharmaceutically effective amount of a c-Met inhibitor to a subject to which the selected c-Met inhibitor is applied

It may include.

At this time, the administration conditions of the c-Met inhibitor, such as the dosage, the interval of administration, and / or the number of administrations may be appropriate administration conditions of the c-Met inhibitor determined in the efficacy assay method of the c-Met inhibitor.

On the other hand, since DKK1 is a Wnt antagonist, when DKK1 expression is high, Wnt signaling is suppressed. When DKK1 expression is decreased, Wnt signaling may be activated. If resistance to c-Met inhibitors such as anti-c-Met antibodies is induced, activation of Wnt signaling may be one cause, so Wnt signaling of c-Met inhibitors such as anti-c-Met antibodies Use with inhibitors can overcome resistance to c-Met inhibitors such as anti-c-Met antibodies (see FIG. 5).

Accordingly, another embodiment of the present invention provides a pharmaceutical composition for concomitant administration for overcoming or reducing (improving) resistance to a c-Met inhibitor including an c-Met inhibitor and a Wnt signaling inhibitor as an active ingredient. Another example provides a pharmaceutical composition for concomitant administration for the prevention and / or treatment of cancer comprising a c-Met inhibitor and a Wnt signaling inhibitor as an active ingredient. The cancer may be a cancer having acquired resistance by intrinsic or sustained administration to a c-Met inhibitor, such as an anti-c-Met antibody.

In one embodiment, the pharmaceutical composition for concomitant administration may be in the form for simultaneous administration of two drugs, including a mixture of a pharmaceutically effective amount of a c-Met inhibitor and a pharmaceutically effective amount of a Wnt signaling inhibitor. In another embodiment, the pharmaceutical composition for concomitant administration may be in a form for formulating a pharmaceutically effective amount of a c-Met inhibitor and a pharmaceutically effective amount of a Wnt signaling inhibitor, respectively, to be administered simultaneously or sequentially. In this case, the pharmaceutical composition for concomitant administration comprises a first pharmaceutical composition comprising a pharmaceutically effective amount of a c-Met inhibitor as an active ingredient and a second pharmaceutical composition comprising a pharmaceutically effective amount of a Wnt signaling inhibitor as an active ingredient. It may be a pharmaceutical composition for concomitant administration for simultaneous or sequential administration. In the case of sequential administration, the order may be interchanged.

Another example overcomes resistance to c-Met inhibitors, including a first pharmaceutical composition comprising a pharmaceutically effective amount of a c-Met inhibitor, a second pharmaceutical composition comprising a pharmaceutically effective amount of a Wnt signaling inhibitor, and a packaging container Or kits for abatement (improvement). Another example is for the prevention and / or treatment of cancer comprising a first pharmaceutical composition comprising a pharmaceutically effective amount of a c-Met inhibitor, a second pharmaceutical composition comprising a pharmaceutically effective amount of a Wnt signaling inhibitor, and a packaging container Provide the kit. The cancer may be a cancer having acquired resistance by intrinsic or sustained administration to a c-Met inhibitor, such as an anti-c-Met antibody.

Another example provides a method of overcoming or reducing (improving) resistance to a c-Met inhibitor comprising co-administering a c-Met inhibitor and a Wnt signaling inhibitor to a patient in need of prophylaxis and / or treatment of cancer. . Another example provides a method of preventing and / or treating cancer comprising co-administering a c-Met inhibitor and a Wnt signaling inhibitor to a patient in need thereof. The cancer may be a cancer having acquired resistance by intrinsic or sustained administration to a c-Met inhibitor, such as an anti-c-Met antibody. The method may further comprise identifying, prior to administering, the patient in need of overcoming or reducing (improving) resistance to the c-Met inhibitor or preventing and / or treating cancer.

In one embodiment, the combination administration may be carried out by administering a mixture of c-Met inhibitors and Wnt signaling inhibitors. In another embodiment, the combination administration may be performed simultaneously or sequentially with the first step of administering the c-Met inhibitor and the second step of administering the Wnt signaling inhibitor. When sequentially administered, the order may be interchanged.

In one embodiment, the Wnt signaling inhibitor may be any substance that inhibits the expression and / or function of proteins involved in the Wnt signaling pathway and / or genes encoding them, such as, for example, those involved in the Wnt signaling pathway. Antibodies, aptamers, small molecules that specifically bind and / or act on proteins, antisense oligonucleotides that specifically bind to genes encoding proteins involved in the Wnt signaling pathway, and small interfering RNA ), shRNA (small hairpin RNA), miRNA (microRNA), and the like. The proteins involved in the Wnt signaling pathway are Wnt protein families (e.g., human origin; Wnt1, Wnt2, Wnt2B, Wnt3, Wnt3A, Wnt4, Wnt5A, Wnt5B, Wnt6, Wnt7A, Wnt7B, Wnt8A, Wnt8B, Wnt9A, Wnt9B, Wnt10A) , Wnt10B, Wnt11, Wnt16, etc.), lipoprotein receptor-related protein (LRP), Frizzled (Fz) family receptor, DSH (phosphoprotein Dishevelled), Axin, etc. It may be abnormal. For example, the Wnt signaling inhibitor may be a DKK protein (such as DKK1), XAV939 (CAS Number 284028-89-3; 3,5,7,8-Tetrahydro-2- [4- (trifluoromethyl) phenyl] -4H-thiopyrano [ 4,3-d] pyrimidin-4-one), PRI-724 (CAS Number: 847591-62-2; (6S, 9aS) -N-benzyl-6- (4-hydroxybenzyl) -8- (naphthalen-1 -ylmethyl) -4,7-dioxooctahydro-1H-pyrazino [1,2-a] pyrimidine-1-carboxamide), CWP232291, 2,4-Diamino-quinazoline, FJ9 (chemical structure:

), LGK974 (CAS Number: 1243244-14-5; 2 ', 3-dimethyl-N- [5- (2-pyrazinyl) -2-pyridinyl]-[2,4'-bipyridine] -5-acetamide), G007-LK (CAS number: 1380672-07-0 (G007-LK, E-isomer) or 1380672-82-1 (E or Z isomer); (E) -4- (5- (2- (4- ( 2-chlorophenyl) -5- (5- (methylsulfonyl) pyridin-2-yl) -4H-1,2,4-triazol-3-yl) vinyl) -1,3,4-oxadiazol-2-yl) benzonitrile ), Pyrvinium, Foxy-5 (peptide: N- Formyl-MDGCEL; SEQ ID NO: 110), OMP-54F28 (Fzd8-Fc; SEQ ID NO: 111), OMP-18R5 (vantictumab), OTSA101 (Chimeric humanized mAb against FZD10; US 2013/0230521 A1) may be one or more selected from the group consisting of, but is not limited thereto.

As used herein, a "c-Met inhibitor" may be any substance that recognizes and / or binds to and degrades, inhibits expression or inhibits function of c-Met. For example, the c-Met inhibitor may be at least one selected from the group consisting of anti-c-Met antibodies, antigen-binding fragments thereof, small molecule c-Met inhibitors, and the like.

The small molecule c-Met inhibitor is crizotinib (PF-02341066; 3-((R) -1- (2,6-dichloro-3-fluorophenyl) ethoxy) -5- (1- (piperidin-4- yl) -1H-pyrazol-4-yl) pyridin-2-amine), cabozantinib; XL-184; N- (4- (6,7-dimethoxyquinolin-4-yloxy) phenyl) -N- ( 4-fluorophenyl) cyclopropane-1,1-dicarboxamide), forretinib; N- (3-fluoro-4- (6-methoxy-7- (3-morpholinopropoxy) quinolin-4-yloxy) phenyl) -N- (4-fluorophenyl) cyclopropane-1,1-dicarboxamide), PHA-665752 ((R, Z) -5- (2,6-dichlorobenzylsulfonyl) -3-((3,5-dimethyl-4- (2- ( pyrrolidin-1-ylmethyl) pyrrolidine-1-carbonyl) -1H-pyrrol-2-yl) methylene) indolin-2-one), SU11274 ((Z) -N- (3-chlorophenyl) -3-((3, 5-dimethyl-4- (1-methylpiperazine-4-carbonyl) -1H-pyrrol-2-yl) methylene) -N-methyl-2-oxoindoline-5-sulfonamide), SGX-523 (6- (6- ( 1-methyl-1H-pyrazol-4-yl)-[1,2,4] triazolo [4,3-b] pyridazin-3-ylthio) quinoline), PF-04217903 (2- (4- (3- ( quinolin-6-ylmethyl) -3H- [1,2,3] triazolo [4,5-b] pyrazin-5-yl) -1H-pyrazol-1-yl) ethanol), EMD 1214063 (Benzonitrile, 3- [ 1,6-Di hydro-1-[[3- [5-[(1-Methyl-4-Piperidinyl) Methoxy] -2-PyriMidinyl] Phenyl] Methyl] -6-Oxo-3-Pyridazinyl]), Golvatinib; N- (2-fluoro-4-((2- (4- (4-methylpiperazin-1-yl) piperidine-1-carboxamido) pyridin-4-yl) oxy) phenyl) -N- (4-fluorophenyl) cyclopropane -1,1-dicarboxamide), INCB28060 (capmatinib; 2-fluoro-N-methyl-4- (7- (quinolin-6-ylmethyl) imidazo [1,2-b] [1,2,4] triazin-2 -yl) benzamide), MK-2461 (N-((2R) -1,4-Dioxan-2-ylmethyl) -N-methyl-N '-[3- (1-methyl-1H-pyrazol-4-yl ) -5-oxo-5H-benzo [4,5] cyclohepta [1,2-b] pyridin-7-yl] sulfamide), tivantinib; ARQ 197; (3R, 4R) -3- (5, 6-Dihydro-4H-pyrrolo [3,2,1-ij] quinolin-1-yl) -4- (1H-indol-3-yl) pyrrolidine-2,5-dione), NVP-BVU972 (6- [ [6- (1-Methyl-1H-pyrazol-4-yl) imidazo [1,2-b] pyridazin-3-yl] methyl] quinoline), AMG458 ({1- (2-hydroxy-2-methylpropyl)- N- [5- (7-methoxyquinolin-4-yloxy) pyridin-2-yl] -5-met hyl-3-oxo-2-phenyl-2,3-dihydro-1H-pyrazole-4-carboxamide}), BMS 794833 (N- (4-((2-amino-3-chloropyridin-4-yl) oxy) -3-fluorophenyl) -5- (4-fluorophenyl) -4-oxo-1,4-dihydropyridine-3- carboxamide), BMS 777607 (N- [4-[(2-Amino-3-chloropyridin-4-yl) oxy] -3-fluorophenyl] -4-ethoxy-1- (4-fluorophenyl) -2- oxo-1,2-dihydropyridine-3-carboxamide), MGCD-265 (N- (3-Fluoro-4- (2- (1-methyl-1H-imidazol-4-yl) thieno [3,2-b] pyridin-7-yloxy) phenylcarbamothioyl) -2-phenylacetamide), AMG-208 (7-Methoxy-4-[(6-phenyl-1,2,4-triazolo [4,3-b] pyridazin-3-yl) methoxy] quinoline), BMS-754807 ((2S) -1- [4-[(5-Cyclopropyl-1H-pyrazol-3-yl) amino] pyrrolo [2,1-f] [1,2,4] triazin -2-yl] -N- (6-fluoro-3-pyridinyl) -2-methyl-2-pyrrolidinecarboxamide), JNJ-38877605 (6- [Difluoro [6- (1-methyl-1H-pyrazol-4-yl) ) -1,2,4-triazolo [4,3-b] pyridazin-3-yl] methyl] quinoline), imidazo [1,2-a] pyridine derivatives ; ACS Med. Chem. Lett. 2015, 6, pp.507-512), AMG-337 (

), DE605 (see Oncotarget, Vol. 6, No. 14 pp.12340-12356), or a pharmaceutically acceptable salt thereof, and the like.

For example, the imidazo [1,2, -alpha] pyridine derivative is one having the structure of Formula 1 or Formula 2 as shown in "ACS Med. Chem. Lett. 2015, 6, pp.507-512". Can:

Structural Formula 1

Structural Formula 2

The anti-c-Met antibody or antigen-binding fragment thereof may be any antibody or antigen-binding fragment thereof that recognizes c-Met as an antigen. The antigen binding fragment may be selected from the group consisting of scFv, (scFv) 2, scFv-Fc, Fab, Fab 'and F (ab') 2 of the antibody.

For example, the anti-c-Met antibody may be any antibody or antigen-binding fragment thereof that specifically binds to c-Met to induce intracellular migration and degradation. The anti-c-Met antibody may be to recognize a specific site of c-Met, such as a specific site in the SEMA domain as an epitope.

The "c-Met protein" refers to receptor tyrosine kinase that binds to hepatocyte growth factor. The c-Met protein may be from any species, eg, from a primate such as human c-Met (eg NP_000236), monkey c-Met (eg Macaca mulatta, NP_001162100), or mouse c- Or from rodents such as Met (eg NP — 032617.2), rat c-Met (eg NP — 113705.1), and the like. The protein includes, for example, a polypeptide encoded by a nucleotide sequence provided in GenBank Aceession Number NM_000245, or a protein encoded by a polypeptide sequence provided in GenBank Aceession Number NM_000236, or an extracellular domain thereof. Receptor tyrosine kinase c-Met is involved in various mechanisms, for example, cancer development, cancer metastasis, cancer cell migration, cancer cell infiltration, neovascularization process, and the like.

C-Met, a receptor for hepatocyte growth factor, is divided into three parts: extracellular site, transmembrane site, and intracellular site. In the extracellular site, the α- and β-subunits are separated by disulfide bonds. In linked form, it consists of the HGF binding domain, the SEMA domain, the PSI domain (plexin-semaphorins-integrin homology domain), and the IPT domain (immunoglobulin-like fold shared by plexins and transcriptional factors domain). The SEMA domain of the c-Met protein may have an amino acid sequence of SEQ ID NO: 79, and is a domain existing at an extracellular site of c-Met and corresponds to a site to which HGF binds. A region having an amino acid sequence of SEQ ID NO: 71 corresponding to a specific site in the SEMA domain, for example, 106 to 124, is a loop between propeller domains 2 and 3 of the epitopes in the SEMA domain of the c-Met protein. Corresponds to the site, and can act as the epitope of the anti-c-Met antibody proposed in the present invention.

The term “epitope” is an antigenic determinant and is understood to mean a portion of an antigen recognized by an antibody. According to one embodiment, the epitope is the 106th site in a site comprising five or more contiguous amino acids in the SEMA domain (SEQ ID NO: 79) of the c-Met protein, eg, the SEMA domain (SEQ ID NO: 79) of the c-Met protein. To 124 th may include the contiguous 5 to 19 amino acids located in SEQ ID NO: 71. For example, the epitope may be composed of 5 to 19 consecutive amino acids including SEQ ID NO: 73 (EEPSQ) of the amino acid sequence of SEQ ID NO: 71, for example, SEQ ID NO: 71, SEQ ID NO: 72 or SEQ ID NO: 73 It may be a polypeptide having.

The epitope having the amino acid sequence of SEQ ID NO: 72 corresponds to the outermost position of the loop site between the domains of propeller structure 2 and 3 in the SEMA domain of c-Met protein, and the amino acid sequence of SEQ ID NO: 73 The epitope having is the site to which the antibody or antigen binding fragment according to one embodiment most specifically binds.

Accordingly, the anti-c-Met antibody may specifically bind to an epitope comprising 5 to 19 consecutive amino acids comprising SEQ ID NO: 73 (EEPSQ) in the amino acid sequence of SEQ ID NO: 71, eg, a sequence. Or an antibody or antigen binding fragment that specifically binds to an epitope having the amino acid sequence of SEQ ID NO: 71, SEQ ID NO: 72, or SEQ ID NO: 73.

According to one embodiment, the anti-c-Met antibody,

Consecutive 8 to 19 comprising CDR-H1 having the amino acid sequence of SEQ ID NO: 4, the amino acid sequence of SEQ ID NO: 5, the amino acid sequence of SEQ ID NO: 2, or the third to tenth amino acids within the amino acid sequence of SEQ ID NO: 2 CDR-H2 having an amino acid sequence consisting of four amino acids, and the amino acid sequence of SEQ ID NO: 6, the amino acid sequence of SEQ ID NO: 85, or a contiguous 6 to 6 amino acid including the first to sixth amino acids in the amino acid sequence of SEQ ID NO: 85; At least one heavy chain complementarity determining region (CDR) selected from the group consisting of CDR-H3 having an amino acid sequence of 13 amino acids, or a heavy chain variable region comprising said at least one heavy chain complementarity determining region;

CDR-L1 having an amino acid sequence of the amino acid sequence of SEQ ID NO: 7, CDR-L2 having an amino acid sequence of SEQ ID NO: 8, and an amino acid sequence of SEQ ID NO: 9, SEQ ID NO: 15, amino acid sequence of SEQ ID NO: 86, or SEQ ID NO: 89 At least one light chain complementarity determining region or at least one light chain complementarity determining region selected from the group consisting of CDR-L3 having an amino acid sequence consisting of 9 to 17 amino acids comprising the first to ninth amino acids in the amino acid sequence of Light chain variable region;

A combination of the heavy chain complementarity determining region and the light chain complementarity determining region; or

Combination of the heavy chain variable region and light chain variable region

It may be to include.

SEQ ID NO: 4 to SEQ ID NO: 9 is an amino acid sequence represented by the general formulas (I) to (VI), respectively:

Formula Ⅰ

Xaa ₁ -Xaa ₂ -Tyr-Tyr-Met-Ser (SEQ ID NO: 4),

Formula II

Arg-Asn-Xaa ₃ -Xaa ₄ -Asn-Gly-Xaa ₅ -Thr (SEQ ID NO: 5),

Formula III

Asp-Asn-Trp-Leu-Xaa ₆ -Tyr (SEQ ID NO: 6),

Formula IV

Lys-Ser-Ser-Xaa ₇ -Ser-Leu-Leu-Ala-Xaa ₈ -Gly-Asn-Xaa ₉ -Xaa ₁₀ -Asn-Tyr-Leu-Ala (SEQ ID NO: 7)

General Formula Ⅴ

Trp-Xaa ₁₁ -Ser-Xaa ₁₂ -Arg-Val-Xaa ₁₃ (SEQ ID NO: 8)

General formula Ⅵ

Xaa ₁₄ -Gln-Ser-Tyr-Ser-Xaa ₁₅ -Pro-Xaa ₁₆ -Thr (SEQ ID NO: 9)

In Formula I, Xaa ₁ is absent or Pro or Ser, Xaa ₂ is Glu or Asp,

In Formula II, Xaa ₃ is Asn or Lys, Xaa ₄ is Ala or Val, Xaa ₅ is Asn or Thr,

In Formula III, Xaa ₆ is Ser or Thr,

In Formula IV, Xaa ₇ is His, Arg, Gln or Lys, Xaa ₈ is Ser or Trp, Xaa ₉ is His or Gln, Xaa ₁₀ is Lys or Asn,

In Formula V, Xaa ₁₁ is Ala or Gly, Xaa ₁₂ is Thr or Lys, Xaa ₁₃ is Ser or Pro,

In Formula VI, Xaa ₁₄ is Gly, Ala or Gln, Xaa ₁₅ is Arg, His, Ser, Ala, Gly or Lys, and Xaa ₁₆ is Leu, Tyr, Phe or Met.

In one embodiment, the CDR-H1 may have an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 22, SEQ ID NO: 23 and SEQ ID NO: 24. The CDR-H2 may have an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 25, and SEQ ID NO: 26. The CDR-H3 may have an amino acid sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 27, SEQ ID NO: 28, and SEQ ID NO: 85.

The CDR-L1 may have an amino acid sequence selected from the group consisting of SEQ ID NO: 10, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, and SEQ ID NO: 106. The CDR-L2 may have an amino acid sequence selected from the group consisting of SEQ ID NO: 11, SEQ ID NO: 34, SEQ ID NO: 35, and SEQ ID NO: 36. The CDR-L3 may have an amino acid sequence selected from the group consisting of SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 37, SEQ ID NO: 86, and SEQ ID NO: 89.

In one embodiment, the antibody or antigen-binding fragment is a polypeptide having an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 22, SEQ ID NO: 23 and SEQ ID NO: 24 (CDR-H1), SEQ ID NO: 2, SEQ ID NO: 25, and a polypeptide having an amino acid sequence selected from the group consisting of SEQ ID NO: 26 (CDR-H2), and a poly having an amino acid sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 27, SEQ ID NO: 28, and SEQ ID NO: 85 A heavy chain variable region comprising a peptide (CDR-H3); And polypeptide (CDR-L1), SEQ ID NO: 11, SEQ ID NO: 10, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, and SEQ ID NO: 106; A polypeptide (CDR-L2) having an amino acid sequence selected from the group consisting of SEQ ID NO: 34, SEQ ID NO: 35, and SEQ ID NO: 36, and SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, sequence It may comprise a light chain variable region comprising a polypeptide (CDR-L3) having an amino acid sequence selected from the group consisting of SEQ ID NO: 37, SEQ ID NO: 86, and SEQ ID NO: 89.

According to one embodiment, in the anti-c-Met antibody or antigen-binding fragment, the heavy chain variable region is SEQ ID NO: 17, SEQ ID NO: 74, SEQ ID NO: 87, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93 or An amino acid sequence of SEQ ID NO: 94, wherein the light chain variable region is SEQ ID NO: 109, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 75, SEQ ID NO: 88, SEQ ID NO: 95, SEQ ID NO: 96 , SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99 or may include the amino acid sequence of SEQ ID NO: 107.

Animal-derived antibodies that are produced by immunizing a desired antigen with an immunized animal are generally capable of immunorejection upon administration to humans for therapeutic purposes, and chimeric antibodies have been developed to suppress such rejection. Chimeric antibodies are obtained by replacing the constant region of an animal-derived antibody causing an anti-isotype reaction with the constant region of a human antibody using genetic engineering methods. Chimeric antibodies have been significantly improved in anti-isotype responses compared to animal derived antibodies, but still contain adverse effects on potential anti-idiotypic reactions due to the presence of animal-derived amino acids in the variable region. Doing. Humanized antibodies have been developed to ameliorate these side effects. It is produced by implanting a complementary region determining region (CDR), which plays an important role in antigen binding, among the variable regions of chimeric antibodies in the human antibody framework.

The most important aspect of CDR grafting technology for producing humanized antibody is to select an optimized human antibody that can best accept the CDR region of an animal-derived antibody. structure analysis and molecular modeling techniques. However, even when the CDR region of an animal-derived antibody is implanted into an optimized human antibody skeleton, there are many amino acids that are located in the skeleton of an animal-derived antibody and affect antigen binding. As such, the application of additional antibody engineering techniques to restore antigen binding capacity is essential.

According to one embodiment, the antibody may be a mouse derived antibody, a mouse-human chimeric antibody, a humanized antibody, or a human derived antibody. The antibody or antigen-binding fragment thereof may be isolated in vivo or non-naturally occurring (ie, not naturally present). The antibody or antigen-binding fragment thereof may be prepared recombinantly or synthetically.

A complete antibody is a structure having two full length light chains and two full length heavy chains, each of which is linked by heavy and disulfide bonds. The constant region of the antibody is divided into a heavy chain constant region and a light chain constant region, and the heavy chain constant region has a gamma (γ), mu (μ), alpha (α), delta (δ) and epsilon (ε) type, and a subclass. Gamma 1 (γ1), gamma 2 (γ2), gamma 3 (γ3), gamma 4 (γ4), alpha 1 (α1) and alpha 2 (α2). The constant regions of the light chains have kappa (κ) and lambda (λ) types.

The term "heavy chain" refers to the variable region domain V _H and the three constant region domains C _H1 , C _H2 and C _H3 and hinges, comprising an amino acid sequence having a variable region sequence sufficient to confer specificity to the antigen. It is interpreted to include both the full length heavy chain including the hinge and fragments thereof. In addition, the term “light chain” refers to both the full-length light chain and fragment thereof comprising the variable region domain V _L and the constant region domain C _L comprising an amino acid sequence having sufficient variable region sequence to confer specificity to the antigen. It is interpreted to include.

The term "complementarity determining region" refers to the amino acid sequences of the hypervariable regions of the heavy and light chains of immunoglobulins. The heavy and light chains may each comprise three CDRs (CDRH1, CDRH2, CDRH3 and CDRL1, CDRL2, CDRL3). The CDRs can provide key contact residues for the antibody to bind antigen or epitope. Meanwhile, in the present specification, the term "specifically binds" or "specifically recognized" is the same as commonly known to those skilled in the art, and the antigen and the antibody specifically interact with each other to perform an immunological response. Means that.

The term “antigen binding fragment” refers to a portion of a polypeptide that includes a portion to which an antigen can bind, as a fragment thereof for the entire structure of an immunoglobulin. In one embodiment, the antigen binding fragment may be, but is not limited to, scFv, (scFv) ₂ , Fab, Fab 'or F (ab') ₂ . Fab of the antigen-binding fragment has one antigen-binding site in a structure having a variable region of the light and heavy chains, a constant region of the light chain and a first constant region of the heavy chain (C _H1 ).

Fab 'differs from Fab in that it has a hinge region comprising one or more cysteine residues at the C-terminus of the heavy chain C _H1 domain.

F (ab ') ₂ antibodies are produced when the cysteine residues of the hinge region of Fab' form disulfide bonds. Recombinant techniques for generating Fv fragments with minimal antibody fragments in which Fv has only heavy and variable chain regions are well known in the art.

Double-chain Fv is a non-covalent bond in which the heavy chain variable region and the light chain variable region are linked, and the single-chain Fv is generally shared by the variable region of the heavy chain and the short chain variable region through a peptide linker. It may be linked by bond or directly at the C-terminus to form a dimer-like structure such as a double chain Fv. The peptide linker may be a polypeptide consisting of 1 to 100 or 2 to 50 arbitrary amino acids, and the amino acid type included therein is not limited.

The antigen binding fragments can be obtained using proteolytic enzymes (e.g., restriction digestion of the entire antibody with papain can yield Fab and cleavage with pepsin can yield F (ab ') ₂ fragment). It can be produced through genetic recombination technology.

The previously defined CDR or light chain variable region and heavy chain variable region of the anti-c-Met antibody (e.g., light chain constant region and heavy chain constant region) are immunoglobulins of all subtypes (eg, IgA, IgD, IgE, And (eg, light chain constant region and heavy chain constant region) derived from IgG (IgG1, IgG2, IgG3, IgG4), IgM, and the like.

The term “hinge region” refers to a region included in the heavy chain of an antibody, which exists between CH1 and CH2 regions, and which functions to provide flexibility of the antigen binding site in the antibody.

When an animal-derived antibody undergoes chimerization, the animal-derived IgG1 hinge is replaced with a human IgG1 hinge, but the animal-derived IgG1 hinge is shorter than the human IgG1 hinge and has a disulfide bond between two heavy chains. Disulfide bonds are reduced from three to two, resulting in different rigidity of the hinges. Thus, modification of the hinge region can increase the antigen binding efficiency of the humanized antibody. Deletion, addition or substitution of amino acids for modifying the amino acid sequence of the hinge region is well known to those skilled in the art.

Thus, in one embodiment of the present invention, to enhance antigen binding efficiency, the anti-c-Met antibody or antigen-binding fragment comprises a hinge region in which the amino acid sequence is modified by deletion, addition or substitution of one or more amino acids. Can be. For example, the antibody may comprise a hinge region having an amino acid sequence of SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 103, or SEQ ID NO: 104, or a hinge region having an amino acid sequence of SEQ ID NO: 105 (unmodified human hinge). Area). More specifically, the hinge region may have an amino acid sequence of SEQ ID NO: 100 or SEQ ID NO: 101.

In one embodiment, the anti-c-Met antibody may be a monoclonal antibody that specifically binds to an extracellular region of the c-Met protein produced in a hybridoma cell with accession number KCLRF-BP-00220. (See Korean Patent Publication No. 2011-0047698; which document is incorporated herein by reference). The anti-c-Met antibody may include all of the antibodies defined in Korean Patent Publication No. 2011-0047698.

The light chain constant region and the heavy chain constant region except for the previously defined CDR region or the light chain variable region and the heavy chain variable region of the anti-c-Met antibody may be the light chain constant region and the heavy chain constant region of all subtypes of immunoglobulins.

According to one embodiment, the anti-c-Met antibody,

The amino acid sequence of SEQ ID NO: 62 (wherein the first to seventeenth amino acid sequences are signal peptides), the amino acid sequence of the 18th to 462th sequences of SEQ ID NO: 62, and the amino acid sequence of SEQ ID NO: 64 (from the first The 17th amino acid sequence is the signal peptide) or the 18th to 461th amino acid sequence of SEQ ID NO: 64, the amino acid sequence of SEQ ID NO: 66 (wherein the 1st to 17th amino acid sequences are signal peptide), And a heavy chain comprising an amino acid sequence selected from the group consisting of the 18th to 460th amino acid sequences of SEQ ID 66; And

The amino acid sequence of SEQ ID NO: 68 (the amino acid sequence of 1st to 20th among them is a signal peptide), the amino acid sequence of the 21st to 240th amino acids of SEQ ID NO: 68, and the amino acid sequence of SEQ ID NO: 70 (from 1st of these) A light chain comprising an amino acid sequence selected from the group consisting of the amino acid sequence of the 20th amino acid sequence), the 21st to 240th amino acid sequence of SEQ ID 70, and the amino acid sequence of SEQ ID 108

It may be to include.

For example, the anti-c-Met antibody,

A heavy chain comprising the amino acid sequence of SEQ ID NO: 62 or the amino acid sequence of the 18th to 462th sequence of SEQ ID NO: 62 and a light chain comprising the amino acid sequence of SEQ ID NO: 68 or the amino acid sequence of the 21st to 240th amino acids of SEQ ID NO: 68; Antibody comprising;

A heavy chain comprising the amino acid sequence of SEQ ID NO: 64 or the amino acid sequence of the 18th to 461th sequences of SEQ ID NO: 64 and a light chain comprising the amino acid sequence of SEQ ID NO: 68 or the amino acid sequence of the 21st to 240th amino acids of SEQ ID NO: 68; Antibody comprising;

A heavy chain comprising the amino acid sequence of SEQ ID NO: 66 or the amino acid sequence of the 18th to 460th sequence of SEQ ID NO: 66 and a light chain comprising the amino acid sequence of SEQ ID NO: 68 or the amino acid sequence of the 21st to 240th amino acids of SEQ ID NO: 68; Antibody comprising;

A heavy chain comprising the amino acid sequence of SEQ ID NO: 62 or the amino acid sequence of the 18th to 462th sequence of SEQ ID NO: 62 and a light chain comprising the amino acid sequence of SEQ ID NO: 70 or the amino acid sequence of the 21st to 240th amino acids of SEQ ID NO: 70; Antibody comprising;

A heavy chain comprising the amino acid sequence of SEQ ID NO: 64 or the amino acid sequence of the 18th to 461th sequence of SEQ ID NO: 64 and a light chain comprising the amino acid sequence of SEQ ID NO: 70 or the amino acid sequence of the 21st to 240th amino acids of SEQ ID NO: 70; Antibody comprising; or

A heavy chain comprising the amino acid sequence of SEQ ID NO: 66 or the amino acid sequence of the 18th to 460th sequence of SEQ ID NO: 66 and a light chain comprising the amino acid sequence of the amino acid sequence of SEQ ID NO: 70 or the 21st to 240th amino acid sequence of SEQ ID NO: 70; Containing antibody

An antibody comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 62 or the amino acid sequence of the 18th to 462th sequence of SEQ ID NO: 62 and a light chain comprising the amino acid sequence of SEQ ID NO: 108;

An antibody comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 64 or the amino acid sequence of the 18th to 461th sequences of SEQ ID NO: 64 and a light chain comprising the amino acid sequence of SEQ ID NO: 108; And

An antibody comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 66 or the amino acid sequence of the 18th to 460th sequence of SEQ ID NO: 66 and a light chain comprising the amino acid sequence of SEQ ID NO: 108

It may be selected from the group consisting of.

On the other hand, the polypeptide having the amino acid sequence of SEQ ID NO: 70 is a light chain consisting of a human kappa constant region, the polypeptide having the amino acid sequence of SEQ ID NO: 68 is 36 times (kabat numbering) in the polypeptide having the amino acid sequence of SEQ ID NO: 70 According to the 62nd amino acid position in SEQ ID NO: 68) histidine is a form of polypeptide substituted with tyrosine. Due to the substitution, the yield of the antibody according to one embodiment may be increased. Also, the polypeptide having the amino acid sequence of SEQ ID NO: 108 is located at position 27e by kabat numbering in the polypeptide having the 21st to 240th amino acid sequence except for the 1st to 20th signal peptides among the amino acid sequences of SEQ ID NO: 68 serine (Ser) of position 32 according to kabat numbering (in SEQ ID NO: 108; inside CDR-L1) is substituted with tryptophan (Trp), and because of this substitution, the activity of the antibody according to one embodiment (eg, binding affinity for c-Met, c-Met degrading activity and Akt phosphorylation inhibitory activity, etc.) may be further enhanced.

In one embodiment, the anti-c-Met antibody may be an anti-c-Met antibody comprising a light chain complementarity determining region of SEQ ID NO: 106, a light chain variable region of SEQ ID NO: 107, or a light chain of SEQ ID NO: 108.

The c-Met inhibitor may be applied (administered) together with a pharmaceutically acceptable carrier, and the pharmaceutically acceptable carrier, which is commonly used in the formulation of drugs, includes lactose, dextrose, sucrose, sorbitol , Mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate , Talc, magnesium stearate, mineral oil and the like may be one or more selected from the group, but is not limited thereto. The c-Met inhibitor further includes at least one selected from the group consisting of diluents, excipients, lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc., which are commonly used in the manufacture of pharmaceutical compositions, in addition to the above components. can do.

The c-Met inhibitor may be administered orally or parenterally. In the case of parenteral administration, it can be administered by intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, endothelial administration, topical administration, intranasal administration, pulmonary administration or rectal administration. In oral administration, because proteins or peptides are digested, oral compositions should be formulated to coat the active agent or to protect it from degradation in the stomach. In addition, the c-Met inhibitor may be administered by any device in which the active agent may migrate to the target cell.

As used herein, "pharmaceutically effective amount" refers to an amount in which a drug can produce a pharmaceutically meaningful effect. The pharmaceutically effective amount of a c-Met inhibitor for a single dose depends on factors such as the formulation method, mode of administration, patient's age, weight, sex, morbidity, food, time of administration, interval of administration, route of administration, rate of excretion and response to response. It can be prescribed in various ways. For example, the pharmaceutically effective amount of the c-Met inhibitor for single administration may range from 0.001 to 100 mg / kg, or from 0.02 to 10 mg / kg, but is not limited thereto. Pharmaceutically effective amounts for single administration may be formulated into one formulation in unit dosage form, may be formulated in appropriate quantities, or may be prepared within a multi-dose container.

In the present invention c-Met inhibitors can be used for the prevention and / or treatment of cancer and / or cancer metastasis. The cancer may be associated with overexpression and / or abnormal activation of c-Met and may be solid or hematological cancer. For example, the cancer may be squamous cell carcinoma, small cell lung cancer, non-small cell lung cancer, lung adenocarcinoma, lung squamous cell carcinoma, peritoneal cancer, skin cancer, skin or intraocular melanoma, rectal cancer, anal muscle cancer, esophageal cancer, small intestine cancer, endocrine Adenocarcinoma, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, chronic or acute leukemia, lymphocyte lymphoma, hepatocellular carcinoma, gastrointestinal cancer, gastric cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, liver tumor, breast cancer, colon cancer , Colon cancer, endometrial or uterine cancer, salivary gland cancer, kidney cancer, prostate cancer, vulva cancer, thyroid cancer, head and neck cancer, brain cancer, osteosarcoma, etc. may be one or more selected from the group, but is not limited thereto. Such cancers include primary cancer as well as metastatic cancer. In addition, the cancer may be a cancer (eg, solid cancer such as gastric cancer, lung cancer, kidney cancer, etc.) resistant to existing c-Met inhibitors, such as anti-c-Met antibodies. In one example, the cancer may be gastric cancer or gastric cancer resistant to c-Met inhibitors such as anti-c-Met antibodies.

The prophylactic and / or therapeutic effect of the cancer includes not only the effect of inhibiting the growth of cancer cells, but also the effect of inhibiting migration, invasion, metastasis and the like, thereby inhibiting the exacerbation of the cancer. .

Through the present invention, by predicting the reactivity (c-Met inhibitor efficacy) of each patient to the c-Met inhibitor in advance, it is possible to effectively tailor the individual treatment using the c-Met inhibitor, c-Met after administration of c-Met inhibitor By monitoring the responsiveness to Met inhibitors to determine whether c-Met inhibitors continue to be administered, more efficient treatment strategies can be established.

1 is a graph showing the relative cell viability (%) of anti-c-Met antibody against gastric cancer cell lines MKN45, SNU5, and Hs746T according to the concentration of anti-c-Met antibody (ug / ml).

FIG. 2 is a graph showing the relative cell viability (%) of anti-c-Met antibodies against gastric cancer cell lines NCI-N87, SNU668, MKN74, and NUGC4, depending on the concentration of anti-c-Met antibody (ug / ml).

3 is a graph showing the relative cell viability (%) of crizotinib against gastric cancer cell lines MKN45, Hs746T, SNU668, and MKN74 according to the concentration of crizotinib (nM).

4 is a graph showing the relative cell viability (%) of PHA665752 against gastric cancer cell lines MKN45, Hs746T, SNU668, and MKN74 according to the concentration (nM) of PHA665752.

FIG. 5 is a graph showing DKK1 gene expression levels in gastric cancer cell lines (“blue: efficacy group”: HS746T, MNK45, SNU5; “red: ineffective group”: MNK74, NUGC4, NCIN87, SNU688 in the figure).

FIG. 6 is a graph showing the expression levels of DKK1 genes of the reactive cell line (effective group) and the non-reactive cell line (ineffective group) with respect to the anti-c-Met antibody in the expression level results of FIG. 5.

Figure 7 is a graph showing the results of measuring the DKK1 gene expression level by RT-PCR in gastric cancer cell line.

8 is a graph showing the results of measuring the DKK1 protein expression level in the gastric cancer cell line by ELISA.

Figure 9 is a graph showing the cancer cell proliferation inhibitory effect of the anti-c-Met antibody to DKK1 siRNA-treated gastric cancer patient-derived cells.

10 is a graph showing the cancer cell proliferation inhibitory effect when the anti-c-Met antibody and the Wnt signaling inhibitor are administered in combination to the gastric cancer cell line induced anti-c-Met antibody resistance.

Hereinafter, the present invention will be described in more detail with reference to Examples and Test Examples. However, these examples and test examples are for illustrating the present invention and should not be construed as limiting the present invention.

참고예Reference Example 1: 항 c-Met 항체의 제작 1: Construction of Anti-c-Met Antibody

1.1. c1.1. c -Met에 대한 마우스 항체 'Mouse Antibodies Against -Met '' AbF46AbF46 '의 생산Production

1.1.1.1. 1. 마우스의1. Mouse 면역화 Immunization

To obtain the immunized mice required for the development of hybridoma cell lines, 5 mice each had 100 μg of human c-Met / Fc fusion protein (R & D Systems) equivalent to a complete Freund's adjuvant. Were mixed and injected intraperitoneally of 4-6 week old BALB / c mice (Japan SLC, Inc.). Two weeks later, 50 μg of the previous injection of the human c-Met / Fc fusion protein used as the antigen was mixed with the same amount of incomplete Freund's adjuvant in the same manner as above. Intraperitoneal injection. One week later, the last boosting (boosting) was performed 3 days after the blood was collected from the tail of the mouse to obtain a serum was diluted in PBS to 1/1000 to confirm that the titer of the antibody that recognizes c-Met by ELISA. As a result, mice obtained with sufficient amounts of antibodies were selected, and the following cell fusion process was performed.

1.1.1.1. 2. 세포2. Cell 융합 및 Fusion and 하이브리도마의Hybridoma 제조 Produce

Three days before the cell fusion experiment, 50 μg of PBS was injected with a mixture of human c-Met / Fc fusion protein intraperitoneally of BALB / c mice (Japan SLC, Inc.), and the anesthetized immunized mice were placed on the left side of the trunk. Located spleen was removed. Cells were isolated by grinding the spleens with a mesh and mixed with culture medium (DMEM, GIBCO, Invitrogen) to make a splenocyte suspension. The suspension was centrifuged to recover the cell layer. The obtained splenocytes 1x10 ⁸ and myeloma cells (Sp2 / 0) 1x10 ⁸ were mixed and centrifuged to precipitate the cells. The centrifuged precipitate was slowly dispersed, treated with 45% (w / v) polyethylene glycol (PEG) (1 mL) contained in the culture medium (DMEM), maintained at 37 ° C. for 1 minute, and then culture medium. 1 ml (DMEM) was added. Thereafter, 10 ml of culture medium (DMEM) was added for 1 minute, left for 5 minutes in water at 37 ° C., and centrifuged again at 50 ml. The cell precipitate was resuspended in a separation medium (HAT medium) at about 1 × 2 × 10 ⁵ / ml, aliquoted in 96 ml well plates, and cultured in a 37 ° C. carbon dioxide incubator to prepare a hybridoma cell group.

1.1. 3. Screening for Hybridoma Cells Producing Monoclonal Antibodies to c- Met Protein

Human c-Met / Fc fusion protein and human Fc protein were used as antigens to select hybridoma cells that specifically react with c-Met protein among the hybridoma cell groups prepared in Reference Example 1.1.2. Screened through ELISA assay method.

50 μl (2 ug / ml) of each human c-Met / Fc fusion protein was added to the microtiter plate and attached to the plate surface, and unreacted antigens were washed out. Human Fc protein was attached to the plate surface in the same manner as above to select and exclude antibodies that bind to Fc but not c-Met.

50 μl of each of the hybridoma cells obtained in Reference Example 1.1.2 was added to each of the prepared wells, followed by reaction for 1 hour, followed by sufficient washing with phosphate buffer-twin 20 (TBST) solution to remove unreacted culture. It was. To this was added goat anti-mouse IgG-horseradish peroxidase (goat anti-mouse IgG-HRP), reacted at room temperature for 1 hour, and then sufficiently washed with TBST solution. Subsequently, the substrate solution (OPD) of peroxidase was added to react, and the reaction degree was confirmed by measuring absorbance at 450 nm with an ELISA Reader.

By confirming the degree of reaction as described above, hybridoma cell lines that do not bind to human Fc but secrete antibodies with high specificity only to human c-Met protein were repeatedly selected. Limiting dilution of the hybridoma cell line obtained through repeated screening yielded a final clone of one hybridoma cell line producing monoclonal antibody. The final screened monoclonal antibody-producing hybridomas were deposited on October 6, 2009 with the Korea Cell Line Research Foundation, located in Yeongun-dong, Jongno-gu, Seoul, under the Treaty of Budapest, and received accession number KCLRF-BP-00220 (Korea See Publication 2011-0047698).

1.1.1.1. 4. 단일클론4. Monoclonal 항체의 생산 및 정제 Production and Purification of Antibodies

The hybridoma cells obtained in Reference Example 1.1.3 were cultured in serum-free medium, and monoclonal antibodies were produced and purified from the culture.

First, the hybridoma cells cultured in 50 ml of culture medium (DMEM) medium containing 10% (v / v) FBS were centrifuged, and the cell precipitates were washed two or more times with 20 ml PBS to remove FBS. The cell precipitate was resuspended in 50 ml of culture medium (DMEM) medium, and then cultured in a 37 ° C. carbon dioxide incubator for 3 days.

Subsequently, the cells producing the antibody were removed by centrifugation, and the culture medium in which the antibodies were secreted was separated and stored at 4 ° C. or collected immediately and used for separation and purification of the antibody. After purely purifying the antibody from 50 ml to 300 ml of the prepared culture medium using an AKTA purification apparatus (GE Healthcare) equipped with a Protein G agarose column (Pharmacia, USA), a protein aggregation filter (Amicon) was used. Purified antibody was stored by substituting the supernatant with PBS for use in subsequent examples.

1.2. c1.2. c -Met에 대한 For -Met 키메릭Chimeric 항체 Antibodies chAbF46의of chAbF46 제작 making

In general, mouse antibodies are highly likely to show immunogenicity when injected into humans for therapeutic purposes. To address this, mutations related to antigen binding from the mouse antibody AbF46 produced in Reference Example 1.1.4 above may be solved. A chimeric antibody chAbF46 was constructed in which the constant region except for the variable region was substituted with the sequence of the human IgG1 antibody.

The nucleotide sequence corresponding to the heavy chain is 'EcoRI-signal sequence-VH-NheI-CH-TGA-XhoI' (SEQ ID NO: 38), and the nucleotide sequence corresponding to the light chain is 'EcoRI-signal sequence-VL-BsiWI-CL-TGA' Each gene was designed to be composed of -XhoI '(SEQ ID NO: 39). Subsequently, the DNA fragment (SEQ ID NO: 38) having the nucleotide sequence corresponding to the heavy chain was added to the pOptiVEC ^™ -TOPO TA Cloning Kit included in the OptiCHO ^™ Antibody Express Kit (Cat no. 12762-019) of Invitrogen, pcDNA ^™ 3.3 -TOPO By cloning a DNA fragment (SEQ ID NO: 39) having a nucleotide sequence corresponding to the light chain in a TA Cloning Kit (Cat no. 8300-01) using EcoRI (NEB, R0101S) and XhoI (NEB, R0146S) restriction enzymes, respectively , Vectors comprising a heavy chain for expression of chimeric antibodies and vectors comprising a light chain were constructed, respectively.

The constructed vectors were amplified using Qiagen Maxiprep kit (Cat no. 12662), respectively, and the temporary expression was Freestyle ^TM. This was done using the MAX 293 Expression System (invitrogen). The cell line used was 293 F cells, and cultured by suspension culture using FreeStyle ™ 293 Expression Medium as a medium. The cells were prepared at a concentration of 5x10 ⁵ cells / ml one day before the temporary expression, and then after 24 hours, the cells were temporarily expressed when the number of cells reached 1x10 ⁶ cells / ml. Transfection was performed by liposomal reagent method using Freestyle ^TM MAX reagent (invitrogen), and the DNA was prepared in a ratio of heavy chain DNA to light chain DNA = 1: 1 in a 15 ml tube and mixed with 2 ml of OptiPro ™ SFM (invtrogen). and (a), also after the other Freestyle ^TM MAX reagent 100㎕ with OptiPro ™ SFM 2ml mix (B) to the 15ml tube, then incubation 15 minutes to mix the (a) and (B), the cells prepared the day before The mixture was mixed slowly. After completion of the transduction, incubation for 5 days at 37 ℃, 80% humidity, 8% CO _2, 130 rpm incubator.

Then, incubated in DMEM medium with 10% (v / v) FBS for 5 hours at 37 ° C. and 5% CO ₂ conditions, then 37 ° C., 5% CO ₂ for 48 hours in DMEM medium without FBS. Incubated under conditions.

The cultured cells were centrifuged to obtain 100 ml of supernatant, respectively, and purified using AKTA Prime (GE healthcare). Protein A column (GE healthcare, 17-0405-03) was installed in AKTA Prime, and the culture solution was flowed at a flow rate of 5 ml / min, and then eluted with IgG elution buffer (Thermo Scientific, 21004). The obtained eluate was exchanged with PBS buffer to finally purify the chimeric antibody AbF46 (hereinafter referred to as chAbF46).

1.3. 키메릭1.3. Chimeric 항체 Antibodies chAbF46으로부터from chAbF46 인간화 항체 Humanized antibodies huAbF46의of huAbF46 제작 making

1.3.1.3. 1. 중쇄의1. of heavy chain 인간화(Heavy chain humanization) Heavy chain humanization

For the design of H1-heavy and H3-heavy, first, the VH gene of the mouse antibody AbF46 purified in Reference Example 1.2 above through Ig Blast (http://www.ncbi.nlm.nih.gov/igblast/) The germline genes of humans with the highest homology with were analyzed. As a result, it was confirmed that VH3-71 had 83% homology at the amino acid level, CDR-H1, CDR-H2, CDR-H3 of mouse antibody AbF46 were defined as Kabat numbering, and the CDR portion of mouse antibody AbF46 was defined as It was designed to be introduced into the framework of VH3-71. At this time, amino acids 30 (S → T), 48 (V → L), 73 (D → N), and 78 (T → L) were back-mutated with the amino acid sequence of the original mouse AbF46 antibody. Afterwards, H1 mutated the amino acids 83 (R → K) and 84 (A → T) to finally construct H1-heavy (SEQ ID NO: 40) and H3-heavy (SEQ ID NO: 41).

For the design of H4-heavy, the framework sequence of human antibody was found. As a result, Kabat numbering was defined using the most stable VH3 subtype known to be similar to that of AbF46 antibody. CDR-H1, CDR-H2, CDR-H3 of the mouse antibody AbF46 were introduced. This established H4-heavy (SEQ ID NO: 42).

1.3.1.3. 2. 경쇄의2. light chain 인간화(Light chain humanization) Light chain humanization

For the design of H1-light (SEQ ID NO: 43) and H2-light (SEQ ID NO: 44), mouse antibody AbF46 via Ig Blast (http://www.ncbi.nlm.nih.gov/igblast/) Human germline genes having the highest homology with the VL gene were analyzed. As a result, it was confirmed that VK4-1 had 75% homology at the amino acid level, CDR-L1, CDR-L2, CDR-L3 of mouse antibody AbF46 were defined as Kabat numbering, and the CDR portion of mouse antibody AbF46 was defined as It was designed to be introduced into the backbone of VK4-1. At this time, H1-light back-mutated three amino acids 36 (Y → H), 46 (L → M), 49 (Y → I), and H2-light 49 amino acid (Y → I) Only one was constructed by back-mutation.

For the design of H3-light (SEQ ID NO: 45), Blast (http://www.ncbi.nlm.nih.gov/igblast/) was used to identify a human germline gene with the highest homology with the VL gene of the mouse antibody AbF46. Among the analyzed results, VK2-40 was selected in addition to VK4-1. It was confirmed that the mouse antibodies AbF46 VL and VK2-40 had 61% homology at the amino acid level, CDR-L1, CDR-L2, CDR-L3 of the mouse antibody AbF46 was defined as Kabat numbering, and the CDR of the mouse antibody AbF46 was determined. The part was designed to be introduced into the backbone of VK4-1. In this case, H3-light was constructed by back-mutating three amino acids 36 (Y → H), 46 (L → M), and 49 (Y → I).

For the design of H4-light (SEQ ID NO: 46), we found the framework sequences of human antibodies and found that CDR-L1 of mouse antibody AbF46, defined by Kabat numbering, using the most known Vk1 subtype, CDR-L2, CDR-L3 were introduced. At this time, H4-light was constructed by further back-mutation of three amino acids 36 (Y → H), 46 (L → M), 49 (Y → I).

Subsequently, the DNA fragment having the nucleotide sequence corresponding to the heavy chain in pOptiVEC ^™ -TOPO TA Cloning Kit included in OptiCHO ^™ Antibody Express Kit (Cat no. 12762-019) manufactured by Invitrogen (H1-heavy; SEQ ID NO: 47, H3). -heavy; SEQ ID NO: 48, H4-heavy; SEQ ID NO: 49) for pcDNA ^™ 3.3-TOPO DNA fragments having the nucleotide sequence corresponding to the light chain (H1-light; SEQ ID NO: 50, H2-light; SEQ ID NO: 51, H3-light; SEQ ID NO: 52, H4-light; SEQ ID NO: 53), respectively, were added to the TA Cloning Kit. Cloning was performed using EcoRI (NEB, R0101S) and XhoI (NEB, R0146S) restriction enzymes to construct vectors for expression of humanized antibodies.

The cultured cells were centrifuged to take 100 ml of each supernatant, and purified using AKTA Prime (GE healthcare). Protein A column (GE healthcare, 17-0405-03) was installed in AKTA Prime, and the culture solution was flowed at a flow rate of 5 ml / min, and then eluted with IgG elution buffer (Thermo Scientific, 21004). This was exchanged with PBS buffer to finally purify the humanized antibody AbF46 (hereinafter referred to as huAbF46). Meanwhile, the heavy and light chain combinations of the humanized antibody huAbF46 used in the following examples are H4-heavy (SEQ ID NO: 42) and H4-light (SEQ ID NO: 46).

1.4. huAbF461.4. huAbF46 항체의 Antibody scFvscFv 라이브러리 제작 Library Authoring

Genes for constructing the scFv of the huAbF46 antibody were designed using the heavy and light chain variable regions of the huAbF46 antibody. Each heavy and light chain variable region was in the form of 'VH-linker-VL' and the linker was designed to have an amino acid sequence of 'GLGGLGGGGSGGGGSGGSSGVGS' (SEQ ID NO: 54). The polynucleotide encoding the scFv of the huAbF46 antibody thus designed (SEQ ID NO: 55) was synthesized by Bioneer, and a vector for expressing it was shown in SEQ ID NO: 56.

Then, expressed from the vector Analysis of the results, it was confirmed that showing a specific binding force to c-Met.

1.5. 친화도1.5. Affinity 성숙(affinity maturation)을 위한 라이브러리 유전자의 제작 Construction of Library Genes for Affinity Maturation

1.5.1.5. 1. 표적1. Target CDR의CDR 선정 및 Selection and 프라이머primer 제작 making

Six complementarity determining regions (CDRs) were defined by 'Kabat numbering' from the mouse antibody AbF46 prepared above for affinity maturation of the huAbF46 antibody, and each CDR is shown in Table 1 below. .

CDRCDR	아미노산 서열Amino acid sequence
CDR-H1CDR-H1	DYYMS(서열번호 1)DYYMS (SEQ ID NO: 1)
CDR-H2CDR-H2	FIRNKANGYTTEYSASVKG(서열번호 2)FIRNKANGYTTEYSASVKG (SEQ ID NO: 2)
CDR-H3CDR-H3	DNWFAY(서열번호 3)DNWFAY (SEQ ID NO: 3)
CDR-L1CDR-L1	KSSQSLLASGNQNNYLA(서열번호 10)KSSQSLLASGNQNNYLA (SEQ ID NO: 10)
CDR-L2CDR-L2	WASTRVS(서열번호 11)WASTRVS (SEQ ID NO: 11)
CDR-L3CDR-L3	QQSYSAPLT(서열번호 12)QQSYSAPLT (SEQ ID NO: 12)

Primers were prepared as follows to introduce random sequences of antibody CDRs. Conventional random sequence introduction method using N codon to introduce the same ratio of bases (25% A, 25% G, 25% C, 25% T) to the site to be mutated, but in this example huAbF46 antibody To introduce a random base into the CDRs of the 85% of the first and second nucleotides of the wild-type nucleotides were preserved and 5% of the remaining three bases were introduced. In addition, primers were designed such that the third nucleotide was introduced equally (33% G, 33% C, 33% T).

1.5.1.5. 2. huAbF46HuAbF46 항체의 라이브러리 제작 및 c-Met에 대한 결합력 확인 Library Preparation of Antibodies and Confirmation of Avidity for c-Met

Construction of the antibody library gene by random sequence introduction of CDRs was performed using primers prepared in the same manner as in Reference Example 1.5.1. Using the polynucleotide containing the scFv of the huAbF46 antibody as a template, two PCR fragments were prepared, and through the overlap extension PCR method, the scFv library of the huAbF46 antibody mutated only the desired CDRs, respectively. Libraries were constructed to target each of the six CDRs prepared by securing the gene.

The prepared library was found to bind the wild type and c-Met of each library, each library showed a tendency to lower the binding capacity to c-Met than the wild type, but the binding capacity to some c-Met Remaining mutations were identified.

1.6. 제작된1.6. Made 라이브러리로부터 From the library 친화도가Affinity 개선된 항체의 선별 Improved Screening of Antibodies

After enhancing the binding capacity of the library to c-Met from the constructed library, the gene sequence of scFv was analyzed from each individual clone. The obtained gene sequences are shown in Table 2, respectively, and these were converted into IgG forms. Among the following clones, four antibodies produced from L3-1, L3-2, L3-3, L3-5 were selected for subsequent experiments.

클론 이름Clone name	도출된 라이브러리Derived library	CDR 서열CDR sequence
H11-4H11-4	CDR-H1CDR-H1	PEYYMS(서열번호 22)PEYYMS (SEQ ID NO: 22)
YC151YC151	CDR-H1CDR-H1	PDYYMS(서열번호 23)PDYYMS (SEQ ID NO: 23)
YC193YC193	CDR-H1CDR-H1	SDYYMS(서열번호 24)SDYYMS (SEQ ID NO: 24)
YC244YC244	CDR-H2CDR-H2	RNNANGNT(서열번호 25)RNNANGNT (SEQ ID NO: 25)
YC321YC321	CDR-H2CDR-H2	RNKVNGYT(서열번호 26)RNKVNGYT (SEQ ID NO: 26)
YC354YC354	CDR-H3CDR-H3	DNWLSY(서열번호 27)DNWLSY (SEQ ID NO: 27)
YC374YC374	CDR-H3CDR-H3	DNWLTY(서열번호 28)DNWLTY (SEQ ID NO: 28)
L1-1L1-1	CDR-L1CDR-L1	KSSHSLLASGNQNNYLA(서열번호 29)KSSHSLLASGNQNNYLA (SEQ ID NO: 29)
L1-3L1-3	CDR-L1CDR-L1	KSSRSLLSSGNHKNYLA(서열번호 30)KSSRSLLSSGNHKNYLA (SEQ ID NO: 30)
L1-4L1-4	CDR-L1CDR-L1	KSSKSLLASGNQNNYLA(서열번호 31)KSSKSLLASGNQNNYLA (SEQ ID NO: 31)
L1-12L1-12	CDR-L1CDR-L1	KSSRSLLASGNQNNYLA(서열번호 32)KSSRSLLASGNQNNYLA (SEQ ID NO: 32)
L1-22L1-22	CDR-L1CDR-L1	KSSHSLLASGNQNNYLA(서열번호 33)KSSHSLLASGNQNNYLA (SEQ ID NO: 33)
L2-9L2-9	CDR-L2CDR-L2	WASKRVS(서열번호 34)WASKRVS (SEQ ID NO 34)
L2-12L2-12	CDR-L2CDR-L2	WGSTRVS(서열번호 35)WGSTRVS (SEQ ID NO 35)
L2-16L2-16	CDR-L2CDR-L2	WGSTRVP(서열번호 36)WGSTRVP (SEQ ID NO: 36)
L3-1L3-1	CDR-L3CDR-L3	QQSYSRPYT(서열번호 13)QQSYSRPYT (SEQ ID NO: 13)
L3-2L3-2	CDR-L3CDR-L3	GQSYSRPLT(서열번호 14)GQSYSRPLT (SEQ ID NO: 14)
L3-3L3-3	CDR-L3CDR-L3	AQSYSHPFS(서열번호 15)AQSYSHPFS (SEQ ID NO: 15)
L3-5L3-5	CDR-L3CDR-L3	QQSYSRPFT(서열번호 16)QQSYSRPFT (SEQ ID NO: 16)
L3-32L3-32	CDR-L3CDR-L3	QQSYSKPFT(서열번호 37)QQSYSKPFT (SEQ ID NO: 37)

1.7. 선별된1.7. Selected 항체의 Antibody IgG로의To IgG 변환 conversion

The polynucleotides encoding the heavy chains of the four selected antibodies consist of 'EcoRI-signal sequence-VH-NheI-CH-XhoI' (SEQ ID NO: 38), and the heavy chains do not alter the amino acid of the antibody after affinity maturation. The heavy chain of huAbF46 antibody was used as it was. However, the hinge region was replaced with the U6-HC7 hinge (SEQ ID NO: 57), not the hinge of human IgG1. The light chains were designed to be composed of 'EcoRI-signal sequence-VL-BsiWI-CL-XhoI' to synthesize genes, and the polynucleotides encoding the light chain variable regions of the four antibodies selected after affinity maturation (sequences). No. 58 to SEQ ID NO: 61) were synthesized by BIONIA. Subsequently, the DNA fragment (SEQ ID NO: 38) having the nucleotide sequence corresponding to the heavy chain was added to the pOptiVEC ^™ -TOPO TA Cloning Kit included in the OptiCHO ^™ Antibody Express Kit (Cat no. 12762-019) of Invitrogen, pcDNA ^™ 3.3 -TOPO DNA fragment having a nucleotide sequence corresponding to the light chain (TA fragment containing L3-1 derived CDR-L3: SEQ ID NO: 58, including CDR-L3 derived from L3-2) in TA Cloning Kit (Cat no. 8300-01) DNA fragment comprising SEQ ID NO: 59, L3-3-derived CDR-L3 DNA fragment: SEQ ID NO: 60, L3-5-derived CDR-L3 DNA fragment: SEQ ID NO: 61) by EcoRI (NEB, R0101S) By cloning with the XhoI (NEB, R0146S) restriction enzyme, a vector was constructed for expression of affinity matured antibodies.

The cultured cells were centrifuged to take 100 ml of each supernatant, and purified using AKTA Prime (GE healthcare). Protein A column (GE healthcare, 17-0405-03) was installed in AKTA Prime, and the culture solution was flowed at a flow rate of 5 ml / min, and then eluted with IgG elution buffer (Thermo Scientific, 21004). It was exchanged with PBS buffer to finally produce four types of antibodies (hereinafter, huAbF46-H4-A1 (from L3-1), huAbF46-H4-A2 (from L3-2), huAbF46-H4-A3 (L3-). 3), and huAbF46-H4-A5 (named from L3-5)).

1.8. 불변영역 및/또는 1.8. Constant region and / or 힌지영역이Hinge area 치환된 Substituted huAbF46huAbF46 -H4-A1의 제조Preparation of -H4-A1

Among the four antibodies selected in Reference Example 1.7, the hinge region of huAbF46-H4-A1, which was determined to have the highest binding affinity with c-Met and the lowest degree of Akt phosphorylation and c-Met differentiation, Alternatively, an antibody was prepared in which the constant region and the hinge region were substituted.

An antibody consisting of a heavy chain consisting of a heavy chain variable region of huAbF46-H4-A1, a U6-HC7 hinge and a IgG1 constant region of human, and a light chain consisting of a light chain variable region of huAbF46-H4-A1 and a kappa constant region of human, was selected from huAbF46 -H4-A1 (U6-HC7); An antibody consisting of a heavy chain consisting of a heavy chain variable region of huAbF46-H4-A1, a human IgG2 hinge and a human IgG1 constant region, and a light chain consisting of a light chain variable region of huAbF46-H4-A1 and a human kappa constant region was selected from huAbF46-H4- With Al (IgG2 hinge); An antibody consisting of a heavy chain consisting of a heavy chain variable region of huAbF46-H4-A1, a human IgG2 hinge and a human IgG2 constant region, and a light chain consisting of a light chain variable region of huAbF46-H4-A1 and a human kappa constant region was selected from huAbF46-H4- Each named A1 (IgG2 Fc). On the other hand, the three antibodies were all substituted histidine No. 36 of the light chain consisting of the human kappa constant region in order to increase the production of tyrosine (tyrosine).

To prepare the three antibodies, a polynucleotide encoding the polypeptide consisting of the heavy chain variable region of huAbF46-H4-A1, the U6-HC7 hinge and the IgG1 constant region of human (SEQ ID NO: 62), huAbF46- Polynucleotide encoding the polypeptide consisting of the heavy chain variable region of H4-A1, the human IgG2 hinge and the human IgG1 constant region (SEQ ID NO: 64) (SEQ ID NO: 65), the heavy chain variable region of huAbF46-H4-A1, human IgG2 Polynucleotide encoding the polypeptide consisting of a hinge and a human IgG2 constant region (SEQ ID NO: 66) (SEQ ID NO: 67), a light chain variable region of huAbF46-H4-A1 where histidine 36 is substituted with tyrosine and a human kappa constant region A polynucleotide (SEQ ID NO: 69) encoding a polypeptide consisting of (SEQ ID NO: 68) was submitted to Bioneer and synthesized. Subsequently, the DNA fragment having the nucleotide sequence corresponding to the heavy chain was added to the pOptiVEC ^™ -TOPO TA Cloning Kit included in the OptiCHO ^™ Antibody Express Kit (Cat no. 12762-019) of Invitrogen, pcDNA ^™ 3.3-TOPO A DNA fragment having a nucleotide sequence corresponding to the light chain was inserted into a TA Cloning Kit (Cat no. 8300-01) to construct a vector for expression of the antibody.

The constructed vectors were amplified using Qiagen Maxiprep kit (Cat no. 12662), respectively, and the temporary expression was Freestyle ^TM. This was done using the MAX 293 Expression System (invitrogen). The cell line used was 293 F cells, and cultured by suspension culture using FreeStyle ™ 293 Expression Medium as a medium. The cells were prepared at a concentration of 5x10 ⁵ cells / ml one day before the temporary expression, and after 24 hours, the cells were temporarily expressed when the number of cells reached 1x10 ⁶ cells / ml. Transfection was performed by liposomal reagent method using Freestyle ^TM MAX reagent (invitrogen), and the DNA was prepared in a ratio of heavy chain DNA to light chain DNA = 1: 1 in a 15 ml tube and mixed with 2 ml of OptiPro ™ SFM (invtrogen). and (a), also after the other Freestyle ^TM MAX reagent 100㎕ with OptiPro ™ SFM 2ml mix (B) to the 15ml tube, then incubation 15 minutes to mix the (a) and (B), the cells prepared the day before The mixture was mixed slowly. After completion of the transduction, incubation for 5 days at 37 ℃, 80% humidity, 8% CO _2, 130 rpm incubator.

The cultured cells were centrifuged to take 100 ml of each supernatant, and purified using AKTA Prime (GE healthcare). Protein A column (GE healthcare, 17-0405-03) was installed in AKTA Prime, and the culture solution was flowed at a flow rate of 5 ml / min, and then eluted with IgG elution buffer (Thermo Scientific, 21004). Finally, three antibodies (huAbF46-H4-A1 (U6-HC7), huAbF46-H4-A1 (IgG2 hinge), huAbF46-H4-A1 (IgG2 Fc)) were purified. Among them, huAbF46-H4-A1 (IgG2 Fc) was selected for the anti-c-Met antibody according to the present invention and used in the following examples, and for convenience, the antibody was named L3-1Y / IgG2.

실시예Example 1: 위암 세포주의 항 c-Met 항체에 대한 효능 여부 확인 1: Confirmation of efficacy against anti-c-Met antibody in gastric cancer cell line

The anticancer efficacy of L3-1Y / IgG2 in various gastric cancer cell lines was confirmed.

Specifically, MKN45 (JCRB0254, JCRB), SNU5 (CRL-5973, ATCC), Hs746T (HTB-135, ATCC), MKN74 (JCRB0255, JCRB), NUGC4 (JCRB0834, JCRB), NCI-N87 (CRL-5822, ATCC), and SNU668 (00668, KCLB) were dispensed into a 96-well plate in 5000 quantities each, and after 24 hours antibody (L3-1Y / IgG2) was added to 0 ug (microgram) / ml, 0.00064 ug / ml, 0.0032 ug / ml, 0.016 ug / ml, 0.08 ug / ml, 0.4 ug / ml, or 2 ug / ml (MKN45, SNU5, and Hs746T), 0 ug / ml, 0.08 ug / ml, 0.4 ug / ml, 2 ug / ml, or 10 ug / ml (NCI-N87 and SNU668), or 0 ug / ml, 0.08 ug / ml, 0.04 ug / ml, 2 ug / ml, 10 ug / ml, or 50 ug / ml (NUGC4 and MKN74). 72 hours after the antibody treatment, cell number change was measured by CellTiter Glo assay (Promega, G7573). This method measures the amount of ATP that reflects the metabolism of living cells. Within the CellTiter Glo assay, a substrate is added that emits luminoscence upon reaction with ATP in the cell. By measuring this luminoscence, the number of living cells can be quantified. The results are shown in FIG. 1 (MKN45, SNU5, and Hs746T) and FIG. 2 (NCI-N87, SNU668, NUGC4, and MKN74). As shown in FIG. 1 and FIG. 2, L3-1Y / IgG2 inhibits cancer cell growth by MKN45, SNU5, and Hs746T cell lines, whereas MKN74, NUGC4, NCI-N87, and SNU668 cell lines do not exhibit this effect. You can check it. Therefore, gastric cancer cell lines MKN45, SNU5 and Hs746T were classified into L3-1Y / IgG2 efficacy group, MKN74, NUGC4, NCI-N87, and SNU668 into L3-1Y / IgG2 ineffective group.

실시예Example 2: 위암 세포주의 c-Met 저해제에 대한 효능 여부 확인 2: Validation of c-Met Inhibitors on Gastric Cancer Cell Lines

To determine the responsiveness to c-Met inhibitors other than L3-1Y / IgG2 in the gastric cancer cell line, crizotinib (Clezotinib; Selleckchem, S1068) and PHA-665752 (Selleckchem, S1070) were used to determine the anticancer efficacy It was.

Specifically, MKN45 (JCRB0254, JCRB), Hs746T (HTB-135, ATCC), MKN74 (JCRB0255, JCRB), and SNU668 (00668, KCLB) were each dispensed in a 96-well plate in 5000 quantities, and after 24 hours crizotinib or PHA665752 was treated in amounts of 0 nM, 8 nM, 16 nM, 31 nM, 63 nM, 125 nM, 250 nM, 500 nM, 1000 nM, or 2000 nM. 72 hours after the antibody treatment, cell number change was measured by CellTiter Glo assay (Promega, G7573). The results are shown in Figure 3 (Crizotinib) and Figure 4 (PHA665752). As shown in FIGS. 3 and 4, it can be seen that the cancer cell growth inhibitory effect of crizotinib and PHA665752 is higher in MKN45 and Hs746T cell lines than in SNU668 and MKN74 cell lines. Therefore, MKN45 and Hs746T can be classified into c-Met inhibitor agonist group, and SNU668 and MKN74 are c-Met inhibitor agonist group.

실시예Example 3: 위암 세포주에서 3: in gastric cancer cell line DKK1DKK1 발현량 측정 Expression level measurement

In order to determine whether there is a correlation between DKK1 expression and anti-c-Met antibody efficacy in gastric cancer cell lines, gene expression information of 38 gastric cancer cell lines (see FIG. 5) was analyzed in a CCLE (Cancer Cell Line Encyclopedia) database.

Cell lines MKN45, SNU5 and Hs746T (L3-1Y / IgG2 potency group (response group) with efficacy of anti-c-Met antibody L3-1Y / IgG2) (see Example 1) and ineffective cell lines MKN74, NUGC4, NCI When genes with large expression differences were found in -N87 and SNU668 (L3-1Y / IgG2 ineffective group (non-responder group); see Example 1), the DKK1 gene was found to show the largest difference in expression amount.

DKK1 gene expression levels of the 38 gastric cancer cell lines are shown in FIG. 5 (blue: L3-1Y / IgG2 efficacy group; red: L3-1Y / IgG2 ineffective group). The gene expression level shown in FIG. 5 is a value measured using the Affymetrix U133plus2.0 platform, and the y axis represents the average value of DKK1 gene expression levels of 38 cell lines obtained through a Gene Expression Omnibus (GEO) database. As can be seen in Figure 5, it can be seen that the DKK1 expression level of the L3-1Y / IgG2 efficacy group is significantly higher than the L3-1Y / IgG2 ineffective group.

In the results of FIG. 5, DKK1 gene expression results of the L3-1Y / IgG2 efficacy group (3 cell lines) and the L3-1Y / IgG2 ineffective group (4 cell lines) were extracted, and the distribution thereof is shown in FIG. 6 ( Resp: L3-1Y / IgG2 efficacy group; nonResp: L3-1Y / IgG2 ineffective group). As shown in Figure 5, it can be seen that the expression level of the DKK1 gene in the efficacy group is significantly higher than the ineffective group.

실시예Example 4: 항 c-Met 항체 4: anti-c-Met antibody 효능군과Efficacy group 비효능군에서의In the ineffective group DKK1DKK1 유전자 발현 검증 Gene Expression Verification

The expression level of the DKK1 gene was high in the L3-1Y / IgG2 efficacy group, and it was verified by RT-PCR. DKK1 gene expression level was measured by measuring mRNA level, and the expression level was measured using the following primers.

Sense, AGACCATTGACAACTACCAGCCGT (SEQ ID NO: 112)

Antisense, GGAATACCCATCCAAGGTGCT (SEQ ID NO: 113)

DKK1 gene expression levels were measured for L3-1Y / IgG2 agonist MKN45, Hs746T, SNU and L3-1Y / IgG2 ineffective group NUGC4, NCIN87. QPCR for the expression level measurement consists of cell seeding, RNA extraction, cDNA synthesis, RT-PCR reaction. First, to extract RNA, each cell was aliquoted at a concentration of 10 ⁶ cells / plate in a 60 mm dish and incubated for 2 days. After 2 days, RNA was extracted using RNeasy Mini kit (Qiagen, # 74106), and extracted to RNase free DW 50 ul (microliter) during RNA extraction. Two to three ug of RNA was synthesized by cDNA using a Transcriptor First Strand cDNA synthesis kit (Roche, # 04 896 866 001). At this time, it proceeded according to manufacture's protocol. pPCR reaction was performed using LC480 SYBR Green I Master (Roche, # 04 887 352 001) and LightCycler® 480 Real-Time PCR System (Roche). HPRT1 is used as an internal control to calibrate the amount of RNA in the sample. The primer sequence is as follows.

Sense, tgaccttgatttattttgcatacc (SEQ ID NO: 114)

Antisense, cgagcaagacgttcagtcct (SEQ ID NO: 115)

qPCR was performed according to the following procedure for all primers. Step 1: 95, 10 min; Step 2 (45 cycles): Step 2-1: 95 ° C., 10 sec; Step 2-2: 60, 20 sec; Step 2-3: 72, 20 sec; Step 3: 95, 5 sec; Step 4: 65, 1 min; Step 5: 95, continuous (every 5); Step 6: 40, 10 sec.

The DKK1 transcript levels of each cell line obtained above are shown in FIG. 7 relative to MKN45 cells (relative transcripts = 1). As can be seen in Figure 7, the expression level of DKK1 is significantly increased in the L3-1Y / IgG2 agonist group MKN45, Hs746T, SNU, while DKK1 is rarely expressed in the L3-1Y / IgG2 ineffective group NUGC4, NCIN87. Able to know.

실시예Example 5: 항 c-Met 항체 5: anti-c-Met antibody 효능군과Efficacy group 비효능군에서의In the ineffective group DKK1DKK1 단백질 발현 검증 Protein expression verification

The expression level of the DKK1 protein was high in the anti-c-Met antibody potency group by ELISA (R & D, DY1906).

DKK1 protein expression levels were measured for anti-c-Met antibody potency group MKN45, Hs746T and ineffective group SNU668, NUGC4. 250000 gastric cancer cells were dispensed in a 60 mm dish and incubated for 4 days. After 4 days, the culture solution was filtered with a 2 um filter, followed by ELISA. At this time, the number of remaining cells was measured to calculate DKK1 expression according to unit cells. As shown in FIG. 8, DKK1 expression was high in the anti-c-Met antibody potency group, and DKK1 expression was low in the ineffective group. It can be seen that it is consistent with the gene expression of Example 4, it can be seen that the expression of DKK1 can be measured not only by the gene but also by the protein.

실시예Example 6: 6: DKK1DKK1 발현 수준에 따른 항 c-Met 항체 효능 확인 Confirmation of anti-c-Met antibody efficacy according to expression level

To verify the effect of DKK1 gene expression levels on the efficacy of anti-c-Met antibodies, an in vitro efficacy test using patient-derived esophageal cancer cells (provided by Prof. Lee Ji-yeon, Samsung Medical Center, Seoul, Korea) Proceeded.

DKK1 siRNA (ThermoFisher, L-003843-01-0005) was used to control DKK1 gene expression levels, and siGENOME Non-Targeting siRNA Pool # 2 (ThermoFisher, D-001206-14-20) was used as a control. First, dilute RNAiMAX in Opti-MEM in A tube with 0.3 ul RNAiMax (transfection reagent, 13778-150, Invitrogen) diluted with Opti-MEM (GIBCO) in 96 well plate and final concentration of 20 nM. The siRNA was diluted in Opti-MEM, the solution of the B tube was mixed with the A tube, incubated for 5 minutes, and incubated at room temperature for 15 minutes. At this time, the total volume of the diluted RNAiMax and siRNA was 25 ul. 80 ul of the cells diluted with RPMI1640 medium (GIBCO) containing 10% FBS were seeded into 5000 wells of gastric cancer patient-derived cells per 96 wells. After 24 hours, the cultured cells were treated with L3-1Y / IgG2 antibodies at concentrations of 0.0, 4.0, 20.0 and 100.0 ug / ml.

72 hours after the treatment, CellTiter Glo (Promega, G7573) was added to 100 ul per well for counting the cells and incubated at room temperature for 30 minutes. Cell counts were counted through luminescence signals and luminescence signals were recorded using an Envision 2104 Multi-label Reader (Perkin Elmer).

The obtained results are shown in FIG. 9 (siNEG: control siGENOME Non-Targeting siRNA Pool # 2 treatment group; siDKK1: DKK1 siRNA treatment group). As shown in FIG. 9, when the expression of the DKK1 gene was lowered by treating the DKK1 siRNA, the cancer cell killing effect of L3-1Y / IgG2 may be inhibited. This suggests that expression of the DKK1 gene is associated with L3-1Y / IgG2 efficacy.

실시예Example 7: 항 c-Met 항체에 대한 저항성이 유도된 경우 7: When resistance to anti-c-Met antibodies is induced WntWnt 저해제에 의한 저항성 극복 여부 확인 Determine whether to overcome resistance by inhibitor

Since DKK1 is a Wnt antagonist, when DKK1 expression is high, Wnt signaling is suppressed. Wnt signaling may be activated by decreasing DKK1 expression. Wnt signaling may be one cause when resistance to anti-c-Met antibodies is induced. To prove this, we tested whether the Wnt inhibitor XAV939 (Selleckchem, S1180) can overcome anti-c-Met antibody resistance. .

To determine how DKK1 expression changes when repeated administration of anti-c-Met antibody is induced, repeated administration of L3-1Y / IgG2 results in a MKN45 gastric cancer cell line that is resistant to L3-1Y / IgG2 antibody. Was used. The procedure for the production of resistance-resistant MKN45 gastric cancer cell line was as follows: MKN45 cells (JCRB, JCRB0254) were treated with L3-1Y antibody for more than 3 months with increasing throughput. Throughput of L3-1Y / IgG2 antibody was increased from the initial treatment concentration of 1 ug / ml to 10 ug / ml until resistance appeared.

MKN45 gastric cancer cells obtained resistance to the L3-1Y / IgG2 antibody obtained were seeded in 96 wells so that 5000 cells per well. After 24 hours, the cells were treated with L3-1Y / IgG2 antibody or co-treated with L3-1Y / IgG2 antibody with XAV939. Since XAV939 is ineffective in MKN45 gastric cancer cells, it was fixed at 10 uM (micromole), the highest concentration used in general, and various concentrations (0, 0.08, 0.40, 2.00, and 10.00 ug /) for L3-1Y / IgG2 antibodies. ml). 72 hours after the antibody treatment, cell number change was measured by CellTiter Glo assay (Promega, G7573).

The obtained result is shown in FIG. As shown in FIG. 10, when only L3-1Y / IgG2 antibody was treated (-○-), no cell proliferation inhibitory effect was observed. Thus, the obtained MKN45 gastric cancer cells were resistant to L3-1Y / IgG2 antibody. It can be confirmed that obtained. When the L3-1Y / IgG2 resistance obtained MKN45 gastric cancer cells were treated with the L3-1Y / IgG2 antibody together with the Wnt inhibitor XAV939 (-●-), a significant cell proliferation inhibitory effect was observed. These results show that the anti-c-Met antibody can be reduced or overcome by co-administration with the anti-c-Met antibody.

Claims

A composition for predicting the efficacy of a c-Met inhibitor comprising a substance interacting with at least one selected from the group consisting of a DKK1 protein and a gene encoding the same.
A composition for selection of c-Met inhibitors to be applied comprising a substance interacting with at least one selected from the group consisting of a DKK1 protein and a gene encoding the same.
A composition for monitoring the efficacy of a c-Met inhibitor comprising a substance interacting with at least one selected from the group consisting of a DKK1 protein and a gene encoding the same.
The method of claim 1, wherein the interacting substance is a small molecule chemical, a protein, a peptide, or a nucleic acid molecule that binds to at least one selected from the group consisting of a DKK1 protein and a gene encoding the same. At least one selected from the group consisting of, the composition.
The composition of any one of claims 1 to 3, further comprising a substance that interacts with at least one selected from the group consisting of c-Met and genes encoding the same.
The composition of claim 1, wherein the c-Met inhibitor is at least one selected from the group consisting of anti c-Met antibodies, antigen binding fragments thereof, and small molecule c-Met inhibitors.
The small molecule c-Met inhibitor according to claim 6, wherein the small molecule c-Met inhibitor is crizotinib, carbozantinib, poretinib, PHA-665752, SU11274, SGX-523, PF-04217903, EMD 1214063, golbatinib, INCB28060, MK-2461 , Tivantinib, NVP-BVU972, AMG458, BMS 794833, BMS 777607, MGCD-265, AMG-208, BMS-754807, JNJ-38877605, imidazo [1,2, -alpha] pyridine derivatives, AMG-337, DE605 Or one or more selected from the group consisting of pharmaceutically acceptable salts thereof, and the like.
The epitope of claim 6, wherein the anti-c-Met antibody or antigen-binding fragment thereof comprises a contiguous 5-19 amino acid sequence comprising the amino acid sequence of SEQ ID NO: 73 in the SEMA domain (SEQ ID NO: 79) of c-Met. An anti c-Met antibody or antigen binding fragment thereof that binds to a composition.
The method of claim 8, wherein the anti-c-Met antibody or antigen-binding fragment thereof,

Consecutive 8 to 19 comprising CDR-H1 having the amino acid sequence of SEQ ID NO: 4, the amino acid sequence of SEQ ID NO: 5, the amino acid sequence of SEQ ID NO: 2, or the third to tenth amino acids within the amino acid sequence of SEQ ID NO: 2 CDR-H2 having an amino acid sequence consisting of four amino acids, and the amino acid sequence of SEQ ID NO: 6, the amino acid sequence of SEQ ID NO: 85, or a contiguous 6 to 6 amino acid including the first to sixth amino acids in the amino acid sequence of SEQ ID NO: 85; At least one heavy chain complementarity determining region (CDR) selected from the group consisting of CDR-H3 having an amino acid sequence of 13 amino acids, or a heavy chain variable region comprising said at least one heavy chain complementarity determining region;

CDR-L1 having an amino acid sequence of SEQ ID NO: 7, CDR-L2 having an amino acid sequence of SEQ ID NO: 8, and an amino acid sequence of SEQ ID NO: 9, an amino acid sequence of SEQ ID NO: 15, an amino acid sequence of SEQ ID NO: 86, or One or more light chain complementarity determining regions or one or more light chain complementarity determining regions selected from the group consisting of CDR-L3 having an amino acid sequence consisting of 9 to 17 amino acids comprising the first to ninth amino acids in the amino acid sequence of SEQ ID NO: 89; Light chain variable region comprising a region;

A combination of the heavy chain complementarity determining region and the light chain complementarity determining region; or

Combination of the heavy chain variable region and light chain variable region

It comprises, composition.
A method of providing information for predicting efficacy of a c-Met inhibitor, comprising measuring at least one level selected from the group consisting of DKK1 and a gene encoding the same in a biological sample isolated from a patient.
A method of providing information for monitoring the efficacy of a c-Met inhibitor, comprising measuring at least one level selected from the group consisting of DKK1 and a gene encoding the same in a biological sample isolated from a patient.
A method of providing information for selection of a subject to be applied to a c-Met inhibitor, comprising measuring at least one level selected from the group consisting of DKK1 and a gene encoding the same in a biological sample isolated from the patient.
The method of claim 9, further comprising measuring at least one level selected from the group consisting of c-Met and genes encoding the same.
The method of claim 10, wherein the c-Met inhibitor is at least one selected from the group consisting of anti c-Met antibodies, antigen binding fragments thereof, and small molecule c-Met inhibitors.
15. The method according to claim 14, wherein the small molecule c-Met inhibitor is crizotinib, carbozantinib, forretinib, PHA-665752, SU11274, SGX-523, PF-04217903, EMD 1214063, golbatinib, INCB28060, MK-2461 , Tivantinib, NVP-BVU972, AMG458, BMS 794833, BMS 777607, MGCD-265, AMG-208, BMS-754807, JNJ-38877605, imidazo [1,2, -alpha] pyridine derivatives, AMG-337, DE605 Or at least one selected from the group consisting of pharmaceutically acceptable salts thereof, and the like.
The epitope of claim 14, wherein said anti-c-Met antibody or antigen-binding fragment thereof is an epitope consisting of a contiguous 5-19 amino acid sequence comprising the amino acid sequence of SEQ ID NO: 73 in the SEMA domain (SEQ ID NO: 79) of c-Met. An anti c-Met antibody or antigen binding fragment thereof that binds thereto.
The method of claim 16, wherein the anti-c-Met antibody or antigen-binding fragment thereof,

Consecutive 8 to 19 comprising CDR-H1 having the amino acid sequence of SEQ ID NO: 4, the amino acid sequence of SEQ ID NO: 5, the amino acid sequence of SEQ ID NO: 2, or the third to tenth amino acids within the amino acid sequence of SEQ ID NO: 2 CDR-H2 having an amino acid sequence consisting of four amino acids, and the amino acid sequence of SEQ ID NO: 6, the amino acid sequence of SEQ ID NO: 85, or a contiguous 6 to 6 amino acid including the first to sixth amino acids in the amino acid sequence of SEQ ID NO: 85; At least one heavy chain complementarity determining region (CDR) selected from the group consisting of CDR-H3 having an amino acid sequence of 13 amino acids, or a heavy chain variable region comprising said at least one heavy chain complementarity determining region;

CDR-L1 having an amino acid sequence of the amino acid sequence of SEQ ID NO: 7, CDR-L2 having an amino acid sequence of SEQ ID NO: 8, and an amino acid sequence of SEQ ID NO: 9, SEQ ID NO: 15, amino acid sequence of SEQ ID NO: 86, or SEQ ID NO: 89 At least one light chain complementarity determining region or at least one light chain complementarity determining region selected from the group consisting of CDR-L3 having an amino acid sequence consisting of 9 to 17 amino acids comprising the first to ninth amino acids in the amino acid sequence of Light chain variable region;

A combination of the heavy chain complementarity determining region and the light chain complementarity determining region; or

Combination of the heavy chain variable region and light chain variable region

It comprises a.
A pharmaceutical composition for concomitant administration for the prevention or treatment of cancer, comprising a c-Met inhibitor and a Wnt signaling inhibitor.
The pharmaceutical composition of claim 18, wherein the c-Met inhibitor is one or more selected from the group consisting of anti-c-Met antibodies, antigen binding fragments thereof, and small molecule c-Met inhibitors.
20. The method of claim 19, wherein the small molecule c-Met inhibitor is crizotinib, carbozantinib, forretinib, PHA-665752, SU11274, SGX-523, PF-04217903, EMD 1214063, galvatinib, INCB28060, MK-2461 , Tivantinib, NVP-BVU972, AMG458, BMS 794833, BMS 777607, MGCD-265, AMG-208, BMS-754807, JNJ-38877605, imidazo [1,2, -alpha] pyridine derivatives, AMG-337, DE605 Or at least one selected from the group consisting of pharmaceutically acceptable salts thereof, and the like.
The epitope of claim 19, wherein said anti-c-Met antibody or antigen-binding fragment thereof is an epitope consisting of a contiguous 5-19 amino acid sequence comprising the amino acid sequence of SEQ ID NO: 73 in the SEMA domain (SEQ ID NO: 79) of c-Met. A pharmaceutical composition, which is an anti c-Met antibody or antigen binding fragment thereof.
The method of claim 21, wherein the anti-c-Met antibody or antigen-binding fragment thereof,

Consecutive 8 to 19 comprising CDR-H1 having the amino acid sequence of SEQ ID NO: 4, the amino acid sequence of SEQ ID NO: 5, the amino acid sequence of SEQ ID NO: 2, or the third to tenth amino acids within the amino acid sequence of SEQ ID NO: 2 CDR-H2 having an amino acid sequence consisting of four amino acids, and the amino acid sequence of SEQ ID NO: 6, the amino acid sequence of SEQ ID NO: 85, or a contiguous 6 to 6 amino acid including the first to sixth amino acids in the amino acid sequence of SEQ ID NO: 85; At least one heavy chain complementarity determining region (CDR) selected from the group consisting of CDR-H3 having an amino acid sequence of 13 amino acids, or a heavy chain variable region comprising said at least one heavy chain complementarity determining region;

CDR-L1 having an amino acid sequence of the amino acid sequence of SEQ ID NO: 7, CDR-L2 having an amino acid sequence of SEQ ID NO: 8, and an amino acid sequence of SEQ ID NO: 9, SEQ ID NO: 15, amino acid sequence of SEQ ID NO: 86, or SEQ ID NO: 89 At least one light chain complementarity determining region or at least one light chain complementarity determining region selected from the group consisting of CDR-L3 having an amino acid sequence consisting of 9 to 17 amino acids comprising the first to ninth amino acids in the amino acid sequence of Light chain variable region;

A combination of the heavy chain complementarity determining region and the light chain complementarity determining region; or

Combination of the heavy chain variable region and light chain variable region

It comprises, pharmaceutical composition.
The method of claim 18, wherein the Wnt signaling inhibitor is DKK1, XAV939, PRI-724, CWP232291, 2,4-Diamino-quinazoline, FJ9, LGK974, G007-LK, Pyrvinium, Foxy-5, OMP-54F28, OMP- 18R5 (vantictumab), and OTSA101 is one or more selected from the group consisting of, the pharmaceutical composition.
The pharmaceutical composition of any one of claims 18-23, wherein the cancer is a cancer resistant to anti-c-Met inhibitors.
The pharmaceutical composition of claim 18, wherein the cancer is gastric cancer.