WO2017116005A1 - Gène de petit arn pour réguler la génération de vésicule extracellulaire et la réponse immunitaire de l'hôte, et son utilisation - Google Patents

Gène de petit arn pour réguler la génération de vésicule extracellulaire et la réponse immunitaire de l'hôte, et son utilisation Download PDF

Info

Publication number
WO2017116005A1
WO2017116005A1 PCT/KR2016/013276 KR2016013276W WO2017116005A1 WO 2017116005 A1 WO2017116005 A1 WO 2017116005A1 KR 2016013276 W KR2016013276 W KR 2016013276W WO 2017116005 A1 WO2017116005 A1 WO 2017116005A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
srna
nucleotide sequence
set forth
coli
Prior art date
Application number
PCT/KR2016/013276
Other languages
English (en)
Korean (ko)
Inventor
김광선
김윤근
김태연
Original Assignee
한국생명공학연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국생명공학연구원 filed Critical 한국생명공학연구원
Publication of WO2017116005A1 publication Critical patent/WO2017116005A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/13—Nucleic acids or derivatives thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora

Definitions

  • the present invention relates to an immunomodulatory pharmaceutical composition, health functional food, cosmetic composition and the like containing a vector expressing E. coli-derived small RNA (sRNA) as an active ingredient.
  • sRNA E. coli-derived small RNA
  • Immunity is largely divided into innate immunity that has been born since birth and acquired immunity that is acquired by adapting to life.
  • Innate immunity also known as 'natural immunity', responds nonspecifically to the antigen and does not have a special memory function.
  • Innate immune systems include skin, mucous tissue, acidic acid, and complement that are present in the blood to block antigen invasion.
  • Cells include macrophage and polymorphonuclear leukocytes, which are responsible for phagocytosis, and natural killer (NK) cells that can kill infected cells. In fact, most infections are protected by innate immunity.
  • acquired immunity is also known as 'acquired immunity' and can remember the first invading antigen, and the characteristic that can effectively remove the antigen by reacting specifically when invading again serves to reinforce innate immunity.
  • Humoral immunity differentiates after B lymphocytes recognize an antigen to secrete an antibody, which shows its function mainly to remove infected bacteria.
  • Antibodies are present in body fluids and consist of glycoproteins called immunoglobulins (Ig). These include IgG, IgM, IgA, IgD, and IgE, each of which performs unique functions and sometimes duplicates some functions.
  • IgA antibodies are characterized by their delivery to the fetus via the placenta. This immunity is called maternal immunity, which is why it does not infect well for many months after birth.
  • Cellular immunity plays a role in the thymus-derived T lymphocytes recognizing antigens to secrete lymphokine or to directly kill infected cells. Secreted lymphokines may also activate phagocytes to aid phagocytosis.
  • Such cellular immunity primarily functions to remove cells infected with viruses or bacteria that can grow within cells. Acquired immunity can be obtained by immunization of a pathogen or its toxin with an immunogen, and such immunity is called artificial immunity.
  • Hypersensitivity reactions can be divided into four types based on expression time and reaction type.
  • Type I immediate
  • Type II antibody involvement
  • Symptoms include hemolysis of red blood cells due to inadequate blood transfusion, and neonatal hemolytic disease.
  • Type III is caused by reactions by antigen-antibody binding or by antigens of small molecular weight. Causes acute glomerulonephritis, irritable pneumonia.
  • type IV (delayed) is a type of cellular immune response induced by T lymphocytes and macrophages that causes important reactions such as tuberculin response, tuberculosis, and microorganisms such as viruses. .
  • Immunotherapy against pathogenic antigens is largely active immunotherapy that injects a substance such as a vaccine into the body to induce an antigen-specific immune response, and a manual method of modulating the immune response by administering a substance such as a monoclonal antibody to the antigen. It may be divided into passive immunotherapy.
  • Vaccines which are active immunotherapy, induce immunity to specific diseases by administering antigenic substances, together with an adjuvant for inducing not only information about the antigen but also a desired immune response.
  • Extracellular vesicles are spherical, phospholipid bilayer, 20-200 nm in size.
  • Gram-negative bacterial-derived extracellular vesicles contain LPS as well as several outer membrane proteins.
  • meningococcal-derived endoplasmic reticulum in the blood of patients who died of severe sepsis, and it has been reported that extracellular vesicles derived from meningococcal bacteria secrete inflammatory mediators in vitro.
  • the inventors of the present invention while studying to develop a substance that modulates the immune response, when the recombinant E. coli-derived sRNA that regulates various cellular functions introduced into the strain, the sRNA overexpressing strain increases the production of extracellular vesicles, sRNA Extracellular vesicles derived from overexpressing strains were found to increase the induction of immune responses and induce Th1 and Th17 immune responses similar to live bacterial infections.
  • toxicity of Gram-negative bacteria-derived extracellular vesicles could be eliminated by co-administering a substance that inhibited endotoxin activity in bacterial-derived extracellular vesicles.
  • the present invention was completed by revealing that the vector expressing the E. coli-derived sRNA can be usefully used as an active ingredient of the immunomodulatory composition.
  • An object of the present invention is to provide an immunomodulatory pharmaceutical composition, health functional food, and cosmetic composition containing a vector expressing E. coli-derived small RNA (sRNA) as an active ingredient.
  • sRNA E. coli-derived small RNA
  • the present invention provides a pharmaceutical composition for immunomodulation containing a vector expressing E. coli-derived small RNA (sRNA) as an active ingredient.
  • sRNA E. coli-derived small RNA
  • the present invention provides a pharmaceutical composition for immunomodulation comprising a strain transformed with a vector expressing E. coli-derived sRNA, a culture medium thereof, or an extracellular vesicle isolated from the strain or culture medium thereof as an active ingredient. do.
  • the present invention also provides a dietary supplement for immunomodulation containing a vector expressing E. coli-derived sRNA as an active ingredient.
  • the present invention provides a health functional food for immunomodulation comprising a strain transformed with a vector expressing E. coli-derived sRNA, a culture thereof, or an extracellular vesicle isolated from the strain or culture medium thereof as an active ingredient.
  • the present invention also provides a cosmetic composition for immunomodulation containing a vector expressing E. coli-derived sRNA as an active ingredient.
  • the present invention provides a cosmetic composition for immunomodulation comprising a strain transformed with a vector expressing E. coli-derived sRNA, a culture medium thereof, or an extracellular vesicle isolated from the strain or culture medium thereof as an active ingredient.
  • the present invention provides an immunomodulatory method comprising administering to a subject a pharmaceutical composition containing a vector expressing E. coli-derived small RNA (sRNA) as an active ingredient.
  • sRNA E. coli-derived small RNA
  • the present invention also provides an immunomodulatory use of a vector expressing E. coli-derived small RNA (sRNA).
  • sRNA E. coli-derived small RNA
  • the present invention is administered to a subject a pharmaceutical composition containing a strain transformed with a vector expressing E. coli-derived sRNA, a culture thereof, or an extracellular vesicle isolated from the strain or culture thereof as an active ingredient. It provides an immunomodulation method comprising the step of.
  • the present invention also provides an immunomodulatory use of a strain transformed with a vector expressing E. coli-derived sRNA, a culture thereof, or an extracellular vesicle isolated from the strain or the culture thereof.
  • E. coli-derived sRNA small RNA
  • sRNA overexpressing strain increases the extracellular vesicle production
  • sRNA overexpressing strain-derived extracellular vesicles Th1 similar to live infection
  • the vector expressing the E. coli-derived sRNA can be usefully used as an immunomodulatory composition.
  • FIG. 1 is a diagram showing the expression of sRNA (small RNA) through the Northern blot (northern blot) analysis.
  • FIG. 2 is a diagram confirming the immune response by sRNA overexpressing strain culture through the amount of IL-6 inducing Th17 immune response:
  • NT Badge that did not process anything.
  • Figure 3 is the result of measuring the amount of extracellular vesicle (extracellular vesicle) in the sRNA overexpressing strain:
  • Figure 4 is a diagram observing the morphological characteristics of sRNA overexpressing strain-derived extracellular vesicles by dynamic light scattering method and electron microscopy.
  • Figure 5 is a measure of the immune response caused by extracellular vesicles derived from sRNA overexpression strain by the secretion amount of TNF-alpha and IL-6 in inflammatory cells (macrophage lines):
  • sup-EV culture medium in which extracellular vesicles were removed.
  • FIG. 6 is a diagram confirming the immune response and apoptosis caused by sRNA overexpressing strain-derived extracellular vesicles through colon epithelial cell line:
  • sup-EV culture medium in which extracellular vesicles were removed.
  • Figure 7 is a diagram confirming the immune response in the body by the extracellular vesicles derived from the sRNA overexpressing strain through a test animal.
  • FIG. 8 is a diagram illustrating the characteristics of E. coli strain-derived extracellular vesicles after heat treatment or polymyxin B (PMB), followed by electron microscopy and dynamic light scattering.
  • FIG. 9 is a diagram illustrating the measurement of vesicle-specific antibodies in serum by treatment of E. coli-derived extracellular vesicles with heat treatment or polymyxin B (PMB), followed by administration of extracellular vesicles (5 ug) to the mouse abdominal cavity.
  • PMB polymyxin B
  • FIG. 10 is a diagram illustrating the survival rate of mice by injecting E. coli intraperitoneally three times after injecting E. coli-derived extracellular vesicles (5 ug) treated with heat treatment or polymyxin B (PMB).
  • the present invention provides a pharmaceutical composition for immunomodulation containing a vector expressing E. coli-derived small RNA (sRNA) as an active ingredient.
  • sRNA E. coli-derived small RNA
  • the present invention provides a pharmaceutical composition for immunomodulation comprising a strain transformed with a vector expressing E. coli-derived sRNA, a culture medium thereof, or an extracellular vesicle isolated from the strain or culture medium thereof as an active ingredient. do.
  • the present invention provides a dietary supplement for immunomodulation containing a vector expressing E. coli-derived small RNA (sRNA) as an active ingredient.
  • sRNA E. coli-derived small RNA
  • the present invention provides a health functional food for immunomodulation comprising a strain transformed with a vector expressing E. coli-derived sRNA, a culture medium thereof, or an extracellular vesicle isolated from the strain or culture medium thereof as an active ingredient. do.
  • the present invention provides a cosmetic composition for immunomodulation containing a vector expressing E. coli-derived small RNA (sRNA) as an active ingredient.
  • sRNA E. coli-derived small RNA
  • the present invention provides a cosmetic composition for immunomodulation comprising a strain transformed with a vector expressing E. coli-derived sRNA, a culture medium thereof, or an extracellular vesicle isolated from the strain or culture medium thereof as an active ingredient. .
  • E. coli-derived sRNA is SgrS, RybD, RybB, FnrS, MicC, MicF, GlmY, RprA, CyaR, MicA, OmrA, MgrR, RyhB, GadY, GlmZ, OxyS, DicF, DsrA, Spot42, RseX, IS118, ArcZ, Omr , RyeB, ChiX and GcvB are preferred, DsrA, MicF, GlmY, RprA, CyaR, MicA, OmrA, MgrR, GadY, GlmZ, OxyS, DicF, RseX, ArcZ, OmrB and RyeB, more preferably RseX and Most preferred is MicA.
  • the vector is preferably a vector that overexpresses sRNA.
  • the vector is preferably any one selected from the group consisting of plasmid DNA, linear DNA and recombinant viral vectors.
  • the extracellular vesicles can be separated using methods such as centrifugation, ultracentrifugation, filtration by filter, gel filtration chromatography, pre-flow electrophoresis, capillary electrophoresis, and combinations thereof. In addition, it may further include a process for washing to remove impurities, concentration of the obtained extracellular vesicles and the like.
  • the extracellular vesicles separated by the method is preferably 15 nm to 100 nm in size.
  • This strain is Salmonella (Salmonella), E. coli (Escherichia coli), keurep when Ella bacteria (Klebsiella pneumoniae) and Pseudomonas species that the (Pseudomonas) strain are preferred, and most preferably Salmonella and E. coli strains.
  • the present inventors prepared a vector expressing E. coli-derived sRNA, and confirmed that it is overexpressed by introducing it into a Salmonella strain (see FIG. 1), as a result of confirming the induction of the immune response of the sRNA overexpressing strain, It was confirmed that the sRNA overexpressing strain induces an immune response more than the control (see FIG. 2).
  • the present inventors confirmed the extracellular vesicle generation amount of the sRNA overexpressing strain, the sRNA overexpressing strain was confirmed to produce more extracellular vesicles than the control group (see Figure 3), the physical properties of the resulting extracellular vesicles As a result, it was confirmed that the size and shape are similar to the extracellular vesicles generated in the control group (see Fig. 4).
  • the present inventors confirmed the immune response of the sRNA overexpressing strain-derived extracellular vesicles, and confirmed that the immune response is efficiently induced by the sRNA overexpressing strain-derived extracellular vesicles (see FIG. 5).
  • the control group and the sRNA overexpressing strain was confirmed that there is no significant difference (see Figure 6).
  • the present inventors confirmed the ability of the sRNA overexpressing strain-derived extracellular vesicles to induce an immune response, inducing Th1 and Th17 immune responses similar to probiotic infection (see FIG. 7).
  • the present inventors heat treated the E. coli-derived extracellular vesicles, or treated with polymyxin B to induce an immune response, and then observed whether to suppress the mortality caused by E. coli infection, when treated with polymyxin B , Similar to the case without pretreatment, it was confirmed that the vaccine efficacy (see Figure 10).
  • the vector was confirmed that it can be usefully used as an immunomodulatory pharmaceutical composition, health functional food, and cosmetic composition.
  • polymyxin B which inhibits LPS activity, generated vesicular-specific antibodies and induced vaccine efficacy similarly to untreated vesicles. It was confirmed that the extracellular vesicles derived from Gram-negative bacteria containing the vector expressing can be useful as an immunomodulatory pharmaceutical composition, health functional food, and cosmetic composition.
  • the pharmaceutical composition of the present invention may be administered orally or parenterally and may be administered in various formulations.
  • a diluent or excipient such as fillers, extenders, binders, wetting agents, disintegrating agents and surfactants that are commonly used may be used. Are prepared using.
  • compositions of the present invention may be formulated in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, oral formulations, external preparations, suppositories, and sterile injectable solutions, respectively, according to a conventional method. Can be used.
  • Carriers, excipients and diluents that may be included in the composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, Methylcellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
  • diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, and surfactants are usually used.
  • Solid preparations for oral administration include tablets, pills, powders, granules and capsules, and the like, which may be used in the pharmaceutical composition of the present invention at least one excipient such as starch, calcium carbonate, sucrose, lactose And gelatin etc. are mixed and prepared. In addition to simple excipients, lubricants such as magnesium styrate talc are also used.
  • Liquid preparations for oral administration include suspensions, solutions, emulsions and syrups, and may include various excipients such as wetting agents, sweeteners, fragrances and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin. have.
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations and suppositories.
  • non-aqueous solvent and the suspension solvent propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used.
  • base of the suppository witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerol and gelatin may be used.
  • the preferred dosage of the pharmaceutical composition of the present invention depends on the condition and weight of the patient, the extent of the disease, the form of the drug, the route of administration and the duration, and may be appropriately selected by those skilled in the art.
  • the administration may be administered once a day, or may be divided several times.
  • the dosage does not limit the scope of the invention in any aspect.
  • composition of the present invention in order to use as a dietary supplement for immunomodulation, it can be prepared by a variety of methods known in the food science or pharmaceutical field and mixed with itself or a food-acceptable carrier, excipient, diluent, etc. It can be prepared in any food form that can be taken orally. Preferably in the form of beverages, pills, granules, tablets or capsules.
  • the health functional food of the present invention may further include ingredients that are commonly added during food production and are food acceptable.
  • ingredients that are commonly added during food production and are food acceptable.
  • one or more components from citric acid, liquid fructose, sugar, glucose, acetic acid, malic acid, fruit juice, etc. may be further included in addition to the composition of the present invention.
  • the amount that can be included as an active ingredient of the health functional food according to the present invention may be appropriately selected according to the age, sex, weight, condition, symptoms of the disease of a person who wants an immune enhancing health functional food, preferably adult standard 1 It is good to include about 0.01 g to 10.0 g per day, and by ingesting a health functional food having such a content, an immune enhancing effect can be obtained.
  • the cosmetic composition of the present invention may be prepared in any formulation commonly prepared in the art, for example, solutions, suspensions, emulsions, pastes, gels, creams, lotions, powders, soaps, surfactants- Containing cleansing, oils, powder foundations, emulsion foundations, wax foundations, sprays and the like, but is not limited thereto. More specifically, it may be prepared in the form of a flexible lotion, nutrition lotion, nutrition cream, massage cream, essence, eye cream, cleansing cream, cleansing foam, cleansing water, pack, spray or powder.
  • the cosmetically effective carrier contained in the cosmetic composition of the present invention a carrier commonly used in the art may be used depending on the dosage form.
  • a carrier commonly used in the art may be used depending on the dosage form.
  • the formulation of the present invention is a paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, trakant, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide, etc. may be used as carrier components.
  • lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used, in particular, in the case of spray, additionally chloro fluorohydrocarbon, propane Propellant such as butane or dimethyl ether.
  • a solvent, solubilizer or emulsifier is used as the carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1 Fatty acid esters of, 3-butylglycol oil, glycerol aliphatic ester, polyethyleneglycol or sorbitan.
  • liquid carrier diluents such as water, ethanol or propylene glycol
  • suspending agents such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, microcrystals Soluble cellulose, aluminum metahydroxy, bentonite, agar or tracant and the like can be used.
  • the carrier component is an aliphatic alcohol sulfate, an aliphatic alcohol ether sulfate, a sulfosuccinic acid monoester, an isethionate, an imidazolinium derivative, a methyltaurate, a sarcosinate, a fatty acid amide.
  • Ether sulfates, alkylamidobetaines, aliphatic alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives or ethoxylated glycerol fatty acid esters and the like can be used.
  • ingredients included in the cosmetic composition of the present invention include ingredients commonly used in cosmetic compositions, for example, conventional adjuvants such as antioxidants, stabilizers, solubilizers, vitamins, pigments and flavorings. It may include
  • E. coli sRNA binds to Hfq, a global regulatory protein.
  • Hfq a global regulatory protein.
  • One of the drawbacks of sRNA is that it does not show phenotypes without overexpression.
  • pLac was designed to insert P L lacO-1 (a slightly modified form of the lac transcriptional promoter) into pBR322 to obtain RNA from +1, which is regulated by pLac and the transcriptional start of this promoter.
  • P L lacO-1 is Lutz and Bujard (R. Lutz, H. Bujard, Independent and tight regulation of transcriptional units in Escherichia coli via the LacR / O, the TetR / O and AraC / I1-I2 regulatory elements. Nucleic Acids Research , 1997; 25 (6): 1203-1210) was used as the artificial promoter sequence (ATAAATGTGAGCGGATAACATTGACATTGTGAGCGGATAACAAGATACTGACGT (SEQ ID NO: 27)).
  • 35 regions and 10 regions (underlined) of pLac were transformed from TTTACA to TTGACA and TATGAT to GATACT, respectively, to promote more efficient expression.
  • oligos were designed to be cleaved by Ssp I and Aat II by slightly modifying the sequence of P L lacO-1 at the positions of Ssp I and Aat II of pBR322 (Oligo 1: ATT ATA AAT GTG AGC).
  • Oligo 2 TAA TAT TTA CAC TCG CCT ATT GTA ACT GTA ACA CTC GCC TAT TGT TCT ATG AC (SEQ ID NO: 29) and ligated to pBR322 ( Ssp I / Aat II) to obtain pLac.
  • Hfq-binding sRNA library was constructed using pLac obtained in Example ⁇ 1-1>.
  • the obtained pLac was cleaved into Aat II and Eco RI, Aat II and Hin dIII (for MicA) or Bam HI and Hin dIII (for SgrS), and the primer containing sRNA in pLac (Table 1; Restriction enzyme cleavage sites were prepared by underlining), and MG1655 chromosomal DNA was used as a template for PCR amplification using Pfu polymerase (PCR reaction condition: 5 minutes at 94 ° C, 30 sec at 94 ° C., 30 sec at 59 ° C., 30 sec at 72 ° C., 30 min extension at 72 ° C., 5 min extension at 72 ° C.), cleavage using the above-mentioned restriction enzymes, and 10 ⁇ ligation buffer in 5 ul of PCR product.
  • Pfu polymerase PCR reaction condition: 5 minutes at 94 ° C, 30 sec at 94 ° C., 30 sec at 59 ° C., 30 sec at
  • the total 10 ul volume is added to room temperature by adding 1 ul of ligation buffer, 1 ul of pLac cleavage product (20 ng / ul), 2 ul of sterile distilled water, and 1 ul of Ligase (Roche, 1 unit / ul). Ligation at 1 hour. 10 ul of the ligation mixture (mixture) was mixed well with XL1-blue 100 ul for 10 minutes on ice (ice) and then gave a heat-shock (heat-shock) for 1 minute 30 seconds at 42 °C and placed on ice again for 5 minutes. 900 ul of LB media was added to re-generation at 37 ° C. for 1 hour, and then centrifuged at 12,000 rpm for 30 seconds to spread the whole cells onto an LB plate. The next day colonies were identified and then Mini-prep was performed.
  • the mini-preps were grown in 3 ml LB medium and transferred to 1.5 ml microtubes and centrifuged at 12,000 rpm for 30 seconds to bring down the cells.
  • the down cells were obtained by a manufacturer's method using a Mini-prep kit (Thermo Scientific). Thus obtained DNA was confirmed whether the desired sRNA entered through sequencing, 26 pBRplac-sRNA was obtained. This is listed in Table 2 along with the size of the sRNA.
  • sRNA type Size (nt) sRNA type Size (nt) SgrS To 220 RyhB 90 ChiX 88 GadY 105, 90, 59 RybB 80 Glmz 210 FnrS 122 Oxys 109 MicC 109 DicF 53 MicF 93 DsrA 85 Glmy 150, 180 Spot42 109 RprA 105 RseX 91 CyaR 86 IS118 194 MicA To 70 Arcz ⁇ 55, 88, 120 Omra 88 Ommrb 82 MgrR 98 Ryeb 104, 74 RybD 130 GcvB 205
  • Hfq-binding sRNAs are excellent in species conservation. Since the nucleotide sequence alone could be a method of expressing the same morphology in Salmonella and exploring its function, the same species as the E. coli sRNA sequence was utilized by utilizing a species-preserved sRNA among Hfq-linked sRNAs. PBRplac-sRNA plasmid containing eggplant sRNA was introduced into Salmonella.
  • pBRplac-sRNA was introduced into Salmonella Typhimurium 14028S species by electroporation.
  • sRNA Oligo (5 ' ⁇ 3') SEQ ID NO: MicF TCAACCGGATGCCTCGCATTCGGTTTTTTTT SEQ ID NO: 82 RydC CTAAAACCGACCCGTGGTACAGGCGAAGAATACGGGTCT SEQ ID NO: 83 Arcz CGCCGTAAATTATTATGATGAGTTACAAGGGCACAGCAC SEQ ID NO: 84 Glmz GTGGACGATAAGCACCGTAAACGGCTCTGCGTCATTCCGG SEQ ID NO: 85 Glmy CATTCGTATTTTATGTAGCACGTCCCGAAGGGGCTG SEQ ID NO: 86 RseX GATAAAAGGCTAATAACGGAAGCATCATGACACAG SEQ ID NO: 87 Omra GAGACAGGGTACGAAGAGCGTACCGAATAATCTCACC SEQ ID NO: 88 GadY GGGGACCGGGAGAGGATAGTCTGCCGTCCAGAC SEQ ID NO: 89 DsrA TGAGGGGGTCGGGATGAAACT
  • Salmonella cell cultures overexpressing sRNA were obtained, and the same amount was treated in mouse peritoneal macrophage line (RAW 264.7), and the amount of IL-6 as an indicator of immune response was confirmed.
  • Cell lines (RAW 264.7) were treated with 1 ⁇ 10 5 cell numbers and cultured for 12 hours.
  • IL-6 an inflammatory cytokine
  • the ELISA adds 100 ul of primary antibody (BD Bioscience, USA) that binds to the cytokine to be searched in a 96-well microplate for 12 hours at room temperature.
  • the assay solution (Reagent diluent; BD Bioscience, USA) was dispensed at 300 ul / well and then blocked for 1 hour at room temperature. It was. Then, after washing again using the washing buffer, the sample and the quantitative material to be analyzed are put together (BD Bioscience, USA) and reacted for 2 hours. Again washed three times with wash buffer and 100 ul of avidin-HRP bound detection antibody was added to each well.
  • TMB Substrate Reagent Pharmingen, BD Bioscience, USA
  • 50 ul of 2NH 2 SO 4 was added, and then measured at a wavelength of 450 nm / 570 nm with a Microplate reader (Molecular Devices, Sunnyvale, USA) within 30 minutes. It was.
  • Example ⁇ 3-1> the amount of extracellular vesicles was confirmed using RseX and MicA strains that repeatedly increased the amount of IL-6 among sRNA overexpressing strains affecting the immune response.
  • the amount of extracellular vesicles was confirmed using BCA protein assay (Pierce, USA), and directly through nanosite tracking analysis (LM-10HS) to determine whether the number of extracellular vesicles increased.
  • the extracellular vesicle sample is adjusted to 500 ng / ml and 2 mL is prepared. 0.3-0.4 ml of the sample is placed in the chamber of the LM-10HS instrument and the camera is focused to ensure that the particles are clearly visible. When the camera is in focus, the camera is raised to the maximum level, and the sample is captured by decreasing the level by one step to confirm that there is no drift of the sample. After confirming that the sample was free of concentration, focus and drift, the capture interval was set to 30 seconds and data was confirmed.
  • Example ⁇ 3-2> The physical properties of the extracellular vesicles produced in Example ⁇ 3-2> were confirmed using dynamic light scattering and transmission electron microscopy.
  • sRNA Average size (nm) Salmonella typhimurium (pBRplac) 26.07 ⁇ 5.98 Salmonella typhimurium (RseX) 19.93 ⁇ 2.503 Salmonella typhimurium (MicA) 21.39 ⁇ 1.92
  • each strain-derived extracellular vesicles (EV), extracellular vesicles (supernatant, sup) and extracellular vesicles removed (sup-EV) 1 Inflammatory cytokines IL-6 and TNF- ⁇ 12 hours after treatment with ug / ml of mouse peritoneal macrophage (RAW 264.7) 1 ⁇ 10 5 cell number in the same manner as in Example ⁇ 3-1> It was confirmed by measurement.
  • mice colon epithelial cell line (CT-26) was used to confirm the immune response inducing ability and cell death. Immune responses were confirmed in the same manner as above, and cell death experiments were confirmed using MTT assay.
  • Salmonella strains are known to induce enteritis and induce Th1 immune responses. Thus, the ability to induce Th1 immune response of extracellular vesicles obtained through sRNA overexpression was confirmed.
  • mice per group 100 ug / hd of extracellular vesicles were administered to the five mice per group (C67BL / 6) at two-day intervals through the intraperitoneal route. After dissecting on day 5, cells were isolated from intraperitoneal lymph nodes and subjected to T cell restimulation for 12 hours using anti-CD3 and CD28, and confirmed in the same manner as in Example ⁇ 3-1>.
  • E. coli was incubated in a test tube containing 3 ml LB solution for 4 hours at 37 °C, 10 ⁇ l of each was transferred to 8 2L Erlenmeyer flask containing 500 ml LB solution and incubated for 37 hours, 4 hours.
  • the culture solution was divided into 12 350 ml high-speed centrifuge tubes, and then performed twice in succession at 4 ° C. and 5,000 ⁇ g for 15 minutes.
  • Four liters of supernatant are passed through a membrane filter with a pore size of 0.45 ⁇ m once and then up to 300 ml using a Quixstand system that can only pass molecules up to 100 kDa. Concentrated.
  • the concentrate was passed once through a membrane filter with a pore size of 0.22 ⁇ m, then divided into 50 ml ultracentrifuge tubes, followed by ultratrace separation for 3 hours at 150,000 xg at 4 ° C. It was. The supernatant was discarded and the intestinal coliform-derived extracellular vesicles were extracted by dissolving the precipitate under the tube with PBS.
  • E. coli-derived extracellular vesicles isolated by 4-1 were treated with heat treatment or polymyxin B, and then extracellular vesicles (5 ⁇ g) were injected three times a week into the abdominal cavity of mice. 72 hours after injection, mouse serum was isolated to determine IgG antibodies specific for vesicles.
  • the IgG antibody was generated similarly to the case where the vesicle-specific antibody was not pretreated regardless of the heat treatment or polymyxin B administration from the first vesicle administration (see FIG. 9).
  • E. coli-derived extracellular vesicles isolated by 4-1 heat treatment or polymyxin B
  • immunotherapy was performed by injecting extracellular vesicles (5 ⁇ g) three times a week into the abdominal cavity of mice.
  • E. coli was administered intraperitoneally to evaluate the effect of preventing E. coli death.
  • the vector expressing sRNA (small RNA) according to the present invention overexpresses sRNA and increases the production of extracellular vesicles of the strain, thereby inducing a Th1, Th17 immune response by the extracellular vesicles, which expresses the sRNA.
  • Vectors may be usefully used in the fields of medicines, nutraceuticals, and cosmetics for the prevention, improvement, or treatment of various diseases related to lowered immune function through immunomodulatory effects.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Food Science & Technology (AREA)
  • Nutrition Science (AREA)
  • Mycology (AREA)
  • Polymers & Plastics (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

Il a été établi qu'un vecteur exprimant un petit ARN dérivé d'E. coli (ARNs), de la présente invention, surexprime un ARNs, une souche à surexpression d'ARNs augmente la génération de vésicule extracellulaire, et une vésicule extracellulaire dérivée de souche à surexpression d'ARNs induit des réponses immunitaires à Th1 et Th17 semblables à celles des infections par bactéries vivantes, et il a ainsi été établi que le vecteur exprimant un ARNs dérivé d'E. coli peut être utile en tant que composition immunorégulatrice. En outre, il a été établi que le traitement d'une vésicule extracellulaire dérivée d'E. coli avec de la polymyxine B permet d'éliminer la toxicité provoquée par l'endotoxine dans la vésicule et permet simultanément de maintenir l'effet immunorégulateur de la vésicule, et il a ainsi été établi qu'une vésicule extracellulaire contenant le vecteur exprimant un ARNs dérivé d'E. coli peut être utile en tant que composition immunorégulatrice.
PCT/KR2016/013276 2015-12-31 2016-11-17 Gène de petit arn pour réguler la génération de vésicule extracellulaire et la réponse immunitaire de l'hôte, et son utilisation WO2017116005A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020150191428A KR101745809B1 (ko) 2015-12-31 2015-12-31 세포밖 소포 생성 및 숙주 면역반응을 조절하는 Small RNA 유전자 및 이의 용도
KR10-2015-0191428 2015-12-31

Publications (1)

Publication Number Publication Date
WO2017116005A1 true WO2017116005A1 (fr) 2017-07-06

Family

ID=59219721

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2016/013276 WO2017116005A1 (fr) 2015-12-31 2016-11-17 Gène de petit arn pour réguler la génération de vésicule extracellulaire et la réponse immunitaire de l'hôte, et son utilisation

Country Status (2)

Country Link
KR (1) KR101745809B1 (fr)
WO (1) WO2017116005A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109439683A (zh) * 2018-11-14 2019-03-08 天津大学 抑制、敲除和/或表达基因在提高丙酮酸代谢路径产物及提高单克隆抗体表达量中的应用

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020122450A1 (fr) * 2018-12-10 2020-06-18 주식회사 엠디헬스케어 Nanovésicules dérivées de bactéries du genre sphingomonas et leurs utilisations
KR102242196B1 (ko) 2018-12-10 2021-04-20 주식회사 엠디헬스케어 스핀고모나스 속 세균 유래 나노소포 및 이의 용도

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140186398A1 (en) * 2011-07-18 2014-07-03 Icahn School Of Medicine At Mount Sinai BACTERIAL RNAs AS VACCINE ADJUVANTS

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140186398A1 (en) * 2011-07-18 2014-07-03 Icahn School Of Medicine At Mount Sinai BACTERIAL RNAs AS VACCINE ADJUVANTS

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
CHEN, S. ET AL.: "MicC, a Second Small-RNA Regulator of Omp Protein Expression in Escherichi a Coli", JOURNAL OF BACTERIOLOGY, vol. 186, no. 20, 2004, pages 6689 - 6697, XP055358563 *
HARRIS, J. F. ET AL.: "Small RNA-mediated Regulation of Host-pathogen Interactions", VIRULENCE, vol. 4, no. 8, 2013, pages 785 - 795, XP055397343 *
KIM, T. ET AL.: "Systematic Analysis of the Role of Bacterial Hfq-interacting sRNAs in the Response to Antibiotics", JOURNAL OF ANTIMICROBIAL CHEMOTHERAPY, vol. 70, 26 February 2015 (2015-02-26), pages 1659 - 1668, XP055397350 *
PEER, A. ET AL.: "Evolutionary Patterns of Escherichia Coli Small RNAs and Their Regulatory Interactions", RNA, vol. 20, 2014, pages 994 - 1003, XP055397340 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109439683A (zh) * 2018-11-14 2019-03-08 天津大学 抑制、敲除和/或表达基因在提高丙酮酸代谢路径产物及提高单克隆抗体表达量中的应用

Also Published As

Publication number Publication date
KR101745809B1 (ko) 2017-06-12

Similar Documents

Publication Publication Date Title
WO2020141685A1 (fr) Vésicules dérivées de lactobacillus paracasei et utilisation correspondante
WO2016144139A2 (fr) Composition pour prévenir ou traiter des maladies inflammatoires, comprenant des vésicules extracellulaires dérivées de bactéries d'acide lactique comme principes actifs
WO2017116005A1 (fr) Gène de petit arn pour réguler la génération de vésicule extracellulaire et la réponse immunitaire de l'hôte, et son utilisation
WO2019225962A1 (fr) Variant d'antigène du virus varicelle-zona et utilisation associée
WO2011025310A9 (fr) Souche variante de salmonelle atténuée résultant de la transformation génétique de l'adhésine provenant de escherichia coli porcin pathogène et composition vaccinale comprenant ladite souche variante pour prévenir et traiter la colibacillose et la salmonellose pathogènes chez les porcs
WO2019212293A1 (fr) Vésicules extracellulaires issues d'un micro-organisme recombinant comprenant un polynucléotide codant pour une protéine cible et leur utilisation
WO2016108394A1 (fr) Composition comprenant un néo-agaro-oligosaccharide en tant que substance active, pour la prévention ou le traitement de la septicémie ou d'un choc septique
WO2018124393A1 (fr) Composition vaccinale pour la prévention ou le traitement de la brucellose contenant une souche de salmonelle non pathogène dans laquelle un antigène o de lps est supprimé, exprimant des antigènes communs majeurs brucelliques
WO2023038419A1 (fr) Souche de protection de la santé intestinale lactobacillus paracasei eps da-bacs possédant des effets favorisant la croissance de lactobacillus bifidus et inhibant les bactéries intestinales nuisibles clostridium difficile, et son polysaccharide
WO2018034492A1 (fr) Composition pour la prévention, l'amélioration ou le traitement d'une maladie immunitaire à médiation par th1, d'une maladie immunitaire à médiation par th17 ou d'une maladie immunitaire à médiation par th2 comprenant du pediococcus pentosaceus en tant que principe actif
WO2019004668A1 (fr) Nanovésicule dérivée de bactéries du genre proteus et son utilisation
WO2019190137A1 (fr) Composé 1,2-diacylglycérol, son procédé de préparation et immunomodulateur le contenant en tant qu'ingrédient actif
WO2012093754A1 (fr) Composition comprenant des vésicules extracellulaires provenant de l'intérieur d'un corps de mammifère et utilisation de celle-ci
WO2020171279A1 (fr) Liposome pour vaccin destiné à être administré par voie orale pour poisson, et procédé de production associé
WO2022139524A1 (fr) Nouveau dérivé de fk506 et composition le comportant pour favoriser la pousse des cheveux
Ebrahimzadeh et al. Induction of immunogenic response in balb/c mice by live and killed form of recombinant Lactococcus lactis displaying EG95 of echinococcus granulosus
WO2022154576A1 (fr) Exosomes comprenant une protéine antigénique dérivée de coronavirus ou gène la codant, et leur utilisation
WO2022255744A1 (fr) Vésicule issue de lactobacillus plantarum et son utilisation
WO2021242056A1 (fr) Souche de l'espèce bifidobacterium et vésicule extracellulaire dérivée de cette dernière, et leurs utilisations anti-inflammatoires et antibactériennes
WO2021242057A1 (fr) Souche de lactobacillus sp., reticulum endoplasmique dérivé de cette dernière, et utilisation anti-inflammatoire et antibactérienne associée
WO2020166868A1 (fr) Nanovésicules issues de bactéries du genre rothia et leur utilisation
WO2019164230A1 (fr) Nano-vésicules dérivées de bactéries de l'espèce cupriavidus et utilisation associée
WO2023282622A1 (fr) Composition pour le traitement de maladies auto-immunes comprenant lactobacillus sakei ou des vésicules extracellulaires dérivées de celui-ci en tant que principe actif
EP3403670B1 (fr) Immunomodulateur pour réaction d'hypersensibilité à un allergène dérivé d'acarien dermatophagoïde
WO2022255784A1 (fr) Vésicule dérivée de lactobacillus rhamnosus et ses utilisations

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16881958

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16881958

Country of ref document: EP

Kind code of ref document: A1