WO2017085241A1 - A family of microbial lysine transporter polypeptides - Google Patents

A family of microbial lysine transporter polypeptides Download PDF

Info

Publication number
WO2017085241A1
WO2017085241A1 PCT/EP2016/078110 EP2016078110W WO2017085241A1 WO 2017085241 A1 WO2017085241 A1 WO 2017085241A1 EP 2016078110 W EP2016078110 W EP 2016078110W WO 2017085241 A1 WO2017085241 A1 WO 2017085241A1
Authority
WO
WIPO (PCT)
Prior art keywords
lysine
amino acid
transporter
cell
genetically modified
Prior art date
Application number
PCT/EP2016/078110
Other languages
French (fr)
Inventor
Sailesh MALLA
Morten Sommer
Eric VAN DER HELM
Stefan WIESCHALKA
Jochen FÖRSTER
Original Assignee
Danmarks Tekniske Universitet
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Danmarks Tekniske Universitet filed Critical Danmarks Tekniske Universitet
Publication of WO2017085241A1 publication Critical patent/WO2017085241A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/08—Lysine; Diaminopimelic acid; Threonine; Valine
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y401/00—Carbon-carbon lyases (4.1)
    • C12Y401/01—Carboxy-lyases (4.1.1)
    • C12Y401/01018—Lysine decarboxylase (4.1.1.18)

Definitions

  • the microbial cell of the invention is adapted for lysine production by genetic modifications that reduce the depletion of the intracellular lysine pool and/or enhance the synthesis of lysine when compared to the cell from which the genetically modified cell was derived.
  • the metabolic consumption of lysine in the microbial cell of the invention may for example be reduced by blocking the conversion of lysine to cadaverine by lysine decarboxylase (see example 4 and figure 7).
  • the genetically modified micro-organism according to the invention for production and export of lysine, may be a bacterium.
  • suitable bacteria A non-exhaustive list of suitable bacteria is given as follows: a species belonging to a genus selected from the group consisting of Corynebacterium, Escherichia, Bacillus, Lactobacillus, Lactococcus, Acetobacter, Acinetobacter, Pseudomonas, Streptococcaceae, and Brevibacteriaceae; especially preferred group members being Corynebacterium, Escherichia and Brevibacteriaceae.
  • the bacterium is a Generally Recognized As Safe (GRAS) strain.
  • the genetically modified micro-organism according to the invention for production and export of lysine, may be a fungus, and more specifically a filamentous fungus belonging to the genus of Aspergillus, e.g. A. niger, A. awamori, A. oryzae, A. nidulans; a yeast belonging to the genus of Saccharomyces, e.g. S. cerevisiae, S. kluyveri, S. bay anus, S. exiguus, S. sevazzi, S. uvarum; a yeast belonging to the genus Kluyveromyces, e.g. K. lactis K. marxianus var.
  • a filamentous fungus belonging to the genus of Aspergillus e.g. A. niger, A. awamori, A. oryzae, A. nidulans
  • marxianus K. thermotolerans
  • a yeast belonging to the genus Candida e.g. C. utilis C. tropicalis, C. albicans, C. lipolytica, C. versatilis
  • a yeast belonging to the genus Pichia e.g. P. stipidis, P. pastoris, P. sorbitophila, or other yeast genera, e.g. Cryptococcus, Debaromyces, Hansenula, Pichia, Yarrowia, Zygosaccharomyces or Schizosaccharomyces.
  • filamentous fungi a species belonging to the genus Penicillium, Rhizopus, Fusarium, Fusidium, Gibberella, Mucor, Mortierella, and Trichoderma.
  • the preferred micro-organisms of the invention may be Escherichia coli,
  • Lysine can be produced and exported using microbial cells of the invention (e.g. recombinant bacterial cells) by introducing the cells into a culture medium comprising a carbon source for biosynthesis of lysine or its precursors (see Figure 1); and finally recovering the lysine produced by the culture, as illustrated in the Examples.
  • microbial cells of the invention e.g. recombinant bacterial cells
  • a nucleic acid molecule that encodes a lysine transporter according to the invention, can be introduced into a cell or cells and integrated into the host cell genome using methods and techniques that are standard in the art.
  • nucleic acid molecules can be introduced by standard protocols such as transformation including chemical transformation and electroporation, transduction, particle bombardment, etc.
  • Expressing the nucleic acid molecule encoding the enzymes of the claimed invention also may be accomplished by integrating the nucleic acid molecule into the genome.
  • the invention further encompasses the use of a transgene encoding a lysine transporter to enhance the extracellular production of lysine in a microbial cell.
  • the transgene encoding a lysine transporter encodes an amino acid sequence having at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 % sequence identity to SEQ ID No: 2 that is capable of exporting lysine from a microbial cell.
  • microbial cell of the invention comprises a transgene encoding a lysine transporter protein, wherein the encoded amino acid sequence has at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 % sequence identity to SEQ ID No: 2 or 65, but with the proviso that amino acid residues at the indicated positions are V 240 and F 278 .
  • the microbial population of cow fecal samples comprises a wide range of bacteria, including both bacteria that are auxotrophic and bacteria that are prototrophic for lysine. Common for many bacterial cells is a limited capacity to catabolize lysine and lysine dipeptides, while the accumulation of inhibitory levels of lysine is avoided by the export of lysine by means of transporters. Accordingly, metagenomic libraries constructed from DNA extracted from fecal samples provides a potentially rich source of novel lysine transporters.
  • Plasmids comprising the metagenomics library (see 1.1) were isolated; and 400 ng of the plasmid DNA were transformed into electro-competent cells of E.coli C4860 strain.
  • 10 6 cells i.e., 100 ⁇ of the library cells
  • L-lysine at the selective concentration (12 and 14 g/L). Plates were incubated at 37 °C and growth of colonies (potential lysine-tolerant clones) was assayed after 48- 65 h of incubation.
  • the transport properties of the four putative lysine transporters were compared by measuring the concentration of lysine needed to inhibit the growth by 90% [IC90] of E.coli C4860 clones expressing each of the putative lysine transporters.
  • the L-lysine IC90s of the selected E. coli C4860 clones ranged from 10.44 ⁇ 1.277 g/L to 14.25 ⁇ 0.415 g/L; corresponding to a 43% increase in IC90 for the clone harboring pZE-RCL-MglE (nucleotide sequence of DNA insert in pZE-RCL-MglE: SEQ ID No. : 1) compared to the control cells of the E. coli C4860 comprising the vector pZE21 ( Figure 2A).
  • the pZE-RCL-MglE plasmid encoding the MglE transporter [SEQ ID No. : 2] was introduced into the following E. coli production strains; i) MG1655, ii) Crooks, iii) W1116 and iv) W3110.
  • the lysine tolerance (measured as IC90) of each E.coli strains was increased when harboring and expressing the pZE-RCL-MglE plasmid ( Figure 3).
  • the L-lysine tolerance of strain E. coli W3110, which is widely used for the commercial production of L-lysine, was increased by 29.5%. Hence the lysine tolerance conferred by this transporter is widely applicable to industrial E. coli based L-lysine fermentation.
  • the MglE protein is predicted to be a member of a new family of RhaT/EamA-like transporters related to the drug/metabolite transporter (DMT) superfamily.
  • EamA family members are very diverse and most of their functions are unknown, although PecM from Erwinia chrysanthemi and YdeD in E. coli, are characterized as exporters (Franke et al., 2003).
  • MglE also contains two copies of the EamA domain found in members of this superfamily: one in the region of 9-143 amino acids and another in 152-292 amino acids.
  • Two-dimensional topological model of MglE transporter possesses six cytoplasmic domains, five periplasmic domains and ten transmembrane domains with both N- and C-terminals in the cytoplasmic region ( Figure 5).
  • MglE protein shows homology to some hypothetical proteins of Bacteroides species ( Figure 6) sharing an amino acid sequence identity of >50%; the majority of this group sharing an amino acid sequence identity of >74%.
  • the known L-lysine specific transporters from various strains formed a group that is phylogenetically very remote from MglE. MglE does not have any significant homology with the LysE lysine exporter from C. glutamicum. Accordingly, the MglE protein is a novel L-lysine transporter, whose function could not have been predicted by sequence homology to known L-lysine transporters.
  • E. coli comprises genes encoding lysine decarboxylases that degrade intracellular lysine.
  • the E. coli strain W3110 was genetically modified to knock-out the constitutive gene (IdcC) and the acid-inducible gene (cadA) encoding two lysine decarboxylases to produce the strain E.coli DMLC, having a reduced lysine degradation capacity.
  • Cells of this knock-out strain were used as a host to compare the effect of the lysine transporter MglE on lysine tolerance with two known lysine transporters, the L-Lysine efflux permease (LysE) from Corynebacterium glutamicum [SEQ ID No. : 47] and the lysine exporter (YbjE; LysO protein) from E. coli [SEQ ID No. : 49] .
  • Disruption of the IdcC and cadA genes was carried out using the ampicillin resistant pSJI8 helper plasmid containing genes for ⁇ Red recombinase ( ⁇ , ⁇ , exo) enhancing recombination rate under control of arabinose promoter; and the FLP recombinase to eliminate the resistance cassette under the control of rhamnose promoter.
  • IdcC disruption Chemically competent cells of E. coli W3110 strain were transformed with the pSJI8 plasmid and the transformed cells were selected in LB- amp solid media and incubated at 30 °C. The E. coli W3110/pSJI8 transformants were grown in LB-amp at 30°C to an OD 6 oonm of 0.3 and 1 mM arabinose was added to induce the ⁇ Red system.
  • a PCR product was generated by using primer pair LdcC_F2/LdcC_R (Table 1 ; positioned 64 bp from the IdcC gene start/stop codon) to amplify a kanamycin cassette from the genomic DNA of IdcC in-frame knocked-out Kieo strain b0186.
  • Electro-competent cells were prepared from the induced E. coli W3110/pSJI8 transformants; which were then transformed with about 200 ng of the purified PCR product.
  • the transformed cells were plated in LB-km, amp solid media.
  • the replacement of the IdcC gene (2. 1 kb) by the kanamycin (km) cassette was confirmed by colony PCR using a primer pair LdcC_Fl/LdcC_R that gave a 1.6 kb DNA band corresponding to the km cassette.
  • the colony confirmed to have the IdcC gene replaced by the km cassette, was grown in 1 ml of LB-km-amp at 30 °C for 3-4 h.
  • the cells were collected by centrifugation and re-suspended in 100 ⁇ of sterilized water and 10 ⁇ of the re-suspended cells were inoculated into 1 ml of LB- amp and 50 mM of rhamnose, followed by incubation at 30 °C for 4-6 h . The cells were then spread onto LB-amp plates and incubated at 30 °C for overnight. To confirm the removal of the km cassette, colony PCR was performed using a primer pair LdcC_Fl/LdcC_R which gave band at ⁇ 0.25 kb instead of 1.6 kb, confirming the successful resistant markerless IdcC deletion. The strain was named as E.
  • cadA disruption Similarly, primer pair CadA_F2/CadA_R (Table 1 ; located 56 bp from the cadA gene start/stop codon) was used to amplify the kanamycin cassette from the genomic DNA of a cadA inframe knocked-out Kieo strain b4131. The purified PCR product was transformed into E. coli W3110 : :AldcC/pSJI8 and a similar protocol was followed for the confirmation of the cadA deletion. To confirm the replacement of cadA by the km cassette, as well as the removal of the km cassette in the double deletion mutant, a primer pair CadA_Fl/CadA_R was used for colony PCR.
  • the helper plasmid pSJI8 was removed from the double deletion mutant, by growing the E. coli W3110 : :AldcC.AcadA/pSJI8 strain on LB plates incubated at 37 °C overnight and then streaking colonies on LB and LB-amp plates. Cells of E. coli W3110 : :AldcC.AcadA that had lost pSJI8 grew on LB but not on LB-amp media. The double (IdcC and cadA) deletion strain was designated E.coli DMLC.
  • pZE-LysE and pZE-YbjE plasmids Oligonucleotides LysE-F and LysE-R (Table 2) were synthesized to amplify nucleotide sequence of lysE gene (Genbank accession no. AGT05251) from genomic DNA of C. glutamicum. Similarly oligonucleotides YbjE-F and YbjE-R were used to amplify the ybjE gene (Genbank accession no. CAQ31402) from E. coli BL21 (DE3) .
  • the lysE and ybjE PCR products were cloned into the pZE21 vector excised with Kpnl and BamHI restriction enzymes to construct pZE-LysE and pZE-YbjE expression plasmids, respectively.
  • LysE-R CCGGGATCCCTAACCCATCAACATCAGTTTG 57 lysE gene Encoding GenBankAcc: AGT05251 46
  • E.coli DMLC expressing the lysine transporter MglE Cells of the NdcC.AcadA strain E.coli DMLC were then transformed with either the pZE-RCL- MglE, pZE-LysE, pZE-YbjE plasmids or the control vector pZE21.
  • the lysine tolerance (measured as IC90) of the NdcC.AcadA strain E.coli DMLC was enhanced by expressing of each of the lysine transporters; however, cells harboring and expressing the pZE-RCL-MglE plasmid showed the highest lysine tolerance ( Figure 8).
  • the lysine exporter MglE confers a higher lysine tolerance in the E. coli DMLC strain adapted for lysine production than the known lysine transporters lysE and ybjE.
  • the primer pair pZE21_F/pZE21_R (Table 3) was used for amplification of mg IE gene from pZE-MglE plasmid DNA while the primer pair
  • pZE21_EP_Gib.F/pZE21_EP_Gib.R (Table 3) was used to amplify the vector backbone using the pZE21 vector as a template.
  • the ligation mixture was briefly centrifuged and the reaction was carried out in a thermocycler held constant at 50 °C for 1 h.
  • the ligation mixture was then desalted for an hour using a Millipore (type VSWP) drop dialysis film with 0.025 ⁇ on Milli- Q water (Desalting DNA Drop dialysis method).
  • the purified ligation product (pZE- MglE* library) was transformed into electro-competent cells of E. coli C4860 strain to give a library of 75-80,000 CFU/ml.
  • MglE lysine transporters each conferring higher levels of lysine tolerance that the parent MglE lysine transporter were identified on the basis of the MIC of cells expressing the mutant transporters and a corresponding mutation in the amino acid sequence of the expressed transporter.
  • the mutant conferring the highest L-lysine tolerance in the E. coli C4860 was MglEl* [SEQ ID No. : 65] ; which was characterized by 2 amino acid mutations as indicated in Table 4.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention provides a genetically modified microbial cell for production of lysine, comprising a transgene encoding a polypeptide capable of exporting lysine from the cell. The genetically modified microbial cell for production of lysine may be further characterized by genetic modifications that confer reduced lysine metabolism and/or enhanced lysine synthesis as compared to the parent cell from which said genetically modified cell was derived. The invention further provides a method for producing lysine using the genetically modified microbial cell. The invention further provides a novel family of lysine transporter polypeptides; and the use of said polypeptide to enhance production of extracellular lysine in a microbial cell.

Description

Title: A family of microbial lysine transporter polypeptides
Field of the invention
The invention provides a genetically modified microbial cell for production of lysine, comprising a transgene encoding a polypeptide capable of exporting lysine from the cell. The genetically modified microbial cell for production of lysine may be further characterized by genetic modifications that confer reduced lysine metabolism and/or enhanced lysine synthesis as compared to the parent cell from which said genetically modified cell was derived. The invention further provides a method for producing lysine using the genetically modified microbial cell. The invention further provides a novel family of lysine transporter polypeptides; and the use of said polypeptide to enhance production of extracellular lysine in a microbial cell.
Background of the invention
Current global demand for lysine market is about 2 million tons per year with an annual growth of 7% on average. Industrial stereospecific L-lysine bioprocesses are primarily based on Escherichia coli and Corynebacterium glutamicum, which are capable of producing lysine titers in excess of 100 g/L. The specific export rate of L- lysine is however inhibited these production microorganisms when the extracellular lysine reaches these titers. It has, for example been observed that when the extracellular lysine titer increases from 80 mM (11.7 g/L) to 400 mM (58.5 g/L), this causes a 50% reduction in lysine export rate, associated with the accumulation of intracellular L-lysine pool impeding the cell survivability. L-lysine toxicity arises conceivably due to i) feedback inhibition of aspartokinase by L-lysine inhibiting other necessary amino acids synthesis, ii) inhibition of L-arginine transporter reducing arginine uptake; and increased osmotic pressure and pH stress. Irrespective of the toxicity mechanism these issues could be mitigated by active secretion of L-lysine into culture media. This strategy has been deployed for L- lysine production by expressing a lysine exporter LysE from C. glutamicum into Methylophilis methylotrophus (Gunji, Y. & Yasueda, H . ; 2006), however, options for rational engineering are nearly exhausted and hence search for new genetic building blocks to further improve L-lysine tolerance are urgently needed. On the other hand, functional metagenomics selection is a powerful method for discovering novel genes and enzymes from the environment because of its potential to access all the genetic elements present in a particular environmental niche.
Summary of the invention According to a first embodiment, the invention provides a genetically modified microbial cell for production of lysine comprising a transgene encoding a lysine transporter polypeptide, wherein the amino acid sequence of the lysine transporter polypeptide has at least 85% sequence identity to SEQ ID No. : 2. Alternatively, the genetically modified microbial cell of the invention comprises a transgene encoding a lysine transporter polypeptide, wherein the amino acid sequence of the lysine transporter polypeptide has at least 85 % sequence identity to SEQ ID No: 2, but with the proviso that amino acid residue at position 240 is valine and amino acid residue at position 278 is phenylalanine.
The genetically modified microbial cell of the invention may further be characterized by one or more genetic modification conferring : reduced lysine metabolism and/or enhanced lysine synthesis, as compared to the parent cell from which said genetically modified cell was derived.
The genetically modified microbial, characterized by reduced lysine metabolism, may comprise one or more endogenous genes encoding a polypeptide having lysine decarboxylase activity (EC 4.1.1.18) are deleted or inactivated. The genetically modified microbial of the invention that is characterized by enhanced lysine synthesis, may further comprise one additional transgene or a combination of two or more additional transgenes encoding a polypeptide selected from the group consisting of: aspartate kinase (EC No. : 2.7.2.4); dihydrodipicolinate synthase (EC No. : 4.2.1.52 or 4.3.3.7); aspartate- semialdehyde dehydrogenase (EC No. : 1.2.1.11); meso-diaminopimelate dehydrogenase (EC No. : 1.4.1.16); diaminopimelate decarboxylase (EC No. : 4.1.1.20); aspartate aminotransferase (EC No. : 2.6.1.1); dihydrodipicolinate reductase (EC No. : 1.3.1.26 or 1.17.1.8); succinyldiaminopimelate aminotransferase, AT class I (EC No. : 2.6.1.17); tetrahydrodipicolinate succinylase (EC No. : 2.3.1.117); succinyl-diaminopimelate desuccinylase (EC No. : 3.5.1.18); and diaminopimelate epimerase (EC No. : 5.1.1.7).
The genetically modified microbial of the invention may be selected from among a bacterium, a yeast, and a filamentous fungus; preferably a species of bacterium selected from the group consisting of: Corynebacterium, Escherichia, Brevibacteriaceae, Bacillus, Lactobacillus, Lactococcus, Acetobacter, Acinetobacter, Pseudomonas and Streptococcaceae. According to a second embodiment, the invention provides an isolated polynucleotide encoding a lysine transporter polypeptide, wherein the amino acid sequence of the polypeptide has at least 85% sequence identity to SEQ ID No. : 2.
Alternatively, the isolated polynucleotide encodes an amino acid sequence of the having at least 85 % sequence identity to SEQ ID No: 2, but with the proviso that amino acid residue at position 240 is valine and amino acid residue at position 278 is phenylalanine.
According to a third embodiment, the invention provides a method for producing lysine in vivo comprising : providing a microbial cell comprising a transgene encoding a lysine transporter polypeptide according to the invention; introducing said microbial cell into a growth medium to produce a culture; providing a substrate for lysine production; recovering the produced lysine from the culture and optionally purifying the lysine recovered.
According to a fourth embodiment, the invention provides for the use of a transgene encoding a lysine transporter polypeptide to enhance lysine export from a microorganism, wherein the amino acid sequence of said polypeptide has at least 85% sequence identity to SEQ ID No: 2. The transgene encoding a lysine transporter may further be used to enhance lysine export from a microorganism, wherein said cell is characterized by one or more genetic modification conferring : reduced lysine metabolism and/or enhanced lysine synthesis as compared to the parent cell from which said genetically modified cell was derived; as detailed above. The transgene encoding a lysine transporter may further be used to enhance lysine export from a microorganism of the invention, wherein the micro-organism is a species of a genus selected from the group consisting of: Corynebacterium, Escherichia, Brevibacteriaceae, Bacillus, Lactobacillus, Lactococcus, Acetobacter, Acinetobacter, Pseudomonas and Streptococcaceae.
Description of the invention Description of the figures:
Figure 1. Cartoon illustrating the lysine biosynthesis pathway in a micro-organism. Metabolic steps in the lysine biosynthesis pathway are catalyzed by the following enzymes (and encoded by their respective genes) aspartate kinase (LysC);
aspartate-semialdehyde dehydrogenase (ASD); dihydrodipicolinate synthase (DapA); dihydrodipicolinate reductase (DapB); succinyldiaminopimelate
aminotransferase, AT class I (DapC); tetrahydrodipicolinate succinylase (DapD); succinyl-diaminopimelate desuccinylase (DapE); diaminopimelate epimerase (DapF) and diaminopimelate decarboxylase (LysA).
Figure 2 (A) L-lysine IC90 values for four selected lysine-tolerant E.coli C4860 clones (strains) harboring putative transporters (pZE-RCL-MglE; pZE-CGMLl ; pZE- CGML2; and pZE-CGML3) as compared to a clone harboring the vector (pZE21). Cells (1 x 104) from an overnight culture of each selected E. coli clones were inoculated into LB liquid media and grown at 30 °C and 300 RPM in 96-well microtiter plates containing 150 μΙ of medium per well. The lysine concentration in the wells followed a logarithmic L-lysine concentration gradient with two-fold serial dilutions. Growth in each well was determined as endpoint absorbance measurements (A600nm) taken after 24 h of incubation using a plate reader (Synergy H I, BioTek) and background-subtracted. Growth inhibition of the E. coli clones were plotted against L-lysine concentrations with a polynomial interpolation between neighboring data points using R software (http://www. r-project.org). The percentage of inhibition was calculated using the formula : 1 - [A60onm L- lysine/ A60onm control] - The inhibitory concentration was defined as the lowest concentration of lysine that inhibited 90% (IC90) of the growth of the clone tested. Figure 2 (B) Graphical presentation of growth rates of the four selected lysine- tolerant E.coli C4860 clones (strains) harboring putative transporters (pZE-RCL- MglE; pZE-CGMLl; pZE-CGML2; and pZE-CGML3) as compared to a clone harboring the vector (pZE21) in the presence or absence of lysine. Single colonies of the selected lysine-tolerant E. coli C4860 and control clones were grown overnight; and the cultures were diluted to adjust (OD)60onm of 0.1 and 5 μΙ of the cultures were inoculated in 150 μΙ of fresh media with kanamycin (50 μg/ml) and L-lysine (0 and 8 g/l) in a 96-well micro-titer plate. The plate was incubated at 37 °C for 24 h in an automated spectrophotometer (ELx808, BioTek) which recorded the (OD)630nm at an interval of 60 min. Then the data points at the exponential phase of the growth curves were used to determine the growth rates by applying the formula Ιη(002/ΟΟι) = μ(ί2-ίι), where OD is the optical density of the cell culture at 630nm, t is the time in h and μ is the growth rate in h"1. The data represents the average of triplicate experiments, with error bars being representative of the standard error of the mean (SEM).
Figure 3 Bar graph showing the L-lysine tolerance of E. coli production strains: i) C4860, ii) MG1655, iii) W3110, iv) Crooks and v) W1116 harboring the plasmid pZE-RCL-MglE encoding a lysine transporter, or the vector (pZE21). Lysine tolerance, measured as IC90, was determined as set out in Figure 2A.
Figure 4 Cartoon showing the structure of the metagenomics DNA insert in pZE- RCL-MglE.
Figure 5 Cartoon showing the predicted membrane topology of the MglE transporter protein showing 6 cytoplasmic regions, 5 periplasmic regions and 10 transmembrane a-helices.
Figure 6 Diagram showing the origin of 16 closest homologs to MglE, identified by BLASTp, with a >50% sequence identity compared to MglE and having the following GenBank numbers: Bacteroides sp. CAG: 598 (GenBank: CCX61976.1); Bacteroides sp. CAG:443 (GenBank: CDB98382.1); Bacteroides sp. CAG: 1076 (GenBank: CCY93346.1); Bacteroides coprocola CAG: 162 (GenBank:CDA70121.1); Bacteroides coprocola DSM 17136 (GenBank: EDV02549.1); Bacteroides coprocola (GenBank:WP_040311754.1); Prevotella sp., CAG: 1031 (GenBank:CCX44039.1); Bacteroides sp. CAG: 1060 (GenBank: CCX56076.1; SEQ ID No : 83); Bacteroides sp. CAG: 545 (GenBank:CCZ43287.1 ; SEQ ID No : 81); Bacteroides sp. CAG: 770 (GenBank:CDC66277.1 ; SEQ ID No: 79); Bacteroides sp. CAG 714 (GenBank:CDD32682.1); Bacteroides barnesiae (GenBank: WP_018711839.1); Bacteroides plebeius (GenBank:WP_007558717.1); Bacteroides plebeius CAG : 211 (GenBank:CCZ87371.1); Bacteriodes coprophilus (GenBank:WP_008140691.1); and Bacteriodes coprophilus CAG : 333 (GenBank: CDC57518.1); Figure 7 Cartoon illustrating the lysine biosynthesis pathway in a genetically modified micro-organism adapted for lysine production, and harboring the plasmid pZE-RCL-MglE encoding a lysine transporter. Metabolic steps in the lysine biosynthesis pathway are catalyzed by the following enzymes (and encoded by their respective genes) aspartate kinase (LysC); aspartate-semialdehyde dehydrogenase (ASD); dihydrodipicolinate synthase (DapA); dihydrodipicolinate reductase (DapB); succinyldiaminopimelate aminotransferase, AT class I (DapC); tetrahydrodipicolinate succinylase (DapD); succinyl-diaminopimelate desuccinylase (DapE); diaminopimelate epimerase (DapF) and diaminopimelate decarboxylase (LysA); while the conversion of lysine to cadaverine is catalyzed by lysine decarboxylases (LdcC and CadA).
Figure 8 Histogram showing the L-lysine tolerance of cells of the E.coli W3110 AldcC.AcadA strain (named as E.coli DMLC) (adapted for lysine production) transformed with the control vector pZE21; or the plasmids pZE-RCL-MglE, pZE- LysE, and pZE-YbjE plasmids encoding the lysine exporters MglE, LysE and YbjE respectively. Lysine tolerance, measured as IC90, was determined as set out in Figure 2A.
Figure 9 Histogram showing the extracellular L-lysine content (A) and the specific lysine production (extracellular); (B) of cell cultures of the parent E. coli strain W3110 transformed with the control vector pZE21; compared to the E. coli DMLC strain (adapted for lysine production) harboring the control vector pZE21 or the plasmid pZE-RCL-MglE encoding the lysine exporter MglE. The lysine content of the LB growth medium is shown.
Figure 10 Bar graph showing the fold change in L-lysine tolerance (IC90) of 2 strains of E. coli expressing a MglE gene encoding the lysine exporter MglE, or one of four genes showing homology to the MglE gene. (Left side) E. coli C4860 strain and (right side) E. coli DMLC strain (adapted for lysine production) transformed with the control vector (pZE21), or the plasmid pZE-RCL-MglE encoding the lysine exporter MglE, or a plasmid comprising one of the homologous genes: pZE-Gene 1, pZE-Gene 2, pZE-Gene 3, and pZE-Gene 4. Lysine tolerance, measured as IC90, was determined as set out in Figure 2A.
Abbreviations and terms: gi number: (genlnfo identifier) is a unique integer which identifies a particular sequence, independent of the database source, which is assigned by NCBI to all sequences processed into Entrez, including nucleotide sequences from DDBJ/EMBL/GenBank, protein sequences from SWISS-PROT, PIR and many others. Amino acid sequence identity: The term "sequence identity" as used herein, indicates a quantitative measure of the degree of homology between two amino acid sequences of substantially equal length. The two sequences to be compared must be aligned to give a best possible fit, by means of the insertion of gaps or alternatively, truncation at the ends of the protein sequences. The sequence identity can be calculated as ((Nref-Ndif) 100)/(Nref), wherein Ndif is the total number of non-identical residues in the two sequences when aligned and wherein Nref is the number of residues in one of the sequences. Sequence identity can alternatively be calculated by the BLAST program e.g. the BLASTP program (Pearson W.R and DJ. Lipman (1988)) (www.ncbi. nlm.nih.gov/cgi-bin/BLAST). In one embodiment of the invention, alignment is performed with the sequence alignment method ClustalW with default parameters as described by Thompson J., et al 1994, available at http://www2.ebi.ac.uk/clustalw/.
Preferably, the numbers of substitutions, insertions, additions or deletions of one or more amino acid residues in the polypeptide as compared to its comparator polypeptide is limited, i.e. no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 substitutions, no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 insertions, no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 additions, and no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 deletions. Preferably the substitutions are conservative amino acid substitutions: limited to exchanges within members of group 1 : Glycine, Alanine, Valine, Leucine, Isoleucine; group 2: Serine, Cysteine, Selenocysteine, Threonine, Methionine; group 3 : Proline; group 4: Phenylalanine, Tyrosine, Tryptophan; Group 5 : Aspartate, Glutamate, Asparagine, Glutamine.
Deleted gene: the deletion of a gene from the genome of a microbial cell leads to a loss of function of the gene and hence where the gene encodes a polypeptide the deletion results in a loss of expression of the encoded polypeptide. Where the encoded polypeptide is an enzyme, the gene deletion leads to a loss of detectable enzymatic activity of the respective polypeptide in the microbial cell.
Lysine transporter protein: lysine transporter polypeptide; polypeptide capable of transporting lysine, more specifically polypeptide capable of exporting lysine from a microbial cell. Native gene: endogenous gene in a microbial cell genome, homologous to host micro-organism.
Parent cell : a cell of a microbial strain which is the subject of genetic modification to obtain a genetically modified microbial strain that is derived from the parent cell; whereby the properties of the derivative, attributable to the genetic modification, can be compared to that of the parent cell.
Detailed description of the invention
The present invention relates to the provision of a transporter protein capable of exporting lysine from a microbial cell, and thereby enhancing lysine export and/or production by the cell. Whereas the enzymes of the lysine biosynthesis pathway (figure 1) have been extensively studied and are conserved among diverse bacterial genomes, very few bacterial lysine transporters have been experimentally validated. A functional search for candidate lysine transporters, capable of exporting lysine, was initiated by screening for lysine transporters encoded by metagenomic DNA isolated from cow gut microbiota samples. DNA molecules derived from shearing the isolated metagenomic DNA were cloned into an expression plasmid compatible with expression in the host bacterium, Escherichia coli.
Bacterial cells, such as E. coli, are able to assimilate lysine provided in their growth medium, however, at high concentrations, lysine becomes toxic for growth due to three physiological factors:
i) lysine causes feedback inhibition of aspartokinase: impeding the synthesis of necessary amino acids for cell growth;
ii) lysine reduces L-arginine uptake; since L-lysine is a natural inhibitor of L-Arg transport,
iii) lysine increases osmotic pressure and pH stress due to the accumulation of intracellular L-lysine.
E. coli can be used as a host cell to screen for transporters capable of exporting lysine; since growth of a transformed host cell at toxic lysine concentration is dependent on the expression of a gene encoding a transporter capable of exporting lysine. A library of 106 E. coli cells, transformed with the metagenomic library, was screened, from which a clone (pZE-RCL-MglE) conferring a 43% increase in lysine tolerance was identified, when measured as the lowest concentration of lysine that inhibited growth by 90% (IC90). I A novel family of lysine transporters that facilitate lysine export
The invention provides a new family of novel transporter proteins capable of exporting lysine from a microbial cell of the invention. One member of this family is the lysine transporter, designated MglE, which is expressed as a polypeptide having 297 amino acids and a deduced amino acid sequence having SEQ ID No : 2. Based on phylogenetic analysis, this new family of novel lysine transporters (including MglE) show structural features in common with the RhaT/EamA-like transporter family belonging to the drug/metabolite transporter (DMT) superfamily. The MglE protein contains two copies of the EamA domain common to members of this superfamily: of which one is located in the region of amino acid residues 9-143 and another in the region of amino acid residues 152-292. A two-dimensional topological model shows MglE transporter to possess six cytoplasmic domains, five periplasmic domains and ten transmembrane domains with both N- and C-terminals in the cytoplasmic region (Figure 5). The members of this new protein family of lysine transporters are characterized by an amino acid sequence having at least 85% sequence identity to SEQ ID No. :2; for example at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 % sequence identity to SEQ ID No. : 2. Members of this family of novel lysine transporters are phylogenetically remote from known L-lysine specific transporters, and do not have any significant homology with the LysE lysine exporter from C. glutamicum. Accordingly, the MglE protein family comprises novel L-lysine transporters, whose function could not have been predicted by sequence homology to known L-lysine transporters.
The members of the family of novel lysine transporter proteins, when expressed in a microbial cell of the invention, e.g. E. coli cell, are capable of enhancing the cell's lysine tolerance. For example, when expressed in E. coli the cells lysine tolerance was increased by 43%, when measured as the lowest concentration of lysine that inhibited growth by 90% (IC90). The observed increase in lysine tolerance is due to the ability of the novel transporter protein to export lysine from the cell, at a rate that is sufficient to prevent the intracellular lysine concentration reaching levels that are toxic for microbial cell growth. The members of the family of novel transporter proteins, are capable of enhancing lysine export when expressed in different microbial cells, for example, lysine export is enhanced in a number of different lysine production strains of E. coli (Example 2). When the novel transporter protein (MglE) is expressed in a microorganism adapted for lysine production, the extracellular lysine concentration is enhanced as compared to a control strain not expressing the transport protein MglE. The extracellular lysine concentration produced by MdcC cadA E. coli strain was increased by 8% in cells expressing the transport protein MglE as compared to control cells (Example 4). Surprisingly, the increased in lysine tolerance of a microorganism conferred by expression of the novel transporter protein (MglE) was greater than that conferred by expression of with the LysE or YbjE transporter proteins (Example 4).
Phylogenetic analyses revealed that this new family of novel lysine transporters showed partial amino acid sequence identity to a number of un-identified polypeptides reported in the GenBank, for example, the polypeptides identified as: GenBank:CDC57518.1 (SEQ ID No: 67); GenBank:WP_008140691.1 (SEQ ID No : 69); GenBank:CCZ87371.1 (SEQ ID No: 71); GenBank:WP_007558717.1 (SEQ ID No: 73); GenBank:WP_018711839.1 (SEQ ID No : 75); GenBank:CDD32682.1 (SEQ ID No: 77); GenBank:CCX44039.1 (SEQ ID No: 85); GenBank: WP_040311754.1
SEQ ID No : 87; GenBank: EDV02549.1 (SEQ ID No : 89); GenBank:CDA70121.1 (SEQ ID No: 91); GenBank: CCY93346.1 (SEQ ID No : 93); GenBank: CDB98382.1 (SEQ ID No: 95); and GenBank: CCX61976.1 (SEQ ID No : 97) (see figure 6). Surprisingly however, these un-identified polypeptides were not found to exhibit the same properties as the MglE lysine transporter, since they failed to provide a similar increase in lysine tolerance when expressed in a microorganism (see example 7). This leads to the surprising observation, that the new family of novel lysine transporters of the invention are indeed phylogenetically remote from known L-lysine specific transporters, and their properties could not have been predicted.
The members of the family of novel lysine transporter proteins, include variants or mutants thereof, having an amino acid sequence having at least 85% sequence identity to SEQ ID No: 2. More specifically, the family includes lysine transporter proteins produced by mutation, wherein the mutant proteins confer a higher levels of lysine tolerance (as compared to the parent protein from which the mutant was derived) when expressed in a microbial cell; for example lysine transporter proteins MglEl* and MglE2*. As illustrated in Example 6, microbial cells expressing either MglEl* and MglE2*, showed a 61% increase in lysine tolerance as compared to cells expressing the parent lysine transport protein (MglE). The amino acid sequence of MglEl* [SEQ ID No. : 65] differs from the amino acid sequence of MglE [SEQ ID No. : 2] by 2 substitutions (A/V240 and L/F278). Accordingly, in one embodiment, the amino acid sequence of the lysine transporter protein has at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 % sequence identity to SEQ ID No: 2, but with the proviso that amino acid residues at the indicated positions are V240 and F278.
II: A genetically modified cell expressing the novel lysine transporter
The present invention provides a genetically modified microbial cell capable of exporting enhanced levels of lysine. The microbial cell of the invention comprises a transgene encoding a lysine transporter, where the amino acid sequence of the transporter has at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 % sequence identity to SEQ ID No: 2 that is capable of exporting lysine from a microbial cell. In one embodiment, the microbial cell of the invention comprises a transgene encoding a lysine transporter protein; where the amino acid sequence of the transporter has at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 % (for example at least 85%) sequence identity to SEQ ID No: 2, but
240 278 with the proviso that amino acid residues at the indicated positions are V and F .
In a preferred embodiment the microbial cell of the invention is adapted for lysine production by genetic modifications that reduce the depletion of the intracellular lysine pool and/or enhance the synthesis of lysine when compared to the cell from which the genetically modified cell was derived. The metabolic consumption of lysine in the microbial cell of the invention may for example be reduced by blocking the conversion of lysine to cadaverine by lysine decarboxylase (see example 4 and figure 7). The microbial cell of the invention, suitable for lysine production, may either be selected from a genotype having reduced lysine decarboxylase activity; or alternatively one or more genes encoding a polypeptide having lysine decarboxylase activity (EC 4.1.1.18) are deleted/inactivated from the genome of the microbial cell. A suitable microbial cell having reduced lysine decarboxylase activity (EC 4.1.1.18), includes a cell having a genome from which the IdcC and cadA genes are deleted or are not present. For example, the amino acid sequence of the lysine decarboxylase whose activity is reduced in the microbial cell of the invention has at least 80, 85, 90, 95 or 100% sequence identity to SEQ ID No: 4 [GenBank: BAA77861.2] and SEQ ID No: 6 [GenBank: BAE78134.1].
The microbial cell of the invention, adapted for lysine production, may be characterized by genetic modifications that enhance the synthesis of lysine when compared to the cell from which the genetically modified cell was derived. For example the expression of one or more enzymatic steps in the lysine biosynthesis pathway can be enhanced (Figure 1); either by upregulating expression of a native gene encoding the enzyme catalyzing the respective enzymatic step (e.g. substituting or complementing the native promoter with a DNA fragment conferring higher transcription rates of the cognate native gene), or by introducing a transgene encoding the respective enzyme. One or more genes, whose upregulated expression in the microbial cell of the invention will enhance lysine production, may be selected from the group consisting of:
a) Polynucleotide (/ysC gene) coding for an aspartate kinase (LysC, EC NO. :
2.7.2.4); for example wherein the encoded amino acid sequence has at least 80, 85, 90, 95 or 100% sequence identity to SEQ ID No: 8 [GenBank: BAE78026.1] (for example in E.coli strains) and SEQ ID No: 10 [GenBank: CAA40502.1] (for example in Corynebacterium glutamicum strains);
b) Polynucleotide (dapA gene) coding for a dihydrodipicolinate synthase (DapA, EC No. : 4.2.1.52 or 4.3.3.7); for example wherein the encoded amino acid sequence has at least 80, 85, 90, 95 or 100% sequence identity to SEQ ID No: 12 [GenBank: BAA16355.1] (for example in E.coli strains) and SEQ ID No: 14 [GenBank: X53993.1] (for example in Corynebacterium glutamicum strains)
c) Polynucleotide (asd gene) coding for an aspartate-semialdehyde dehydrogenase (ASD, EC No. : 1.2.1.11); for example wherein the encoded amino acid sequence has at least 80, 85, 90, 95 or 100% sequence identity to SEQ ID No: 16 [GenBank: BAE77859.1] (for example in E.coli strains) and SEQ ID No: 18 [GenBank: CAA40504.1] (for example in Corynebacterium glutamicum strains);
d) Polynucleotide (ddh gene) coding for a meso-diaminopimelate dehydrogenase (Ddh, EC No. : 1.4.1.16); for example wherein the encoded amino acid sequence has at least 80, 85, 90, 95 or 100% sequence identity to SEQ ID No : 20 [GenBank: WP_038587080.1]
e) Polynucleotide (lysA gene) coding for a diaminopimelate decarboxylase (LysA, EC No. : 4.1.1.20); for example wherein the encoded amino acid sequence has at least 80, 85, 90, 95 or 100% sequence identity to SEQ ID
No: 22 [GenBank: BAE76907.1] (for example in E.coli strains) and SEQ ID No: 24 [GenBank: WP_003861293.1] (for example in Corynebacterium glutamicum strains);
f) Polynucleotide (aat gene) coding for an aspartate aminotransferase (aspC or Aat, EC No. : 2.6.1.1); for example wherein the encoded amino acid sequence has at least 80, 85, 90, 95 or 100% sequence identity to SEQ ID No: 26 [GenBank: BAA35674.1] (for example in E.coli strains) and SEQ ID No: 28 [GenBank: WP_003862086.1] (for example in Corynebacterium glutamicum strains);
g) Polynucleotide (dapB gene) coding for a dihydrodipicolinate reductase
(DapB, EC No. : 1.3.1.26 or 1.17.1.8), for example wherein the encoded amino acid sequence has at least 80, 85, 90, 95 or 100% sequence identity to SEQ ID No: 30 [GenBank: BAB96600.1];
h) Polynucleotide (dapC gene) coding for a succinyldiaminopimelate aminotransferase, AT class I (DapC, EC No. : 2.6.1.17); for example wherein the encoded amino acid sequence has at least 80, 85, 90, 95 or 100% sequence identity to SEQ ID No: 32 [GenBank: BAE77931.1] (for example in E.coli strains) and SEQ ID No: 32 [GenBank: WP_040967251.1] (for example in Corynebacterium glutamicum strains);
i) Polynucleotide (dapD gene) coding for a tetrahydrodipicolinate succinylase
(DapD, EC NO. : 2.3.1.117); for example wherein the encoded amino acid sequence has at least 80, 85, 90, 95 or 100% sequence identity to SEQ ID No: 36 [GenBank: BAB96742.1] ;
j) Polynucleotide (dapE gene) coding for a succinyl-diaminopimelate desuccinylase (DapE, EC NO. : 3.5.1.18); for example wherein the encoded amino acid sequence has at least 80, 85, 90, 95 or 100% sequence identity to SEQ ID No : 38 [GenBank: BAA16346.1] (for example in E.coli strains) and SEQ ID No : 40 [GenBank: WP_038583476.1] (for example in Corynebacterium glutamicum strains); k) Polynucleotide (dapF gene) coding for a diaminopimelate epimerase (DapF, EC NO. : 5.1.1.7); for example wherein the encoded amino acid sequence has at least 80, 85, 90, 95 or 100% sequence identity to SEQ ID No : 42 [GenBank: BAE77491.1] (for example in E.coli strains) SEQ ID No: 44 [GenBank: WP_038584409.1] (for example in Corynebacterium glutamicum strains);
with particular preference being given to the genes dapA, asd, ddh, lysA, dapB and lysC and very particular preference being given to the genes dapA and lysC, since L-lysine production may be enhanced by using the two latter genes in particular.
Alternatively, enhanced synthesis of lysine in the micro-organism of the invention may be achieved by introducing a transgene encoding a feedback-resistant aspartate kinase (LysC) which, by comparison with the wild form (wild type), shows less sensitivity to inhibition by mixtures of lysine and threonine or mixtures of AEC (aminoethylcysteine) and threonine or lysine alone or AEC alone. The genes or alleles coding for aspartate kinases that are desensitized by comparison to the wild type allele are known as lysCFBR alleles. Numerous lysCFBR alleles coding for aspartate kinase variants that have amino acid substitutions by comparison with the wild-type protein are conventionally known (Kikuchi Yl, et al., 1999).
The genetically modified micro-organism according to the invention, for production and export of lysine, may be a bacterium. A non-exhaustive list of suitable bacteria is given as follows: a species belonging to a genus selected from the group consisting of Corynebacterium, Escherichia, Bacillus, Lactobacillus, Lactococcus, Acetobacter, Acinetobacter, Pseudomonas, Streptococcaceae, and Brevibacteriaceae; especially preferred group members being Corynebacterium, Escherichia and Brevibacteriaceae. Preferably the bacterium is a Generally Recognized As Safe (GRAS) strain.
Alternatively, the genetically modified micro-organism according to the invention, for production and export of lysine, may be a fungus, and more specifically a filamentous fungus belonging to the genus of Aspergillus, e.g. A. niger, A. awamori, A. oryzae, A. nidulans; a yeast belonging to the genus of Saccharomyces, e.g. S. cerevisiae, S. kluyveri, S. bay anus, S. exiguus, S. sevazzi, S. uvarum; a yeast belonging to the genus Kluyveromyces, e.g. K. lactis K. marxianus var. marxianus, K. thermotolerans; a yeast belonging to the genus Candida, e.g. C. utilis C. tropicalis, C. albicans, C. lipolytica, C. versatilis; a yeast belonging to the genus Pichia, e.g. P. stipidis, P. pastoris, P. sorbitophila, or other yeast genera, e.g. Cryptococcus, Debaromyces, Hansenula, Pichia, Yarrowia, Zygosaccharomyces or Schizosaccharomyces. Concerning other micro-organisms a non-exhaustive list of suitable filamentous fungi is supplied : a species belonging to the genus Penicillium, Rhizopus, Fusarium, Fusidium, Gibberella, Mucor, Mortierella, and Trichoderma. The preferred micro-organisms of the invention may be Escherichia coli,
Corynebacterium glutamicum, Brevi bacterium flavum, Brevi bacterium lactofermentum, Lactococcus lactis, Lactococcus plantarum, Bacillus subtilis, Aspergillus oryzae and Saccharomyces cerevisiae. III Methods for producing lysine using the genetically modified microorganism of the invention
Lysine can be produced and exported using microbial cells of the invention (e.g. recombinant bacterial cells) by introducing the cells into a culture medium comprising a carbon source for biosynthesis of lysine or its precursors (see Figure 1); and finally recovering the lysine produced by the culture, as illustrated in the Examples.
The microbial cells of the invention will produce lysine when supplied with a suitable carbon source including glucose, maltose, galactose, fructose, sucrose, arabinose, xylose, raffinose, mannose, and lactose. When the microorganism of the invention is an aerobic bacterial strain, the cells are grown under aerobic conditions; while the selection of a suitable temperature for growth of bacterial strain belonging to a given Genus lies within the competence of the skilled man.
IV Methods for producing a micro-organism of the invention Integration and self-replicating vectors suitable for cloning and introducing a gene encoding a lysine transporter of the invention in a micro-organism of the invention are commercially available and known to those skilled in the art (see, e.g., Sambrook et al., Molecular Cloning : A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, 1989). Cells of a micro-organism are genetically engineered by the introduction into the cells of heterologous DNA. Heterologous expression of genes encoding a lysine transporter in a micro-organism of the invention is demonstrated in Example 2, 5 and 6.
A nucleic acid molecule, that encodes a lysine transporter according to the invention, can be introduced into a cell or cells and integrated into the host cell genome using methods and techniques that are standard in the art. For example, nucleic acid molecules can be introduced by standard protocols such as transformation including chemical transformation and electroporation, transduction, particle bombardment, etc. Expressing the nucleic acid molecule encoding the enzymes of the claimed invention also may be accomplished by integrating the nucleic acid molecule into the genome.
Methods for obtaining a micro-organism of the invention adapted for lysine production can be obtained by genetic modifications that reduce the depletion of the intracellular lysine pool and/or enhance the synthesis of lysine, as described in Section II. For example the metabolic consumption of lysine in the microbial cell of the invention may be reduced by blocking the conversion of lysine to cadaverine by lysine decarboxylase (EC 4.1.1.18). The genome of the microbial cell is deleted for one or more genes encoding a polypeptide having lysine decarboxylase activity [SEQ ID No: 4 and/or 6] such as the IdcC and cadA genes as described in example 4.
Methods for enhancing the synthesis of lysine in the micro-organism of the invention may be carried out by introducing one or more genes into the micro- organism, whose upregulated expression will enhance lysine production. Suitable genes may be selected from the group listed/named in section II.
V Use of the lysine transporter in a genetically modified micro-organism of the invention for production of a lysine
The invention further encompasses the use of a transgene encoding a lysine transporter to enhance the extracellular production of lysine in a microbial cell. The transgene encoding a lysine transporter, encodes an amino acid sequence having at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 % sequence identity to SEQ ID No: 2 that is capable of exporting lysine from a microbial cell. In one embodiment, microbial cell of the invention comprises a transgene encoding a lysine transporter protein, wherein the encoded amino acid sequence has at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 % sequence identity to SEQ ID No: 2 or 65, but with the proviso that amino acid residues at the indicated positions are V240 and F278.
VI A method of detecting lysine production
Methods for detecting and quantifying extracellular and intracellular lysine produced by a micro-organism of the invention include LC-MS Fusion (Thermo Fisher Scientific, USA) with positive electrospray ionization (ESI+). One suitable method for quantitating lysine is detailed in Example 5.2.
Examples Example 1 Metagenomic Library Construction and Functional Screening for L-lysine
The microbial population of cow fecal samples comprises a wide range of bacteria, including both bacteria that are auxotrophic and bacteria that are prototrophic for lysine. Common for many bacterial cells is a limited capacity to catabolize lysine and lysine dipeptides, while the accumulation of inhibitory levels of lysine is avoided by the export of lysine by means of transporters. Accordingly, metagenomic libraries constructed from DNA extracted from fecal samples provides a potentially rich source of novel lysine transporters.
The growth of E.coli strain C4860 (DSM 13127), is inhibited by elevated levels of lysine in the growth medium, with a determined IC90 of 8.28 g/L extracellular L- lysine after 24 h culture. Accordingly E.coli strain C4860 was used as a host cell to screen for plasmids with a metagenomic DNA fragment encoding a lysine transporter, whereby only those host cells transformed with a plasmid expressing a lysine transporter (encoded by metagenomic DNA) will survive and grow when cultivated on a medium comprising 12 or 14 g/L lysine.
1.1 Metagenomic library construction : A metagenomic expression library of total DNA extracted from a cow fecal sample was constructed by the steps of: i) isolation of total DNA from 5 g of fecal material using the PowerMax Soil DNA Isolation Kit (Mobio Laboratories Inc.), ii) fragmentation of extracted DNA into pieces of an average size of 2 kb by sonication using a Covaris E210 (Massachusetts, USA) followed by end-repairing using the End-It end repair kit (Epicentre) and iii) blunt-end ligation into pZE21 MCS1 expression vector (Lutz and Bujard, 1997) at the Hindi site using the Fast Link ligation kit (Epicentre), and iv) transformation of the ligated sample into E. coli toplO cells by electroporation.
After electroporation, cells were recovered in 1ml of SOC medium for 1 h at 37 °C and the library was titered by plating out 1 μΙ, 0.1 μΙ and 0.01 μΙ of recovered cells onto LB-km plates. The insert size distribution was estimated by gel electrophoresis of PCR products obtained by amplifying insert using primers site annealing to the vector backbone, flanking the Hindi site. The average insert size for the library was found to be 1.7 kb. The total size of the metagenomics library was determined by multiplying the average insert size with the number of colony forming units (CFU) per ml, which is 5xl08 bp. 1.2 Functional screening for L-lysine transporters in E. coli C4860
Plasmids comprising the metagenomics library (see 1.1) were isolated; and 400 ng of the plasmid DNA were transformed into electro-competent cells of E.coli C4860 strain. On the basis of the determined library sizes and titer of the library, 106 cells (i.e., 100 μΙ of the library cells) were plated out on LB-km agar supplemented with L-lysine at the selective concentration (12 and 14 g/L). Plates were incubated at 37 °C and growth of colonies (potential lysine-tolerant clones) was assayed after 48- 65 h of incubation. Colonies appeared only on the plates with the metagenomic library but not on the control plates with E.coli C4860 harboring the vector, pZE21. Eighty L-lysine tolerant clones were selected for further analysis. The metagenomic inserts present in the L-lysine-tolerant clones were Sanger sequenced using pZE21_F and pZE21_R primer pairs (Table 3) annealing to the vector backbone. Annotation of the sequenced inserts indicated that lysine tolerance in the transformed strains was conferred by either degradation/modification of L-lysine or active L-lysine export. Six unique metagenomic inserts encoding putative lysine transporters. Four inserts were selected for further testing based on the absence of putative degradation enzymes flanking the putative transporters on the metagenomic insert.
1.3 Functional comparison of putative lysine transporters
The transport properties of the four putative lysine transporters were compared by measuring the concentration of lysine needed to inhibit the growth by 90% [IC90] of E.coli C4860 clones expressing each of the putative lysine transporters.
The L-lysine IC90s of the selected E. coli C4860 clones ranged from 10.44 ± 1.277 g/L to 14.25 ± 0.415 g/L; corresponding to a 43% increase in IC90 for the clone harboring pZE-RCL-MglE (nucleotide sequence of DNA insert in pZE-RCL-MglE: SEQ ID No. : 1) compared to the control cells of the E. coli C4860 comprising the vector pZE21 (Figure 2A). The growth of each selected E. coli C4860 clones in LB-media was compared and found to be similar, whereas in the presence of 8 g/L of L-lysine, the growth rate of the clone harboring pZE-RCL-MglE (0.31 h"1) was ~30 % higher than the control strain comprising the vector pZE21 (0.24 h"1) (Figure 2B). Example 2 Lysine transporter MglE confers enhanced lysine tolerance on a range of E. coli strains
The pZE-RCL-MglE plasmid encoding the MglE transporter [SEQ ID No. : 2] was introduced into the following E. coli production strains; i) MG1655, ii) Crooks, iii) W1116 and iv) W3110. The lysine tolerance (measured as IC90) of each E.coli strains was increased when harboring and expressing the pZE-RCL-MglE plasmid (Figure 3). The L-lysine tolerance of strain E. coli W3110, which is widely used for the commercial production of L-lysine, was increased by 29.5%. Hence the lysine tolerance conferred by this transporter is widely applicable to industrial E. coli based L-lysine fermentation.
Example 3 Structural properties of the Lysine transporter MglE
Sequence analysis of the metagenomics insert in pZE-RCL-MglE [SEQ ID No. : 1] showed an operon with an open reading frame (coined as mglE, metagenomics gene for lysine export) flanked by a promoter and a terminator sequences (figure 4). The deduced amino acid sequence of MglE transporter is 297 amino acids [SEQ ID No: 2], and showed the closest amino acid sequence identity (82%) to a hypothetical protein from Bacteroides coprophilus (Genbank accession no. WP_022277040) [SEQ ID No: 45] . The MglE protein is predicted to be a member of a new family of RhaT/EamA-like transporters related to the drug/metabolite transporter (DMT) superfamily. EamA family members are very diverse and most of their functions are unknown, although PecM from Erwinia chrysanthemi and YdeD in E. coli, are characterized as exporters (Franke et al., 2003). MglE also contains two copies of the EamA domain found in members of this superfamily: one in the region of 9-143 amino acids and another in 152-292 amino acids. Two-dimensional topological model of MglE transporter possesses six cytoplasmic domains, five periplasmic domains and ten transmembrane domains with both N- and C-terminals in the cytoplasmic region (Figure 5).
Phylogenetic analysis of selected bacterial transporter protein sequences shows that the MglE protein shows homology to some hypothetical proteins of Bacteroides species (Figure 6) sharing an amino acid sequence identity of >50%; the majority of this group sharing an amino acid sequence identity of >74%. In contrast, the known L-lysine specific transporters from various strains formed a group that is phylogenetically very remote from MglE. MglE does not have any significant homology with the LysE lysine exporter from C. glutamicum. Accordingly, the MglE protein is a novel L-lysine transporter, whose function could not have been predicted by sequence homology to known L-lysine transporters.
Example 4 Lysine transporter, MglE confers enhanced lysine tolerance in an E. coli strain adapted for lysine production
E. coli comprises genes encoding lysine decarboxylases that degrade intracellular lysine. The E. coli strain W3110 was genetically modified to knock-out the constitutive gene (IdcC) and the acid-inducible gene (cadA) encoding two lysine decarboxylases to produce the strain E.coli DMLC, having a reduced lysine degradation capacity. Cells of this knock-out strain were used as a host to compare the effect of the lysine transporter MglE on lysine tolerance with two known lysine transporters, the L-Lysine efflux permease (LysE) from Corynebacterium glutamicum [SEQ ID No. : 47] and the lysine exporter (YbjE; LysO protein) from E. coli [SEQ ID No. : 49] .
Disruption of the IdcC and cadA genes was carried out using the ampicillin resistant pSJI8 helper plasmid containing genes for λ Red recombinase (γ, β, exo) enhancing recombination rate under control of arabinose promoter; and the FLP recombinase to eliminate the resistance cassette under the control of rhamnose promoter.
Table 1: Primers and genes for generating a AldcC.AcadA bacterial strain
Figure imgf000022_0001
* Nucleotide sequence
4.1 IdcC disruption : Chemically competent cells of E. coli W3110 strain were transformed with the pSJI8 plasmid and the transformed cells were selected in LB- amp solid media and incubated at 30 °C. The E. coli W3110/pSJI8 transformants were grown in LB-amp at 30°C to an OD6oonm of 0.3 and 1 mM arabinose was added to induce the λ Red system.
A PCR product was generated by using primer pair LdcC_F2/LdcC_R (Table 1 ; positioned 64 bp from the IdcC gene start/stop codon) to amplify a kanamycin cassette from the genomic DNA of IdcC in-frame knocked-out Kieo strain b0186.
Electro-competent cells were prepared from the induced E. coli W3110/pSJI8 transformants; which were then transformed with about 200 ng of the purified PCR product. The transformed cells were plated in LB-km, amp solid media. The replacement of the IdcC gene (2. 1 kb) by the kanamycin (km) cassette was confirmed by colony PCR using a primer pair LdcC_Fl/LdcC_R that gave a 1.6 kb DNA band corresponding to the km cassette. The colony, confirmed to have the IdcC gene replaced by the km cassette, was grown in 1 ml of LB-km-amp at 30 °C for 3-4 h. The cells were collected by centrifugation and re-suspended in 100 μΙ of sterilized water and 10 μΙ of the re-suspended cells were inoculated into 1 ml of LB- amp and 50 mM of rhamnose, followed by incubation at 30 °C for 4-6 h . The cells were then spread onto LB-amp plates and incubated at 30 °C for overnight. To confirm the removal of the km cassette, colony PCR was performed using a primer pair LdcC_Fl/LdcC_R which gave band at ~0.25 kb instead of 1.6 kb, confirming the successful resistant markerless IdcC deletion. The strain was named as E. coli W3110 : :AldcC/pSJI8. 4.2 cadA disruption : Similarly, primer pair CadA_F2/CadA_R (Table 1 ; located 56 bp from the cadA gene start/stop codon) was used to amplify the kanamycin cassette from the genomic DNA of a cadA inframe knocked-out Kieo strain b4131. The purified PCR product was transformed into E. coli W3110 : :AldcC/pSJI8 and a similar protocol was followed for the confirmation of the cadA deletion. To confirm the replacement of cadA by the km cassette, as well as the removal of the km cassette in the double deletion mutant, a primer pair CadA_Fl/CadA_R was used for colony PCR.
The helper plasmid pSJI8 was removed from the double deletion mutant, by growing the E. coli W3110 : :AldcC.AcadA/pSJI8 strain on LB plates incubated at 37 °C overnight and then streaking colonies on LB and LB-amp plates. Cells of E. coli W3110 : :AldcC.AcadA that had lost pSJI8 grew on LB but not on LB-amp media. The double (IdcC and cadA) deletion strain was designated E.coli DMLC.
4.3 Construction of pZE-LysE and pZE-YbjE plasmids: Oligonucleotides LysE-F and LysE-R (Table 2) were synthesized to amplify nucleotide sequence of lysE gene (Genbank accession no. AGT05251) from genomic DNA of C. glutamicum. Similarly oligonucleotides YbjE-F and YbjE-R were used to amplify the ybjE gene (Genbank accession no. CAQ31402) from E. coli BL21 (DE3) . The lysE and ybjE PCR products were cloned into the pZE21 vector excised with Kpnl and BamHI restriction enzymes to construct pZE-LysE and pZE-YbjE expression plasmids, respectively.
Table 2 Primers and genes for constructing lysE and ybjE plasmids
Primer/gene Oligonucleotides (5'-3')/ genes SEQ ID No*
LysE-F ATGGGTACCATGGAAATCTTCATTACAGGTC 56
LysE-R CCGGGATCCCTAACCCATCAACATCAGTTTG 57 lysE gene Encoding GenBankAcc: AGT05251 46
YbjE-F AAAGG 1 A A 1 G 1111 U GGGC 1 G 11 AA 1 CA 58
YbjE-R TATGGATCCTTACGCAGAGAAAAAGGCGAT 59
ybJE gene Encoding GenBankAcc: CAQ31402 48
* Nucleotide sequence
4.4 E.coli DMLC expressing the lysine transporter MglE: Cells of the NdcC.AcadA strain E.coli DMLC were then transformed with either the pZE-RCL- MglE, pZE-LysE, pZE-YbjE plasmids or the control vector pZE21.
The lysine tolerance (measured as IC90) of the NdcC.AcadA strain E.coli DMLC was enhanced by expressing of each of the lysine transporters; however, cells harboring and expressing the pZE-RCL-MglE plasmid showed the highest lysine tolerance (Figure 8).
In conclusion, the lysine exporter MglE confers a higher lysine tolerance in the E. coli DMLC strain adapted for lysine production than the known lysine transporters lysE and ybjE.
Example 5 Lysine productivity of recombinant E. coli cells adapted for lysine production is enhanced by the lysine transporter MglE
Cells of the recombinant NdcC.AcadA strain E.coli DMLC, adapted for lysine production, were also used to demonstrate the effect of lysine transporter MglE on lysine production and export. 5.1 L-lysine production: Recombinant E.coli DMLC were transformed with either the pZE-RCL-MglE plasmid (E.coli DMLC/pZE-RCL-MglE) or the control vector pZE21 (E. coli DMLC/pZE21) and their lysine production was analyzed and compared to the control strain E.coli W3110/pZE21. Cells of each strain were grown for 24 h in LB media; and the lysine levels were quantitated as described below (5.1). Both extracellular L-lysine levels and specific L-lysine titers were enhanced in the E.coli DMLC strains confirming that knock-out of the lysine degradation genes promotes lysine accumulation. Additionally, the level of extracellular L-lysine produced by the DMLC strain harboring the pZE-RCL-MglE plasmid was increased 8.3% as compared to the DMLC/pZE21 vector control strain (Figure 9A); while the specific L-lysine titer (Figure 9B) were increased 2.1 fold. In conclusion, MglE functions as a lysine exporter in E. coli, and can enhance L-lysine excretion from bacteria adapted for lysine production (e.g. E.coli DMLC/pZE-RCL-MglE). 5.2 L-lysine quantitation: A calibration curve of authentic L-lysine standard was drawn using concentrations ranging from 0.4 to 77 mg/L. The accurate mass of L- lysine from 20-fold diluted samples (supernatants containing L-lysine to be quantified) was analyzed using an LC-MS Fusion (Thermo Fisher Scientific, USA) with positive electrospray ionization (ESI+). The final concentration was adjusted for the dilution factor. Bracketing calibration was used for quantifying the external lysine concentration. The quantification of L-lysine was determined with an LC- MS/MS, EVOQ (Bruker, Fremont USA), using multiple reaction monitoring (MRM) transition in positive ionisation mode (ESI+), with quantified transition 147→84 (CE 10), and qualifier transition 147→130 (CE 7).
Example 6 Mutant lysine transporter MglE confers increased lysine tolerance on E. co/i" strains
Random mutagenesis was used to generate a library of mutated genes encoding mutant MglE lysine transporters in order to isolate a more efficient MglE lysine transporter.
6.1 Random mutagenesis: Following primer pairs were used for amplification the mglE insert and the pZE21 vector backbone, respectively.
Table 3 Primers for amplification of mglE gene and pZE21 backbone
Figure imgf000025_0001
The primer pair pZE21_F/pZE21_R (Table 3) was used for amplification of mg IE gene from pZE-MglE plasmid DNA while the primer pair
pZE21_EP_Gib.F/pZE21_EP_Gib.R (Table 3) was used to amplify the vector backbone using the pZE21 vector as a template.
Error prone PCR of mglE gene was carried out using the GeneMorph II Random Mutagenesis Kit (Agilent) according to the protocol (using 20 ng template DNA in 50 μΙ reaction volume) to create random mutants of the mglE gene. Then the error prone PCR product of mglE (mglE*) was gel purified and ligated into pZE21 vector backbone using the Gibson assembly composition: i. PCR product of mglE* = 76 ng,
ii. PCR product of vector backbone = 48 ng
iii. Gibson assembly master mix= 5 μΙ.
iv. MQ-Water= adjusted to final volume of 10 μΙ
The ligation mixture was briefly centrifuged and the reaction was carried out in a thermocycler held constant at 50 °C for 1 h. The ligation mixture was then desalted for an hour using a Millipore (type VSWP) drop dialysis film with 0.025 μιη on Milli- Q water (Desalting DNA Drop dialysis method). The purified ligation product (pZE- MglE* library) was transformed into electro-competent cells of E. coli C4860 strain to give a library of 75-80,000 CFU/ml.
6.2 Screening lysine transport mutants: The library was screened by plating 100 μΙ (107 cells) of the amplified random mutant library (E. coli C4860/pZE-MglE*) and the control parent strain E. coli C4860/pZE-MglE on LB-km agar plates supplemented with different concentrations of L-lysine. Then the plates were incubated at 37 °C for 48 to 68 h. Colonies having the highest L-lysine tolerance were sequenced using the primer pair pZE21_F/pZE21_R to characterize the relevant mutation (s). In parallel, the L-lysine MICs of the selected clones were determined.
Eight mutants MglE lysine transporters, each conferring higher levels of lysine tolerance that the parent MglE lysine transporter were identified on the basis of the MIC of cells expressing the mutant transporters and a corresponding mutation in the amino acid sequence of the expressed transporter. The mutant conferring the highest L-lysine tolerance in the E. coli C4860 was MglEl* [SEQ ID No. : 65] ; which was characterized by 2 amino acid mutations as indicated in Table 4.
Table 4 Mutations in mutant MglE lysine transporter
Amino acid position
IC90
MglE
n at STDEV
mutant
24h
64 146 197 200 240 249 265 278 281 296
S G V G A A T L C R 4 Wildtype 9.79 0.24
S G V G V A T F c R 23 MglEl* 15.83 0.24
s G V E V A T F c K 1 MqlE2* 15.79
s G V G A A T L Y K 8 MqlE3* 13.27 0.46 s G V G A V T L C K 1 MqlE4* 13.31
s G V G A V T L C R 8 MqlE5* 12.63 0.70
s D V V A A T L C R 2 MglE6* 10.98 0.54
s G L G A A T L C R 1 MqlE7* 11.25
G G V G A A s L C R 1 MqlE8* 10.41
In conclusion, the lysine tolerance of E. coli C4860 can be further enhanced by 61% (IC90: 9.79/15.83 or 15.83) by the expression of the mutant lysine transporters MqlEl* and MglE2*as compared to the parent lysine transporter, MqlE; while E. coli C4860 cells expressinq variant MqlE lysine transporters havinq a number of different amino acid substitutions either retain lysine tolerance or also exhibit enhanced lysine tolerance as compared to the parent lysine transporter. Example 7 Comparison of Lysine tolerance conferred by expression of the MglE gene and homologous genes encoding hypothetical proteins
Recombinant plasmids were constructed for the expression of four homoloqous qenes encodinq polypeptides showinq different levels of amino acid sequence identity to the lysine transporter, MqlE. The four qenes were: i) Genel (891 bp, Genbank accession no. CDC57518.1) [SEQ ID No: 66] from Bacteroides coprophilus CAG: 333, ii) Gene2 (891 bp, Genbank accession no. WP_018711839) [SEQ ID No: 76] from Bacteroides barnesiae, iii) Gene3 (870 bp, Genbank accession no.
CDC66277) [SEQ ID No: 78] from Bacteroides sp. CAG : 770, and iv) Gene4 (912 bp, 43% identity, Genbank accession no. CCZ76555) [SEQ ID No: 98, encodinq polypeptide with SEQ ID No. :99] from Alistipes finegoldii CAG: 68, were synthetized alonq with 5 'and 3' linker sequences (Table 5) includinq uracil easinq direct USER cloninq. These four synthetized qene fraqments were cloned into the linear PCR fraqment of pZE21 vector amplified by usinq oliqonucleotides pZE21_User-F4 and pZE21_User-R4 (Table 5) to construct pZE-Genel, pZE-Gene2, pZE-Gene3 and pZE-Gene4 recombinant plasmids, respectively. The hypothetical proteins encoded by qenes 1, 2, 3 and 4 showed an amino acid sequence identity of 82, 78, 54 and 43% respectively to the lysine transporter, MqlE.
Table 5 Primers for amplification of mglE gene Primers Oligonucleotide sequences (5'-3') Cloning strategy SEQ ID No.:
pZE21_User_F4 ATAAGCTU GATATCGAATTCCTGCAGCCC USER cloning 100
pZE21_User_R4 AATGAATU CGGTCAGTGCGTCCTGCTGAT USER cloning 101
5' linker AATTCATU AAAGAGGAGAAAGGTACC USER cloning 102
GTCGACGGTATCG ATAAGCTT (in the 103
3' linker complementary sequence, T is replaced by U USER cloning
for pairing with A)
The lysine tolerance conferred by expression of the gene encoding the lysine transporter MglE, as compared to that of the four genes encoding the hypothetical proteins, was determined by introducing the four constructed plasmids, pZE-MglE and the pZE21 vector as control, into E.coli C4860 and E.coli DMLC strains. The transformed strains were then cultured under conditions for determining their IC90 for L-lysine as described in Example 6.2. Surprisingly, none of the four genes encoded proteins that conferred lysine tolerance at the same level as expression of the MglE gene in either E.coli C4860 and E.coli DMLC strains. The relative L-lysine tolerance conferred by introducing the recombinant plasmids containing the four genes in E.coli C4860 and E.coli DMLC is shown in figure 10.
References
Franke, I., Resch, A., Da Bier, T., Maier, T. & Bock, A. J. (2003) YfiK from Escherichia coli Promotes Export of O-Acetylserine and Cysteine, J Bacteriol. 185: 1161-1166
Gunji, Y. & Yasueda, H. (2006) Enhancement of l-lysine production in
methylotroph Methylophilus methylotrophus by introducing a mutant LysE exporter. J. Biotechnol. 127, 1- 13 Kikuchi Yl, Kojima H, Tanaka T. (1999) Mutational analysis of the feedback sites of lysine-sensitive aspartokinase of Escherichia coli. FEMS Microbiol Lett., 173(l) : 211-5.
Lutz, R., Bujard, H., 1997. Independent and tight regulation of transcriptional units in Escherichia coli via the LacR / O , the TetR / O and AraC / I 1 -I 2 regulatory elements. Pharmacia 25 : 1203- 1210.

Claims

A genetically modified microbial cell for production of lysine, comprising a transgene encoding a lysine transporter polypeptide, wherein the amino acid sequence of the lysine transporter polypeptide has at least 85% sequence identity to SEQ ID No. : 2.
The genetically modified microbial cell of claim 1, wherein the amino acid sequence of the lysine transporter polypeptide has at least 85 % sequence identity to SEQ ID No: 2, but with the proviso that amino acid residue at position 240 is valine and amino acid residue at position 278 is
phenylalanine.
The genetically modified microbial cell of claim 1 or 2, wherein the cell is further characterized by one or more genetic modification conferring :
a. reduced lysine metabolism and/or
b. enhanced lysine synthesis
as compared to a parent cell from which said genetically modified cell was derived.
The genetically modified microbial cell of claim 3, wherein one or more genes encoding a polypeptide having lysine decarboxylase activity (EC 4.1.1.18) are deleted or inactivated to confer reduced lysine metabolism.
The genetically modified microbial cell of claim 3 or 4, wherein the cell comprises one additional transgene or a combination of two or more additional transgenes conferring enhanced lysine synthesis and wherein said transgenes encode polypeptides selected from the group consisting of: a. aspartate kinase (EC No. : 2.7.2.4);
b. dihydrodipicolinate synthase (EC No. : 4.
2.1.52 or 4.3.
3.7);
c. aspartate-semialdehyde dehydrogenase (EC No. : 1.2.1.11);
d. meso-diaminopimelate dehydrogenase (EC No. : 1.
4.1.16);
e. diaminopimelate decarboxylase (EC No. : 4.1.1.20);
f. aspartate aminotransferase (EC No. : 2.6.1.1);
g. dihydrodipicolinate reductase (EC No. : 1.3.1.26 or 1.17.1.8); h. succinyldiaminopimelate aminotransferase, AT class I (EC No. :
2.6.1.17);
i. tetrahydrodipicolinate succinylase (EC No. : 2.3.1.117);
j. succinyl-diaminopimelate desuccinylase (EC No. : 3.
5.1.18); and k. diaminopimelate epimerase (EC No. : 5.1.1.7).
6. The genetically modified microbial cell according to any one of claims 1 to 5, wherein said micro-organism is selected from among a bacterium, a yeast, and a filamentous fungus.
7. The genetically modified microbial cell according to claim 6, wherein said micro-organism is a species of a genus selected from the group consisting of: Corynebacterium, Escherichia, Brevibacteriaceae, Bacillus, Lactobacillus, Lactococcus, Acetobacter, Acinetobacter, Pseudomonas and
Streptococcaceae.
8. An isolated polynucleotide encoding a lysine transporter polypeptide,
wherein the amino acid sequence of the polypeptide has at least 85% sequence identity to SEQ ID No. : 2.
9. The isolated polynucleotide of claim 8, wherein the amino acid sequence of the lysine transporter polypeptide has at least 85 % sequence identity to SEQ ID No: 2, but with the proviso that amino acid residue at position 240 is valine and amino acid residue at position 278 is phenylalanine.
10. A method for producing lysine in vivo comprising :
a. providing a genetically modified microbial cell comprising a transgene encoding a lysine transporter polypeptide according to any one of claims 1 to 7;
b. introducing said microbial cell into a growth medium to produce a culture;
c. providing a substrate for lysine production;
d. recovering the produced lysine from the culture and optionally e. purifying the lysine recovered.
11. Use of a transgene encoding a lysine transporter polypeptide to enhance lysine export in a microorganism, wherein the amino acid sequence of said polypeptide has at least 85% sequence identity to SEQ ID No: 2.
12. Use of a transgene encoding a lysine transporter to enhance lysine export in a microorganism according to claim 11, wherein said microorganism is characterized by one or more additional genetic modification conferring : a. reduced lysine metabolism and/or b. enhanced lysine synthesis
as compared to the parent cell from which said genetically modified cell was derived.
13. Use of a transgene encoding a lysine transporter to enhance lysine export in a microorganism according to claim 12, wherein one or more genes encoding a polypeptide having lysine decarboxylase activity (EC 4.1.1.18) are deleted or inactivated to confer reduced lysine metabolism.
14. Use of a transgene encoding a lysine transporter to enhance lysine export from a microorganism according to claim 12 or 13, wherein the
microorganism comprises one additional transgene or a combination of two or more additional transgenes conferring enhanced lysine synthesis and wherein said transgenes encode polypeptides selected from the group consisting of:
a. aspartate kinase (EC No. : 2.7.2.4);
b. dihydrodipicolinate synthase (EC No. : 4.2.1.52 or 4.3.3.7);
c. aspartate-semialdehyde dehydrogenase (EC No. : 1.2.1.11);
d. meso-diaminopimelate dehydrogenase (EC No. : 1.4.1.16);
e. diaminopimelate decarboxylase (EC No. : 4.1.1.20);
f. aspartate aminotransferase (EC No. : 2.6.1.1);
g. dihydrodipicolinate reductase (EC No. : 1.3.1.26 or 1.17.1.8);
h. succinyldiaminopimelate aminotransferase, AT class I (EC No. :
2.6.1.17);
i. tetrahydrodipicolinate succinylase (EC No. : 2.3.1.117);
j. succinyl-diaminopimelate desuccinylase (EC No. : 3.5.1.18); and k. diaminopimelate epimerase (EC No. : 5.1.1.7).
15. Use of a transgene encoding a lysine transporter to enhance lysine export from a microorganism according to any one of claims 11 to 14, wherein said micro-organism is a species of a genus selected from the group consisting of: Corynebacterium, Escherichia, Brevibacteriaceae, Bacillus, Lactobacillus, Lactococcus, Acetobacter, Acinetobacter, Pseudomonas and
Streptococcaceae.
PCT/EP2016/078110 2015-11-19 2016-11-18 A family of microbial lysine transporter polypeptides WO2017085241A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP15195401 2015-11-19
EP15195401.3 2015-11-19

Publications (1)

Publication Number Publication Date
WO2017085241A1 true WO2017085241A1 (en) 2017-05-26

Family

ID=54695523

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2016/078110 WO2017085241A1 (en) 2015-11-19 2016-11-18 A family of microbial lysine transporter polypeptides

Country Status (1)

Country Link
WO (1) WO2017085241A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115490761A (en) * 2021-11-01 2022-12-20 中国科学院天津工业生物技术研究所 Recombinant microorganism constructed based on lysine efflux protein and method for producing lysine

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE19548222A1 (en) * 1995-12-22 1997-06-26 Forschungszentrum Juelich Gmbh Process for the microbial production of amino acids through increased activity of export carriers
EP1067192A1 (en) * 1999-07-07 2001-01-10 Degussa-Hüls Aktiengesellschaft L-lysine producing coryneform bacteria and methods for the production of L-lysine
WO2005073390A2 (en) * 2004-01-30 2005-08-11 Ajinomoto Co., Inc. L-amino acid-producing microorganism and method for producing l-amino acid

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE19548222A1 (en) * 1995-12-22 1997-06-26 Forschungszentrum Juelich Gmbh Process for the microbial production of amino acids through increased activity of export carriers
EP1067192A1 (en) * 1999-07-07 2001-01-10 Degussa-Hüls Aktiengesellschaft L-lysine producing coryneform bacteria and methods for the production of L-lysine
WO2005073390A2 (en) * 2004-01-30 2005-08-11 Ajinomoto Co., Inc. L-amino acid-producing microorganism and method for producing l-amino acid

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
AKE VÄSTERMARK ET AL: "Functional specialization in nucleotide sugar transporters occurred through differentiation of the gene cluster EamA (DUF6) before the radiation of Viridiplantae", BMC EVOLUTIONARY BIOLOGY, BIOMED CENTRAL LTD., LONDON, GB, vol. 11, no. 1, 12 May 2011 (2011-05-12), pages 123, XP021100173, ISSN: 1471-2148, DOI: 10.1186/1471-2148-11-123 *
DATABASE EMBL [online] 4 July 2016 (2016-07-04), "Uncultured bacterium clone pZE-RCL MglE gene, complete cds.", XP002765499, retrieved from EBI accession no. EM_STD:KU708839 Database accession no. KU708839 *
DATABASE UniProt [online] 18 September 2013 (2013-09-18), "SubName: Full=Putative membrane protein {ECO:0000313|EMBL:EEF75136.1};", XP002756696, retrieved from EBI accession no. UNIPROT:S0F9D6 Database accession no. S0F9D6 *
DATABASE UniProt [online] 24 July 2013 (2013-07-24), "SubName: Full=Uncharacterized protein {ECO:0000313|EMBL:CDC57518.1};", XP002756695, retrieved from EBI accession no. UNIPROT:R6S8M7 Database accession no. R6S8M7 *
EGGELING LOTHAR ET AL: "A giant market and a powerful metabolism:l-lysine provided byCorynebacterium glutamicum", APPLIED MICROBIOLOGY AND BIOTECHNOLOGY, SPRINGER, DE, vol. 99, no. 8, 13 March 2015 (2015-03-13), pages 3387 - 3394, XP035475429, ISSN: 0175-7598, [retrieved on 20150313], DOI: 10.1007/S00253-015-6508-2 *
GUNJI Y ET AL: "Enhancement of l-lysine production in methylotroph Methylophilus methylotrophus by introducing a mutant LysE exporter", JOURNAL OF BIOTECHNOLOGY, ELSEVIER SCIENCE PUBLISHERS, AMSTERDAM, NL, vol. 127, no. 1, 15 June 2006 (2006-06-15), pages 1 - 13, XP024956556, ISSN: 0168-1656, [retrieved on 20061215], DOI: 10.1016/J.JBIOTEC.2006.06.003 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115490761A (en) * 2021-11-01 2022-12-20 中国科学院天津工业生物技术研究所 Recombinant microorganism constructed based on lysine efflux protein and method for producing lysine
WO2023071580A1 (en) * 2021-11-01 2023-05-04 中国科学院天津工业生物技术研究所 Recombinant microorganism constructed based on lysine efflux protein and method for producing lysine

Similar Documents

Publication Publication Date Title
JP5813907B2 (en) Mutant acetolactate synthase and branched L-amino acid production method
Wu et al. Markerless deletions of pil genes in Myxococcus xanthus generated by counterselection with the Bacillus subtilis sacB gene
Wang et al. An update of the suicide plasmid‐mediated genome editing system in Corynebacterium glutamicum
KR101996769B1 (en) A homoserine dehydrogenase variant and a method for producing homoserine or L-amino acid derived from homoserine using the same
EP0620853B1 (en) Materials and methods for biosynthesis of serine and serine-related products
EP1616940A1 (en) L-tyrosine-producing bacterium and a method for producing L-tyrosine
EP2233562A1 (en) Method for producing high amount of glycolic acid by fermentation
CN112251391B (en) Construction method and application of lysine production strain
KR101947959B1 (en) A modified homoserine dehydrogenase and a method for producing homoserine or L- amino acid derived from homoserine using the same
IL293952A (en) Method for the fermentative production of guanidinoacetic acid
CN107429275B (en) Genetically modified microorganisms with improved tolerance to L-serine
Aagaard et al. General vectors for archaeal hyperthermophiles: strategies based on a mobile intron and a plasmid
EP2326709A2 (en) Methods, systems and compositions related to reduction of conversions of microbially produced 3-hydroxypropionic acid (3-hp) to aldehyde metabolites
JP6539691B2 (en) Genome-reduced bacteria with improved genetic stability
EP3778901A1 (en) Novel promoter, and method for producing l-amino acid by using same
US12031170B2 (en) System for improved production titers in fermentations
AU2016335266A1 (en) High-level production of diacetyl in a metabolically engineered lactic acid bacterium
EP2987854B1 (en) Microorganism having l-tryptophan productivity and method for production of l-tryptophan using same
JP6489014B2 (en) Yeast high in Abu, γ-Glu-Abu, and / or γ-Glu-Abu-Gly
Commichau et al. Characterization of Bacillus subtilis mutants with carbon source-independent glutamate biosynthesis
WO2017085241A1 (en) A family of microbial lysine transporter polypeptides
DK2806022T3 (en) Recombinant microorganism with improved putrescine productivity and method of producing putrescine using the same
Mikulskis et al. Regulation of expression of the ethanol dehydrogenase gene (adhE) in Escherichia coli by catabolite repressor activator protein Cra
WO2023222515A1 (en) Biotechnological production of bisucaberins, desferrioxamines and analogs thereof
JP6697525B2 (en) Recombinant microorganism producing quinolinic acid and method for producing quinolinic acid using the same

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16798704

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16798704

Country of ref document: EP

Kind code of ref document: A1