WO2017083683A1 - Recombinant host cells and methods for the anaerobic production of l-aspartate and beta-alanine - Google Patents

Recombinant host cells and methods for the anaerobic production of l-aspartate and beta-alanine Download PDF

Info

Publication number
WO2017083683A1
WO2017083683A1 PCT/US2016/061578 US2016061578W WO2017083683A1 WO 2017083683 A1 WO2017083683 A1 WO 2017083683A1 US 2016061578 W US2016061578 W US 2016061578W WO 2017083683 A1 WO2017083683 A1 WO 2017083683A1
Authority
WO
WIPO (PCT)
Prior art keywords
aspartate
seq
beta
alanine
host cell
Prior art date
Application number
PCT/US2016/061578
Other languages
French (fr)
Inventor
Jeffrey Dietrich
Original Assignee
Lygos, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Lygos, Inc. filed Critical Lygos, Inc.
Priority to CA3042854A priority Critical patent/CA3042854A1/en
Priority to AU2016353242A priority patent/AU2016353242A1/en
Priority to CN201680076240.7A priority patent/CN109072172A/en
Priority to EP16865105.7A priority patent/EP3374505A4/en
Publication of WO2017083683A1 publication Critical patent/WO2017083683A1/en
Priority to US15/976,861 priority patent/US20180258437A1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0012Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
    • C12N9/0014Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on the CH-NH2 group of donors (1.4)
    • C12N9/0016Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on the CH-NH2 group of donors (1.4) with NAD or NADP as acceptor (1.4.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52Genes encoding for enzymes or proenzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88Lyases (4.)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/93Ligases (6)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00Preparation of nitrogen-containing organic compounds
    • C12P13/04Alpha- or beta- amino acids
    • C12P13/06Alanine; Leucine; Isoleucine; Serine; Homoserine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00Preparation of nitrogen-containing organic compounds
    • C12P13/04Alpha- or beta- amino acids
    • C12P13/20Aspartic acid; Asparagine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y104/00Oxidoreductases acting on the CH-NH2 group of donors (1.4)
    • C12Y104/01Oxidoreductases acting on the CH-NH2 group of donors (1.4) with NAD+ or NADP+ as acceptor (1.4.1)
    • C12Y104/01021Aspartate dehydrogenase (1.4.1.21)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y401/00Carbon-carbon lyases (4.1)
    • C12Y401/01Carboxy-lyases (4.1.1)
    • C12Y401/01011Aspartate 1-decarboxylase (4.1.1.11)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y604/00Ligases forming carbon-carbon bonds (6.4)
    • C12Y604/01Ligases forming carbon-carbon bonds (6.4.1)
    • C12Y604/01001Pyruvate carboxylase (6.4.1.1)

Definitions

  • Aspartic acid (“L-aspartate”, CAS No. 56-84-8) is currently produced from fumaric acid, a non-renewable, petroleum-derived chemical feedstock.
  • beta-alanine (CAS No. 107-96-9) is produced from acrylamide, another non-renewable, petroleum feedstock.
  • L-aspartate and L- aspartate-derived compounds are based on fumaric acid.
  • an enzymatic process in which L-aspartate ammonia lyase catalyzes the formation of L-aspartate from fumaric acid and ammonia see "Amino Acids," In: Ullmann's Encyclopedia of Industrial Chemistry, Wiley - VCH, Weinheim, New York (2002)).
  • the present invention provides a recombinant host cell capable of producing L-aspartate or beta-alanine under substantially anaerobic conditions, the host cell comprising one or more heterologous nucleic acids encoding a L-aspartate pathway enzyme and optionally (in the case of beta-alanine producing host cells) a L-aspartate 1 -decarboxylase.
  • the recombinant host cell has been engineered to produce L-aspartate or beta- alanine under substantially anaerobic conditions.
  • any suitable host cell may be used in practice of the methods of the present invention, and exemplary host cells useful in the compositions and methods provided herein include archaeal, prokaryotic, or eukaryotic cells.
  • the recombinant host cell is a yeast cell.
  • the recombinant yeast cells provided herein are engineered by the introduction of one or more genetic modifications (including, for example, heterologous nucleic acids encoding enzymes and/or disruption or deletion of native nucleic acids encoding enzymes) into a Crabtree-negative yeast cell.
  • the host cell belongs to the Pichia/Issatchenkia/Saturnispora/Dekkera clade.
  • the host cell belongs to the genus selected from the group consisting of Pichia, Issatchenkia, or Candida. In certain embodiments, the host cell belongs to the genus Pichia, and in some of these embodiments the host cell is Pichia kudriavzevii.
  • recombinant host cells having at least one active L-aspartate pathway from phosphoenolpyruvate or pyruvate to L-aspartate.
  • the recombinant host cell further expresses an L-aspartate 1 -decarboxylase.
  • the recombinant host cells provided herein have a L-aspartate pathway that proceeds via phosphoenolpyruvate or pyruvate, and oxaloacetate intermediates.
  • the recombinant host cell comprises one or more heterologous nucleic acids encoding one or more L-aspartate pathway enzymes selected from the group consisting of phosphoenolpyruvate carboxylase, pyruvate carboxylase, phosphoenolpyruvate carboxykinase, and L-aspartate dehydrogenase wherein the heterologous nucleic acid is expressed in sufficient amounts to produce L-aspartate under substantially anaerobic conditions.
  • the recombinant host cell comprises one or more heterologous nucleic acids encoding one or more L-aspartate pathway enzymes selected from the group consisting of phosphoenolpyruvate carboxylase, pyruvate carboxylase, phosphoenolpyruvate carboxykinase, and L-aspartate dehydrogenase wherein the heterologous nucleic acid is expressed in sufficient amounts to produce L-aspartate under aerobic conditions.
  • the recombinant host cell comprises one or more heterologous nucleic acids encoding one or more L-aspartate pathway enzymes selected from the group consisting of pyruvate carboxylase and L-aspartate dehydrogenase wherein the heterologous nucleic acid is expressed in sufficient amounts to produce L-aspartate under substantially anaerobic conditions.
  • the recombinant host cell comprises one or more heterologous nucleic acids encoding one or more L-aspartate pathway enzymes selected from the group consisting of pyruvate carboxylase and L-aspartate dehydrogenase wherein the heterologous nucleic acid is expressed in sufficient amounts to produce L-aspartate under aerobic conditions.
  • the cell further comprises a heterologous nucleic acid encoding an L-aspartate 1- decarboxylase wherein said heterologous nucleic acid is expressed in sufficient amounts to produce beta-alanine under substantially anaerobic conditions.
  • the recombinant host cell provided herein comprises a heterologous nucleic acid encoding a L-aspartate dehydrogenase.
  • the recombinant host cell provided herein comprises a heterologous nucleic acid encoding Pseudomonas aeruginosa L-aspartate dehydrogenase (SEQ ID NO: 1) and is capable of producing L-aspartate and/or beta-alanine.
  • the recombinant host cell provided herein comprises a heterologous nucleic acid encoding Cupriavidus taiwanensis L- aspartate dehydrogenase (SEQ ID NO: 2) and is capable of producing L-aspartate and/or beta- alanine.
  • SEQ ID NO: 2 Cupriavidus taiwanensis L- aspartate dehydrogenase
  • the recombinant host cell further comprises a heterologous nucleic acid encoding an L-aspartate 1 -decarboxylase and is capable of producing beta-alanine where cultured under suitable conditions.
  • a L-aspartate 1 -decarboxylase as used herein refers to any protein with L-aspartate decarboxylase activity, meaning the ability to catalyze the decarboxylation of L-aspartate to beta-alanine.
  • the recombinant host cell provided herein comprises one or more heterologous nucleic acid encoding a L-aspartate 1 -decarboxylase selected from the group consisting of Bacillus subtilis L-aspartate 1 -decarboxylase (SEQ ID NO: 5), Corynebacterium L-aspartate 1 -decarboxylase (SEQ ID NO: 4), and/or Tribolium castaneum L-aspartate 1 -decarboxylase (SEQ ID NO: 3) and is capable of producing beta-alanine.
  • a L-aspartate 1 -decarboxylase selected from the group consisting of Bacillus subtilis L-aspartate 1 -decarboxylase (SEQ ID NO: 5), Corynebacterium L-aspartate 1 -decarboxylase (SEQ ID NO: 4), and/or Tribolium castaneum L-aspartate 1 -decarboxylase (SEQ ID
  • L-aspartate dehydrogenase enzymes suitable for use in accordance with the methods of the invention have L-aspartate dehydrogenase activity and comprise an amino acid sequence with at least 55%, at least 60%>, at least 70%, at least 80%>, at least 90%), or at least 95% sequence identity to SEQ ID NO: 14.
  • L- aspartate 1 -decarboxylase enzymes suitable for use in accordance with the methods of the invention have L-aspartate 1 -decarboxylase activity and comprise an amino acid sequence with at least 40%, at least 45%, at least 50%, or at least 55% sequence identity to SEQ ID NO: 15 and/or 16.
  • the invention provides host cells genetically modified to delete or otherwise reduce the activity of endogenous proteins.
  • Deletion or disruption of ethanol fermentation pathway(s) and nucleic acids encoding ethanol fermentation pathway enzymes is important for engineering a recombinant host cell capable of efficient production of L-aspartate and/or beta-alanine under substantially anaerobic conditions.
  • recombinant host cells comprising deletion or disruption of one or more nucleic acids encoding ethanol fermentation pathway enzymes decreases ethanol production by at least 10%>, at least 25%, at least 50%, at least 60%, at least 70%, at least 90%, at least 95%, or at least 99% as compared to parental cells that do not comprise this genetic modification.
  • the recombinant host cells comprise a deletion or disruption of one or more nucleic acids encoding an enzyme selected from the group consisting of pyruvate decarboxylase, alcohol dehydrogenase, and/or malate dehydrogenase.
  • methods are provided herein for producing L-aspartate or beta- alanine by recombinant host cells of the invention.
  • these methods comprise the step culturing a recombinant host cell described herein in a medium containing at least one carbon source and one nitrogen source under substantially anaerobic conditions such that L-aspartate is produced.
  • conditions are selected to produce an oxygen uptake rate of around 0-25 mmol/l/hr. In some embodiments, conditions are selected to produce an oxygen uptake rate of around 2.5-15 mmol/l/hr.
  • these methods comprise the step of culturing a recombinant host cell described herein in a medium containing at least one carbon source and one nitrogen source under aerobic conditions such that L-aspartate is produced.
  • Figure 1 provides a schematic of the L-aspartate pathway enzymes and L-aspartate 1- decarboxylase enzymes provided by the invention. Conversion of oxaloacetate to L-aspartate is catalyzed by L-aspartate dehydrogenase (EC 1.4.1.21) and conversion of L-aspartate to beta- alanine is catalyzed by L-aspartate 1 -decarboxylase (EC 4.1.1.11).
  • Oxaloacetate-forming enzymes provided by the invention include pyruvate carboxylase (EC 6.4.1.1), phosphoenolpyruvate carboxylase (EC 4.1.1.31), and phosphoenolpyruvate carboxykinase (EC 4.1.1.49). Conversion of pyruvate to oxaloacetate is catalyzed by pyruvate carboxylase; conversion of phosphoenolpyruvate to oxaloacetate is catalyzed by phosphoenolpyruvate carboxylase and/or phosphoenolpyruvate carboxykinase.
  • the present invention provides recombinant host cells, materials, and methods for the biological production of L-aspartate and/or beta-alanine under substantially anaerobic conditions.
  • an "expression vector” includes a single expression vector as well as a plurality of expression vectors, either the same (e.g., the same operon) or different; reference to "cell” includes a single cell as well as a plurality of cells; and the like.
  • accession number and similar terms such as “protein accession number”, “UniProt ID”, “gene ID”, “gene accession number” refer to designations given to specific proteins or genes. These identifiers describe a gene or enzyme sequence in publicly accessible databases, such as NCBI.
  • a dash (-) in a consensus sequence indicates that there is no amino acid at the specified position.
  • a plus (+) in a consensus sequence indicates any amino acid may be present at the specified position.
  • a plus in a consensus sequence herein indicates a position at which the amino acid is generally non-conserved; a homologous enzyme sequence, when aligned with the consensus sequence, can have any amino acid at the indicated "+" position.
  • the term “express”, when used in connection with a nucleic acid encoding an enzyme or an enzyme itself in a cell, means that the enzyme, which may be an endogenous or exogenous (heterologous) enzyme, is produced in the cell.
  • the term “overexpress”, in these contexts, means that the enzyme is produced at a higher level, i.e., enzyme levels are increased, as compared to the wild-type, in the case of an endogenous enzyme.
  • overexpression of an enzyme can be achieved by increasing the strength or changing the type of the promoter used to drive expression of a coding sequence, increasing the strength of the ribosome binding site or Kozak sequence, increasing the stability of the mRNA transcript, altering the codon usage, increasing the stability of the enzyme, and the like.
  • expression vector refers to a nucleic acid and/or a composition comprising a nucleic acid that can be introduced into a host cell, e.g., by transduction, transformation, or infection, such that the cell then produces (“expresses") nucleic acids and/or proteins other than those native to the cell, or in a manner not native to the cell, that are contained in or encoded by the nucleic acid so introduced.
  • an "expression vector” contains nucleic acids (ordinarily DNA) to be expressed by the host cell.
  • the expression vector can be contained in materials to aid in achieving entry of the nucleic acid into the host cell, such as the materials associated with a virus, liposome, protein coating, or the like.
  • Expression vectors suitable for use in various aspects and embodiments of the present invention include those into which a nucleic acid sequence can be, or has been, inserted, along with any preferred or required operational elements.
  • an expression vector can be transferred into a host cell and, typically, replicated therein (although, one can also employ, in some embodiments, non-replicable vectors that provide for "transient" expression).
  • an expression vector that integrates into chromosomal, mitochondrial, or plastid DNA is employed.
  • an expression vector that replicates extrachromasomally is employed.
  • Typical expression vectors include plasmids, and expression vectors typically contain the operational elements required for transcription of a nucleic acid in the vector.
  • Such plasmids, as well as other expression vectors, are described herein or are well known to those of ordinary skill in the art.
  • heterologous refers to a material that is non-native to a cell.
  • a nucleic acid is heterologous to a cell, and so is a "heterologous nucleic acid" with respect to that cell, if at least one of the following is true: (a) the nucleic acid is not naturally found in that cell (that is, it is an "exogenous” nucleic acid); (b) the nucleic acid is naturally found in a given host cell (that is, "endogenous to”), but the nucleic acid or the RNA or protein resulting from transcription and translation of this nucleic acid is produced or present in the host cell in an unnatural (e.g., greater or lesser than naturally present) amount; (c) the nucleic acid comprises a nucleotide sequence that encodes a protein endogenous to a host cell but differs in sequence from the endogenous nucleotide sequence that encodes that same protein (having the same or
  • a protein is heterologous to a host cell if it is produced by translation of RNA or the corresponding RNA is produced by transcription of a heterologous nucleic acid; a protein is also heterologous to a host cell if it is a mutated version of an endogenous protein, and the mutation was introduced by genetic engineering.
  • homologous refers to the similarity of a nucleic acid or amino acid sequence, typically in the context of a coding sequence for a gene or the amino acid sequence of a protein. Homology searches can be employed using a known amino acid or coding sequence (the "reference sequence") for a useful protein to identify homologous coding sequences or proteins that have similar sequences and thus are likely to perform the same useful function as the protein defined by the reference sequence.
  • the reference sequence a known amino acid or coding sequence
  • a protein having greater than 90% identity to a reference protein as determined by, for example and without limitation, a BLAST (blast.ncbi.nlm.nih.gov) search is highly likely to carry out the identical biochemical reaction as the reference protein.
  • two enzymes having greater than 20% identity will carry out identical biochemical reactions, and the higher the identity, i.e., 40% or 80% identity, the more likely the two proteins have the same or similar function.
  • homologous enzymes can be identified by BLAST searching.
  • host cell and "host microorganism” are used interchangeably herein to refer to a living cell that can be (or has been) transformed via insertion of an expression vector.
  • a host microorganism or cell as described herein may be a prokaryotic cell (e.g., a microorganism of the kingdom Eubacteria) or a eukaryotic cell.
  • a prokaryotic cell lacks a membrane-bound nucleus, while a eukaryotic cell has a membrane-bound nucleus.
  • isolated or “pure” refer to material that is substantially, e.g. greater than 50% or greater than 75%, or essentially, e.g. greater than 90%, 95%, 98% or 99%, free of components that normally accompany it in its native state, e.g. the state in which it is naturally found or the state in which it exists when it is first produced.
  • nucleic acid and variations thereof shall be generic to polydeoxyribonucleotides (containing 2-deoxy-D-ribose) and to polyribonucleotides (containing D-ribose).
  • Nucleic acid can also refer to any other type of polynucleotide that is an N- glycoside of a purine or pyrimidine base, and to other polymers containing nonnucleotidic backbones, provided that the polymers contain nucleobases in a configuration that allows for base pairing and base stacking, as found in DNA and RNA.
  • nucleic acid may also be referred to herein with respect to its sequence, the order in which different nucleotides occur in the nucleic acid, as the sequence of nucleotides in a nucleic acid typically defines its biological activity, e.g., as in the sequence of a coding region, the nucleic acid in a gene composed of a promoter and coding region, which encodes the product of a gene, which may be an RNA, e.g. a rRNA, tRNA, or mRNA, or a protein (where a gene encodes a protein, both the mRNA and the protein are "gene products" of that gene).
  • operably linked refers to a functional linkage between a nucleic acid expression control sequence (such as a promoter, ribosome-binding site, and transcription terminator) and a second nucleic acid sequence, the coding sequence or coding region, wherein the expression control sequence directs or otherwise regulates transcription and/or translation of the coding sequence.
  • a nucleic acid expression control sequence such as a promoter, ribosome-binding site, and transcription terminator
  • recombinant refers to the alteration of genetic material by human intervention. Typically, recombinant refers to the manipulation of DNA or RNA in a cell or virus or expression vector by molecular biology (recombinant DNA technology) methods, including cloning and recombination. Recombinant can also refer to manipulation of DNA or RNA in a cell or virus by random or directed mutagenesis.
  • a "recombinant" cell or nucleic acid can typically be described with reference to how it differs from a naturally occurring counterpart (the "wild-type”).
  • any reference to a cell or nucleic acid that has been “engineered” or “modified” and variations of those terms is intended to refer to a recombinant cell or nucleic acid.
  • transduce refers to the introduction of one or more nucleic acids into a cell.
  • the nucleic acid must be stably maintained or replicated by the cell for a sufficient period of time to enable the function(s) or product(s) it encodes to be expressed for the cell to be referred to as “transduced”, “transformed”, or “transfected”.
  • stable maintenance or replication of a nucleic acid may take place either by incorporation of the sequence of nucleic acids into the cellular chromosomal DNA, e.g., the genome, as occurs by chromosomal integration, or by replication extrachromosomally, as occurs with a freely- replicating plasmid.
  • a virus can be stably maintained or replicated when it is "infective”: when it transduces a host microorganism, replicates, and (without the benefit of any complementary virus or vector) spreads progeny expression vectors, e.g., viruses, of the same type as the original transducing expression vector to other microorganisms, wherein the progeny expression vectors possess the same ability to reproduce.
  • progeny expression vectors e.g., viruses, of the same type as the original transducing expression vector to other microorganisms, wherein the progeny expression vectors possess the same ability to reproduce.
  • L-aspartate is intended to mean an amino acid having the chemical formula C 4 H 5 NO 4 and a molecular mass of 131.10 g/mol (CAS# 56-84-8). L-aspartate as described herein can be a salt, acid, base, or derivative depending on the structure, pH, and ions present.
  • the terms "L-aspartate”, “L-aspartic acid”, “L-aspartate”, and “aspartic acid” are used interchangeably herein.
  • beta-alanine is intended to mean a beta amino acid having the chemical formula C 3 H 6 NO 2 and a molecular mass of 88.09 g/mol (CAS # 107-95-9).
  • Beta- alanine as described herein can be a salt, acid, base, or derivative depending on the structure, pH, and ions present.
  • Beta-alanine is also referred to as " ⁇ -alanine", “3-aminopropionic acid”, and “3-aminopropanoate”, and these terms are used interchangeably herein.
  • substantially anaerobic when used in reference to a culture or growth condition is intended to mean the amount of oxygen is less than about 10% of saturation for dissolved oxygen in liquid media.
  • the term is also intended to include sealed chambers of liquid or solid growth medium maintained with an atmosphere of less than about 1% oxygen.
  • Section 2 Recombinant host cells for production of L-aspartate and beta-alanine 2.1 Host cells
  • the invention provides a recombinant host cell capable of producing
  • the host cell comprising one or more heterologous nucleic acids encoding a L-aspartate pathway enzyme and optionally (in the case of beta-alanine producing host cells) a L-aspartate 1 -decarboxylase.
  • the recombinant host cell has been engineered to produce L-aspartate or beta-alanine under substantially anaerobic conditions.
  • the recombinant host cell natively produces L-aspartate or beta-alanine under substantially anaerobic conditions.
  • the recombinant host cell has been engineered to produce L-aspartate or beta- alanine under aerobic conditions.
  • Any suitable host cell may be used in practice of the methods of the present invention, and exemplary host cells useful in the compositions and methods provided herein include archaeal, prokaryotic, or eukaryotic cells.
  • the recombinant host cell is a yeast cell.
  • Yeast cells are excellent host cells for construction of recombinant metabolic pathways comprising heterologous enzymes catalyzing production of small-molecule products.
  • molecular biology techniques and nucleic acids encoding genetic elements necessary for construction of yeast expression vectors including, but not limited to, promoters, origins of replication, antibiotic resistance markers, auxotrophic markers, terminators, and the like.
  • Second, techniques for integration/insertion of nucleic acids into the yeast chromosome by homologous recombination are well established. Yeast also offers a number of advantages as an industrial fermentation host.
  • Yeast cells can generally tolerate high concentrations of organic acids and maintain cell viability at low pH and can grow under both aerobic and anaerobic culture conditions, and there are established fermentation broths and fermentation protocols.
  • the ability of a strain to propagate and/or produce the desired product under substantially anaerobic conditions provides a number of advantages with regard to the present invention. First, this characteristic results in efficient product biosynthesis when the host cell is supplied with a carbohydrate carbon source. Second, from a process standpoint, the ability to run a fermentation under substantially anaerobic conditions decreases production cost.
  • yeast cells useful in the method of the invention include yeasts of a genera selected from the non-limiting group consisting of Aciculoconidium, Ambrosiozyma, Arthroascus, Arxiozyma, Ashbya, Babjevia, Bensingtonia, Botryoascus, Botryozyma, Brettanomyces, Bullera, Bulleromyces, Candida, Citeromyces, Clavispora, Cryptococcus, Cystofilobasidium, Debaryomyces, Dekkara, Dipodascopsis, Dipodascus, Eeniella, Endomycopsella, Eremascus, Eremothecium, Erythrobasidium, Fellomyces, Filobasidium, Galactomyces, Geotrichum, Guilliermondella, Hanseniaspora, Hansenula, Hasegawaea, Holtermannia, Hormoascus, Hyphopich
  • the yeast cell is of a species selected from the non- limiting group consisting of Candida albicans, Candida ethanolica, Candida guilliermondii,
  • the recombinant yeast cells provided herein are engineered by the introduction of one or more genetic modifications (including, for example, heterologous nucleic acids encoding enzymes and/or disruption or deletion of native nucleic acids encoding enzymes) into a Crabtree-negative yeast cell.
  • the host cell belongs to the Pichia/Issatchenkia/Saturnispora/Dekkera clade.
  • the host cell belongs to the genus selected from the group consisting of Pichia, Issatchenkia, or Candida.
  • the host cell belongs to the genus Pichia, and in some of these embodiments the host cell is Pichia kudriavzevii.
  • the recombinant host cells provided herein are engineered by introduction of one or more genetic modifications into a Crabtree-positive yeast cell.
  • the host cell belongs to the Saccharomyces clad.
  • the host cell belongs to a genus selected from the group consisting of Saccharomyces, Hanseniaspora, and Kluyveromyces.
  • the host cell belongs to the genus Saccharomyces, and in one of these embodiments the host cell is Saccharomyces cerevisiae.
  • Host cells encompassed by a clade exhibit greater sequence identity in the D1/D2 domain of the 26S ribosomal subunit DNA to other host cells within the clade as compared to host cells outside the clade. Therefore, host cells that are members of a clade (e.g., the Pichia/Issatchenkia/Saturnispora/Dekkera or Saccharomyces clades) can be identified using the methods of Kurtzman and Robnett.
  • Recombinant host cells other than yeast cells are also suitable for use in accordance with the methods of the invention so long as the engineered host cell is capable of growth and/or product formation under substantially anaerobic conditions
  • illustrative examples include various eukaryotic, prokaryotic, and archaeal host cells.
  • Illustrative examples of eukaryotic host cells provided by the invention include, but are not limited to cells belonging to the genera Aspergillus, Crypthecodinium, Cunninghamella, Entomophthora, Mortierella, Mucor, Neurospora, Pythium, Schizochytnum, Thraustochytrium, Trichoderma, Xanthophyllomyces.
  • eukaryotic strains include, but are not limited to: Aspergillus niger, Aspergillus oryzae, Crypthecodiniurn. cohnii, Cunninghamella japonica, Entomophthora coronata, Mortierella alpina, Mucor circinelloides, Neurospora crassa, Pythium uitimum, Schizochytnum limacinum, Thraustochytrium aureum, Trichoderma reesei and Xanthophyllomyces dendrorhous.
  • Illustrative examples of recombinant archaea host cells include, but are not limited to, cells belonging to the genera: Aeropyrum, Archaeglobus, Halobacterium, Methanococcus, Methanobacterium, Pyrococcus, Sulfolobus, and Thermoplasma.
  • archae strains include, but are not limited to Archaeoglobus fulgidus, Halobacterium sp., Methanococcus jarmaschii, Methanobacterium thernioautotrophicum, Thermoplasma acidophilum, Thermoplasma volcanium, Pyrococcus horikoshii, Pyrococcus abyssi, and Aeropyrum peraix.
  • Illustrative examples of recombinant prokaryotic host ceils include, but are not limited to, ceils belonging to the genera Agrobacterium, Aiicyciobacillus, Anabaena, Anacystis, Arthrobacter, Azobacter, Bacillus, Brevibacterium, Chromatium, Clostridium, Corynebacterium, Enterobacter, Erwinia, Escherichia, Lactobacillus, Lactococcus, Mesorhizobium, Methyl obacterium, Microbacterium, Phormidium, Pseudomonas, Rhodobacter, Rhodopseudomonas, Rhodospirillum, Rhodococcus, Salmonella, Scenedesmun, Serratia, Shigella, Staphlococcus, Strepromyces, Synnecoccus, and Zymomonas.
  • prokaryotic strains include, but are not limited to Bacillus subtilis, Brevibacterium ammoniagenes, Bacillus amyloliquefacines, Brevibacterium ammoniagenes, Brevibacterium immariophilum, Clostridium beigerinckii, Enterobacter sakazakii, Escherichia coli, Lactobacillus acidophilus, Lactococcus lactis, Mesorhizobium loti, Pseudomonas aeruginosa, Pseudomonas mevalonic, Pseudomonas pudita, Rhodobacter capsulatus, Rhodobacter sphaeroides, Rhodospirillum rubrum, Salmonella enterica, Salmonella typhi, Salmonella typhimurium, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, and Staphylococcus aureus.
  • Escherichia coli and Corynebacterium glutamicum are particularly good prokaryotic host cells for use in accordance with the methods of the invention.
  • E. coli is capable of growth and/or product (L-aspartate or beta-alanine) formation under substantially anaerobic conditions, is well-utilized in industrial fermentation of small-molecule products, and can be readily engineered. Unlike most wild type yeast strains, wild type E. coli can catabolize both pentose and hexose sugars as carbon sources.
  • the present invention provides a wide variety of E. coli host cells suitable for use in the methods of the invention.
  • the recombinant host cell is an Escherichia coli host cell.
  • Corynebacterium glutamicum is well utilized for industrial production of various amino acids. While generally regarded as a strict aerobe, wild type Corynebacterium glutamicum is capable of growth under substantially anaerobic conditions if nitrate is supplied to the fermentation broth as an electron acceptor.
  • the recombinant host cell is a Corynebacterium host cell.
  • the host cell is a microbe that is capable of growth and/or production of L-aspartate or beta-alanine under substantially anaerobic conditions.
  • Suitable host ceils may natively grow under substantially anaerobic conditions or may be engineered to be capable of growth under substantially anaerobi c conditions,
  • Lactobacillus acidophilus have been designated by the Food and Drug Administration as Generally Regarded As Safe (or GRAS) and so are employed in various embodiments of the methods of the invention. While desirable from public safety and regulatory standpoints, GRAS status does not impact the ability of a host strain to be used in the practice of this invention, hence, non-GRAS and even pathogenic organisms are included in the list of illustrative host strains suitable for use in the practice of this invention.
  • recombinant host cells having at least one active L-aspartate pathway from phosphoenolpyruvate or pyruvate to L-aspartate In some embodiments wherein the host cell produces beta-alanine, the recombinant host cell further expresses an L-aspartate 1 -decarboxylase.
  • a recombinant host cell having an active L-aspartate pathway as used herein produces active enzymes necessary to catalyze each metabolic reaction in a L-aspartate fermentation pathway, and therefore is capable of producing L-aspartate and/or beta-alanine in measurable yields and/or titers when cultured under suitable conditions.
  • a recombinant host cell having an active L-aspartate pathway comprises one or more heterologous nucleic acids encoding L-aspartate pathway enzymes.
  • the recombinant host cells provided herein have a L- aspartate pathway that proceeds via phosphoenolpyruvate or pyruvate, and oxaloacetate intermediates.
  • the recombinant host cell comprises one or more heterologous nucleic acids encoding one or more L-aspartate pathway enzymes selected from the group consisting of phosphoenolpyruvate carboxylase, pyruvate carboxylase, phosphoenolpyruvate carboxykinase, and L-aspartate dehydrogenase wherein the heterologous nucleic acid is expressed in sufficient amounts to produce L-aspartate under substantially anaerobic conditions.
  • the recombinant host cell comprises one or more heterologous nucleic acids encoding one or more L-aspartate pathway enzymes selected from the group consisting of phosphoenolpyruvate carboxylase, pyruvate carboxylase, phosphoenolpyruvate carboxykinase, and L-aspartate dehydrogenase wherein the heterologous nucleic acid is expressed in sufficient amounts to produce L-aspartate under aerobic conditions.
  • the cell further comprises a heterologous nucleic acid encoding an L- aspartate 1 -decarboxylase wherein said heterologous nucleic acid is expressed in sufficient amounts to produce beta-alanine under substantially anaerobic conditions.
  • recombinant host cells engineered for production of L-aspartate in accordance with the methods of the invention express an L-aspartate pathway, and recombinant host cells engineered for production of beta-alanine express, in addition to an L-aspartate pathway, a L- aspartate 1 -decarboxylase.
  • the recombinant host cell comprises one or more heterologous nucleic acids encoding one or more enzymes of an L-aspartate pathway. In some embodiments, the recombinant host cell comprises one or more heterologous nucleic acids encoding one L-aspartate pathway enzyme. In some embodiments, said one L-aspartate pathway enzyme is L-aspartate dehydrogenase. In other embodiments, said one L-aspartate pathway enzyme is pyruvate carboxylase. In other embodiments, said one L-aspartate pathway enzyme is phosphoenolpyruvate carboxylase.
  • said one L-aspartate pathway enzyme is phosphoenolpyruvate carboxykinase.
  • the recombinant host cell comprises one or more heterologous nucleic acids encoding two L-aspartate pathway enzymes.
  • said two L-aspartate pathway enzymes are L-aspartate dehydrogenase and pyruvate carboxylase.
  • said two L-aspartate pathway enzymes are L-aspartate dehydrogenase and phosphoenolpyruvate carboxylase.
  • said two L-aspartate pathway enzymes are L-aspartate dehydrogenase and phosphoenolpyruvate carboxykinase.
  • the recombinant host cell comprises one or more heterologous nucleic acids encoding three L-aspartate pathway enzymes.
  • said three L-aspartate pathway enzymes are L-aspartate dehydrogenase, pyruvate carboxylase, and phosphoenolpyruvate carboxylase.
  • said three L-aspartate pathway enzymes are L-aspartate dehydrogenase, pyruvate carboxylase, and phosphoenolpyruvate carboxykinase. In other embodiments, said three L-aspartate pathway enzymes are L-aspartate dehydrogenase, phosphoenolpyruvate carboxylase, and phosphoenolpyruvate carboxykinase.
  • the recombinant host cell comprises one or more heterologous nucleic acids encoding all four L-aspartate pathway enzymes (i.e., L-aspartate dehydrogenase, pyruvate carboxylase, phosphoenolpyruvate carboxylase, and phosphoenolpyruvate carboxykinase).
  • the recombinant host cell further comprises a heterologous nucleic acid encoding L-aspartate 1 -decarboxylase.
  • the recombinant host cells of the present invention include microbes that employ combinations of metabolic reactions for biosynthetically producing the compounds of the invention.
  • the biosynthesized compounds can be produced intracellularly and/or secreted into the culture medium.
  • the biosynthesized compounds produced by the recombinant host cells are L-aspartate and/or beta-alanine. The relationship of these compounds with respect to the metabolic reactions described herein are depicted in Figure 1.
  • the recombinant host cell is engineered to produce L-aspartate under substantially anaerobic conditions.
  • the recombinant host cell is engineered to produce L- aspartate under aerobic conditions.
  • the recombinant host cell is engineered to produce beta-alanine under substantially anaerobic conditions.
  • the production of L-aspartate or beta-alanine via the biosynthetic pathways and recombinant host cells of the invention is particularly useful because L-aspartate and beta- alanine can be produced under substantially anaerobic conditions.
  • Microorganisms generally lack the capacity to produce L-aspartate or beta-alanine (derived from L-aspartate using a L- aspartate 1 -decarboxylase) under substantially anaerobic conditions.
  • the recombinant host cells of the invention are engineered to produce L-aspartate and/or beta-alanine when grown under substantially anaerobic conditions and supplied with a carbohydrate as the primary carbon source and an assimilable nitrogen source.
  • the L-aspartate pathway and L-aspartate 1 -decarboxylase enzymes and nucleic acids encoding said enzymes may be endogenous or heterologous.
  • the recombinant host cells provided herein comprise one or more heterologous nucleic acids encoding L-aspartate pathway and/or L-aspartate 1 -decarboxylase enzymes.
  • the recombinant host cell comprises a single heterologous nucleic acid encoding a L-aspartate pathway or L-aspartate 1 -decarboxylase gene.
  • the cell comprises multiple heterologous nucleic acids encoding L-aspartate pathway and/or L-aspartate 1 -decarboxylase enzymes.
  • the recombinant host cell may comprise multiple copies of a single heterologous nucleic acid and/or multiple copies of two or more heterologous nucleic acids.
  • Recombinant host cells comprising multiple heterologous nucleic acids may comprise any number of heterologous nucleic acids.
  • the recombinant host cells provided herein comprise one or more endogenous nucleic acids encoding L-aspartate pathway and/or L-aspartate 1- decarboxylase enzymes.
  • the cells may be engineered to express more of these endogenous enzymes.
  • the endogenous enzyme being expressed at a higher level (produced at a higher amount as compared to a parental or control cell) may be operatively linked to one or more exogenous promoters or other regulatory elements.
  • the recombinant host cells provided herein comprise one or more endogenous nucleic acids encoding L-aspartate pathway and/or L-aspartate 1- decarboxylase enzymes and one or more heterologous nucleic acids encoding L-aspartate pathway and/or L-aspartate 1 -decarboxylase enzymes.
  • the recombinant host cells may have an active L-aspartate pathway and/or L-aspartate 1 -decarboxylase that comprises one or more endogenous nucleic acids encoding L-aspartate pathway and/or L- aspartate 1 -decarboxylase enzymes and one or more heterologous nucleic acids encoding L- aspartate pathway and/or L-aspartate 1 -decarboxylase enzymes.
  • the recombinant host cell may comprise both endogenous and heterologous nucleic acids encoding an L-aspartate pathway or L-aspartate 1 -decarboxylase enzyme.
  • FIG. 1 provides a schematic showing the biosynthetic relationship of the three oxaloacetate-forming enzymes to the production of L- aspartate and beta-alanine.
  • One oxaloacetate-forming enzyme provided by the invention is pyruvate carboxylase (EC 6.4.1.1), catalyzing conversion of pyruvate and hydrogen carbonate to oxaloacetate along with concomitant hydrolysis of adenosine triphosphate (ATP) to adenosine diphosphate (ADP).
  • ATP adenosine triphosphate
  • ADP adenosine diphosphate
  • Another oxaloacetate-forming enzyme is phosphoenolpyruvate carboxylase (EC 4.1.1.31), catalyzing conversion of phosphoenolpyruvate and hydrogen carbonate to oxaloacetate along with concomitant release of phosphate.
  • the third oxaloacetate-forming enzymes is phosphoenolpyruvate carboxykinase (EC 4.1.1.49), catalyzing formation of oxaloacetate from phosphoenolpyruvate and carbon dioxide along with concomitant formation of ATP from ADP.
  • the recombinant host cell comprises one or more heterologous nucleic acids encoding an oxaloacetate-forming enzyme selected from the group consisting of pyruvate carboxylase, phosphoenolpyruvate carboxylase, and phosphoenolpyruvate carboxykinase that results in increased production of L-aspartate or beta-alanine under substantially anaerobic conditions as compared to a parent cell not comprising said one or more heterologous nucleic acids.
  • an oxaloacetate-forming enzyme selected from the group consisting of pyruvate carboxylase, phosphoenolpyruvate carboxylase, and phosphoenolpyruvate carboxykinase that results in increased production of L-aspartate or beta-alanine under substantially anaerobic conditions as compared to a parent cell not comprising said one or more heterologous nucleic acids.
  • the recombinant host cell comprises one or more heterologous nucleic acids encoding an oxaloacetate-forming enzyme selected from the group consisting of pyruvate carboxylase, phosphoenolpyruvate carboxylase, and phosphoenolpyruvate carboxykinase that results in increased production of L-aspartate or beta- alanine under aerobic conditions as compared to a parent cell not comprising said one or more heterologous nucleic acids.
  • an oxaloacetate-forming enzyme selected from the group consisting of pyruvate carboxylase, phosphoenolpyruvate carboxylase, and phosphoenolpyruvate carboxykinase that results in increased production of L-aspartate or beta- alanine under aerobic conditions as compared to a parent cell not comprising said one or more heterologous nucleic acids.
  • Recombinant host cells of the invention engineered for production of L-aspartate or beta-alanine under substantially anaerobic conditions through increased expression of oxaloacetate-forming enzymes generally comprise one or more heterologous nucleic acids encoding at least one oxaloacetate-forming enzyme.
  • a recombinant host cell engineered for production of L-aspartate or beta-alanine under substantially anaerobic conditions comprises one or more heterologous nucleic acid encoding one oxaloacetate-forming enzyme.
  • a recombinant host cell engineered for production of L-aspartate or beta-alanine under substantially anaerobic conditions comprises heterologous nucleic acids encoding two oxaloacetate-forming enzymes.
  • recombinant host cells of the invention engineered for production of L-aspartate or beta-alanine under substantially anaerobic conditions comprise heterologous nucleic acids encoding all three oxaloacetate- forming enzymes.
  • a recombinant host cell of the invention comprises one or more heterologous nucleic acids encoding a pyruvate carboxylase wherein said host cell is capable of producing L- aspartate or beta-alanine under substantially anaerobic conditions.
  • a recombinant host cell of the invention comprises one or more heterologous nucleic acids encoding a pyruvate carboxylase wherein said host cell is capable of producing L-aspartate or beta-alanine under aerobic conditions.
  • a nucleic acid encoding pyruvate carboxylase is derived from a fungal source.
  • pyruvate carboxylase enzymes derived from fungal sources suitable for use in accordance with the methods of the invention include those selected from the group consisting of Aspergillus niger (UniProt ID: Q9HES8), Aspergillus terreus (UniProt ID: 093918), Aspergillus oryzae (UniProt ID:Q2UGL1; SEQ ID NO: 7), Aspergillus fumigatus (UniProt ID: Q4WP18), Paecilomyces variotii (UniProt ID: V5FWI7), and Saccharomyces cerevisiae (UniProt ID: PI 1154) pyruvate carboxylase.
  • a recombinant host cell of the invention comprises one or more heterologous nucleic acids encoding Aspergillus oryzae pyruvate carboxylase (SEQ ID NO: 7) wherein said host cell is capable of producing L-aspartate or beta-alanine under substantially anaerobic conditions.
  • a recombinant host cell of the invention comprises one or more heterologous nucleic acids encoding Aspergillus oryzae pyruvate carboxylase (SEQ ID NO: 7) wherein said host cell is capable of producing L-aspartate or beta-alanine under aerobic conditions.
  • Oxaloacetate can also be produced from phosphoenolpyruvate, which serves as the substrate for both phosphoenolpyruvate carboxylase and phosphoenolpyruvate carboxykinase enzymes.
  • a nucleic acid encoding phosphoenolpymvate carboxylase is derived from a fungal source.
  • a specific, non-limiting example of a phosphoenolpyruvate carboxylase enzyme derived from a fungal source suitable for use in accordance with the methods of the invention is Aspergillus niger phosphoenolpyruvate carboxylase (UniProt ID: A2QM99).
  • a nucleic acid encoding phosphoenolpyruvate carboxylase is derived from a bacterial source.
  • Non-limiting examples of phosphoenolpyruvate carboxylase enzymes derived from bacterial sources suitable for use in accordance with the methods of the invention include Escherichia coli (UniProt ID: H9UZE7; SEQ ID NO: 8), Mycobacterium tuberculosis (UniProt ID: P9WIH3), and Cory neb acterium glutamicum (UniProt ID: P12880) phosphoenolpyruvate carboxylase enzymes.
  • said phosphoenolpyruvate carboxylase is Escherichia coli phosphoenolpyruvate carboxylase (SEQ ID NO: 8).
  • the recombinant host cell comprises one or more heterologous nucleic acids encoding a phosphoenolpyruvate carboxylase that results in increased production of L-aspartate or beta-alanine under substantially anaerobic conditions as compared to a parent cell not comprising said one or more heterologous nucleic acids.
  • said phosphoenolpyruvate carboxylase is Escherichia coli phosphoenolpyruvate carboxylase (SEQ ID NO: 8).
  • Non-limiting examples of phosphoenolpyruvate carboxykinase enzymes suitable for use in accordance with the methods of the invention include Escherichia coli (UniProt ID: P22259), Anaerobiospirillum succiniciproducens (UniProt ID: 009460), Actinobacillus succinogenes (UniProt ID: A6VKV4), Mannheimia succiniciproducens (SEQ ID NO: 6), and Haemophilus influenzae (UniProt ID: A5UDR5) PEP carboxykinase enzymes.
  • the recombinant host cell comprises one or more heterologous nucleic acids encoding a phosphoenolpyruvate carboxykinase that results in increased production of L- aspartate or beta-alanine under substantially anaerobic conditions as compared to a parent cell not comprising said one or more heterologous nucleic acids.
  • said phosphoenolpyruvate carboxykinase is Mannheimia succiniciproducens phosphoenolpyruvate carboxykinase (SEQ ID NO: 6).
  • L-aspartate dehydrogenase enzymes Provided herein is a recombinant host cell capable of producing L-aspartate or beta-alanine, the cell comprising one or more heterologous nucleic acids encoding a L-aspartate dehydrogenase.
  • a L-aspartate dehydrogenase as used herein refers to any protein with L- aspartate dehydrogenase activity, meaning the ability to catalyze the conversion of oxaloacetate to L-aspartate.
  • Proteins capable of catalyzing this reaction suitable for use in the compositions and methods provided herein include both NAD-dependent L-aspartate dehydrogenase and NADP-dependent L-aspartate dehydrogenase enzymes.
  • NAD-dependent L-aspartate dehydrogenase enzymes catalyze the conversion of oxaloacetate and ammonia to L-aspartate using NADH as the electron donor.
  • NADP-dependent L-aspartate dehydrogenase enzymes catalyze the conversion of oxaloacetate and ammonia to L-aspartate using NADPH as the electron donor.
  • L-aspartate dehydrogenase enzymes are capable of using both NADH and NADPH as electron acceptors; as such, an NAD-dependent L-aspartate dehydrogenase may also be an NADP-dependent L-aspartate dehydrogenase (and vice versa).
  • usage of either NADH or NADPH as the electron donor is dependent on both the relative concentration of, and affinity constant of the L-aspartate dehydrogenase exhibits for, NADH or NADPH, respectively.
  • the recombinant host cell provided herein comprises a heterologous nucleic acid encoding an L-aspartate dehydrogenase, which is capable of producing L-aspartate and/or beta-alanine.
  • L-aspartate dehydrogenases suitable for use in accordance with the methods of the invention include those selected from the non-limiting group consisting of Acinetobacter sp.
  • the recombinant host cell provided herein comprises a heterologous nucleic acid encoding Pseudomonas aeruginosa L-aspartate dehydrogenase (SEQ ID NO: 1), which is capable of producing L-aspartate and/or beta-alanine.
  • the recombinant host cell provided herein comprises a heterologous nucleic acid encoding Cupriavidus taiwanensis L-aspartate dehydrogenase (SEQ ID NO: 2), which is capable of producing L-aspartate and/or beta-alanine.
  • a recombinant host cell of the present invention comprises a heterologous nucleic acid encoding an L-aspartate dehydrogenase selected from the group consisting of SEQ ID NOs: 17, 18, 19, 20, 21, 22, 23, 24, 25, 25, and 27, wherein the recombinant host cell is capable of producing L- aspartate and/or beta-alanine.
  • a recombinant host cell of the present invention comprises a plurality of heterologous nucleic acids, each encoding an L-aspartate dehydrogenase selected from the group consisting of SEQ ID NOs: 17, 18, 19, 20, 21, 22, 23, 24, 25, 25, and 27, wherein the recombinant host cell is capable of producing L-aspartate and/or beta-alanine.
  • L-aspartate dehydrogenases also useful in the compositions and methods provided herein include those enzymes that are said to be "homologous" to any of the L-aspartate dehydrogenase enzymes described herein.
  • homologs have the following characteristics: (1) is capable of catalyzing the conversion of oxaloacetate to L-aspartate; (2) it shares substantial sequence identity with any L-aspartate dehydrogenase described herein; (3) comprises a substantial number of amino acids corresponding to highly conserved amino acids in any L- aspartate dehydrogenase described herein; and (4) comprises one or more specific amino acids corresponding to strictly conserved amino acids in any L-aspartate dehydrogenase described herein.
  • a homolog is said to share substantial sequence identity to an L-aspartate dehydrogenase if the amino acid sequence of the homolog is at least 60%, at least 70%, at least 80%), at least 90%>, at least 95%>, or at least 97%> the same as that of a L-aspartate dehydrogenase amino acid sequence set forth herein.
  • a number of amino acids in L-aspartate dehydrogenase enzymes provided by the invention are highly conserved, and proteins homologous to an L-aspartate dehydrogenase enzyme of the invention will generally comprise amino acids corresponding to a substantial number of highly conserved amino acids.
  • a homolog is said to comprise a substantial number of amino acids corresponding to highly conserved amino acids in a reference sequence if at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or more than 95% of the highly conserved amino acids in the reference sequence are found in the homologous protein.
  • L-aspartate enzymes homologous to Pseudomonas aeruginosa L-aspartate dehydrogenase comprise amino acids corresponding to at least a 50% of these highly conserved amino acids.
  • L-aspartate enzymes homologous to Pseudomonas aeruginosa L-aspartate dehydrogenase comprise amino acids corresponding to at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or more than 95% of these highly conserved amino acids.
  • L- aspartate enzymes homologous to Cupriavidus taiwanensis L-aspartate dehydrogenase comprise amino acids corresponding to at least 50% of these highly conserved amino acids.
  • L-aspartate enzymes homologous to Cupriavidus taiwanensis L- aspartate dehydrogenase comprise amino acids corresponding to at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or more than 95% of these highly conserved amino acids.
  • amino acids in L-aspartate dehydrogenase enzymes provided by the invention are strictly conserved, and proteins homologous to an L-aspartate dehydrogenase enzyme of the invention must comprise amino acid(s) corresponding to these strictly conserved amino.
  • Amino acid H220 in SEQ ID NO: 1 functions as a general acid/base (although the invention is not to be limited by any theory of mechanism of action) and is necessary for enzyme activity; thus, an amino acid corresponding to H220 in SEQ ID NO: 1 is present in all enzymes homologous to SEQ ID NO: 1.
  • Amino acid H220 in SEQ ID NO: 1 corresponds to amino acid HI 19 in SEQ ID NO: 2, and L-aspartate dehydrogenase enzymes homologous to SEQ ID NO: 2 must comprise an amino acid corresponding to HI 19 in SEQ ID NO: 2.
  • L-aspartate dehydrogenase enzymes homologous to those described above
  • another class of L-aspartate dehydrogenase enzymes that can be expressed in engineered P. kudriavzevii to produce L-aspartate from oxaloacetate are L-aspartate transaminase (EC 2.6.1.1) enzymes, which catalyzes reduction of oxaloacetate to L-aspartate along with concomitant oxidation of glutamate to alpha-ketoglutarate.
  • the recombinant host cell comprises a heterologous nucleic acid encoding a L-aspartate dehydrogenase that is an L-aspartate transaminase.
  • L-aspartate transaminase enzymes include those selected from the non-limiting group consisting of Saccharomyces cerevisiae AAT2 (UnitProt ID: P23542), Schizosaccharomyces pombe L-aspartate transaminase (UniProt ID: 094320), Escherichia coli AspC (UniProt ID: P00509), Pseudomonas aeruginosa AspC (UniProt ID: P72173), and Rhizobium meliloti AatB (UniProt ID: Q06191), among others.
  • Saccharomyces cerevisiae AAT2 UnitProt ID: P23542
  • Schizosaccharomyces pombe L-aspartate transaminase UniProt ID: 094320
  • Escherichia coli AspC UniProt ID: P00509
  • the recombinant host cell further comprises a heterologous nucleic acid encoding a L-aspartate 1-decarboxylase.
  • a L-aspartate 1- decarboxylase as used herein refers to any protein with L-aspartate decarboxylase activity, meaning the ability to catalyze the decarboxylation of L-aspartate to beta-alanine.
  • Proteins capable of catalyzing this reaction suitable for use in the compositions and methods provided herein include both bacterial L-aspartate 1 -decarboxylases and eukaryotic L-aspartate decarboxylases.
  • Bacterial L-aspartate 1 -decarboxylases are pyruvoyl-dependent decarboxylases where the covalently bound pyruvoyl cofactor is produced by autocatalytic rearrangement of a specific serine residues (e.g., S25 in SEQ IDs NO: 4 and 5).
  • Eukaryotic L- aspartate decarboxylases do not possess a pyruvoyl cofactor and instead possess a pyridoxal 5 '-phosphate cofactor.
  • the recombinant host cell comprises a heterologous nucleic acid encoding a bacterial L-aspartate 1 -decarboxylase and is capable of producing beta-alanine.
  • the recombinant host cell comprises a heterologous nucleic acid encoding a eukaryotic L-aspartate 1 -decarboxylase and is capable of producing beta-alanine.
  • Bacterial L-aspartate 1 -decarboxylase enzymes suitable for use in accordance with the methods of the invention include those selected from the non-limiting group consisting of Arthrobacter aurescens (UniProt ID: A1RDH3), Bacillus cereus (UniProt ID: A7GN78), Bacillus subtilis (UniProt ID: P52999; SEQ ID NO: 5), Burkholderia xenovorans (UniProt ID: Q143J3), Clostridium acetobutylicum (UniProt ID: P58285), Clostridium beijerinckii (UniProt ID: A6LWN4), Corynebacterium efficiens (UniProt ID: Q8FU86), Corynebacterium glutamicum (UniProt ID: Q9X4N0; SEQ ID NO: 4), Corynebacterium jeikeium (UniProt ID: Q4JXL3), Cupri
  • the recombinant host cell provided herein comprises a heterologous nucleic acid encoding Bacillus subtilis L-aspartate 1 -decarboxylase (SEQ ID NO: 5) and is capable of producing beta-alanine.
  • the recombinant host cell provided herein comprises a heterologous nucleic acid encoding Corynebacterium L-aspartate 1 -decarboxylase (SEQ ID NO: 4) and is capable of producing beta-alanine.
  • the invention also provides eukaryotic L-aspartate 1 -decarboxylases suitable for use in the compositions and methods of the invention.
  • Eukaryotic L-aspartate 1 -decarboxylase enzymes suitable for use in accordance with the methods of the invention include those selected from the non-limiting group consisting of Tribolium castaneum (UniProt ID: A9YVA8; SEQ ID NO: 3), Aedes aegypti (UniProt ID: Q171 S0), Drosophila mojavensis (UniProt ID: B4KIX9), and Dendroctonus ponderosae (UniProt ID: U4UTD4) L-aspartate 1 -decarboxylase.
  • Tribolium castaneum UniProt ID: A9YVA8; SEQ ID NO: 3
  • Aedes aegypti UniProt ID: Q171 S0
  • Drosophila mojavensis UniProt ID: B4KIX9
  • Dendroctonus ponderosae UniProt ID: U4UTD
  • the recombinant host cell provided herein comprises a heterologous nucleic acid encoding Tribolium castaneum L-aspartate 1 -decarboxylase (SEQ ID NO: 3) and is capable of producing beta- alanine.
  • SEQ ID NO: 3 Tribolium castaneum L-aspartate 1 -decarboxylase
  • L-aspartate 1 -decarboxylase enzymes also useful in the compositions and methods provided herein include those enzymes which are said to be “homologous" to any of the L-aspartate 1 -decarboxylase enzymes described herein.
  • Such homologs have the following characteristics: (1) is capable of catalyzing the decarboxylation of L-aspartate to beta-alanine; (2) it shares substantial sequence identity with any L-aspartate 1 -decarboxylase described herein; (3) comprises a substantial number of amino acids corresponding to highly conserved amino acids in any L-aspartate 1 -decarboxylase described herein; and (4) comprises one or more specific amino acids corresponding to strictly conserved amino acids in any L-aspartate 1 -decarboxylase described herein.
  • a homolog is said to share substantial sequence identity to an L-aspartate 1- decarboxylase if the amino acid sequence of the homolog is at least 60%, at least 70%, at least 80%), at least 90%, at least 95%, or at least 97% the same as that of a L-aspartate 1- decarboxylase amino acid sequence described herein.
  • a number of amino acids in both bacterial and eukaryotic L-aspartate 1- decarboxylase enzymes provided herein are highly conserved, and proteins homologous to either a bacterial or a eukaryotic L-aspartate dehydrogenase enzyme of the invention will generally comprise amino acids corresponding to a substantial number of highly conserved amino acids.
  • a homolog is said to comprise a substantial number of amino acids corresponding to highly conserved amino acids in a reference sequence if at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or more than 95% of the highly conserved amino acids in the reference sequence are found in the homologous protein.
  • Corynebacterium glutamicum L-aspartate 1- decarboxylase (SEQ ID NO: 4) are K9, Hl l, R12, A13, V15, T16, A18, L20, Y22, G24, S25, D29, E42, N51, G52, R54, T57, Y58, 160, G62, G65, G67, N72, G73, A74, A75, A76, G82, D83, V85, 186, Y90, E97, P103, and N112.
  • L-aspartate 1-decarboxylase enzymes homologous to Corynebacterium glutamicum L-aspartate 1-decarboxylase comprise amino acids corresponding to at least a 50% of these highly conserved amino acids.
  • L-aspartate 1 -decarboxylase enzymes homologous to Corynebacterium glutamicum L-aspartate 1 -decarboxylase comprise amino acids corresponding to at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%), or more than 95% of these highly conserved amino acids.
  • L-aspartate 1 -decarboxylase enzymes homologous to Bacillus subtilis L-aspartate 1 -decarboxylase comprise amino acids corresponding to at least a 50% of these highly conserved amino acids.
  • L- aspartate 1 -decarboxylase enzymes homologous to Bacillus subtilis L-aspartate 1 -decarboxylase comprise amino acids corresponding to at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or more than 95% of these highly conserved amino acids.
  • Tribolium castaneum L-aspartate 1- decarboxylase (SEQ ID NO: 3) are V88, P94, D102, LI 15, S126, V127, T129, H131, P132, F134, N136, Q137, L138, S140, D143, Y145, Q150, T153, D154, L156, N157, P158, S159, Y161, T162, E164, V165, P167, L171, M172, E173, E174, V176, L177, E179, M180, R181, 1183, G185, G191, G193, F195, P197, G198, G199, S200, A202, N203, G204, Y205, 1207, A210, R211, P216, K219, G222, L229, F232, T233, S234, E235, A237, H238, Y239, S240, K243, A245, F247, G249, G
  • L-aspartate 1- decarboxylase enzymes homologous to Tribolium castaneum L-aspartate 1 -decarboxylase comprise amino acids corresponding to at least a 50% of these highly conserved amino acids.
  • L-aspartate 1 -decarboxylase enzymes homologous to Tribolium castaneum L-aspartate 1 -decarboxylase comprise amino acids corresponding to at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%), or more than 95% of these highly conserved amino acids.
  • L-aspartate 1-decarboxylase enzymes provided by the invention are strictly conserved, and proteins homologous to an L-aspartate 1-decarboxylase enzyme of the invention must comprise amino acid(s) corresponding to these strictly conserved amino acids.
  • Strictly conserved amino acids in both the Bacillus subtilis L-aspartate 1- decarboxylase (SEQ ID NO: 5) and Corynebacterium glutamicum L-aspartate 1-decarobxylase (SEQ ID NO: 4) amino acid sequences are K9, G24, S25, R54, and Y58.
  • the epsilon-amine group on K9 is believed to form an ion pair with alpha-carboxyl group on L-aspartate
  • R54 is believed to form an ion pair with the gamma-carboxyl group on L-aspartate
  • Y58 is believed to donate a proton to an extended enolate reaction intermediate; thus, these three amino acids are important for L-aspartate binding and subsequent decarboxylation.
  • proteolytic cleavage between residues G24 and S25 produces an N-terminal pyruvoyl moiety also necessary for decarboxylase activity. Therefore, enzymes homologous to SEQ ID NO: 4 and/or SEQ ID 5 will comprise amino acids corresponding to K9, G24, S25, R54, and Y58 in SEQ ID NOs: 4 and/or 5.
  • Strictly conserved amino acids in the Tribolium castaneum L-aspartate 1- decarboxylase (SEQ ID NO: 3) amino acid sequence are Q137, H238, K352, and R513.
  • Q137 and R513 form a salt bridge with the gamma-carboxyl group on L-aspartate
  • H238 is a base- stacking residue with the pyridine ring of the pyridoxal 5 '-phosphate cofactor
  • K352 forms a Schiff base linkage with the pyridoxal 5 '-phosphate cofactor.
  • amino acids are important for L-aspartate or cofactor binding and subsequent L-aspartate decarboxylation, and enzymes homologous to SEQ ID NO: 3 will comprise amino acids corresponding to Q137, H238, K352, and R513 in SEQ ID NO : 3.
  • the present invention also provides consensus sequences useful in identifying and/or constructing L-aspartate dehydrogenases and L-aspartate 1 -decarboxylases suitable for use in accordance with the methods of the invention.
  • these consensus sequences comprise active site amino acid residues believed to be necessary (although the invention is not to be limited by any theory of mechanism of action) for substrate recognition and reaction catalysis, as described below.
  • a L-aspartate dehydrogenase encompassed by a L- aspartate dehydrogenase consensus sequence provided herein has an enzymatic activity that is identical, or essentially identical, or at least substantially similar with respect to ability to reduce oxaloacetate to L-aspartate to that of one of the enzymes exemplified herein.
  • a L- aspartate 1 -decarboxylase encompassed by a L-aspartate 1 -decarboxylase consensus sequence provided herein has an enzymatic activity that is identical, or essentially identical, or at least substantially similar with respect to ability to decarboxylate L-aspartate to beta-alanine to that of one of the enzymes exemplified herein.
  • Enzymes also useful in the compositions and methods provided herein include those that are homologous to consensus sequences provided by the invention. As noted above, any enzyme substantially homologous to an enzyme described herein can be used in a host cell of the invention.
  • the percent sequence identity of an enzyme relative to a consensus sequence is determined by aligning the enzyme sequence against the consensus sequence.
  • sequence alignment algorithms are suitable for aligning an enzyme with a consensus sequence. See, for example, Needleman, SB, et al "A general method applicable to the search for similarities in the amino acid sequence of two proteins.” Journal of Molecular Biology 48 (3): 443-53 (1970).
  • the percentage of positions where the enzyme possesses an amino acid (or dash) described by the same position in the consensus sequence determines the percent sequence identity.
  • An L-aspartate dehydrogenase consensus sequence (SEQ ID NO: 14) provides the sequence of amino acids in which each position identifies the amino acid (if a specific amino acid is identified) or a subset of amino acids (if a position is identified as variable) most likely to be found at a specified position in an L-aspartate dehydrogenase.
  • SEQ ID NO: 14 provides the sequence of amino acids in which each position identifies the amino acid (if a specific amino acid is identified) or a subset of amino acids (if a position is identified as variable) most likely to be found at a specified position in an L-aspartate dehydrogenase.
  • the occurrence of a dash in the aligned query protein sequence indicates an amino acid deletion in the query protein sequence relative to the consensus sequence at the indicated position.
  • the occurrence of a dash in the aligned consensus sequence indicates an amino acid addition in the query protein sequence relative to the consensus sequence at the indicated position.
  • Amino acid additions and deletions are common to proteins encompassed by consensus sequences of the invention, and their occurrence is reflected as a lower percent sequence identity (i.e., amino acid addition or deletions are treated identically to amino acid mismatches when calculating percent sequence identity).
  • L-aspartate dehydrogenase enzymes suitable for use in accordance with the methods of the invention have L-aspartate dehydrogenase activity and comprise an amino acid sequence with at least 55%, at least 60%>, at least 70%, at least 80%>, at least 90%), or at least 95% sequence identity to SEQ ID NO: 14.
  • the Pseudomonas aeruginosa L-aspartate dehydrogenase (SEQ ID NO: 1) and Cupriavidus taiwanensis L-aspartate dehydrogenase (SEQ ID NO: 2) sequences are 79% and 83%> identical to consensus sequence SEQ ID NO: 14, and are therefore encompassed by consensus sequence SEQ ID NO: 14.
  • amino acids that are highly conserved are G8, G10, Al l, 112, G13, E69, A71, G72, H73, A75, H79, P82, L84, G87, S94, G96, A97, L98, A110, Al l l, G114, L120, G123, A124, 1125, G126, D129, A130, A133, A134, G137, G138, L139, V142, Y144, G146, R147, K148, P149, W153, T156, P157, E159, D163, L164, 1173, F174, G176, A178, A181, A182, P186, K187, N188, A189, N190, V191, A192, A193, T194, A198, G199, G201, L202, T205, V207, L209, A211, D212, P213, N218, H220, A224, G226, A227
  • L-aspartate dehydrogenase enzymes homologous to SEQ ID NO: 14 comprise at least 50%, at least 60%>, at least 70%), at least 80%>, at least 85%>, at least 90%, at least 95%, or sometimes all of these highly conserved amino acids at positions corresponding to the highly conserved amino acids identified in SEQ ID NO: 14. In some embodiments, each of these highly conserved amino acids are found in a desired L-aspartate dehydrogenase, as provided in SEQ ID NOs: 1 and 2.
  • Amino acid H220 in SEQ ID NO: 14 functions as a general acid/base (although the invention is not to be limited by any theory of mechanism of action) and is necessary for enzyme activity; thus, an amino acid corresponding to H220 in consensus sequence SEQ ID NO: 14 is found in enzymes homologous to SEQ ID NO: 14. For example, the strictly conserved amino acid corresponding to H220 in consensus sequence SEQ ID NO: 14 is found in L- aspartate dehydrogenases set forth in SEQ ID NOs: 1 and 2.
  • L-aspartate 1 -decarboxylases also useful in the compositions and methods provided herein include those that are homologous to L-aspartate 1-decarboxylase consensus sequences described herein. Any L-aspartate 1-decarboxylase substantially homologous to an L- aspartate 1-decarboxylase consensus sequence described herein can be used in a host cell of the invention.
  • the invention provides two L-aspartate 1-decarboxylase consensus sequences: (i) L- aspartate 1-decarboxylase based on bacterial L-aspartate 1-decarboxylase enzymes (SEQ ID NO: 15), and (ii) L-aspartate 1-decarboxylase based on eukaryotic L-aspartate 1-decarboxylase enzymes (SEQ ID NO: 16).
  • the consensus sequences provide a sequence of amino acids in which each position identifies the amino acid (if a specific amino acid is identified) or a subset of amino acids (if a position is identified as variable) most likely to be found at a specified position in an L-aspartate dehydrogenase of that class.
  • Amino acid additions and deletions are common to proteins encompassed by consensus sequences of the invention, and their occurrence is reflected as a lower percent sequence identity (i.e., amino acid addition or deletions are treated identically to amino acid mismatches when calculating percent sequence identity).
  • the invention provides a L-aspartate 1-decarboxylase consensus sequence based on bacterial L-aspartate 1-decarboxylase enzymes (SEQ ID NO: 15), and in various embodiments, L-aspartate 1-decarboxylase enzymes suitable for use in accordance with the methods of the invention have L-aspartate 1-decarboxylase activity and comprise an amino acid sequence with at least 40%, at least 45%, at least 50%, or at least 55% sequence identity to SEQ ID NO: 15.
  • Bacillus subtilis L-aspartate 1-decarboxylase SEQ ID NO: 5
  • Corynebacterium glutamicum L-aspartate 1 -decarboxylase SEQ ID NO: 4 amino acid sequences are 55% and 79% identical to consensus sequence SEQ ID NO: 15, and are therefore encompassed by consensus sequence SEQ ID NO: 15.
  • amino acids that are highly conserved are K9, Hl l, R12, A13, V15, T16, A18, L20, Y22, G24, S25, D29, E42, N51, G52, R54, T57, Y58, 160, G62, G65, G67, N72, G73, A74, A75, A76, G82, D83, V85, 186, Y90, E97, P103, and N112.
  • L-aspartate 1 -decarboxylase enzymes homologous to SEQ ID NO: 15 comprise at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%), at least 95%, or sometimes all of these highly conserved amino acids at positions corresponding to the highly conserved amino acids identified in SEQ ID NO: 15. For example, all of the highly conserved amino acids are found in the L-aspartate 1 -decarboxylase sequences set forth in SEQ ID NOs: 4 and 5.
  • SEQ ID NO: 15 Additional strictly conserved residues in SEQ ID NO: 15 are G24 and S25, and proteolytic cleavage between G24 and S25 results in production of an N-terminal pyruvoyl moiety required for decarboxylase activity.
  • Enzymes homologous to consensus sequence SEQ ID NO: 15 comprise amino acids corresponding to all five of the strictly conserved amino acids identified in consensus sequence SEQ ID NO: 15.
  • the invention provides a second L-aspartate 1-decarboxylase consensus sequence based on eukaryotic L-aspartate 1-decarboxylase enzymes (SEQ ID NO: 16).
  • L-aspartate 1-decarboxylase enzymes suitable for use in accordance with the methods of the invention have L-aspartate 1-decarboxylase activity and comprise an amino acid sequence with at least 55%, at least 60%, at least 65%, at least 70%, or at least 75% sequence identity to SEQ ID NO: 16.
  • Tribolium castaneum L-aspartate 1-decarboxylase (SEQ ID NO: 3) amino acid sequence is 70% identical to consensus sequence SEQ ID NO: 16, and is therefore encompassed by consensus sequence SEQ ID NO: 16. [0106] In enzymes homologous to SEQ ID NO: 16, highly conserved amino acids are
  • L-aspartate 1 -decarboxylase enzymes homologous to SEQ ID NO: 16 comprise at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or sometimes all of these highly conserved amino acids at positions corresponding to the highly conserved amino acids identified in SEQ ID NO: 16. All of these highly conserved amino acids are found in the Tribolium castaneum L-aspartate 1- decarboxylases set forth in SEQ ID NO: 3.
  • Strictly conserved amino acids in the eukaryotic L-aspartate 1 -decarboxylase consensus sequence are Q179, H281, K395, and R557.
  • the function, although the invention is not to be limited by any theory of mechanism of action, of each strictly conserved amino acid is as follows.
  • Q179 and R557 form a salt bridge with the gamma-carboxyl group on L-aspartate
  • H281 is a base-stacking residue with the pyridine ring of the pyridoxal 5'- phosphate cofactor
  • K395 forms a Schiff base linkage with the pyridoxal 5 '-phosphate cofactor.
  • Enzymes homologous to consensus sequence SEQ ID NO: 16 comprise amino acids corresponding to all four strictly conserved amino acids identified in consensus sequence SEQ ID NO: 16. All four of these strictly conserved amino acids are found in the Tribolium castaneum L-aspartate 1 -decarboxylase set forth in SEQ ID NO: 3.
  • Section 3 Deletions or disruption of endogenous nucleic acids
  • the invention provides host cells genetically modified to delete or otherwise reduce the activity of endogenous proteins.
  • Specific nucleic acid sequences are partially, substantially, or completely deleted or disrupted, silenced, inactivated, or down- regulated in order to partially, substantially, or completely reduce or eliminate the activity for which they encode, as in, for example, expression or activity of an enzyme.
  • deletion or disruption with regard to a nucleic acid means that either all or part of a protein coding region, a promoter, a terminator, and/or other regulatory element is modified (such as by deletion, insertion, or mutation of nucleic acids) such that the nucleic acid no longer produces an protein, produces a reduced quantity of an protein, or produces a protein with reduced activity (e.g., reduced enzymatic activity).
  • deletion or disruption with regard to an enzyme means deletion or disruption of at least one, and often more than one, and sometimes all copies of nucleic acid(s) encoding enzymes with the specified activity.
  • Many host cells suitable for use in the compositions and methods of the invention comprise two or more endogenous nucleic acids encoding two or more enzymes with the same activity.
  • diploid, triploid, and tetraploid microbes comprise two, three, and four sets of chromosomes, respectively, and two nucleic acids encoding for two enzymes with the same enzyme activity are found on each chromosome pair.
  • gene duplication events can lead to the occurrence of two or more nucleic acids on the genome of a host cell encoding for two or more enzymes with the same activity.
  • the recombinant host cells comprise a deletion or disruption of one nucleic acid encoding an enzyme. In other embodiments, the recombinant host cells comprise a deletion or disruption of more than one nucleic acids encoding an enzyme, and sometimes all nucleic acids encoding an enzyme.
  • the recombinant host cells provided herein comprise a deletion or disruption of one or more metabolic pathways.
  • deletion or disruption with regard to a metabolic pathway means that the pathway produces a reduced quantity of one or more end-products of the metabolic pathway.
  • deletion or disruption of a metabolic pathway is accomplished by deletion or disruption of one or more nucleic acids encoding metabolic pathway enzymes.
  • the recombinant host cell comprising said deleted or disrupted metabolic pathway no longer produces the end-product of the metabolic pathway, or produces at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or more than 95% less end-product of the metabolic pathway as compared to a parental cell.
  • the nucleic acids deleted or disrupted as described herein may be endogenous to the native strain of the microorganism, and may be understood to be “native nucleic acids” or "endogenous nucleic acids”.
  • a nucleic acid is thus an endogenous nucleic acid if it has not been genetically modified or manipulated through human intervention in a manner that intentionally alters the genotype and/or phenotype of the microorganism.
  • a nucleic acid of a wild type organism may be considered to be an endogenous nucleic acid.
  • the nucleic acids targeted for deletion or disruption may be heterologous to the microorganism.
  • the recombinant host cells provided herein comprise a deletion or disruption of one or more nucleic acids encoding enzymes.
  • the host cells comprising the one or more deleted or disrupted nucleic acids no longer produce an enzyme, or produce less than 10%>, less than 25%, less than 50%, less than 75%), less than 90%, less than 95%, or less than 97% of the amount of enzyme produced by parental cells.
  • the recombinant host cells comprising the deleted or disrupted nucleic acid(s) produces the same amount of enzyme as parental cells, but the enzyme exhibits reduced activity as compared to the enzyme encoded by the unmodified nucleic acid.
  • the deleted or disrupted nucleic acid no longer encodes for an active enzyme, or encodes for an enzyme with at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or more than 90% reduced activity as compared to the enzyme encoded by the endogenous nucleic acid.
  • deletion or disruption of a nucleic acid can simultaneously result in both a decrease in the quantity of an enzyme produced by a recombinant host cell as well as a decrease in the activity of an enzyme encoded by the deleted or disrupted nucleic acid.
  • the present invention describes the engineering of a recombinant host cell to convert various endogenous anaerobic fermentation pathways into anaerobic L-aspartate, and optionally beta-alanine, pathways. Microbes will not grow under anaerobic growth conditions unless the fermentation pathway is redox balanced (i.e., there is no net accumulation of NADH, NADPH, or other redox cofactor).
  • Reduction and oxidation (redox) reactions play a key role in anaerobic metabolism, allowing the transfer of electrons from one compound to another, and thereby creating free energy for use in cellular metabolism.
  • Redox co-factors facilitate the transfer of electrons from one chemical to another within the host cell.
  • NADH and NADPH nicotinamide adenine dinucleotides
  • Fd iron sulfur protein ferredoxin
  • NADH is the most relevant co-factor in yeast cells during anaerobic catabolism of carbohydrates.
  • the redox co-factors In order for cellular growth, the redox co-factors must discharge the same number of electrons they accept; thus, the net electron accumulation in the host cell is zero. Electrons are placed onto redox co-factors during carbohydrate catabolism, and must be removed from redox co-factors during end-product formation. In order for an end-product to be produced at high yield under anaerobic conditions the type and number of redox co-factors used during carbohydrate catabolism must match the type and number of redox co-factors used during end-product formation.
  • Carbohydrate catabolism ends in the formation of pyruvate, and electrons are removed during the conversion of glyceraldehyde 3-phosphate to 1, 3 -biphosphogly cerate (providing two electrons).
  • This reaction is catalyzed by glyceraldehyde phosphate dehydrogenase (GAPDH; EC 1.2.1.12), and in yeast the endogenous enzyme uses NAD+ is used as the electron acceptor.
  • GAPDH glyceraldehyde phosphate dehydrogenase
  • GAPDH enzymes may use alternate co-factors, including NADPH; NADP-dependent GAPDH enzymes are categorized under enzyme commission number EC 1.2.1.13, and include those found in Chlamydomonas reinhardtii, Clostridium acetobutylicum, Spinacia oleracea, and Sulfolobus solfataricus, among others.
  • Host cells comprising NAD-dependent GAPDH enzymes can be engineered using standard microbial engineering techniques to express NADP-dependent GAPDH enzymes and thus produce NADPH, or a combination of NADH and NADPH, during carbohydrate catabolism to pyruvate.
  • Redox co-factors accepting electrons during catabolism of carbohydrates to pyruvate must discharge those electrons during production of the fermentation end- product to enable anaerobic growth and/or production of the end-product at high yield.
  • Microbes capable of growth under substantially anaerobic conditions comprise one or more endogenous anaerobic fermentation pathways whose activity results in the reconsumption of redox cofactors produced during carbohydrate catabolism.
  • the activity of endogenous anaerobic fermentation pathway(s) reduces the availability of redox cofactors for use by the heterologous L-aspartate pathway enzymes of the invention, thereby decreasing L-aspartate and/or beta-alanine yields from carbohydrates.
  • deletion or disruption of endogenous anaerobic fermentation pathways and nucleic acids encoding endogenous anaerobic fermentation pathway enzymes is useful for increasing the yield of L-aspartate and/or beta-alanine produced by recombinant host cells of the invention grown under substantially anaerobic conditions.
  • An anaerobic fermentation pathway is any metabolic pathway that: (i) comprises enzymes that reconsume redox cofactors produced during carbohydrate catabolism, and (ii) whose activity results in a detectable level of end-product in host cells grown under substantially anaerobic conditions.
  • Examples of anaerobic fermentation pathways include, but are not limited to, ethanol, glycerol, malate, lactate, 1-butanol, isobutanol, 1,3 -propanediol, and 1,2-propanediol anaerobic fermentation pathways.
  • ethanol is the main fermentation end-product of most wild-type microbes, and especially yeast, grown anaerobically on carbohydrate, and the redox co-factors produced during catabolism of carbohydrates to pyruvate are reconsumed during conversion of pyruvate to ethanol.
  • the endogenous fermentation pathway typically, but not limited to, an ethanol fermentation pathway, has been deleted or disrupted.
  • Redox cofactors produced during pyruvate formation from glucose are reconsumed during production of L-aspartate through the activity of an L- aspartate dehydrogenase, and the net result is a redox balanced, and thus anaerobic, fermentation pathway capable of producing L-aspartate and/or beta-alanine at high yield.
  • an ethanol fermentation pathway comprises two enzymes: pyruvate decarboxylase and alcohol dehydrogenase.
  • Pyruvate decarboxylase catalyzes the decarboxylation of pyruvate to acetaldehyde
  • alcohol dehydrogenase catalyzes the reduction of acetaldehyde to ethanol along with concomitant oxidation of NADH to NAD+ and/or NADPH to NADP+.
  • an ethanol fermentation pathway can be deleted or disrupted by deletion or disruption of one or more nucleic acids encoding pyruvate decarboxylase and/or alcohol dehydrogenase.
  • the recombinant host cells provided herein comprise a deletion or disruption of one or more endogenous nucleic acids encoding an ethanol fermentation pathway enzyme.
  • the recombinant host cells provided herein comprise a deletion or disruption of one or more nucleic acids encoding pyruvate decarboxylase.
  • the recombinant host cells provided herein comprise a deletion or disruption of one or more nucleic acids encoding alcohol dehydrogenase.
  • the recombinant host cells provided herein comprise a deletion or disruption of one or more nucleic acids encoding pyruvate decarboxylase and alcohol dehydrogenase.
  • nucleic acids encoding ethanol fermentation pathway enzymes decrease the ability of the recombinant host cell to produce ethanol and/or increases the ability of the recombinant host cell to produce L-aspartate or beta-alanine.
  • recombinant host cells comprising deletion or disruption of one or more nucleic acids encoding ethanol fermentation pathway enzymes decreases ethanol production by at least 10%, at least 25%, at least 50%, at least 60%, at least 70%, at least 90%, at least 95%, or at least 99%) as compared to parental cells that do not comprise this genetic modification.
  • recombinant host cells comprising deletion or disruption of one or more nucleic acids encoding ethanol fermentation pathway enzymes increase L-aspartate or beta-alanine production by at least 10%>, at least 25%, at least 50%, at least 75%, at least 100%>, or more than 100%) as compared to parental cells that do not comprise this genetic modification.
  • the recombinant host cells comprise a deletion or disruption of one or more nucleic acids encoding pyruvate decarboxylase.
  • one nucleic acid encoding pyruvate decarboxylase is deleted or disrupted.
  • two nucleic acids encoding pyruvate decarboxylase are deleted or disrupted.
  • more than two nucleic acids encoding pyruvate decarboxylase are deleted or disrupted.
  • all nucleic acids encoding pyruvate decarboxylase are deleted or disrupted.
  • the recombinant host cell comprises a deletion or disruption of one or more nucleic acids encoding pyruvate decarboxylases with an amino acid sequence set forth in SEQ ID NO: 9, or one or more nucleic acids encoding enzymes with an amino sequence with at least 50%, at least 60%, at least 70%, at least 80%, at least 95%, at least 97%), or at least 99% sequence identity to the amino acid sequence of SEQ ID NO: 9.
  • the recombinant host cell of the invention comprises a deletion or disruption of two nucleic acids encoding pyruvate decarboxylases with an amino acid sequence set forth in SEQ ID NO: 9, or two nucleic acids encoding enzymes with amino sequences with at least 50%, at least 60%, at least 70%, at least 80%), at least 95%, at least 97%, or at least 99% sequence identity to the amino acid sequence of SEQ ID NO: 9.
  • Some yeast cells have more than one nucleic acid encoding pyruvate decarboxylase, and in these host cells one or more nucleic acids encoding pyruvate decarboxylases may be deleted or disrupted for the purposes of deleting or disrupting the ethanol fermentation pathway.
  • wild type Saccharomyces cerevisiae has three endogenous pyruvate decarboxylases: PDC1 (SEQ ID NO: 10), PDC5, and PDC6.
  • PDC1 is the major isoform (has the highest expression level and/or activity) in S. cerevisiae while PDC5 and PDC6 are minor isoforms.
  • the recombinant host cell of the invention comprises Saccharomyces cerevisiae
  • the recombinant host cell comprises a deletion or disruption of one or more nucleic acids encoding pyruvate decarboxylases with an amino acid sequence set forth in SEQ ID NO: 10, or one or more nucleic acids encoding enzymes with amino acid sequences with at least 50%, at least 60%, at least 70%, at least 80%, at least 95%, at least 97%, or at least 99% sequence identity to the amino acid sequence of SEQ ID NO: 10.
  • S. cerevisiae pyruvate decarboxylases PDC5 and PDC6 have 88% and 84% amino acid sequence identity, respectively, to the amino acid sequence set forth in SEQ ID NO: 10.
  • a yeast ethanol fermentation pathway can be deleted or disrupted by deletion or disruption of nucleic acids encoding alcohol dehydrogenase.
  • the recombinant host cells provided herein comprise a deletion or disruption of one or more nucleic acids encoding alcohol dehydrogenase.
  • one nucleic acid encoding alcohol dehydrogenase is deleted or disrupted.
  • two nucleic acids encoding alcohol dehydrogenase are deleted or disrupted.
  • more than two nucleic acids encoding alcohol dehydrogenase are deleted or disrupted.
  • all nucleic acids encoding alcohol dehydrogenase are deleted or disrupted.
  • the recombinant host cell comprises a deletion or disruption of a nucleic acid encoding an alcohol dehydrogenase with an amino acid sequence set forth in SEQ ID NO: 11, or with at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or greater than 97% sequence identity to SEQ ID NO: 11.
  • the recombinant host cell of the invention comprises a deletion or disruption of two nucleic acids encoding alcohol dehydrogenase with an amino acid sequence set forth in SEQ ID NO: 11, or two nucleic acids encoding enzymes with amino sequences with at least 50%, at least 60%, at least 70%), at least 80%, at least 95%, at least 97%, or at least 99% sequence identity to the amino acid sequence of SEQ ID NO: 11.
  • a malate fermentation pathway comprises one enzyme, malate dehydrogenase
  • deletion or disruption of a malate fermentation pathway is useful for increasing L-aspartate or beta-alanine production in recombinant host cells of the invention grown under substantially anaerobic conditions.
  • a malate fermentation pathway can be deleted or disrupted by deletion or disruption of nucleic acids encoding malate dehydrogenase.
  • the recombinant host cells comprise a deletion or disruption of one or more nucleic acids encoding malate dehydrogenase.
  • one nucleic acid encoding malate dehydrogenase is deleted or disrupted.
  • two nucleic acids encoding malate dehydrogenase are deleted or disrupted.
  • more than two nucleic acids encoding malate dehydrogenase are deleted or disrupted.
  • all nucleic acids encoding malate dehydrogenase are deleted or disrupted.
  • the recombinant host cell comprises a deletion or disruption of one or more nucleic acids encoding malate dehydrogenase with an amino acid sequence set forth in SEQ ID NO: 13, or one or more nucleic acids encoding enzymes with an amino sequence with at least 50%, at least 60%>, at least 70%, at least 80%>, at least 95%, at least 97%), or at least 99% sequence identity to the amino acid sequence of SEQ ID NO: 13.
  • the recombinant host cell of the invention comprises a deletion or disruption of two nucleic acids encoding malate dehydrogenase with an amino acid sequence set forth in SEQ ID NO: 13, or two nucleic acids encoding enzymes with amino sequences with at least 50%, at least 60%, at least 70%, at least 80%), at least 95%, at least 97%, or at least 99% sequence identity to the amino acid sequence of SEQ ID NO: 13.
  • additional byproducts are formed by host cells of the invention, including glycerol, acetic acid, and various four-carbon dicarboxylic acids (e.g., fumarate and succinate). Deletion or disruption of these byproduct metabolic pathways and nucleic acids encoding byproduct metabolic pathway enzymes are also useful for increasing L- aspartate or beta-alanine production by host cells of the invention.
  • recombinant host cells provided herein comprise a deletion or disruption of a glycerol fermentation pathway.
  • a glycerol fermentation pathway comprises one enzyme, NAD-dependent glycerol-3 -phosphate dehydrogenase (EC 1.1.1.8), which catalyzes the formation of glycerol (the end-product of a glycerol metabolic pathway) from glycerol-3 -phosphate along with concomitant oxidation of NADH to NAD+.
  • Glycerol fermentation pathway activity decreases the pool of NADH available for use L-aspartate dehydrogenase in the production of L-aspartate from oxaloacetate in recombinant host cells of the invention grown under substantially anaerobic conditions.
  • deletion or disruption of a glycerol fermentation pathway is useful for increasing L-aspartate or beta-alanine production in recombinant host cells of the invention.
  • a glycerol metabolic pathway can be deleted or disrupted by deletion or disruption of nucleic acids encoding NAD-dependent glycerol-3- phosphate dehydrogenase.
  • the recombinant host cells comprise a deletion or disruption of one or more nucleic acids encoding NAD-dependent glycerol-3 -phosphate dehydrogenase.
  • one nucleic acid encoding NAD-dependent glycerol-3 - phosphate dehydrogenase is deleted or disrupted.
  • two nucleic acids encoding NAD-dependent glycerol-3 -phosphate dehydrogenase are deleted or disrupted.
  • more than two nucleic acids encoding NAD-dependent glycerol-3 -phosphate dehydrogenase are deleted or disrupted.
  • all nucleic acids encoding NAD-dependent glycerol-3 -phosphate dehydrogenase are deleted or disrupted.
  • the recombinant host cell comprises a deletion or disruption of one or more nucleic acids encoding NAD-dependent glycerol-3 -phosphate dehydrogenase with an amino acid sequence set forth in SEQ ID NO: 12, or one or more nucleic acids encoding enzymes with an amino sequence with at least 50%, at least 60%, at least 70%, at least 80%), at least 95%, at least 97%, or at least 99% sequence identity to the amino acid sequence of SEQ ID NO: 12.
  • the recombinant host cell of the invention comprises a deletion or disruption of two nucleic acids encoding NAD-dependent glycerol-3 -phosphate dehydrogenase with an amino acid sequence set forth in SEQ ID NO: 12, or two nucleic acids encoding enzymes with amino sequences with at least 50%, at least 60%, at least 70%, at least 80%, at least 95%, at least 97%, or at least 99% sequence identity to the amino acid sequence of SEQ ID NO: 12.
  • the invention provides host cells genetically modified to express heterologous nucleic acids encoding enzymes enabling energy efficient L-aspartic acid production.
  • "Energy efficient”, as defined herein, refers to production of L-aspartic acid with a lower ATP requirement as compared to a parental, or control strain. Decreasing the expenditure of ATP is important aspect of L-aspartate production under substantially anaerobic conditions. If host cell ATP requirements become sufficiently high, additional oxygen must be provided to the culture to support L-aspartate production.
  • Two enzymes useful for increasing the energy efficiency of L-aspartate production in genetically modified host cells of the invention are ureases (EC 3.5.1.5) and L-aspartate permeases.
  • Ammonia is a co-substrate necessary for L-aspartate production using an L- aspartate dehydrogenase and a nitrogen source must be provided to the fermentation for L- aspartate production.
  • Two commonly used nitrogen sources for fermentative production of small-molecule products are ammonia and urea.
  • Urea is the preferred source of nitrogen as compared to ammonia for at least three reasons. First, urea is non-toxic and can be added at high concentrations; by comparison, ammonia, another commonly used nitrogen source in industry, is basic and high concentrations are toxic to many host cells.
  • urea is neutrally charged, can diffuse across the host cell plasma membrane (i.e., no energy is expended for transport), and the fermentation pH is unaffected by its addition to the fermentation medium. By comparison, ammonia charged and must be transported into the cell enzymatically. Third, the breakdown of urea also releases C0 2 , a co-substrate for enzymes in all L-aspartate biosynthetic pathways. No CO 2 is released during catabolism of ammonia.
  • Urease enzymes catalyze the hydrolysis of one molecule urea to one molecule carbamate and one molecule ammonia; subsequent to enzymatic production, the one molecule carbamate then degrades into a ammonia and carbonic acid.
  • urease activity results in production of two molecules urea and one molecule carbon dioxide per catalytic cycle.
  • urease performs this reaction without expenditure of ATP.
  • alternative metabolic pathways capable of catalyzing conversion of urea to ammonia and carbon dioxide do require expenditure of ATP.
  • many host cells including many yeast host cells, use a urea catabolic pathway comprising the enzymes urea carboxylase and allophenate hydrolase; using this pathway, one molecule ATP is expended per molecule urea catabolized.
  • host cells engineered for production of L-aspartate express heterologous nucleic acids encoding a urease.
  • the expressed urease is a Schizosaccharomyces pombe urease.
  • the Schizosaccharomyces pombe urease is comprised of four protein subunits, namely Ure2, UreD, UreF, and UreG proteins.
  • the Schizosaccharomyces pombe urease also uses nickel metal as a cofactor and in some embodiments the engineered host cell expresses one or more heterologous genes encoding a nickel transporter.
  • One suitable nickel transporter protein is the Schizosaccharomyces pombe Nicl nickel-transporter.
  • L-aspartate transport protein suitable for L-aspartate export in engineered host cells of the invention is Arabidopsis thaliana SIAR1 and its homologs.
  • Another suitable L- aspartate transport protein is Arabidopsis thaliana bidirectional amino acid transporter 1 (BAT1) Section 5.
  • methods are provided herein for producing L-aspartate or beta- alanine by recombinant host cells of the invention.
  • these methods comprise the steps of: (a) culturing a recombinant host cell described herein in a medium containing at least one carbon source and one nitrogen source under substantially anaerobic conditions such that L-aspartate is produced; and (b) recovering said L-aspartate from the medium.
  • these methods comprise the steps of: (a) culturing a recombinant host cell described herein in a medium containing at least one carbon source and one nitrogen source under aerobic conditions such that L-aspartate is produced; and (b) recovering said L- aspartate from the medium.
  • these methods comprise the steps of: (a) culturing a recombinant host cell described herein in a medium containing at least one carbon source and one nitrogen source under substantially anaerobic conditions such that beta-alanine is produced; and (b) recovering said beta-alanine from the medium.
  • the L-aspartate or beta-alanine can be secreted into the culture medium.
  • any of the one or more heterologous nucleic acids can be introduced into a host cell to produce a recombinant host cell of the invention.
  • the heterologous nucleic acids can be introduced so as to confer a L-aspartate fermentation pathway onto the host cell.
  • the recombinant host cell may further comprise heterologous nucleic acids encoding L-aspartate 1 -decarboxylase so as to confer the ability for the recombinant host cell to produce beta-alanine.
  • heterologous nucleic acids can be introduced to produce an intermediate host cell having the biosynthetic capability to catalyze some of the required metabolic reactions to confer L-aspartate or beta-alanine biosynthetic capability.
  • any of the recombinant host cells described herein can be cultured to produce and/or secrete L-aspartate or beta-alanine.
  • recombinant host cells producing L- aspartate can be cultured for the biosynthetic production of L-aspartate.
  • the L-aspartate can be isolated or treated as described below to produce beta-alanine or polyL-aspartate.
  • recombinant host cells producing beta-alanine can be cultured for the biosynthetic production of beta-alanine.
  • beta-alanine can be isolated and subjected to further treatments for the chemical synthesis of beta-alanine family of compounds, including, but not limited to, pantothenic acid, beta-alanine alkyl esters (e.g., beta-alanine methyl ester, beta-alanine ethyl ester, beta-alanine propyl ester, and the like), and poly(beta-alanine).
  • beta-alanine alkyl esters e.g., beta-alanine methyl ester, beta-alanine ethyl ester, beta-alanine propyl ester, and the like
  • poly(beta-alanine) e.g., poly(beta-alanine).
  • the methods of producing L-aspartate or beta-alanine provided herein may be performed in a suitable fermentation broth in a suitable fermentation vessel, including but not limited to a culture plate, a flask, or a fermentor. Further, the methods of the invention can be performed at any scale of fermentation known in the art to support industrial production of microbially produced small-molecules. Any suitable fermentor may be used including a stirred tank fermentor, an airlift fermentor, a bubble column fermentor, a fixed bed bioreactor, or any combination thereof.
  • the fermentation broth is any fermentation broth in which a recombinant host cell capable of producing L-aspartate or beta-alanine can subsist (maintain growth and/or viability).
  • the fermentation broth is an aqueous medium comprising assimilable carbon, nitrogen, and phosphate sources. Such a medium can also include appropriate salts, minerals, metals, and other nutrients.
  • the carbon source and each of the essential cell nutrients are provided to the fermentation broth incrementally or continuously, and is essential cell nutrient is maintained at essentially the minimum level required for efficient assimilation by growing cells.
  • culturing of the cells provided herein to produce L- aspartate or beta-alanine may be divided up into phases.
  • the cell culture process may be divided up into a growth phase, a production phase, and/or a recovery phase.
  • the following paragraphs provide examples of specific conditions that may be used for these phases.
  • One skilled in the art will recognize that these conditions may be varied based on the host cell used, the desired L-aspartate or beta-alanine yield, titer, and/or productivity, or other factors.
  • Carbon source The carbon source provided to the fermentation can be any carbon source that can be fermented by the host cell. Suitable carbon sources include, but are not limited to, monosaccharides, disaccharides, polysaccharides, acetate, ethanol, methanol, methane, or one or more combinations thereof. Exemplary monosaccharides suitable for use in accordance to the methods of the invention include, but are not limited to, dextrose, fructose, galactose, xylose, arabinose, and combinations thereof. Exemplary disaccharides suitable for use in accordance to the methods of the invention include, but are not limited to, sucrose, lactose, maltose, trehalose, cellobiose, and combinations thereof.
  • Exemplary polysaccharides suitable for use in accordance to the methods of the invention include, but are not limited to, starch, glycogen, cellulose, and combinations thereof.
  • the carbon source is dextrose. In other embodiments, the carbon source is sucrose.
  • Nitrogen Every molecule of L-aspartate or beta-alanine comprises nitrogen atom, and in order to produce L-aspartate or beta-alanine at a high yield, a suitable source of assimilable nitrogen must be provided to the fermentation during host cell cultivation.
  • assimilable nitrogen refers to nitrogen that is capable of being metabolized by the host cell of the invention and used in produce L-aspartate.
  • the nitrogen source may be any assimilable nitrogen source that can be utilized by the host cell, including, but not limited to, anhydrous ammonia, ammonium sulfate, ammonium nitrate, diammonium phosphate, monoammonium phosphate, ammonium polyphosphate, sodium nitrate, urea, peptone, protein hydrolysates, and yeast extract.
  • the nitrogen source is anhydrous ammonia.
  • the nitrogen source is ammonium sulfate.
  • the nitrogen source is urea.
  • the mols assimilable nitrogen is dependent on the nitrogen source, and, for example, one mol of anhydrous ammonia ( H3) comprises 1 mol assimilable nitrogen while one mol of diammonium phosphate ( H 4 ) 2 P0 4 comprises 2 mols assimilable nitrogen.
  • a minimum amount of assimilable nitrogen must be provided to the fermentation during host cell cultivation to achieve high L-aspartate or beta-alanine yields.
  • the carbon source is dextrose
  • the molar ratio of assimilable nitrogen to dextrose provided to the fermentation during host cell cultivation is at least 0.25 : 1, at least 0.5 : 1, at least 0.75 : 1, 1 : 1, at least 1.25 : 1, at least 1.5 : 1, at least 1.75 : 1, at least 2: 1, or greater than 2: 1.
  • the molar ratio of assimilable nitrogen to sucrose is at least 0.1 : 1, at least 0.2: 1, at least 0.3 : 1, at least 0.4: 1, at least 0.5 : 1, at least 0.6: 1, at least 0.7: 1, at least 0.8: 1, at least 0.9: 1, at least 1 : 1, or greater than 1 : 1.
  • the pH of the culture medium can be controlled by the addition of acid or base to the culture medium.
  • the pH is maintained from about 3.0 to about 8.0.
  • Aspartic acid exhibits a relatively low solubility in water and will crystallize from solution. Only about 6 g/1 aspartic acid is soluble at 30°C. Crystallization occurs when the concentration of the fully protonated, aspartic acid, form of L-aspartate increases to above the solubility limit. It is advantageous to crystallize aspartic acid during the fermentation for several reasons. First, crystallization provides an aspartic acid sink, enabling a high concentration gradient to be maintained across the cell membrane and helping to increase the kinetics of product export outside the host cell. Second, the L-aspartic acid that has crystallized from solution in the fermentation can be more readily separated from the majority of the cells and fermentation broth, accomplishing a purification step.
  • the majority of the L-aspartate is in the insoluble, crystallized form (i.e. crystallized aspartic acid) prior to purification.
  • the majority of the L-aspartate is in the insoluble, crystallized form (i.e. crystallized aspartic acid) prior to purification.
  • greater than about 50 g/1 aspartic acid is in an insoluble, crystallized form prior to purification of the aspartic acid from the fermentation broth. More preferably, greater than about 75 g/1 of aspartic acid produced is an insoluble, crystallized form prior to purification of the aspartic acid from the fermentation broth.
  • the pH of the fermentation should be decreased to below pH 3.86, the pKa of aspartic acid R-chain, prior to L-aspartate purification.
  • the broth pH can be decreased during the fermentation (i.e., while the host cells are producing aspartic acid), and/or the broth pH can be decreased at the conclusion of the fermentation.
  • the broth pH can be decreased due to endogenous production of aspartic acid, and/or the broth pH can be decreased due to supplementation of an acid to the fermentation.
  • suitable acids include aspartic acid, acetic acid, hydrochloric acid, and sulfuric acid.
  • the temperature of the fermentation broth can be any temperature suitable for growth of the recombinant host cells and/or production of L-aspartate or beta- alanine.
  • the fermentation broth is maintained at a temperature in the range of from about 20° C to about 45° C, preferably in the range of from about 25° C to about 37° C, and more preferably in the range from about 28° C to about 32° C.
  • Oxygen During cultivation, aeration and agitation conditions are selected to produce a desired oxygen uptake rate. In various embodiments, conditions are selected to produce an oxygen uptake rate of around 0-25 mmol/l/hr. In some embodiments conditions are selected to produce an oxygen uptake rate of around 2.5-15 mmol/l/hr.
  • Oxygen uptake rate as used herein refers to the volumetric rate at which oxygen is consumed during the fermentation. Inlet and outlet oxygen concentrations can be measured with exhaust gas analysis, for example by mass spectrometers. Oxygen uptake rate can be calculated by one of ordinary skill in the art using the Direct Method described in Bioreaction Engineering Principles 3 rd Edition, 2011, Spring Science + Business Media, p. 449.
  • L-aspartate or beta-alanine under substantially anaerobic conditions they are capable of producing L-aspartate or beta-alanine under a range of oxygen concentrations.
  • the L-aspartate pathways produce L-aspartate or beta-alanine under aerobic conditions.
  • the L-aspartate pathways produce L-aspartate or beta- alanine under substantially anaerobic conditions.
  • a high yield of either L-aspartate or beta-alanine from the provided carbon and nitrogen source(s) is desirable in order to decrease the production cost.
  • yield is calculated as the percentage of the mass of carbon source catabolized by host cells of the invention and used to produce either L-aspartate or beta-alanine.
  • only a fraction of the carbon source provided to a fermentation is catabolized by host the cells, and the remainder is found unconsumed in the fermentation broth or is consumed by contaminating microbes in the fermentation.
  • the beta-alanine yield is 27.7% (i.e., 10 grams beta-alanine from 90 grams glucose).
  • the final yield of L-aspartate on the carbon source is at least 10%>, at least 20%, at least 30%>, at least 40%), at least 50%, or greater than 50%.
  • the host cells provided herein are capable of producing at least 80%>, at least 85%>, or at least 90% by weight of carbon source to L-aspartate.
  • the final yield of beta-alanine on the carbon source is at least 10%, at least 20%, at least 30%, at least 40%, at least 50%), or greater than 50%.
  • the host cells provided herein are capable of producing at least 80%, at least 85%, or at least 90% by weight of carbon source to beta-alanine.
  • the titer, or concentration, of L-aspartate or beta-alanine produced in the fermentation is another important metric for decreasing production, and, assuming all other metrics are equal, a higher titer is preferred as compared to a lower titer.
  • titer is provided as grams product (e.g., L-aspartate or beta-alanine) produced per liter of fermentation broth (i.e., g/1).
  • the L-aspartate titer is at least 1 g/1, at least 5 g/1, at least 10 g/1, at least 15 g/1, at least 20 g/1, at least 25 g/1, at least 30 g/1, at least 40 g/1, at least 50 g/1, at least 60 g/1, at least 70 g/1, at least 80 g/1, at least 90 g/1, at least 100 g/1, or greater than 100 g/1 at some point during the fermentation, and preferably at the conclusion of the fermentation.
  • the beta-alanine titer is at least 1 g/1, at least 5 g/1, at least 10 g/1, at least 15 g/1, at least 20 g/1, at least 25 g/1, at least 30 g/1, at least 40 g/1, at least 50 g/1, at least 60 g/1, at least 70 g/1, at least 80 g/1, at least 90 g/1, at least 100 g/1, or greater than 100 g/1 at some point during the fermentation, and preferably at the conclusion of the fermentation.
  • productivity is important for decreasing production cost, and, assuming all other metrics are equal, a higher productivity is preferred over a lower productivity.
  • productivity is provided as grams product produced per liter of fermentation broth per hour (i.e., g/l/hr).
  • the L-aspartate productivity is at least 0.1 g/1, at least 0.25 g/1, at least 0.5 g/1, at least 0.75 g/1, at least 1.0 g/1, at least 1.25 g/1, at least 1.25g/l, at least 1.5 g/1, or greater than 1.5 g/1 over some time period during the fermentation.
  • the beta-alanine productivity is at least 0.1 g/1, at least 0.25 g/1, at least 0.5 g/1, at least 0.75 g/1, at least 1.0 g/1, at least 1.25 g/1, at least 1.25g/l, at least 1.5 g/1, or greater than 1.5 g/1 over some time period during the fermentation.
  • Byproducts that can occur during production of L-aspartate or beta-alanine producing host cells in accordance with the methods of the invention include ethanol, acetate, and pyruvate.
  • the recombinant host cells produce ethanol at a low yield from the provided carbon source.
  • ethanol may be produced at a yield of 10% or less, and preferably at a yield of 5% or less at the conclusion of the fermentation.
  • the recombinant host cells produce acetate at a low yield from the provided carbon source.
  • acetate may be produced at a yield of 10% or less, and preferably at a yield of 5% or less at the conclusion of the fermentation.
  • the recombinant host cells produce pyruvate at a low yield from the provided carbon source.
  • pyruvate may be produced at a yield of 10% or less, and preferably at a yield of 5% or less at the conclusion of the fermentation.
  • Fermentation procedures are particularly useful for the biosynthetic production of commercial quantities of L-aspartate and/or beta-alanine. Fermentation procedures can be scaled up for manufacturing of L-aspartate or beta-alanine. Exemplary fermentation procedures include, for example, fed-batch fermentation and batch product separation; fed-batch fermentation and continuous product separation; batch fermentation and batch product separation; and continuous fermentation and continuous product separation. All of these processes are well known in the art.
  • the recombinant host cells and methods of the invention can also be utilized in various combinations with each other and with other microbes and methods known in the art to achieve product biosynthesis by other routes.
  • one alternative to product beta-alanine other than the use of L-aspartate producing host cell of the invention and chemical conversion or other than the use of a beta-alanine producing host cell of the invention is through addition of a second microbe capable of converting L-aspartate to beta-alanine.
  • One such procedure includes, for example, the cultivation of a L-aspartate producing host cell of the invention to produce L-aspartate as described herein.
  • the L-aspartate can then be used as a substrate for a second microbe that converts L-aspartate to beta-alanine.
  • the L-aspartate can be added directly to another culture of the second microbe, or the L- aspartate producing microbes in the original culture can be removed by, for example, cell separation and the second microbe capable of producing beta-alanine from L-aspartate added to the culture in a sufficient amount to enable production of beta-alanine from the L-aspartate in the fermentation broth.
  • Example 1 Construction of engineered Pichia kudriavzevii strains expressing L-aspartate dehydrogenases, and their use in the production of L-aspartate in yeast
  • Nucleic acids encoding different L-aspartate dehydrogenases were codon-optimized for yeast, synthesized, and integrated into the Pichia kudriavzevii genome; in vivo expression of the L-aspartate dehydrogenases resulted in production of L-aspartate.
  • Codon optimized DNA encoding for each L- aspartate dehydrogenase was first synthesized by a commercial DNA synthesis company (e.g. , Gen9, Inc.). The synthetic DNA was then amplified by PCR using primers to add DNA sequences aiding molecular cloning of the DNA into expression constructs.
  • the primers used were as follows (listed as UniProt ID for the protein encoded by the template DNA, forward primer name and sequence, reverse primer name and sequence): Q9HYA4 encoding template DNA, YO1504 forward primer (5'- CACAAACAAACACAATTACAAAAAATGTTGAATATCGTTATGATTGGTTG-3 ' ) and YO 1505 reverse primer (5 '- GAGTATGGATTTTACTGGCTGGATTAAATAGAGATAGCGTGAGCATG); B3R8S4 encoding template DNA, YO 1506 forward primer (5 '- CACAAACAAACACAATTACAAAAAATGTTGCACGTTTCTATGGTTGG-3 ') and YO 1507 reverse primer (5 '- GAGTATGGATTTTACTGGCTGGATTAGATAGAAACGGCGTGGG-3 ' ) ; Q8XRV9 encoding template DNA, YO 1508 forward primer (5 '-
  • the resulting DNA fragments were purified and cloned downstream of the P. kudriavzevii TDHl promoter and upstream of the S. cerevisiae GRE3 terminator, which are flanked in 5' by 473 bp of sequence upstream of the P. kudriavzevii Adh6c gene and in 3' by a non-functional portion of the Ura3 selection marker, in a plasmid vector containing the ampicillin resistance cassette and the pUC origin of replication using conventional molecular cloning methods.
  • the resulting plasmids were transformed into E. coli competent host cells and selected on LB agar plates containing Amp 100 .
  • P. kudriavzevii strain LPK15434 was used as the background strain for genomic integration of the L-aspartate dehydrogenase expression constructs.
  • LPK15434 is a uracil auxotroph generated from wild type Pichia kudriavzevii through deletion of the URA3 gene.
  • the plasmids encoding the various L-aspartate dehydrogenase expression cassettes (s393-405) were first digested with restriction enzyme Mssl to release the linear integration cassette and co- transformed into the host strains with Mssl-digested s376 using standard procedures and selected on defined agar medium lacking uracil. After 3 days incubation at 30°C, uracil prototroph transformants were re-streaked on selective medium lacking uracil, and correct integration of the L-aspartate dehydrogenase expression cassettes was confirmed by PCR.
  • PCR verified transformants (2-6 for each strain) were inoculated in a 96-well plate containing 0.5 ml of medium (YNB, 2% glucose, 100 mM citrate buffer pH 5.0) along with control strain LPK15419 and grown at 30°C for 3 days, shaking at 300 rpm with 50 mm throw in an incubator maintained at 80% r.h.
  • Control strain LPK15419 is identical to LPK15434 with the exception that the URA3 gene has not been deleted. After 3 days, the cultures were pelleted and the medium supernatant was filtered on a 0.2 micron PVDF membrane and stored at 4°C until analysis.
  • control strain LPK15419 did not produce a detectable amount of L-aspartate.
  • LPK15434 background engineered for expression of L-aspartate dehydrogenase proteins a detectable level of L-aspartate was measured.
  • L-aspartate dehydrogenase proteins resulted in the indicate amount of L-aspartate (mean +/- standard deviation): Q9HYA4, 13 ⁇ 2 mg/L; B3R8S4, 9 ⁇ 0 mg/L; Q8XRV9, 13 ⁇ 3 mg/L; Q126F5, 13 ⁇ 1 mg/L; Q2T559, 11 ⁇ 1 mg/L; Q3JFK2, 15 ⁇ 2 mg/L; A6X792, 13 ⁇ 3 mg/L; D6JRV1, 13 ⁇ 4 mg/L; A6TDT8, 12 ⁇ 1 mg/L; A8LLH8, 11 ⁇ 2 mg/L; Q5LPG8, 14 ⁇ 1 mg/L; D0IX49, 12 ⁇ 2 mg/L; and Q46VA0, 10 ⁇ 2 mg/L.
  • SEQ ID NO: 1 Pseudomonas aeruginosa L-aspartate dehydrogenase.
  • SEQ ID NO: 7 Aspergillus oryzae pyruvate carboxylase amino acid sequence.
  • SEQ ID NO: 8 Escherichia coli phosphoenolpyruvate carboxylase amino acid sequence.
  • SEQ ID NO: 10 Saccharomyces cerevisiae PDCl .
  • SEQ ID NO: 17 Ralstonia solanacearum L- aspartate dehydrogenase.
  • SEQ ID NO: 20 Burkholderia pseudomallei L-aspartate dehydrogenase.
  • SEQ ID NO: 21 Ochrobactrum anthropi L-aspartate dehydrogenase.
  • SEQ ID NO: 22 Acinetobacter sp. SH024 L-aspartate dehydrogenase.
  • SEQ ID NO: 23 Klebsiella pneumoniae L-aspartate dehydrogenase.
  • SEQ ID NO: 24 Dinoroseobacter shibae L-aspartate dehydrogenase.
  • SEQ ID NO: 25 Ruegeria pomeroyi L-aspartate dehydrogenase.
  • SEQ ID NO: 26 Comamonas testosteroni L-aspartate dehydrogenase.
  • SEQ ID NO: 27 Cupriavidus pinatubonensis L-aspartate dehydrogenase.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Plant Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

Recombinant host cells, materials, and methods for the biological production of L-aspartate and/or beta-alanine under substantially anaerobic conditions.

Description

RECOMBINANT HOST CELLS AND METHODS FOR THE ANAEROBIC PRODUCTION OF L-ASPARTATE AND BETA-ALANINE
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] The present application claims priority to U.S. Provisional Patent Application
Serial No. 62/254,635, filed on November 12, 2015, and entitled "RECOMBINANT HOST CELLS AND METHODS FOR THE ANAEROBIC PRODUCTION OF L-ASPARTATE AND BETA-ALANINE," the complete disclosure of which is expressly incorporated by reference herein.
GOVERNMENT INTEREST
[0002] This invention was made with government support under award number DE-
EE0007565 awarded by the United States Department of Energy. The government has certain rights in the invention.
BACKGROUND OF THE INVENTION
[0003] The long-term economic and environmental concerns associated with the petrochemical industry has provided the impetus for increased research, development, and commercialization of processes for conversion of carbon feedstocks into chemicals that can replace those derived from petroleum feedstocks. One approach is the development of biorefining processes to convert renewable feedstocks into products that can replace petroleum- derived chemicals. Two common goals in improving a biorefining process include achieving a lower cost of production and reducing carbon dioxide emissions.
[0004] Aspartic acid ("L-aspartate", CAS No. 56-84-8) is currently produced from fumaric acid, a non-renewable, petroleum-derived chemical feedstock. Likewise, beta-alanine (CAS No. 107-96-9) is produced from acrylamide, another non-renewable, petroleum feedstock.
[0005] The current, preferred route for industrial synthesis of L-aspartate and L- aspartate-derived compounds is based on fumaric acid. For example, an enzymatic process in which L-aspartate ammonia lyase catalyzes the formation of L-aspartate from fumaric acid and ammonia (see "Amino Acids," In: Ullmann's Encyclopedia of Industrial Chemistry, Wiley - VCH, Weinheim, New York (2002)).
[0006] The existing, petrochemical-based production routes to L-aspartate and beta- alanine are environmentally damaging, dependent on non-renewable feedstocks, and costly. Thus, there remains a need for methods and materials for biocatalytic conversion of renewable feedstocks into L-aspartate and/or beta-alanine and purification of biosynthetic L-aspartate and/or beta-alanine. SUMMARY OF THE INVENTION
[0007] In a first aspect, the present invention provides a recombinant host cell capable of producing L-aspartate or beta-alanine under substantially anaerobic conditions, the host cell comprising one or more heterologous nucleic acids encoding a L-aspartate pathway enzyme and optionally (in the case of beta-alanine producing host cells) a L-aspartate 1 -decarboxylase. In one embodiment, the recombinant host cell has been engineered to produce L-aspartate or beta- alanine under substantially anaerobic conditions.
[0008] Any suitable host cell may be used in practice of the methods of the present invention, and exemplary host cells useful in the compositions and methods provided herein include archaeal, prokaryotic, or eukaryotic cells. In an important embodiment, the recombinant host cell is a yeast cell. In certain embodiments, the recombinant yeast cells provided herein are engineered by the introduction of one or more genetic modifications (including, for example, heterologous nucleic acids encoding enzymes and/or disruption or deletion of native nucleic acids encoding enzymes) into a Crabtree-negative yeast cell. In certain of these embodiments, the host cell belongs to the Pichia/Issatchenkia/Saturnispora/Dekkera clade. In certain of these embodiments, the host cell belongs to the genus selected from the group consisting of Pichia, Issatchenkia, or Candida. In certain embodiments, the host cell belongs to the genus Pichia, and in some of these embodiments the host cell is Pichia kudriavzevii.
[0009] Provided herein in certain embodiments are recombinant host cells having at least one active L-aspartate pathway from phosphoenolpyruvate or pyruvate to L-aspartate. In some embodiments wherein the host cell produces beta-alanine, the recombinant host cell further expresses an L-aspartate 1 -decarboxylase. In certain embodiments, the recombinant host cells provided herein have a L-aspartate pathway that proceeds via phosphoenolpyruvate or pyruvate, and oxaloacetate intermediates. In many embodiments, the recombinant host cell comprises one or more heterologous nucleic acids encoding one or more L-aspartate pathway enzymes selected from the group consisting of phosphoenolpyruvate carboxylase, pyruvate carboxylase, phosphoenolpyruvate carboxykinase, and L-aspartate dehydrogenase wherein the heterologous nucleic acid is expressed in sufficient amounts to produce L-aspartate under substantially anaerobic conditions. In other embodiments, the recombinant host cell comprises one or more heterologous nucleic acids encoding one or more L-aspartate pathway enzymes selected from the group consisting of phosphoenolpyruvate carboxylase, pyruvate carboxylase, phosphoenolpyruvate carboxykinase, and L-aspartate dehydrogenase wherein the heterologous nucleic acid is expressed in sufficient amounts to produce L-aspartate under aerobic conditions. In one embodiment, the recombinant host cell comprises one or more heterologous nucleic acids encoding one or more L-aspartate pathway enzymes selected from the group consisting of pyruvate carboxylase and L-aspartate dehydrogenase wherein the heterologous nucleic acid is expressed in sufficient amounts to produce L-aspartate under substantially anaerobic conditions. In one embodiment, the recombinant host cell comprises one or more heterologous nucleic acids encoding one or more L-aspartate pathway enzymes selected from the group consisting of pyruvate carboxylase and L-aspartate dehydrogenase wherein the heterologous nucleic acid is expressed in sufficient amounts to produce L-aspartate under aerobic conditions. In certain embodiments, the cell further comprises a heterologous nucleic acid encoding an L-aspartate 1- decarboxylase wherein said heterologous nucleic acid is expressed in sufficient amounts to produce beta-alanine under substantially anaerobic conditions.
[0010] In some embodiments, the recombinant host cell provided herein comprises a heterologous nucleic acid encoding a L-aspartate dehydrogenase. In certain embodiments, the recombinant host cell provided herein comprises a heterologous nucleic acid encoding Pseudomonas aeruginosa L-aspartate dehydrogenase (SEQ ID NO: 1) and is capable of producing L-aspartate and/or beta-alanine. In other embodiments, the recombinant host cell provided herein comprises a heterologous nucleic acid encoding Cupriavidus taiwanensis L- aspartate dehydrogenase (SEQ ID NO: 2) and is capable of producing L-aspartate and/or beta- alanine.
[0011] In various embodiments, the recombinant host cell further comprises a heterologous nucleic acid encoding an L-aspartate 1 -decarboxylase and is capable of producing beta-alanine where cultured under suitable conditions. A L-aspartate 1 -decarboxylase as used herein refers to any protein with L-aspartate decarboxylase activity, meaning the ability to catalyze the decarboxylation of L-aspartate to beta-alanine. In various embodiments, the recombinant host cell provided herein comprises one or more heterologous nucleic acid encoding a L-aspartate 1 -decarboxylase selected from the group consisting of Bacillus subtilis L-aspartate 1 -decarboxylase (SEQ ID NO: 5), Corynebacterium L-aspartate 1 -decarboxylase (SEQ ID NO: 4), and/or Tribolium castaneum L-aspartate 1 -decarboxylase (SEQ ID NO: 3) and is capable of producing beta-alanine. [0012] In various embodiments, L-aspartate dehydrogenase enzymes suitable for use in accordance with the methods of the invention have L-aspartate dehydrogenase activity and comprise an amino acid sequence with at least 55%, at least 60%>, at least 70%, at least 80%>, at least 90%), or at least 95% sequence identity to SEQ ID NO: 14. In various embodiments, L- aspartate 1 -decarboxylase enzymes suitable for use in accordance with the methods of the invention have L-aspartate 1 -decarboxylase activity and comprise an amino acid sequence with at least 40%, at least 45%, at least 50%, or at least 55% sequence identity to SEQ ID NO: 15 and/or 16.
[0013] In a second aspect, the invention provides host cells genetically modified to delete or otherwise reduce the activity of endogenous proteins. Deletion or disruption of ethanol fermentation pathway(s) and nucleic acids encoding ethanol fermentation pathway enzymes is important for engineering a recombinant host cell capable of efficient production of L-aspartate and/or beta-alanine under substantially anaerobic conditions. In various embodiments, recombinant host cells comprising deletion or disruption of one or more nucleic acids encoding ethanol fermentation pathway enzymes decreases ethanol production by at least 10%>, at least 25%, at least 50%, at least 60%, at least 70%, at least 90%, at least 95%, or at least 99% as compared to parental cells that do not comprise this genetic modification.
[0014] In various embodiments, the recombinant host cells comprise a deletion or disruption of one or more nucleic acids encoding an enzyme selected from the group consisting of pyruvate decarboxylase, alcohol dehydrogenase, and/or malate dehydrogenase.
[0015] In a third aspect, methods are provided herein for producing L-aspartate or beta- alanine by recombinant host cells of the invention. In certain embodiments, these methods comprise the step culturing a recombinant host cell described herein in a medium containing at least one carbon source and one nitrogen source under substantially anaerobic conditions such that L-aspartate is produced. In various embodiments, conditions are selected to produce an oxygen uptake rate of around 0-25 mmol/l/hr. In some embodiments, conditions are selected to produce an oxygen uptake rate of around 2.5-15 mmol/l/hr. In other embodiments, these methods comprise the step of culturing a recombinant host cell described herein in a medium containing at least one carbon source and one nitrogen source under aerobic conditions such that L-aspartate is produced. BRIEF DESCRIPTION OF THE FIGURES
[0016] Figure 1 provides a schematic of the L-aspartate pathway enzymes and L-aspartate 1- decarboxylase enzymes provided by the invention. Conversion of oxaloacetate to L-aspartate is catalyzed by L-aspartate dehydrogenase (EC 1.4.1.21) and conversion of L-aspartate to beta- alanine is catalyzed by L-aspartate 1 -decarboxylase (EC 4.1.1.11). Oxaloacetate-forming enzymes provided by the invention include pyruvate carboxylase (EC 6.4.1.1), phosphoenolpyruvate carboxylase (EC 4.1.1.31), and phosphoenolpyruvate carboxykinase (EC 4.1.1.49). Conversion of pyruvate to oxaloacetate is catalyzed by pyruvate carboxylase; conversion of phosphoenolpyruvate to oxaloacetate is catalyzed by phosphoenolpyruvate carboxylase and/or phosphoenolpyruvate carboxykinase.
DETAILED DESCRIPTION OF THE INVENTION
[0017] The present invention provides recombinant host cells, materials, and methods for the biological production of L-aspartate and/or beta-alanine under substantially anaerobic conditions.
[0018] While the present invention is described herein with reference to aspects and specific embodiments thereof, those skilled in the art will recognize that various changes may be made and equivalents may be substituted without departing from the invention. The present invention is not limited to particular nucleic acids, expression vectors, enzymes, biosynthetic pathways, host microorganisms, or processes, as such may vary. The terminology used herein is for purposes of describing particular aspects and embodiments only, and is not to be construed as limiting. In addition, many modifications may be made to adapt a particular situation, material, composition of matter, process, process steps or steps, in accordance with the invention. All such modifications are within the scope of the claims appended hereto.
[0019] All patents, patent applications, and publications cited herein are incorporated by reference in their entireties.
Section 1: Definitions
[0020] In this specification and in the claims that follow, reference will be made to a number of terms that shall be defined to have the following meanings.
[0021] As used in the specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to an "expression vector" includes a single expression vector as well as a plurality of expression vectors, either the same (e.g., the same operon) or different; reference to "cell" includes a single cell as well as a plurality of cells; and the like.
[0022] The term "accession number", and similar terms such as "protein accession number", "UniProt ID", "gene ID", "gene accession number" refer to designations given to specific proteins or genes. These identifiers describe a gene or enzyme sequence in publicly accessible databases, such as NCBI.
[0023] A dash (-) in a consensus sequence indicates that there is no amino acid at the specified position. A plus (+) in a consensus sequence indicates any amino acid may be present at the specified position. Thus, a plus in a consensus sequence herein indicates a position at which the amino acid is generally non-conserved; a homologous enzyme sequence, when aligned with the consensus sequence, can have any amino acid at the indicated "+" position.
[0024] As used herein, the term "express", when used in connection with a nucleic acid encoding an enzyme or an enzyme itself in a cell, means that the enzyme, which may be an endogenous or exogenous (heterologous) enzyme, is produced in the cell. The term "overexpress", in these contexts, means that the enzyme is produced at a higher level, i.e., enzyme levels are increased, as compared to the wild-type, in the case of an endogenous enzyme. Those skilled in the art appreciate that overexpression of an enzyme can be achieved by increasing the strength or changing the type of the promoter used to drive expression of a coding sequence, increasing the strength of the ribosome binding site or Kozak sequence, increasing the stability of the mRNA transcript, altering the codon usage, increasing the stability of the enzyme, and the like.
[0025] The terms "expression vector" or "vector" refer to a nucleic acid and/or a composition comprising a nucleic acid that can be introduced into a host cell, e.g., by transduction, transformation, or infection, such that the cell then produces ("expresses") nucleic acids and/or proteins other than those native to the cell, or in a manner not native to the cell, that are contained in or encoded by the nucleic acid so introduced. Thus, an "expression vector" contains nucleic acids (ordinarily DNA) to be expressed by the host cell. Optionally, the expression vector can be contained in materials to aid in achieving entry of the nucleic acid into the host cell, such as the materials associated with a virus, liposome, protein coating, or the like. Expression vectors suitable for use in various aspects and embodiments of the present invention include those into which a nucleic acid sequence can be, or has been, inserted, along with any preferred or required operational elements. Thus, an expression vector can be transferred into a host cell and, typically, replicated therein (although, one can also employ, in some embodiments, non-replicable vectors that provide for "transient" expression). In some embodiments, an expression vector that integrates into chromosomal, mitochondrial, or plastid DNA is employed. In other embodiments, an expression vector that replicates extrachromasomally is employed. Typical expression vectors include plasmids, and expression vectors typically contain the operational elements required for transcription of a nucleic acid in the vector. Such plasmids, as well as other expression vectors, are described herein or are well known to those of ordinary skill in the art.
[0026] The terms "ferment", "fermentative", and "fermentation" are used herein to describe culturing microbes under conditions to produce useful chemicals, including but not limited to conditions under which microbial growth, be it aerobic or anaerobic, occurs.
[0027] The term "heterologous" as used herein refers to a material that is non-native to a cell. For example, a nucleic acid is heterologous to a cell, and so is a "heterologous nucleic acid" with respect to that cell, if at least one of the following is true: (a) the nucleic acid is not naturally found in that cell (that is, it is an "exogenous" nucleic acid); (b) the nucleic acid is naturally found in a given host cell (that is, "endogenous to"), but the nucleic acid or the RNA or protein resulting from transcription and translation of this nucleic acid is produced or present in the host cell in an unnatural (e.g., greater or lesser than naturally present) amount; (c) the nucleic acid comprises a nucleotide sequence that encodes a protein endogenous to a host cell but differs in sequence from the endogenous nucleotide sequence that encodes that same protein (having the same or substantially the same amino acid sequence), typically resulting in the protein being produced in a greater amount in the cell, or in the case of an enzyme, producing a mutant version possessing altered (e.g. higher or lower or different) activity; and/or (d) the nucleic acid comprises two or more nucleotide sequences that are not found in the same relationship to each other in the cell. As another example, a protein is heterologous to a host cell if it is produced by translation of RNA or the corresponding RNA is produced by transcription of a heterologous nucleic acid; a protein is also heterologous to a host cell if it is a mutated version of an endogenous protein, and the mutation was introduced by genetic engineering.
[0028] The term "homologous", as well as variations thereof, such as "homology", refers to the similarity of a nucleic acid or amino acid sequence, typically in the context of a coding sequence for a gene or the amino acid sequence of a protein. Homology searches can be employed using a known amino acid or coding sequence (the "reference sequence") for a useful protein to identify homologous coding sequences or proteins that have similar sequences and thus are likely to perform the same useful function as the protein defined by the reference sequence. As will be appreciated by those of skill in the art, a protein having greater than 90% identity to a reference protein as determined by, for example and without limitation, a BLAST (blast.ncbi.nlm.nih.gov) search is highly likely to carry out the identical biochemical reaction as the reference protein. In some cases, two enzymes having greater than 20% identity will carry out identical biochemical reactions, and the higher the identity, i.e., 40% or 80% identity, the more likely the two proteins have the same or similar function. As will be appreciated by those skilled in the art, homologous enzymes can be identified by BLAST searching.
[0029] The terms "host cell" and "host microorganism" are used interchangeably herein to refer to a living cell that can be (or has been) transformed via insertion of an expression vector. A host microorganism or cell as described herein may be a prokaryotic cell (e.g., a microorganism of the kingdom Eubacteria) or a eukaryotic cell. As will be appreciated by one of skill in the art, a prokaryotic cell lacks a membrane-bound nucleus, while a eukaryotic cell has a membrane-bound nucleus.
[0030] The terms "isolated" or "pure" refer to material that is substantially, e.g. greater than 50% or greater than 75%, or essentially, e.g. greater than 90%, 95%, 98% or 99%, free of components that normally accompany it in its native state, e.g. the state in which it is naturally found or the state in which it exists when it is first produced.
[0031] As used herein, the term "nucleic acid" and variations thereof shall be generic to polydeoxyribonucleotides (containing 2-deoxy-D-ribose) and to polyribonucleotides (containing D-ribose). "Nucleic acid" can also refer to any other type of polynucleotide that is an N- glycoside of a purine or pyrimidine base, and to other polymers containing nonnucleotidic backbones, provided that the polymers contain nucleobases in a configuration that allows for base pairing and base stacking, as found in DNA and RNA. As used herein, the symbols for nucleotides and polynucleotides are those recommended by the IUPAC-IUB Commission of Biochemical Nomenclature (Biochem. 9:4022, 1970). A "nucleic acid" may also be referred to herein with respect to its sequence, the order in which different nucleotides occur in the nucleic acid, as the sequence of nucleotides in a nucleic acid typically defines its biological activity, e.g., as in the sequence of a coding region, the nucleic acid in a gene composed of a promoter and coding region, which encodes the product of a gene, which may be an RNA, e.g. a rRNA, tRNA, or mRNA, or a protein (where a gene encodes a protein, both the mRNA and the protein are "gene products" of that gene).
[0032] The term "operably linked" refers to a functional linkage between a nucleic acid expression control sequence (such as a promoter, ribosome-binding site, and transcription terminator) and a second nucleic acid sequence, the coding sequence or coding region, wherein the expression control sequence directs or otherwise regulates transcription and/or translation of the coding sequence.
[0033] The terms "optional" or "optionally" as used herein mean that the subsequently described feature or structure may or may not be present, or that the subsequently described event or circumstance may or may not occur, and that the description includes instances where a particular feature or structure is present and instances where the feature or structure is absent, or instances where the event or circumstance occurs and instances where it does not.
[0034] As used herein, "recombinant" refers to the alteration of genetic material by human intervention. Typically, recombinant refers to the manipulation of DNA or RNA in a cell or virus or expression vector by molecular biology (recombinant DNA technology) methods, including cloning and recombination. Recombinant can also refer to manipulation of DNA or RNA in a cell or virus by random or directed mutagenesis. A "recombinant" cell or nucleic acid can typically be described with reference to how it differs from a naturally occurring counterpart (the "wild-type"). In addition, any reference to a cell or nucleic acid that has been "engineered" or "modified" and variations of those terms, is intended to refer to a recombinant cell or nucleic acid.
[0035] The terms "transduce", "transform", "transfect", and variations thereof as used herein refers to the introduction of one or more nucleic acids into a cell. For practical purposes, the nucleic acid must be stably maintained or replicated by the cell for a sufficient period of time to enable the function(s) or product(s) it encodes to be expressed for the cell to be referred to as "transduced", "transformed", or "transfected". As will be appreciated by those of skill in the art, stable maintenance or replication of a nucleic acid may take place either by incorporation of the sequence of nucleic acids into the cellular chromosomal DNA, e.g., the genome, as occurs by chromosomal integration, or by replication extrachromosomally, as occurs with a freely- replicating plasmid. A virus can be stably maintained or replicated when it is "infective": when it transduces a host microorganism, replicates, and (without the benefit of any complementary virus or vector) spreads progeny expression vectors, e.g., viruses, of the same type as the original transducing expression vector to other microorganisms, wherein the progeny expression vectors possess the same ability to reproduce.
[0036] As used herein, "L-aspartate" is intended to mean an amino acid having the chemical formula C4H5NO4 and a molecular mass of 131.10 g/mol (CAS# 56-84-8). L-aspartate as described herein can be a salt, acid, base, or derivative depending on the structure, pH, and ions present. The terms "L-aspartate", "L-aspartic acid", "L-aspartate", and "aspartic acid" are used interchangeably herein.
[0037] As used herein, beta-alanine is intended to mean a beta amino acid having the chemical formula C3H6NO2 and a molecular mass of 88.09 g/mol (CAS # 107-95-9). Beta- alanine as described herein can be a salt, acid, base, or derivative depending on the structure, pH, and ions present. Beta-alanine is also referred to as "β-alanine", "3-aminopropionic acid", and "3-aminopropanoate", and these terms are used interchangeably herein.
[0038] As used herein, the term "substantially anaerobic" when used in reference to a culture or growth condition is intended to mean the amount of oxygen is less than about 10% of saturation for dissolved oxygen in liquid media. The term is also intended to include sealed chambers of liquid or solid growth medium maintained with an atmosphere of less than about 1% oxygen.
Section 2: Recombinant host cells for production of L-aspartate and beta-alanine 2.1 Host cells
[0039] In one aspect, the invention provides a recombinant host cell capable of producing
L-aspartate or beta-alanine under substantially anaerobic conditions, the host cell comprising one or more heterologous nucleic acids encoding a L-aspartate pathway enzyme and optionally (in the case of beta-alanine producing host cells) a L-aspartate 1 -decarboxylase. In one embodiment, the recombinant host cell has been engineered to produce L-aspartate or beta-alanine under substantially anaerobic conditions. In another embodiment, the recombinant host cell natively produces L-aspartate or beta-alanine under substantially anaerobic conditions. In another embodiment, the recombinant host cell has been engineered to produce L-aspartate or beta- alanine under aerobic conditions.
[0040] Any suitable host cell may be used in practice of the methods of the present invention, and exemplary host cells useful in the compositions and methods provided herein include archaeal, prokaryotic, or eukaryotic cells.
2.1.1 Yeast cells [0041] In an important embodiment, the recombinant host cell is a yeast cell. Yeast cells are excellent host cells for construction of recombinant metabolic pathways comprising heterologous enzymes catalyzing production of small-molecule products. There are established molecular biology techniques and nucleic acids encoding genetic elements necessary for construction of yeast expression vectors, including, but not limited to, promoters, origins of replication, antibiotic resistance markers, auxotrophic markers, terminators, and the like. Second, techniques for integration/insertion of nucleic acids into the yeast chromosome by homologous recombination are well established. Yeast also offers a number of advantages as an industrial fermentation host. Yeast cells can generally tolerate high concentrations of organic acids and maintain cell viability at low pH and can grow under both aerobic and anaerobic culture conditions, and there are established fermentation broths and fermentation protocols. The ability of a strain to propagate and/or produce the desired product under substantially anaerobic conditions provides a number of advantages with regard to the present invention. First, this characteristic results in efficient product biosynthesis when the host cell is supplied with a carbohydrate carbon source. Second, from a process standpoint, the ability to run a fermentation under substantially anaerobic conditions decreases production cost.
[0042] In various embodiments, yeast cells useful in the method of the invention include yeasts of a genera selected from the non-limiting group consisting of Aciculoconidium, Ambrosiozyma, Arthroascus, Arxiozyma, Ashbya, Babjevia, Bensingtonia, Botryoascus, Botryozyma, Brettanomyces, Bullera, Bulleromyces, Candida, Citeromyces, Clavispora, Cryptococcus, Cystofilobasidium, Debaryomyces, Dekkara, Dipodascopsis, Dipodascus, Eeniella, Endomycopsella, Eremascus, Eremothecium, Erythrobasidium, Fellomyces, Filobasidium, Galactomyces, Geotrichum, Guilliermondella, Hanseniaspora, Hansenula, Hasegawaea, Holtermannia, Hormoascus, Hyphopichia, Issatchenkia, Kloeckera, Kloeckeraspora, Kluyveromyces, Kondoa, Kuraishia, Kurtzmanomyces, Leucosporidium, Lipomyces, Lodderomyces, Malassezia, Metschnikowia, Mrakia, Myxozyma, Nadsonia, Nakazawaea, Nematospora, Ogataea, Oosporidium, Pachysolen, Phachytichospora, Phaffia, Pichia, Rhodosporidium, Rhodotorula, Saccharomyces, Saccharomycodes, Saccharomycopsis, Saitoella, Sakaguchia, Saturnospora, Schizoblastosporion, Schizosaccharomyces, Schwanniomyces, Sporidiobolus, Sporobolomyces, Sporopachydermia, Stephanoascus, Sterigmatomyces, Sterigmatosporidium, Symbiotaphrina, Sympodiomyces, Sympodiomycopsis, Torulaspora, Trichosporiella, Trichosporon, Trigonopsis, Tsuchiyaea, Udeniomyces, Waltomyces, Wickerhamia, Wickerhamiella, Williopsis, Yamadazyma, Yarrowia, Zygoascus, Zygosaccharomyces, Zygowilliopsis, and Zygozyma, among others.
[0043] In various embodiments, the yeast cell is of a species selected from the non- limiting group consisting of Candida albicans, Candida ethanolica, Candida guilliermondii,
Candida krusei, Candida lipolytica, Candida metbanosorbosa, Candida sonorensis, Candida tropicalis, Candida utilis, Cryptococcus curvatus, Hansenula polymorpha, Issatchenkia orientalis, Kluyveromyces lactis, Kluyveromyces marxianus, Kluyveromyces thermotolerans, omagataella pastoris, Lipomyces starkeyi, Pichia angusta, Pichia deserticola, Pichia galeiformis, Pichia kodamae, Pichia kudriavzevii, Pichia membranaefaciens, Pichia methanolica, Pichia pastoris, Pichia salictaria, Pichia stipitis, Pichia thermotolerans, Pichia trehalophila, Rhodosporidium toruloides, Rhodotorula glutinis, Rhodotorula graminis, Saccharomyces bayanus, Saccharomyces boulardi, Saccharomyces cerevisiae, Saccharomyces kluyveri, Schizosaccharomyces pombe and Yarrowia lipolytica. One skilled in the art will recognize that this list encompasses yeast in the broadest sense.
[0044] In certain embodiments, the recombinant yeast cells provided herein are engineered by the introduction of one or more genetic modifications (including, for example, heterologous nucleic acids encoding enzymes and/or disruption or deletion of native nucleic acids encoding enzymes) into a Crabtree-negative yeast cell. In certain of these embodiments, the host cell belongs to the Pichia/Issatchenkia/Saturnispora/Dekkera clade. In certain of these embodiments, the host cell belongs to the genus selected from the group consisting of Pichia, Issatchenkia, or Candida. In certain embodiments, the host cell belongs to the genus Pichia, and in some of these embodiments the host cell is Pichia kudriavzevii.
[0045] In certain embodiments, the recombinant host cells provided herein are engineered by introduction of one or more genetic modifications into a Crabtree-positive yeast cell. In certain of these embodiments, the host cell belongs to the Saccharomyces clad. In certain of these embodiments, the host cell belongs to a genus selected from the group consisting of Saccharomyces, Hanseniaspora, and Kluyveromyces. In certain embodiments, the host cell belongs to the genus Saccharomyces, and in one of these embodiments the host cell is Saccharomyces cerevisiae.
[0046] Members of the Pichia/Issatchenkia/Saturnispora/Dekkera or the Saccharomyces clade are identified by analysis of their 26S ribosomal DNA using the methods described by Kurtzman CP., and Robnett C.J., ("Identification and Phylogeny of Ascomycetous Yeasts from Analysis of Nuclear Large Subunit (26S) Ribosomal DNA Partial Sequences", Atonie van Leeuwenhoek 73(4):331-371; 1998). Kurtzman and Robnett report analysis of approximately 500 ascomycetous yeasts were analyzed for the extent of divergence in the variable D1/D2 domain of the large subunit (26S) ribosomal DNA. Host cells encompassed by a clade exhibit greater sequence identity in the D1/D2 domain of the 26S ribosomal subunit DNA to other host cells within the clade as compared to host cells outside the clade. Therefore, host cells that are members of a clade (e.g., the Pichia/Issatchenkia/Saturnispora/Dekkera or Saccharomyces clades) can be identified using the methods of Kurtzman and Robnett.
2.1.2 Other host cells
[0047] Recombinant host cells other than yeast cells are also suitable for use in accordance with the methods of the invention so long as the engineered host cell is capable of growth and/or product formation under substantially anaerobic conditions, illustrative examples include various eukaryotic, prokaryotic, and archaeal host cells. Illustrative examples of eukaryotic host cells provided by the invention include, but are not limited to cells belonging to the genera Aspergillus, Crypthecodinium, Cunninghamella, Entomophthora, Mortierella, Mucor, Neurospora, Pythium, Schizochytnum, Thraustochytrium, Trichoderma, Xanthophyllomyces. Examples of eukaryotic strains include, but are not limited to: Aspergillus niger, Aspergillus oryzae, Crypthecodiniurn. cohnii, Cunninghamella japonica, Entomophthora coronata, Mortierella alpina, Mucor circinelloides, Neurospora crassa, Pythium uitimum, Schizochytnum limacinum, Thraustochytrium aureum, Trichoderma reesei and Xanthophyllomyces dendrorhous.
[0048] Illustrative examples of recombinant archaea host cells provided by the invention include, but are not limited to, cells belonging to the genera: Aeropyrum, Archaeglobus, Halobacterium, Methanococcus, Methanobacterium, Pyrococcus, Sulfolobus, and Thermoplasma. Examples of archae strains include, but are not limited to Archaeoglobus fulgidus, Halobacterium sp., Methanococcus jarmaschii, Methanobacterium thernioautotrophicum, Thermoplasma acidophilum, Thermoplasma volcanium, Pyrococcus horikoshii, Pyrococcus abyssi, and Aeropyrum peraix.
[0049] Illustrative examples of recombinant prokaryotic host ceils provided by the invention include, but are not limited to, ceils belonging to the genera Agrobacterium, Aiicyciobacillus, Anabaena, Anacystis, Arthrobacter, Azobacter, Bacillus, Brevibacterium, Chromatium, Clostridium, Corynebacterium, Enterobacter, Erwinia, Escherichia, Lactobacillus, Lactococcus, Mesorhizobium, Methyl obacterium, Microbacterium, Phormidium, Pseudomonas, Rhodobacter, Rhodopseudomonas, Rhodospirillum, Rhodococcus, Salmonella, Scenedesmun, Serratia, Shigella, Staphlococcus, Strepromyces, Synnecoccus, and Zymomonas. Examples of prokaryotic strains include, but are not limited to Bacillus subtilis, Brevibacterium ammoniagenes, Bacillus amyloliquefacines, Brevibacterium ammoniagenes, Brevibacterium immariophilum, Clostridium beigerinckii, Enterobacter sakazakii, Escherichia coli, Lactobacillus acidophilus, Lactococcus lactis, Mesorhizobium loti, Pseudomonas aeruginosa, Pseudomonas mevalonic, Pseudomonas pudita, Rhodobacter capsulatus, Rhodobacter sphaeroides, Rhodospirillum rubrum, Salmonella enterica, Salmonella typhi, Salmonella typhimurium, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, and Staphylococcus aureus.
[0050] Escherichia coli and Corynebacterium glutamicum are particularly good prokaryotic host cells for use in accordance with the methods of the invention. E. coli is capable of growth and/or product (L-aspartate or beta-alanine) formation under substantially anaerobic conditions, is well-utilized in industrial fermentation of small-molecule products, and can be readily engineered. Unlike most wild type yeast strains, wild type E. coli can catabolize both pentose and hexose sugars as carbon sources. The present invention provides a wide variety of E. coli host cells suitable for use in the methods of the invention. In one embodiment, the recombinant host cell is an Escherichia coli host cell. Corynebacterium glutamicum is well utilized for industrial production of various amino acids. While generally regarded as a strict aerobe, wild type Corynebacterium glutamicum is capable of growth under substantially anaerobic conditions if nitrate is supplied to the fermentation broth as an electron acceptor. In one embodiment, the recombinant host cell is a Corynebacterium host cell.
[0051] In some embodiments, the host cell is a microbe that is capable of growth and/or production of L-aspartate or beta-alanine under substantially anaerobic conditions. Suitable host ceils may natively grow under substantially anaerobic conditions or may be engineered to be capable of growth under substantially anaerobi c conditions,
[0052] Certain of these host ceils, including Saccharomyces cerevisiae, Bacillus subtilis,
Lactobacillus acidophilus, have been designated by the Food and Drug Administration as Generally Regarded As Safe (or GRAS) and so are employed in various embodiments of the methods of the invention. While desirable from public safety and regulatory standpoints, GRAS status does not impact the ability of a host strain to be used in the practice of this invention, hence, non-GRAS and even pathogenic organisms are included in the list of illustrative host strains suitable for use in the practice of this invention. 2.2 L-aspartate pathway enzymes and L-aspartate 1-decarboxylases
[0053] Provided herein in certain embodiments are recombinant host cells having at least one active L-aspartate pathway from phosphoenolpyruvate or pyruvate to L-aspartate. In some embodiments wherein the host cell produces beta-alanine, the recombinant host cell further expresses an L-aspartate 1 -decarboxylase. A recombinant host cell having an active L-aspartate pathway as used herein produces active enzymes necessary to catalyze each metabolic reaction in a L-aspartate fermentation pathway, and therefore is capable of producing L-aspartate and/or beta-alanine in measurable yields and/or titers when cultured under suitable conditions. A recombinant host cell having an active L-aspartate pathway comprises one or more heterologous nucleic acids encoding L-aspartate pathway enzymes.
[0054] In certain embodiments, the recombinant host cells provided herein have a L- aspartate pathway that proceeds via phosphoenolpyruvate or pyruvate, and oxaloacetate intermediates. In many embodiments, the recombinant host cell comprises one or more heterologous nucleic acids encoding one or more L-aspartate pathway enzymes selected from the group consisting of phosphoenolpyruvate carboxylase, pyruvate carboxylase, phosphoenolpyruvate carboxykinase, and L-aspartate dehydrogenase wherein the heterologous nucleic acid is expressed in sufficient amounts to produce L-aspartate under substantially anaerobic conditions. In other embodiments, the recombinant host cell comprises one or more heterologous nucleic acids encoding one or more L-aspartate pathway enzymes selected from the group consisting of phosphoenolpyruvate carboxylase, pyruvate carboxylase, phosphoenolpyruvate carboxykinase, and L-aspartate dehydrogenase wherein the heterologous nucleic acid is expressed in sufficient amounts to produce L-aspartate under aerobic conditions. In certain embodiments, the cell further comprises a heterologous nucleic acid encoding an L- aspartate 1 -decarboxylase wherein said heterologous nucleic acid is expressed in sufficient amounts to produce beta-alanine under substantially anaerobic conditions. Thus, one will recognize that recombinant host cells engineered for production of L-aspartate in accordance with the methods of the invention express an L-aspartate pathway, and recombinant host cells engineered for production of beta-alanine express, in addition to an L-aspartate pathway, a L- aspartate 1 -decarboxylase.
[0055] In some embodiments, the recombinant host cell comprises one or more heterologous nucleic acids encoding one or more enzymes of an L-aspartate pathway. In some embodiments, the recombinant host cell comprises one or more heterologous nucleic acids encoding one L-aspartate pathway enzyme. In some embodiments, said one L-aspartate pathway enzyme is L-aspartate dehydrogenase. In other embodiments, said one L-aspartate pathway enzyme is pyruvate carboxylase. In other embodiments, said one L-aspartate pathway enzyme is phosphoenolpyruvate carboxylase. In still further embodiments, said one L-aspartate pathway enzyme is phosphoenolpyruvate carboxykinase. In various embodiments, the recombinant host cell comprises one or more heterologous nucleic acids encoding two L-aspartate pathway enzymes. In some embodiments, said two L-aspartate pathway enzymes are L-aspartate dehydrogenase and pyruvate carboxylase. In other embodiments, said two L-aspartate pathway enzymes are L-aspartate dehydrogenase and phosphoenolpyruvate carboxylase. In other embodiments, said two L-aspartate pathway enzymes are L-aspartate dehydrogenase and phosphoenolpyruvate carboxykinase. In various embodiments, the recombinant host cell comprises one or more heterologous nucleic acids encoding three L-aspartate pathway enzymes. In some embodiments, said three L-aspartate pathway enzymes are L-aspartate dehydrogenase, pyruvate carboxylase, and phosphoenolpyruvate carboxylase. In other embodiments, said three L-aspartate pathway enzymes are L-aspartate dehydrogenase, pyruvate carboxylase, and phosphoenolpyruvate carboxykinase. In other embodiments, said three L-aspartate pathway enzymes are L-aspartate dehydrogenase, phosphoenolpyruvate carboxylase, and phosphoenolpyruvate carboxykinase. In various embodiments, the recombinant host cell comprises one or more heterologous nucleic acids encoding all four L-aspartate pathway enzymes (i.e., L-aspartate dehydrogenase, pyruvate carboxylase, phosphoenolpyruvate carboxylase, and phosphoenolpyruvate carboxykinase). In certain embodiments, the recombinant host cell further comprises a heterologous nucleic acid encoding L-aspartate 1 -decarboxylase.
[0056] The recombinant host cells of the present invention include microbes that employ combinations of metabolic reactions for biosynthetically producing the compounds of the invention. The biosynthesized compounds can be produced intracellularly and/or secreted into the culture medium. The biosynthesized compounds produced by the recombinant host cells are L-aspartate and/or beta-alanine. The relationship of these compounds with respect to the metabolic reactions described herein are depicted in Figure 1. In one embodiment, the recombinant host cell is engineered to produce L-aspartate under substantially anaerobic conditions. In another embodiment, the recombinant host cell is engineered to produce L- aspartate under aerobic conditions. In another embodiment, the recombinant host cell is engineered to produce beta-alanine under substantially anaerobic conditions. [0057] The production of L-aspartate or beta-alanine via the biosynthetic pathways and recombinant host cells of the invention is particularly useful because L-aspartate and beta- alanine can be produced under substantially anaerobic conditions. Microorganisms generally lack the capacity to produce L-aspartate or beta-alanine (derived from L-aspartate using a L- aspartate 1 -decarboxylase) under substantially anaerobic conditions. As described herein, the recombinant host cells of the invention are engineered to produce L-aspartate and/or beta-alanine when grown under substantially anaerobic conditions and supplied with a carbohydrate as the primary carbon source and an assimilable nitrogen source.
[0058] The L-aspartate pathway and L-aspartate 1 -decarboxylase enzymes and nucleic acids encoding said enzymes may be endogenous or heterologous. In certain embodiments, the recombinant host cells provided herein comprise one or more heterologous nucleic acids encoding L-aspartate pathway and/or L-aspartate 1 -decarboxylase enzymes. In certain embodiments, the recombinant host cell comprises a single heterologous nucleic acid encoding a L-aspartate pathway or L-aspartate 1 -decarboxylase gene. In other embodiments, the cell comprises multiple heterologous nucleic acids encoding L-aspartate pathway and/or L-aspartate 1 -decarboxylase enzymes. In these embodiments, the recombinant host cell may comprise multiple copies of a single heterologous nucleic acid and/or multiple copies of two or more heterologous nucleic acids. Recombinant host cells comprising multiple heterologous nucleic acids may comprise any number of heterologous nucleic acids.
[0059] In certain embodiments, the recombinant host cells provided herein comprise one or more endogenous nucleic acids encoding L-aspartate pathway and/or L-aspartate 1- decarboxylase enzymes. In certain of these embodiments, the cells may be engineered to express more of these endogenous enzymes. In certain of these embodiments, the endogenous enzyme being expressed at a higher level (produced at a higher amount as compared to a parental or control cell) may be operatively linked to one or more exogenous promoters or other regulatory elements.
[0060] In certain embodiments, the recombinant host cells provided herein comprise one or more endogenous nucleic acids encoding L-aspartate pathway and/or L-aspartate 1- decarboxylase enzymes and one or more heterologous nucleic acids encoding L-aspartate pathway and/or L-aspartate 1 -decarboxylase enzymes. In these embodiments, the recombinant host cells may have an active L-aspartate pathway and/or L-aspartate 1 -decarboxylase that comprises one or more endogenous nucleic acids encoding L-aspartate pathway and/or L- aspartate 1 -decarboxylase enzymes and one or more heterologous nucleic acids encoding L- aspartate pathway and/or L-aspartate 1 -decarboxylase enzymes. In certain embodiments, the recombinant host cell may comprise both endogenous and heterologous nucleic acids encoding an L-aspartate pathway or L-aspartate 1 -decarboxylase enzyme.
2.2.1 Oxaloacetate-forming enzymes
[0061] Three enzymes can be used to form oxaloacetate from the glycolytic intermediates phosphoenolpyruvate and/or pyruvate, and Figure 1 provides a schematic showing the biosynthetic relationship of the three oxaloacetate-forming enzymes to the production of L- aspartate and beta-alanine. One oxaloacetate-forming enzyme provided by the invention is pyruvate carboxylase (EC 6.4.1.1), catalyzing conversion of pyruvate and hydrogen carbonate to oxaloacetate along with concomitant hydrolysis of adenosine triphosphate (ATP) to adenosine diphosphate (ADP). Another oxaloacetate-forming enzyme is phosphoenolpyruvate carboxylase (EC 4.1.1.31), catalyzing conversion of phosphoenolpyruvate and hydrogen carbonate to oxaloacetate along with concomitant release of phosphate. The third oxaloacetate-forming enzymes is phosphoenolpyruvate carboxykinase (EC 4.1.1.49), catalyzing formation of oxaloacetate from phosphoenolpyruvate and carbon dioxide along with concomitant formation of ATP from ADP. In various embodiments, the recombinant host cell comprises one or more heterologous nucleic acids encoding an oxaloacetate-forming enzyme selected from the group consisting of pyruvate carboxylase, phosphoenolpyruvate carboxylase, and phosphoenolpyruvate carboxykinase that results in increased production of L-aspartate or beta-alanine under substantially anaerobic conditions as compared to a parent cell not comprising said one or more heterologous nucleic acids. In various embodiments, the recombinant host cell comprises one or more heterologous nucleic acids encoding an oxaloacetate-forming enzyme selected from the group consisting of pyruvate carboxylase, phosphoenolpyruvate carboxylase, and phosphoenolpyruvate carboxykinase that results in increased production of L-aspartate or beta- alanine under aerobic conditions as compared to a parent cell not comprising said one or more heterologous nucleic acids.
[0062] Recombinant host cells of the invention engineered for production of L-aspartate or beta-alanine under substantially anaerobic conditions through increased expression of oxaloacetate-forming enzymes generally comprise one or more heterologous nucleic acids encoding at least one oxaloacetate-forming enzyme. In some embodiments, a recombinant host cell engineered for production of L-aspartate or beta-alanine under substantially anaerobic conditions comprises one or more heterologous nucleic acid encoding one oxaloacetate-forming enzyme. In other embodiments, a recombinant host cell engineered for production of L-aspartate or beta-alanine under substantially anaerobic conditions comprises heterologous nucleic acids encoding two oxaloacetate-forming enzymes. In yet a further embodiment, recombinant host cells of the invention engineered for production of L-aspartate or beta-alanine under substantially anaerobic conditions comprise heterologous nucleic acids encoding all three oxaloacetate- forming enzymes.
2.2.1.1 Pyruvate carboxylase
[0063] One oxaloacetate-forming enzyme is pyruvate carboxylase, and in one embodiment, a recombinant host cell of the invention comprises one or more heterologous nucleic acids encoding a pyruvate carboxylase wherein said host cell is capable of producing L- aspartate or beta-alanine under substantially anaerobic conditions. In another embodiment, a recombinant host cell of the invention comprises one or more heterologous nucleic acids encoding a pyruvate carboxylase wherein said host cell is capable of producing L-aspartate or beta-alanine under aerobic conditions.
[0064] In some embodiments, a nucleic acid encoding pyruvate carboxylase is derived from a fungal source. Non-limiting examples of pyruvate carboxylase enzymes derived from fungal sources suitable for use in accordance with the methods of the invention include those selected from the group consisting of Aspergillus niger (UniProt ID: Q9HES8), Aspergillus terreus (UniProt ID: 093918), Aspergillus oryzae (UniProt ID:Q2UGL1; SEQ ID NO: 7), Aspergillus fumigatus (UniProt ID: Q4WP18), Paecilomyces variotii (UniProt ID: V5FWI7), and Saccharomyces cerevisiae (UniProt ID: PI 1154) pyruvate carboxylase. In a specific embodiment, a recombinant host cell of the invention comprises one or more heterologous nucleic acids encoding Aspergillus oryzae pyruvate carboxylase (SEQ ID NO: 7) wherein said host cell is capable of producing L-aspartate or beta-alanine under substantially anaerobic conditions. In another specific embodiment, a recombinant host cell of the invention comprises one or more heterologous nucleic acids encoding Aspergillus oryzae pyruvate carboxylase (SEQ ID NO: 7) wherein said host cell is capable of producing L-aspartate or beta-alanine under aerobic conditions.
2.2.1.2 Phosphoenolpyruvate carboxylase
[0065] Oxaloacetate can also be produced from phosphoenolpyruvate, which serves as the substrate for both phosphoenolpyruvate carboxylase and phosphoenolpyruvate carboxykinase enzymes. In some embodiments, a nucleic acid encoding phosphoenolpymvate carboxylase is derived from a fungal source. A specific, non-limiting example of a phosphoenolpyruvate carboxylase enzyme derived from a fungal source suitable for use in accordance with the methods of the invention is Aspergillus niger phosphoenolpyruvate carboxylase (UniProt ID: A2QM99).
[0066] In other embodiments, a nucleic acid encoding phosphoenolpyruvate carboxylase is derived from a bacterial source. Non-limiting examples of phosphoenolpyruvate carboxylase enzymes derived from bacterial sources suitable for use in accordance with the methods of the invention include Escherichia coli (UniProt ID: H9UZE7; SEQ ID NO: 8), Mycobacterium tuberculosis (UniProt ID: P9WIH3), and Cory neb acterium glutamicum (UniProt ID: P12880) phosphoenolpyruvate carboxylase enzymes. In a specific embodiment, said phosphoenolpyruvate carboxylase is Escherichia coli phosphoenolpyruvate carboxylase (SEQ ID NO: 8).
[0067] In various embodiments, the recombinant host cell comprises one or more heterologous nucleic acids encoding a phosphoenolpyruvate carboxylase that results in increased production of L-aspartate or beta-alanine under substantially anaerobic conditions as compared to a parent cell not comprising said one or more heterologous nucleic acids. In a specific embodiment, said phosphoenolpyruvate carboxylase is Escherichia coli phosphoenolpyruvate carboxylase (SEQ ID NO: 8).
2.2.1.3 Phosphoenolpyruvate carboxylase
[0068] Non-limiting examples of phosphoenolpyruvate carboxykinase enzymes suitable for use in accordance with the methods of the invention include Escherichia coli (UniProt ID: P22259), Anaerobiospirillum succiniciproducens (UniProt ID: 009460), Actinobacillus succinogenes (UniProt ID: A6VKV4), Mannheimia succiniciproducens (SEQ ID NO: 6), and Haemophilus influenzae (UniProt ID: A5UDR5) PEP carboxykinase enzymes. In yet another embodiment, the recombinant host cell comprises one or more heterologous nucleic acids encoding a phosphoenolpyruvate carboxykinase that results in increased production of L- aspartate or beta-alanine under substantially anaerobic conditions as compared to a parent cell not comprising said one or more heterologous nucleic acids. In a specific embodiment, said phosphoenolpyruvate carboxykinase is Mannheimia succiniciproducens phosphoenolpyruvate carboxykinase (SEQ ID NO: 6).
2.2.2 L-aspartate dehydrogenase enzymes [0069] Provided herein is a recombinant host cell capable of producing L-aspartate or beta-alanine, the cell comprising one or more heterologous nucleic acids encoding a L-aspartate dehydrogenase. A L-aspartate dehydrogenase as used herein refers to any protein with L- aspartate dehydrogenase activity, meaning the ability to catalyze the conversion of oxaloacetate to L-aspartate.
[0070] Proteins capable of catalyzing this reaction suitable for use in the compositions and methods provided herein include both NAD-dependent L-aspartate dehydrogenase and NADP-dependent L-aspartate dehydrogenase enzymes. NAD-dependent L-aspartate dehydrogenase enzymes catalyze the conversion of oxaloacetate and ammonia to L-aspartate using NADH as the electron donor. Likewise, NADP-dependent L-aspartate dehydrogenase enzymes catalyze the conversion of oxaloacetate and ammonia to L-aspartate using NADPH as the electron donor. Many L-aspartate dehydrogenase enzymes are capable of using both NADH and NADPH as electron acceptors; as such, an NAD-dependent L-aspartate dehydrogenase may also be an NADP-dependent L-aspartate dehydrogenase (and vice versa). In these cases, usage of either NADH or NADPH as the electron donor is dependent on both the relative concentration of, and affinity constant of the L-aspartate dehydrogenase exhibits for, NADH or NADPH, respectively.
In some embodiments, the recombinant host cell provided herein comprises a heterologous nucleic acid encoding an L-aspartate dehydrogenase, which is capable of producing L-aspartate and/or beta-alanine. L-aspartate dehydrogenases suitable for use in accordance with the methods of the invention include those selected from the non-limiting group consisting of Acinetobacter sp. SH024 (UniProt ID: D6JRV1; SEQ ID NO: 22), Arthrobacter aurescens (UniProt ID: A1R621), Burkholderia pseudomallei (UniProt ID: Q3JFK2; SEQ ID NO: 20), Burkholderia thailandensis (UniProt ID: Q2T559; SEQ ID NO: 19), Comamonas testosteroni (UniProt ID: D0IX49), Cupriavidus taiwanensis (UniProt ID: B3R8S4; SEQ ID NO: 2), Dinoroseobacter shibae (UniProt ID: A8LLH8; SEQ ID NO: 24), Klebsiella pneumoniae (UniProt ID: A6TDT8; SEQ ID NO: 23), Ochrobactrum anthropi (UniProt ID: A6X792; SEQ ID NO: 21), Polaromonas sp. (UniProt ID: Q126F5; SEQ ID NO: 18), Pseudomonas aeruginosa (UniProt ID: Q9HYA4; SEQ ID NO: 1), Ralstonia solanacearum (UniProt ID: Q8XRV9; SEQ ID NO: 17), Comamonas testosterone (UniProt ID: D0IX49; SEQ ID NO: 26), Cupriavidus pinatubonensis (UniProt ID: Q46VA0; SEQ ID NO: 27), and Ruegeria pomeroyi (UniProt ID: Q5LPG8; SEQ ID NO: 25) L- aspartate dehydrogenase. In certain embodiments, the recombinant host cell provided herein comprises a heterologous nucleic acid encoding Pseudomonas aeruginosa L-aspartate dehydrogenase (SEQ ID NO: 1), which is capable of producing L-aspartate and/or beta-alanine. In other embodiments, the recombinant host cell provided herein comprises a heterologous nucleic acid encoding Cupriavidus taiwanensis L-aspartate dehydrogenase (SEQ ID NO: 2), which is capable of producing L-aspartate and/or beta-alanine. In some embodiments, a recombinant host cell of the present invention comprises a heterologous nucleic acid encoding an L-aspartate dehydrogenase selected from the group consisting of SEQ ID NOs: 17, 18, 19, 20, 21, 22, 23, 24, 25, 25, and 27, wherein the recombinant host cell is capable of producing L- aspartate and/or beta-alanine. In some embodiments, a recombinant host cell of the present invention comprises a plurality of heterologous nucleic acids, each encoding an L-aspartate dehydrogenase selected from the group consisting of SEQ ID NOs: 17, 18, 19, 20, 21, 22, 23, 24, 25, 25, and 27, wherein the recombinant host cell is capable of producing L-aspartate and/or beta-alanine.
Homologs to L-aspartate dehydrogenase enzymes
[0071] L-aspartate dehydrogenases also useful in the compositions and methods provided herein include those enzymes that are said to be "homologous" to any of the L-aspartate dehydrogenase enzymes described herein. Such homologs have the following characteristics: (1) is capable of catalyzing the conversion of oxaloacetate to L-aspartate; (2) it shares substantial sequence identity with any L-aspartate dehydrogenase described herein; (3) comprises a substantial number of amino acids corresponding to highly conserved amino acids in any L- aspartate dehydrogenase described herein; and (4) comprises one or more specific amino acids corresponding to strictly conserved amino acids in any L-aspartate dehydrogenase described herein.
[0072] A homolog is said to share substantial sequence identity to an L-aspartate dehydrogenase if the amino acid sequence of the homolog is at least 60%, at least 70%, at least 80%), at least 90%>, at least 95%>, or at least 97%> the same as that of a L-aspartate dehydrogenase amino acid sequence set forth herein.
[0073] A number of amino acids in L-aspartate dehydrogenase enzymes provided by the invention are highly conserved, and proteins homologous to an L-aspartate dehydrogenase enzyme of the invention will generally comprise amino acids corresponding to a substantial number of highly conserved amino acids. A homolog is said to comprise a substantial number of amino acids corresponding to highly conserved amino acids in a reference sequence if at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or more than 95% of the highly conserved amino acids in the reference sequence are found in the homologous protein.
[0074] Highly conserved amino acids in Pseudomonas aeruginosa L-aspartate dehydrogenase (SEQ ID NO: 1) are G8, G10, Al l, 112, G13, E69, C70, A71, A75, L84, V92, S94, G96, A97, G123, A124, 1125, G126, D129, L131, A134, V142, K148, P149, F174, G176, A178, A181, L184, P186, N188, N190, V191, A192, A193, T194, L197, A198, G201, V207, A211, D212, P213, N218, G226, A227, F228, G229, P239, N243, P244, K245, T246, S247, L249, T250, S253, R256, L258, and N260. In some embodiments, L-aspartate enzymes homologous to Pseudomonas aeruginosa L-aspartate dehydrogenase (SEQ ID NO: 1) comprise amino acids corresponding to at least a 50% of these highly conserved amino acids. In some embodiments, L-aspartate enzymes homologous to Pseudomonas aeruginosa L-aspartate dehydrogenase (SEQ ID NO: 1) comprise amino acids corresponding to at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or more than 95% of these highly conserved amino acids.
[0075] Highly conserved amino acids in Cupriavidus taiwanensis L-aspartate dehydrogenase (SEQ ID NO: 2) are G8, G10, Al l, 112, G13, C69, A70, A74, L83, V91, S93, G95, A96, S121, G122, A123, 1124, G125, D128, L130, A133, V141, K147, P148, F173, E174, G175, A177, A180, L183, P185, N187, N189, V190, A191, A192, T193, L196, A197, G200, V206, A210, D211, P212, N217, G225, A226, F227, G228, P238, N242, P243, K244, T245, S246, L248, T249, S252, S252, R255, A256, L257, L257, and N259. In some embodiments, L- aspartate enzymes homologous to Cupriavidus taiwanensis L-aspartate dehydrogenase (SEQ ID NO: 2) comprise amino acids corresponding to at least 50% of these highly conserved amino acids. In some embodiments, L-aspartate enzymes homologous to Cupriavidus taiwanensis L- aspartate dehydrogenase (SEQ ID NO: 2) comprise amino acids corresponding to at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or more than 95% of these highly conserved amino acids.
Strictly conserved amino acids in L-aspartate dehydrogenase enzymes
[0076] Some amino acids in L-aspartate dehydrogenase enzymes provided by the invention are strictly conserved, and proteins homologous to an L-aspartate dehydrogenase enzyme of the invention must comprise amino acid(s) corresponding to these strictly conserved amino. [0077] Amino acid H220 in SEQ ID NO: 1 functions as a general acid/base (although the invention is not to be limited by any theory of mechanism of action) and is necessary for enzyme activity; thus, an amino acid corresponding to H220 in SEQ ID NO: 1 is present in all enzymes homologous to SEQ ID NO: 1. Amino acid H220 in SEQ ID NO: 1 corresponds to amino acid HI 19 in SEQ ID NO: 2, and L-aspartate dehydrogenase enzymes homologous to SEQ ID NO: 2 must comprise an amino acid corresponding to HI 19 in SEQ ID NO: 2.
Additional L-aspartate dehydrogenase enzymes
[0078] In addition to L-aspartate dehydrogenase enzymes homologous to those described above, another class of L-aspartate dehydrogenase enzymes that can be expressed in engineered P. kudriavzevii to produce L-aspartate from oxaloacetate are L-aspartate transaminase (EC 2.6.1.1) enzymes, which catalyzes reduction of oxaloacetate to L-aspartate along with concomitant oxidation of glutamate to alpha-ketoglutarate. Using this enzyme, it is important to recycle the alpha- ketoglutarate back to glutamate to provide the glutamate substrate necessary for additional rounds of L-aspartate transaminase catalysis. This can be accomplished by expressing a glutamate dehydrogenase (EC 1.4.1.2) that reduces alpha-ketoglutarate back to glutamate using NADH as the electron donor. This alternative metabolic pathway to L-aspartate from oxaloacetate is most useful in cases where L-aspartate dehydrogenase activity is insufficient to produce L-aspartate at the desired rate. In some embodiments of the present invention, the recombinant host cell comprises a heterologous nucleic acid encoding a L-aspartate dehydrogenase that is an L-aspartate transaminase.
[0079] Examples of suitable L-aspartate transaminase enzymes include those selected from the non-limiting group consisting of Saccharomyces cerevisiae AAT2 (UnitProt ID: P23542), Schizosaccharomyces pombe L-aspartate transaminase (UniProt ID: 094320), Escherichia coli AspC (UniProt ID: P00509), Pseudomonas aeruginosa AspC (UniProt ID: P72173), and Rhizobium meliloti AatB (UniProt ID: Q06191), among others.
2.2.3 L-aspartate 1-decarboxylase enzymes
[0080] In various embodiments, the recombinant host cell further comprises a heterologous nucleic acid encoding a L-aspartate 1-decarboxylase. A L-aspartate 1- decarboxylase as used herein refers to any protein with L-aspartate decarboxylase activity, meaning the ability to catalyze the decarboxylation of L-aspartate to beta-alanine.
[0081] Proteins capable of catalyzing this reaction suitable for use in the compositions and methods provided herein include both bacterial L-aspartate 1 -decarboxylases and eukaryotic L-aspartate decarboxylases. Bacterial L-aspartate 1 -decarboxylases are pyruvoyl-dependent decarboxylases where the covalently bound pyruvoyl cofactor is produced by autocatalytic rearrangement of a specific serine residues (e.g., S25 in SEQ IDs NO: 4 and 5). Eukaryotic L- aspartate decarboxylases, in contrast, do not possess a pyruvoyl cofactor and instead possess a pyridoxal 5 '-phosphate cofactor. In some embodiments, the recombinant host cell comprises a heterologous nucleic acid encoding a bacterial L-aspartate 1 -decarboxylase and is capable of producing beta-alanine. In other embodiments, the recombinant host cell comprises a heterologous nucleic acid encoding a eukaryotic L-aspartate 1 -decarboxylase and is capable of producing beta-alanine.
[0082] Bacterial L-aspartate 1 -decarboxylase enzymes suitable for use in accordance with the methods of the invention include those selected from the non-limiting group consisting of Arthrobacter aurescens (UniProt ID: A1RDH3), Bacillus cereus (UniProt ID: A7GN78), Bacillus subtilis (UniProt ID: P52999; SEQ ID NO: 5), Burkholderia xenovorans (UniProt ID: Q143J3), Clostridium acetobutylicum (UniProt ID: P58285), Clostridium beijerinckii (UniProt ID: A6LWN4), Corynebacterium efficiens (UniProt ID: Q8FU86), Corynebacterium glutamicum (UniProt ID: Q9X4N0; SEQ ID NO: 4), Corynebacterium jeikeium (UniProt ID: Q4JXL3), Cupriavidus necator (UniProt ID: Q9ZHI5), Enterococcus faecalis (UniProt ID: Q833S7), Escherichia coli (UniProt ID: Q0TLK2), Helicobacter pylori (UniProt ID: P56065), Lactobacillus plantarum (UniProt ID: Q88Z02), Mycobacterium smegmatis (UniProt ID: A0QNF3), Pseudomonas aeruginosa (UniProt ID: Q9HV68), Pseudomonas fluorescens (UniProt ID: Q848I5), Staphylococcus aureus (UniProt ID: A6U4X7), and Streptomyces coelicolor (UniProt ID: P58286) L-aspartate 1 -decarboxylase. In one embodiment, the recombinant host cell provided herein comprises a heterologous nucleic acid encoding Bacillus subtilis L-aspartate 1 -decarboxylase (SEQ ID NO: 5) and is capable of producing beta-alanine. In another embodiment, the recombinant host cell provided herein comprises a heterologous nucleic acid encoding Corynebacterium L-aspartate 1 -decarboxylase (SEQ ID NO: 4) and is capable of producing beta-alanine.
[0083] In addition to the bacterial L-aspartate 1 -decarboxylase enzymes, the invention also provides eukaryotic L-aspartate 1 -decarboxylases suitable for use in the compositions and methods of the invention. Eukaryotic L-aspartate 1 -decarboxylase enzymes suitable for use in accordance with the methods of the invention include those selected from the non-limiting group consisting of Tribolium castaneum (UniProt ID: A9YVA8; SEQ ID NO: 3), Aedes aegypti (UniProt ID: Q171 S0), Drosophila mojavensis (UniProt ID: B4KIX9), and Dendroctonus ponderosae (UniProt ID: U4UTD4) L-aspartate 1 -decarboxylase. In one embodiment, the recombinant host cell provided herein comprises a heterologous nucleic acid encoding Tribolium castaneum L-aspartate 1 -decarboxylase (SEQ ID NO: 3) and is capable of producing beta- alanine.
[0084] L-aspartate 1 -decarboxylase enzymes also useful in the compositions and methods provided herein include those enzymes which are said to be "homologous" to any of the L-aspartate 1 -decarboxylase enzymes described herein. Such homologs have the following characteristics: (1) is capable of catalyzing the decarboxylation of L-aspartate to beta-alanine; (2) it shares substantial sequence identity with any L-aspartate 1 -decarboxylase described herein; (3) comprises a substantial number of amino acids corresponding to highly conserved amino acids in any L-aspartate 1 -decarboxylase described herein; and (4) comprises one or more specific amino acids corresponding to strictly conserved amino acids in any L-aspartate 1 -decarboxylase described herein.
Percent sequence identity
[0085] A homolog is said to share substantial sequence identity to an L-aspartate 1- decarboxylase if the amino acid sequence of the homolog is at least 60%, at least 70%, at least 80%), at least 90%, at least 95%, or at least 97% the same as that of a L-aspartate 1- decarboxylase amino acid sequence described herein.
Highly conserved amino acids in L-aspartate 1-decarboxylase enzymes
[0086] A number of amino acids in both bacterial and eukaryotic L-aspartate 1- decarboxylase enzymes provided herein are highly conserved, and proteins homologous to either a bacterial or a eukaryotic L-aspartate dehydrogenase enzyme of the invention will generally comprise amino acids corresponding to a substantial number of highly conserved amino acids. As described above, a homolog is said to comprise a substantial number of amino acids corresponding to highly conserved amino acids in a reference sequence if at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or more than 95% of the highly conserved amino acids in the reference sequence are found in the homologous protein.
[0087] Highly conserved amino acids in Corynebacterium glutamicum L-aspartate 1- decarboxylase (SEQ ID NO: 4) are K9, Hl l, R12, A13, V15, T16, A18, L20, Y22, G24, S25, D29, E42, N51, G52, R54, T57, Y58, 160, G62, G65, G67, N72, G73, A74, A75, A76, G82, D83, V85, 186, Y90, E97, P103, and N112. In some embodiments, L-aspartate 1-decarboxylase enzymes homologous to Corynebacterium glutamicum L-aspartate 1-decarboxylase (SEQ ID NO: 4) comprise amino acids corresponding to at least a 50% of these highly conserved amino acids. In some embodiments, L-aspartate 1 -decarboxylase enzymes homologous to Corynebacterium glutamicum L-aspartate 1 -decarboxylase (SEQ ID NO: 4) comprise amino acids corresponding to at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%), or more than 95% of these highly conserved amino acids.
[0088] Highly conserved amino acids in Bacillus subtilis L-aspartate 1 -decarboxylase
(SEQ ID NO: 5) are K9, Hl l, R12, A13, V15, T16, A18, L20, Y22, G24, S25, D29, E42, N51, G52, R54, T57, Y58, 160, G62, G65, G67, N72, G73, A74, A75, A76, G82, D83, V85, 186, Y90, E97, P103, and N112. In some embodiments, L-aspartate 1 -decarboxylase enzymes homologous to Bacillus subtilis L-aspartate 1 -decarboxylase (SEQ ID NO: 5) comprise amino acids corresponding to at least a 50% of these highly conserved amino acids. In some embodiments, L- aspartate 1 -decarboxylase enzymes homologous to Bacillus subtilis L-aspartate 1 -decarboxylase (SEQ ID NO: 5) comprise amino acids corresponding to at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or more than 95% of these highly conserved amino acids.
[0089] Highly conserved amino acids in Tribolium castaneum L-aspartate 1- decarboxylase (SEQ ID NO: 3) are V88, P94, D102, LI 15, S126, V127, T129, H131, P132, F134, N136, Q137, L138, S140, D143, Y145, Q150, T153, D154, L156, N157, P158, S159, Y161, T162, E164, V165, P167, L171, M172, E173, E174, V176, L177, E179, M180, R181, 1183, G185, G191, G193, F195, P197, G198, G199, S200, A202, N203, G204, Y205, 1207, A210, R211, P216, K219, G222, L229, F232, T233, S234, E235, A237, H238, Y239, S240, K243, A245, F247, G249, G251, G264, P285, V288, T291, G293, T294, T295, V296, G298, A299, F300, D301, C310, K312, W316, H318, D320, A321, A322, W323, G324, G325, G326, A327, L328, S330, R334, L336, L337, G339, D344, S345, V346, T347, W348, N349, P350, H351, K352, L353, L354, A356, Q358, Q359, C360, S361, T362, L364, H367, L371, H375, A379, Y381, L382, F383, Q384, D386, K387, F388, Y389, D390, D394, G396, D397, H399, Q401, C402, G403, R404, A406, D407, V408, K410, F411, W412, M414, W415, A417, K418, G419, G422, H426, F431, R444, G446, P454, N458, F461, Y463, P465, R469, L481, A485, P486, K489, E490, M492, G496, M498, T501, Y502, Q503, N510, F511, F512, R513, V515, Q517, S519, L521, D525, M526, E532, E534, L536. In some embodiments, L-aspartate 1- decarboxylase enzymes homologous to Tribolium castaneum L-aspartate 1 -decarboxylase (SEQ ID NO: 3) comprise amino acids corresponding to at least a 50% of these highly conserved amino acids. In some embodiments, L-aspartate 1 -decarboxylase enzymes homologous to Tribolium castaneum L-aspartate 1 -decarboxylase (SEQ ID NO: 3) comprise amino acids corresponding to at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%), or more than 95% of these highly conserved amino acids.
L-aspartate 1-decarboxylase strictly conserved amino acids
[0090] Some amino acids in L-aspartate 1-decarboxylase enzymes provided by the invention are strictly conserved, and proteins homologous to an L-aspartate 1-decarboxylase enzyme of the invention must comprise amino acid(s) corresponding to these strictly conserved amino acids.
[0091] Strictly conserved amino acids in both the Bacillus subtilis L-aspartate 1- decarboxylase (SEQ ID NO: 5) and Corynebacterium glutamicum L-aspartate 1-decarobxylase (SEQ ID NO: 4) amino acid sequences are K9, G24, S25, R54, and Y58. The epsilon-amine group on K9 is believed to form an ion pair with alpha-carboxyl group on L-aspartate, R54 is believed to form an ion pair with the gamma-carboxyl group on L-aspartate, and Y58 is believed to donate a proton to an extended enolate reaction intermediate; thus, these three amino acids are important for L-aspartate binding and subsequent decarboxylation. Additionally, proteolytic cleavage between residues G24 and S25 produces an N-terminal pyruvoyl moiety also necessary for decarboxylase activity. Therefore, enzymes homologous to SEQ ID NO: 4 and/or SEQ ID 5 will comprise amino acids corresponding to K9, G24, S25, R54, and Y58 in SEQ ID NOs: 4 and/or 5.
[0092] Strictly conserved amino acids in the Tribolium castaneum L-aspartate 1- decarboxylase (SEQ ID NO: 3) amino acid sequence are Q137, H238, K352, and R513. Q137 and R513 form a salt bridge with the gamma-carboxyl group on L-aspartate, H238 is a base- stacking residue with the pyridine ring of the pyridoxal 5 '-phosphate cofactor, and K352 forms a Schiff base linkage with the pyridoxal 5 '-phosphate cofactor. Thus, these four amino acids are important for L-aspartate or cofactor binding and subsequent L-aspartate decarboxylation, and enzymes homologous to SEQ ID NO: 3 will comprise amino acids corresponding to Q137, H238, K352, and R513 in SEQ ID NO : 3.
2.2.4 Consensus Sequences
[0093] The present invention also provides consensus sequences useful in identifying and/or constructing L-aspartate dehydrogenases and L-aspartate 1 -decarboxylases suitable for use in accordance with the methods of the invention. In various embodiments, these consensus sequences comprise active site amino acid residues believed to be necessary (although the invention is not to be limited by any theory of mechanism of action) for substrate recognition and reaction catalysis, as described below. Thus, a L-aspartate dehydrogenase encompassed by a L- aspartate dehydrogenase consensus sequence provided herein has an enzymatic activity that is identical, or essentially identical, or at least substantially similar with respect to ability to reduce oxaloacetate to L-aspartate to that of one of the enzymes exemplified herein. Likewise, a L- aspartate 1 -decarboxylase encompassed by a L-aspartate 1 -decarboxylase consensus sequence provided herein has an enzymatic activity that is identical, or essentially identical, or at least substantially similar with respect to ability to decarboxylate L-aspartate to beta-alanine to that of one of the enzymes exemplified herein.
[0094] Enzymes also useful in the compositions and methods provided herein include those that are homologous to consensus sequences provided by the invention. As noted above, any enzyme substantially homologous to an enzyme described herein can be used in a host cell of the invention.
[0095] The percent sequence identity of an enzyme relative to a consensus sequence is determined by aligning the enzyme sequence against the consensus sequence. Those skilled in the art will recognize that various sequence alignment algorithms are suitable for aligning an enzyme with a consensus sequence. See, for example, Needleman, SB, et al "A general method applicable to the search for similarities in the amino acid sequence of two proteins." Journal of Molecular Biology 48 (3): 443-53 (1970). Following alignment of the enzyme sequence relative to the consensus sequence, the percentage of positions where the enzyme possesses an amino acid (or dash) described by the same position in the consensus sequence determines the percent sequence identity.
2.2.4.1 L-aspartate dehydrogenase consensus sequences
[0096] An L-aspartate dehydrogenase consensus sequence (SEQ ID NO: 14) provides the sequence of amino acids in which each position identifies the amino acid (if a specific amino acid is identified) or a subset of amino acids (if a position is identified as variable) most likely to be found at a specified position in an L-aspartate dehydrogenase. Those of skill in the art will recognize that fixed amino acids and conserved amino acids in these consensus sequences are identical to (in the case of fixed amino acids) or consistent with (in the case of conserved amino acids) with the wild-type sequence(s) on which the consensus sequence is based. Following alignment of a query protein with a consensus sequence provided herein, the occurrence of a dash in the aligned query protein sequence indicates an amino acid deletion in the query protein sequence relative to the consensus sequence at the indicated position. Likewise, the occurrence of a dash in the aligned consensus sequence indicates an amino acid addition in the query protein sequence relative to the consensus sequence at the indicated position. Amino acid additions and deletions are common to proteins encompassed by consensus sequences of the invention, and their occurrence is reflected as a lower percent sequence identity (i.e., amino acid addition or deletions are treated identically to amino acid mismatches when calculating percent sequence identity).
[0097] In various embodiments, L-aspartate dehydrogenase enzymes suitable for use in accordance with the methods of the invention have L-aspartate dehydrogenase activity and comprise an amino acid sequence with at least 55%, at least 60%>, at least 70%, at least 80%>, at least 90%), or at least 95% sequence identity to SEQ ID NO: 14. For example, the Pseudomonas aeruginosa L-aspartate dehydrogenase (SEQ ID NO: 1) and Cupriavidus taiwanensis L-aspartate dehydrogenase (SEQ ID NO: 2) sequences are 79% and 83%> identical to consensus sequence SEQ ID NO: 14, and are therefore encompassed by consensus sequence SEQ ID NO: 14.
[0098] In enzymes homologous to SEQ ID NO: 14, amino acids that are highly conserved are G8, G10, Al l, 112, G13, E69, A71, G72, H73, A75, H79, P82, L84, G87, S94, G96, A97, L98, A110, Al l l, G114, L120, G123, A124, 1125, G126, D129, A130, A133, A134, G137, G138, L139, V142, Y144, G146, R147, K148, P149, W153, T156, P157, E159, D163, L164, 1173, F174, G176, A178, A181, A182, P186, K187, N188, A189, N190, V191, A192, A193, T194, A198, G199, G201, L202, T205, V207, L209, A211, D212, P213, N218, H220, A224, G226, A227, F228, G229, L233, P239, L240, N243, P244, K245, T246, S247, A248, L249, T250, S253, R256, A257, N260, and 1267. In various embodiments, L-aspartate dehydrogenase enzymes homologous to SEQ ID NO: 14 comprise at least 50%, at least 60%>, at least 70%), at least 80%>, at least 85%>, at least 90%, at least 95%, or sometimes all of these highly conserved amino acids at positions corresponding to the highly conserved amino acids identified in SEQ ID NO: 14. In some embodiments, each of these highly conserved amino acids are found in a desired L-aspartate dehydrogenase, as provided in SEQ ID NOs: 1 and 2.
[0099] Amino acid H220 in SEQ ID NO: 14 functions as a general acid/base (although the invention is not to be limited by any theory of mechanism of action) and is necessary for enzyme activity; thus, an amino acid corresponding to H220 in consensus sequence SEQ ID NO: 14 is found in enzymes homologous to SEQ ID NO: 14. For example, the strictly conserved amino acid corresponding to H220 in consensus sequence SEQ ID NO: 14 is found in L- aspartate dehydrogenases set forth in SEQ ID NOs: 1 and 2.
2.2.4.2 L-aspartate 1-decarboxylase Consensus Sequences
[00100] L-aspartate 1 -decarboxylases also useful in the compositions and methods provided herein include those that are homologous to L-aspartate 1-decarboxylase consensus sequences described herein. Any L-aspartate 1-decarboxylase substantially homologous to an L- aspartate 1-decarboxylase consensus sequence described herein can be used in a host cell of the invention.
[00101] The invention provides two L-aspartate 1-decarboxylase consensus sequences: (i) L- aspartate 1-decarboxylase based on bacterial L-aspartate 1-decarboxylase enzymes (SEQ ID NO: 15), and (ii) L-aspartate 1-decarboxylase based on eukaryotic L-aspartate 1-decarboxylase enzymes (SEQ ID NO: 16). The consensus sequences provide a sequence of amino acids in which each position identifies the amino acid (if a specific amino acid is identified) or a subset of amino acids (if a position is identified as variable) most likely to be found at a specified position in an L-aspartate dehydrogenase of that class. Those of skill in the art will recognize that fixed amino acids and conserved amino acids in these consensus sequences are identical to (in the case of fixed amino acids) or consistent with (in the case of conserved amino acids) with the wild- type sequence(s) on which the consensus sequence is based. Following alignment of a query protein with a consensus sequence provided herein, the occurrence of a dash in the aligned query protein sequence indicates an amino acid deletion in the query protein sequence relative to the consensus sequence at the indicated position. Likewise, the occurrence of a dash in the aligned consensus sequence indicates an amino acid addition in the query protein sequence relative to the consensus sequence at the indicated position. Amino acid additions and deletions are common to proteins encompassed by consensus sequences of the invention, and their occurrence is reflected as a lower percent sequence identity (i.e., amino acid addition or deletions are treated identically to amino acid mismatches when calculating percent sequence identity).
Bacterial L-aspartate 1-decarboxylase Consensus Sequences
[0102] The invention provides a L-aspartate 1-decarboxylase consensus sequence based on bacterial L-aspartate 1-decarboxylase enzymes (SEQ ID NO: 15), and in various embodiments, L-aspartate 1-decarboxylase enzymes suitable for use in accordance with the methods of the invention have L-aspartate 1-decarboxylase activity and comprise an amino acid sequence with at least 40%, at least 45%, at least 50%, or at least 55% sequence identity to SEQ ID NO: 15. The Bacillus subtilis L-aspartate 1-decarboxylase (SEQ ID NO: 5) and Corynebacterium glutamicum L-aspartate 1 -decarboxylase (SEQ ID NO: 4) amino acid sequences are 55% and 79% identical to consensus sequence SEQ ID NO: 15, and are therefore encompassed by consensus sequence SEQ ID NO: 15.
[0103] In enzymes homologous to SEQ ID NO: 15, amino acids that are highly conserved are K9, Hl l, R12, A13, V15, T16, A18, L20, Y22, G24, S25, D29, E42, N51, G52, R54, T57, Y58, 160, G62, G65, G67, N72, G73, A74, A75, A76, G82, D83, V85, 186, Y90, E97, P103, and N112. In various embodiments, L-aspartate 1 -decarboxylase enzymes homologous to SEQ ID NO: 15 comprise at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%), at least 95%, or sometimes all of these highly conserved amino acids at positions corresponding to the highly conserved amino acids identified in SEQ ID NO: 15. For example, all of the highly conserved amino acids are found in the L-aspartate 1 -decarboxylase sequences set forth in SEQ ID NOs: 4 and 5.
[0104] Five strictly conserved amino acids (K9, G24, S25, R54, and Y58) are present in consensus sequence SEQ ID NO: 15, and these residues are important for L-aspartate 1- decarboxylase activity. The function, although the invention is not to be limited by any theory of mechanism of action, of each strictly conserved amino acid is as follows. The epsilon-amine group on K9 forms an ion pair with alpha-carboxyl group on L-aspartate, R54 is forms an ion pair with the gamma-carboxyl group on L-aspartate, and Y58 donates a proton to an extended enolate reaction intermediate. Additional strictly conserved residues in SEQ ID NO: 15 are G24 and S25, and proteolytic cleavage between G24 and S25 results in production of an N-terminal pyruvoyl moiety required for decarboxylase activity. Enzymes homologous to consensus sequence SEQ ID NO: 15 comprise amino acids corresponding to all five of the strictly conserved amino acids identified in consensus sequence SEQ ID NO: 15.
Eukaryotic L-aspartate 1-decarboxylase Consensus Sequences
[0105] The invention provides a second L-aspartate 1-decarboxylase consensus sequence based on eukaryotic L-aspartate 1-decarboxylase enzymes (SEQ ID NO: 16). In various embodiments, L-aspartate 1-decarboxylase enzymes suitable for use in accordance with the methods of the invention have L-aspartate 1-decarboxylase activity and comprise an amino acid sequence with at least 55%, at least 60%, at least 65%, at least 70%, or at least 75% sequence identity to SEQ ID NO: 16. The Tribolium castaneum L-aspartate 1-decarboxylase (SEQ ID NO: 3) amino acid sequence is 70% identical to consensus sequence SEQ ID NO: 16, and is therefore encompassed by consensus sequence SEQ ID NO: 16. [0106] In enzymes homologous to SEQ ID NO: 16, highly conserved amino acids are
V130, P136, D144, L157, S168, V169, T171, H173, P174, F176, N178, Q179, L180, S182, D185, Y187, Q192, T195, D196, L198, N199, P200, S201, Y203, T204, E206, V207, P209, L213, M214, E215, E216, V218, L219, E221, M222, R223, 1225, G227, G234, G236, F238, P240, G241, G242, S243, A245, N246, G247, Y248, 1250, A253, R254, P259, K262, G265, L272, F275, T276, S277, E278, A280, H281, Y282, S283, K286, A288, F290, G292, G294, G307, P328, V331, T334, G336, T337, T338, V339, G341, A342, F343, D344, C353, K355, W359, H361, D363, A364, A365, W366, G367, G368, G369, A370, L371, S373, R377, L379, L380, G382, D387, S388, V389, T390, W391, N392, P393, H394, K395, L396, L397, A399, Q401, Q402, C403, S404, T405, L407, H410, L414, H418, A422, Y424, L425, F426, Q427, D429, K430, F431, Y432, D433, D437, G439, D440, H442, Q444, C445, G446, R447, A449, D450, V451, K453, F454, W455, M457, W458, A460, K461, G462, G465, H469, F474, R487, G489, P497, N501, F504, Y506, P508, R512, L525, A529, P530, K533, E534, M536, G540, M542, T545, Y546, Q547, N554, F555, F556, R557, V559, Q561, S563, L565, D569, M570, E576, E578, and L580. In various embodiments, L-aspartate 1 -decarboxylase enzymes homologous to SEQ ID NO: 16 comprise at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or sometimes all of these highly conserved amino acids at positions corresponding to the highly conserved amino acids identified in SEQ ID NO: 16. All of these highly conserved amino acids are found in the Tribolium castaneum L-aspartate 1- decarboxylases set forth in SEQ ID NO: 3.
[0107] Strictly conserved amino acids in the eukaryotic L-aspartate 1 -decarboxylase consensus sequence (SEQ ID NO: 16) are Q179, H281, K395, and R557. The function, although the invention is not to be limited by any theory of mechanism of action, of each strictly conserved amino acid is as follows. Q179 and R557 form a salt bridge with the gamma-carboxyl group on L-aspartate, H281 is a base-stacking residue with the pyridine ring of the pyridoxal 5'- phosphate cofactor, and K395 forms a Schiff base linkage with the pyridoxal 5 '-phosphate cofactor. Thus, these four amino acids are important for L-aspartate or cofactor binding and subsequent L-aspartate decarboxylation. Enzymes homologous to consensus sequence SEQ ID NO: 16 comprise amino acids corresponding to all four strictly conserved amino acids identified in consensus sequence SEQ ID NO: 16. All four of these strictly conserved amino acids are found in the Tribolium castaneum L-aspartate 1 -decarboxylase set forth in SEQ ID NO: 3.
Section 3: Deletions or disruption of endogenous nucleic acids [0108] In another aspect, the invention provides host cells genetically modified to delete or otherwise reduce the activity of endogenous proteins. Specific nucleic acid sequences are partially, substantially, or completely deleted or disrupted, silenced, inactivated, or down- regulated in order to partially, substantially, or completely reduce or eliminate the activity for which they encode, as in, for example, expression or activity of an enzyme. As used herein, "deletion or disruption" with regard to a nucleic acid means that either all or part of a protein coding region, a promoter, a terminator, and/or other regulatory element is modified (such as by deletion, insertion, or mutation of nucleic acids) such that the nucleic acid no longer produces an protein, produces a reduced quantity of an protein, or produces a protein with reduced activity (e.g., reduced enzymatic activity).
[0109] As used herein, "deletion or disruption" with regard to an enzyme means deletion or disruption of at least one, and often more than one, and sometimes all copies of nucleic acid(s) encoding enzymes with the specified activity. Many host cells suitable for use in the compositions and methods of the invention comprise two or more endogenous nucleic acids encoding two or more enzymes with the same activity. For example, diploid, triploid, and tetraploid microbes comprise two, three, and four sets of chromosomes, respectively, and two nucleic acids encoding for two enzymes with the same enzyme activity are found on each chromosome pair. Likewise, gene duplication events can lead to the occurrence of two or more nucleic acids on the genome of a host cell encoding for two or more enzymes with the same activity. In some embodiments, the recombinant host cells comprise a deletion or disruption of one nucleic acid encoding an enzyme. In other embodiments, the recombinant host cells comprise a deletion or disruption of more than one nucleic acids encoding an enzyme, and sometimes all nucleic acids encoding an enzyme.
[0110] In certain embodiments, the recombinant host cells provided herein comprise a deletion or disruption of one or more metabolic pathways. As used herein, "deletion or disruption" with regard to a metabolic pathway means that the pathway produces a reduced quantity of one or more end-products of the metabolic pathway. In certain embodiments, deletion or disruption of a metabolic pathway is accomplished by deletion or disruption of one or more nucleic acids encoding metabolic pathway enzymes. In some of these embodiments, the recombinant host cell comprising said deleted or disrupted metabolic pathway no longer produces the end-product of the metabolic pathway, or produces at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or more than 95% less end-product of the metabolic pathway as compared to a parental cell.
[0111] In certain embodiments, the nucleic acids deleted or disrupted as described herein may be endogenous to the native strain of the microorganism, and may be understood to be "native nucleic acids" or "endogenous nucleic acids". A nucleic acid is thus an endogenous nucleic acid if it has not been genetically modified or manipulated through human intervention in a manner that intentionally alters the genotype and/or phenotype of the microorganism. For example, a nucleic acid of a wild type organism may be considered to be an endogenous nucleic acid. In other embodiments, the nucleic acids targeted for deletion or disruption may be heterologous to the microorganism.
[0112] In certain embodiments, the recombinant host cells provided herein comprise a deletion or disruption of one or more nucleic acids encoding enzymes. In some of these embodiments, the host cells comprising the one or more deleted or disrupted nucleic acids no longer produce an enzyme, or produce less than 10%>, less than 25%, less than 50%, less than 75%), less than 90%, less than 95%, or less than 97% of the amount of enzyme produced by parental cells. In other embodiments, the recombinant host cells comprising the deleted or disrupted nucleic acid(s) produces the same amount of enzyme as parental cells, but the enzyme exhibits reduced activity as compared to the enzyme encoded by the unmodified nucleic acid. In some of these embodiments, the deleted or disrupted nucleic acid no longer encodes for an active enzyme, or encodes for an enzyme with at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or more than 90% reduced activity as compared to the enzyme encoded by the endogenous nucleic acid. Those skilled in the art will recognize that deletion or disruption of a nucleic acid can simultaneously result in both a decrease in the quantity of an enzyme produced by a recombinant host cell as well as a decrease in the activity of an enzyme encoded by the deleted or disrupted nucleic acid.
3.1. Deletion or disruption of endogenous anaerobic pathways and enzymes encoding endogenous anaerobic pathway enzymes
[0113] The present invention describes the engineering of a recombinant host cell to convert various endogenous anaerobic fermentation pathways into anaerobic L-aspartate, and optionally beta-alanine, pathways. Microbes will not grow under anaerobic growth conditions unless the fermentation pathway is redox balanced (i.e., there is no net accumulation of NADH, NADPH, or other redox cofactor). [0114] Reduction and oxidation (redox) reactions play a key role in anaerobic metabolism, allowing the transfer of electrons from one compound to another, and thereby creating free energy for use in cellular metabolism. Redox co-factors facilitate the transfer of electrons from one chemical to another within the host cell. Several compounds and proteins can function as redox co-factors. During anaerobic catabolism of carbohydrates the most relevant co- factors are nicotinamide adenine dinucleotides (NADH and NADPH), and the iron sulfur protein ferredoxin (Fd). Typically, NADH is the most relevant co-factor in yeast cells during anaerobic catabolism of carbohydrates.
[0115] In order for cellular growth, the redox co-factors must discharge the same number of electrons they accept; thus, the net electron accumulation in the host cell is zero. Electrons are placed onto redox co-factors during carbohydrate catabolism, and must be removed from redox co-factors during end-product formation. In order for an end-product to be produced at high yield under anaerobic conditions the type and number of redox co-factors used during carbohydrate catabolism must match the type and number of redox co-factors used during end-product formation.
[0116] Carbohydrate catabolism ends in the formation of pyruvate, and electrons are removed during the conversion of glyceraldehyde 3-phosphate to 1, 3 -biphosphogly cerate (providing two electrons). This reaction is catalyzed by glyceraldehyde phosphate dehydrogenase (GAPDH; EC 1.2.1.12), and in yeast the endogenous enzyme uses NAD+ is used as the electron acceptor. When using glucose as the carbohydrate, two mols glyceraldehyde 3- phosphate can be theoretically produced per mol glucose, and thus two mols NADH can theoretically be produced per mol glucose in host cells expressing an NAD-dependent GAPDH. GAPDH enzymes may use alternate co-factors, including NADPH; NADP-dependent GAPDH enzymes are categorized under enzyme commission number EC 1.2.1.13, and include those found in Chlamydomonas reinhardtii, Clostridium acetobutylicum, Spinacia oleracea, and Sulfolobus solfataricus, among others. Host cells comprising NAD-dependent GAPDH enzymes can be engineered using standard microbial engineering techniques to express NADP-dependent GAPDH enzymes and thus produce NADPH, or a combination of NADH and NADPH, during carbohydrate catabolism to pyruvate.
[0117] Redox co-factors accepting electrons during catabolism of carbohydrates to pyruvate must discharge those electrons during production of the fermentation end- product to enable anaerobic growth and/or production of the end-product at high yield. Microbes capable of growth under substantially anaerobic conditions comprise one or more endogenous anaerobic fermentation pathways whose activity results in the reconsumption of redox cofactors produced during carbohydrate catabolism. The activity of endogenous anaerobic fermentation pathway(s) reduces the availability of redox cofactors for use by the heterologous L-aspartate pathway enzymes of the invention, thereby decreasing L-aspartate and/or beta-alanine yields from carbohydrates. Therefore, deletion or disruption of endogenous anaerobic fermentation pathways and nucleic acids encoding endogenous anaerobic fermentation pathway enzymes is useful for increasing the yield of L-aspartate and/or beta-alanine produced by recombinant host cells of the invention grown under substantially anaerobic conditions.
[0118] An anaerobic fermentation pathway is any metabolic pathway that: (i) comprises enzymes that reconsume redox cofactors produced during carbohydrate catabolism, and (ii) whose activity results in a detectable level of end-product in host cells grown under substantially anaerobic conditions. Examples of anaerobic fermentation pathways include, but are not limited to, ethanol, glycerol, malate, lactate, 1-butanol, isobutanol, 1,3 -propanediol, and 1,2-propanediol anaerobic fermentation pathways. For example, ethanol is the main fermentation end-product of most wild-type microbes, and especially yeast, grown anaerobically on carbohydrate, and the redox co-factors produced during catabolism of carbohydrates to pyruvate are reconsumed during conversion of pyruvate to ethanol. In the recombinant host cells of the present invention, the endogenous fermentation pathway, typically, but not limited to, an ethanol fermentation pathway, has been deleted or disrupted. Redox cofactors produced during pyruvate formation from glucose are reconsumed during production of L-aspartate through the activity of an L- aspartate dehydrogenase, and the net result is a redox balanced, and thus anaerobic, fermentation pathway capable of producing L-aspartate and/or beta-alanine at high yield.
3.2. Deletion or disruption of ethanol fermentation pathways and nucleic acids encoding ethanol fermentation pathway enzymes
[0119] Deletion or disruption of ethanol fermentation pathway(s) and nucleic acids encoding ethanol fermentation pathway enzymes is important for engineering a recombinant host cell capable of efficient production of L-aspartate and/or beta-alanine under substantially anaerobic conditions.
[0120] In yeast host cells, an ethanol fermentation pathway comprises two enzymes: pyruvate decarboxylase and alcohol dehydrogenase. Pyruvate decarboxylase (EC 4.1.1.1) catalyzes the decarboxylation of pyruvate to acetaldehyde; alcohol dehydrogenase (EC 1.1.1.1) catalyzes the reduction of acetaldehyde to ethanol along with concomitant oxidation of NADH to NAD+ and/or NADPH to NADP+. In yeast cells of the invention, an ethanol fermentation pathway can be deleted or disrupted by deletion or disruption of one or more nucleic acids encoding pyruvate decarboxylase and/or alcohol dehydrogenase. In certain embodiments, the recombinant host cells provided herein comprise a deletion or disruption of one or more endogenous nucleic acids encoding an ethanol fermentation pathway enzyme. In some embodiments, the recombinant host cells provided herein comprise a deletion or disruption of one or more nucleic acids encoding pyruvate decarboxylase. In some embodiments, the recombinant host cells provided herein comprise a deletion or disruption of one or more nucleic acids encoding alcohol dehydrogenase. In some embodiments, the recombinant host cells provided herein comprise a deletion or disruption of one or more nucleic acids encoding pyruvate decarboxylase and alcohol dehydrogenase.
[0121] Deletion or disruption of nucleic acids encoding ethanol fermentation pathway enzymes decrease the ability of the recombinant host cell to produce ethanol and/or increases the ability of the recombinant host cell to produce L-aspartate or beta-alanine. In various embodiments, recombinant host cells comprising deletion or disruption of one or more nucleic acids encoding ethanol fermentation pathway enzymes decreases ethanol production by at least 10%, at least 25%, at least 50%, at least 60%, at least 70%, at least 90%, at least 95%, or at least 99%) as compared to parental cells that do not comprise this genetic modification. In some embodiments, recombinant host cells comprising deletion or disruption of one or more nucleic acids encoding ethanol fermentation pathway enzymes increase L-aspartate or beta-alanine production by at least 10%>, at least 25%, at least 50%, at least 75%, at least 100%>, or more than 100%) as compared to parental cells that do not comprise this genetic modification.
3.2.1 Deletion or disruption of nucleic acids encoding pyruvate decarboxylase
[0122] In various embodiments, the recombinant host cells comprise a deletion or disruption of one or more nucleic acids encoding pyruvate decarboxylase. In some embodiments, one nucleic acid encoding pyruvate decarboxylase is deleted or disrupted. In other embodiments, two nucleic acids encoding pyruvate decarboxylase are deleted or disrupted. In other embodiments, more than two nucleic acids encoding pyruvate decarboxylase are deleted or disrupted. In still further embodiments, all nucleic acids encoding pyruvate decarboxylase are deleted or disrupted. [0123] In various embodiments, the recombinant host cell comprises a deletion or disruption of one or more nucleic acids encoding pyruvate decarboxylases with an amino acid sequence set forth in SEQ ID NO: 9, or one or more nucleic acids encoding enzymes with an amino sequence with at least 50%, at least 60%, at least 70%, at least 80%, at least 95%, at least 97%), or at least 99% sequence identity to the amino acid sequence of SEQ ID NO: 9. In specific embodiments wherein the recombinant host cell of the invention is Pichia kudriavzevii, the recombinant host cell comprises a deletion or disruption of two nucleic acids encoding pyruvate decarboxylases with an amino acid sequence set forth in SEQ ID NO: 9, or two nucleic acids encoding enzymes with amino sequences with at least 50%, at least 60%, at least 70%, at least 80%), at least 95%, at least 97%, or at least 99% sequence identity to the amino acid sequence of SEQ ID NO: 9.
[0124] Some yeast cells have more than one nucleic acid encoding pyruvate decarboxylase, and in these host cells one or more nucleic acids encoding pyruvate decarboxylases may be deleted or disrupted for the purposes of deleting or disrupting the ethanol fermentation pathway. For example, wild type Saccharomyces cerevisiae has three endogenous pyruvate decarboxylases: PDC1 (SEQ ID NO: 10), PDC5, and PDC6. PDC1 is the major isoform (has the highest expression level and/or activity) in S. cerevisiae while PDC5 and PDC6 are minor isoforms. In certain embodiments wherein the recombinant host cell of the invention is Saccharomyces cerevisiae, the recombinant host cell comprises a deletion or disruption of one or more nucleic acids encoding pyruvate decarboxylases with an amino acid sequence set forth in SEQ ID NO: 10, or one or more nucleic acids encoding enzymes with amino acid sequences with at least 50%, at least 60%, at least 70%, at least 80%, at least 95%, at least 97%, or at least 99% sequence identity to the amino acid sequence of SEQ ID NO: 10. For example, S. cerevisiae pyruvate decarboxylases PDC5 and PDC6 have 88% and 84% amino acid sequence identity, respectively, to the amino acid sequence set forth in SEQ ID NO: 10.
3.2.2 Deletion or disruption of nucleic acids encoding alcohol dehydrogenase
[0125] In addition to deletion or disruption of nucleic acid encoding pyruvate decarboxylase, a yeast ethanol fermentation pathway can be deleted or disrupted by deletion or disruption of nucleic acids encoding alcohol dehydrogenase. In various embodiments, the recombinant host cells provided herein comprise a deletion or disruption of one or more nucleic acids encoding alcohol dehydrogenase. In some embodiments, one nucleic acid encoding alcohol dehydrogenase is deleted or disrupted. In other embodiments, two nucleic acids encoding alcohol dehydrogenase are deleted or disrupted. In other embodiments, more than two nucleic acids encoding alcohol dehydrogenase are deleted or disrupted. In still further embodiments, all nucleic acids encoding alcohol dehydrogenase are deleted or disrupted.
[0126] In certain embodiments, the recombinant host cell comprises a deletion or disruption of a nucleic acid encoding an alcohol dehydrogenase with an amino acid sequence set forth in SEQ ID NO: 11, or with at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or greater than 97% sequence identity to SEQ ID NO: 11. In specific embodiments wherein the recombinant host cell of the invention is Pichia kudriavzevii, the recombinant host cell comprises a deletion or disruption of two nucleic acids encoding alcohol dehydrogenase with an amino acid sequence set forth in SEQ ID NO: 11, or two nucleic acids encoding enzymes with amino sequences with at least 50%, at least 60%, at least 70%), at least 80%, at least 95%, at least 97%, or at least 99% sequence identity to the amino acid sequence of SEQ ID NO: 11.
3.3 Deletion or disruption of malate fermentation pathways and nucleic acids encoding malate dehydrogenase
[0127] A malate fermentation pathway comprises one enzyme, malate dehydrogenase
(EC 1.1.1.37), which catalyzes the formation of malate (the end-product of a malate fermentation pathway) from oxaloacetate along with concomitant oxidation of NADH to NAD+. Those skilled in the art will recognize that malate dehydrogenase and L-aspartate dehydrogenase use the same substrate (oxaloacetate) and will often use the same redox cofactor (NADH or NADPH) to produce their respective products. Thus, the expression of endogenous malate dehydrogenase, and particularly malate dehydrogenase located in the cytosol of yeast cells, can decrease anaerobic production of L-aspartate and/or beta-alanine. Thus, deletion or disruption of a malate fermentation pathway is useful for increasing L-aspartate or beta-alanine production in recombinant host cells of the invention grown under substantially anaerobic conditions. A malate fermentation pathway can be deleted or disrupted by deletion or disruption of nucleic acids encoding malate dehydrogenase.
[0128] In various embodiments, the recombinant host cells comprise a deletion or disruption of one or more nucleic acids encoding malate dehydrogenase. In some embodiments, one nucleic acid encoding malate dehydrogenase is deleted or disrupted. In other embodiments, two nucleic acids encoding malate dehydrogenase are deleted or disrupted. In other embodiments, more than two nucleic acids encoding malate dehydrogenase are deleted or disrupted. In still further embodiments, all nucleic acids encoding malate dehydrogenase are deleted or disrupted.
[0129] In various embodiments, the recombinant host cell comprises a deletion or disruption of one or more nucleic acids encoding malate dehydrogenase with an amino acid sequence set forth in SEQ ID NO: 13, or one or more nucleic acids encoding enzymes with an amino sequence with at least 50%, at least 60%>, at least 70%, at least 80%>, at least 95%, at least 97%), or at least 99% sequence identity to the amino acid sequence of SEQ ID NO: 13. In specific embodiments wherein the recombinant host cell of the invention is Pichia kudriavzevii, the recombinant host cell comprises a deletion or disruption of two nucleic acids encoding malate dehydrogenase with an amino acid sequence set forth in SEQ ID NO: 13, or two nucleic acids encoding enzymes with amino sequences with at least 50%, at least 60%, at least 70%, at least 80%), at least 95%, at least 97%, or at least 99% sequence identity to the amino acid sequence of SEQ ID NO: 13.
3.4 Deletion or disruption of additional byproduct metabolic pathways and nucleic acids encoding byproduct metabolic pathway enzymes
[0130] Besides ethanol and malate, additional byproducts are formed by host cells of the invention, including glycerol, acetic acid, and various four-carbon dicarboxylic acids (e.g., fumarate and succinate). Deletion or disruption of these byproduct metabolic pathways and nucleic acids encoding byproduct metabolic pathway enzymes are also useful for increasing L- aspartate or beta-alanine production by host cells of the invention.
[0131] In certain embodiments, recombinant host cells provided herein comprise a deletion or disruption of a glycerol fermentation pathway. A glycerol fermentation pathway comprises one enzyme, NAD-dependent glycerol-3 -phosphate dehydrogenase (EC 1.1.1.8), which catalyzes the formation of glycerol (the end-product of a glycerol metabolic pathway) from glycerol-3 -phosphate along with concomitant oxidation of NADH to NAD+. Glycerol fermentation pathway activity decreases the pool of NADH available for use L-aspartate dehydrogenase in the production of L-aspartate from oxaloacetate in recombinant host cells of the invention grown under substantially anaerobic conditions. Thus, deletion or disruption of a glycerol fermentation pathway is useful for increasing L-aspartate or beta-alanine production in recombinant host cells of the invention. A glycerol metabolic pathway can be deleted or disrupted by deletion or disruption of nucleic acids encoding NAD-dependent glycerol-3- phosphate dehydrogenase. [0132] In various embodiments, the recombinant host cells comprise a deletion or disruption of one or more nucleic acids encoding NAD-dependent glycerol-3 -phosphate dehydrogenase. In some embodiments, one nucleic acid encoding NAD-dependent glycerol-3 - phosphate dehydrogenase is deleted or disrupted. In other embodiments, two nucleic acids encoding NAD-dependent glycerol-3 -phosphate dehydrogenase are deleted or disrupted. In other embodiments, more than two nucleic acids encoding NAD-dependent glycerol-3 -phosphate dehydrogenase are deleted or disrupted. In still further embodiments, all nucleic acids encoding NAD-dependent glycerol-3 -phosphate dehydrogenase are deleted or disrupted.
[0133] In various embodiments, the recombinant host cell comprises a deletion or disruption of one or more nucleic acids encoding NAD-dependent glycerol-3 -phosphate dehydrogenase with an amino acid sequence set forth in SEQ ID NO: 12, or one or more nucleic acids encoding enzymes with an amino sequence with at least 50%, at least 60%, at least 70%, at least 80%), at least 95%, at least 97%, or at least 99% sequence identity to the amino acid sequence of SEQ ID NO: 12. In specific embodiments wherein the recombinant host cell of the invention is Pichia kudriavzevii, the recombinant host cell comprises a deletion or disruption of two nucleic acids encoding NAD-dependent glycerol-3 -phosphate dehydrogenase with an amino acid sequence set forth in SEQ ID NO: 12, or two nucleic acids encoding enzymes with amino sequences with at least 50%, at least 60%, at least 70%, at least 80%, at least 95%, at least 97%, or at least 99% sequence identity to the amino acid sequence of SEQ ID NO: 12.
Section 4. Genetic modifications to increase L-aspartic acid production
[0134] In another aspect, the invention provides host cells genetically modified to express heterologous nucleic acids encoding enzymes enabling energy efficient L-aspartic acid production. "Energy efficient", as defined herein, refers to production of L-aspartic acid with a lower ATP requirement as compared to a parental, or control strain. Decreasing the expenditure of ATP is important aspect of L-aspartate production under substantially anaerobic conditions. If host cell ATP requirements become sufficiently high, additional oxygen must be provided to the culture to support L-aspartate production. Two enzymes useful for increasing the energy efficiency of L-aspartate production in genetically modified host cells of the invention are ureases (EC 3.5.1.5) and L-aspartate permeases.
Urease enzymes
[0135] Ammonia is a co-substrate necessary for L-aspartate production using an L- aspartate dehydrogenase and a nitrogen source must be provided to the fermentation for L- aspartate production. Two commonly used nitrogen sources for fermentative production of small-molecule products are ammonia and urea. Urea is the preferred source of nitrogen as compared to ammonia for at least three reasons. First, urea is non-toxic and can be added at high concentrations; by comparison, ammonia, another commonly used nitrogen source in industry, is basic and high concentrations are toxic to many host cells. Second, urea is neutrally charged, can diffuse across the host cell plasma membrane (i.e., no energy is expended for transport), and the fermentation pH is unaffected by its addition to the fermentation medium. By comparison, ammonia charged and must be transported into the cell enzymatically. Third, the breakdown of urea also releases C02, a co-substrate for enzymes in all L-aspartate biosynthetic pathways. No CO2 is released during catabolism of ammonia.
[0136] Urease enzymes catalyze the hydrolysis of one molecule urea to one molecule carbamate and one molecule ammonia; subsequent to enzymatic production, the one molecule carbamate then degrades into a ammonia and carbonic acid. Thus, in sum, urease activity results in production of two molecules urea and one molecule carbon dioxide per catalytic cycle. Importantly, urease performs this reaction without expenditure of ATP. In contrast, alternative metabolic pathways capable of catalyzing conversion of urea to ammonia and carbon dioxide do require expenditure of ATP. For example, many host cells, including many yeast host cells, use a urea catabolic pathway comprising the enzymes urea carboxylase and allophenate hydrolase; using this pathway, one molecule ATP is expended per molecule urea catabolized.
[0137] In many embodiments of the present invention, host cells engineered for production of L-aspartate express heterologous nucleic acids encoding a urease. In many of these embodiments, the expressed urease is a Schizosaccharomyces pombe urease. The Schizosaccharomyces pombe urease is comprised of four protein subunits, namely Ure2, UreD, UreF, and UreG proteins. The Schizosaccharomyces pombe urease also uses nickel metal as a cofactor and in some embodiments the engineered host cell expresses one or more heterologous genes encoding a nickel transporter. One suitable nickel transporter protein is the Schizosaccharomyces pombe Nicl nickel-transporter. Aspartate permeases
[0138] Low-cost L-aspartate production benefits from export of L-aspartate from the cytosol, across the host cell membrane, and into the surrounding culture medium. Likewise, it is desirable to export L-aspartate without ATP expenditure, thereby enabling more energy efficient L-aspartate production. [0139] One L-aspartate transport protein suitable for L-aspartate export in engineered host cells of the invention is Arabidopsis thaliana SIAR1 and its homologs. Another suitable L- aspartate transport protein is Arabidopsis thaliana bidirectional amino acid transporter 1 (BAT1) Section 5. Methods of producing L-aspartate or Beta-alanine
[0140] In another aspect, methods are provided herein for producing L-aspartate or beta- alanine by recombinant host cells of the invention. In certain embodiments, these methods comprise the steps of: (a) culturing a recombinant host cell described herein in a medium containing at least one carbon source and one nitrogen source under substantially anaerobic conditions such that L-aspartate is produced; and (b) recovering said L-aspartate from the medium. In other embodiments, these methods comprise the steps of: (a) culturing a recombinant host cell described herein in a medium containing at least one carbon source and one nitrogen source under aerobic conditions such that L-aspartate is produced; and (b) recovering said L- aspartate from the medium. In other embodiments, these methods comprise the steps of: (a) culturing a recombinant host cell described herein in a medium containing at least one carbon source and one nitrogen source under substantially anaerobic conditions such that beta-alanine is produced; and (b) recovering said beta-alanine from the medium. The L-aspartate or beta-alanine can be secreted into the culture medium.
[0141] It is understood that, in the methods of the invention, any of the one or more heterologous nucleic acids can be introduced into a host cell to produce a recombinant host cell of the invention. For example, the heterologous nucleic acids can be introduced so as to confer a L-aspartate fermentation pathway onto the host cell. The recombinant host cell may further comprise heterologous nucleic acids encoding L-aspartate 1 -decarboxylase so as to confer the ability for the recombinant host cell to produce beta-alanine. Alternatively, heterologous nucleic acids can be introduced to produce an intermediate host cell having the biosynthetic capability to catalyze some of the required metabolic reactions to confer L-aspartate or beta-alanine biosynthetic capability.
[0142] Any of the recombinant host cells described herein can be cultured to produce and/or secrete L-aspartate or beta-alanine. For example, recombinant host cells producing L- aspartate can be cultured for the biosynthetic production of L-aspartate. The L-aspartate can be isolated or treated as described below to produce beta-alanine or polyL-aspartate. Similarly, recombinant host cells producing beta-alanine can be cultured for the biosynthetic production of beta-alanine. The beta-alanine can be isolated and subjected to further treatments for the chemical synthesis of beta-alanine family of compounds, including, but not limited to, pantothenic acid, beta-alanine alkyl esters (e.g., beta-alanine methyl ester, beta-alanine ethyl ester, beta-alanine propyl ester, and the like), and poly(beta-alanine).
[0143] The methods of producing L-aspartate or beta-alanine provided herein may be performed in a suitable fermentation broth in a suitable fermentation vessel, including but not limited to a culture plate, a flask, or a fermentor. Further, the methods of the invention can be performed at any scale of fermentation known in the art to support industrial production of microbially produced small-molecules. Any suitable fermentor may be used including a stirred tank fermentor, an airlift fermentor, a bubble column fermentor, a fixed bed bioreactor, or any combination thereof.
[0144] In some embodiments, the fermentation broth is any fermentation broth in which a recombinant host cell capable of producing L-aspartate or beta-alanine can subsist (maintain growth and/or viability). In some embodiments, the fermentation broth is an aqueous medium comprising assimilable carbon, nitrogen, and phosphate sources. Such a medium can also include appropriate salts, minerals, metals, and other nutrients. In some embodiments, the carbon source and each of the essential cell nutrients are provided to the fermentation broth incrementally or continuously, and is essential cell nutrient is maintained at essentially the minimum level required for efficient assimilation by growing cells.
[0145] In some embodiments, culturing of the cells provided herein to produce L- aspartate or beta-alanine may be divided up into phases. For example, the cell culture process may be divided up into a growth phase, a production phase, and/or a recovery phase. The following paragraphs provide examples of specific conditions that may be used for these phases. One skilled in the art will recognize that these conditions may be varied based on the host cell used, the desired L-aspartate or beta-alanine yield, titer, and/or productivity, or other factors.
[0146] Carbon source. The carbon source provided to the fermentation can be any carbon source that can be fermented by the host cell. Suitable carbon sources include, but are not limited to, monosaccharides, disaccharides, polysaccharides, acetate, ethanol, methanol, methane, or one or more combinations thereof. Exemplary monosaccharides suitable for use in accordance to the methods of the invention include, but are not limited to, dextrose, fructose, galactose, xylose, arabinose, and combinations thereof. Exemplary disaccharides suitable for use in accordance to the methods of the invention include, but are not limited to, sucrose, lactose, maltose, trehalose, cellobiose, and combinations thereof. Exemplary polysaccharides suitable for use in accordance to the methods of the invention include, but are not limited to, starch, glycogen, cellulose, and combinations thereof. In some embodiments, the carbon source is dextrose. In other embodiments, the carbon source is sucrose.
[0147] Nitrogen. Every molecule of L-aspartate or beta-alanine comprises nitrogen atom, and in order to produce L-aspartate or beta-alanine at a high yield, a suitable source of assimilable nitrogen must be provided to the fermentation during host cell cultivation. As used herein, assimilable nitrogen refers to nitrogen that is capable of being metabolized by the host cell of the invention and used in produce L-aspartate. The nitrogen source may be any assimilable nitrogen source that can be utilized by the host cell, including, but not limited to, anhydrous ammonia, ammonium sulfate, ammonium nitrate, diammonium phosphate, monoammonium phosphate, ammonium polyphosphate, sodium nitrate, urea, peptone, protein hydrolysates, and yeast extract. In one embodiment, the nitrogen source is anhydrous ammonia. In another embodiment, the nitrogen source is ammonium sulfate. In yet a further embodiment, the nitrogen source is urea. Those skilled in the art will recognize that the mols assimilable nitrogen is dependent on the nitrogen source, and, for example, one mol of anhydrous ammonia ( H3) comprises 1 mol assimilable nitrogen while one mol of diammonium phosphate ( H4)2P04 comprises 2 mols assimilable nitrogen.
[0148] A minimum amount of assimilable nitrogen must be provided to the fermentation during host cell cultivation to achieve high L-aspartate or beta-alanine yields. In certain embodiments of the methods provided herein wherein the carbon source is dextrose, the molar ratio of assimilable nitrogen to dextrose provided to the fermentation during host cell cultivation is at least 0.25 : 1, at least 0.5 : 1, at least 0.75 : 1, 1 : 1, at least 1.25 : 1, at least 1.5 : 1, at least 1.75 : 1, at least 2: 1, or greater than 2: 1. In certain embodiments of the methods provided herein wherein the carbon source is sucrose, the molar ratio of assimilable nitrogen to sucrose is at least 0.1 : 1, at least 0.2: 1, at least 0.3 : 1, at least 0.4: 1, at least 0.5 : 1, at least 0.6: 1, at least 0.7: 1, at least 0.8: 1, at least 0.9: 1, at least 1 : 1, or greater than 1 : 1.
[0149] pH. The pH of the culture medium can be controlled by the addition of acid or base to the culture medium. Preferably, the pH is maintained from about 3.0 to about 8.0.
[0150] Aspartic acid exhibits a relatively low solubility in water and will crystallize from solution. Only about 6 g/1 aspartic acid is soluble at 30°C. Crystallization occurs when the concentration of the fully protonated, aspartic acid, form of L-aspartate increases to above the solubility limit. It is advantageous to crystallize aspartic acid during the fermentation for several reasons. First, crystallization provides an aspartic acid sink, enabling a high concentration gradient to be maintained across the cell membrane and helping to increase the kinetics of product export outside the host cell. Second, the L-aspartic acid that has crystallized from solution in the fermentation can be more readily separated from the majority of the cells and fermentation broth, accomplishing a purification step.
[0151] To facilitate efficient purification, in many cases, it is desirable for the majority of the L-aspartate to be in the insoluble, crystallized form (i.e. crystallized aspartic acid) prior to purification. Preferably, greater than about 50 g/1 aspartic acid is in an insoluble, crystallized form prior to purification of the aspartic acid from the fermentation broth. More preferably, greater than about 75 g/1 of aspartic acid produced is an insoluble, crystallized form prior to purification of the aspartic acid from the fermentation broth.
[0152] To crystallize aspartic acid from the fermentation broth, the pH of the fermentation should be decreased to below pH 3.86, the pKa of aspartic acid R-chain, prior to L-aspartate purification. The broth pH can be decreased during the fermentation (i.e., while the host cells are producing aspartic acid), and/or the broth pH can be decreased at the conclusion of the fermentation. The broth pH can be decreased due to endogenous production of aspartic acid, and/or the broth pH can be decreased due to supplementation of an acid to the fermentation. Non-limiting examples of suitable acids include aspartic acid, acetic acid, hydrochloric acid, and sulfuric acid.
[0153] Temperature. The temperature of the fermentation broth can be any temperature suitable for growth of the recombinant host cells and/or production of L-aspartate or beta- alanine. Preferably, during host cell production of L-aspartate or beta-alanine the fermentation broth is maintained at a temperature in the range of from about 20° C to about 45° C, preferably in the range of from about 25° C to about 37° C, and more preferably in the range from about 28° C to about 32° C.
[0154] Oxygen. During cultivation, aeration and agitation conditions are selected to produce a desired oxygen uptake rate. In various embodiments, conditions are selected to produce an oxygen uptake rate of around 0-25 mmol/l/hr. In some embodiments conditions are selected to produce an oxygen uptake rate of around 2.5-15 mmol/l/hr. Oxygen uptake rate as used herein refers to the volumetric rate at which oxygen is consumed during the fermentation. Inlet and outlet oxygen concentrations can be measured with exhaust gas analysis, for example by mass spectrometers. Oxygen uptake rate can be calculated by one of ordinary skill in the art using the Direct Method described in Bioreaction Engineering Principles 3rd Edition, 2011, Spring Science + Business Media, p. 449.
[0155] While the L-aspartate pathways described herein are preferably used to produce
L-aspartate or beta-alanine under substantially anaerobic conditions, they are capable of producing L-aspartate or beta-alanine under a range of oxygen concentrations. In some embodiments, the L-aspartate pathways produce L-aspartate or beta-alanine under aerobic conditions. In preferred embodiments, the L-aspartate pathways produce L-aspartate or beta- alanine under substantially anaerobic conditions.
[0156] A high yield of either L-aspartate or beta-alanine from the provided carbon and nitrogen source(s) is desirable in order to decrease the production cost. As used herein, yield is calculated as the percentage of the mass of carbon source catabolized by host cells of the invention and used to produce either L-aspartate or beta-alanine. In some cases, only a fraction of the carbon source provided to a fermentation is catabolized by host the cells, and the remainder is found unconsumed in the fermentation broth or is consumed by contaminating microbes in the fermentation. Thus, it is important to both ensure that fermentation is both substantially pure of contaminating microbes and that the concentration of unconsumed carbon source at the completion of the fermentation is measured. For example, if 100 grams of glucose are provided to host cells, and at the end of the fermentation 25 grams of beta-alanine are produced and there remains 10 grams of glucose, the beta-alanine yield is 27.7% (i.e., 10 grams beta-alanine from 90 grams glucose). In certain embodiments of the methods provided herein, the final yield of L-aspartate on the carbon source is at least 10%>, at least 20%, at least 30%>, at least 40%), at least 50%, or greater than 50%. In certain embodiments, the host cells provided herein are capable of producing at least 80%>, at least 85%>, or at least 90% by weight of carbon source to L-aspartate. In certain embodiments of the methods provided herein, the final yield of beta-alanine on the carbon source is at least 10%, at least 20%, at least 30%, at least 40%, at least 50%), or greater than 50%. In certain embodiments, the host cells provided herein are capable of producing at least 80%, at least 85%, or at least 90% by weight of carbon source to beta-alanine.
[0157] In addition to yield, the titer, or concentration, of L-aspartate or beta-alanine produced in the fermentation is another important metric for decreasing production, and, assuming all other metrics are equal, a higher titer is preferred as compared to a lower titer. Generally speaking, titer is provided as grams product (e.g., L-aspartate or beta-alanine) produced per liter of fermentation broth (i.e., g/1). In some embodiments, the L-aspartate titer is at least 1 g/1, at least 5 g/1, at least 10 g/1, at least 15 g/1, at least 20 g/1, at least 25 g/1, at least 30 g/1, at least 40 g/1, at least 50 g/1, at least 60 g/1, at least 70 g/1, at least 80 g/1, at least 90 g/1, at least 100 g/1, or greater than 100 g/1 at some point during the fermentation, and preferably at the conclusion of the fermentation. In other embodiments, the beta-alanine titer is at least 1 g/1, at least 5 g/1, at least 10 g/1, at least 15 g/1, at least 20 g/1, at least 25 g/1, at least 30 g/1, at least 40 g/1, at least 50 g/1, at least 60 g/1, at least 70 g/1, at least 80 g/1, at least 90 g/1, at least 100 g/1, or greater than 100 g/1 at some point during the fermentation, and preferably at the conclusion of the fermentation.
[0158] Further, productivity, or the rate of product (i.e., L-aspartate or beta-alanine) formation, is important for decreasing production cost, and, assuming all other metrics are equal, a higher productivity is preferred over a lower productivity. Generally speaking, productivity is provided as grams product produced per liter of fermentation broth per hour (i.e., g/l/hr). In some embodiments, the L-aspartate productivity is at least 0.1 g/1, at least 0.25 g/1, at least 0.5 g/1, at least 0.75 g/1, at least 1.0 g/1, at least 1.25 g/1, at least 1.25g/l, at least 1.5 g/1, or greater than 1.5 g/1 over some time period during the fermentation. In other embodiments, the beta-alanine productivity is at least 0.1 g/1, at least 0.25 g/1, at least 0.5 g/1, at least 0.75 g/1, at least 1.0 g/1, at least 1.25 g/1, at least 1.25g/l, at least 1.5 g/1, or greater than 1.5 g/1 over some time period during the fermentation.
[0159] Decreasing byproduct formation is also important for decreasing production cost, and, generally speaking, the lower the byproduct concentration the lower the production cost. Byproducts that can occur during production of L-aspartate or beta-alanine producing host cells in accordance with the methods of the invention include ethanol, acetate, and pyruvate. In certain embodiments of the methods provided herein, the recombinant host cells produce ethanol at a low yield from the provided carbon source. In certain embodiments, ethanol may be produced at a yield of 10% or less, and preferably at a yield of 5% or less at the conclusion of the fermentation. In certain embodiments of the methods provided herein, the recombinant host cells produce acetate at a low yield from the provided carbon source. In certain embodiments, acetate may be produced at a yield of 10% or less, and preferably at a yield of 5% or less at the conclusion of the fermentation. In certain embodiments of the methods provided herein, the recombinant host cells produce pyruvate at a low yield from the provided carbon source. In certain embodiments, pyruvate may be produced at a yield of 10% or less, and preferably at a yield of 5% or less at the conclusion of the fermentation. [0160] Fermentation procedures are particularly useful for the biosynthetic production of commercial quantities of L-aspartate and/or beta-alanine. Fermentation procedures can be scaled up for manufacturing of L-aspartate or beta-alanine. Exemplary fermentation procedures include, for example, fed-batch fermentation and batch product separation; fed-batch fermentation and continuous product separation; batch fermentation and batch product separation; and continuous fermentation and continuous product separation. All of these processes are well known in the art.
[0161] In addition to the biosynthesis of L-aspartate and beta-alanine as described herein, the recombinant host cells and methods of the invention can also be utilized in various combinations with each other and with other microbes and methods known in the art to achieve product biosynthesis by other routes. For example, one alternative to product beta-alanine other than the use of L-aspartate producing host cell of the invention and chemical conversion or other than the use of a beta-alanine producing host cell of the invention is through addition of a second microbe capable of converting L-aspartate to beta-alanine.
[0162] One such procedure includes, for example, the cultivation of a L-aspartate producing host cell of the invention to produce L-aspartate as described herein. The L-aspartate can then be used as a substrate for a second microbe that converts L-aspartate to beta-alanine. The L-aspartate can be added directly to another culture of the second microbe, or the L- aspartate producing microbes in the original culture can be removed by, for example, cell separation and the second microbe capable of producing beta-alanine from L-aspartate added to the culture in a sufficient amount to enable production of beta-alanine from the L-aspartate in the fermentation broth.
EXAMPLES
Example 1: Construction of engineered Pichia kudriavzevii strains expressing L-aspartate dehydrogenases, and their use in the production of L-aspartate in yeast
[0163] Nucleic acids encoding different L-aspartate dehydrogenases were codon-optimized for yeast, synthesized, and integrated into the Pichia kudriavzevii genome; in vivo expression of the L-aspartate dehydrogenases resulted in production of L-aspartate. Codon optimized DNA encoding for each L- aspartate dehydrogenase was first synthesized by a commercial DNA synthesis company (e.g. , Gen9, Inc.). The synthetic DNA was then amplified by PCR using primers to add DNA sequences aiding molecular cloning of the DNA into expression constructs. The primers used were as follows (listed as UniProt ID for the protein encoded by the template DNA, forward primer name and sequence, reverse primer name and sequence): Q9HYA4 encoding template DNA, YO1504 forward primer (5'- CACAAACAAACACAATTACAAAAAATGTTGAATATCGTTATGATTGGTTG-3 ' ) and YO 1505 reverse primer (5 '- GAGTATGGATTTTACTGGCTGGATTAAATAGAGATAGCGTGAGCATG); B3R8S4 encoding template DNA, YO 1506 forward primer (5 '- CACAAACAAACACAATTACAAAAAATGTTGCACGTTTCTATGGTTGG-3 ') and YO 1507 reverse primer (5 '- GAGTATGGATTTTACTGGCTGGATTAGATAGAAACGGCGTGGG-3 ' ) ; Q8XRV9 encoding template DNA, YO 1508 forward primer (5 '-
CACAAACAAACACAATTACAAAAAATGTTACATGTTTCTATGGTCGG-3 ') and YO 1509 reverse primer (5 '- GAGTATGGATTTTACTGGCTGGATTAGATAGAGACAGC ATGAGCTC-3 ' ) ; Q 126F5 encoding template DNA, YO 1510 forward primer (5 '-
CACAAACAAACACAATTACAAAAAATGTTGAAGATCGCTATGATTGG-3 ') and YO 151 1 reverse primer (5 '- GAGTATGGATTTTACTGGCTGGATTAAATAACCAAAGCTCTACCTCTG-3'); Q2T559 encoding template DNA, Y01512 forward primer (5 '-
CACAAACAAACACAATTACAAAAAATGAGAAACGCTCATGCCC-3 ') and Y01513 reverse primer (5 '- GAGTATGGATTTTACTGGCTGGATTAAATGACACAATGGGAAGCAC-3 '); Q3JFK2 encoding template DNA, Y01514 forward primer (5 '-
CACAAACAAACACAATTACAAAAAATGCGTAACGCCCATGCTC-3 ' ) and Y01515 reverse primer (5 '- GAGTATGGATTTTACTGGCTGGATTAAATAACACAATGGGAGGCTC-3 '); A6X792 encoding template DNA, Y01516 forward primer (5 '-
CACAAACAAACACAATTACAAAAAATGTCTGTCTCTGAAACTATCGTC-3 ') and Y01517 reverse primer (5 '- GAGTATGGATTTTACTGGCTGGATTAAATAACGGTGGTAGCAACTC-3 '); D6JRV1 encoding template DNA, Y01518 forward primer (5 '- CACAAACAAACACAATTACAAAAAATGAAGAAGTTGATGATGATCGG-3 ') and Y01519 reverse primer (5 '- GAGTATGGATTTTACTGGCTGGATTAAATTTGGATGGCCTCAAC AG-3 ' ) ; A6TDT8 encoding template DNA, YO 1520 forward primer (5 '- CACAAACAAACACAATTACAAAAAATGATGAAGAAGGTCATGTTAATTG-3 ') and Y01521 reverse primer (5 '- GAGTATGGATTTTACTGGCTGGATTAGGCCAATTCTCTACAAGC-3 '); A8LLH8 encoding template DNA, Y01522 forward primer (5 '- CACAAACAAACACAATTACAAAAAATGAGATTGGCTTTGATCGG-3 ' ) and Y01523 reverse primer (5'- GAGTATGGATTTTACTGGCTGGATTAAACAACCCAGGCAGCG-3 '); Q5LPG8 encoding template DNA, Y01524 forward primer (5 '-
CACAAACAAACACAATTACAAAAAATGTGGAAGTTGTGGGGTTC-3 ') and Y01525 reverse primer (5 '- GAGTATGGATTTTACTGGCTGGATTAGAAGGATGGTCTAATGGCAG-3 '); DOIX49 encoding template DNA, Y01526 encoding forward primer (5 '- CACAAACAAACACAATTACAAAAAATGAAAAACATCGCCTTAATTGG-3 ' ) and Y01527 encoding reverse primer (5 '- GAGTATGGATTTTACTGGCTGGATTAAATAGCCAATGGAGCGAC- 3'). For DNA encoding L-aspartate dehydrogenase Q46VA0, 5'- and 3'- DNA sequences with homology to the adjacent parts needed for molecular cloning was included during synthesis and no PCR amplification step was used when cloning the Q46VA0 encoding DNA.
[0164] The resulting DNA fragments were purified and cloned downstream of the P. kudriavzevii TDHl promoter and upstream of the S. cerevisiae GRE3 terminator, which are flanked in 5' by 473 bp of sequence upstream of the P. kudriavzevii Adh6c gene and in 3' by a non-functional portion of the Ura3 selection marker, in a plasmid vector containing the ampicillin resistance cassette and the pUC origin of replication using conventional molecular cloning methods. The resulting plasmids were transformed into E. coli competent host cells and selected on LB agar plates containing Amp100. Following overnight incubation at 37°C, individual colonies were inoculated in 5 ml of LB-Amp100 grown overnight at 37°C on a shaker before the plasmids were isolated and the identity and integrity of the constructs confirmed by sequencing, resulting in plasmids s393-405. The complementary construct for genomic integration containing the remaining part of the Ura3 marker and a region corresponding to 385 bp downstream of the P. kudriavzevii Adh6c gene was constructed similarly to produce plasmid s376.
[0165] P. kudriavzevii strain LPK15434 was used as the background strain for genomic integration of the L-aspartate dehydrogenase expression constructs. LPK15434 is a uracil auxotroph generated from wild type Pichia kudriavzevii through deletion of the URA3 gene. The plasmids encoding the various L-aspartate dehydrogenase expression cassettes (s393-405) were first digested with restriction enzyme Mssl to release the linear integration cassette and co- transformed into the host strains with Mssl-digested s376 using standard procedures and selected on defined agar medium lacking uracil. After 3 days incubation at 30°C, uracil prototroph transformants were re-streaked on selective medium lacking uracil, and correct integration of the L-aspartate dehydrogenase expression cassettes was confirmed by PCR.
[0166] PCR verified transformants (2-6 for each strain) were inoculated in a 96-well plate containing 0.5 ml of medium (YNB, 2% glucose, 100 mM citrate buffer pH 5.0) along with control strain LPK15419 and grown at 30°C for 3 days, shaking at 300 rpm with 50 mm throw in an incubator maintained at 80% r.h. Control strain LPK15419 is identical to LPK15434 with the exception that the URA3 gene has not been deleted. After 3 days, the cultures were pelleted and the medium supernatant was filtered on a 0.2 micron PVDF membrane and stored at 4°C until analysis. [0167] For HPLC analysis, samples and L-aspartate standards were derivatized with one volume of phtaldialdehyde reagent according to standard procedures and immediately analyzed on a Shimadzu HPLC system configured as follows: Agilent C18 Plus (2.1x150mm, 5μπι) column at 40°C, UV detector at 340 nm; 0.4 mL/min isocratic mobile phase (40mM NaH2P04, pH = 7.8) flow; 5 μL injection volume; 18 min total run time.
[0168] The control strain LPK15419 did not produce a detectable amount of L-aspartate. In the LPK15434 background engineered for expression of L-aspartate dehydrogenase proteins, a detectable level of L-aspartate was measured. Expression of the following L-aspartate dehydrogenase proteins resulted in the indicate amount of L-aspartate (mean +/- standard deviation): Q9HYA4, 13±2 mg/L; B3R8S4, 9±0 mg/L; Q8XRV9, 13±3 mg/L; Q126F5, 13±1 mg/L; Q2T559, 11±1 mg/L; Q3JFK2, 15±2 mg/L; A6X792, 13±3 mg/L; D6JRV1, 13±4 mg/L; A6TDT8, 12±1 mg/L; A8LLH8, 11±2 mg/L; Q5LPG8, 14±1 mg/L; D0IX49, 12±2 mg/L; and Q46VA0, 10±2 mg/L. Thus, all engineered Pichia kudriavzevii strains expressing heterologous L-aspartate dehydrogenase proteins resulted in production of L-aspartate while no L-aspartate was observed in the parental, control strain. This example demonstrates, in accordance with the present invention, the expression of nucleic acids encoding L-aspartate dehydrogenase proteins in engineered Pichia kudriavzevii for production of L-aspartate.
SEQUENCE LISTINGS
SEQ ID NO: 1. Pseudomonas aeruginosa L-aspartate dehydrogenase.
1- MLNIVMIGCG AIGAGVLELL ENDPQLRVDA VIVPRDSETQ
41- VRHRLASLRR PPRVLSALPA GERPDLLVEC AGHRAIEQHV
81- LPALAQGIPC LVVSVGALSE PGLVERLEAA AQAGGSRIEL
121- LPGAIGAIDA LSAARVGGLE SVRYTGRKPA SAWLGTPGET
161- VCDLQRLEKA RVIFDGSARE AARLYPKNAN VAATLSLAGL
201- GLDRTQVRLI ADPESCENVH QVEASGAFGG FELTLRGKPL
241- AANPKTSALT VYSVVRALGN HAHAISI -267
SEQ ID NO: 2. Cupriavidus taiwanensis L-aspartate dehydrogenase.
1- MLHVSMVGCG AIGRGVLELL KSDPDVVFDV VIVPEHTMDE
41- ARGAVSALAP RARVATHLDD QRPDLLVECA GHHALEEHIV
81- PALERGIPCM VVSVGALSEP GMAERLEAAA RRGGTQVQLL
121- SGAIGAIDAL AAARVGGLDE VIYTGRKPAR AWTGTPAEQL
161- FDLEALTEAT VIFEGTARDA ARLYPKNANV AATVSLAGLG
201- LDRTAVKLLA DPHAVENVHH VEARGAFGGF ELTMRGKPLA
241- ANPKTSALTV FSVVRALGNR AHAVSI -266
SEQ ID NO: 3. Tribolium castaneum L-aspartate 1 -decarboxylase.
1- MPATGEDQDL VQDLIEEPAT FSDAVLSSDE ELFHQKCPKP
41 - APIYSPISKP VSFESLPNRR LHEEFLRSSV DVLLQEAVFE
81 - GTNRKNRVLQ WREPEELRRL MDFGVRGAPS THEELLEVLK
12 1- KVVTYSVKTG HPYFVNQLFS AVDPYGLVAQ WATDALNPSV
16 1- YTYEVSPVFV LMEEVVLREM RAIVGFEGGK GDGIFCPGGS
20 1- IANGYAISCA RYRFMPDIKK KGLHSLPRLV LFTSEDAHYS
24 1- IKKLASFEGI GTDNVYLIRT DARGRMDVSH LVEEIERSLR
28 1- EGAAPFMVSA TAGTTVIGAF DPIEKIADVC QKYKLWLHVD
32 1- AAWGGGALVS AKHRHLLKGI ERADSVTWNP HKLLTAPQQC
36 1- STLLLRHEGV LAEAHSTNAA YLFQKDKFYD TKYDTGDKHI
40 1- QCGRRADVLK FWFMWKAKGT SGLEKHVDKV FENARFFTDC
44 1- IKNREGFEMV IAEPEYTNIC FWYVPKSLRG RKDEADYKDK
48 1- LHKVAPRIKE RMMKEGSMMV TYQAQKGHPN FFRIVFQNSG
52 1- LDKADMVHFV EEIERLGSDL -540
SEQ ID NO: 4. Corynebactenum glutamicum L-aspartate 1 -decarboxylase.
1- MLRTILGSKI HRATVTQADL DYVGSVTIDA DLVHAAGLIE
41- GEKVAIVDIT NGARLETYVI VGDAGTGNIC INGAAAHLIN
81- PGDLVIIMSY LQATDAEAKA YEPKIVHVDA DNRIVALGND
121- LAEALPGSGL LTSRSI -136
SEQ ID NO: 5. Bacillus subtilis L-aspartate 1 -decarboxylase.
1- MYRTMMSGKL HRATVTEANL NYVGSITIDE DLIDAVGMLP
41- NEKVQIVNNN NGARLETYI I PGKRGSGVIC LNGAAARLVQ
81- EGDKVIIISY KMMSDQEAAS HEPKVAVLND QNKIEQMLGN
121- EPARTIL -127
SEQ ID NO: 6. Mannheimia succiniciproducens phosphoenolpyruvate carboxykinase.
1- MTDLNQLTQE LGALGIHDVQ EVVYNPSYEL LFAEETKPGL
41- EGYEKGTVTN QGAVAVNTGI FTGRSPKDKY IVLDDKTKDT 81- VWWTSEKVKN DNKPMSQDTW NSLKGLVADQ LSGKRLFVVD
121- AFCGANKDTR LAVRVVTEVA WQAHFVTNMF IRPSAEELKG
161- FKPDFVVMNG AKCTNPNWKE QGLNSENFVA FNITEGVQLI
201- GGTWYGGEMK KGMFSMMNYF LPLRGIASMH CSANVGKDGD
241- TAIFFGLSGT GKTTLSTDPK RQLIGDDEHG WDDEGVFNFE
281- GGCYAKTINL SAENEPDIYG AIKRDALLEN VVVLDNGDVD
321- YADGSKTENT RVSYPIYHIQ NIVKPVSKAG PATKVIFLSA
361- DAFGVLPPVS KLTPEQTKYY FLSGFTAKLA GTERGITEPT
401- PTFSACFGAA FLSLHPTQYA EVLVKRMQES GAEAYLVNTG
441- WNGTGKRISI KDTRGI IDAI LDGSIDKAEM GSLPIFDFSI
481- PKALPGVNPA ILDPRDTYAD KAQWEEKAQD LAGRFVKNFE
521- KYTGTAEGQA LVAAGPKA -538
SEQ ID NO: 7. Aspergillus oryzae pyruvate carboxylase amino acid sequence.
1- MAAPFRQPEE AVDDTEFIDD HHEHLRDTVH HRLRANSSIM
41- HFQKILVANR GEIPIRIFRT AHELSLQTVA IYSHEDRLSM
81 - HRQKADEAYM IGHRGQYTPV GAYLAGDEII KIALEHGVQL
121- IHPGYGFLSE NADFARKVEN AGIVFVGPTP DTIDSLGDKV
161- SARRLAIKCE VPVVPGTEGP VERYEEVKAF TDTYGFPIII
201- KAAFGGGGRG MRVVRDQAEL RDSFERATSE ARSAFGNGTV
241- FVERFLDKPK HIEVQLLGDS HGNVVHLFER DCSVQRRHQK
281 - VVEVAPAKDL PADVRDRILA DAVKLAKSVN YRNAGTAEFL 321- VDQQNRHYFI EINPRIQVEH TITEEITGID IVAAQIQIAA
361- GASLEQLGLT QDRISARGFA IQCRITTEDP AKGFSPDTGK
401- IEVYRSAGGN GVRLDGGNGF AGAI ITPHYD SMLVKCTCRG 441- STYEIARRKV VRALVEFRIR GVKTNIPFLT SLLSHPTFVD 481- GNCWTTFIDD TPELFSLVGS QNRAQKLLAY LGDVAVNGSS 521- IKGQIGEPKL KGDVIKPKLF DAEGKPLDVS APCTKGWKQI 561- LDREGPAAFA KAVRANKGCL IMDTTWRDAH QSLLATRVRT 601- IDLLNIAHET SYAYSNAYSL ECWGGATFDV AMRFLYEDPW 641- DRLRKMRKAV PNIPFQMLLR GANGVAYSSL PDNAIYHFCK 681- QAKKCGVDIF RVFDALNDVD QLEVGIKAVH AAEGVVEATM 721- CYSGDMLNPH KKYNLEYYMA LVDKIVAMKP HILGIKDMAG 761- VLKPQAARLL VGSIRQRYPD LPIHVHTHDS AGTGVASMIA 801 - CAQAGADAVD AATDSMSGMT SQPSIGAILA SLEGTEQDPG 841- LNLAHVRAID SYWAQLRLLY SPFEAGLTGP DPEVYEHEIP 881- GGQLTNLIFQ ASQLGLGQQW AETKKAYEAA NDLLGDIVKV 921- TPTSKVVGDL AQFMVSNKLT PEDVVERAGE LDFPGSVLEF 961- LEGLMGQPFG GFPEPLRSRA LRDRRKLEKR PGLYLEPLDL 1001- AKIKSQIREK FGAATEYDVA SYAMYPKVFE DYKKFVQKFG 1041- DLSVLPTRYF LAKPEIGEEF HVELEKGKVL ILKLLAIGPL 1081- SEQTGQREVF YEVNGEVRQV AVDDNKASVD NTSRPKADVG 1121- DSSQVGAPMS GVVVEIRVHD GLEVKKGDPL AVLSAMKMEM 1161- VISAPHSGKV SSLLVKEGDS VDGQDLVCKI VKA -1193
SEQ ID NO: 8. Escherichia coli phosphoenolpyruvate carboxylase amino acid sequence.
1 - MNEQYSALRS NVSMLGKVLG ETIKDALGEH ILERVETIRK 41- LSKSSRAGND ANRQELLTTL QNLSNDELLP VARAFSQFLN 81- LANTAEQYHS ISPKGEAASN PEVIARTLRK LKNQPELSED 121- TIKKAVESLS LELVLTAHPT EITRRTLIHK MVEVNACLKQ 161- LDNKDIADYE HNQLMRRLRQ LIAQSWHTDE IRKLRPSPVD
201 - EAKWGFAVVE NSLWQGVPNY LRELNEQLEE NLGYKLPVEF 241- VPVRFTSWMG GDRDGNPNVT ADITRHVLLL SRWKATDLFL 281- KDIQVLVSEL SMVEATPELL ALVGEEGAAE PYRYLMKNLR
321- SRLMATQAWL EARLKGEELP KPEGLLTQNE ELWEPLYACY
361- QSLQACGMGI IANGDLLDTL RRVKCFGVPL VRIDIRQEST
401- RHTEALGELT RYLGIGDYES WSEADKQAFL IRELNSKRPL
441- LPRNWQPSAE TREVLDTCQV IAEAPQGSIA AYVISMAKTP
481- SDVLAVHLLL KEAGIGFAMP VAPLFETLDD LNNANDVMTQ
521- LLNIDWYRGL IQGKQMVMIG YSDSAKDAGV MAASWAQYQA
561- QDALIKTCEK AGIELTLFHG RGGSIGRGGA PAHAALLSQP
601- PGSLKGGLRV TEQGEMIRFK YGLPEITVSS LSLYTGAILE
641- ANLLPPPEPK ESWRRIMDEL SVISCDVYRG YVRENKDFVP
681- YFRSATPEQE LGKLPLGSRP AKRRPTGGVE SLRAIPWIFA
721- WTQNRLMLPA WLGAGTALQK VVEDGKQSEL EAMCRDWPFF
761- STRLGMLEMV FAKADLWLAE YYDQRLVDKA LWPLGKELRN
801- LQEEDIKVVL AIANDSHLMA DLPWIAESIQ LRNIYTDPLN
841- VLQAELLHRS RQAEKEGQEP DPRVEQALMV TIAGIAAGMR
881- NTG -883
SEQ ID NO: 9. Pichia kudriavzevii pyruvate decarboxylase.
1- MTDKISLGTY LFEKLKEAGS YSIFGVPGDF NLALLDHVKE
41- VEGIRWVGNA NELNAGYEAD GYARINGFAS LITTFGVGEL
81- SAVNAIAGSY AEHVPLIHIV GMPSLSAMKN NLLLHHTLGD
121- TRFDNFTEMS KKISAKVEIV YDLESAPKLI NNLIETAYHT
161- KRPVYLGLPS NFADELVPAA LVKENKLHLE EPLNNPVAEE
201- EFIHNVVEMV KKAEKPI ILV DACAARHNIS KEVRELAKLT
241- KFPVFTTPMG KSTVDEDDEE FFGLYLGSLS APDVKDIVGP
281- TDCILSLGGL PSDFNTGSFS YGYTTKNVVE FHSNYCKFKS
321- ATYENLMMKG AVQRLISELK NIKYSNVSTL SPPKSKFAYE
361- SAKVAPEGII TQDYLWKRLS YFLKPRDI IV TETGTSSFGV
401- LATHLPRDSK SISQVLWGSI GFSLPAAVGA AFAAEDAHKQ
441- TGEQERRTVL FIGDGSLQLT VQSISDAARW NIKPYIFILN
481- NRGYTIEKLI HGRHEDYNQI QPWDHQLLLK LFADKTQYEN
521- HVVKSAKDLD ALMKDEAFNK EDKIRVIELF LDEFDAPEIL
561- VAQAKLSDEI NSKAA -575
SEQ ID NO: 10. Saccharomyces cerevisiae PDCl .
1- MSEITLGKYL FERLKQVNVN TVFGLPGDFN LSLLDKIYEV
41- EGMRWAGNAN ELNAAYAADG YARIKGMSCI ITTFGVGELS
81- ALNGIAGSYA EHVGVLHVVG VPSISAQAKQ LLLHHTLGNG
121- DFTVFHRMSA NISETTAMIT DIATAPAEID RCIRTTYVTQ
161- RPVYLGLPAN LVDLNVPAKL LQTPIDMSLK PNDAESEKEV
201- IDTILALVKD AKNPVILADA CCSRHDVKAE TKKLIDLTQF
241- PAFVTPMGKG SIDEQHPRYG GVYVGTLSKP EVKEAVESAD
281- LILSVGALLS DFNTGSFSYS YKTKNIVEFH SDHMKIRNAT
321- FPGVQMKFVL QKLLTTIADA AKGYKPVAVP ARTPANAAVP
361- ASTPLKQEWM WNQLGNFLQE GDVVIAETGT SAFGINQTTF
401- PNNTYGISQV LWGSIGFTTG ATLGAAFAAE EIDPKKRVIL
441- FIGDGSLQLT VQEISTMIRW GLKPYLFVLN NDGYTIEKLI
481- HGPKAQYNEI QGWDHLSLLP TFGAKDYETH RVATTGEWDK
521- LTQDKSFNDN SKIRMIEIML PVFDAPQNLV EQAKLTAATN
561- AKQ -563 SEQ ID NO: 11. Pichia kudriavzevii alcohol dehydrogenase (ADHl).
1- MFASTFRSQA VRAARFTRFQ STFAIPEKQM GVIFETHGGP
41- LQYKEIPVPK PKPTEILINV KYSGVCHTDL HAWKGDWPLP
81- AKLPLVGGHE GAGIVVAKGS AVTNFEIGDY AGIKWLNGSC
121- MSCEFCEQGD ESNCEHADLS GYTHDGSFQQ YATADAIQAA
161- KIPKGTDLSE VAPILCAGVT VYKALKTADL RAGQWVAISG
201- AAGGLGSLAV QYAKAMGLRV LGIDGGEGKK ELFEQCGGDV
241- FIDFTRYPRD APEKMVADIK AATNGLGPHG VINVSVSPAA
281- ISQSCDYVRA TGKVVLVGMP SGAVCKSDVF THVVKSLQIK
321- GSYVGNRADT REALEFFNEG KVRSPIKVVP LSTLPEIYEL
361- MEQGKILGRY VVDTSK -376
SEQ ID NO: 12. Pichia kudriavzevii glycerol 3-phosphate dehydrogenase.
1- MVSPAERLST IASTIKPNRK DSTSLQPEDY PEHPFKVTVV
41- GSGNWGCTIA KVIAENTVER PRQFQRDVNM WVYEELIEGE
81- KLTEI INTKH ENVKYLPGIK LPVNVVAVPD IVEACAGSDL
121- IVFNIPHQFL PRILSQLKGK VNPKARAISC LKGLDVNPNG
161- CKLLSTVITE ELGIYCGALS GANLAPEVAQ CKWSETTVAY
201- TIPDDFRGKG KDIDHQILKS LFHRPYFHVR VISDVAGISI
241- AGALKNVVAM AAGFVEGLGW GDNAKAAVMR IGLVETIQFA
281- KTFFDGCHAA TFTHESAGVA DLITTCAGGR NVRVGRYMAQ
321- HSVSATEAEE KLLNGQSCQG IHTTREVYEF LSNMGRTDEF
361- PLFTTTYRI I YENFPIEKLP ECLEPVED -388
SEQ ID NO: 13. Pichia kudriavzevii cytosolic malate dehydrogenase
1- MSNVKVALLG AAGGIGQPLA LLLKLNPNIT HLALYDVVHV
41- PGVAADLHHI DTDVVITHHL KDEDGTALAN ALKDATFVIV
81- PAGVPRKPGM TRGDLFTINA GICAELANAI SLNAPNAFTL
121- VITNPVNSTV PIFKEIFAKN EAFNPRRLFG VTALDHVRSN
161- TFLSELIDGK NPQHFDVTVV GGHSGNSIVP LFSLVKAAEN
201- LDDEI IDALI HRVQYGGDEV VEAKSGAGSA TLSMAYAANK
241- FFNILLNGYL GLKKTMISSY VFLDDSINGV PQLKENLSKL
281- LKGSEVELPT YLAVPMTYGK EGIEQVFYDW VFEMSPKEKE
321- NFITAIEYID QNIEKGLNFM VR -342
SEQ ID NO: 14. L-aspartate dehydrogenase consensus sequence
1- MLHIAMIGCG AIGAGVLELL KSDPDLRVDA VIVPEESMDA
41- VREAVAALAP VARVLTALPA DARPDLLVEC AGHRAIEEHV
81- VPALERGIPC AVASVGALSE PGLAERLEAA ARRGGTQVQL
121- LSGAIGAIDA LAAARVGGLD SVVYTGRKPP LAWKGTPAEQ
161- VCDLDALTEA TVIFEGSARE AARLYPKNAN VAATLSLAGL
201- GLDRTQVRLI ADPAVTENVH HVEARGAFGG FELTMRGKPL
241- AANPKTSALT VYSVVRALGN RAHALSI -267
SEQ ID NO: 15. Bacterial L-aspartate 1 -decarboxylase consensus sequence
1- MLRTMLKSKI HRATVTQADL HYVGSVTIDA DLLDAADILE
41- GEKVAIVDIT NGARLETYVI AGERGSGVIG INGAAAHLVH
81- PGDLVIIIAY AQMSDAEARA YEPRVVFVDA DNRIVE-LGN
121- DPAEALPGG -129 SEQ ID NO: 16. Eukaryotic L-aspartate 1 -decarboxylase consensus sequence
1- MPANGNFPVA LEVISIFKPY NSAVEDLASM AKTDTSASSS
41- GSDSAGSSED EDVQLFASKG NLLNSKLLKK SNNNNKNNNI
81- NENNNKNAAA GLKRFASLPN RAEHEEFLRD CVDEILKLAV
121- FEGTNRSSKV VEWHDPEELK KLFDFELRAE PDSHEKLLEL
161- LRATIRYSVK TGHPYFVNQL FSSVDPYGLV GQWLTDALNP
201- SVYTYEVAPV FTLMEEVVLR EMRRIVGFPN DGEGDGIFCP
241- GGSIANGYAI SCARYKYAPE VKKKGLHSLP RLVIFTSEDA
281- HYSVKKLASF MGIGSDNVYK IATDEVGKMR VSDLEQEILR
321- ALDEGAQPFM VSATAGTTVI GAFDPLEGIA DLCKKYNLWM
361- HVDAAWGGGA LMSKKYRHLL KGIERADSVT WNPHKLLAAP
401- QQCSTFLTRH EGILSECHST NATYLFQKDK FYDTSYDTGD
441- KHIQCGRRAD VLKFWFMWKA KGTSGFEAHV DKVFENAEYF
481- TDSIKARPGF ELVIEEPECT NICFWYVPPS LRGMERDNAE
521- FYEKLHKVAP KIKERMIKEG SMMITYQPLR DLPNFFRLVL
561- QNSGLDKSDM LYFINEIERL GSDLV -585
SEQ ID NO: 17. Ralstonia solanacearum L- aspartate dehydrogenase.
1- MLHVSMVGCG AIGQGVLELL KSDPDLCFDT VIVPEHGMDR
41- ARAAIAPFAP RTRVMTRLPA QADRPDLLVE CAGHDALREH
81- VVPALEQGID CLVVSVGALS EPGLAERLEA AARRGHAQMQ
121- LLSGAIGAID ALAAARVGGL DAVVYTGRKP PRAWKGTPAE
161- RQFDLDALDR TTVIFEGKAS DAALLFPKNA NVAATLALAG
201- LGMERTHVRL LADPTIDENI HHVEARGAFG GFELIMRGKP
241- LAANPKTSAL TVFSVVRALG NRAHAVSI -268
SEQ ID NO: 18. Polaromonas sp. L-aspartate dehydrogenase.
1- MLKIAMIGCG AIGASVLELL HGDSDVVVDR VITVPEARDR
41- TEIAVARWAP RARVLEVLAA DDAPDLVVEC AGHGAIAAHV
81- VPALERGIPC VVTSVGALSA PGMAQLLEQA ARRGKTQVQL
121- LSGAIGGIDA LAAARVGGLD SVVYTGRKPP MAWKGTPAEA
161- VCDLDSLTVA HCIFDGSAEQ AAQLYPKNAN VAATLSLAGL
201- GLKRTQVQLF ADPGVSENVH HVAAHGAFGS FELTMRGRPL
241- AANPKTSALT VYSVVRALLN RGRALVI -267
SEQ ID NO: 19. Burkholderia thailandensis L-aspartate dehydrogenase.
1- MRNAHAPVDV AMIGFGAIGA AVYRAVEHDA ALRVAHVIVP
41- EHQCDAVRGA LGERVDVVSS VDALAYRPQF ALECAGHGAL
81- VDHVVPLLRA GTDCAVASIG ALSDLALLDA LSEAADEGGA
121- TLTLLSGAIG GVDALAAAKQ GGLDEVQYIG RKPPLGWLGT
161- PAEALCDLRA MTAEQTIFEG SARDAARLYP KNANVAATVA
201- LAGVGLDATK VRLIADPAVT RNVHRVVARG AFGEMSIEMS
241- GKPLPDNPKT SALTAFSAIR ALRNRASHCV I -271
SEQ ID NO: 20. Burkholderia pseudomallei L-aspartate dehydrogenase.
1- MRNAHAPVDV AMIGFGAIGA AVYRAVEHDA ALRVAHVIVP
41- EHQCDAVRGA LGERVDVVSS VDALACRPQF ALECAGHGAL
81- VDHVVPLLKA GTDCAVASIG ALSDLALLDA LSNAADAGGA 121- TLTLLSGAIG GIDALAAARQ GGLDEVRYIG RKPPLGWLGT
161- PAEAICDLRA MAAEQTIFEG SARDAAQLYP RNANVAATIA
201- LAGVGLDATR VCLIADPAVT RNVHRIVARG AFGEMSIEMS
241- GKPLPDNPKT SALTAFSAIR ALRNRASHCV I -271
SEQ ID NO: 21. Ochrobactrum anthropi L-aspartate dehydrogenase.
1- MSVSETIVLV GWGAIGKRVA DLLAERKSSV RIGAVAVRDR
41- SASRDRLPAG AVLIENPAEL AASGASLVVE AAGRPSVLPW
81- GEAALSTGMD FAVSSTSAFV DDALFQRLKD AAAASGAKLI
121- IPPGALGGID ALSAASRLSI ESVEHRIIKP AKAWAGTQAA
161- QLVPLDEISE ATVFFTDTAR KAADAFPQNA NVAVITSLAG
201- IGLDRTRVTL VADPAARLNT HEI IAEGDFG RMHLRFENGP
241- LATNPKSSEM TALNLVRAIE NRVATTVI -268
SEQ ID NO: 22. Acinetobacter sp. SH024 L-aspartate dehydrogenase.
1- MKKLMMIGFG AMAAEVYAHL PQDLQLKWIV VPSRSIEKVQ
41- SQVSSEIQVI SDIEQCDGTP DYVIEVAGQA AVKEHAQKVL
81- AKGWTIGLIS VGTLADSEFL IQLKQTAEKN DAHLHLLAGA
121- IAGIDGISAA KEGGLQKVTY KGCKSPKSWK GSYAEQLVDL
161- DHVVEATVFF TGTAREAATK FPANANVAAT IALAGLGMDE
201- TMVELTVDPT INKNKHTIVA EGGFGQMTIE LVGVPLPSNP
241- KTSTLAALSV IRACRNSVEA IQI -263
SEQ ID NO: 23. Klebsiella pneumoniae L-aspartate dehydrogenase.
1- MMKKVMLIGY GAMAQAVIER LPPQVRVEWI VARESHHAAI
41- CLQFGQAVTP LTDPLQCGGT PDLVLECASQ QAVAQYGEAV
81 - LARGWHLAVI STGALADSEL EQRLRQAGGK LTLLAGAVAG
121- IDGLAAAKEG GLERVTYQSR KSPASWRGSY AEQLIDLSAV
161- NEAQIFFEGS AREAARLFPA NANVAATIAL GGIGLDATRV
201- QLMVDPATQR NTHTLHAEGL FGEFHLELSG LPLASNPKTS
241- TLAALSAVRA CRELA -255
SEQ ID NO: 24. Dinoroseobacter shibae L-aspartate dehydrogenase.
1- MRLALIGLGA INRAVAAGMA GQAEMVALTR SGAEAPGVMA
41- VSDLSALRVF APDLVVEAAG HGAARAYLPG LLAAGIDVLM
81- ASVGVLADPE TEAAFRAAPA HGAQLTIPAG AIGGLDLLAA
121- LPKDSLRAVR YTGVKPPAAW AGSPAADGRD LSALDGPVTL
161 - FEGTARQAAL RFPNNANVAA TLALAGAGFD RTEARLVADP
201 - DAAGNGHAYD VISDTAEMTF SVRARPSDTP GTSATTAMSL
241- LRAIRNRDAA WW - 267
SEQ ID NO: 25. Ruegeria pomeroyi L-aspartate dehydrogenase.
1 - MWKLWGSWPE GDRVRIALIG HGPIAAHVAA HLPVGVQLTG
41- ALCRPGRDDA ARAALGVSVA QALEGLPQRP DLLVDCAGHS
81 - GLRAHGLTAL GAGVEVLTVS VGALADAVFC AELEDAARAG
121- GTRLCLASGA IGALDALAAA AMGTGLQVTY TGRKPPQGWR
161- GSRAEKVLDL KALTGPVTHF TGTARAAAQA YPKNANVAAA
201 - VALAGAGLDA TRAELIADPG AAANIHEIAA EGAFGRFRFQ 241- IEGLPLPGNP RSSALTALSL LAALRQRGAA IRPSF -275
SEQ ID NO: 26. Comamonas testosteroni L-aspartate dehydrogenase.
1- MKNIALIGCG AIGSSVLELL SGDTQLQVGW VLVPEITPAV
41 - RETAARLAPQ AQLLQALPGD AVPDLLVECA GHAAIEEHVL
81- PALARGIPAV IASIGALSAP GMAERVQAAA ETGKTQAQLL
121- SGAIGGIDAL AAARVGGLET VLYTGRKPPK AWSGTPAEQV
161- CDLDGLTEAF CIFEGSAREA AQLYPKNANV AATLSLAGLG
201- LDKTMVRLFA DPGVQENVHQ VEARGAFGAM ELTMRGKPLA
241- ANPKTSALTV YSVVRAVLNN VAPLAI -266
SEQ ID NO: 27. Cupriavidus pinatubonensis L-aspartate dehydrogenase.
1 - MSMLHVSMVG CGAIGRGVLE LLKADPDVAF DVVIVPEGQM
41- DEARSALSAL APNVRVATGL DGQRPDLLVE CAGHQALEEH
81- IVPALERGIP CMVVSVGALS EPGLVERLEA AARRGNTQVQ
121- LLSGAIGAID ALAAARVGGL DEVIYTGRKP ARAWTGTPAA
161- ELFDLEALTE PTVIFEGTAR DAARLYPKNA NVAATVSLAG
201- LGLDRTSVRL LADPNAVENV HHIEARGAFG GFELTMRGKP
241- LAANPKTSAL TVFSVVRALG NRAHAVSI -268

Claims

1. A recombinant yeast cell comprising:
(a) a heterologous nucleic acid encoding an L-aspartate dehydrogenase; and
(b) a heterologous nucleic acid encoding an oxaloacetate-forming enzyme selected from the group consisting of pyruvate carboxylase, phosphoenolpyruvate carboxylase, and phosphoenolpyruvate carboxykinase.
2. The recombinant yeast cell of claim 1, wherein the heterologous nucleic acid encoding an oxaloacetate-forming enzyme is pyruvate carboxylase.
3. A recombinant yeast cell comprising:
(a) a heterologous nucleic acid encoding an L-aspartate dehydrogenase;
(b) a heterologous nucleic acid encoding an oxaloacetate-forming enzyme selected from the group consisting of pyruvate carboxylase, phosphoenolpyruvate carboxylase, and phosphoenolpyruvate carboxykinase; and
(c) a deletion or disruption of a nucleic acid encoding pyruvate decarboxylase.
4. The recombinant yeast cell of claim 2 wherein the recombinant host cell is capable of producing L-aspartate and/or beta-alanine under substantially anaerobic conditions.
5. The recombinant yeast cell of claim 2 wherein the recombinant host cell is capable of producing L-aspartate and/or beta-alanine under aerobic conditions.
6. The recombinant yeast cell of claim 3 wherein the heterologous nucleic acid encoding an oxaloacetate-forming enzyme is pyruvate carboxylase.
7. The recombinant host cell of Claim 1, further comprising a heterologous nucleic acid encoding a L-aspartate 1 -decarboxylase wherein the recombinant host cell is capable of producing beta-alanine under substantially anaerobic conditions.
PCT/US2016/061578 2015-11-12 2016-11-11 Recombinant host cells and methods for the anaerobic production of l-aspartate and beta-alanine WO2017083683A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
CA3042854A CA3042854A1 (en) 2015-11-12 2016-11-11 Recombinant host cells and methods for the anaerobic production of l-aspartate and beta-alanine
AU2016353242A AU2016353242A1 (en) 2015-11-12 2016-11-11 Recombinant host cells and methods for the anaerobic production of L-aspartate and beta-alanine
CN201680076240.7A CN109072172A (en) 2015-11-12 2016-11-11 The recombinant host cell and method of L-Aspartic acid and Beta-alanine are generated for anaerobism
EP16865105.7A EP3374505A4 (en) 2015-11-12 2016-11-11 Recombinant host cells and methods for the anaerobic production of l-aspartate and beta-alanine
US15/976,861 US20180258437A1 (en) 2015-11-12 2018-05-10 Recombinant host cells and methods for the production of l-aspartate and beta-alanine

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201562254635P 2015-11-12 2015-11-12
US62/254,635 2015-11-12

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US15/976,861 Continuation-In-Part US20180258437A1 (en) 2015-11-12 2018-05-10 Recombinant host cells and methods for the production of l-aspartate and beta-alanine

Publications (1)

Publication Number Publication Date
WO2017083683A1 true WO2017083683A1 (en) 2017-05-18

Family

ID=58696123

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/061578 WO2017083683A1 (en) 2015-11-12 2016-11-11 Recombinant host cells and methods for the anaerobic production of l-aspartate and beta-alanine

Country Status (5)

Country Link
EP (1) EP3374505A4 (en)
CN (1) CN109072172A (en)
AU (1) AU2016353242A1 (en)
CA (1) CA3042854A1 (en)
WO (1) WO2017083683A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019062874A1 (en) 2017-10-01 2019-04-04 Enzymaster (Ningbo) Bio-Engineering Co., Ltd. Engineered decarboxylase polypeptides and their application in preparing beta-alanine
WO2020005834A1 (en) * 2018-06-25 2020-01-02 Lygos, Inc. RECOMBINANT HOST CELLS AND METHODS FOR THE PRODUCTION OF ASPARTIC ACID AND β-ALANINE
WO2021256511A1 (en) 2020-06-17 2021-12-23 住友化学株式会社 Transformant of genus hydrogenophilus bacterium capable of producing aspartic acid and methionine

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109735522B (en) * 2018-12-26 2021-02-02 浙江工业大学 L-aspartic acid-alpha-decarboxylase mutant and application thereof
CN111778200B (en) * 2019-04-04 2022-11-01 中国科学院微生物研究所 Platform bacterium for producing L-aspartic acid, recombinant bacterium for producing beta-alanine constructed based on platform bacterium and construction method thereof
CN112410245B (en) * 2020-10-13 2024-03-08 哈尔滨雁成生物科技有限公司 Low-temperature composting microbial composite microbial agent and preparation method and application thereof
CN113604459B (en) * 2021-08-31 2023-10-10 江南大学 Phosphoenolpyruvate carboxykinase and application thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110124060A1 (en) * 2009-09-29 2011-05-26 Butamax(Tm) Advanced Biofuels Llc Yeast production host cells
US20130029381A1 (en) * 2009-10-13 2013-01-31 Genomatica, Inc. Microorganisms for the production of 1,4-butanediol, 4-hydroxybutanal, 4-hydroxybutyryl-coa, putrescine and related compounds, and methods related thereto

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8048624B1 (en) * 2007-12-04 2011-11-01 Opx Biotechnologies, Inc. Compositions and methods for 3-hydroxypropionate bio-production from biomass
US20100021978A1 (en) * 2008-07-23 2010-01-28 Genomatica, Inc. Methods and organisms for production of 3-hydroxypropionic acid
RU2010101135A (en) * 2010-01-15 2011-07-20 Закрытое акционерное общество "Научно-исследовательский институт "Аджиномото-Генетика" (ЗАО АГРИ) (RU) BACTERIA OF THE ENTEROBACTERIACEAE FAMILY - PRODUCER OF L-ASAPPARATE OR METABOLITES, L-ASPARATE DERIVATIVES, AND METHOD OF PRODUCING L-ASAPPARATE OR METABOLITES, PRODUCED L-ASAPPARATE
CA2807561C (en) * 2010-08-06 2022-04-12 Mascoma Corporation Production of malonyl-coa derived products via anaerobic pathways
JP6061862B2 (en) * 2010-11-22 2017-01-18 カーギル,インコーポレイティド Compositions and methods for the production of 3-hydroxypropionic acid
WO2013134424A1 (en) * 2012-03-06 2013-09-12 Lygos, Inc. Recombinant host cells for the production of malonate
WO2015031504A1 (en) * 2013-08-27 2015-03-05 The Regents Of The University Of California RECOMBINANT PATHWAY AND ORGANISMS FOR MALONYL-CoA SYNTHESIS

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110124060A1 (en) * 2009-09-29 2011-05-26 Butamax(Tm) Advanced Biofuels Llc Yeast production host cells
US20130029381A1 (en) * 2009-10-13 2013-01-31 Genomatica, Inc. Microorganisms for the production of 1,4-butanediol, 4-hydroxybutanal, 4-hydroxybutyryl-coa, putrescine and related compounds, and methods related thereto

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
ISHIDA, N ET AL.: "The Effect of Pyruvate Decarboxylase Gene Knockout in Saccharomyces cerevisiae on L-Lactic Acid Production.", BIOSCIENCE, BIOTECHNOLOGY AND BIOCHEMISTRY, vol. 70, no. 5, May 2006 (2006-05-01), pages 1148 - 1153, XP008129166 *
LI, Y ET AL.: "L-Aspartate Dehydrogenase: Features and Applications.", APPLIED MICROBIOLOGY AND BIOTECHNOLOGY., vol. 93, no. 2, 27 November 2011 (2011-11-27), pages 503 - 516, XP035001295 *
See also references of EP3374505A4 *
YANG, Z ET AL.: "Aspartate Dehydrogenase, a Novel Enzyme Identified from Structural and Functional Studies of TM1643.", THE JOURNAL OF BIOLOGICAL CHEMISTRY ., vol. 278, no. 10, 21 December 2002 (2002-12-21), pages 8804 - 8808, XP002288044 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019062874A1 (en) 2017-10-01 2019-04-04 Enzymaster (Ningbo) Bio-Engineering Co., Ltd. Engineered decarboxylase polypeptides and their application in preparing beta-alanine
EP3692142A4 (en) * 2017-10-01 2022-02-16 Enzymaster (Ningbo) Bio-Engineering Co., Ltd. Engineered decarboxylase polypeptides and their application in preparing beta-alanine
WO2020005834A1 (en) * 2018-06-25 2020-01-02 Lygos, Inc. RECOMBINANT HOST CELLS AND METHODS FOR THE PRODUCTION OF ASPARTIC ACID AND β-ALANINE
CN113039281A (en) * 2018-06-25 2021-06-25 利戈斯股份有限公司 Recombinant host cells and methods for producing aspartic acid and beta-alanine
EP3810786A4 (en) * 2018-06-25 2022-06-08 Lygos, Inc. Recombinant host cells and methods for the production of aspartic acid and beta-alanine
WO2021256511A1 (en) 2020-06-17 2021-12-23 住友化学株式会社 Transformant of genus hydrogenophilus bacterium capable of producing aspartic acid and methionine

Also Published As

Publication number Publication date
CN109072172A (en) 2018-12-21
CA3042854A1 (en) 2017-05-18
EP3374505A1 (en) 2018-09-19
AU2016353242A1 (en) 2018-06-21
EP3374505A4 (en) 2019-05-01

Similar Documents

Publication Publication Date Title
EP3374505A1 (en) Recombinant host cells and methods for the anaerobic production of l-aspartate and beta-alanine
US20220119821A1 (en) Recombinant host cells and methods for the production of aspartic acid and b-alanine
US11781122B2 (en) Ectoine-producing yeast
EP2668281A2 (en) Compositions and methods for succinate production
US20220235385A1 (en) Engineered microorganisms and methods for improved aldehyde dehydrogenase activity
US11390891B2 (en) Recombinant host cells and methods for the production of D-lactic acid
JP2015536669A (en) Production of 3-hydroxypropionic acid by recombinant yeast
WO2015013295A1 (en) Recombinant production of chemicals from methane or methanol
US20180258437A1 (en) Recombinant host cells and methods for the production of l-aspartate and beta-alanine
US20240167063A1 (en) Recombinant host cells and methods for the production of isobutyric acid
WO2012103263A2 (en) Compositions and methods for malate and fumarate production
US11535830B2 (en) Threonine-producing yeast
WO2022265934A1 (en) Preparing diesters of malonic acid
WO2023023092A2 (en) Recombinant host cells and methods for the production of glycolic acid
CN115176023A (en) Amorpha-4, 11-diene 12-monooxygenase variants and uses thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16865105

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2016865105

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2016353242

Country of ref document: AU

Date of ref document: 20161111

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 3042854

Country of ref document: CA