WO2017082377A1 - Pyrazolopyridine derivative and use therefor - Google Patents

Abstract

The present invention provides: a PPARα transcriptional activator including as an active ingredient a 1-H-pyrazolo[3,4-b]pyridine derivative represented by general formula (1) or a salt thereof, or a solvate or hydrate thereof; and a novel compound for selectively activating PPARα. [In the formula, R1 represents a hydrogen atom, a halogen atom, a C1-10 straight-chain or branched alkyl group, or the like, R2 represents a C1-10 straight-chain or branched alkyl group or cyclic alkyl group, R3 represents a C1-10 straight-chain or branched alkyl group, a fluoromethyl group, a phenyl group, or a 2-thienyl group, R4 represents a carboxy group, an ethoxycarbonyl group, or a propionic acid group having a C1-10 straight-chain or branched alkyl group at the α position, and X represents a carbon atom or a nitrogen atom.]

Description

Pyrazolopyridine derivatives and uses thereof

The present invention relates to a pharmaceutical, a method for treating and / or preventing a disease, etc., containing a compound that selectively activates a peroxisome proliferator-responsive receptor (PPARα), and a novel compound that selectively activates PPARα. .

In patients with dyslipidemia, low density lipoprotein cholesterol (LDL-C) and triglyceride (TG) levels increase and high density lipoprotein cholesterol (HDL-C) decreases. Such high LDL-C, high TG, and low HDL-C status are also common in patients with metabolic syndrome and diabetes, and are considered to be risk factors for serious diseases such as heart disease and cerebrovascular disorder. Improvement is considered an important issue.

Peroxisome proliferator-activated receptor (PPAR) is a ligand-dependent transcription factor belonging to the nuclear receptor superfamily and induces transcription of target genes in a ligand-dependent manner. To do. That is, when a ligand binds to PPAR, PPAR binds to a PPAR response element present in the promoter region of the target gene, and transcription of the target gene is induced.
In the cell, PPAR forms a heterodimer with the retinoid X receptor (RXR). This heterodimer binds to a DNA sequence known as a PPAR responsive element and activates transcription of various genes. In addition, the PPAR / RXR heterodimer incorporates activation cofactors such as DRIP-205 and SRC-1 to regulate the expression level of mRNA encoded by the target gene.
So far, three types of subtypes (α type, β / δ type, γ type) with different tissue distributions have been identified in various animal species including humans. Among these subtypes, PPARα is distributed in the liver, kidney, heart, muscle and the like having high fatty acid catabolism, and high expression is particularly observed in the liver. When transcription of a target gene is induced by PPARα, a decrease in blood neutral fat, an increase in HDL cholesterol, a decrease in body weight, promotion of angiogenesis, etc. are induced (Non-patent Document 1). Of inflammatory diseases (Non-patent document 2), cancer (Non-patent document 3), skin diseases (inflammation of the skin, reduced barrier function, etc.) that have been reported to be related to PPARα. For the purpose of developing therapeutic agents such as (Non-patent Document 4), search for compounds that activate PPARα has been vigorously conducted.

Fibrates that have been widely used as therapeutic agents for dyslipidemia so far are gene products that activate PPARα and control fatty acid metabolism and intracellular transport (for example, acyl-CoA synthase, fatty acid-binding protein and lipoprotein lipase). ) And apolipoprotein gene products related to cholesterol and neutral lipid metabolism are positively or negatively controlled. As a result, administration of fibrate drugs reduces the synthesis of TG and very low density lipoprotein (VLDL) in the body, and increases lipoprotein lipase (LPL) activity in the vascular endothelium, thus promoting fat degradation. Is done.
Known fibrates include fenofibrate (Ripantole (registered trademark)), bezafibrate (bezatol SR (registered trademark), bezalip (registered trademark)), gemfibrozil (ropid (registered trademark)) and the like (Non-patent Document 5). However, these fibrate drugs are accompanied by side effects, particularly hepatic dysfunction (Non-patent Document 6), and therefore sufficient attention is required for their use.
However, it is true that PPARα agonists play an important role in improving various phenomena associated with dyslipidemia, and they do not exhibit a wide range of effects as conventional fibrate drugs, and are more selective for PPARα. The development of therapeutic drugs that act is important.
In recent years, compounds that selectively activate PPARα have been reported, and their effects as therapeutic agents are expected (Patent Documents 1 to 4).

WO2006 / 033891 WO2006 / 049232 WO2008 / 006043 WO2009 / 047240

In view of the circumstances described above, the present inventors have made it a problem to develop a new transcriptional activator of PPARα (an agent containing a PPARα agonist) for the purpose of developing a therapeutic drug for dyslipidemia and the like.
That is, an object of the present invention is to provide a transcription activator that selectively activates PPARα, a medicament containing the PPARα transcription activator, and a method for treating and / or preventing diseases such as dyslipidemia. .
Furthermore, an object of the present invention is to provide a novel compound (a novel selective PPARα agonist) that selectively activates PPARα.

The present inventors have conducted extensive studies to solve the above-mentioned problems, and as a result, found 1H-pyrazolo [3,4-b] pyridine derivatives having selective agonist activity for PPARα, and completed the present invention. It was.
That is, the present invention is a 1H-pyrazolo [3,4-b] pyridine derivative represented by the following general formula (1), a salt thereof, a solvate thereof, or a hydrate thereof.

[Wherein, R ₁ represents a hydrogen atom, a halogen atom, a linear or branched alkyl group having 1 to 10 carbon atoms, a linear or branched alkyl halide group having 1 to 10 carbon atoms, or 1 to 10 carbon atoms. A linear or branched alkoxy group, an unsubstituted or substituted phenyl group, an unsubstituted or substituted phenoxy group, an unsubstituted or substituted benzyloxy group, R ₂ has 1 to 10 carbon atoms Linear or branched alkyl group or cyclic alkyl group, R ₃ is a linear or branched alkyl group having 1 to 10 carbon atoms, fluoromethyl group, phenyl group or 2-thienyl group, R ₄ is a carboxy group, ethoxy group A carbonyl group, a propionic acid group having a linear or branched alkyl group having 1 to 10 carbon atoms at the α-position, and X represents a carbon atom or a nitrogen atom. However, X is carbon, R ₄ is 4-carboxy group, R ₁ is 4-fluorine, R ₂ is isopropyl group and R ₃ is methyl group or cyclopropyl group, X is carbon, R ₄ is 4-carboxy group, R ₁ is 4-fluorine, R ₂ is a cyclopropyl group and R ₃ is an isopropyl group or cyclopropyl group, X is carbon, R ₄ is a 4-carboxy group, R ₁ is 4-fluorine, R ₂ is a methyl group and R ₃ Is a cyclopropyl group, and X is carbon, R ₄ is a 4-carboxy group, R ₁ is hydrogen, and R ₂ and R ₃ are methyl groups. ]

Furthermore, the present invention includes a 1H-pyrazolo [3,4-b] pyridine derivative represented by the following general formula (1), a salt thereof, a solvate thereof, or a hydrate thereof as an active ingredient. PPARα transcription activator.

[Wherein, R ₁ represents a hydrogen atom, a halogen atom, a linear or branched alkyl group having 1 to 10 carbon atoms, a linear or branched alkyl halide group having 1 to 10 carbon atoms, or 1 to 10 carbon atoms. A linear or branched alkoxy group, an unsubstituted or substituted phenyl group, an unsubstituted or substituted phenoxy group, an unsubstituted or substituted benzyloxy group, R ₂ has 1 to 10 carbon atoms Linear or branched alkyl group or cyclic alkyl group, R ₃ is a linear or branched alkyl group having 1 to 10 carbon atoms, fluoromethyl group, phenyl group or 2-thienyl group, R ₄ is a carboxy group, ethoxy group A carbonyl group, a propionic acid group having a linear or branched alkyl group of 1 to 10 carbon atoms at the α-position, X represents a carbon atom or a nitrogen atom]

The present invention also provides a pharmaceutical (therapeutic or therapeutic) comprising 1H-pyrazolo [3,4-b] pyridine derivative represented by the above general formula (1) or a salt thereof, or a solvate or hydrate thereof as an active ingredient. Prophylactic agent) or pharmaceutical composition, or a pharmaceutical (therapeutic or prophylactic agent) or pharmaceutical composition containing the PPARα transcription activator.

The 1H-pyrazolo [3,4-b] pyridine derivative according to the present invention can selectively activate PPARα. Therefore, the PPARα transcription activator or medicament containing the 1H-pyrazolo [3,4-b] pyridine derivative according to the present invention is, for example, dyslipidemia, diabetes, obesity, hypertension, arteriosclerosis, liver disease. (Such as fatty liver diseases such as alcoholic or non-alcoholic steatohepatitis), diseases associated with metabolic syndrome such as angina pectoris, myocardial infarction, inflammatory diseases, cancer, skin diseases (such as skin inflammation and reduced barrier function) ) Can be used for prevention or treatment.

Furthermore, the present invention provides a novel 1H-pyrazolo [3,4-b] pyridine derivative that selectively activates PPARα.

It is the result of examining the PPAR selectivity of the compound according to the present invention (the compound of Example 1). It is the result of having investigated about the influence which the compound concerning this invention (The compound of Example 19 and Example 20) has on the mRNA expression level of a PPAR (alpha) target gene (PDK4). Fenofibrate; added fenofibrate. It is the result of having investigated about the influence which the compound concerning this invention (compound of Example 20) has on serum TG (triglyceride) value using the dyslipidemia model rat. Normal is obtained by freely ingesting water that complies with the water quality standards of the Waterworks Law and administered with 0.5 μw / v% methylcellulose (MC) solution as a negative control. All other groups are dyslipidemia models given 10 w / v% fructose water, Control is 0.5 w / v% MC solution as negative control, Fenofibrate is fenofibrate 0.5 w / v% as positive control The result of administering a suspension suspended in MC solution is shown. Pre-treatment is a measurement value before treatment with a compound, and Post-treatment is a measurement value after treatment with a compound. It is the result of having investigated about the influence which the compound concerning this invention (compound of Example 20) has on blood parameters (HDL-C, LDL-C, AST, ALT, UN, and CK) using the dyslipidemia model rat. . Normal and Control are the same as described in FIG. As a result of investigating the effects of the compounds according to the present invention (the compounds of Examples 1 and 51 on the body weight (A) and the weight of the liver, kidney and soleus muscle (B)) using dyslipidemia model rats Yes, Control, Pre-treatment, and Post-treatment are the same as those in Fig. 3. It is the result of having investigated about the influence which the compound (Example 1 and the compound of Example 51) concerning this invention has on serum TG (triglyceride) value using the dyslipidemia model rat. Control, Pre-treatment, and Post-treatment are the same as those in FIG. It is the result of investigating the fluctuation | variation of the serum TG value for every rat individual when the compound (Example 1 and the compound of Example 51) concerning this invention is administered to a dyslipidemia model rat. Control is the same as the description of FIG. The results of examining the effects of the compounds according to the present invention (the compounds of Example 1 and Example 51) on blood total cholesterol level, HDL-cholesterol level and LDL-cholesterol level using dyslipidemia model rats is there. Control is the same as the description of FIG. It is the result of having investigated about the influence which the compound (Example 1 and the compound of Example 51) concerning this invention has on the blood parameter (AST, ALT, UN, and CK) using the dyslipidemia model rat. Control is the same as the description of FIG.

The first embodiment of the present invention is a 1H-pyrazolo [3,4-b] pyridine derivative represented by the above general formula (1), or a salt thereof, a solvate thereof, or a hydrate thereof. .

Furthermore, the second embodiment of the present invention provides a 1H-pyrazolo [3,4-b] pyridine derivative represented by the above general formula (1), a salt thereof, a solvate thereof, or a hydrate thereof. Effective as a PPARα transcription activator, or a 1H-pyrazolo [3,4-b] pyridine derivative represented by the above general formula (1) or a salt thereof, or a solvate or hydrate thereof It is a pharmaceutical (therapeutic or preventive agent) or pharmaceutical composition containing as a component, or a pharmaceutical (therapeutic or preventive agent) or pharmaceutical composition containing the PPARα transcription activator.

In general formula (1),
R ₁ is a hydrogen atom, a halogen atom, a linear or branched alkyl group having 1 to 10 carbon atoms, a linear or branched halogenated alkyl group having 1 to 10 carbon atoms, or a straight chain having 1 to 10 carbon atoms Or a branched alkoxy group, an unsubstituted or substituted phenyl group, an unsubstituted or substituted phenoxy group, an unsubstituted or substituted benzyloxy group, preferably a chlorine atom, a fluorine atom or a bromine atom It is. The position of R ₁ is preferably 4-position, 3-position or 2-position, more preferably 4-position or 3-position.
R ₂ is a linear or branched alkyl group or cyclic alkyl group having 1 to 10 carbon atoms, preferably a methyl group, an isopropyl group, a cyclopropyl group, a cyclobutyl group, a cyclopentyl group, or a 1- (ethyl) propyl group. More preferably, they are an isopropyl group and a cyclopropyl group.
R ₃ is a linear or branched alkyl group having 1 to 10 carbon atoms, a fluoromethyl group, a phenyl group or a 2-thienyl group, preferably a methyl group, an ethyl group, a cyclopropyl group or an isopropyl group.
R ₄ is a carboxy group, an ethoxycarbonyl group, or a propionic acid group having a substituent at the α-position, preferably a carboxy group, and particularly preferably a 4-carboxy group.
X is a carbon atom or a nitrogen atom, preferably a carbon atom.

However, from the first embodiment, a compound in which X is carbon, R ₄ is a 4-carboxy group, R ₁ is 4-fluorine, R ₂ is an isopropyl group and R ₃ is a methyl group or a cyclopropyl group, and X is carbon , R ₄ is a 4-carboxy group, R ₁ is 4-fluorine, R ₂ is a cyclopropyl group and R ₃ is an isopropyl group or a cyclopropyl group, X is carbon, R ₄ is a 4-carboxy group, R ₁ Wherein X is 4-fluorine, R ₂ is a methyl group and R ₃ is a cyclopropyl group, and X is carbon, R ₄ is a 4-carboxy group, R ₁ is hydrogen, and R ₂ and R ₃ are methyl groups Excludes compounds.

The salt of the compound of the present invention represented by the general formula (1) may be a pharmaceutically acceptable salt. For example, when an acidic group is present, lithium, sodium, potassium, magnesium, calcium and the like Alkali metal and alkaline earth metal salts of ammonia, methylamine, dimethylamine, trimethylamine, dicyclohexylamine, tris (hydroxymethyl) aminomethane, N, N-bis (hydroxyethyl) piperazine, 2-amino-2-methyl- Examples thereof include salts of amines such as 1-propanol, ethanolamine, N-methylglucamine and L-glucamine; and salts with basic amino acids such as lysine, δ-hydroxylysine and arginine. If basic groups are present, salts of mineral acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid; methanesulfonic acid, benzenesulfonic acid, paratoluenesulfonic acid, acetic acid, propionate, tartaric acid , Fumaric acid, maleic acid, malic acid, oxalic acid, succinic acid, citric acid, benzoic acid, mandelic acid, cinnamic acid, lactic acid, glycolic acid, glucuronic acid, ascorbic acid, nicotinic acid, salicylic acid and other organic acids Salts; or salts with acidic amino acids such as aspartic acid and glutamic acid.

Further, the 1H-pyrazolo [3,4-b] pyridine derivative represented by the general formula (1) includes stereoisomers such as tautomers and enantiomers unless otherwise specified. That is, when one or more asymmetric carbons are contained in the 1H-pyrazolo [3,4-b] pyridine derivative represented by the general formula (1), the stereochemistry of the asymmetric carbon is as follows: Each can independently take either the (R) form or the (S) form, and may exist as a stereoisomer such as an enantiomer or diastereoisomer of the derivative.
As the active ingredient of the PPARα transcription activator, medicament or pharmaceutical composition of the present invention, any stereoisomer in a pure form, any mixture of stereoisomers, racemate and the like can be used.

The 1H-pyrazolo [3,4-b] pyridine derivative represented by the general formula (1) is not limited, and examples thereof include the following.
1- (4-fluorophenyl) -3-isopropyl-6-methyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid,
6-cyclopropyl-1- (4-fluorophenyl) -3-isopropyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid,
1- (4-chlorophenyl) -3-isopropyl-6-methyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid,
1- (3-chlorophenyl) -3-isopropyl-6-methyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid,
1- (4-bromophenyl) -3-isopropyl-6-methyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid,
1- (4-iodophenyl) -3-isopropyl-6-methyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid,
3-isopropyl-6-methyl-1- (4-methylphenyl) -1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid,
1- (4-chlorophenyl) -6-ethyl-3-isopropyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid,
1- (4-chlorophenyl) -6-cyclopropyl-3-isopropyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid,
1- (3-chlorophenyl) -6-ethyl-3-isopropyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid,
1- (3-chlorophenyl) -6-cyclopropyl-3-isopropyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid,
1- (4-bromophenyl) -6-ethyl-3-isopropyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid,
1- (4-bromophenyl) -6-cyclopropyl-3-isopropyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid,
6-ethyl-1- (4-iodophenyl) -3-isopropyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid,
1- (4-bromophenyl) -3-isopropyl-6-phenyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid,
1- (4-chlorophenyl) -3-isopropyl-6-phenyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid,
1- (4-fluorophenyl) -3-isopropyl-6-phenyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid,
1- (4-chlorophenyl) -6- (fluoromethyl) -3-isopropyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid,
6- (Fluoromethyl) -1- (4-fluorophenyl) -3-isopropyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid

In an embodiment of the present invention, a transcriptional activator of PPARα comprising a novel 1H-pyrazolo [3,4-b] pyridine derivative represented by the general formula (1) (activating (or inducing) transcription of a PPARα target gene) Drug). The transcriptional activator of PPARα according to the present invention can be used for treatment and / or prevention of a disease caused by a decrease in PPARα transcriptional activity.

In addition, a medicament (therapeutic or prophylactic agent) or medicament comprising as an active ingredient the 1H-pyrazolo [3,4-b] pyridine derivative represented by the general formula (1) or a salt thereof, or a solvate or hydrate thereof A composition, or a pharmaceutical (therapeutic or prophylactic agent) or pharmaceutical composition containing the PPARα transcription activator is also an embodiment of the present invention. The medicament or pharmaceutical composition according to the present invention includes, for example, dyslipidemia, diabetes, obesity, hypertension, arteriosclerosis, liver diseases (such as fatty liver diseases such as alcoholic or non-alcoholic steatohepatitis), narrow It can be used for prevention and / or treatment of diseases associated with metabolic syndrome such as heart disease and myocardial infarction, inflammatory diseases, cancer, skin diseases (such as skin inflammation and reduced barrier function).

The PPARα transcription activator and medicament according to the present invention are active ingredients such as 1H-pyrazolo [3,4-b] pyridine derivative represented by the general formula (1) or a salt thereof, or a solvate or water thereof. Although the Japanese product itself may be administered, it is generally desirable to administer it in the form of a pharmaceutical composition containing these substances as active ingredients and one or more pharmaceutical additives.
Moreover, you may use in combination of 2 or more types among the compounds represented by General formula (1) as a transcriptional activator of PPAR (alpha) concerning this invention, or an active ingredient of a pharmaceutical. The pharmaceutical composition may contain known ingredients that are effective in treating diseases associated with metabolic syndrome.

The kind of the medicine or pharmaceutical composition according to the present invention is not particularly limited, and dosage forms include tablets, capsules, granules, powders, syrups, suspensions, suppositories, ointments, creams, gels, Examples include patches, inhalants, injections and the like. These preparations are prepared according to a conventional method. The liquid preparation may be dissolved or suspended in water or other appropriate solvent at the time of use. Tablets and granules may be coated by a known method. In the case of injection, it is prepared by dissolving the compound of the present invention in water, but it may be dissolved in physiological saline or glucose solution as necessary, and a buffer or preservative may be added. Also good.

The preparation for oral administration or parenteral administration is provided in an arbitrary preparation form. Examples of the dosage form include granules, fine granules, powders, hard capsules, soft capsules, syrups, emulsions, suspensions, liquids and the like for oral administration or pharmaceutical composition, intravenous administration. Pharmaceuticals or pharmaceutical compositions for parenteral administration in the form of injections, drops, transdermal absorption agents, transmucosal absorption agents, nasal drops, inhalants, suppositories, etc. Can be prepared as a product. Injections, infusions, and the like can be prepared as powdered dosage forms such as freeze-dried forms, and can be used by dissolving in an appropriate aqueous medium such as physiological saline at the time of use.

The type of pharmaceutical additive used for the production of the pharmaceutical or pharmaceutical composition according to the present invention, the ratio of the pharmaceutical additive to the active ingredient, or the method for producing the pharmaceutical or pharmaceutical composition depends on the form thereof. Can be appropriately selected. As an additive for formulation, an inorganic or organic substance, or a solid or liquid substance can be used, and it can generally be blended in an amount of 1 to 90% by weight based on the weight of the active ingredient. . Specific examples of pharmaceutical additives include lactose, glucose, mannitol, dextrin, cyclodextrin, starch, sucrose, magnesium aluminate metasilicate, synthetic aluminum silicate, sodium carboxymethylcellulose, hydroxypropyl starch, carboxymethylcellulose calcium , Ion exchange resin, methylcellulose, gelatin, gum arabic, hydroxypropylcellulose, hydroxypropylmethylcellulose, polyvinylpyrrolidone, polyvinyl alcohol, light anhydrous silicic acid, magnesium stearate, talc, tragacanth, bentonite, bee gum, titanium oxide, sorbitan fatty acid ester, Sodium lauryl sulfate, glycerin, fatty acid glycerin ester, purified lanolin, glycerogelatin, polyso Bate, macrogol, vegetable oils, waxes, liquid paraffin, white petrolatum, fluorocarbons, nonionic surfactants, propylene glycol, water and the like.

In order to produce a solid preparation for oral administration, an active ingredient and excipient components such as lactose, starch, crystalline cellulose, calcium lactate, anhydrous silicic acid and the like are mixed to form a powder, or if necessary, sucrose, Add a binder such as hydroxypropylcellulose or polyvinylpyrrolidone, a disintegrant such as carboxymethylcellulose or carboxymethylcellulose calcium, and wet or dry granulate to form granules. In order to produce a tablet, these powders and granules may be tableted as they are or after adding a lubricant such as magnesium stearate and talc. These granules or tablets should be coated with an enteric solvent base such as hydroxypropylmethylcellulose phthalate or methacrylic acid-methyl methacrylate polymer and coated with an enteric solvent preparation, or with ethylcellulose, carnauba wax, hardened oil, etc. to make a sustained preparation. You can also. In order to produce a capsule, a hard capsule is filled with a powder or granule, or an active ingredient is directly or dissolved in glycerin, polyethylene glycol, sesame oil, olive oil, etc. can do.

In order to produce injections, active ingredients such as hydrochloric acid, sodium hydroxide, lactose, lactic acid, sodium, sodium monohydrogen phosphate, sodium dihydrogen phosphate, etc. Dissolve in distilled water for injection together with an isotonic agent, filter aseptically and fill into ampoules, or add mannitol, dextrin, cyclodextrin, gelatin, etc. . In addition, reticin, polysorbate 80, polyoxyethylene hydrogenated castor oil, etc. may be added to the active ingredient and emulsified in water to give an emulsion for injection.

To produce a rectal dosage form, the active ingredient is moistened with a suppository base material such as cacao butter, fatty acid tri-, di- and monoglycerides, polyethylene glycol, etc., dissolved, poured into a mold and cooled, or the active ingredient is made of polyethylene. What is necessary is just to coat | cover with a gelatin film | membrane after melt | dissolving in glycol, soybean oil, etc.

The dose and frequency of administration of the medicament or pharmaceutical composition according to the present invention are not particularly limited, and may vary depending on conditions such as prevention and / or progression of the disease to be treated and / or purpose of treatment, type of disease, patient weight and age. Accordingly, it is possible to make an appropriate selection based on the judgment of the doctor.
In general, the daily dose for adults is about 0.01 to 1000 mg (active ingredient weight), and can be administered once or several times a day or every few days. it can. When used as an injection, daily dosages of 0.001 to 100 mg (active ingredient weight) are preferably administered continuously or intermittently to adults.

The medicament or pharmaceutical composition according to the present invention can be prepared as a sustained release preparation such as a delivery system encapsulated in implantable tablets and microcapsules using a carrier that can prevent immediate removal from the body. it can. Such carriers can be biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Such materials can be readily prepared by those skilled in the art. Liposome suspensions can also be used as pharmaceutically acceptable carriers. Liposomes are prepared as a lipid composition comprising, but not limited to, phosphatidylcholine, cholesterol and PEG-derived phosphatidylethanol (PEG-PE) through a suitable pore size filter to obtain a suitable size for use in the reverse phase evaporation method. Can be purified by.

The medicament or pharmaceutical composition according to the present invention may be provided in the form of a kit together with instructions such as an administration method. The drug contained in the kit is a container made of a material that maintains the activity of the components of the medicine or the pharmaceutical composition effectively for a long period of time, does not adsorb inside the container, and does not alter the components. Supplied by For example, a sealed glass ampoule may include a buffer sealed in the presence of a neutral and non-reactive gas such as nitrogen gas.
In addition, instructions for use may be attached to the kit. Instructions for using the kit may be printed on paper or the like, stored on an electromagnetically readable medium such as a CD-ROM or DVD-ROM, and supplied to the user.

Furthermore, in another embodiment of the present invention, a PPARα transcription activator or a medicine containing the same is administered to a patient or the like, for example, dyslipidemia, diabetes, obesity, hypertension, arteriosclerosis, liver disease It is a method for preventing or treating diseases associated with metabolic syndrome such as angina pectoris and myocardial infarction, inflammatory diseases, cancer, skin diseases (such as skin inflammation and reduced barrier function).
Here, “treatment” means to prevent or alleviate the progression and worsening of the disease state in a mammal suffering from a disease, etc., and thereby to prevent or alleviate the progression and worsening of the disease. It is treatment to do.
In addition, “prevention” means to prevent the onset or illness of the disease in advance for a mammal that may be affected by the disease, thereby preventing the onset of various symptoms of the disease in advance. It is treatment for the purpose.
The “mammal” to be treated means any animal classified as a mammal, and is not particularly limited. For example, in addition to humans, pet animals such as dogs, cats, rabbits, cows, pigs, sheep , Livestock animals such as horses. Particularly preferred “mammals” are humans.

Among the compounds represented by the general formula (1), R ₁ is a hydrogen atom, a halogen atom, a linear or branched halogenated alkyl group having 1 to 10 carbon atoms, or a linear or branched group having 1 to 10 carbon atoms. An alkyl group, a linear or branched alkoxy group having 1 to 10 carbon atoms, an unsubstituted or substituted phenyl group, an unsubstituted or substituted phenoxy group, an unsubstituted or substituted benzyloxy group, R ₂ is a linear or branched alkyl group or cyclic alkyl group having 1 to 10 carbon atoms, R ₃ is a linear or branched alkyl group having 1 to 10 carbon atoms, a fluoromethyl group, a phenyl group, or 2-thienyl. 1H-pyrazolo [3,4-b] pyridine derivative compound (1a) in which R ₄ is a 4-position carboxy group, 4-position ethoxycarbonyl group, X is a carbon atom or a nitrogen atom, It can be produced by the following method (Scheme 1).

That is, the general formula (1a):

[Wherein, R ₁ represents a hydrogen atom, a halogen atom, a linear or branched alkyl group having 1 to 10 carbon atoms, a linear or branched alkyl halide group having 1 to 10 carbon atoms, or 1 to 10 carbon atoms. A linear or branched alkoxy group, an unsubstituted or substituted phenyl group, an unsubstituted or substituted phenoxy group, an unsubstituted or substituted benzyloxy group, R ₂ has 1 to 10 carbon atoms Linear or branched alkyl group or cyclic alkyl group, R ₃ is a linear or branched alkyl group having 1 to 10 carbon atoms, fluoromethyl group, phenyl group or 2-thienyl group, X is a carbon atom or nitrogen atom Represents]
The compound represented by:

[Wherein, R ₁ and X are as defined above. And a compound (A) represented by the following:

[Wherein, R ₂ has the same meaning as described above. The compound (B) represented by formula (B) is reacted (first step), and the following:

[Wherein, R ₁ , R ₂ and X are as defined above. And the following compound (C):

[Wherein R ₃ has the same meaning as described above. The compound (D) represented by the above is reacted (second step), and the following:

[Wherein, R ₁ , R ₂ , R ₃ and X are as defined above. ] It can manufacture by hydrolyzing the compound (E) represented by (3rd process).

The reaction in the first step can be carried out in hydrochloric acid, acetic acid, toluene, xylene and a mixed solvent of hydrochloric acid and ethanol or hydrochloric acid and propanol. The reaction can be carried out at 100 to 200 ° C., preferably at the boiling temperature of the solvent. The reaction time is usually 1 to 48 hours, preferably 12 to 24 hours.

The reaction in the second step can be carried out in hydrochloric acid, acetic acid, toluene, xylene and a mixed solvent of hydrochloric acid and ethanol or hydrochloric acid and propanol. The reaction can be carried out at 100 to 200 ° C., preferably at the boiling temperature of the solvent. The reaction time is usually 1 to 48 hours, preferably 12 to 24 hours.

The reaction in the third step can be performed under alkaline conditions. The alkaline conditions can be carried out in a mixed solvent of lithium hydroxide, sodium hydroxide, potassium hydroxide and ethanol or propanol. The reaction temperature can be 0 to 150 ° C., preferably room temperature to the reflux temperature of the solvent. The reaction time is usually 1 to 48 hours, preferably 4 to 24 hours.

In the compound represented by the general formula (1) of the present invention, R ₁ is a hydrogen atom, a halogen atom, a linear or branched alkyl group having 1 to 10 carbon atoms, or a linear chain having 1 to 10 carbon atoms. A linear or branched alkyl group having 1 to 10 carbon atoms, a linear or branched alkoxy group having 1 to 10 carbon atoms, an unsubstituted or substituted phenyl group, an unsubstituted or substituted phenoxy group, an unsubstituted or substituted group Benzyloxy group, R ₂ is a linear or branched alkyl group or cyclic alkyl group having 1 to 10 carbon atoms, R ₃ is a linear or branched alkyl group having 1 to 10 carbon atoms, fluoromethyl group, phenyl Group or 2-thienyl group, R ₅ is a propionic acid group having a linear or branched alkyl group having 1 to 10 carbon atoms at the α-position, and 1H-pyrazolo [3,4-b] wherein X is carbon Pi Derivative Compound (1b) can be produced by the following method (Scheme 2).

That is, the following general formula (1b):

[Wherein, R ₁ is a hydrogen atom, a halogen atom, a linear or branched alkyl group having 1 to 10 carbon atoms, a linear or branched alkyl halide group having 1 to 10 carbon atoms, or 1 to 10 carbon atoms. A linear or branched alkoxy group, an unsubstituted or substituted phenyl group, an unsubstituted or substituted phenoxy group, an unsubstituted or substituted benzyloxy group, and R ₂ having 1 to 10 carbon atoms Linear or branched alkyl group or cyclic alkyl group, R ₃ is a linear or branched alkyl group having 1 to 10 carbon atoms, fluoromethyl group, phenyl group or 2-thienyl group, R ₅ is carbon at the α-position A propionic acid group having a linear or branched alkyl group of formula 1 to 10 is represented. ]
The compound represented by:

[Wherein, R ₁ , R ₂ and R ₃ have the same meanings as described above. ] (4th step) obtained by reducing the compound (1a ′) represented by the following:

[Wherein, R ₁ , R ₂ and R ₃ have the same meanings as described above. The compound (F) represented by the following formula is oxidized (fifth step), and the following:

[Wherein, R ₁ , R ₂ and R ₃ have the same meanings as described above. And a compound (G) represented by the following:

[Wherein, R ₅ has the same meaning as described above. ] (6th process), and the following obtained:

[Wherein, R ₁ , R ₂ , R ₃ and R ₅ have the same meanings as described above. The compound (I) represented by formula (I) is reduced (seventh step), and the following:

[Wherein, R ₁ , R ₂ , R ₃ and R ₅ have the same meanings as described above. ] It can manufacture by hydrolyzing the compound (J) represented by (8th process).

The reaction in the fourth step can be performed in diethyl ether, tetrahydrofuran, toluene, xylene using lithium aluminum hydride, diisobutylaluminum hydride, or borane-tetrahydrofuran complex as a reducing agent. The reaction can be carried out at -70 ° C to 200 ° C, preferably 0 ° C to the boiling temperature of the solvent. The reaction time is usually 1 to 48 hours, preferably 12 to 24 hours.

The reaction in the fifth step can be carried out in dichloromethane, chloroform, tetrahydrofuran or toluene using an oxidizing agent such as pyridinium chlorochromate, pyridinium dichromate or manganese dioxide as the oxidizing agent. The reaction temperature can be 0 to 200 ° C., preferably from room temperature to the boiling temperature of the solvent. The reaction time is usually 1 to 48 hours, preferably 12 to 24 hours.

The reaction in the sixth step is carried out in a solvent such as tetrahydrofuran, toluene, dioxane, N, N-dimethylformamide, as a base, for example, an alkali metal hydride such as sodium hydride, an organometallic compound such as butyl lithium, lithium diisopropylamide And metal alkoxides such as sodium methoxide and potassium t-butoxide can be used. The reaction temperature can be −20 ° C. to 150 ° C., preferably 0 ° C. to 50 ° C. The reaction time is usually 1 to 48 hours, preferably 2 to 24 hours.

The reaction in the seventh step is carried out in the presence of a metal catalyst such as palladium-supported activated carbon, platinum-supported activated carbon, platinum oxide, rhodium-supported alumina, etc. in a solvent such as ethanol, methanol, tetrahydrofuran, ethyl acetate, N, N-dimethylformamide and the like under a hydrogen pressure of 1 kgf. / Cm ² to 5 kgf / cm ² . The reaction temperature can be 0 to 100 ° C., preferably room temperature to 80 ° C. The reaction time is usually 1 to 48 hours, preferably 6 to 24 hours.

The reaction in the eighth step can be performed under alkaline conditions. As alkaline conditions, lithium hydroxide, sodium hydroxide, potassium hydroxide or the like is used. The reaction temperature can be 0 to 80 ° C., preferably room temperature to 60 ° C. The reaction time is usually 1 to 48 hours, preferably 2 to 24 hours.

The disclosures of all documents cited herein are hereby incorporated by reference in their entirety. Also, if the specification includes the English indefinite articles "a", "an", and the definite article "the", these articles are used unless the context clearly indicates otherwise. , Used to refer to both singular and plural.
Hereinafter, the present invention will be described in more detail with reference to examples, but the present invention is not limited to the examples.

Example 1 1- (4-Chlorophenyl) -3-isopropyl-6-methyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid

Synthesis of 1- (4-chlorophenyl) -3-isopropyl-1H-pyrazol-5-amine In a biotage pressure-resistant glass reaction vessel for 10 mL to 20 mL, 4-fluorophenylhydrazine hydrochloride (1.00 g, 6. 17 mmol), 4-methyl-3-oxopentanenitrile (1.00 g, 9.00 mmol), ethanol 10 mL and concentrated hydrochloric acid 3 mL were charged. After sealing with a dedicated cap, the reaction was carried out at 160 ° C. for 50 minutes using an ultrasonic reaction device (Biotage Initiator). After completion of the reaction, the reaction solution was poured into 100 mL of 1 mol / L / sodium hydroxide aqueous solution and extracted with ethyl acetate (3 × 20 mL). The extract was washed with saturated brine, dried over anhydrous magnesium sulfate, and concentrated. The residue was purified by silica gel column chromatography (n-hexane / AcOEt 4: 1 v / v) to obtain 0.90 g of the target compound as a yellow powder in a yield of 62%.

Synthesis of 1- (4-chlorophenyl) -3-isopropyl-6-methyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid ethyl ester In a biotage pressure-resistant glass reaction vessel for 10 mL to 20 mL, 1- (4-Chlorophenyl) -3-isopropyl-1H-pyrazol-5-amine (0.90 g, 3.82 mmol), 2,4-dioxopentanoic acid ethyl ester (0.54 g, 3.41 mmol), acetic acid 12 mL was charged. After sealing with a dedicated cap, the reaction was carried out at 160 ° C. for 50 minutes using an ultrasonic reaction device (Biotage Initiator). After completion of the reaction, the reaction solution was poured into 100 mL of 1 mol / L aqueous sodium hydroxide solution and extracted with ethyl acetate (3 × 20 ml). The extract was washed with saturated brine, dried over anhydrous magnesium sulfate, and concentrated. The residue was purified by silica gel column chromatography (n-hexane / AcOEt 9: 1 v / v) to obtain 0.60 g of the target compound as a yellow oil in a yield of 49%.

Synthesis of 1- (4-chlorophenyl) -3-isopropyl-6-methyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid In a 100 mL eggplant type flask, 1- (4-chlorophenyl)- 3-Isopropyl-6-methyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid ethyl ester (0.60 g, 1.68 mmol), ethanol 10 mL and 1 mol / L aqueous sodium hydroxide solution 5 mL were charged. . The mixture was heated to reflux overnight. After completion of the reaction, the reaction solution was concentrated to about 1/3, and concentrated hydrochloric acid was added dropwise to the residual solution under ice-cooling and stirring, followed by stirring for several minutes. The precipitate was filtered and dried to obtain 0.60 g of the title compound in a yield of 100%.
¹ H-NMR (CDCl ₃ , δ) 8.31, (2H, d, J = 9.3Hz), 7.56, (1H, s), 7.47, (2H, d, J = 9.0Hz), 3.86, (1H, sep , J = 6.9Hz), 2.76, (3H, s), 1.42, (6H, d, J = 6.9Hz). Mp. 270-271 ° C. MS 330 (M + H) ⁺ _.

[Examples 2 to 41, 46 to 50]
Example compounds shown in Tables 1 to 5 were synthesized in the same manner as in Example 1 for the compounds of the following general formula (1c) (Note that the PPAR-HM numbers are numbers used for data reduction). .

Example 51 Sodium 1- (4-chlorophenyl) -3-isopropyl-6-methyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylate (sodium salt of the compound of Example 1)

In a 100 mL eggplant-shaped flask, 1- (4-chlorophenyl) -3-isopropyl-6-methyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid (the compound of Example 1) (0. 60 g, 1.82 mmol) 20 mL of a 1 mol / L aqueous sodium hydroxide solution was added, and the mixture was stirred with ice cooling for 10 minutes. The precipitated solid was filtered and dried, and then recrystallized from ethanol to obtain 0.62 g of the title compound in a yield of 97%.
¹ H-NMR (300 MHz CD3OD) δ = 8.32, (2H, dd, J = 6.9, 2.2Hz), 7.48, (2H, dd, J = 7.0, 2.3Hz), 7.08, (1H, s), 3.78 , (1H, sep, J = 6.9Hz), 2.65, (3H, s), 1.40, (6H, d, J = 6.9Hz) .mp. 300 ℃

[Experimental example]
[Experimental Example 1] Measurement of PPARα agonist activity of the compound of the present invention ( luciferase assay using GAL4-chimera system )
Human liver cancer-derived HepG2 cells cultured in Dulbecco's modified Eagle's medium (10% charcoal / dextran treated FBS-DMEM) containing 10% charcoal / dextran-treated bovine serum, 3 × 10 ⁴ cells per well on a 96-well plate / 110 μL was seeded.
The receptor plasmid pBIND-hPPARα expressing the fusion protein of yeast transcription factor GAL4 DNA-binding domain and human PPARα ligand-binding domain after replacement for serum-free medium OPTI-MEM I (Life Technologies) after 16-24 hours of culture (And pBIND-hPPARδ, pBIND-hPPARγ) Vector (Promega) 10 ng and its reporter plasmid 4 × UAS-tk-luc vector 100 ng were transfected with Lipofect AMINE ^™ 2000 reagent (Life Technologies).
After culturing for 24 hours, each Example compound (1 μM) or fenofibrate (10 μM) was added to 10% charcoal / dextran treated FBS-DMEM, and further cultivated for 24 hours, followed by luciferase assay.
Dual-Luciferase (registered trademark) Reporter Assay System (Promega) reagent was used for the assay, and luciferase activity was measured using a luminometer according to the instructions attached to the kit. The measurement results are shown in Tables 6 to 9. The compounds of Examples 42, 43, 44, 52 and 53 were purchased from Vitas-M, and the compound of Example 54 was purchased from Enamine.

As shown in Tables 6 to 9, the compounds according to the present invention have transcription activation activity (agonist activity) against PPARα. The strength of the transcriptional activation effect of these compounds is a known PPARα agonist measured by the same method, which is equal to or higher than that of fenofibrate, a therapeutic agent clinically used as a therapeutic agent for dyslipidemia. Is a good PPARα agonist.
Further, the PPAR selectivity of the compound according to the present invention was examined by taking the compound of Example 1 as an example, and as shown in FIG. 1, it is clear that it has a selective transcription activation activity (agonist activity) for PPARα. Became.

[Experimental Example 2] Measurement of gene expression enhancing activity under the PPARα control of a compound of the present invention (gene expression analysis using real time PCR method)
Human liver cancer-derived HepG2 cells cultured in Dulbecco's modified Eagle's medium (10% charcoal / dextran treated FBS-DMEM) containing 10% charcoal / dextran-treated bovine serum, 5 × 10 ⁵ cells per well on a 6-well plate /2.5 mL was seeded. Test compounds were added after 16-20 hours of culture and cells were harvested after an additional 48 hours of culture.
For RNA extraction from cells, QuickGene RNA cultured cell HC kit S (RC-S2) (KURABO) was used, and RNA was extracted according to the instructions attached to the kit. Using 2 μg of the extracted total RNA, cDNA was synthesized according to the instructions attached to the SuperScriptIII ^™ RT (Life Technologies) kit. Using 25 ng of the synthesized cDNA, real time PCR was performed according to the instructions attached to QuantiTect (registered trademark) SYBR (registered trademark) Green PCR kit (QIAGEN) to analyze gene expression.

The primers used for the real time PCR method and the length of the sequence to be amplified are shown below. TBP was used for correction.
PDK4: 102 bp
fw; TTCCAGACCAACCAATTCACA (SEQ ID NO: 1)
rv; CCTGGTGTTCAACTGTTGCC (SEQ ID NO: 2)
PPARα: 121 bp
fw; CTATCATTTGCTGTGGAGATCG (SEQ ID NO: 3)
rv; AAGATATCGTCCGGGTGGTT (SEQ ID NO: 4)
TBP: 172 bp
fw; AGCCAAGAGTGAAGAACAGTCC (SEQ ID NO: 5)
rv; AAATTGTTGGTGGGTGAGCA (SEQ ID NO: 6)
As shown in FIG. 2, the compounds according to the present invention (the compounds of Examples 19 and 20) increased the mRNA expression level of the PPARα target gene (PDK4). From this, the compound of this invention is a PPAR (alpha) agonist also in a gene expression level.

[Experimental Example 3] Measurement of lipid-lowering action of compound of the present invention (Compound of Example 20)
Male Crl: CD (SD) rats (Nippon Charles River) were fed with solid feed (Oriental Yeast Industry). A 4-week-old rat was allowed to ingest 10 w / v% fructose water freely using a water bottle, and was bred for 2 weeks to be a dyslipidemia model rat.
A test compound (the compound of Example 20) (0, 1, 3 and 10 mg / kg) suspended in a 0.5 w / v% methylcellulose solution and a fenofibrate as a control compound in a 6-week-old dyslipidemia model rat (30 mg / kg) was orally administered once a day for 14 consecutive days. During the test compound administration period, 10 w / v% fructose water was freely ingested.
One day after the final administration, blood was collected from the abdominal aorta under anesthesia, allowed to stand at room temperature for 20-60 minutes, and then serum was obtained by centrifugation. Serum triglyceride level (GPO / HMMPS method, glycerol elimination method), aspartate transaminase level (corresponding to JSCC standardization), alanine transaminase level (corresponding to JSCC standardization), creatine kinase level (corresponding to JSCC standardization), urea nitrogen level (urease / GIDH method), HDL cholesterol level (selective elimination method), and LDL cholesterol level (selective elimination method) were measured using an automatic analyzer JCA-BM6070 (JEOL).
As shown in FIG. 3, it was confirmed that the serum triglyceride (TG) level was increased by fructose loading. In addition, when the compound according to the present invention (the compound of Example 20) was administered at a dose of 3 mg / kg or more, an effect of decreasing the rat serum triglyceride value was observed. In addition, the level of the lowering effect was similar to that of rat serum TG when fenofibrate was administered at 30 mg / kg.
Thus, the compound of the present invention has an action for improving dyslipidemia.

Further, as shown in FIG. 4, it was confirmed that the compound of the present invention (Example 20) gives fluctuations to blood parameters of rats due to fructose load. That is, serum HDL-C (HDL cholesterol) tended to decrease by administration of the compound of the present invention, but the degree was less than that of fenofibrate. Neither the compound of the present invention (Example 20) nor fenofibrate affected AST (aspartate aminotransferase), ALT (alanine aminotransferase) and UN (urea nitrogen). On the other hand, administration of the compound of the present invention decreased CK (creatine kinase), and its action was similar to that of fenofibrate. Also in this respect, the compound of the present invention has an action for improving dyslipidemia.

[Example 4] Measurement of lipid lowering action of the compound according to the present invention (the compound of Example 1 and the compound of Example 51)
Male Crl: CD (SD) rats (Nippon Charles River) were fed with solid feed (Oriental Yeast Industry). A 7-week-old rat was allowed to freely consume 25 w / v% fructose water using a water bottle, and was bred for 3 weeks to be a dyslipidemia model rat.
An 11-week-old dyslipidemia model rat was mixed with the compound of Example 1 (10 mg / kg), the compound of Example 51 (10 mg / kg), and the control compound fenofibrate (30 mg / kg), pema Fibrate (1 mg / kg) was orally administered once a day for 14 consecutive days (3 mice per administration group). Here, the compound of Example 51 was suspended in water for injection, and the other compounds were suspended in a 0.5 w / v% methylcellulose solution. During the test compound administration period, 25 w / v% fructose water was freely ingested.
The animals were fasted for 5 hours before blood collection, and blood was collected from the abdominal aorta under anesthesia 4 hours after the final administration. The collected blood was allowed to stand at room temperature for 20-60 minutes, and then serum was obtained by centrifugation. Serum triglyceride level (GPO / HMMPS method, glycerol elimination method), aspartate transaminase level (corresponding to JSCC standardization), alanine transaminase level (corresponding to JSCC standardization), creatine kinase level (corresponding to JSCC standardization), urea nitrogen level (urease / GIDH method), HDL cholesterol level (selective elimination method), and LDL cholesterol level (selective elimination method) were measured using an automatic analyzer JCA-BM6070 (JEOL).
The organ weight was measured by taking out the target organ and using an electronic balance (HR-200, A & D Co., Ltd.). Furthermore, the relative weight per 100 g was calculated from the body weight measured using an electronic balance (GX-4000, A & D Co., Ltd.).

The effect of the test compound on the weight of the rat (FIG. 5A), liver, kidney and soleus muscle was examined (FIG. 5B). No effect on body weight was observed for each test compound. On the other hand, for any organ, an increase in liver weight was observed with any compound, and the degree was particularly high in the pemafibrate administration group (FIG. 5B). In addition, an increase in kidney weight was observed in the group administered with the compound of Example 1 and fenofibrate (FIG. 5B).

Next, when each test compound was administered to a dyslipidemia model rat having an increased serum triglyceride (TG) value, a decrease in blood triglyceride value was observed when any of the compounds was administered (FIG. 6). ).
Furthermore, when each test compound was administered to a dyslipidemia model rat, the change in the serum triglyceride level of each individual was examined. As a result, although one rat had no effect in the pemafibrate administration group, there was a slight individual difference in any compound administration group, but a decrease in the blood triglyceride value was observed (FIG. 7). .
From the above results, the compound of Example 1 and the compound of Example 51 for the dyslipidemia model rat were compared with the known lipid abnormality-improving drugs Fenofibrate and Pemafibrate, and the blood triglyceride was comparable or higher. It was suggested that a value lowering effect was exhibited (FIG. 6). Regarding the effects on organs, the compound of Example 1 and the compound of Example 51 are less in comparison with the increase in liver weight observed with Fenofibrate and Pemafibrate, and the kidney weight observed with Fenofibrate Compared with the increase, the degree of the compound of Example 51 was low, suggesting that the compound of the present invention is highly safe (FIG. 5B).

The effects of the compound of Example 1 and the compound of Example 51 of the present invention on blood parameters of dyslipidemia model rats were examined. Blood cholesterol showed no significant change in any group administered with each test compound, but no significant effect was observed (FIG. 8). In addition, for AST, ALT, UN and CK, there was no effect due to the administration of each test compound (FIG. 9).

The compound according to the present invention activates PPARα transcription. Therefore, a medicament containing these compounds as an active ingredient is expected to exert an effect on the treatment or prevention of diseases such as dyslipidemia.

Claims (14)

1. A PPARα transcription activator comprising a 1H-pyrazolo [3,4-b] pyridine derivative represented by the following general formula (1), a salt thereof, a solvate thereof, or a hydrate thereof as an active ingredient.
   

   

   
   [Wherein, R ₁ represents a hydrogen atom, a halogen atom, a linear or branched alkyl group having 1 to 10 carbon atoms, a linear or branched alkyl halide group having 1 to 10 carbon atoms, or 1 to 10 carbon atoms. A linear or branched alkoxy group, an unsubstituted or substituted phenyl group, an unsubstituted or substituted phenoxy group, an unsubstituted or substituted benzyloxy group, R ₂ has 1 to 10 carbon atoms Linear or branched alkyl group or cyclic alkyl group, R ₃ is a linear or branched alkyl group having 1 to 10 carbon atoms, fluoromethyl group, phenyl group or 2-thienyl group, R ₄ is a carboxy group, ethoxy group A carbonyl group, a propionic acid group having a linear or branched alkyl group having 1 to 10 carbon atoms at the α-position, and X represents a carbon atom or a nitrogen atom. ]
2. The PPARα transcription activator according to claim 1, wherein R ₄ is a 4-carboxy group.
3. The PPARα transcription activator according to claim 1 or 2, wherein R ₁ is any _one of a hydrogen atom, a halogen atom, a methyl group, a trifluoromethyl group, and a benzyloxy group.
4. 4. The PPARα transcription activator according to claim 1, wherein R ₂ is any one of a methyl group, an isopropyl group, a cyclopropyl group, a cyclobutyl group, a cyclopentyl group, and a 1- (ethyl) propyl group.
5. 5. The PPARα transcription activator according to claim 1, wherein R ₃ is any one of a methyl group, an ethyl group, a cyclopropyl group, an isopropyl group, a fluoromethyl group, a phenyl group, and a 2-thienyl group.
6. The compound represented by the general formula (1) is 1- (4-fluorophenyl) -3-isopropyl-6-methyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid, 6-cyclopropyl -1- (4-Fluorophenyl) -3-isopropyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid, 1- (4-chlorophenyl) -3-isopropyl-6-methyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid, 1- (3-chlorophenyl) -3-isopropyl-6-methyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid, 1- ( 4-Bromophenyl) -3-isopropyl-6-methyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid, 1- (4-iodophenyl) -3-isopropyl-6-methyl-1 -Pyrazolo [3,4-b] pyridine-4-carboxylic acid, 3-isopropyl-6-methyl-1- (4-methylphenyl) -1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid, 1- (4-Chlorophenyl) -6-ethyl-3-isopropyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid, 1- (4-chlorophenyl) -6-cyclopropyl-3-isopropyl- 1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid, 1- (3-chlorophenyl) -6-ethyl-3-isopropyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid, 1- (3-Chlorophenyl) -6-cyclopropyl-3-isopropyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid, 1- (4-bromophenyl) -6-ethyl 3-Isopropyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid, 1- (4-bromophenyl) -6-cyclopropyl-3-isopropyl-1H-pyrazolo [3,4-b] pyridine -4-carboxylic acid, 6-ethyl-1- (4-iodophenyl) -3-isopropyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid, 1- (4-bromophenyl) -3 -Isopropyl-6-phenyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid, 1- (4-chlorophenyl) -3-isopropyl-6-phenyl-1H-pyrazolo [3,4-b] Pyridine-4-carboxylic acid, 1- (4-fluorophenyl) -3-isopropyl-6-phenyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid, 1- (4-chlorophenol Enyl) -6- (fluoromethyl) -3-isopropyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid, 6- (fluoromethyl) -1- (4-fluorophenyl) -3-isopropyl The PPARα transcription activator according to claim 1, which is selected from the group consisting of -1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid.
7. A medicament comprising the PPARα transcription activator according to any one of claims 1 to 6.
8. The medicament according to claim 7, which is dyslipidemia, diabetes, obesity, hypertension, arteriosclerosis, liver disease, angina pectoris, myocardial infarction, inflammatory disease, cancer or skin disease.
9. 1H-pyrazolo [3,4-b] pyridine derivative represented by the following general formula (1), or a salt thereof, a solvate thereof, or a hydrate thereof.
   

   

   
   [Wherein, R ₁ represents a hydrogen atom, a halogen atom, a linear or branched alkyl group having 1 to 10 carbon atoms, a linear or branched alkyl halide group having 1 to 10 carbon atoms, or 1 to 10 carbon atoms. A linear or branched alkoxy group, an unsubstituted or substituted phenyl group, an unsubstituted or substituted phenoxy group, an unsubstituted or substituted benzyloxy group, R ₂ has 1 to 10 carbon atoms Linear or branched alkyl group or cyclic alkyl group, R ₃ is a linear or branched alkyl group having 1 to 10 carbon atoms, fluoromethyl group, phenyl group or 2-thienyl group, R ₄ is a carboxy group, ethoxy group A carbonyl group, a propionic acid group having a linear or branched alkyl group having 1 to 10 carbon atoms at the α-position, and X represents a carbon atom or a nitrogen atom. However, X is carbon, R ₄ is 4-carboxy group, R ₁ is 4-fluorine, R ₂ is isopropyl group and R ₃ is methyl group or cyclopropyl group, X is carbon, R ₄ is 4-carboxy group, R ₁ is 4-fluorine, R ₂ is a cyclopropyl group and R ₃ is an isopropyl group or cyclopropyl group, X is carbon, R ₄ is a 4-carboxy group, R ₁ is 4-fluorine, R ₂ is a methyl group and R ₃ Is a cyclopropyl group, and X is carbon, R ₄ is a 4-carboxy group, R ₁ is hydrogen, and R ₂ and R ₃ are methyl groups. ]
10. The 1H-pyrazolo [3,4-b] pyridine derivative according to claim 9, wherein R ₄ is a 4-carboxy group, or a salt thereof, a solvate thereof, or a hydrate thereof.
11. The 1H-pyrazolo [3,4-b] pyridine derivative or a salt thereof according to claim 9 or 10, wherein R ₁ is any _one of a hydrogen atom, a halogen atom, a methyl group, a trifluoromethyl group, and a benzyloxy group. Their solvates or their hydrates.
12. The 1H-pyrazolo [3,4-- group according to any one of claims 9 to 11, wherein R ₂ is any one of a methyl group, an isopropyl group, a cyclopropyl group, a cyclobutyl group, a cyclopentyl group, and a 1- (ethyl) propyl group. b] A pyridine derivative, a salt thereof, a solvate thereof, or a hydrate thereof.
13. The 1H-pyrazolo [3,4, R _{4 according} to any one of claims 9 to 12, wherein R ₃ is any one of a methyl group, an ethyl group, a cyclopropyl group, an isopropyl group, a fluoromethyl group, a phenyl group, and a 2-thienyl group. -B] A pyridine derivative, or a salt thereof, or a solvate or hydrate thereof.
14. The compound represented by the general formula (1) is 1- (4-chlorophenyl) -3-isopropyl-6-methyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid, 1- (3- Chlorophenyl) -3-isopropyl-6-methyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid, 1- (4-bromophenyl) -3-isopropyl-6-methyl-1H-pyrazolo [3 , 4-b] pyridine-4-carboxylic acid, 1- (4-iodophenyl) -3-isopropyl-6-methyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid, 3-isopropyl- 6-methyl-1- (4-methylphenyl) -1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid, 1- (4-chlorophenyl) -6-ethyl-3-isopropyl-1H-pyrazolo 3,4-b] pyridine-4-carboxylic acid, 1- (4-chlorophenyl) -6-cyclopropyl-3-isopropyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid, 1- ( 3-chlorophenyl) -6-ethyl-3-isopropyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid, 1- (3-chlorophenyl) -6-cyclopropyl-3-isopropyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid, 1- (4-bromophenyl) -6-ethyl-3-isopropyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid, 1- (4-Bromophenyl) -6-cyclopropyl-3-isopropyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid, 6-ethyl-1- (4-iodophenyl) -3 Isopropyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid, 1- (4-bromophenyl) -3-isopropyl-6-phenyl-1H-pyrazolo [3,4-b] pyridine-4- Carboxylic acid, 1- (4-chlorophenyl) -3-isopropyl-6-phenyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid, 1- (4-fluorophenyl) -3-isopropyl-6 -Phenyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid, 1- (4-chlorophenyl) -6- (fluoromethyl) -3-isopropyl-1H-pyrazolo [3,4-b] pyridine -4-carboxylic acid, 6- (fluoromethyl) -1- (4-fluorophenyl) -3-isopropyl-1H-pyrazolo [3,4-b] pyridine-4-carboxylic acid The 1H-pyrazolo [3,4-b] pyridine derivative according to claim 9, or a salt thereof, a solvate thereof or a hydrate thereof, which is selected from the group.

Images