WO2017079428A1 - Site specific germline modification - Google Patents
Site specific germline modification Download PDFInfo
- Publication number
- WO2017079428A1 WO2017079428A1 PCT/US2016/060315 US2016060315W WO2017079428A1 WO 2017079428 A1 WO2017079428 A1 WO 2017079428A1 US 2016060315 W US2016060315 W US 2016060315W WO 2017079428 A1 WO2017079428 A1 WO 2017079428A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- gsc
- nucleic acid
- germline
- acid sequence
- target nucleic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0608—Germ cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/60—Fusion polypeptide containing spectroscopic/fluorescent detection, e.g. green fluorescent protein [GFP]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
Definitions
- the genetic modifications are made to the germline of an animal.
- the animal is a mammal.
- the animal is a human. In some embodiments, the animal is a non-human mammal.
- a target nucleic acid sequence in the genome of a germ stem cell e.g., a mammalian GSC, such as a human GSC.
- the target nucleic acid sequence in the germline of the GSC is replaced with a modified target nucleic acid sequence.
- the method includes the step of contacting the GSC with a nucleic acid molecule encoding a germline targeted nuclease.
- the GSC is an oogonial stem cell (OSC) or a spermatogonial stem cell (SSC).
- the method includes the step of contacting a sample comprising a population of GSCs with a germline targeted nuclease, wherein the germline targeted nuclease is targeted to the target nucleic acid sequence.
- the method includes the step of isolating single GSCs from the population of GSCs.
- the method includes the step of culturing the single GSCs to form clonal GSC colonies.
- the method includes the step of identifying the clonal GSC colonies that contain a modified target nucleic acid sequence in its genome.
- the method includes the step of generating an animal from a cell from an identified clonal GSC colony.
- the GSC is an oogonial stem cell (OSC) or a spermatogonial stem cell (SSC).
- OSC oogonial stem cell
- SSC spermatogonial stem cell
- the target nucleic acid sequence is a gene encoding an allele associated with a disease or disorder (e.g., a Brcal or Brca2 allele associated with breast cancer, a Htt allele associated with Huntington's disease, a Cftr allele associated with cystic fibrosis, a Hbb allele associated with thalassemia or sickle cell disease).
- a disease or disorder e.g., a Brcal or Brca2 allele associated with breast cancer, a Htt allele associated with Huntington's disease, a Cftr allele associated with cystic fibrosis, a Hbb allele associated with thalassemia or sickle cell disease.
- the modified target nucleic acid sequence is an allele of the gene that is not associated with the disease or disorder.
- the target nucleic acid sequence is a gene encoding an allele associated with a particular trait in an animal (e.g., disease resistance, toxin resistance, cancer resistance, radiation resistance, cell stress resistance, growth rate, adult size, lifespan, milk production, meat production, leather production, endurance, wool production, egg production, domestication, allergies, food sensitivities, hair properties (e.g., growth, length, thickness, color, waviness), fertility, speed, endurance).
- the modified target nucleic acid sequence is an allele of the gene that is associated with a different trait in the animal.
- the modified target nucleic acid sequence is a DNA sequence from another species with a particular trait.
- the target nucleic acid sequence is located in chromosomal DNA.
- the target nucleic acid sequence is located on mitochondrial DNA.
- the methods provided herein include the step of contacting the GSC with a nucleic acid molecule encoding a germline targeted nuclease, wherein the germline targeted nuclease is targeted to the target nucleic acid.
- the GSC is transfected with a nucleic acid molecule encoding the germline targeted nuclease.
- the GSC is contacted with a vector (e.g., an expression vector) comprising a nucleic acid molecule encoding the germline targeted nuclease.
- the nucleic acid sequence encoding the germline targeted nuclease is operably linked to a regulatable or non-regulatable transcription control element (e.g., an inducible promoter) such that the germline targeted nuclease is expressed in the GSC.
- a regulatable or non-regulatable transcription control element e.g., an inducible promoter
- the GSC is contacted with a nucleic acid molecule encoding a marker (e.g., a fluorescent protein or an antibiotic resistance protein).
- a marker e.g., a fluorescent protein or an antibiotic resistance protein.
- any germline targeted nuclease can be employed.
- the germline targeted nuclease is a zinc- finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), an RNA- guided endonuclease (RGEN) or an engineered homing meganuclease (EHM).
- ZFN zinc- finger nuclease
- TALEN transcription activator-like effector nuclease
- RGEN RNA- guided endonuclease
- EHM engineered homing meganuclease
- the germline targeted nuclease is a component of a CRISPR/Cas system, such as Cas9.
- the germline targeted nuclease is a fusion protein comprising the germline targeted nuclease and a detectable moiety (e.g., a fluorescent moiety such as GFP).
- the GSC is transfected with a homology repair template.
- the homology repair template comprises the modified target nucleic acid sequence flanked by homology arms.
- each of the homology arms comprise a nucleic acid sequence homologous to the nucleic acid sequence flanking the target nucleic acid sequence in the genome of the GSC.
- the germline targeted nuclease induces a double-stranded DNA break or a single-stranded DNA nick in the target nucleic acid sequence, which induces homology - directed repair of the break or nick and the replacement of the target nucleic acid sequence in the genome of the GSC with the modified target nucleic acid sequence of the homology repair template.
- the target nucleic acid sequence is modified using a CRISPR/Cas system.
- the Cas protein in the CRISPR/Cas system is Cas9.
- the GSC is transfected with a nucleic acid encoding Cas9 and a nucleic acid encoding a guide-RNA that is specific to the target nucleic acid sequence.
- Cas9 and the guide-RNA are encoded on the same nucleic acid.
- the guide-RNA is directly transfected into the GSC.
- the guide-RNA comprises a target-specific guide sequence (e.g., a sequence that is complementary to a sequence of the target RNA sequence) and a guide-RNA scaffold sequence.
- the target-specific guide sequence is 5' of the guide-RNA scaffold sequence.
- the nucleic acid encoding Cas9 is codon optimized.
- the Cas9 carries a mutation that causes it to be a DNA nickase (e.g., a D 10A mutation).
- the GSC is also transfected with a homology repair template.
- the homology repair template comprises the modified target nucleic acid sequence flanked by homology arms.
- the homology arms comprise nucleic acid sequences homologous to the nucleic acid sequences flanking the target nucleic acid sequence in the genome of the GSC.
- Cas9 is targeted to the target nucleic acid sequence by the guide- RNA, where it induces a double-stranded break or a single-stranded nick.
- the double-stranded break or single-stranded nick induces homology-directed repair of the break or nick and the replacement of the target nucleic acid sequence in the genome with the modified target nucleic acid sequence.
- the modified target nucleic acid sequence is on a homology repair template.
- the methods provided herein include the step of isolating the GSC prior to contacting it with the germline targeted nuclease.
- the method includes the isolation of OSCs from ovarian tissue.
- the method includes the step of isolating SSCs from testes tissue.
- the GSC is isolated by fluorescent activated cell sorting (FACS).
- FACS fluorescent activated cell sorting
- the GSC is isolated based on Ddx4 expression.
- the methods provided herein include the step of clonally culturing the transfected GSC to generate a clonal GSC colony.
- the GSC is isolated from other GSCs prior to being cultured (e.g., by FACS).
- GSCs that express the germline targeted nuclease are isolated from GSCs that do not express the germline targeted nuclease.
- GSCs that express a low level of the germline targeted nuclease are isolated from other GSCs prior to clonal culturing.
- the GSCs that express a low level of the germline targeted nuclease are the about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 1 1%, 12%, 13%, 14%, 15% 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45% or 50% of GSCs that are positive for germline-targeted nuclease with the lowest level of germline targeted nuclease expression.
- the germline-targeted nuclease is a fusion protein that comprises a detectable marker, such as a fluorescent marker.
- the fluorescent marker is GFP.
- the level of germline targeted nuclease expression is determined by determining the amount of detectable marker in the GSC (e.g., by FACS).
- the methods provided herein include the step of determining whether the target nucleic acid sequence has been modified in the GSC. In some embodiments, the methods provided herein include the step of determining whether the target nucleic acid sequence has been modified in the GSC.
- the method includes the step of determining whether the target nucleic acid sequence has been modified in cells of the clonal GSC colony. In some embodiments, whether the target nucleic acid sequence has been modified is determined by sequencing the locus in which the target nucleic acid sequence was located in the genome of the GSC. In some embodiments, whether the target nucleic acid sequence has been modified is determined by contacting the locus in which the target nucleic acid sequence was located in the genome of the GSC with a probe that selectively hybridizes to the target nucleic acid sequence or the modified target nucleic acid sequence.
- the locus in which the target nucleic acid sequence was located in the genome of the GSC is amplified using a nucleic acid amplification procedure and the amplification product is sequenced. In some embodiments, the locus in which the target nucleic acid sequence was located in the genome of the GSC is amplified using a nucleic acid amplification procedure and the amplification product is contacted with a probe that selectively hybridizes to the target nucleic acid sequence or the modified target nucleic acid sequence.
- the methods provided herein include the step of sequencing the genome of the cells from the clonal GSC colony.
- the genome sequencing step is used to identify GSC colonies in which only the target nucleic acid sequence has been modified (i.e., cells in which the germline targeted nuclease did not cause any off-target mutations).
- a cell from a clonal GSC colony (e.g., a clonal GSC colony in which the target nucleic acid has been modified) is caused to differentiate into mature germ cells (e.g., mature spermatocytes or mature oocytes).
- the methods provided herein include the step of inducing the maturation of a cell from the clonal GSC colony into a mature germ cell.
- the maturation of the GSC is induced by transplantation of the GSC into testes or ovarian tissue, directed differentiation in vitro or nuclear transfer into a mature germ cell.
- the mature germ cell is used in an in vitro fertilization procedure.
- the GSC is an OSC and it is transplanted into a surrogate mother. In some embodiments, the GSC is a SSC and it is transplanted into a surrogate father. In some embodiments the surrogate mother and/or the surrogate father is mated to generate offspring comprising the modified target nucleic acid.
- Figure 1 is a flowchart illustrating an exemplary method in accordance with one or more embodiments.
- Figure 2 shows two FACS plots, each depicting the isolation of primary OSCs from murine ovaries.
- Figure 3 shows fluorescent microscope images taken of OSCs that have been transfected using the specified amounts of a Cas9-GFP expression vector and lipofectamine 2000.
- Figure 4 shows a series of FACS plots depicting the isolation of transfected OSCs expressing Cas9-GFP.
- Figure 5 shows an example of a clonal colony generated from a FACS-purified single OSC transfected with components of the CRISPR/Cas9 system.
- Figure 6 provides the nucleic acid sequence of human codon optimized Cas9.
- Figure 7 shows an exemplary gating strategy for isolating OSCs using flow cytometry.
- Figure 8 shows the expansion of sorted OSCs in culture.
- One-day post isolation, cells are fluorescent in the FITC channel due to Calcein uptake during sorting.
- Figure 9 shows the PCR genotyping of the GFP insertion into the ROSA26 locus in the germline of OSCs.
- the top panel is a diagram of the edited ROSA26 locus, showing regions of homology to the donor plasmid and the primers used for genotyping.
- the bottom channel depicts the genotyping results for five OSC lines.
- Figure 10 shows the genomic sequencing results of the genome-insert junction of an edited OSC lines.
- Figure 11 shows fluorescent microscope images of two of the edited OSC cell lines depicting GFP expression by the cells.
- Figure 12 shows expression of germline genes by edited OSC cell lines.
- Figure 13 has four panels and shows the targeting of the AAVSl "safe-harbor" locus in human OSCs.
- Panel (a) is a diagram of the human AAVSl locus after knock-in of a GFP reporter.
- Panel (b) shows a representative genotyping PCR for unmodified and modified AAVSl alleles.
- Panels (c) and (d) show human OSCs transfected with CRISPR plasmids of AAVSl -GFP knock-in.
- Figure 14 is a flowchart illustrating an exemplary pipeline for editing OSCs.
- Figure 15 has two panels.
- Panel (a) shows a mixed population of human OSCs in which the GFP gene has been directed to the AAV1 safe harbor locus using CRISPR/Cas9.
- Panel (b) shows GFP-positive single sorted EggPCs that were selected for clonal expansion under optimized conditions.
- GSC germ stem cell
- OSC oogonial stem cell
- SSC spermatogonial stem cell
- the target nucleic acid sequence is replaced with a modified target nucleic acid sequence.
- a germline targeted nuclease such as a zinc-finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), an RNA-guided endonuclease (RGEN) or an engineered homing meganuclease (EHM) is used to induce the modification.
- ZFN zinc-finger nuclease
- TALEN transcription activator-like effector nuclease
- RGEN RNA-guided endonuclease
- EHM engineered homing meganuclease
- the RGEN is Cas9 and the target nucleic acid sequence is modified using the CRISPR/Cas9 system.
- IGMs inheritable genetic modifications
- SSCs germline stem cells
- EggPCs egg precursor cells
- the methods provided herein can be used to fix mutations associated with genetic diseases, to knock-out genes, to insert transgenes, and/or to make other changes or enhancements to the germline genome, which are inherited by the next generation.
- the mitochondrial genome of the GSC is edited prior to mitochondrial transfer into a GSC, oocyte, or zygote.
- the nuclear genome of the GSC is edited prior to transferring the nucleus into a GSC, oocyte, or zygote.
- the methods provided herein can be applied to mammals for research, ecological, agricultural ⁇ e.g. farm animals or pets), and therapeutic purposes, including the application to humans for purposes relating to health.
- the methods provided herein use genome editing in GSCs as an alternative to genome editing in pluripotent cells such as embryonic (ES) cells, induced pluripotent (iPS) cells, and zygotes.
- ES embryonic
- iPS induced pluripotent
- FIG. 1 A flowchart illustrating an exemplary method in accordance with one or more embodiments is provided in Figure 1.
- GSCs are isolated from ovarian or testes tissue using methods such as FACS (e.g., as described in Woods and Tilly, Nat Pr otoc. 8:966-88 (2013), incorporated by reference in its entirety).
- the GSCs are transfected and/or infected with targeted nucleases to make genetic alterations ⁇ e.g., using components of the CRISPR/Cas9 system).
- Single transfected cells that have a high chance of being error free ⁇ e.g. that express low levels of CAS9) are FACS purified into individual wells and grown into clonal colonies. The colonies are genotyped to identify those with desired alterations. The genomes of the colonies containing the desired alteration are then sequenced to confirm that the genetic change is correct and to exclude colonies that have additional genetic changes.
- the cells can be induced to form competent, mature spermatocytes or oocytes by any one of several methods, including transplantation to testes or ovarian tissue, directed differentiation in vitro, or nuclear transfer from an in v/Yro-derived immature spermatocyte or oocyte to a mature cell.
- Genetically-modified mature germ cells can be used to produce offspring by conventional mating or in vitro fertilization (IVF) techniques.
- an "allele” refers to one of two or more alternative forms of a nucleotide sequence at a given position (locus) on a chromosome.
- An individual can be heterozygous or homozygous for any allele described herein.
- an "expression vector” is a vector which is capable of promoting expression of a nucleic acid incorporated therein.
- the nucleic acid to be expressed is “operably linked' to a transcriptional control element, such as a promoter and/or an enhancer, and is therefore subject to transcription regulatory control by the transcriptional control element.
- a transcriptional control element such as a promoter and/or an enhancer
- the term “gene” is used broadly to refer to any nucleic acid associated with a biological function.
- the term “gene” applies to a specific genomic sequence, as well as to a cDNA or an mRNA encoded by that genomic sequence.
- germline targeted nuclease refers to programmable nucleases capable of targeted genome modification.
- Examples of germline targeted nucleases include, but are not limited to, zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), RNA-guided endonucleases (RGENs), such as the CRISPR/Cas9 system, and engineered homing meganucleases (EHMs).
- polynucleotide ' and “nucleic acid' are used interchangeably. They refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or
- Polynucleotides may have any three-dimensional structure, and may perform any function.
- loci locus
- a polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. A polynucleotide may be further modified, such as by conjugation with a labeling component. In all nucleic acid sequences provided herein, U nucleotides are interchangeable with T nucleotides.
- vector refers to the means by which a nucleic acid can be propagated and/or transferred between animals, cells, or cellular components.
- Vectors include plasmids, viruses, bacteriophage, pro-viruses, phagemids, transposons, and artificial chromosomes, and the like, that may or may not be able to replicate autonomously or integrate into a
- the methods provided herein include the step of isolating a population of GSCs from an animal.
- the GSCs can be isolated from any animal.
- the animal is a non-human animal.
- the animal is a mammal.
- the animal is a non-human mammal.
- the mammal is a domesticated mammal ⁇ e.g., a cow, a pig, a horse, a donkey, a goat, a camel, a cat, a dog, a guinea pig, a rat, a mouse, a sheep, a zebu, a water buffalo, a yak, a llama, an alpaca, a ferret, a rabbit, a caribou, a reindeer).
- a domesticated mammal ⁇ e.g., a cow, a pig, a horse, a donkey, a goat, a camel, a cat, a dog, a guinea pig, a rat, a mouse, a sheep, a zebu, a water buffalo, a yak, a llama, an alpaca, a ferret, a rabbit, a caribou, a reindeer).
- the GSCs are OSCs.
- the OSCs are isolated from the ovarian tissue of the animal. Any method for the isolation of OSCs can be used. Methods for the isolation of OSCs from ovarian tissue are known in the art and described, for example, in Woods and Tilly, Nat Protoc. 8:966-88 (2013) and White et al, Nat. Med. 18:413-421 (2012), each of which is incorporated by reference in its entirety.
- the GSCs are SSCs.
- SSCs are isolated from testes tissue. Any method for the isolation of SSCs can be used. Methods for the isolation of SSCs from testes tissue are known in the art and described, for example, in Guan et al, Nature 440: 1199-1203 (2006) and Kossack et al, Stem Cells 27: 138-149 (2009), each of which is incorporated by reference in its entirety.
- the GSC is isolated by fluorescent activated cell sorting (FACS). In some embodiments, the GSC are stained with an anti-Ddx4 antibody and then isolated based on Ddx4 expression.
- FACS fluorescent activated cell sorting
- the methods provided herein require the introduction of an extrinsic nucleic acid molecule into a GSC.
- the methods provided herein require the introduction of a nucleic acid molecule encoding a germline targeted nuclease ⁇ e.g., a germline targeted nuclease targeted to a germline target nucleic acid sequence) into the GSC.
- the methods require the introduction of a homology repair template into the GSC.
- the methods require the introduction of a guide-RNA and/or a nucleic acid molecule encoding a guide-RNA into the GSC.
- any method can be used to facilitate the introduction of an extrinsic nucleic acid molecule into the GSC.
- the GSC is transfected with the nucleic acid molecule.
- transfection encompasses any process of introducing a nucleic acid molecule into a cell, including, but not limited to, chemical-based methods ⁇ e.g., using calcium phosphate, dendrimers, liposomes and/or cationic polymers), electroporation, sono-poration, optical transfection, protoplast fusion, impalefection, viral methods ⁇ e.g., using adenovirus vectors, adeno-associated virus vectors, retrovirus vectors and/or lentivirus vectors), and particle-based methods ⁇ e.g., using a gene gun, magnetofection or particle bombardment).
- the transfection is transient transfection.
- the GSC is transfected by contacting the GSC with a vector (e.g., an expression vector) comprising a nucleic acid molecule encoding a germline targeted nuclease and/or a guide-RNA.
- a vector e.g., an expression vector
- the nucleic acid sequence encoding the germline targeted nuclease or guide-RNA is operably linked to a transcription control element (e.g., a promoter and/or an enhancer) such that the germline targeted nuclease is expressed in the GSC.
- the transcription control element is an inducible promoter.
- the transcription control element is a constitutive promoter.
- the transfected nucleic acid molecule also encodes a detectable moiety, such as a fluorescent moiety.
- a detectable moiety such as a fluorescent moiety.
- the germline targeted nuclease is a fusion protein that includes a fluorescent moiety.
- any fluorescent protein can be used as the detectable moiety. Examples of fluorescent proteins useful in the methods described herein include, but are not limited to, EGFP, mPlum, mCherry, mOrange, mKO, EYFP, mCitrine, Venus, YPet, Emerald, Cerulean and CyPet.
- Nucleic acid molecules can be delivered to the GSC in any desired vector. These include viral or non-viral vectors, including adenovirus vectors, adeno-associated virus vectors, retrovirus vectors, lentivirus vectors, and plasmid vectors. Exemplary types of viruses include HSV (herpes simplex virus), AAV (adeno associated virus), HIV (human immunodeficiency virus), BIV (bovine immunodeficiency virus), and MLV (murine leukemia virus). Nucleic acid molecules can be administered in any desired format that provides sufficiently efficient delivery levels, including in virus particles, in liposomes, in nanoparticles, and complexed to polymers.
- viral or non-viral vectors including adenovirus vectors, adeno-associated virus vectors, retrovirus vectors, lentivirus vectors, and plasmid vectors. Exemplary types of viruses include HSV (herpes simplex virus), AAV (adeno associated virus), HIV (human immunodeficiency virus),
- the nucleic acid molecule is associated with a liposome to form a gene delivery vehicle.
- Liposomes are small, lipid vesicles comprised of an aqueous compartment enclosed by a lipid bilayer, typically spherical or slightly elongated structures several hundred Angstroms in diameter. Under appropriate conditions, a liposome can fuse with the plasma membrane of a cell or with the membrane of an endocytic vesicle within a cell which has internalized the liposome, thereby releasing its contents into the cytoplasm.
- the liposome membrane acts as a relatively impermeable barrier that sequesters and protects its contents, for example, from degradative enzymes.
- a liposome is a synthetic structure, specially designed liposomes can be produced which incorporate desirable features. See Stryker, Biochemistry, pp. 236-240, 1975 (W.H. Freeman, San Francisco, CA); Soak et al, Biochip. Biopsy's. Acta 600: 1, 1980; Bayer et al, Biochip. Biopsy's. Acta. 550:464, 1979; Rivnay et al, Meth. Enzymol. 149: 119, 1987; Wang et al, PROC. NATL. ACAD. SCI. U.S.A. 84: 7851, 1987, Plant et al, Anal. Biochem. 176:420, 1989, and U.S. Patent 4,762,915.
- Liposomes can encapsulate a variety of nucleic acid molecules including DNA, RNA, plasmids, and expression constructs comprising growth factor polynucleotides such those disclosed in the present invention.
- Liposomal preparations useful in the methods described herein include cationic (positively charged), anionic (negatively charged) and neutral preparations.
- Cationic liposomes have been shown to mediate intracellular delivery of plasmid DNA (Feigner et al, Proc. Natl. Acad. Sci. USA 84:7413-7416, 1987), mRNA (Malone et al, Proc. Natl. Acad. Sci. USA 86:6077-6081, 1989), and purified transcription factors (Debs et al, J. Biol. Chem. 265: 10189-10192, 1990), in functional form. Cationic liposomes are readily available.
- N[l-2,3-dioleyloxy)propyl]-N,N,N-triethylammonium (DOTMA) liposomes are available under the trademark Lipofectin, from GIBCO BRL, Grand Island, NY. See also Feigner et al, Proc. Natl. Acad. Sci. USA 91 : 5148-5152.87, 1994.
- Other commercially available liposomes include Transfectace (DDAB/DOPE) and DOTAP/DOPE (Boerhinger).
- Other cationic liposomes can be prepared from readily available materials using techniques well known in the art. See, e.g., Soak et al, Proc. Natl. Acad. Sci. USA 75:4194-4198, 1978; and WO 90/11092 for descriptions of the synthesis of DOTAP (l,2-bis(oleoyloxy)-3- (trimethylammonio)propane) liposomes.
- anionic and neutral liposomes are readily available, such as from Avanti Polar Lipids (Birmingham, AL), or can be easily prepared using readily available materials.
- Such materials include phosphatidyl choline, cholesterol, phosphatidyl ethanolamine, dioleoylphosphatidyl choline (DOPC), dioleoylphosphatidyl glycerol (DOPG),
- dioleoylphoshatidyl ethanolamine DOPE
- DOPE dioleoylphoshatidyl ethanolamine
- One or more nucleic acid sequence ⁇ e.g., encoding a germline targeted nuclease and a guide-RNA) of interest may be introduced into a GSC as part of a single nucleic acid molecule.
- separate nucleic acid molecules can be used to introduce multiple nucleic acid sequences into the GSC ⁇ e.g., a germline targeted nuclease, a guide-RNA and/or a homology repair template co-transfected into the GSC on separate vectors). Transfection of the multiple vectors can be performed simultaneously or sequentially.
- a target nucleic acid in the genome of a GSC is modified using a germline targeted nuclease.
- any germline targeted nuclease can be used.
- the germline targeted nuclease is a zinc-finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), an RNA-guided endonuclease (RGEN) or an engineered homing meganuclease (EHM).
- a germline targeted nuclease is a programmable nuclease capable of targeted genome modification.
- germline targeted nucleases are able to induce double-stranded DNA breaks or single-stranded DNA nicks within the a specific nucleic acid sequence in the genome of a cell. The presence of the break or nick stimulates the cell's DNA repair machinery.
- the DNA damage can be repaired either by non- homologous end joining (NHEJ) or homology directed repair (HDR).
- NHEJ non- homologous end joining
- HDR homology directed repair
- NHEJ is a pathway that repairs double-stranded DNA breaks without the need of a homologous template.
- the NHEJ process is error prone, and will frequently result in an insertion or deletion at the position of the break.
- Targeting two adjacent sites in a genome with a germline targeted nuclease can be used to delete the intervening sequence.
- Induction of NHEJ at a locus using a germline targeted nuclease can therefore be used to inactivate the gene present at the locus. This process can be used, for example, to inactivate or delete alleles associated with autosomal dominant phenotypes.
- HDR is a DNA repair mechanism in which a cell uses a homologous DNA sequence to repair a DNA break or nick. Induction of HDR at a target nucleic acid sequence requires the presence of a DNA molecule having a homologous sequence to the target nucleic acid sequence ⁇ i.e., a homology repair template). If the template used in the HDR process contains minor nucleic acid sequence differences compared to the target nucleic acid sequence, those minor differences can be incorporated into the repaired target sequence, thereby creating a modified target nucleic acid sequence.
- the GSC is transfected with a homology repair template along with the germline targeted nuclease.
- the homology repair template comprises a modified target nucleic acid sequence flanked by homology arms.
- each of the homology arms comprise a nucleic acid sequence that is homologous to the nucleic acid sequences flanking the target nucleic acid sequence in the genome of the GSC.
- the break or nick is repaired via HDR using the homology repair template, causing the replacement of the target nucleic acid sequence in the genome of the GSC with the modified target nucleic acid sequence.
- induction of HDR can be used to replace an allele of a gene associated with an undesired trait with an allele of a gene associated with a desired trait.
- the methods include a step wherein the expression level of the germline targeted nuclease is determined in a GSC.
- GSCs that express the germline targeted nuclease are isolated from GSCs that do not express the germline targeted nuclease prior to clonal expansion.
- GSCs expressing a low level of germline targeted nuclease are selected to reduce the likelihood of off-target genome modification.
- GSCs that express a low level of the germline targeted nuclease are isolated from other GSCs prior to clonal culturing.
- the GSCs that express a low level of the germline targeted nuclease are the about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 1 1%, 12%, 13%, 14%, 15% 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45% or 50% of GSCs that are positive for germline-targeted nuclease with the lowest level of germline targeted nuclease expression.
- GSCs expressing a high level of the germline targeted nuclease are selected to increase the likelihood of modification of the target nucleic acid sequence.
- the GSCs that express a high level of the germline targeted nuclease are the about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 1 1%, 12%, 13%, 14%, 15% 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45% or 50% of GSCs with the highest level of germline targeted nuclease expression.
- the germline targeted nuclease is a fusion protein that comprises a detectable moiety, such as a fluorescent protein.
- a detectable moiety such as a fluorescent protein.
- any fluorescent protein can be used as the detectable moiety.
- fluorescent proteins useful in the methods described herein include, but are not limited to, EGFP, mPlum, mCherry, mOrange, mKO, EYFP, mCitrine, Venus, YPet, Emerald, Cerulean and CyPet.
- the level of germline targeted nuclease expression is determined by determining the amount of detectable moiety in the GSC (e.g., by FACS).
- RGENs are endonucleases capable of forming double-stranded DNA breaks (or, in some cases, single stranded DNA nicks) at a nucleic acid sequence to which the RGEN is targeted by a "guide-RNA” molecules.
- RGENs are generally derived from a prokaryotic immune system known as the CRISPR-Cas system that is found in many bacteria and archaea. In prokaryotes, CRISPR (clustered regularly interspaced short palindromic repeats) and CRISPR-associated proteins (Cas) provide a defense against viruses and plasmids by taking up and storing short fragments (about 30 bp) of extraneous genetic sequence in arrays separated by direct repeats. The arrays are transcribed and processed into small CRISPR RNAs (“crRNAs" or "guide-RNAs”) that direct the cleavage of complementary viral or bacterial DNA by the Cas-encoded endonucleases.
- RGENs use the CRISPR-Cas system to facilitate targeted genome editing in eukaryotic cells, including mammalian cells, such as human cells.
- the cell to be modified is co-transfected with an expression vector encoding the Cas machinery along with a guide-RNA molecule or an expression vector encoding a guide-RNA molecule.
- the CRISPR-Cas9 system requires only a single protein, Cas9, to catalyze blunt double-stranded DNA breaks at sites targeted by a guide- RNA molecule.
- the Cas9 guide-RNA includes a 20-nucleotide target-specific guide sequence that is complementary to the targeted nucleic acid sequence and that is positioned 5' of a guide RNA scaffold sequence.
- the guide RNA scaffold sequence is, from 5' to 3':
- RNA sequences can be encoded in a single CRISPR array to facilitate the simultaneous editing of multiple sites within a cell's genome.
- a pair of guide RNAs can target proximally located sequences to facilitate the deletion of the intervening sequence.
- Cas9 can be converted into a nicking enzyme by engineering an aspartate-to-alanine substitution (D10A) in the Cas9 RuvCI domain.
- D10A aspartate-to-alanine substitution
- Cas9 is encoded by a codon- optimized sequence. Plasmids encoding Cas9, including codon-optimized plasmids and plasmids encoding engineered Cas9 nickase are publicly available from Addgene
- Jinek et al Science 337:816-821 (2012); Cho et al., Nature Biotechnology 31 :230-232 (2013); Cong et al, Science 339:819-823 (2013); Jinek et al, eLife 2:e00471 (2013); Mali et al, Science 339:823-826 (2013); Qi et al, Cell 152: 1173- 1183 (2013); Fu et al, Nature Biotechnology 31 :822-826 (2013); Fu et al, Nature
- the target nucleic acid sequence is modified using a CRISPR/Cas system.
- the CRISPR/Cas system is a CRISPR/Cas9 system.
- the GSC is transfected with a nucleic acid encoding Cas9 and a nucleic acid encoding a guide-RNA that is specific to the target nucleic acid sequence.
- the GSC is transfected with a nucleic acid encoding Cas9 and a guide-RNA that is specific to the target nucleic acid sequence.
- the nucleic acid encoding the guide-RNA encodes multiple guide RNAs in a tandem array.
- Cas9 and the guide-RNA are encoded on the same nucleic acid.
- the guide-RNA comprises a target-specific guide sequence ⁇ e.g., a sequence that is complementary to a sequence of the target RNA sequence) and a guide-RNA scaffold sequence.
- the target-specific guide sequence is 20 nt in length. In some embodiments, at least 14, 15, 16, 17, 18, 19 or 20 nt of the guider RNA sequence are complementary to the target sequence. In some embodiments, the target- specific guide sequence is 5' of the guide-RNA scaffold sequence.
- the nucleic acid encoding Cas9 is codon optimized for the organism from which the GSC was obtained. In some embodiments, the nucleic acid sequence encoding Cas9 is human codon optimized. In some embodiments, the Cas9 carries a mutation that causes it to be a DNA nickase (e.g., a D10A mutation).
- TALENs are artificial restriction enzymes generated by fusing a Transcription activator-like effectors (TALE) DNA binding domain with a DNA cleavage domain.
- TALE Transcription activator-like effectors
- TALEs are nucleic acid binding proteins secreted by numerous species of
- TALEs contain a DNA binding domain composed of tandem repeats of highly conserved monomer polypeptides that are predominantly 33, 34 or 35 amino acids in length and that differ from each other mainly in amino acid positions 12 and 13 (the "repeat variable di -residues" or "RVD"). Polypeptide monomers have a nucleotide binding affinity that is determined by the identity of the amino acids in its RVD.
- polypeptide monomers with an RVD of NI preferentially bind to adenine
- monomers with an RVD of NG preferentially bind to thymine
- monomers with an RVD of HD preferentially bind to cytosine
- monomers with an RVD of NN preferentially bind to both adenine and guanine
- monomers with an RVD of HN or NH preferentially bind to guanine.
- TALEs The structure and function of TALEs is further described in, for example, Moscou et al, Science 326: 1501 (2009); Boch et al, Science 326: 1509-1512 (2009); and Zhang et al, Nature Biotechnology 29: 149-153 (2011), each of which is incorporated by reference in its entirety.
- the TAL DNA binding domain is fused to a non-specific DNA cleavage domain, generally the cleavage domain of the Fokl endonuclease.
- a non-specific DNA cleavage domain generally the cleavage domain of the Fokl endonuclease.
- the design of the TALE DNA binding domain determines the nucleic acid sequence at which Fokl cleavage domain to generates double-stranded DNA breaks.
- Zinc-Finger Nucleases ZFNs are similar to TALENS, except that a zinc finger DNA binding domain (instead of a TALE DNA binding domain) is fused to a DNA cleavage domain to target DNA cleavage to a particular sequence.
- a zinc finger is a small protein structural motif that is characterized by the coordination of one or more zinc ions to stabilize the protein structure.
- the DNA-binding domain of a ZFN typically contains between three and six zinc finger repeats, enabling it to recognize a specific nucleic acid sequence of between 9 and 18 bp in length.
- This DNA binding domain is fused to a non-specific DNA cleavage domain, generally the cleavage domain of the Fokl endonuclease. In this way, the design of the zinc finger DNA binding domain determines the nucleic acid sequence at which Fokl cleavage domain to generates double-stranded DNA breaks.
- EFDVIs are derived from meganuclease endodeoxyribonucleases that are characterized by a large recognition site that can recognize double-stranded DNA sequences of 12 to 40 bp in length.
- EFDVIs are engineered to recognize a particular DNA sequence either by mutating the amino acid sequence of a naturally occurring homing meganuclease DNA binding domain or by fusing DNA binding domains from multiple different homing meganucleases.
- Precision Biosciences offers a EHM design program called Directed Nuclease Editor that is capable of creating EHMs that target and modify a user- defined location in the genome.
- GSCs transfected according to a method described herein are screened to determine whether the target nucleic acid sequence has been modified in the genome of the GSC. In some embodiments, GSCs transfected according to a method described herein are screened to determine whether any non-target nucleic acid sequences have been modified in the genome of the GSC.
- the methods provided herein include the step of clonally culturing transfected GSCs to generate clonal GSC colonies.
- the GSCs are separated from each other prior to being cultured. For example, single GSCs can be placed into separate wells of a microtiter plate via FACS. The individual cells can be grown in culture using known GSC culture techniques until clonal colonies are formed.
- the methods provided herein include the step of determining whether the target nucleic acid sequence has been modified in the GSC. In some embodiments, the method includes the step of determining whether the target nucleic acid sequence has been modified in cells of the clonal GSC colony. In some embodiments, whether the target nucleic acid sequence has been modified is determined by sequencing the locus in which the target nucleic acid sequence was located in the genome of the GSC. Nucleic acid sequencing processes include, but are not limited to chain termination sequencing, sequencing by ligation, sequencing by synthesis, pyrosequencing, ion semiconductor sequencing, single-molecule real-time sequencing, 454 sequencing, and/or Dilute-'N'-Go sequencing.
- whether the target nucleic acid sequence has been modified is determined by contacting the locus in which the target nucleic acid sequence was located in the genome of the GSC a probe that selectively hybridizes to the target nucleic acid sequence or the modified target nucleic acid sequence ⁇ e.g., a molecular beacon).
- the locus in which the target nucleic acid sequence was located in the genome of the GSC is amplified using a nucleic acid amplification procedure and the amplification product is sequenced.
- the locus in which the target nucleic acid sequence was located in the genome of the GSC is amplified using a nucleic acid amplification procedure and the amplification product is contacted with a probe that selectively hybridizes to the target nucleic acid sequence or the modified target nucleic acid sequence.
- nucleic acid amplification processes include, but are not limited to, polymerase chain reaction (PCR), LATE-PCR a non-symmetric PCR method of amplification, ligase chain reaction (LCR), strand displacement amplification (SDA), transcription mediated amplification (TMA), self-sustained sequence replication (3SR), QP replicase based amplification, nucleic acid sequence-based amplification (NASBA), repair chain reaction (RCR), boomerang DNA amplification (BDA) and/or rolling circle amplification (RCA).
- Probes that can be used in conjunction with nucleic acid amplification processes include, but are not limited to, molecular beacons, molecular torches, TaqMan probes, scorpion probes and HPA probes.
- the methods provided herein include the step of sequencing the genome of the cells from the clonal GSC colony.
- the genome sequencing step is used to identify GSC colonies in which only the target nucleic acid sequence has been modified (i.e., cells in which the germline targeted nuclease did not cause any off-target mutations).
- Nucleic acid sequencing processes include, but are not limited to chain termination sequencing, sequencing by ligation, sequencing by synthesis,
- a GSC containing a modified target nucleic acid sequence in its genome is used to generate an organism having the modified target nucleic acid sequence in its genome.
- any method of generating an organism from a GSC can be used.
- the GSC is caused to differentiate into mature germ cells (e.g., mature spermatocytes or mature oocytes).
- maturation of the GSC is induced by transplantation of the GSC into testes or ovarian tissue, directed differentiation in vitro or nuclear transfer into a mature germ cell.
- the target nucleic acid sequence is a mitochondrial DNA sequence
- mitochondria from the GSC are transferred to a mature germ cell.
- the GSC can be transplanted into a surrogate parent, which is then mated to produce offspring.
- the GSC is an OSC and it is transplanted into a surrogate mother.
- the GSC is a SSC and it is transplanted into a surrogate father.
- the surrogate mother and/or the surrogate father is mated to generate offspring comprising the modified target nucleic acid.
- the GSC can be matured in vitro, for example by culturing the GSC under conditions that induce maturation or by nuclear transfer into a mature germ cell, which can then be used to generate offspring.
- mature spermatocytes can be used in an artificial insemination, or either mature spermatocytes or mature oocytes can be used in an in vitro fertilization procedure.
- the methods provided herein can be used to modify any target nucleic acid.
- the methods provided herein can be used to fix mutations associated with genetic diseases, to knock-out genes, to insert transgenes, and/or to make other changes or enhancements to the germline genome, which are inherited by the next generation.
- the target nucleic acid sequence is located in chromosomal DNA.
- the target nucleic acid sequence is located on mitochondrial DNA.
- the methods provided herein can be applied to mammals for research, ecological, agricultural ⁇ e.g. farm animals or pets), and therapeutic purposes, including the application to humans for purposes relating to health.
- the target nucleic acid sequence is a gene encoding an allele associated with a disease or disorder ⁇ e.g., an Brcal or Brca2 allele associated with breast cancer, a Htt allele associated with Huntington's disease, a Cftr allele associated with cystic fibrosis, a Hbb allele associated with thalassemia or sickle cell disease) that is modified to an allele of the gene that is not associated with the disease or disorder.
- a disease or disorder e.g., an Brcal or Brca2 allele associated with breast cancer, a Htt allele associated with Huntington's disease, a Cftr allele associated with cystic fibrosis, a Hbb allele associated with thalassemia or sickle cell disease
- the target nucleic acid sequence is a gene associated with hemochromatosis (HFE-related), alpha- 1 antitrypsin deficiency, phenylketonuria, familial dysautonomia, canavan disease, familial hyperinsulinism (ABCC8-related), primary hyperoxaluria type 2 (PH2), primary hyperoxaluria type 2 (PH2), rhizomelic
- RCDP1 chondrodysplasia punctata type 1
- torsion dystonia polycystic kidney disease
- TTR-related cardiac amyloidosis mucolipidosis IV
- limb-girdle muscular dystrophy limb-girdle muscular dystrophy
- LSFC french Canadian type
- PMM2-CDG DPD deficiency
- dihydrolipoamide dehydrogenase deficiency deuronal ceroid lipofuscinosis
- PPT 1 -related medium-chain acyl-coA dehydrogenase
- Glycogen Storage Disease Type la glycogen storage disease type lb, gaucher disease, ARSACS, G6PD deficiency, cystic fibrosis, factor XI deficiency, Zellweger syndrome spectrum, Nijmegen breakage syndrome, D-bifunctional protein deficiency, LAMB3-related junctional epidermolysis bullosa, familial mediterranean fever, TTR-related familial amyloid polyneuropathy, pendred syndrome, tyrosinemia type I, hereditary fructose intolerance, familial hypercholesterolemia type B, hypertrophic cardiomyopathy (MYBPC3 25bp-deletion), BRCA cancer mutations, connexin
- the target nucleic acid sequence is a gene encoding an allele associated with a particular trait in an animal (e.g., disease resistance, toxin resistance, cancer resistance, radiation resistance, cell stress resistance, growth rate, adult size, lifespan, milk production, meat production, leather production, endurance, wool production, egg production, domestication, allergies, food sensitivities, baldness, hair color, fertility) that is modified to an allele associated with a different trait.
- a particular trait in an animal e.g., disease resistance, toxin resistance, cancer resistance, radiation resistance, cell stress resistance, growth rate, adult size, lifespan, milk production, meat production, leather production, endurance, wool production, egg production, domestication, allergies, food sensitivities, baldness, hair color, fertility
- the target nucleic acid sequence is a gene associated with alcohol flush reaction, bitter taste perception, earwax type, hair curl, lactose intolerance, malaria resistance, muscle performance, non-ABO blood groups, norovirus resistance, resistance to HIV/ AIDS (e.g., CCR5 delta32 gene resistance), male pattern baldness, adiponectin levels, asparagus metabolite detection, biological aging, birth weight, blood glucose, breast morphology.
- C-reactive protein level childhood and adolescent growth, resistance to chronic hepatitis B, finger length ratio, freckling, hair color, height, LDL cholesterol levels, HDL cholesterol levels, leprosy susceptibility, obesity, nearsightedness and farsightedness, persistent fetal hemoglobin, reading ability, response to diet, response to exercise, sex hormone regulation, tooth development, tuberculosis susceptibility, hypospadias, prostate-specific antigen, eating behavior, hair thickness, longevity, memory, odor detection, pain sensitivity or avoidance of errors.
- Ovaries were dissected from female mice, taking care to remove the attached fat pad, bursa and oviduct from each ovary. Using a scalpel blade or mincing scissors, the ovaries were minced into slurry in 0.5 ml of collagenase/DNase I solution in a glass tissue culture dish. Using a 5-ml glass serological pipette, the slurry was rinsed to the bottom of the dish with 2.5 ml of collagenase/DNase I solution and collected the by placing the entire 3 ml of solution into a 15-ml conical tube. The tube was incubated in a prewarmed (37 °C) orbital shaker for 15 min at 250 r.p.m.
- the tube was removed from the orbital shaker and the slurry manually dispersed with gentle pipetting using a 5-ml glass serological pipette.
- the tube was incubated in the orbital shaker at 37 °C for an additional 15 min at 250 r.p.m.
- the tube was removed from the orbital shaker and the slurry manually dispersed with gentle pipetting until no visible pieces of ovary were present.
- the cell suspension was filtered through a 100- ⁇ nylon mesh cell strainer, collecting the filtrate into a new 15-ml conical tube.
- Ten ml of warm HBSS was added to the conical tube containing the strained cell suspension, and the tube was centrifuged at 300g for 5 min at room temperature, with the centrifuge brake turned off.
- the liquid was decanted, taking care to remove as much of the supernatant as possible without disturbing the cell pellet.
- the cell pellet was resuspended in 4 ml of warm HBSS. The volume of the solution was brought to 10 ml with warm HBSS. The cell suspension was centrifuged at 300g for 5 min at room temperature with the brake on the centrifuge turned off. After centrifugation, the liquid was decanted, taking care to remove as much of the supernatant as possible without disturbing the cell pellet.
- the cell pellet was resuspended in 500 ⁇ of cold antibody blocking/dilution solution, which was placed on ice for 20 minutes. 100 ⁇ of cell suspension was added to negative control and secondary antibody only tubes, which were placed on ice. The remaining 300 ⁇ of cell suspension were diluted to 10 ml in cold HBSS. The suspension was centrifuged at 300g for 5 min at 4 °C. The sample tube was removed from the centrifuge and the supernatant discarded, being careful not to disturb or dislodge the cell pellet. The cell pellet was resuspended in 100 ⁇ of primary antibody solution. The suspension was placed on ice and incubated for 20 min.
- the resuspended cell sample was mixed with primary antibody to a total of 10 ml with cold HBSS and centrifuged at 300g for 5 min at 4 °C.
- the sample tube was removed from the centrifuge and the supernatant discarded.
- the sample tube cell pellet was resuspended in 10 ml of cold HBSS.
- the suspension was centrifuged at 300g for 5 min at 4 °C.
- the cells in the secondary antibody only tube were also centrifuged and the supernatant discarded.
- the cell pellet in the sample tube, as well as the cell pellet in the secondary antibody only tube were resuspended in 250 ⁇ of prepared secondary antibody solution for FACS and placed on ice for 20 minutes.
- the volume in the sample tube and the secondary antibody only tube were brought to a total of 10 ml with cold FIBSS and centrifuged at 300g for 5 min at 4 °C. The supernatants were discarded and the cell pellets resuspended in 10 ml of cold FIBSS. At this time, the volume of the negative control tube was brought to 10 ml with cold HBSS. All three tubes were centrifuged at 300g for 5 min at 4 °C and the supernatants discarded. Each cell pellet (sample tube, secondary antibody only tube and negative control tube) were resuspended in in 0.5 ml of FACS buffer and isolated by FACS. As depicted in Figure 2, Ddx4 positive oogonial stem cells were isolated by FACS.
- Oogonial stem cells that had been expanded in culture were transfected with various amounts of Cas9-GFP fusion protein expression vector using different amounts
- lipofectamine 2000 Briefly, 1.6 ug of total plasmid DNA was diluted into OptiMEM to a total volume of 100 uL, per sample. Four uL of Lipofectamine 2000 was diluted into OptiMEM to a total volume of 100 uL, per sample. After a 5 m incubation, 100 uL of each were combined and the resulting mixture incubated for 20 minutes - 5 hours. The OSCs were pelleted by spinning at 200g for 5 min, and the supernatant removed. The pellet was resuspended to a concentration of 100,000 cells per mL.
- Single OSCs were sorted, unstained, by FACS into individual wells of a 96-well plate and grown in culture.
- the OSCs were trypsinized and then centrifuged at 200g for 5 min, and the supernatant removed. The pellet was resuspended in 1 mL of FACS buffer (0.1% FBS in HBSS).
- FACS buffer 0.1% FBS in HBSS
- To each well of a 96-well plate was added 50 uL of OSC media.
- a single cell was sorted into each well of the 96-well plate by FACS. In general, small colonies were visible within a few days. Within 1-2 weeks, colonies grew large enough to be passaged to larger wells. Between 21% and 33% of the isolated single OSCs produced clonal OSC colonies, one of which is depicted in Figure 5. Whether the OSCs were transfected or not prior to isolation did not significantly affect the efficiency of colony formation.
- Ddx4-positive cells were grown in MEM-a GlutaMax (Invitrogen 32561) with 10% (v/v) FBS (Invitrogen 26140), 1 mM sodium pyruvate (Invitrogen 11360), 0.1 mM EAA (Invitrogen 11140), pen-strep-glutamine (Invitrogen 10378), N-2 Plus supplement (R&D Systems 212-GD-050) , 0.1 mM ⁇ -mercaptoethanol, 1000 units/mL LIF (Millipore
- the genomes of the cultured OSCs were modified by the targeted integration of GFP into the ROSA26 locus (Figure 9).
- the established OSC lines were reverse-transfected with 4 of Lipofectamine 2000 (Life Technologies 11668027), and 3 ⁇ g/mL of DNA.
- hCas9 Additional Gene 41815
- ROSA26 gRNA modified from AddGene 41824
- ROSA26- GFP-puro donor Additional plasmids were transfected in an equimolar ratio.
- GFP- expressing cells were sorted as single cells into wells of a 96-well plate 1-2 weeks after transfection.
- AAVSl "safe harbor" locus as depicted in Figure 13a.
- Primary human OSCs were transfected with X-tremeGENE HP DNA Transfection Reagent (Roche) and four plasmids: Cas9, two gRNAs (guide sequences: GTCCCCTCCACCCCACAGTG and
- GGGGCCACTAGGGACAGGAT GGGGCCACTAGGGACAGGAT
- Cells are grown for 1-2 weeks, after which GFP + cells were sorted into individual wells of a 96-well plate to form clonal colonies. Colonies are genotyped with primers flanking the target site
- OSCs human oogonial stem cells
- This pipeline utilizes nine quality control checkpoints to ensure successful genome editing of OSCs ( Figure 14).
- isolated OSCs are confirmed to advance to a sufficient passage number for genome editing to take place (checkpoint 1) and tested for mycoplasma (checkpoint 2).
- Early-passage OSCs are then genome edited using reverse transfection delivery of CRISPR/Cas9 directed towards a gene of interest (checkpoints 3-4). Enrichment/isolation of edited cells is conducted in three arms
- Figure 15A shows a mixed population of human OSCs in which the GFP gene has been directed to the AAVl safe harbor locus using CRISPR/Cas9. GFP-positive single sorted EggPCs were selected for clonal expansion under optimized conditions ( Figure 15B).
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Developmental Biology & Embryology (AREA)
- Medicinal Chemistry (AREA)
- Mycology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Provided herein are methods for the safe and reliable generation of inheritable genetic modifications. In some embodiments, provided herein are methods of modifying a target nucleic acid sequence in the genome of a germ stem cell using a germline targeted nuclease, such as a zinc-finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), an RNA-guided endonuclease (RGEN) or an engineered homing meganuclease (EHM).
Description
SITE SPECIFIC GERMLINE MODIFICATION
RELATED APPLICATIONS
This application claims the benefit of priority to Provisional Application No.
62/250,893, filed November 4, 2015, which is hereby incorporated by reference in its entirety.
BACKGROUND
The reliable generation of inheritable genetic modifications has been a tantalizing goal for many years. Such technology would, for example, allow the permanent correction of genetic defects in the germline, thereby eliminating the need to treat many genetic disorders and alleviating much pain and suffering. However, for a germline genetic modification technology to become widely accepted, it is necessary to ensure that the technology only modifies the targeted site with the intended genetic change. Unfortunately, technology for the generation of safe germline genetic modifications is not currently available.
SUMMARY
Provided herein are methods for the safe and reliable generation of inheritable genetic modifications. In certain embodiments, the genetic modifications are made to the germline of an animal. In some embodiments, the animal is a mammal. In some
embodiments, the animal is a human. In some embodiments, the animal is a non-human mammal.
In certain aspects, provided herein are methods of modifying a target nucleic acid sequence in the genome of a germ stem cell (GSC, e.g., a mammalian GSC, such as a human GSC). In some embodiments, the target nucleic acid sequence in the germline of the GSC is replaced with a modified target nucleic acid sequence. In some embodiments, the method includes the step of contacting the GSC with a nucleic acid molecule encoding a germline targeted nuclease. In some embodiments, the GSC is an oogonial stem cell (OSC) or a spermatogonial stem cell (SSC).
In some aspects, provided herein is a method of generating an animal carrying a modified target nucleic acid sequence in its genome. In some embodiments, the method includes the step of contacting a sample comprising a population of GSCs with a germline targeted nuclease, wherein the germline targeted nuclease is targeted to the target nucleic acid sequence. In some embodiments, the method includes the step of isolating single GSCs from the population of GSCs. In some embodiments, the method includes the step of
culturing the single GSCs to form clonal GSC colonies. In some embodiments, the method includes the step of identifying the clonal GSC colonies that contain a modified target nucleic acid sequence in its genome. In some embodiments, the method includes the step of generating an animal from a cell from an identified clonal GSC colony. In some
embodiments, the GSC is an oogonial stem cell (OSC) or a spermatogonial stem cell (SSC).
In some embodiments of the methods provided herein, the target nucleic acid sequence is a gene encoding an allele associated with a disease or disorder (e.g., a Brcal or Brca2 allele associated with breast cancer, a Htt allele associated with Huntington's disease, a Cftr allele associated with cystic fibrosis, a Hbb allele associated with thalassemia or sickle cell disease). In some embodiments, the modified target nucleic acid sequence is an allele of the gene that is not associated with the disease or disorder. In some embodiments, the target nucleic acid sequence is a gene encoding an allele associated with a particular trait in an animal (e.g., disease resistance, toxin resistance, cancer resistance, radiation resistance, cell stress resistance, growth rate, adult size, lifespan, milk production, meat production, leather production, endurance, wool production, egg production, domestication, allergies, food sensitivities, hair properties (e.g., growth, length, thickness, color, waviness), fertility, speed, endurance). In some embodiments, the modified target nucleic acid sequence is an allele of the gene that is associated with a different trait in the animal. In some embodiments, the modified target nucleic acid sequence is a DNA sequence from another species with a particular trait. In some embodiments, the target nucleic acid sequence is located in chromosomal DNA. In some embodiments, the target nucleic acid sequence is located on mitochondrial DNA.
In some embodiments, the methods provided herein include the step of contacting the GSC with a nucleic acid molecule encoding a germline targeted nuclease, wherein the germline targeted nuclease is targeted to the target nucleic acid. In some embodiments, the GSC is transfected with a nucleic acid molecule encoding the germline targeted nuclease. In some embodiments, the GSC is contacted with a vector (e.g., an expression vector) comprising a nucleic acid molecule encoding the germline targeted nuclease. In some embodiments the nucleic acid sequence encoding the germline targeted nuclease is operably linked to a regulatable or non-regulatable transcription control element (e.g., an inducible promoter) such that the germline targeted nuclease is expressed in the GSC. In some embodiments, the GSC is contacted with a nucleic acid molecule encoding a marker (e.g., a fluorescent protein or an antibiotic resistance protein).
In some embodiments of the methods provided herein, any germline targeted nuclease can be employed. In some embodiments, the germline targeted nuclease is a zinc- finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), an RNA- guided endonuclease (RGEN) or an engineered homing meganuclease (EHM). In some embodiments, the germline targeted nuclease is a component of a CRISPR/Cas system, such as Cas9. In some embodiments the germline targeted nuclease is a fusion protein comprising the germline targeted nuclease and a detectable moiety (e.g., a fluorescent moiety such as GFP).
In some embodiments of the methods provided herein, the GSC is transfected with a homology repair template. In some embodiments, the homology repair template comprises the modified target nucleic acid sequence flanked by homology arms. In some embodiments, each of the homology arms comprise a nucleic acid sequence homologous to the nucleic acid sequence flanking the target nucleic acid sequence in the genome of the GSC. In certain embodiments, the germline targeted nuclease induces a double-stranded DNA break or a single-stranded DNA nick in the target nucleic acid sequence, which induces homology - directed repair of the break or nick and the replacement of the target nucleic acid sequence in the genome of the GSC with the modified target nucleic acid sequence of the homology repair template.
In some embodiments of the methods provided herein, the target nucleic acid sequence is modified using a CRISPR/Cas system. In some embodiments, the Cas protein in the CRISPR/Cas system is Cas9. In some embodiments, the GSC is transfected with a nucleic acid encoding Cas9 and a nucleic acid encoding a guide-RNA that is specific to the target nucleic acid sequence. In some embodiments, Cas9 and the guide-RNA are encoded on the same nucleic acid. In some embodiments, the guide-RNA is directly transfected into the GSC. In some embodiments, the guide-RNA comprises a target-specific guide sequence (e.g., a sequence that is complementary to a sequence of the target RNA sequence) and a guide-RNA scaffold sequence. In some embodiments, the target-specific guide sequence is 5' of the guide-RNA scaffold sequence. In some embodiments, the nucleic acid encoding Cas9 is codon optimized. In some embodiments, the Cas9 carries a mutation that causes it to be a DNA nickase (e.g., a D 10A mutation). In some embodiments, the GSC is also transfected with a homology repair template. In some embodiments, the homology repair template comprises the modified target nucleic acid sequence flanked by homology arms. In some embodiments, the homology arms comprise nucleic acid sequences homologous to the
nucleic acid sequences flanking the target nucleic acid sequence in the genome of the GSC. In certain embodiments, Cas9 is targeted to the target nucleic acid sequence by the guide- RNA, where it induces a double-stranded break or a single-stranded nick. In some embodiments, the double-stranded break or single-stranded nick induces homology-directed repair of the break or nick and the replacement of the target nucleic acid sequence in the genome with the modified target nucleic acid sequence. In some embodiments the modified target nucleic acid sequence is on a homology repair template.
In some embodiments, the methods provided herein include the step of isolating the GSC prior to contacting it with the germline targeted nuclease. In some embodiments the method includes the isolation of OSCs from ovarian tissue. In some embodiments, the method includes the step of isolating SSCs from testes tissue. In some embodiments, the GSC is isolated by fluorescent activated cell sorting (FACS). In some embodiments, the GSC is isolated based on Ddx4 expression.
In some embodiments, the methods provided herein include the step of clonally culturing the transfected GSC to generate a clonal GSC colony. In some embodiments, the GSC is isolated from other GSCs prior to being cultured (e.g., by FACS). In some embodiments, GSCs that express the germline targeted nuclease are isolated from GSCs that do not express the germline targeted nuclease. In some embodiments, GSCs that express a low level of the germline targeted nuclease (e.g., a low level relative to other transfected GSCs) are isolated from other GSCs prior to clonal culturing. In some embodiments, the GSCs that express a low level of the germline targeted nuclease are the about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 1 1%, 12%, 13%, 14%, 15% 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45% or 50% of GSCs that are positive for germline-targeted nuclease with the lowest level of germline targeted nuclease expression. In some embodiments, the germline-targeted nuclease is a fusion protein that comprises a detectable marker, such as a fluorescent marker. In some embodiments the fluorescent marker is GFP. In some embodiments, the level of germline targeted nuclease expression is determined by determining the amount of detectable marker in the GSC (e.g., by FACS).
In some embodiments, the methods provided herein include the step of determining whether the target nucleic acid sequence has been modified in the GSC. In some
embodiments, the method includes the step of determining whether the target nucleic acid sequence has been modified in cells of the clonal GSC colony. In some embodiments, whether the target nucleic acid sequence has been modified is determined by sequencing the
locus in which the target nucleic acid sequence was located in the genome of the GSC. In some embodiments, whether the target nucleic acid sequence has been modified is determined by contacting the locus in which the target nucleic acid sequence was located in the genome of the GSC with a probe that selectively hybridizes to the target nucleic acid sequence or the modified target nucleic acid sequence. In some embodiments, the locus in which the target nucleic acid sequence was located in the genome of the GSC is amplified using a nucleic acid amplification procedure and the amplification product is sequenced. In some embodiments, the locus in which the target nucleic acid sequence was located in the genome of the GSC is amplified using a nucleic acid amplification procedure and the amplification product is contacted with a probe that selectively hybridizes to the target nucleic acid sequence or the modified target nucleic acid sequence.
In some embodiments, the methods provided herein include the step of sequencing the genome of the cells from the clonal GSC colony. In some embodiments, the genome sequencing step is used to identify GSC colonies in which only the target nucleic acid sequence has been modified (i.e., cells in which the germline targeted nuclease did not cause any off-target mutations).
In some embodiments of the methods provided herein, a cell from a clonal GSC colony (e.g., a clonal GSC colony in which the target nucleic acid has been modified) is caused to differentiate into mature germ cells (e.g., mature spermatocytes or mature oocytes). In some embodiments, the methods provided herein include the step of inducing the maturation of a cell from the clonal GSC colony into a mature germ cell. In some embodiments, the maturation of the GSC is induced by transplantation of the GSC into testes or ovarian tissue, directed differentiation in vitro or nuclear transfer into a mature germ cell. In some embodiments, the mature germ cell is used in an in vitro fertilization procedure. In some embodiments, the GSC is an OSC and it is transplanted into a surrogate mother. In some embodiments, the GSC is a SSC and it is transplanted into a surrogate father. In some embodiments the surrogate mother and/or the surrogate father is mated to generate offspring comprising the modified target nucleic acid.
BRIEF DESCRIPTION OF FIGURES
Figure 1 is a flowchart illustrating an exemplary method in accordance with one or more embodiments.
Figure 2 shows two FACS plots, each depicting the isolation of primary OSCs from murine ovaries.
Figure 3 shows fluorescent microscope images taken of OSCs that have been transfected using the specified amounts of a Cas9-GFP expression vector and lipofectamine 2000.
Figure 4 shows a series of FACS plots depicting the isolation of transfected OSCs expressing Cas9-GFP.
Figure 5 shows an example of a clonal colony generated from a FACS-purified single OSC transfected with components of the CRISPR/Cas9 system.
Figure 6 provides the nucleic acid sequence of human codon optimized Cas9.
Figure 7 shows an exemplary gating strategy for isolating OSCs using flow cytometry.
Figure 8 shows the expansion of sorted OSCs in culture. One-day post isolation, cells are fluorescent in the FITC channel due to Calcein uptake during sorting.
Figure 9 shows the PCR genotyping of the GFP insertion into the ROSA26 locus in the germline of OSCs. The top panel is a diagram of the edited ROSA26 locus, showing regions of homology to the donor plasmid and the primers used for genotyping. The bottom channel depicts the genotyping results for five OSC lines.
Figure 10 shows the genomic sequencing results of the genome-insert junction of an edited OSC lines.
Figure 11 shows fluorescent microscope images of two of the edited OSC cell lines depicting GFP expression by the cells.
Figure 12 shows expression of germline genes by edited OSC cell lines.
Figure 13 has four panels and shows the targeting of the AAVSl "safe-harbor" locus in human OSCs. Panel (a) is a diagram of the human AAVSl locus after knock-in of a GFP reporter. Panel (b) shows a representative genotyping PCR for unmodified and modified AAVSl alleles. Panels (c) and (d) show human OSCs transfected with CRISPR plasmids of AAVSl -GFP knock-in.
Figure 14 is a flowchart illustrating an exemplary pipeline for editing OSCs.
Figure 15 has two panels. Panel (a) shows a mixed population of human OSCs in which the GFP gene has been directed to the AAV1 safe harbor locus using CRISPR/Cas9.
Panel (b) shows GFP-positive single sorted EggPCs that were selected for clonal expansion under optimized conditions.
DETAILED DESCRIPTION
General
Provided herein are methods for the reliable generation of inheritable genetic modifications. In some embodiments, provided herein are methods of modifying a target nucleic acid sequence in the genome of a germ stem cell (GSC), such as an oogonial stem cell (OSC) or a spermatogonial stem cell (SSC). In some embodiments the target nucleic acid sequence is replaced with a modified target nucleic acid sequence. In some
embodiments, a germline targeted nuclease, such as a zinc-finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), an RNA-guided endonuclease (RGEN) or an engineered homing meganuclease (EHM) is used to induce the modification. In some embodiments, the RGEN is Cas9 and the target nucleic acid sequence is modified using the CRISPR/Cas9 system.
Disclosed herein is a way to make permanent genetic alterations or inheritable genetic modifications (IGMs) in the mammalian {e.g., human) germline using germline stem cells (GSCs) from males or females. Male GSCs are known as spermatogonial stem cells (SSCs). The female GSCs are known as oogonial stem cells (OSCs) or egg precursor cells (EggPCs).
In some embodiments, the methods provided herein can be used to fix mutations associated with genetic diseases, to knock-out genes, to insert transgenes, and/or to make other changes or enhancements to the germline genome, which are inherited by the next generation. In some embodiments, the mitochondrial genome of the GSC is edited prior to mitochondrial transfer into a GSC, oocyte, or zygote. In some embodiments, the nuclear genome of the GSC is edited prior to transferring the nucleus into a GSC, oocyte, or zygote. In certain embodiments, the methods provided herein can be applied to mammals for research, ecological, agricultural {e.g. farm animals or pets), and therapeutic purposes, including the application to humans for purposes relating to health.
In some embodiments, the methods provided herein use genome editing in GSCs as an alternative to genome editing in pluripotent cells such as embryonic (ES) cells, induced pluripotent (iPS) cells, and zygotes. Advantages over these systems include the fact that GSCs may be more easily obtained, may have less cellular defects, and are pre-meiotic cells.
A flowchart illustrating an exemplary method in accordance with one or more embodiments is provided in Figure 1. In certain embodiments, GSCs are isolated from ovarian or testes tissue using methods such as FACS (e.g., as described in Woods and Tilly, Nat Pr otoc. 8:966-88 (2013), incorporated by reference in its entirety). The GSCs are transfected and/or infected with targeted nucleases to make genetic alterations {e.g., using components of the CRISPR/Cas9 system). Single transfected cells that have a high chance of being error free {e.g. that express low levels of CAS9) are FACS purified into individual wells and grown into clonal colonies. The colonies are genotyped to identify those with desired alterations. The genomes of the colonies containing the desired alteration are then sequenced to confirm that the genetic change is correct and to exclude colonies that have additional genetic changes. Once cells with desired genetic alterations (and only the desired genetic alterations) are identified, the cells can be induced to form competent, mature spermatocytes or oocytes by any one of several methods, including transplantation to testes or ovarian tissue, directed differentiation in vitro, or nuclear transfer from an in v/Yro-derived immature spermatocyte or oocyte to a mature cell. Genetically-modified mature germ cells can be used to produce offspring by conventional mating or in vitro fertilization (IVF) techniques.
Definitions
In order that the present invention may be more readily understood, certain terms are first defined. Additional definitions are set forth throughout the detailed description.
The articles "a" and "a«" are used herein to refer to one or to more than one {i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.
As used herein, an "allele" refers to one of two or more alternative forms of a nucleotide sequence at a given position (locus) on a chromosome. An individual can be heterozygous or homozygous for any allele described herein.
As used herein, the term animaF includes both human and non-human animals. An "expression vector" is a vector which is capable of promoting expression of a nucleic acid incorporated therein. Typically, the nucleic acid to be expressed is "operably linked' to a transcriptional control element, such as a promoter and/or an enhancer, and is therefore subject to transcription regulatory control by the transcriptional control element.
The term "gene" is used broadly to refer to any nucleic acid associated with a biological function. The term "gene" applies to a specific genomic sequence, as well as to a cDNA or an mRNA encoded by that genomic sequence.
The term "germline targeted nuclease'" refers to programmable nucleases capable of targeted genome modification. Examples of germline targeted nucleases include, but are not limited to, zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), RNA-guided endonucleases (RGENs), such as the CRISPR/Cas9 system, and engineered homing meganucleases (EHMs).
The terms "polynucleotide'", and "nucleic acid' are used interchangeably. They refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or
ribonucleotides, or analogs thereof. Polynucleotides may have any three-dimensional structure, and may perform any function. The following are non-limiting examples of polynucleotides: coding or non-coding regions of a gene or gene fragment, loci (locus) defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. A polynucleotide may be further modified, such as by conjugation with a labeling component. In all nucleic acid sequences provided herein, U nucleotides are interchangeable with T nucleotides.
The term "vector" refers to the means by which a nucleic acid can be propagated and/or transferred between animals, cells, or cellular components. Vectors include plasmids, viruses, bacteriophage, pro-viruses, phagemids, transposons, and artificial chromosomes, and the like, that may or may not be able to replicate autonomously or integrate into a
chromosome of a host cell.
Isolation of Germline Stem Cells
In some embodiments, the methods provided herein include the step of isolating a population of GSCs from an animal. In some embodiments, the GSCs can be isolated from any animal. In some embodiments, the animal is a non-human animal. In some embodiments, the animal is a mammal. In some embodiments, the animal is a non-human mammal. In some embodiments the mammal is a domesticated mammal {e.g., a cow, a pig, a horse, a
donkey, a goat, a camel, a cat, a dog, a guinea pig, a rat, a mouse, a sheep, a zebu, a water buffalo, a yak, a llama, an alpaca, a ferret, a rabbit, a caribou, a reindeer).
In some embodiments, the GSCs are OSCs. In some embodiments, the OSCs are isolated from the ovarian tissue of the animal. Any method for the isolation of OSCs can be used. Methods for the isolation of OSCs from ovarian tissue are known in the art and described, for example, in Woods and Tilly, Nat Protoc. 8:966-88 (2013) and White et al, Nat. Med. 18:413-421 (2012), each of which is incorporated by reference in its entirety.
In some embodiments, the GSCs are SSCs. In some embodiments, SSCs are isolated from testes tissue. Any method for the isolation of SSCs can be used. Methods for the isolation of SSCs from testes tissue are known in the art and described, for example, in Guan et al, Nature 440: 1199-1203 (2006) and Kossack et al, Stem Cells 27: 138-149 (2009), each of which is incorporated by reference in its entirety.
In some embodiments, the GSC is isolated by fluorescent activated cell sorting (FACS). In some embodiments, the GSC are stained with an anti-Ddx4 antibody and then isolated based on Ddx4 expression.
Transfection of Germline Stem Cells
In some embodiments, the methods provided herein require the introduction of an extrinsic nucleic acid molecule into a GSC. For example, in some embodiments, the methods provided herein require the introduction of a nucleic acid molecule encoding a germline targeted nuclease {e.g., a germline targeted nuclease targeted to a germline target nucleic acid sequence) into the GSC. In some embodiments, the methods require the introduction of a homology repair template into the GSC. In some embodiments, the methods require the introduction of a guide-RNA and/or a nucleic acid molecule encoding a guide-RNA into the GSC.
In certain embodiments, any method can be used to facilitate the introduction of an extrinsic nucleic acid molecule into the GSC. In some embodiments, the GSC is transfected with the nucleic acid molecule. As used herein, "transfection" encompasses any process of introducing a nucleic acid molecule into a cell, including, but not limited to, chemical-based methods {e.g., using calcium phosphate, dendrimers, liposomes and/or cationic polymers), electroporation, sono-poration, optical transfection, protoplast fusion, impalefection, viral methods {e.g., using adenovirus vectors, adeno-associated virus vectors, retrovirus vectors and/or lentivirus vectors), and particle-based methods {e.g., using a gene gun,
magnetofection or particle bombardment). In some embodiments, the transfection is transient transfection.
In some embodiments, the GSC is transfected by contacting the GSC with a vector (e.g., an expression vector) comprising a nucleic acid molecule encoding a germline targeted nuclease and/or a guide-RNA. In some embodiments the nucleic acid sequence encoding the germline targeted nuclease or guide-RNA is operably linked to a transcription control element (e.g., a promoter and/or an enhancer) such that the germline targeted nuclease is expressed in the GSC. In some embodiments, the transcription control element is an inducible promoter. In some embodiments, the transcription control element is a constitutive promoter. In some embodiments, the transfected nucleic acid molecule also encodes a detectable moiety, such as a fluorescent moiety. For example, in some embodiments the germline targeted nuclease is a fusion protein that includes a fluorescent moiety. In general, any fluorescent protein can be used as the detectable moiety. Examples of fluorescent proteins useful in the methods described herein include, but are not limited to, EGFP, mPlum, mCherry, mOrange, mKO, EYFP, mCitrine, Venus, YPet, Emerald, Cerulean and CyPet.
Nucleic acid molecules can be delivered to the GSC in any desired vector. These include viral or non-viral vectors, including adenovirus vectors, adeno-associated virus vectors, retrovirus vectors, lentivirus vectors, and plasmid vectors. Exemplary types of viruses include HSV (herpes simplex virus), AAV (adeno associated virus), HIV (human immunodeficiency virus), BIV (bovine immunodeficiency virus), and MLV (murine leukemia virus). Nucleic acid molecules can be administered in any desired format that provides sufficiently efficient delivery levels, including in virus particles, in liposomes, in nanoparticles, and complexed to polymers.
In some embodiments, the nucleic acid molecule is associated with a liposome to form a gene delivery vehicle. Liposomes are small, lipid vesicles comprised of an aqueous compartment enclosed by a lipid bilayer, typically spherical or slightly elongated structures several hundred Angstroms in diameter. Under appropriate conditions, a liposome can fuse with the plasma membrane of a cell or with the membrane of an endocytic vesicle within a cell which has internalized the liposome, thereby releasing its contents into the cytoplasm.
Prior to interaction with the surface of a cell, however, the liposome membrane acts as a relatively impermeable barrier that sequesters and protects its contents, for example, from degradative enzymes. Additionally, because a liposome is a synthetic structure, specially
designed liposomes can be produced which incorporate desirable features. See Stryker, Biochemistry, pp. 236-240, 1975 (W.H. Freeman, San Francisco, CA); Soak et al, Biochip. Biopsy's. Acta 600: 1, 1980; Bayer et al, Biochip. Biopsy's. Acta. 550:464, 1979; Rivnay et al, Meth. Enzymol. 149: 119, 1987; Wang et al, PROC. NATL. ACAD. SCI. U.S.A. 84: 7851, 1987, Plant et al, Anal. Biochem. 176:420, 1989, and U.S. Patent 4,762,915.
Liposomes can encapsulate a variety of nucleic acid molecules including DNA, RNA, plasmids, and expression constructs comprising growth factor polynucleotides such those disclosed in the present invention.
Liposomal preparations useful in the methods described herein include cationic (positively charged), anionic (negatively charged) and neutral preparations. Cationic liposomes have been shown to mediate intracellular delivery of plasmid DNA (Feigner et al, Proc. Natl. Acad. Sci. USA 84:7413-7416, 1987), mRNA (Malone et al, Proc. Natl. Acad. Sci. USA 86:6077-6081, 1989), and purified transcription factors (Debs et al, J. Biol. Chem. 265: 10189-10192, 1990), in functional form. Cationic liposomes are readily available. For example, N[l-2,3-dioleyloxy)propyl]-N,N,N-triethylammonium (DOTMA) liposomes are available under the trademark Lipofectin, from GIBCO BRL, Grand Island, NY. See also Feigner et al, Proc. Natl. Acad. Sci. USA 91 : 5148-5152.87, 1994. Other commercially available liposomes include Transfectace (DDAB/DOPE) and DOTAP/DOPE (Boerhinger). Other cationic liposomes can be prepared from readily available materials using techniques well known in the art. See, e.g., Soak et al, Proc. Natl. Acad. Sci. USA 75:4194-4198, 1978; and WO 90/11092 for descriptions of the synthesis of DOTAP (l,2-bis(oleoyloxy)-3- (trimethylammonio)propane) liposomes.
Similarly, anionic and neutral liposomes are readily available, such as from Avanti Polar Lipids (Birmingham, AL), or can be easily prepared using readily available materials. Such materials include phosphatidyl choline, cholesterol, phosphatidyl ethanolamine, dioleoylphosphatidyl choline (DOPC), dioleoylphosphatidyl glycerol (DOPG),
dioleoylphoshatidyl ethanolamine (DOPE), among others. These materials can also be mixed with the DOTMA and DOTAP starting materials in appropriate ratios. Methods for making liposomes using these materials are well known in the art.
One or more nucleic acid sequence {e.g., encoding a germline targeted nuclease and a guide-RNA) of interest may be introduced into a GSC as part of a single nucleic acid molecule. Alternatively, separate nucleic acid molecules can be used to introduce multiple nucleic acid sequences into the GSC {e.g., a germline targeted nuclease, a guide-RNA and/or
a homology repair template co-transfected into the GSC on separate vectors). Transfection of the multiple vectors can be performed simultaneously or sequentially.
Germline Targeted Nucleases
In some embodiments of the methods provided herein, a target nucleic acid in the genome of a GSC is modified using a germline targeted nuclease. In some embodiments, any germline targeted nuclease can be used. In some embodiments, the germline targeted nuclease is a zinc-finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), an RNA-guided endonuclease (RGEN) or an engineered homing meganuclease (EHM).
A germline targeted nuclease is a programmable nuclease capable of targeted genome modification. In general, germline targeted nucleases are able to induce double-stranded DNA breaks or single-stranded DNA nicks within the a specific nucleic acid sequence in the genome of a cell. The presence of the break or nick stimulates the cell's DNA repair machinery. In the case of a break, the DNA damage can be repaired either by non- homologous end joining (NHEJ) or homology directed repair (HDR). In the case of a nick, HDR is induced.
NHEJ is a pathway that repairs double-stranded DNA breaks without the need of a homologous template. The NHEJ process is error prone, and will frequently result in an insertion or deletion at the position of the break. Targeting two adjacent sites in a genome with a germline targeted nuclease can be used to delete the intervening sequence. Induction of NHEJ at a locus using a germline targeted nuclease can therefore be used to inactivate the gene present at the locus. This process can be used, for example, to inactivate or delete alleles associated with autosomal dominant phenotypes.
HDR is a DNA repair mechanism in which a cell uses a homologous DNA sequence to repair a DNA break or nick. Induction of HDR at a target nucleic acid sequence requires the presence of a DNA molecule having a homologous sequence to the target nucleic acid sequence {i.e., a homology repair template). If the template used in the HDR process contains minor nucleic acid sequence differences compared to the target nucleic acid sequence, those minor differences can be incorporated into the repaired target sequence, thereby creating a modified target nucleic acid sequence.
In some embodiments of the methods provided herein, the GSC is transfected with a homology repair template along with the germline targeted nuclease. In some embodiments, the homology repair template comprises a modified target nucleic acid sequence flanked by
homology arms. In some embodiments, each of the homology arms comprise a nucleic acid sequence that is homologous to the nucleic acid sequences flanking the target nucleic acid sequence in the genome of the GSC. As a result, in some embodiments when the germline targeted nuclease induces a double-stranded DNA break or a single-stranded DNA nick in the target nucleic acid sequence, the break or nick is repaired via HDR using the homology repair template, causing the replacement of the target nucleic acid sequence in the genome of the GSC with the modified target nucleic acid sequence. Thus, induction of HDR can be used to replace an allele of a gene associated with an undesired trait with an allele of a gene associated with a desired trait.
In some embodiments, the methods include a step wherein the expression level of the germline targeted nuclease is determined in a GSC. For example, in some embodiments, GSCs that express the germline targeted nuclease are isolated from GSCs that do not express the germline targeted nuclease prior to clonal expansion. Moreover, in some embodiments it is desirable to identify GSCs that express a certain level of the germline targeted nuclease. For example, in some embodiments GSCs expressing a low level of germline targeted nuclease are selected to reduce the likelihood of off-target genome modification. In some embodiments, GSCs that express a low level of the germline targeted nuclease (e.g., a low level relative to other transfected GSCs) are isolated from other GSCs prior to clonal culturing. In some embodiments, the GSCs that express a low level of the germline targeted nuclease are the about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 1 1%, 12%, 13%, 14%, 15% 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45% or 50% of GSCs that are positive for germline-targeted nuclease with the lowest level of germline targeted nuclease expression. In some embodiments, GSCs expressing a high level of the germline targeted nuclease are selected to increase the likelihood of modification of the target nucleic acid sequence. In some embodiments, the GSCs that express a high level of the germline targeted nuclease are the about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 1 1%, 12%, 13%, 14%, 15% 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45% or 50% of GSCs with the highest level of germline targeted nuclease expression.
To facilitate monitoring of germline targeted nuclease expression, in some embodiments the germline targeted nuclease is a fusion protein that comprises a detectable moiety, such as a fluorescent protein. In general, any fluorescent protein can be used as the detectable moiety. Examples of fluorescent proteins useful in the methods described herein include, but are not limited to, EGFP, mPlum, mCherry, mOrange, mKO, EYFP, mCitrine,
Venus, YPet, Emerald, Cerulean and CyPet. In some embodiments, the level of germline targeted nuclease expression is determined by determining the amount of detectable moiety in the GSC (e.g., by FACS).
RNA-Guided Endonucleases
RGENs are endonucleases capable of forming double-stranded DNA breaks (or, in some cases, single stranded DNA nicks) at a nucleic acid sequence to which the RGEN is targeted by a "guide-RNA" molecules. RGENs are generally derived from a prokaryotic immune system known as the CRISPR-Cas system that is found in many bacteria and archaea. In prokaryotes, CRISPR (clustered regularly interspaced short palindromic repeats) and CRISPR-associated proteins (Cas) provide a defense against viruses and plasmids by taking up and storing short fragments (about 30 bp) of extraneous genetic sequence in arrays separated by direct repeats. The arrays are transcribed and processed into small CRISPR RNAs ("crRNAs" or "guide-RNAs") that direct the cleavage of complementary viral or bacterial DNA by the Cas-encoded endonucleases.
RGENs use the CRISPR-Cas system to facilitate targeted genome editing in eukaryotic cells, including mammalian cells, such as human cells. To facilitate genome editing, the cell to be modified is co-transfected with an expression vector encoding the Cas machinery along with a guide-RNA molecule or an expression vector encoding a guide-RNA molecule.
While many different CRISPR-Cas systems could be modified to facilitate targeted genome modification, the most commonly used CRISPR-Cas system in targeted genome modification is the CRISPR-Cas9 system. The CRISPR-Cas9 system requires only a single protein, Cas9, to catalyze blunt double-stranded DNA breaks at sites targeted by a guide- RNA molecule. The Cas9 guide-RNA includes a 20-nucleotide target-specific guide sequence that is complementary to the targeted nucleic acid sequence and that is positioned 5' of a guide RNA scaffold sequence. In some embodiments, the guide RNA scaffold sequence is, from 5' to 3':
GUUUUAGAGCUAGAAAUAGCUUAAAAUAAGGCUAGUCCUUAUCAACUUGAAA
AAGUGGCACCGAGUCGGUGCUUUU
Multiple guide RNA sequences can be encoded in a single CRISPR array to facilitate the simultaneous editing of multiple sites within a cell's genome. For example, a pair of guide RNAs can target proximally located sequences to facilitate the deletion of the intervening sequence. In addition, Cas9 can be converted into a nicking enzyme by
engineering an aspartate-to-alanine substitution (D10A) in the Cas9 RuvCI domain. Use of the engineered Cas9 nickase results in HDR repair of the targeted sequence, without the risk of HEJ and the resulting mutations. In some embodiments, Cas9 is encoded by a codon- optimized sequence. Plasmids encoding Cas9, including codon-optimized plasmids and plasmids encoding engineered Cas9 nickase are publicly available from Addgene
(http://www.addgene.org/CRISPR/). An exemplary human codon optimized nucleic acid sequence encoding Cas9 is provided in Figure 6.
Additional information on the application of CRISPR-Cas systems to targeted genome engineering can be found in Jinek et al, Science 337:816-821 (2012); Cho et al., Nature Biotechnology 31 :230-232 (2013); Cong et al, Science 339:819-823 (2013); Jinek et al, eLife 2:e00471 (2013); Mali et al, Science 339:823-826 (2013); Qi et al, Cell 152: 1173- 1183 (2013); Fu et al, Nature Biotechnology 31 :822-826 (2013); Fu et al, Nature
Biotechnology 31 :822-826 (2013); Hsu et al, Nature Biotechnology 31 :827-832 (2013); Mali et al, Nature Biotechnology 31 :833-838 (2013); Pattanayak et al, Nature
Biotechnology 31 :839-843 (2013) and WO/2013/142578, each of which is hereby incorporated by reference in its entirety.
In some embodiments of the methods provided herein, the target nucleic acid sequence is modified using a CRISPR/Cas system. In some embodiments, the CRISPR/Cas system is a CRISPR/Cas9 system. In some embodiments, the GSC is transfected with a nucleic acid encoding Cas9 and a nucleic acid encoding a guide-RNA that is specific to the target nucleic acid sequence. In some embodiments, the GSC is transfected with a nucleic acid encoding Cas9 and a guide-RNA that is specific to the target nucleic acid sequence. In some embodiments, the nucleic acid encoding the guide-RNA encodes multiple guide RNAs in a tandem array. In some embodiments, Cas9 and the guide-RNA are encoded on the same nucleic acid.
In some embodiments, the guide-RNA comprises a target-specific guide sequence {e.g., a sequence that is complementary to a sequence of the target RNA sequence) and a guide-RNA scaffold sequence. In some embodiments, the target-specific guide sequence is 20 nt in length. In some embodiments, at least 14, 15, 16, 17, 18, 19 or 20 nt of the guider RNA sequence are complementary to the target sequence. In some embodiments, the target- specific guide sequence is 5' of the guide-RNA scaffold sequence.
In some embodiments, the nucleic acid encoding Cas9 is codon optimized for the organism from which the GSC was obtained. In some embodiments, the nucleic acid
sequence encoding Cas9 is human codon optimized. In some embodiments, the Cas9 carries a mutation that causes it to be a DNA nickase (e.g., a D10A mutation).
Transcription Activator-Like Effector Nucleases
TALENs are artificial restriction enzymes generated by fusing a Transcription activator-like effectors (TALE) DNA binding domain with a DNA cleavage domain.
TALEs are nucleic acid binding proteins secreted by numerous species of
proteobacteria. TALEs contain a DNA binding domain composed of tandem repeats of highly conserved monomer polypeptides that are predominantly 33, 34 or 35 amino acids in length and that differ from each other mainly in amino acid positions 12 and 13 (the "repeat variable di -residues" or "RVD"). Polypeptide monomers have a nucleotide binding affinity that is determined by the identity of the amino acids in its RVD. For example, polypeptide monomers with an RVD of NI preferentially bind to adenine, monomers with an RVD of NG preferentially bind to thymine, monomers with an RVD of HD preferentially bind to cytosine, monomers with an RVD of NN preferentially bind to both adenine and guanine, and monomers with an RVD of HN or NH preferentially bind to guanine. Thus, the number and order of the polypeptide monomer repeats in the nucleic acid binding domain of a TALE determines its nucleic acid target specificity. The structure and function of TALEs is further described in, for example, Moscou et al, Science 326: 1501 (2009); Boch et al, Science 326: 1509-1512 (2009); and Zhang et al, Nature Biotechnology 29: 149-153 (2011), each of which is incorporated by reference in its entirety.
In TALENs, the TAL DNA binding domain is fused to a non-specific DNA cleavage domain, generally the cleavage domain of the Fokl endonuclease. In this way, the design of the TALE DNA binding domain determines the nucleic acid sequence at which Fokl cleavage domain to generates double-stranded DNA breaks.
Additional information of the construction and use of TALENs is provided in Miller et al, Nucleic Acids Research 39:e82 (2011); Miller et al, Nature Biotechnology 29: 143-148 (2011); Mussolino et al, Nucleic Acids Research 39:9283-9293 (2011); Moirbitzer et al, Nucleic Acids Research 39:5790-5799 (2011); U.S. Pat. Pubs. US/2013/0117869,
US/2011/0145940, US/2011/0301073, US/2013/0217131; and U.S. Pat. Nos. 8,450,471, 8,440,432, 8,440,431, each of which is hereby incorporated by reference in its entirety. Zinc-Finger Nucleases
ZFNs are similar to TALENS, except that a zinc finger DNA binding domain (instead of a TALE DNA binding domain) is fused to a DNA cleavage domain to target DNA cleavage to a particular sequence.
A zinc finger is a small protein structural motif that is characterized by the coordination of one or more zinc ions to stabilize the protein structure. There are a large number of unique zinc finger structures, many of which have their own DNA binding characteristics. The DNA-binding domain of a ZFN typically contains between three and six zinc finger repeats, enabling it to recognize a specific nucleic acid sequence of between 9 and 18 bp in length. This DNA binding domain is fused to a non-specific DNA cleavage domain, generally the cleavage domain of the Fokl endonuclease. In this way, the design of the zinc finger DNA binding domain determines the nucleic acid sequence at which Fokl cleavage domain to generates double-stranded DNA breaks.
Additional information regarding the construction and use of ZFNs is provided in Urnov et al, Nature 435:646-651 (2005); Bibikova et al, Science 300:764 (2003); Maeder et al, Molecular Cell ' 31 :294-301 (2008); Porteus et al, Nature Biotechnology 23 :96 '-973 (2005); U.S. Pat. Pub. Nos. US/2012/0329067, US/2012/0214241, US/2012/0219959, US/2012/0309091; and U.S. Pat. Nos. 8,524,221, 8,106.255, each of which is hereby incorporated by reference in its entirety.
Engineered Homing Meganucleases
EFDVIs are derived from meganuclease endodeoxyribonucleases that are characterized by a large recognition site that can recognize double-stranded DNA sequences of 12 to 40 bp in length.
Among the homing endonucleases, those of the LAGLIDADG family are the most widely used for genome engineering. EFDVIs are engineered to recognize a particular DNA sequence either by mutating the amino acid sequence of a naturally occurring homing meganuclease DNA binding domain or by fusing DNA binding domains from multiple different homing meganucleases. Precision Biosciences offers a EHM design program called Directed Nuclease Editor that is capable of creating EHMs that target and modify a user- defined location in the genome.
Additional information regarding the construction and use of EHMs is provided in
Grizot et al, Nucleic Acids Research 38:2006-2018 (2009); Seligman et al., Nucleic Acids
Research 30:3870-3879 (2002); Rosen et al, Nucleic Acids Research 34:4791-4800 (2006);
Arnould et al., Journal of Molecular Microbiology 355:443-458 (2006); Smith et al, Nucleic
Acids Research 34:el49 (2006); Chevalier et al, Molecular Cell 10:895-905 (2002); U.S. Pat. Pub. Nos. US/2013/0203840, US/2010/0325745, US/2011/0207199, US/2011/0041194; and U.S. Pat. Nos. 8,530,214, 7,897,372, 8,143,015, 8,163,514, 8,119,381, each of which is hereby incorporated by reference in its entirety.
Screening Transfected GSCs
In some embodiments, GSCs transfected according to a method described herein are screened to determine whether the target nucleic acid sequence has been modified in the genome of the GSC. In some embodiments, GSCs transfected according to a method described herein are screened to determine whether any non-target nucleic acid sequences have been modified in the genome of the GSC.
To facilitate the screening and/or use of genome-modified GSCs, in some
embodiments, the methods provided herein include the step of clonally culturing transfected GSCs to generate clonal GSC colonies. In some embodiments, the GSCs are separated from each other prior to being cultured. For example, single GSCs can be placed into separate wells of a microtiter plate via FACS. The individual cells can be grown in culture using known GSC culture techniques until clonal colonies are formed.
In some embodiments, the methods provided herein include the step of determining whether the target nucleic acid sequence has been modified in the GSC. In some embodiments, the method includes the step of determining whether the target nucleic acid sequence has been modified in cells of the clonal GSC colony. In some embodiments, whether the target nucleic acid sequence has been modified is determined by sequencing the locus in which the target nucleic acid sequence was located in the genome of the GSC. Nucleic acid sequencing processes include, but are not limited to chain termination sequencing, sequencing by ligation, sequencing by synthesis, pyrosequencing, ion semiconductor sequencing, single-molecule real-time sequencing, 454 sequencing, and/or Dilute-'N'-Go sequencing. In some embodiments, whether the target nucleic acid sequence has been modified is determined by contacting the locus in which the target nucleic acid sequence was located in the genome of the GSC a probe that selectively hybridizes to the target nucleic acid sequence or the modified target nucleic acid sequence {e.g., a molecular beacon). In some embodiments, the locus in which the target nucleic acid sequence was located in the genome of the GSC is amplified using a nucleic acid amplification procedure and the amplification product is sequenced. In some embodiments, the locus in which the target nucleic acid sequence was located in the genome of the GSC is amplified using a
nucleic acid amplification procedure and the amplification product is contacted with a probe that selectively hybridizes to the target nucleic acid sequence or the modified target nucleic acid sequence. Examples of nucleic acid amplification processes include, but are not limited to, polymerase chain reaction (PCR), LATE-PCR a non-symmetric PCR method of amplification, ligase chain reaction (LCR), strand displacement amplification (SDA), transcription mediated amplification (TMA), self-sustained sequence replication (3SR), QP replicase based amplification, nucleic acid sequence-based amplification (NASBA), repair chain reaction (RCR), boomerang DNA amplification (BDA) and/or rolling circle amplification (RCA). Probes that can be used in conjunction with nucleic acid amplification processes include, but are not limited to, molecular beacons, molecular torches, TaqMan probes, scorpion probes and HPA probes.
In some embodiments, the methods provided herein include the step of sequencing the genome of the cells from the clonal GSC colony. In some embodiments, the genome sequencing step is used to identify GSC colonies in which only the target nucleic acid sequence has been modified (i.e., cells in which the germline targeted nuclease did not cause any off-target mutations). Nucleic acid sequencing processes include, but are not limited to chain termination sequencing, sequencing by ligation, sequencing by synthesis,
pyrosequencing, ion semiconductor sequencing, single-molecule real-time sequencing, 454 sequencing, and/or Dilute-'N'-Go sequencing.
Creation of Organisms from GSCs
In some embodiments of the methods provided herein, a GSC containing a modified target nucleic acid sequence in its genome is used to generate an organism having the modified target nucleic acid sequence in its genome. In some embodiments, any method of generating an organism from a GSC can be used. In some embodiments, the GSC is caused to differentiate into mature germ cells (e.g., mature spermatocytes or mature oocytes). In some embodiments, maturation of the GSC is induced by transplantation of the GSC into testes or ovarian tissue, directed differentiation in vitro or nuclear transfer into a mature germ cell. In some embodiments where the target nucleic acid sequence is a mitochondrial DNA sequence, mitochondria from the GSC are transferred to a mature germ cell.
For example, for non-human animals, the GSC can be transplanted into a surrogate parent, which is then mated to produce offspring. In some embodiments, the GSC is an OSC and it is transplanted into a surrogate mother. In some embodiments, the GSC is a SSC and it
is transplanted into a surrogate father. In some embodiments the surrogate mother and/or the surrogate father is mated to generate offspring comprising the modified target nucleic acid.
In all animals, including humans, the GSC can be matured in vitro, for example by culturing the GSC under conditions that induce maturation or by nuclear transfer into a mature germ cell, which can then be used to generate offspring. For example, mature spermatocytes can be used in an artificial insemination, or either mature spermatocytes or mature oocytes can be used in an in vitro fertilization procedure.
Target Nucleic Acids
In some embodiments, the methods provided herein can be used to modify any target nucleic acid. For example, in some embodiments, the methods provided herein can be used to fix mutations associated with genetic diseases, to knock-out genes, to insert transgenes, and/or to make other changes or enhancements to the germline genome, which are inherited by the next generation. In some embodiments, the target nucleic acid sequence is located in chromosomal DNA. In some embodiments, the target nucleic acid sequence is located on mitochondrial DNA. In certain embodiments, the methods provided herein can be applied to mammals for research, ecological, agricultural {e.g. farm animals or pets), and therapeutic purposes, including the application to humans for purposes relating to health.
In some embodiments of the methods provided herein, the target nucleic acid sequence is a gene encoding an allele associated with a disease or disorder {e.g., an Brcal or Brca2 allele associated with breast cancer, a Htt allele associated with Huntington's disease, a Cftr allele associated with cystic fibrosis, a Hbb allele associated with thalassemia or sickle cell disease) that is modified to an allele of the gene that is not associated with the disease or disorder.
In some embodiments, the target nucleic acid sequence is a gene associated with hemochromatosis (HFE-related), alpha- 1 antitrypsin deficiency, phenylketonuria, familial dysautonomia, canavan disease, familial hyperinsulinism (ABCC8-related), primary hyperoxaluria type 2 (PH2), primary hyperoxaluria type 2 (PH2), rhizomelic
chondrodysplasia punctata type 1 (RCDP1), torsion dystonia, polycystic kidney disease,
TTR-related cardiac amyloidosis, mucolipidosis IV, limb-girdle muscular dystrophy, leigh syndrome french Canadian type (LSFC), congenital disorder of glycosylation type la
(PMM2-CDG), DPD deficiency, dihydrolipoamide dehydrogenase deficiency, deuronal ceroid lipofuscinosis (PPT 1 -related), medium-chain acyl-coA dehydrogenase (MCAD) deficiency, Glycogen Storage Disease Type la, glycogen storage disease type lb, gaucher
disease, ARSACS, G6PD deficiency, cystic fibrosis, factor XI deficiency, Zellweger syndrome spectrum, Nijmegen breakage syndrome, D-bifunctional protein deficiency, LAMB3-related junctional epidermolysis bullosa, familial mediterranean fever, TTR-related familial amyloid polyneuropathy, pendred syndrome, tyrosinemia type I, hereditary fructose intolerance, familial hypercholesterolemia type B, hypertrophic cardiomyopathy (MYBPC3 25bp-deletion), BRCA cancer mutations, connexin 26-related sensorineural hearing loss, beta thalassemia, sickle cell anemia and malaria resistance, Fanconi anemia (FANCC- related), Bloom's syndrome, salla disease, GRACILE syndrome, maple syrup urine disease type IB, Tay-Sachs disease, agenesis of the corpus callosum with peripheral neuropathy (ACCPN) or neuronal ceroid lipofuscinosis (CLN5-related).
In some embodiments, the target nucleic acid sequence is a gene encoding an allele associated with a particular trait in an animal (e.g., disease resistance, toxin resistance, cancer resistance, radiation resistance, cell stress resistance, growth rate, adult size, lifespan, milk production, meat production, leather production, endurance, wool production, egg production, domestication, allergies, food sensitivities, baldness, hair color, fertility) that is modified to an allele associated with a different trait.
In some embodiments, the target nucleic acid sequence is a gene associated with alcohol flush reaction, bitter taste perception, earwax type, hair curl, lactose intolerance, malaria resistance, muscle performance, non-ABO blood groups, norovirus resistance, resistance to HIV/ AIDS (e.g., CCR5 delta32 gene resistance), male pattern baldness, adiponectin levels, asparagus metabolite detection, biological aging, birth weight, blood glucose, breast morphology. C-reactive protein level, childhood and adolescent growth, resistance to chronic hepatitis B, finger length ratio, freckling, hair color, height, LDL cholesterol levels, HDL cholesterol levels, leprosy susceptibility, obesity, nearsightedness and farsightedness, persistent fetal hemoglobin, reading ability, response to diet, response to exercise, sex hormone regulation, tooth development, tuberculosis susceptibility, hypospadias, prostate-specific antigen, eating behavior, hair thickness, longevity, memory, odor detection, pain sensitivity or avoidance of errors.
EXAMPLES
Example 1: Transfection and Expansion of Primary Germline Stem Cells
Primary oogonial stem cells were isolated from mouse ovaries as set forth in Woods and Tilly Nat. Protoc. 8:966-988 (2013), which is hereby incorporated by reference in its entirety. Ovaries were dissected from 3 month old female mice, and the ovarian cells were
dissociated, washed and stained with anti-Ddx4 primary and APC-labeled secondary antibodies, as follows.
Ovaries were dissected from female mice, taking care to remove the attached fat pad, bursa and oviduct from each ovary. Using a scalpel blade or mincing scissors, the ovaries were minced into slurry in 0.5 ml of collagenase/DNase I solution in a glass tissue culture dish. Using a 5-ml glass serological pipette, the slurry was rinsed to the bottom of the dish with 2.5 ml of collagenase/DNase I solution and collected the by placing the entire 3 ml of solution into a 15-ml conical tube. The tube was incubated in a prewarmed (37 °C) orbital shaker for 15 min at 250 r.p.m. The tube was removed from the orbital shaker and the slurry manually dispersed with gentle pipetting using a 5-ml glass serological pipette. The tube was incubated in the orbital shaker at 37 °C for an additional 15 min at 250 r.p.m. The tube was removed from the orbital shaker and the slurry manually dispersed with gentle pipetting until no visible pieces of ovary were present. The cell suspension was filtered through a 100-μπι nylon mesh cell strainer, collecting the filtrate into a new 15-ml conical tube. Ten ml of warm HBSS was added to the conical tube containing the strained cell suspension, and the tube was centrifuged at 300g for 5 min at room temperature, with the centrifuge brake turned off. After centrifugation, the liquid was decanted, taking care to remove as much of the supernatant as possible without disturbing the cell pellet. Using a sterile 5-ml glass serological pipette, the cell pellet was resuspended in 4 ml of warm HBSS. The volume of the solution was brought to 10 ml with warm HBSS. The cell suspension was centrifuged at 300g for 5 min at room temperature with the brake on the centrifuge turned off. After centrifugation, the liquid was decanted, taking care to remove as much of the supernatant as possible without disturbing the cell pellet.
The cell pellet was resuspended in 500 μΐ of cold antibody blocking/dilution solution, which was placed on ice for 20 minutes. 100 μΐ of cell suspension was added to negative control and secondary antibody only tubes, which were placed on ice. The remaining 300 μΐ of cell suspension were diluted to 10 ml in cold HBSS. The suspension was centrifuged at 300g for 5 min at 4 °C. The sample tube was removed from the centrifuge and the supernatant discarded, being careful not to disturb or dislodge the cell pellet. The cell pellet was resuspended in 100 μΐ of primary antibody solution. The suspension was placed on ice and incubated for 20 min. The resuspended cell sample was mixed with primary antibody to a total of 10 ml with cold HBSS and centrifuged at 300g for 5 min at 4 °C. The sample tube was removed from the centrifuge and the supernatant discarded. The sample tube cell pellet
was resuspended in 10 ml of cold HBSS. The suspension was centrifuged at 300g for 5 min at 4 °C. At this time, the cells in the secondary antibody only tube were also centrifuged and the supernatant discarded. The cell pellet in the sample tube, as well as the cell pellet in the secondary antibody only tube, were resuspended in 250 μΐ of prepared secondary antibody solution for FACS and placed on ice for 20 minutes. The volume in the sample tube and the secondary antibody only tube were brought to a total of 10 ml with cold FIBSS and centrifuged at 300g for 5 min at 4 °C. The supernatants were discarded and the cell pellets resuspended in 10 ml of cold FIBSS. At this time, the volume of the negative control tube was brought to 10 ml with cold HBSS. All three tubes were centrifuged at 300g for 5 min at 4 °C and the supernatants discarded. Each cell pellet (sample tube, secondary antibody only tube and negative control tube) were resuspended in in 0.5 ml of FACS buffer and isolated by FACS. As depicted in Figure 2, Ddx4 positive oogonial stem cells were isolated by FACS.
Oogonial stem cells that had been expanded in culture were transfected with various amounts of Cas9-GFP fusion protein expression vector using different amounts
lipofectamine 2000. Briefly, 1.6 ug of total plasmid DNA was diluted into OptiMEM to a total volume of 100 uL, per sample. Four uL of Lipofectamine 2000 was diluted into OptiMEM to a total volume of 100 uL, per sample. After a 5 m incubation, 100 uL of each were combined and the resulting mixture incubated for 20 minutes - 5 hours. The OSCs were pelleted by spinning at 200g for 5 min, and the supernatant removed. The pellet was resuspended to a concentration of 100,000 cells per mL. One mL of cells were added to a well of a 12-well plate, to which the plasmid/Lipofectamine mixture was added drop-wise. After 18-24 hours, the media was changed. The resulting transfection efficiencies at 24 hours post-transfection are shown in Figure 3. As depicted in Figure 4, at 72 hours post- transfection, GFP positive cells were isolated by FACS.
Single OSCs were sorted, unstained, by FACS into individual wells of a 96-well plate and grown in culture. The OSCs were trypsinized and then centrifuged at 200g for 5 min, and the supernatant removed. The pellet was resuspended in 1 mL of FACS buffer (0.1% FBS in HBSS). To each well of a 96-well plate was added 50 uL of OSC media. A single cell was sorted into each well of the 96-well plate by FACS. In general, small colonies were visible within a few days. Within 1-2 weeks, colonies grew large enough to be passaged to larger wells. Between 21% and 33% of the isolated single OSCs produced clonal
OSC colonies, one of which is depicted in Figure 5. Whether the OSCs were transfected or not prior to isolation did not significantly affect the efficiency of colony formation.
Example 2: Genome Modification of Primary Germline Stem Cells
Primary OSCs were isolated from mouse ovaries as set forth in Woods and Tilly Nat. Protoc. 8:966-988 (2013), which is hereby incorporated by reference in its entirety. Ovaries were dissected from 2-4 month old female C57BL6/J mice, digested with Liberase TL (Roche 05401020001) and DNase I in HBSS, and stained with a Ddx4 primary antibody (Abeam 13840) and an APC-conjugated secondary antibody (Jackson ImmunoResearch 111- 136-144). Cells were also stained with 1 μg/mL DAPI and 5 μg/mL Calcein-AM (Invitrogen C3099) for exclusion of dead cells and debris. Calcein high, Ddx4+ cells were sorted on a BD FACSAria II cell sorter using the sorting strategy depicted in Figure 7.
Ddx4-positive cells were grown in MEM-a GlutaMax (Invitrogen 32561) with 10% (v/v) FBS (Invitrogen 26140), 1 mM sodium pyruvate (Invitrogen 11360), 0.1 mM EAA (Invitrogen 11140), pen-strep-glutamine (Invitrogen 10378), N-2 Plus supplement (R&D Systems 212-GD-050) , 0.1 mM β-mercaptoethanol, 1000 units/mL LIF (Millipore
ESG1106), 10 ng/mL EGF (Invitrogen PHG0314), 1 ng/mL bFGF (Invitrogen 13256), and 40 ng/mL GDNF (R&D Systems 212-GD-010). During culture of freshly-isolated cells, half the media was replaced every second day. Expansion of the sorted OSC colonies are depicted in Figure 8.
The genomes of the cultured OSCs were modified by the targeted integration of GFP into the ROSA26 locus (Figure 9). The established OSC lines were reverse-transfected with 4 of Lipofectamine 2000 (Life Technologies 11668027), and 3 μg/mL of DNA. hCas9 (AddGene 41815), ROSA26 gRNA (modified from AddGene 41824), and ROSA26- GFP-puro donor (AddGene 26890) plasmids were transfected in an equimolar ratio. GFP- expressing cells were sorted as single cells into wells of a 96-well plate 1-2 weeks after transfection. Two to three weeks later, colonies were screened using prepGEM Tissue (Zygem PTI0500) to isolate genomic DNA, and KAPA Hifi polymerase (KAPA Biosystems KK2602) to PCR-amplify the genome-insertion junction, with the primers
TAGGTAGGGGATCGGGACTC and GAAAGACCGCGAAGAGTTTG (Figure 9).
Modifications were verified using DNeasy Blood & Tissue kit (QIAGEN 69581) to re- isolate genomic DNA, and by sequencing with the PCR-primers (DF/HCC DNA Resource Core) (Figure 10). Expression of GFP by the modified cells was detected by fluorescent microscopy (Figure 11).
Expression of germline genes was determined in the edited OSCs (Figure 12). RNA was isolated using RNeasy Mini kit (QIAGEN 74140) and converted to cDNA using iScript cDNA Synthesis kit (BIO-RAD 170-8890). Real-time quantitative PCR was done using LightCycler 480 SYRB Green I Master (Roche 04707516001) using primers having the following sequences.
Example 3: Targeting the AAVSl "Safe-Harbor" Locus in Human OSCs
Human OSCs were modified using CRISPR-Cas9 to insert a GFP reporter into the
AAVSl "safe harbor" locus as depicted in Figure 13a. Primary human OSCs were transfected with X-tremeGENE HP DNA Transfection Reagent (Roche) and four plasmids: Cas9, two gRNAs (guide sequences: GTCCCCTCCACCCCACAGTG and
GGGGCCACTAGGGACAGGAT) and a donor plasmid encoding a GFP and puroR genes with two homology arms to the AAVSl locus, each of about 800 bp. Cells are grown for 1-2 weeks, after which GFP+ cells were sorted into individual wells of a 96-well plate to form clonal colonies. Colonies are genotyped with primers flanking the target site
(CCCCTTACCTCTCTAGTCTGTGC and CTCAGGTTCTGGGAGAGGGTAG) and modified colonies were identified (Figure 13b). Expression of GFP in the positive colonies was confirmed by fluorescent microscopy (Figures 13c and 13d).
Example 4: Genome Editing of Human Oogonial Stem Cells
A pipeline was developed to edit human oogonial stem cells (OSCs). This pipeline utilizes nine quality control checkpoints to ensure successful genome editing of OSCs (Figure 14). During the maintenance phase of the pipeline, isolated OSCs are confirmed to advance to a sufficient passage number for genome editing to take place (checkpoint 1) and tested for mycoplasma (checkpoint 2). Early-passage OSCs are then genome edited using
reverse transfection delivery of CRISPR/Cas9 directed towards a gene of interest (checkpoints 3-4). Enrichment/isolation of edited cells is conducted in three arms
(checkpoints 5-7) using either single cell fluorescence-activated cell sorting (FACS)
(checkpoint 5), limiting dilution (checkpoint 6) or mixed population FACS enrichment (checkpoint 7). Finally, successful genome editing is confirmed through PCR (checkpoints 8, 9). Figure 15A shows a mixed population of human OSCs in which the GFP gene has been directed to the AAVl safe harbor locus using CRISPR/Cas9. GFP-positive single sorted EggPCs were selected for clonal expansion under optimized conditions (Figure 15B).
All publications, patents, and patent applications mentioned herein are hereby incorporated by reference in their entirety as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference. In case of conflict, the present application, including any definitions herein, will control.
Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.
Claims
What is claimed is:
I . A method of modifying a target nucleic acid sequence in the genome of a germ stem cell (GSC) comprising contacting the GSC with a germline targeted nuclease, wherein the germline targeted nuclease modifies the target nucleic acid sequence.
2. The method of claim 1, wherein the GSC is contacted with the germline targeted nuclease by transfecting the GSC with an expression vector or RNA encoding the germline targeted nuclease or introducing a functional targeted nuclease protein.
3. The method of claim 1, wherein the germline targeted nuclease is a zinc-finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), an RNA-guided endonuclease (RGEN) or an engineered homing meganuclease (EMH).
4. The method of claim 1, wherein the germline targeted nuclease is Cas9.
5. The method of claim 1, wherein the germline targeted nuclease is a fusion protein comprising a detectable moiety.
6. The method of claim 1, wherein the GSC is an oogonial stem cell or a
spermatogonial stem cell.
7. The method of claim 1, further comprising the step of isolating the GSC prior to contacting it with the germline targeted nuclease.
8. The method of claim 7, wherein the GSC is isolated by FACS.
9. The method of claim 1, further comprising the step of clonally culturing the transfected GSC to generate a clonal GSC colony.
10. The method of claim 9, wherein the transfected GSC is isolated from other GSCs prior to being cultured.
I I . The method of claim 10, wherein the GSC is isolated by FACS.
12. The method of claim 11, wherein the GSC is isolated based on its expression of the germline targeted nuclease.
13. The method of claim 12, wherein the GSC expresses a low level of the germline targeted nuclease.
14. The method of claim 9, further comprising the step of determining whether the target nucleic acid sequence has been modified in cells in the clonal GSC colony.
15. The method of claim 14, wherein whether the target nucleic acid sequence has been modified is determined by sequencing the target nucleic acid sequence.
16. The method of claim 9, further comprising the step of sequencing the genome of cells in the clonal GSC colony.
17. The method of claim 9, further comprising the step of inducing the maturation of a cell from the clonal GSC colony into a mature germ cell.
18. The method of claim 17, wherein the maturation of the GSC is induced by transplantation of the GSC into testes or ovarian tissue, directed differentiation in vitro or nuclear transfer into a mature germ cell.
19. The method of claim 9, wherein the target nucleic acid sequence is a mitochondrial DNA sequence.
20. The method of claim 19, further comprising the step of transferring mitochondria from a cell in the GSC colony to a mature germ cell.
21. The method of claim 17, further comprising the step of using the mature germ cell in an in vitro fertilization procedure.
22. The method of claim 9, wherein the GSC is an oogonial stem cell and further comprising transferring a cell of the clonal GSC colony to a surrogate mother.
23. The method of claim 1, wherein the target nucleic acid sequence is a gene encoding a disease causing allele.
24. The method of claim 23, wherein the gene is modified such that it does not encode a disease causing allele.
25. A method of generating an animal carrying a modified target nucleic acid sequence in its genome, the method comprising the steps of:
a) contacting a sample comprising a population of GSCs with a germline targeted nuclease, wherein the germline targeted nuclease is targeted to the target nucleic acid sequence;
b) isolating single GSCs from the population of GSCs;
c) culturing the single GSCs to form clonal GSC colonies;
d) identifying the clonal GSC colonies that comprise a modified target nucleic acid sequence; and
e) generating an animal from a cell of a clonal GSC colony identified in step d).
26. The method of claim 23, wherein the GSC is contacted with the germline targeted nuclease by transfecting the GSC with an expression vector or RNA encoding the germline targeted nuclease or introduction of a germline targeted nuclease protein.
27. The method of claim 25, wherein the germline targeted nuclease is a zinc-finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN) an RNA-guided endonuclease (RGEN) or an engineered homing meganuclease (EMH).
28. The method of claim 25, wherein the germline targeted nuclease is Cas9.
29. The method of claim 25, wherein the germline targeted nuclease is a fusion protein comprising the detectable moiety.
30. The method of claim 29, wherein the single GSCs isolated in step b) are cells that express the germline targeted nuclease.
31. The method of claim 30, wherein the single GSCs isolated in step b) are cells that express a low level of the germline targeted nuclease.
32. The method of claim 25, wherein the GSCs are an oogonial stem cells or spermatogonial stem cells.
33. The method of claim 25, wherein the single GSCs are isolated in step b) by FACS.
34. The method of claim 25, further comprising the step of sequencing the genome of the clonal GSC colonies that comprise a modified target nucleic acid.
35. The method of claim 25, wherein step e) comprises inducing the maturation of a cell from the clonal GSC colony into a mature germ cell and the animal is generated from the mature germ cell.
36. The method of claim 35, wherein the maturation of the GSC is induced by
transplantation of the GSC into testes or ovarian tissue, directed differentiation in vitro or nuclear transfer into a mature germ cell.
37. The method of claim 35, wherein the animal is generated in step e) from the mature germ cell using in vitro fertilization.
38. The method of claim 25, wherein the GSC is an oogonial stem cell and wherein the animal is generated in step e) by transferring a cell from a clonal GSC colony comprising a modified target nucleic acid to a surrogate mother and mating the surrogate mother.
39. The method of claim 25, further comprising the step of isolating the population of GSCs prior to step a).
40. The method of claim 25, wherein the target nucleic acid sequence is a gene encoding a disease causing allele.
41. The method of claim 40, wherein the gene is modified such that it does not encode a disease causing allele.
42. The method of claim 25, wherein the animal is a mammal.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201562250893P | 2015-11-04 | 2015-11-04 | |
| US62/250,893 | 2015-11-04 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2017079428A1 true WO2017079428A1 (en) | 2017-05-11 |
Family
ID=57543133
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2016/060315 Ceased WO2017079428A1 (en) | 2015-11-04 | 2016-11-03 | Site specific germline modification |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2017079428A1 (en) |
Cited By (32)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9999671B2 (en) | 2013-09-06 | 2018-06-19 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10167457B2 (en) | 2015-10-23 | 2019-01-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| EP3821004A4 (en) * | 2018-07-12 | 2022-04-20 | Twinstrand Biosciences, Inc. | METHODS AND REAGENTS FOR CHARACTERIZING GENOMIC EDITING AND CLONAL EXPANSION, AND RELATED APPLICATIONS |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| US12157760B2 (en) | 2018-05-23 | 2024-12-03 | The Broad Institute, Inc. | Base editors and uses thereof |
| US12281338B2 (en) | 2018-10-29 | 2025-04-22 | The Broad Institute, Inc. | Nucleobase editors comprising GeoCas9 and uses thereof |
| US12351837B2 (en) | 2019-01-23 | 2025-07-08 | The Broad Institute, Inc. | Supernegatively charged proteins and uses thereof |
| US12390514B2 (en) | 2017-03-09 | 2025-08-19 | President And Fellows Of Harvard College | Cancer vaccine |
| US12406749B2 (en) | 2017-12-15 | 2025-09-02 | The Broad Institute, Inc. | Systems and methods for predicting repair outcomes in genetic engineering |
| US12435330B2 (en) | 2019-10-10 | 2025-10-07 | The Broad Institute, Inc. | Methods and compositions for prime editing RNA |
| US12473543B2 (en) | 2019-04-17 | 2025-11-18 | The Broad Institute, Inc. | Adenine base editors with reduced off-target effects |
| US12522807B2 (en) | 2018-07-09 | 2026-01-13 | The Broad Institute, Inc. | RNA programmable epigenetic RNA modifiers and uses thereof |
Citations (22)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4762915A (en) | 1985-01-18 | 1988-08-09 | Liposome Technology, Inc. | Protein-liposome conjugates |
| WO1990011092A1 (en) | 1989-03-21 | 1990-10-04 | Vical, Inc. | Expression of exogenous polynucleotide sequences in a vertebrate |
| US20100325745A1 (en) | 2007-06-06 | 2010-12-23 | Cellectis | Meganuclease variants cleaving a dna target sequence from the mouse rosa26 locus and uses thereof |
| US20110041194A1 (en) | 2007-11-28 | 2011-02-17 | Cellectis | I-msoi homing endonuclease variants having novel substrate specificity and use thereof |
| US7897372B2 (en) | 2005-03-15 | 2011-03-01 | Cellectis | I-CreI meganuclease variants with modified specificity, method of preparation and uses thereof |
| US20110145940A1 (en) | 2009-12-10 | 2011-06-16 | Voytas Daniel F | Tal effector-mediated dna modification |
| US20110207199A1 (en) | 2007-08-03 | 2011-08-25 | Cellectis | Novel method to generate meganucleases with altered characteristics |
| US20110301073A1 (en) | 2010-05-17 | 2011-12-08 | Sangamo Biosciences, Inc. | Novel DNA-binding proteins and uses thereof |
| US8106255B2 (en) | 2002-01-23 | 2012-01-31 | Dana Carroll | Targeted chromosomal mutagenasis using zinc finger nucleases |
| US8119381B2 (en) | 2005-10-18 | 2012-02-21 | Duke University | Rationally-designed meganucleases with altered sequence specificity and DNA-binding affinity |
| US20120214241A1 (en) | 2010-12-22 | 2012-08-23 | Josee Laganiere | Zinc finger nuclease modification of leucine rich repeat kinase 2 (lrrk2) mutant fibroblasts and ipscs |
| US20120309091A1 (en) | 2006-05-25 | 2012-12-06 | Sangamo Biosciences, Inc. | Methods And Compositions For Gene Inactivation |
| US20120329067A1 (en) | 2010-01-22 | 2012-12-27 | Barbas Iii Carlos F | Methods of Generating Zinc Finger Nucleases Having Altered Activity |
| WO2013002880A1 (en) * | 2011-06-29 | 2013-01-03 | The General Hospital Corporation | Compositions and methods for enhancing bioenergetic status in female germ cells |
| US20130117869A1 (en) | 2011-04-05 | 2013-05-09 | Cellectis S.A. | Method for the generation of compact tale-nucleases and uses thereof |
| US20130203840A1 (en) | 2003-01-28 | 2013-08-08 | Cellectis S.A. | Use of meganucleases for inducing homologous recombination ex vivo and in toto in vertebrate somatic tissues and application thereof |
| US20130217131A1 (en) | 2011-01-03 | 2013-08-22 | Toolgen Incorporation | Genome engineering via designed tal effector nucleases |
| WO2013142578A1 (en) | 2012-03-20 | 2013-09-26 | Vilnius University | RNA-DIRECTED DNA CLEAVAGE BY THE Cas9-crRNA COMPLEX |
| WO2013192316A1 (en) * | 2012-06-21 | 2013-12-27 | Recombinetics, Inc. | Genetically modified animals and methods for making the same |
| WO2015035034A1 (en) * | 2013-09-04 | 2015-03-12 | Mice With Horns, Llc | Materials and methods for correcting recessive mutations in animals |
| WO2015054315A1 (en) * | 2013-10-07 | 2015-04-16 | Northeastern University | Methods and compositions for ex vivo generation of developmentally competent eggs from germ line cells using autologous cell systems |
| CN105602935A (en) * | 2014-10-20 | 2016-05-25 | 聂凌云 | Novel mitochondrial genome editing tool |
-
2016
- 2016-11-03 WO PCT/US2016/060315 patent/WO2017079428A1/en not_active Ceased
Patent Citations (30)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4762915A (en) | 1985-01-18 | 1988-08-09 | Liposome Technology, Inc. | Protein-liposome conjugates |
| WO1990011092A1 (en) | 1989-03-21 | 1990-10-04 | Vical, Inc. | Expression of exogenous polynucleotide sequences in a vertebrate |
| US20120219959A1 (en) | 2002-01-23 | 2012-08-30 | Dana Carroll | Targeted Chromosomal Mutagenesis Using Zinc Finger Nucleases |
| US8106255B2 (en) | 2002-01-23 | 2012-01-31 | Dana Carroll | Targeted chromosomal mutagenasis using zinc finger nucleases |
| US8530214B2 (en) | 2003-01-28 | 2013-09-10 | Cellectis S.A. | Use of meganucleases for inducing homologous recombination ex vivo and in toto in vertebrate somatic tissues and application thereof |
| US20130203840A1 (en) | 2003-01-28 | 2013-08-08 | Cellectis S.A. | Use of meganucleases for inducing homologous recombination ex vivo and in toto in vertebrate somatic tissues and application thereof |
| US7897372B2 (en) | 2005-03-15 | 2011-03-01 | Cellectis | I-CreI meganuclease variants with modified specificity, method of preparation and uses thereof |
| US8143015B2 (en) | 2005-10-18 | 2012-03-27 | Duke University | Methods of cleaving DNA with rationally-designed meganucleases |
| US8163514B2 (en) | 2005-10-18 | 2012-04-24 | Duke University | Methods of cleaving DNA with rationally-designed meganucleases |
| US8119381B2 (en) | 2005-10-18 | 2012-02-21 | Duke University | Rationally-designed meganucleases with altered sequence specificity and DNA-binding affinity |
| US20120309091A1 (en) | 2006-05-25 | 2012-12-06 | Sangamo Biosciences, Inc. | Methods And Compositions For Gene Inactivation |
| US8524221B2 (en) | 2006-05-25 | 2013-09-03 | Sangamo Biosciences, Inc. | Methods and compositions for gene inactivation |
| US20100325745A1 (en) | 2007-06-06 | 2010-12-23 | Cellectis | Meganuclease variants cleaving a dna target sequence from the mouse rosa26 locus and uses thereof |
| US20110207199A1 (en) | 2007-08-03 | 2011-08-25 | Cellectis | Novel method to generate meganucleases with altered characteristics |
| US20110041194A1 (en) | 2007-11-28 | 2011-02-17 | Cellectis | I-msoi homing endonuclease variants having novel substrate specificity and use thereof |
| US8440431B2 (en) | 2009-12-10 | 2013-05-14 | Regents Of The University Of Minnesota | TAL effector-mediated DNA modification |
| US20110145940A1 (en) | 2009-12-10 | 2011-06-16 | Voytas Daniel F | Tal effector-mediated dna modification |
| US8440432B2 (en) | 2009-12-10 | 2013-05-14 | Regents Of The University Of Minnesota | Tal effector-mediated DNA modification |
| US8450471B2 (en) | 2009-12-10 | 2013-05-28 | Regents Of The University Of Minnesota | TAL effector-mediated DNA modification |
| US20120329067A1 (en) | 2010-01-22 | 2012-12-27 | Barbas Iii Carlos F | Methods of Generating Zinc Finger Nucleases Having Altered Activity |
| US20110301073A1 (en) | 2010-05-17 | 2011-12-08 | Sangamo Biosciences, Inc. | Novel DNA-binding proteins and uses thereof |
| US20120214241A1 (en) | 2010-12-22 | 2012-08-23 | Josee Laganiere | Zinc finger nuclease modification of leucine rich repeat kinase 2 (lrrk2) mutant fibroblasts and ipscs |
| US20130217131A1 (en) | 2011-01-03 | 2013-08-22 | Toolgen Incorporation | Genome engineering via designed tal effector nucleases |
| US20130117869A1 (en) | 2011-04-05 | 2013-05-09 | Cellectis S.A. | Method for the generation of compact tale-nucleases and uses thereof |
| WO2013002880A1 (en) * | 2011-06-29 | 2013-01-03 | The General Hospital Corporation | Compositions and methods for enhancing bioenergetic status in female germ cells |
| WO2013142578A1 (en) | 2012-03-20 | 2013-09-26 | Vilnius University | RNA-DIRECTED DNA CLEAVAGE BY THE Cas9-crRNA COMPLEX |
| WO2013192316A1 (en) * | 2012-06-21 | 2013-12-27 | Recombinetics, Inc. | Genetically modified animals and methods for making the same |
| WO2015035034A1 (en) * | 2013-09-04 | 2015-03-12 | Mice With Horns, Llc | Materials and methods for correcting recessive mutations in animals |
| WO2015054315A1 (en) * | 2013-10-07 | 2015-04-16 | Northeastern University | Methods and compositions for ex vivo generation of developmentally competent eggs from germ line cells using autologous cell systems |
| CN105602935A (en) * | 2014-10-20 | 2016-05-25 | 聂凌云 | Novel mitochondrial genome editing tool |
Non-Patent Citations (47)
| Title |
|---|
| "METHODS IN ENZYMOLOGY", vol. 546, 2014, ACADEMIC PRESS, US, ISSN: 0076-6879, article SUSAN M. BYRNE ET AL: "Genome Editing in Human Stem Cells", pages: 119 - 138, XP055242837, DOI: 10.1016/B978-0-12-801185-0.00006-4 * |
| ARNOULD ET AL., JOURNAL OF MOLECULAR MICROBIOLOGY, vol. 355, 2006, pages 443 - 458 |
| BAYER ET AL., BIOCHIP. BIOPSY'S. ACTA., vol. 550, 1979, pages 464 |
| BIBIKOVA ET AL., SCIENCE, vol. 300, 2003, pages 764 |
| BOCH ET AL., SCIENCE, vol. 326, 2009, pages 1509 - 1512 |
| CHEVALIER ET AL., MOLECULAR CELL, vol. 10, 2002, pages 895 - 905 |
| CHO ET AL., NATURE BIOTECHNOLOGY, vol. 31, 2013, pages 230 - 232 |
| CONG ET AL., SCIENCE, vol. 339, 2013, pages 819 - 823 |
| DEBS ET AL., J. BIOL. CHEM., vol. 265, 1990, pages 10189 - 10192 |
| FEIGNER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 91, 1994, pages 5148 - 5152 |
| FELGNER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 84, 1987, pages 7413 - 7416 |
| FU ET AL., NATURE BIOTECHNOLOGY, vol. 31, 2013, pages 822 - 826 |
| GRIZOT ET AL., NUCLEIC ACIDS RESEARCH, vol. 38, 2009, pages 2006 - 2018 |
| GUAN ET AL., NATURE, vol. 440, 2006, pages 1199 - 1203 |
| HSU ET AL., NATURE BIOTECHNOLOGY, vol. 31, 2013, pages 827 - 832 |
| JINEK ET AL., ELIFE, vol. 2, 2013, pages E00471 |
| JINEK ET AL., SCIENCE, vol. 337, 2012, pages 816 - 821 |
| K. DUDA ET AL: "High-efficiency genome editing via 2A-coupled co-expression of fluorescent proteins and zinc finger nucleases or CRISPR/Cas9 nickase pairs", NUCLEIC ACIDS RESEARCH, vol. 42, no. 10, 21 April 2014 (2014-04-21), pages e84 - e84, XP055352337, ISSN: 0305-1048, DOI: 10.1093/nar/gku251 * |
| KOSSACK ET AL., STEM CELLS, vol. 27, 2009, pages 138 - 149 |
| MAEDER ET AL., MOLECULAR CELL, vol. 31, 2008, pages 294 - 301 |
| MALI ET AL., NATURE BIOTECHNOLOGY, vol. 31, 2013, pages 833 - 838 |
| MALI ET AL., SCIENCE, vol. 339, 2013, pages 823 - 826 |
| MALONE ET AL., PROC. NATL. ACAD. SCI. USA, vol. 86, 1989, pages 6077 - 6081 |
| MILLER ET AL., NATURE BIOTECHNOLOGY, vol. 29, 2011, pages 143 - 148 |
| MILLER ET AL., NUCLEIC ACIDS RESEARCH, vol. 39, 2011, pages E82 |
| MOIRBITZER ET AL., NUCLEIC ACIDS RESEARCH, vol. 39, 2011, pages 5790 - 5799 |
| MOSCOU ET AL., SCIENCE, vol. 326, 2009, pages 1501 |
| MUSSOLINO ET AL., NUCLEIC ACIDS RESEARCH, vol. 39, 2011, pages 9283 - 9293 |
| OZLEM BINGOL OZAKPINAR: "Ovarian stem cells: From basic to clinical applications", WORLD JOURNAL OF STEM CELLS, vol. 7, no. 4, 26 May 2015 (2015-05-26), CN, pages 757, XP055352649, ISSN: 1948-0210, DOI: 10.4252/wjsc.v7.i4.757 * |
| PATTANAYAK ET AL., NATURE BIOTECHNOLOGY, vol. 31, 2013, pages 839 - 843 |
| PLANT ET AL., ANAL. BIOCHEM., vol. 176, 1989, pages 420 |
| PORTEUS ET AL., NATURE BIOTECHNOLOGY, vol. 23, 2005, pages 967 - 973 |
| QI ET AL., CELL, vol. 152, 2013, pages 1173 - 1183 |
| RIVNAY ET AL., METH. ENZYMOL., vol. 149, 1987, pages 119 |
| ROSEN ET AL., NUCLEIC ACIDS RESEARCH, vol. 34, 2006, pages 4791 - 4800 |
| SELIGMAN ET AL., NUCLEIC ACIDS RESEARCH, vol. 30, 2002, pages 3870 - 3879 |
| SMITH ET AL., NUCLEIC ACIDS RESEARCH, vol. 34, 2006, pages E149 |
| SOAK ET AL., BIOCHIP. BIOPSY'S. ACTA, vol. 600, 1980, pages 1 |
| SOAK ET AL., PROC. NATL. ACAD. SCI. USA, vol. 75, 1978, pages 4194 - 4198 |
| STRYKER: "Biochemistry", 1975, W.H. FREEMAN, pages: 236 - 240 |
| URNOV ET AL., NATURE, vol. 435, 2005, pages 646 - 651 |
| WANG ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 84, 1987, pages 7851 |
| WANG SI ET AL: "Eliminate mitochondrial diseases by gene editing in germ-line cells and embryos", PROTEIN & CELL, SPRINGER ASIA, BEIJING, CN, vol. 6, no. 7, 17 June 2015 (2015-06-17), pages 472 - 475, XP035507312, ISSN: 1674-800X, [retrieved on 20150617], DOI: 10.1007/S13238-015-0177-X * |
| WHITE ET AL., NAT. MED., vol. 18, 2012, pages 413 - 421 |
| WOODS; TILLY, NAT PROTOC., vol. 8, 2013, pages 966 - 88 |
| WOODS; TILLY, NAT. PROTOC., vol. 8, 2013, pages 966 - 988 |
| ZHANG ET AL., NATURE BIOTECHNOLOGY, vol. 29, 2011, pages 149 - 153 |
Cited By (68)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12006520B2 (en) | 2011-07-22 | 2024-06-11 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US11920181B2 (en) | 2013-08-09 | 2024-03-05 | President And Fellows Of Harvard College | Nuclease profiling system |
| US10954548B2 (en) | 2013-08-09 | 2021-03-23 | President And Fellows Of Harvard College | Nuclease profiling system |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US11299755B2 (en) | 2013-09-06 | 2022-04-12 | President And Fellows Of Harvard College | Switchable CAS9 nucleases and uses thereof |
| US12473573B2 (en) | 2013-09-06 | 2025-11-18 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US12559737B2 (en) | 2013-09-06 | 2026-02-24 | President And Fellows Of Harvard College | Cas9 variants and uses thereof |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US10912833B2 (en) | 2013-09-06 | 2021-02-09 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US12584118B2 (en) | 2013-09-06 | 2026-03-24 | President And Fellows Of Harvard College | Cas9 variants and uses thereof |
| US9999671B2 (en) | 2013-09-06 | 2018-06-19 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US10682410B2 (en) | 2013-09-06 | 2020-06-16 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US11053481B2 (en) | 2013-12-12 | 2021-07-06 | President And Fellows Of Harvard College | Fusions of Cas9 domains and nucleic acid-editing domains |
| US11124782B2 (en) | 2013-12-12 | 2021-09-21 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US12215365B2 (en) | 2013-12-12 | 2025-02-04 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US11578343B2 (en) | 2014-07-30 | 2023-02-14 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US12398406B2 (en) | 2014-07-30 | 2025-08-26 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US11214780B2 (en) | 2015-10-23 | 2022-01-04 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US12344869B2 (en) | 2015-10-23 | 2025-07-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US10167457B2 (en) | 2015-10-23 | 2019-01-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US12043852B2 (en) | 2015-10-23 | 2024-07-23 | President And Fellows Of Harvard College | Evolved Cas9 proteins for gene editing |
| US11702651B2 (en) | 2016-08-03 | 2023-07-18 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11999947B2 (en) | 2016-08-03 | 2024-06-04 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10947530B2 (en) | 2016-08-03 | 2021-03-16 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US12084663B2 (en) | 2016-08-24 | 2024-09-10 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US11820969B2 (en) | 2016-12-23 | 2023-11-21 | President And Fellows Of Harvard College | Editing of CCR2 receptor gene to protect against HIV infection |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US12390514B2 (en) | 2017-03-09 | 2025-08-19 | President And Fellows Of Harvard College | Cancer vaccine |
| US12516308B2 (en) | 2017-03-09 | 2026-01-06 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US12435331B2 (en) | 2017-03-10 | 2025-10-07 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US12359218B2 (en) | 2017-07-28 | 2025-07-15 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11932884B2 (en) | 2017-08-30 | 2024-03-19 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US12406749B2 (en) | 2017-12-15 | 2025-09-02 | The Broad Institute, Inc. | Systems and methods for predicting repair outcomes in genetic engineering |
| US12157760B2 (en) | 2018-05-23 | 2024-12-03 | The Broad Institute, Inc. | Base editors and uses thereof |
| US12522807B2 (en) | 2018-07-09 | 2026-01-13 | The Broad Institute, Inc. | RNA programmable epigenetic RNA modifiers and uses thereof |
| EP3821004A4 (en) * | 2018-07-12 | 2022-04-20 | Twinstrand Biosciences, Inc. | METHODS AND REAGENTS FOR CHARACTERIZING GENOMIC EDITING AND CLONAL EXPANSION, AND RELATED APPLICATIONS |
| US12529101B2 (en) | 2018-07-12 | 2026-01-20 | Twinstrand Biosciences, Inc. | Methods and reagents for characterizing genomic editing, clonal expansion, and associated applications |
| US11845985B2 (en) | 2018-07-12 | 2023-12-19 | Twinstrand Biosciences, Inc. | Methods and reagents for characterizing genomic editing, clonal expansion, and associated applications |
| US12281338B2 (en) | 2018-10-29 | 2025-04-22 | The Broad Institute, Inc. | Nucleobase editors comprising GeoCas9 and uses thereof |
| US12351837B2 (en) | 2019-01-23 | 2025-07-08 | The Broad Institute, Inc. | Supernegatively charged proteins and uses thereof |
| US11643652B2 (en) | 2019-03-19 | 2023-05-09 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US12509680B2 (en) | 2019-03-19 | 2025-12-30 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11795452B2 (en) | 2019-03-19 | 2023-10-24 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US12570972B2 (en) | 2019-03-19 | 2026-03-10 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US12281303B2 (en) | 2019-03-19 | 2025-04-22 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US12624353B2 (en) | 2019-03-19 | 2026-05-12 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US12624354B2 (en) | 2019-03-19 | 2026-05-12 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US12473543B2 (en) | 2019-04-17 | 2025-11-18 | The Broad Institute, Inc. | Adenine base editors with reduced off-target effects |
| US12435330B2 (en) | 2019-10-10 | 2025-10-07 | The Broad Institute, Inc. | Methods and compositions for prime editing RNA |
| US12031126B2 (en) | 2020-05-08 | 2024-07-09 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12213466B2 (en) | Process for using CRISPR to transfect primordial germ cells in avians | |
| US20250280805A1 (en) | Methods for producing antigen-binding proteins against foreign antigens | |
| JP7101211B2 (en) | Methods and compositions of gene modification by targeting using a pair of guide RNAs | |
| AU2015269187B2 (en) | Methods and compositions for modifying a targeted locus | |
| US12317874B2 (en) | Method of using a genetically modified mouse that expresses human albumin | |
| CN116064550A (en) | Nuclease-mediated repeat amplification | |
| JP7700222B2 (en) | Prime-editing-based gene editing composition with improved editing efficiency and uses thereof | |
| JP7426101B2 (en) | How to produce genome-edited cells | |
| US20220323609A1 (en) | Gene editing to correct aneuploidies and frame shift mutations | |
| RU2842438C1 (en) | Methods of overcoming immunological tolerance using plurality of guide rna | |
| RU2829155C2 (en) | Methods of overcoming immunological tolerance using multiple targeting rnas | |
| WO2023191063A1 (en) | Cell suitable for gene engineering, cell engineering and cellular medicine, and method for producing same | |
| CN117363649A (en) | Gene integration methods and applications | |
| HK40009103B (en) | Methods for targeted genetic modification using paired guide rnas |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 16810113 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 16810113 Country of ref document: EP Kind code of ref document: A1 |
