WO2017078526A2 - Saut d'exon médié par un oligonucléotide antisens à titre de thérapie systémique de l'épidermolyse bulleuse dystrophique récessive (ebdr) - Google Patents

Saut d'exon médié par un oligonucléotide antisens à titre de thérapie systémique de l'épidermolyse bulleuse dystrophique récessive (ebdr) Download PDF

Info

Publication number
WO2017078526A2
WO2017078526A2 PCT/NL2016/050767 NL2016050767W WO2017078526A2 WO 2017078526 A2 WO2017078526 A2 WO 2017078526A2 NL 2016050767 W NL2016050767 W NL 2016050767W WO 2017078526 A2 WO2017078526 A2 WO 2017078526A2
Authority
WO
WIPO (PCT)
Prior art keywords
aon
exon
sequence
bases
nucleotides
Prior art date
Application number
PCT/NL2016/050767
Other languages
English (en)
Other versions
WO2017078526A3 (fr
Inventor
Anna Maria Gerdina PASMOOIJ
Peter Christiaan VAN DEN AKKER
Jeroen BREMER
Marcellinus Franciscus JONKMAN
Original Assignee
Rijksuniversiteit Groningen
Academisch Ziekenhuis Groningen
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Rijksuniversiteit Groningen, Academisch Ziekenhuis Groningen filed Critical Rijksuniversiteit Groningen
Publication of WO2017078526A2 publication Critical patent/WO2017078526A2/fr
Publication of WO2017078526A3 publication Critical patent/WO2017078526A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/33—Alteration of splicing

Definitions

  • the invention relates to the field of medicine, in particular to means and methods for the treatment of the devastating skin blistering disease Recessive dystrophic epidermolysis bullosa (RDEB; MIM# 226600).
  • RDEB Recessive dystrophic epidermolysis bullosa
  • RDEB is caused by biallelic null mutations in the COL7A1 gene encoding type VII collagen (1).
  • Type VII collagen (C7) is the major component of anchoring fibrils that secure attachment of the epidermis to the dermis and is expressed by both basal keratinocytes and dermal fibroblasts (2).
  • the absence of type VII collagen in RDEB leads to severe blistering of the skin and mucosa just below the lamina densa. Abnormal wound healing with excessive scarring inevitably results in the fusion of fingers and toes (i.e. pseudosyndactyly) (3).
  • Patients have a highly increased risk of aggressive squamous cell carcinomas, which are the major cause of death before the age of 30-40 (4).
  • the 118 small exons of COL7A1 collectively encode the type VII collagen pro- ⁇ chain, which consists of a central 145 kDa triple helix domain (THD) flanked by a 145 kDa amino-terminal non-collagenous 1 (NCI) domain and a 30 kDa carboxyl-terminal non-collagenous 2 (NC2) domain (5).
  • THD triple helix domain
  • NCI non-collagenous 1
  • NC2 carboxyl-terminal non-collagenous 2
  • Posttranslational modifications lead to stable trimerization of three pro- ⁇ chains to pro-type VII collagen homotrimers, followed by removal of part of the NC2 domain and antiparallel dimerization of type VII collagen trimers (6).
  • Numerous type VII collagen dimers aggregate laterally to form anchoring fibrils that hnk the epidermis to the dermis.
  • the THD is encoded by exons 29 to 112, which are all in-frame.
  • AON Antisense oligonucleotide
  • COL7A1 seems a suitable candidate gene for AON-mediated exon skipping, as most RDEB patients have exonic mutations, and most COL7A1 exons are in-frame and encode highly repetitive Gly-X-Y amino acid sequences. This is underscored by findings that patients carrying COL7A1 mutations that lead to the natural skipping of an in-frame exon have relatively mild phenotypes (14). Additionally, the severity of the clinical phenotype in RDEB is highly correlated to the level of expression of partial type VII collagen variants at the cutaneous basement membrane zone (BMZ) (15).
  • BMZ cutaneous basement membrane zone
  • WO2013/053819 relates to an antisense oligonucleotide
  • roller et al. show correction of mutations in the COL17A1 and COL7A1 genes using double RNA trans-splicing, and propose it as a tool in the treatment of DEB.
  • exon 105 and exon 13 of each contain a target sequence that is preferentially targeted by AONs to achieve highly efficient exon skipping (up to 50% in vitro).
  • the exon 105 AONs are characterized in that they are capable of binding to a target sequence comprising a stretch of at least 17 contiguous nucleotides of the exon 105 sequence, which stretch sequence comprises at least one of the nucleotide sequences 5'-CCUGGUA-3' and 5'-AGGAG-3'.
  • Example 5 herein below demonstrates that variant exon 105 AONs complying with
  • the exon 13 AONs of the invention are characterized in that they bind to a target sequence, the target sequence comprising a stretch of at least 17 contiguous nucleotides of the exon 13 sequence 5' -GAGUCAGACA GCAUUC GACUUGGAUGACGUUCAGGCUGGGCUUAGCUACACUG UGCGG-3'.
  • novel AONs lead to in-frame exon skipping at the RNA level and restore C7 protein production in vitro in cultured primary keratinocytes and fibroblasts, and in vivo using a human skin-graft mouse model,
  • the invention provides an isolated AON of 14 to 35 nucleotides in length capable of binding to a target sequence of exon 105 in the COL7A1 gene, said target sequence comprising a stretch of at least 17 contiguous nucleotides of the exon 105 sequence and comprising at least one of the nucleotide sequences 5'-CCUGGUA-3' and 5'-AGGAG-3'.
  • the AON is 14 to 30 nucleotides in length, preferably 15-28 nucleotides, more preferably 18 to 26 nucleotides.
  • the nucleotides can be naturally occurring nucleotides or analogs thereof.
  • said AON comprises between 15-25 nucleotides or analogues thereof.
  • the exon 105 AON comprises the nucleotide sequence 5'- UACCAGG-3', wherein uracil bases (U) are optionally thymine bases (T).
  • the exonl05 AON comprises the nucleotide sequence 5'- CUCCU-3', wherein uracil bases (U) are optionally thymine bases (T).
  • the AON comprises the nucleotide sequences 5'- UACCAGG-3' and 5'-CUCCU-3' wherein uracil bases (U) are optionally thymine bases (T).
  • the AON is typically capable of binding to the target sequence with a Tm of at least 44°C, preferably at least 48°C, more preferably at least 50°C.
  • Exon 105 skipping and de novo type VII collagen expression was observed after systemically treating mice carrying skin grafts constituted of the same patient cells with the same AONs. Our results show that the anti-exon 105 AONs are capable of inducing skipping of their target exon from the
  • COL 7A1 pre-mRNA and traveling through the treated mice to exert their exon skipping effect in the patient graft at a relative large distance from the site of injection.
  • Our results demonstrate that the skin -humanized mouse model is a reliable and relative easy model to test systemic therapeutic approaches for genetic skin diseases.
  • the type VII collagen protein that is produced after exon skipping will lack the amino acids encoded by the skipped exon, which might have functional consequences related to the function of the exon involved.
  • Exon 105 is a small exon in the THD and likely has a predominantly structural function. In contrast to many other proteins that do not tolerate the skipping of an exon, skipping of exon 105 has been shown to have rather limited functional consequences on type VII collagen (Bornert et al., manuscript in preparation). This is supported by our findings of the normal incorporation of ⁇ 105 type VII collagen at the graft's BMZ. Taken together, the confirmed high functionality of the ⁇ 105 type VII collagen, and the correlation of type VII collagen expression and the severity of the
  • fibroblasts or both.
  • basal keratinocytes show higher levels of expression of type VII collagen than fibroblasts (6). Therefore, the treatment effect is anticipated to be higher if the systemically administered AONs reach the basal keratinocytes.
  • targeting the fibroblasts only may already result in significant amelioration of the phenotype, as indicated by the clinical improvement seen after injections of type VII collagen expressing fibroblasts (21).
  • As only 30-35% of type VII collagen expression is needed to prevent skin fragility (33), complete restoration of type VII collagen expression seems, however, not required for significant phenotypic improvement. Therefore, targeting the fibroblasts alone may already result in significant amelioration of the phenotype, as witnessed by the clinical improvement after injections of type VII collagen expressing fibroblasts (21).
  • Exemplary AONs for target exon 105 and inducing exon skipping include oligonucleotides having a sequence selected from the group consisting of
  • uracil bases (U) are optionally thymine bases (T)
  • Preferred AONs include 5'- GAUACCAGGCACUCCAUCCU-3' and 5'- CAUGAAGCCAACAUCUCCUU-3'.
  • the AON may be inserted in a vector.
  • the invention provides a pair of AONs wherein the first member is selected from the group consisting of
  • AON pair consisting of 5'- GAUACCAGGCACUCCAUCCU-3' and 5'-CAUGAAGCCAACAUCUCCUU- 3'.
  • an AON of 14 to 35 nucleotides in length capable of binding to a target sequence of exon 13 in the COL7A1 gene, said target sequence comprising a stretch of at least 17 contiguous nucleotides of the exon 13 sequence 5' -GAGUCAGACAGCAUUCGACUUGGAUG
  • the exon 13 AON is capable of binding to a target sequence comprising a stretch of at least 17 contiguous nucleotides of the sequence 5'-GCAUUCG
  • the AON may be 14 to 30 nucleotides in length, preferably 15-28
  • nucleotides more preferably 17 to 22 or 18 to 26 nucleotides.
  • the exonl3 AON comprises or consists of the sequence 5'-GCCUGAACGUCAUCCAAGUCG-3' , wherein uracil bases (U) are optionally thymine bases (T).
  • the AON is selected from the group consisting of the sequence 5'-GCCUGAACGUCAUCCAAGUCG-3'
  • An AON of the invention (be it an exonl05 or exonl3 AON) preferably comprises less than 10% nucleotide analogues.
  • An AON preferably comprises less than 4 nucleotide analogues, preferably less than 3, more preferably less than 2.
  • An AON of the invention is preferably a modified oligonucleotide.
  • the AON comprises RNA and wherein said RNA contains a modification.
  • said AON comprises one or more 2'-0- methyl oligoribonucleotides, which render the AON resistant to RNase H induced degradation of DNA/RNA hybrids.
  • a phosphorothiate backbone can be used to increase the stability of AONs against nucleases and to enhance cellular uptake.
  • An AON of the invention has in a preferred embodiment a full length
  • phosphorothioate backbone and all bases have a 2'-O-methyl modification.
  • the modification can be selected from the group consisting of a 2'-0-methyl phosphorothioate modified ribose (RNA) or deoxyribose (DNA) modification.
  • RNA 2'-0-methyl phosphorothioate modified ribose
  • DNA deoxyribose
  • AONs have been used to modulate splicing.
  • An AON of the present invention can therefore also have these modifications. These modifications render the AONs RNase H and nuclease resistant and increase or decrease the affinity for the target RNA. For the ENA and LNA modification this increase is accompanied by a decreased sequence specificity.
  • the AON may also comprise a mixture of different modifications.
  • An AON of the invention may be delivered in vivo alone or in association with a vector.
  • a "vector” is any vehicle capable of facilitating the transfer of the antisense sequence to the cells and preferably cells expressing collagen VII.
  • the vector transports the nucleic acid to cells with reduced degradation relative to the extent of degradation that would result in the absence of the vector.
  • the vectors useful in the invention include, but are not limited to, plasmids, phagemids, viruses, other vehicles derived from viral or bacterial sources that have been manipulated by the insertion or incorporation of the antisense
  • Viral vectors are a preferred type of vector and include, but are not limited to nucleic acid sequences from the following viruses: lentivirus such as HIV-1, retrovirus, such as moloney murine leukemia virus, adenovirus, adeno-associated virus; SV40-type viruses; Herpes viruses such as HSV-1 and vaccinia virus.
  • viruses include, but are not limited to nucleic acid sequences from the following viruses: lentivirus such as HIV-1, retrovirus, such as moloney murine leukemia virus, adenovirus, adeno-associated virus; SV40-type viruses; Herpes viruses such as HSV-1 and vaccinia virus.
  • lentivirus such as HIV-1
  • retrovirus such as moloney murine leukemia virus, adenovirus, adeno-associated virus
  • SV40-type viruses such as Herpes viruses such as HSV-1 and vaccinia virus.
  • Herpes viruses such as HSV-1 and
  • Retro virus-based and lentivirus-based vectors that are replication- deficient (i.e., capable of directing synthesis of the desired proteins, but incapable of manufacturing an infectious particle) have been approved for human gene therapy trials. They have the property to integrate into the target cell genome, thus allowing for a persistent transgene expression in the target cells and their progeny.
  • AAV human parvovirus Adeno-Associated Virus
  • AAVS1 located on the chromosome 19 (19ql3.3-qter).
  • AAV-based recombinant vectors lack the Rep protein, AAV vectors and integrate with low efficacy and low specificity into the host genome, and are mainly present as stable circular episomes that can persists for months and maybe years in the target cells. Therefore AAV has aroused considerable interest as a potential vector for human gene therapy.
  • viruses Among the favourable properties of the virus are its lack of association with any human disease and the wide range of cell lines derived from different tissues that can be infected. Actually 12 different AAV serotypes (AAVl to 12) are known, each with different tissue tropisms (Wu et al., 2006). Other vectors include plasmid vectors. Plasmid vectors have been extensively described in the art and are well known to those skilled in the art. In the last few years, plasmid vectors have been used as DNA vaccines for delivering antigen-encoding genes to cells in vivo. They are particularly advantageous for this because they do not have the same safety concerns as with many of the viral vectors.
  • Plasmids may be delivered by a variety of parenteral, mucosal and topical routes.
  • the DNA plasmid can be injected by intradermal, subcutaneous, or other routes. It may also be administered into the epidermis or a mucosal surface using a gene-gun.
  • the plasmids may be given in an aqueous solution, dried onto gold particles or in association with another DNA delivery system including but not limited to liposomes, dendrimers, cochleate and micro
  • the vectorized antisense sequences are fused with a small nuclear NA (snR A) such as U7 or Ul in order to ensure their stability and spliceosome targeting.
  • snR A small nuclear NA
  • the invention also provides an AON or an AON pair (or a vector comprising the same) as disclosed herein for use in a method for the treatment of a patient suffering from Dystrophic Epidermolysis Bullosa.
  • treating or “treatment” refers to reversing, alleviating, inhibiting the progress of, or preventing the disorder or condition to which such term applies, or one or more symptoms of such disorder or condition.
  • the amount of an AON (or a vector comprising it) to be administered will be an amount that is sufficient to induce amelioration of unwanted disease symptoms. Such an amount may vary inter alia depending on such factors as the gender, age, weight, overall physical condition, of the patient, etc. and may be determined on a case by case basis. The amount may also vary according to the type of condition being treated, and the other components of a treatment protocol (e.g.
  • a suitable dose is in the range of from about 0.1 mg/kg to about 100 mg/kg, hke 1 mg/kg to about 100 mg/kg.
  • suitable doses will depend on different factors such as the viral strain that is employed, the route of delivery (intramuscular, intravenous, intra-arterial or other), but may typically range from lOexp lO to 10exp l2 viral particles /kg. Those skilled in the art will recognize that such parameters are normally worked out during clinical trials. Further, the skilled artisan will recognize that, while disease symptoms may be completely alleviated by the treatments described herein, this need not be the case.
  • AONs of the invention will likely be administered on multiple occasions, that may be, depending on the results obtained, several days apart, several weeks apart, or several months apart, or even several years apart.
  • a further embodiment relates to a pharmaceutical composition
  • a pharmaceutical composition comprising at least one antisense oligonucleotide or oligonucleotide pair according to the invention and at least one pharmaceutically acceptable carrier, diluent or vehicle.
  • pharmaceutically acceptable refers to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to a mammal, especially a human, as
  • a pharmaceutically acceptable carrier or excipient refers to a non-toxic solid, semi-solid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type.
  • the invention also relates to methods for restoring the function of mutated proteins of interest using exon skipping technology.
  • the method involves blocking or preventing the incorporation into mature mRNA of one or more targeted exon(s), which encodes amino sequences that are responsible for the protein dysfunction. This is accomplished by exposing the pre-mRNA that includes exons encoding the protein to one or more AONs of the invention which are complementary to the defined target sequence motifs that are required for correct splicing of the one or more targeted exons.
  • said method comprises administering at least one of 5'- GAUACCAGGCACUCCAUCCU-3' (AON1 or AON-53), 5'-
  • CAUGAAGCCAACAUCUCCUU-3' (AON2 or AON-262) and 5'- GCCUGAACGUCAUCCAAGUCG-3'. Most preferably, it comprises administering the pair of 5'- GAUACCAGGCACUCCAUCCU-3' and 5'- CAUGAAGCCAACAUCUCCUU-3'.
  • the AONs bind to complementary required sequences in the pre- mRNA and prevent normal splicing. Instead, the targeted exons are excised and are not included in the mature mRNA that is translated into protein, and the amino acid sequences encoded by the targeted exons are missing from the translated protein.
  • One object of the present invention relates to a method for restoring the function of a mutated type VII collagen comprising the step of preventing splicing of one or more exons, which encode amino acid sequences that cause said type VII collagen dysfunction.
  • said method for restoring the function of a mutated type VII collagen comprises the step of preventing splicing of at least one exon selected from the group consisting of exon 105 and exon 13 using at least one of the novel AONs as disclosed herein.
  • one or more exons selected from the group consisting of exon 105 and exon 13 may be removed in order to restore the functionality of a mutated collagen VII.
  • the selection of exons for removal as described herein will usually be predicated on the expectation of a beneficial result such as restoration of the protein functionality.
  • the invention herewith provides methods of restoring partial or complete functionality to type VII collagen, e.g. an unstable, defective, dysfunctional, not enough functional or non- functional type VII collagen.
  • a still further embodiment provides a method for restoring the function of a mutated type VII collagen comprising administering to an individual in need thereof an AON (pair) or a pharmaceutical composition comprising the same. Also, the invention provides a method for alleviating one or more symptom(s) of Dystrophic Epidermolysis Bullosa in an individual, the method comprising administering to said individual an AON (pair) or a pharmaceutical composition comprising the same.
  • AONs of the invention may be used to cause exon skipping resulting in an amelioration of
  • Dystrophic Epidermolysis Bullosa symptoms typically in the range of 30 to 100%, compared to a non-treated patient case. Such symptoms may be observed on a micro level (i.e. restoration of protein expression and/or localization evaluated by immunohistochemistry, immunofluorescence, Western-blot analyses;
  • Fig.l. Puzzle like structure of COL7A1 exon organization The figure represents all COL7A1 exons and their corresponding reading phases.
  • the shapes of the exons depict the phasing of the triplet codons over different exons.
  • Light and dark green boxes indicate skippable exons, which can be divided into two groups: those that start and end with a complete codon (square boxes), all but one located in the THD domain, and those that begin and end with a partial codon (arrow shaped boxes), located exclusively in the NCI and NC2 domains. Red boxes depict unskippable exons.
  • Exons 29 to 112 encode the collagenous triple-helix domain (THD). Dark green boxes depict exons of the THD that encode a Gly-X-Y amino acid sequence only.
  • Fig.2. Specific AONs restore type VII collagen synthesis in vitro, (a) Position of AON 1 and AON2 and patient's mutation (red arrow) in exon 105. Predicted exon splice enhancer sequences reveal two potential regions for AON targeting (pink bars and orange curve), (b) RT-PCR on patient keratinocytes showed most effective exon skipping with 250 mM of both AONs. Healthy keratinocytes (1), Scrambled AONs (2-3), 250 mM and 500 mM AON1 (4-5), AON2 (6-7) or AON1+AON2 (8-9). (c) RT-PCR on healthy and patient keratinocytes and fibroblasts after transfection with 250mM AONs (3-4 and 7-8 respectively) or scrambled AON (1-2 and 5-6
  • Fig.4 In vivo AON-induced exon skipping leads to restoration of type VII collagen synthesis upon systemic treatment, (a) Illustration of the skin -humanized mouse model. Primary control keratinocytes and fibroblasts were seeded into silicone grafting chambers implanted on the back of athymic nude mice. The injection site is indicated (grey dotted circle), (b) RT-PCR showed in vivo exon 105 skipping after eight weeks of treatment. Saline treated healthy and patient skin grafts (lane 1 and 2, respectively) show only a wild-type RNA product including exon 105, whereas patient skin grafts from specific AON treated mice revealed skipping of exon 105 (lane 3). Sanger sequencing confirmed skipping of exon 105.
  • AON-3'splice and AON-overlap53 do not induce exon 105 skipping.
  • Expected wild-type size (WT) and product size after skipping of exon 105 ( ⁇ 105) are indicated.
  • the transfection of primary keratinocytes was performed in duplicate.
  • Fig.6 RNA analysis of exon 13 AON transfected fibroblasts.
  • A Gel electrophoresis showed a product at wild-type (WT) length and an additional smaller product (Skip). From left to right: ladder; 250 nM exon 13 -specific AON469; 500 nM AON469, control.
  • B Sanger sequencing of this product revealed a lack of exon 13 in this product, i.e. the exon is skipped.
  • Control keratinocytes and fibroblasts were isolated from skin after informed consent of healthy patients undergoing reconstructive surgery.
  • RDEB patient keratinocytes and fibroblasts were isolated from a biopsy after informed consent of a patient having the homozygous c.7828C>T,
  • pArg2610Ter null mutation in exon 105 of the COL 7A1 gene After incubation of the skin in trypsin (Invitrogen) for 1 hour at 37°C 5% CO2, the epidermis sheet was separated from the dermis with tweezers.
  • the epidermis was cut into small ⁇ lxl mm pieces followed by a five to ten minutes incubation in trypsin (Invitrogen) at 37°C for separation.
  • Bovine calf serum (BCS) Gibco was added to the solution to stop trypsinization.
  • the cells were pelleted by centrifugation for 10 minutes at 200 g and resuspended in complete Cnt-07 (CELLnTEC Advanced Cell Systems AG) serum free medium to be plated into a culture Petri dish. For continuation of culture, the cells are split in 3 when 90% confluence was reached.
  • AONs Antisense oligonucleotides
  • AON1 (herein also referred to as AON-53) , 5'- GAUACCAGGCACUCCAUCCU-3', and AON2 (herein also referred to as AON-262), 5'-CAUGAAGCCAACAUCUCCUU-3'.
  • GCUUUUCUUUUAGUUGCUGC-3' was used as negative control and with the addition of a 5'-FAM 537.46 fluorescent label as positive control.
  • All AONs comprise 2' O-methyl modified bases and phosphorothioate linkages, and were synthesized and purified by reverse-phase high performance liquid chromatography (Eurogentec BV). In vitro transfection
  • PEI polyethylenimine
  • LF Lipofectamine-2000
  • Lipid-AON complexes were formed according to the manufacturer's protocol and drop-wise added to the cells at a final concentration of 250 nM of AON in the medium. After six hours of incubation at 37°C 5% CO2 the medium was removed, cells were washed, and complete culture medium was added.
  • Superscript-Ill Invitrogen
  • mice For the generation of skin grafts, a mouse model was used as described (17). Briefly, primary cultured fibroblasts and keratinocytes were used to reconstitute human skin on the back of Atymic nude mice (Charles River strain 490). For the validation of the mouse model, four mice were grafted using healthy control cells. After validation, six mice were grafted with RDEB-gen sev patient cells. After implantation of the silicone grafting chamber, a mixture of 6xl0 6 fibroblasts and 6xl0 6 keratinocytes was seeded in the grafting chamber in a total volume of 400 ⁇ ⁇ in 1% low calcium BCS (HyClone) DMEM (Gibco).
  • HyClone low calcium BCS
  • the BCS was chelexed using Chelex- 100 (Bio-Rad) resin to remove calcium ions. Eight days after implantation, the silicone grafting chamber was removed and the wound was left to heal forming a scab in the process. Around ten days post removal of the grafting chamber, the scab fell off and the treatment phase was initiated.
  • Chelex- 100 Bio-Rad
  • the treatment scheme was composed of five daily injections of 50 mg/kg of each AON in a 0.15M NaCl solution for eight weeks. The subcutaneous injections were given in the trunk of the mice around 7 cm distal to the graft. Four mice with patient grafts were treated with the mixture of AON 1 and AON2 solution, and two mice with patient grafts and two mice with control grafts were injected with saline solutions as negative controls.
  • mice were sacrificed and the skin grafts were harvested. The entire full skin thickness grafts were removed from the back of the mice and flash frozen using hquid nitrogen and stored at -80°C prior to further analysis.
  • a cryosection of 50 ⁇ was cut on a Leica CM3050S cryostat and RNA was isolated, reverse transcribed, and PCR was performed as described above.
  • 4 ⁇ cryosections were stained using Zenon (Thermo Fisher Scientific) labelled LH7.2 monoclonal antibody. Cell nuclei were stained using Hoechst staining. Sections were analysed using a Leica DMRA fluorescence microscope.
  • EXAMPLE 2 In vitro exon skipping and restoration of type VII collagen synthesis
  • exon 105 As primary keratinocyte and fibroblast cultures from a patient (EB-023, patient 4 in ref (15)) with RDEB due to the homozygous nonsense mutation in exon 105 (c.7828C>T, p.Arg2610Ter) were readily available.
  • This nonsense mutation introduces a premature termination codon (PTC) that leads to the total absence of type VII collagen in his skin and explains the individual's severe phenotype ( Figure 2A).
  • Control and patient primary keratinocytes and fibroblasts were subsequently cultured and transfected with non-specific AONs or the combination of specific AONs. Forty-eight hours after transfection, RNA was isolated from transfected control and patient keratinocytes and fibroblasts. In the control and patient cells transfected with the anti-exonl05 AONs, RT-PCR analysis revealed exon skipping at the RNA level in both control and patient keratinocytes and fibroblasts, which was confirmed by Sanger sequencing ( Figure 2C). The keratinocytes and fibroblast from the patient carrying mutation c.7828C>T in exon 105 exhibit no expression of type VII collagen.
  • control and patient cells were cultured on cover slips prior to transfection with the two AONs targeting exon 105. Seventy-two hours after transfection, the cells were fixated to the cover slips and analysed by immunofluorescence staining. In comparison to control keratinocytes and fibroblast, no expression of type VII collagen is observed in patient cells, either untransfected or transfected with
  • keratinocytes on athymic immune deficient nude mice 17.
  • This model constitutes a personalized model offering the opportunity to easily and directly test the in vivo efficacy of AONs on patient cells and additionally allows long-term treatment and observation of treatment effect of the target skin.
  • Cultured control or patient keratinocytes and fibroblasts were seeded into grafting chambers on the back of athymic nude mice ( Figure 3A). After eight weeks, the skin grafts were harvested.
  • mice Six mice were grafted with patient keratinocytes and fibroblasts carrying the premature termination codon c.7828C>T mutation in exon 105 and two mice were grafted with healthy control keratinocytes and
  • mice bearing patient skin grafts were treated with 50 mg/kg of each AON (AON1 and AON2 described herein above) via subcutaneously injections at the tail base for a period of eight weeks (injection site indicated in Figure 3A).
  • the four remaining mice bearing either patient or healthy control skin grafts were given saline solution as a negative control.
  • the human skin grafts were harvested and RNA was isolated from graft cryosections.
  • RT-PCR analysis revealed exon 105 skipping in the RNA isolated from the patient grafts grown on mice treated with the specific anti- exon 105 AONs. As expected exon 105 skipping was not observed in RNA isolated from the patient or control grafts grown on mice injected with saline solution. Sanger sequencing confirmed exon 105 skipping (Figure 4A).
  • exon 105 AONs were tested (indicated in bold below), which both comply with the conventional design guidelines (17- 23 nt long, Tm >44°C, no G or C triplets, low self-dimerization, binding affinity 18-28), but which do not comprise the unique target sequences for exon 105: 5'-CCUGGUA-3' and 5'-AGGAG-3' according to the present invention (indicated as underlined sequence).
  • GGATC C C AGGAAAGGATGGAGTGC CTGGTATC C GAGGAGAAA
  • Exon skipping is a personalized therapy. To be able to develop a therapy for which many patients will profit, we have also looked at other exons than exon 105. In this case at exon 13 of the COL7A1 gene, as in the British population there is a recurrent mutation in this exon, i.e. c. l732C>T;
  • dystrophic epidermolysis bullosa This substitution of a C to a T changes the codon of an arginine to a premature termination codon, leading to nonsense mediated RNA decay, and the complete lack of type VII collagen.
  • Exon 13 contains 144 bp, which is a multiple of 3. Therefore, skipping of this exon will keep the reading frame intact.
  • the sequence of exon 13 plus minus 50 base pairs is as follows (Exon 13 indicated in bold):
  • AON 5'- GCCUGAACGUCAUCCAAGUCG-'3; AON469) was designed to specifically target this sequence and it was evaluated for its ability to induce exon 13 skipping.
  • All AONs comprise 2' O-methyl modified bases and phosphorothioate linkages, and were synthesized and purified by reverse-phase high performance liquid chromatography (Eurogentec BV).
  • Control keratinocytes were isolated from skin after informed consent of healthy patients undergoing reconstructive surgery. After incubation of the skin in trypsin (Invitrogen) for 1 hour at 37°C 5% CO2, the epidermis sheet was separated from the dermis with tweezers. Subsequently, the epidermis was cut into small ⁇ lxl mm pieces followed by a five to ten minutes incubation in trypsin (Invitrogen) at 37°C for separation. Bovine calf serum (BCS) (Gibco) was added to the solution to stop trypsinization.
  • BCS Bovine calf serum
  • the cells were pelleted by centrifugation for 10 minutes at 200 g and resuspended in complete Cnt-07 (CELLnTEC Advanced Cell Systems AG) serum free medium to be plated into a culture petri dish. For continuation of culture, the cells are split in 3 when 90% confluence was reached.
  • Cnt-07 CELLnTEC Advanced Cell Systems AG
  • Opti-MEM Gibco
  • Lipid-AON complexes were formed according to the manufacturer's protocol and drop-wise added to the cells at a final concentration of 250 nM or 500 nM of AON in the medium. After six hours of incubation at 37°C 5% CO2 the medium was removed, cells were washed, and complete culture medium was added.
  • Superscript-Ill Invitrogen
  • Reverse transcription was followed by PCR analysis of exon 13 of the COL7A1 gene using nested PCR primers (first forward: 5'- GGTGGTACTGCCCTCTGATG-'3, first reverse: 5'- TCCGTTCGAGCCACGATGAC-'3, nested forward: 5'- CCGCCTCACACTCTACACTC-'3, nested reverse: 5'- AGCCACCTGGTAGGTGGTTC-'3)
  • primary fibroblasts were cultured until 70-80% confluence in a 12 well plate prior transfection. The fibroblasts were transfected using 250nM and 500nM of exon 13 specific AON469 using polyethylenimine in complete culture medium.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Biophysics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biochemistry (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Dermatology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention se rapporte au domaine de la médecine et notamment à des moyens et des méthodes de traitement de l'épidermolyse bulleuse dystrophique récessive (EBDR) à cloques cutanées dévastatrices. Un oligonucléotide antisens (AON) isolé de 14 à 35 nucléotides de long, capable de se lier à une séquence cible de l'exon 105 du gène COL7A1, ladite séquence cible comportant une série d'au moins 17 nucléotides contigus de la séquence de l'exon 105 et comprenant au moins une des séquences de nucléotides 5'-CCUGGUA-3' et 5'-AGGAG-3' est en outre décrit.
PCT/NL2016/050767 2015-11-05 2016-11-04 Saut d'exon médié par un oligonucléotide antisens à titre de thérapie systémique de l'épidermolyse bulleuse dystrophique récessive (ebdr) WO2017078526A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP15193281 2015-11-05
EP15193281.1 2015-11-05

Publications (2)

Publication Number Publication Date
WO2017078526A2 true WO2017078526A2 (fr) 2017-05-11
WO2017078526A3 WO2017078526A3 (fr) 2017-07-20

Family

ID=54477886

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/NL2016/050767 WO2017078526A2 (fr) 2015-11-05 2016-11-04 Saut d'exon médié par un oligonucléotide antisens à titre de thérapie systémique de l'épidermolyse bulleuse dystrophique récessive (ebdr)

Country Status (1)

Country Link
WO (1) WO2017078526A2 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10563198B2 (en) 2015-03-11 2020-02-18 Wings Therapeutics, Inc. Oligonucleotides matching COL7A1 exon 73 for epidermolysis bullosa therapy
WO2020176904A1 (fr) 2019-02-28 2020-09-03 Wings Therapeutics, Inc. Oligonucléotides pour utilisation dans le traitement de l'épidermolyse bulleuse dystrophique

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013053819A1 (fr) 2011-10-11 2013-04-18 INSERM (Institut National de la Santé et de la Recherche Médicale) Thérapie par sauts d'exon pour l'épidermolyse bulleuse dystrophique

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013053819A1 (fr) 2011-10-11 2013-04-18 INSERM (Institut National de la Santé et de la Recherche Médicale) Thérapie par sauts d'exon pour l'épidermolyse bulleuse dystrophique

Non-Patent Citations (37)

* Cited by examiner, † Cited by third party
Title
AARTSMA-RUS ET AL., MOLECULAR THERAPY, vol. 17, no. 3, 2008, pages 548 - 553
AARTSMA-RUS ET AL., OLIGONUCLEOTIDES, vol. 20, no. 2, 2010, pages 69 - 77
AARTSMA-RUS; MUNTONI, NEUROMUSCULAR DISORDERS, vol. 23, no. 11, 2013, pages 934 - 944
BORNERT ET AL., MOLECULAR THERAPY, 2016
BURGESON ET AL., ANNALS OF THE NEW YORK ACADEMY OF SCIENCES, vol. 460, no. 1, 1985, pages 47 - 57
CHEN ET AL., JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 276, no. 24, 2001, pages 21649 - 21655
CHEN YQ ET AL., JOURNAL OF INVESTIGATIVE DERMATOLOGY, vol. 102, no. 2, 1994, pages 205 - 209
CHRISTIANO AM ET AL., GENOMICS, vol. 21, no. 1, 1994, pages 160 - 168
CHRISTIANO ET AL., HUMAN MOL. GENETICS, vol. 4, 1995, pages 1579 - 1583
FILARETO ET AL., NATURE COMMUNICATIONS, vol. 4, 2013, pages 1549
FINE ET AL., JOURNAL OF THE AMERICAN ACADEMY OF DERMATOLOGY, vol. 61, no. 3, 2009, pages 367 - 384
FINE ET AL., JOURNAL OF THE AMERICAN ACADEMY OF DERMATOLOGY, vol. 70, no. 6, 2014, pages 1103 - 1126
FO DESMET ET AL: "Human Splicing Finder: an online bioinformatics tool to predict splicing signals", NUCLEIC ACID RESEARCH, 2009
FRITSCH ET AL., JOURNAL OF CLINICAL INVESTIGATION, vol. 118, no. 5, 2008, pages 1669 - 1679
GOEMANS ET AL., NEW ENGLAND JOURNAL OF MEDICINE, vol. 364, no. 16, 2011, pages 1513 - 1522
GOTO ET AL., JOURNAL OF INVESTIGATIVE DERMATOLOGY, vol. 126, no. 12, 2006, pages 2614 - 2620
HEINONEN SEPPO ET AL., JOURNAL OF CELL SCIENCE, vol. 112, 1999, pages 3648
ITO ET AL., THE AMERICAN JOURNAL OF PATHOLOGY, vol. 175, no. 6, 2009, pages 2508 - 2517
KERN ET AL., MOLECULAR THERAPY, vol. 17, no. 9, 2009, pages 1605 - 1615
KOO ET AL., HUMAN GENE THERAPY, vol. 24, no. 5, 2013, pages 479 - 488
MARTINS ET AL., JOURNAL OF CELL SCIENCE, vol. 122, no. 11, 2009, pages 1788 - 1799
NEVALA-PLAGEMANN ET AL., CYTOTHERAPY, vol. 17, no. 6, 2015, pages 786 - 795
PASMOOIJ AMG ET AL., EXPERIMENTAL DERMATOLOGY, vol. 13, no. 2, 2004, pages 125 - 128
REMINGTON ET AL., MOLECULAR THERAPY, vol. 17, no. 1, 2008, pages 26 - 33
ROLLER ET AL., J. INVEST. DERMATOLOGY, vol. 132, 2012, pages S93
SAKAI LY ET AL., JOURNAL OF CELL BIOLOGY, vol. 103, no. 4, 1986, pages 1141
SEBASTIANO ET AL., SCIENCE TRANSLATIONAL MEDICINE, vol. 6, no. 264, 2014, pages 264RA163
TOLAR ET AL., JOURNAL OF INVESTIGATIVE DERMATOLOGY, vol. 134, no. 5, 2013, pages 1246 - 1254
TOYONAGA ET AL., BRITISH JOURNAL OF DERMATOLOGY, vol. 172, no. 4, 2015, pages 1141 - 1144
TURCZYNSKI S ET AL., METHODS MOLECULAR BIOLOGY, 2012, pages 221 - 238
UMEGAKI-ARAO N ET AL., SCIENCE TRANSLATIONAL MEDICINE, vol. 6, no. 264, 2014, pages 264RA164
VAN DEN AKKER ET AL., JOURNAL OF DERMATOLOGICAL SCIENCE, vol. 56, no. 1, 2009, pages 9 - 18
VAN ROON-MOM ET AL., METHODS IN MOLECULAR BIOLOGY, 2012, pages 1179
VENUGOPAL ET AL., JOURNAL OF THE AMERICAN ACADEMY OF DERMATOLOGY, vol. 69, no. 6, 2013, pages 898 - 908
VOIT T ET AL., THE LANCET NEUROLOGY, vol. 13, no. 10, October 2014 (2014-10-01), pages 987 - 996
WANG ET AL., JOURNAL OF INVESTIGATIVE DERMATOLOGY, vol. 114, no. 4, 2000, pages 674 - 680
WENZEL ET AL., SCIENCE TRANSLATIONAL MEDICINE, vol. 6, no. 264, 2014, pages 264RA165

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10563198B2 (en) 2015-03-11 2020-02-18 Wings Therapeutics, Inc. Oligonucleotides matching COL7A1 exon 73 for epidermolysis bullosa therapy
US11352626B2 (en) 2015-03-11 2022-06-07 Wings Therapeutics, Inc. Oligonucleotides matching COL7A1 exon 73 for epidermolysis bullosa therapy
WO2020176904A1 (fr) 2019-02-28 2020-09-03 Wings Therapeutics, Inc. Oligonucléotides pour utilisation dans le traitement de l'épidermolyse bulleuse dystrophique
JP2022523783A (ja) * 2019-02-28 2022-04-26 フェニシス セラピューティクス， インコーポレイテッド 栄養障害型表皮水疱症の治療に使用されるオリゴヌクレオチド

Also Published As

Publication number Publication date
WO2017078526A3 (fr) 2017-07-20

Similar Documents

Publication Publication Date Title
ES2551154T3 (es) Procedimiento para la eficiente omisión del exón (44) en distrofia muscular de Duchenne y medios asociados
EP2349287B1 (fr) Méthodes et moyens pour sauter efficacement au moins l`un des exons suivants du gène de la dystrophie musculaire humaine de duchenne : 43, 46, 50 à 53
ES2692886T3 (es) Métodos y medios para el salto eficaz de al menos uno de los siguientes exones del gen de distrofia muscular de Duchenne humana: 43, 46, 50-53
US20150141320A1 (en) Compositions and methods for modulating gene expression
KR20210005031A (ko) Pten 억제제를 포함하는 소포 및 이의 용도
US11352626B2 (en) Oligonucleotides matching COL7A1 exon 73 for epidermolysis bullosa therapy
KR20180104075A (ko) IL4Rα, TRPA1, 또는 F2RL1을 표적화하는 RNA 복합체를 사용한 아토피 피부염 및 천식의 치료
US11104900B2 (en) Antisense oligonucleotides to treat dystrophic epidermolysis bullosa
WO2017078526A2 (fr) Saut d'exon médié par un oligonucléotide antisens à titre de thérapie systémique de l'épidermolyse bulleuse dystrophique récessive (ebdr)
WO2017186815A1 (fr) Oligonucléotides antisens pour l'expression améliorée de la frataxine
US20150329857A1 (en) Rna interference to activate stem cells
KR20220154772A (ko) Pgc-1a 발현을 사용하는 진단 방법
KR20220155585A (ko) Sirt1 발현을 사용하는 진단 방법
NZ737592B2 (en) Antisense oligonucleotides to treat dystrophic epidermolysis bullosa

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16809197

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16809197

Country of ref document: EP

Kind code of ref document: A2