WO2017078499A2 - Composition for prevention or treatment of neuroinflammatory disease, containing protein tyrosine phosphatase inhibitor - Google Patents

Composition for prevention or treatment of neuroinflammatory disease, containing protein tyrosine phosphatase inhibitor Download PDF

Info

Publication number
WO2017078499A2
WO2017078499A2 PCT/KR2016/012746 KR2016012746W WO2017078499A2 WO 2017078499 A2 WO2017078499 A2 WO 2017078499A2 KR 2016012746 W KR2016012746 W KR 2016012746W WO 2017078499 A2 WO2017078499 A2 WO 2017078499A2
Authority
WO
WIPO (PCT)
Prior art keywords
ptp
ptp1b
inhibitor
neuroinflammatory
microglia
Prior art date
Application number
PCT/KR2016/012746
Other languages
French (fr)
Korean (ko)
Other versions
WO2017078499A3 (en
Inventor
석경호
송견지
Original Assignee
경북대학교 산학협력단
경북대학교병원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 경북대학교 산학협력단, 경북대학교병원 filed Critical 경북대학교 산학협력단
Priority to US15/773,928 priority Critical patent/US20180325925A1/en
Priority claimed from KR1020160147537A external-priority patent/KR101826690B1/en
Publication of WO2017078499A2 publication Critical patent/WO2017078499A2/en
Publication of WO2017078499A3 publication Critical patent/WO2017078499A3/en
Priority to US16/998,867 priority patent/US20200384001A1/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/16—Amides, e.g. hydroxamic acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/16—Amides, e.g. hydroxamic acids
    • A61K31/165—Amides, e.g. hydroxamic acids having aromatic rings, e.g. colchicine, atenolol, progabide
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19—Carboxylic acids, e.g. valproic acid
    • A61K31/195—Carboxylic acids, e.g. valproic acid having an amino group
    • A61K31/197—Carboxylic acids, e.g. valproic acid having an amino group the amino and the carboxyl groups being attached to the same acyclic carbon chain, e.g. gamma-aminobutyric acid [GABA], beta-alanine, epsilon-aminocaproic acid or pantothenic acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/66—Phosphorus compounds

Definitions

  • the present invention relates to a pharmaceutical composition for the prevention or treatment of neuroinflammatory diseases, including protein tyrosine phosphatas inhibitors.
  • the central nervous system consists of neurons and glial cells. Glial cells make up about 90% of all brain cells, and by volume they make up about 50% of the entire brain. Glial cells can be further classified into three types: astrocytes, microglia, and oligodendrocytes. Among these, microglia are a kind of specialized macrophage and are widely distributed in the brain. Microglia serve as a phagocytic cell that swallows tissue debris and dead cells, as well as participates in the bioprotective activity of the brain.
  • Neuroinflammation is a type of immune response in the nervous system that is closely associated with many degenerative neurological disorders, including Alzheimer's, Parkinson's disease, and multiple sclerosis, and is currently considered a typical feature of degenerative neurological disease.
  • Neuroinflammatory responses include activation of innate immune cells (microglia), release of inflammatory mediators such as nitric oxide (NO), cytokines and chemokines, and macrophage infiltration, which induce neuronal cell death.
  • Inflammatory activation of microglia and astrocytes is thought to be an important mechanism in the pathological marker and progression of degenerative neurological diseases. Strict regulation of microglia activity is essential for maintaining brain homeostasis and preventing infectious and inflammatory diseases.
  • protein tyrosine phosphatase (hereinafter referred to as 'PTP') is a group of enzymes that remove phosphate groups from tyrosine residues of phosphorylated proteins.
  • Protein tyrosine phosphorylation is a common post-translational modification that creates new recognition motifs for protein interactions, affects protein stability and modulates enzyme activity. Thus, maintaining adequate levels of protein tyrosine phosphorylation is essential for cellular function.
  • proteins are known as protein tyrosine phosphatase.
  • protein tyrosine phosphatase 1B (PTP1B) is one of protein tyrosine dephosphatase and is a major negative regulator of insulin and leptin signaling.
  • PTP1B protein tyrosine phosphatase 1B
  • Mouse studies with PTP1B removal confirmed that PTP1B senses insulin and that PTP1B inhibitors have a protective effect on diabetes.
  • Many studies have shown that PTP1B is associated with cancer, but is currently associated with protein tyrosine dephosphatase and neuroinflammatory inflammation. Little is known about the relationship.
  • the present inventors have continued to study substances that can fundamentally cure a wide range of neuroinflammatory diseases by inhibiting microglia activation and neuroinflammatory responses in various ways. As a result, the present inventors confirmed that PTP inhibitors have an effect of inhibiting neuroinflammatory inflammation.
  • the present invention has been completed.
  • a pharmaceutical composition for the prophylaxis or treatment of neuroinflammatory diseases comprising a PTP inhibitor.
  • the present invention provides a pharmaceutical composition for the prevention or treatment of neuroinflammatory diseases comprising a protein tyrosine phosphatase (PTP) inhibitor.
  • PTP protein tyrosine phosphatase
  • the present invention provides a food composition for improving neuroinflammatory diseases comprising a PTP inhibitor.
  • the present invention also provides a method for preventing or treating a neuroinflammatory disease comprising administering a PTP inhibitor to a subject.
  • the protein tyrosine dephosphatase inhibitor of the present invention prevents neuroinflammatory diseases by inhibiting activated microglial cells through reduction of nitric oxide (NO) levels in microglial cells, and reduction of expression of proinflammatory factors TNF ⁇ , IL1 ⁇ , iNOS, etc. Or may be usefully used for treatment.
  • NO nitric oxide
  • 1 is a diagram showing the results confirmed by RT-PCR changes in the expression level of PTP mRNA by LPS in the mouse brain.
  • Figure 2 shows the results confirmed by RT-PCR changes in the expression level of PTP mRNA by LPS in mouse primary microglia and primary astrocytic cells.
  • Figure 3 is a diagram showing the results confirmed by the NO production level measurement and MTT analysis whether PTP inhibitors inhibit the activation of microglial cell line BV2.
  • FIG. 4 is a diagram showing the results of confirming whether the PTP inhibitor inhibits microglial activation.
  • 4A shows an experimental design
  • FIG. 4B shows histological changes of morphological changes in the brain of the mouse.
  • FIG. 4C shows Iba-1 positive cells as microglia markers in the hippocampus, cortex and thalamus of the mouse.
  • a graph quantifying the results of identifying Iba-1 positive cells, microglia markers in the hippocampus, cortex and thalamus of mice.
  • FIG. 5 is a diagram showing the results of confirming the expression level of PTP1B in the BV2 microglia (HA-PTP1B) overexpressing the prepared PTP1B.
  • Figure 6 shows the results of measuring the NO production level in Lg-stimulated microglia cell line BV2 according to the dose of LPS.
  • Figure 7 is a diagram showing the results of measuring the NO production level in Lg-stimulated microglia cell line BV2 over time.
  • FIG. 8 is a diagram showing the results confirmed by real-time PCR the change in the expression level of inflammatory cytokine mRNA in BV2 microglial cell line overexpressing PTP1B.
  • FIG. 9 is a diagram showing the results of confirming the change in the expression level of LPS-induced NO according to the treatment of the PTP1B inhibitor (iPTP1B) in the microglial cell line BV2.
  • FIG. 10 is a diagram showing the results of confirming the change in the expression level of LPS-induced NO according to the treatment of PTP1B inhibitor (iPTP1B) in primary microglia.
  • Figure 11 shows the results of confirming the change in the expression level of LPS-induced NO according to the treatment of PTP1B inhibitor (iPTP1B) in rat microglia.
  • FIG. 12 is a diagram showing the results of confirming the change in the expression level of TNF ⁇ -induced NO according to the treatment of PTP1B inhibitor (iPTP1B) in rat microglia.
  • Figure 13 is a diagram showing the results confirmed by RT-PCR change in the expression level of proinflammatory molecules according to the treatment of PTP1B inhibitor (iPTP1B) in microglial cell line BV2.
  • PTP1B inhibitor iPTP1B
  • Figure 14 is a diagram showing the numerical results of confirming the change in the expression level of pro-inflammatory molecules according to the treatment of PTP1B inhibitor (iPTP1B) in microglia cell line BV2 by RT-PCR.
  • PTP1B inhibitor iPTP1B
  • FIG. 15 is a diagram showing the results of confirming the change in the expression level of TNF ⁇ protein according to the treatment of the PTP1B inhibitor (iPTP1B) in microglia cell line BV2 by ELISA.
  • iPTP1B PTP1B inhibitor
  • 17 is a diagram confirming the increase of NO levels induced by LPS in microglial cell lines overexpressing PTP1B.
  • 18 is a diagram confirming the decrease of NO levels induced by LPS by Src kinase inhibitors in microglia.
  • 20 is a diagram showing the results confirming that the PTP1B inhibitor increases the phosphorylation of the Src Y527 position.
  • Figure 21 is a simplified diagram illustrating the mechanism by which PTP1B is involved in neuroinflammatory.
  • FIG. 22 is a diagram showing an experimental design for confirming the neuroinflammatory mitigation effect of the PTP1B inhibitor in vivo.
  • Figure 23 shows the results confirmed by real-time PCR that PTP1B inhibitors inhibit the expression of TNF ⁇ and IL1 ⁇ in vivo.
  • the present invention provides a pharmaceutical composition for the prophylaxis or treatment of neuroinflammatory diseases comprising a PTP inhibitor.
  • PTP inhibitor protein tyrosine phosphatase inhibitor
  • PTP1B protein tyrosine phosphatase type 1B
  • TC-PTP T-cell phosphatase
  • SHP2 Src homology domain2-containing PTP2
  • MEG2 Megakaryocyte-PTP2
  • LYP Lymphoid specific-tyrosine phosphatase
  • RPTP ⁇ Receptor-type tyrosine protein phosphatase beta
  • the PTP inhibitors include, but are not limited to, the compounds listed in the table below or pharmaceutically acceptable salts thereof.
  • the "pharmaceutically acceptable salt” is not limited as long as it forms an addition salt with the compound, and includes salts derived from pharmaceutically acceptable inorganic acids, organic acids, or bases.
  • suitable acid addition salts include inorganic acids such as sulfuric acid, hydrochloric acid, nitric acid, phosphoric acid, bromic acid, perchloric acid, hydroiodic acid and the like; Organic carbon acids such as oxalic acid, citric acid, succinic acid, tartaric acid, formic acid, acetic acid, trichloroacetic acid, trifluoroacetic acid, glycolic acid, benzoic acid, lactic acid, fumaric acid, maleic acid, salicylic acid, and the like; Acid addition salts formed by sulfonic acids such as methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid, toluene-p-sulfonic acid, naphthalene-2-sulf
  • Suitable base addition salts include alkali metal or alkaline earth metal salts formed by lithium, sodium, potassium, calcium, magnesium, and the like; Amino acid salts such as lysine, arginine and guanidine; Base addition salts formed by organic salts such as dicyclohexylamine, N-methyl-D-glucamine, tris (hydroxymethyl) methylamine, diethanolamine, choline, triethylamine and the like.
  • the PTP1B inhibitor and the compound of formula 1 according to the present invention can be converted to their salts by conventional methods, and the preparation of the salts can be easily carried out by those skilled in the art based on the structure of the compound without further explanation.
  • the "neuroinflammatory disease” may include without limitation any disease caused by inflammation of the nervous system, for example, multiple sclerosis, neuroblastoma, stroke, Alzheimer's disease, Parkinson's disease, Lou Gehrig's disease, Huntington's disease, Creutzfeldt-Jakob disease , Post traumatic stress disorder, depression, schizophrenia, and amyotrophic lateral sclerosis.
  • prevention means to inhibit the occurrence of a disease or a disease in an individual who has not been diagnosed as having a neuroinflammatory disease or a disease, but is prone to such a disease or a disease.
  • treatment in the present invention also means the inhibition of the development of a neuroinflammatory disease or disease, the alleviation of the disease or disease, and the elimination of the disease or disease.
  • PTP inhibitors reduce the activation of microglia under inflammatory conditions induced by LPS (lipopolysaccharide), reduce the secretion of inflammatory cytokines TNF ⁇ , IL1 ⁇ , iNOS, and reduce nitric oxide ( It was confirmed that the production of NO) was also reduced. Therefore, it was confirmed that the pharmaceutical composition including the PTP inhibitor as an active ingredient may be useful for the prevention or treatment of neuroinflammatory diseases by reducing the anti-inflammatory effect and the activation of microglia.
  • LPS lipopolysaccharide
  • the neuroinflammatory inhibitory effect of the PTP inhibitor was verified through in vitro and in vivo experiments.
  • PTP1B promotes the production of proinflammatory cytokines, activates Src through dephosphorylation of the Y527 position of Src, and this activated Src also activates NF ⁇ B to increase the expression of proinflammatory factors. Confirmed. From these results, it was confirmed that the inhibitor of PTP1B can be usefully used as an active ingredient of a composition for preventing or treating neuroinflammatory diseases.
  • the pharmaceutical composition of the present invention may further include a pharmaceutically acceptable carrier.
  • a pharmaceutically acceptable carrier refers to a carrier or diluent that does not significantly irritate an organism and does not inhibit the biological activity and properties of the administered compound.
  • Pharmaceutically acceptable carriers include, for example, oral carriers such as lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, and the like for parenteral administration such as water, suitable oils, saline, aqueous glucose and glycols, and the like. Carrier and the like.
  • Such pharmaceutically acceptable carriers may be used in combination with saline, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol and one or more of these components, as necessary.
  • Other conventional additives such as stabilizers, preservatives, antioxidants, buffers and bacteriostatic agents can be added.
  • compositions of the present invention may be prepared in various parenteral or oral administration forms according to known methods.
  • Representative formulations for parenteral administration include isotonic aqueous solutions or suspensions, and can be prepared according to techniques known in the art using suitable dispersing or wetting agents and suspending agents.
  • each component may be formulated for injection by dissolving in saline or buffer.
  • oral dosage forms include, but are not limited to, powders, granules, tablets, pills, emulsions, syrups and capsules.
  • the present invention also provides a method for preventing or treating a neuroinflammatory disease comprising administering a PTP inhibitor to a subject.
  • administration refers to the introduction of the pharmaceutical composition of the present invention to an individual in need of treatment of the disease in any suitable manner, and the route of administration of the composition of the present invention can reach the target tissue as long as it can Administration can be via oral or parenteral routes.
  • the subject to be administered may be a mammal such as a mouse, mouse, livestock, human, etc., and may be administered through various routes including oral, transdermal, subcutaneous, intravenous, or intracranial injection.
  • the prophylactic or therapeutic method of the present invention comprises administering a PTP inhibitor or a pharmaceutically acceptable salt thereof in a pharmaceutically effective amount.
  • a suitable total daily dose may be determined by the practitioner within the correct medical judgment.
  • the specific therapeutically effective amount for a particular patient is determined by the specific composition, including the type and extent of the reaction to be achieved and whether other agents are used, as appropriate, the age, body weight, general health status, sex of the patient. And various factors and similar factors well known in the medicinal art, including diet, time of administration, route of administration and rate of composition, duration of treatment, drugs used with or concurrent with the specific composition.
  • the present invention provides a food composition for improving neuroinflammatory diseases comprising a PTP inhibitor.
  • the term "food” means a natural product or processed product containing one or more nutrients, and preferably means a state in which it can be directly eaten through some processing process, It is used to mean all kinds of foods, health foods, beverages, food additives and beverage additives.
  • the food composition of the present invention may be added to various foods, candy, chocolate, beverages, gums, teas, vitamin complexes, various health supplements, and the like, and may be used in the form of powders, granules, tablets, pills, capsules, or beverages.
  • the food composition of the present invention may further include a food acceptable carrier.
  • a food acceptable carrier There is no special limitation except for containing the PTP inhibitor of the present invention or a food-acceptable salt thereof, and for example, it may further contain various flavors or natural carbohydrates.
  • the food composition of the present invention includes ingredients that are commonly added during food production, and may include, for example, proteins, carbohydrates, fats, nutrients and seasonings.
  • various nutrients, vitamins, minerals, flavors such as synthetic and natural flavors, colorants, enhancers, fact acids and salts thereof, alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH regulators, stabilizers, Preservatives, glycerin, alcohols, carbonation agents used in carbonated drinks, and the like.
  • the amount of the PTP inhibitor or salt thereof may be included as 0.00001% to 50% by weight of the total weight of the food, if the food is a beverage based on the volume of 100 ml of the entire food 0.001 g to 50 g, preferably 0.01 g to 10 g, but is not limited thereto.
  • mice injected with LPS were prepared as follows in an infected animal model.
  • LPS Lipopolysaccharid
  • mice All experiments were performed using 9-11 week-old male C57BL / 6 mice (25-30 g) supplied by Koatech (Pyeongtaek, Korea), and a mouse model was prepared by intraperitoneally injecting LPS at 5 mg / kg. .
  • the control group was injected with a vehicle.
  • PTP is correlated with inflammation of the brain because the expression of PTP is increased in the brain of mice induced by LPS.
  • Microglial cells are immune cells present in the central nervous system and play a role in the initiation and progression of inflammatory responses resulting from inflammatory stimuli. The expression level change of was confirmed.
  • mRNA levels of PTP1B, TC-PTP, SHP2, MEG2, LYP, and RPTP ⁇ in primary microglia and primary astrocytic cells were confirmed by RT-PCR. The confirmation result is shown in FIG.
  • PTP is increased in glial cells under the inflammatory conditions induced by the injection of LPS, it can be seen that PTP is associated with brain inflammation.
  • BV-2 microglia were treated with LPS (100 ng / ml) for 24 hours in the presence of 1, 2, 5, and 10 ⁇ M of each PTP inhibitor, and then the amount of NO was measured using a Greiss reaction. In addition, the cytotoxicity was confirmed using the MTT assay, and the results are shown in FIG. 3.
  • the PTP inhibitor can safely inhibit the activation of microglial cells because it safely reduces the amount of NO induced by LPS without cytotoxicity.
  • Encephalitis mouse models were prepared to determine whether PTP inhibitors inhibit microglial activation.
  • C57BL / 6 mice were injected cerebral with vehicle (saline containing 0.5% DMSO and 5% propylene glycol) or PTP inhibitors (dilution in saline containing 5% propylene glycol) in Table 2 above.
  • LPS (5 mg / kg) was injected intraperitoneally 30 minutes after infusion. Mice were sacrificed and brains were analyzed 48 hours after LPS injection.
  • Mouse models were divided into a total of eight experimental groups; Group 1 treated with saline and 0.5% DMSO; Group 2 treated with LPS and 0.5% DMSO; Group 3 treated with LPS and PTP1B inhibitors; Group 4 treated with LPS and TC-PTP inhibitors; Group 5 treated with LPS and SHP2 inhibitors; Group 6 treated with LPS and MEG2 inhibitors; Group 7 treated with LPS and LYP inhibitors; Group 8 treated with LPS and RPTP ⁇ inhibitors.
  • the experimental design as above is shown in Figure 4A.
  • 4B shows the histologically confirmed result of staining of the brain of the sacrificed mouse with an antibody against Iba-1, a marker of microglia.
  • the brain was removed and sectioned and stained with an antibody against Iba-1 for hippocampus, cortex and thalamus and histochemically confirmed.
  • the results are shown in FIG. 4C and the graph shows the number of Iba-1 positive cells per mm 2 .
  • the results are shown in FIG. 4D.
  • the PTP inhibitor has an effect of reducing activation of microglia under inflammatory conditions in vitro and in vivo.
  • PTP1B induces the expression of inflammatory cytokines in microglia, which indicates the overactivation of microglia, and thus, can be inferred that microglial cells are overactivated by PTP1B.
  • PTP1B inhibitor ((S) -4-(((S) -1- (l2-azanyl) -3- (4- (difluoro (phosphono) methyl) phenyl) -1) -Oxopropan-2-yl) amino) -3-((S) -3- (4- (difluoro (phosphono) methyl) phenyl) -2-pentadecanamidopropaneamido) -4-oxo Butanoic acid) Obtained from Zhang group and used.
  • the PTP1B inhibitor (hereinafter referred to as “iPTP1B”) used in the present invention has proved to be very specific for PTP1B.
  • BV2 microglia were pretreated with different concentrations of iPTP1B indicated and stimulated with LPS (100 ng / ml) after 1 hour, and NO levels were measured according to the Griess method in the treated cells.
  • LPS 100 ng / ml
  • NO levels were measured according to the Griess method in the treated cells.
  • MTT assay was performed 24 hours after iPTP1B treatment and the results are shown in FIG. 9.
  • iPTP1B alone did not inhibit or increase NO production and significantly inhibited NO levels induced by LPS. Thus, iPTP1B itself does not change the basic level of NO production.
  • iPTP1B the effect of iPTP1B on NO production was confirmed in mouse primary microglia. Specifically, primary microglia were pretreated with 5 ⁇ M of iPTP1B and then stimulated with LPS (50 ng / ml) for 24 hours. NO levels were confirmed in the stimulated primary microglia. In order to confirm the cytotoxicity of iPTP1B on primary microglia, MTT assay was performed 24 hours after iPTP1B treatment and the results are shown in FIG. 10.
  • HAPI cells rat microglia
  • LPS 100 ng / ml
  • iPTP1B 10 ⁇ M
  • NO levels were confirmed in HAPI cells, the stimulated rat microglia.
  • MTT assay was performed 24 hours after iPTP1B treatment and the results are shown in FIG. 11.
  • the rat microglia HAPI cells were stimulated with TNF ⁇ (100ng / ml) for 24 hours after pretreatment with 10 ⁇ M of iPTP1B for 1 hour. NO levels were confirmed in these stimulated cells.
  • MTT assay was performed 24 hours after iPTP1B treatment and the results are shown in FIG. 12.
  • BV2 microglia were treated with LPS (100 ng / ml) for 6 hours in the presence or absence of 10 ⁇ M of iPTP1B, and mRNA levels of iNOS, IL1 ⁇ , TNF ⁇ , Cox2, which are proinflammatory molecules, were RT in the treated cell samples. Confirmed by -PCR, the result is shown in FIG. In addition, the band strength obtained by RT-PCR is numerically shown in Figure 14 is shown in the graph.
  • iPBP1B significantly inhibits the production of LPS-induced cytokine and proinflammatory molecules (iNOS, IL1 ⁇ , TNF ⁇ , Cox2).
  • TNF ⁇ protein levels in BV2 microglia cultures treated with LPS as described above were confirmed by ELISA. Specifically, 24 hours after culturing BV2 cells in the presence or absence of iPTP1B with LPS, rat monoclonal anti-mouse TNF ⁇ antibodies as capture antibodies and goat biotinylated polyclonal anti-mouse TNF ⁇ antibodies as detection agents TNF ⁇ levels in the culture medium were measured. The results of the measured levels of TNF ⁇ protein are shown in FIG. 15.
  • PTP1B increased the neuroinflammatory response and was performed as follows to determine how PTP1B increases the LPS-induced inflammatory response.
  • Src kinases, tyrosine kinases were selected as targets of PTP1B among other known PTP1B substrates. The reason for this choice is that Src has a negative regulatory phosphorylation site (Y527). PTP1B can dephosphorylate the negative regulatory sites of Src, which induces Src kinase activity.
  • BV2 microglia were prepared by transfecting BV2 microglia with HA-PTP1B to overexpress PTP1B.
  • the band intensity was standardized and quantified by beta-actin, and the graph is shown in FIG. 16.
  • LPS-induced NO production levels were determined after BV2 treatment with Src kinase inhibitor PP2 (5 ⁇ M) or PDTC (Ammonium pyrrolidinedithiocarbamate (NF ⁇ b inhibitor)). It was. This is shown in FIG. 18.
  • BV2 microglia pretreated with Src inhibitor PP2 or iPTP1B for 1 hour were treated with LPS for 24 hours.
  • the levels of NO in the treated BV2 microglia were shown in FIG. 19.
  • the anti-inflammatory effect of iPTP1B was investigated.
  • PTP1B promotes the production of proinflammatory cytokines and activates Src through dephosphorylation of Y527. This activated Src activates NF ⁇ B and increases the expression of proinflammatory factors.
  • a schematic of this mechanism is briefly shown in FIG.
  • inflammatory stimuli increase PTP1B expression, induce microglial hyperactivation in the brain, and blocking inflammatory cell PTP1B activity in inflammatory conditions prevents microglial hyperactivation in vitro and in vivo. It can be seen that it is possible to effectively prevent or treat an inflammatory disease in.
  • the above ingredients are mixed and filled in an airtight cloth to prepare a powder.
  • tablets are prepared by tableting according to a conventional method for preparing tablets.
  • the above ingredients are mixed and filled into gelatin capsules to prepare tablets.
  • the amount of the above ingredient is prepared per ampoule (2 ml).
  • Purified water was added to adjust the total volume to 1,000 ml. According to the conventional method for preparing a liquid, the above components are mixed, and then filled into a brown bottle and sterilized to prepare a liquid.
  • Vitamin B6 0.5 mg
  • composition ratio of the above-mentioned vitamin and mineral mixtures is a composition that is relatively suitable for the health functional food
  • the composition is mixed in a preferred embodiment, but the compounding ratio may be arbitrarily modified, and the above ingredients are mixed according to a conventional health functional food manufacturing method. Then, it can be used for the manufacture of the nutraceutical composition (eg, nutrition candy, etc.) according to a conventional method.
  • the mixture was heated by stirring at 85 °C for about 1 hour, the resulting solution was filtered and obtained in a sterilized 2 L container, sealed and sterilized and then stored in a refrigerator. It is used for the manufacture of the health functional beverage composition of the invention.
  • composition ratio is a composition suitable for a preferred beverage in a preferred embodiment
  • the composition ratio may be arbitrarily modified according to regional and ethnic preferences such as demand hierarchy, demand country, use purpose.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Mycology (AREA)
  • Nutrition Science (AREA)
  • Engineering & Computer Science (AREA)
  • Food Science & Technology (AREA)
  • Polymers & Plastics (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The present invention relates to a pharmaceutical composition for the prevention or treatment of a neuroinflammatory disease, the composition containing a protein tyrosine phosphatase inhibitor. The protein tyrosine phosphatase inhibitor of the present invention inhibits activated microglia cells by decreasing the level of nitric oxide (NO) in microglia cells and reducing the expression of proinflammatory factors TNFα, IL1β, iNOS, and the like, and thus, can be favorably used in the prevention or treatment of a neuroinflammatory disease.

Description

단백질 타이로신 탈인산화효소 억제제를 포함하는 신경염증성 질환의 예방 또는 치료용 조성물A composition for the prevention or treatment of neuroinflammatory diseases comprising a protein tyrosine dephosphatase inhibitor
본 발명은 단백질 타이로신 탈인산화효소(protein tyrosine phosphatas) 억제제를 포함하는 신경염증성 질환의 예방 또는 치료용 약학적 조성물에 관한 것이다.The present invention relates to a pharmaceutical composition for the prevention or treatment of neuroinflammatory diseases, including protein tyrosine phosphatas inhibitors.
중추신경계는 신경세포와 신경교세포로 이루어져 있다. 신경교세포는 전체 뇌세포의 약 90%를 차지하며, 부피로는 뇌 전체의 약 50%를 차지하고 있다. 신경교세포는 다시 성상세포(astrocytes), 소교세포(microglia) 및 희소돌기아교세포(oligodendrocytes)의 세 종류로 분류할 수 있다. 이 중, 소교세포는 분화된 대식세포(specialized macrophage)의 일종으로, 뇌에 널리 분포한다. 소교세포는 조직 잔해 및 죽은 세포들을 삼키는 식세포로서 작용할 뿐 아니라 뇌의 생체방어활동에 참여하는 역할을 한다. The central nervous system consists of neurons and glial cells. Glial cells make up about 90% of all brain cells, and by volume they make up about 50% of the entire brain. Glial cells can be further classified into three types: astrocytes, microglia, and oligodendrocytes. Among these, microglia are a kind of specialized macrophage and are widely distributed in the brain. Microglia serve as a phagocytic cell that swallows tissue debris and dead cells, as well as participates in the bioprotective activity of the brain.
신경염증은 신경계의 면역 반응의 일종으로, 알츠하이머, 파킨슨병, 다발성경화증을 포함하는 많은 퇴행성 신경 질환과 매우 밀접하게 연관되어 있으며, 현재 퇴행성 신경 질환의 전형적 특징으로 생각되고 있다. 신경염증 반응은 선천성 면역 세포(소교세포)의 활성화, 염증 매개체 예컨대 산화질소(nitric oxide; NO), 사이토카인 및 케모카인의 방출, 대식세포 침윤을 포함하며, 이는 신경 세포 사멸을 유도한다. 소교세포 및 성상세포의 염증 활성화는 병리학적 마커 및 퇴행성 신경 질환의 진행에 있어 중요한 메커니즘으로 생각되어진다. 소교세포 활성의 엄격한 조절은 뇌 항상성을 유지하고 감염 및 염증 질환을 예방하는 데 필수적이다. Neuroinflammation is a type of immune response in the nervous system that is closely associated with many degenerative neurological disorders, including Alzheimer's, Parkinson's disease, and multiple sclerosis, and is currently considered a typical feature of degenerative neurological disease. Neuroinflammatory responses include activation of innate immune cells (microglia), release of inflammatory mediators such as nitric oxide (NO), cytokines and chemokines, and macrophage infiltration, which induce neuronal cell death. Inflammatory activation of microglia and astrocytes is thought to be an important mechanism in the pathological marker and progression of degenerative neurological diseases. Strict regulation of microglia activity is essential for maintaining brain homeostasis and preventing infectious and inflammatory diseases.
한편, 단백질 타이로신 탈인산화효소(protein tyrosine phosphatase, 이하 ‘PTP’라 한다)는 인산화된 단백질의 타이로신 잔기에서 인산기를 제거하는 효소 군이다. 단백질 타이로신 인산화는 흔하게 일어나는 번역 후 변형이며 단백질 상호작용을 위한 신규한 인식 모티프를 생성하고, 단백질 안정성에 영향을 주며 효소 활성을 조절한다. 따라서, 적절한 수준의 단백질 티로신 인산화를 유지하는 것은 세포 기능을 위해 필수적이다. 단백질 티로신 포스파타제로는 여러 종류의 단백질이 알려져 있다. 이 중, PTP1B(protein tyrosine phosphatase 1B)는 단백질 타이로신 탈인산화효소 중 하나로, 인슐린 및 렙틴 신호전달의 주요한 음성 조절자이다. PTP1B를 제거한 마우스 연구로부터 PTP1B가 인슐린을 감지하며 PTP1B 억제제가 당뇨병 보호 효과를 나타냄을 확인하였고, 많은 연구 결과에 의해서 PTP1B가 암과 연관되어있음이 증명되었지만 현재 단백질 타이로신 탈인산화효소와 신경 염증과의 관계에 대해서는 밝혀진 바가 거의 없다.Meanwhile, protein tyrosine phosphatase (hereinafter referred to as 'PTP') is a group of enzymes that remove phosphate groups from tyrosine residues of phosphorylated proteins. Protein tyrosine phosphorylation is a common post-translational modification that creates new recognition motifs for protein interactions, affects protein stability and modulates enzyme activity. Thus, maintaining adequate levels of protein tyrosine phosphorylation is essential for cellular function. Several types of proteins are known as protein tyrosine phosphatase. Among these, protein tyrosine phosphatase 1B (PTP1B) is one of protein tyrosine dephosphatase and is a major negative regulator of insulin and leptin signaling. Mouse studies with PTP1B removal confirmed that PTP1B senses insulin and that PTP1B inhibitors have a protective effect on diabetes. Many studies have shown that PTP1B is associated with cancer, but is currently associated with protein tyrosine dephosphatase and neuroinflammatory inflammation. Little is known about the relationship.
신경염증성 질환을 치료하기 위해 많은 연구가 시도되어 왔으나, 아직까지 광범위한 신경염증성 질환에 적용 가능하도록 그 효과가 명확히 검증되고 상용화된 물질이 개발되지 않았으므로 새로운 치료제에 대한 연구가 필요한 실정이다.Although many studies have been attempted to treat neuroinflammatory diseases, studies have yet to be made on new therapeutic agents because their effects have not been clearly demonstrated and commercialized to be applicable to a wide range of neuroinflammatory diseases.
이에 본 발명자들은 소교세포의 활성화 및 신경염증 반응을 다각적으로 저해함으로써 광범위한 신경염증성 질환을 근본적으로 치료할 수 있는 물질에 대한 연구를 계속한 결과, PTP 억제제가 신경염증을 억제하는 효과를 나타냄을 확인함으로써 본 발명을 완성하였다.Accordingly, the present inventors have continued to study substances that can fundamentally cure a wide range of neuroinflammatory diseases by inhibiting microglia activation and neuroinflammatory responses in various ways. As a result, the present inventors confirmed that PTP inhibitors have an effect of inhibiting neuroinflammatory inflammation. The present invention has been completed.
따라서, 본 발명의 목적은 PTP 억제제를 포함하는 신경염증성 질환의 예방 또는 치료용 약학적 조성물을 제공하는 것이다.Accordingly, it is an object of the present invention to provide a pharmaceutical composition for the prophylaxis or treatment of neuroinflammatory diseases comprising a PTP inhibitor.
본 발명의 또다른 목적은 PTP 억제제를 포함하는 신경염증성 질환의 개선용 식품 조성물을 제공하는 것이다.It is another object of the present invention to provide a food composition for improving neuroinflammatory diseases comprising a PTP inhibitor.
본 발명의 또다른 목적은 PTP 억제제를 개체에 투여하는 단계;를 포함하는 신경염증성 질환의 예방 또는 치료 방법을 제공하는 것이다.It is another object of the present invention to provide a method for preventing or treating a neuroinflammatory disease comprising administering to a subject a PTP inhibitor.
상기 목적을 달성하기 위하여, 본 발명은 PTP(protein tyrosine phosphatase) 억제제를 포함하는 신경염증성 질환의 예방 또는 치료용 약학적 조성물을 제공한다.In order to achieve the above object, the present invention provides a pharmaceutical composition for the prevention or treatment of neuroinflammatory diseases comprising a protein tyrosine phosphatase (PTP) inhibitor.
또한, 본 발명은 PTP 억제제를 포함하는 신경염증성 질환의 개선용 식품 조성물을 제공한다.In addition, the present invention provides a food composition for improving neuroinflammatory diseases comprising a PTP inhibitor.
또한, 본 발명은 PTP 억제제를 개체에 투여하는 단계;를 포함하는 신경염증성 질환의 예방 또는 치료 방법을 제공한다.The present invention also provides a method for preventing or treating a neuroinflammatory disease comprising administering a PTP inhibitor to a subject.
본 발명의 단백질 타이로신 탈인산화효소 억제제는 소교세포에서 산화질소(NO) 수준의 감소, 전염증성 인자인 TNFα, IL1β, iNOS 등의 발현의 감소를 통하여 활성화된 소교세포를 저해함으로써 신경염증성 질환의 예방 또는 치료에 유용하게 사용될 수 있다.The protein tyrosine dephosphatase inhibitor of the present invention prevents neuroinflammatory diseases by inhibiting activated microglial cells through reduction of nitric oxide (NO) levels in microglial cells, and reduction of expression of proinflammatory factors TNFα, IL1β, iNOS, etc. Or may be usefully used for treatment.
도 1은 마우스 뇌에서 LPS에 의한 PTP mRNA의 발현 수준 변화를 RT-PCR로 확인한 결과를 나타낸 도이다.1 is a diagram showing the results confirmed by RT-PCR changes in the expression level of PTP mRNA by LPS in the mouse brain.
도 2는 마우스 일차 소교세포 및 일차 성상세포에서 LPS에 의한 PTP mRNA의 발현 수준 변화를 RT-PCR로 확인한 결과를 나타낸 도이다.Figure 2 shows the results confirmed by RT-PCR changes in the expression level of PTP mRNA by LPS in mouse primary microglia and primary astrocytic cells.
도 3은 PTP 억제제가 소교세포주 BV2의 활성화를 억제하는지 여부와 세포독성 여부를 NO 생성 수준 측정 및 MTT 분석에 의해 확인한 결과를 나타낸 도이다.Figure 3 is a diagram showing the results confirmed by the NO production level measurement and MTT analysis whether PTP inhibitors inhibit the activation of microglial cell line BV2.
도 4는 PTP 억제제가 소교세포 활성화를 억제하는지 여부를 확인한 결과를 나타낸 도이다. 도 4A는 실험 디자인, 도 4B는 마우스의 뇌의 형태적 변화를 조직화학적으로 확인한 결과, 도 4C는 마우스의 해마, 피질, 시상에서 소교세포 마커인 Iba-1 양성 세포를 확인한 결과, 도 4D는 마우스의 해마, 피질, 시상에서 소교세포 마커인 Iba-1 양성 세포를 확인한 결과를 정량화한 그래프.4 is a diagram showing the results of confirming whether the PTP inhibitor inhibits microglial activation. 4A shows an experimental design, and FIG. 4B shows histological changes of morphological changes in the brain of the mouse. FIG. 4C shows Iba-1 positive cells as microglia markers in the hippocampus, cortex and thalamus of the mouse. A graph quantifying the results of identifying Iba-1 positive cells, microglia markers in the hippocampus, cortex and thalamus of mice.
도 5는 제조된 PTP1B를 과발현시키는 BV2 소교세포주(HA-PTP1B)에서 PTP1B의 발현 수준을 확인한 결과를 나타낸 도이다.5 is a diagram showing the results of confirming the expression level of PTP1B in the BV2 microglia (HA-PTP1B) overexpressing the prepared PTP1B.
도 6은 LPS로 자극한 소교세포주 BV2에서 NO 생성 수준을 측정한 결과를 LPS의 용량에 따라 나타낸 도이다.Figure 6 shows the results of measuring the NO production level in Lg-stimulated microglia cell line BV2 according to the dose of LPS.
도 7은 LPS로 자극한 소교세포주 BV2에서 NO 생성 수준을 측정한 결과를 시간에 따라 나타낸 도이다.Figure 7 is a diagram showing the results of measuring the NO production level in Lg-stimulated microglia cell line BV2 over time.
도 8은 PTP1B를 과발현시키는 BV2 소교세포주에서 염증성 사이토카인 mRNA의 발현 수준 변화를 real-time PCR로 확인한 결과를 나타낸 도이다. 8 is a diagram showing the results confirmed by real-time PCR the change in the expression level of inflammatory cytokine mRNA in BV2 microglial cell line overexpressing PTP1B.
도 9는 소교세포주 BV2에서 PTP1B 억제제(iPTP1B)의 처리에 따른 LPS-유도된 NO의 발현 수준 변화를 확인한 결과를 나타낸 도이다.9 is a diagram showing the results of confirming the change in the expression level of LPS-induced NO according to the treatment of the PTP1B inhibitor (iPTP1B) in the microglial cell line BV2.
도 10은 일차 소교세포에서 PTP1B 억제제(iPTP1B)의 처리에 따른 LPS-유도된 NO의 발현 수준 변화를 확인한 결과를 나타낸 도이다.10 is a diagram showing the results of confirming the change in the expression level of LPS-induced NO according to the treatment of PTP1B inhibitor (iPTP1B) in primary microglia.
도 11은 랫트 소교세포에서 PTP1B 억제제(iPTP1B)의 처리에 따른 LPS-유도된 NO의 발현 수준 변화를 확인한 결과를 나타낸 도이다.Figure 11 shows the results of confirming the change in the expression level of LPS-induced NO according to the treatment of PTP1B inhibitor (iPTP1B) in rat microglia.
도 12는 랫트 소교세포에서 PTP1B 억제제(iPTP1B)의 처리에 따른 TNFα-유도된 NO의 발현 수준 변화를 확인한 결과를 나타낸 도이다.12 is a diagram showing the results of confirming the change in the expression level of TNFα-induced NO according to the treatment of PTP1B inhibitor (iPTP1B) in rat microglia.
도 13은 소교세포주 BV2에서 PTP1B 억제제(iPTP1B)의 처리에 따른 전염증성 분자의 발현 수준 변화를 RT-PCR로 확인한 결과를 나타낸 도이다.Figure 13 is a diagram showing the results confirmed by RT-PCR change in the expression level of proinflammatory molecules according to the treatment of PTP1B inhibitor (iPTP1B) in microglial cell line BV2.
도 14는 소교세포주 BV2에서 PTP1B 억제제(iPTP1B)의 처리에 따른 전염증성 분자의 발현 수준 변화를 RT-PCR로 확인한 결과를 수치화하여 나타낸 도이다.Figure 14 is a diagram showing the numerical results of confirming the change in the expression level of pro-inflammatory molecules according to the treatment of PTP1B inhibitor (iPTP1B) in microglia cell line BV2 by RT-PCR.
도 15는 소교세포주 BV2에서 PTP1B 억제제(iPTP1B)의 처리에 따른 TNFα 단백질의 발현 수준 변화를 ELISA를 통해 확인한 결과를 나타낸 도이다.15 is a diagram showing the results of confirming the change in the expression level of TNFα protein according to the treatment of the PTP1B inhibitor (iPTP1B) in microglia cell line BV2 by ELISA.
도 16은 소교세포주 BV2에서 PTP1B에 의해 Src Y527 위치의 인산화가 감소함을 확인한 도이다.16 shows that phosphorylation of the Src Y527 position is reduced by PTP1B in the microglial cell line BV2.
도 17은 PTP1B를 과발현시키는 소교세포주에서 LPS에 의해 유도된 NO 수준이 증가함을 확인한 도이다.17 is a diagram confirming the increase of NO levels induced by LPS in microglial cell lines overexpressing PTP1B.
도 18은 소교세포에서 Src 키나제 억제제에 의해서 LPS에 의해 유도된 NO 수준이 감소함을 확인한 도이다.18 is a diagram confirming the decrease of NO levels induced by LPS by Src kinase inhibitors in microglia.
도 19는 Src 키나제 억제제의 처리가 PTP1B 억제제의 항염증 효과를 제거함을 확인한 결과를 나타낸 도이다.19 shows the results confirming that the treatment of the Src kinase inhibitor eliminates the anti-inflammatory effect of the PTP1B inhibitor.
도 20은 PTP1B 억제제가 Src Y527 위치의 인산화를 증가시킴을 확인한 결과를 나타낸 도이다.20 is a diagram showing the results confirming that the PTP1B inhibitor increases the phosphorylation of the Src Y527 position.
도 21은 PTP1B가 신경염증에 관여하는 메커니즘을 간략하게 나타낸 도이다.Figure 21 is a simplified diagram illustrating the mechanism by which PTP1B is involved in neuroinflammatory.
도 22는 생체내에서 PTP1B 억제제의 신경염증 완화 효과를 확인하기 위한 실험 설계를 나타낸 도이다.22 is a diagram showing an experimental design for confirming the neuroinflammatory mitigation effect of the PTP1B inhibitor in vivo.
도 23은 생체내에서 PTP1B 억제제가 TNFα 및 IL1β의 발현을 억제시킴을 real-time PCR로 확인한 결과를 나타낸 도이다.Figure 23 shows the results confirmed by real-time PCR that PTP1B inhibitors inhibit the expression of TNFα and IL1β in vivo.
이하 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail.
본 발명은 PTP 억제제를 포함하는 신경염증성 질환의 예방 또는 치료용 약학적 조성물을 제공한다.The present invention provides a pharmaceutical composition for the prophylaxis or treatment of neuroinflammatory diseases comprising a PTP inhibitor.
본 발명에서 "PTP 억제제(protein tyrosine phosphatase inhibitor)"는 PTP1B(Protein tyrosine phosphatase type 1B), TC-PTP(T-cell phosphatase), SHP2(Src homology domain2-containing PTP2), MEG2(Megakaryocyte-PTP2), LYP(Lymphoid specific-tyrosine phosphatase) 및 RPTPβ(Receptor-type tyrosine protein phosphatase beta)로 구성된 군으로부터 선택된 1종 이상의 PTP에 대한 억제제를 포함하나, 이에 제한되는 것은 아니다."PTP inhibitor (protein tyrosine phosphatase inhibitor)" in the present invention is protein tyrosine phosphatase type 1B (PTP1B), TC-PTP (T-cell phosphatase), SHP2 (Src homology domain2-containing PTP2), MEG2 (Megakaryocyte-PTP2), Including but not limited to inhibitors for at least one PTP selected from the group consisting of Lymphoid specific-tyrosine phosphatase (LYP) and Receptor-type tyrosine protein phosphatase beta (RPTPβ).
상기 PTP 억제제는 하기 표에 기재된 화합물 또는 이의 약학적으로 허용가능한 염을 포함하나, 이에 제한되는 것은 아니다.The PTP inhibitors include, but are not limited to, the compounds listed in the table below or pharmaceutically acceptable salts thereof.
Figure PCTKR2016012746-appb-I000001
Figure PCTKR2016012746-appb-I000001
상기 표의 화합물 중 일부는 종래 논문 Cellular Effects of Small Molecule PTP1B Inhibitors on Insulin Signaling(Biochemistry 2003, 42, 12792-12804)에 개시된 것으로, 신경염증을 억제하는 활성 및 이에 따라 신경염증성 질환의 예방 또는 치료에 이용될 수 있다는 사실에 대해서는 밝혀진 바가 없다. Some of the compounds in the table are disclosed in the conventional paper Cellular Effects of Small Molecule PTP1B Inhibitors on Insulin Signaling (Biochemistry 2003, 42, 12792-12804), which are used for the prevention of neuroinflammatory activity and thus for the prevention or treatment of neuroinflammatory diseases. It is not known that it can be.
본 발명에서 상기 "약학적으로 허용가능한 염"이란 상기 화합물과 부가염을 형성한 것이라면 한정되지 않으며, 약학적으로 허용가능한 무기산, 유기산, 또는 염기로부터 유도된 염을 포함한다. 적합한 산 부가염의 예로는 황산, 염산, 질산, 인산, 브롬산, 과염소산, 요오드화수소산 등과 같은 무기산; 옥살산, 구연산, 숙신산, 타타르산, 포름산, 아세트산, 트리클로로아세트산, 트리플루오로아세트산, 글리콜산, 벤조산, 락트산, 푸마르산, 말레산, 살리실산 등과 같은 유기 카본산; 메탄설폰산, 에탄설폰산, 벤젠설폰산, 톨루엔-p-설폰산, 나프탈렌-2-설폰산 등과 같은 설폰산 등에 의해 형성된 산 부가염을 포함한다. 적합한 염기 부가염의 예로는, 리튬, 나트륨, 칼륨, 칼슘, 마그네슘 등에 의해 형성된 알칼리 금속 또는 알칼리토금속 염; 라이신, 아르기닌, 구아니딘 등의 아미노산 염; 디사이클로헥실아민, N-메틸-D-글루카민, 트리스(하이드록시메틸)메틸아민, 디에탄올아민, 콜린, 트리에틸아민 등과 같은 유기염 등에 의해 형성된 염기 부가염을 포함한다.In the present invention, the "pharmaceutically acceptable salt" is not limited as long as it forms an addition salt with the compound, and includes salts derived from pharmaceutically acceptable inorganic acids, organic acids, or bases. Examples of suitable acid addition salts include inorganic acids such as sulfuric acid, hydrochloric acid, nitric acid, phosphoric acid, bromic acid, perchloric acid, hydroiodic acid and the like; Organic carbon acids such as oxalic acid, citric acid, succinic acid, tartaric acid, formic acid, acetic acid, trichloroacetic acid, trifluoroacetic acid, glycolic acid, benzoic acid, lactic acid, fumaric acid, maleic acid, salicylic acid, and the like; Acid addition salts formed by sulfonic acids such as methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid, toluene-p-sulfonic acid, naphthalene-2-sulfonic acid and the like. Examples of suitable base addition salts include alkali metal or alkaline earth metal salts formed by lithium, sodium, potassium, calcium, magnesium, and the like; Amino acid salts such as lysine, arginine and guanidine; Base addition salts formed by organic salts such as dicyclohexylamine, N-methyl-D-glucamine, tris (hydroxymethyl) methylamine, diethanolamine, choline, triethylamine and the like.
본 발명에 따른 PTP1B 억제제 및 화학식 1의 화합물은 통상적인 방법에 의해 그의 염으로 전환될 수 있으며, 염의 제조는 별도의 설명이 없이도 상기 화합물의 구조를 바탕으로 당업자에 의해 용이하게 수행될 수 있다.The PTP1B inhibitor and the compound of formula 1 according to the present invention can be converted to their salts by conventional methods, and the preparation of the salts can be easily carried out by those skilled in the art based on the structure of the compound without further explanation.
본 발명에서 상기 "신경염증성 질환"은 신경계의 염증에 의하여 발생하는 질환이라면 제한 없이 포함할 수 있으며, 예컨대 다발성 경화증, 신경모세포종, 뇌졸중, 알츠하이머 병, 파킨슨 병, 루게릭 병, 헌팅턴 병, 크로이츠펠트야콥병, 외상 후 스트레스 장애, 우울증, 정신분열증, 및 근위축성측색경화증을 포함하나, 이에 제한되지 않는다. In the present invention, the "neuroinflammatory disease" may include without limitation any disease caused by inflammation of the nervous system, for example, multiple sclerosis, neuroblastoma, stroke, Alzheimer's disease, Parkinson's disease, Lou Gehrig's disease, Huntington's disease, Creutzfeldt-Jakob disease , Post traumatic stress disorder, depression, schizophrenia, and amyotrophic lateral sclerosis.
본 발명에서 용어 "예방"은 신경염증성 질환 또는 질병을 보유하고 있다고 진단된 적은 없으나, 이러한 질환 또는 질병에 걸리기 쉬운 경향이 있는 개체에서 질환 또는 질병의 발생을 억제하는 것을 의미한다. 또한 본 발명에서 용어 "치료"라 함은 신경염증성 질환 또는 질병의 발전의 억제, 질환 또는 질병의 경감, 및 질환 또는 질병의 제거를 의미한다.In the present invention, the term "prevention" means to inhibit the occurrence of a disease or a disease in an individual who has not been diagnosed as having a neuroinflammatory disease or a disease, but is prone to such a disease or a disease. The term "treatment" in the present invention also means the inhibition of the development of a neuroinflammatory disease or disease, the alleviation of the disease or disease, and the elimination of the disease or disease.
본 발명의 구체적인 실시예에서 PTP 억제제는 LPS(리포폴리사카라이드)에 의해서 유도된 염증 조건 하에서 소교세포의 활성화를 감소시키며, 염증성 사이토카인인 TNFα, IL1β, iNOS의 분비를 감소시키고, 산화질소(NO)의 생성 또한 감소시키는 것을 확인하였다. 따라서 PTP 억제제를 유효성분으로 포함하는 약학적 조성물은 항염증 효과 및 소교세포의 활성화를 감소시켜 신경염증성 질환의 예방 또는 치료에 유용하게 사용될 수 있음을 확인하였다.In a specific embodiment of the present invention, PTP inhibitors reduce the activation of microglia under inflammatory conditions induced by LPS (lipopolysaccharide), reduce the secretion of inflammatory cytokines TNFα, IL1β, iNOS, and reduce nitric oxide ( It was confirmed that the production of NO) was also reduced. Therefore, it was confirmed that the pharmaceutical composition including the PTP inhibitor as an active ingredient may be useful for the prevention or treatment of neuroinflammatory diseases by reducing the anti-inflammatory effect and the activation of microglia.
본 발명의 구체적인 실시예에서는 PTP 억제제의 신경염증 억제 효과를 시험관내 및 생체내 실험을 통하여 검증하였다. In a specific embodiment of the present invention, the neuroinflammatory inhibitory effect of the PTP inhibitor was verified through in vitro and in vivo experiments.
본 발명의 구체적인 실시예에서는 PTP1B가 전염증성 사이토카인의 생성을 촉진하며, Src의 Y527 위치의 탈인산화를 통해서 Src를 활성화시키고 이처럼 활성화된 Src가 NFκB 또한 활성화시켜 전염증성 인자의 발현을 증가시킴을 확인하였다. 이러한 결과로부터 PTP1B의 억제제가 신경염증성 질환의 예방 또는 치료용 조성물의 유효성분으로서 유용하게 사용될 수 있음을 확인하였다. In a specific embodiment of the present invention, PTP1B promotes the production of proinflammatory cytokines, activates Src through dephosphorylation of the Y527 position of Src, and this activated Src also activates NFκB to increase the expression of proinflammatory factors. Confirmed. From these results, it was confirmed that the inhibitor of PTP1B can be usefully used as an active ingredient of a composition for preventing or treating neuroinflammatory diseases.
또한, 본 발명의 약학적 조성물은 약학적으로 허용 가능한 담체를 추가로 포함할 수 있다. 본 발명에서 용어, "약학적으로 허용가능한 담체"란 생물체를 상당히 자극하지 않고 투여 화합물의 생물학적 활성 및 특성을 저해하지 않는 담체 또는 희석제를 말한다. 약학적으로 허용되는 담체로는 예를 들면, 락토스, 전분, 셀룰로스 유도체, 마그네슘 스테아레이트, 스테아르산 등과 같은 경구 투여용 담체, 및 물, 적합한 오일, 식염수, 수성 글루코스 및 글리콜 등과 같은 비경구 투여용 담체 등이 있다. 이러한 약학적으로 허용 가능한 담체는 식염수, 멸균수, 링거액, 완충 식염수, 덱스트로즈 용액, 말토 덱스트린 용액, 글리세롤, 에탄올 및 이들 성분 중 1 성분 또는 1 성분 이상을 혼합하여 사용할 수 있으며, 필요에 따라 안정화제, 보존제, 항산화제, 완충액 및 정균제 등 다른 통상의 첨가제를 첨가할 수 있다. In addition, the pharmaceutical composition of the present invention may further include a pharmaceutically acceptable carrier. As used herein, the term "pharmaceutically acceptable carrier" refers to a carrier or diluent that does not significantly irritate an organism and does not inhibit the biological activity and properties of the administered compound. Pharmaceutically acceptable carriers include, for example, oral carriers such as lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, and the like for parenteral administration such as water, suitable oils, saline, aqueous glucose and glycols, and the like. Carrier and the like. Such pharmaceutically acceptable carriers may be used in combination with saline, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol and one or more of these components, as necessary. Other conventional additives such as stabilizers, preservatives, antioxidants, buffers and bacteriostatic agents can be added.
또한, 본 발명의 약학적 조성물은 공지의 방법에 따라 다양한 비경구 또는 경구 투여용 형태로 제조될 수 있다. 비경구 투여용 제형의 대표적인 것으로는 주사용 제형으로는 등장성 수용액 또는 현탁액 등이 있으며, 적합한 분산제 또는 습윤제 및 현탁화제를 사용하여 당업계에 공지된 기술에 따라 제조할 수 있다. 예를 들면, 각 성분을 식염수 또는 완충액에 용해시켜 주사용으로 제형화 할 수 있다. 또한, 경구 투여용 제형으로는 이에 한정되지는 않으나, 분말, 과립, 정제, 환약, 에멀젼, 시럽 및 캡슐 등이 있다.In addition, the pharmaceutical compositions of the present invention may be prepared in various parenteral or oral administration forms according to known methods. Representative formulations for parenteral administration include isotonic aqueous solutions or suspensions, and can be prepared according to techniques known in the art using suitable dispersing or wetting agents and suspending agents. For example, each component may be formulated for injection by dissolving in saline or buffer. In addition, oral dosage forms include, but are not limited to, powders, granules, tablets, pills, emulsions, syrups and capsules.
또한, 본 발명은 PTP 억제제를 개체에 투여하는 단계;를 포함하는 신경염증성 질환의 예방 또는 치료 방법을 제공한다.The present invention also provides a method for preventing or treating a neuroinflammatory disease comprising administering a PTP inhibitor to a subject.
본 발명에서 용어 "투여"는 어떠한 적절한 방법으로 질환의 치료를 필요로하는 개체에게 본 발명의 약학적 조성물을 도입하는 것을 의미하며, 본 발명의 조성물의 투여 경로는 목적 조직에 도달할 수 있는 한 경구 또는 비경구의 다양한 경로를 통하여 투여될 수 있다. As used herein, the term "administration" refers to the introduction of the pharmaceutical composition of the present invention to an individual in need of treatment of the disease in any suitable manner, and the route of administration of the composition of the present invention can reach the target tissue as long as it can Administration can be via oral or parenteral routes.
상기 투여 대상인 개체는 쥐, 생쥐, 가축, 인간 등의 포유동물이 될 수 있으며, 경구, 경피, 피하, 정맥, 또는 대뇌내 주사를 포함한 여러 경로를 통해 투여될 수 있다. The subject to be administered may be a mammal such as a mouse, mouse, livestock, human, etc., and may be administered through various routes including oral, transdermal, subcutaneous, intravenous, or intracranial injection.
본 발명의 예방 또는 치료 방법은 PTP 억제제 또는 이의 약학적으로 허용가능한 염을 약학적 유효량으로 투여하는 것을 포함한다. 적합한 총 1일 사용량은 올바른 의학적 판단범위 내에서 처치의에 의해 결정될 수 있다는 것은 당업자에게 자명한 일이다. 본 발명의 목적상, 특정 환자에 대한 구체적인 치료적 유효량은 달성하고자 하는 반응의 종류와 정도, 경우에 따라 다른 제제가 사용되는지의 여부를 비롯한 구체적 조성물, 환자의 연령, 체중, 일반 건강 상태,성별 및 식이, 투여 시간, 투여 경로 및 조성물의 분비율, 치료 기간, 구체적 조성물과 함께 사용되거나 동시 사용되는 약물을 비롯한 다양한 인자와 의약 분야에 잘 알려진 유사 인자에 따라 다르게 적용하는 것이 바람직하다.The prophylactic or therapeutic method of the present invention comprises administering a PTP inhibitor or a pharmaceutically acceptable salt thereof in a pharmaceutically effective amount. It will be apparent to those skilled in the art that a suitable total daily dose may be determined by the practitioner within the correct medical judgment. For the purposes of the present invention, the specific therapeutically effective amount for a particular patient is determined by the specific composition, including the type and extent of the reaction to be achieved and whether other agents are used, as appropriate, the age, body weight, general health status, sex of the patient. And various factors and similar factors well known in the medicinal art, including diet, time of administration, route of administration and rate of composition, duration of treatment, drugs used with or concurrent with the specific composition.
또한, 본 발명은 PTP 억제제를 포함하는 신경염증성 질환의 개선용 식품 조성물을 제공한다.In addition, the present invention provides a food composition for improving neuroinflammatory diseases comprising a PTP inhibitor.
본 발명에서 용어 "식품"은 영양소를 한 가지 또는 그 이상 함유하고 있는 천연물 또는 가공품을 의미하며, 바람직하게는 어느 정도의 가공 공정을 거쳐 직접 먹을 수 있는 상태가 된 것을 의미하며, 통상적인 의미로서, 각종 식품, 건강기능 식품, 음료, 식품 첨가제 및 음료 첨가제를 모두 포함하는 의미로 사용된다.In the present invention, the term "food" means a natural product or processed product containing one or more nutrients, and preferably means a state in which it can be directly eaten through some processing process, It is used to mean all kinds of foods, health foods, beverages, food additives and beverage additives.
본 발명의 식품 조성물은 각종 식품류, 캔디, 초콜릿, 음료, 껌, 차, 비타민 복합체, 각종 건강보조 식품류 등에 첨가될 수 있으며, 분말, 과립, 정제, 환제, 캡슐 또는 음료의 형태로 사용될 수 있다.The food composition of the present invention may be added to various foods, candy, chocolate, beverages, gums, teas, vitamin complexes, various health supplements, and the like, and may be used in the form of powders, granules, tablets, pills, capsules, or beverages.
또한 상기 본 발명의 식품 조성물은 식품학적으로 허용되는 담체를 추가로 포함할 수 있다. 본 발명의 PTP 억제제 또는 이의 식품학적으로 허용 가능한 염을 함유하는 이외에는 특별한 제한이 없으며, 예를 들어, 여러 가지 향미제 또는 천연 탄수화물 등을 추가로 함유할 수 있다. 또한 본 발명의 식품 조성물은 식품 제조 시에 통상적으로 첨가되는 성분을 포함하며, 예를 들어 단백질, 탄수화물, 지방, 영양소 및 조미제를 포함할 수 있다. 이 외에도 여러 가지 영양제, 비타민, 광물, 합성 풍미제 및 천연 풍미제 등의 풍미제, 착색제, 증진제, 팩트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알코올, 탄산음료에 사용되는 탄산화제 등을 함유할 수 있다.In addition, the food composition of the present invention may further include a food acceptable carrier. There is no special limitation except for containing the PTP inhibitor of the present invention or a food-acceptable salt thereof, and for example, it may further contain various flavors or natural carbohydrates. In addition, the food composition of the present invention includes ingredients that are commonly added during food production, and may include, for example, proteins, carbohydrates, fats, nutrients and seasonings. In addition, various nutrients, vitamins, minerals, flavors such as synthetic and natural flavors, colorants, enhancers, fact acids and salts thereof, alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH regulators, stabilizers, Preservatives, glycerin, alcohols, carbonation agents used in carbonated drinks, and the like.
또한, 상기 식품에 있어서, 상기 PTP 억제제 또는 이의 염의 양은 전체 식품 중량의 0.00001 중량% 내지 50 중량%로 포함될 수 있으며, 상기 식품이 음료인 경우에는 식품 전체의 부피 100 ml 를 기준으로 0.001 g 내지 50 g, 바람직하게는 0.01 g 내지 10 g의 비율로 포함될 수 있으나, 이에 한정되는 것은 아니다.In addition, in the food, the amount of the PTP inhibitor or salt thereof may be included as 0.00001% to 50% by weight of the total weight of the food, if the food is a beverage based on the volume of 100 ml of the entire food 0.001 g to 50 g, preferably 0.01 g to 10 g, but is not limited thereto.
본 명세서에서 달리 정의되지 않은 용어들은 본 발명이 속하는 기술분야에서 통상적으로 사용되는 의미를 갖는 것이다.Terms not defined otherwise in this specification are intended to have a meaning commonly used in the art to which the present invention pertains.
이하, 본 발명을 실시예, 제제예에 의해 상세히 설명한다. 단, 하기 실시예, 제제예는 본 발명을 예시하는 것일 뿐 본 발명의 내용이 하기 실시예, 제제예에 한정되는 것은 아니다.Hereinafter, the present invention will be described in detail by way of examples and preparation examples. However, the following Examples and Formulation Examples are merely illustrative of the present invention, and the contents of the present invention are not limited to the following Examples and Formulation Examples.
실시예 1. 염증 조건 하에서 PTP의 발현 변화 확인Example 1 Confirmation of Changes in Expression of PTP Under Inflammatory Conditions
염증 조건이 마우스 뇌에서 PTP의 발현을 조절하는지 확인하기 위해서 감염 동물 모델로, 하기와 같이 LPS를 주사한 마우스를 제조하였다.In order to confirm whether the inflammatory condition regulates the expression of PTP in the mouse brain, mice injected with LPS were prepared as follows in an infected animal model.
1-1. 신경염증 마우스 모델의 제조1-1. Preparation of Neuroinflammatory Mouse Model
마우스에 신경염증을 유발하기 위해서 LPS(Lipopolysaccharid)를 복강내 투여하였다. 모든 실험은 Koatech (평택시, 한국)에서 공급받은 9-11주령 수컷 C57BL/6 마우스(25-30g)를 사용하였고, 마우스에 LPS를 5 mg/kg으로 복강내 주입하여 신경염증 마우스 모델을 제조하였다. 대조군에는 비히클(vehicle)을 주입하였다.LPS (Lipopolysaccharid) was administered intraperitoneally to induce neuroinflammatory in mice. All experiments were performed using 9-11 week-old male C57BL / 6 mice (25-30 g) supplied by Koatech (Pyeongtaek, Korea), and a mouse model was prepared by intraperitoneally injecting LPS at 5 mg / kg. . The control group was injected with a vehicle.
1-2. 염증 조건 하의 마우스 뇌에서 PTP의 발현 확인1-2. Expression of PTP in Mouse Brain Under Inflammatory Conditions
염증 조건 하에서 마우스 뇌에서 PTP의 역할을 확인하기 위해서, 상기 실시예 1-1과 같이 LPS를 주입하고 48시간 후에 수집한 뇌 시료에서 PTP1B, TC-PTP, SHP2, MEG2, LYP, 및 RPTPβ의 mRNA 발현 수준을 RT-PCR로 확인하였다. 하기 표 1에 사용한 프라이머를 나타내었고, 확인 결과를 도 1에 나타내었다.To confirm the role of PTP in mouse brain under inflammatory conditions, mRNA of PTP1B, TC-PTP, SHP2, MEG2, LYP, and RPTPβ in brain samples collected 48 hours after injecting LPS as in Example 1-1 above Expression levels were confirmed by RT-PCR. The primers used in Table 1 are shown, and the results are shown in FIG. 1.
타겟 유전자Target genes 번호(Accession number)Access number 정방향 프라이머(5’->3’)Forward primer (5 '-> 3') 서열번호SEQ ID NO: 역방향 프라이머(5’->3’)Reverse primer (5 '-> 3') 서열번호SEQ ID NO:
PTP1BPTP1B NM_011201.3NM_011201.3 AAGACCCATCTTCCGTGGAC AAGACCCATCTTCCGTGGAC 1One ACAGACGCCTGAGCACTTTGACAGACGCCTGAGCACTTTG 22
TC-PTPTC-PTP NM_008977.3NM_008977.3 GCTGGCAGCCGTTATACTTG GCTGGCAGCCGTTATACTTG 33 TGGCCAGGTGGTATAATGGA TGGCCAGGTGGTATAATGGA 44
SHP2SHP2 NM_011202.3NM_011202.3 TGGTTTCACCCCAACATC TGGTTTCACCCCAACATC 55 CGTGGGTCACTTTGGACTTG CGTGGGTCACTTTGGACTTG 66
MEG2MEG2 NM_019651.2NM_019651.2 CCTGGAATGTGGCTGTCAAGCCTGGAATGTGGCTGTCAAG 77 ATGCTCCCTTCAGCAGGTTT ATGCTCCCTTCAGCAGGTTT 88
LYPLYP NM_008979.2NM_008979.2 TTCCTGAACAAAGCCTCACG TTCCTGAACAAAGCCTCACG 99 GGGAGTTGATTTGGTCCGTT GGGAGTTGATTTGGTCCGTT 1010
RPTPβRPTPβ NM_001311064.1NM_001311064.1 AGATCAAGGGTGGGCATT AGATCAAGGGTGGGCATT 1111 ATGGGACTATCCGGATTTGGATGGGACTATCCGGATTTGG 1212
GAPDHGAPDH NM_008084NM_008084 ACCACAGTCCATGCCATCACACCACAGTCCATGCCATCAC 1313 TCCACCACCCTGTTGCTGTATCCACCACCCTGTTGCTGTA 1414
도 1에 나타낸 바와 같이, LPS를 주입하여 염증을 유도한 마우스의 뇌에서 PTP1B, TC-PTP, SHP2 및 LYP 의 mRNA 발현이 증가하는 것을 확인하였고, 특히 PTP1B, SHP2 및 LYP의 발현이 유의적으로 증가하는 것을 확인하였다.As shown in Figure 1, it was confirmed that the mRNA expression of PTP1B, TC-PTP, SHP2 and LYP increased in the brain of mice induced by LPS injection, especially the expression of PTP1B, SHP2 and LYP significantly It was confirmed to increase.
따라서, LPS의 주입에 의해 염증이 유발된 마우스의 뇌에서 PTP의 발현이 증가하므로 PTP가 뇌의 염증과 상관관계가 있음을 알 수 있다.Therefore, it can be seen that PTP is correlated with inflammation of the brain because the expression of PTP is increased in the brain of mice induced by LPS.
1-3. 염증 조건 1-3. Inflammatory conditions 하 의pants 마우스 일차 소교세포 및 일차  Mouse primary microglia and primary 성상세포에서In astrocytes PTP의Of PTP 발현 확인 Expression confirmation
소교세포는 중추신경계에 존재하는 면역 세포이고 염증 자극으로부터 발생하는 염증 반응의 시작과 진행에 있어 역할을 수행하므로, RT-PCR 방법으로 마우스에서 분리한 일차 소교세포 및 일차 성상세포에서 LPS에 의한 PTP의 발현 수준 변화를 확인하였다. Microglial cells are immune cells present in the central nervous system and play a role in the initiation and progression of inflammatory responses resulting from inflammatory stimuli. The expression level change of was confirmed.
구체적으로, 마우스 일차 소교세포에 100 ng/ml로 LPS를 처리하고 마우스 일차 성상세포에 LPS와 IFN-γ(10 U/ml)을 처리하여 염증 반응을 일으켰다. 상기 처리를 하고 24시간 후에 일차 소교세포와 일차 성상세포에서 PTP1B, TC-PTP, SHP2, MEG2, LYP, 및 RPTPβ의 mRNA 수준을 RT-PCR을 통해 확인하였다. 확인 결과를 도 2에 나타내었다. Specifically, the mouse primary microglia treated with LPS at 100 ng / ml and the mouse primary astrocytes treated with LPS and IFN-γ (10 U / ml) to cause an inflammatory response. 24 hours after the treatment, mRNA levels of PTP1B, TC-PTP, SHP2, MEG2, LYP, and RPTPβ in primary microglia and primary astrocytic cells were confirmed by RT-PCR. The confirmation result is shown in FIG.
도 2에 나타낸 바와 같이, PTP1B, TC-PTP 및 LYP의 mRNA 발현이 증가함을 확인하였다.As shown in Figure 2, it was confirmed that the mRNA expression of PTP1B, TC-PTP and LYP increased.
따라서, LPS의 주입에 의해 유발된 염증 조건 하의 신경교세포에서 PTP의 발현이 증가하므로 PTP가 뇌의 염증과 연관되어있음을 알 수 있다.Therefore, the expression of PTP is increased in glial cells under the inflammatory conditions induced by the injection of LPS, it can be seen that PTP is associated with brain inflammation.
실시예 2. PTP 억제제의 소교세포 활성화 억제 확인Example 2 Confirmation of Inhibition of Microglial Activation of PTP Inhibitor
활성화된 소교세포는 NO와 같은 신경독성 인자를 분비함으로써 신경염증 반응을 유발하므로, NO의 생성은 소교세포 내 염증반응의 강력한 표지이다. PTP 억제제가 소교세포 활성화를 억제하는지 여부를 확인하기 위해서, 하기 표 2에 기재된 PTP 억제제를 사용하였다.Since activated microglial cells induce a neuroinflammatory response by secreting neurotoxic factors such as NO, production of NO is a powerful marker of inflammatory responses in microglial cells. In order to confirm whether the PTP inhibitor inhibits microglial activation, the PTP inhibitor described in Table 2 below was used.
화합물 명칭Compound name 타겟 PTPTarget PTP
(S)-4-(((S)-1-(l2-아자닐)-3-(4-(디플루오로(포스포노)메틸)페닐)-1-옥소프로판-2-일)아미노)-3-((S)-3-(4-(디플루오로(포스포노)메틸)페닐)-2-펜타데칸아미도프로판아미도)-4-옥소부탄산(S) -4-(((S) -1- (l2-azanyl) -3- (4- (difluoro (phosphono) methyl) phenyl) -1-oxopropan-2-yl) amino) -3-((S) -3- (4- (difluoro (phosphono) methyl) phenyl) -2-pentadecanamidopropaneamido) -4-oxobutanoic acid PTP1BPTP1B
((4-((S)-3-(((S)-1-아미노-6-(4-에틸벤즈아미도)-1-옥소헥산-2-일)아미노)-2-((S)-2-(2-(((1R,2R,5S)-2-이소프로필-5-메틸사이클로헥실)옥시)아세트아미도)-3-페닐프로판아미도)-3-옥소프로필)페닐)디플루오로메틸)포스폰산((4-((S) -3-(((S) -1-amino-6- (4-ethylbenzamido) -1-oxohexan-2-yl) amino) -2-((S) -2- (2-(((1R, 2R, 5S) -2-isopropyl-5-methylcyclohexyl) oxy) acetamido) -3-phenylpropaneamido) -3-oxopropyl) phenyl) di Fluoromethyl) phosphonic acid TC-PTPTC-PTP
((4-((S)-3-(((S)-1-(((S)-1-아미노-3-(2-(4-히드록시-3-메톡시페닐)아세트아미도)-1-옥소프로판-2-일)아미노)-5-(3-아이도오벤즈아미도)-1-옥소펜탄-2-일)아미노)-6-히드록시-3-아이오도-1-메틸-2-(3-(2-옥소-2-((4-(티오펜-3-일)페닐)아미노)아세트아미도)페닐)-1H-인돌-5-카복시산((4-((S) -3-(((S) -1-(((S) -1-amino-3- (2- (4-hydroxy-3-methoxyphenyl) acetamido) -1-oxopropan-2-yl) amino) -5- (3-idodobenzamido) -1-oxopentan-2-yl) amino) -6-hydroxy-3-iodo-1- Methyl-2- (3- (2-oxo-2-((4- (thiophen-3-yl) phenyl) amino) acetamido) phenyl) -1H-indole-5-carboxylic acid SHP2SHP2
((4-((S)-3-(((S)-1-(((S)-1-아미노-3-(2-(4-히드록시-3-메톡시페닐)아세트아미도)-1-옥소프로판-2-일)아미노)-5-(3-아이오도벤즈아미도)-1-옥소펜탄-2-일)아미노)-2-(3-브로모-4-메틸벤즈아미도)-3-옥소프로필)페닐)디플루오로메틸)포스폰산((4-((S) -3-(((S) -1-(((S) -1-amino-3- (2- (4-hydroxy-3-methoxyphenyl) acetamido) -1-oxopropan-2-yl) amino) -5- (3-iodobenzamido) -1-oxopentan-2-yl) amino) -2- (3-bromo-4-methylbenzami Figure 3--3-oxopropyl) phenyl) difluoromethyl) phosphonic acid MEG2MEG2
3-((3-클로로페닐)에티닐)-2-(4-(2-(사이클로프로필아미노)-2-옥소에톡시)페닐)-6-히드록시벤조퓨란-5-카복시산3-((3-chlorophenyl) ethynyl) -2- (4- (2- (cyclopropylamino) -2-oxoethoxy) phenyl) -6-hydroxybenzofuran-5-carboxylic acid LYP LYP
2-(3-(2-(3-브로모-5-아이오도벤즈아미도)아세트아미도)페닐)-6-히드록시-3-아이오도-1-메틸-1H-인돌-5-카복시산2- (3- (2- (3-bromo-5-iodobenzamido) acetamido) phenyl) -6-hydroxy-3-iodo-1-methyl-1H-indole-5-carboxy mountain RPTPβRPTPβ
구체적으로, 1, 2, 5, 10 μM의 각각의 PTP 억제제 존재 하에서 BV-2 소교세포를 LPS(100 ng/ml)로 24시간 동안 처리한 후 Greiss 반응을 이용해서 NO의 양을 측정하였다. 또한 MTT 분석법을 이용하여 세포독성을 확인하였고, 그 결과를 도 3에 나타내었다. Specifically, BV-2 microglia were treated with LPS (100 ng / ml) for 24 hours in the presence of 1, 2, 5, and 10 μM of each PTP inhibitor, and then the amount of NO was measured using a Greiss reaction. In addition, the cytotoxicity was confirmed using the MTT assay, and the results are shown in FIG. 3.
도 3에 나타낸 바와 같이, LPS에 의해 유도되는 NO의 양이 PTP 억제제의 처리에 따라 감소하는 것을 확인하였고, 세포 생존률이 유의적으로 감소하지 않음을 확인하였다.As shown in FIG. 3, it was confirmed that the amount of NO induced by LPS decreased with treatment of the PTP inhibitor, and the cell viability was not significantly reduced.
따라서, PTP 억제제가 세포독성 없이 안전하게 LPS에 의해 유도되는 NO의 양을 감소시키므로 소교세포의 활성화를 억제할 수 있음을 확인하였다. Therefore, it was confirmed that the PTP inhibitor can safely inhibit the activation of microglial cells because it safely reduces the amount of NO induced by LPS without cytotoxicity.
실시예 3. 뇌염증 모델에서 PTP 억제제의 소교세포 활성화 억제 효과 확인Example 3 Confirmation of Inhibitory Effect of PTP Inhibitor on Microglial Activation in Encephalitis Model
3-1. 마우스 모델3-1. Mouse model
PTP 억제제가 소교세포 활성화를 억제하는지 여부를 확인하기 위해서 뇌염증 마우스 모델을 제조하였다. C57BL/6 마우스를 비히클(0.5% DMSO 및 5% 프로필렌 글리콜을 포함하는 식염수) 또는 상기 표 2의 PTP 억제제(5% 프로필렌 글리콜을 포함하는 식염수 내 희석)를 대뇌내 주입하였다. 주입하고 30분 후에 LPS(5 mg/kg)를 복강내 주입하였다. 마우스를 희생하고 LPS 주입 48시간 후에 뇌를 분석하였다. Encephalitis mouse models were prepared to determine whether PTP inhibitors inhibit microglial activation. C57BL / 6 mice were injected cerebral with vehicle (saline containing 0.5% DMSO and 5% propylene glycol) or PTP inhibitors (dilution in saline containing 5% propylene glycol) in Table 2 above. LPS (5 mg / kg) was injected intraperitoneally 30 minutes after infusion. Mice were sacrificed and brains were analyzed 48 hours after LPS injection.
마우스 모델은 총 8개의 실험군으로 분류하였다; 식염수 및 0.5% DMSO를 처리한 1군; LPS 및 0.5% DMSO를 처리한 2군; LPS 및 PTP1B 억제제를 처리한 3군; LPS 및 TC-PTP 억제제를 처리한 4군; LPS 및 SHP2 억제제를 처리한 5군; LPS 및 MEG2 억제제를 처리한 6군; LPS 및 LYP 억제제를 처리한 7군; LPS 및 RPTPβ 억제제를 처리한 8군. 상기와 같은 실험 디자인을 도 4A에 나타내었다. Mouse models were divided into a total of eight experimental groups; Group 1 treated with saline and 0.5% DMSO; Group 2 treated with LPS and 0.5% DMSO; Group 3 treated with LPS and PTP1B inhibitors; Group 4 treated with LPS and TC-PTP inhibitors; Group 5 treated with LPS and SHP2 inhibitors; Group 6 treated with LPS and MEG2 inhibitors; Group 7 treated with LPS and LYP inhibitors; Group 8 treated with LPS and RPTPβ inhibitors. The experimental design as above is shown in Figure 4A.
희생한 마우스의 뇌가 형태적으로 변화했는지 여부를 소교세포의 마커인 Iba-1에 대한 항체로 염색하여 조직화학적으로 확인한 결과를 도 4B에 나타내었다. 4B shows the histologically confirmed result of staining of the brain of the sacrificed mouse with an antibody against Iba-1, a marker of microglia.
도 4B에 나타낸 바와 같이, LPS의 주입 후 소교세포의 형태적 변화가 관찰되었다. As shown in FIG. 4B, morphological changes of microglia were observed after injection of LPS.
또한, 뇌를 제거하고 절편화하여 해마, 피질, 시상에 대해 Iba-1에 대한 항체로 염색하여 조직화학적으로 확인한 결과를 도 4C에 나타내었으며 mm2 당 Iba-1 양성인 세포의 수를 그래프로 나타낸 결과를 도 4D에 나타내었다.In addition, the brain was removed and sectioned and stained with an antibody against Iba-1 for hippocampus, cortex and thalamus and histochemically confirmed. The results are shown in FIG. 4C and the graph shows the number of Iba-1 positive cells per mm 2 . The results are shown in FIG. 4D.
도 4C 및 4D에 나타낸 바와 같이, LPS의 처리에 의해 Iba-1 양성인 활성화된 소교세포의 수가 유의적으로 증가하였고 PTP 억제제에 의해 활성화된 소교세포의 수가 감소함을 확인하였다. 특히 PTP1B 억제제(PTP1Bi) 및 RPTPβ 억제제(RPTPβi)는 해마와 피질에서, TC-PTP 억제제(TC-PTPi)는 피질에서, SHP2 억제제(SHP2i)는 해마에서 LPS에 의해 유도된 소교세포의 활성화를 감소시키는 것을 확인하였다. As shown in FIGS. 4C and 4D, it was confirmed that the number of Iba-1 positive activated microglia was significantly increased by the treatment of LPS and the number of microglia activated by the PTP inhibitor was decreased. In particular, PTP1B inhibitors (PTP1Bi) and RPTPβ inhibitors (RPTPβi) decreased the activation of microglia induced by LPS in hippocampus and cortex, TC-PTP inhibitors (TC-PTPi) in cortex, and SHP2 inhibitors (SHP2i) in hippocampus. It was confirmed to make.
상기와 같은 실험 결과에 의해, 시험관 내 및 생체 내에서 PTP 억제제가 염증 조건 하에서 소교세포의 활성화를 감소시키는 효과가 있음을 확인하였다.From the above experimental results, it was confirmed that the PTP inhibitor has an effect of reducing activation of microglia under inflammatory conditions in vitro and in vivo.
다양한 종류의 PTP 중 PTP1B에 대해서 추가적인 실험을 실시하였다.Further experiments were performed on PTP1B among various types of PTP.
실시예 4. LPS-자극된 소교세포에서 PTP1B의 과발현이 NO 생성을 증가시킴을 확인Example 4 Overexpression of PTP1B in LPS-stimulated Microglial Cells Increases NO Production
상기 실시예로부터 염증 조건 하에서 소교세포내 PTP1B의 발현이 증가됨을 확인하였고, 증가된 PTP1B 발현이 기능적으로 어떠한 역할을 수행하는지 확인하기 위해서 하기와 같이 실험하였다. HA-PTP1B 플라스미드로 형질전환시켜 제조한 HA-PTP1B를 안정적으로 과발현시키는 BV2 소교세포주(HA-PTP1B)를 제조하여 제조된 세포주내 향상된 PTP1B 발현을 웨스턴 블롯팅으로 확인하고 그 결과를 도 5에 나타내었다. From the above example, it was confirmed that the expression of PTP1B in microglia was increased under inflammatory conditions, and the following experiment was performed to confirm what role functional PTP1B expression plays. The production of BV2 microglia (HA-PTP1B) stably overexpressing HA-PTP1B prepared by transformation with HA-PTP1B plasmid confirmed the enhanced PTP1B expression in the cell lines prepared by Western blotting and the results are shown in FIG. 5. It was.
도 5에 나타낸 바와 같이 naive BV2 소교세포주에 비해 PTP1B를 과발현시키는 BV2 소교세포주(HA-PTP1B)에서 PTP1B의 발현 수준이 2배 이상으로 증가하므로, 상기 세포주가 적절하게 제조되었음을 확인하였고, 이를 하기 실시예에 사용하였다.As shown in FIG. 5, since the expression level of PTP1B is more than doubled in BV2 microglia (HA-PTP1B) overexpressing PTP1B compared to naive BV2 microglia, it was confirmed that the cell line was properly prepared. Used in the example.
NO(nitric oxide)의 생성은 소교세포내 염증 반응의 강력한 표지이므로, LPS-유도된 NO 생성에 대한 PTP1B의 효과를 Griess 반응을 통하여 조사하였다. NO의 생성은 아질산염(nitrite)의 양을 이용해서 측정하였다. naive 소교세포 또는 PTP1B를 과발현시키는 소교세포에 LPS(E.coli 055 유래: B5; Sigma)를 처리하였다. 이때 표시한 용량의 LPS로 BV2 소교세포주에 처리한 결과를 도 6에, 표시한 시간에 100ng의 LPS로 BV2 소교세포주를 처리한 결과를 도 7에 나타내었다. 배양 후 24시간 후에 5μl의 세포 배양액을 동일한 부피의 Griess 시약 (0.1% 나프틸에틸렌디아민 디하이드로클로라이드 및 5% 인산 내 1% 설파닐아민)과 96-웰 microtiter 플레이트에 혼합했다. 540nm에서 흡광도를 읽었으며 표준 커브 생성을 위해서는 소듐 아질산염(nitrite)을 사용하였다.Since NO (nitric oxide) production is a strong marker of inflammatory responses in microglia, the effect of PTP1B on LPS-induced NO production was investigated by Griess reaction. NO production was measured using the amount of nitrite. LPS (derived from E. coli 055: B5; Sigma) was treated to microglia overexpressing naive microglia or PTP1B. The results of treatment of BV2 microglia cell line with the indicated dose of LPS is shown in FIG. 6, and the results of treatment of BV2 microglia cell line with 100ng LPS at the indicated time are shown in FIG. 7. Twenty four hours after incubation, 5 μl of cell culture was mixed with an equal volume of Griess reagent (0.1% naphthylethylenediamine dihydrochloride and 1% sulfanylamine in 5% phosphoric acid) in a 96-well microtiter plate. Absorbance was read at 540 nm and sodium nitrite was used for standard curve generation.
도 6에 나타낸 바와 같이, LPS에 의해서 유도된 NO 생성은 LPS에 대해 용량 의존적으로 증가됨을 확인하였고, 도 7에 나타낸 바와 같이 시간이 지남에 따라 NO가 축적됨을 확인하였다. 즉, naive BV2 세포와 비교해서 PTP1B를 과발현시키는 BV2 세포의 경우 LPS-유도된 NO 생성이 LPS의 농도에 의존적으로 시간이 지남에 따라 증가되었음을 확인하였다. As shown in FIG. 6, it was confirmed that NO production induced by LPS was dose-dependently increased with respect to LPS, and that NO was accumulated over time as shown in FIG. 7. That is, it was confirmed that LPS-induced NO production increased over time depending on the concentration of LPS in BV2 cells overexpressing PTP1B compared to naive BV2 cells.
실시예Example 5. 소교세포에서  5. In microglia PTP1BPTP1B 과발현이 전염증성Overexpression is proinflammatory 매개체의 발현을 증가시킴을 확인 Increased expression of mediators
증가된 염증성 사이토카인의 수준은 소교세포의 과활성화를 나타내는 표지 중 하나이므로, 염증성 사이토카인에 대한 PTP1B의 효과를 확인하기 위해서 real-time PCR을 수행하였다. 구체적으로, naive BV2 세포 및 PTP1B를 과발현시키는 BV2 세포에 LPS를 각각 처리한 후 LPS가 처리된 세포에서 염증성 사이토카인인 TNFα, iNOS, IL-6의 mRNA 발현 수준을 real-time PCR로 측정한 결과를 도 8에 나타내었다.Since the increased level of inflammatory cytokines is one of the markers indicating the overactivation of microglia, real-time PCR was performed to confirm the effect of PTP1B on inflammatory cytokines. Specifically, after LPS treatment to naive BV2 cells and BV2 cells overexpressing PTP1B, mRNA expression levels of inflammatory cytokines TNFα, iNOS and IL-6 were measured by real-time PCR in LPS-treated cells. Is shown in FIG. 8.
도 8에 나타낸 바와 같이, 대조군인 naive 세포에 비해서 PTP1B를 과발현시키는 BV2 세포에서 TNFα, iNOS 및 IL-6의 LPS-유도된 발현이 증가되었음을 확인하였다. As shown in FIG. 8, it was confirmed that LPS-induced expression of TNFα, iNOS and IL-6 was increased in BV2 cells overexpressing PTP1B as compared to naive cells as control.
즉 PTP1B는 소교세포에서 염증성 사이토카인의 발현을 유도하며 이는 소교세포의 과활성화를 나타내므로, PTP1B에 의해서 소교세포가 과활성화됨을 유추할 수 있다.That is, PTP1B induces the expression of inflammatory cytokines in microglia, which indicates the overactivation of microglia, and thus, can be inferred that microglial cells are overactivated by PTP1B.
실시예Example 6. 소교세포에서  6. In microglia PTP1BPTP1B 억제제가  Inhibitor 전염증성Proinflammatory 신호-유발된 NO 생성을 저해함을 확인 Found to inhibit signal-induced NO production
상기 실시예 5에서 확인한 바와 같이, PTP1B의 과발현은 염증 조건에서 NO 및 전염증성 사이토카인의 생성을 증가시킨다. 본 발명자들은 이러한 결과로부터 PTP1B의 억제가 소교세포가 과활성화되는 것을 막을 수 있을 것이라고 가정하였다. 이러한 가정을 증명하기 위해서, PTP1B 억제제((S)-4-(((S)-1-(l2-아자닐)-3-(4-(디플루오로(포스포노)메틸)페닐)-1-옥소프로판-2-일)아미노)-3-((S)-3-(4-(디플루오로(포스포노)메틸)페닐)-2-펜타데칸아미도프로판아미도)-4-옥소부탄산)를 Dr. Zhang 그룹으로부터 수득하여 사용하였다. 본 발명에 사용된 PTP1B 억제제(이하 “iPTP1B”로 지칭한다)는 PTP1B에 매우 특이적인 것으로 증명되었다. As confirmed in Example 5 above, overexpression of PTP1B increases the production of NO and proinflammatory cytokines in inflammatory conditions. The present inventors hypothesized that the inhibition of PTP1B could prevent the microglia from overactivating from these results. To demonstrate this assumption, the PTP1B inhibitor ((S) -4-(((S) -1- (l2-azanyl) -3- (4- (difluoro (phosphono) methyl) phenyl) -1) -Oxopropan-2-yl) amino) -3-((S) -3- (4- (difluoro (phosphono) methyl) phenyl) -2-pentadecanamidopropaneamido) -4-oxo Butanoic acid) Obtained from Zhang group and used. The PTP1B inhibitor (hereinafter referred to as “iPTP1B”) used in the present invention has proved to be very specific for PTP1B.
iPTP1B의 염증 억제 효과를 확인하기 위해서 LPS-유도된 BV2 소교세포내 NO 생성에 대한 iPTP1B의 효과를 조사하였다. BV2 소교세포주를 표시된 다른 농도의 iPTP1B로 사전처리하고 1시간 후 LPS(100ng/ml)로 자극하였고, 상기 처리된 세포에서 Griess 방법에 따라 NO 수준을 측정하였다. 또한 소교세포에 대한 iPTP1B의 세포독성을 확인하기 위해서, iPTP1B 처리한 뒤 24시간 후에 MTT 분석법을 수행하였고 그 결과를 도 9에 나타내었다. To investigate the inhibitory effect of iPTP1B, the effect of iPTP1B on NO production in LPS-induced BV2 microglia was investigated. BV2 microglia were pretreated with different concentrations of iPTP1B indicated and stimulated with LPS (100 ng / ml) after 1 hour, and NO levels were measured according to the Griess method in the treated cells. In addition, to confirm the cytotoxicity of iPTP1B against microglia, MTT assay was performed 24 hours after iPTP1B treatment and the results are shown in FIG. 9.
도 9에 나타낸 바와 같이 소교세포에서 LPS-유도된 NO의 수준이 iPTP1B에 의해서 용량 의존적으로 감소되며 IC50 값이 10.27μM임을 확인하였다. 또한 시험에 사용된 농도에서 iPTP1B의 세포독성이 유의적인 수준으로 관찰되지 않았다 As shown in FIG. 9, it was confirmed that the level of LPS-induced NO in microglia was dose-dependently reduced by iPTP1B and the IC50 value was 10.27 μM. In addition, no significant cytotoxicity of iPTP1B was observed at the concentrations used in the test.
또한 iPTP1B만 처리하였을 경우에는 NO 생성을 억제하거나 증가시키지 않았으며 LPS에 의해 과다 생성이 유도된 NO 수준을 유의적으로 억제하였으므로, iPTP1B 자체는 NO 생성의 기본 수준을 변화시키지 못하는 것을 알 수 있다.In addition, iPTP1B alone did not inhibit or increase NO production and significantly inhibited NO levels induced by LPS. Thus, iPTP1B itself does not change the basic level of NO production.
또한, NO 생성에 대한 iPTP1B의 효과를 마우스 일차 소교세포에서 확인하였다. 구체적으로, 일차 소교세포에 5μM의 iPTP1B를 사전처리하고 이후 24시간 동안 LPS(50ng/ml)로 자극했다. 상기 자극된 일차 소교세포에서 NO 수준을 확인하였다. 일차 소교세포에 대한 iPTP1B의 세포독성을 확인하기 위해서, iPTP1B 처리한 뒤 24시간 후에 MTT 분석법을 수행하고 그 결과를 도 10에 나타내었다. In addition, the effect of iPTP1B on NO production was confirmed in mouse primary microglia. Specifically, primary microglia were pretreated with 5 μM of iPTP1B and then stimulated with LPS (50 ng / ml) for 24 hours. NO levels were confirmed in the stimulated primary microglia. In order to confirm the cytotoxicity of iPTP1B on primary microglia, MTT assay was performed 24 hours after iPTP1B treatment and the results are shown in FIG. 10.
도 10에 나타낸 바와 같이 LPS-유도된 NO 수준이 iPTP1B에 의해서 유의적으로 감소함을 확인하였다. 또한 시험에 사용된 농도에서 iPTP1B의 세포독성이 유의적인 수준으로 관찰되지 않았다.As shown in FIG. 10, it was confirmed that LPS-induced NO levels were significantly decreased by iPTP1B. In addition, no significant cytotoxicity of iPTP1B was observed at the concentrations used in the test.
또한, NO 생성에 대한 iPTP1B의 효과를 랫트 소교세포주인 HAPI 세포에서 확인하였다. 구체적으로, 랫트 소교세포주인 HAPI 세포에 10μM의 iPTP1B를 1시간 동안 사전처리한 이후 24시간 동안 LPS(100ng/ml)로 자극했다. 상기 자극된 랫트 소교세포주인 HAPI 세포에서 NO 수준을 확인하였다. 또한 랫트 소교세포주인 HAPI 세포에 대한 iPTP1B의 세포독성을 확인하기 위해서, iPTP1B 처리한 뒤 24시간 후에 MTT 분석법을 수행하고 그 결과를 도 11에 나타내었다. In addition, the effect of iPTP1B on NO production was confirmed in HAPI cells, rat microglia. Specifically, HAPI cells, rat microglia, were stimulated with LPS (100 ng / ml) for 24 hours after pretreatment with 10 μM of iPTP1B for 1 hour. NO levels were confirmed in HAPI cells, the stimulated rat microglia. In addition, to confirm the cytotoxicity of iPTP1B against HAPI cells, the rat microglia cell line, MTT assay was performed 24 hours after iPTP1B treatment and the results are shown in FIG. 11.
도 11에 나타낸 바와 같이 LPS-유도된 NO 수준이 iPTP1B에 의해서 유의적으로 감소함을 확인하였다. 또한 시험에 사용된 농도에서 iPTP1B의 세포독성이 유의적인 수준으로 관찰되지 않았다.As shown in FIG. 11, it was confirmed that LPS-induced NO levels were significantly decreased by iPTP1B. In addition, no significant cytotoxicity of iPTP1B was observed at the concentrations used in the test.
또한, TNFα 유발된 NO 생성도 iPTP1B에 의해서 억제됨을 확인하기 위해서, 랫트 소교세포주인 HAPI 세포에 10μM의 iPTP1B를 1시간 동안 사전처리한 이후 24시간 동안 TNFα(100ng/ml)로 자극했다. 자극된 상기 세포에서 NO 수준을 확인하였다. 또한 랫트 소교세포주인 HAPI 세포에 대한 iPTP1B의 세포독성을 확인하기 위해서, iPTP1B 처리한 뒤 24시간 후에 MTT 분석법을 수행하고 그 결과를 도 12에 나타내었다.In addition, to confirm that TNFα-induced NO production was also inhibited by iPTP1B, the rat microglia HAPI cells were stimulated with TNFα (100ng / ml) for 24 hours after pretreatment with 10 μM of iPTP1B for 1 hour. NO levels were confirmed in these stimulated cells. In addition, to confirm the cytotoxicity of iPTP1B against HAPI cells, a rat microglial cell line, MTT assay was performed 24 hours after iPTP1B treatment and the results are shown in FIG. 12.
도 12에 나타낸 바와 같이 TNFα-유도된 NO 수준이 iPTP1B에 의해서 유의적으로 감소함을 확인하였다. 또한 시험에 사용된 농도에서 iPTP1B의 세포독성이 유의적인 수준으로 관찰되지 않았다.As shown in FIG. 12, it was confirmed that TNFα-induced NO levels were significantly decreased by iPTP1B. In addition, no significant cytotoxicity of iPTP1B was observed at the concentrations used in the test.
따라서, BV2 소교세포, 일차 소교세포 및 랫트 HAPI 소교세포에서 LPS-유도된 NO 생성이 PTP1B 억제제에 의해서 저해될 수 있음을 확인하였다. HAPI 소교세포에서 TNFα-유도된 NO 생성이 PTP1B 억제제에 의해서 저해될 수 있는 사실 또한 확인하였다.Thus, it was confirmed that LPS-induced NO production in BV2 microglia, primary microglia and rat HAPI microglia could be inhibited by PTP1B inhibitors. It was also confirmed that TNFα-induced NO production in HAPI microglia could be inhibited by PTP1B inhibitors.
실시예 7. PTP1B 억제제가 LPS-유도된 전염증성 매개체 생성을 조절함을 확인Example 7 Confirming that PTP1B Inhibitors Modulate LPS-Induced Proinflammatory Mediator Production
PTP1B 억제제가 LPS-유도된 전염증성 매개체의 생성을 조절하는지 여부를 확인하기 위해서 BV2 소교세포에서 iPTP1B가 전염증성 사이토카인의 생성에 미치는 영향을 확인하였다. 구체적으로, 10μM의 iPTP1B 존재 또는 부존재하에서 BV2 소교세포를 6시간 동안 LPS(100ng/ml)로 처리하였고, 상기 처리된 세포 시료에서 전염증성 분자인 iNOS, IL1β, TNFα, Cox2의 mRNA 발현 수준을 RT-PCR로 확인하여 그 결과를 도 13에 나타내었다. 또한 RT-PCR로 얻은 밴드 강도를 수치화하여 그래프로 표시한 결과를 도 14에 나타내었다.To determine whether PTP1B inhibitors regulate the production of LPS-induced proinflammatory mediators, the effects of iPTP1B on the production of proinflammatory cytokines in BV2 microglia were examined. Specifically, BV2 microglia were treated with LPS (100 ng / ml) for 6 hours in the presence or absence of 10 μM of iPTP1B, and mRNA levels of iNOS, IL1β, TNFα, Cox2, which are proinflammatory molecules, were RT in the treated cell samples. Confirmed by -PCR, the result is shown in FIG. In addition, the band strength obtained by RT-PCR is numerically shown in Figure 14 is shown in the graph.
도 13 및 도 14에 나타낸 바와 같이 iPBP1B의 사전처리는 LPS-유도된 사이토카인 및 전염증성 분자들(iNOS, IL1β, TNFα, Cox2)의 생성을 유의적으로 억제함을 알 수 있다. As shown in FIGS. 13 and 14, pretreatment of iPBP1B significantly inhibits the production of LPS-induced cytokine and proinflammatory molecules (iNOS, IL1β, TNFα, Cox2).
또한, 상기와 같이 LPS로 처리된 BV2 소교세포 배양액내 TNFα 단백질 수준을 ELISA로 확인하였다. 구체적으로, iPTP1B 존재 또는 부존재 하에서 BV2 세포를 LPS로 처리하고 배양 24시간 후에, 포획 항체로서 랫트 모노클로날 항-마우스 TNFα 항체를, 검출 항제로서 염소 비오티닐화된 폴리클로날 항-마우스 TNFα 항체를 이용하여 배양 배지내의 TNFα 수준을 측정하였다. 측정된 TNFα 단백질의 수준 결과를 도 15에 나타내었다.In addition, TNFα protein levels in BV2 microglia cultures treated with LPS as described above were confirmed by ELISA. Specifically, 24 hours after culturing BV2 cells in the presence or absence of iPTP1B with LPS, rat monoclonal anti-mouse TNFα antibodies as capture antibodies and goat biotinylated polyclonal anti-mouse TNFα antibodies as detection agents TNFα levels in the culture medium were measured. The results of the measured levels of TNFα protein are shown in FIG. 15.
도 15에 나타낸 바와 같이, iPTP1B를 처리한 경우 배양액내 TNFα의 발현 수준이 유의적으로 낮았으므로 PTP1B 억제제가 LPS-유도된 TNFα의 방출을 억제함을 확인하였다.As shown in FIG. 15, it was confirmed that the PTP1B inhibitor inhibited the release of LPS-induced TNFα because the expression level of TNFα in the culture medium was significantly lower when iPTP1B was treated.
따라서 LPS에 의해 염증이 유도된 BV2 소교세포에 iPTP1B를 처리한 결과 전염증성 인자인 iNOS, IL1β, TNFα, Cox2의 생성이 억제되므로 PTP1B 억제제가 염증을 억제하는 효과를 나타냄을 확인하였다.Therefore, as a result of treating iPTP1B to LPS-induced inflammation of BV2 microglia, the production of pro-inflammatory factors iNOS, IL1β, TNFα, Cox2 was inhibited, and thus the PTP1B inhibitor showed an effect of inhibiting inflammation.
실시예 8. 소교세포 활성에 있어 PTP1B의 표적 분자로서 Src 확인Example 8 Src Identification as Target Molecule of PTP1B in Microglial Activity
상기 실시예를 통하여 PTP1B가 신경염증 반응을 증가시킴을 확인하였고 PTP1B가 LPS-유도된 염증 반응을 어떻게 증가시키는지 확인하기 위해서 하기와 같이 수행하였다. 문헌 검색에 기초하여, 알려진 다른 PTP1B 기질 중에서 Src 키나제, 티로신 키나제를 PTP1B의 표적으로 선택하였다. 이러한 선택의 이유는 Src가 음성 조절 인산화 자리(Y527)를 갖기 때문이다. PTP1B는 Src의 음성 조절 자리를 탈인산화시킬 수 있고, 이는 Src 키나제 활성을 유도한다. It was confirmed through the above example that PTP1B increased the neuroinflammatory response and was performed as follows to determine how PTP1B increases the LPS-induced inflammatory response. Based on literature searches, Src kinases, tyrosine kinases were selected as targets of PTP1B among other known PTP1B substrates. The reason for this choice is that Src has a negative regulatory phosphorylation site (Y527). PTP1B can dephosphorylate the negative regulatory sites of Src, which induces Src kinase activity.
PTP1B가 소교세포에서 Src를 탈인산화시키고 이로 인해 Src를 활성화시킬 수 있는지 확인하기 위해서, BV2 소교세포를 HA-PTP1B로 형질감염시켜 PTP1B를 과발현시키는 BV2 소교세포를 제조하였다. 이와 같이 제조된 PTP1B를 과발현시키는 BV2 소교세포와 naive BV2 소교세포에서 Src Y527의 인산화를 비교한 결과 및 밴드 강도를 베타-액틴으로 표준화하고 정량화하여 그래프로 나타낸 결과를 도 16에 나타내었다.In order to confirm that PTP1B can dephosphorylate Src in microglia and thereby activate Src, BV2 microglia were prepared by transfecting BV2 microglia with HA-PTP1B to overexpress PTP1B. As a result of comparing the phosphorylation of Src Y527 in BV2 microglial cells and naive BV2 microglial cells overexpressing the PTP1B thus prepared, the band intensity was standardized and quantified by beta-actin, and the graph is shown in FIG. 16.
도 16에 나타낸 바와 같이, 대조군에 비해 PTP1B가 과발현된 소교세포에서 Src Y527 인산화가 60%까지 감소함을 확인하였다. 이는 선행 연구결과와 일치하며 PTP1B가 Src의 Y527을 탈인산화시키는 작용을 함을 나타낸다. As shown in FIG. 16, Src Y527 phosphorylation was reduced by 60% in microglial cells overexpressed with PTP1B compared to the control group. This is in agreement with previous studies and shows that PTP1B acts to dephosphorylate Y527 in Src.
또한, PTP1B가 과발현된 소교세포주에서 LPS-유도된 NO 생성 변화를 확인하고 그 결과를 도 17에 나타내었다. In addition, the change in LPS-induced NO production in the microglial cell line overexpressing PTP1B was shown, and the results are shown in FIG. 17.
도 17에 나타낸 바와 같이. PTP1B가 과발현된 소교세포주에서 LPS에 의해 유도된 NO 수준이 증가함을 확인하였으며, 이로부터 Src 활성을 증가시키는 PTP1B 과발현이 NO 수준을 향상시켰음을 알 수 있다.As shown in FIG. 17. It was confirmed that LPS-induced NO levels were increased in microglial cell lines overexpressing PTP1B, indicating that PTP1B overexpression, which increased Src activity, improved NO levels.
또한, Src가 LPS-유도된 소교세포 활성과 연관되어있는지 확인하기 위해서 Src 키나제 억제제인 PP2(5μM) 또는 PDTC(Ammonium pyrrolidinedithiocarbamate, NFκb 억제제)로 BV2를 처리한 후 LPS-유도된 NO 생성 수준을 확인하였다. 이를 도 18에 나타내었다.In addition, to determine whether Src is associated with LPS-induced microglial activity, LPS-induced NO production levels were determined after BV2 treatment with Src kinase inhibitor PP2 (5 μM) or PDTC (Ammonium pyrrolidinedithiocarbamate (NFκb inhibitor)). It was. This is shown in FIG. 18.
도 18에 나타낸 바와 같이 소교세포에서 Src 키나제인 PP2는 IKK 억제제인 PDTC 만큼 유의적으로 LPS-유도된 NO 생성을 억제함을 확인하였고 PP2 사전처리에 의한 LPS-유도된 NO 생성의 억제는 용량 의존적인 것으로 관찰되었다.As shown in FIG. 18, it was confirmed that PP2, an Src kinase, inhibited LPS-induced NO production as much as IKK inhibitor PDTC in microglia, and inhibition of LPS-induced NO production by PP2 pretreatment was dose dependent. Was observed.
다음, PTP1B-매개된 전염증성 반응이 소교세포에서 Src 활성에 의존하는지 여부를 확인하였다. 이를 위해 Src 억제제인 PP2 또는 iPTP1B로 1시간 동안 사전처리된 BV2 소교세포를 24시간 동안 LPS로 처리하였다. 상기 처리된 BV2 소교세포에서 NO 수준을 측정하여 결과를 도 19에 나타내었다. iPTP1B의 항-염증성 효과를 조사했다. Next, it was confirmed whether the PTP1B-mediated proinflammatory response was dependent on Src activity in microglia. To this end, BV2 microglia pretreated with Src inhibitor PP2 or iPTP1B for 1 hour were treated with LPS for 24 hours. The levels of NO in the treated BV2 microglia were shown in FIG. 19. The anti-inflammatory effect of iPTP1B was investigated.
도 19에 나타낸 바와 같이, PP2 처리는 소교세포에서 iPTP1B의 항-염증 효과를 제거함을 확인하였다. 이러한 데이터는 PTP1B-매개된 소교세포 활성이 Src 활성에 의존함을 증명한다.As shown in Figure 19, PP2 treatment was confirmed to eliminate the anti-inflammatory effect of iPTP1B in microglia. These data demonstrate that PTP1B-mediated microglia activity is dependent on Src activity.
추가적으로, 생체내에서 Src Y527의 인산화에 대한 PTP1B의 효과를 확인하기 위해서, LPS가 주입된 염증 마우스 모델을 이용하여 생체내 실험을 수행하였다. LPS+iPTP1B 또는 iPTP1B를 뇌에 주입하고 24시간 후에 Src Y527의 인산화를 확인하였다. 이때 총 Src 및 베타-액틴은 로딩 대조군으로 사용하고 Lnc2를 신경 염증의 마커로 사용하여 그 결과를 도 20에 나타내었다. Additionally, to confirm the effect of PTP1B on phosphorylation of Src Y527 in vivo, in vivo experiments were performed using an inflammatory mouse model infused with LPS. Phosphorylation of Src Y527 was confirmed 24 hours after LPS + iPTP1B or iPTP1B was injected into the brain. At this time, total Src and beta-actin were used as a loading control and Lnc2 was used as a marker of nerve inflammation, and the results are shown in FIG. 20.
도 20에 나타낸 바와 같이 iPTP1B의 주입에 의해서 억제된 PTP1B 활성은 Src의 Y527에서 인산화를 증가시킴을 확인하였다. 이로부터 소교세포에서 증가된 PTP1B의 수준이 염증성 사이토카인의 신호전달을 향상시킬 수 있으며, PTP1B가 소교세포에서 Src의 Y527에서 탈인산화 시킴으로써 전염증성 인자로 작용할 수 있음을 확인하였다. As shown in FIG. 20, it was confirmed that PTP1B activity inhibited by infusion of iPTP1B increased phosphorylation at Y527 of Src. From this, it was confirmed that the increased level of PTP1B in microglia could improve the signaling of inflammatory cytokines, and that PTP1B could act as a pro-inflammatory factor by dephosphorylation of Src Y527 in microglia.
즉, PTP1B는 전염증성 사이토카인의 생성을 촉진하며, Y527의 탈인산화를 통해서 Src를 활성화시킨다. 이처럼 활성화된 Src는 NFκB를 활성화시키고 전염증성 인자의 발현을 증가시킨다. 이러한 메커니즘의 모식도를 도 21에 간략하게 나타내었다.That is, PTP1B promotes the production of proinflammatory cytokines and activates Src through dephosphorylation of Y527. This activated Src activates NFκB and increases the expression of proinflammatory factors. A schematic of this mechanism is briefly shown in FIG.
실시예 9. 생체내에서 PTP1B 억제제는 소교세포-매개된 신경염증을 제한함을 확인Example 9 In Vivo PTP1B Inhibitors Restricted Microglia-Mediated Neuroinflammatory
생체내에서 iPTP1B의 항염증 효과를 확인하기 위해서, 뇌 조직에서 LPS 및 iPTP1B 주입 후 전염증성 인자의 생성을 측정하였다. LPS를 주입하고 6시간 후에 전염증성 인자인 TNFα 및 IL1β 유전자의 발현 정도를 Real time-RCR에 의해서 측정하고 그 결과를 도 23에 나타내었다. To confirm the anti-inflammatory effects of iPTP1B in vivo, the production of proinflammatory factors after LPS and iPTP1B injection in brain tissues was measured. Six hours after the injection of LPS, the expression levels of the pro-inflammatory factors TNFα and IL1β gene were measured by real time-RCR, and the results are shown in FIG. 23.
도 23에 나타낸 바와 같이 염증성 뇌에서 PTP1B의 억제에 의해서 TNFα 및 IL1β의 발현이 유의적으로 약화됨을 확인하였다. As shown in FIG. 23, it was confirmed that expression of TNFα and IL1β was significantly weakened by inhibition of PTP1B in the inflammatory brain.
따라서 염증 자극이 PTP1B 발현을 증가시키고 뇌에서 소교세포 과활성화를 유도하며 염증성 조건에서 PTP1B 활성 차단은 시험관내 및 생체내에서 소교세포 과활성화를 예방하므로, PTP 억제제를 사용하면 신경염증성 질환, 특히 뇌에서의 염증성 질환을 효과적으로 예방 또는 치료할 수 있음을 알 수 있다.Therefore, inflammatory stimuli increase PTP1B expression, induce microglial hyperactivation in the brain, and blocking inflammatory cell PTP1B activity in inflammatory conditions prevents microglial hyperactivation in vitro and in vivo. It can be seen that it is possible to effectively prevent or treat an inflammatory disease in.
비록 본 발명이 상기에 언급된 바람직한 실시예로서 설명되었으나, 발명의 요지와 범위로부터 벗어남이 없이 다양한 수정이나 변형을 하는 것이 가능하다. 또한 첨부된 청구 범위는 본 발명의 요지에 속하는 이러한 수정이나 변형을 포함한다.Although the present invention has been described as the preferred embodiment mentioned above, it is possible to make various modifications or variations without departing from the spirit and scope of the invention. The appended claims also cover such modifications and variations as fall within the spirit of the invention.
제제예 1. 의약품의 제조Formulation Example 1 Preparation of Pharmaceuticals
1.1 산제의 제조1.1 Preparation of Powder
PTP 억제제 1-15mg/LPTP inhibitor 1-15mg / L
유당 100mgLactose 100mg
탈 10mg10 mg
상기의 성분들을 혼합하고 기밀포에 충진하여 산제를 제조한다.The above ingredients are mixed and filled in an airtight cloth to prepare a powder.
1.2 정제의 제조1.2 Preparation of Tablets
PTP 억제제 1-15mg/LPTP inhibitor 1-15mg / L
옥수수전분 100mgCorn Starch 100mg
유당 100mgLactose 100mg
스테아린산 마그네슘 2mg2 mg magnesium stearate
상기의 성분들을 혼합한 후 통상의 정제의 제조방법에 따라서 타정하여 정제를 제조한다.After mixing the above components, tablets are prepared by tableting according to a conventional method for preparing tablets.
1.3 캡슐제의 제조1.3 Preparation of Capsules
PTP 억제제 1-15mg/LPTP inhibitor 1-15mg / L
옥수수전분 100mgCorn Starch 100mg
유당 100mgLactose 100mg
스테아린산 마그네슘 2mg2 mg magnesium stearate
통상의 캡슐제 제조방법에 따라 상기의 성분을 혼합하고 젤라틴 캡슐에 충전하여 정제를 제조한다.According to a conventional capsule preparation method, the above ingredients are mixed and filled into gelatin capsules to prepare tablets.
1.4 주사제의 제조1.4 Preparation of Injections
PTP 억제제 1-15mg/LPTP inhibitor 1-15mg / L
주사용 멸균 증류수 적량Appropriate sterile distilled water for injection
pH 조절제 적량pH adjuster
통상의 주사제의 제조방법에 따라 1 앰플당(2ml) 상기의 성분 함량으로 제조한다.According to the conventional method for preparing an injection, the amount of the above ingredient is prepared per ampoule (2 ml).
1.5 액제의 제조1.5 Preparation of Liquids
PTP 억제제 1-15mg/LPTP inhibitor 1-15mg / L
설탕 20g20 g of sugar
이성화당 20g20 g of isomerized sugar
레몬향 적량Lemon flavor
정제수를 가하여 전체 1,000ml로 맞추었다. 통상의 액제의 제조방법에 따라 상기의 성분을 혼합한 다음, 갈색병에 충전하고 멸균시켜 액제를 제조한다.Purified water was added to adjust the total volume to 1,000 ml. According to the conventional method for preparing a liquid, the above components are mixed, and then filled into a brown bottle and sterilized to prepare a liquid.
제제예 2. 식품의 제조Formulation Example 2 Preparation of Food
PTP 억제제 1-15mg/LPTP inhibitor 1-15mg / L
비타민 혼합물 적량Vitamin mixture proper amount
비타민 A 아세테이트 70 ㎍70 μg of Vitamin A Acetate
비타민 E 1.0 ㎎Vitamin E 1.0 mg
비타민 B1 0.13 ㎎Vitamin B1 0.13 mg
비타민 B2 0.15 ㎎Vitamin B2 0.15 mg
비타민 B6 0.5 ㎎Vitamin B6 0.5 mg
비타민 B12 0.2 ㎍0.2 μg of vitamin B12
비타민 C 10 ㎎ Vitamin C 10 mg
비오틴 10 ㎍10 μg biotin
니코틴산아미드 1.7 ㎎Nicotinic Acid 1.7 mg
엽산 50 ㎍ Folate 50 ㎍
판토텐산 칼슘 0.5 ㎎Calcium Pantothenate 0.5mg
무기질 혼합물 적량Mineral mixture
황산제1철 1.75 ㎎Ferrous Sulfate 1.75 mg
산화아연 0.82 ㎎Zinc Oxide 0.82 mg
탄제1인산칼륨 15 ㎎Potassium monophosphate 15 mg
제2인산칼슘 55 ㎎Dibasic calcium phosphate 55 mg
구연산칼륨 90 ㎎Potassium Citrate 90 mg
탄산칼슘 100 ㎎ Calcium Carbonate 100 mg
염화마그네슘 24.8 ㎎Magnesium chloride 24.8 mg
상기의 비타민 및 미네랄 혼합물의 조성비는 비교적 건강기능식품에 적합한 성분을 바람직한 실시예로 혼합 조성하였지만, 그 배합비를 임의로 변형 실시하여도 무방하며, 통상의 건강기능식품 제조방법에 따라 상기의 성분을 혼합한 다음, 통상의 방법에 따라 건강기능식품 조성물 제조(예, 영양캔디 등)에 사용할 수 있다.Although the composition ratio of the above-mentioned vitamin and mineral mixtures is a composition that is relatively suitable for the health functional food, the composition is mixed in a preferred embodiment, but the compounding ratio may be arbitrarily modified, and the above ingredients are mixed according to a conventional health functional food manufacturing method. Then, it can be used for the manufacture of the nutraceutical composition (eg, nutrition candy, etc.) according to a conventional method.
제제예 3. 음료의 제조Formulation Example 3 Preparation of Beverage
PTP 억제제 1-15mg/LPTP inhibitor 1-15mg / L
구연산 1000 ㎎ Citric acid 1000 mg
올리고당 100 g100 g oligosaccharides
매실농축액 2 gPlum concentrate 2 g
타우린 1 g1 g of taurine
정제수를 가하여 전체 900 ㎖Add 900 ml of purified water
통상의 건강기능성 음료 제조방법에 따라 상기의 성분을 혼합한 다음, 약 1시간동안 85℃에서 교반 가열한 후, 만들어진 용액을 여과하여 멸균된 2ℓ용기에 취득하여 밀봉 멸균한 뒤 냉장 보관한 다음 본 발명의 건강기능성 음료 조성물 제조에 사용한다. After mixing the above components in accordance with the conventional method for preparing a health functional beverage, the mixture was heated by stirring at 85 ℃ for about 1 hour, the resulting solution was filtered and obtained in a sterilized 2 L container, sealed and sterilized and then stored in a refrigerator. It is used for the manufacture of the health functional beverage composition of the invention.
상기 조성비는 비교적 기호음료에 적합한 성분을 바람직한 실시예로 혼합 조성하였지만, 수요계층, 수요국가, 사용 용도 등 지역적, 민족적 기호도에 따라서 그 배합비를 임의로 변형 실시하여도 무방하다.Although the composition ratio is a composition suitable for a preferred beverage in a preferred embodiment, the composition ratio may be arbitrarily modified according to regional and ethnic preferences such as demand hierarchy, demand country, use purpose.

Claims (8)

  1. PTP (protein tyrosine phosphatase) 억제제를 포함하는 신경염증성 질환의 예방 또는 치료용 약학적 조성물.A pharmaceutical composition for the prevention or treatment of neuroinflammatory diseases comprising a protein tyrosine phosphatase (PTP) inhibitor.
  2. 제1항에 있어서, 상기 PTP 억제제는 PTP1B(Protein tyrosine phosphatase type 1B), TC-PTP(T-cell phosphatase), SHP2(Src homology domain2-containing PTP2), MEG2(Megakaryocyte-PTP2), LYP(Lymphoid specific-tyrosine phosphatase) 및 RPTPβ(Receptor-type tyrosine protein phosphatase beta)로 구성된 군으로부터 선택된 1종 이상의 PTP에 대한 억제제인 것을 특징으로 하는, 신경염증성 질환의 예방 또는 치료용 약학적 조성물.According to claim 1, wherein the PTP inhibitor is protein tyrosine phosphatase type 1B (PTP1B), T-cell phosphatase (TC-PTP), Src homology domain2-containing PTP2 (SHP2), Megagaryocyte-PTP2 (MEG2), Lymphoid specific A pharmaceutical composition for preventing or treating neuroinflammatory diseases, characterized in that the inhibitor is at least one PTP selected from the group consisting of -tyrosine phosphatase) and RPTPβ (Receptor-type tyrosine protein phosphatase beta).
  3. 제1항에 있어서, 상기 PTP 억제제는 하기 표에 기재된 화합물 또는 이의 약학적으로 허용가능한 염을 포함하는 것을 특징으로 하는, 신경염증성 질환의 예방 또는 치료용 약학적 조성물.According to claim 1, wherein the PTP inhibitor is a pharmaceutical composition for the prevention or treatment of neuroinflammatory diseases, characterized in that it comprises a compound described in the following table or a pharmaceutically acceptable salt thereof.
    Figure PCTKR2016012746-appb-I000002
    Figure PCTKR2016012746-appb-I000002
  4. 제1항에 있어서 상기 신경염증성 질환은 다발성 경화증, 신경모세포종, 뇌졸중, 알츠하이머 병, 파킨슨 병, 루게릭 병, 헌팅턴 병, 크로이츠펠트야콥병, 외상 후 스트레스 장애, 우울증, 정신분열증, 및 근위축성측색경화증으로 이루어진 군에서 선택되는 것인, 신경염증성 질환의 예방 또는 치료용 약학적 조성물.The method of claim 1, wherein the neuroinflammatory disease is multiple sclerosis, neuroblastoma, stroke, Alzheimer's disease, Parkinson's disease, Lou Gehrig's disease, Huntington's disease, Creutzfeldt-Jakob disease, post-traumatic stress disorder, depression, schizophrenia, and muscular dystrophy The pharmaceutical composition for the prevention or treatment of neuroinflammatory diseases, which is selected from the group consisting of.
  5. 제1항에 있어서, 상기 신경염증성 질환은 뇌염증 질환인 것을 특징으로 하는, 신경염증성 질환의 예방 또는 치료용 약학적 조성물.The method of claim 1, wherein the neuroinflammatory disease is characterized in that the encephalitis diseases, the pharmaceutical composition for the prevention or treatment of neuroinflammatory diseases.
  6. 제1항에 있어서, 상기 PTP 억제제는 소교세포의 활성화 억제를 통하여 신경염증을 억제하는 것인, 신경염증성 질환의 예방 또는 치료용 약학적 조성물.According to claim 1, wherein the PTP inhibitor is to inhibit neuroinflammatory inflammation through the activation of microglia, the pharmaceutical composition for preventing or treating neuroinflammatory diseases.
  7. 제1항에 있어서, 상기 PTP 억제제는 Src 활성을 감소시킴으로써 신경염증의 억제 효과를 나타내는 것을 특징으로 하는, 신경염증성 질환의 예방 또는 치료용 약학적 조성물.According to claim 1, wherein the PTP inhibitor is characterized in that to exhibit an inhibitory effect of neuro-inflammatory by reducing Src activity, a pharmaceutical composition for the prevention or treatment of neuro-inflammatory diseases.
  8. PTP 억제제를 포함하는 신경염증성 질환의 개선용 식품 조성물.Food composition for improving neuroinflammatory diseases comprising a PTP inhibitor.
PCT/KR2016/012746 2015-11-06 2016-11-07 Composition for prevention or treatment of neuroinflammatory disease, containing protein tyrosine phosphatase inhibitor WO2017078499A2 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US15/773,928 US20180325925A1 (en) 2015-11-06 2016-11-07 Composition for prevention or treatment of neuroinflammatory disease, containing protein tyrosine phosphatase inhibitor
US16/998,867 US20200384001A1 (en) 2015-11-06 2020-08-20 Composition for prevention or treatment of neuroinflammatory disease, containing protein tyrosine phosphatase

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20150155961 2015-11-06
KR10-2015-0155961 2015-11-06
KR10-2016-0147537 2016-11-07
KR1020160147537A KR101826690B1 (en) 2015-11-06 2016-11-07 Composition for preventing or treating of neuroinflammatory disease containing PTP(protein tyrosine phosphatase) inhibitor

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US15/773,928 A-371-Of-International US20180325925A1 (en) 2015-11-06 2016-11-07 Composition for prevention or treatment of neuroinflammatory disease, containing protein tyrosine phosphatase inhibitor
US16/998,867 Division US20200384001A1 (en) 2015-11-06 2020-08-20 Composition for prevention or treatment of neuroinflammatory disease, containing protein tyrosine phosphatase

Publications (2)

Publication Number Publication Date
WO2017078499A2 true WO2017078499A2 (en) 2017-05-11
WO2017078499A3 WO2017078499A3 (en) 2017-06-22

Family

ID=58663051

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2016/012746 WO2017078499A2 (en) 2015-11-06 2016-11-07 Composition for prevention or treatment of neuroinflammatory disease, containing protein tyrosine phosphatase inhibitor

Country Status (1)

Country Link
WO (1) WO2017078499A2 (en)

Cited By (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020180768A1 (en) 2019-03-01 2020-09-10 Revolution Medicines, Inc. Bicyclic heteroaryl compounds and uses thereof
WO2020180770A1 (en) 2019-03-01 2020-09-10 Revolution Medicines, Inc. Bicyclic heterocyclyl compounds and uses thereof
US10851073B2 (en) 2019-03-14 2020-12-01 Abbvie Inc. Protein tyrosine phosphatase inhibitors and methods of use thereof
US10954202B2 (en) 2018-06-21 2021-03-23 Abbvie Inc. Protein tyrosine phosphatase inhibitors and methods of use thereof
WO2021091956A1 (en) 2019-11-04 2021-05-14 Revolution Medicines, Inc. Ras inhibitors
WO2021091982A1 (en) 2019-11-04 2021-05-14 Revolution Medicines, Inc. Ras inhibitors
WO2021092115A1 (en) 2019-11-08 2021-05-14 Revolution Medicines, Inc. Bicyclic heteroaryl compounds and uses thereof
WO2021091967A1 (en) 2019-11-04 2021-05-14 Revolution Medicines, Inc. Ras inhibitors
WO2021108683A1 (en) 2019-11-27 2021-06-03 Revolution Medicines, Inc. Covalent ras inhibitors and uses thereof
WO2021257736A1 (en) 2020-06-18 2021-12-23 Revolution Medicines, Inc. Methods for delaying, preventing, and treating acquired resistance to ras inhibitors
WO2022060583A1 (en) 2020-09-03 2022-03-24 Revolution Medicines, Inc. Use of sos1 inhibitors to treat malignancies with shp2 mutations
WO2022060836A1 (en) 2020-09-15 2022-03-24 Revolution Medicines, Inc. Indole derivatives as ras inhibitors in the treatment of cancer
WO2022140427A1 (en) 2020-12-22 2022-06-30 Qilu Regor Therapeutics Inc. Sos1 inhibitors and uses thereof
WO2022235870A1 (en) 2021-05-05 2022-11-10 Revolution Medicines, Inc. Ras inhibitors for the treatment of cancer
WO2022235866A1 (en) 2021-05-05 2022-11-10 Revolution Medicines, Inc. Covalent ras inhibitors and uses thereof
WO2022235864A1 (en) 2021-05-05 2022-11-10 Revolution Medicines, Inc. Ras inhibitors
WO2023060253A1 (en) 2021-10-08 2023-04-13 Revolution Medicines, Inc. Ras inhibitors
WO2023172940A1 (en) 2022-03-08 2023-09-14 Revolution Medicines, Inc. Methods for treating immune refractory lung cancer
WO2023240263A1 (en) 2022-06-10 2023-12-14 Revolution Medicines, Inc. Macrocyclic ras inhibitors

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2002506055A (en) * 1998-03-12 2002-02-26 ノボ ノルディスク アクティーゼルスカブ Regulator of protein tyrosine phosphatase (PTPase)
CN1747936A (en) * 2003-02-12 2006-03-15 特兰斯泰克制药公司 Substituted azole derivatives as therapeutic agents
JP4018610B2 (en) * 2003-09-12 2007-12-05 株式会社サン・クロレラ Tyrosine phosphatase inhibitor
UA94921C2 (en) * 2005-12-08 2011-06-25 Новартис Аг 1-orthofluorophenyl substituted 1, 2, 5-thiazolidinedione derivatives as ptp-as inhibitors
EP2227245A2 (en) * 2007-11-30 2010-09-15 Novartis AG Combination of protein tyrosine phosphatase inhibitors and human growth hormone for the treatment of muscle atrophy and related disorders
KR101646725B1 (en) * 2012-09-24 2016-08-09 한양대학교 산학협력단 Pharmaceutical composition for treating or preventing protein tyrosine phosphatase sigma mediated disease

Cited By (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10954202B2 (en) 2018-06-21 2021-03-23 Abbvie Inc. Protein tyrosine phosphatase inhibitors and methods of use thereof
WO2020180768A1 (en) 2019-03-01 2020-09-10 Revolution Medicines, Inc. Bicyclic heteroaryl compounds and uses thereof
WO2020180770A1 (en) 2019-03-01 2020-09-10 Revolution Medicines, Inc. Bicyclic heterocyclyl compounds and uses thereof
US10851073B2 (en) 2019-03-14 2020-12-01 Abbvie Inc. Protein tyrosine phosphatase inhibitors and methods of use thereof
WO2021091956A1 (en) 2019-11-04 2021-05-14 Revolution Medicines, Inc. Ras inhibitors
WO2021091982A1 (en) 2019-11-04 2021-05-14 Revolution Medicines, Inc. Ras inhibitors
WO2021091967A1 (en) 2019-11-04 2021-05-14 Revolution Medicines, Inc. Ras inhibitors
WO2021092115A1 (en) 2019-11-08 2021-05-14 Revolution Medicines, Inc. Bicyclic heteroaryl compounds and uses thereof
US11168102B1 (en) 2019-11-08 2021-11-09 Revolution Medicines, Inc. Bicyclic heteroaryl compounds and uses thereof
WO2021108683A1 (en) 2019-11-27 2021-06-03 Revolution Medicines, Inc. Covalent ras inhibitors and uses thereof
WO2021257736A1 (en) 2020-06-18 2021-12-23 Revolution Medicines, Inc. Methods for delaying, preventing, and treating acquired resistance to ras inhibitors
WO2022060583A1 (en) 2020-09-03 2022-03-24 Revolution Medicines, Inc. Use of sos1 inhibitors to treat malignancies with shp2 mutations
WO2022060836A1 (en) 2020-09-15 2022-03-24 Revolution Medicines, Inc. Indole derivatives as ras inhibitors in the treatment of cancer
WO2022140427A1 (en) 2020-12-22 2022-06-30 Qilu Regor Therapeutics Inc. Sos1 inhibitors and uses thereof
WO2022235870A1 (en) 2021-05-05 2022-11-10 Revolution Medicines, Inc. Ras inhibitors for the treatment of cancer
WO2022235866A1 (en) 2021-05-05 2022-11-10 Revolution Medicines, Inc. Covalent ras inhibitors and uses thereof
WO2022235864A1 (en) 2021-05-05 2022-11-10 Revolution Medicines, Inc. Ras inhibitors
WO2023060253A1 (en) 2021-10-08 2023-04-13 Revolution Medicines, Inc. Ras inhibitors
WO2023172940A1 (en) 2022-03-08 2023-09-14 Revolution Medicines, Inc. Methods for treating immune refractory lung cancer
WO2023240263A1 (en) 2022-06-10 2023-12-14 Revolution Medicines, Inc. Macrocyclic ras inhibitors

Also Published As

Publication number Publication date
WO2017078499A3 (en) 2017-06-22

Similar Documents

Publication Publication Date Title
WO2017078499A2 (en) Composition for prevention or treatment of neuroinflammatory disease, containing protein tyrosine phosphatase inhibitor
WO2017007162A1 (en) Azelaic acid composition having adipose tissue triglyceride degradation effect
WO2021261632A1 (en) Novel faecalibacterium prausnitzii strain eb-fpdk11 and use thereof
WO2019093673A2 (en) Pharmaceutical composition for preventing or treating bone disease
WO2019231220A1 (en) Use of 2,3,5-substituted thiophene compound to prevent, ameliorate, or treat breast cancers
WO2018088862A1 (en) Pharmaceutical composition for preventing or treating neurodegenerative diseases which includes flower extract of daphne genkwa or fractions thereof as active ingredient
WO2020141828A2 (en) Anticancer compositions comprising immune checkpoint inhibitors
WO2012064159A2 (en) Anticancer composition
WO2020040382A1 (en) Novel magnesium-serinate compound and use thereof
WO1998002149A2 (en) Use of idebenone and analogues against beta amyloid induced cytotoxicity
WO2020116810A1 (en) Pharmaceutical composition, comprising inhibitory peptide against fas signaling, for prevention or treatment of obesity, fatty liver, or steatohepatitis
WO2018190511A1 (en) Pharmaceutical composition containing dusp1 inhibitor
WO2021033995A1 (en) Composition comprising amomum tsaoko extract for prevention, alleviation, or treatment of sarcopenia-related disease
WO2018208107A1 (en) Composition for alleviating, preventing, or treating somnipathy or composition for suppressing resistance to benzodiazepine binding site agonist of gaba-a receptor or for alleviating side-effect of benzodiazepine binding site agonist of gaba-a receptor, each composition comprising phloroglucinol as effective ingredient
WO2022163971A1 (en) Composite pharmaceutical composition for treatment of brain disease, comprising cholinesterase inhibitor and antioxidant
WO2021261631A1 (en) Novel picalibacterium prosnich eb-fpdk9 strain and uses thereof
WO2015102205A1 (en) Pharmaceutical composition for preventing or treating cancer, containing proteasome inhibitor and loperamide as active ingredients
WO2015108372A1 (en) Composition for preventing or treating neurological disorders caused by excitotoxicity or synaptic dysfunction, containing osmotin, and method for preventing or treating neurological disorders by using same
WO2015199454A1 (en) Receptor tyrosine kinase inhibitor-resistant anticancer drug composition comprising 3,4,5-trihydroxybenzoic acid, derivative thereof or salt thereof as active ingredient
WO2015111971A1 (en) Pharmaceutical composition containing gpr119 ligand as active ingredient for preventing or treating non-alcoholic fatty liver disease
WO2017014545A1 (en) Pharmaceutical composition for treating parkinson's disease and inhibiting side effects of levodopa, containing melanin concentrating hormone as active ingredient
WO2011059294A2 (en) Anticancer and immunity-enhancing composition containing morphinan alkaloids as active ingredients
WO2020111325A1 (en) Pharmaceutical composition for preventing or treating cancer, containing activation inhibitor of plk1 as active ingredient
WO2020130208A1 (en) Dietary control composition comprising ecklonia cava extract and preparation method therefor
EP3880190A1 (en) Anticancer composition

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16862514

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase in:

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 15773928

Country of ref document: US

122 Ep: pct application non-entry in european phase

Ref document number: 16862514

Country of ref document: EP

Kind code of ref document: A2