WO2017067942A1 - Detection of microbial pathogens related to bacterial infections through amplification especially by rt-lamp - Google Patents

Detection of microbial pathogens related to bacterial infections through amplification especially by rt-lamp Download PDF

Info

Publication number
WO2017067942A1
WO2017067942A1 PCT/EP2016/074999 EP2016074999W WO2017067942A1 WO 2017067942 A1 WO2017067942 A1 WO 2017067942A1 EP 2016074999 W EP2016074999 W EP 2016074999W WO 2017067942 A1 WO2017067942 A1 WO 2017067942A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
nos
set consisting
primer set
primer
Prior art date
Application number
PCT/EP2016/074999
Other languages
French (fr)
Inventor
Jean-Claude Manuguerra
Aurelia KWASIBORSKI
Jessica VANHOMWEGEN
Original Assignee
Institut Pasteur
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institut Pasteur filed Critical Institut Pasteur
Publication of WO2017067942A1 publication Critical patent/WO2017067942A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the invention is in the field of the detection of microbial pathogens related to bacterial infections. More particularly, the invention relates to methods and products, particularly primers, for the simultaneous or individual detection of Salmonella spp., Staphylococcus aureus and/or Streptococcus pneumoniae, Haemophilus influenzae and/or Escherichia coli, in particular for performing this detection using isothermal amplification of specific genes of these pathogens, and more particularly using loop-mediated isothermal amplification (LAMP), either as end-point assay or as real-time LAMP assays.
  • LAMP loop-mediated isothermal amplification
  • the invention also comprises specific nucleic acid extraction procedures suitable in particular for the in vitro testing of bacterial nucleic acid in whole blood samples, in particular whole human blood.
  • the inventors have identified a need for a rapid and convenient test for bacterial infections particularly suitable to detect most major childhood bacterial infections and in particular those common in sub-Saharan African children.
  • a test should be suited for in- field testing or point-of-care (POC) testing.
  • POC point-of-care
  • such test should not require highly trained personnel, expensive, high power-consuming or heavy material; such test should be rapid enough to enable POC testing and/or for high-throughput testing, in addition to being sufficiently specific and sensitive.
  • enteric bacteria may be as important as those bacteria more usually associated with respiratory disease among children presenting with a clinical picture of pneumoniae during the wet season or in children with measles, malnutrition and other immunocompromised states.
  • S. pneumoniae, H influenzae and S. aureus have consistently been reported as the major bacterial causes of pneumoniae in developing countries, these bacteria are also among the most common meningeal pathogens in infants and small children.
  • NTS non-typhoidal Salmonella
  • S. enterica serotype Typhi represented less than 1% of the isolates in children presenting with bacteremia. Only on rare occasions and in specific settings (i.e. non- endemic area for malaria) has S. Typhi been identified among the most important pathogens recovered from bacteriemic children.
  • nucleic acid testing for infectious diseases at the point of care (POC) can provide access to much-needed diagnostic methods in low-resource, high disease-burden areas, especially for applications requiring fast turnaround times.
  • Tests available from the prior art include in particular molecular testing (testing for the presence of bacterial nucleic acid) and more particularly polymerase chain reaction (PCR) tests. Although they allow for relatively fast, specific and sensitive results, such tests suffer major drawbacks for the sought applications. Chief among these drawbacks is the requirement for specific training and material, such tests requiring in particular thermal cycling in order to achieve amplification of the target nucleic acids, through the use of a thermal cycler.
  • PCR tests are commonly very sensitive to various contaminants of the nucleic acid sample, which inhibit the activity of the polymerase, such contaminants being commonly found in blood. PCR tests therefore require complex nucleic acid extraction procedures and/or perform unreliably.
  • POC devices should be affordable, robust and easy to use by minimally trained personnel, with stable, ready-to-use reagents, simple, maintenance-free instrumentation, and clear, actionable results, in addition to being suitably sensitive and specific.
  • LAMP loop-mediated isothermal amplification
  • S. enterica Typhi and non-Typhi serotypes.
  • LAMP assays have been developed to target Salmonella spp. genes invA, phoP and fimY or specific Salmonella serogroup/type gene regions including prt (rfbS), rfbJ, Sdfl, recF and SPA3440 with analytical sensitivities up to 10 cfu / mL sample, 4 genome copies per reaction or 76 fg DNA per reaction.
  • S. aureus LAMP assays have been developed to target the S. aureus femA, arc, spa or rrs genes, enterotoxin genes entA-D or drug-resistance genes mecA, qacA/B and cfr with analytical sensitivities up to 100 cfu / mL sample or 100 fg DNA per reaction.
  • E. coli LAMP assays have been developed to target E. coli housekeeping genes including malB, specific E.
  • coli pathotype VTEC/STEC, EHEC, ETEC, EAggEC, EIEC genes including stxl, stx2, eae, ipaH, aggR, rfbE, LTI, STI and F5 fimbriae protein gene, specific E. coli serogroup/type gene regions including wzx, wzy or fliC or resistance genes including £/a N DM-i and blci K? c- These assays have demonstrated analytical sensitivities up to 24 cfu / mL sample, 10 copies per reaction or 8,6 fg DNA per ⁇ .
  • H. influenzae. LAMP assays have been developed to target H. influenzae genes including bexA, pal and rrs, with analytical sensitivities up to 100 cfu / mL sample or 10 genome copies per reaction.
  • S. pneumoniae [17] S. pneumoniae. Studies have shown that the magnitude of S. pneumoniae bacteremia correlated with the severity of the infection: patients with greater than or equal to 100 colony- forming units (CFU) per mL were significantly more likely to have meningitis. On the other hand, all patients with S. pneumoniae bacteremia with colony counts lower than 15 CFU per mL had occult bacteremia with no focus of infection. S. pneumoniae DNA can be detected in whole blood, serum, plasma and the buffy coat. The type of blood specimen used does not seem to impact DNA detection performance.
  • CFU colony- forming units
  • S. aureus A study on bacteremia in childhood demonstrated a concentration in S. aureus bacteria of 50 CFU/mL. S. aureus DNA can be detected in whole blood, serum, plasma and buffy coat. Whole blood results in maximum DNA detection as opposed to cell-associated bacteria (in WBCs) or free bacterial DNA in plasma.
  • Salmonella spp. (Typhi and non-Typhi serotypes). Analysis of typhoid patients showed that children ( ⁇ 15 years old) had higher median blood S. enterica serotype Typhi counts than adults: 1.5 (range, ⁇ 0.3 to 387) versus 0.6 (range, ⁇ 0.3 to 17.7) CFU/ml. However, after an extensive review of the literature, we were not able to find quantitative data on the number of NTS that can be found in blood during bacteremiac episodes in children. Gordon et al. have shown that NTS in bacteremic HIV-infected adults are present at a similarly low concentration (1 CFU/ml) (Gordon et al, 2010). Salmonella spp.
  • DNA can be detected in whole blood, serum, plasma and buffy coat.
  • the principal difference between systemic infection with Salmonellae and that with other Enterobacteriaceae is that two-thirds of the bacteria in the circulatory system are located within phagocytic cells, where they remain viable (S. Typhi is able to survive and reproduce inside monocytic phagocytes, and in typhoid fever S. Typhi is reported to be confined to the monocyte- platelet fraction of the blood). Thus, the most adequate specimens for detection of those bacteria appear to be buffy coat or whole-blood.
  • E. Coli In neonatal E. coli sepsis, Dietzman et al. demonstrated that 78% of patients had >5 CFU/ml of blood and one-third had bacterial counts in excess of 1,000 CFU/ml (Dietzman, Fischer, et Schoenknecht 1974). E.coli DNA can be detected in whole blood, serum, plasma and buffy coat. Analysis of plasma samples showed a 10- to 100-fold reduction of bacterial 23S rDNA in comparison to the corresponding whole blood specimens, thus indicating that whole blood is the preferential sample type to be used in PCR protocols.
  • H. influenzae Studies performed in children with bacteremic diseases caused by encapsulated bacteria (H. influenzae type b) have shown bacterial counts higher than 30 CFU/ml in 73% of the patients. H. influenzae genomic DNA can be detected in whole blood, serum or plasma.
  • extraction from anticoagulant-treated whole-blood samples provides a higher number of possible target bacteria than methods using serum and plasma, thus potentially improving the overall sensitivity.
  • sample volume as little as 1 mL of blood should be considered adequate in most cases.
  • LAMP assays remained sensitive and specific despite the addition of untreated biological fluids (such as stool, urine or blood) that commonly inhibit PCR amplification. Whereas the detection of microorganisms from whole blood or a blood-culture medium typically requires extensive sample purification and removal of inhibitors, LAMP amplification remained more sensitive than conventional qPCR when omitting such preparatory steps.
  • inertial micro fluidics has gained some attention for high-throughput separation of blood volumes in the milliliter range.
  • Alternative microfiuidic devices have used electrokinetic or dielectrophoretic capture of bacterial cells.
  • paper-machine practically a portable, paper-based device, was described that allows performing LAMP reactions for the detection E. coli malB gene in a format suitable for field applications (Connelly et al., 2015).
  • the inventors have therefore developed and validated testing procedures and products used therein which allow the simultaneous, isothermal detection of infection by several bacterial species including the most commonly found severe disease-provoking bacteria in sub-Saharan African children, with minimal sample preparation and specificity relative to non-pathogenic bacteria yet capable of detecting all or most strains of pathogenic bacteria.
  • these tests comprise the use of LAMP assays for amplification of the nucleic acids and in particular the use of real-time LAMP assays.
  • the methods provided herein allow the detection of at least one, preferably at least two and most preferably at least three, four or five pathogenic bacterial species, including species selected among the group consisting of Salmonella spp., Staphylococcus aureus and Streptococcus pneumoniae.
  • the methods provided herein allow the detection of at least one, preferably at least two and most preferably at least three, four or five pathogenic bacterial species, including species selected among the group consisting of Salmonella spp., Staphylococcus aureus, Streptococcus pneumoniae, Haemophilus influenzae and Escherichia coli.
  • the methods provided herein allow the detection of at least one, preferably at least two and most preferably all three bacterial species selected from the group consisting of Salmonella spp., Staphylococcus aureus and Streptococcus pneumoniae.
  • the methods provided herein allow the detection of at least one, preferably at least two, at least three or at least four and most preferably all five bacterial species selected from the group consisting of Salmonella spp., Staphylococcus aureus, Streptococcus pneumoniae, Haemophilus, influenzae and Escherichia coli.
  • the invention therefore provides methods of in vitro testing for the presence of bacterial nucleic acid from one or more bacterial species on a sample obtained from a subject, in particular a human subject, in particular wherein the method comprises steps of isothermal amplification of nucleic acids.
  • the invention further provides methods for in vitro testing comprising the steps of preparing the samples, in particular the steps of extracting nucleic acid, suitable for preparing samples obtained from the subject for testing using the provided in vitro assays.
  • the invention further provides such methods for simultaneous testing of the presence of bacterial nucleic acid, wherein the presence of more than one gene region is tested, in particular gene regions from at least two distinct genes, in particular from at least two distinct bacterial species and preferably from at least three or four distinct bacterial species and most preferably from at least five distinct bacterial species.
  • Methods for simultaneous testing are provided in particular wherein the steps of preparation of the samples, in particular of nucleic acid extraction, are performed only once per sample in which more than one region is tested and/or wherein the steps of isothermal amplification of nucleic acids are performed in similar conditions for all the tested gene regions, preferably conditions that are identical except for the primer sets used for the steps of amplification.
  • the invention further provides products, in particular primers, particularly suitable for these in vitro testing methods.
  • the products are provided in particular as individual primers, as combinations of primers, in particular as sets of primers suitable for amplification of nucleic acids of a given gene regions, in particular a set of six primers (six-primer set) suitable for amplifying a given gene region in a LAMP assay and/or as kits comprising primers or primer combinations as above and / or other products required for carrying out the methods above.
  • the products are provided in particular for use in the methods above.
  • the products, particular primers and primer sets are also particularly provided for use in the manufacturing of kits for use in the methods above.
  • the above products and methods are provided herein for the in vitro detection of a bacterial infection. More particularly, the above products and methods are provided herein for in vitro diagnostics. Alternatively, the above products and methods are provided for use in procedures which do not result in diagnostics (e.g. testing for contamination of food products, environmental testing, ). [30] In particular, provided herein are any of the above methods and products, wherein the tested bacterial species are selected from the group consisting of Salmonella spp., Staphylococcus aureus and Streptococcus pneumoniae.
  • any of the above methods and products wherein one of these bacterial species is tested for, wherein two of these bacterial species are tested for, or wherein all three of these bacterial species are tested for.
  • the tested bacterial species are selected from the group consisting of Salmonella spp., Staphylococcus aureus, Streptococcus pneumoniae, Haemophilus influenzae and Escherichia coli.
  • any of the above methods and products wherein one of these bacterial species is tested for, wherein two of these bacterial species are tested for, wherein three of these bacterial species are tested for, wherein four of these bacterial species are tested for, or wherein all five of these bacterial species are tested for.
  • sample is from a human subject, in particular a human child.
  • sample consists of or comprises blood from the subject, or a blood extract from said subject, and in particular wherein the sample is whole blood.
  • nucleic acids are amplified using isothermal nucleic acid amplification, in particular LAMP, and more particularly real-time LAMP. More particularly, provided herein are any of the above methods and products, wherein the detection is performed by an end-point assay and any of the above methods and products, wherein the detection is performed by a real-time assay, in particular a realtime quantitative assay.
  • any of the above methods and products wherein a combination of six primers is used for the detection of one bacterial species.
  • a combination of primers in particular a combination of six primers, allows the detection of a gene selected among the following: the invasion protein invA, the transcriptional regulator phoP, the pathogenicity 1 island effector protein prgK and the tetrathionate reductase ttrR genes from S. enterica, the the aminoacyltransferase femA, the carbamate kinase arcC and the nuclease nuc genes from S.
  • the primers are selected, individually or in combination, from the group consisting of the primers disclosed in Table 1, Table 2, Table 3, Table 4 and Table 5, namely the group consisting of primers specific for the invA gene of Salmonella spp., in particular of S.
  • enterica i.e. the subgroup consisting of SEQ ID Nos: 1 to 6, the subgroup consisting of SEQ ID Nos: 7 to 12, the subgroup consisting of SEQ ID Nos: 13 to 18; primers specific for the phoP gene of Salmonella spp., in particular of S. enterica, i.e. the subgroup consisting of SEQ ID Nos: 19 to 24, the subgroup consisting of SEQ ID Nos: 25 to 30, the subgroup consisting of SEQ ID Nos: 31 to 36; primers specific for the prgK gene of Salmonella spp., in particular of S. enterica, i.e.
  • a particularly preferred combination of primer consists of one or several sets of six primers, each set consisting of one of the subgroups disclosed above.
  • FIG. 1 Visual inspection of LAMP amplified products of S. enterica DNA carried out with invA primers.
  • Lanes 1, 2, and 3 LAMP carried out with invA primers in the presence of 100 pg, 10 pg and 1 pg of genomic DNA from S. enterica strain CIP 60.62T, respectively; lane NC: negative control.
  • E E
  • F due to representation in greyscale the difference between tubes 1 and 2 and the negative control tube is not readily observable; nevertheless, the difference in color was striking in the original experience, as it is in the original color photography of which the present figure is a reproduction: the color was clearly yellow in tubes 1 and 2, while it was either pink (in (E)) or purple (in (F)) in the NC tube.
  • LAMP on S. enterica DNA was carried out with invA primers using the ISO001 Mastermix.
  • Curves 1, 2, and 3 LAMP carried out with invA primers in triplicate in the presence of 10 pg, 1 pg and 0.1 pg of genomic DNA from S. enterica strain CIP 60.62T, respectively; curve NC: negative control.
  • a bacterial infection is defined as the presence of bacteria, in particular living bacteria, in an organism, in particular a mammal and more particularly a human subject. "An infection 'in' a subject” or “an infection Of a subject” are used interchangeably herein.
  • the presence of bacteria in some compartments or tissues of the organism may be considered unrelated to pathology, e.g. on the skin or in the digestive tract, in which case an infection only designates the presence of bacteria in said organism, outside of such tissues and compartments.
  • an infection refers to the state of an individual, i.e. an entire organism. Therefore, as used herein "detecting an infection in a sample of an individual" must be understood as detecting an infection of said individual, using a sample obtained from said individual for the testing procedure and corresponding meanings are conveyed by similar expressions. As provided, the sample is implicitly one suitable for detecting an infection, i.e. a fraction of a tissue or compartment wherein the detection of bacteria is indicative of an infection, rather than one wherein such detection is clinically insignificant.
  • a bacterial infection refers more particularly to an infection by a bacterial species selected among the group consisting of Salmonella spp., Staphylococcus aureus, Streptococcus pneumoniae, Haemophilus influenzae and Escherichia coli.
  • a bacterial infection may refer more particularly herein to an infection by a bacterial species selected among the group consisting of: Salmonella spp., Staphylococcus aureus and Streptococcus pneumoniae.
  • Salmonella spp. all species (e.g. S. enterica, S. bongori, ...), subspecies (e.g. S. enterica subsp. enterica, S. enterica subsp.
  • serotypes e.g. S. enterica subsp. enterica serotype Typhi, designated herein S. enterica Typhi following common usage
  • S. enterica Typhi in particular all known pathogenic strains
  • NTS non-Typhi serotypes of the Salmonella enterica subsp. enterica, e.g. S. enterica subsp. enterica serotype Typhimurium, S.enterica subsp. enterica serotype Enteritidis,...) and S. enterica Typhi, as well as unspecified Salmonella spp., and in particular all strains disclosed in Table 19.
  • Salmonella spp may be referred to as if it were a single species (in particular using singular rather than plural forms as in 'the specie Salmonella spp'), yet it is explicitly provided that all species belonging to Salmonella spp are included in the term.
  • all strains in particular all known pathogenic strains, and in particular methicillin-resistant strains, are contemplated, and in particular all strains disclosed in Table 21.
  • all strains in particular all known pathogenic strains of any serotype, are contemplated, and in particular all strains disclosed in Table 20.
  • bacterial species H When referring to bacterial species H.
  • influenzae all strains, in particular all known pathogenic strains of any serotype, are contemplated, and in particular all strains disclosed in Table 22.
  • all strains, in particular all known pathogenic strains of any serotype are contemplated, and in particular all strains disclosed in Table 23.
  • any of the methods or products herein may be suitable for the detection of all known pathogenic Salmonella spp. strains, and in particular the strains listed in Table 19.
  • any of the methods or products herein may be suitable for the detection of all known pathogenic S. aureus strains, and in particular the strains listed in table Table 21.
  • any of the methods or products herein may be suitable for the detection of all known pathogenic S. pneumoniae strains, and in particular the strains listed in table Table 20.
  • any of the methods or products herein may be suitable for the detection of all known pathogenic H. influenzae strains, and in particular the strains listed in table Table 22.
  • any of the methods or products herein may be suitable for the detection of all known pathogenic E. coli strains, and in particular the strains listed in Table 23.
  • Molecular testing for the presence of bacterial nucleic acid may lead to false positive results (conclusion that bacterial nucleic acid is present when in fact it is not) due to the presence of bacteria from other species than the targeted species, in particular from related species, with sufficiently homologous nucleic acid sequences. This is preferably avoided, as infection with distinct species have distinct clinical outcome and handling. Therefore, the products and methods provided herein are preferably capable of providing negative results when the tested bacteria are absent, but other bacteria are present, in particular other bacteria from closely related species and in particular bacteria listed in Table 12, Table 13, Table 14, Table 15 or Table 16. It may be said herein that such methods and products "do not detect" said other bacteria.
  • products and methods provided herein may detect all of the pathogenic strains of a given bacterial species and do not detect any of the related bacterial species, in particular they may detect all of the strains listed in Table 19 and none of the strains of Table 12 and/or all of the strains of Table 21 and none of the strains of Table 13 and/or all of the strains of Table 20 and none of the strains of Table 14 and/or all of the strains of Table 22 and none of the strains of Table 15 and/or all of the strains of Table 23 and none of the strains of Table 16.
  • Bacterial nucleic acid refers to any nucleic acid originating from bacteria, including in particular DNA and R A, including in particular genomic DNA.
  • the expression refers in particular to nucleic acid from the following bacterial genes: the invA, phoP, prgK and ttrR genes from S. enterica, the femA, arcC and nuc genes from S. aureus, the lytA gene from S. pneumoniae, the hpd gene from H.
  • detecting is used with the same meaning as "testing for the presence of, which may be understood in the same manner than "testing for the presence or absence of.
  • "detecting" or “testing for the presence of may comprise determining (or estimating) the amount present.
  • the most significant and/or sought for conclusion is the absence of all of the tested bacterial species (and/or bacterial nucleic acids and/or genes and/or gene regions) in the sample (and/or the individual providing the sample).
  • Such a method is explicitly provided when referring herein to a method of detecting the bacterial species or a method of detecting the presence of the bacterial species (and/or of bacterial nucleic acids, etc) or other similar expressions.
  • the element which is tested for (of which the presence and/or amount is sought) is referred to as the analyte.
  • the analyte is concretely a specific region in a gene of a bacteria, but the term analyte may be used, as understood in its context, to designate the gene or nucleic acid of the bacteria or the bacteria (as the presence of a gene region implies the presence of the gene, which in turn implies the presence of nucleic acid of the bacteria and of the bacteria).
  • 'a method suitable for the detection of several given analytes' refers to 'a method suitable for the detection of the presence of at least one of the given analytes', regardless of whether the method readout allows the distinction of the analytes, if at least one is present. Such a method will provide a positive detection result if any one of the given analytes is present (including if more than one analytes are present, in any combination) and a negative result if none of the analytes are present.
  • wordings such as 'method for the detection of one or more of three bacterial species', which designates a method allowing to distinguish whether none of the three bacterial species is present or whether at least one specie is present, or implicit in more concise wordings such as 'method for the detection of three bacterial species' which is used with the same meaning.
  • wordings such as 'method for the detection of one or more of five bacterial species' designate a method allowing to distinguish whether none of the five bacterial species is present or whether at least one specie is present, and more concise wordings such as 'method for the detection of five bacterial species' are used with the same meaning.
  • 'methods for the detection of at least two bacterial species' is used herein to designate collectively 'methods for the detection of two bacterial species' (i.e. for detection of the presence of one or more of the two species), 'methods for the detection of three bacterial species' (i.e. for detection of the presence of one or more of the three species), methods for the detection of four bacterial species (i.e. for detection of the presence of one or more of the four species), methods for the detection of five bacterial species (i.e. for detection of the presence of one or more of the five species), and methods for the detection of more than five bacterial species.
  • a method of detecting [the presence of] a gene region is a particular method of detecting [the presence of] a gene, which in turn is a particular method of detecting [the presence of] a bacterial nucleic acid, which in turn may be a particular method of detecting [the presence of] a bacteria and/or of an infection by a bacteria.
  • a method of detecting [the presence of] a gene region is a particular method of detecting [the presence of] a gene, which in turn is a particular method of detecting [the presence of] a bacterial nucleic acid, which in turn may be a particular method of detecting [the presence of] a bacteria and/or of an infection by a bacteria.
  • the nucleic acid may be detected in particular as intact genomic DNA, in particular genomic DNA present in viable bacteria in the sample and / or as free DNA, in particular sheared genomic DNA, e.g. resulting from bacterial lysis.
  • primers are specific for a sequence of said gene in said bacterial species.
  • the primers must allow specific detection of single species of bacteria, excluding closely related species, and must allow for the detection of all or most strains of the target species, taking in account genetic variation between said strains.
  • a primer having the sequence of SEQ ID No:xx designate either (i) a primer of which the sequence consists of the sequence provided in the sequence listing with the relevant ID (the listed sequence) and in particular which has the exact length of the listed sequence, or (ii) a primer of which the sequence comprises the listed sequence and optionally additional nucleotides (also called variant primers if necessary to distinguish them from their respective originally specified primers having the described sequences of SEQ ID No:xx), e.g.
  • primers encompassed within the definitions of the primers, combinations of primers, primer sets and their uses according to the present invention are those which distinguish from the sequences of SED ID No:xx provided herein by the addition of up to 20 consecutive nucleotides (any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20), preferably up to 15 nucleotides (any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15) up to 10 nucleotides (any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10) or up to 5 nucleotides (any of 1, 2, 3, 4, 5) of the 5 ' and/or 3' flanking sequence in the region of the gene to be amplified using the original primer having the sequence of SED ID No:xx.
  • the preferred primers provided herein in particular for use in LAMP applications are primers of (i) above, i.e. have the exact length of the listed sequence.
  • a primer with the reverse complementary sequence of a primer provided herein (or a combination of primers, each having a reverse complementary sequence of a primer provided herein, or some of the primers within the combination having a reverse complementary sequence of a primer provided herein) may be used with similar effect as the primer (or combination of primers) provided herein.
  • Such reverse complementary primers are therefore also provided herein.
  • the primer with the reverse complementary sequence (or use thereof) is also provided, where suitable.
  • primers bind to a given sequence in a given gene region of a given bacterial species and the sequence is usually specific to said gene region and gene and bacterial species (and common to all the bacteria of the given species, which all possess said gene region and gene). Therefore, said primer may be said to be specific to said gene region, and/or said gene and/or said bacterial species.
  • primers which usually will also be specific, the specificity of amplification is increased relative to the specificity of each individual primer, i.e.
  • the other primers in the primer set are likely not to bind to any sequence of the alternative sequences/regions (or at least not in a configuration relative to the other primer(s) allowing amplification), and no amplification of said alternative sequence/region will occur.
  • the specificity referred here must be understood to be relative in particular to any, and preferably to all, other bacterial species (or nucleic acid thereof), in particular non-pathogenic bacteria, more preferably relative to all other microbiological organisms or entities and more preferably to all other nucleic acid sequences likely to be found in a sample of the tested subject.
  • the individual primers and primer sets provided herein are specific of the indicated gene region, of the indicated gene, of the indicated bacterial species in particular relative to other gene regions, genes and/or bacterial species and particularly of all other bacterial species and more particularly of all other nucleic acid sequences likely to be found in a blood sample of a human individual.
  • the individual primers and primer sets provided herein do not allow amplification of any nucleic acid from a sample, in particular a blood sample, obtained from an individual which does not present an infection by any of the tested bacteria.
  • primers selected, individually or in combination, from the group consisting of the primers disclosed in Table 1, Table 2, Table 3, Table 4 and Table 5, namely the group consisting of primers specific for the invA gene of Salmonella spp. (in particular S. enterica), primers specific for the phoP gene of Salmonella spp. (in particular S. enterica), primers specific for the prgK gene of Salmonella spp. (in particular S. enterica), primers specific for the ttrR gene of Salmonella spp. (in particular S. enterica), primers specific for the lytA gene of S. pneumoniae, primers specific for the ply gene of S.
  • primers selected, individually or in combination, from the group consisting of the primers disclosed in Table 1, Table 2, Table 3, Table 4 and Table 5, namely the group consisting of primers specific for the invA gene of Salmonella spp. (in particular S. enterica), primers specific for the phoP gene of Salmonella spp. (in particular S. enterica), primers
  • primers specific for the invA gene of Salmonella spp. consist of SEQ ID Nos: 1 to 18, consisting of the subgroup consisting of SEQ ID Nos: 1 to 6, the subgroup consisting of
  • primers specific for the phoP gene of Salmonella spp. consist of SEQ ID Nos: 19 to 36, consisting of the subgroup consisting of SEQ ID Nos: 19 to 24, the subgroup consisting of
  • primers specific for the prgK gene of Salmonella spp. consist of SEQ ID Nos: 37 to 60, consisting of the subgroup consisting of SEQ ID Nos: 37 to 42, the subgroup consisting of
  • primers specific for the ttrR gene of Salmonella spp. consist of SEQ ID Nos: 61 to 72, consisting of the subgroup consisting of SEQ ID Nos: 61 to 66 and the subgroup consisting of SEQ ID Nos: 67 to 72;
  • primers specific for the lytA gene of S. pneumoniae consist of SEQ ID Nos: 73 to 90, consisting of the subgroup consisting of SEQ ID Nos: 73 to 78, the subgroup consisting of SEQ ID Nos: 79 to 84 and the subgroup consisting of SEQ ID Nos: 85 to 90;
  • primers specific for the ply gene of S. pneumoniae consist of SEQ ID Nos: 91 to 108, consisting of the subgroup consisting of SEQ ID Nos: 91 to 96, the subgroup consisting of SEQ ID Nos: 97 to 102 and the subgroup consisting of SEQ ID Nos: 103 to 108; primers specific for the femA gene of S. aureus consist of SEQ ID Nos: 109 to 120, consisting of the subgroup consisting of SEQ ID Nos: 109 to 114 and the subgroup consisting of SEQ ID Nos: 115 to 120;
  • primers specific for the arcC gene of S. aureus consist of SEQ ID Nos: 121 to 132, consisting of the subgroup consisting of SEQ ID Nos: 121 to 126 and the subgroup consisting of SEQ ID Nos: 127 to 132; and
  • primers specific for the nuc gene of S. aureus consist of SEQ ID Nos: 133 to 156, consisting of the subgroup consisting of SEQ ID Nos: 133 to 138, the subgroup consisting of SEQ ID Nos: 139 to 144, the subgroup consisting of SEQ ID Nos: 145 to 150 and the subgroup consisting of SEQ ID Nos: 151 to 156;
  • primers specific for the hpd gene of H. influenzae consist of: SEQ ID Nos: 157 to 174, consisting of the subgroup consisting of SEQ ID Nos: 157 to 162, the subgroup consisting of 163 to 168, and the subgroup consisting of 169 to 174;
  • primers specific for the malB gene of E. coli consist of: SEQ ID Nos: 175 to 192, consisting of the subgroup consisting of SEQ ID Nos: 175 to 180, the subgroup consisting of SEQ ID
  • primers specific for the glyK gene of E. coli consist of: SEQ ID Nos: 193 to 210, consisting of the subgroup consisting of SEQ ID Nos: 193 to 198, the subgroup consisting of SEQ ID
  • primers specific for the yiaO gene of E. coli consist of: SEQ ID Nos: 211 to 228, consisting of the subgroup consisting of SEQ ID Nos: 211 to 216, the subgroup consisting of SEQ ID
  • primers and combinations of primers are provided excluding primers specific for the ply gene of S. pneumoniae, in particular primers with SEQ ID Nos: 91 to 108.
  • Primers provided herein and identified as F3, B3, LoopF or LoopB in Table 1, Table 2, Table 3, Table 4 or Table 5 have a sequence comprised in naturally occurring nucleic acids.
  • Primers provided herein and identified as FIP or BIP have non-naturally occurring sequences, as they result from the fusion of two sequences which are not adjacent in the targeted gene.
  • Primers provided herein are particularly provided in non-naturally occurring forms, in particular in mixes and/or compositions not found in nature, and/or in presentations not found in nature, such as in sealed vials, test tubes, lyophilized form, etc.
  • the primers and combinations thereof are provided in particular for use in the amplification of a given gene region in a given gene in a given species of bacteria, all indicated in Table 1, Table 2, Table 3, Table 4 or Table 5.
  • the primers and combinations thereof are also provided for use in the manufacture of a kit for such detection.
  • the primers are also provided for use in non-diagnostics related methods, in particular for use in methods for food or environmental contamination testing.
  • Primers intended to be used together, in particular for the amplification of one nucleic acid sequence are commonly referred to as forming a primer set herein. Accordingly, a primer set will commonly designate a combination of primers allowing the amplification of a given nucleic acid sequence.
  • the primers are not necessarily intended to be presented as forming separate, specifically defined primer sets, and may be considered, in particular depending on the context, as presented in a single group consisting of all the primers mentioned in the subgroups (or in a logical intermediate group, e.g.
  • each subgroup comprises a set of primers (but all primers in the subgroup are not necessarily included in the set) and/or wherein each subgroup forms a set of primers (i.e. the set of primers consists of all of the primers in the subgroup).
  • a single gene region is amplified using a set of six primers, which allows in particular for increased specificity.
  • the primers mentioned above are provided in particular as sets of six primers, the primers being grouped in sets as depicted in Table 1, Table 2, Table 3, Table 4 or Table 5, each set consisting of a subgroup in the list above.
  • a six-primer set consists of six consecutive sequence identifiers (e.g.
  • a combination or set of primers may be provided in separate form, e.g. each primer being in an individual container, or in combined form, e.g. by providing the primers of a six-primer set in the form of a mix consisting of the six primers in relative quantity suitable for performing the methods provided herein.
  • the primers may be provided in particular in lyophilized form, or in solution, in particular in a pure-water solution.
  • a LAMP assay may also be performed using only four primers for the amplification of a specific gene region, although such 4-primer LAMP methods usually show reduced efficiency (and in particular increased time-to-result).
  • the four-primer sets used in such a setup include the F3 ,B3, FIP and BIP primers of the subgroups presented in Table 1, Table 2, Table 3, Table 4 or Table 5, i.e. each four-primer set consists of one of the subgroups wherein the LoopF (or LF) and LoopB (or LB) primers (together designated as "loop primers”) have been removed. Combinations of primers forming such four-primer sets are provided herein, comprising one or several of such four-primer sets.
  • a LAMP assay may also be performed using five primers for the amplification of a specific gene region.
  • the five-primer sets used in such a setup include the F3, B3, FIP and BIP primers (i.e. the primers of the four-primer set) and in addition one of the two loop primers, i.e. LoopF or LoopB, i.e. two alternative five-primer sets may be designed using five of the six primers of the subgroups provided herein: one consisting of the F3, B3, FIP, BIP and Loop F primers and the second one consisting of the F3, B3, FIP, BIP and Loop B primers.
  • Five-primer sets may also be said to consist of the primers of a six-primer set wherein one of the loop primers was removed. Combinations of primers forming such five-primer sets are provided herein, comprising one or several of such four-primer sets.
  • any mode of the methods referred to herein which comprises using isothermal amplification and in particular LAMP whether such mode is disclosed with explicit reference to the use of six-primer sets or not, it should be understood that use of the relevant four-primer sets (i.e. the six-primer sets wherein both the loop primers have been removed), the use of the relevant five- primer sets (i.e. the six-primer sets wherein either one of the loop primers has been removed) and the use of the six-primer sets are provided, while the six-primer sets usually constitute the preferred mode unless otherwise specified or obvious from the context.
  • one or more of the primer sets, and in particular all of the primer sets consist of the four primers FIP, BIP, F3 and B3 of the six-primer sets provided herein.
  • one or more of the referred six-primer sets (or subgroups), and in particular all of the primer sets (or subgroups) is (are) replaced with (a) four- primer set(s) consisting of the six-primer set(s) wherein the loop primers have been removed (and/or the subgroup(s) of six primers is(are) replaced with the corresponding subgroup(s) of four primers).
  • one or more of the primer sets consists of a five-primer set consisting of the four primers FIP, BIP, F3 and B3 and one of the LoopF or LoopB primers of the six-primer sets provided herein.
  • one or more of the referred six-primer sets (or subgroups), and in particular all of the primer sets (or subgroups), is (are) replaced with (a) four-primer set(s) consisting of the six-primer set(s) wherein the loop primers have been removed (and/or the subgroup(s) of six primers is(are) replaced with the corresponding subgroup(s) of four primers) and/or one or more of the referred six-primer sets (or subgroups), and in particular all of the primer sets (or subgroups), is (are) replaced with (a) five-primer set(s) consisting of the six-primer set(s) wherein one of the loop primers has been removed (and/or the subgroup(s) of six primers is(are) replaced with the corresponding subgroup(s) of five primers)
  • a six-primer set consisting of six consecutive sequence identifiers may be replaced by the four-primer set consisting of the four first sequence identifiers, as they correspond to F3, B3, FIP and BIP, by the five-primer set consisting of the five first sequence identifiers, corresponding to F3, B3, FIP, BIP and LoopF, and/or by the five-primer set consisting of the four first and the last sequence identifiers, corresponding to F3, B3, FIP, BIP and LoopB; e.g.
  • SEQ ID Nos: [n] to [n+5] may be replaced with "SEQ ID Nos: [n] to [n+3]", with “SEQ ID Nos: [n] to [n+4]” and/or with "SEQ ID Nos: [n] to [n+3] and SEQ ID No: [n+5]".
  • primer sets specific for the invA gene of Salmonella spp. i.e.
  • the four-primer set consisting of primers having the sequence of SEQ ID Nos: 1 to 4;
  • the four-primer set consisting of primers having the sequence of SEQ ID Nos: 7 to 10;
  • the four-primer set consisting of primers having the sequence of SEQ ID Nos: 13 to 16; primer sets specific for the phoP gene of Salmonella spp., i.e. the six-primer set consisting of SEQ ID Nos: 19 to 24;
  • the five-primer set consisting of SEQ ID Nos: 19 to 22 and SEQ ID No: 24; and the four-primer set consisting of primers having the sequence of SEQ ID Nos: 19 to 22; the six-primer set consisting of SEQ ID Nos: 25 to 30;
  • the five-primer set consisting of SEQ ID Nos: 25 to 28 and SEQ ID No: 30; and the four-primer set consisting of primers having the sequence of SEQ ID Nos: 25 to 28; the six-primer set consisting of SEQ ID Nos: 31 to 36;
  • the five-primer set consisting of SEQ ID Nos: 31 to 34 and SEQ ID No: 36; and the four-primer set consisting of primers having the sequence of SEQ ID Nos: 31 to 34; primer sets specific for the prgK gene of Salmonella spp., i.e.
  • the five-primer set consisting of SEQ ID Nos: 37 to 40 and SEQ ID No: 42; and the four-primer set consisting of primers having the sequence of SEQ ID Nos: 37 to 40; the six-primer set consisting of SEQ ID Nos: 43 to 48;
  • the five-primer set consisting of SEQ ID Nos: 43 to 46 and SEQ ID No: 48; and the four-primer set consisting of primers having the sequence of SEQ ID Nos: 43 to 46; the six-primer set consisting of SEQ ID Nos: 49 to 54;
  • the five-primer set consisting of SEQ ID Nos: 49 to 52 and SEQ ID No: 54; and the four-primer set consisting of primers having the sequence of SEQ ID Nos: 49 to 52; the six-primer set consisting of SEQ ID Nos: 55 to 60;
  • the five-primer set consisting of SEQ ID Nos: 55 to 58 and SEQ ID No: 60; and the four-primer set consisting of primers having the sequence of SEQ ID Nos: 55 to 58; primer sets specific for the ttrR gene of Salmonella spp., i.e.
  • the five-primer set consisting of SEQ ID Nos: 61 to 64 and SEQ ID No: 66; and the four-primer set consisting of primers having the sequence of SEQ ID Nos: 61 to 64; the six-primer set consisting of SEQ ID Nos: 67 to 72;
  • the five-primer set consisting of SEQ ID Nos: 67 to 70 and SEQ ID No: 72; and the four-primer set consisting of primers having the sequence of SEQ ID Nos: 67 to 70; primer sets specific for the lytA gene of S. pneumoniae, i.e.
  • the five-primer set consisting of SEQ ID Nos: 85 to 88 and SEQ ID No: 90; and the four-primer set consisting of primers having the sequence of SEQ ID Nos: 85 to 88; primer sets specific for the ply gene of S. pneumoniae, i.e.
  • the five-primer set consisting of SEQ ID Nos: 103 to 106 and SEQ ID No: 108; and the four-primer set consisting of primers having the sequence of SEQ ID Nos: 103 to 106; primer sets specific for the femA gene of S. aureus, i.e.
  • the five-primer set consisting of SEQ ID Nos: 115 to 118 and SEQ ID No: 120; and the four-primer set consisting of primers having the sequence of SEQ ID Nos: 115 to 118; primer sets specific for the arcC gene of S. aureus, i.e.
  • the five-primer set consisting of SEQ ID Nos: 121 to 124 and SEQ ID No: 126; and the four-primer set consisting of primers having the sequence of SEQ ID Nos: 121 to 124; the six-primer set consisting of SEQ ID Nos: 127 to 132;
  • the five-primer set consisting of SEQ ID Nos: 127 to 130 and SEQ ID No: 132; and the four-primer set consisting of primers having the sequence of SEQ ID Nos: 127 to 130; primer sets specific for the nuc gene of S. aureus, i.e.
  • the five-primer set consisting of SEQ ID Nos: 133 to 136 and SEQ ID No: 138; and the four-primer set consisting of primers having the sequence of SEQ ID Nos: 133 to 136; the six-primer set consisting of SEQ ID Nos: 139 to 144;
  • the five-primer set consisting of SEQ ID Nos: 139 to 142 and SEQ ID No: 144; and the four-primer set consisting of primers having the sequence of SEQ ID Nos: 139 to 142; the six-primer set consisting of SEQ ID Nos: 145 to 150;
  • the five-primer set consisting of SEQ ID Nos: 145 to 148 and SEQ ID No: 150; and the four-primer set consisting of primers having the sequence of SEQ ID Nos: 145 to 148; the six-primer set consisting of SEQ ID Nos: 151 to 156;
  • the five-primer set consisting of SEQ ID Nos: 151 to 154 and SEQ ID No: 156; and the four-primer set consisting of primers having the sequence of SEQ ID Nos: 151 to 154; primer sets specific for the hpd gene of H. influenzae, i.e.
  • primer sets specific for the malB gene of E. coli i.e.
  • primer sets specific for the gly gene of E. coli i.e.
  • the five-primer set consisting of SEQ ID Nos: 205 to 209; the five-primer set consisting of SEQ ID Nos: 205 to 208 and SEQ ID No: 210; and the four-primer set consisting of SEQ ID Nos: 205 to 208;
  • primer sets specific for the yiaO gene of E.coli i.e.
  • primers among the above wherein at least one primer distinguishes by the addition of up to 20 or up to 15 or up to 10 consecutive nucleotides of the 5' and/or 3' flanking sequence in the region of the gene to be amplified.
  • primers provided herein are provided in a format wherein (a) FIP and BIP primers, (b) F3 and B3 primers and (c) LF and LB primers are in a 40 / 5 / 20 (a/b/c) molar ratio, both primers of (a) being provided in the same molar quantity, as well as both primers of (b), and both primers of (c).
  • F3 primer is provided in a quantity equal to 1 (in arbitrary molar units)
  • B3 will be provided in a quantity equal to 1, LF and BF both in a quantity equal to 4 and FIB and BIP both in a quantity equal to 8.
  • Deviation from the above ratio is possible, preferably limited so that each one-to-one ratio for couples of primers is within 50 %, and more preferably with 20 %, of the value disclosed above; e.g. F3/B3 (ratio of the molar quantities) is 1 +/- .5, preferably 1 +/- .2; LF/F3 is 4 +/- 2, preferably 4 +/- 0.8; FIB/B3 is 8 +/- 4, preferably 8 +/- 1.6.
  • F3/B3 ratio of the molar quantities
  • the relative quantity of the provided primers may be that which would result from the above-disclosed ratios.
  • the BIP and FIP primers when only the BIP and FIP primers are provided together, they may be provided at a 1 : 1 ratio, while e.g. BIP and LB provided together would be provided at a 2:1 BIP:LB ratio.
  • each of the primers is provided individually.
  • each six-primer set is provided as a product combination.
  • each four-primer set is provided as a product combination.
  • each five-primer set is provided as a product combination.
  • Each of these products (individual primers and primer sets) is provided in particular for use in methods for the detection of nucleic acids from the relevant gene region of the relevant gene in the relevant bacterial species.
  • combinations of primer sets are provided.
  • combinations comprising at least one primer set for each of at least two, and preferably three, species of bacteria selected among the group consisting of Salmonella spp. , Staphylococcus aureus and Streptococcus pneumoniae are provided, in particular for the simultaneous testing of the presence of the nucleic acid of any of said species of bacteria and/or for the simultaneous testing of a bacterial infection by any of said species, or for the manufacturing of kits suitable for such simultaneous testing methods.
  • Particular such combinations are as follows, wherein the primer sets are selected among the relevant groups of primer sets provided herein:
  • combinations consisting of or comprising three primer sets (of six primers each), one set being specific for of the invA, gene of S. enterica, one for the arcC gene or the femA gene of S. aureus and one for the lytA gene of S. pneumoniae;
  • primer set n° l for gene invA, gene of S. enterica, arcC gene of S. aureus and lytA gene of S. pneumoniae in Table 1 , Table 3, and Table 2, i.e. the subgroup consisting of SEQ ID Nos: 1 to 6, the subgroup consisting of SEQ ID Nos: 121 to 126, and the subgroup consisting of SEQ ID Nos: 73 to 78.
  • Particularly preferred combinations comprise at least one primer set for each of at least two, and preferably three or four and even more preferably five species of bacteria selected among the group consisting of Salmonella spp. , Staphylococcus aureus, Streptococcus pneumoniae, Haemophilus influenzae and Escherichia coli.
  • the primer sets are selected among the relevant groups of primer sets provided herein:
  • primer set n°l for the invA gene of S. enterica primer set n°l for the arcC gene of S. aureus
  • primer set n°l for the lytA gene of S. pneumoniae primer set n°2 for the hpd gene of H. influenzae
  • primer set n°3 for the malB gene of E. coli in Table 1, Table 3, Table 2, Table 4 and Table 5 i.e.
  • the explicitly provided primer sets comprise four-primer sets, five-primer sets and/or six-primer sets, or preferably are all four-primer sets, or are all five-primer sets or even more preferably are all six-primer sets.
  • an alternative combination to the preferred combination above consists of or comprises the set of primers with SEQ ID NOs: 1 to 4, primers with SEQ ID NOs: 121 to 124 and primes with SEQ ID NOs: 73 to 76.
  • Another alternative combination consists or comprises the set of primers with SEQ ID NOs: 1 to 4, primers with SEQ ID NOs: 121 to 124, primers with SEQ ID NOs: 73 to 76, primers with SEQ ID NOs: 163 to 166 and primers with SEQ ID NOs: 187 to 190.
  • the primers designated herein as F3 and B3, which in a LAMP amplification are provided to allow for strand displacement, may be used together, and without the additional primers required for a LAMP reaction, in a PCR reaction.
  • the pair of primers consisting of the F3 and B3 primers from one of the six-primer sets disclosed in Table 1, Table 2, Table 3, Table 4 and Table 5 may be used to amplify, by PCR or PCR-related amplification methods, a specific gene region of the indicated gene from the indicated bacterial species.
  • the primers provided herein are provided in particular as combinations of primers suitable for use in PCR or PCR-related amplification of nucleic acids from the relevant bacterial species, in particular as pairs of primers consisting of a B3 and an F3 primer from one of the subgroups disclosed above and/or in Table 1, Table 2, Table 3, Table 4 and Table 5.
  • LAMP technique uses a DNA polymerase with a high auto-cycling strand displacement activity, and six specially designed primers to synthesize large amounts of DNA molecules under a constant temperature between 60-65°C. The LAMP reaction yields high amount of amplification products, which can be detected either visually or by simple detectors.
  • dsDNA synthesized double strand DNA
  • dsDNA synthesized double strand DNA
  • pyrophosphate ion byproducts which combine with divalent metallic ion (such as Mg2+) to form an insoluble salt, resulting in a decrease of Mg2+ ion concentration as the LAMP reaction progresses.
  • divalent metallic ion such as Mg2+
  • real-time monitoring of the LAMP reaction can be achieved by: (i) fluorescence, using DNA intercalating dyes, fluorescent molecular beacon probes or a fluorescence metal indicator such as calcein; (ii) colorimetry, using a colored indicator for alkaline metal ions, such as hydroxy naphthol blue or pH indicators; (iii) turbidity, as the LAMP reaction produces large amounts of magnesium pyrophosphate (a white precipitate) and dsDNA, which allow visual inspection of results using a turbidimeter; (iv) electrochemically, using a pH meter for direct measurement of released hydrogen ions during the LAMP procedure, or using integrated electrodes for measuring decreases in current resulting from increasing binding of electrochemically-active DNA-binding redox reporters, such as Methylene Blue, to LAMP reaction products; (v) enzyme-linked immunosorbent assays (ELISA) or lateral flow immunoassays based on the use of specific probes; (vi) bio luminescence,
  • LAMP techniques (i) have moderate incubation temperature leading to simplified heating and low power consumption, (ii) yield high amount of amplification products, which can be detected either visually or by simple detectors, (iii) allow direct genetic amplification from bacterial cells due to the superior tolerance to well-known PCR inhibitors such as blood (iv) have high specificity, and sensitivity, and (v) result in rapid detection often within 10-20 min.
  • the amplified gene region is the region indicated in Table 1, Table 2, Table 3, Table 4 and Table 5 and/or is the region comprised between the sequence of the primer identified as F3 and the inverse complementary sequence of the primer designated as B3 of the gene indicated, in the indicated bacterial species (and/or the region that is or would be amplified using the F3 and B3 primers in a PCR amplification reaction).
  • the amplification of the nucleic acid is said herein to be performed in one step, in particular since there is essentially no intervention from the operator or automate during this step (except to maintain temperature, homogeneity of the solution, etc), regardless of the number of chemical reactions (or cycles of reactions) actually occurring in the solution.
  • the step of amplification starts when all reagents required for the amplification reaction to occur are mixed under conditions (in particular temperature conditions) allowing for said reaction to start, and said step ends when either the reaction ends without a change in reaction conditions, e.g. due to the consumption of a required reagent or when the reaction is stopped by a modification of the conditions (e.g. cooling of the solution) or when the result is read, whether the reaction actually ended or not.
  • the amplification step is performed isothermally, in particular at a constant temperature equal to or higher than 50 °C, in particular lower than or equal to 70 °C, and more particularly in the 50 °C to 70 °C range, and yet even more particularly in the 60 °C to 65 °C range, equal to 60 °C or equal to 65 °C.
  • the amplification is performed using a LAMP assay, and in particular using a real-time LAMP assay.
  • An 'assay' designates in particular the essential step in the method leading to an informative result (i.e. a result which is different depending on the presence or absence of the assayed analyte(s) in the sample). In such a meaning, this will usually exclude e.g. sample preparation steps, as well as readout and reporting steps. Moreover, this will usually designate a step carried out in a single reaction solution (and/or container, or compartment), e.g. for the detection of a single analyte (or multiple analytes in multiplex assays as detailed below).
  • Detection in particular the conversion of an amplification to a visible or detectable signal and recording of said signal, is generally comprised in the assay, in particular since the preferred assays provided herein comprise real-time assays.
  • a 'test' (and similar expressions: testing, etc) as used herein designates in particular the method including all of its steps and may, as detailed below for simultaneous tests, comprise several assays.
  • the step of amplifying the nucleic acids is performed using a DNA polymerase with strand-displacement activity, in particular a DNA polymerase suitable for LAMP assays, preferably a so-called hot start DNA polymerase or a WarmStart® DNA polymerase (i.e. a polymerase whose activity is inhibited until it has been heated to a given temperature, e.g. by binding with an aptamer).
  • the polymerase may be Bst I DNA polymerase, Bst 2.0 DNA polymerase, Bst I LF DNA polymerase (consisting of the large fragment (LF) of Bst I DNA polymerase), GeobaciUus sp. M.
  • GspM GspM LF polymerase
  • GspSSD Bst 2.0 WarmStart® DNA polymerase
  • OptiGene the engineered version of GspM LF polymerase known as GspSSD (OptiGene, comprised e.g. in the Mastermix IsoOOl).
  • GspSSDl an engineered LF DNA polymerase isolated from GeobaciUus sp with enhanced reverse transcription activity (Optigene).
  • the step of amplifying the nucleic acids is performed in a mix comprising:
  • Betain 0.6 M to 1 M Betain, preferably 0.8 M Betain;
  • lx ThermoPol® reaction buffer [20mM Tris-HCl, lOmM (NH 4 ) 2 S0 4 , lOmM KC1, 2mM MgS0 4 , 0.1% Triton® X-100, pH 8.8] or, preferably, lx isothermal amplification buffer [20mM Tris-HCl, lOmM (NH 4 ) 2 S0 4 , 50mM KC1, 2mM MgS0 4 , 0.1% Tween® 20, pH 8.8]; and
  • a particular preferred mode comprises use of the mix disclosed as composition 19 in Table 6.
  • the step of amplifying the nucleic acids may be performed using the reagents comprised in the IsoOOl Master Mix provided by OptiGene with the addition of primers.
  • the step of amplifying the nucleic acids is preferably performed in reaction volumes of 0.5 ⁇ ⁇ ⁇ 100 ⁇ , preferably from 1 ⁇ ⁇ to 50 ⁇ ⁇ .
  • the reaction volume may be from 1.5 to 10 ⁇ ⁇ , in particular 1.5 to 5 ⁇ ⁇ , in particular 1.6 ⁇ ⁇ .
  • the reaction volume may be from 10 to 50 ⁇ , preferably from 20 to 40 ⁇ , and in particular may be 25 ⁇ .
  • Time-to-result as defined herein is related to the duration of the detection assay required to make the readout of a result possible, usually excluding any sample preparation steps.
  • time-to-result refers to the duration of the amplification reaction which allows for sufficient amplification of the target nucleic acid, when present, in order for said amplification to be readily detected.
  • time-to-result may be assessed by reading the amplification curve, and is defined as the time required to achieve amplification levels significantly above background, in exponential amplification phase.
  • the methods provided herein allow obtaining a result in (or have a time-to-result of) less than 30 minutes, preferably less than 20 minutes, and even more preferably less than 15 or 10 minutes.
  • the amplification step in the methods provided herein has a duration of 30 minutes or less, and preferably 20 minutes or less, and even more preferably 15 minutes or 10 minutes or less.
  • results of an assay as provided herein may be either a binary result (two possible outcomes, i.e. presence and absence of a nucleic acid) or a more detailed result, in particular an estimate of the quantity of bacterial nucleic acid and/or bacteria present in the sample.
  • the amplification when seeking for a binary readout, is usually allowed to carry out for a predefined time - in particular a time sufficient to achieve complete reaction - before a result is read-out.
  • the amplification may be left to carry out until a positive result is apparent in a positive control performed under identical conditions (usually simultaneously). In both cases, since the result is read at a given point in time when the reaction is considered sufficient, these testing procedures are termed end-point testing.
  • methods of detection of bacterial nucleic acids comprising a step of amplification by LAMP with the provided primer sets, and further comprising a step of assessing the color and/or fluorescence of the assay solution, in particular when a specific color, or change of color, or when a specific level of fluorescence (or any level of fluorescence distinguishable from background) is indicative of the presence of said nucleic acids.
  • the methods provided herein, and the provided products in particular when used in such methods may allow for a realtime readout.
  • Methods allowing for a real-time readout are referred to generally as real-time tests (or assays) herein.
  • Methods for real-time amplification of nucleic acids are known to the skilled person, in particular such methods for isothermal amplification and in particular methods where the amplification of DNA is monitored during amplification, thanks e.g. to changes in fluorescence properties of primers or of intercalating agents induced by their incorporation, or change of pH, turbidity, conductivity, etc.
  • LAMP the preferred method for performing the real-time testing methods provided herein, in particular, provides the ability for real-time monitoring, and is termed herein real-time LAMP when such monitoring is performed. Accordingly, provided herein are methods allowing for real-time testing of the presence of bacterial nucleic acids, and in particular methods based on real-time assays, and more particularly real-time LAMP assays.
  • the mentioned binary readout is for one given assay, i.e. for example one amplification reaction. Since it is possible to test for several bacterial species simultaneously, the result of the assays may be a binary readout for each species. The result in this case is therefore not strictly speaking binary, although the test is still an end-point test.
  • the results of the global test may be reported as binary (absence / presence of any bacterial species) or preferably as either the absence of any bacterial species or the presence of one, or more, identified bacterial species.
  • any quantitative or semi-quantitative method and in particular a real-time method may be modified to provide a binary output.
  • a threshold lower detected amount
  • Said threshold might be set in particular to reflect a clinical significant amount of bacteria in a sample, in particular the amount characterizing the presence of bacteria as an infection.
  • the amount might reflect e.g. hygiene standards in the testing of food samples and/or environmental standards in the testing of environmental samples.
  • test results are reported as a single or as several test result(s), with a level of detail which may range from a binary result (positive / negative) to the provision of amounts of detected DNA for each gene region tested in each bacterial species.
  • the results are reported as presence or absence of each tested species.
  • the primer sets provided herein in particular when used in LAMP procedures, may be used either in end-point testing procedures, or in real-time LAMP, testing, with satisfactory results in terms of sensitivity and specificity.
  • real-time methods require more complex testing procedures and possibly more complex material and training. Therefore, binary methods will often be preferred in setups where little access to technical resources are available.
  • the methods provided herein may indeed involve end-point testing procedures, in particular tested by color and/or fluorescence.
  • real-time detection methods provide for improved sensitivity (lower detection limit) which may be considered critical in some of the applications for the methods or products provided herein, and low price fluorescence detectors, suitable for even resource- limited applications, are readily available.
  • the primers for the LAMP assay are the primers provided herein, in particular provided as six-primer sets.
  • the assay readout is performed visually, more particularly by visualization of a change of color of the assay solution, particularly by pH-driven colorimetry and/or by visualization of a change in fluorescence of the solution, particularly using a DNA intercalating agent and/or revealed under UV-light.
  • the amplification steps in the assay are allowed to carry on for 30 minutes.
  • kits for detecting bacterial nucleic acid using a real-time LAMP assay wherein the primers for the LAMP assay are the primers provided herein, in particular a fluorescent real-time LAMP assay wherein monitoring is performed by using a fluorescent intercalating dye.
  • the calibration of the assay has been or is performed using spiked whole blood samples, i.e. whole blood samples of control, uninfected individuals, wherein a known quantity of bacteria or bacterial nucleic acid was added prior and wherein the spiked whole blood sample was or is tested in conditions identical to the samples wherein detection is performed.
  • the lower limit of detection of such assays i.e. the minimal amount of colony forming units in the assayed sample ensuring a positive result
  • the methods provided herein allow for detection of bacterial nucleic acid in whole blood samples with 125 CFU/mL or more (e.g. with assays having lower limits of detection of 25 CFU/reaction or lower, if one fifth of the sample is used for each reaction, e.g.
  • nucleic acids are extracted from a volume of lmL blood sample, eluted in 100 and if 20 ⁇ , of the eluted DNA template is used to resuspend the freeze-dried LAMP assay reagents) 50 CFU/mL or more (e.g., with assays having lower limits of detection of 2.5 CFU/reaction or lower, if nucleic acids are extracted from a volume of lmL blood sample, eluted in 100 and if 5 of the eluted DNA template is added to 20 ⁇ , of LAMP assay reagents) or with 10 CFU/mL or more, which is generally considered sufficient for the intended applications of the methods provided herein (e.g.
  • nucleic acids are extracted from a volume of lmL blood sample, eluted in 100 ⁇ _, and if 25 ⁇ , of the eluted DNA template is used to resuspend the freeze- dried LAMP assay reagents).
  • the sample used for testing may be in particular from a mammal, more particularly a human subject.
  • the subject from whom the sample is obtained may be at risk of bacterial infection, and/or present clinical signs which lead to suspicion of bacterial infection.
  • the sample is obtained from a human child, in particular less than 15 and more particularly less than 5 years old.
  • the methods provided herein are intended to detect a bacterial infection in a mammal, in particular in a human individual, and testing is then usually performed in vitro on a sample from said mammal.
  • the step of obtaining the sample from the subject is generally not included in the method provided herein.
  • Providing a sample from said individual is common practice and is usually best achieved by drawing blood from the individual.
  • the methods provided herein are intended to detect in vitro a bacterial infection in an individual, using a blood sample obtained from said individual.
  • the blood sample requires specific storage conditions, in particular specific conditions for storing the sample immediately after collection and/or for storing the sample in the time lapse between collection and testing.
  • Whole blood used in such procedures may have undergone one or more preparation steps such as collection in tubes containing anticoagulant agents, dilution, etc...
  • the blood draw must be performed using collection tubes containing conventional anti-coagulant agents (such as heparin or EDTA).
  • anti-coagulant agents such as heparin or EDTA
  • the inventors provide herein methods using 1 mL-blood samples, collected in such anticoagulant agent containing tubes, preferably EDTA or citrate containing tubes.
  • the blood sample requires specific preparation before performing the procedure.
  • the blood sample requires no specific preparation.
  • the blood sample is said to be whole blood in cases where no specific separation of blood components, in particular of serum, plasma, buffy coat and /or of specific blood cells or blood cell fractions, is required prior to perform the testing procedures.
  • the samples, in particular the blood samples are not subjected to any centrifugation step and preferably are not subjected to any boiling step and more preferably are not subjected to any step of heating above 80 °C.
  • the methods of testing provided herein may comprise the preparation of the sample, such preparation possibly including in particular a step of diluting the whole blood sample and / or a step of lysing the sample.
  • total nucleic acids are extracted from the whole blood samples prior to the amplification reaction. Such an extraction is essentially required in order to concentrate nucleic acids so they can be used in a solution with the suitable pH, salinity, polarity etc (and corresponding concentrations of salts), at a suitable concentration and in a suitable final volume for the amplification reaction to take place.
  • the presence of non-nucleic acid contaminants is essentially not an issue, as few if any of the possible contaminants have the ability to inhibit the amplification reaction.
  • the extraction of nucleic acids designates the separation of nucleic acid from any other fraction of the sample, including from a fraction of the solvent, whether or not an enrichment is observed of the nucleic acid relatively to other solutes or biological macromolecules.
  • a step of extracting nucleic acids may sometimes actually be a step of concentrating nucleic acids (and possibly all or most other solutes in the sample).
  • Such a step may also be a step of separation nucleic acids from all or most small molecules in the sample, resulting in obtaining a concentrated fraction comprising the majority of nucleic acids, and at least part of the proteins in the sample.
  • the methods of detection of bacterial nucleic acids may comprise the extraction of nucleic acids from the sample, in particular may comprise a step of mixing the sample with a solid substrate capable of binding the nucleic acids (therefore allowing immobilization of the nucleic acids on the solid substrate), in particular with a magnetic solid substrate and more particularly with magnetic silica-based beads, in particular silica-based beads with large surface area (at least 600 nm diameter), long suspension time, fast separation, suitable for nucleic isolation from various sources (blood, cell, bacteria) for manual and automated workflow (less than ⁇ ⁇ diameter for use in miniaturized tests such as microchips).
  • the mixing of the sample with the solid substrate may be performed in particular after lysis.
  • Such steps are performed in particular with magnetic beads that are not carboxyl-based beads and/or which are silica-based beads which are not NucliSENS® beads from Biomerieux or Dynabeads® from Life Technologies. Chaotropic lysis methods are used in particular embodiments. Such particularly preferred extraction methods are disclosed below, in particular in Example 3, such as the method adapted from Boom et al. ("Boom extraction method").
  • nucleic acids are immobilized on a solid substrate
  • it is possible to recover the immobilized nucleic acid in particular recover by resuspension in a solution (elution), preferably in water, by creating conditions where they no longer bind the solid substrate, in particular by modifying salt conditions and/or by heating.
  • the step of immobilizing the nucleic acids on a solid substrate in the method provided herein may be followed by a step of rinsing the immobilized nucleic acids, preferably by at least three successive steps of rinsing and more preferably by at least five successive steps of rinsing.
  • Each step of rinsing may be performed with 250 to 3 mL, preferably 500 to 2 mL, and in particular 500 ⁇ , 1 mL or 2 mL.
  • Three steps are preferably performed with a lab-on-chip device as disclosed hereinafter, to preserve minimal fluid volumes. Five steps are preferably performed with conventional (non-micro fluidic) setups or devices, since this allows for greater efficiency.
  • the step of immobilizing the nucleic acid may alternatively to the rinsing steps, or preferably in addition to and after said steps, be followed by a step of eluting the nucleic acids, preferably in water, preferably in a volume of 50 ⁇ , to 200 ⁇ ⁇ , and more preferably in a volume of 50 ⁇ ⁇ or 100 ⁇ ⁇ for a sample corresponding to 1 mL of whole blood.
  • An extraction of 50 ⁇ , (or 25 to 75, or 40 to 60 ⁇ ) is particularly preferred for use with a lab-on-chip device as disclosed hereinafter, to preserve minimal fluid volumes.
  • an extraction of 100 ⁇ , (or 50 to 150, or 80 to 120 ⁇ ) is particularly preferred for use with conventional (non- microfluidic) setups or devices, since this allows for greater efficiency.
  • elution volumes must be adapted in particular to the quantity of starting material (e.g. whole blood sample volume), in particular may be proportional to said quantity.
  • the total volume used for rinsing is less than or equal to 2 mL, in particular less than or equal to 1.5 mL.
  • extraction methods may comprise a heating step at a temperature higher than 80 °C, in particular higher than 90 °C in particular at a temperature of 95 °C (or about 95 °C, i.e. within 2 °C, preferably 1 °C of 95 °C) and/or extraction methods may comprise the immobilization of whole cells and bacteria on solid substrates such as beads.
  • Such extraction methods are particularly suitable when the extraction is not performed on a chip (due to the heating step) and/or when optimal extraction of nucleic acids from a wide variety of bacterial species is sought.
  • Such methods indeed allow for efficient lysis of and recovery of nucleic acids from multiple types of bacteria, including in particular the species targeted by the tests disclosed herein, while minimal pipetting and manipulation steps are required which is adequate for manual handling or simple liquid handling devices.
  • such methods may comprise a step of mixing the sample with a solid substrate capable of binding the cells and bacteria comprising the nucleic acids (therefore allowing immobilization of said cells and bacteria on the solid substrate), in particular with a magnetic solid substrate.
  • the mixing of the sample with the solid substrate is performed before lysis, and lysis may be performed in particular by heating the cells and bacteria immobilized on beads, in particular at 95 °C, in an elution buffer.
  • Rinsing steps may be performed between immobilization of cells and bacteria on the beads and lysis/elution, essentially as in paragraph [93] above.
  • the volume of elution buffer may be adjusted as in paragraph [93] above, and in particular may be a volume of 50 to 200 ⁇ , and more preferably a volume of 50 ⁇ _, to 100 ⁇ ,, in particular 100 ⁇ , for a sample corresponding to 1 mL of whole blood.
  • Such particularly preferred extraction methods are disclosed below, in particular in Example 3, such as the "speedXtract" extraction method.
  • the sample used in the testing procedure may be collected and used in a single reaction container for all the procedures, or may be collected and / or distributed in several containers, each for performing one or several assays.
  • one individual sample may be distributed for testing several distinct bacterial species and / or for providing control subsamples.
  • Such distribution is preferably automated and / or performed at the stage of injecting the sample in the container where the nucleic acid assay provided herein is performed, e.g. in particular in the wells of multiwell plates or in loading inlets of microfluidic devices commonly used in such procedures.
  • the distribution of the sample in subsamples may be performed by or with the help of the device used for testing, e.g.
  • the microfluidic device may have a single injection inlet while its design allows for distribution of the sample between different reaction compartments inside the device.
  • the distribution of the sample in subsamples may be performed directly on the whole blood sample, prior to any further manipulation of the sample, or may be performed after initial preparation of the samples, in particular after nucleic acid extraction.
  • the testing methods provided herein may in particular comprise a step of distributing the sample (splitting the sample in subsamples) in distinct containers for performing distinct assays (each subsample / container allowing the performance of one assay).
  • the step of distributing the sample may take place after the step of extracting the nucleic acids; alternatively, the step of distributing the sample may take place before the step of extracting the nucleic acids (and in particular after or before the step of diluting and/or lysing the sample).
  • the distinct containers are comprised in a single device, in particular are the wells of a micro-well plate or separate chambers (or compartments) in a micro fluidics device.
  • the reagents required for LAMP assays may be lyophilized and provided in a lyophilized presentation.
  • the extracted nucleic acid as obtained in the elution solution after extraction, or a fraction thereof may be used to resuspend said lyophilized reagents (resuspension, as used herein, must be understood to include solubilization, i.e. the initially lyophilized elements are eventually in a solution, rather than as a suspension).
  • Such a procedure minimizes pipetting and dilution of the extracted nucleic acids after the extraction.
  • Particular modes of the methods provided herein comprise a step of resuspending the required reagents, presented in lyophilized state, in the solution comprising the nucleic acid (in particular the elution solution), or a fraction thereof.
  • said required reagents comprise all of the required reagents as disclosed herein, with the exception of primers.
  • reagents constituting the Mastermix IsoOOl solution available from OptiGene may be provided in lyophilized presentation for resuspension with the solution comprising the extracted nucleic acid.
  • reagents constituting the composition disclosed as composition 19 in Table 6 in Example 2.3 may be provided in lyophilized presentation for resuspension with the solution comprising the extracted nucleic acid.
  • the method may additionally comprise a subsequent step of using the resulting solution (comprising the extracted nucleic acid and the resuspended and resolubilized reagents) to resuspend the primers.
  • Such methods are particularly efficient in terms of limiting the handling steps and the dilution of reagents, in particular the sample nucleic acids.
  • Simultaneous testing designates herein testing using one individual sample. Simultaneous testing is usually intended to mean that the result for several bacterial species is provided in one single testing procedure, or in several testing procedures performed on the same sample. In some cases, however, which the skilled person which identify in particular taking the context in account, simultaneous testing may designate the testing of one single bacterial species, in particular when said testing involves testing for several distinct genes of that species and/or using several distinct sets of primers. In some cases, the testing procedures are performed using one single reaction container for all bacterial species.
  • the methods steps are not replicated for the distinct bacterial species (or genes, or primer sets), the steps being performed one single time for all analytes together, and/or the result is provided as a single result reflecting the presence of at least one of, or the absence of all, the tested bacteria (or genes, or gene regions).
  • the testing procedures for distinct bacterial species (or genes, or gene regions) are performed in several distinct reaction containers and/or several reaction compartments, in particular in containers (or compartments) wherein the sample is distributed as described above.
  • the containers (or compartments) are all contained in a single device, such as multiwell plate, or a microfluidic device with several injection inlets and/or designed to allow splitting of the sample in several compartments within the microfluidic device.
  • the testing procedures involve identical steps and manipulations, in particular operator-performed operations are essentially performed in parallel for all the procedures, preferably as a single manipulation.
  • all the containers may be subjected to the heating step (or to temperature control to maintain isothermal conditions) in one single operator intervention, e.g. the multiwell plate, containing the multiple reaction containers for the tests, is placed in a heating (and/or temperature-controlling) device by the operator.
  • a preferred mode of the simultaneous testing methods provided herein is a method wherein several assays are performed with one sample, each assay being for the detection of an analyte (or possibly as in multiplex assay described below, for the detection of several analytes), all of the assays being performed in identical conditions.
  • Identical conditions comprise in particular use of identical reagents, preferably in all the steps of the testing method, preferably including the sample and sample preparation steps (i.e. the same sample is used and prepared following the same methods for all assays, and/or identical samples, in particular obtained from the same individual and prepared following the same methods, are used), with the exception of primers (primer sets) which will usually differ from one assay to the other.
  • Identical conditions comprise in particular performing identical testing steps, including handling steps, testing conditions such as reaction times, temperature, volumes, etc.
  • Identical conditions comprise in particular identical detection and/or readout method steps, in particular identical detection reactions and conditions, identical devices for readout and/or identical interpretation of results.
  • identical conditions consist of using identical reagents and performing identical testing steps, including identical detection and readout method steps.
  • the reaction containers may consist of identical containers and content, except that the primer sets for each distinct assay (i.e. distinct primer pairs for the same gene and/or for distinct genes of the same bacteria and/or of distinct bacterial species) are different from one container to the other.
  • the reaction containers may be provided in a completely ready-to-use format, in particular in a kit as provided herein, wherein primer sets are already distributed in the containers, so that operator (and/or automate) interventions may be identical for all the assays.
  • the primers may be provided separately, e.g. individually or as primer sets, in particular as mixes of six primers constituting the primer sets provided herein.
  • the operator or an automate might have to perform a step of addition of the primers separately in the multiple assaying containers, while all other steps of the testing procedures will still possibly be identical and performed simultaneously.
  • primer sets provided herein have all been validated for testing in identical conditions, including identical sample collection and storage conditions, and identical testing procedures. This allows for particularly simple simultaneous testing for one or several bacterial species, including when testing for several genes or gene regions if required e.g. for enhanced sensitivity.
  • methods for simultaneous testing of nucleic acids of at least three distinct bacterial species such methods being therefore suitable for simultaneous testing for an infection by any one of said three species
  • using a single 1 mL whole blood sample e.g. for enhanced sensitivity.
  • methods for simultaneous testing of nucleic acids of at least three distinct bacterial species such methods being therefore suitable for simultaneous testing for an infection by any one of said three species
  • methods for simultaneous testing of nucleic acids of at least three or at least five distinct bacterial species such methods being therefore suitable for simultaneous testing for an infection by any one of said five species
  • nucleic acids representing several gene regions of one or more genes of a one or more bacterial species in particular selected from the group consisting of the the invA, phoP, prgK and ttrR genes from S. enterica, the femA, arcC and nuc genes from S. Aureus, the lytA gene from S. pneumoniae, the hpd gene from H. influenzae and the malB, glyK and yiaO genes from E. coli and more particularly selected from the group consisting of the the invA, phoP, prgK and ttrR genes from S.
  • enterica the femA, arcC and nuc genes from S. Aureus, the lytA gene from S. pneumoniae.
  • Such methods are provided in particular for simultaneous in vitro testing of bacterial infections in a subject, in particular by one or two, and preferably three bacterial species selected among the group consisting of Salmonella spp., Staphylococcus aureus and Streptococcus pneumoniae and/or for simultaneous in vitro testing of infections by one of at least two, preferably at least three or four and even more preferably five bacterial species selected among the group consisting of Salmonella spp., Staphylococcus aureus, Streptococcus pneumoniae, Haemophilus influenzae and Escherichia coli.
  • Such methods are provided in particular wherein distinct set of primers, each set being specific for a given gene region (of a given bacterial species), are used in distinct containers for assaying procedures performed simultaneously, a sample obtained from the subject being distributed in the containers (optionally after a step for sample preparation, in particular after extraction of nucleic acids), and preferably wherein identical conditions are used for all the assaying procedures, apart from the distinct primer sets.
  • nucleic acid of, at least two (and preferably all three) bacterial species selected from Salmonella spp., S. aureus and S. pneumoniae comprising the steps of:
  • Such methods are also provided for the simultaneous testing of infection by, and/or presence of the nucleic acid of, at least two, at least three, at least four and preferably all five bacterial species selected from Salmonella spp. , S. aureus, S. pneumoniae, H. influenzae and E. coli.
  • steps (i) to (iii)a) may all be (and preferably, are all) performed in a single container for each sample, while from step (iii)b) on the sample is split in different containers, although these further steps may still advantageously be performed all at one time.
  • products are also provided herein which are suitable for performing the methods involving simultaneous testing as above and in particular in a presentation intended for such simultaneous testing.
  • the products are provided as a kit comprising several items required and/or suitable for performing such methods, said kits in particular comprising or consisting of the primers required for such methods.
  • multiplex testing In multiplex testing, several analytes are assayed in one single reaction solution (multiplex assay), i.e. a simultaneous test is performed in which several analytes are detected in one single container.
  • multiplex testing provides several advantages over simultaneous tests of single analytes in independent assays/containers (single assays): in particular, a multiplex assay may use the same sample volume as a single assay with no loss in performance, resulting in the same sample being usable for testing an increased number of analytes, or for testing the same number of analytes using a greater "share" of the sample (single assays require splitting the sample in greater number of shares), and therefore more sample, which in turn results in increased sensitivity; a multiplex assay may also require less handling of the sample, as the sample may be injected in less (preferably one) container(s) / inlet(s).
  • the result provided by a multiplex assay may or may not allow to report which of the analytes has been detected, if at least one is present.
  • the assay will usually not allow to report which analyte is detected.
  • methods known to the skilled person are available which allow to specifically report which analyte(s) are present. In particular, such methods are based on e.g. the hybridization of distinguishable nucleotide probes on the different amplification products, and/or specific capture of the different amplification products at distinct locations or on distinct substrates, etc.
  • amplification products are abundant in the reaction solution, in a relatively low complexity mix (only a limited number of different amplification products will be present abundantly), have distinct sequences and are likely to have distinct sizes, such methods are readily available and require only very limited adaptations, well within common knowledge of the skilled person.
  • multiplex assays are performed and the detection step allows the distinction of which analytes (in particular which bacterial species and/or genes and/or gene regions, preferably which bacterial species) are present, if any.
  • the appropriate combination of primers comprises primers forming several six-primer sets provided herein, in particular such combinations may comprise 12, 18, 24 or 30 primers or said otherwise 2, 3, 4 or 5 sets of primers selected among the six-primer sets provided herein.
  • Combination of four-primer sets and combinations of five-primer sets are also similarly possible, as well as combinations comprising six-primer, five-primer and/or four-primer sets, although the latter combinations comprising primer sets with different numbers of primers are preferably avoided in multiplex assays.
  • an appropriate combination comprises several pairs (in particular 2, 3, 4 or 5 pairs) of B3 and F3 primers, each of the pairs being taken from a subgroup selected form the subgroups provided herein.
  • a multiplex assay may be designed so that each of the analytes in one assay is from the same bacterial species. In such a case, the detection of any of the analytes may allow to conclude to the presence of a bacterial infection by said species. Such assays may allow for increased sensitivity, or increased broadness of the test in particular relative to e.g. rare variant strain, while still allowing to report specifically which bacterial species is detected.
  • at least one multiplex assay is performed wherein several analytes (in particular several genes and/or several gene regions from the same gene) from a single bacterial species are detected.
  • Particular combinations of primers provided herein are suitable for multiplex amplification of several analytes from a single bacterial species, in particular comprise several six- primer sets provided herein for amplification using a LAMP assay of gene regions from the same bacterial species.
  • a multiplex assay may allow the detection of analytes from at least two distinct bacterial species, and in particular may allow the detection of the absence of a bacterial infection and/or of the presence of a bacterial infection by either of the detected bacterial species.
  • multiplex assays may allow for detection of at least one analyte from each of Salmonella spp. (in particular S. enterica), Staphylococcus aureus and Streptococcus pneumoniae species.
  • multiplex assays may allow for detection of at least one analyte from each of Salmonella spp., Staphylococcus aureus, Streptococcus pneumoniae, Haemophilus influenzae and Escherichia coli species.
  • at least one multiplex assay is performed wherein analytes from at least two distinct bacterial species are detected.
  • the simultaneous testing comprises a step of assaying, in a single multiplex LAMP assay, the presence of at least one analyte from each of Salmonella spp., Staphylococcus aureus and Streptococcus pneumoniae species and/or the presence of at least one analyte from each of Salmonella spp., Staphylococcus aureus, Streptococcus pneumoniae, Haemophilus influenzae and Escherichia coli species.
  • primers provided herein are suitable for multiplex amplification of at least three and preferably at least four and even more preferably at least five analytes, comprising at least one analyte from each of Salmonella spp., Staphylococcus aureus and Streptococcus pneumoniae species and/or comprising at least one analyte from each of Salmonella spp., Staphylococcus aureus, Streptococcus pneumoniae, Haemophilus influenzae and Escherichia coli species.
  • such combinations consist of the same primers as the combinations of primers provided for (non-multiplex) simultaneous testing above, in particular in a presentation adapted for multiplex testing, e.g. as a mix comprising all of the primers for a single assay.
  • kits and devices are provided in particular in presentations suitable for use in in vitro testing of bacterial infection by Salmonella spp. , Staphylococcus aureus and Streptococcus pneumoniae species, in particular for use in in vitro testing of bacterial infection by Salmonella spp., Staphylococcus aureus, Streptococcus pneumoniae, Haemophilus influenzae and Escherichia coli species; for use in testing for the presence of nucleic acid of said bacterial species; and/or for use in simultaneous testing of infection by and / or nucleic acid of several of these bacterial species; and in particular are provided in presentations comprising combinations of sets of primers suitable for said methods using LAMP assays.
  • kits for performing the methods provided herein and in particular the methods recited above comprise in particular combinations of sets of primers and in particular comprise one or several six-primer sets for LAMP assays as provided herein.
  • combinations of primers are in presentations suitable for, and comprise the pairs of primers suitable for, amplification by PCR or PCR-related methods.
  • the products provided in addition to the primers may be suitable for in particular for the preservation of the primers, for the preparation of the samples, for performing the testing and/or for revealing the test result.
  • the products may be hardware products, e.g. multiwell plates, reaction vials, filters, etc and / or reagents, e.g. DNA polymerase with strand-displacement activity; nucleotide or their precursors (dNTPs, etc); buffers and/or buffer salts; water and/or media for rinsing, diluting, washing; pH color indicator; DNA intercalating agents, etc.
  • the kit may comprise a solution consisting of a mix of all the required reagents for carrying out the amplification procedure, with the exception of the primers (and, as the skilled person would realize, the template, which is provided in the sample when present therein).
  • said mix may consist of or comprise a DNA polymerase with strand-displacement activity, dNTPs, a DNA intercalating agent, pH-buffering salts and other salts required for enabling the amplification, e.g. for adjusting salinity.
  • the kit may comprise reagents for sample preparation and/or extraction of nucleic acids.
  • the products are presented for use performing the tests in multiwell plates.
  • the products may consist of or comprise multiwell plates with primer sets distributed in the wells, optionally in addition to other products (including products distributed in the wells and/or separately supplied products).
  • primers are intended for simultaneous use or for separate use, and whether they are provided as mixes comprising all the primers of a set or as individual primers, they may be presented in lyophilized form.
  • reagents may also be provided in lyophilized form, and optionally may be provide in the same multiwell plates.
  • Such multiwell plates may preferably be spatially organized so as to facilitate transfer of the sample or reaction solution from one well to the next as required by the testing procedure.
  • the methods disclosed herein comprise the use of a microfluidics device, in particular a so-called lab-on-a-chip or other similar portable, optionally disposable device, for use in either automated of manual setups.
  • a microfluidics device in particular a so-called lab-on-a-chip or other similar portable, optionally disposable device, for use in either automated of manual setups.
  • Such devices allow for the use of minimal reaction volumes and therefore high concentration of material provided in low quantity.
  • Such devices comprise several distinct compartments contacted by a network of channels allowing for the circulation of liquids between compartments.
  • compartments usually allow the physical retention of a solution and its isolation from other elements, in particular chemical and biochemical elements, they may be considered as distinct containers.
  • said compartments may be pre-loaded with reagents, in liquid or solid (e.g. lyophilized formats).
  • the network of channels is designed to allow for the solution to be transported from one compartment to another following the requirements of the method, such transportation being the result of either active (e.g. by pumping, aspiration, ...) or passive (e.g. by capillarity, diffusion, ...) flowing of the solution.
  • Such devices will usually comprise at least one sample loading inlet to allow for the sample to be injected in the device.
  • said device may be designed to be connected to liquid handling automates and in particular may comprise additional inlets and / or outlets for the injection or extraction of reagents, washing or rinsing solutions, etc.
  • a compartment which contains all the fluids to be discarded after the assay, in particular fluids used for extraction, rinsing, etc.
  • the use of such a device is in particular advantageous in terms of safety, and particularly prevents the risk of contamination, since no fluids are circulated outside the disposable device after they have been in contact with the sample.
  • the inclusion of the waste compartment within the lab-on-chip requires to keep the total volume of the fluids used for he assay minimal, as any increase in said total volume increases the bulk of the lab- on-chip.
  • the extraction protocols disclosed herein are particularly suitable for such devices, since they use minimal fluids.
  • the total volume of fluids used for the test is less than or equal to 6 mL.
  • the microfluidics device may comprise a network of channels such that after extraction of the nucleic acid, the resulting solution is separated in several compartments, each compartment constituting a distinct container for carrying out an assay, in particular a LAMP assay.
  • Such devices are particularly preferably for performing the simultaneous testing methods provided herein, as handling is reduced to a minimum while performance is optimal.
  • the microfluidics devices provided herein may be suitable for convenient readout of the detection, in particular may comprise a readout "window" which allows for automated readout of the result using a camera, in particular a fluorescence camera.
  • kits in particular for performing the methods disclosed herein, comprising or consisting of a microfluidics device, said device comprising: at least one sample loading inlet; optionally, inlets and outlets for washing of the sample, in particular for performing extraction of nucleic acids, in particular wherein such inlets / outlets are compatible with automated liquid handlers; optionally, a network of channels and compartments suitable for splitting of the solution comprising the sample nucleic acid and use of said sample in several distinct assays; optionally, at least one compartment allowing for on-board storage of discarded fluids; optionally, reagents required for an amplification assay, in particular for amplification by LAMP; a combination of primers as provided herein, in particular comprising at least two, preferably at least three or four, and more preferably at least five six-primer sets (and/or four-primer sets and/or five-primer sets) as provided herein, in distinct compartments ('assay compartments'); optionally at least
  • Target genes for each bacterial species were identified based on an extensive review of the literature. Subsequently, specific target gene regions were selected by multiple sequence alignments of all genome sequences available in the GenBank database. Core genes, present in all strains of a particular bacterial species, were selected as target for the specific detection of Salmonella spp., S. aureus, S. pneumoniae, H. influenzae and E. coli. The invasion protein gene invA, the tetrathionate reductase gene ttrR, the transcriptional regulator gene phoP and the pathogenicity 1 island effector protein gene prgK were selected as targets for the detection of Salmonella spp.
  • the autolysin gene lytA and the pneumolysin gene ply were selected as targets for the detection of S. pneumoniae; the aminoacyltransferase gene femA, the nuclease gene nuc, and the carbamate kinase gene arcC were selected as targets for the detection of S. aureus ; the glycerophosphodiester phosphodiesterase gene hpd was selected as target for the detection of H. influenzae; and the maltose outer membrane porin gene malB, the glycerate kinase II gene glyK and the 2,3-diketo-L-gulonate-binding periplasmic protein yiaO gene were selected as targets for the detection of E.
  • the primers in Table 1, Table 2, Table 3, Table 4 and Table 5 are grouped by gene, as indicated in the top line of each group and, within each group of primers specific for a gene, the primers are grouped by primer set, as indicated in the first column from left.
  • the second column name designates the specific function of a primer within a primer set in a LAMP assay, i.e. whether it is a forward or backward inner primer (FIP or BIP), a forward or backward outer primer (F3 or B3) or a forward or backward loop primer (LoopF or LoopB).
  • primer set n°3 for the PrgK gene of Salmonella spp. which is one of four different six-primer sets provided for amplification of said gene, consists of primers with SEQ ID Nos: 49 to 54.
  • primers with SEQ ID Nos: 49 to 52 are also provided. Also provided is the corresponding four-primer set consisting of primers with SEQ ID Nos: 49 to 52, the five-primer set consisting of primers with SEQ ID Nos: 49 to 53, the five-primer set consisting of primers with SEQ ID Nos:49 to 52 and the primer with SEQ ID No:54, as well as the primer pair for PCR consisting of primers with SEQ ID No: 49 and 50 (with the F3 and B3 suffix).
  • LoopB TATTGGCGATAGCCTGGC cpt(1724..1741 ) 12
  • LoopB CCGGATATCGCTATTGTCGAT (136..156) 36 prgK (NC_003197, 1254395)
  • LoopB CCTCCATCGTCTGTAATGACTG cpt(343..364) 42
  • Primer sequence Primer position ID n° on
  • LoopF CTGTTCGATTTAGCTTGTTGGA (743.764)
  • LoopB TATGAAGGTGTTGAAGCGGTTA cpt(312..333) 132 nuc (NC_007795, 3919380)
  • N ⁇ position malB (NC_000913, 948548)
  • LoopB CG AG G ATACG CAGCATGT (189..206) 18 ⁇ F3 ATTCGACGTTGTCGTAGC (12..29) ⁇ B3 GTAAAGGTCTGTCGCAGG cpt(264..281 ) 132
  • LoopB GTGGTCGAGGATACGCAG (184..201 ) 186 F3 CCTGCGACAGACCTTTAC (264..281 ) 137 B3 TATGACTATACCAACGAAACCG cpt(507..528) 188 FIP AGACGGCTGGTTGTTCACTGCAGTAGCGTACTGAACAACA ⁇ o ⁇ ) ⁇ ' 189
  • LoopF CATACTCAGAGTGTCCTGAAGG cpt(333..354) 191 LoopB GACGATAGTTATCACGCAGGT (399..419) 192 g/yK (NC_000913, 945129)
  • LoopF CAATG CGG ATATTAAACCAG GT cpt(343..364) 203
  • LoopB AACACGGGCGTAA I I I I GC (451..469) 204
  • LoopB CAGGTAAAGTGTGGTACGACA (695..715) 228
  • a LAMP protocol based on SYBR Green fluorescent staining of DNA was developed for end-point detection of target bacterial species.
  • the reactions were carried out in a 25 reaction volume with 5 of the nucleic acid sample, 1.4 mM dNTP, lx Thermopol® reaction buffer or lx Isothermal amplification buffer (New England Bio labs), 2 mM MgS0 4 , 0.8 M Betain, 40 pmol of FIP and BIP primers, 5 pmol of F3 and B3 primers, 20 pmol of LF and LB primers, and 8 units of Bst 2.0 or Bst 2.0 WarmStart® DNA polymerase (New England Bio labs).
  • Amplification was performed at a constant temperature of 65°C for 30 minutes. All reactions were conducted in a conventional thermal cycler (ABI 9700, Eppendorf). LAMP amplicons in the reaction tube were directly detected with the naked eye by addition of 1 of 1/10-diluted SYBR Green I dye (Invitrogen) to the tube and observation of the fluorescent color of the solution under UV light. A dilution of the original orange color indicates a negative result, whereas a fluorescent green color indicates a positive amplification.
  • the reactions were carried out in a 25 ⁇ , reaction volume with 5 ⁇ ⁇ of the nucleic acid sample, 1.2 mM dNTP, lx in-house reaction buffer [10 mM (NH 4 ) 2 S0 4 , 50 mM KC1, 8 mM MgS0 4 , 0.1% Tween-20; adjusted to pH 9.0], 0.1 mM Cresol-Red or Cresol-Purple dye (Sigma), 40 pmol of FIP and BIP primers, 5 pmol of F3 and B3 primers, 20 pmol of LF and LB, and 8 units of Bst 2.0 DNA polymerase (New England Bio labs). Amplification was performed at a constant temperature of 65°C for 30 minutes.
  • a LAMP protocol using a DNA intercalating dye as fluorophore was developed for real-time detection of target bacterial species.
  • Genomic DNA from S. enterica strain CIP 60.62T 250 fg/ ⁇ was prepared, aliquoted and tested in triplicate using the various LAMP master mixes to determine conditions for optimal reaction rapidity (Table 6).
  • the final real-time LAMP reactions were carried out in a 25 ⁇ , reaction volume with 5 ⁇ , of the nucleic acid sample, 15 ⁇ , of ISO001 Mastermix (OptiGene), 40 pmol of FIP and BIP primers, 5 pmol of F3 and B3 primers, 20 pmol of LF and LB primers and sterile water.
  • Amplification was performed at a constant temperature of 65°C for 30 minutes. All reactions were conducted in a LightCycler 480 (Roche) or a Genie III (OptiGene) instrument.
  • IX Isothermal amplification buffer 1.4 mM dNTP, 2 mM MgS0 4 , 0.8 M Betain, 19.41 40 pmol of FIP and BIP primers, 5 pmol of F3 and B3 primers, 20 pmol of LF and
  • primers EvaGreen 0.25X, 8 units of Bst 2.0 WarmStart® DNA polymerase.
  • IX Isothermal amplification buffer 1.4 mM dNTP, 2 mM MgS0 4 , 0.8 M Betain, 12.71 40 pmol of FIP and BIP primers, 5 pmol of F3 and B3 primers, 20 pmol of LF and
  • IX Isothermal amplification buffer 1.4 mM dNTP, 2 mM MgS0 4 , 0.8 M Betain, 12.77 40 pmol of FIP and BIP primers, 5 pmol of F3 and B3 primers, 20 pmol of LF and
  • IX Isothermal amplification buffer 1.4 mM dNTP, 2 mM MgS0 4 , 0.8 M Betain, 12.23 40 pmol of FIP and BIP primers, 5 pmol of F3 and B3 primers, 20 pmol of LF and
  • IX Isothermal amplification buffer 1.4 mM dNTP, 2 mM MgS0 4 , 0.8 M Betain, 11.91 40 pmol of FIP and BIP primers, 5 pmol of F3 and B3 primers, 20 pmol of LF and
  • IX Isothermal amplification buffer 1.4 mM dNTP, 2 mM MgS0 4 , 0.8 M Betain, 13.00 40 pmol of FIP and BIP primers, 5 pmol of F3 and B3 primers, 20 pmol of LF and
  • IX Isothermal amplification buffer 1.4 mM dNTP, 2 mM MgS0 4 , 0.8 M Betain, 13.47 40 pmol of FIP and BIP primers, 5 pmol of F3 and B3 primers, 20 pmol of LF and
  • IX Isothermal amplification buffer 1.2 mM dNTP, 2 mM MgSQ 4 . 0.8 M Betain, 20.49 40 pmol of FIP and BIP primers, 5 pmol of F3 and B3 primers, 20 pmol of LF and
  • IX Isothermal amplification buffer 1.6 mM dNTP. 2 mM MgSQ 4 . 0.8 M Betain. 52.10 40 pmol of FIP and BIP primers, 5 pmol of F3 and B3 primers, 20 pmol of LF and
  • IX Isothermal amplification buffer 1.4 mM dNTP, 0 mM MgSQ 4 , 0.8 M Betain, No detection 40 pmol of FIP and BIP primers, 5 pmol of F3 and B3 primers, 20 pmol of LF and
  • IX Isothermal amplification buffer 1.4 mM dNTP, 4 mM MgSQ 4 , 0.8 M Betain, 9.95 40 pmol of FIP and BIP primers, 5 pmol of F3 and B3 primers, 20 pmol of LF and
  • IX Isothermal amplification buffer 1.4 mM dNTP, 6 mM MgSQ 4 , 0.8 M Betain, 8.29 40 pmol of FIP and BIP primers, 5 pmol of F3 and B3 primers, 20 pmol of LF and
  • IX Isothermal amplification buffer 1.4 mM dNTP, 2 mM MgS0 4 , 0.6 M Betain. 35.09 40 pmol of FIP and BIP primers, 5 pmol of F3 and B3 primers, 20 pmol of LF and
  • IX Isothermal amplification buffer 1.4 mM dNTP, 2 mM MgS0 4 , 1 M Betain. 40 33.94 pmol of FIP and BIP primers, 5 pmol of F3 and B3 primers, 20 pmol of LF and LB
  • primers EvaGreen 0.25X, 8 units of Bst 2.0 Warm Start DNA polymerase.
  • IX Isothermal amplification buffer 1.0 mM dNTP. 6 mM MgSQ 4 , 0.8 M Betain, 9.93 40 pmol of FIP and BIP primers, 5 pmol of F3 and B3 primers, 20 pmol of LF and
  • IX Isothermal amplification buffer 1.0 mM dNTP, 6 mM MgS0 4 , 0.8 M Betain, 7.58 40 pmol of FIP and BIP primers, 5 pmol of F3 and B3 primers, 20 pmol of LF and
  • Time-to-result is the mean value observed on three replicates.
  • Bacterial nucleic acids were extracted from nutrient agar plates or enumerated bacterial suspensions using the QiaAmp DNA Mini Kit (Qiagen, Hilden, Germany), according to the manufacturer's instructions. Alternatively, bacterial nucleic acids were extracted from enumerated bacterial suspensions using the "Boil & Spin” method. An aliquot of bacterial suspension (100 ⁇ ) was boiled for 10 min and immediately cooled on ice for 5 min. After a short spin, the supernatant was collected and used for LAMP analysis.
  • enterica strain CIP 60.62T were prepared, aliquoted (lmL) and extracted in triplicate using the in-house bead- based extraction method. Protocol parameters including the bead type and size (Table 9), the elution volume (Table 10) and the number of wash steps (Table 11) were modified independently to determine conditions for optimal DNA extraction and subsequent LAMP detection. bead types LAMP
  • end-point LAMP assays are rapid ( ⁇ 30 min) and can be analyzed immediately without the need for specialized and expensive instrumentation, they do not allow high-throughput or quantitative applications. For these reasons, a standardized real-time LAMP reaction protocol was developed and optimized for rapid high-throughput detection of the target bacterial species. Although different reaction master mix compositions, DNA polymerization enzymes (including Bst 2.0, Bst 2.0 WarmStart® and GspSSDl) and DNA intercalating dyes (including EvaGreenTM and Syto-9) were proven efficient for real-time LAMP using the designed primer sets, the ISO001 Mastermix (OptiGene), containing a proprietary DNA intercalating dye, demonstrated optimal amplification. Detection of S. enterica genomic DNA by real-time fluorescent LAMP assay is shown in Figure 2.
  • Analytical specificity of the real-time LAMP assays was assessed using panels of genomic DNA extracts obtained from 10 bacterial species closely related to Salmonella spp., 12 bacterial species closely related to S. aureus, 12 bacterial species closely related to S. pneumoniae, 10 bacterial species closely related to E. coli or 12 bacterial species closely related to H. influenzae (Table 12 to Table 16). None of the bacterial species related to Salmonella spp. were detected by the invA, phoP, prgK or ttrR primers and none of the bacterial species closely related to S.
  • aureus were detected by the fern A, arcC or nuc primers, demonstrating the high specificity of the developed Salmonella spp. and S. aureus LAMP assays.
  • none of the bacterial species related to E. coli were detected by the malB, glyK or yiaO primers and none of the bacterial species closely related to H. influenzae were detected by the lpd primers, demonstrating the high specificity of the developed H. influenzae and E. coli LAMP assays.
  • none of the bacterial species closely related to S. pneumoniae were detected by the lytA primers, however S. pseudopneumoniae DNA was detected by the ply primers. LAMP using ply primers was therefore discarded for the specific detection of S. pneumoniae.
  • the analytical sensitivity and time-to-result of the developed real-time LAMP assays were assessed using serial dilutions (10-fold) of purified genomic DNA from pure bacterial cultures of Salmonella enterica reference strain CIP 60.62T, Streptococcus pneumoniae reference strain CIP 102911, Staphylococcus aureus reference strain CIP 65.8T, Haemophilus influenzae strain CIP 102514 and E. coli strain CIP 54.8T.
  • the developed LAMP assays demonstrated a limit of detection ranging from 1 to 10 colony forming units (CFU) per reaction and a time-to-result inferior to 20 minutes (Table 17 and Table 18).
  • LAMP assays targeting gene invA, gene arcC, gene lytA and gene malB demonstrated the lowest limit of detection (LOD) associated with the shortest reaction time for detection of S. enterica, S. aureus, S. pneumoniae and E. coli, respectively.
  • pneumoniae strains were detected by the lytA LAMP assay, all E. coli strains were detected by the malB, glyK and yiaO LAMP assays and all H. influenzae strains were detected by the hpd LAMP assay.
  • Salmonella enterica enterica Dublin CIP 106215
  • Salmonella enterica enterica Dublin CIP 110276 NCTC 9676;CECT 4152
  • Salmonella enterica enterica Newport CIP 105629
  • Salmonella enterica enterica Stanley CIP 106230

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Detection of microbial pathogens related to bacterial infections through amplification especially by RT- LAMP The invention is in the field of the detection of microbial pathogens related to bacterial infections. More particularly, the invention relates to methods and products, particularly primers, for the simultaneous or individual detection of Salmonella spp., Staphylococcus aureus, Streptococcus pneumoniae, Haemophilus influenzae and/or Escherichia coli, in particular for performing this detection using isothermal amplification of specific genes of these pathogens, and more particularly using loop-mediated isothermal amplification (LAMP), either as end-point assay or as real-time LAMP assays.

Description

Detection of microbial pathogens related to bacterial infections through amplification especially by
RT-LAMP
[1] The invention is in the field of the detection of microbial pathogens related to bacterial infections. More particularly, the invention relates to methods and products, particularly primers, for the simultaneous or individual detection of Salmonella spp., Staphylococcus aureus and/or Streptococcus pneumoniae, Haemophilus influenzae and/or Escherichia coli, in particular for performing this detection using isothermal amplification of specific genes of these pathogens, and more particularly using loop-mediated isothermal amplification (LAMP), either as end-point assay or as real-time LAMP assays. The invention also comprises specific nucleic acid extraction procedures suitable in particular for the in vitro testing of bacterial nucleic acid in whole blood samples, in particular whole human blood.
Backround of the invention
[2] The inventors have identified a need for a rapid and convenient test for bacterial infections particularly suitable to detect most major childhood bacterial infections and in particular those common in sub-Saharan African children. In order to fulfill this need, such a test should be suited for in- field testing or point-of-care (POC) testing. In particular, such test should not require highly trained personnel, expensive, high power-consuming or heavy material; such test should be rapid enough to enable POC testing and/or for high-throughput testing, in addition to being sufficiently specific and sensitive.
[3] The burden of mortality in children younger than 5 years is the highest in Africa, with a striking 73.2% of these deaths due to infectious causes (Liu et al, 2010). Among severe infectious disorders, malaria, pneumoniae and diarrhea remain the leading causes of high infant mortality rates, especially in rural settings in sub-Saharan African countries where access to health services is often difficult. Severe illnesses associated with invasive bacterial infections are now recognized as one of the leading cause of childhood mortality and morbidity in this region (Bahwere et al., 2001; Onipede et al, 2009; Reddy et al, 2010). The most prevalent bacterial etiologies associated with these infections are Streptococcus pneumoniae, (nontyphoidal) salmonellae and Staphylococcus aureus.
[4] Unfortunately, the clinical presentation of severe pediatric illnesses overlap considerably, making it difficult to identify the true cause of illness based on clinical symptoms alone. Indeed, invasive bacterial infections can be associated with a range of different non-specific symptoms, depending on the setting (endemic co -morbidities), the season and the susceptibility of the pediatric population. For instance, enteric bacteria may be as important as those bacteria more usually associated with respiratory disease among children presenting with a clinical picture of pneumoniae during the wet season or in children with measles, malnutrition and other immunocompromised states. Moreover, although S. pneumoniae, H influenzae and S. aureus have consistently been reported as the major bacterial causes of pneumoniae in developing countries, these bacteria are also among the most common meningeal pathogens in infants and small children. In addition, Salmonella species now represent a leading cause of Gram-negative bacterial meningitis in the developing world and has been increasing in importance as a result of the AIDS epidemic. Finally, hospitalized children often present fever without apparent focus of infection. Therefore, detection of bacteremia and differential diagnosis of the possible etiological agents can only be performed by laboratory methods. Unfortunately, the availability of diagnostic microbiology services for infections other than malaria is often limited by cost, infrastructure and personnel constraints.
[5] As bacteremia remains one of the most consistent predictor of mortality in sub-saharan countries (K O Gradel et ah, 2009; Mulholland and Adegbola, 2005), bacterial species associated with a substantial risk of death in children were selected based on a systematic review and metaanalysis of studies on community-acquired bloodstream infections among children in sub-Saharan Africa (Reddy Shaw et Crump 2010). The results of the meta-analysis, for children under the age of five specifically, are summarized in the table below. This study identified the following bacterial species, in order of highest prevalence: S. pneumoniae (23,3%), non-typhoidal Salmonella (18,7%), S. aureus (12,0%), E. coli (9,4%>) and H. influenzae (8,0%>). The prevalence of non-typhoidal Salmonella (NTS) bacteremia has risen in many countries and is probably related to the increase in HIV infection. In fact, S. enterica serotype Typhi represented less than 1% of the isolates in children presenting with bacteremia. Only on rare occasions and in specific settings (i.e. non- endemic area for malaria) has S. Typhi been identified among the most important pathogens recovered from bacteriemic children.
[6] Despite its limitations, the blood culture remains the "gold standard" for the detection of microbial pathogens related to bacteraemia and sepsis. In general, clinicians collect blood cultures around the time of temperature elevation to increase the chance of detecting bacteraemia, however this practice can become complicated especially in patients that are hypothermic or unable to mount a temperature response with clinical sepsis. Fever can also be related to non-infectious causes e.g. drug reaction or malignancy. Moreover, blood cultures taken while on antimicrobial therapy will prevent detection of some bacteraemias. In sub-Saharan Africa, blood culture facilities are available in only a limited number of urban centers, leaving small hospitals across the region and rural care providers without any means for diagnosis and management of bloodstream infections.
[7] In this context, nucleic acid testing (NAT) for infectious diseases at the point of care (POC) can provide access to much-needed diagnostic methods in low-resource, high disease-burden areas, especially for applications requiring fast turnaround times. Tests available from the prior art include in particular molecular testing (testing for the presence of bacterial nucleic acid) and more particularly polymerase chain reaction (PCR) tests. Although they allow for relatively fast, specific and sensitive results, such tests suffer major drawbacks for the sought applications. Chief among these drawbacks is the requirement for specific training and material, such tests requiring in particular thermal cycling in order to achieve amplification of the target nucleic acids, through the use of a thermal cycler. In addition, PCR tests are commonly very sensitive to various contaminants of the nucleic acid sample, which inhibit the activity of the polymerase, such contaminants being commonly found in blood. PCR tests therefore require complex nucleic acid extraction procedures and/or perform unreliably. In contrast, POC devices should be affordable, robust and easy to use by minimally trained personnel, with stable, ready-to-use reagents, simple, maintenance-free instrumentation, and clear, actionable results, in addition to being suitably sensitive and specific.
[8] Several isothermal nucleic acid amplification methods have been developed for rapid, simple, and cost-effective detection of pathogenic microorganisms in smaller size systems. Among these methods, loop-mediated isothermal amplification (LAMP) appears to be a promising assay, highly suited for on-site detection of bacteria.
[9] Several LAMP assays have been developed for the detection of the targeted bacteria:
[10] S. pneumoniae. LAMP assays have been developed to target the lytA or rrs genes, with analytical sensitivities up to 100 cfu / mL sample or 10 genome copies per reaction.
[11] S. enterica (Typhi and non-Typhi serotypes). LAMP assays have been developed to target Salmonella spp. genes invA, phoP and fimY or specific Salmonella serogroup/type gene regions including prt (rfbS), rfbJ, Sdfl, recF and SPA3440 with analytical sensitivities up to 10 cfu / mL sample, 4 genome copies per reaction or 76 fg DNA per reaction.
[12] S. aureus. LAMP assays have been developed to target the S. aureus femA, arc, spa or rrs genes, enterotoxin genes entA-D or drug-resistance genes mecA, qacA/B and cfr with analytical sensitivities up to 100 cfu / mL sample or 100 fg DNA per reaction. [13] E. coli. LAMP assays have been developed to target E. coli housekeeping genes including malB, specific E. coli pathotype (VTEC/STEC, EHEC, ETEC, EAggEC, EIEC) genes including stxl, stx2, eae, ipaH, aggR, rfbE, LTI, STI and F5 fimbriae protein gene, specific E. coli serogroup/type gene regions including wzx, wzy or fliC or resistance genes including £/aNDM-i and blciK?c- These assays have demonstrated analytical sensitivities up to 24 cfu / mL sample, 10 copies per reaction or 8,6 fg DNA per μΕ.
[14] H. influenzae. LAMP assays have been developed to target H. influenzae genes including bexA, pal and rrs, with analytical sensitivities up to 100 cfu / mL sample or 10 genome copies per reaction.
[15] These assays have in particular practical limitations which render them unsuitable for the targeted application. In particular, the testing conditions for these tests are heterogeneous, which does not allow either evaluation of their performance, or performing in conditions for simultaneous testing of several bacterial species. In addition, few of these tests have been developed for or validated on whole blood samples and therefore do not overcome the requirement for complex sample preparation procedures. In addition, these tests are based on a variable number of primers, with as little as four primers for the amplification of a single target, which does not allow sufficiently fast and efficient amplification.
[16] When using NAT identification techniques, effective DNA purification and concentration from infected biological samples is important. Bacteria causing bloodstream infection can theoretically exist in three blood components: 1) as intact bacteria that are free within patient blood, 2) as free DNA in patient plasma (presumably from lysed bacteria), or 3) as intact bacteria that are trapped in white blood cells (WBCs). Although quantitation is not widely used in the study of bacteremia, a limited number of studies have provided several conclusions on the bacterial load during infection in children and adults. Firstly, the magnitude of bacteremia is usually much higher in children than in adults and in general is inversely related to the child's age. Moreover, data suggest that high bacterial counts and in excess of 100 organisms per mL of blood are closely associated with the existence or possible development of serious disease in children (and adults). Finally, a correlation with symptom severity can also be drawn regarding the bacterial DNA load recovered in the blood infected patients. The data found on blood bacterial load (usually obtained through direct plating methods) and the possibility to detect bacterial DNA in the different blood components, are listed below for the high-priority pathogens selected for the project:
[17] S. pneumoniae. Studies have shown that the magnitude of S. pneumoniae bacteremia correlated with the severity of the infection: patients with greater than or equal to 100 colony- forming units (CFU) per mL were significantly more likely to have meningitis. On the other hand, all patients with S. pneumoniae bacteremia with colony counts lower than 15 CFU per mL had occult bacteremia with no focus of infection. S. pneumoniae DNA can be detected in whole blood, serum, plasma and the buffy coat. The type of blood specimen used does not seem to impact DNA detection performance.
[18] S. aureus. A study on bacteremia in childhood demonstrated a concentration in S. aureus bacteria of 50 CFU/mL. S. aureus DNA can be detected in whole blood, serum, plasma and buffy coat. Whole blood results in maximum DNA detection as opposed to cell-associated bacteria (in WBCs) or free bacterial DNA in plasma.
[19] Salmonella spp. (Typhi and non-Typhi serotypes). Analysis of typhoid patients showed that children (<15 years old) had higher median blood S. enterica serotype Typhi counts than adults: 1.5 (range, <0.3 to 387) versus 0.6 (range, <0.3 to 17.7) CFU/ml. However, after an extensive review of the literature, we were not able to find quantitative data on the number of NTS that can be found in blood during bacteremiac episodes in children. Gordon et al. have shown that NTS in bacteremic HIV-infected adults are present at a similarly low concentration (1 CFU/ml) (Gordon et al, 2010). Salmonella spp. DNA can be detected in whole blood, serum, plasma and buffy coat. The principal difference between systemic infection with Salmonellae and that with other Enterobacteriaceae is that two-thirds of the bacteria in the circulatory system are located within phagocytic cells, where they remain viable (S. Typhi is able to survive and reproduce inside monocytic phagocytes, and in typhoid fever S. Typhi is reported to be confined to the monocyte- platelet fraction of the blood). Thus, the most adequate specimens for detection of those bacteria appear to be buffy coat or whole-blood.
[20] E. Coli. In neonatal E. coli sepsis, Dietzman et al. demonstrated that 78% of patients had >5 CFU/ml of blood and one-third had bacterial counts in excess of 1,000 CFU/ml (Dietzman, Fischer, et Schoenknecht 1974). E.coli DNA can be detected in whole blood, serum, plasma and buffy coat. Analysis of plasma samples showed a 10- to 100-fold reduction of bacterial 23S rDNA in comparison to the corresponding whole blood specimens, thus indicating that whole blood is the preferential sample type to be used in PCR protocols.
[21] H. Influenzae. Studies performed in children with bacteremic diseases caused by encapsulated bacteria (H. influenzae type b) have shown bacterial counts higher than 30 CFU/ml in 73% of the patients. H. influenzae genomic DNA can be detected in whole blood, serum or plasma. [22] As the utility of a particular sample processing technique to detect bacteremia depends greatly on the relative amounts of target in each of these blood components, extraction from anticoagulant-treated whole-blood samples provides a higher number of possible target bacteria than methods using serum and plasma, thus potentially improving the overall sensitivity. Moreover, as the magnitude of bacteremia in infants and children is generally greater than that in adults, sample volume as little as 1 mL of blood should be considered adequate in most cases. Based on a review of published LAMP assays targeting bacterial genomic DNA, an analytical sensitivity ranging between 10-100 CFU/mL can be expected, allowing detection of clinically relevant bacteremia in children. Indeed, clinically relevant bacteremia has been found to be associated with a bacterial blood concentration of more than 100 CFU/ml as well as high bacterial DNA load. Moreover, as the tool is not intended to detect viable bacteria but specific genomic material, the chance of detection of the target and therefore the overall sensitivity of the assay is expected to be increased, particularly in comparison to blood cultures which have intrinsic limitations in terms of sensitivity and rapidity. Although, the presence of PCR inhibitors in whole blood may make this approach less sensitive, the higher robustness of the LAMP method compared to classical PCR allows overcoming this issue. Furthermore, the robustness evaluation of LAMP assays has demonstrated that they remained sensitive and specific despite the addition of untreated biological fluids (such as stool, urine or blood) that commonly inhibit PCR amplification. Whereas the detection of microorganisms from whole blood or a blood-culture medium typically requires extensive sample purification and removal of inhibitors, LAMP amplification remained more sensitive than conventional qPCR when omitting such preparatory steps.
[23] Several types of easy-to-perform sample treatments have been described in the literature for pathogen detection using LAMP assays. These simple sample processing methods, with or without centrifugation step, are listed below for different types of blood specimens:
Unprocessed whole blood for detection of Salmonella enterica serotypes from septic animals,
Unprocessed serum for detection of trypanozoon,
Boiled whole blood for detection of P. falciparum,
Boiled diluted animal serum/plasma for detection of M. mycoides,
Whole blood lysis by addition of detergent (Triton X-100) followed by boiling to detect Salmonella strains,
Boiled whole blood followed by centrifugation for detection of trypanozoon,
Boiled serum followed by centrifugation for detection of S. pneumoniae, Whole blood lysis by addition of detergent (SDS), followed by boiling and centrifugation for detection of P. falciparum.
[24] Next to sample preparation strategies, several concentration methods have been developed for concentration of bacteria or genomic DNA in blood. Conventional technologies adaptable on a microfluidics/microchip format usually rely on size-based filtration or magnetic bead approaches. Pore sizes of the filters applied are defined by the pathogen size (e.g., 1 μιη for bacteria) while magnetic beads are either labeled with antibodies or show specifically modified surfaces. By pumping a fluid sample through a bed of magnetic beads coated with antibodies, microorganisms are efficiently captured. Using permanent magnets or electromagnets, the magnetic beads can be located and easily fixed in place for capturing, washing and elution. They can even be transported to subsequent reaction chambers, such as a LAMP chamber, by using a movable magnet. In addition, inertial micro fluidics has gained some attention for high-throughput separation of blood volumes in the milliliter range. Alternative microfiuidic devices have used electrokinetic or dielectrophoretic capture of bacterial cells. A so-called "paper-machine", practically a portable, paper-based device, was described that allows performing LAMP reactions for the detection E. coli malB gene in a format suitable for field applications (Connelly et al., 2015).
Brief description of the invention
[25] The inventors have therefore developed and validated testing procedures and products used therein which allow the simultaneous, isothermal detection of infection by several bacterial species including the most commonly found severe disease-provoking bacteria in sub-Saharan African children, with minimal sample preparation and specificity relative to non-pathogenic bacteria yet capable of detecting all or most strains of pathogenic bacteria. In particular, these tests comprise the use of LAMP assays for amplification of the nucleic acids and in particular the use of real-time LAMP assays. In particular, the methods provided herein allow the detection of at least one, preferably at least two and most preferably at least three, four or five pathogenic bacterial species, including species selected among the group consisting of Salmonella spp., Staphylococcus aureus and Streptococcus pneumoniae. In particular, the methods provided herein allow the detection of at least one, preferably at least two and most preferably at least three, four or five pathogenic bacterial species, including species selected among the group consisting of Salmonella spp., Staphylococcus aureus, Streptococcus pneumoniae, Haemophilus influenzae and Escherichia coli. In particular, the methods provided herein allow the detection of at least one, preferably at least two and most preferably all three bacterial species selected from the group consisting of Salmonella spp., Staphylococcus aureus and Streptococcus pneumoniae. In particular, the methods provided herein allow the detection of at least one, preferably at least two, at least three or at least four and most preferably all five bacterial species selected from the group consisting of Salmonella spp., Staphylococcus aureus, Streptococcus pneumoniae, Haemophilus, influenzae and Escherichia coli.
[26] The invention therefore provides methods of in vitro testing for the presence of bacterial nucleic acid from one or more bacterial species on a sample obtained from a subject, in particular a human subject, in particular wherein the method comprises steps of isothermal amplification of nucleic acids. The invention further provides methods for in vitro testing comprising the steps of preparing the samples, in particular the steps of extracting nucleic acid, suitable for preparing samples obtained from the subject for testing using the provided in vitro assays.
[27] The invention further provides such methods for simultaneous testing of the presence of bacterial nucleic acid, wherein the presence of more than one gene region is tested, in particular gene regions from at least two distinct genes, in particular from at least two distinct bacterial species and preferably from at least three or four distinct bacterial species and most preferably from at least five distinct bacterial species. Methods for simultaneous testing are provided in particular wherein the steps of preparation of the samples, in particular of nucleic acid extraction, are performed only once per sample in which more than one region is tested and/or wherein the steps of isothermal amplification of nucleic acids are performed in similar conditions for all the tested gene regions, preferably conditions that are identical except for the primer sets used for the steps of amplification.
[28] The invention further provides products, in particular primers, particularly suitable for these in vitro testing methods. The products are provided in particular as individual primers, as combinations of primers, in particular as sets of primers suitable for amplification of nucleic acids of a given gene regions, in particular a set of six primers (six-primer set) suitable for amplifying a given gene region in a LAMP assay and/or as kits comprising primers or primer combinations as above and / or other products required for carrying out the methods above. The products are provided in particular for use in the methods above. The products, particular primers and primer sets, are also particularly provided for use in the manufacturing of kits for use in the methods above.
[29] In particular, the above products and methods are provided herein for the in vitro detection of a bacterial infection. More particularly, the above products and methods are provided herein for in vitro diagnostics. Alternatively, the above products and methods are provided for use in procedures which do not result in diagnostics (e.g. testing for contamination of food products, environmental testing, ...). [30] In particular, provided herein are any of the above methods and products, wherein the tested bacterial species are selected from the group consisting of Salmonella spp., Staphylococcus aureus and Streptococcus pneumoniae. More particularly, provided herein are any of the above methods and products, wherein one of these bacterial species is tested for, wherein two of these bacterial species are tested for, or wherein all three of these bacterial species are tested for. In particular, provided herein are any of the above methods and products, wherein the tested bacterial species are selected from the group consisting of Salmonella spp., Staphylococcus aureus, Streptococcus pneumoniae, Haemophilus influenzae and Escherichia coli. More particularly, provided herein are any of the above methods and products, wherein one of these bacterial species is tested for, wherein two of these bacterial species are tested for, wherein three of these bacterial species are tested for, wherein four of these bacterial species are tested for, or wherein all five of these bacterial species are tested for.
[31] In particular, provided herein are any of the above methods and products, wherein the sample is from a human subject, in particular a human child. In particular, provided herein are any of the above methods and products, wherein the sample consists of or comprises blood from the subject, or a blood extract from said subject, and in particular wherein the sample is whole blood.
[32] In particular, provided herein are any of the above methods and products, wherein the nucleic acids are amplified using isothermal nucleic acid amplification, in particular LAMP, and more particularly real-time LAMP. More particularly, provided herein are any of the above methods and products, wherein the detection is performed by an end-point assay and any of the above methods and products, wherein the detection is performed by a real-time assay, in particular a realtime quantitative assay.
[33] In particular, provided herein are any of the above methods and products, wherein a combination of six primers is used for the detection of one bacterial species. In particular, provided herein are any of the above methods and products, wherein a combination of primers, in particular a combination of six primers, allows the detection of a gene selected among the following: the invasion protein invA, the transcriptional regulator phoP, the pathogenicity 1 island effector protein prgK and the tetrathionate reductase ttrR genes from S. enterica, the the aminoacyltransferase femA, the carbamate kinase arcC and the nuclease nuc genes from S. aureus, the autolysin lytA gene from S. pneumoniae, the glycerophosphodiester phosphodiesterase hpd gene from H. influenzae and the maltose outer membrane porin malB, glycerate kinase II glyK and 2,3-diketo-L- gulonate-binding periplasmic protein yiaO genes from E. coli. [34] In particular, provided herein are any of the above methods and products, wherein the primers are selected, individually or in combination, from the group consisting of the primers disclosed in Table 1, Table 2, Table 3, Table 4 and Table 5, namely the group consisting of primers specific for the invA gene of Salmonella spp., in particular of S. enterica, i.e. the subgroup consisting of SEQ ID Nos: 1 to 6, the subgroup consisting of SEQ ID Nos: 7 to 12, the subgroup consisting of SEQ ID Nos: 13 to 18; primers specific for the phoP gene of Salmonella spp., in particular of S. enterica, i.e. the subgroup consisting of SEQ ID Nos: 19 to 24, the subgroup consisting of SEQ ID Nos: 25 to 30, the subgroup consisting of SEQ ID Nos: 31 to 36; primers specific for the prgK gene of Salmonella spp., in particular of S. enterica, i.e. the subgroup consisting of SEQ ID Nos: 37 to 42, the subgroup consisting of SEQ ID Nos: 43 to 48, the subgroup consisting of SEQ ID Nos: 49 to 54, the subgroup consisting of SEQ ID Nos: 55 to 60; primers specific for the ttrR gene of Salmonella spp., in particular of S. enterica, i.e. the subgroup consisting of SEQ ID Nos: 61 to 66, the subgroup consisting of SEQ ID Nos: 67 to 72; primers specific for the lytA gene of S. pneumoniae, i.e. the subgroup consisting of SEQ ID Nos: 73 to 78, the subgroup consisting of SEQ ID Nos: 79 to 84, the subgroup consisting of SEQ ID Nos: 85 to 90; primers specific for the ply gene of S. pneumoniae, i.e. the subgroup consisting of SEQ ID Nos: 91 to 96, the subgroup consisting of SEQ ID Nos: 97 to 102, the subgroup consisting of SEQ ID Nos: 103 to 108; primers specific for the femA gene of S. aureus, i.e. the subgroup consisting of SEQ ID Nos: 109 to 114, the subgroup consisting of SEQ ID Nos: 115 to 120; primers specific for the arcC gene of S. aureus, i.e. the subgroup consisting of SEQ ID Nos: 121 to 126, the subgroup consisting of SEQ ID Nos: 127 to 132; primers specific for the nuc gene of S. aureus, i.e. the subgroup consisting of SEQ ID Nos: 133 to 138, the subgroup consisting of SEQ ID Nos: 139 to 144, the subgroup consisting of SEQ ID Nos: 145 to 150, the subgroup consisting of SEQ ID Nos: 151 to 156; primers specific for the hpd gene of H. influenzae, i.e. the subgroup consisting of SEQ ID Nos: 157 to 162, the subgroup consisting of SEQ ID Nos: 163 to 168, the subgroup consisting of SEQ ID Nos: 169 to 174; primers specific for the malB gene of E. coli, i.e. the subgroup consisting of SEQ ID Nos: 175 to 180, the subgroup consisting of SEQ ID Nos: 181 to 186, the subgroup consisting of SEQ ID Nos: 187 to 192; primers specific for the glyK gene of E. coli, i.e. the subgroup consisting of SEQ ID Nos: 193 to 198, the subgroup consisting of SEQ ID Nos: 199 to 204, the subgroup consisting of SEQ ID Nos: 205 to 210 and primers specific for the yiaO gene of E. coli, i.e. the subgroup consisting of SEQ ID Nos: 211 to 216, the subgroup consisting of SEQ ID Nos: 217 to 222, the subgroup consisting of SEQ ID Nos: 223 to 228. A particularly preferred combination of primer consists of one or several sets of six primers, each set consisting of one of the subgroups disclosed above.
Brief description of drawings
Figure 1. Visual inspection of LAMP amplified products of S. enterica DNA carried out with invA primers.
[35] (A) End-point LAMP assay using Thermopol® reaction buffer, Bst 2.0 DNA polymerase and SYBR Green I dye; (B) End-point LAMP assay using Isothermal amplification buffer, Bst 2.0 Warm Start DNA polymerase and SYBR Green I dye; (C) End-point LAMP assay using Thermopol® reaction buffer, Bst 2.0 Warm Start DNA polymerase and SYBR Green I dye; (D) End-point LAMP assay using Isothermal amplification buffer, Bst 2.0 DNA polymerase and SYBR Green I dye; (E): End-point LAMP assay using Bst 2.0 DNA polymerase and Cresol-red dye; (F): End-point LAMP assay using Bst 2.0 DNA polymerase and Cresol-purple dye. Lanes 1, 2, and 3 : LAMP carried out with invA primers in the presence of 100 pg, 10 pg and 1 pg of genomic DNA from S. enterica strain CIP 60.62T, respectively; lane NC: negative control. In (E) and (F), due to representation in greyscale the difference between tubes 1 and 2 and the negative control tube is not readily observable; nevertheless, the difference in color was striking in the original experience, as it is in the original color photography of which the present figure is a reproduction: the color was clearly yellow in tubes 1 and 2, while it was either pink (in (E)) or purple (in (F)) in the NC tube.
Figure 2. Real-time detection of LAMP amplified products of S. enterica.
LAMP on S. enterica DNA was carried out with invA primers using the ISO001 Mastermix. Curves 1, 2, and 3 : LAMP carried out with invA primers in triplicate in the presence of 10 pg, 1 pg and 0.1 pg of genomic DNA from S. enterica strain CIP 60.62T, respectively; curve NC: negative control.
Detailed description of the invention
[36] Detection of bacterial infection. A bacterial infection is defined as the presence of bacteria, in particular living bacteria, in an organism, in particular a mammal and more particularly a human subject. "An infection 'in' a subject" or "an infection Of a subject" are used interchangeably herein. The presence of bacteria in some compartments or tissues of the organism may be considered unrelated to pathology, e.g. on the skin or in the digestive tract, in which case an infection only designates the presence of bacteria in said organism, outside of such tissues and compartments. The presence of bacteria in numbers so small, in particular when counting only living or viable bacteria, that the organism shows no signs of said presence and presents no risk, or an insignificant risk, of developing a disease due to said presence (in particular because its immune system suffices to prevent the development of such a disease and / or an increase in the number of bacteria), as the skilled person would appreciate, may be excluded from the term infection. As provided in the above definition, an infection refers to the state of an individual, i.e. an entire organism. Therefore, as used herein "detecting an infection in a sample of an individual" must be understood as detecting an infection of said individual, using a sample obtained from said individual for the testing procedure and corresponding meanings are conveyed by similar expressions. As provided, the sample is implicitly one suitable for detecting an infection, i.e. a fraction of a tissue or compartment wherein the detection of bacteria is indicative of an infection, rather than one wherein such detection is clinically insignificant.
[37] A bacterial infection, herein, refers more particularly to an infection by a bacterial species selected among the group consisting of Salmonella spp., Staphylococcus aureus, Streptococcus pneumoniae, Haemophilus influenzae and Escherichia coli. A bacterial infection may refer more particularly herein to an infection by a bacterial species selected among the group consisting of: Salmonella spp., Staphylococcus aureus and Streptococcus pneumoniae. When referring to the bacterial species Salmonella spp., all species (e.g. S. enterica, S. bongori, ...), subspecies (e.g. S. enterica subsp. enterica, S. enterica subsp. houtenae, ...) and serotypes (e.g. S. enterica subsp. enterica serotype Typhi, designated herein S. enterica Typhi following common usage), in particular all known pathogenic strains, are contemplated, including NTS (non-Typhi serotypes of the Salmonella enterica subsp. enterica, e.g. S. enterica subsp. enterica serotype Typhimurium, S.enterica subsp. enterica serotype Enteritidis,...) and S. enterica Typhi, as well as unspecified Salmonella spp., and in particular all strains disclosed in Table 19. For conciseness, Salmonella spp. may be referred to as if it were a single species (in particular using singular rather than plural forms as in 'the specie Salmonella spp'), yet it is explicitly provided that all species belonging to Salmonella spp are included in the term. When referring to bacterial species S. aureus, all strains, in particular all known pathogenic strains, and in particular methicillin-resistant strains, are contemplated, and in particular all strains disclosed in Table 21. When referring to bacterial species S. pneumoniae, all strains, in particular all known pathogenic strains of any serotype, are contemplated, and in particular all strains disclosed in Table 20. When referring to bacterial species H. influenzae, all strains, in particular all known pathogenic strains of any serotype, are contemplated, and in particular all strains disclosed in Table 22. When referring to bacterial species E. coli, all strains, in particular all known pathogenic strains of any serotype, are contemplated, and in particular all strains disclosed in Table 23. [38] In particular, any of the methods or products herein may be suitable for the detection of all known pathogenic Salmonella spp. strains, and in particular the strains listed in Table 19. In particular, any of the methods or products herein may be suitable for the detection of all known pathogenic S. aureus strains, and in particular the strains listed in table Table 21. In particular, any of the methods or products herein may be suitable for the detection of all known pathogenic S. pneumoniae strains, and in particular the strains listed in table Table 20. In particular, any of the methods or products herein may be suitable for the detection of all known pathogenic H. influenzae strains, and in particular the strains listed in table Table 22. In particular, any of the methods or products herein may be suitable for the detection of all known pathogenic E. coli strains, and in particular the strains listed in Table 23.
[39] Molecular testing for the presence of bacterial nucleic acid may lead to false positive results (conclusion that bacterial nucleic acid is present when in fact it is not) due to the presence of bacteria from other species than the targeted species, in particular from related species, with sufficiently homologous nucleic acid sequences. This is preferably avoided, as infection with distinct species have distinct clinical outcome and handling. Therefore, the products and methods provided herein are preferably capable of providing negative results when the tested bacteria are absent, but other bacteria are present, in particular other bacteria from closely related species and in particular bacteria listed in Table 12, Table 13, Table 14, Table 15 or Table 16. It may be said herein that such methods and products "do not detect" said other bacteria. In particular, products and methods provided herein may detect all of the pathogenic strains of a given bacterial species and do not detect any of the related bacterial species, in particular they may detect all of the strains listed in Table 19 and none of the strains of Table 12 and/or all of the strains of Table 21 and none of the strains of Table 13 and/or all of the strains of Table 20 and none of the strains of Table 14 and/or all of the strains of Table 22 and none of the strains of Table 15 and/or all of the strains of Table 23 and none of the strains of Table 16.
[40] Detection of bacterial nucleic acid. The detection of bacteria and/or of bacterial infection with the products and methods disclosed herein are allowed thanks to the detection of bacterial nucleic acid. Bacterial nucleic acid refers to any nucleic acid originating from bacteria, including in particular DNA and R A, including in particular genomic DNA. As used herein, the expression refers in particular to nucleic acid from the following bacterial genes: the invA, phoP, prgK and ttrR genes from S. enterica, the femA, arcC and nuc genes from S. aureus, the lytA gene from S. pneumoniae, the hpd gene from H. influenzae and the malB, glyK or yiaO genes from E.coli. [41] Of note, the term detecting is used with the same meaning as "testing for the presence of, which may be understood in the same manner than "testing for the presence or absence of. The skilled person will appreciate that in the case of quantitative tests (as detailed below), "detecting" or "testing for the presence of may comprise determining (or estimating) the amount present. The skilled person will also appreciate that in some applications of the methods disclosed herein, the most significant and/or sought for conclusion is the absence of all of the tested bacterial species (and/or bacterial nucleic acids and/or genes and/or gene regions) in the sample (and/or the individual providing the sample). Such a method is explicitly provided when referring herein to a method of detecting the bacterial species or a method of detecting the presence of the bacterial species (and/or of bacterial nucleic acids, etc) or other similar expressions.
[42] Generally, the element which is tested for (of which the presence and/or amount is sought) is referred to as the analyte. In preferred methods provided herein, in particular comprising a step of amplifying the analyte, the analyte is concretely a specific region in a gene of a bacteria, but the term analyte may be used, as understood in its context, to designate the gene or nucleic acid of the bacteria or the bacteria (as the presence of a gene region implies the presence of the gene, which in turn implies the presence of nucleic acid of the bacteria and of the bacteria).
[43] As used herein, 'a method suitable for the detection of several given analytes' refers to 'a method suitable for the detection of the presence of at least one of the given analytes', regardless of whether the method readout allows the distinction of the analytes, if at least one is present. Such a method will provide a positive detection result if any one of the given analytes is present (including if more than one analytes are present, in any combination) and a negative result if none of the analytes are present. This is true regardless of the specific wording and may be made explicit herein by wordings such as 'method for the detection of one or more of three bacterial species', which designates a method allowing to distinguish whether none of the three bacterial species is present or whether at least one specie is present, or implicit in more concise wordings such as 'method for the detection of three bacterial species' which is used with the same meaning. Similarly, wordings such as 'method for the detection of one or more of five bacterial species' designate a method allowing to distinguish whether none of the five bacterial species is present or whether at least one specie is present, and more concise wordings such as 'method for the detection of five bacterial species' are used with the same meaning. Accordingly, it is specified for illustration purposes that 'methods for the detection of at least two bacterial species' is used herein to designate collectively 'methods for the detection of two bacterial species' (i.e. for detection of the presence of one or more of the two species), 'methods for the detection of three bacterial species' (i.e. for detection of the presence of one or more of the three species), methods for the detection of four bacterial species (i.e. for detection of the presence of one or more of the four species), methods for the detection of five bacterial species (i.e. for detection of the presence of one or more of the five species), and methods for the detection of more than five bacterial species.
[44] It will appear clearly to the skilled person, although not always explicitly stated herein, that a method of detecting [the presence of] a gene region is a particular method of detecting [the presence of] a gene, which in turn is a particular method of detecting [the presence of] a bacterial nucleic acid, which in turn may be a particular method of detecting [the presence of] a bacteria and/or of an infection by a bacteria. When one of these particular methods is provided explicitly, therefore, the more general methods which are thus logically implied are also provided.
[45] The nucleic acid may be detected in particular as intact genomic DNA, in particular genomic DNA present in viable bacteria in the sample and / or as free DNA, in particular sheared genomic DNA, e.g. resulting from bacterial lysis.
[46] Primers and sets of primers. The nucleic acid which is to be detected (the "target" nucleic acid) in the methods provided herein is detected thanks to amplification of one given region of said gene, said region being defined by the set of primers used for said amplification. Accordingly, the primers provided herein are specific for a sequence of said gene in said bacterial species. As stated herein, the primers must allow specific detection of single species of bacteria, excluding closely related species, and must allow for the detection of all or most strains of the target species, taking in account genetic variation between said strains. The following descriptions of a primer all bear the same meaning herein: "a primer having the sequence of SEQ ID No:xx", "a primer consisting of SEQ ID NO:xx", "a primer with the sequence of SEQ ID No:xx". These expressions designate either (i) a primer of which the sequence consists of the sequence provided in the sequence listing with the relevant ID (the listed sequence) and in particular which has the exact length of the listed sequence, or (ii) a primer of which the sequence comprises the listed sequence and optionally additional nucleotides (also called variant primers if necessary to distinguish them from their respective originally specified primers having the described sequences of SEQ ID No:xx), e.g. for incorporation of the additional nucleotides in the amplification product, for detection, cloning, etc. Particular variant primers encompassed within the definitions of the primers, combinations of primers, primer sets and their uses according to the present invention are those which distinguish from the sequences of SED ID No:xx provided herein by the addition of up to 20 consecutive nucleotides (any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20), preferably up to 15 nucleotides (any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15) up to 10 nucleotides (any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10) or up to 5 nucleotides (any of 1, 2, 3, 4, 5) of the 5 ' and/or 3' flanking sequence in the region of the gene to be amplified using the original primer having the sequence of SED ID No:xx. Importantly, the preferred primers provided herein in particular for use in LAMP applications are primers of (i) above, i.e. have the exact length of the listed sequence. As the skilled person will appreciate, depending on the specific application, a primer with the reverse complementary sequence of a primer provided herein (or a combination of primers, each having a reverse complementary sequence of a primer provided herein, or some of the primers within the combination having a reverse complementary sequence of a primer provided herein) may be used with similar effect as the primer (or combination of primers) provided herein. Such reverse complementary primers are therefore also provided herein. In other words, whenever a primer with a given sequence (or use thereof) is provided herein, the primer with the reverse complementary sequence (or use thereof) is also provided, where suitable.
[47] As the skilled person will appreciate, primers bind to a given sequence in a given gene region of a given bacterial species and the sequence is usually specific to said gene region and gene and bacterial species (and common to all the bacteria of the given species, which all possess said gene region and gene). Therefore, said primer may be said to be specific to said gene region, and/or said gene and/or said bacterial species. When used in combination with other primers, which usually will also be specific, the specificity of amplification is increased relative to the specificity of each individual primer, i.e. even if some of the primers may bind to an alternative sequence (or the same sequence found in an alternative region) in particular in other bacterial species, the other primers in the primer set are likely not to bind to any sequence of the alternative sequences/regions (or at least not in a configuration relative to the other primer(s) allowing amplification), and no amplification of said alternative sequence/region will occur. The specificity referred here must be understood to be relative in particular to any, and preferably to all, other bacterial species (or nucleic acid thereof), in particular non-pathogenic bacteria, more preferably relative to all other microbiological organisms or entities and more preferably to all other nucleic acid sequences likely to be found in a sample of the tested subject. In particular, the individual primers and primer sets provided herein are specific of the indicated gene region, of the indicated gene, of the indicated bacterial species in particular relative to other gene regions, genes and/or bacterial species and particularly of all other bacterial species and more particularly of all other nucleic acid sequences likely to be found in a blood sample of a human individual. In particular, the individual primers and primer sets provided herein do not allow amplification of any nucleic acid from a sample, in particular a blood sample, obtained from an individual which does not present an infection by any of the tested bacteria.
[48] Accordingly, provided herein are the following primers: primers selected, individually or in combination, from the group consisting of the primers disclosed in Table 1, Table 2, Table 3, Table 4 and Table 5, namely the group consisting of primers specific for the invA gene of Salmonella spp. (in particular S. enterica), primers specific for the phoP gene of Salmonella spp. (in particular S. enterica), primers specific for the prgK gene of Salmonella spp. (in particular S. enterica), primers specific for the ttrR gene of Salmonella spp. (in particular S. enterica), primers specific for the lytA gene of S. pneumoniae, primers specific for the ply gene of S. pneumoniae, primers specific for the femA gene of S. aureus, primers specific for the arcC gene of S. aureus, primers specific for the nuc gene of S. aureus, primers specific for the hpd gene of H. influenzae, primers specific for the malB gene of E. coli, primers specific for the glyK gene of E. coli and primers specific for the yiaO gene of E. coli wherein: primers specific for the invA gene of Salmonella spp. consist of SEQ ID Nos: 1 to 18, consisting of the subgroup consisting of SEQ ID Nos: 1 to 6, the subgroup consisting of
SEQ ID Nos: 7 to 12 and the subgroup consisting of SEQ ID Nos: 13 to 18;
primers specific for the phoP gene of Salmonella spp. consist of SEQ ID Nos: 19 to 36, consisting of the subgroup consisting of SEQ ID Nos: 19 to 24, the subgroup consisting of
SEQ ID Nos: 25 to 30 and the subgroup consisting of SEQ ID Nos: 31 to 36;
primers specific for the prgK gene of Salmonella spp. consist of SEQ ID Nos: 37 to 60, consisting of the subgroup consisting of SEQ ID Nos: 37 to 42, the subgroup consisting of
SEQ ID Nos: 43 to 48, the subgroup consisting of SEQ ID Nos: 49 to 54 and the subgroup consisting of SEQ ID Nos: 55 to 60;
primers specific for the ttrR gene of Salmonella spp. consist of SEQ ID Nos: 61 to 72, consisting of the subgroup consisting of SEQ ID Nos: 61 to 66 and the subgroup consisting of SEQ ID Nos: 67 to 72;
primers specific for the lytA gene of S. pneumoniae consist of SEQ ID Nos: 73 to 90, consisting of the subgroup consisting of SEQ ID Nos: 73 to 78, the subgroup consisting of SEQ ID Nos: 79 to 84 and the subgroup consisting of SEQ ID Nos: 85 to 90;
primers specific for the ply gene of S. pneumoniae consist of SEQ ID Nos: 91 to 108, consisting of the subgroup consisting of SEQ ID Nos: 91 to 96, the subgroup consisting of SEQ ID Nos: 97 to 102 and the subgroup consisting of SEQ ID Nos: 103 to 108; primers specific for the femA gene of S. aureus consist of SEQ ID Nos: 109 to 120, consisting of the subgroup consisting of SEQ ID Nos: 109 to 114 and the subgroup consisting of SEQ ID Nos: 115 to 120;
primers specific for the arcC gene of S. aureus consist of SEQ ID Nos: 121 to 132, consisting of the subgroup consisting of SEQ ID Nos: 121 to 126 and the subgroup consisting of SEQ ID Nos: 127 to 132; and
primers specific for the nuc gene of S. aureus consist of SEQ ID Nos: 133 to 156, consisting of the subgroup consisting of SEQ ID Nos: 133 to 138, the subgroup consisting of SEQ ID Nos: 139 to 144, the subgroup consisting of SEQ ID Nos: 145 to 150 and the subgroup consisting of SEQ ID Nos: 151 to 156;
primers specific for the hpd gene of H. influenzae consist of: SEQ ID Nos: 157 to 174, consisting of the subgroup consisting of SEQ ID Nos: 157 to 162, the subgroup consisting of 163 to 168, and the subgroup consisting of 169 to 174;
primers specific for the malB gene of E. coli consist of: SEQ ID Nos: 175 to 192, consisting of the subgroup consisting of SEQ ID Nos: 175 to 180, the subgroup consisting of SEQ ID
Nos: 181 to 186 and the subgroup consisting of SEQ ID Nos: 187 to 192;
primers specific for the glyK gene of E. coli consist of: SEQ ID Nos: 193 to 210, consisting of the subgroup consisting of SEQ ID Nos: 193 to 198, the subgroup consisting of SEQ ID
Nos: 199 to 204 and the subgroup consisting of SEQ ID Nos: 205 to 210;
primers specific for the yiaO gene of E. coli consist of: SEQ ID Nos: 211 to 228, consisting of the subgroup consisting of SEQ ID Nos: 211 to 216, the subgroup consisting of SEQ ID
Nos: 217 to 222 and the subgroup consisting of SEQ ID Nos: 223 to 228.
[49] In particular, the primers and combinations of primers are provided excluding primers specific for the ply gene of S. pneumoniae, in particular primers with SEQ ID Nos: 91 to 108.
[50] Primers provided herein and identified as F3, B3, LoopF or LoopB in Table 1, Table 2, Table 3, Table 4 or Table 5 have a sequence comprised in naturally occurring nucleic acids. Primers provided herein and identified as FIP or BIP have non-naturally occurring sequences, as they result from the fusion of two sequences which are not adjacent in the targeted gene. Primers provided herein are particularly provided in non-naturally occurring forms, in particular in mixes and/or compositions not found in nature, and/or in presentations not found in nature, such as in sealed vials, test tubes, lyophilized form, etc.
[51] The primers and combinations thereof are provided in particular for use in the amplification of a given gene region in a given gene in a given species of bacteria, all indicated in Table 1, Table 2, Table 3, Table 4 or Table 5. The primers and combinations thereof are also provided for use in the manufacture of a kit for such detection. The primers are also provided for use in non-diagnostics related methods, in particular for use in methods for food or environmental contamination testing.
[52] Primers intended to be used together, in particular for the amplification of one nucleic acid sequence, are commonly referred to as forming a primer set herein. Accordingly, a primer set will commonly designate a combination of primers allowing the amplification of a given nucleic acid sequence. When more generically presented as subgroups, the primers are not necessarily intended to be presented as forming separate, specifically defined primer sets, and may be considered, in particular depending on the context, as presented in a single group consisting of all the primers mentioned in the subgroups (or in a logical intermediate group, e.g. consisting of all of the primers specific for a given gene) and/or as presented as subgroups wherein each subgroup comprises a set of primers (but all primers in the subgroup are not necessarily included in the set) and/or wherein each subgroup forms a set of primers (i.e. the set of primers consists of all of the primers in the subgroup).
[53] In the preferred methods provided herein, in particular in LAMP assays, a single gene region is amplified using a set of six primers, which allows in particular for increased specificity. Accordingly, the primers mentioned above are provided in particular as sets of six primers, the primers being grouped in sets as depicted in Table 1, Table 2, Table 3, Table 4 or Table 5, each set consisting of a subgroup in the list above. When primers sets are designated as subgroups of references to sequence identifiers in the sequence listing, a six-primer set consists of six consecutive sequence identifiers (e.g. SEQ ID No: [n], SEQ ID No: [n+1], SEQ ID No: [n+2], SEQ ID No: [n+3], SEQ ID No: [n+4], SEQ ID No: [n+5], also noted as "SEQ ID Nos: [n] to [n+5]").
[54] A combination or set of primers may be provided in separate form, e.g. each primer being in an individual container, or in combined form, e.g. by providing the primers of a six-primer set in the form of a mix consisting of the six primers in relative quantity suitable for performing the methods provided herein. The primers may be provided in particular in lyophilized form, or in solution, in particular in a pure-water solution.
[55] A LAMP assay may also be performed using only four primers for the amplification of a specific gene region, although such 4-primer LAMP methods usually show reduced efficiency (and in particular increased time-to-result). The four-primer sets used in such a setup include the F3 ,B3, FIP and BIP primers of the subgroups presented in Table 1, Table 2, Table 3, Table 4 or Table 5, i.e. each four-primer set consists of one of the subgroups wherein the LoopF (or LF) and LoopB (or LB) primers (together designated as "loop primers") have been removed. Combinations of primers forming such four-primer sets are provided herein, comprising one or several of such four-primer sets.
[56] A LAMP assay may also be performed using five primers for the amplification of a specific gene region. The five-primer sets used in such a setup include the F3, B3, FIP and BIP primers (i.e. the primers of the four-primer set) and in addition one of the two loop primers, i.e. LoopF or LoopB, i.e. two alternative five-primer sets may be designed using five of the six primers of the subgroups provided herein: one consisting of the F3, B3, FIP, BIP and Loop F primers and the second one consisting of the F3, B3, FIP, BIP and Loop B primers. Five-primer sets may also be said to consist of the primers of a six-primer set wherein one of the loop primers was removed. Combinations of primers forming such five-primer sets are provided herein, comprising one or several of such four-primer sets.
[57] More generally, when a six-primer set is referred to herein, in particular when referring to products provided herein and comprising or consisting of six-primer sets, it should be understood that the corresponding four-primer set and both of the corresponding five-primer sets are also referred to (as consisting of the six-primer set in which both or one of the loop primers were (was) removed), and that the four-primer set, both of the five-primer sets and the six-primer set are provided as alternatives, the six-primer set usually constituting the preferred combination. Similarly, in any mode of the methods referred to herein which comprises using isothermal amplification and in particular LAMP, whether such mode is disclosed with explicit reference to the use of six-primer sets or not, it should be understood that use of the relevant four-primer sets (i.e. the six-primer sets wherein both the loop primers have been removed), the use of the relevant five- primer sets (i.e. the six-primer sets wherein either one of the loop primers has been removed) and the use of the six-primer sets are provided, while the six-primer sets usually constitute the preferred mode unless otherwise specified or obvious from the context.
[58] In particular modes of the methods provided herein, one or more of the primer sets, and in particular all of the primer sets, consist of the four primers FIP, BIP, F3 and B3 of the six-primer sets provided herein. In particular modes of the methods provided herein and referring to six-primer sets (or subgroups consisting of six primers), one or more of the referred six-primer sets (or subgroups), and in particular all of the primer sets (or subgroups), is (are) replaced with (a) four- primer set(s) consisting of the six-primer set(s) wherein the loop primers have been removed (and/or the subgroup(s) of six primers is(are) replaced with the corresponding subgroup(s) of four primers). In particular modes of the methods provided herein, one or more of the primer sets, and in particular all of the primer sets, consists of a five-primer set consisting of the four primers FIP, BIP, F3 and B3 and one of the LoopF or LoopB primers of the six-primer sets provided herein. In particular modes of the methods provided herein and referring to six-primer sets (or subgroups consisting of six primers), one or more of the referred six-primer sets (or subgroups), and in particular all of the primer sets (or subgroups), is (are) replaced with (a) four-primer set(s) consisting of the six-primer set(s) wherein the loop primers have been removed (and/or the subgroup(s) of six primers is(are) replaced with the corresponding subgroup(s) of four primers) and/or one or more of the referred six-primer sets (or subgroups), and in particular all of the primer sets (or subgroups), is (are) replaced with (a) five-primer set(s) consisting of the six-primer set(s) wherein one of the loop primers has been removed (and/or the subgroup(s) of six primers is(are) replaced with the corresponding subgroup(s) of five primers)
[59] Accordingly, when primers sets are designated as subgroups of references to sequence identifiers, a six-primer set consisting of six consecutive sequence identifiers may be replaced by the four-primer set consisting of the four first sequence identifiers, as they correspond to F3, B3, FIP and BIP, by the five-primer set consisting of the five first sequence identifiers, corresponding to F3, B3, FIP, BIP and LoopF, and/or by the five-primer set consisting of the four first and the last sequence identifiers, corresponding to F3, B3, FIP, BIP and LoopB; e.g. "SEQ ID Nos: [n] to [n+5]" may be replaced with "SEQ ID Nos: [n] to [n+3]", with "SEQ ID Nos: [n] to [n+4]" and/or with "SEQ ID Nos: [n] to [n+3] and SEQ ID No: [n+5]".
[60] Specifically, the following primer sets are provided herein: primer sets specific for the invA gene of Salmonella spp., i.e.
the six-primer set consisting of SEQ ID Nos: 1 to 6;
the five-primer set consisting of SEQ ID Nos: 1 to 5;
the five-primer set consisting of SEQ ID Nos: 1 to 4 and SEQ ID No: 6; and
the four-primer set consisting of primers having the sequence of SEQ ID Nos: 1 to 4;
the six-primer set consisting of SEQ ID Nos: 7 to 12;
the five-primer set consisting of SEQ ID Nos: 7 to 11;
the five-primer set consisting of SEQ ID Nos: 7 to 10 and SEQ ID No: 12; and
the four-primer set consisting of primers having the sequence of SEQ ID Nos: 7 to 10;
the six-primer set consisting of SEQ ID Nos: 13 to 18;
the five-primer set consisting of SEQ ID Nos: 13 to 17;
the five-primer set consisting of SEQ ID Nos: 13 to 16 and SEQ ID No: 18; and
the four-primer set consisting of primers having the sequence of SEQ ID Nos: 13 to 16; primer sets specific for the phoP gene of Salmonella spp., i.e. the six-primer set consisting of SEQ ID Nos: 19 to 24;
the five-primer set consisting of SEQ ID Nos: 19 to 23;
the five-primer set consisting of SEQ ID Nos: 19 to 22 and SEQ ID No: 24; and the four-primer set consisting of primers having the sequence of SEQ ID Nos: 19 to 22; the six-primer set consisting of SEQ ID Nos: 25 to 30;
the five-primer set consisting of SEQ ID Nos: 25 to 29;
the five-primer set consisting of SEQ ID Nos: 25 to 28 and SEQ ID No: 30; and the four-primer set consisting of primers having the sequence of SEQ ID Nos: 25 to 28; the six-primer set consisting of SEQ ID Nos: 31 to 36;
the five-primer set consisting of SEQ ID Nos: 31 to 35;
the five-primer set consisting of SEQ ID Nos: 31 to 34 and SEQ ID No: 36; and the four-primer set consisting of primers having the sequence of SEQ ID Nos: 31 to 34; primer sets specific for the prgK gene of Salmonella spp., i.e.
the six-primer set consisting of SEQ ID Nos: 37 to 42;
the five-primer set consisting of SEQ ID Nos: 37 to 41;
the five-primer set consisting of SEQ ID Nos: 37 to 40 and SEQ ID No: 42; and the four-primer set consisting of primers having the sequence of SEQ ID Nos: 37 to 40; the six-primer set consisting of SEQ ID Nos: 43 to 48;
the five-primer set consisting of SEQ ID Nos: 43 to 47;
the five-primer set consisting of SEQ ID Nos: 43 to 46 and SEQ ID No: 48; and the four-primer set consisting of primers having the sequence of SEQ ID Nos: 43 to 46; the six-primer set consisting of SEQ ID Nos: 49 to 54;
the five-primer set consisting of SEQ ID Nos: 49 to 53;
the five-primer set consisting of SEQ ID Nos: 49 to 52 and SEQ ID No: 54; and the four-primer set consisting of primers having the sequence of SEQ ID Nos: 49 to 52; the six-primer set consisting of SEQ ID Nos: 55 to 60;
the five-primer set consisting of SEQ ID Nos: 55 to 59;
the five-primer set consisting of SEQ ID Nos: 55 to 58 and SEQ ID No: 60; and the four-primer set consisting of primers having the sequence of SEQ ID Nos: 55 to 58; primer sets specific for the ttrR gene of Salmonella spp., i.e.
the six-primer set consisting of SEQ ID Nos: 61 to 66;
the five-primer set consisting of SEQ ID Nos: 61 to 65;
the five-primer set consisting of SEQ ID Nos: 61 to 64 and SEQ ID No: 66; and the four-primer set consisting of primers having the sequence of SEQ ID Nos: 61 to 64; the six-primer set consisting of SEQ ID Nos: 67 to 72;
the five-primer set consisting of SEQ ID Nos: 67 to 71;
the five-primer set consisting of SEQ ID Nos: 67 to 70 and SEQ ID No: 72; and the four-primer set consisting of primers having the sequence of SEQ ID Nos: 67 to 70; primer sets specific for the lytA gene of S. pneumoniae, i.e.
the six-primer set consisting of SEQ ID Nos: 73 to 78;
the five-primer set consisting of SEQ ID Nos: 73 to 77;
the five-primer set consisting of SEQ ID Nos: 73 to 76 and SEQ ID No: 78; and the four-primer set consisting of primers having the sequence of SEQ ID Nos: 73 to 76; the six-primer set consisting of SEQ ID Nos: 79 to 84;
the five-primer set consisting of SEQ ID Nos: 79 to 83;
the five-primer set consisting of SEQ ID Nos: 79 to 82 and SEQ ID No: 84; and the four-primer set consisting of primers having the sequence of SEQ ID Nos: 79 to 82; the six-primer set consisting of SEQ ID Nos: 85 to 90;
the five-primer set consisting of SEQ ID Nos: 85 to 89;
the five-primer set consisting of SEQ ID Nos: 85 to 88 and SEQ ID No: 90; and the four-primer set consisting of primers having the sequence of SEQ ID Nos: 85 to 88; primer sets specific for the ply gene of S. pneumoniae, i.e.
the six-primer set consisting of SEQ ID Nos: 91 to 96;
the five-primer set consisting of SEQ ID Nos: 91 to 95;
the five-primer set consisting of SEQ ID Nos: 91 to 94 and SEQ ID No: 96; and the four-primer set consisting of primers having the sequence of SEQ ID Nos: 91 to 94; the six-primer set consisting of SEQ ID Nos: 97 to 102;
the five-primer set consisting of SEQ ID Nos: 97 to 101;
the five-primer set consisting of SEQ ID Nos: 97 to 100 and SEQ ID No: 102; and the four-primer set consisting of primers having the sequence of SEQ ID Nos: 97 to 100; the six-primer set consisting of SEQ ID Nos: 103 to 108;
the five-primer set consisting of SEQ ID Nos: 103 to 107;
the five-primer set consisting of SEQ ID Nos: 103 to 106 and SEQ ID No: 108; and the four-primer set consisting of primers having the sequence of SEQ ID Nos: 103 to 106; primer sets specific for the femA gene of S. aureus, i.e.
the six-primer set consisting of SEQ ID Nos: 109 to 114;
the five-primer set consisting of SEQ ID Nos: 109 to 113;
the five-primer set consisting of SEQ ID Nos: 109 to 112 and SEQ ID No: 114; and the four-primer set consisting of primers having the sequence of SEQ ID Nos: 109 to 112; the six-primer set consisting of SEQ ID Nos: 115 to 120;
the five-primer set consisting of SEQ ID Nos: 115 to 119;
the five-primer set consisting of SEQ ID Nos: 115 to 118 and SEQ ID No: 120; and the four-primer set consisting of primers having the sequence of SEQ ID Nos: 115 to 118; primer sets specific for the arcC gene of S. aureus, i.e.
the six-primer set consisting of SEQ ID Nos: 121 to 126;
the five-primer set consisting of SEQ ID Nos: 121 to 125;
the five-primer set consisting of SEQ ID Nos: 121 to 124 and SEQ ID No: 126; and the four-primer set consisting of primers having the sequence of SEQ ID Nos: 121 to 124; the six-primer set consisting of SEQ ID Nos: 127 to 132;
the five-primer set consisting of SEQ ID Nos: 127 to 131;
the five-primer set consisting of SEQ ID Nos: 127 to 130 and SEQ ID No: 132; and the four-primer set consisting of primers having the sequence of SEQ ID Nos: 127 to 130; primer sets specific for the nuc gene of S. aureus, i.e.
the six-primer set consisting of SEQ ID Nos: 133 to 138;
the five-primer set consisting of SEQ ID Nos: 133 to 137;
the five-primer set consisting of SEQ ID Nos: 133 to 136 and SEQ ID No: 138; and the four-primer set consisting of primers having the sequence of SEQ ID Nos: 133 to 136; the six-primer set consisting of SEQ ID Nos: 139 to 144;
the five-primer set consisting of SEQ ID Nos: 139 to 143;
the five-primer set consisting of SEQ ID Nos: 139 to 142 and SEQ ID No: 144; and the four-primer set consisting of primers having the sequence of SEQ ID Nos: 139 to 142; the six-primer set consisting of SEQ ID Nos: 145 to 150;
the five-primer set consisting of SEQ ID Nos: 145 to 149;
the five-primer set consisting of SEQ ID Nos: 145 to 148 and SEQ ID No: 150; and the four-primer set consisting of primers having the sequence of SEQ ID Nos: 145 to 148; the six-primer set consisting of SEQ ID Nos: 151 to 156;
the five-primer set consisting of SEQ ID Nos: 151 to 155;
the five-primer set consisting of SEQ ID Nos: 151 to 154 and SEQ ID No: 156; and the four-primer set consisting of primers having the sequence of SEQ ID Nos: 151 to 154; primer sets specific for the hpd gene of H. influenzae, i.e.
the six-primer set consisting of SEQ ID Nos: 157 to 162;
the five-primer set consisting of SEQ ID Nos: 157 to 161; the five-primer set consisting of SEQ ID Nos: 157 to 160 and SEQ ID No: 162; and the four-primer set consisting of SEQ ID Nos: 157 to 160;
the six-primer set consisting of SEQ ID Nos: 163 to 168;
the five-primer set consisting of SEQ ID Nos: 163 to 167;
the five-primer set consisting of SEQ ID Nos: 163 to 166 and SEQ ID No: 168; and the four-primer set consisting of SEQ ID Nos: 163 to 166;
the six-primer set consisting of SEQ ID Nos: 169 to 174;
the five-primer set consisting of SEQ ID Nos: 169 to 173;
the five-primer set consisting of SEQ ID Nos: 169 to 172 and SEQ ID No: 174; and the four-primer set consisting of SEQ ID Nos: 169 to 172;
primer sets specific for the malB gene of E. coli, i.e.
the six-primer set consisting of SEQ ID Nos: 175 to 180;
the five-primer set consisting of SEQ ID Nos: 175 to 179;
the five-primer set consisting of SEQ ID Nos: 175 to 178 and SEQ ID No: 180; and the four-primer set consisting of SEQ ID Nos: 175 to 178;
the six-primer set consisting of SEQ ID Nos: 181 to 186;
the five-primer set consisting of SEQ ID Nos: 181 to 185;
the five-primer set consisting of SEQ ID Nos: 181 to 184 and SEQ ID No: 186; and the four-primer set consisting of SEQ ID Nos: 181 to 184;
the six-primer set consisting of SEQ ID Nos: 187 to 192;
the five-primer set consisting of SEQ ID Nos: 187 to 191;
the five-primer set consisting of SEQ ID Nos: 187 to 190 and SEQ ID No: 192; and the four-primer set consisting of SEQ ID Nos: 187 to 190;
primer sets specific for the gly gene of E. coli, i.e.
the six-primer set consisting of SEQ ID Nos: 193 to 198;
the five-primer set consisting of SEQ ID Nos: 193 to 197;
the five-primer set consisting of SEQ ID Nos: 193 to 196 and SEQ ID No: 198; and the four-primer set consisting of SEQ ID Nos: 193 to 196;
the six-primer set consisting of SEQ ID Nos: 199 to 204;
the five-primer set consisting of SEQ ID Nos: 199 to 203;
the five-primer set consisting of SEQ ID Nos: 199 to 202 and SEQ ID No: 204; and the four-primer set consisting of SEQ ID Nos: 199 to 202;
the six-primer set consisting of SEQ ID Nos: 205 to 210;
the five-primer set consisting of SEQ ID Nos: 205 to 209; the five-primer set consisting of SEQ ID Nos: 205 to 208 and SEQ ID No: 210; and the four-primer set consisting of SEQ ID Nos: 205 to 208;
primer sets specific for the yiaO gene of E.coli, i.e.
the six-primer set consisting of SEQ ID Nos: 211 to 216;
the five-primer set consisting of SEQ ID Nos: 211 to 215;
the five-primer set consisting of SEQ ID Nos: 211 to 214 and SEQ ID No: 216; and the four-primer set consisting of SEQ ID Nos: 211 to 214;
the six-primer set consisting of SEQ ID Nos: 217 to 222;
the five-primer set consisting of SEQ ID Nos: 217 to 221;
the five-primer set consisting of SEQ ID Nos: 217 to 220 and SEQ ID No: 222; and the four-primer set consisting of SEQ ID Nos: 217 to 220;
the six-primer set consisting of SEQ ID Nos: 223 to 228;
the five-primer set consisting of SEQ ID Nos: 223 to 227;
the five-primer set consisting of SEQ ID Nos: 223 to 226 and SEQ ID No: 228; and the four-primer set consisting of SEQ ID Nos: 223 to 226;
or primer sets among the above wherein at least one primer distinguishes by the addition of up to 20 or up to 15 or up to 10 consecutive nucleotides of the 5' and/or 3' flanking sequence in the region of the gene to be amplified.
[61] In particular, primers provided herein are provided in a format wherein (a) FIP and BIP primers, (b) F3 and B3 primers and (c) LF and LB primers are in a 40 / 5 / 20 (a/b/c) molar ratio, both primers of (a) being provided in the same molar quantity, as well as both primers of (b), and both primers of (c). For illustration purposes, if for example the F3 primer is provided in a quantity equal to 1 (in arbitrary molar units), B3 will be provided in a quantity equal to 1, LF and BF both in a quantity equal to 4 and FIB and BIP both in a quantity equal to 8. Deviation from the above ratio is possible, preferably limited so that each one-to-one ratio for couples of primers is within 50 %, and more preferably with 20 %, of the value disclosed above; e.g. F3/B3 (ratio of the molar quantities) is 1 +/- .5, preferably 1 +/- .2; LF/F3 is 4 +/- 2, preferably 4 +/- 0.8; FIB/B3 is 8 +/- 4, preferably 8 +/- 1.6.
[62] If only a subset of the six primers is provided as a combination (possibly for further combination with a subset representing the remainder of the six primers), the relative quantity of the provided primers may be that which would result from the above-disclosed ratios. E.g. when only the BIP and FIP primers are provided together, they may be provided at a 1 : 1 ratio, while e.g. BIP and LB provided together would be provided at a 2:1 BIP:LB ratio. [63] For the sake of clarity, it is specified that each of the primers is provided individually. In addition, each six-primer set is provided as a product combination. In addition, each four-primer set is provided as a product combination. In addition, each five-primer set is provided as a product combination. Each of these products (individual primers and primer sets) is provided in particular for use in methods for the detection of nucleic acids from the relevant gene region of the relevant gene in the relevant bacterial species. In addition, combinations of primer sets are provided. In particular, combinations comprising at least one primer set for each of at least two, and preferably three, species of bacteria selected among the group consisting of Salmonella spp. , Staphylococcus aureus and Streptococcus pneumoniae, are provided, in particular for the simultaneous testing of the presence of the nucleic acid of any of said species of bacteria and/or for the simultaneous testing of a bacterial infection by any of said species, or for the manufacturing of kits suitable for such simultaneous testing methods. Particular such combinations are as follows, wherein the primer sets are selected among the relevant groups of primer sets provided herein:
combinations consisting of or comprising three primers sets (of six primers each), one set being specific for one gene from Salmonella spp. , in particular from S. enterica, one set being specific for one gene from Staphylococcus aureus and one set being specific for one gene from Streptococcus pneumoniae;
combinations consisting of or comprising three primer sets (of six primers each), one set being specific for of the invA, gene of S. enterica, one for the arcC gene or the femA gene of S. aureus and one for the lytA gene of S. pneumoniae;
preferably, combinations consisting of or comprising the three primer sets designated as primer set n° l for gene invA, gene of S. enterica, arcC gene of S. aureus and lytA gene of S. pneumoniae in Table 1 , Table 3, and Table 2, i.e. the subgroup consisting of SEQ ID Nos: 1 to 6, the subgroup consisting of SEQ ID Nos: 121 to 126, and the subgroup consisting of SEQ ID Nos: 73 to 78.
[64] Particularly preferred combinations comprise at least one primer set for each of at least two, and preferably three or four and even more preferably five species of bacteria selected among the group consisting of Salmonella spp. , Staphylococcus aureus, Streptococcus pneumoniae, Haemophilus influenzae and Escherichia coli. In particular such combinations are as follows, wherein the primer sets are selected among the relevant groups of primer sets provided herein:
combinations consisting of or comprising five primers sets (of six primers each), one set being specific for one gene from Salmonella spp. , in particular from S. enterica, one set being specific for one gene from Staphylococcus aureus, one set being specific for one gene from Streptococcus pneumoniae, one set being specific for H. influenzae and one set being specific for E. coli;
combinations consisting of or comprising five primer sets (of six primers each), one set being specific for of the invA, gene of S. enterica, one set being specific for the arcC gene or the femA gene of S. aureus, one set being specific for the lytA gene of S. pneumoniae, one set being specific for the hpd gene of H. influenzae and one set being specific for the malB gene or the glyK gene or the yiaO gene of E. coli;
preferably, combinations consisting of or comprising the five primer sets designated as primer set n°l for the invA gene of S. enterica, primer set n°l for the arcC gene of S. aureus, primer set n°l for the lytA gene of S. pneumoniae, primer set n°2 for the hpd gene of H. influenzae and primer set n°3 for the malB gene of E. coli in Table 1, Table 3, Table 2, Table 4 and Table 5 i.e. the subgroup consisting of SEQ ID Nos: 1 to 6, the subgroup consisting of SEQ ID Nos: 121 to 126, the subgroup consisting of SEQ ID Nos: 73 to 78, the subgroup consisting of SEQ ID Nos: 163 to 168 and the subgroup consisting of SEQ ID Nos: 187 to 192.
[65] In the above combinations, the explicitly provided primer sets comprise four-primer sets, five-primer sets and/or six-primer sets, or preferably are all four-primer sets, or are all five-primer sets or even more preferably are all six-primer sets. In particular, an alternative combination to the preferred combination above consists of or comprises the set of primers with SEQ ID NOs: 1 to 4, primers with SEQ ID NOs: 121 to 124 and primes with SEQ ID NOs: 73 to 76. Another alternative combination consists or comprises the set of primers with SEQ ID NOs: 1 to 4, primers with SEQ ID NOs: 121 to 124, primers with SEQ ID NOs: 73 to 76, primers with SEQ ID NOs: 163 to 166 and primers with SEQ ID NOs: 187 to 190.
[66] As the skilled person will appreciate, the primers designated herein as F3 and B3, which in a LAMP amplification are provided to allow for strand displacement, may be used together, and without the additional primers required for a LAMP reaction, in a PCR reaction. In particular, the pair of primers consisting of the F3 and B3 primers from one of the six-primer sets disclosed in Table 1, Table 2, Table 3, Table 4 and Table 5 may be used to amplify, by PCR or PCR-related amplification methods, a specific gene region of the indicated gene from the indicated bacterial species. The primers provided herein are provided in particular as combinations of primers suitable for use in PCR or PCR-related amplification of nucleic acids from the relevant bacterial species, in particular as pairs of primers consisting of a B3 and an F3 primer from one of the subgroups disclosed above and/or in Table 1, Table 2, Table 3, Table 4 and Table 5. [67] LAMP technique. The LAMP technique uses a DNA polymerase with a high auto-cycling strand displacement activity, and six specially designed primers to synthesize large amounts of DNA molecules under a constant temperature between 60-65°C. The LAMP reaction yields high amount of amplification products, which can be detected either visually or by simple detectors. These large amounts of synthesized double strand DNA (dsDNA) yield large amounts of pyrophosphate ion byproducts, which combine with divalent metallic ion (such as Mg2+) to form an insoluble salt, resulting in a decrease of Mg2+ ion concentration as the LAMP reaction progresses. In addition, it has been reported that there is a strong correlation between the change in pH and the amplification yield during the LAMP, as hydrogen ions are released during the LAMP procedure. Due to these properties, real-time monitoring of the LAMP reaction can be achieved by: (i) fluorescence, using DNA intercalating dyes, fluorescent molecular beacon probes or a fluorescence metal indicator such as calcein; (ii) colorimetry, using a colored indicator for alkaline metal ions, such as hydroxy naphthol blue or pH indicators; (iii) turbidity, as the LAMP reaction produces large amounts of magnesium pyrophosphate (a white precipitate) and dsDNA, which allow visual inspection of results using a turbidimeter; (iv) electrochemically, using a pH meter for direct measurement of released hydrogen ions during the LAMP procedure, or using integrated electrodes for measuring decreases in current resulting from increasing binding of electrochemically-active DNA-binding redox reporters, such as Methylene Blue, to LAMP reaction products; (v) enzyme-linked immunosorbent assays (ELISA) or lateral flow immunoassays based on the use of specific probes; (vi) bio luminescence, through bio luminescent output of the coupled conversion of inorganic pyrophosphate produced stoichio metrically during nucleic acid synthesis to ATP by the enzyme ATP sulfurylase. In addition to their relative simplicity and low infrastructure costs, LAMP techniques (i) have moderate incubation temperature leading to simplified heating and low power consumption, (ii) yield high amount of amplification products, which can be detected either visually or by simple detectors, (iii) allow direct genetic amplification from bacterial cells due to the superior tolerance to well-known PCR inhibitors such as blood (iv) have high specificity, and sensitivity, and (v) result in rapid detection often within 10-20 min.
[68] Accordingly, provided herein are methods for the detection of nucleic acid from bacteria, said methods comprising a step of amplifying nucleic acid of at least one gene region of at least one bacterial species using a set of primers as disclosed herein. In particular, the amplified gene region is the region indicated in Table 1, Table 2, Table 3, Table 4 and Table 5 and/or is the region comprised between the sequence of the primer identified as F3 and the inverse complementary sequence of the primer designated as B3 of the gene indicated, in the indicated bacterial species (and/or the region that is or would be amplified using the F3 and B3 primers in a PCR amplification reaction). As will appear to the skilled person, the amplification of the nucleic acid is said herein to be performed in one step, in particular since there is essentially no intervention from the operator or automate during this step (except to maintain temperature, homogeneity of the solution, etc), regardless of the number of chemical reactions (or cycles of reactions) actually occurring in the solution. Accordingly, the step of amplification starts when all reagents required for the amplification reaction to occur are mixed under conditions (in particular temperature conditions) allowing for said reaction to start, and said step ends when either the reaction ends without a change in reaction conditions, e.g. due to the consumption of a required reagent or when the reaction is stopped by a modification of the conditions (e.g. cooling of the solution) or when the result is read, whether the reaction actually ended or not.
[69] In particular modes, the amplification step is performed isothermally, in particular at a constant temperature equal to or higher than 50 °C, in particular lower than or equal to 70 °C, and more particularly in the 50 °C to 70 °C range, and yet even more particularly in the 60 °C to 65 °C range, equal to 60 °C or equal to 65 °C. In particular modes provided herein, the amplification is performed using a LAMP assay, and in particular using a real-time LAMP assay.
[70] An 'assay' (and corresponding expressions: assaying, etc) as used herein designates in particular the essential step in the method leading to an informative result (i.e. a result which is different depending on the presence or absence of the assayed analyte(s) in the sample). In such a meaning, this will usually exclude e.g. sample preparation steps, as well as readout and reporting steps. Moreover, this will usually designate a step carried out in a single reaction solution (and/or container, or compartment), e.g. for the detection of a single analyte (or multiple analytes in multiplex assays as detailed below). Detection, in particular the conversion of an amplification to a visible or detectable signal and recording of said signal, is generally comprised in the assay, in particular since the preferred assays provided herein comprise real-time assays. A 'test' (and similar expressions: testing, etc) as used herein designates in particular the method including all of its steps and may, as detailed below for simultaneous tests, comprise several assays. Although distinction of these terms is made wherever deemed suitable to provide for clearer understanding, these terms are not intended to convey strictly the meaning defined above, and should more generally be given the meaning a skilled person would understand in the context of their use, and in particular the terms may be used interchangeably.
[71] In particular modes, the step of amplifying the nucleic acids is performed using a DNA polymerase with strand-displacement activity, in particular a DNA polymerase suitable for LAMP assays, preferably a so-called hot start DNA polymerase or a WarmStart® DNA polymerase (i.e. a polymerase whose activity is inhibited until it has been heated to a given temperature, e.g. by binding with an aptamer). More particularly, the polymerase may be Bst I DNA polymerase, Bst 2.0 DNA polymerase, Bst I LF DNA polymerase (consisting of the large fragment (LF) of Bst I DNA polymerase), GeobaciUus sp. M. (GspM) LF polymerase, or, preferably, Bst 2.0 WarmStart® DNA polymerase, or the engineered version of GspM LF polymerase known as GspSSD (OptiGene, comprised e.g. in the Mastermix IsoOOl). A particular preferred polymerase is GspSSDl , an engineered LF DNA polymerase isolated from GeobaciUus sp with enhanced reverse transcription activity (Optigene).
[72] In particular modes, the step of amplifying the nucleic acids is performed in a mix comprising:
0.8 mM to 2mM dNTP, preferably 1.0 to 1.4 mM dNTP;
2mM to 6 mM MgS04, preferably 6 mM MgS04;
0.6 M to 1 M Betain, preferably 0.8 M Betain;
0.1 to I X EvaGreen™ intercalating agent, preferably 0.25 X EvaGreen™, or 0.5 to 3 μΜ Syto-9, preferably 3 μΜ Syto-9;
40 pmol of FIP and BIP primers, 5 pmol of F3 and B3 primers, 20 pmol of LF and BF primers;
lx ThermoPol® reaction buffer [20mM Tris-HCl, lOmM (NH4)2S04, lOmM KC1, 2mM MgS04, 0.1% Triton® X-100, pH 8.8] or, preferably, lx isothermal amplification buffer [20mM Tris-HCl, lOmM (NH4)2S04, 50mM KC1, 2mM MgS04, 0.1% Tween® 20, pH 8.8]; and
At least 1 unit, preferably 5 to 10 units, preferably 8 units of DNA polymerase, preferably of GspSSDl DNA polymerase, for one assay.
A particular preferred mode comprises use of the mix disclosed as composition 19 in Table 6.
[73] The step of amplifying the nucleic acids may be performed using the reagents comprised in the IsoOOl Master Mix provided by OptiGene with the addition of primers. The step of amplifying the nucleic acids is preferably performed in reaction volumes of 0.5 μΐ^ ίο 100 μί, preferably from 1 μΐ^ to 50 μΐ^. In particular, and in particular where the reaction is performed within a microfluidics device, the reaction volume may be from 1.5 to 10 μΐ^, in particular 1.5 to 5 μΐ^, in particular 1.6 μΐ^. in particular, and in particular when the reaction is performed in microtubes and/or in wells of microwell plates, the reaction volume may be from 10 to 50 μί, preferably from 20 to 40 μί, and in particular may be 25 μί.
[74] The inventors have shown that the primers provided herein allow for fast testing. Practically, in particular for end-point testing, the results have been shown to be obtainable in less than 30 minutes. Time-to-result as defined herein is related to the duration of the detection assay required to make the readout of a result possible, usually excluding any sample preparation steps. In particular, in methods involving amplification of a gene region for detection of a nucleic acid, as provided herein, time-to-result refers to the duration of the amplification reaction which allows for sufficient amplification of the target nucleic acid, when present, in order for said amplification to be readily detected. In real-time amplification procedures, and in particular in real-time LAMP, time-to-result may be assessed by reading the amplification curve, and is defined as the time required to achieve amplification levels significantly above background, in exponential amplification phase. In particular modes, the methods provided herein allow obtaining a result in (or have a time-to-result of) less than 30 minutes, preferably less than 20 minutes, and even more preferably less than 15 or 10 minutes. In particular modes, the amplification step in the methods provided herein has a duration of 30 minutes or less, and preferably 20 minutes or less, and even more preferably 15 minutes or 10 minutes or less.
[75] End-point vs. real-time testing. The results of an assay as provided herein may be either a binary result (two possible outcomes, i.e. presence and absence of a nucleic acid) or a more detailed result, in particular an estimate of the quantity of bacterial nucleic acid and/or bacteria present in the sample.
[76] In the preferred methods of detection provided herein, the skilled person using knowledge common in the art can use several approaches to design an assay with binary readout. Practically, the amplification of target DNA (which only occurs in the presence of bacterial nucleic acid and/or bacteria) induces a number of changes in the solution where the amplification takes place, and such changes may be readily detected, in particular visually. This includes e.g. change of pH of the reaction solution, which may be detected with the use of a color pH indicator. Another option is the detection of increased fluorescence of a DNA intercalating agent. In assays such as those provided herein, when seeking for a binary readout, the amplification is usually allowed to carry out for a predefined time - in particular a time sufficient to achieve complete reaction - before a result is read-out. Alternatively, the amplification may be left to carry out until a positive result is apparent in a positive control performed under identical conditions (usually simultaneously). In both cases, since the result is read at a given point in time when the reaction is considered sufficient, these testing procedures are termed end-point testing. Accordingly, provided herein are methods of detection of bacterial nucleic acids comprising a step of amplification by LAMP with the provided primer sets, and further comprising a step of assessing the color and/or fluorescence of the assay solution, in particular when a specific color, or change of color, or when a specific level of fluorescence (or any level of fluorescence distinguishable from background) is indicative of the presence of said nucleic acids.
[77] Alternatively, or in addition to the binary readout mentioned above, the methods provided herein, and the provided products in particular when used in such methods, may allow for a realtime readout. Methods allowing for a real-time readout are referred to generally as real-time tests (or assays) herein. Methods for real-time amplification of nucleic acids are known to the skilled person, in particular such methods for isothermal amplification and in particular methods where the amplification of DNA is monitored during amplification, thanks e.g. to changes in fluorescence properties of primers or of intercalating agents induced by their incorporation, or change of pH, turbidity, conductivity, etc. LAMP, the preferred method for performing the real-time testing methods provided herein, in particular, provides the ability for real-time monitoring, and is termed herein real-time LAMP when such monitoring is performed. Accordingly, provided herein are methods allowing for real-time testing of the presence of bacterial nucleic acids, and in particular methods based on real-time assays, and more particularly real-time LAMP assays.
[78] As is well known to the skilled person, such methods allow a reliable and reproducible comparison of the amount of target nucleic acids in samples, and may therefore be used either for comparison purposes and/or for estimating an absolute amount, after calibration of the procedure has been performed using samples of known content. As such, these methods are sometimes termed "quantitative" methods herein, although generally they will not allow measurement of an absolute quantity, but rather comparison of quantities - the conversion to absolute quantities being possible thanks to calibration. "Semi-quantitative" may be used herein to designate such methods.
[79] In the preceding paragraphs, it must be understood that the mentioned binary readout is for one given assay, i.e. for example one amplification reaction. Since it is possible to test for several bacterial species simultaneously, the result of the assays may be a binary readout for each species. The result in this case is therefore not strictly speaking binary, although the test is still an end-point test. The skilled person will appreciate that the results of the global test may be reported as binary (absence / presence of any bacterial species) or preferably as either the absence of any bacterial species or the presence of one, or more, identified bacterial species. [80] Similarly, since in testing for a given species of bacteria it is possible to test for several distinct genes and/or distinct gene regions, the assays for each gene region would each provide a binary output, the test results therefore not being binary. In this case, the skilled person would appreciate that the results for all gene regions of a given species of bacteria should be identical in the majority of cases, as shown by the validation results presented herein, thus allowing for the aggregation of results when reporting absence or presence of said species. In cases where distinct gene regions of a single gene, or of genes from a single bacterial species, lead to distinct results, the skilled person will appreciate whether a negative or positive test result may still be provided or whether, for example, further testing is required.
[81] Further, as would appear to the skilled person, any quantitative or semi-quantitative method and in particular a real-time method may be modified to provide a binary output. In particular, it is possible to set a threshold (lower detected amount) for reporting a positive result. Said threshold might be set in particular to reflect a clinical significant amount of bacteria in a sample, in particular the amount characterizing the presence of bacteria as an infection. In other applications, the amount might reflect e.g. hygiene standards in the testing of food samples and/or environmental standards in the testing of environmental samples.
[82] Generally speaking, the manner in which test results are reported will depend on circumstances and the skilled person will appreciate that assays with binary or quantitative readout, including when several assays are performed simultaneously, may be reported as a single or as several test result(s), with a level of detail which may range from a binary result (positive / negative) to the provision of amounts of detected DNA for each gene region tested in each bacterial species. In preferred modes when the provided methods are for the detection of bacterial infection in an individual, the results are reported as presence or absence of each tested species.
[83] It is noteworthy that the inventors have shown that the primer sets provided herein, in particular when used in LAMP procedures, may be used either in end-point testing procedures, or in real-time LAMP, testing, with satisfactory results in terms of sensitivity and specificity. Generally, real-time methods require more complex testing procedures and possibly more complex material and training. Therefore, binary methods will often be preferred in setups where little access to technical resources are available. The methods provided herein may indeed involve end-point testing procedures, in particular tested by color and/or fluorescence. On another hand, real-time detection methods provide for improved sensitivity (lower detection limit) which may be considered critical in some of the applications for the methods or products provided herein, and low price fluorescence detectors, suitable for even resource- limited applications, are readily available. Moreover, a number of automated platforms have been conceived in particular for high-throughput operation of real-time amplification procedures as described above, and are suitable for high- throughput, in particular quantitative or semi-quantitative LAMP assays. Therefore, in particular in high-throughput applications and/or applications where optimal sensitivity is required, the methods provided herein may involve real-time LAMP assays.
[84] Accordingly, provided herein are methods for detecting bacterial nucleic acid using an end- point LAMP assay, wherein the primers for the LAMP assay are the primers provided herein, in particular provided as six-primer sets. In particular, provided herein are such assays wherein the assay readout is performed visually, more particularly by visualization of a change of color of the assay solution, particularly by pH-driven colorimetry and/or by visualization of a change in fluorescence of the solution, particularly using a DNA intercalating agent and/or revealed under UV-light. In particular, in such end-point assays, the amplification steps in the assay are allowed to carry on for 30 minutes.
[85] Also provided herein are methods for detecting bacterial nucleic acid using a real-time LAMP assay, wherein the primers for the LAMP assay are the primers provided herein, in particular a fluorescent real-time LAMP assay wherein monitoring is performed by using a fluorescent intercalating dye. In particular provided herein are such assays wherein the calibration of the assay has been or is performed using spiked whole blood samples, i.e. whole blood samples of control, uninfected individuals, wherein a known quantity of bacteria or bacterial nucleic acid was added prior and wherein the spiked whole blood sample was or is tested in conditions identical to the samples wherein detection is performed.
[86] In preferred modes of the methods disclosed herein, the lower limit of detection of such assays (i.e. the minimal amount of colony forming units in the assayed sample ensuring a positive result) is 25 CFU per reaction or lower, preferably 10 CFU per reaction or lower, more preferably 5 CFU per reaction or lower, and even more preferably 2.5 CFU per reaction or lower. In particular, the methods provided herein allow for detection of bacterial nucleic acid in whole blood samples with 125 CFU/mL or more (e.g. with assays having lower limits of detection of 25 CFU/reaction or lower, if one fifth of the sample is used for each reaction, e.g. if nucleic acids are extracted from a volume of lmL blood sample, eluted in 100 and if 20μΙ, of the eluted DNA template is used to resuspend the freeze-dried LAMP assay reagents) 50 CFU/mL or more (e.g., with assays having lower limits of detection of 2.5 CFU/reaction or lower, if nucleic acids are extracted from a volume of lmL blood sample, eluted in 100 and if 5 of the eluted DNA template is added to 20 μΐ, of LAMP assay reagents) or with 10 CFU/mL or more, which is generally considered sufficient for the intended applications of the methods provided herein (e.g. with assays having lower limits of detection of 2.5 CFU/reaction or lower, if nucleic acids are extracted from a volume of lmL blood sample, eluted in 100 μΙ_, and if 25μΙ, of the eluted DNA template is used to resuspend the freeze- dried LAMP assay reagents).
[87] Origin of the sample and sample preparation. The sample used for testing may be in particular from a mammal, more particularly a human subject. In particular, the subject from whom the sample is obtained may be at risk of bacterial infection, and/or present clinical signs which lead to suspicion of bacterial infection. In particular, the sample is obtained from a human child, in particular less than 15 and more particularly less than 5 years old.
[88] In a number of cases, the methods provided herein are intended to detect a bacterial infection in a mammal, in particular in a human individual, and testing is then usually performed in vitro on a sample from said mammal. The step of obtaining the sample from the subject is generally not included in the method provided herein. Providing a sample from said individual is common practice and is usually best achieved by drawing blood from the individual. In particular, the methods provided herein are intended to detect in vitro a bacterial infection in an individual, using a blood sample obtained from said individual.
[89] In some testing procedures, the blood sample requires specific storage conditions, in particular specific conditions for storing the sample immediately after collection and/or for storing the sample in the time lapse between collection and testing. Whole blood used in such procedures may have undergone one or more preparation steps such as collection in tubes containing anticoagulant agents, dilution, etc... In particular, in some modes the blood draw must be performed using collection tubes containing conventional anti-coagulant agents (such as heparin or EDTA). In particular, the inventors provide herein methods using 1 mL-blood samples, collected in such anticoagulant agent containing tubes, preferably EDTA or citrate containing tubes.
[90] In some testing procedures, the blood sample requires specific preparation before performing the procedure. In other testing procedures, the blood sample requires no specific preparation. The blood sample is said to be whole blood in cases where no specific separation of blood components, in particular of serum, plasma, buffy coat and /or of specific blood cells or blood cell fractions, is required prior to perform the testing procedures. In particular, provided herein are methods wherein the samples, in particular the blood samples, are not subjected to any centrifugation step and preferably are not subjected to any boiling step and more preferably are not subjected to any step of heating above 80 °C. In particular, the methods of testing provided herein may comprise the preparation of the sample, such preparation possibly including in particular a step of diluting the whole blood sample and / or a step of lysing the sample.
[91] In preferred testing methods provided herein, total nucleic acids are extracted from the whole blood samples prior to the amplification reaction. Such an extraction is essentially required in order to concentrate nucleic acids so they can be used in a solution with the suitable pH, salinity, polarity etc (and corresponding concentrations of salts), at a suitable concentration and in a suitable final volume for the amplification reaction to take place. In the preferred methods for testing provided herein, the presence of non-nucleic acid contaminants is essentially not an issue, as few if any of the possible contaminants have the ability to inhibit the amplification reaction. As used herein, the extraction of nucleic acids designates the separation of nucleic acid from any other fraction of the sample, including from a fraction of the solvent, whether or not an enrichment is observed of the nucleic acid relatively to other solutes or biological macromolecules. In other words, a step of extracting nucleic acids may sometimes actually be a step of concentrating nucleic acids (and possibly all or most other solutes in the sample). Such a step may also be a step of separation nucleic acids from all or most small molecules in the sample, resulting in obtaining a concentrated fraction comprising the majority of nucleic acids, and at least part of the proteins in the sample.
[92] Method steps for extracting nucleic acids from whole blood samples, requiring no centrifugation or heating above 80 °C of the samples, are provided herein, which are suitable for the subsequent amplification required in the testing methods, in particular using magnetic beads and preferably silica-based magnetic beads. In particular, the extraction methods provided herein do not require the use of enzymes, which is advantageous in some setups, in particular since kits comprising enzymes require stringent storage conditions and in particular cooling. Accordingly, the methods of detection of bacterial nucleic acids provided herein may comprise the extraction of nucleic acids from the sample, in particular may comprise a step of mixing the sample with a solid substrate capable of binding the nucleic acids (therefore allowing immobilization of the nucleic acids on the solid substrate), in particular with a magnetic solid substrate and more particularly with magnetic silica-based beads, in particular silica-based beads with large surface area (at least 600 nm diameter), long suspension time, fast separation, suitable for nucleic isolation from various sources (blood, cell, bacteria) for manual and automated workflow (less than Ι μιη diameter for use in miniaturized tests such as microchips). The mixing of the sample with the solid substrate may be performed in particular after lysis. Such steps are performed in particular with magnetic beads that are not carboxyl-based beads and/or which are silica-based beads which are not NucliSENS® beads from Biomerieux or Dynabeads® from Life Technologies. Chaotropic lysis methods are used in particular embodiments. Such particularly preferred extraction methods are disclosed below, in particular in Example 3, such as the method adapted from Boom et al. ("Boom extraction method").
[93] In particular where the nucleic acids are immobilized on a solid substrate, it is possible to wash (or rinse) the immobilized nucleic acid with a solution in a convenient manner. Moreover, it is possible to recover the immobilized nucleic acid, in particular recover by resuspension in a solution (elution), preferably in water, by creating conditions where they no longer bind the solid substrate, in particular by modifying salt conditions and/or by heating. Accordingly, the step of immobilizing the nucleic acids on a solid substrate in the method provided herein may be followed by a step of rinsing the immobilized nucleic acids, preferably by at least three successive steps of rinsing and more preferably by at least five successive steps of rinsing. Each step of rinsing may be performed with 250 to 3 mL, preferably 500 to 2 mL, and in particular 500 μί, 1 mL or 2 mL. Three steps are preferably performed with a lab-on-chip device as disclosed hereinafter, to preserve minimal fluid volumes. Five steps are preferably performed with conventional (non-micro fluidic) setups or devices, since this allows for greater efficiency. The step of immobilizing the nucleic acid may alternatively to the rinsing steps, or preferably in addition to and after said steps, be followed by a step of eluting the nucleic acids, preferably in water, preferably in a volume of 50 μΐ, to 200 μΐ^, and more preferably in a volume of 50 μΐ^ or 100 μΐ^ for a sample corresponding to 1 mL of whole blood. An extraction of 50 μΐ, (or 25 to 75, or 40 to 60 μί) is particularly preferred for use with a lab-on-chip device as disclosed hereinafter, to preserve minimal fluid volumes. An extraction of 100 μΐ, (or 50 to 150, or 80 to 120 μί) is particularly preferred for use with conventional (non- microfluidic) setups or devices, since this allows for greater efficiency. The skilled person will realize that elution volumes must be adapted in particular to the quantity of starting material (e.g. whole blood sample volume), in particular may be proportional to said quantity. In a particular embodiment, the total volume used for rinsing is less than or equal to 2 mL, in particular less than or equal to 1.5 mL.
[94] Alternatively, extraction methods may comprise a heating step at a temperature higher than 80 °C, in particular higher than 90 °C in particular at a temperature of 95 °C (or about 95 °C, i.e. within 2 °C, preferably 1 °C of 95 °C) and/or extraction methods may comprise the immobilization of whole cells and bacteria on solid substrates such as beads. Such extraction methods are particularly suitable when the extraction is not performed on a chip (due to the heating step) and/or when optimal extraction of nucleic acids from a wide variety of bacterial species is sought. Such methods indeed allow for efficient lysis of and recovery of nucleic acids from multiple types of bacteria, including in particular the species targeted by the tests disclosed herein, while minimal pipetting and manipulation steps are required which is adequate for manual handling or simple liquid handling devices. In particular, such methods may comprise a step of mixing the sample with a solid substrate capable of binding the cells and bacteria comprising the nucleic acids (therefore allowing immobilization of said cells and bacteria on the solid substrate), in particular with a magnetic solid substrate. In such methods, the mixing of the sample with the solid substrate is performed before lysis, and lysis may be performed in particular by heating the cells and bacteria immobilized on beads, in particular at 95 °C, in an elution buffer. Cell debris and various contaminants are retained on the beads and the supernatant, comprising the nucleic acids, is recovered. Rinsing steps may be performed between immobilization of cells and bacteria on the beads and lysis/elution, essentially as in paragraph [93] above. The volume of elution buffer may be adjusted as in paragraph [93] above, and in particular may be a volume of 50 to 200 μί, and more preferably a volume of 50 μΙ_, to 100 μΐ,, in particular 100 μί, for a sample corresponding to 1 mL of whole blood. Such particularly preferred extraction methods are disclosed below, in particular in Example 3, such as the "speedXtract" extraction method.
[95] The sample used in the testing procedure may be collected and used in a single reaction container for all the procedures, or may be collected and / or distributed in several containers, each for performing one or several assays. In particular, one individual sample may be distributed for testing several distinct bacterial species and / or for providing control subsamples. Such distribution is preferably automated and / or performed at the stage of injecting the sample in the container where the nucleic acid assay provided herein is performed, e.g. in particular in the wells of multiwell plates or in loading inlets of microfluidic devices commonly used in such procedures. In particular in the case of microfluidic devices, the distribution of the sample in subsamples may be performed by or with the help of the device used for testing, e.g. the microfluidic device may have a single injection inlet while its design allows for distribution of the sample between different reaction compartments inside the device. Depending on the specific testing methods used, the distribution of the sample in subsamples may be performed directly on the whole blood sample, prior to any further manipulation of the sample, or may be performed after initial preparation of the samples, in particular after nucleic acid extraction.
[96] Accordingly, the testing methods provided herein may in particular comprise a step of distributing the sample (splitting the sample in subsamples) in distinct containers for performing distinct assays (each subsample / container allowing the performance of one assay). In particular, where relevant, the step of distributing the sample may take place after the step of extracting the nucleic acids; alternatively, the step of distributing the sample may take place before the step of extracting the nucleic acids (and in particular after or before the step of diluting and/or lysing the sample). In particular, the distinct containers are comprised in a single device, in particular are the wells of a micro-well plate or separate chambers (or compartments) in a micro fluidics device.
[97] The reagents required for LAMP assays, and in particular the mix of reagents comprising all of the required elements but for the template nucleic acid (i.e. the sample), and preferably also excluding the primers, may be lyophilized and provided in a lyophilized presentation. In such a case, the extracted nucleic acid as obtained in the elution solution after extraction, or a fraction thereof, may be used to resuspend said lyophilized reagents (resuspension, as used herein, must be understood to include solubilization, i.e. the initially lyophilized elements are eventually in a solution, rather than as a suspension). Such a procedure minimizes pipetting and dilution of the extracted nucleic acids after the extraction. Particular modes of the methods provided herein comprise a step of resuspending the required reagents, presented in lyophilized state, in the solution comprising the nucleic acid (in particular the elution solution), or a fraction thereof. In particularly preferred modes, said required reagents comprise all of the required reagents as disclosed herein, with the exception of primers. In particular, reagents constituting the Mastermix IsoOOl solution available from OptiGene may be provided in lyophilized presentation for resuspension with the solution comprising the extracted nucleic acid. Alternatively, reagents constituting the composition disclosed as composition 19 in Table 6 in Example 2.3 may be provided in lyophilized presentation for resuspension with the solution comprising the extracted nucleic acid. In such modes, in particular where the lyophilized reagents exclude the required primers, the method may additionally comprise a subsequent step of using the resulting solution (comprising the extracted nucleic acid and the resuspended and resolubilized reagents) to resuspend the primers. Such methods are particularly efficient in terms of limiting the handling steps and the dilution of reagents, in particular the sample nucleic acids.
[98] Simultaneous testing. Simultaneous testing designates herein testing using one individual sample. Simultaneous testing is usually intended to mean that the result for several bacterial species is provided in one single testing procedure, or in several testing procedures performed on the same sample. In some cases, however, which the skilled person which identify in particular taking the context in account, simultaneous testing may designate the testing of one single bacterial species, in particular when said testing involves testing for several distinct genes of that species and/or using several distinct sets of primers. In some cases, the testing procedures are performed using one single reaction container for all bacterial species. In some cases the methods steps are not replicated for the distinct bacterial species (or genes, or primer sets), the steps being performed one single time for all analytes together, and/or the result is provided as a single result reflecting the presence of at least one of, or the absence of all, the tested bacteria (or genes, or gene regions). In preferred methods, however, the testing procedures for distinct bacterial species (or genes, or gene regions) are performed in several distinct reaction containers and/or several reaction compartments, in particular in containers (or compartments) wherein the sample is distributed as described above. In preferred modes, the containers (or compartments) are all contained in a single device, such as multiwell plate, or a microfluidic device with several injection inlets and/or designed to allow splitting of the sample in several compartments within the microfluidic device.
[99] In preferred modes, the testing procedures involve identical steps and manipulations, in particular operator-performed operations are essentially performed in parallel for all the procedures, preferably as a single manipulation. For example, when the testing procedure requires a heating step (or a step to be carried out isothermally), all the containers may be subjected to the heating step (or to temperature control to maintain isothermal conditions) in one single operator intervention, e.g. the multiwell plate, containing the multiple reaction containers for the tests, is placed in a heating (and/or temperature-controlling) device by the operator.
[100] A preferred mode of the simultaneous testing methods provided herein is a method wherein several assays are performed with one sample, each assay being for the detection of an analyte (or possibly as in multiplex assay described below, for the detection of several analytes), all of the assays being performed in identical conditions. Identical conditions comprise in particular use of identical reagents, preferably in all the steps of the testing method, preferably including the sample and sample preparation steps (i.e. the same sample is used and prepared following the same methods for all assays, and/or identical samples, in particular obtained from the same individual and prepared following the same methods, are used), with the exception of primers (primer sets) which will usually differ from one assay to the other. Identical conditions comprise in particular performing identical testing steps, including handling steps, testing conditions such as reaction times, temperature, volumes, etc. Identical conditions comprise in particular identical detection and/or readout method steps, in particular identical detection reactions and conditions, identical devices for readout and/or identical interpretation of results. In particular, identical conditions consist of using identical reagents and performing identical testing steps, including identical detection and readout method steps.
[101] In the methods provided herein, in particular, the reaction containers may consist of identical containers and content, except that the primer sets for each distinct assay (i.e. distinct primer pairs for the same gene and/or for distinct genes of the same bacteria and/or of distinct bacterial species) are different from one container to the other. The reaction containers may be provided in a completely ready-to-use format, in particular in a kit as provided herein, wherein primer sets are already distributed in the containers, so that operator (and/or automate) interventions may be identical for all the assays.
[102] Alternatively, the primers may be provided separately, e.g. individually or as primer sets, in particular as mixes of six primers constituting the primer sets provided herein. In such a case, the operator (or an automate) might have to perform a step of addition of the primers separately in the multiple assaying containers, while all other steps of the testing procedures will still possibly be identical and performed simultaneously.
[103] It is noteworthy that the primer sets provided herein have all been validated for testing in identical conditions, including identical sample collection and storage conditions, and identical testing procedures. This allows for particularly simple simultaneous testing for one or several bacterial species, including when testing for several genes or gene regions if required e.g. for enhanced sensitivity. In particular, provided herein are methods for simultaneous testing of nucleic acids of at least three distinct bacterial species (such methods being therefore suitable for simultaneous testing for an infection by any one of said three species), using a single 1 mL whole blood sample. In particular, provided herein are methods for simultaneous testing of nucleic acids of at least three or at least five distinct bacterial species (such methods being therefore suitable for simultaneous testing for an infection by any one of said five species), using a single 1 mL whole blood sample
[104] Provided herein are methods for the simultaneous testing of the presence of nucleic acids representing several gene regions of one or more genes of a one or more bacterial species, in particular selected from the group consisting of the the invA, phoP, prgK and ttrR genes from S. enterica, the femA, arcC and nuc genes from S. Aureus, the lytA gene from S. pneumoniae, the hpd gene from H. influenzae and the malB, glyK and yiaO genes from E. coli and more particularly selected from the group consisting of the the invA, phoP, prgK and ttrR genes from S. enterica, the femA, arcC and nuc genes from S. Aureus, the lytA gene from S. pneumoniae. Such methods are provided in particular for simultaneous in vitro testing of bacterial infections in a subject, in particular by one or two, and preferably three bacterial species selected among the group consisting of Salmonella spp., Staphylococcus aureus and Streptococcus pneumoniae and/or for simultaneous in vitro testing of infections by one of at least two, preferably at least three or four and even more preferably five bacterial species selected among the group consisting of Salmonella spp., Staphylococcus aureus, Streptococcus pneumoniae, Haemophilus influenzae and Escherichia coli. Such methods are provided in particular wherein distinct set of primers, each set being specific for a given gene region (of a given bacterial species), are used in distinct containers for assaying procedures performed simultaneously, a sample obtained from the subject being distributed in the containers (optionally after a step for sample preparation, in particular after extraction of nucleic acids), and preferably wherein identical conditions are used for all the assaying procedures, apart from the distinct primer sets.
[105] Accordingly, provided herein are methods for the simultaneous testing of infection by, and/or presence of the nucleic acid of, at least two (and preferably all three) bacterial species selected from Salmonella spp., S. aureus and S. pneumoniae, such methods comprising the steps of:
(i) providing a sample, in particular a whole blood sample obtained from an individual;
(ii) preparing the sample, in particular extracting nucleic acid, and more particularly:
(ii)a) optionally, diluting the sample;
(ii)b) optionally, lysing cells in the sample;
(ii)c) adding to the sample a solid magnetic substrate capable of binding the nucleic acids in the sample, in particular magnetic silica-based beads;
(ii)d) optionally, rinsing, and in particular rinsing at least three times, the nucleic acids retained on the magnetic solid support;
(ii) e) eluting the nucleic acids from the solid support, thus obtaining a solution of extracted nucleic acids;
(iii) preparing appropriate reaction solutions in distinct containers for several assays, and more particularly:
(iii) a) optionally, using the solution of extracted nucleic acids to resuspend a lyophilized mix of reagents, consisting of all or most of the reagents required for the assay, with the exception of the primers;
(iii)b) distributing fractions of the solution of extracted nucleic acid (optionally comprising reagents required for the assay) in distinct containers, in particular containers in which primers, in particular in lyophilized form, were previously distributed;
(iii)c) adding any reagent required for the assay not already comprised in the appropriate container; (iv) performing the assay, in particular the LAMP assay, in particular bringing and maintaining the reaction solution at a suitable temperature for a time not shorter than the longest expected time-to-result for the assays performed;
(v) reading out the results after such time has elapsed, in particular by reading the result of each individual assay in each container;
(vi) optionally, concluding that the individual from whom the sample was obtained has a bacterial infection and/or that bacterial nucleic acids are present in the sample, preferably designating the specific specie or species that was(were) detected, or concluding that said individual does not have a bacterial infection and/or that no bacterial nucleic acid is present in the sample.
Such methods are also provided for the simultaneous testing of infection by, and/or presence of the nucleic acid of, at least two, at least three, at least four and preferably all five bacterial species selected from Salmonella spp. , S. aureus, S. pneumoniae, H. influenzae and E. coli.
[106] As the skilled person will appreciate, steps (i) to (iii)a) may all be (and preferably, are all) performed in a single container for each sample, while from step (iii)b) on the sample is split in different containers, although these further steps may still advantageously be performed all at one time.
[107] In addition, such methods are also provided wherein the extraction steps of [105](ii) above are replaced as follows, the remaining steps being and tested bacterial species being otherwise as above:
(ii) preparing the sample, in particular extracting nucleic acid, and more particularly:
(ii)a) optionally, diluting the sample;
(ii)b) adding to the sample a solid magnetic substrate capable of binding the cells and/or bacteria in the sample, in particular magnetic beads;
(ii)c) optionally, rinsing, and in particular rinsing at least two times, the cells and/or bacteria retained on the magnetic solid support;
(ii)d) resuspending the cells and/or bacteria retained on the magnetic solid support solid support in an elution buffer and heating the sample, in particular at 95 °C, in order to lyse and elute the nucleic acids.
[108] Accordingly, products are also provided herein which are suitable for performing the methods involving simultaneous testing as above and in particular in a presentation intended for such simultaneous testing. Generally, the products are provided as a kit comprising several items required and/or suitable for performing such methods, said kits in particular comprising or consisting of the primers required for such methods.
[109] Multiplex testing. In multiplex testing, several analytes are assayed in one single reaction solution (multiplex assay), i.e. a simultaneous test is performed in which several analytes are detected in one single container. As is well known to the skilled person, multiplex testing provides several advantages over simultaneous tests of single analytes in independent assays/containers (single assays): in particular, a multiplex assay may use the same sample volume as a single assay with no loss in performance, resulting in the same sample being usable for testing an increased number of analytes, or for testing the same number of analytes using a greater "share" of the sample (single assays require splitting the sample in greater number of shares), and therefore more sample, which in turn results in increased sensitivity; a multiplex assay may also require less handling of the sample, as the sample may be injected in less (preferably one) container(s) / inlet(s). Manufacturing, storage, distribution of the required components for the test is also simplified. Importantly, as the inventors have shown that the primers provided herein allow for efficient amplification of the target analytes in identical conditions, it will appear to the skilled person that they may be used in multiplex amplifications. Moreover, the inventors have shown that no increase in detection time is observed when two of the six -primer sets provided herein are used in a single multiplex LAMP amplification.
[110] The result provided by a multiplex assay may or may not allow to report which of the analytes has been detected, if at least one is present. With the detection methods explicitly illustrated herein, and which are designed essentially for ease of use, the assay will usually not allow to report which analyte is detected. However, methods known to the skilled person are available which allow to specifically report which analyte(s) are present. In particular, such methods are based on e.g. the hybridization of distinguishable nucleotide probes on the different amplification products, and/or specific capture of the different amplification products at distinct locations or on distinct substrates, etc. Generally, since the amplification products are abundant in the reaction solution, in a relatively low complexity mix (only a limited number of different amplification products will be present abundantly), have distinct sequences and are likely to have distinct sizes, such methods are readily available and require only very limited adaptations, well within common knowledge of the skilled person. In particular modes of the simultaneous detection methods provided herein, multiplex assays are performed and the detection step allows the distinction of which analytes (in particular which bacterial species and/or genes and/or gene regions, preferably which bacterial species) are present, if any. [111] In many circumstances, however, it is not required to report which analyte is detected in a multiplex assay, in particular since for example the objective of performing the method may be in fact limited to the detection of the absence of an infection (i.e. to allow for ending follow-up, release from hospitalization, etc). In such cases, the methods reported herein may be performed as explicitly illustrated herein, including the detection steps provided herein which will detect without distinction the amplification of any product, with the appropriate combination of primers mixed in one reaction container to allow for amplification of any one or more of several analytes. As would appear to the skilled person, for LAMP assays the appropriate combination of primers comprises primers forming several six-primer sets provided herein, in particular such combinations may comprise 12, 18, 24 or 30 primers or said otherwise 2, 3, 4 or 5 sets of primers selected among the six-primer sets provided herein. Combination of four-primer sets and combinations of five-primer sets are also similarly possible, as well as combinations comprising six-primer, five-primer and/or four-primer sets, although the latter combinations comprising primer sets with different numbers of primers are preferably avoided in multiplex assays. Similarly, for PCR assays or assays using related methods, the skilled person will appreciate that an appropriate combination comprises several pairs (in particular 2, 3, 4 or 5 pairs) of B3 and F3 primers, each of the pairs being taken from a subgroup selected form the subgroups provided herein.
[112] A multiplex assay may be designed so that each of the analytes in one assay is from the same bacterial species. In such a case, the detection of any of the analytes may allow to conclude to the presence of a bacterial infection by said species. Such assays may allow for increased sensitivity, or increased broadness of the test in particular relative to e.g. rare variant strain, while still allowing to report specifically which bacterial species is detected. In particular modes of the methods provided herein, at least one multiplex assay is performed wherein several analytes (in particular several genes and/or several gene regions from the same gene) from a single bacterial species are detected. Particular combinations of primers provided herein are suitable for multiplex amplification of several analytes from a single bacterial species, in particular comprise several six- primer sets provided herein for amplification using a LAMP assay of gene regions from the same bacterial species.
[113] Alternatively, a multiplex assay may allow the detection of analytes from at least two distinct bacterial species, and in particular may allow the detection of the absence of a bacterial infection and/or of the presence of a bacterial infection by either of the detected bacterial species. In particular, such multiplex assays may allow for detection of at least one analyte from each of Salmonella spp. (in particular S. enterica), Staphylococcus aureus and Streptococcus pneumoniae species. More particularly, such multiplex assays may allow for detection of at least one analyte from each of Salmonella spp., Staphylococcus aureus, Streptococcus pneumoniae, Haemophilus influenzae and Escherichia coli species. In particular modes of the methods provided herein, at least one multiplex assay is performed wherein analytes from at least two distinct bacterial species are detected. In particular modes of the methods provided herein, the simultaneous testing comprises a step of assaying, in a single multiplex LAMP assay, the presence of at least one analyte from each of Salmonella spp., Staphylococcus aureus and Streptococcus pneumoniae species and/or the presence of at least one analyte from each of Salmonella spp., Staphylococcus aureus, Streptococcus pneumoniae, Haemophilus influenzae and Escherichia coli species. Particular combinations of primers provided herein are suitable for multiplex amplification of at least three and preferably at least four and even more preferably at least five analytes, comprising at least one analyte from each of Salmonella spp., Staphylococcus aureus and Streptococcus pneumoniae species and/or comprising at least one analyte from each of Salmonella spp., Staphylococcus aureus, Streptococcus pneumoniae, Haemophilus influenzae and Escherichia coli species. In particular, such combinations consist of the same primers as the combinations of primers provided for (non-multiplex) simultaneous testing above, in particular in a presentation adapted for multiplex testing, e.g. as a mix comprising all of the primers for a single assay.
[114] Kits and devices. As mentioned above, the primers provided herein are provided in particular in presentations suitable for use in in vitro testing of bacterial infection by Salmonella spp. , Staphylococcus aureus and Streptococcus pneumoniae species, in particular for use in in vitro testing of bacterial infection by Salmonella spp., Staphylococcus aureus, Streptococcus pneumoniae, Haemophilus influenzae and Escherichia coli species; for use in testing for the presence of nucleic acid of said bacterial species; and/or for use in simultaneous testing of infection by and / or nucleic acid of several of these bacterial species; and in particular are provided in presentations comprising combinations of sets of primers suitable for said methods using LAMP assays. Accordingly, provided herein are kits for performing the methods provided herein and in particular the methods recited above. Such kits comprise in particular combinations of sets of primers and in particular comprise one or several six-primer sets for LAMP assays as provided herein. Alternatively, and with the required adaptations which the skilled person will readily identify, such combinations of primers are in presentations suitable for, and comprise the pairs of primers suitable for, amplification by PCR or PCR-related methods.
[115] The products provided in addition to the primers may be suitable for in particular for the preservation of the primers, for the preparation of the samples, for performing the testing and/or for revealing the test result. The products may be hardware products, e.g. multiwell plates, reaction vials, filters, etc and / or reagents, e.g. DNA polymerase with strand-displacement activity; nucleotide or their precursors (dNTPs, etc); buffers and/or buffer salts; water and/or media for rinsing, diluting, washing; pH color indicator; DNA intercalating agents, etc. In particular, the kit may comprise a solution consisting of a mix of all the required reagents for carrying out the amplification procedure, with the exception of the primers (and, as the skilled person would realize, the template, which is provided in the sample when present therein). In particular, said mix may consist of or comprise a DNA polymerase with strand-displacement activity, dNTPs, a DNA intercalating agent, pH-buffering salts and other salts required for enabling the amplification, e.g. for adjusting salinity. In addition to said mix, the kit may comprise reagents for sample preparation and/or extraction of nucleic acids.
[116] In a specific mode, the products are presented for use performing the tests in multiwell plates. Specifically, the products may consist of or comprise multiwell plates with primer sets distributed in the wells, optionally in addition to other products (including products distributed in the wells and/or separately supplied products). Whether the primers are intended for simultaneous use or for separate use, and whether they are provided as mixes comprising all the primers of a set or as individual primers, they may be presented in lyophilized form. As mentioned above, reagents may also be provided in lyophilized form, and optionally may be provide in the same multiwell plates. Such multiwell plates may preferably be spatially organized so as to facilitate transfer of the sample or reaction solution from one well to the next as required by the testing procedure.
[117] In an alternative mode, the methods disclosed herein comprise the use of a microfluidics device, in particular a so-called lab-on-a-chip or other similar portable, optionally disposable device, for use in either automated of manual setups. Among other advantages, such devices allow for the use of minimal reaction volumes and therefore high concentration of material provided in low quantity. Such devices comprise several distinct compartments contacted by a network of channels allowing for the circulation of liquids between compartments. As compartments usually allow the physical retention of a solution and its isolation from other elements, in particular chemical and biochemical elements, they may be considered as distinct containers. In the process of manufacturing these devices, said compartments may be pre-loaded with reagents, in liquid or solid (e.g. lyophilized formats). The network of channels is designed to allow for the solution to be transported from one compartment to another following the requirements of the method, such transportation being the result of either active (e.g. by pumping, aspiration, ...) or passive (e.g. by capillarity, diffusion, ...) flowing of the solution. Such devices will usually comprise at least one sample loading inlet to allow for the sample to be injected in the device. Optionally, said device may be designed to be connected to liquid handling automates and in particular may comprise additional inlets and / or outlets for the injection or extraction of reagents, washing or rinsing solutions, etc. In some settings, it is particularly advantageous to provide the device with an onboard waste compartment, i.e. a compartment which contains all the fluids to be discarded after the assay, in particular fluids used for extraction, rinsing, etc. The use of such a device is in particular advantageous in terms of safety, and particularly prevents the risk of contamination, since no fluids are circulated outside the disposable device after they have been in contact with the sample. The inclusion of the waste compartment within the lab-on-chip requires to keep the total volume of the fluids used for he assay minimal, as any increase in said total volume increases the bulk of the lab- on-chip. The extraction protocols disclosed herein are particularly suitable for such devices, since they use minimal fluids. In a particular embodiment, the total volume of fluids used for the test is less than or equal to 6 mL. A more complete description of such devices is provided e.g. in Bisceglia, 2013.
[118] In particular, as stated above, the microfluidics device may comprise a network of channels such that after extraction of the nucleic acid, the resulting solution is separated in several compartments, each compartment constituting a distinct container for carrying out an assay, in particular a LAMP assay. Such devices are particularly preferably for performing the simultaneous testing methods provided herein, as handling is reduced to a minimum while performance is optimal.
[119] In addition to being designed for simplified handling and in particular compatibility with automated liquid handlers, the microfluidics devices provided herein may be suitable for convenient readout of the detection, in particular may comprise a readout "window" which allows for automated readout of the result using a camera, in particular a fluorescence camera.
[120] Provided herein is a kit, in particular for performing the methods disclosed herein, comprising or consisting of a microfluidics device, said device comprising: at least one sample loading inlet; optionally, inlets and outlets for washing of the sample, in particular for performing extraction of nucleic acids, in particular wherein such inlets / outlets are compatible with automated liquid handlers; optionally, a network of channels and compartments suitable for splitting of the solution comprising the sample nucleic acid and use of said sample in several distinct assays; optionally, at least one compartment allowing for on-board storage of discarded fluids; optionally, reagents required for an amplification assay, in particular for amplification by LAMP; a combination of primers as provided herein, in particular comprising at least two, preferably at least three or four, and more preferably at least five six-primer sets (and/or four-primer sets and/or five-primer sets) as provided herein, in distinct compartments ('assay compartments'); optionally at least a visualization 'window' for readout of the signal by an operator or a detection device such as a camera, in particular one window per assay compartment.
Use of primers as disclosed herein in the manufacturing of the devices and kits above is also provided.
Examples
1. Reference strains and biological samples
[121] Clinical and environmental strains of Salmonella spp., Staphylococcus aureus, Streptococcus pneumoniae, Haemophilus influenzae and Escherichia coli were obtained from the "Collection de l'lnstitut Pasteur" (CIP). Overnight brain-heart infusion (BHI) broth cultures of the strains were serially diluted (10-fold) in sterile water and enumerated on Trypcase Soy Agar or Columbia Horse Blood Agar spread plates. Diluted bacterial suspensions were used immediately for nucleic acid extraction or aliquoted and stored at -80°C until use.
[122] Whole blood samples collected into commercially available anticoagulant-treated tubes were obtained from the Institut Pasteur biobank (IcareB) and the French Blood Service (EFS). Spiked whole blood samples were prepared using enumerated bacterial suspensions of Salmonella enterica strain CIP 60.62T. Spiked blood samples were used immediately for nucleic acid extraction or aliquoted and stored at -80°C until use. All strains identified with a CIP identifier may be obtained from the "Collection de l'lnstitut Pasteur" (Institut Pasteur, 25-28 rue du Dr Roux, 75724 Paris Cedex 15 - France). Strains identified with a CRBIP identifier may be obtained through the CABRI catalogue (www.cabri.org).
2. LAMP assays
2.1 Primer design [123] Target genes for each bacterial species were identified based on an extensive review of the literature. Subsequently, specific target gene regions were selected by multiple sequence alignments of all genome sequences available in the GenBank database. Core genes, present in all strains of a particular bacterial species, were selected as target for the specific detection of Salmonella spp., S. aureus, S. pneumoniae, H. influenzae and E. coli. The invasion protein gene invA, the tetrathionate reductase gene ttrR, the transcriptional regulator gene phoP and the pathogenicity 1 island effector protein gene prgK were selected as targets for the detection of Salmonella spp. ; the autolysin gene lytA and the pneumolysin gene ply were selected as targets for the detection of S. pneumoniae; the aminoacyltransferase gene femA, the nuclease gene nuc, and the carbamate kinase gene arcC were selected as targets for the detection of S. aureus ; the glycerophosphodiester phosphodiesterase gene hpd was selected as target for the detection of H. influenzae; and the maltose outer membrane porin gene malB, the glycerate kinase II gene glyK and the 2,3-diketo-L-gulonate-binding periplasmic protein yiaO gene were selected as targets for the detection of E. coli. Primers specifically targeting selected core gene regions were designed using the LAMP explorer software (Premier Biosoft, United Kingdom). Primer specificity was verified in silico by BLAST analysis. A total of 38 different primer sets, each composed of 6 primers, two inner primers (FIP and BIP), two outer primers (F3 and B3) and two loop primers (LoopF and LoopB), were designed: 12 primer sets targeting Salmonella spp. (more particularly S. enterica) genes invA, phoP, prgK or ttrR (Table 1), 6 primer sets targeting S. pneumoniae genes lytA or ply (Table 2), 8 primer sets targeting S. aureus genes femA, arcC and nuc (Table 3), 3 primer sets targeting H. influenzae gene hpd (Table 4) and 9 primer sets targeting E. coli genes malB, glyK or yiaO (Table 5).
[124] As will appear clearly to the skilled person, the primers in Table 1, Table 2, Table 3, Table 4 and Table 5 (each of these tables comprising primers specific for a bacterial species) are grouped by gene, as indicated in the top line of each group and, within each group of primers specific for a gene, the primers are grouped by primer set, as indicated in the first column from left. In these tables, the second column name designates the specific function of a primer within a primer set in a LAMP assay, i.e. whether it is a forward or backward inner primer (FIP or BIP), a forward or backward outer primer (F3 or B3) or a forward or backward loop primer (LoopF or LoopB). The precise composition of each of the six-primer sets, as well as the four-primer sets (consisting of the F3, B3, FIP and BIP primers) and the five-primer sets (consisting of the LoopF or the LoopB primer in addition to the primers of the four-primer set) and the primer pairs for PCR mentioned in the description is therefore immediately readable from the table. For example, primer set n°3 for the PrgK gene of Salmonella spp., which is one of four different six-primer sets provided for amplification of said gene, consists of primers with SEQ ID Nos: 49 to 54. Also provided is the corresponding four-primer set consisting of primers with SEQ ID Nos: 49 to 52, the five-primer set consisting of primers with SEQ ID Nos: 49 to 53, the five-primer set consisting of primers with SEQ ID Nos:49 to 52 and the primer with SEQ ID No:54, as well as the primer pair for PCR consisting of primers with SEQ ID No: 49 and 50 (with the F3 and B3 suffix).
SEQ
Set c
Function Primer sequence Primer position ID n
No: invA (NC_003197, 1254419)
Λ F3 ATCG CACTG AATATCGTACTG cpt(1918..1938) 1
B3 CCACG GTG ACAATAG AG AAG (1689..1708) 2
FIP AATG CCAG ACG AAAG AG CGTTCGTTCTACATTG ACAG AA (1817..1837) ; 3
TCC cpt(1875..1895)
BIP TCGATCAGTACCAGCCGTCTTACGCCAATAACGAATTGC cpt(1796..1815) ; 4
C (1732..1751 )
LoopF GGTAATTAACAGTACCGCAGGA (1837..1858) 5
LoopB CTTGATTGAAGCCGATGCC cpt(1774..1792) 6
2 F3 GGTCGTTCTACATTGACAGAA cpt(1878..1898) 7
B3 G CGTTCTG AACC I I I GGTA (1654..1672) 8
FIP CGGCATCGGCTTCAATCAAGGGTACTGTTAATTACCACG (1773..1792) ; 9
CT cpt(1832..1851 )
BIP GTGAAATTATCGCCACGTTCGGGGTGACAATAGAGAAGA cpt(1751..1772) ; 10
CAACA (1693..1714)
LoopF GACGGCTGGTACTGATCG (1797..1814) 1 1
LoopB TATTGGCGATAGCCTGGC cpt(1724..1741 ) 12
3 F3 GGTACTGTTAATTACCACGCT cpt(1832..1852) 13
B3 ATCGGCATCAATACTCATCTG (1585..1605) 14
FIP CCAATAACGAATTGCCCGAACGATCAGTACCAGCCGTCT (1736..1755) ; 15
T cpt(1795..1814)
BIP GCGGTGGGTTTTGTTGTCTTCGCGTTCTGAACCTTTGGT cpt(1706..1725) ; 16
A (1732..1751 )
LoopF GGCATCGGCTTCAATCAAG (1774..1792) 17
LoopB ATTGTCACCGTGGTCCAG cpt(1684..1701 ) 18 pftoP (NC_003197, 1252749)
Λ F3 ACCTTAATGAACACCTTCCG (1 19..138) 19
B3 CGCTATTACGGCGCATTA cpt(347..364) 20
FIP CACCAGAACCGGCAGTGAATTAGGTCTGCCGGATGAA cpt(217..234) ; 21
(157..174) BIP GCGAAGGCTGGCAGGATAAATGTGGAATGGCTTCGTC (245..262) ; 22 cpt(300..317) LoopF CAGCGGCGTATCAAGGAA cpt(183..200) 23
LoopB GTCGAGGTTCTCAGCTCC (265..282) 24
2 F3 GAGGTAATGGCGCGTATG (322..339) 25
B3 GACATCGTGCGGATACTG cpt(613..630) 26
FIP GGTGTATTCGAACGCCGTGACGTTCCAGGTGGATCTCT cpt(453..471 ) ; 27
(394..412) BIP AGTGGTCAGCAAGGATTCGCGGTATGAC I I I CCCGCAG (504..522) ; 28 cpt(553..571 ) LoopF G ATG ACCTCTTCATTG ACG G A cpt(427..447) 29
LoopB TGATGCTTCAGCTGTATCCG (524..543) 30
F3 ACTGGTTGTAGAGGATAATGC (12..32) 31
B3 CGGCGTATTAAGGAAAGG cpt(180..197) 32
FIP TTCTGCGGCATCGACCTGTATTACGCCACCACCTGA cpt(79..96) ; 33
(35..52)
BIP GCCAGGGAAGCTGATTACTACCTTCATCCGGCAGACCTA (100..1 19) ; 34
A cpt(157..176)
LoopF GTGACCTGAATCCTGGAGC cpt(60..78) 35
LoopB CCGGATATCGCTATTGTCGAT (136..156) 36 prgK (NC_003197, 1254395)
F3 ACGTTCTGACAACACAACA cpt(552..570) 37
B3 GATTCGCTGGTATCGTCTC (274..292) 38
FIP AACCTGTTCATCTGTCGGCA I I I GATATCGCTGATCTGAT (431..451 ) ; 39
GC cpt(483..503)
BIP AATATGGACCCTGGCGGAGACTATTGAACAGCGACTGG cpt(371..390) ; 40
AA (323..342)
LoopF AGCCGTATATGAACGAGGTTC (453..473) 41
LoopB CCTCCATCGTCTGTAATGACTG cpt(343..364) 42
F3 GCCTTATCATCAGCCGTTAT cpt(721..740) 43
B3 ATCAGATCAGCGATATCAAGC (485..505) 44
FIP TGCAACCAGTTGGATTGTGTTG I I I GTAATACCAGACGC (621..641 ) ; 45
CAA cpt(674..694)
BIP GGAGCCTGTAATTGGGCATCAGCCGATGTGGATTATGAC cpt(574..593) ; 46
A (525..544)
LoopF TTATCCGTGATGTCAGCAGG (652..671 ) 47
LoopB ACGTTCTGACAACACAACAGA cpt(550..570) 48
F3 GCTAATGCCGACAGATGAA cpt(437..455) 49
B3 CGTTGCTGAGCCTGA I I I (177..194) 50
FIP TCGGCTATTGAACAGCGACTGCATAACTAATATGGACCC (319..339) ; 51
TGGC cpt(376..396)
BIP CGGAGACGATACCAGCGAATCAAACTTATCAGCTTCCTC cpt(275..294) ; 52
CC (218..237)
LoopF ACAGTCATTACAGACGATGGAG (342..363) 53
LoopB GAACATCTGCGCTATTTCCAC cpt(247..267) 54
F3 CCTCCATCGTCTGTAATGAC cpt(345..364) 55
B3 GAGGTCATTGCCGTTCTG (100..1 17) 56
FIP GATTCGCTGGTATCGTCTCCGGTTCCAGTCGCTGTTCAA (274..292) ; 57 cpt(326..344)
BIP CGGGGAGGAAGCTGATAAG I I I CGTTGCTGAGCCTGATT cpt(220..239) ; 58
T (175..194)
LoopF GGCCAGGTTATATTCGGCTA (306..325) 59
LoopB TAATCCAGTACACCGCAGC cpt(199..217) 60 ffr ? (NC_003197, 1252905)
F3 GGATGGCGACAATTCATCT (17..35) 61
B3 CATCG GTACATCG CCATG cpt(262..279) 62
FIP CTGATACAGACTGGCCTGCGTACTGGAAAGTCTGGGATA 134..154 ; (78..98) 63
TGA
BIP GCGAATGCCGGTACTGGATAGAAAAACAACCGCCAGG (177..194) ; 64 cpt(237..254) LoopF CTGCGTCCAGCA I I I I ACG cpt(99..1 17) 65
LoopB GG CGTTCATG ATG CGTTG (202..219) 66
F3 GGATGGCGACAATTCATCT (17..35) 67
B3 CCATG CCCG GTAAG AAAA cpt(249..266) 68
FIP CCCCTGCGTCCAGCA I I I I GATACGGCGGTCACTAA cpt(103..120) ; 69
(45..62) BIP CGCAGGCCAGTCTGTATCAGCATCCAGTACCGGCATTC (134..152) ; 70 cpt(179..197) LoopF CGTCATATCCCAGAC I I I CCA cpt(80..100) 71
LoopB CGGGGTCGTATTACTGGATATG (156..177) 72
Table 1. LAMP primer list for detection of Salmonella spp.
SED
Set
Function Primer sequence Primer position ID n°
No: lytA (NC_003098, 933669)
F3 TTGCACGAATAACCAACCA (405..423) 73
B3 GAACCAGTACCAGTTGCC cpt(676..693) 74
FIP TTCTTCTGCCAGCCTG I I I CAACATTAGCCGTGAGCAG cpt(523..542) ; 75
TT (472..491 )
BIP TGACACTGGCTACTGGTACGTAGTAGTACCAAGTGCCA (543..563) ; 76
TTGAT cpt(604..624)
LoopF AGCCGTTCTCAATATCATGCT cpt(494..514) 77
LoopB CATTCAGACGGCTCTTATCCA (565..585) 78
F3 ACAGATTTGCCTCAAGTCG (28..46) 79
B3 GTAGTCCGTCATGAACTCTTC cpt(286..306) 80
FIP CCGCCAGTGATAATCCGC I I I ACACGCACACTCAACTG cpt(1 14..132) ; 81
(67..85)
BIP AACGGTTGCATCATGCAGGTAGGTCTCAGCATTCCAAC (172..190) ; 82
C cpt(229..247)
LoopF TGTACGGTTGAATGCGGAT cpt(89..107) 83
LoopB GACCTGTTGATAATGGTGCCT (194..214) 84
F3 AATGGCTACAGGCTGGAA (708..725) 85
B3 GGCTCTACTGTGAATTCTGG cpt(913..932) 86
FIP GCGCCTTC I I I AGCGTCTAAGTCAACGAAGAAGGTGCC cpt(81 1..830) ; 87
AT (751..770)
BIP TATCCAGTCAGCGGACGGACTTGTCTGCCAGTGTTCC (849..866) ; 88 cpt(895..912)
LoopF AAGTGTCCTTGTACTTGACCC cpt(782..802) 89
LoopB ACAGG CTG GTACTACCTCA (868..886) 90
ply (NC_003098, 933687)
F3 TTCTGTAACAG CTACCAACG (180..199) 91
B3 GACCTGACCATAATCCTGATG cpt(403..423) 92
FIP ATCGACCGCAAGAAGAGTGGACAGTCGCCTCTATCCT cpt(261..279) ; 93
G (199..217)
BIP CCTGGTTTGGCAAGTAGCGAGCGAACACTTGAATTGCT (310..328) ; 94 cpt(354..372) G
LoopF CAAGGTCTCATCCACTACGAG cpt(226..246) 95
LoopB TAGC 1 1 1 CTCCAAGTGGAAGAC (330..351 ) 96
2 F3 TCGAAAGAAAGAAGCGGAG (137..155) 97
B3 GACCTGACCATAATCCTGATG cpt(403..423) 98
FIP G ACCG CAAG AAG AGTGG G ATTG ACAGTCG CCTCTATC cpt(258..276) ; 99
CT (198..216)
BIP CCTGGTTTGGCAAGTAGCGAGCGAACACTTGAATTGCT (310..328) ; 100
G cpt(354..372)
LoopF CAAGGTCTCATCCACTACGAG cpt(226..246) 101
LoopB TAGC 1 1 1 CTCCAAGTGGAAGAC (330..351 ) 102
3 F3 CTCCTCAGACAGAGTGGAA (818..836) 103
B3 GCTGTAACCTTAGTCTCAACAT cpt(1049..1070) 104
FIP CCTCTACCATATCCACCTTGCCCAGAAGTGAAGGCGGT cpt(915..934) ; 105
TAT (853..872)
BIP GGCAGTCGC 1 1 1 ACAGCAGATGGTCGCAACTACATTGT (949..968) ; 106
CA cpt(1011..1030)
LoopF TGTTACAACTCGGGCACC cpt(895..912) 107
LoopB CATCCAGGCTTGCCGATT (970..987) 108
Table 2. LAMP primer list for detection of S. pneumonia
SED
Set Functi
Primer sequence Primer position ID n° on
No: femA (NC_007795, 3920782)
F3 TGGAAGATACGTCAGAATCA (623..642) 109
B3 TTG ATGTACC ACC AG CATAA cpt(981..1000) 1 10
FIP TCACGCTCTTCGTTTAGTTCTTTTGCTGATCGTGATGACAA cpt(751..770) ; 1 1 1
(649..668)
BIP AGCACATAACAAGCGAGATAACAACCAGCAGAGATAGGTAA (834..855) ; 1 12
TTC cpt(928..949)
LoopF AGGTACTAACACACGGTC I M G cpt(696..717) 1 13
LoopB ACGTCTACAAG AAG AACATG GT (903..924) 1 14
F3 GCTAAAGAGTTTGGTGCCT (22..40) 1 15 B3 CGCCATCATGATTCAAGTATTG cpt(340..361 ) 1 16 FIP ACCTTCAGCAAG CTTTAACTCATTACAG ATAG CATG CCATAC cpt(90..1 1 1 ) ; 1 17 AG (41..62)
BIP CG AG GTCATTG CAGCTTG CTTC ATAATCAATCACTG G ACCG (150..169) ; 1 18 cpt(222..241 )
LoopF GCCAACAGTTTGCGTGAAA cpt(66..84) 1 19 LoopB ACTTACTGCTGTACCTGTTATG (171..192) 120 arcC (NC_007795, 3921667)
F3 CAGCTATTAGACGTGCGAT cpt(848..866) 121 B3 TGTAACGATTGTGCCTACAG (607..626) 122
FIP ATTGCCGGCGTTGTGTCATAATGGCCCACAAATTGGAA (725.743) ; 123 cpt(774..792)
BIP GCCATTGGATACTTGTGGTGCCGATTGATTTCAGTTTCCAA cpt(704.724) 124 CC (657..677)
LoopF CTGTTCGATTTAGCTTGTTGGA (743.764) 125 LoopB AATGTCACAGGGTATGATAGGC cpt(682..703) 126
2 F3 GATGATCCACGATTCAATAACC cpt(567..588) 127
B3 TACCTTGTG CCG CGTATT (147..164) 128
FIP TTG AG GTAGTG GTG ACG CAACAG AACAGCCAG ACTCAGT (436..454) ; 129 cpt(494..512)
BIP GTGGTGGCGGTATTCCAGTTATCTGCTTCAATCAGCGTT cpt(353..371 ) ; 130
(262..280)
LoopF CCACGTCCTGCATCTTCTT (470..488) 131
LoopB TATGAAGGTGTTGAAGCGGTTA cpt(312..333) 132 nuc (NC_007795, 3919380)
1 F3 GGATGGCTATCAGTAATGTT (62..81 ) 133
B3 GCTAAGCCACGTCCATAT cpt(489..506) 134
FIP ACTGTTGGATCTTCAGAACCACCGCTACTAGTTGCTTAGTG cpt(209..230) ; 135 TTA (1 17..138)
BIP AGCGATTGATGGTGATACGGTTCAGGACCATA I I I CTCTAC (285..306) ; 136 ACC cpt(385..406)
LoopF TGCTGAGCTACTTAGACTTGAA cpt(153..174) 137
LoopB AGGTCAACCAATGACATTCAGA (321..342) 138
2 F3 GAAGTGGTTCTGAAGATCCAA (206..226) 139
B3 CCAAG CCTTG ACG AACTAA cpt(544..562) 140
FIP AGGATGCTTTG I I I CAGGTGTCGATTGATGGTGATACGGTT cpt(358..378) ; 141 A (287..307)
BIP AATATG GTCCTG AAG CAAGTG CGCTAAG CCACGTCCATAT (395..414) ; 142 cpt(489..508)
LoopF TCTGAATGTCATTGGTTGACCT cpt(321..342) 143
LoopB GAAGTCGAG I I I GACAAAGGTC (454..475) 144
3 F3 CG CTACTAGTTG CTTAGTGTTA (1 17..138) 145
B3 GCTAAGCCACGTCCATAT cpt(489..506) 146
FIP ACTGTTGGATCTTCAGAACCACCAAGTCTAAGTAGCTCAGC cpt(210..230) ; 147 AA (155..175)
BIP AGCGATTGATGGTGATACGGTTCAGGACCATA I I I CTCTAC (285..306) ; 148 ACC cpt(385..406)
LoopF ACGCCATTATCTG I I I GTGATG cpt(179..200) 149
LoopB AGGTCAACCAATGACATTCAGA (321..342) 150
4 F3 CAAGTCTAAGTAGCTCAGCAA (155..175) 151
B3 CCAAG CCTTG ACG AACTAA cpt(544..562) 152
FIP AGGATGCTTTGTTTCAGGTGTCCTGCGACATTAATTAAAGC cpt(358..378) ; 153 G (268..288)
BIP AATATG GTCCTG AAG CAAGTG CGCTAAG CCACGTCCATAT (395..414) ; 154 cpt(489..508)
LoopF TCTGAATGTCATTGGTTGACCT cpt(321..342) 155
LoopB GAAGTCGAG I I I GACAAAGGTC (454..475) 156
Table 3. LAMP primer list for detection of S. aureus
SEQ
Set Functi
Primer sequence Primer position ID
N° on
No ftpd (NC_000907, 949981 )
1 F3 TCATTATTGCTCACCGTGG (107..125) 157 B3 GCTTGTTTGCCATCTTTGG cpt(380..398) 158
FIP ACGACCATCCTTAGTCATTGCTACGTTAGAGTCTAAAGCAC cpt(209..231 ); 159
TTG (152..172)
BIP ATGGCTTGACTGATGTTGCGACGATGACATAGTAACGACC (260..280); 160
AT cpt(308..328)
LoopF CAGCCTGTTGTGCAAACG cpt(173..190) 161
LoopB CCCACATCGTCACCGTAAA (288..306) 162
F3 TCATTATTGCTCACCGTGG (107..125) 163
B3 ATAAACTTGCGCTTG 1 1 1 GC cpt(389..408) 164
FIP ACGACCATCCTTAGTCATTGCTACGTTAGAGTCTAAAGCAC cpt(209..231 ); 165
TTG (152..172)
BIP ATGGCTTGACTGATGTTGCGACGATGACATAGTAACGACC (260..280); 166
AT cpt(308..328)
LoopF CAGCCTGTTGTGCAAACG cpt(173..190) 167
LoopB CCCACATCGTCACCGTAAA (288..306) 168
F3 CCAAAGGGTTATTGGGTAAACT (757.778) 169
B3 TTAAGAATTCCACGCCAGT cpt(1063..1081 ) 170
FIP ACCAACGGAGTGTACACAATAGCAATGGCAGAAGTGGTTA cpt(894..914); 171
(808..826)
BIP TGTGGAAGTGCATCCTTACACCTCAGTAAATACACCTGTTG (936..957); 172
CC cpt(1032..1052)
LoopF GCCAACACCATCGGCATAT cpt(828..846) 173
LoopB TG CGTAAAG ATG CACTACCC (959..978) 174
Table 4. LAMP primer list for detection of H. influenzae klo Function Primer sequence ... ID
N ^ position malB (NC_000913, 948548)
F3 TCACGGTGCTCATGATTG (39..56) 175 B3 TACTGACTCGATGACCTCG cpt(286..304) 176
FIP GGATAACGACAACGGCACCACGTCCACTTGTACATCGG ^ 1 8); 1 ??
BIP CATGGAGATCGCTCCGTGGGCCTACAATATCAACAACAACG cp (2io8231 ) 178
LoopF GGTGGACCGTCGGTATTC cpt(78..95) 179
LoopB CG AG G ATACG CAGCATGT (189..206) 18Ο F3 ATTCGACGTTGTCGTAGC (12..29) ϊδ B3 GTAAAGGTCTGTCGCAGG cpt(264..281 ) 132
FIP ATAACGACAACGGCACCAAGTCATGATTGGCGTCCACTT 183
BIP TACATCATGTCCCAGTTGTCGCTCAACAACAACGGTCACAT 184
Figure imgf000058_0001
LoopF GGTGGACCGTCGGTATTC cpt(78..95) 135
LoopB GTGGTCGAGGATACGCAG (184..201 ) 186 F3 CCTGCGACAGACCTTTAC (264..281 ) 137 B3 TATGACTATACCAACGAAACCG cpt(507..528) 188 FIP AGACGGCTGGTTGTTCACTGCAGTAGCGTACTGAACAACA ^o^ ) ^' 189
BIP TTCGATGCGCCATCAACCACGGCACATTAGAACTGGG ¾4409457) 190
LoopF CATACTCAGAGTGTCCTGAAGG cpt(333..354) 191 LoopB GACGATAGTTATCACGCAGGT (399..419) 192 g/yK (NC_000913, 945129)
F3 TTAATGGCGCAGGCAATA (26..43) 193
B3 CAGCACTGGTGATTACCG cpt(276..293) 194 cpt(118..138);
FIP GGCATTGATGCGGTATTCAGCAGATTGA I I I CACCGCTGG
(62..80) 195 (149..167);
BIP ACCACTTCCACG CCATCACTG GCG AAG CAGTTTAATGT
cpt(197..215) 196
LoopF ACGTCTGGCACC I I I AGC cpt(92..109) 197
LoopB ATACGCCAGCAATCCCAAT (171..189) 198
F3 CG GTAATCACCAGTG CTG (276..293) 199
B3 GTTGATAACCCGCTGGTAG cpt(549..567) 200 cpt(368..385);
FIP TATTGCGGCGGCGGTATTACCGCATTCAACACAATCT
(320..338) 201 (413..432);
BIP GCCATCTGGCAGACGTTGATGTCGAAGAGCTGGAACAG cpt(475..492) 202
LoopF CAATG CGG ATATTAAACCAG GT cpt(343..364) 203
LoopB AACACGGGCGTAA I I I I GC (451..469) 204
F3 ATCAAGGAAACGCACACC (682..699) 205
B3 CATCGTGACGCTTGAAGT cpt(953..970) 206 cpt(813..830);
FIP CGTTG CTG GCCTCCAGTTAATATGG CG AATG CCGTTA (760..778) 207
(864..881 );
BIP CACTTGCTGCCGCCATCTGCGAAACAGTGAATGC I I I cpt(920..938) 208
LoopF TAATTCGTCATG CG CTG G A cpt(779..797) 209
LoopB CAATCACCGCCG I I I I CC (882..899) 210
yiaO (NC_000913, 948091 )
F3 TATTACGATGATGTCGAAGTCG (394..415) 21 1
B3 CTCTTCATGCTGCCGTAG cpt(621..638) 212 cpt(488..508);
FIP AACTACCACCTGCATCGCTGGCGTATCACTCTATACTGGC (432..450) 213
(522..541 );
BIP TTCCGTGCGTCTGAATGACCGGTGTAAGCACCTGTTCC cpt(580..597) 214
LoopF GTATAGCGGTAGCTGGTGATC cpt(456..476) 215
LoopB CGGCACTGGTTATACGCA (546..563) 216
F3 G CGTATCACTCTATACTG GC (431..450) 217
B3 CTCTTCATGCTGCCGTAG cpt(621..638) 218 cpt(533..541 );
FIP GGTCATTCAGACGCACGGAACTACCGCTATACCCATTATGAC (465..486) 219
(546..567);
BIP CGGCACTGGTTATACGCAACTATTCTGGCGTCCAGTCATA
cpt(598..615) 220
LoopF TATAACTACCACCTGCATCGC cpt(491..511 ) 221
LoopB GCGGAACAGGTGCTTACA (578..595) 222
F3 GC ACTG GTTATACG CAACTA (548..567) 223
B3 GAA I I I CCAGGTCAGACGG cpt(753..771 ) 224 cpt(642..663);
FIP CGGTTGAATACGTTGCAGACTGGTGCTTACACCTATGACTGG (587..606) 225
(671..693);
BIP AGCAACTTAATCTCGGGCTGACGCAAGTTGCAGACCGTTA
cpt(732..748) 226
LoopF GCTCTTCATGCTGCCGTA cpt(622..639) 227
LoopB CAGGTAAAGTGTGGTACGACA (695..715) 228
Table 5. LAMP primer list for detection of E. coli 2.2 End-point LAMP assays
[125] A LAMP protocol based on SYBR Green fluorescent staining of DNA was developed for end-point detection of target bacterial species. The reactions were carried out in a 25 reaction volume with 5 of the nucleic acid sample, 1.4 mM dNTP, lx Thermopol® reaction buffer or lx Isothermal amplification buffer (New England Bio labs), 2 mM MgS04, 0.8 M Betain, 40 pmol of FIP and BIP primers, 5 pmol of F3 and B3 primers, 20 pmol of LF and LB primers, and 8 units of Bst 2.0 or Bst 2.0 WarmStart® DNA polymerase (New England Bio labs). Amplification was performed at a constant temperature of 65°C for 30 minutes. All reactions were conducted in a conventional thermal cycler (ABI 9700, Eppendorf). LAMP amplicons in the reaction tube were directly detected with the naked eye by addition of 1 of 1/10-diluted SYBR Green I dye (Invitrogen) to the tube and observation of the fluorescent color of the solution under UV light. A dilution of the original orange color indicates a negative result, whereas a fluorescent green color indicates a positive amplification.
[126] Additionally, a colorimetric LAMP protocol using pH-sensitive dyes was developed for simple end-point detection of the targeted bacterial species. The use of pH-sensitive dyes allows harnessing the change from an initial alkaline pH to a final acidic pH resulting from amplification reactions performed with minimal buffering capacity. Reaction conditions were adapted from a previously published protocol (Tanner et al, 2015). The reactions were carried out in a 25 μΐ, reaction volume with 5 μΐ^ of the nucleic acid sample, 1.2 mM dNTP, lx in-house reaction buffer [10 mM (NH4)2S04, 50 mM KC1, 8 mM MgS04, 0.1% Tween-20; adjusted to pH 9.0], 0.1 mM Cresol-Red or Cresol-Purple dye (Sigma), 40 pmol of FIP and BIP primers, 5 pmol of F3 and B3 primers, 20 pmol of LF and LB, and 8 units of Bst 2.0 DNA polymerase (New England Bio labs). Amplification was performed at a constant temperature of 65°C for 30 minutes. All reactions were conducted in a conventional thermal cycler (ABI 9700, Eppendorf). LAMP amplicons in the reaction tube were directly detected with the naked eye by observing the color of the solution: a pink or purple color indicates a negative result, whereas a yellow color indicates a positive amplification.
2.3 Real-time LAMP assays
[127] A LAMP protocol using a DNA intercalating dye as fluorophore was developed for real-time detection of target bacterial species. Genomic DNA from S. enterica strain CIP 60.62T (250 fg/μί) was prepared, aliquoted and tested in triplicate using the various LAMP master mixes to determine conditions for optimal reaction rapidity (Table 6). The final real-time LAMP reactions were carried out in a 25 μΐ, reaction volume with 5 μΐ, of the nucleic acid sample, 15 μΐ, of ISO001 Mastermix (OptiGene), 40 pmol of FIP and BIP primers, 5 pmol of F3 and B3 primers, 20 pmol of LF and LB primers and sterile water. Amplification was performed at a constant temperature of 65°C for 30 minutes. All reactions were conducted in a LightCycler 480 (Roche) or a Genie III (OptiGene) instrument.
LAMP Mastermix Time-to-
N° Composition result (min)
IX ThermoPol® reaction buffer. 1.4 mM dNTP, 2 mM MgS04 , 0.8 M Betain, 40
pmol of FIP and BIP primers, 5 pmol of F3 and B3 primers, 20 pmol of LF and LB
33.3 primers, EvaGreen™ 0.25X, 8 units of Bst 2.0 DNA polymerase.
IX Isothermal amplification buffer, 1.4 mM dNTP, 2 mM MgS04 , 0.8 M Betain, 19.41 40 pmol of FIP and BIP primers, 5 pmol of F3 and B3 primers, 20 pmol of LF and
LB primers, EvaGreen 0.25X, 8 units of Bst 2.0 DNA polymerase.
IX ThermoPol reaction buffer, 1.4 mM dNTP, 2 mM MgS04 , 0.8 M Betain, 40 No detection pmol of FIP and BIP primers, 5 pmol of F3 and B3 primers, 20 pmol of LF and LB
primers, EvaGreen 0.25X, 8 units of Bst 2.0 WarmStart® DNA polymerase.
IX Isothermal amplification buffer, 1.4 mM dNTP, 2 mM MgS04 , 0.8 M Betain, 12.71 40 pmol of FIP and BIP primers, 5 pmol of F3 and B3 primers, 20 pmol of LF and
LB primers, EvaGreen 0.25X, 8 units of Bst 2.0 Warm Start DNA polymerase.
IX Isothermal amplification buffer, 1.4 mM dNTP, 2 mM MgS04 , 0.8 M Betain, 12.77 40 pmol of FIP and BIP primers, 5 pmol of F3 and B3 primers, 20 pmol of LF and
LB primers, EvaGreen IX, 8 units of Bst 2.0 Warm Start DNA polymerase.
IX Isothermal amplification buffer, 1.4 mM dNTP, 2 mM MgS04 , 0.8 M Betain, 12.23 40 pmol of FIP and BIP primers, 5 pmol of F3 and B3 primers, 20 pmol of LF and
LB primers, EvaGreen 0.5X, 8 units of Bst 2.0 Warm Start DNA polymerase.
IX Isothermal amplification buffer, 1.4 mM dNTP, 2 mM MgS04 , 0.8 M Betain, 11.91 40 pmol of FIP and BIP primers, 5 pmol of F3 and B3 primers, 20 pmol of LF and
LB primers, 3 μΜ Syto-9, 8 units of Bst 2.0 Warm Start DNA polymerase.
IX Isothermal amplification buffer, 1.4 mM dNTP, 2 mM MgS04 , 0.8 M Betain, 13.00 40 pmol of FIP and BIP primers, 5 pmol of F3 and B3 primers, 20 pmol of LF and
LB primers, 1.5 μΜ Syto-9, 8 units of Bst 2.0 Warm Start DNA polymerase.
IX Isothermal amplification buffer, 1.4 mM dNTP, 2 mM MgS04 , 0.8 M Betain, 13.47 40 pmol of FIP and BIP primers, 5 pmol of F3 and B3 primers, 20 pmol of LF and
LB primers, 0.75 μΜ Syto-9, 8 units of Bst 2.0 Warm Start DNA polymerase. IX Isothermal amplification buffer, 1.0 mM dNTP, 2 mM MgSQ4 . 0.8 M Betain, 12.28 40 pmol of FIP and BIP primers, 5 pmol of F3 and B3 primers, 20 pmol of LF and
LB primers, EvaGreen 0.25X, 8 units of Bst 2.0 Warm Start DNA polymerase.
IX Isothermal amplification buffer, 1.2 mM dNTP, 2 mM MgSQ4 . 0.8 M Betain, 20.49 40 pmol of FIP and BIP primers, 5 pmol of F3 and B3 primers, 20 pmol of LF and
LB primers, EvaGreen 0.25X, 8 units of Bst 2.0 Warm Start DNA polymerase.
IX Isothermal amplification buffer. 1.6 mM dNTP. 2 mM MgSQ4 . 0.8 M Betain. 52.10 40 pmol of FIP and BIP primers, 5 pmol of F3 and B3 primers, 20 pmol of LF and
LB primers, EvaGreen 0.25X, 8 units of Bst 2.0 Warm Start DNA polymerase.
IX Isothermal amplification buffer, 1.4 mM dNTP, 0 mM MgSQ4 , 0.8 M Betain, No detection 40 pmol of FIP and BIP primers, 5 pmol of F3 and B3 primers, 20 pmol of LF and
LB primers, EvaGreen 0.25X, 8 units of Bst 2.0 Warm Start DNA polymerase.
IX Isothermal amplification buffer, 1.4 mM dNTP, 4 mM MgSQ4 , 0.8 M Betain, 9.95 40 pmol of FIP and BIP primers, 5 pmol of F3 and B3 primers, 20 pmol of LF and
LB primers, EvaGreen 0.25X, 8 units of Bst 2.0 Warm Start DNA polymerase.
IX Isothermal amplification buffer, 1.4 mM dNTP, 6 mM MgSQ4 , 0.8 M Betain, 8.29 40 pmol of FIP and BIP primers, 5 pmol of F3 and B3 primers, 20 pmol of LF and
LB primers, EvaGreen 0.25X, 8 units of Bst 2.0 Warm Start DNA polymerase.
IX Isothermal amplification buffer, 1.4 mM dNTP, 2 mM MgS04 , 0.6 M Betain. 35.09 40 pmol of FIP and BIP primers, 5 pmol of F3 and B3 primers, 20 pmol of LF and
LB primers, EvaGreen 0.25X, 8 units of Bst 2.0 Warm Start DNA polymerase.
IX Isothermal amplification buffer, 1.4 mM dNTP, 2 mM MgS04 , 1 M Betain. 40 33.94 pmol of FIP and BIP primers, 5 pmol of F3 and B3 primers, 20 pmol of LF and LB
primers, EvaGreen 0.25X, 8 units of Bst 2.0 Warm Start DNA polymerase.
IX Isothermal amplification buffer, 1.0 mM dNTP. 6 mM MgSQ4 , 0.8 M Betain, 9.93 40 pmol of FIP and BIP primers, 5 pmol of F3 and B3 primers, 20 pmol of LF and
LB primers, EvaGreen 0.25X, 8 units of Bst 2.0 Warm Start DNA polymerase.
IX Isothermal amplification buffer, 1.0 mM dNTP, 6 mM MgS04 , 0.8 M Betain, 7.58 40 pmol of FIP and BIP primers, 5 pmol of F3 and B3 primers, 20 pmol of LF and
LB primers, EvaGreen 0.25X, 8 units of GspSSDl DNA polymerase. lx ISO001 no dye Mastermix, 40 pmol of FIP and BIP primers, 5 pmol of F3 and 7.73 B3 primers, 20 pmol of LF and LB primers, EvaGreen 0.25X.
IX ISO001 Mastermix, 40 pmol of FIP and BIP primers, 5 pmol of F3 and B3 6.41 primers, 20 pmol of LF and LB primers. Table 6. Comparison of LAMP assay efficiency for different master mix compositions.
Time-to-result is the mean value observed on three replicates.
[128] Upon optimization of the real-time LAMP assay conditions, all primers sets were compared individually for optimal amplification of target bacterial DNA. Genomic DNA from S. enterica strain CIP 60.62T (250 fgVL), S. aureus strain CIP 65.8T (200 fg/ μί), S. pneumoniae strain CIP 10291 IT (50 fg^L), E. coli strain CIP 54.8T (3 pg/μΤ) and H. influenzae strain CIP 102514 (2.5 pg L) were prepared, aliquoted and tested in triplicate using the different LAMP primer sets to identify primers for optimal reaction rapidity (Table 7 and Table 8). For each target gene of interest, only the optimal primer set demonstrating the shortest reaction time was kept for further investigation of LAMP assay performances (analytical sensitivity, specificity and broadness).
Species Gene Primer set N° Time-to-result (min)
Salmonella spp. invA 1 6.41
2 10.38
3 8,03
phoP 1 11.88
2 9.61
3 6,58
prgK 1 24.31
2 15.71
3 7.71
4 TM
ttrR 1 8.96
2 13.60
S. aureus femA 1 14.21
2 9^85
arcC 1 8.28
2 16.49
nuc 1 23.13
2 10.86
3 18.81
4 11.83
S. pneumoniae lytA 1 7.60
2 13.49
3 8^44
ply 1 8.43
2 10.67
3 16.15
Table 7. Comparison of LAMP assay efficiency for different LAMP primer sets. Time- to-result is the mean value observed on three replicates.
Species Gene Primer set N° Time-to-result (min)
E. coli malB 1 8.0
2 11.2
3 4.7 glyK 1 7.5
2 12.0
3 \9 _
yiaO 1 8.2
2 8.4
3 8^
H. influenzae hpd 1 11.0
2 10.0
3 13.3
Table 8. Comparison of LAMP assay efficiency for different LAMP primer sets. Time-to- result is the mean value observed on three replicates.
3. Nucleic acid extraction
[129] Bacterial nucleic acids were extracted from nutrient agar plates or enumerated bacterial suspensions using the QiaAmp DNA Mini Kit (Qiagen, Hilden, Germany), according to the manufacturer's instructions. Alternatively, bacterial nucleic acids were extracted from enumerated bacterial suspensions using the "Boil & Spin" method. An aliquot of bacterial suspension (100 μί) was boiled for 10 min and immediately cooled on ice for 5 min. After a short spin, the supernatant was collected and used for LAMP analysis.
[130] Total DNA extracts from spiked whole blood samples (1 mL) were obtained using the QiaAmp DNA Blood Midi Kit (Qiagen, Hilden, Germany), according to the manufacturer's instructions. In addition, an enhanced magnetic silica version of the "Boom" nucleic acid extraction method was drawn up and optimized for simple and efficient extraction of 1 mL blood volumes (Boom et al, 1990). Nucleic acid extraction conditions (choice, composition and concentration of reagents and buffers) were compared individually for optimal bacterial DNA recovery. Citrate- treated whole blood samples spiked with 3000 CFU / mL (or 150 CFU / reaction) S. enterica strain CIP 60.62T were prepared, aliquoted (lmL) and extracted in triplicate using the in-house bead- based extraction method. Protocol parameters including the bead type and size (Table 9), the elution volume (Table 10) and the number of wash steps (Table 11) were modified independently to determine conditions for optimal DNA extraction and subsequent LAMP detection. bead types LAMP
Surface time-to-
N° Magnetic bead types (Reference) Size
chemistry result (min)
1 NucliSENS® (Biomerieux) Unknown Silica 38.50
2 Dynabeads® Sylane (Life technologies) 1 μηι Silica -
3 Dynabeads® Blood (Life technologies) 1 μηι Silica 54.01
4 Mag- Si DNA (MagnaMedics) 300 nm Silica 17.92
5 Mag-Si DNA COOH (MagnaMedics) 300 nm Carboxyle 54.87
6 Mag-Si DNA 600 (MagnaMedics) 600 nm Silica 14.35
7 Mag-Si DNA 600 COOH (MagnaMedics) 600 nm Carboxyle 37.58 8 Mag-Si DNA allround (MagnaMedics) 1,2 um Silica 19.05
9 Mag-Si DNA allround COOH (MagnaMedics) 1,2 μηι Carboxyle 39.42
10 Mag-Si DNA 3.0 (MagnaMedics) 3,0 μηι Silica 14.50
11 Mag-Si DNA 3.0 COOH (MagnaMedics) 3,0 μηι Carboxyle 23.82
Table 9. Comparison of LAMP assay efficiency for detection of bacterial DNA extracted from spiked whole blood samples using different magnetic bead types. Time-to-result is the mean value observed on three replicates.
Elution volume LAMP time-to-result (min)
50 \L water 14.35
100 \L water 11.97
Table 10. Comparison of LAMP assay efficiency for detection of bacterial DNA extracted from spiked whole blood samples using different elution volumes. Time-to- result is the mean value observed on three replicates.
Number of wash steps LAMP time-to-result (min)
5 washes 11.97
3 washes 15.46
0 washes No detection
Table 11. Comparison of LAMP assay efficiency for detection of bacterial DNA extracted from spiked whole blood samples using different number of wash steps. Time-to-result is the mean value observed on three replicates.
[131] Briefly, 1 mL spiked blood samples were mixed with 2 mL NucliSENS® lysis buffer (Biomerieux, France) and incubated at room temperature for 10 minutes. Following sample lysis, 200 μΐ, of Mag-Si DNA 600 microbead suspension (MagnaMedics Diagnostics, The Netherlands) were added to the lysed sample and incubated at room temperature for 10 minutes. Following incubation, beads were washed twice in 500 μΐ, NucliSENS®Wash buffer I, twice in 500 μΐ, NucliSENS® Wash buffer II and once in 500 μΕ NucliSENS® Wash buffer III (Biomerieux, France) using a magnetic tube holder. Total DNA was eluted by incubating the beads in 100 μΐ^ DNAse-free water for 5 minutes at 65°C under constant shaking (1100 rpm).
[132] An alternative centrifugation-free extraction protocol entitled "SpeedXtract", based on the use of magnetic particles for cell/bacteria capture and thermal lysis for nucleic acid elution, was adapted and optimized for efficient extraction of 1 mL citrate-treated blood samples. Protocol parameters including the volume of magnetic beads, wash buffer and lysis buffer as well as the number of wash steps were modified independently to determine conditions for optimal DNA extraction and subsequent LAMP detection. Briefly, 1 mL spiked blood samples were mixed with 3 mL enrichment buffer and 100 μΐ, suspension A microbeads (SpeedXtract nucleic acid kit, Qiagen) and incubated at room temperature for 3 minutes. Following incubation, beads were washed twice in 1 mL enrichment buffer. Total DNA was eluted by incubating the beads in 100 lysis buffer (SpeedXtract nucleic acid kit, Qiagen) for 10 minutes at 95°C under constant shaking (1100 rpm).
4. Development and optimization of end-point and real-time LAMP assays:
[133] Core genes, present in all strains of a particular bacterial species, were selected as target for the specific detection of Salmonella spp., S. pneumoniae and S. aureus. The invasion protein gene invA, the tetrathionate reductase gene ttrR, the transcriptional regulator gene phoP and the pathogenicity 1 island effector protein gene prgK were selected as targets for the detection of Salmonella spp.; the autolysin gene lytA and the pneumolysin gene ply were selected as targets for the detection of S. pneumoniae; the aminoacyltransferase gene fern A, the nuclease gene nuc, and the carbamate kinase gene arcC were selected as targets for the detection of S. aureus.
[134] In order to confirm that the newly designed LAMP primer sets would amplify target DNA, a preliminary assessment of the primer efficiency was conducted using established end-point LAMP protocols. The detection of the LAMP amplification products was performed by naked-eye inspection, either by fluorescent staining using a DNA intercalating dye or by colorimetry using pH-sensitive dyes. Both types of end-point LAMP assays were successfully applied for the detection of S. enterica, S. pneumoniae or S. aureus genomic DNA using the specifically designed primer sets. Detection of S. enterica genomic DNA by fluorescent and colorimetric end-point LAMP assays is shown in Figure 1.
[135] Although end-point LAMP assays are rapid (<30 min) and can be analyzed immediately without the need for specialized and expensive instrumentation, they do not allow high-throughput or quantitative applications. For these reasons, a standardized real-time LAMP reaction protocol was developed and optimized for rapid high-throughput detection of the target bacterial species. Although different reaction master mix compositions, DNA polymerization enzymes (including Bst 2.0, Bst 2.0 WarmStart® and GspSSDl) and DNA intercalating dyes (including EvaGreen™ and Syto-9) were proven efficient for real-time LAMP using the designed primer sets, the ISO001 Mastermix (OptiGene), containing a proprietary DNA intercalating dye, demonstrated optimal amplification. Detection of S. enterica genomic DNA by real-time fluorescent LAMP assay is shown in Figure 2.
5. Analytical specificity of the real-time LAMP assays [136] The analytical specificity of the developed LAMP assays was assessed using panels of genomic DNA extracts obtained from 10 bacterial species closely related to Salmonella spp., 12 bacterial species closely related to S. aureus, 12 bacterial species closely related to S. pneumoniae, 10 bacterial species closely related to E. coli or 12 bacterial species closely related to H. influenzae (Table 12 to Table 16). None of the bacterial species related to Salmonella spp. were detected by the invA, phoP, prgK or ttrR primers and none of the bacterial species closely related to S. aureus were detected by the fern A, arcC or nuc primers, demonstrating the high specificity of the developed Salmonella spp. and S. aureus LAMP assays. Similarly, none of the bacterial species related to E. coli were detected by the malB, glyK or yiaO primers and none of the bacterial species closely related to H. influenzae were detected by the lpd primers, demonstrating the high specificity of the developed H. influenzae and E. coli LAMP assays. Similarly, none of the bacterial species closely related to S. pneumoniae were detected by the lytA primers, however S. pseudopneumoniae DNA was detected by the ply primers. LAMP using ply primers was therefore discarded for the specific detection of S. pneumoniae.
Species Strain
Escherichia coli CIP 54.8T
Shigella dysenteriae CIP 57.28T
Klebsiella pneumoniae CIP 82.91T
Streptococcus pneumoniae CIP 10291 IT
Staphylococcus aureus CIP 65.8T
Haemophilus influenzae CIP 102514T
Bacillus subtilis CIP 52.65T
Listeria monocytogenes CIP 82.110T
Leptospira interrogans icterohaemorrhagiae CIP 6.1204
Neisseria meningitidis CIP 73.10T
Table 12. Related bacterial strains analyzed by the Salmonella spp. LAMP assays
Species Strain
Staphylococcus epidermis CIP 81.55T
Staphylococcus caprae CIP 104000T
Staphylococcus warneri CIP 81.65T
Staphylococcus simiae CIP 108931T
Streptococcus pneumoniae CIP 10291 IT
Salmonella enterica CIP 60.62T
Haemophilus influenzae CIP 102514T
Escherichia coli CIP 54.8T
Bacillus subtilis CIP 52.65T
Listeria monocytogenes CIP 82.110T
Leptospira interrogans icterohaemorrhagiae CIP 6.1204
Neisseria meningitides CIP 73.10T
Table 13. Related bacterial strains analyzed by the S. aureus LAMP assays
Species Strain Streptococcus mitis 1 CIP 103335T
Streptococcus infantis CIP 105949T
Streptococcus pseudopneumoniae CIP 108659T
Streptococcus oralis CIP 102922T
Salmonella enterica CIP 60.62T
Staphylococcus aureus CIP 65.8T
Haemophilus influenzae CIP 102514T
Escherichia coli CIP 54.8T
Bacillus subtilis CIP 52.65T
Listeria monocytogenes CIP 82.110T
Leptospira interrogans icterohaemorrhagiae CIP 6.1204
Neisseria meningitides CIP 73.10T
Table 14. Related bacterial strains analyzed by the S. pneumoniae LAMP assays
Species Strain
Haemophilus parainfluenzae CIP 102513T
Haemophilus aegyptus CIP 52.129T
Haemophilus haemolyticus CIP 103290T
Haemophilus parahaemolyticus CIP 56.86T
Streptococcus pneumoniae CIP 10291 IT
Salmonella enterica CIP 60.62T
Staphylococcus aureus CIP 65.8T
Escherichia coli CIP 54.8T
Bacillus subtilis CIP 52.65T
Listeria monocytogenes CIP 82.110T
Leptospira interrogans icterohaemorrhagiae CIP 6.1204
Neisseria meningitides CIP 73.10T
Table 15. Related bacterial strains analyzed by the H. influenzae LAMP assays
Species Strain
Salmonella enteritica CIP 60.62T
Shigella dysenteriae CIP 57.28T
Klebsiella pneumoniae CIP 82.9 IT
Streptococcus pneumoniae CIP 10291 IT
Staphylococcus aureus CIP 65.8T
Haemophilus influenzae CIP 102514T
Bacillus subtilis CIP 52.65T
Listeria monocytogenes CIP 82.11 OT
Leptospira interrogans icterohaemorrhagiae CIP 6.1204
Neisseria meningitidis CIP 73.1 OT
Table 16. Related bacterial strains analyzed by the E. coli LAMP assays 6. Analytical sensitivity and reaction time of the real-time LAMP assays
[137] The analytical sensitivity and time-to-result of the developed real-time LAMP assays were assessed using serial dilutions (10-fold) of purified genomic DNA from pure bacterial cultures of Salmonella enterica reference strain CIP 60.62T, Streptococcus pneumoniae reference strain CIP 102911, Staphylococcus aureus reference strain CIP 65.8T, Haemophilus influenzae strain CIP 102514 and E. coli strain CIP 54.8T. The developed LAMP assays demonstrated a limit of detection ranging from 1 to 10 colony forming units (CFU) per reaction and a time-to-result inferior to 20 minutes (Table 17 and Table 18). The LAMP assays targeting gene invA, gene arcC, gene lytA and gene malB demonstrated the lowest limit of detection (LOD) associated with the shortest reaction time for detection of S. enterica, S. aureus, S. pneumoniae and E. coli, respectively.
Species Target LOD Time-to- gene (CFU/reaction) result (min)
S. enterica invA 2,5 8.2 ± 0.7
phoP 2,5 8.3 ± 0.63
prgK 2,5 19.2 ± 2.2
ttrR 5 9.0 ± 0.1
S. aureus femA 5 18.53 ± 1.03
arcC 5 18.01 ± 0.08
nuc 50 10.86 ± 0.13
S. pneumoniae lytA 2,5 13.7 ± 0.5
Table 17. Analytical sensitivity and reaction time of the LAMP assays for detection of purified bacterial genomic DNA
Species Target LAMP LOD Time-to- gene (CFU / reaction) result (min)
E. coli malB 1 9.9 ± 0.8
gfyK 5 12.6 ± 0.3
yiaO 1 10.9 ± 0.8
H. influenzae hpd 2.5 16.0 ± 1.3
Table 18. Analytical sensitivity and reaction time of the LAMP assays for detection of purified bacterial genomic DNA
7. Broadness of the real-time LAMP assays
[138] The broadness of the developed LAMP assays was assessed using panels of purified genomic DNA obtained from 90 Salmonella spp. strains (including 7 different Salmonella species and 32 different S. enterica serotypes), 26 S. aureus strains (including 26 Methicillin-resistant strains), 88 S. pneumoniae strains (including 80 different serotypes), 32 E. coli strains or 82 H. influenzae strains (including 7 different biotypes) (Table 19 to Table 23). All Salmonella spp. strains were detected by the invA, phoP, prgK and ttrR LAMP assays, all S. aureus strains were detected by the femA, arcC and nuc LAMP assays, all S. pneumoniae strains were detected by the lytA LAMP assay, all E. coli strains were detected by the malB, glyK and yiaO LAMP assays and all H. influenzae strains were detected by the hpd LAMP assay.
Species Strain Other strain references
Salmonella enterica indica CIP 10250 IT
Salmonella enterica salamae CIP 82.29T
Salmonella enterica arizonae CIP 82.30T
Salmonella enterica bongori CIP 82.33T
Salmonella enterica diarizonae CIP 82.3 IT
Salmonella enterica houtenae CIP 82.32T Salmonella enterica enterica Gallinarum CIP 56.8
Salmonella enterica enterica Typhi
Salmonella enterica enterica Typhimurium CIP 105734
Salmonella enterica enterica Typhimurium CIP 58.58 ATCC 13311 ;DSM 5569;JCM
1652;NCTC 74;CCUG 11732;CECT 443;LMG 10396;WDCM 00121
Salmonella enterica enterica Typhimurium CIP 110278 NCTC 12190;CECT 4156
Salmonella enterica enterica Typhimurium CIP 106086
Salmonella enterica enterica Typhimurium CIP 103446 NCTC 12484
Salmonella enterica enterica Typhimurium CIP 104115 ATCC 14028;NCTC 12023;CCM
7205;DSM 19587;LMG 14933;NCIMB 13284;WDCM 00031
Salmonella enterica enterica Typhimurium CIP 104474 ATCC 33275
Salmonella enterica enterica Typhimurium CIP 55.43 NCTC 8391
Salmonella enterica enterica Typhimurium CIP 55.44 NCTC 8392
Salmonella enterica enterica Typhimurium CIP 60.63 NCIMB 11451
Salmonella enterica enterica Typhimurium CIP 103793
Salmonella enterica enterica Typhimurium CIP 52.10
Salmonella enterica enterica Typhimurium CIP 67.26
Salmonella enterica enterica Enteritidis CIP 105150
Salmonella enterica enterica Enteritidis CIP 81.3
Salmonella enterica enterica Enteritidis CIP 82.97 ATCC 13076;CCM 7189;NCTC
12694;DSM 9898;LMG 10395;WDCM 00030
Salmonella enterica enterica Enteritidis CIP 106158
Salmonella enterica enterica Enteritidis CIP 106232
Salmonella enterica enterica Enteritidis CIP 56.29
Salmonella enterica enterica Enteritidis CIP 57.29
Salmonella enterica enterica Paratyphi A CIP 55.38 NCTC 8386
Salmonella enterica enterica Paratyphi A CIP 55.39 NCTC 8387
Salmonella enterica enterica Paratyphi A CIP 55.40 NCTC 8388
Salmonella enterica enterica Paratyphi A CIP 55.41 NCTC 8389
Salmonella enterica enterica Paratyphi B CIP 106179
Salmonella enterica enterica Paratyphi B CIP 106246
Salmonella enterica enterica Paratyphi B CIP 106248
Salmonella enterica enterica Paratyphi B CIP 106252
Salmonella enterica enterica Paratyphi B CIP 106465
Salmonella enterica enterica Paratyphi B CIP 106950
Salmonella enterica enterica Paratyphi B CIP 54.100
Salmonella enterica enterica Paratyphi B CIP 54.116
Salmonella enterica enterica Paratyphi B CIP 55.42 NCTC 8390
Salmonella enterica enterica Paratyphi B CIP A214
Salmonella enterica enterica Paratyphi C CIP 106175
Salmonella enterica enterica Paratyphi C CIP 55.108 NCTC 5733
Salmonella enterica enterica Anatum CIP 56.30
Salmonella enterica enterica CIP 106185
Bovismorbificans
Salmonella enterica enterica CIP 106218
Bovismorbificans
Salmonella enterica enterica CIP 56.28
Bovismorbificans
Salmonella enterica enterica Choleraesuis CIP 106214
Salmonella enterica enterica Choleraesuis CIP 55.133 ATCC 13312;CIP 58.57;NCTC
5735;CCUG 49677;DSM 14846;JCM 1651 Salmonella enterica enterica Choleraesuis CIP 57.13 NCTC 5737;CCUG 49678
Salmonella enterica enterica Choleraesuis CIP A221
Salmonella enterica enterica Corvallis CIP 105342
Salmonella enterica enterica Dakar CIP 105620
Salmonella enterica enterica Derby CIP 104918
Salmonella enterica enterica Derby CIP 106205
Salmonella enterica enterica Dublin CIP 106215
Salmonella enterica enterica Dublin CIP 106222
Salmonella enterica enterica Dublin CIP 110276 NCTC 9676;CECT 4152
Salmonella enterica enterica Dublin CIP 70.53
Salmonella enterica enterica Hadar CIP 105813
Salmonella enterica enterica Hessarek CIP 54.140
Salmonella enterica enterica Infantis CIP 103549 ATCC 35664
Salmonella enterica enterica Mbandaka CIP 105859
Salmonella enterica enterica Muenster CIP 107859
Salmonella enterica enterica Newport CIP 105629
Salmonella enterica enterica Newport CIP 106176
Salmonella enterica enterica Newport CIP 106180
Salmonella enterica enterica Newport CIP 70.52
Salmonella enterica enterica Senftenberg CIP 105343 NCTC 5788
Salmonella enterica enterica Senftenberg CIP 106242
Salmonella enterica enterica Senftenberg CIP 107178
Salmonella enterica enterica Stanley CIP 106163
Salmonella enterica enterica Stanley CIP 106221
Salmonella enterica enterica Stanley CIP 106230
Salmonella enterica enterica Tananarive CIP 54.142
Salmonella enterica enterica Zanzibar CIP 107479
Salmonella enterica enterica Virchow CIP 105355
Salmonella enterica enterica Virchow CIP 110069 CECT 4154;BTCC 41 ;CNCTC SK
41 ;GISK 100354;KOS 41 ;NCTC 5742;StBL 4519;WDCM 00124
Salmonella enterica enterica Braenderup CIP 107951
Salmonella enterica enterica Chester CIP 103543 ATCC 11997
Salmonella enterica enterica Kentucky CIP 105623
Salmonella enterica enterica London CIP 105625
Salmonella enterica enterica Montevideo CIP 104583
Salmonella enterica enterica Muenchen CIP 106178 NCTC 4642
Salmonella enterica enterica Muenchen CIP 106253
Salmonella enterica enterica Panama CIP 106249
Salmonella enterica enterica Panama CIP 81.40
Salmonella enterica enterica Pomona CIP 105630
Salmonella enterica enterica Saintpaul CIP 110280 CNCT SK 108;GISK 100331 ;KOS
108;NCTC 6022;CECT 4153
Table 19. Bacterial strains analyzed by the Salmonella spp. LAMP assays
Species Strain
Streptococcus pneumoniae CIP 10291 IT
Streptococcus pneumoniae CIP 103566
Streptococcus pneumoniae CIP 103908
Streptococcus pneumoniae 15B CIP 104121
Streptococcus pneumoniae CIP 104340
Streptococcus pneumoniae 23F CIP 104469
Streptococcus pneumoniae 14 CIP 104470 Streptococcus pneumoniae 9V CIP 104471
Streptococcus pneumoniae CIP 104481
Streptococcus pneumoniae 23F CIP 104485
Streptococcus pneumoniae 18F CIP 104486
Streptococcus pneumoniae 1 CIP 104487
Streptococcus pneumoniae 3 CIP 104489
Streptococcus pneumoniae 3 CIP 104490
Streptococcus pneumoniae 3 CIP 104491
Streptococcus pneumoniae CIP 105179
Streptococcus pneumoniae CIP 105880
Streptococcus pneumoniae CIP 106412
Streptococcus pneumoniae CIP 106413
Streptococcus pneumoniae CIP 106498
Streptococcus pneumoniae 1 CIP 106534
Streptococcus pneumoniae 2 CIP 106535
Streptococcus pneumoniae 3 CIP 106536
Streptococcus pneumoniae 4 CIP 106537
Streptococcus pneumoniae 5 CIP 106538
Streptococcus pneumoniae 6A CIP 106539
Streptococcus pneumoniae 6B CIP 106540
Streptococcus pneumoniae 7F CIP 106541
Streptococcus pneumoniae 7 A CIP 106542
Streptococcus pneumoniae 7B CIP 106543
Streptococcus pneumoniae 7C CIP 106544
Streptococcus pneumoniae 8 CIP 106545
Streptococcus pneumoniae 9 A CIP 106546
Streptococcus pneumoniae 9L CIP 106547
Streptococcus pneumoniae 9N CIP 106548
Streptococcus pneumoniae 9V CIP 106549
Streptococcus pneumoniae I OF CIP 106550
Streptococcus pneumoniae 10 A CIP 106551
Streptococcus pneumoniae I OB CIP 106552
Streptococcus pneumoniae IOC CIP 106553
Streptococcus pneumoniae I IF CIP 106554
Streptococcus pneumoniae 11 A CIP 106555
Streptococcus pneumoniae I IB CIP 106556
Streptococcus pneumoniae 11C CIP 106557
Streptococcus pneumoniae 1 ID CIP 106558
Streptococcus pneumoniae 12F CIP 106559
Streptococcus pneumoniae 12A CIP 106560
Streptococcus pneumoniae 12B CIP 106561
Streptococcus pneumoniae 13 CIP 106562
Streptococcus pneumoniae 14 CIP 106563
Streptococcus pneumoniae 15F CIP 106564
Streptococcus pneumoniae 15A CIP 106565
Streptococcus pneumoniae 15B CIP 106566
Streptococcus pneumoniae 15C CIP 106567
Streptococcus pneumoniae 16F CIP 106568
Streptococcus pneumoniae 16A CIP 106569
Streptococcus pneumoniae 17F CIP 106570
Streptococcus pneumoniae 17 A CIP 106571
Streptococcus pneumoniae 18F CIP 106572
Streptococcus pneumoniae 18A CIP 106573
Streptococcus pneumoniae 18B CIP 106574 Streptococcus pneumoniae 18C CIP 106575 Streptococcus pneumoniae 19F CIP 106576 Streptococcus pneumoniae 19A CIP 106577 Streptococcus pneumoniae 19B CIP 106578 Streptococcus pneumoniae 19C CIP 106579 Streptococcus pneumoniae 20 CIP 106580 Streptococcus pneumoniae 21 CIP 106581 Streptococcus pneumoniae 22F CIP 106582 Streptococcus pneumoniae 22A CIP 106583 Streptococcus pneumoniae 23F CIP 106584 Streptococcus pneumoniae 23 A CIP 106585 Streptococcus pneumoniae 23B CIP 106586 Streptococcus pneumoniae 24F CIP 106587 Streptococcus pneumoniae 24 A CIP 106588 Streptococcus pneumoniae 24B CIP 106589 Streptococcus pneumoniae 25F CIP 106590 Streptococcus pneumoniae 25A CIP 106591 Streptococcus pneumoniae 27 CIP 106592 Streptococcus pneumoniae 28F CIP 106593 Streptococcus pneumoniae 28A CIP 106594 Streptococcus pneumoniae 29 CIP 106595 Streptococcus pneumoniae 31 CIP 106596 Streptococcus pneumoniae 32F CIP 106597 Streptococcus pneumoniae 32A CIP 106598 Streptococcus pneumoniae 33F CIP 106599 Streptococcus pneumoniae 33 A CIP 106600 Streptococcus pneumoniae 33B CIP 106601 Streptococcus pneumoniae 33C CIP 106602 Streptococcus pneumoniae 33D CIP 106603 Streptococcus pneumoniae 34 CIP 106604 Streptococcus pneumoniae 35F CIP 106605 Streptococcus pneumoniae 35A CIP 106606 Streptococcus pneumoniae 35B CIP 106607 Streptococcus pneumoniae 35C CIP 106608 Streptococcus pneumoniae 36 CIP 106609 Streptococcus pneumoniae 37 CIP 106610 Streptococcus pneumoniae 38 CIP 10661 1 Streptococcus pneumoniae 39 CIP 106612 Streptococcus pneumoniae 40 CIP 106613 Streptococcus pneumoniae 41F CIP 106614 Streptococcus pneumoniae 41 A CIP 106615 Streptococcus pneumoniae 42 CIP 106616 Streptococcus pneumoniae 43 CIP 106617 Streptococcus pneumoniae 44 CIP 106618 Streptococcus pneumoniae 45 CIP 106619 Streptococcus pneumoniae 46 CIP 106620 Streptococcus pneumoniae 47 F CIP 106621 Streptococcus pneumoniae 47 A CIP 106622 Streptococcus pneumoniae 48 CIP 106623 Streptococcus pneumoniae CIP 106671 Streptococcus pneumoniae CIP 106777 Streptococcus pneumoniae CIP 53.145 Streptococcus pneumoniae CIP 53.146 Streptococcus pneumoniae CIP 57.3 Streptococcus pneumoniae CIP 57.4
Streptococcus pneumoniae CIP 69.2
Streptococcus pneumoniae CIP 77.23
Streptococcus pneumoniae CIP 78.15
Streptococcus pneumoniae CIP 78.20
Streptococcus pneumoniae CIP A146
Table 20. Bacterial strains analyzed by the S. pneumoniae LAMP assays
Species Strain
Staphylococcus aureus aureus CRBIP21 1
Staphylococcus aureus aureus CRBIP21 10
Staphylococcus aureus aureus CRBIP21 100
Staphylococcus aureus aureus CRBIP21 102
Staphylococcus aureus aureus CRBIP21 104
Staphylococcus aureus aureus CRBIP21 11
Staphylococcus aureus aureus CRBIP21 13
Staphylococcus aureus aureus CRBIP21 17
Staphylococcus aureus aureus CRBIP21 18
Staphylococcus aureus aureus CRBIP21 21
Staphylococcus aureus aureus CRBIP21 24
Staphylococcus aureus aureus CRBIP21 29
Staphylococcus aureus aureus CRBIP21 32
Staphylococcus aureus aureus CRBIP21 33
Staphylococcus aureus aureus CRBIP21 34
Staphylococcus aureus aureus CRBIP21 36
Staphylococcus aureus aureus CRBIP21 37
Staphylococcus aureus aureus CRBIP21 38
Staphylococcus aureus aureus CRBIP21 40
Staphylococcus aureus aureus CRBIP21 66
Staphylococcus aureus aureus CRBIP21 67
Staphylococcus aureus aureus CRBIP21 68
Staphylococcus aureus aureus CRBIP21 7
Staphylococcus aureus aureus CRBIP21 8
Staphylococcus aureus aureus CRBIP21 82
Staphylococcus aureus aureus CRBIP21 83
Staphylococcus aureus aureus CRBIP21 84
Table 21. Bacterial strains analyzed by the S. aureus LAMP assays
Species Strain Other strain references
Haemophilus influenzae II CIP 100032
Haemophilus influenzae II CIP 100033
Haemophilus influenzae III CIP 100606
Haemophilus influenzae III CIP 100923
Haemophilus influenzae III CIP 101002
Haemophilus influenzae IV CIP 101038
Haemophilus influenzae I CIP 101083
Haemophilus influenzae III CIP 101171
Haemophilus influenzae II CIP 101713
Haemophilus influenzae III CIP 101906
Haemophilus influenzae III CIP 101921
Haemophilus influenzae II CIP 101931
Haemophilus influenzae III CIP 102014
Haemophilus influenzae I CIP 102016
Haemophilus influenzae IV CIP 102033
Haemophilus influenzae III CIP 102119 Haemoph lus influenzae CIP 102121
Haemop lus influenzae I CIP 102147
Haemoph lus influenzae II CIP 102173
Haemoph lus influenzae II CIP 102216
Haemoph lus influenzae II CIP 102224
Haemoph lus influenzae CIP 102227
Haemoph lus influenzae III CIP 102284
Haemoph lus influenzae IV CIP 102291
Haemophilus influenzae III CIP 102295
Haemoph lus influenzae I CIP 102368
Haemoph lus influenzae V CIP 102381
Haemoph lus influenzae II CIP 102390
ATCC 33391;CCUG 23945;NCTC 8143;DSM
Haemoph lus influenzae II CIP 102514T 4690
Haemoph lus influenzae I CIP 102587
Haemoph lus influenzae I CIP 102765
Haemoph lus influenzae II CIP 102777
Haemoph lus influenzae I CIP 102795
Haemoph lus influenzae II CIP 102803
Haemoph lus influenzae III CIP 102866
Haemoph lus influenzae II CIP 102873
Haemoph lus influenzae I CIP 102877
Haemoph lus influenzae V CIP 102889
Haemoph lus influenzae I CIP 103712
Haemoph lus influenzae IV CIP 103722 CCUG 31339 Haemoph lus influenzae IV CIP 103723 CCUG 31340 Haemoph lus influenzae I CIP 103777 ATCC 35056 Haemophilus influenzae II CIP 104278
Haemoph lus influenzae IV CIP 104418
Haemoph lus influenzae I CIP 104604 ATCC 49247 Haemoph lus influenzae IV CIP 104746 ATCC 51907 Haemoph lus influenzae VI CIP 105280
Haemoph lus influenzae VII CIP 105281
Haemoph lus influenzae II CIP 107144
Haemoph lus influenzae II CIP 107145
Haemoph lus influenzae III CIP 107146
Haemoph lus influenzae II CIP 107147
Haemoph lus influenzae II CIP 107148
Haemoph lus influenzae II CIP 107149
Haemoph lus influenzae II CIP 107150
Haemoph, lus influenzae II CIP 107151
Haemoph lus influenzae II CIP 107152
Haemoph lus influenzae II CIP 107153
Haemoph lus influenzae II CIP 107154
Haemoph lus influenzae II CIP 107155
Haemoph lus influenzae III CIP 107156
Haemoph lus influenzae II CIP 107157
Haemoph lus influenzae II CIP 107158
Haemoph lus influenzae CIP 107299
Haemoph lus influenzae CIP 52.143
Haemoph lus influenzae I CIP 52.151
Haemoph lus influenzae I CIP 52.152
Haemoph lus influenzae II CIP 52.153
Haemoph lus influenzae IV CIP 52.154 Haemophilus influenzae IV CIP 52.155
Haemophilus influenzae CIP 52.202
Haemophilus influenzae CIP 52.93
Haemophilus influenzae IV CIP 54.24
Haemophilus influenzae I CIP 54.81 ATCC 9006;NCTC 8465
Haemophilus influenzae II CIP 54.82 ATCC 9007;NCTC 8469
Haemophilus influenzae IV CIP 54.83
Haemophilus influenzae IV CIP 54.84 ATCC 8142;NCTC 8472
Haemophilus influenzae I CIP 54.85 ATCC 9833;NCTC 8473
Haemophilus influenzae IV CIP 54.94 NCTC 8468
Haemophilus influenzae CIP 57.38
Haemophilus influenzae CIP A54
Haemophilus influenzae CIP A70
Table 22. Bacterial strains analyzed by the H. influenzae LAMP assays
Other strain
Species Strain references
Escherichia coli Enteroaggregative CRBIP14.10
Escherichia coli Enteroaggregative CRBIP14.12
Escherichia coli Enterohaemorrhagic CRBIP14.13
Escherichia coli Enterohaemorrhagic CRBIP14.14
Escherichia coli Enterotoxinogenic CRBIP14.16
Escherichia coli Enterotoxinogenic CRBIP14.17
Escherichia coli Diffusely Adherent CRBIP14.19
Escherichia coli Diffusely Adherent CRBIP 14.20
Escherichia coli Diffusely Adherent CRBIP 14.21
Escherichia coli Extra-intestinal CRBIP 14.23
Escherichia coli Extra-intestinal CRBIP 14.24
Escherichia coli Extra-intestinal CRBIP 14.25
Escherichia coli Extra-intestinal CRBIP 14.26
Escherichia coli Diffusely-adherent CRBIP14.28
Escherichia coli Diffusely-adherent CRBIP 14.29
Escherichia coli Enteroaggregative CRBIP 14.3
Escherichia coli Extra-intestinal CRBIP 14.30
Escherichia coli CRBIP 14.31
Escherichia coli Extra-intestinal CRBIP14.32
Escherichia coli Extra-intestinal CRBIP 14.33
Escherichia coli Extra-intestinal CRBIP14.34
Escherichia coli Extra-intestinal CRBIP 14.35
Escherichia coli Extra-intestinal CRBIP 14.36
Escherichia coli Extra-intestinal CRBIP 14.38
Escherichia coli Extra-intestinal CRBIP14.39
Escherichia coli Enterotoxinogenic CRBIP 14.46
Escherichia coli Diffusely Adherent CRBIP 14.47
Escherichia coli Enteroaggregative CRBIP 14.5
Escherichia coli Enteroaggregative CRBIP14.6
Escherichia coli Enteroaggregative CRBIP 14.7
Escherichia coli Enteroaggregative CRBIP14.8
Escherichia coli Enteroaggregative CRBIP 14.9
Table 23. Bacterial strains analyzed by the E. coli LAMP assays bility and reproducibility of the real-time LAMP assays [139] The precision of the LAMP assays was assessed using replicates of target S. enterica, S. aureus or S. pneumoniae genomic DNA. To assess the repeatability of the LAMP assays, the intra- assay coefficient of variation (CV) was calculated on 8 replicates of target genomic DNA (at concentrations within the LAMP assays working range) within a single run: the CV% observed for the Salmonella spp. invA, the S. aureus femA and the S. pneumoniae lytA LAMP assays were 6.9%, 7.8 % and 6.3 %, respectively. To assess the reproducibility of the LAMP assays, the inter-assay CV was calculated on 8 replicates analyzed during 3 independent assays performed at 3 different times: the CV% observed for the Salmonella spp. invA, the S. aureus femA and the S. pneumoniae lytA LAMP assays were 16.4 %, 12.6 % and 13,7 %, respectively. These results confirm the high precision of the developed real-time LAMP assays.
9. Robustness of the real-time LAMP assays
[140] In order to assess the robustness of the LAMP assays, the potential effects of three key parameters (reaction temperature, master mix volume and instrumentation) on LAMP reaction efficiency (time-to-result) were evaluated. The effect each individual parameter variation as compared to standard LAMP reaction parameters was observed on 3 replicates of target genomic DNA. The CV% observed for the Salmonella spp. invA LAMP assay for variations of temperature of ± 2°C, variations of master mix volumes of ± 10 % and the use of different instrumentation (Genie III instead of Lightcycler 480 instrument) was less than 6.5% (range 4.6%> - 6.5%>). The absence of significant effects of a range of parameter variations on the LAMP reaction efficiency demonstrates the robustness of the standardized real-time LAMP assay protocol.
10. Nucleic acid extraction efficiency
[141] The detection of bacterial pathogens in clinical samples by LAMP requires the use of chip- compatible extraction methods that efficiently lyse bacterial cells and recover DNA suitable for amplification. For this reason, two simple magnetic silica-based extraction protocols were developed and optimized for total DNA extraction from 1 mL human whole blood samples, the "Boom" protocol and the "SpeedXtract" protocol described in Example 3. We used the developed LAMP assays to measure the DNA recovery from blood samples spiked with suspensions of 2000, 1000, 500, 250, 125 or 75 CFU / mL of S. enterica, S.pneumoniae or S. aureus bacteria and subjected to the developed DNA extraction method. The extraction efficiencies of the bead-based protocols were compared to the reference commercial extraction kit (QiaAmp DNA Blood Midi Kit, Qiagen). Results have demonstrated efficient DNA recovery and subsequent LAMP-based detection from spiked whole blood samples using the bead-based methods. The extraction method based on the SpeedXtract approach showing the lowest limit of detection for all three bacterial species (LOD ranging from 75 to 125 CFU / mL) (Table 24 and Table 25).
Target Target Spin-column DNA extraction Bead-based DNA extraction species gene (Qiagen DNA blood mini kit) (Boom)
LAMP LOD Time-to- LAMP LOD Time-to- (CFU / result (min) (CFU / result (min) reaction) reaction)
S. enterica invA 6.25 12.52 10 14.1
Table 24. Analytical sensitivity and reaction time of the LAMP assays for detection of bacterial DNA extracted from spiked whole blood samples get species Target Spin-column DNA Bead-based DNA Bead-based DNA
gene extraction (Qiagen extraction extraction
DNA blood mini kit) (Boom) (SpeedXtract) LAMP Time-to- LAMP Time-to- LAMP Time-to- LOD result LOD result LOD result (CFU /mL) (min) (CFU /mL) (min) (CFU /mL) (min)
S. enterica invA 125 12.5 125 15.2 75 13.9
S. pneumoniae lytA 75 8.7 75 11.6 75 9.3
S. aureus arcC 1000 18.0 2000 26.3 125 11.3
Table 25. Analytical sensitivity and reaction time of the LAMP assays for detection of bacterial
DNA extracted from spiked whole blood samples
References
Bahwere, P, J Levy, P Hennart, P Donnen, W Lomoyo, M Dramaix-Wilmet, J P Butzler, et P De Mol. 2001. « Community- Acquired Bacteremia among Hospitalized Children in Rural Central Africa. » International Journal of Infectious Diseases: IJID: Official Publication of the International Society for Infectious Diseases 5 (4): 180-88.
Boom R, Sol CJ, Salimans MM, Jansen CL, Wertheim-van Dillen PM, van der Noordaa J. 1990. "Rapid and simple method for purification of nucleic acids". J Clin Microbiol. 28(3):495-503.
Bisceglia, E. Methodes physiques d'extraction de micro-organismes a partir d'echantillons sanguins a l'aide de microsystemes. (PhD thesis) Ecole normale superieure de Cachan - ENS Cachan, 2013. French. <NNT : 2013DENS0042>. <tel-00957785>
Connelly, J. T., Rolland, J. P. and Whitesides, G. M. 2015. « "Paper Machine" for Molecular Diagnostics ». Anal. Chem. 87: 7595-601
Gordon, Melita A, Anstead M K Kankwatira, Gershom Mwafulirwa, Amanda L Walsh, Mark J Hopkins, Christopher M Parry, E Brian Faragher, Eduard E Zijlstra, Robert S Heyderman, et Malcolm E Molyneux. 2010. « Invasive Non-Typhoid Salmonellae Establish Systemic Intracellular Infection in HIV-infected Adults: An Emerging Disease Pathogenesis. » Clinical Infectious Diseases: An Official Publication of the Infectious Diseases Society of America 50 (7): 953 -62. doi: 10.1086/651080. Gradel, K O, M Sogaard, C Dethlefsen, H Nielsen, et H C Schonheyder. 2009. « Magnitude of Bacteraemia Is a Predictor of Mortality during 1 Year of Follow-Up. » Epidemiology and Infection 137 (1): 94- 101. doi: 10.1017/S0950268808000575.
Liu, Li, Hope L Johnson, Simon Cousens, Jamie Perin, Susana Scott, Joy E Lawn, Igor Rudan, et al. 2010. « Global, regional, and national causes of child mortality: an updated systematic analysis for 2010 with time trends since 2000. » The Lancet 379 (9832): 2151 -61. doi: 10.1016/S0140- 6736(12)60560-1.
Mulholland, E. Kim, et Richard A. Adegbola. 2005. « Bacterial Infections— A Major Cause of Death among Children in Africa. » New England Journal of Medicine 352 (1): 75 -77. doi: 10.1056/NEJMe048306.
Onipede, Anthony O, Adedeji A Onayade, Jerome B E Elusiyan, Perpetua O Obiajunwa, Ezra O O Ogundare, Olarinde O Olaniran, Lateef A Adeyemi, et Oyeku O Oyelami. 2009. « Invasive Bacteria Isolates from Children with Severe Infections in a Nigerian Hospital. » Journal of Infection in Developing Countries 3 (6): 429-36.
Reddy, Elizabeth A, Andrea V Shaw, et John A Crump. 2010. « Community-acquired bloodstream infections in Africa: a systematic review and meta-analysis. » The Lancet infectious diseases 10 (6): 417-32. doi: 10.1016/S 1473-3099(10)70072-4.
Tanner, Nathan A., Yinhua Zhang, et Thomas C. Evans. 2015. « Visual Detection of Isothermal Nucleic Acid Amplification Using pH-Sensitive Dyes. » BioTechniques 58 (2): 59~68.
doi: 10.2144/000114253.

Claims

Claims
1. A combination of two, three, four, five or more sets of primers, of at least four primers each, wherein each set is suitable for amplification by LAMP of a specific gene from a bacterial species and wherein at least two of said genes to be amplified are from distinct bacterial species, the sets of primers being selected from either
- the group consisting of primer sets specific for the invA gene of Salmonella spp., primer sets specific for the phoP gene of Salmonella spp., primer sets specific for the prgK gene of Salmonella spp., primer sets specific for the ttrR gene of Salmonella spp., primer sets specific for the lytA gene of S. pneumoniae, primer sets specific for the ply gene of S. pneumoniae, primer sets specific for the femA gene of S. aureus, primer sets specific for the arcC gene of S. aureus, and primer sets specific for the nuc gene of S. aureus;
or
- the group consisting of primer sets specific for the invA gene of Salmonella spp., primer sets specific for the phoP gene of Salmonella spp., primer sets specific for the prgK gene of Salmonella spp., primer sets specific for the ttrR gene of Salmonella spp., primer sets specific for the lytA gene of S. pneumoniae, primer sets specific for the ply gene of S. pneumoniae, primer sets specific for the femA gene of S. aureus, primer sets specific for the arcC gene of S. aureus, primer sets specific for the nuc gene of S. aureus, primer sets specific for the hpd gene of H. influenzae, primer sets specific for the malB gene of E. coli, primer sets specific for the glyK gene of E. coli and primer sets specific for the yiaO gene of E. coli,
wherein
primer sets specific for the invA gene of Salmonella spp. consist of:
the six-primer set consisting of SEQ ID Nos: 1 to 6;
the five-primer set consisting of SEQ ID Nos: 1 to 5;
the five-primer set consisting of SEQ ID Nos: 1 to 4 and SEQ ID No: 6;
the four-primer set consisting of SEQ ID Nos: 1 to 4;
the six-primer set consisting of SEQ ID Nos: 7 to 12;
the five-primer set consisting of SEQ ID Nos: 7 to 11 ;
the five-primer set consisting of SEQ ID Nos: 7 to 10 and SEQ ID No: 12;
the four-primer set consisting of SEQ ID Nos: 7 to 10;
the six-primer set consisting of SEQ ID Nos: 13 to 18; the five-primer set consisting of SEQ ID Nos: 13 to 17;
the five-primer set consisting of SEQ ID Nos: 13 to 16 and SEQ ID No: 18; and
the four-primer set consisting of SEQ ID Nos: 13 to 16;
or primer sets among the above wherein at least one primer distinguishes by the addition of up to 20 consecutive nucleotides of the 5' and/or 3' flanking sequence in the region of the gene to be amplified;
primer sets specific for the phoP gene of Salmonella spp. consist of:
the six-primer set consisting of SEQ ID Nos: 19 to 24;
the five-primer set consisting of SEQ ID Nos: 19 to 23;
the five-primer set consisting of SEQ ID Nos: 19 to 22 and SEQ ID No: 24;
the four-primer set consisting of SEQ ID Nos: 19 to 22;
the six-primer set consisting of SEQ ID Nos: 25 to 30;
the five-primer set consisting of SEQ ID Nos: 25 to 29;
the five-primer set consisting of SEQ ID Nos: 25 to 28 and SEQ ID No: 30;
the four-primer set consisting of SEQ ID Nos: 25 to 28;
the six-primer set consisting of SEQ ID Nos: 31 to 36;
the five-primer set consisting of SEQ ID Nos: 31 to 35;
the five-primer set consisting of SEQ ID Nos: 31 to 34 and SEQ ID No: 36; and
the four-primer set consisting of SEQ ID Nos: 31 to 34;
or primer sets among the above wherein at least one primer distinguishes by the addition of up to 20 consecutive nucleotides of the 5' and/or 3' flanking sequence in the region of the gene to be amplified;
primer sets specific for the prgK gene of Salmonella spp. consist of:
the six-primer set consisting of SEQ ID Nos: 37 to 42;
the five-primer set consisting of SEQ ID Nos: 37 to 41 ;
the five-primer set consisting of SEQ ID Nos: 37 to 40 and SEQ ID No: 42;
the four-primer set consisting of SEQ ID Nos: 37 to 40;
the six-primer set consisting of SEQ ID Nos: 43 to 48;
the five-primer set consisting of SEQ ID Nos: 43 to 47;
the five-primer set consisting of SEQ ID Nos: 43 to 46 and SEQ ID No: 48;
the four-primer set consisting of SEQ ID Nos: 43 to 46;
the six-primer set consisting of SEQ ID Nos: 49 to 54; the five-primer set consisting of SEQ ID Nos: 49 to 53;
the five-primer set consisting of SEQ ID Nos: 49 to 52 and SEQ ID No: 54;
the four-primer set consisting of SEQ ID Nos: 49 to 52;
the six-primer set consisting of SEQ ID Nos: 55 to 60;
the five-primer set consisting of SEQ ID Nos: 55 to 59;
the five-primer set consisting of SEQ ID Nos: 55 to 58 and SEQ ID No: 60; and
the four-primer set consisting of SEQ ID Nos: 55 to 58;
or primer sets among the above wherein at least one primer distinguishes by the addition of up to 20 consecutive nucleotides of the 5' and/or 3' flanking sequence in the region of the gene to be amplified;
primer sets specific for the ttrR gene of Salmonella spp. consist of:
the six-primer set consisting of SEQ ID Nos: 61 to 66;
the five-primer set consisting of SEQ ID Nos: 61 to 65;
the five-primer set consisting of SEQ ID Nos: 61 to 64 and SEQ ID No: 66;
the four-primer set consisting of SEQ ID Nos: 61 to 64;
the six-primer set consisting of SEQ ID Nos: 67 to 72;
the five-primer set consisting of SEQ ID Nos: 67 to 71 ;
the five-primer set consisting of SEQ ID Nos: 67 to 70 and SEQ ID No: 72; and
the four-primer set consisting of SEQ ID Nos: 67 to 70;
or primer sets among the above wherein at least one primer distinguishes by the addition of up to 20 consecutive nucleotides of the 5' and/or 3' flanking sequence in the region of the gene to be amplified;
primer sets specific for the lytA gene of S. pneumoniae consist of:
the six-primer set consisting of SEQ ID Nos: 73 to 78;
the five-primer set consisting of SEQ ID Nos: 73 to 77;
the five-primer set consisting of SEQ ID Nos: 73 to 76 and SEQ ID No: 78;
the four-primer set consisting of SEQ ID Nos: 73 to 76;
the six-primer set consisting of SEQ ID Nos: 79 to 84;
the five-primer set consisting of SEQ ID Nos: 79 to 83;
the five-primer set consisting of SEQ ID Nos: 79 to 82 and SEQ ID No: 84;
the four-primer set consisting of SEQ ID Nos: 79 to 82;
the six-primer set consisting of SEQ ID Nos: 85 to 90; the five-primer set consisting of SEQ ID Nos: 85 to 89;
the five-primer set consisting of SEQ ID Nos: 85 to 88 and SEQ ID No: 90; and
the four-primer set consisting of primers having the sequence of SEQ ID Nos: 85 to 88;
or primer sets among the above wherein at least one primer distinguishes by the addition of up to 20 consecutive nucleotides of the 5' and/or 3' flanking sequence in the region of the gene to be amplified;
primer sets specific for the ply gene of S. pneumoniae consist of:
the six-primer set consisting of SEQ ID Nos: 91 to 96;
the five-primer set consisting of SEQ ID Nos: 91 to 95;
the five-primer set consisting of SEQ ID Nos: 91 to 94 and SEQ ID No: 96;
the four-primer set consisting of SEQ ID Nos: 91 to 94;
the six-primer set consisting of SEQ ID Nos: 97 to 102;
the five-primer set consisting of SEQ ID Nos: 97 to 101 ;
the five-primer set consisting of SEQ ID Nos: 97 to 100 and SEQ ID No: 102;
the four-primer set consisting of SEQ ID Nos: 97 to 100;
the six-primer set consisting of SEQ ID Nos: 103 to 108;
the five-primer set consisting of SEQ ID Nos: 103 to 107;
the five-primer set consisting of SEQ ID Nos: 103 to 106 and SEQ ID No: 108; and
the four-primer set consisting of SEQ ID Nos: 103 to 106;
or primer sets among the above wherein at least one primer distinguishes by the addition of up to 20 consecutive nucleotides of the 5' and/or 3' flanking sequence in the region of the gene to be amplified;
primer sets specific for the femA gene of S. aureus consist of:
the six-primer set consisting of SEQ ID Nos: 109 to 114;
the five-primer set consisting of SEQ ID Nos: 109 to 113;
the five-primer set consisting of SEQ ID Nos: 109 to 112 and SEQ ID No: 114;
the four-primer set consisting of SEQ ID Nos: 109 to 112;
the six-primer set consisting of SEQ ID Nos: 115 to 120;
the five-primer set consisting of SEQ ID Nos: 115 to 119;
the five-primer set consisting of SEQ ID Nos: 115 to 118 and SEQ ID No: 120; and
the four-primer set consisting of SEQ ID Nos: 115 to 118; or primer sets among the above wherein at least one primer distinguishes by the addition of up to 20 consecutive nucleotides of the 5' and/or 3' flanking sequence in the region of the gene to be amplified;
primer sets specific for the arcC gene of S. aureus consist of:
the six-primer set consisting of SEQ ID Nos: 121 to 126;
the five-primer set consisting of SEQ ID Nos: 121 to 125;
the five-primer set consisting of SEQ ID Nos: 121 to 124 and SEQ ID No: 126;
the four-primer set consisting of SEQ ID Nos: 121 to 124;
the six-primer set consisting of SEQ ID Nos: 127 to 132;
the five-primer set consisting of SEQ ID Nos: 127 to 131 ;
the five-primer set consisting of SEQ ID Nos: 127 to 130 and SEQ ID No: 132; and
the four-primer set consisting of primers having the sequence of SEQ ID Nos: 127 to 130;
or primer sets among the above wherein at least one primer distinguishes by the addition of up to 20 consecutive nucleotides of the 5' and/or 3' flanking sequence in the region of the gene to be amplified;
primer sets specific for the nuc gene of S. aureus consist of:
the six-primer set consisting of SEQ ID Nos: 133 to 138;
the five-primer set consisting of SEQ ID Nos: 133 to 137;
the five-primer set consisting of SEQ ID Nos: 133 to 136 and SEQ ID No: 138;
the four-primer set consisting of SEQ ID Nos: 133 to 136;
the six-primer set consisting of SEQ ID Nos: 139 to 144;
the five-primer set consisting of SEQ ID Nos: 139 to 143;
the five-primer set consisting of SEQ ID Nos: 139 to 142 and SEQ ID No: 144;
the four-primer set consisting of SEQ ID Nos: 139 to 142;
the six-primer set consisting of SEQ ID Nos: 145 to 150;
the five-primer set consisting of SEQ ID Nos: 145 to 149;
the five-primer set consisting of SEQ ID Nos: 145 to 148 and SEQ ID No: 150;
the four-primer set consisting of SEQ ID Nos: 145 to 148;
the six-primer set consisting of SEQ ID Nos: 151 to 156;
the five-primer set consisting of SEQ ID Nos: 151 to 155;
the five-primer set consisting of SEQ ID Nos: 151 to 154 and SEQ ID No: 156; and
the four-primer set consisting of primers having the sequence of SEQ ID Nos: 151 to 154 or primer sets among the above wherein at least one primer distinguishes by the addition of up to 20 consecutive nucleotides of the 5' and/or 3' flanking sequence in the region of the gene to be amplified;
primer sets specific for the hpd gene of H. influenzae consist of:
the six-primer set consisting of SEQ ID Nos: 157 to 162;
the five-primer set consisting of SEQ ID Nos: 157 to 161 ;
the five-primer set consisting of SEQ ID Nos: 157 to 160 and SEQ ID No: 162;
the four-primer set consisting of SEQ ID Nos: 157 to 160;
the six-primer set consisting of SEQ ID Nos: 163 to 168;
the five-primer set consisting of SEQ ID Nos: 163 to 167;
the five-primer set consisting of SEQ ID Nos: 163 to 166 and SEQ ID No: 168;
the four-primer set consisting of SEQ ID Nos: 163 to 166;
the six-primer set consisting of SEQ ID Nos: 169 to 174;
the five-primer set consisting of SEQ ID Nos: 169 to 173;
the five-primer set consisting of SEQ ID Nos: 169 to 172 and SEQ ID No: 174;
the four-primer set consisting of SEQ ID Nos: 169 to 172;
or primer sets among the above wherein at least one primer distinguishes by the addition of up to 20 consecutive nucleotides of the 5' and/or 3' flanking sequence in the region of the gene to be amplified;
primer sets specific for the malB gene of E. coli consist of:
the six-primer set consisting of SEQ ID Nos: 175 to 180;
the five-primer set consisting of SEQ ID Nos: 175 to 179;
the five-primer set consisting of SEQ ID Nos: 175 to 178 and SEQ ID No: 180;
the four-primer set consisting of SEQ ID Nos: 175 to 178;
the six-primer set consisting of SEQ ID Nos: 181 to 186;
the five-primer set consisting of SEQ ID Nos: 181 to 185;
the five-primer set consisting of SEQ ID Nos: 181 to 184 and SEQ ID No: 186;
the four-primer set consisting of SEQ ID Nos: 181 to 184;
the six-primer set consisting of SEQ ID Nos: 187 to 192;
the five-primer set consisting of SEQ ID Nos: 187 to 191 ;
the five-primer set consisting of SEQ ID Nos: 187 to 190 and SEQ ID No: 192;
the four-primer set consisting of SEQ ID Nos: 187 to 190; or primer sets among the above wherein at least one primer distinguishes by the addition of up to 20 consecutive nucleotides of the 5' and/or 3' flanking sequence in the region of the gene to be amplified;
primer sets specific for the glyK gene of E. coli consist of:
the six-primer set consisting of SEQ ID Nos: 193 to 198;
the five-primer set consisting of SEQ ID Nos: 193 to 197;
the five-primer set consisting of SEQ ID Nos: 193 to 196 and SEQ ID No: 198;
the four-primer set consisting of SEQ ID Nos: 193 to 196;
the six-primer set consisting of SEQ ID Nos: 199 to 204;
the five-primer set consisting of SEQ ID Nos: 199 to 203;
the five-primer set consisting of SEQ ID Nos: 199 to 202 and SEQ ID No: 204;
the four-primer set consisting of SEQ ID Nos: 199 to 202;
the six-primer set consisting of SEQ ID Nos: 205 to 210;
the five-primer set consisting of SEQ ID Nos: 205 to 209;
the five-primer set consisting of SEQ ID Nos: 205 to 208 and SEQ ID No: 210;
the four-primer set consisting of SEQ ID Nos: 205 to 208;
or primer sets among the above wherein at least one primer distinguishes by the addition of up to 20 consecutive nucleotides of the 5' and/or 3' flanking sequence in the region of the gene to be amplified;
and primer sets specific for the yiaO gene of E. coli consist of:
the six-primer set consisting of SEQ ID Nos: 211 to 216;
the five-primer set consisting of SEQ ID Nos: 211 to 215;
the five-primer set consisting of SEQ ID Nos: 211 to 214 and SEQ ID No: 216;
the four-primer set consisting of SEQ ID Nos: 211 to 214;
the six-primer set consisting of SEQ ID Nos: 217 to 222;
the five-primer set consisting of SEQ ID Nos: 217 to 221 ;
the five-primer set consisting of SEQ ID Nos: 217 to 220 and SEQ ID No: 222;
the four-primer set consisting of SEQ ID Nos: 217 to 220;
the six-primer set consisting of SEQ ID Nos: 223 to 228;
the five-primer set consisting of SEQ ID Nos: 223 to 227;
the five-primer set consisting of SEQ ID Nos: 223 to 226 and SEQ ID No: 228;
the four-primer set consisting of SEQ ID Nos: 223 to 226; or primer sets among the above wherein at least one primer distinguishes by the addition of up to 20 consecutive nucleotides of the 5' and/or 3' flanking sequence in the region of the gene to be amplified.
2. A combination of two, three, four or five or more sets of primers of claim 1, wherein the sets of primers are six-primer sets.
3. A combination of at least three sets of primers of any of the preceding claims, wherein at least one primer set is specific for Samonella spp., one primer set is specific for Staphylococcus Aureus and one primer set is specific for Streptococcus pneumoniae, in particular wherein the primer set specific for Streptococcus pneumoniae is specific for the lytA gene of S. pneumoniae.
4. A combination of at least five sets of primers of any of the preceding claims, wherein at least one primer set is specific for Samonella spp., one primer set is specific for Staphylococcus Aureus, one primer set is specific for Streptococcus pneumoniae, one primer set is specific for H. influenzae and one primer set is specific for E. coli, in particular wherein the primer set specific for Streptococcus pneumoniae is specific for the lytA gene of S. pneumoniae.
5. A combination of at least three sets of primers of any of the preceding claims, wherein at least one set is specific for the invA gene of S. enterica, at least one set is specific for the arcC gene or the femA gene of S. aureus and at least one set is specific for the lytA gene of S. pneumoniae, in particular a combination comprising or consisting of the following sets of primers: the set consisting of the primers with the sequences of SEQ ID Nos: 1 to 6, the set consisting of the primers with the sequences of SEQ ID Nos: 121 to 126, and the set consisting of the primers with the sequences of SEQ ID Nos: 73 to 78.
6. A combination of at least five sets of primers of any of the preceding claims, wherein at least one set is specific for the invA gene of S. enterica, at least one set is specific for the arcC gene or the femA gene of S. aureus, at least one set is specific for the lytA gene of S. pneumoniae, at least one set is specific of the hpd gene of H. influenzae and at least one set of primers is specific of the malB gene of E. coli, in particular a combination comprising or consisting of the following sets of primers: the set consisting of the primers with the sequences of SEQ ID Nos: 1 to 6, the set consisting of the primers with the sequences of SEQ ID Nos: 121 to 126, the set consisting of the primers with the sequences of SEQ ID Nos: 73 to 78, the set comprising the primers with the sequences of SEQ ID Nos: 163 to 168 and the set comprising the primers with the sequences of SEQ ID Nos: 187 to 192.
7. A kit comprising or consisting of a microfluidics device, said device comprising: at least one sample loading inlet;
optionally, inlets and outlets for washing of the sample, in particular for performing extraction of nucleic acids, in particular wherein such inlets / outlets are compatible with automated liquid handlers;
optionally, a network of channels and compartments suitable for splitting of the solution comprising the sample nucleic acid and use of said sample in several distinct assays;
optionally, reagents required for an amplification assay, in particular for amplification by LAMP; a combination of primers of any of the preceding claims, in particular comprising at least two, and more preferably at least three, six-primer sets as provided herein, in distinct compartments ('assay compartments');
optionally at least a visualization 'window' for readout of the signal by an operator or a detection device such as a camera, in particular one window per assay compartment.
8. A kit comprising the combinations of primers of any of the preceding claims, and optionally other components, suitable for amplification of nucleic acids of at least two species of bacteria selected among Salmonella spp., Staphylococcus aureus, Streptococcus pneumoniae, Haemophilus influenzae and Escherichia coli, in particular selected among Salmonella spp., Staphylococcus aureus and Streptococcus pneumoniae.
9. Use of a combination of primers or kit of any of the preceding claims for the detection, in particular the simultaneous detection, of nucleic acids of at least two species of bacteria selected among
Salmonella spp., Staphylococcus aureus, Streptococcus pneumoniae, Haemophilus influenzae and Escherichia coli, in particular selected among Salmonella spp., Staphylococcus aureus and Streptococcus pneumoniae, in particular by a LAMP assay.
10. Use of a combination of primers or kit of any of the preceding claims for the in vitro detection, in particular simultaneous detection, of a bacterial infection of a mammal by any one or more of at least two species of bacteria selected among Salmonella spp., Staphylococcus aureus, Streptococcus pneumoniae, Haemophilus influenzae and Escherichia coli, in particular selected among Salmonella spp. , Staphylococcus aureus and Streptococcus pneumoniae, said detection being carried out using a sample obtained from said mammal, in particular wherein said mammal is a human individual.
11. Use of a combination of primers or kit of any of the preceding claims for the in vitro detection, in particular simultaneous detection, of a bacterial infection of a mammal by any one or more of the three species of bacteria Salmonella spp. , Staphylococcus aureus and Streptococcus pneumoniae, preferably by any one or more of the five species of bacteria Salmonella spp., Staphylococcus aureus, Streptococcus pneumoniae, Haemophilus influenzae and Escherichia coli, said detection being carried out using a sample obtained from said mammal, in particular wherein said mammal is a human individual.
12. A method for the in vitro detection in a sample of nucleic acids from one or more of at least two species of bacteria selected among Salmonella spp., Staphylococcus aureus, Streptococcus pneumoniae, Haemophilus influenzae and Escherichia coli, in particular selected among Salmonella spp. , Staphylococcus aureus and Streptococcus pneumoniae, said method comprising the use of at least one set of primers for each of said at least two species of bacteria, wherein said primers are selected from
- the group consisting of primer sets specific for the invA gene of Salmonella spp., primer sets specific for the phoP gene of Salmonella spp. , primer sets specific for the prgK gene of Salmonella spp. , primer sets specific for the ttrR gene of Salmonella spp. , primer sets specific for the lytA gene of S. pneumoniae, primer sets specific for the ply gene of S. pneumoniae, primer sets specific for the femA gene of S. aureus, primer sets specific for the arcC gene of S. aureus, and primer sets specific for the nuc gene of S. aureus, or
- the group consisting of primer sets specific for the invA gene of Salmonella spp., primer sets specific for the phoP gene of Salmonella spp. , primer sets specific for the prgK gene of Salmonella spp. , primer sets specific for the ttrR gene of Salmonella spp. , primer sets specific for the lytA gene of S. pneumoniae, primer sets specific for the ply gene of S. pneumoniae, primer sets specific for the femA gene of S. aureus, primer sets specific for the arcC gene of S. aureus, primer sets specific for the nuc gene of S. aureus, primer sets specific for the hpd gene of H. influenzae, primer sets specific for the malB gene of E. coli, primer sets specific for the glyK gene of E. coli and primer sets specific for the yiaO gene of E. coli, wherein
primer sets specific for the invA gene of Salmonella spp. consist of:
the six-primer set consisting of SEQ ID Nos: 1 to 6;
the five-primer set consisting of SEQ ID Nos: 1 to 5;
the five-primer set consisting of SEQ ID Nos: 1 to 4 and SEQ ID No: 6;
the four-primer set consisting of SEQ ID Nos: 1 to 4;
the six-primer set consisting of SEQ ID Nos: 7 to 12; the five-primer set consisting of SEQ ID Nos: 7 to 11 ;
the five-primer set consisting of SEQ ID Nos: 7 to 10 and SEQ ID No: 12;
the four-primer set consisting of SEQ ID Nos: 7 to 10;
the six-primer set consisting of SEQ ID Nos: 13 to 18;
the five-primer set consisting of SEQ ID Nos: 13 to 17;
the five-primer set consisting of SEQ ID Nos: 13 to 16 and SEQ ID No: 18; and
the four-primer set consisting of SEQ ID Nos: 13 to 16;
or primer sets among the above wherein at least one primer distinguishes by the addition of up to 20 consecutive nucleotides of the 5' and/or 3' flanking sequence in the region of the gene to be amplified;
primer sets specific for the phoP gene of Salmonella spp. consist of:
the six-primer set consisting of SEQ ID Nos: 19 to 24;
the five-primer set consisting of SEQ ID Nos: 19 to 23;
the five-primer set consisting of SEQ ID Nos: 19 to 22 and SEQ ID No: 24;
the four-primer set consisting of SEQ ID Nos: 19 to 22;
the six-primer set consisting of SEQ ID Nos: 25 to 30;
the five-primer set consisting of SEQ ID Nos: 25 to 29;
the five-primer set consisting of SEQ ID Nos: 25 to 28 and SEQ ID No: 30;
the four-primer set consisting of SEQ ID Nos: 25 to 28;
the six-primer set consisting of SEQ ID Nos: 31 to 36;
the five-primer set consisting of SEQ ID Nos: 31 to 35;
the five-primer set consisting of SEQ ID Nos: 31 to 34 and SEQ ID No: 36; and
the four-primer set consisting of SEQ ID Nos: 31 to 34;
or primer sets among the above wherein at least one primer distinguishes by the addition of up to 20 consecutive nucleotides of the 5' and/or 3' flanking sequence in the region of the gene to be amplified;
primer sets specific for the prgK gene of Salmonella spp. consist of:
the six-primer set consisting of SEQ ID Nos: 37 to 42;
the five-primer set consisting of SEQ ID Nos: 37 to 41 ;
the five-primer set consisting of SEQ ID Nos: 37 to 40 and SEQ ID No: 42;
the four-primer set consisting of SEQ ID Nos: 37 to 40;
the six-primer set consisting of SEQ ID Nos: 43 to 48; the five-primer set consisting of SEQ ID Nos: 43 to 47;
the five-primer set consisting of SEQ ID Nos: 43 to 46 and SEQ ID No: 48;
the four-primer set consisting of SEQ ID Nos: 43 to 46;
the six-primer set consisting of SEQ ID Nos: 49 to 54;
the five-primer set consisting of SEQ ID Nos: 49 to 53;
the five-primer set consisting of SEQ ID Nos: 49 to 52 and SEQ ID No: 54;
the four-primer set consisting of SEQ ID Nos: 49 to 52;
the six-primer set consisting of SEQ ID Nos: 55 to 60;
the five-primer set consisting of SEQ ID Nos: 55 to 59;
the five-primer set consisting of SEQ ID Nos: 55 to 58 and SEQ ID No: 60; and
the four-primer set consisting of SEQ ID Nos: 55 to 58;
or primer sets among the above wherein at least one primer distinguishes by the addition of up to 20 consecutive nucleotides of the 5' and/or 3' flanking sequence in the region of the gene to be amplified;
primer sets specific for the ttrR gene of Salmonella spp. consist of:
the six-primer set consisting of SEQ ID Nos: 61 to 66;
the five-primer set consisting of SEQ ID Nos: 61 to 65;
the five-primer set consisting of SEQ ID Nos: 61 to 64 and SEQ ID No: 66;
the four-primer set consisting of SEQ ID Nos: 61 to 64;
the six-primer set consisting of SEQ ID Nos: 67 to 72;
the five-primer set consisting of SEQ ID Nos: 67 to 71 ;
the five-primer set consisting of SEQ ID Nos: 67 to 70 and SEQ ID No: 72; and
the four-primer set consisting of SEQ ID Nos: 67 to 70;
or primer sets among the above wherein at least one primer distinguishes by the addition of up to 20 consecutive nucleotides of the 5' and/or 3' flanking sequence in the region of the gene to be amplified;
primer sets specific for the lytA gene of S. pneumoniae consist of:
the six-primer set consisting of SEQ ID Nos: 73 to 78;
the five-primer set consisting of SEQ ID Nos: 73 to 77;
the five-primer set consisting of SEQ ID Nos: 73 to 76 and SEQ ID No: 78;
the four-primer set consisting of SEQ ID Nos: 73 to 76;
the six-primer set consisting of SEQ ID Nos: 79 to 84; the five-primer set consisting of SEQ ID Nos: 79 to 83;
the five-primer set consisting of SEQ ID Nos: 79 to 82 and SEQ ID No: 84;
the four-primer set consisting of SEQ ID Nos: 79 to 82;
the six-primer set consisting of SEQ ID Nos: 85 to 90;
the five-primer set consisting of SEQ ID Nos: 85 to 89;
the five-primer set consisting of SEQ ID Nos: 85 to 88 and SEQ ID No: 90; and
the four-primer set consisting of SEQ ID Nos: 85 to 88;
or primer sets among the above wherein at least one primer distinguishes by the addition of up to 20 consecutive nucleotides of the 5' and/or 3' flanking sequence in the region of the gene to be amplified;
primer sets specific for the ply gene of S. pneumoniae consist of:
the six-primer set consisting of SEQ ID Nos: 91 to 96;
the five-primer set consisting of SEQ ID Nos: 91 to 95;
the five-primer set consisting of SEQ ID Nos: 91 to 94 and SEQ ID No: 96;
the four-primer set consisting of SEQ ID Nos: 91 to 94;
the six-primer set consisting of SEQ ID Nos: 97 to 102;
the five-primer set consisting of SEQ ID Nos: 97 to 101 ;
the five-primer set consisting of SEQ ID Nos: 97 to 100 and SEQ ID No: 102;
the four-primer set consisting of SEQ ID Nos: 97 to 100;
the six-primer set consisting of SEQ ID Nos: 103 to 108;
the five-primer set consisting of SEQ ID Nos: 103 to 107;
the five-primer set consisting of SEQ ID Nos: 103 to 106 and SEQ ID No: 108; and
the four-primer set consisting of SEQ ID Nos: 103 to 106;
or primer sets among the above wherein at least one primer distinguishes by the addition of up to 20 consecutive nucleotides of the 5' and/or 3' flanking sequence in the region of the gene to be amplified;
primer sets specific for the femA gene of S. aureus consist of:
the six-primer set consisting of SEQ ID Nos: 109 to 114;
the five-primer set consisting of SEQ ID Nos: 109 to 113;
the five-primer set consisting of SEQ ID Nos: 109 to 112 and SEQ ID No: 114;
the four-primer set consisting of SEQ ID Nos: 109 to 112;
the six-primer set consisting of SEQ ID Nos: 115 to 120; the five-primer set consisting of SEQ ID Nos: 115 to 119;
the five-primer set consisting of SEQ ID Nos: 115 to 118 and SEQ ID No: 120; and
the four-primer set consisting of SEQ ID Nos: 115 to 118;
or primer sets among the above wherein at least one primer distinguishes by the addition of up to 20 consecutive nucleotides of the 5' and/or 3' flanking sequence in the region of the gene to be amplified;
primer sets specific for the arcC gene of S. aureus consist of:
the six-primer set consisting of SEQ ID Nos: 121 to 126;
the five-primer set consisting of SEQ ID Nos: 121 to 125;
the five-primer set consisting of SEQ ID Nos: 121 to 124 and SEQ ID No: 126;
the four-primer set consisting of SEQ ID Nos: 121 to 124;
the six-primer set consisting of SEQ ID Nos: 127 to 132;
the five-primer set consisting of SEQ ID Nos: 127 to 131 ;
the five-primer set consisting of SEQ ID Nos: 127 to 130 and SEQ ID No: 132; and
the four-primer set consisting of SEQ ID Nos: 127 to 130;
or primer sets among the above wherein at least one primer distinguishes by the addition of up to 20 consecutive nucleotides of the 5' and/or 3' flanking sequence in the region of the gene to be amplified;
primer sets specific for the nuc gene of S. aureus consist of:
the six-primer set consisting of SEQ ID Nos: 133 to 138;
the five-primer set consisting of SEQ ID Nos: 133 to 137;
the five-primer set consisting of SEQ ID Nos: 133 to 136 and SEQ ID No: 138;
the four-primer set consisting of SEQ ID Nos: 133 to 136;
the six-primer set consisting of SEQ ID Nos: 139 to 144;
the five-primer set consisting of SEQ ID Nos: 139 to 143;
the five-primer set consisting of SEQ ID Nos: 139 to 142 and SEQ ID No: 144;
the four-primer set consisting of SEQ ID Nos: 139 to 142;
the six-primer set consisting of SEQ ID Nos: 145 to 150;
the five-primer set consisting of SEQ ID Nos: 145 to 149;
the five-primer set consisting of SEQ ID Nos: 145 to 148 and SEQ ID No: 150;
the four-primer set consisting of SEQ ID Nos: 145 to 148;
the six-primer set consisting of SEQ ID Nos: 151 to 156; the five-primer set consisting of SEQ ID Nos: 151 to 155;
the five-primer set consisting of SEQ ID Nos: 151 to 154 and SEQ ID No: 156; and
the four-primer set consisting of SEQ ID Nos: 151 to 154,
or primer sets among the above wherein at least one primer distinguishes by the addition of up to 20 consecutive nucleotides of the 5' and/or 3' flanking sequence in the region of the gene to be amplified, primer sets specific for the hpd gene of H. influenzae consist of:
the six-primer set consisting of SEQ ID Nos: 157 to 162;
the five-primer set consisting of SEQ ID Nos: 157 to 161 ;
the five-primer set consisting of SEQ ID Nos: 157 to 160 and SEQ ID No: 162;
the four-primer set consisting of SEQ ID Nos: 157 to 160;
the six-primer set consisting of SEQ ID Nos: 163 to 168;
the five-primer set consisting of SEQ ID Nos: 163 to 167;
the five-primer set consisting of SEQ ID Nos: 163 to 166 and SEQ ID No: 168;
the four-primer set consisting of SEQ ID Nos: 163 to 166;
the six-primer set consisting of SEQ ID Nos: 169 to 174;
the five-primer set consisting of SEQ ID Nos: 169 to 173;
the five-primer set consisting of SEQ ID Nos: 169 to 172 and SEQ ID No: 174;
the four-primer set consisting of SEQ ID Nos: 169 to 172;
or primer sets among the above wherein at least one primer distinguishes by the addition of up to 20 consecutive nucleotides of the 5' and/or 3' flanking sequence in the region of the gene to be amplified;
primer sets specific for the malB gene of E. coli consist of:
the six-primer set consisting of SEQ ID Nos: 175 to 180;
the five-primer set consisting of SEQ ID Nos: 175 to 179;
the five-primer set consisting of SEQ ID Nos: 175 to 178 and SEQ ID No: 180;
the four-primer set consisting of SEQ ID Nos: 175 to 178;
the six-primer set consisting of SEQ ID Nos: 181 to 186;
the five-primer set consisting of SEQ ID Nos: 181 to 185;
the five-primer set consisting of SEQ ID Nos: 181 to 184 and SEQ ID No: 186;
the four-primer set consisting of SEQ ID Nos: 181 to 184;
the six-primer set consisting of SEQ ID Nos: 187 to 192;
the five-primer set consisting of SEQ ID Nos: 187 to 191 ; the five-primer set consisting of SEQ ID Nos: 187 to 190 and SEQ ID No: 192; the four-primer set consisting of SEQ ID Nos: 187 to 190;
or primer sets among the above wherein at least one primer distinguishes by the addition of up to 20 consecutive nucleotides of the 5' and/or 3' flanking sequence in the region of the gene to be amplified;
primer sets specific for the glyK gene of E. coli consist of:
the six-primer set consisting of SEQ ID Nos: 193 to 198;
the five-primer set consisting of SEQ ID Nos: 193 to 197;
the five-primer set consisting of SEQ ID Nos: 193 to 196 and SEQ ID No: 198;
the four-primer set consisting of SEQ ID Nos: 193 to 196;
the six-primer set consisting of SEQ ID Nos: 199 to 204;
the five-primer set consisting of SEQ ID Nos: 199 to 203;
the five-primer set consisting of SEQ ID Nos: 199 to 202 and SEQ ID No: 204;
the four-primer set consisting of SEQ ID Nos: 199 to 202;
the six-primer set consisting of SEQ ID Nos: 205 to 210;
the five-primer set consisting of SEQ ID Nos: 205 to 209;
the five-primer set consisting of SEQ ID Nos: 205 to 208 and SEQ ID No: 210;
the four-primer set consisting of SEQ ID Nos: 205 to 208;
or primer sets among the above wherein at least one primer distinguishes by the addition of up to 20 consecutive nucleotides of the 5' and/or 3' flanking sequence in the region of the gene to be amplified;
and primer sets specific for the yiaO gene of E. coli consist of:
the six-primer set consisting of SEQ ID Nos: 211 to 216;
the five-primer set consisting of SEQ ID Nos: 211 to 215;
the five-primer set consisting of SEQ ID Nos: 211 to 214 and SEQ ID No: 216;
the four-primer set consisting of SEQ ID Nos: 211 to 214;
the six-primer set consisting of SEQ ID Nos: 217 to 222;
the five-primer set consisting of SEQ ID Nos: 217 to 221 ;
the five-primer set consisting of SEQ ID Nos: 217 to 220 and SEQ ID No: 222;
the four-primer set consisting of SEQ ID Nos: 217 to 220;
the six-primer set consisting of SEQ ID Nos: 223 to 228;
the five-primer set consisting of SEQ ID Nos: 223 to 227; the five-primer set consisting of SEQ ID Nos: 223 to 226 and SEQ ID No: 228; the four-primer set consisting of SEQ ID Nos: 223 to 226;
or primer sets among the above wherein at least one primer distinguishes by the addition of up to 20 consecutive nucleotides of the 5' and/or 3' flanking sequence in the region of the gene to be amplified, in particular such a method comprising a step of isothermal amplification of a gene region from said bacteria using said primers.
13. A method of claim 12, wherein the sets of primers are six-primer sets.
14. A method of claim 12 or claim 13, for the in vitro simultaneous detection of nucleic acids of bacteria from one or more of the three bacterial specices Salmonella spp., Staphylococcus aureus and Streptococcus pneumoniae, in particular from one or more of the five bacterial species Salmonella spp., Staphylococcus aureus, Streptococcus pneumoniae, Haemophilus influenzae and Escherichia coli, said method comprising a step of amplification of nucleic acid using at least three sets of primers, in particular wherein the amplification is isothermal and in particular is performed by a LAMP assay, in particular wherein the amplification is performed for each set of primers in a distinct container on a subsample of the sample , in otherwise identical conditions for all sets of primers.
15. A method of any one of claims 12 to 14, wherein the primer sets comprise at least the following: the set consisting of the primers with the sequences of SEQ ID Nos: 1 to 6, the set consisting of the primers with the sequences of SEQ ID Nos: 121 to 126, the set consisting of the primers with the sequences of SEQ ID Nos: 73 to 78 and optionally, the set comprising the primers with the sequences of SEQ ID Nos: 163 to 168 and the set comprising the primers with the sequences of SEQ ID Nos: 187 to 192.
16. A method of any one of claims 12 to 15, for the in vitro simultaneous detection of bacterial infection of a subject, in particular a human subject, by one or more of at least three bacterial species consisting of or comprising Salmonella spp., Staphylococcus aureus and Streptococcus pneumoniae, in particular by one or more of at least five bacterial species consisting of or comprising Salmonella spp., Staphylococcus aureus, Streptococcus pneumoniae, Haemophilus influenzae and Escherichia coli, in a whole blood sample obtained from said subject, comprising a step of amplification, in particular of isothermal amplification, of a gene region from said bacteria using said primers, said method optionally comprising one or more of the following steps: a step of diluting or lysing the whole blood sample;
a step of concentrating or extracting the total nucleic acids from the sample; and/or
a step of distributing the sample in subsamples in distinct containers; wherein each of the above steps, when performed, is performed before the step of amplification of the nucleic acids; and/or wherein said method comprises a step of visualizing the color or fluorescence of the amplification solution, wherein a specific color or color change, or a change in fluorescence intensity, is indicative of an amplification; or
comprises, during the step of amplification of the nucleic acids, monitoring a signal correlating with the amplification, in particular monitoring an increase in fluorescence due to incorporation of a DNA intercalating agent; wherein an amplification is detected through a significant change in said signal; and optionally wherein the method further comprises a step of concluding to the presence of bacterial nucleic acids when an amplification is observed and optionally concluding therefrom that the subject has a bacterial infection. 7. A method of any of claims 12 to 16, wherein the sample is a blood sample, in particular a whole blood sample, and wherein the method does not comprise any step of centrifugating the sample and/or does not comprise any step of heating the sample above 80 °C.
PCT/EP2016/074999 2015-10-19 2016-10-18 Detection of microbial pathogens related to bacterial infections through amplification especially by rt-lamp WO2017067942A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP15306676 2015-10-19
EP15306676.6 2015-10-19

Publications (1)

Publication Number Publication Date
WO2017067942A1 true WO2017067942A1 (en) 2017-04-27

Family

ID=54365174

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2016/074999 WO2017067942A1 (en) 2015-10-19 2016-10-18 Detection of microbial pathogens related to bacterial infections through amplification especially by rt-lamp

Country Status (1)

Country Link
WO (1) WO2017067942A1 (en)

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107022638A (en) * 2017-06-05 2017-08-08 温和心 The LAMP primer group of quick detection salmonella and its application
CN107058599A (en) * 2017-06-22 2017-08-18 上海速创诊断产品有限公司 A kind of Primer composition, kit and its dual signal channel detection methods for detecting staphylococcus aureus
CN107904161A (en) * 2017-12-15 2018-04-13 上海交通大学医学院附属仁济医院 It is a kind of to visualize micro-fluidic chip of detection pathogen nucleic acid and preparation method thereof and detection method immediately
CN108570511A (en) * 2018-05-30 2018-09-25 华南理工大学 A kind of LAMP detection primer group of staphylococcus aureus, its LAMP detection kit and its detection method
KR101938557B1 (en) 2017-06-16 2019-01-15 대한민국 Primers for LAMP based detection of skeletal disease causing pathogen in chicken and its use
CN110079607A (en) * 2019-04-04 2019-08-02 陕西师范大学 A kind of primer sets, the method and application for detecting blood sample kind
CN110229918A (en) * 2019-06-18 2019-09-13 暨南大学 A kind of method and its kit of quick detection Staphylococcus aureus in food
CN110229915A (en) * 2019-05-22 2019-09-13 北京勤邦生物技术有限公司 A kind of staphylococcus aureus detection of nucleic acids primer sets and its detection method
CN111850152A (en) * 2020-08-24 2020-10-30 上海市东方医院（同济大学附属东方医院） Kit for detecting haemophilus influenzae through loop-mediated isothermal amplification and using method
CN112063731A (en) * 2020-09-15 2020-12-11 南开大学 LAMP detection method for typing streptococcus pneumoniae 19A serotype capsular polysaccharide antigen molecules
CN114717341A (en) * 2022-03-11 2022-07-08 丽水市质量检验检测研究院 Salmonella detection kit based on ttr gene and non-diagnostic detection method
WO2023279061A1 (en) * 2021-07-02 2023-01-05 Rt Microfluidics, Inc. Pathogen testing device
WO2023027604A1 (en) * 2021-08-25 2023-03-02 Genomtec S.A. Set of primers for amplifying the nucleotide sequence of the reca gene of salmonella enterica sp. bacteria, method for detecting salmonella enterica sp. bacteria, method for detecting an infection caused by salmonella enterica sp. bacteria, and kit for detecting an infection caused by salmonella enterica sp. bacteria
CN115992270A (en) * 2022-08-30 2023-04-21 四川省亚中基因科技有限责任公司 Primer probe composition, reagent and kit for detecting respiratory bacterial pathogens

Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2003199572A (en) * 2001-12-28 2003-07-15 Eiken Chem Co Ltd Primer for detection of salmonella and detection method using the same
US20080305472A1 (en) * 2004-10-19 2008-12-11 Mitsuko Seki Method of detecting influenza bacillus, primer set for detection of influenza bacillus and kit for detection of influenza bacillus
CN102206703A (en) * 2011-01-23 2011-10-05 浙江省质量技术监督检测研究院 Multiple rapid detection method for three food borne pathogenic bacteria, and detection primer set and kit thereof
CN102329882A (en) * 2011-10-15 2012-01-25 浙江省质量技术监督检测研究院 Multiple rapid detection method, detection primer group and kit for three food-borne pathogenic bacteria
WO2012103353A2 (en) * 2011-01-26 2012-08-02 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Selective detection of haemophilus influenzae
CN102864226A (en) * 2012-09-21 2013-01-09 武汉真福医药科技发展有限公司 LAMP (loop-mediated isothermal amplification) kit for rapid detection of staphylococcus aureus
CN104164508A (en) * 2014-08-18 2014-11-26 广州医科大学附属第三医院 LAMP (Loop-Mediated Isothermal Amplification) primer group, kit and method for detecting streptococcus pneumoniae
CN103361429B (en) * 2013-06-28 2015-06-03 厦门银祥集团有限公司 LAMP detection primer, kit and detection method for staphylococcus aureus containing internal standard
CN104818333A (en) * 2015-05-08 2015-08-05 博奥生物集团有限公司 System of detecting pathogenic microorganisms related to respiratory tract infection and LAMP primer specially used therefor

Patent Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2003199572A (en) * 2001-12-28 2003-07-15 Eiken Chem Co Ltd Primer for detection of salmonella and detection method using the same
US20080305472A1 (en) * 2004-10-19 2008-12-11 Mitsuko Seki Method of detecting influenza bacillus, primer set for detection of influenza bacillus and kit for detection of influenza bacillus
CN102206703A (en) * 2011-01-23 2011-10-05 浙江省质量技术监督检测研究院 Multiple rapid detection method for three food borne pathogenic bacteria, and detection primer set and kit thereof
WO2012103353A2 (en) * 2011-01-26 2012-08-02 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Selective detection of haemophilus influenzae
CN102329882A (en) * 2011-10-15 2012-01-25 浙江省质量技术监督检测研究院 Multiple rapid detection method, detection primer group and kit for three food-borne pathogenic bacteria
CN102864226A (en) * 2012-09-21 2013-01-09 武汉真福医药科技发展有限公司 LAMP (loop-mediated isothermal amplification) kit for rapid detection of staphylococcus aureus
CN103361429B (en) * 2013-06-28 2015-06-03 厦门银祥集团有限公司 LAMP detection primer, kit and detection method for staphylococcus aureus containing internal standard
CN104164508A (en) * 2014-08-18 2014-11-26 广州医科大学附属第三医院 LAMP (Loop-Mediated Isothermal Amplification) primer group, kit and method for detecting streptococcus pneumoniae
CN104818333A (en) * 2015-05-08 2015-08-05 博奥生物集团有限公司 System of detecting pathogenic microorganisms related to respiratory tract infection and LAMP primer specially used therefor

Non-Patent Citations (13)

* Cited by examiner, † Cited by third party
Title
BAHWERE, P; J LEVY; P HENNART; P DONNEN; W LOMOYO; M DRAMAIX-WILMET; J P BUTZLER; P DE MOL.: "Community-Acquired Bacteremia among Hospitalized Children in Rural Central Africa", INTERNATIONAL JOURNAL OF INFECTIOUS DISEASES: IJID: OFFICIAL PUBLICATION OF THE INTERNATIONAL SOCIETY FOR INFECTIOUS DISEASES, vol. 5, no. 4, 2001, pages 180 - 88
BISCEGLIA, E.: "Methodes physiques d'extraction de micro-organismes a partir d'echantillons sanguins a l'aide de microsystemes", PHD THESIS, 2013
BOOM R; SOL CJ; SALIMANS MM; JANSEN CL; WERTHEIM-VAN DILLEN PM; VAN DER NOORDAA J.: "Rapid and simple method for purification of nucleic acids", J CLIN MICROBIOL., vol. 28, no. 3, 1990, pages 495 - 503
CONNELLY, J. T.; ROLLAND, J. P.; WHITESIDES, G. M.: "Paper Machine'' for Molecular Diagnostics", ANAL. CHEM., vol. 87, 2015, pages 7595 - 601
GORDON, MELITA A; ANSTEAD M K KANKWATIRA; GERSHOM MWAFULIRWA; AMANDA L WALSH; MARK J HOPKINS; CHRISTOPHER M PARRY; E BRIAN FARAGHE: "Invasive Non-Typhoid Salmonellae Establish Systemic Intracellular Infection in HIV-Infected Adults: An Emerging Disease Pathogenesis", CLINICAL INFECTIOUS DISEASES: AN OFFICIAL PUBLICATION OF THE INFECTIOUS DISEASES SOCIETY OF AMERICA, vol. 50, no. 7, 2010, pages 953 - 62
GRADEL, K O; M SOGAARD; C DETHLEFSEN; H NIELSEN; H C SCHONHEYDER: "Magnitude of Bacteraemia Is a Predictor of Mortality during 1 Year of Follow-Up.", EPIDEMIOLOGY AND INFECTION, vol. 137, no. 1, 2009, pages 94 - 101
J. HILL ET AL: "Loop-Mediated Isothermal Amplification Assay for Rapid Detection of Common Strains of Escherichia coli", JOURNAL OF CLINICAL MICROBIOLOGY, vol. 46, no. 8, 1 August 2008 (2008-08-01), US, pages 2800 - 2804, XP055330791, ISSN: 0095-1137, DOI: 10.1128/JCM.00152-08 *
LIU, LI; HOPE L JOHNSON; SIMON COUSENS; JAMIE PERIN; SUSANA SCOTT; JOY E LAWN; IGOR RUDAN ET AL.: "Global, regional, and national causes of child mortality: an updated systematic analysis for 2010 with time trends since 2000", THE LANCET, vol. 379, no. 9832, 2010, pages 2151 - 61
MULHOLLAND, E. KIM; RICHARD A. ADEGBOLA: "Bacterial Infections — A Major Cause of Death among Children in Africa", NEW ENGLAND JOURNAL OF MEDICINE, vol. 352, no. 1, 2005, pages 75 - 77
ONIPEDE, ANTHONY O; ADEDEJI A ONAYADE; JEROME B E ELUSIYAN; PERPETUA O OBIAJUNWA; EZRA O O OGUNDARE; OLARINDE O OLANIRAN; LATEEF A: "Invasive Bacteria Isolates from Children with Severe Infections in a Nigerian Hospital", JOURNAL OF INFECTION IN DEVELOPING COUNTRIES, vol. 3, no. 6, 2009, pages 429 - 36
REDDY, ELIZABETH A; ANDREA V SHAW; JOHN A CRUMP: "Community-acquired bloodstream infections in Africa: a systematic review and meta-analysis", THE LANCET INFECTIOUS DISEASES, vol. 10, no. 6, 2010, pages 417 - 32
TANNER, NATHAN A.; YINHUA ZHANG; THOMAS C. EVANS: "Visual Detection of Isothermal Nucleic Acid Amplification Using pH-Sensitive Dyes", BIOTECHNIQUES, vol. 58, no. 2, 2015, pages 59 - 68
XUZHI ZHANG ET AL: "Recording the Reaction Process of Loop-Mediated Isothermal Amplification (LAMP) by Monitoring the Voltammetric Response of 2'-Deoxyguanosine 5'-Triphosphate", ELECTROANALYSIS., vol. 23, no. 10, 27 September 2011 (2011-09-27), US, pages 2438 - 2445, XP055331091, ISSN: 1040-0397, DOI: 10.1002/elan.201100279 *

Cited By (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107022638A (en) * 2017-06-05 2017-08-08 温和心 The LAMP primer group of quick detection salmonella and its application
KR101938557B1 (en) 2017-06-16 2019-01-15 대한민국 Primers for LAMP based detection of skeletal disease causing pathogen in chicken and its use
CN107058599A (en) * 2017-06-22 2017-08-18 上海速创诊断产品有限公司 A kind of Primer composition, kit and its dual signal channel detection methods for detecting staphylococcus aureus
CN107904161A (en) * 2017-12-15 2018-04-13 上海交通大学医学院附属仁济医院 It is a kind of to visualize micro-fluidic chip of detection pathogen nucleic acid and preparation method thereof and detection method immediately
CN107904161B (en) * 2017-12-15 2024-03-08 上海交通大学医学院附属仁济医院 Micro-fluidic chip for visual immediate detection of pathogen nucleic acid and preparation method and detection method thereof
CN108570511A (en) * 2018-05-30 2018-09-25 华南理工大学 A kind of LAMP detection primer group of staphylococcus aureus, its LAMP detection kit and its detection method
CN110079607B (en) * 2019-04-04 2022-08-02 陕西师范大学 Primer group, method for detecting blood sample species and application
CN110079607A (en) * 2019-04-04 2019-08-02 陕西师范大学 A kind of primer sets, the method and application for detecting blood sample kind
CN110229915A (en) * 2019-05-22 2019-09-13 北京勤邦生物技术有限公司 A kind of staphylococcus aureus detection of nucleic acids primer sets and its detection method
CN110229918A (en) * 2019-06-18 2019-09-13 暨南大学 A kind of method and its kit of quick detection Staphylococcus aureus in food
CN111850152A (en) * 2020-08-24 2020-10-30 上海市东方医院（同济大学附属东方医院） Kit for detecting haemophilus influenzae through loop-mediated isothermal amplification and using method
CN112063731A (en) * 2020-09-15 2020-12-11 南开大学 LAMP detection method for typing streptococcus pneumoniae 19A serotype capsular polysaccharide antigen molecules
WO2023279061A1 (en) * 2021-07-02 2023-01-05 Rt Microfluidics, Inc. Pathogen testing device
WO2023027604A1 (en) * 2021-08-25 2023-03-02 Genomtec S.A. Set of primers for amplifying the nucleotide sequence of the reca gene of salmonella enterica sp. bacteria, method for detecting salmonella enterica sp. bacteria, method for detecting an infection caused by salmonella enterica sp. bacteria, and kit for detecting an infection caused by salmonella enterica sp. bacteria
CN114717341A (en) * 2022-03-11 2022-07-08 丽水市质量检验检测研究院 Salmonella detection kit based on ttr gene and non-diagnostic detection method
CN114717341B (en) * 2022-03-11 2024-04-16 丽水市质量检验检测研究院 Salmonella detection kit based on ttr gene and non-diagnostic detection method
CN115992270A (en) * 2022-08-30 2023-04-21 四川省亚中基因科技有限责任公司 Primer probe composition, reagent and kit for detecting respiratory bacterial pathogens

Similar Documents

Publication Publication Date Title
WO2017067942A1 (en) Detection of microbial pathogens related to bacterial infections through amplification especially by rt-lamp
Slack et al. Evaluation of a modified Taqman assay detecting pathogenic Leptospira spp. against culture and Leptospira-specific IgM enzyme-linked immunosorbent assay in a clinical environment
Ooteman et al. Evaluation of MAT, IgM ELISA and PCR methods for the diagnosis of human leptospirosis
Zhao et al. Development and application of a loop-mediated isothermal amplification method on rapid detection Escherichia coli O157 strains from food samples
Musso et al. Laboratory diagnosis of leptospirosis: a challenge
Tzanakaki et al. Simultaneous single-tube PCR assay for the detection of Neisseria meningitidis, Haemophilus influenzae type b and Streptococcus pneumoniae
Du et al. A rapid Salmonella detection method involving thermophilic helicase-dependent amplification and a lateral flow assay
Jensen Protocol for the detection of Mycoplasma genitalium by PCR from clinical specimens and subsequent detection of macrolide resistance-mediating mutations in region V of the 23S rRNA gene
Jaroenram et al. Xylenol orange-based loop-mediated DNA isothermal amplification for sensitive naked-eye detection of Escherichia coli
CN102618655B (en) Loop-mediated isotherm amplification (LAMP) kit for detecting mycoplasma pneumoniae (Mp)
Odumeru et al. Salmonella detection methods for food and food ingredients
Van Lint et al. Evaluation of a real-time multiplex PCR for the simultaneous detection of Campylobacter jejuni, Salmonella spp., Shigella spp./EIEC, and Yersinia enterocolitica in fecal samples
Thapa et al. Direct detection of Mycobacterium tuberculosis in clinical samples by a dry methyl green loop-mediated isothermal amplification (LAMP) method
Fearnley et al. The development of a real-time PCR to detect pathogenic Leptospira species in kidney tissue
Xia et al. Rapid detection of Streptococcus pneumoniae by real-time fluorescence loop-mediated isothermal amplification
Mu et al. Real-time recombinase-aided amplification with improved propidium monoazide for the rapid detection of viable Escherichia coli O157: H7 in milk
Hu et al. Detection of eight respiratory bacterial pathogens based on multiplex real‐time PCR with fluorescence melting curve analysis
Saengsawang et al. Development of a fluorescent distance-based paper device using loop-mediated isothermal amplification to detect Escherichia coli in urine
Zakham et al. Comparison of a DNA based PCR approach with conventional methods for the detection of Mycobacterium tuberculosis in Morocco
Huang et al. Rapid detection of nusG and fadA in Fusobacterium nucleatum by loop-mediated isothermal amplification
Paton et al. Methods for detection of STEC in humans: an overview
KR20170030746A (en) Primers used for LAMP reaction for the detection of Salmonella and its use
Xiao et al. Loop-mediated isothermal amplification coupled with nanoparticle-based biosensor: a rapid and sensitive method to detect mycoplasma pneumoniae
Gupta et al. Single-step PCR for detection of Brucella melitensis from tissue and blood of goats
Kaur et al. Simultaneous and high sensitive detection of Salmonella typhi and Salmonella paratyphi a in human clinical blood samples using an affordable and portable device

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16784857

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16784857

Country of ref document: EP

Kind code of ref document: A1