WO2017066537A1

WO2017066537A1 - Multiplexed detection of circulating tumor antigens and epigenetic markers using plasmon-enhanced raman spectroscopic assays

Info

Publication number: WO2017066537A1
Application number: PCT/US2016/056998
Authority: WO
Inventors: Ming Li; Ishan Barman
Original assignee: The Johns Hopkins University
Priority date: 2015-10-16
Filing date: 2016-10-14
Publication date: 2017-04-20

Abstract

In one aspect, the present invention provides a new liquid biopsy tool for multiplex detection of a panel of circulating tumor antigens based on plasmon-enhanced spectroscopic imaging. The structured nanoprobes realize substantive signal amplification while the attached Raman reporter independently tailors the spectral response. Moreover, the nanoprobes of the present invention have the excitation and emission spectral signatures in the clear near infrared window and are designed to suppress both intimate contact (Raman) and through-space (fluorescence) enhancement of endogenous markers, and the inventive methods show high detection sensitivity. In another aspect, the present invention provides a new multiplex and ultrasensitive diagnostic platform by exploiting SERS signatures of nucleic acid molecules tagged specifically to circulating DNA fragments carrying tumor-specific alterations, which are methylated in certain disease states. Significantly, development of this platform will aid in sample conservation, reduce sample-handling requirements and lower overall cost and turn-around time. Methods of diagnosis and treatment using these methods are also provided.

Description

MULTIPLEXED DETECTION OF CIRCULATING TUMOR ANTIGENS AND EPIGENETIC MARKERS USING PLASMON-ENHANCED RAMAN SPECTROSCOPIC

ASSAYS

REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of U.S. Provisional Patent Application No. 62/242,371, filed on October 16, 2015, which is hereby incorporated by reference for all purposes as if fully set forth herein.

INCORPORATION-BY-REFERENCE OF MATERIAL SUBMITTED

ELECTRONICALLY

[0002] The instant application contains a Sequence Listing which has been submitted in ASCII format via EFS-Web and is hereby incorporated by reference in its entirety. Said ASCII copy, created on October 15, 2015, is named P13581-01_ST25.txt and is 4,112 bytes in size.

BACKGROUND OF THE INVENTION

[0003] Despite recent advances in the understanding of breast cancer progression and in the development of therapeutic modalities, breast cancer remains a global problem with a significant mortality rate and an equally substantial socio-economic burden. Our rudimentary knowledge of local recurrence and distant metastatic breast cancer is primarily responsible for the continued loss of lives. While local breast cancer responds very well to therapy and has a 5-year survival near 98%, the 5-year survival rate for metastatic breast cancer that involves distant organs drops to a dismal 24%. Extending life expectancies, therefore, requires sustained research in monitoring and managing recurrence and metastatic disease. Specifically, sensitive measurement of changes in tumor burden will assist the development of optimal treatment strategies for metastatic breast cancer. Moreover, early detection of recurrence prior to diagnosis by conventional modalities such as radiographic imaging will allow surveillance of asymptomatic cancer survivors.

[0004] In this milieu, there has been a burgeoning interest in circulating biomarkers owing to their potential for diagnosis, prognostication and monitoring response to systemic therapies in the neoadjuvant, adjuvant and metastatic settings. While promising data has recently been reported on circulating tumor cells and circulating tumor DNA, serum-based glycosylated tumor markers, notably cancer antigen 15-3 (CA15-3), CA 27-29 and carcinoembryonic antigen (CEA), represent the most mature panel for monitoring patients with metastatic disease. These biomarkers are significantly overexpressed in stage IV breast cancer patients, which contain much higher concentrations than normal levels of <30 U/mL, <38 U/mL and <10 ng/mL for CA15-3, CA 27-29 and CEA, respectively. Despite being endorsed by American Society of Clinical Oncology, however, their utility has been limited by the sensitivity and specificity of the individual markers. To overcome this drawback, a shift in paradigm towards concomitant measurement of multiple markers has gained impetus. Yet, current diagnostic techniques, including enzyme-linked immunosorbent assay (ELISA), radioimmunometric assay and Western blot, do not provide the necessary multiplexing functionality and additionally often suffer from limited sensitivity and heavy interference from biological matrices. Given these limitations, a single blood-based test for these tumor antigens is still to be incorporated into a clinical laboratory assay.

[0005] Critically, suitable strategies for early detection of disease recurrence, such as in breast cancer, as distant metastasis and reliable markers and tools for speedy evaluation of therapeutic benefit have not been determined. In the quest for better cues for detection, surveillance and prognostication of breast cancer, circulating biomarkers have surfaced as attractive candidates owing to the intrinsic advantages of a non-invasive, repeatable liquid biopsy procedure. While much of the attention has been focused on cancer antigens and circulating tumor cells, emerging data suggests that circulating DNA fragments carrying tumor-specific alterations (ctDNA) are most robust for monitoring tumor burden and response to therapy. Specifically, epigenetic silencing of tumor-related genes due to hypermethylation presents a promising marker in circulating DNA.

[0006] Diagnosis based on aberrantly methylated genes is attractive because of high DNA stability, high levels of gene promoter methylation in breast cancer, and very low methylation levels in normal specimens. However, a reproducible, facile blood-based test for hypermethylated genes for diagnosis and follow-up of breast cancer have yet to be incorporated into a clinical laboratory assay.

SUMMARY OF THE INVENTION

[0007] The present invention provides methods and compositions for surface enhanced Raman spectroscopic (SERS) detection of antigens of interest and methylated promoter regions of genes of interest which are associated with various diseases and disorders. In some embodiments, the disease is breast cancer.

[0008] In accordance with an embodiment, the present invention provides a method for surface enhanced Raman spectroscopic detection of an antigen comprising: a) conjugating a first set of antibody molecules, or functional portions thereof, specific for a first antigen to a substrate such that the F(ab)2 portion of the antibody molecules are free to bind the first antigen; b) adding a sample to the conjugated antibody molecules on the substrate of a) and incubating the mixture; c) separating the bound fraction from the unbound fraction of the incubated mixture of b); d) adding SERS tags comprising antibody molecules, or functional portions thereof, specific for the first antigen which are conjugated to the tags such that the F(ab)2 portion of the antibody molecules are free to bind the first antigen in the bound fraction of c) and incubating the mixture; e) separating the bound fraction from the unbound fraction of the incubated mixture of d); and f) determining the presence of the bound antigen in the bound fraction of e) by Raman spectroscopy.

[0009] In accordance with another embodiment, the present invention provides a method for surface enhanced Raman spectroscopic detection of a plurality of antigens comprising: a) conjugating two or more sets of different antibody molecules, or functional portions thereof, specific for two or more different antigens, to a substrate such that the F(ab)2 portion of the antibody molecules are free to bind the two or more antigens; b) adding a sample to the conjugated antibody molecules on the substrate of a) and incubating the mixture; c) separating the bound fraction from the unbound fraction of the incubated mixture of b); d) adding SERS tags comprising antibody molecules, or functional portions thereof, specific for the two or more different antigens which are conjugated to the tags such that the F(ab)2 portion of the antibody molecules are free to bind the two or more different antigens in the bound fraction of c) and incubating the mixture; e) separating the bound fraction from the unbound fraction of the incubated mixture of d); and f) determining the presence of the two or more different bound antigens in the bound fraction of e) by Raman spectroscopy.

[0010] In accordance with another embodiment, the present invention provides a nanoprobe-amplified Raman spectroscopic assay for methylated gene detection comprising: a) conjugating to a substrate, one or more capture probes comprising at least a first set of single base extension reaction probes for a specific CpG methylation site of a promoter region of at least one or more genes of interest, which are conjugated to a surface enhanced Raman spectroscopy substrate; b) adding a sample of bisulfite treated DNA to the conjugated capture probes on the substrate of a), and adding a plurality of detection probes comprising dGTP covalently linked to rhodamine 6G (R6G) to the sample, and incubating the mixture with single-base extension reagents; c) separating the sample and reagents and

unincorporated detection probes from the substrate of a); and d) determining the presence of the one or more methylated single base extension reaction probes of the genes of interest on the substrate of c) by Raman spectroscopy.

BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figures 1A-1E illustrate an embodiment of the multiplex surface-enhanced Raman spectroscopy (SERS)-based assay for sensitive and specific detection of antigens of the present invention. (1 A) Schematic structure of a SERS tag where a number of Raman reporter molecules, 4-nitrothiophenol (4-NTP), are sandwiched between a gold nanostar particle (GNS) and thin silica layer. (IB) Extinction spectra of bare GNS and SERS tags in aqueous solution, showing the ca. 14 nm red-shift in localized surface plasmon resonance (LSPR) absorption maximum of SERS tags (748 nm) compared with the bare GNS (734 nm). (1C) Representative TEM image of SERS tags. (ID) Raman and SERS spectra of 4-NTP, SERS tag and CA15-3 mAb-modified SERS tag. (IE) Schematic illustration of SERS assay for multiplex detection of antigen biomarkers. Imaging is performed over a wide field of the wells in the SERS panel and spatial average of the SERS response is correlated to the levels of corresponding biomarkers. For each measurement, the control is used as the internal standard to calibrate the SERS response.

[0012] Figures 2A-2B are TEM images of as-made GNS nanoparticles and SERS tags.

[0013] Figures 3A-3B depict schematic illustrations of SERS tag preparation and antibody functionalization on SERS tags and chip panel. (3 A) SERS tag synthesis and its conjugation onto antibodies (CA15-3 mAb, CA 27-29 mAb and CEA mAb). (3B) SERS assay panel modification with functional antibodies.

[0014] Figure 4 shows SERS spectra of CA 27-29 mAb modified SERS tags and CEA mAb modified SERS tags.

[0015] Figure 5 is a schematic of the multiplexed assay format showing operation of the single base extension reaction.

[0016] Figures 6A-6B depict proof-of-concept experiments for SERS assay of CA15-3 antigen. (6A) SERS spectroscopic images and (6B) Corresponding average SERS spectral response in the absence/presence of SERS tag and CA15-3 antigen. Blank indicates that the SERS measurement is directly performed on CA15-3 mAb-modified quartz substrate without addition of either CA15-3 SERS probe or CA15-3 antigen; no biomarker indicates SERS acquired from the SERS platform in the presence of CA15-3 SERS probe but in absence of CA15-3 antigen. SERS responses represent acquisition intensities when 100 U/mL concentration of CA15-3 antigen is incorporated to complete the sandwich assay. All experiments are triply performed in parallel, and the relative SERS response with respect to the blank is used to generate the SERS image. Scale bar in (6A) is 20 μηι. Highlighted area (1500 cm^"1 to 1630 cm^"1) in (2B) indicates the area surrounding the characteristic Raman peak (1570 cm^"1) that is used for construction of SERS images in (6A) and the ensuing analysis.

[0017] Figure 7A shows spectroscopic images from the SERS assay for detection of CA15-3 antigen and concentration-dependent SERS response for CA15-3, CA 27-29 and CEA antigens in PBS buffer solution. Spectroscopic images are from the SERS assays of CA15-3, CA 27-29 and CEA antigens in buffer. Three capture probes against CA15-3, CA 27-29 and CEA are immobilized onto the pre-defined patterned wells on a quartz slide, and the biomarkers (CA15-3, CA 27-29 and CEA) of various concentrations are then applied. The labels on the left indicate the corresponding concentrations for each image. Scale bar is 20 um.

[0018] Figures 7B (i)-(iii) show concentration-dependent relative SERS responses of (i) CA15-3, (ii) CA 27-29 and (iii) CEA. In each assay, the ratio of the average SERS response over the examined region in the sandwich assay to that of the control experiment (blank) is used as the relative SERS response. The results are presented on the basis of parallel triplicate experiments.

[0019] Figure 8 shows concentration-dependent SERS assays of CA15-3, CA 27-29 and CEA in serum. The concentrations are 0.1, 1.0, 10, 50, 100 and 500 U/mL for CA15-3 and CA 27-29, respectively, while the concentrations are 0.1, 1.0, 10, 50, 100 and 500 ng/mL for CEA. Corresponding concentration for each image is shown in the left. Scale bar is 20 μιτι.

[0020] Figure 9 depicts a concentration-dependent SERS assay of CA15-3, CA 27-29 and CEA in serum. Fittings of curves are performed using Langmuir isotherms:

where y is relative SERS response, yo is a constant, x is the biomarker concentration, and kd is the dissociation constant. Thus, we obtain the dissociation constants in sera: 95.9 U/mL for CA15-3, 83.1 U/mL for CA 27-29, and 113.2 ng/mL for CEA, respectively.

[0021] Figures 10A-10B depict concentration-dependent SERS assay of CA15-3, CA 27- 29 and CEA antigens in serum. (10A) Relative SERS response as a function of the biomarker concentration. (10B) Representative partial least squares (PLS) pre-diction results for CA 27-29 quantification in serum. The solid line denotes y=x values. Samples were prepared by spiking the biomarkers in fetal bovine serum (0.1, 1.0, 10, 50, 100 and 500 U/mL for CA 27-29).

[0022] Figure 11 shows. PLS regression analysis results for CA15-3, CA 27-29 and CEA. The solid line denotes y=x values. Samples were prepared by spiking the biomarkers in FBS (0.1, 1.0, 10, 50, 100 and 500 U/mL for CA15-3 and CA 27-29, and 0.1, 1.0, 10, 50, 100 and 500 ng/mL for CEA).

[0023] Figures 12A-12C depict an embodiment of the multiplexing assays of the present invention using serum samples with healthy and patient biomarker concentrations. (12A) Schematic illustration of SERS assay chip for multiplexing assay of biomarkers at a single test. Briefly, the SERS assay panel is functionalized with CA15-3 mAb, CA 27-29 mAb and CEA mAb in their respective defined regions. A drop of serum sample is deposited onto the panel and covers the entire region. After the incubation, a mixture of SERS probes functionalized with various mAb molecules are dropped. After vigorously washed with PBS buffer solution, the SERS assay panel is subject to the SERS assay. (12B) Relative SERS response for healthy (red) and patient (blue) serum samples (for healthy sample, CA15-3: 10 U/mL, CA 27-29: 30 U/mL and CEA: 1 ng/mL; for patient sample, CA15-3: 150 U/mL, CA 27-29: 180 U/mL and CEA: 200 ng/mL). The mean integral area over the examined region is divided by that from the blank to give the relative SERS response. Three independent experiments are performed in parallel for each type of serum sample. (12C) SERS images acquired by Raman spectroscopic scanner. Images from spiked serum samples mimicking the concentrations observed in (i) healthy serum sample and (ii) patient serum sample. For both i and ii, the first row is for CA15-3, the second row for CA 27-29 and the third row for CEA. Each experiment is triply performed in parallel. Scale bar in (12C) is 1.5 mm.

[0024] Figure 13 shows a PLS regression analysis of serum samples with healthy concentrations and patient biomarker concentrations. The table lists the resultant parameters from the PLS regression. DETAILED DESCRIPTION OF THE INVENTION

[0025] In accordance with an embodiment, the present invention provides a plasmon- enhanced Raman spectroscopic assay featuring nanostructured biomolecular probes and spectroscopic imaging for multiplexed detection of disease associated antigens, such as tumor antigens. In some embodiments, the disease associated antigens are disseminated breast cancer markers, such as, for example, cancer antigen (CA) 15-3, CA 27-29 and cancer embryonic antigen (CEA).

[0026] In one embodiment of the present invention, both the assay chip surface-enhanced Raman scattering (SERS) tags are functionalized with monoclonal antibodies against CA15- 3, CA 27-29 and CEA, respectively. Sequential addition of biomarkers and functionalized SERS tags onto the functionalized assay chip enable the specific recognition of these biomarkers and others, through the antibody-antigen interactions, leading to a sandwich spectro-immunoassay. In addition to offering extensive multiplexing capability, the present invention provides higher sensitivity than conventional immunoassays and demonstrates exquisite specificity owing to selective formation of conjugated complexes and fingerprint spectra of the Raman reporter.

[0027] In accordance with another embodiment, the present invention provides a nanoparticle-amplified Raman spectroscopic assay that can concomitantly detect a panel of gene-specific methylation markers in circulating cell-free DNA, associated with a disease or disorder, at levels below those achievable today. Using novel techniques disclosed herein, the present invention provides a SERS assay, featuring gold (Au) nanostar-derived tags, for use in the determination of the methylation status of specific CpG islands of genes of interest, in oligonucleotide sequences based on the highly selective single base extension reaction.

[0028] The present invention provides a fundamentally new approach for multiplex detection of epigenetic markers, including the use of the inventive compositions and methods for identifying unique methylation signatures in primary tumors, circulating markers and distant metastases in order to facilitate personalized cancer treatment.

[0029] SERS, is a surface sensitive technique that results in the enhancement of Raman scattering by molecules adsorbed on metal surfaces. The enhancement factor can be as much as 10¹⁴ to 10¹⁵, which allows the technique to be sensitive enough to detect single molecules.

[0030] The compounds according to various embodiments of the invention are Raman reporters, i.e. compounds which have a high Raman cross section and the Raman vibrational "finger print" is detectably altered, for example by a shift and/or an increase in intensity, upon the binding an analyte, such as to allow detection and quantitation of the analyte.

Accordingly, the compounds are also known as Raman-active marker compounds, and can be considered to represent reporters or receptors of the analyte.

[0031] SERS has evolved as one of the most sensitive techniques for analyte detection due to enhancement of the Raman spectral intensity by interaction of the adsorbed SERS active analyte molecules with the surface of a metal substrate.

[0032] In SERS, the intensity of the vibrational spectra of a molecule is enhanced by several orders of magnitude when the molecule is in close proximity to metallic nanoparticles such as gold and silver. SERS has been successfully applied for labeling biological systems even in cells and tissues to sense multiplexed biomarkers. Nanoparticle tags that use SERS, herein referred as SERS tags, to generate detectable Raman signals have been shown to be a successful alternative to fluorescence labeling, which has the drawbacks of photobleaching, peaks overlapping in multiplexed experiments, and inability to function in some extreme environments in biological systems.

[0033] SERS tags typically include immobilizing a Raman active dye (Raman reporter) on a metal colloid followed by bioconjugation to target specific locations. Such a nanoparticle— Raman reporter can provide a platform for multiplexing, targeting and tracking in bioimaging and sensing applications.

[0034] The types of reporter molecules and metal nanoparticles are major determinants of the sensitivity of the tag. Among the different reporter molecules, triphenylmethine (TM) compounds exhibit absorption at visible ranges that allows the compounds to be a useful Raman reporter in visible-near infrared (visible-NIR) excitation.

[0035] I. A Multiplex surface-enhanced Raman Spectroscopy (SERS)-based Assay for Sensitive and Specific Detection of Antigens.

[0036] In accordance with an embodiment, the present invention provides a multiplex SERS-based assay for sensitive and specific detection of an antigen panel. The invention combines spectroscopic imaging with tailored SERS probes, where the signal enhancement arises from the proximity of the Raman reporter molecule to the intense localized plasmonic fields created by the nanostructured metals. The signal of this reporter transduces the presence (and concentration) of the tumor antigen at extremely low concentrations to a quantitative and reproducible spectral pattern. [0037] In some embodiments, a SERS chip is provided that comprises pre-defined wells patterned in a quartz substrate. Each array is functionalized with monoclonal antibody (mAb) for different antigens, such as tumor antigens. A Raman microscope or other suitable spectrographic means can be used to scan the chip, and the individual spectra are integrated into numerical algorithms for robust estimation of the expression levels. The present invention provides a multiplexing capability in a single serum droplet (~2 μί) while achieving a high sensitivity and molecular specificity. In conjunction with these inventive methods, the use of a wide-area, compact Raman spectroscopic scanner can sample the chip in a small fraction of the time necessary for standard chemical imaging. Collectively, these findings underline the transformative potential of the present inventive methods and compositions for serum detection.

[0038] In accordance with an embodiment, the present invention provides a method for surface enhanced Raman spectroscopic detection of an antigen comprising: a) conjugating a first set of antibody molecules, or functional portions thereof, specific for a first antigen to a substrate such that the F(ab)2 portion of the antibody molecules are free to bind the first antigen; b) adding a sample to the conjugated antibody molecules on the substrate of a) and incubating the mixture; c) separating the bound fraction from the unbound fraction of the incubated mixture of b); d) adding SERS tags comprising antibody molecules, or functional portions thereof, specific for the first antigen which are conjugated to the tags such that the F(ab)2 portion of the antibody molecules are free to bind the first antigen in the bound fraction of c) and incubating the mixture; e) separating the bound fraction from the unbound fraction of the incubated mixture of d); and f) determining the presence of the bound antigen in the bound fraction of e) by Raman spectroscopy.

[0039] As used herein, the term "substrate" means a chip comprised of glass, quartz, silica, or other suitable composition to which antigen peptides or nucleic acids can be conjugated.

[0040] As used herein, "antibody" or "antibody molecule" can be any type of

immunoglobulin that is known in the art. For instance, the antibody can be of any isotype, e.g., IgA, IgD, IgE, IgG, IgM, etc. The antibody can be monoclonal or polyclonal. The antibody can be a naturally-occurring antibody, e.g., an antibody isolated and/or purified from a mammal, e.g., mouse, rabbit, goat, horse, chicken, hamster, human, etc. The terms "antibody" or "antibody molecule" also refers to a recombinant (e.g., genetically engineered) or induced protein comprising a polypeptide chain of an antibody, or a portion thereof which binds to a specific antigen with high specificity. The polypeptide of an antibody, or portion thereof, includes a heavy chain, a light chain, a variable or constant region of a heavy or light chain, a single chain variable fragment (scFv), or an Fc, Fab, or F(ab)2' fragment of an antibody, etc. The polypeptide chain of an antibody, or portion thereof, can exist as a separate polypeptide of the antibody. The polypeptide of an antibody, or portion thereof, can be a polypeptide of any antibody or any antibody fragment, including any of the antibodies and antibody fragments described herein.

[0041] The antibodies used in the inventive compositions and methods can be conjugated to substrates by functionalizing the substrates with carboxyl groups which are then reacted with free amine groups on the Fc portion of the antibodies.

[0042] As used herein, the term "separating the bound fraction from the unbound fraction" means that the substrate is washed with suitable buffers to remove unreacted reagents and unbound antigens from the substrate. Washes can be done multiple times and can include different buffers and salts and have different pH levels.

[0043] In accordance with one or more embodiments, gold nanostars (GNS) were used as the basis for designing SERS probes with substantive signal enhancement and exceptional multiplexing capability (Figure 1A). By modulating the protrusion length and density as well as the core size, the localized surface plasmon resonance (LSPR) of the GNS was optimally tuned to 734 nm and observed that the thin silica coating caused a slight red-shift to 748 nm (Figure IB). The interplay between plasmonic enhancement and optical extinction causes the GNS with LSPR blue-shifted (off-resonant) from the 785 nm excitation wavelength to provide the maximum net amplification in the colloidal suspension. A Raman reporter, such as 4-nitrobenzenethiol (4-NTP), was then embedded on the GNS surface, which was then coated with a thin silica layer (~5 nm thickness, Figure 1C and Figure 2). The silica coating enables flexible surface functionalization rendering the desired molecular specificity and prevents the leaching of 4-NTP during the processing and assay operations. Next, standard amine coupling chemistry was used to conjugate antibodies, such as, for example, CA15-3 monoclonal antibody (mAb), CA 27-29 mAb and CEA mAb to carboxyl group-modified SERS tags (Figure 3).² Detection of LSPR was performed using a Raman microscope. A spectra is then acquired from 4-NTP, SERS tags and the mAb-modified SERS tags (SERS probes) for probe characterization (Figure ID). The acquisition confirmed that the signatures of the SERS tags and the CA15-3 targeted probes were identical to that of 4-NTP (Figure ID). Similar results were also observed for CA 27-29 and CEA targeted probes (Figure 4). The methods for making the SERS tags, chip and detection thereof, is described in more detail in the Examples.

[0044] The terms "sample," "patient sample," "biological sample," and the like, encompass a variety of sample types obtained from a patient, individual, or subject and can be used in a diagnostic, prognostic or monitoring assay. The patient sample may be obtained from a healthy subject, or a diseased patient including, for example, a patient having associated symptoms of cancer, such as breast cancer. Moreover, a sample obtained from a patient can be divided and only a portion may be used for diagnosis, prognosis or monitoring. Further, the sample, or a portion thereof, can be stored under conditions to maintain sample for later analysis. The definition specifically encompasses blood and other liquid samples of biological origin (including, but not limited to, peripheral blood, serum, plasma, urine, saliva, amniotic fluid, stool and synovial fluid), solid tissue samples such as a biopsy specimen or tissue cultures or cells derived therefrom and the progeny thereof. In a specific embodiment, a sample comprises a tissue sample. In other embodiments, a sample comprises a blood or serum sample. The definition also includes samples that have been manipulated in any way after their procurement, such as by centrifugation, filtration, precipitation, dialysis, chromatography, treatment with reagents, washed, or enriched for certain cell populations. The terms further encompass a clinical sample, and also include cells in culture, cell supernatants, tissue samples, organs, and the like. Samples may also comprise fresh-frozen and/or formalin-fixed, paraffin-embedded tissue blocks, such as blocks prepared from clinical or pathological biopsies, prepared for pathological analysis or study by

immunohistochemistry .

[0045] In accordance with one or more embodiments of the present invention, it will be understood that the term "biological sample" or "biological fluid" includes, but is not limited to, any quantity of a substance from a living or formerly living patient or mammal. Such substances include, but are not limited to, blood, serum, plasma, urine, cells, organs, tissues, bone, bone marrow, lymph, lymph nodes, synovial tissue, chondrocytes, synovial macrophages, endothelial cells, and skin. In a preferred embodiment the biological sample is a breast tissue sample, and more preferably, a breast tumor tissue sample.

[0046] The terms "providing a sample" and "obtaining a biological (or patient) sample" are used interchangeably and mean to provide or obtain a biological sample for use in methods described in this invention. Most often, this will be done by removing a sample of cells from a patient, but can also be accomplished by using previously isolated cells (e.g., isolated by another person, at another time, and/or for another purpose). Archival tissues, having treatment or outcome history, can also be used.

[0047] The terms "polypeptide," "peptide" and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers, those containing modified residues, and non-naturally occurring amino acid polymer.

[0048] With respect to the antibody molecules, the functional portion can be any portion comprising contiguous amino acids of the antibody of which it is a part, provided that the functional portion specifically binds to the antigen of interest. The term "functional portion" when used in reference to an antibody refers to any part or fragment of the antibody of the invention, which part or fragment retains the biological activity of the antibody of which it is a part (the parent antibody). Functional portions encompass, for example, those parts of a antibody that retain the ability to specifically bind to the specific antigen of interest to a similar extent, the same extent, or to a higher extent, as the parent antibody. In reference to the parent antibody, the functional portion can comprise, for instance, about 10%, 25%, 30%, 50%, 68%, 80%, 90%, 95%, or more, of the parent antibody.

[0049] The functional portion can comprise additional amino acids at the amino or carboxy terminus of the portion, or at both termini, which additional amino acids are not found in the amino acid sequence of the parent antibody. Desirably, the additional amino acids do not interfere with the biological function of the functional portion, e.g., specifically binding to an antigen of interest. More desirably, the additional amino acids enhance the biological activity, as compared to the biological activity of the parent antibody.

[0050] The term "amino acid" refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function similarly to the naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, .gamma. - carboxyglutamate, and O-phosphoserine. "Amino acid analogs" refers to compounds that have the same basic chemical structure as a naturally occurring amino acid, e.g., an .alpha, carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium. Such analogs may have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid. Amino acid mimetics refers to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that functions similarly to a naturally occurring amino acid.

[0051] Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes.

[0052] II. A Multiplex Nanoparticle-amplified Raman Spectroscopic assay for Detection of a panel of gene-specific methylation markers in circulating cell-free DNA

[0053] In accordance with one or more embodiments, the present invention provides a surface enhanced Raman spectroscopic (SERS) assay, featuring gold (Au) nanostar-derived tags, to determine the methylation status of specific CpG islands in oligonucleotide sequences based on the highly selective single base extension reaction. Based on the inventors' recent validation of a 10-gene methylation panel using q-PCR, the inventive assays will expand the platform to spectroscopically quantify multiple methylated gene markers on a single chip and will be validated using spiked sera from healthy donors and in sera collected from patients with recurrent stage IV breast cancer. In addition to providing a fundamentally new approach for multiplex detection of epigenetic markers, the present inventions address the potential for identifying unique methylation signatures in primary tumors, circulating markers and distant metastases in order to facilitate personalized breast cancer treatment.

[0054] The present inventors' prior studies in breast tumors and normal breast tissues obtained through tissue biopsy, ductal lavage, and nipple aspiration fluid have shown the clinical utility of methylated biomarkers, including the presence of statistically significant differences between methylation levels and ER/PR status, tumor relapse and lymph node metastasis. Recent whole genome analysis in the Sukumar lab of breast tissue DNA and circulating serum DNA has yielded a 10-gene marker panel, which includes seven novel markers (AKR1B1, COL6A2, GPX7, HIST1H3C, HOXB4, RASGRF2 and TM6SF1) and three known ones (ARHGEF7, TMEFF2 and RASSF1A). The 10-gene methylation panel was verified in silico for sensitivity and specificity. Subsequently, the epigenetic marker panel exhibited excellent performance in independent training and test sets of sera collected in prospective clinical trials of patients with recurrent stage IV breast cancer (data not shown). Using classification rules derived from the training set, the sensitivity, specificity and overall accuracy in the test set (27 normal, 33 cancer) was observed to be 90.9%, 100% and 95%. Additionally, the present inventors have provided nanoparticle-enhanced Raman assays described herein, that can surpass detection limits of conventional immunoassays (ELISA) in detecting CA 15-3, CA 27-29 and CEA. By selective morphological

manipulation, these nanoprobes of the present invention can be tailored to offer

unprecedented signal enhancement while the spectral response is independently regulated by the reporter molecule. This inventive method does not require pre-purification and pre- concentration steps because of large signal amplification and lack of matrix interference in the SERS spectra.

[0055] In accordance with one or more embodiments, the present invention provides a nanoprobe-amplified Raman spectroscopic assay for methylated gene detection comprising: a) conjugating to a substrate, one or more capture probes comprising at least a first set of single base extension reaction probes for a specific CpG methylation site of a promoter region of at least one or more genes of interest, which are conjugated to a surface enhanced Raman spectroscopy substrate; b) adding a sample of bisulfite treated DNA to the conjugated capture probes on the substrate of a), and adding a plurality of detection probes comprising dGTP covalently linked to rhodamine 6G (R6G) to the sample, and incubating the mixture with single-base extension reagents; c) separating the sample and reagents and

[0056] In some embodiments, the substrate used in the methylated gene detection assay is a glass or quartz slide or silicon wafer or chip with a Au triangle nanoarray on its surface, using a nanosphere lithography technique. Generally, a monolayer of hexagonally close packed polystyrene spheres (500 nm in a diameter) are self-assembled on a glass or quartz slide. A 10 nm thick titanium and a 50 nm thick Au layer are then deposited on the slide using e-beam evaporation. Subsequently, the slides are sonicated in ethanol to lift off the polystyrene spheres, leaving an array of Au triangles on the slide.

[0057] As used herein, the term "single base extension reaction" is described as follows. Briefly, a single base extension reaction capture probe complementary to the CpG site sequence of the promoter region of the gene of interest is conjugated to the substrate. A biological sample is then obtained and the DNA extracted from it using known methods. The DNA is then bisulfite treated and allowed to come in contact with the substrate having the capture probe conjugated to it. The CpG site sequence promoter region of the gene of interest, if present in the sample, will bind to the capture probe. The substrate is then subjected to a reaction solution comprising R6G-labled dGTP and Taq polymerase, which will incorporate the single R6G-labled dGTP into the capture probe's 3' end if the CpG site is methylated. After the reaction is complete, the reaction solution is removed and the substrate is washed and subjected to SERS measurements using a Raman microscope or other detection means. When the site is methylated, a SERS response is detected. A schematic of the inventive composition and method is shown in Fig. 5. Thus, the methylation status of a specific CpG site can be monitored by SERS response using Raman spectroscopy.

[0058] As used herein, the term "single base extension reaction probes" means an oligonucleotide capture probe comprising at least three or more bp of nucleic acids complementary to the CpG site sequence of the promoter region of the gene of interest. The capture probe is labeled with a cytosine having a Au nanostar ligated to it at its 3' end as depicted in Table 1.

[0059] TABLE 1 : Single Base Extension Reaction Probes

Probe Name Sequence

AKR1B1 GCGCGTTAATCGTAGGCGTTT (SEQ ID NO: 1)

AKR1B1 CC C AAT AC AAT AC AAC CTTAAC C (SEQ ID NO: 2)

ARHGEF7 GTTTTTCGGGTC GTAGC GATG (SEQ ID NO: 3)

ARHGEF7 CAAAAAACCCTCCAAATCCAAAAT (SEQ ID NO: 4)

COL6A2 ATTCGGGTTGATAGCGATTCGT (SEQ ID NO: 5)

COL6A2 CAATTCCACCAACACCCCAAC (SEQ ID NO: 6)

GPX7 ACGGTGGTAGCGGCGTGGTT (SEQ ID NO: 7)

GPX7 ACCCCAAATATTAACCACCTTAA (SEQ ID NO: 8)

HIST1H3C AATAGTTCGTAAGTTTATCGGCG (SEQ ID NO: 9)

HIST1H3C TTTCTTCACACCACCAATAACCAA (SEQ ID NO: 10)

HOXB4 C GGGATTTTGGGTTTTC GTC G (SEQ ID NO: 11)

HOXB4 CAAACCAAACAATAACAAAAACAAC (SEQ ID NO: 12)

RASGRF2 GT A AGA AGAC GGTC GAGGC G (SEQ ID NO: 13)

RASGRF2 CAACAACTCTACTCACCCTCAA (SEQ ID NO: 14)

RASSF1A GCGTTGAAGTCGGGGTTC (SEQ ID NO: 15)

RASSF1A CCCATACTTCACTAACTTTAAAC (SEQ ID NO: 16)

TM6SF1 CGTTTAGCGGGATGCGGTGA (SEQ ID NO: 17)

TM6SF1 ACACAAAAACCCCAATAACCACA (SEQ ID NO: 18)

TMEFF2 TTTCGTTTCGGGGTTGAGTTTAG (SEQ ID NO: 19) TMEFF2 CAACAATAACAATAACACCCAACAA (SEQ ID NO: 20)

[0060] By "nucleic acid" as used herein includes "polynucleotide," "oligonucleotide," and "nucleic acid molecule," and generally means a polymer of DNA or RNA, which can be single-stranded or double-stranded, synthesized or obtained (e.g., isolated and/or purified) from natural sources, which can contain natural, non-natural or altered nucleotides, and which can contain a natural, non-natural or altered internucleotide linkage, such as a phosphoroamidate linkage or a phosphorothioate linkage, instead of the phosphodiester found between the nucleotides of an unmodified oligonucleotide. It is generally preferred that the nucleic acid does not comprise any insertions, deletions, inversions, and/or substitutions. However, it may be suitable in some instances, as discussed herein, for the nucleic acid to comprise one or more insertions, deletions, inversions, and/or substitutions.

[0061] In an embodiment, the nucleic acids of the invention are recombinant. As used herein, the term "recombinant" refers to (i) molecules that are constructed outside living cells by joining natural or synthetic nucleic acid segments to nucleic acid molecules that can replicate in a living cell, or (ii) molecules that result from the replication of those described in (i) above. For purposes herein, the replication can be in vitro replication or in vivo replication.

[0062] The nucleic acids used as primers in embodiments of the present invention can be constructed based on chemical synthesis and/or enzymatic ligation reactions using procedures known in the art. See, for example, Sambrook et al. (eds.), Molecular Cloning, A Laboratory Manual, 3^rd Edition, Cold Spring Harbor Laboratory Press, New York (2001) and Ausubel et al, Current Protocols in Molecular Biology, Greene Publishing Associates and John Wiley & Sons, NY (1994). For example, a nucleic acid can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed upon hybridization (e.g., phosphorothioate derivatives and acridine substituted nucleotides).

Examples of modified nucleotides that can be used to generate the nucleic acids include, but are not limited to, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxymethyl) uracil, 5-carboxymethylaminomethyl- 2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N⁶-isopentenyladenine, 1 -methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2- methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N⁶-substituted adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5 -methoxy uracil, 2-methylthio- N⁶-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2- thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5- oxyacetic acid methylester, 3-(3-amino-3-N-2-carboxypropyl) uracil, and 2,6-diaminopurine. Alternatively, one or more of the nucleic acids of the invention can be purchased from companies, such as Macromolecular Resources (Fort Collins, CO) and Synthegen (Houston, TX).

[0063] "Complement" or "complementary" as used herein to refer to a nucleic acid may mean Watson-Crick (e.g., A-T/U and C-G) or Hoogsteen base pairing between nucleotides or nucleotide analogs of nucleic acid molecules.

[0064] "Identical" or "identity" as used herein in the context of two or more nucleic acids or polypeptide sequences may mean that the sequences have a specified percentage of residues that are the same over a specified region. The percentage may be calculated by optimally aligning the two sequences, comparing the two sequences over the specified region, determining the number of positions at which the identical residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the specified region, and multiplying the result by 100 to yield the percentage of sequence identity. In cases where the two sequences are of different lengths or the alignment produces one or more staggered ends and the specified region of comparison includes only a single sequence, the residues of single sequence are included in the denominator but not the numerator of the calculation. When comparing DNA and RNA, thymine (T) and uracil (U) may be considered equivalent. Identity may be performed manually or by using a computer sequence algorithm such as BLAST 2.0.

[0065] "Probe" as used herein may mean an oligonucleotide capable of binding to a target nucleic acid of complementary sequence through one or more types of chemical bonds, usually through complementary base pairing, usually through hydrogen bond formation. Probes may bind target sequences lacking complete complementarity with the probe sequence depending upon the stringency of the hybridization conditions. There may be any number of base pair mismatches which will interfere with hybridization between the target sequence and the single stranded nucleic acids described herein. However, if the number of mutations is so great that no hybridization can occur under even the least stringent of hybridization conditions, the sequence is not a complementary target sequence. A probe may be single stranded or partially single and partially double stranded. The strandedness of the probe is dictated by the structure, composition, and properties of the target sequence. Probes may be directly labeled or indirectly labeled such as with biotin to which a streptavidin complex may later bind.

[0066] The probe may have a length of from 8 to 500, 10 to 100 or 20 to 60 nucleotides. The probe may also have a length of at least 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280 or 300 nucleotides. The probe may further comprise a linker sequence of from 10-60 nucleotides.

[0067] "Substantially complementary" used herein may mean that a first sequence is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identical to the complement of a second sequence over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more nucleotides, or that the two sequences hybridize under stringent hybridization conditions.

[0068] "Substantially identical" used herein may mean that a first and second sequence are at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identical over a region of 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more nucleotides or amino acids, or with respect to nucleic acids, if the first sequence is substantially complementary to the complement of the second sequence.

[0069] "Target" as used herein can mean an oligonucleotide or portions or fragments thereof, which may be bound by one or more DNA binding proteins, such as zinc finger proteins, for example. In some embodiments, "target" can mean a specific sequence which has at least one CpG site which can be methylated by the methylase containing fusion proteins of the present invention.

[0070] The term "methylase" or "methyltransferase" as used herein, means an enzyme or functional fragment or portion thereof, which is capable of methylating one or more CpG sites on a nucleic acid molecule.

[0071] In accordance with one or more embodiments, the arrays of the present invention further comprise at least one randomly-generated oligonucleotide probe sequence used as a negative control; at least one oligonucleotide sequence derived from a housekeeping gene, used as a negative control for total DNA degradation; at least one randomly -generated sequence used as a positive control; and a series of dilutions of at least one positive control sequence used as saturation controls; wherein at least one positive control sequence is positioned on the array to indicate orientation of the array.

[0072] The solid support of the present invention can be in the form of a biochip. The biochip is an apparatus which, in certain embodiments, comprises a solid substrate comprising an attached probe or plurality of probes described herein. The probes may be capable of hybridizing to a target sequence under stringent hybridization conditions. The probes may be attached at spatially defined address on the substrate. More than one probe per target sequence may be used, with either overlapping probes or probes to different sections of a particular target sequence. In an embodiment, two or more probes per target sequence are used. The probes may be capable of hybridizing to target sequences associated with a single disorder.

[0073] The probes may be attached to the biochip in a wide variety of ways, as will be appreciated by those in the art. The probes may either be synthesized first, with subsequent attachment to the biochip, or may be directly synthesized on the biochip.

[0074] In accordance with one or more embodiments, the biochips of the present invention are capable of hybridizing to a target sequence under stringent hybridization conditions and attached at spatially defined address on the substrate.

[0075] The solid substrate may be a material that may be modified to contain discrete individual sites appropriate for the attachment or association of the probes and is amenable to at least one detection method. Representative examples of substrates include glass and modified or functionalized glass, plastics (including acrylics, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethanes, Teflon, etc.), polysaccharides, nylon or nitrocellulose, resins, silica or silica-based materials including silicon and modified silicon, carbon, metals, inorganic glasses and plastics. The substrates may allow optical detection without appreciably fluorescing.

[0076] The substrate may be planar, although other configurations of substrates may be used as well. For example, probes may be placed on the inside surface of a tube, for flow- through sample analysis to minimize sample volume. Similarly, the substrate may be flexible, such as a flexible foam, including closed cell foams made of particular plastics.

[0077] The biochip and the probe may be derivatized with chemical functional groups for subsequent attachment of the two. For example, the biochip may be derivatized with a chemical functional group including, but not limited to, amino groups, carboxyl groups, oxo groups or thiol groups. Using these functional groups, the probes may be attached using functional groups on the probes either directly or indirectly using a linkers. The probes may be attached to the solid support by either the 5' terminus, 3' terminus, or via an internal nucleotide.

[0078] The probe may also be attached to the solid support non-covalently. For example, biotinylated oligonucleotides can be made, which may bind to surfaces covalently coated with streptavidin, resulting in attachment. Alternatively, probes may be synthesized on the surface using techniques such as photopolymerization and photolithography.

[0079] Exemplary biochips of the present invention include an organized assortment of oligonucleotide probes described above immobilized onto an appropriate platform. In accordance with another embodiment, the biochip of the present invention can also include one or more positive or negative controls. For example, oligonucleotides with randomized sequences can be used as positive controls, indicating orientation of the biochip based on where they are placed on the biochip, and providing controls for the detection time of the biochip when it is used for detecting methylated gene targets from a sample.

[0080] Each discrete probe is then attached to an appropriate platform in a discrete location, to provide an organized array of probes. Appropriate platforms include membranes and glass slides. Appropriate membranes include, for example, nylon membranes and nitrocellulose membranes. The probes are attached to the platform using methods and materials known to those skilled in the art. Briefly, the probes can be attached to the platform by synthesizing the probes directly on the platform, or probe-spotting using a contact or non- contact printing system. Probe-spotting can be accomplished using any of several commercially available systems, such as the GeneMachines™ OmniGrid (San Carlos, Calif).

[0081] The biochips are scanned, for example, using an Epson Expression 1680 Scanner (Seiko Epson Corporation, Long Beach, Calif.) at a resolution of about 1500 dpi and 16-bit grayscale, although other resolutions and scanners can be used. The biochip images can be analyzed using Array-Pro Analyzer (Media Cybernetics, Inc., Silver Spring, Md.) software. Because the identity of the target DNA gene probes on the biochip are known, the sample can be identified as including particular target DNA genes when spots of hybridized target DNA genes-and-probes are visualized. Additionally, the density of the spots can be obtained and used to quantitate the identified target DNA genes in the sample.

[0082] The methylation state of a disease-associated target DNA gene provides information in a number of ways. For example, a differential methylation state of a cancer- associated gene target compared to a control may be used as a diagnostic that a patient suffers from breast cancer. Methylation states of a cancer-associated gene targets may also be used to monitor the treatment and disease state of a patient. Furthermore, Methylation states of a cancer-associated gene targets may allow the screening of drug candidates for altering a particular expression profile or suppressing an expression profile associated with cancer.

[0083] The term "DNA target site" or "target DNA gene" as used herein, means one or more regions of the target gene that are analyzed for CpG methylation.

[0084] As used herein, the term "methylation state" means the detection of one or more methyl groups on a cytidine in a target site of the DNA in the sample.

[0085] It will be understood that the methods of the present invention which determine the methylation state of a target gene or target gene loci in a sample of DNA are useful in preclinical research activities as well as in clinical research in various diseases or disorders, including, for example, cancer.

[0086] In accordance with one or more embodiments of the present invention, it will be understood that the types of cancer diagnosis which may be made, using the methods provided herein, is not necessarily limited. For purposes herein, the cancer can be any cancer. As used herein, the term "cancer" is meant any malignant growth or tumor caused by abnormal and uncontrolled cell division that may spread to other parts of the body through the lymphatic system or the blood stream. The cancer can be an epithelial cancer. As used herein the term "epithelial cancer" refers to an invasive malignant tumor derived from epithelial tissue that can metastasize to other areas of the body, e.g., a carcinoma. Preferably, the epithelial cancer is breast cancer. The cancer can be a non-epithelial cancer. As used herein, the term "non-epithelial cancer" refers to an invasive malignant tumor derived from non-epithelial tissue that can metastasize to other areas of the body.

[0087] The phrase "controls or control materials" refers to any standard or reference tissue or material that has not been identified as having cancer.

[0088] As used herein, the term "treat," as well as words stemming therefrom, includes diagnostic and preventative as well as disorder remitative treatment. The terms "treat," and "prevent" as well as words stemming therefrom, as used herein, do not necessarily imply 100% or complete treatment or prevention. Rather, there are varying degrees of treatment or prevention of which one of ordinary skill in the art recognizes as having a potential benefit or therapeutic effect. In this respect, the inventive methods can provide any amount of any level of diagnosis, screening, or other patient management, including treatment or prevention of cancer in a mammal. Furthermore, the treatment or prevention provided by the inventive method can include treatment or prevention of one or more conditions or symptoms of the disease, e.g., cancer, being treated or prevented. Also, for purposes herein, "prevention" can encompass delaying the onset of the disease, or a symptom or condition thereof.

[0089] As used herein, the term "poor treatment outcome" or "poor prognosis" means that tumors having one or more of the above genes methylated have been shown to have a high likelihood of recurrence after initial treatment. This can include tumors which are resistant to radiation, chemotherapy, surgery and combinations of two or more of these types of treatments. While not being limited to any particular theory, these results of the present invention, discussed herein, support the finding that highly methylated homeobox loci and loss of their expression may likely contribute to poor outcome in breast cancer.

[0090] A kit is also provided comprising an array of oligonucleotides as described herein, or portions or fragments thereof, as well as a biochip as described herein, along with any or all of the following: assay reagents, buffers, probes and/or primers, and sterile saline or another pharmaceutically acceptable emulsion and suspension base. In addition, the kits may include instructional materials containing directions (e.g., protocols) for the practice of the methods described herein.

EXAMPLES

[0091] Multiplex surface-enhanced Raman Spectroscopy (SERS)-based Assay for Sensitive and Specific Detection of Antigens.

[0092] Materials and chemicals. Gold chloride hydrate (HAuCl4^»xH₂0, 99.999% trace metals basis), trisodium citrate dihydrate (HOC(COONa)(CH₂COONa)₂ ^»2H₂0, >99%), poly(vinylpyrrolidone) (PVP, (CeH9NO)n, MW-10 kg/mol), sodium borohydride (>99%), Ν,Ν-dimethyformamide (DMF, anhydrous 99.8%), sodium hydroxide (pellets, 99.99% trace metals basis), (3-aminopropyl) trimethoxysilane (APTMS, 97%), sodium silicate

(Na₂0(Si0₂)x^»xH₂0, reagent grade), 4-nitrothiophenol (4-NTP, technical grade 80%), N- hydroxysuccinimide (NHS, 98%), N-ethyl-N'-(3-dimethylaminopropyl)carbodiirnide (EDC, >97.0%) and bovine serum albumin (BSA) were purchased from Sigma- Aldrich (St. Louis, MO). (3-triethoxysilyl) propylsuccinic anhydride (TEPSA, CistfcOeSi, >95%) was purchased from Gelest, Inc. (Morrisville, PA). Cancer antigen 15-3 monoclonal antibody (CA15-3 mAb), CA15-3 antigen, CA 27-29 antigen, carcinoembryonic antigen (CEA) and CEA monoclonal antibody (CEA mAb) were obtained from MyBioSource (San Diego, CA). Mouse anti-cancer CA 27-29 monoclonal antibody (CA 27-29 mAb) was purchased from Creative Diagnostics (Shirley, NY). Quartz cover slips (25.4x25.4x0.15-0.25 mm) were purchased from Alfa Aesar (Ward Hill, MA) for use as the SERS measurement substrate. Phosphate buffered saline (lOxPBS) solution was purchased from OmniPur (Billerica, MA) and fetal bovine serum (FBS, BenchMarkTM) was acquired from Gemini Bio-Products (West Sacramento, CA). All other reagents or solvents were obtained from VWR (Radnor, PA) and used as received.

[0093] SERS tag synthesis. SERS tags were synthesized according to our previously reported method with a slight modification (Angew. Chem.,Int. Ed., 2014, 53, 14115-14119; ACS Nano, 2013, 7, 4967-4976; Anal. Chem, 2012, 84, 2837-2842). Briefly, gold nanostar (GNS) nanoparticles with the LSPR band maximum of 734 nm in aqueous solution were synthesized by employing the gold seed-mediated method. The GNS nanoparticles were dispersed into deionized water with a concentration of 1.7 pM for further use. To prepare the SERS tag, a freshly prepared solution of Raman reporter (4-NTP, 10 μΜ) was added dropwise to 15 mL GNS colloid while subject to rapid magnetic stirring. Stirring was continued for another 30 min before adding \0 μΐ. of freshly prepared APTMS ethanolic solution (50 mM). After stirring for another 30 min, the pH value of reaction solution was adjusted to 9-10 by addition of NaOH aqueous solution. Following this, 200 of freshly prepared 0.54 wt% sodium silicate solution was added slowly, and then stirred for one day. 5 mL anhydrous ethanol was subsequently added to generate a condensed silica layer. The reaction solution was kept standing for one more day, centrifuged and washed with anhydrous ethanol and deionized water, respectively. Finally, the solid was dispersed into 0.5 mL 1 xPBS buffer solution for further use.

[0094] Antibody conjugation to quartz chip and SERS tags. Assay panel

functionalization. The underlying principle here is that by associating a set of antibodies with a particular row, a combinatorial utilization of the same nanoparticle-surface species with multiple antibodies can be implemented. To make the SERS assay panel, quartz slides were used and cleaned by subsequent sonication in ethanol and water. To pre-define the functional assay regions for different biomarkers, the Parafilm was bonded onto the cleaned quartz chip with punched wells (3 rows ^χ 7 columns). In the inventive assay, each row was defined for one type of biomarker. All of the following operations were carried out in a home-built humid chamber. Antibodies were immobilized onto the panel with pre-defined patterns through standard amine coupling chemistry. First, all wells were incubated over-night in an ethanol solution containing 100 mM TEPSA and then sequentially washed with ethanol and 1 x PBS buffer solution to achieve a carboxyl group-modified surface. The resulting carboxyl-terminated quartz array panel was activated by immersion in a PBS buffer solution containing 50 mM NHS and 200 mM EDC. After washing with the PBS buffer solution to remove excess NHS and EDC, the panel was incubated overnight in the buffer solution of 100 μg/mL CA15-3 mAb (CA 27-29 mAb or CEA mAb). The non-specifically bound antibodies were washed away with the l xPBS buffer.

[0095] To achieve high assay specificity, it is crucial to minimize the non-specific biomarker adsorption. In this work, we used BSA as the surface blocking reagent because of its excellent stability and biocompatibility, although other blocking reagents can be used. The antibody-immobilized patterned panel was spotted and then incubated for 2 hours in a 1 xPBS buffer solution of 1 mg/mL BSA, followed by rinsing with 1 xPBS buffer solution. Next, the resultant assay was kept in the humid chamber for further SERS assembly.

[0096] Antibody-conjugated SERS tags. The antibody-SERS tag conjugates (SERS probes) were synthesized as detailed in the references cited above. First, the SERS tags with carboxyl groups were prepared by incubating 200 SERS tags overnight in a 0.12 M TEPSA buffer solution. The carboxyl group-modified SERS tags were washed twice with a 1 xPBS buffer solution, and then dispersed into a 1 xPBS solution contained 50 mM NHS and 200 mM EDC to activate the carboxyl terminal group. After the 2-hour incubation period, 100 μg/mL CA15-3 mAb (CA 27-29 mAb or CEA mAb) was added onto the activated SERS tags in PBS buffer solution, and then incubated overnight. Unbound mAb residues were removed by centrifugation at 4000 rpm and subsequent washing with 1 xPBS buffer solution at least three times. The resultant SERS probes were re-dispersed into 0.5 mL 1 xPBS buffer solution for further use.

[0097] SERS assay of biomarkers. We performed SERS assay experiments in two different matrices, namely, in 1 xPBS buffer solution and in sera.

[0098] SERS assay in buffer. Various amounts of the biomarkers (CA15-3, CA 27-29 or CEA) were spiked into 1 xPBS buffer solution to achieve a range of biomarker concentrations (0.1, 1.0, 10, 50, 100 and 500 U/mL for CA15-3 and C A 27-29 antigens, 0.1, 1.0, 10, 50, 100 and 500 ng/mL for CEA antigen). These concentrations are selected as it spans the clinically relevant range from that typically encountered in healthy individuals to patients with advanced breast cancer (Ann. Oncol, 2008, 19, 675-681; Health Sci., 2012, 2, 138-143; Biomed. Pharmacother., 2015, 70, 19-23). About 2 μΐ_^ of each biomarker solutions with various concentrations was spotted onto the corresponding pre-defined pattern (i.e., matrix arrangement of wells) on the SERS assay panel, and incubated for one hour. Next, the panel was carefully washed with 1 *PBS buffer solution to remove any traces of unbound biomarkers. Subsequently, 2 of SERS probes were spotted on the corresponding patterns and incubated for one more hour, followed by vigorous rinsing with 1 *PBS buffer solution. Finally, the sandwich assay was subjected to the SERS measurements.

[0099] SERS assay in serum. Similarly, the biomarker serum solutions at the

aforementioned range of CA15-3, CA 27-29 or CEA concentrations were prepared by spiking various amounts of as-received biomarkers into FBS serum. The lack of pre-existing biomarkers in FBS serum precluded any potential interference. SERS assays of biomarkers in sera were prepared following a similar procedure to that outlined above for the buffer solution.

[0100] SERS measurements. SERS measurements were performed using a home-built, confocal, inverted Raman microscope. A Ti: Sapphire laser of 785 nm wavelength (3900S, Spectra-Physics) was used as the excitation source and a 1.2 NA, 60* water immersion objective lens (Olympus UPLASPO60XWIR) was used to focus the laser light to and collect the Raman-scattered light from the assay, as detailed in our previous work (Biomed. Opt. Express, 2011, 2, 2484-2492). The backscattered light was collected by a 50 μιτι multimode fiber (Thorlabs M14L01), delivered to a spectrograph (Holospec f/1.8i, Kaiser Optical Systems) and the dispersed light was finally detected by a TE-cooled, back-illuminated, deep depletion CCD (PIXIS: 100BR eXcelon, Princeton Instruments). The SERS microscopic images were obtained using dual-axis galvo mirrors (CT-6210, Cambridge Technology). The SERS response (RSERS) at 1570 cm^"1, characteristic of the Raman reporter (4-NTP), was computed by considering the integral of the area under the curve in the range of 1500 cra^'1-

1630 cm^"1 and was used to construct the SERS images. The spatial average over the scanning region was used to calculate the SERS response in order to improve prediction robustness, given by:

where

(1),

where N is the number (20x20) of spectra obtained over the scanning region, ω is the Raman shift in the integral range (1500 cm^"1 to 1630 cm^"1), and I(co) is the Raman peak intensity at Raman shift, co. All spectral measurements were obtained with an exposure time of 0.5 s at 4 mW laser power on the sample, unless otherwise noted.

[0101] Furthermore, in order to investigate the feasibility of high throughput, low-cost measurements, a flatbed Raman spectroscopic scanning system was constructed. Updated in design from our diffuse reflectance and autofluorescence scanner reported previously (PLoS One, 2012, 7, e30887), wide area spectroscopic imaging capability is achieved by mechanically scanning the sample on top of inverted Raman imaging system with a quartz substrate. Spectral recording time was 100 msec/pixel. Here, a 785 nm compact solid-state laser is used as the excitation source and the collected light is recorded on a portable spectrometer.

[0102] Characterization. Extinction spectra for the GNS and SERS tags were recorded on a Shimadzu UV-2401 spectrometer. Transmission electron micrographs (TEM) were acquired using the FEI Tecnai G2 Spirit TWIN transmission electron microscope at an accelerating voltage of 120 kV. The sample was dropped onto ultrathin Formvar-coated 200- mesh copper grids (Ted Pella, Inc.) and left to dry in air.

[0103] Data analysis. To evaluate the efficacy of the present assay for quantitative concentration measurements, we performed partial least squares (PLS) regression analysis. Specifically, PLS calibration models were tested using the leave-one-sample-out cross- validation procedure for each biomarker. In this routine, one concentration is left out when developing the calibration model and the resultant model is used to predict concentrations of the left out concentration spectra. This procedure is repeated until all concentrations are left out and each of the concentrations has been predicted. In particular, the calibration models are developed using 50 spectra (5 concentrations with 10 spectra per concentration for each biomarker), and the predictions are performed on the remaining 10 spectra (1 concentration). Furthermore, the limit of detection (LOD) of the developed SERS assay is calculated from the best fit line obtained between the predicted concentrations and reference concentrations according to the IUPAC definition (Clin. Chem 1989, 35, 2152-2153):

where

(2), where s_y/_x is the standard deviation of the residuals and is a measure of the average deviation of the prediction values from the regression line, N is the number of spectra in the dataset, ci indicate the reference concentrations and ci the predicted concentrations.

[0104] We performed the similar PLS analysis for the spiked sera samples mimicking the concentrations of a healthy individual and a patient with advanced metastatic breast cancer to examine the accuracy and precision of quantitative measurements. Relative error of prediction (REP) and relative standard deviation (RSD) were calculated, which correlate directly with the accuracy and precision of SERS assay respectively. REP is calculated by the following equation:

N c, ₍₃₎ [0105] The RSD of predicted concentrations is given by:³⁰

where

(4),

where N∞nc is the number of distinct concentrations in the dataset, p is the number of spectra per concentration and ock is the standard deviation obtained at concentration ck.

[0106] Gold nanostars (GNS) were employed as the basis for designing SERS probes with substantive signal enhancement and exceptional multiplexing capability (Figure 1A). By modulating the protrusion length and density as well as the core size, we optimally tuned the localized surface plasmon resonance (LSPR) of the GNS to 734 nm and observed that the thin silica coating caused a slight red-shift to 748 nm (Figure IB). The interplay between plasmonic enhancement and optical extinction causes the GNS with LSPR blue-shifted (off- resonant) from the 785 nm excitation wavelength to provide the maximum net amplification in the colloidal suspension (ACS Nano, 2013, 7, 2099-2105). Raman reporter, 4- nitrobenzenethiol (4-NTP) was embedded, on the GNS surface, which was then coated with a thin silica layer (~5 nm thickness, Figure 1C and Figure 2). The silica coating enables flexible surface functionalization rendering the desired molecular specificity and prevents the leaching of 4-NTP during the processing and assay operations. Next, standard amine coupling chemistry was used to graft antibodies (CA15-3 monoclonal antibody (mAb), CA 27-29 mAb and CEA mAb) to carboxyl group-modified SERS tags (Figure 3). Using the Raman microscope, we acquired spectra from 4-NTP, SERS tags and the mAb-modified SERS tags (SERS probes) for probe characterization (Figure ID). The acquisition confirmed that the signatures of the SERS tags and the CA15-3 targeted probes were identical to that of 4-NTP (Figure ID). Similar results were also observed for CA 27-29 and CEA targeted probes (Figure 4).

[0107] Additionally, each well in the SERS chip was functionalized with carboxyl group and activated with the standard amine coupling chemistry, followed by conjugation with the respective antibodies (Figure IE and Figure 3). Here the mAb molecules immobilized on the quartz slide act as the capture probe and the mAb molecules on the SERS tag surface serve as the recognition moiety on the detection probes for the biomarkers. Bovine serum albumin was used as the surface blocking reagent to avoid nonspecific adsorption of extraneous species on the chip surface (Figure 3) (Anal. Biochem, 2000, 282, 232-238). The chip bound with biomarkers was then incubated in a solution containing SERS probes forming the sandwich assay configuration. After removal of the free SERS probes, the chip was subjected to spectral acquisition. We performed spectroscopic imaging, as opposed to single point measurements, to improve signal robustness through spatial averaging and to minimize sampling errors.

[0108] To determine the feasibility of the SERS chip for biomarker detection, we first performed proof-of-concept experiments in PBS buffer media (Figure 6). The sandwich configuration, in the presence of 100 U/mL CA15-3, faithfully reproduces the signal of the Raman reporter. In contrast, the control experiments confirm that there was no observable signal in the "blank" as also when only the SERS probe was added. The latter can be attributed to the fact that the SERS probes are easily washed away when the sandwich configuration via the antibody-antigen binding is not formed. In order to display the SERS chip response, we constructed spectral images based on the integral area of the 1570 cm^-1 Raman peak (Figure 6A). We observed substantially brighter SERS images in the presence of CA15-3 antigen - the imaging equivalent of the single point spectral acquisition shown in Figure 6B.

[0109] To investigate its applicability as a quantitative assay, we next examined the SERS response upon varying the biomarker concentrations in the ranges encountered in clinical practice (Figures 7A, B). Concentrations both lower and higher than the clinically relevant levels were also included to obtain a comprehensive assessment of the dynamic range. Specifically, six concentrations of CA15-3, CA 27-29 and CEA were spotted on the SERS chip. The SERS response shows a consistent increase in intensity (brightness) due to more captured SERS probes per well with rising concentration for all three biomarkers. We also correlated the relative SERS response, in relation to the control, with the various biomarker concentrations (Figure 7B). Substantive linearity was observed in the log-log calibration curve over the examined concentration ranges, 0.1U/mL-500U/mL for CA15-3 (coefficient of determination R²=0.94) and CA 27-29 (R²=0.95), and 0.1 ng/mL-500 ng/mL for CEA (R²=0.97).

[0110] Next, we used the SERS chip for biomarker detection in serum (Figure 10A and Figure 8). The logarithm of the SERS responses increases linearly with the logarithm of biomarker concentrations investigated with R² values equal to 0.98, 0.90 and 0.99 for CA15- 3, CA 27-29 and CEA, respectively. We further analyzed the binding characteristics of the biomarkers by fitting the experimental data to Langmuir isotherms, which yielded dissociation constants of 95.9 U/mL, 83.1 U/mL and 113.2 ng/mL for CA15-3, CA 27-29 and CEA, respectively (Figure 9). Although the spectral intensity values are lower in sera than those obtained in buffer, the acquired profiles and the response curves highlight the molecular specificity via the lack of interference from the myriad endogenous constituents of the sera. Additionally, we used multivariate regression analysis for concentration prediction as it exploits the entire spectral information (rather than focusing on a single peak) and has the associated advantage of noise averaging across the spectrum. Leave-one-out cross-validation was performed using partial least squares (PLS) regression (Figure 10B and Figure 11) (PLoS One, 2012, 7, e32406).

[0111] There is close agreement between the predicted and reference concentrations with R² values of 0.98, 0.99 and 0.99 for CA15-3, CA 27-29 and CEA, respectively. Importantly, the limits of detection (LOD) were computed to be 0.99 U/mL, 0.13 U/mL and 0.05 ng/mL for CA15-3, CA 27-29 and CEA, respectively. These values are significantly smaller than the corresponding LOD values reported from the conventional methods, such as commercial ELISA kits (widely treated as the gold standard for proteomics assays): 5.0 U/mL for CA15- 3, 3.8 U/mL for CA 27-29 and 1.0 ng/mL for CEA.28. We note that the SERS responses shown in Figures 7 and 10A are slightly different for each antigen, which may be attributed to the different antibody-antigen binding affinities.

[0112] A key advantage of the present invention is its multiplexing ability. To test this feature, we architected a 3 x3 array of sensing units with each row dedicated to measurement of a specific antigen and the three columns enabling triplicate measurements. A single drop of serum (~2 μί) spiked with differing quantities of the three cancer antigens was pipetted on the whole chip, followed by sequential addition of the mAb-SERS probes (Figure 12A). During the incubation period, the serological markers and mAb-SERS probes together form the sandwich assay configuration with the capture probes on the corresponding wells.

Without any other pretreatment, we employed spectroscopic imaging on the chip to render direct and simultaneous readout of the tumor antigen concentrations. We examined two serum samples spiked with different concentrations of the antigens. The antigen

concentrations in the first sample resembled the levels of a healthy individual whereas the concentrations in the second sample were consistent with observations in metastatic breast cancer patients (Figure 12B). We observed that the first sample generates a weak, yet observable, SERS signal. In contrast, the SERS intensity from the second specimen exhibits a significantly larger response in each case. We also quantified the antigen concentrations on the basis of the acquired spectra and the previously formulated PLS calibration models. The predicted values show excellent agreement with the reference concentrations with relative errors of prediction of 10.4%, 3.0% and 6.0% for CA15-3, CA 27-29 and CEA, respectively (Figure 13). Relative standard deviations were calculated to be 13.5% (CA15-3), 4.0% (CA 27-29) and 8.4% (CEA), which are deemed to be clinically acceptable. Furthermore, our result demonstrates the low interference from other biomarkers, i.e. robustness to cross- reactivity (stemming from the anti-body-antigen affinity), despite the high biomarker concentrations in the serum specimen representative of the patient sample.

[0113] Finally, we assessed the feasibility of higher throughput SERS measurements using a simpler, portable imaging system. We developed a wide-field compact scanning setup to address the limited sampling area and the substantive costs of a Raman microscope. Consisting of a laser diode and an air-cooled CCD imager, the flatbed scanner offered a large field of view (100 cm²). Despite the system's relatively lower detection sensitivity, we observed that the acquired images still allow clear differentiation between the two spiked serum samples (Figure 12C) with the sample mimicking breast cancer patient antigen levels exhibiting markedly higher SERS response. The wide field of view enables direct visualization of the entire 3x3 panel with a 5-fold reduction in acquisition time. Coupled with the facile readout of the flatbed scanner, the SERS chip promises a highly sensitive and specific tool that can be further refined to create an inexpensive, point-of-care platform.

[0114] Multiplex Nanoparticle-amplified Raman Spectroscopic assays for Detection of a panel of gene-specific methylation markers in circulating cell-free DNA. [0115] Employing the RASSF1A gene in the prototype assay, we developed a SERS assay that can detect the presence of RASSFl A methylation (Figure 5). The nanoparticle assay comprises two parts. The first part is the capture probe which is a complementary nucleic acid sequence to the CpG site of interest in the RASSFl A gene. The capture probe is conjugated to a Au nanostar particle. The second part of the assay comprises a Raman reporter molecule. In an embodiment, the reporter molecule is rhodium 6G (R6G). The SERS response is directly dependent on the incorporation of R6G into the bisulfite processed RASSFl A sequence by single base extension reaction when the target/probe pair is complementary at the methylation site.

[0116] The RASSFl A promoter region (400 bp) is cloned into a plasmid and treated with Sssl methylase. The fully methylated DNA is then bisulfite treated. A mixture of Au nanostar-modified capture probes, R6G-dGTP (deoxyguanosine triphosphate) detection probes and methylated DNA is then created. Control experiments will be performed with bisulfite processed unmethylated DNA. Taq polymerase is added to the mixture and the base extension reaction is allowed to proceed. The resultant mixture is then subjected to SERS measurements using a Raman microscope. Additionally, in some embodimentsnanosphere liftoff lithography is used to fabricate Au triangle nanoarrays on a substrate to further enhance the SERS signal due to the generation of high-density hot spots in the 3D space between the substrate and the Au nanostars. Exploiting our multiplex sensing concepts for quantification of protein biomarkers, a 10+-row array is then designed with each row devoted to detection of methylation of a single gene and evaluate the assay performance successively in spiked sera and clinical specimens collected from breast cancer patients.

[0117] By employing routine Raman spectroscopy, the present invention maximizes the cost-effectiveness and scalability of the eventual assay for circulating methylated DNA quantitation. The present invention provides new tools for surveillance of asymptomatic cancer survivors and evaluation of new therapies with general applicability to prostate and colorectal adenocarcinomas, where pathologic conditions are similarly manifest in aberrant epigenetic marker levels.

[0118] All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein. [0119] The use of the terms "a" and "an" and "the" and similar referents in the context of describing the invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms "comprising," "having," "including," and "containing" are to be construed as open-ended terms (i.e., meaning "including, but not limited to,") unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., "such as") provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.

[0120] Preferred embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.

Claims

Claims:

1. A method for surface enhanced Raman spectroscopic (SERS) detection of an antigen comprising:

a) conjugating at least a first set of antibody molecules, or functional portions thereof, specific for a first antigen to a substrate such that the F(ab)2 portion of the antibody molecules are free to bind the first antigen; b) adding a sample to the conjugated antibody molecules on the substrate of a) and incubating the mixture;

c) separating the bound fraction from the unbound fraction of the incubated mixture of b);

d) adding SERS tags comprising antibody molecules, or functional portions thereof, specific for the first antigen which are conjugated to the tags such that the F(ab)2 portion of the antibody molecules are free to bind the first antigen to the bound fraction of c) and incubating the mixture; e) separating the bound fraction from the unbound fraction of the incubated mixture of d); and

f) determining the presence of the bound antigen in the bound fraction of e) by

Raman spectroscopy.

2. The method of claim 1 , wherein two or more sets of different antibody molecules, or functional portions thereof, specific for two or more different antigens, are conjugated to the substrate in a); wherein SERS tags comprising antibody molecules, or functional portions thereof, specific for the two or more different antigens are conjugated to the tags are added in d); and determining the presence of the two or more different bound antigens in the bound fraction of e) by Raman spectroscopy.

3. The method of claims 1 or 2, wherein the substrate is a quartz, glass or silicon chip.

4. The method of claims 1 or 2, wherein the SERS tag is a particle comprising a gold nanostar core, a coating around the nanostar core comprised of a Raman reporter compound, and an outer coating comprising silicon dioxide.

5. The method of claim 4, wherein the Raman reporter compound is 4- nitrobenzenethiol .

6. The method of any of claims 1 to 5, wherein the antibodies are specific for cancer antigens.

7. The method of claim 6, wherein the number of sets of different antibody molecules is between 1 and 20.

8. The method of claim 7, wherein the number of sets of different antibody molecules is 10.

9. The method of claim 7, wherein the cancer antigens are selected from the group consisting of: CA15-3, CA 27-29, and CEA.

10. A nanoprobe-amplified Raman spectroscopic assay for methylated gene detection comprising:

a) conjugating to a substrate, one or more capture probes comprising at least a first set of single base extension reaction probes for a specific CpG methylation site of a promoter region of at least one or more genes of interest, conjugated to a surface enhanced Raman spectroscopy (SERS) substrate;

b) adding a sample of bisulfite treated DNA to the conjugated capture probes on the substrate of a), and adding a plurality of detection probes comprising dGTP covalently linked to rhodamine 6G (R6G) to the sample, and incubating the mixture with single-base extension reagents;

c) separating the sample and reagents and unincorporated detection probes from the substrate of a);

d) determining the presence of the one or more methylated single base

extension reaction probes of the genes of interest on the substrate of c) by Raman spectroscopy.

11. The method of claim 10, wherein the substrate in a) is a quartz, glass or silicon chip.

12. The method of claim 10, wherein the SERS substrate in a) is a particle comprising a gold nanostar.

13. The method of claim 10, wherein the substrate of a) has single base extension reaction probes from 1 to about 20 different genes of interest.

14. The method of claim 13, wherein the single base extension reaction probes for a specific CpG methylation site of a promoter region of at least one or more genes of interest are promoter regions of genes associated with a disease or disorder.

15. The method of claim 14, wherein the disease or disorder is cancer.

16. The method of claim 15, wherein the one or more genes of interest are selected from the group consisting of: AKRIBI, COL6A2, GPX7, HIST1H3C, HOXB4, RASGRF2 and TM6SF1, ARHGEF7, TMEFF2 and RASSF1A.