WO2017059094A2 - Système et procédé de détection d'une maladie dans des fluides corporels - Google Patents

Système et procédé de détection d'une maladie dans des fluides corporels Download PDF

Info

Publication number
WO2017059094A2
WO2017059094A2 PCT/US2016/054483 US2016054483W WO2017059094A2 WO 2017059094 A2 WO2017059094 A2 WO 2017059094A2 US 2016054483 W US2016054483 W US 2016054483W WO 2017059094 A2 WO2017059094 A2 WO 2017059094A2
Authority
WO
WIPO (PCT)
Prior art keywords
mir
nucleic acid
cancer
sample
mrna
Prior art date
Application number
PCT/US2016/054483
Other languages
English (en)
Other versions
WO2017059094A3 (fr
Inventor
Adi Mashiach
Original Assignee
Adi Mashiach
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Adi Mashiach filed Critical Adi Mashiach
Publication of WO2017059094A2 publication Critical patent/WO2017059094A2/fr
Publication of WO2017059094A3 publication Critical patent/WO2017059094A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Definitions

  • the field of the presently disclosed embodiments relates to systems and methods to detect cancer.
  • the presently disclosed embodiments provides a system and method for accurately detecting cancer in a biological sample obtained from a subject, by identifying at least two nucleic acid molecules, or at least one nucleic acid molecules and a protein in the at least one biological sample.
  • Cancer is a leading cause of morbidity and mortality. There are about 14 million new cases and over 8 million deaths from cancer worldwide on an annual basis. Early stage cancer is less likely to metastasize. Early stage cancer can be less invasive in nature and size and therefore can be either excised as a whole by surgery, or be more susceptible to chemotherapy or radiation therapy, for example. It has been shown that diagnosis of cancer in its early form increases likelihood of treatment success. Consequently, effort has been focused on finding biological lab markers, called biomarkers, in various bodily fluids that can indicate the presence of cancer early on.
  • biomarkers biological lab markers
  • miRNAs belong to a class of small noncoding Ribonucleic acids (RNAs) that function as guide molecules for gene regulation in many organisms. miRNAs play a role in cancer. For example, in some tumors, miRNAs are overexpressed with high levels of miRNA. In other tumors, the expression of specific miRNAs plays a role in cancer disease progression, as miRNAs are involved in regulation of biological processes needed for the proliferation, metabolism, signal transduction and metastasis of cancer tumor cells. [0005] However miRNA expression is an inaccurate biomarker for cancer detection.
  • miRNA can be elevated in other conditions unrelated to cancer, such as, for example, usage of aspirin and respiratory infection, thus reducing the specificity of the test. More importantly, the relationship between miRNAs and the tumor cells is not always clear; for example, detecting high levels of a certain miRNA does not mean that the miRNA is expressed and derived from cancer tumor cells or, if indeed cancer tumor cells are present in a test sample, that the miRNA has derived from the tumor cells.
  • Cancer is associated with the over expression of certain proteins. These proteins may also be mutated. Examples include P53 and its gene, TP53. P53 acts as a tumor suppressor, which prevents uncontrolled cell division and growth. Mutated P53 causes a loss of such function and allows cancer cells to develop and survive. The levels of a mutated P53 can be determined by measuring the levels of TP53 mRNA. In addition, there are enzymes, proteins and biomarker that are not mutated but their presence strongly indicates a cancer disease. One such example is telomerase.
  • Telomerase is an enzyme that enables cancer tumor cells to continue to proliferate, avoiding programmed cell death resulting from their mutations or cell aging. Therefore, Telomerase is active is almost all cancer cells. However, Telomerase activity can be found in other cells such as stem cells, reproductive cells and lymphocytes.
  • TRAP Telomeric Repeat Amplification Protocol
  • sample preparation is intricate and requires careful attention to sample collection.
  • TRAP is labor intensive and provides only qualitative results.
  • TRAP methods or assays usually involve detection based on radioactivity and polyacrylamide gel electrophoresis and require 8-10 hours of technician time.
  • the TRAP assay can only reproducibly detect two fold differences and is only quantitative when compared to internal standards and reference cell lines. Thus, TRAP cannot produce absolute quantitative results that can be standardized across different labs and testing facilities.
  • TRAP requires large number of cells in order to have enough substrate or substance to correctly identify Telomerase presence or activity. It usually requires having more than 50 cells in a sample. Most early-stage cancer tumors do not shed that number of tumor cells into bodily fluids, if at all, thus rendering the TRAP assay impractical for early cancer detection.
  • PCR Polymerase Chain Reaction
  • RT-PCR Reverse Transcription Polymerase Chain Reaction
  • PCR and RT-PCR use indirect identification of the molecules and can cause sequence bias and skew the amplification of certain favored or unfavored species. All of these methods could lead to misinterpretation of outcome data.
  • Figure 1 shows a perspective view of the housing and external interfaces of a device according to the presently disclosed embodiments.
  • Figure 2 shows a diagram of main system units and the sample processing steps according to the presently disclosed embodiments.
  • Figure 3 shows a perspective view of a Main Processing Unit according to the presently disclosed embodiments.
  • Figure 4 shows a perspective view of the Reaction Plate and Sensor Plate of the Main Processing Unit according to the presently disclosed embodiments.
  • Figure 5 shows a top view of the Reaction Plate of the Main Processing Unit according to the presently disclosed embodiments.
  • Figure 6 shows a diagram of the main steps of the method according to the presently disclosed embodiments.
  • Figure 7 shows a diagram of pre-determined rules according to some aspects of the presently disclosed embodiments that are used to identify the at least one biological condition in the subject.
  • the presently disclosed embodiments provide a system comprising: a microfluidic device configured to receive a sample containing at least one
  • RNA molecule from a subject comprising: a reaction plate containing a plurality of individual areas; wherein each individual areas comprises a nucleic acid probe configured to hybridize to a specific nucleic acid molecule; wherein each individual area is configured to generate an indication when the specific nucleic acid is bound to the nucleic acid probe; wherein at least one individual area within the plurality of individual areas comprises a unique nucleic acid probe configured to hybridize to a specific nucleic acid molecule comprising an mRNA; wherein at least one individual area within the plurality of individual areas comprises a unique nucleic acid probe configured to hybridize to a specific nucleic acid molecule comprising a non-coding RNA; a reader, configured to detect the generated indication and transmit, based on the detection, a signal; and a specifically programmed processor, to receive the transmitted signal, and execute a series of pre-defined rules, and, based on the pre-defined rules and the transmitted signal, output a result.
  • the outputted result is selected from the group consisting of: an identification of at least one biological condition, the absence of at least one biological condition, the presence of at least one biological condition, the monitoring of at least one biological condition, the diagnosis of at least one biological condition, the prediction of the subject having at least one biological condition, the prognosis of at least one biological condition, and the probability of the subject having at least one biological condition.
  • the mRNA is selected from the group consisting of telomerase mRNA, human telomerase reverse transcriptase (hTERT) mRNA, human catalytically active telomerase subunit (hTC) mRNA, MAPT (Microtubule-Associated Protein Tau) mRNA, amyloid precursor protein (APP) mRNA, and CD 14 mRNA.
  • the non-coding RNA is micro RNA (miRNA).
  • the miRNA is selected from the group consisting of: miR-135b, let-7b, let-7f, let-7g, miR-1, miR-101, miR-105, miR-106, miR-106a, miR-106b, miR-107, miR-10a-5p, miR-lOb, miR-122, miR-1229, miR-124-3p, miR-1246, miR-125, miR-1254, miR-125b, miR-126, miR-127-3p, miR-129-5p, miR-1290, miR-130, miR-130b, miR-133a, miR-133a-3p, miR-133b, miR-135, miR-138-5p, miR-141, miR-142-3p, miR-145, miR-146a, miR-146b, miR-146b-3p, miR-148a, miR-148b, miR-150, miR-150-5p, miR
  • the generated indication is selected from the group consisting of: an electrical indication and a visual indication.
  • the electrical indication is a change in surface plasmon resonance.
  • the visual indication is a change in fluorescence, wherein the change in fluorescence is at least one of a change in a wavelength of emitted light, or a change in an intensity of emitted light.
  • the change in fluorescence is mediated by an enzyme-based reaction.
  • the individual areas further comprise a hydrogel layer.
  • the system further comprises a sample collector configured to receive the sample from the subject and a sample processor configured to extract the at least one RNA molecule from the sample.
  • the system further comprises a processing unit, configured to receive the at least one RNA molecule from the sample, and transfer the at least one RNA molecule from the sample to the reaction plate.
  • the at least one biological condition is selected from the group consisting of: a cancer, a neurodegenerative disease, and an inflammatory condition.
  • the cancer is selected from the group consisting of colorectal cancer, gastric cancer, lung cancer, and breast cancer, pancreatic cancer, ovarian cancer, cervical cancer, leukemia, lymphoma, glioblastoma and other brain cancers, bladder cancer, prostate cancer, esophageal cancer, melanoma, thyroid cancer, kidney cancer, and endometrial cancer.
  • the neurodegenerative disease is selected from the group consisting of Alzheimer's Disease, Pict's disease, Parkinson's Disease, Huntington's Disease, frontotemporal dementia, cortico-basal degeneration and progressive supranuclear palsy.
  • the inflammatory disorder is selected from the group consisting of ulcerative colitis, Crohn's Disease, multiple sclerosis and systemic Lupus Erythematosus.
  • the presently disclosed embodiments provide a method, comprising: obtaining a sample from a subject; extracting at least one RNA molecule from the sample; introducing the extracted at least one RNA molecule from the sample into a microfluidic device, wherein the microfluidic devices is configured to receive the sample, the microfluidic device comprising: a reaction plate containing a plurality of individual areas; wherein each individual areas comprises a nucleic acid probe configured to hybridize to a specific nucleic acid molecule; wherein each individual area is configured to generate an indication when the specific nucleic acid is bound to the nucleic acid probe; wherein at least one individual area within the plurality of individual areas comprises a unique nucleic acid probe configured to hybridize to a specific nucleic acid molecule comprising an mRNA; wherein at least one individual area within the plurality of individual areas comprises a unique nucleic acid probe configured to hybridize to a specific nucleic acid molecule comprising a non-coding RNA; a reaction plate containing a pluralit
  • the outputted result is selected from the group consisting of: an identification of at least one biological condition, the absence of at least one biological condition, the presence of at least one biological condition, the monitoring of at least one biological condition, the diagnosis of at least one biological condition, the prediction of the subject having at least one biological condition, the prognosis of at least one biological condition, and the probability of the subject having at least one biological condition.
  • the mRNA is selected from the group consisting of telomerase mRNA, human telomerase reverse transcriptase (hTERT) mRNA, human catalytically active telomerase subunit (hTC) mRNA, MAPT (Microtubule-Associated Protein Tau) mRNA, amyloid precursor protein (APP) mRNA, and CD 14 mRNA.
  • hTERT human telomerase reverse transcriptase
  • hTC human catalytically active telomerase subunit
  • MAPT Microtubule-Associated Protein Tau
  • APP amyloid precursor protein
  • the non-coding RNA is micro RNA (miRNA).
  • the miRNA is selected from the group consisting of: miR-135b, let-7b, let-7f, let-7g, miR-1, miR-101, miR-105, miR-106, miR-106a, miR-106b, miR-107, miR-10a-5p, miR-lOb, miR-122, miR-1229, miR-124-3p, miR-1246, miR-125, miR-1254, miR-125b, miR-126, miR-127-3p, miR-129-5p, miR-1290, miR-130, miR-130b, miR-133a, miR-133a-3p, miR-133b, miR-135, miR-138-5p, miR-141, miR-142-3p, miR-145, miR-146a, miR-146b, miR-146b-3p, miR-148a, miR-148b, miR-150, miR-150-5p, miR
  • the generated indication is selected from the group consisting of: an electrical indication and a visual indication.
  • the electrical indication is a change in surface plasmon resonance.
  • the visual indication is a change in fluorescence, wherein the change in fluorescence is at least one of a change in a wavelength of emitted light, or a change in an intensity of emitted light.
  • the change in fluorescence is mediated by an enzyme-based reaction.
  • the individual areas further comprise a hydrogel layer.
  • the system further comprises a sample collector configured to receive the sample from the subject and a sample processor configured to extract the at least one RNA molecule from the sample.
  • the system further comprises a processing unit, configured to receive the at least one RNA molecule from the sample, and transfer the at least one RNA molecule from the sample to the reaction plate.
  • the at least one biological condition is selected from the group consisting of: a cancer, a neurodegenerative disease, and an inflammatory condition.
  • the cancer is selected from the group consisting of colorectal cancer, gastric cancer, lung cancer, and breast cancer, pancreatic cancer, ovarian cancer, cervical cancer, leukemia, lymphoma, glioblastoma and other brain cancers, bladder cancer, prostate cancer, esophageal cancer, melanoma, thyroid cancer, kidney cancer, and endometrial cancer.
  • the neurodegenerative disease is selected from the group consisting of Alzheimer's Disease, Pict's disease, Parkinson's Disease, Huntington's Disease, frontotemporal dementia, cortico-basal degeneration and progressive supranuclear palsy.
  • the inflammatory disorder is selected from the group consisting of ulcerative colitis, Crohn's Disease, multiple sclerosis and systemic Lupus Erythematosus.
  • the term “detection” or “identifying” means screening, diagnosing, prediction, monitoring, and prognosis of at least one biological condition.
  • cancer means the presence of malignant tumor, presence of pre-malignance tumor, presence of pre-cancerous tumor, presence of benign tumor, presence of cells that will develop into tumor cells.
  • the system and methods of the presently disclosed embodiments utilize samples obtained from a subject.
  • the system and methods of the presently disclosed embodiments detect at least two different nucleic acids, wherein the results of the detection are further utilized to identify at least one biological condition in the subject.
  • the sample is obtained from the subject's bodily fluids.
  • bodily fluids suitable for use in the system and methods according to some aspects of the presently disclosed embodiments include: blood, serum, plasma, urine, semen, fecal matter, colonic washing, cervical smear, saliva, cerebrospinal fluid, tears, sweat, gastric lavage, gastric fluids, sputum, bronchoalveolar lavage, mucus, peritoneal fluid, pleural fluid, cyst fluid, nipple aspirate, bile fluid, bone marrow, and the like.
  • the sample may be obtained from a biopsy of solid tissue, such as, for example, a liver biopsy, a lung biopsy, and the like.
  • the presently disclosed embodiments are a system and method that enables the identification of at least one biological condition in a subject.
  • the presently disclosed embodiments are comprised of an automated processing system that analyzes samples obtained a subject, such as, for example, bodily fluid samples.
  • the sample is prepared automatically in the system and nucleic acids such as DNA, cell-free DNA (cfDNA), RNA, mRNA, miRNA are extracted and analyzed.
  • the extracted nucleic acids are introduced into a microfluidic device containing a plurality of individual areas. The individual areas are configured to generate an indication, which is in turn, read by a reader.
  • the reaction plate and the reader are referred to as the Main Processing Unit ("MPU").
  • the nucleic acid probe configured to hybridize to a specific nucleic acid molecule is unlabeled.
  • the system is further configured to generate a detectable label only when the specific nucleic acid molecule is hybridized (i.e. bound) to the nucleic acid probe.
  • the system is further configured to capture and optionally label the specific nucleic acid molecule hybridized (i.e. bound) to the nucleic acid probe without requiring a user intervention.
  • a reaction such as an enzyme-assisted amplification reaction or enzymatic amplification reaction, takes place within each individual area, where the result of the reaction can be read by a sensor.
  • the individual area enables the compartmentalization of the enzymatic reaction by confining the sample into a smaller volume, thereby essentially creating a confined compartment wherein the reaction takes place.
  • Integrating or embedding nucleic acid probes allows capturing of specific nucleic acid molecule in the individual area. Without intending to be limited to any particular theory, having a smaller, confined volume with the specific nucleic acid molecule captured within using a probe allows the enzymatic reaction to repeat itself and thereby amplifying the signal inside the confined compartment of the reaction member. In this manner, there is a direct identification of the specific nucleic acid molecule without the artificial amplification of the specific nucleic acid molecule as required in other methods in the art.
  • the repetition of the reaction leads to enhancement of the signal, which allows identification of the specific nucleic acid molecule, which otherwise may have been impossible, or inaccurate.
  • irrelevant nucleic acids present in the sample could be amplified, thus the specific nucleic acid molecule would still be difficult to detect.
  • the primer being used can non- specifically bind to other nucleic acids.
  • Another aspect of the system and method of the presently disclosed embodiments may contain a sensor that generates a signal as a result of binding of a nucleic acid to a probe, the probe being part of the sensor.
  • One advantage of the system according to some aspects of the presently disclosed embodiments is that the system can perform the generation of the indication in isothermal conditions, without requiring the use of additional devices such a thermal cycler.
  • the generated signal is then measured quantitatively by an array of sensors in the reader.
  • the presently disclosed embodiments provide a system comprising: a microfluidic device configured to receive a sample containing at least one RNA molecule from a subject, the microfluidic device comprising: a reaction plate containing a plurality of individual areas; wherein each individual areas comprises a nucleic acid probe configured to hybridize to a specific nucleic acid molecule; wherein each individual area is configured to generate an indication when the specific nucleic acid is bound to the nucleic acid probe; wherein at least one individual area within the plurality of individual areas comprises a unique nucleic acid probe configured to hybridize to a specific nucleic acid molecule comprising an mRNA; wherein at least one individual area within the plurality of individual areas comprises a unique nucleic acid probe configured to hybridize to a specific nucleic acid molecule comprising a non-coding RNA; a reader, configured to detect the generated indication and transmit, based on the detection, a signal; and a specifically programmed processor, to receive the
  • the outputted result is selected from the group consisting of: an identification of at least one biological condition, the absence of at least one biological condition, the presence of at least one biological condition, the monitoring of at least one biological condition, the diagnosis of at least one biological condition, the prediction of the subject having at least one biological condition, the prognosis of at least one biological condition, and the probability of the subject having at least one biological condition.
  • the presently disclosed embodiments a system comprising: a microfluidic device configured to receive a sample containing at least one RNA molecule from a subject, the microfluidic device comprising: a reaction plate containing a plurality of individual areas; wherein each individual areas comprises a nucleic acid probe configured to hybridize to a specific nucleic acid molecule; wherein each individual area is configured to generate an indication when the specific nucleic acid is bound to the nucleic acid probe; wherein at least one individual area within the plurality of individual areas comprises a unique nucleic acid probe configured to hybridize to a specific nucleic acid molecule comprising an mRNA; wherein at least one individual area within the plurality of individual areas comprises a unique nucleic acid probe configured to hybridize to a specific nucleic acid molecule comprising a non-coding RNA; and a reader, configured to detect the generated indication and transmit, based on the detection, a signal; and
  • the data is used to either identify at least one biological condition, determine the absence of at least one biological condition, determine the presence of at least one biological condition, monitor the least one biological condition, diagnose the least one biological condition, predict the probability of the subject having the at least one biological condition, provide a prognosis of at least one biological condition, or determine, or provide the probability of the subject having at least one biological condition.
  • the expression of the mRNA is used to identify, detect, monitor, diagnose, or predict at least one biological condition, according to certain aspects of the presently disclosed embodiments.
  • Any biological condition may be identified, detected, monitored, diagnosed, or predicted, according to certain aspects of the presently disclosed embodiments.
  • the at least one biological condition is selected from the group consisting of: a cancer, a neurodegenerative disease, and an inflammatory condition.
  • the mRNA is selected from the group consisting of telomerase mRNA, human telomerase reverse transcriptase (hTERT) mRNA, human catalytically active telomerase subunit (hTC) mRNA, MAPT (Microtubule-Associated Protein Tau) mRNA, amyloid precursor protein (APP) mRNA, and CD 14 mRNA.
  • hTERT human telomerase reverse transcriptase
  • hTC human catalytically active telomerase subunit
  • MAPT Microtubule-Associated Protein Tau
  • APP amyloid precursor protein
  • the non-coding RNA is micro RNA (miRNA).
  • the miRNA is selected from the group consisting of: miR- 135b, let-7b, let-7f, let-7g, miR-1, miR-101, miR-105, miR-106, miR-106a, miR-106b, miR- 107, miR-10a-5p, miR-lOb, miR-122, miR-1229, miR-124-3p, miR-1246, miR-125, miR- 1254, miR-125b, miR-126, miR-127-3p, miR-129-5p, miR-1290, miR-130, miR-130b, miR- 133a, miR-133a-3p, miR-133b, miR-135, miR-138-5p, miR-141, miR-142-3p, miR-145, miR-146a, miR-146b, miR-146b-3p, miR-148a, miR-148b, miR-150, miR-150, miR-150
  • the system of the presently disclosed embodiments can indicate the overlapping presence of both telomerase mRNA and tumor-associated miRNAs, thus allowing the detection of cancer, such as reporting the cancer detection, displaying or transmitting a report of tumor type and tumor stage. This can be done in a Point-Of-Care setting, such as a doctor's office, by virtue of the system's and method's simplicity of operation and option for automated operation.
  • Figure 1 there is a System 100 having a Sample Collector Opening 110, an Indicator 120, an Opening 130 for applying and replacing a microfluidic device, a Sample Container 140 and a Sample 150.
  • the Sample Collector Opening 110 is configured to collect a sample from Sample 150 from Sample Container 140.
  • the Sample Collector Opening 110 may be covered by a removable lid.
  • Sample Collector Opening 110 may be in a form of a basin.
  • Sample Collector Opening 110 may contain a flushing device (not shown) to ensure proper collection of the sample.
  • Sample Collector Opening 110 may contain a suction mechanism to ensure proper collection of the Sample 150.
  • Sample Collector Opening 110 may be configured to the shape of sample container 140, allowing only the insertion of a single sample container 140 at a time.
  • Sample container 140 may be configured to the shape of Sample Collector Opening 110.
  • Sample Container 140 may contain material/s to allow better storage of Sample 150 such as, for example, Ethylenediaminetetraacetic acid (EDTA).
  • EDTA Ethylenediaminetetraacetic acid
  • Sample 150 may contain different types of bodily fluids. Sample 150 may have a volume of less than 125ml. In other embodiments, Sample 150 may have a volume of less than 100ml. In other embodiments, Bodily Fluid Sample 150 may have a volume of less than 50ml. In other embodiments, Sample 150 may have a volume of less than 25ml. In other embodiments, Sample 150 may have a volume of less than 10ml. In other embodiments, Sample 150 may have a volume of less than 5ml. In other embodiments, Sample 150 may have a volume of less than lml. In other embodiments, Sample 150 may have a volume of less than 0.5ml. In other embodiments, Sample 150 may have a volume of less than 0.1ml. In other embodiments, Sample 150 may have a volume of less than 0.05ml. In other embodiments, Sample 150 may have a volume of less than 0.025ml. In other embodiments, Sample 150 may have a volume of less than 0.01ml.
  • the Indicator 120 may be configured to display any of, for example: instructions to the users, indication of system status, indication of progression of the test, or results of the test. In some embodiments, Indicator 120 may include an LCD screen.
  • Figure 2 shows a diagram of main units and processing steps of System 100.
  • the Sample Collector Opening 110 allows Sample 150 to flow into Sample Collector 200.
  • Sample Collector 200 may contain a sensor to measure at least one of, for example: the volume, weight, temperature, consistency, color, transparency, and electric conductivity of Sample 150.
  • Sample Collector 200 may then allow Sample 150 to pass to Sample Preprocessor 210.
  • Sample 150 is mixed with additional materials in Sample Preprocessor 210, in order to facilitate the flow of Sample 150 through the system.
  • Sample 150 is mixed with additional materials to promote release of nucleic acids or proteins.
  • Sample 150 is mixed with additional materials in order to prevent destruction or denaturation of nucleic acids or proteins which may reduce the ability to identify them.
  • Sample Preprocessor 210 queries Reagent Container 220 for the necessary materials to add to Sample 150, for example, based on predefined protocol or measurements performed by a sensor in Sample Collector 200.
  • Sample Preprocessor 210 may receive from Reagent Container 220 at least one of, for example: air, saline, EDTA, RNAse inhibitor, DNAse inhibitor, polyhydroxylated compounds such as glycerol, protease inhibitors such as phenylmethylsulfonyl fluoride, PMSF 4-(2-aminoethyl)-benzenesulfonyl Fluoride hydrochloride, AEBSF, pepstatin A, SUPERase In RNase Inhibitor, Ion chelators such as EDTA, EGTA, dithiothreitol, ⁇ - mercaptoethanol or other stabilizing agents may be included, phosphate buffered saline, Taq polymerase, Chaps lysis buffer, Taq DNA Polymerase, T4 Pplyneucleotide kinase, bicinchoninic acid, dielthyl pyrocarbonate, Guanidinium thiocyanate and
  • Sample Preprocessor 210 may add from Reagent Container 220, reagents including EDTA, phosphate buffer saline, RNAse inhibitor, DNAse inhibitor.
  • Sample Preprocessor 210 may include a separation device such as, for example, a sedimentation based separation device, for example a centrifuge. In such embodiment, Sample Preprocessor 210 may then extract liquid only or sediment only component of Sample 150 and discard the remainder to container in Waste 240.
  • Sample Preprocessor 210 then passes the processed Sample 150 to Flow Device 230.
  • Flow Device 230 modulates the flow of fluid from processed Sample 150 onto Main Processing Unit 250.
  • Flow Device 230 may use microfluidics.
  • Flow Device 230 may allow continuous flow from Flow Device 230 to Main Processing Unit 250.
  • the reaction plate and the reader are referred to as the Main Processing Unit ("MPU").
  • Flow Device 230 may allow intermittent flow to Main Processing Unit 250. In other embodiments, Flow Device 230 is controlled by Main Processing Unit 250 to release or stop releasing of fluid from Flow Device 230 to Main Processing Unit 250. In some embodiments, Flow Device 230 may contain a capillary network. In some embodiments, Flow Device 230 may create a series of droplets. In some embodiments, Flow Device 230 may contain additional liquids, such as, for example, oil in order to facilitate droplet creation. In other embodiments, Flow Device 230 may contain additional liquids such as Phosphate Buffered Saline or Oil that are released onto Main Processing Unit 250 before, concurrently with, or after the flow of processed Sample 150 from Flow Device 230 to Main Processing Unit 250.
  • Main Processing Unit 250 receives the further processed Sample 150 from Flow Device 230 and performs the identification processing steps.
  • the identification processing steps may include capturing and labeling of specific nucleic acid molecules and at least one of qualitatively or quantitatively analyzing and processing of the bound specific nucleic acid molecules.
  • Main Processing Unit 250 then communicates with Output Device/Monitor 260 with the output results, errors, messages to user, progress indication and the like, collectively referred hereunder as output.
  • Output Device/Monitor 260 may be connected to Indicator 120 for displaying of a message.
  • Output Device/Monitor 260 may contain wireless communications means such as Bluetooth or WiFi.
  • Output Device/Monitor 260 may transmit output to an external device such as a computer or smartphone.
  • FIG. 3 shows components of Main Processing Unit 250 (MPU) according to some aspects of the presently disclosed embodiments.
  • Main Processing Unit 250 includes In-flow connector 310 that receives processed Sample 150 from Flow Device 230; Out-flow connector 340 that flushes remainder of processed Sample 150 to Waste 240; Reaction Plate 320; and Sensor Plate (or reader) 330.
  • Sensor Plate (or reader) 330 is integrated within Reaction Plate 320.
  • Main Processing Unit 250 is packaged as one unit.
  • Main Processing Unit 250 is used once for each Sample 150. In these embodiments, Main Processing Unit 250 may be replaced from test to test.
  • the user may remove and replace Main Processing Unit 250 through Opening 130.
  • only Reaction Plate 320 is replaced from test to test through Opening 130.
  • Reaction Plate 320 is combined with Sensor Plate (or reader) 330 before insertion through Opening 130.
  • Reaction Plate 320 is integrated with Sensor Plate (or reader) 330 and both are inserted through Opening 130.
  • Main Processing Unit 250 has a form of a cartridge.
  • Reaction Plate 320 has a form of a cartridge.
  • Reaction Plate 320 and Sensor Plate (or reader) 330 are combined into a form of a cartridge.
  • Opening 130 is in a shape that allows said cartridge to be inserted and removed through Opening 130.
  • FIG. 4 shows further details of Main Processing Unit 250 according to some aspects of the presently disclosed embodiments.
  • Main Processing Unit 250 includes a Reaction Plate 320 and a Sensor Plate (or reader) 330.
  • Reaction Plate 320 contains at least two individual areas.
  • Reaction Plate 320 is configured to include necessary materials for capturing and/or identifying of specific nucleic acids. The materials may be embedded on different areas on Reaction Plate 320. As the materials are embedded on Reaction Plate 320, there is no requirement to prepare the reaction manually and thereby the overall processing time is reduced, throughput is increased, and the test may be automated.
  • the option to automate the system enables the system to be used in a Point-Of-Care setting, such as a doctor's office or a clinic.
  • the system does not require special laboratory conditions or environment thus does not need to be placed in a specially designed room and can be placed on a tabletop in an office, for example.
  • the system is automated, there is no need for a laboratory technician to operate the system.
  • the Sample 150 can be easily collected by a healthcare practitioner such as a nurse or a doctor or collected at home by the patient and provided to the Point-Of-Care for further analysis.
  • Reaction Plate 320 contains a porous hydrogel.
  • the hydrogel has a porosity configured to retain nucleic acid.
  • the porosity may be configured by selecting particular starting monomer solutions.
  • a starting monomer solutions may be made from at least one of Polyethylene Glycol Diacrylate, Polyethylene Glycol, Darocur- 1173 and 3X Tris-EDTA Buffer.
  • individual areas 410 and 420 contain a porous hydrogel.
  • both Reaction Plate 320 and individual areas 410 and 420 contain porous hydrogel, but the hydrogel of individual areas 410 and 420 has different dimensions than the hydrogel of Reaction Plate 320, for example: the hydrogel of individual areas 410 and 420 may have higher height than the hydrogel of Reaction Plate 320.
  • Reaction Plate 320 is does not contain hydrogel and made from inert materials or non-porous materials such as glass.
  • individual areas 410 and 420 are made from a hydrogel embedded on Reaction Plate 320.
  • Individual areas 410 and 420 may have a height of less than ⁇ . In some embodiments, individual areas 410 and 420 may have a height of less than 75 ⁇ . In some embodiments, individual areas 410 and 420 may have a height of less than 50 ⁇ . In some embodiments, individual areas 410 and 420 may have a height of less than 40 ⁇ . In some embodiments, individual areas 410 and 420 may have a height of less than 35 ⁇ .
  • individual areas 410 and 420 may have a height of less than 30 ⁇ . In some embodiments, individual areas 410 and 420 may have a height of less than 20 ⁇ . In some embodiments, individual areas 410 and 420 may have a height of less than ⁇ . In some embodiments, individual areas 410 and 420 may have a height of less than 5 ⁇ . In some embodiments, individual areas 410 and 420 may have a height of less than ⁇ ⁇ . In some embodiments, individual areas 410 and 420 may have a height of less than 0.5 ⁇ . In some embodiments, individual areas 410 and 420 may have a height of less than 0.1 ⁇ .
  • each of individual areas 410 and 420 is configured to have a volume of less than 500pL. In some embodiments, each of individual areas 410 and 420 is configured to have a volume of less than 400pL. In some embodiments, each of individual areas 410 and 420 is configured to have a volume of less than 300pL. In some embodiments, each of individual areas 410 and 420 is configured to have a volume of less than 250pL. In some embodiments, each of individual areas 410 and 420 is configured to have a volume of less than 200pL. In some embodiments, each of individual areas 410 and 420 is configured to have a volume of less than lOOpL.
  • each of individual areas 410 and 420 is configured to have a volume of less than 75pL. In some embodiments, each of individual areas 410 and 420 is configured to have a volume of less than 50pL. In some embodiments, each of individual areas 410 and 420 is configured to have a volume of less than 40pL. In some embodiments, each of individual areas 410 and 420 is configured to have a volume of less than 30pL. In some embodiments, each of individual areas 410 and 420 is configured to have a volume of less than 20pL. In some embodiments, each of individual areas 410 and 420 is configured to have a volume of less than lOpL. In some embodiments, each of individual areas 410 and 420 is configured to have a volume of less than 5pL. In some embodiments, each of individual areas 410 and 420 is configured to have a volume of less than lpL.
  • the hydrogels are made from at least one of poly (vinyl alcohol), poly(ethylene glycol) (PEG), and poly(acrylic acid), proteins such as collagen and gelatin, polysaccharides such as starch, alginate, and agarose; acrylamide, acrylic acid, salts of acrylic acid including sodium and sulfopropyl acrylates, and 2-hydroxyethyl methacrylate.
  • the hydrogels in individual areas 410 and 420 contains nucleic acid probes bound to the hydrogel. Such nucleic acid probes are configured to capture specific nucleic acid molecule from Sample 150. Each individual areas contains one specific type of nucleic acid probe.
  • the concentration of the nucleic acid probe in a hydrogel in one individual area is less than 50 ⁇ . In some embodiments, the concentration of the nucleic acid probe in a hydrogel in one individual area is less than 40 ⁇ . In some embodiments, the concentration of the nucleic acid probe in a hydrogel in one individual area is less than 30 ⁇ . In some embodiments, the concentration of the nucleic acid probe in a hydrogel in one individual area is less than 25 ⁇ .
  • the concentration of the nucleic acid probe in a hydrogel in one individual area is less than 20 ⁇ . In some embodiments, the concentration of the nucleic acid probe in a hydrogel in one individual area is less than 10 ⁇ . In some embodiments, the concentration of the nucleic acid probe in a hydrogel in one individual area is less than 5 ⁇ . In some embodiments, the concentration of the nucleic acid probe in a hydrogel in one individual area is less than ⁇ ⁇ . In some embodiments, the concentration of the nucleic acid probe in a hydrogel in one individual area is less than 0.5 ⁇ . In some embodiments, the concentration of the nucleic acid probe in a hydrogel in one individual area is less than 0.1 ⁇ .
  • Reaction Plate 320 contains at least two individual areas and each individual area may contain different reagents, materials, indirectly detectable moieties or nucleic acid probes.
  • Reaction Plate 320 and individual areas 410 and 420 may include on at least part of Reaction Plate 320 or individual areas 410 or individual areas 420, additional reaction materials. In some embodiments, Reaction Plate 320 and individual areas 410 and 420 may require application of additional reaction materials that are not contained within Reaction Plate 320 or individual areas 410 and 420 and are contained within Reagent Container 220.
  • Additional reaction materials may be one of a dye agent, for example, tetrazolium dye, oxidoreductase, glucose-6-phosphate dehydrogenase, chemiluminescence, luciferase; an enzyme such as horse radish peroxidase, alkaline phosphatase; biotin, or a hapten such as digoxigenin; an antibody probe conjugated to a radiolabel, fluorophore, chromophore, chemiluminescent moiety, or enzyme; one member of an affinity pair or indirectly detectable moieties, such as biotin that can be detected by avidin or streptavidin; radiolabels such as 3H, 1251, 35S, 14C, 32P, and 33P; luminopores such as inorganic dyes, fluorophores, phosphophores, light absorbing nanoparticles such as Gold, Silver, Platinum, Palladium; organic dyes such as cous, cous, cousulfonic
  • Reaction Plate 320 contains a material that enables the flow of Sample 150, such as glass.
  • individual areas 410 and individual areas 420 are configured to a shape of a well to capture part of Sample 150.
  • each of individual areas 410 and individual areas 420 may contain at least one nucleic acid probe.
  • individual areas 410 and individual areas 420 may contain at least one sensor associated with the at least one nucleic acid probes.
  • An exemplary sensor maybe one of, but not limited to high-performance fluorogenic probes, plasmonic sensors, plasmonic sensors with gold nanoparticles such as gold prisms, magnetic fluorescent microbeads, magnetic fluorescent microbeads, padlock probes, Indium tin oxide electrode, Interdigitated microelectrodes, Graphite electrode using inosine-modified probes, PNA, LNA, and DNA probe modified micro-beads, Silicon nanowire, Pencil graphite electrode, Electrode chip, Nanopore using viral protein pi 9, Nanopore using alpha-hemolysin, Nuclease digestion on gold electrode, Ruthenium oxide nanoparticle -labeled probes, Tetrahedron probes on gold electrode, Molecular beacons on gold electrode, Microelectrode array, Au NP -modified Au electrode, Ruthenium oxide nanoparticle-based assay, Graphene and dendritic gold nano- structured glassy carbon electrode, Molecular switching amperometry on graphene-modified
  • binding of a specific nucleic acid molecule in Sample 150 to a nucleic acid probe and associated sensor within individual areas 410 and/or individual areas 420 will result in a signal generated by the at least one sensor.
  • Such signal maybe at least one of electrical, fluorescence, infra-red, light, vibratory, magnetic, temperature signal.
  • the reader or Sensor Plate 330 may be connected to at least one of sensors to read a signal.
  • Sensor Plate (reader) 330 may read or query a signal from at least one of sensors in individual areas 410 and individual areas 420 periodically or continuously.
  • Sensor Plate (reader) 330 may identify a binding of a specific nucleic acid molecule to the at least on of nucleic acid probes as a change in a signal.
  • additional reaction materials are required to be applied to at least one of Reaction Plate 320, individual areas 410 and/or individual areas 420 following the initial deposition of processed Sample 150 onto Reaction Plate 320.
  • Sample Preprocessor 210 passes additional reaction materials from Reagent Container 220 to Flow Device 230.
  • Sample Preprocessor 210 passes additional reaction materials from Reagent Container 220 directly to In-flow connector 310.
  • Main Processing Unit 250 may control Sample Preprocessor 210 and cause Sample Preprocessor to obtain additional reaction materials from Reactant Container 220 and pass them to Flow Device 230 or directly to In-flow Connector 310.
  • individual areas 410 and 420 may contain a material by having material incorporated in or introduced into individual areas 410 and 420 following the initial deposition of processed Sample 150. As such, individual areas 410 and 420 contain at the point of time when the reaction takes place all the necessary materials for the reaction.
  • individual areas 410 and 420 contain at least nucleic acid probes configured to detect a specific nucleic acid.
  • individual areas 410 and individual areas 420 may contain, in addition to the at least nucleic acid probes a sensor such as a plasmonic containing a gold nanoparticle.
  • the gold nanoparticles may be configured to a shape of a prism with an average edge length of 35nm.
  • Such example of building a gold nanoparticle prism plasmonic sensor is described in "Highly Specific Plasmonic Biosensors for Ultrasensitive MicroRNA Detection in Plasma from Pancreatic Cancer Patients, Gayatri K. Joshi, Samantha Deitz-McElyea, Merrell Johnson, Sonali Mali, Murray Korc, and Rajesh Sardar Nano Letters 2014 14 (12), 6955-6963".
  • individual areas 410 and individual areas 420 may contain, in addition to the at least nucleic acid probes, a material that enables the indirect detection of binding of a nucleic acid to a nucleic acid probe.
  • An exemplary material can be an enzyme that interacts with nucleic acid probes, such as a streptavidin-conjugated enzyme (SAB).
  • SAB streptavidin-conjugated enzyme
  • individual areas 410 and individual areas 420 are loaded with a substance that is made visible by the enzyme such as a fluorescence substrate such as fluorescein-di-B- galactopyranoside or Resorufin-B-galactopyranoside.
  • individual areas 410 and 420 may contain a nucleic acid bound to a molecule such as Biotin as a Universal Adapter.
  • the enzyme interacts with the florescence substrate only when both the target nucleic acid and the Universal Adapter are bound to the nucleic acid probe. Lack of binding of the specific nucleic acid to the nucleic acid probe will cause the Universal Adapter not to bind to the probe and thus no enzymatic reaction will take place.
  • individual areas 410 and individual areas 420 may contain a nucleic acid probe, an enzyme and a dye molecule such as a fluorescence dye substrate, such that when a nucleic acid binds to a nucleic acid probe, an enzymatic reaction is triggered, whereas said enzyme interacts with a fluorescence substrate and subsequently causes a change in color or fluorescence that can be then interpreted quantitatively as a presence of nucleic acid.
  • enzymatic reaction takes place as longs as all said materials are still available and unconsumed. As such, the change in color or change in fluorescence will continue as long as there are unconsumed enzymes bound to the nucleic acid and dyes to be modified by the enzyme.
  • individual areas 410 may contain a plurality of nucleic acid probes, such as, for example, at least one probe configured to hybridize to telomerase mRNA.
  • Other probes may be specific for a micro-
  • the probe configured to hybridize to the specific nucleic acid molecule may hybridize 100% of the specific nucleic acid molecule. Alternatively, the probe configured to hybridize to the specific nucleic acid molecule may hybridize to 90%, 80%, 70%, 60%, 50%, 40%, 30%), 20%), 10%), or less of the specific nucleic acid molecule. Such configuration may be necessary to ensure sufficient affinity, or specificity, or both. Furthermore, the amount of the probe configured to hybridize to the specific nucleic acid molecule may be incorporated onto an individual area in an amount sufficient to capture the specific nucleic acid molecule. Factors that govern the choice of the amount of the specific nucleic acid molecule to be incorporated include, but are not limited to, the specificity of the probe, and the affinity of the probe to the specific nucleic acid molecule.
  • an individual area includes a probe configured to hybridize to telomerase mRNA, having the sequence of 5'- ACCGTCTGCGTGAGGAGATC-3 ' , 5'- CCGGTAGAAAAAAGAGCCTGTT -3', 5 ' -TACGTCGTCGAGCTGCTC AGGTCTTT-3 ; an enzyme such as Streptavidin-P-galactosidase; an enzyme-activated fluorescence dye such as Fluorescein-di-P-galactopyranoside; and a Universal Adapter including Biotin.
  • an enzyme such as Streptavidin-P-galactosidase
  • an enzyme-activated fluorescence dye such as Fluorescein-di-P-galactopyranoside
  • a Universal Adapter including Biotin.
  • the generated indication is selected from the group consisting of: an electrical indication and a visual indication.
  • the electrical indication is a change in surface plasmon resonance.
  • the visual indication is a change in fluorescence, wherein the change in fluorescence is at least one of a change in a wavelength of emitted light, or a change in an intensity of emitted light.
  • the change in fluorescence is mediated by an enzyme-based reaction.
  • individual areas 410 and 420 contain nucleic acid probes.
  • Flow Device 320 is configured to first flow Sample 150 into individual areas 410 and 420, thereby allowing the capturing of the specific nucleic acid molecules by nucleic acid probes in individual areas 410 and 420.
  • Flow Device 320 is then configured to flow additional reaction materials. With each flow cycle, different materials are captured and added to the individual areas 410 and 420.
  • Flow Device 320 is configured to flow a non-water soluble material such as mineral oil such as FC-40. Without intending to be limited to any particular theory, the oil causes effective sealing of each of individual areas 410 and 420.
  • FC-40 non-water soluble material
  • nucleic acid molecules can be detected in quantities of less than 75ng. In some embodiments, specific nucleic acid molecules can be detected in quantities of less than 50ng. In some embodiments, specific nucleic acid molecules can be detected in quantities of less than 40ng. In some embodiments, specific nucleic acid molecules can be detected in quantities of less than 30ng. In some embodiments, specific nucleic acid molecules can be detected in quantities of less than 25ng. In some embodiments, specific nucleic acid molecules can be detected in quantities of less than 20ng.
  • specific nucleic acid molecules can be detected in quantities of less than lOng. In some embodiments, specific nucleic acid molecules can be detected in quantities of less than 5ng. In some embodiments, specific nucleic acid molecules can be detected in quantities of less than lng. In some embodiments, specific nucleic acid molecules can be detected in quantities of less than 0.5ng. In some embodiments, specific nucleic acid molecules can be detected in quantities of less than O. lng.
  • the signal derived from the change in dye or fluoresces, is increased to a detectable level, without any change or need however to replicate or amplify the nucleic acids themselves.
  • the signal is dependent on binding of a specific nucleic molecule to a nucleic acid probe as part of the enzymatic reaction.
  • the enzymatic reaction is based on the use of a nucleic acid probe and not a DNA primer, there is no risk of nonspecifically binding to other nucleic acids. As a result, the detection process is more accurate and less prone to errors.
  • Sensor Plate (reader) 330 may detect a binding of at least one specific nucleic acid molecule to an at least one nucleic acid probe independent of an enzymatic reaction and/or independent of confinement of a reaction in individual area 410 and individual areas 420.
  • individual areas 410 and 420 are configured to essentially confine a reaction, such as an enzymatic amplification reaction.
  • a reaction such as an enzymatic amplification reaction.
  • Confinement of a reaction allows the reaction to repeat itself. For example, having the nucleic acid confined inside individual areas 410 and individual areas 420 allows more enzymes to activate fluorescence substrate thereby increasing the signal detected by Main Processing Unit 250.
  • the reaction panel captures the specific nucleic acid molecule, in part, due to the configured porosity of a hydrogel.
  • the confinement of the reaction by individual areas 410 and individual areas 420 enables the specific nucleic acid molecule and any additional reaction materials to interact longer at a smaller volume of the specific nucleic acid molecule. Without confinement, the specific nucleic acid molecule and additional reaction materials may flow out of individual area 410 and 420 and only a brief, transient reaction would occur. In such cases, a signal would be detectable only if large amounts of the specific nucleic acid molecule are bound to the nucleic acid probe.
  • processed Sample 150 may contain small amounts of telomerase mRNA as an exemplary Telomerase Activity Indicator. Such small amounts are usually not detected by conventional means that are not sensitive enough (e.g. TRAP Assay, RT-PCR, Q-PCR or Digital Droplet PCR).
  • a hydrogel is configured to contain the telomerase mRNA. Telomerase mRNA then binds to the nucleic acid probes, which is then complemented by binding of the Universal Adapter with Biotin. The enzyme then binds to the complex and cleaves the fluorescence substrate.
  • telomerase mRNA As this enzymatic reaction is confined within individual areas 410 and individual areas 420, as time passes, more telomerase mRNA can bind to the probes, with additional usage of Universal Adapter, enzyme and fluorescence substrate, and without flowing out of individual areas 410 and individual areas 420, thus producing a detectable signal.
  • at least one of individual areas 410 and individual areas 420 may contain a nucleic acid probe configured to bind to telomerase mRNA, and a sensor such as a plasmonic sensor containing gold nanoparticle associated with the nucleic acid probe.
  • each binding event of a telomerase mRNA to a nucleic acid probe and associate sensor produces a signal and/or a change of a periodically or continuously measured signal.
  • individual areas 410 may contain probes to detect at least one miRNA and individual areas 420 may contain probes to detect at least one of Telomerase Activity Indicator, such as, for example, telomerase mRNA.
  • Telomerase Activity Indicator such as, for example, telomerase mRNA.
  • telomerase is known to have high specificity for cancer tumors and occurs in all tumor cells, and in some degree in stem cells and reproductive cells.
  • Telomerase Activity Indicator means at least one of, for example: presence of hTERT protein, quantity of hTert protein, length of telomeres repeats (TTAGGG), the presence and quantity of telomerase RNA template, human catalytically active telomerase subunit (hTC), mRNA of hTert, mRNA of hTC.
  • Activity of Telomerase can be measured by at least one of, for example: Telomere Length, presence of hTert enzyme, quantities of hTert enzyme, amounts of DNA repeats produced by Telomerase, RNA transcripts of hTERT; all individually or combined may be referred to as Telomerase Activity.
  • the enzymatic reaction in individual areas 410 and 420 is read using Sensor Plate (reader) 330.
  • enzymatic reaction in individual areas 410 and 420 results in change in fluorescence that can be measured using spectrometry, comprised of a Light Source 440 and a Photo Detector 450.
  • light Source 440 is comprised for example from one of: Laser, high-output light emitting diode (LED), organic light-emitting diode (OLED).
  • the Photo Detector 450 is for example one of: optical photodiode (OPD), a photomultiplier tube (PMT) or a charge coupled detector (CCD).
  • OPD optical photodiode
  • PMT photomultiplier tube
  • CCD charge coupled detector
  • Each pair of Light Source 440 and Photo Detector 450 is positioned around the same axis of each individual area so that each pair is aligned to read the reaction in one individual area.
  • Reaction Plate 320 may contain additional individual areas, shown in Fig 5.
  • additional individual areas may be configured to act as controls, whereas a control may be at least one of negative or positive control or both.
  • negative controls can be an individual area with at least one of: no nucleic acid probes, sample of at least one nucleic acid different from the target nucleic acid to be detected, or a sample of a bodily fluid obtained from one or more individuals without cancer disease.
  • positive controls can be an individual area containing at least one of: probes bound to a target moiety, for example, Biotin, to cause a maximal enzymatic reaction, samples of the at least one target nucleic acid to be detected, or a sample of a bodily fluid obtained from one or more individuals with cancer disease. Any of the mentioned combinations of controls may be used.
  • each Light Source 440 is activated and controlled by Processor 430 through electrical Connectors 460.
  • Processor 430 then reads data from each Photo Detector 450 through electrical Connectors 470.
  • Processor 430 activates the relevant Light Source 440 and Photo Detector 450 to read and register at least one of negative or positive control values, in addition to activating relevant Light Source 440 and Photo Detector 450 that correspond to the individual areas of the tested sample.
  • Processor 430 reads data received from each Photo Detector 450 and translates data from Photo Detector 450 into values indicative of levels of nucleic acid in Reactor Members 410 and 420. Processor 430 interprets levels of nucleic acid in individual area 410 indicative of a presence of predefined miRNAs or Telomerase Activity.
  • Photo Detector 450 is a Charge Coupled Detector (CCD) camera.
  • CCD Charge Coupled Detector
  • the data received from the CCD camera is translated, as known to one skilled in the art, to numeric values indicating the amount of activated fluorescence substrate in the sample.
  • the said numeric values correlate to the amount of the miRNA or Telomerase Activity Indicator present in the Sample 150.
  • Processor 430 calculated the numeric values from the image obtained by Photo Detector 450 of the at least one of negative or positive controls.
  • Processor 430 uses values from at least one of negative or positive controls to calibrate numeric values correlating to the miRNA or Telomerase Activity Indictor levels; such calibration provides absolute values that allow cancer detection, determination of presence of disease, comparison between patients and healthy individuals, and monitoring of disease progression.
  • the presently disclosed embodiments provide a method, comprising: obtaining a sample from a subject; extracting at least one RNA molecule from the sample; introducing the extracted at least one RNA molecule from the sample into a microfluidic device, wherein the microfluidic devices is configured to receive the sample, the microfluidic device comprising: a reaction plate containing a plurality of individual areas; wherein each individual areas comprises a nucleic acid probe configured to hybridize to a specific nucleic acid molecule; wherein each individual area is configured to generate an indication when the specific nucleic acid is bound to the nucleic acid probe; wherein at least one individual area within the plurality of individual areas comprises a unique nucleic acid probe configured to hybridize to a specific nucleic acid molecule comprising an mRNA; wherein at least one individual area within the plurality of individual areas comprises a unique nucleic acid probe configured to hybridize to a specific nucleic acid molecule comprising a non-coding RNA; a reaction plate containing a pluralit
  • the outputted result is selected from the group consisting of: an identification of at least one biological condition, the absence of at least one biological condition, the presence of at least one biological condition, the monitoring of at least one biological condition, the diagnosis of at least one biological condition, the prediction of the subject having at least one biological condition, the prognosis of at least one biological condition, and the probability of the subject having at least one biological condition.
  • the mRNA is selected from the group consisting of telomerase mRNA, human telomerase reverse transcriptase (hTERT) mRNA, human catalytically active telomerase subunit (hTC) mRNA, MAPT (Microtubule- Associated Protein Tau) mRNA, amyloid precursor protein (APP) mRNA, and CD 14 mRNA.
  • hTERT human telomerase reverse transcriptase
  • hTC human catalytically active telomerase subunit
  • MAPT Microtubule- Associated Protein Tau
  • APP amyloid precursor protein
  • the non-coding RNA is micro RNA (miRNA).
  • the miRNA is selected from the group consisting of: miR- 135b, let-7b, let-7f, let-7g, miR-1, miR-101, miR-105, miR-106, miR-106a, miR-106b, miR- 107, miR-10a-5p, miR-lOb, miR-122, miR-1229, miR-124-3p, miR-1246, miR-125, miR- 1254, miR-125b, miR-126, miR-127-3p, miR-129-5p, miR-1290, miR-130, miR-130b, miR- 133a, miR-133a-3p, miR-133b, miR-135, miR-138-5p, miR-141, miR-142-3p, miR-145, miR-146a, miR-146b, miR-146b-3p, miR-148a, miR-148b, miR-150, miR-150
  • the generated indication is selected from the group consisting of: an electrical indication and a visual indication.
  • the electrical indication is a change in surface plasmon resonance.
  • the visual indication is a change in fluorescence, wherein the change in fluorescence is at least one of a change in a wavelength of emitted light, or a change in an intensity of emitted light.
  • the change in fluorescence is mediated by an enzyme-based reaction.
  • the individual areas further comprise a hydrogel layer.
  • the system further comprises a sample collector configured to receive the sample from the subject and a sample processor configured to extract the at least one RNA molecule from the sample.
  • the system further comprises a processing unit, configured to receive the at least one RNA molecule from the sample, and transfer the at least one RNA molecule from the sample to the reaction plate.
  • Any biological condition may be identified, detected, monitored, diagnosed, or predicted, according to certain aspects of the presently disclosed embodiments.
  • the at least one biological condition is selected from the group consisting of: a cancer, a neurodegenerative disease, and an inflammatory condition.
  • the cancer is selected from the group consisting of colorectal cancer, gastric cancer, lung cancer, and breast cancer, pancreatic cancer, ovarian cancer, cervical cancer, leukemia, lymphoma, glioblastoma and other brain cancers, bladder cancer, prostate cancer, esophageal cancer, melanoma, thyroid cancer, kidney cancer, and endometrial cancer.
  • the neurodegenerative disease is selected from the group consisting of Alzheimer's Disease, Pict's disease, Parkinson's Disease, Huntington's Disease, frontotemporal dementia, cortico-basal degeneration and progressive supranuclear palsy.
  • the inflammatory disorder is selected from the group consisting of ulcerative colitis, Crohn's Disease, multiple sclerosis and systemic Lupus Erythematosus.
  • the listed miRNAs are related to the presence of cancerous tumors.
  • an miRNA may be expressed inside tumor cells that are shed into a bodily fluid and part of Sample 150, and then would undergo cell lysis in a reaction to a reagent from Sample Preprocessor 210 to cause a release of said miRNA into processed Sample 150.
  • an miRNA may be excreted in the body of the patient into a bodily fluid and be present in Sample 150. miRNA levels can be overexpressed and, when passing a predefined threshold, Processor 430 will save data and mark Sample 150 as potentially indicative of cancer detection.
  • miRNA levels can be influenced by sample collection, drug intake such as Aspirin or presence of other non-cancerous disease such as respiratory infection.
  • the at least one biological condition is cancer.
  • the presence of at least one miRNA is indicative of a disease, possibly cancer.
  • presence of said miRNA may be a result of another condition such as respiratory infection or as a result of an uptake of drug such as Aspirin.
  • Telomerase Activity is an indication of an active tumor process, including one of stage of benign tumor stage, pre-cancerous stage, early stage, late stage or metastatic stage of a tumor, herein defined as tumor stage.
  • the overlapping presence of both telomerase mRNA and tumor-associated miRNAs is indicative of very high probability that the patient has cancer.
  • a Telomerase Activity Indicator may be expressed inside tumor cells that are shed into a bodily fluid and part of the Sample 150, and then would undergo cell lysis in a reaction to a reagent from Sample Preprocessor 210 to cause a release of the Telomerase Activity Indicator into processed Sample 150.
  • a Telomerase Activity Indicator may be excreted in the body of the patient into a bodily fluid and be present in Sample 150.
  • Telomerase Activity Indicator levels can be overexpressed and, when passing a predefined threshold, Processor 430 will save data and mark Sample 150 as potentially indicative of presence of cancer disease.
  • Telomerase Activity Indicator can also be derived from non-cancerous cells such as reproductive cells, stem cells and lymphocytes.
  • Sample 150 has also increased levels of at least one of miRNA detected through individual area 410, then the probability of the patient having a cancer disease is higher.
  • Processor 430 will correlate the result with saved data for Bodily Fluid Sample 150 and confirm Sample 150 is indicating of cancer detection. Processor 430 will then transmit the data through Output Device/Monitor 260.
  • FIG. 5 shows an exemplary embodiment of Reaction Plate 320 according to some aspects of the presently disclosed embodiments.
  • Reaction Plate 320 has a plurality of individual areas.
  • Individual areas 420 detect one of Telomerase Activity Indicators.
  • Processor 430 will quantitatively measure levels of Telomerase Activity. For example, individual area 420 may detect only presence of hTert protein as a Telomerase Activity Indicator, whereas individual area 530 measures the amount of hTC mRNA and individual area 540 measures the amount of hTert mRNA.
  • Processor 430 can then use data measured not only to confirm the presence of cancer disease but also to provide prognosis information.
  • System 100 can be used to monitor success of treatment by measuring decrease in Telomerase Activity Indicators.
  • Sample 150 contains cells from a patient that are mixed with a potential therapeutic agent, thus System 100 can be used also for identifying optimal therapeutic agents for a patient. For example, several tumor cells are isolated from the same patient. A different potential therapeutic agent is added to each sample and proper time and environmental conditions (as known in the art) are provided to allow the potential therapeutic agent to affect the tumor cells in each sample. Each sample is then processed by System 100 and provides results such as level of Telomerase Activity Indicator.
  • Reaction Plate 320 contains at least one individual area to detect at least one type of miRNA.
  • individual area 510 is configured to detect a different set of miRNAs.
  • individual area 410 is configured to detect a set of one group of miRNA indicative of colorectal cancer, where individual area 510 is configured to detect a set of one group of miRNA indicative of breast cancer, and individual area 520 is configured to detect a set of one group of miRNA indicative of lung cancer.
  • System 100 can be used to detect different types of possible cancer disease from a single Bodily Fluid Sample 150.
  • System 100 can be used as a screening tool for cancer diseases based on the different groups of miRNA and types of bodily fluids detected by individual areas and Reaction Plate 320.
  • Reaction Plate 320 may contain one or more individual areas.
  • individual area is configured to detect one of miR-135b, let- 7b, let-7f, let-7g, miR-1, miR-101, miR-105, miR-106, miR-106a, miR-106b, miR-107, miR-10a-5p, miR-lOb, miR-122, miR-1229, miR-124-3p, miR-1246, miR-125, miR-1254, miR-125b, miR-126, miR-127-3p, miR-129-5p, miR-1290, miR-130, miR-130b, miR-133a, miR-133a- 3p, miR-133b, miR-135, miR-138-5p, miR-141, miR-142-3p, miR-145, miR-146a, miR- 146b, miR-146b-3p, miR-148a, miR
  • System 100 can detect breast, colon, lung, prostate or gastric cancer.
  • Reaction Plate 320 is made from glass. On Reaction Plate 320 there is a plurality of individual areas made from Polyethylene Glycol Hydrogel embedded on Reaction Plate 320. Each individual area has a height of 40 ⁇ . Each individual area contains a nucleic acid probes to detect increase Telomerase Activity Indicator and miRNA. The concentration of the nucleic acid probes in an individual area is 5 ⁇ . There is at least one individual area to detect a set of comprising of miR-21, miR-92a, miR-155, miR-373, miR-93, miR-214, miR-125b and miR-139.
  • miR-21 is increased in breast, colon, lung and prostate cancer.
  • miR-92a is increased in lung and colon cancer but decreased in breast cancer.
  • miR-155 is increased in lung, breast and colon cancer.
  • miR-373 is increased in breast cancer but decreased in colon cancer.
  • miR-93 is increased in colon and lung cancer.
  • miR-214 is increased in gastric cancer but decreased in breast and colon cancer.
  • miR-125b is increased in gastric cancer but decreased in breast cancer.
  • miR-139 is decreased in colon cancer.
  • Each individual area contains one type of probe, such as the individual area configured to detect Telomerase Activity Indicator has a DNA probe with a sequence of 5'- ACCGTCTGCGTGAGGAGATC-3 ' .
  • flow Device 320 causes Sample 150 to flow onto Reaction Plate through channels with a width of 500mm and with a flow pressure of 5 PSI. The flow causes nucleic acids contained in Sample 150 to flow through the hydrogel in individual areas and bind to the probes.
  • Flow Device 320 causes the flow of Streptavidin- ⁇ - galactosidase enzyme, followed by flow of Fluorescein-di-P-galactopyranoside which is an enzyme-activated fluorescence dye and finally flows Biotin, as a Universal Adapter.
  • Flow Device 320 causes FC-40 Fluorinated Oil to flow through Reaction Plate 320 and stops the flow in such a way that oil feels up the glass in Reaction Plate 320 around all individual areas, thus sealing all reaction members with oil.
  • the confirming of the reaction in a volume of lOOpL in each individual area allows amplification of the fluorescence reaction and signal without requiring pre- amplification of the nucleic acids in Sample 150, thus improving the accuracy and enabling detection of nucleic acids in a small amount such as 9ng.
  • Main Processing Unit 250 then processes the results to determine the type of diseases.
  • Main Processing Unit 250 reads whether there is an increase of a Telomerase Activity Indicator and of the miRNA mentioned above in this example.
  • Main Processor Unit 250 can detect Breast, Colon, Prostate, Gastric and Lung cancers.
  • Main Processing Unit 250 gives a score of +1 for the type of cancer in which the miRNA is expected to increased or if there is no increase in a miRNA for which a cancer has a decreased levels of miRNA. For example, detection of miR-21 and no detection if miR-92a will each add a score of +1 to Breast Cancer.
  • Main Processor Unit 250 finds an increased in Telomerase Activity Indicator, and notes there is a cancer. Then, Main Processor Unit 250 calculates a score for each cancer type.
  • the detected miRNAs are miR-21, miR-155, miR-373, and miR-139 while miR-92a, miR-93, miR-214 and miR-125b are not detected in this example.
  • Main Processing Unit 250 gives a score of 6 to breast cancer, 3 to colon cancer, 2 to lung cancer, 1 to prostate cancer and 0 to gastric cancer. Therefore, in this example, Main Processing Unit 250 and System 100 may indicate the Sample 150 is taken from a patient with breast cancer.
  • System 100 may only indicate which miRNAs were tested and whether they were increased or not along with results of Telomerase Activity Indicator.
  • System 100 may indicate which miRNA were increased or not along with results of Telomerase Activity Indicator and the score for each type of cancer disease. Further combinations are possible, with additional and/or different miRNA to allow further detection of multiple types of cancer from one sample, or to allow increased specificity by confirming cancer detection by having more than one miRNA associated with it.
  • System 100 can detect colorectal cancer or gastric cancer.
  • individual area 410 is configured to detect miR-16.
  • miR-16 may be indicative of Lung, Breast, Gastric or Colorectal cancer.
  • individual area 510 is configured to detect other miRNA such as miR-93, which may be indicative of colorectal cancer
  • individual area 520 is configured to detect miR-39, which may be indicative of gastric cancer.
  • Colorectal Cancer has a combination of overexpressed miRNA and under-expressed or normal miRNA. Processor 430 can then determine presence of colorectal cancer in case of high levels of miR-16 and miR-93 but low or normal levels of miR-39.
  • Processor 430 may determine high, low, or normal miRNA or Telomerase Activity Indicator levels by comparing to at least one of negative or positive control. Other individual areas can be added and configured to detect different additional miRNA. Still in the same embodiment, Processor 430 may determine the presence of Colorectal Cancer in case of high miR-16 and miR-93 levels, low or normal levels of mir-39 and increased Telomerase Activity Indicator. Alternatively, Processor 430 may determine the presence of Gastric Cancer in case of high miR-16 and miR-39 levels, low or normal levels of mir-93 and increased Telomerase Activity Indicator. Further combinations are possible, with additional and/or different miRNA to allow further detection of multiple types of cancer from one sample, or to allow increased specificity by confirming cancer detection by having more than one miRNA associated with it.
  • System 100 can detect breast cancer or lung cancer.
  • individual area 410 is configured to detect miR-21.
  • miR-21 may be indicative of Lung, Breast, Gastric or Colorectal cancer.
  • individual area 510 is configured to detect other miRNA such as miR-214, which may be indicative of breast cancer
  • individual area 520 is configured to detect miR-125b, which may be indicative of lung cancer.
  • Breast Cancer has a combination of overexpressed miRNA and under-expressed or normal miRNA.
  • Processor 430 can then determine presence of breast cancer in case of high levels of miR-21 and miR-214 but low or normal levels of miR-125b.
  • Processor 430 may determine high, low, or normal miRNA or Telomerase Activity Indicator levels by comparing to at least one of negative or positive control. Other individual areas can be added and configured to detect different additional miRNA. Still in the same embodiment, Processor 430 may determine the presence of Breast Cancer in case of high miR-21 and miR-214 levels, low or normal levels of mir-125b and increased Telomerase Activity Indicator. Alternatively, Processor 430 may determine the presence of Lung Cancer in case of high miR-21 and miR-125b levels, low or normal levels of mir-214 and increased Telomerase Activity Indicator.
  • the at least one biological condition is a neurodegenerative disease.
  • the neurodegenerative disease is selected from the group consisting of Alzheimer's Disease, Pict's disease, Parkinson's Disease, Huntington's Disease, frontotemporal dementia, cortico-basal degeneration and progressive supranuclear palsy.
  • the mRNA is MAPT (Microtubule-Associated Protein Tau) mRNA.
  • the mRNA is amyloid precursor protein (APP) mRNA.
  • APP amyloid precursor protein
  • System 100 can detect neurodegenerative diseases such as, for example, Alzheimer's Disease, Parkinson's Disease, Huntington's Disease and Frontotemporal Dementia. There is at least one individual well to detect a set of comprising of miR-7, miR-9, miR-29a, miR-128a, miR-133b, mirR-298, miR-320, miR-433, miR-511 and miR-659. Without intending to be limited to any particular theory, miR-7 decreased in Parkinson's Disease. miR-9 is increased in Alzheimer's Disease but decreased in Huntington's Disease. miR-29a is increased in Huntington's Disease but decreased in Alzheimer's Disease. miR-128a is increased in Alzheimer's Disease.
  • miR-133b is decreased in Parkinson's Disease.
  • mirR-298 is decreased in Alzheimer's Disease.
  • miR-320 is increased in Parkinson's Disease.
  • miR-433 is increased in Parkinson's Disease.
  • miR-511 increased in Alzheimer's Diseases.
  • miR-659 is increased in Frontotemporal Dementia.
  • a disease indicator other than Telomerase Activity Indicator may be preferable.
  • Such a disease activity indicator in case of neurodegenerative disease may be one of APP mRNA or MAPT mRNA.
  • APP mRNA has increased activity both in Parkinson's and Alzheimer's disease as well as other forms of Dementia.
  • MAPT Microtubule- Associated Protein Tau
  • Main Processor Unit 250 finds an increased in MAPT mRNA, and notes there is a neurodegenerative disease. Then, Main Processor Unit 250 calculates a score for each neurodegenerative disease type.
  • the detected miRNAs are miR-7, miR-9 and miR-511 while miR-29a, miR-128a, miR-133b, mirR-298, miR-320, miR-433 and miR-659 are not detected in this example.
  • Main Processing Unit 250 gives a score of 4 to Alzheimer's Disease, 1 to Parkinson's Disease and 0 to both Huntington's Disease and Frontotemporal Dementia. Therefore, in this example, Main Processing Unit 250 and System 100 may indicate the Sample 150 is taken from a patient with Alzheimer's Disease.
  • the at least one biological condition is an inflammatory disorder.
  • the inflammatory disorder is selected from the group consisting of ulcerative colitis, Crohn's Disease, multiple sclerosis and systemic Lupus Erythematosus.
  • the mRNA is CD14 mRNA.
  • System 100 can detect immune-mediated diseases such as, for example, Ulcerative Colitis, Crohn's Disease, Multiple Sclerosis and
  • miR-9 is increased in Crohn's Disease.
  • miR-16 is increased in Ulcerative Colitis and Crohn's Disease.
  • miR-21 is increased in Ulcerative Colitis and Crohn's Disease.
  • miR-23a is increased in
  • a disease indicator other than Telomerase Activity Indicator may be preferable.
  • a disease activity indicator in case of immune- mediated disease may be CD14 mRNA.
  • CD14 mRNA is expressed in the immune system.
  • Main Processor Unit 250 finds an increased in CD 14 mRNA, and notes there is an immune-mediated disease. Then, Main Processor Unit 250 calculates a score for each immune-mediated disease type.
  • the detected miRNAs are miR-9, miR-16, miR-126 and miR-130a, while miR-21, miR-23a, miR-146a miR-155, miR-181c and miR- 192 are not detected in this example.
  • Main Processing Unit 250 gives a score of 4 to Ulcerative Colitis, 3 to Crohn's Disease, and 0 to both Multiple Sclerosis and Systemic Lupus Erythematosus. Therefore, in this example, Main Processing Unit 250 and System 100 may indicate the Sample 150 is taken from a patient with Ulcerative Colitis.
  • a Sample 150 is obtained from a patient.
  • a material may be added to the sample to allow better storage of Bodily Fluid Sample such as Ethylenediaminetetraacetic acid (EDTA).
  • EDTA Ethylenediaminetetraacetic acid
  • Step 605 Sample 150 is mixed with additional materials in order to facilitate the flow of Sample 150 through the different instruments required to carry out the described method herein. In some embodiments, Sample 150 is mixed with additional materials to promote release of nucleic acids or proteins. In some embodiments, Sample 150 is mixed with additional materials in order to prevent destruction or denaturation of nucleic acids or proteins which may reduce the ability to identify them.
  • additional material may include at least one of air, saline, EDTA, RNAse inhibitor, DNAse inhibitor, polyhydroxylated compounds such as glycerol, protease inhibitors such as phenylmethylsulfonyl fluoride, PMSF 4-(2-aminoethyl)-benzenesulfonyl Fluoride hydrochloride, AEBSF, pepstatin A, SUPERase In RNase Inhibitor, Ion chelators such as
  • EDTA EDTA
  • EGTA dithiothreitol
  • ⁇ -mercaptoethanol or other stabilizing agents may be included, phosphate buffered saline, Taq polymerase, Chaps lysis buffer, Taq DNA Polymerase, T4 Pplyneucleotide kinase, bicinchoninic acid, dielthyl pyrocarbonate, Guanidinium thiocyanate and Phenol, EGTA
  • Step 610 Sample 150 undergoes optional separation by using a sedimentation based separation device such as a centrifuge.
  • a sedimentation based separation device such as a centrifuge.
  • following the process by a centrifuge only the liquid or sediment component of Bodily Fluid sample is extracted for further analysis.
  • Step 615 Sample 150 is passed and optionally compartmentalized onto a reaction compartment such as microwells, droplets or a hydrogel containing nucleic acid probes by using microfluidics, continuous flow or forming droplets.
  • a reaction compartment such as microwells, droplets or a hydrogel containing nucleic acid probes by using microfluidics, continuous flow or forming droplets.
  • additional liquids such as Phosphate Buffered Saline or Oil are added to the reaction compartment, for example, a hydrogel, containing Sample 150.
  • Step 620 Sample 150, containing the target nucleic acid molecules to be identified, interacts inside the reaction compartment, for example a hydrogel.
  • the hydrogel contains at least two reaction members. In one reaction member, at least one probe for detection of at least one miRNA is embedded within the hydrogel of the reaction member. In the other reaction member, at least one probe for detection of at least one Telomerase Activity Indicator is embedded within the hydrogel of the reaction member.
  • Step 625 a specific nucleic acid molecule from Sample 150 binds to a nucleic acid probe inside at least one of the reaction members.
  • Step 630 additional reaction materials are added such as a dye agent, for example, tetrazolium dye, oxidoreductase, glucose-6-phosphate dehydrogenase, chemiluminescence, luciferase; an enzyme such as horse radish peroxidase, alkaline phosphatas; biotin, or a hapten such as digoxigenin; an antibody probe conjugated to a radiolabel, fluorophore, chromophore, chemiluminescent moiety, or enzyme; one member of an affinity pair or indirectly detectable moieties, such as biotin that can be detected by avidin or streptavidin; radiolabels such as 3H, 1251, 35S, 14C, 32P, and 33P; luminopores such as inorganic dyes, fluorophores, phosphophores, light absorbing nanoparticles such as Gold, Silver, Platinum, Palladium; organic dyes such as coumarins such as 7
  • Exemplary additional reaction materials include an enzyme that interacts with nucleic acid probe, such as a streptavidin-conjugated enzyme (SAB); a substance that is made visible by the enzyme such as a fluorescence substrate such as fluorescein-di-B- galactopyranoside or Resorufin-B-galactopyranosid; a nucleic acid bound to a molecule such as Biotin as a Universal Adapter.
  • SAB streptavidin-conjugated enzyme
  • a substance that is made visible by the enzyme such as a fluorescence substrate such as fluorescein-di-B- galactopyranoside or Resorufin-B-galactopyranosid
  • a nucleic acid bound to a molecule such as Biotin as a Universal Adapter.
  • Step 635 the enzyme interacts with the florescence substrate when both the specific nucleic acid molecule and the Universal Adapter are bound to the nucleic acid probe. Lack of binding of a specific nucleic acid molecule to the nucleic acid probe will cause the Universal Adapter not to bind to the probe and thus no enzymatic reaction will take place.
  • the enzyme interacts with a fluorescence substrate and subsequently causes a change in color or fluorescence that can be then interpreted quantitatively as a presence of the specific nucleic acid molecule.
  • Step 640 the enzymatic reaction is confined inside the reaction member of the reaction compartment such as a hydrogel, for example by having oil applied onto the gel. Confinement of a reaction allows the reaction to repeat itself. Such confinement allows amplification without the need to artificially amplify the nucleic acids, and thereby avoids introducing bias or errors into the test. Thus, as long as the enzymatic reaction continues, the signal, derived from the change in dye or fluoresces, is increased to detectable levels, without any change or need however to replicate or amplify the nucleic acids themselves.
  • Step 645 the change in color or fluorescence are measured to determine the level of miRNA in at least one of the reaction members and to determine the level of Telomerase Activity Indicator.
  • additional reaction members on the hydrogel are used as at least one of negative or positive control.
  • the level of miRNA or Telomerase Activity Indicator are calibrated using the at least one of negative or positive controls.
  • Step 650 the levels of miRNA and Telomerase Activity Indicator are correlated.
  • the detection of cancer disease is determined in the case of an indication of Telomerase Activity and presence of at least one miRNA associated with a cancer disease.
  • a method to determine the most suitable therapeutic agent is also provided.
  • a sample of Sample 150 containing cells from a patient are mixed with a potential therapeutic agent.
  • Several tumor cells are isolated from the same patient.
  • a different potential therapeutic agent is added to each sample and the proper time and environmental conditions (as known in the art) are provided to allow the potential therapeutic agent to affect the tumor cells in each sample.
  • Each sample is then processed by the method described above and results such as level of Telomerase Activity Indicator are measured.
  • the sample that resulted in the lowest level of Telomerase Activity Indicator correlates to the most potent therapeutic agent for that patient.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention concerne, dans ses modes de réalisation, un système comportant : un dispositif microfluidique conçu pour recevoir un échantillon contenant au moins une molécule d'ARN provenant d'un sujet, le dispositif microfluidique comprenant une plaque de réaction qui contient une pluralité de zones individuelles, chaque zone individuelle comportant une sonde d'acide nucléique conçue pour s'hybrider à une molécule d'acide nucléique spécifique, chaque zone individuelle étant conçue pour générer une indication lorsque l'acide nucléique spécifique est lié à la sonde d'acide nucléique, au moins une zone individuelle à l'intérieur de la pluralité de zones individuelles comprenant une sonde d'acide nucléique unique conçue pour s'hybrider à une molécule d'acide nucléique spécifique comprenant un mARN, au moins une zone individuelle à l'intérieur de la pluralité de zones individuelles comprenant une sonde d'acide nucléique unique conçue pour s'hybrider à une molécule d'acide nucléique spécifique comprenant un ARN non codant ; un lecteur, conçu pour détecter l'indication générée et transmettre, en se basant sur la détection, un signal ; et un processeur programmé spécifiquement, pour recevoir le signal transmis, et exécuter une série de règles prédéfinies, et, sur la base des règles prédéfinies et du signal transmis, émettre un résultat.
PCT/US2016/054483 2015-09-29 2016-09-29 Système et procédé de détection d'une maladie dans des fluides corporels WO2017059094A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201562234467P 2015-09-29 2015-09-29
US62/234,467 2015-09-29

Publications (2)

Publication Number Publication Date
WO2017059094A2 true WO2017059094A2 (fr) 2017-04-06
WO2017059094A3 WO2017059094A3 (fr) 2017-05-11

Family

ID=58427861

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/054483 WO2017059094A2 (fr) 2015-09-29 2016-09-29 Système et procédé de détection d'une maladie dans des fluides corporels

Country Status (1)

Country Link
WO (1) WO2017059094A2 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20200120627A (ko) 2018-02-13 2020-10-21 도레이 카부시키가이샤 인지증 검출을 위한 키트 또는 디바이스 및 방법
CN113265447A (zh) * 2021-04-14 2021-08-17 军事科学院军事医学研究院环境医学与作业医学研究所 一种用于检测肌酸激酶同工酶的滚环扩增-金四面体比色检测方法和试剂盒
US20210311017A1 (en) * 2018-08-28 2021-10-07 Roche Sequencing Solutions, Inc. Nanopore sequencing device comprising ruthenium-containing electrodes
US11788120B2 (en) 2017-11-27 2023-10-17 The Trustees Of Columbia University In The City Of New York RNA printing and sequencing devices, methods, and systems

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6358681B2 (en) * 1998-10-30 2002-03-19 The Trustees Of The University Of Pennsylvania Diagnostic methods for alzheimer's disease by detection of multiple mRNAs
US20090137415A1 (en) * 2005-08-05 2009-05-28 Euclid Diagnostics Llc SUBTRACTIVE SEPARATION AND AMPLIFICATION OF NON-RIBOSOMAL TRANSCRIBED RNA (nrRNA)
US20110312732A1 (en) * 2010-06-17 2011-12-22 Geneasys Pty Ltd Test module using lanthanide metal-ligand complex, electrochemiluminescent luminophores
GB201021397D0 (en) * 2010-12-16 2011-01-26 Genetic Analysis As Diagnosis of Crohn's disease
WO2013040251A2 (fr) * 2011-09-13 2013-03-21 Asurgen, Inc. Méthodes et compositions incluant mir-135b, permettant de faire la distinction entre un cancer du pancréas et une maladie pancréatique bénigne
US9937495B2 (en) * 2013-10-28 2018-04-10 Massachusetts Institute Of Technology Hydrogel microstructures with immiscible fluid isolation for small reaction volumes

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11788120B2 (en) 2017-11-27 2023-10-17 The Trustees Of Columbia University In The City Of New York RNA printing and sequencing devices, methods, and systems
KR20200120627A (ko) 2018-02-13 2020-10-21 도레이 카부시키가이샤 인지증 검출을 위한 키트 또는 디바이스 및 방법
EP4328587A2 (fr) 2018-02-13 2024-02-28 Toray Industries, Inc. Utilisation d'un kit ou d'un dispositif et méthode de détection de la démence
US20210311017A1 (en) * 2018-08-28 2021-10-07 Roche Sequencing Solutions, Inc. Nanopore sequencing device comprising ruthenium-containing electrodes
CN113265447A (zh) * 2021-04-14 2021-08-17 军事科学院军事医学研究院环境医学与作业医学研究所 一种用于检测肌酸激酶同工酶的滚环扩增-金四面体比色检测方法和试剂盒

Also Published As

Publication number Publication date
WO2017059094A3 (fr) 2017-05-11

Similar Documents

Publication Publication Date Title
Chen et al. based strip for ultrasensitive detection of OSCC-associated salivary microRNA via CRISPR/Cas12a coupling with IS-primer amplification reaction
Kim et al. Enzyme-free and label-free miRNA detection based on target-triggered catalytic hairpin assembly and fluorescence enhancement of DNA-silver nanoclusters
Schwarzenbach Clinical relevance of circulating, cell-free and exosomal microRNAs in plasma and serum of breast cancer patients
AU2012245580B2 (en) miRNA-based universal screening test (UST)
US20220307076A1 (en) Target reporter constructs and uses thereof
US9493832B2 (en) Methods of detecting sepsis
US20130157886A1 (en) Methods of detecting lung cancer
Quirico et al. The power of microRNAs as diagnostic and prognostic biomarkers in liquid biopsies
Saikumar et al. Noninvasive micromarkers
EP3180464A1 (fr) Détection d'acides nucléiques
Cacheux et al. Technological challenges and future issues for the detection of circulating microRNAs in patients with cancer
WO2017059094A2 (fr) Système et procédé de détection d'une maladie dans des fluides corporels
WO2011012074A1 (fr) Marqueurs de détection du cancer du foie et procédés de détection, nécessaires et biopuces de ceux-ci
Wang et al. Construction of a quencher-free cascade amplification system for highly specific and sensitive detection of serum circulating miRNAs
Usó et al. miRNA detection methods and clinical implications in lung cancer
Visani et al. Contribution of microRNA analysis to characterisation of pancreatic lesions: a review
Tölle et al. miRNA panels as biomarkers for bladder cancer
Zhao et al. Mix-and-detection assay with multiple cyclic enzymatic repairing amplification for rapid and ultrasensitive detection of long noncoding RNAs in breast tissues
Lin et al. Programmable clostridium perfringens argonaute-based, one-pot assay for the multiplex detection of miRNAs
CN107299129B (zh) 循环核酸作为乳腺癌生物标志物的应用
US10858693B2 (en) Systems and methods for localized surface plasmon resonance biosensing
Ghai et al. Circulating miRNAs as tumor biomarkers
EP3036345A2 (fr) Procédé et composition pour la détection de hpv oncogène
Deng et al. Sensing miRNAs for disease diagnostics
WO2014093504A1 (fr) Biomarqueurs micro-arn pour la maladie du greffon contre l'hôte

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16852609

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16852609

Country of ref document: EP

Kind code of ref document: A2