WO2017052178A1 - Biomarker composition, diagnostic kit, and method for providing information - Google Patents

Abstract

The present invention relates to: a biomarker composition containing a nucleotide, having a base sequence of SEQ ID NO: 1 or 2, as an active ingredient; a diagnostic kit comprising the composition; and a method for providing information for atopic dermatitis diagnosis, comprising a step of detecting F. prausnitzii subspecies (F06). By using the present invention, whether F. prausnitzii subspecies (F06) having a specific base sequence is present can be usefully determined and, particularly, whether there is the potential for a disease outbreak can be easily and accurately diagnosed even before atopic dermatitis occurs, and thus the present invention can be very useful for both individuals before and after atopic dermatitis occurs.

Description

Biomarker Compositions, Diagnostic Kits, and Informational Methods

The present invention includes a biomarker composition comprising the base sequence of SEQ ID NO: 1 or SEQ ID NO: 2 as an active ingredient, a diagnostic kit comprising such a composition, and a base sequence comprising SEQ ID NO: 1 or SEQ ID NO: 2 It relates to an information providing method.

Atopic dermatitis (AD) is a growing disease worldwide and is a chronic inflammatory skin disease. Atopic dermatitis is a chronic, recurrent inflammatory skin disease that usually begins in infancy or childhood, accompanied by itching, dry skin, or eczema.

Symptoms of atopic dermatitis change with age, but the lesion is accompanied by itching. In early childhood, symptoms appear on the cheeks, forehead, and head, and on the torso, arms, and legs, and in the late infancy, centering on the folded areas of the earlobe, arms, and legs.

According to US statistics, 25% of children and 2-3% of adults suffer from atopic dermatitis. However, the cause of the development of atopic dermatitis is still unknown. Although the cause of the invention cannot be explained precisely, in view of the recent increase in industrialized countries, environmental factors and genetic factors are considered to be the main causes.

There is no specific test for diagnosing atopic dermatitis, but tests are being done to look for a cause that makes atopic dermatitis worse. Tests to find allergens that cause atopic dermatitis include skin terminal test, serum specific immunoglobulin E test, food oral provocation test, and bacterial culture test.

Although the direct cause and pathogenesis of atopic dermatitis is still unclear, it is believed that skin damage in patients is mainly due to the overproduction of cytokines that cause inflammation by the TH 2 type immune response to hypersensitivity to common antigens. At this time, it was observed that the microbial community in the skin was simplified and characteristic problems such as increased Staphylococcus aureus bacteria were observed. On the other hand, it has been reported that certain bacteria in the intestine may be associated with atopic disease.

However, despite these findings, the microbiological causes of failure to control inflammation that underlie atopy are still unknown. Therefore, it is a very important technical task in the art to find out whether or not the invention of atopy by identifying a biological cause that causes the development of atopy.

It is an object of the present invention to provide a biomarker composition comprising the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 as an active ingredient.

Specifically, Faecalibacterium It is to provide a biomarker composition for detecting a subspecies (F06) of prausnitzii .

More specifically, to provide a biomarker composition for diagnosing atopic dermatitis.

In addition, an object of the present invention is to provide a biomarker composition comprising a nucleotide sequence having at least 97% sequence identity with SEQ ID NO: 1 or SEQ ID NO: 2 as an active ingredient.

Another object of the present invention is to provide a diagnostic kit comprising a biomarker composition comprising the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 as an active ingredient.

Specifically, it is to provide a diagnostic kit comprising a biomarker composition for detecting subspecies (F06) of F. prausnitzii , and more particularly, a diagnostic kit comprising a biomarker composition for diagnosing atopic dermatitis.

In addition, an object of the present invention is to provide a diagnostic kit comprising a biomarker composition comprising a nucleotide sequence having SEQ ID NO: 1 or SEQ ID NO: 2 and at least 97% sequence identity as an active ingredient.

Still another object of the present invention is to provide an isolated nucleic acid sample; And it provides a method of providing information, comprising the step of recognizing the nucleotide sequence comprising SEQ ID NO: 1 or SEQ ID NO: 2.

Specifically, the step of recognizing the nucleotide sequence comprising SEQ ID NO: 1 or SEQ ID NO: 2 provides a method of providing information, comprising the step of detecting a subspecies (F06) of F. prausnitzii .

More specifically, the step of recognizing the nucleotide sequence comprising SEQ ID NO: 1 or SEQ ID NO: 2, An information providing method is provided for diagnosing atopic dermatitis.

In addition, an nucleotide sequence comprising SEQ ID NO: 1 or SEQ ID NO: 2 is an object of providing an information providing method, which is a nucleotide sequence having 97% or more of sequence identity with SEQ ID NO: 1 or SEQ ID NO: 2.

Hereinafter, exemplary embodiments will be described in detail with reference to the accompanying drawings. Like reference numerals in the drawings denote like elements.

Various modifications may be made to the embodiments described below. The examples described below are not intended to limit the embodiments, but should be understood to include all modifications, equivalents, and substitutes for them.

The terminology used herein is for the purpose of describing particular example embodiments only and is not intended to be limiting of examples. Singular expressions include plural expressions unless the context clearly indicates otherwise. In this specification, terms such as "comprise" or "have" are intended to indicate that there is a feature, number, step, operation, component, or combination thereof described on the specification, and one or more other features or It should be understood that it does not exclude in advance the possibility of the presence or addition of numbers, steps, operations, components, or combinations thereof.

Unless defined otherwise, all terms used herein, including technical or scientific terms, have the same meaning as commonly understood by one of ordinary skill in the art. Terms such as those defined in the commonly used dictionaries should be interpreted as having meanings consistent with the meanings in the context of the related art, and are not construed in excessively formal meanings unless expressly defined in the present application.

In addition, in the description with reference to the accompanying drawings, the same components regardless of reference numerals will be given the same reference numerals and redundant description thereof will be omitted. In the following description of the embodiment, when it is determined that the detailed description of the related known technology may unnecessarily obscure the gist of the embodiment, the detailed description thereof will be omitted.

Hereinafter, terms used in the present specification will be described.

As used herein, the term "biomarker" generally refers to an index that can detect changes in the body using proteins, DNA, RNA, metabolites, and the like.

As used herein, "genome" refers to a gene aggregate containing all the genetic information of the human body itself, and "microbiome", also called the second genome, refers to the overall genetic information of microorganisms coexist in the body. In particular, "intestinal microbiome" refers to the overall genetic information of microorganisms present in the body, particularly in the intestine. Recently, various microorganisms in the human body have been reported to affect the living body, regulation, digestive ability and various diseases, and affect all the functions of the human body, such as genetic modification according to environmental changes, increasing interest in the intestinal microbiome have.

As used herein, “diagnosis” includes the prediction or diagnosis of a condition or outcome of an individual, the prediction of a condition or outcome, progression, or response to a particular treatment. The practice of the present invention employs conventional techniques of immunology, biochemistry, molecular biology, microbiology, cell biology, genome, and recombinant DNA, unless otherwise indicated. As used herein, an “individual,“ patient ”, or“ subject ”includes not only humans but also other mammals.

As used herein, "AD" refers to Atopic Dermatitis, "SCFA" refers to short chain fatty acid, and "OTU" refers to operational taxonomic units. In addition, "GalNAc" means N-acetylgalactosamine, and "KO" means a database of genes and genomes of Kyoto University (KEGG (Kyoto Encyclopedia of Genes and Genomes) Orthology).

According to an aspect for achieving the above object, it provides a biomarker composition comprising the base sequence of SEQ ID NO: 1 or SEQ ID NO: 2 as an active ingredient.

Biomarker composition comprising the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 as an active ingredient, the presence or absence of various diseases including the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 from a sample of various individuals with or suspected a disease Can be investigated.

The base sequences of SEQ ID NO: 1 and SEQ ID NO: 2 are as follows (see FIGS. 4A-D).

SEQ ID NO: 1-AGAGATGA G GAG C TTGCTCTTCA A ATC

SEQ ID NO: 2-AC G G C TCGGCAT CGA G CAG A GGGAAAAGGAG TG AT

Referring to FIG. 4B, the nucleotide sequence of the F06 V1 region is not limited to SEQ ID NO: 1, and may have G or A at base position 9, C or T at base position 13, and A or G at base position 24, respectively. (Position 9 (G, A), position 13 (C, T), position 24 (A, G)). On the other hand, referring to Figure 4b, the base sequence of the F06 V2 region is not limited to SEQ ID NO: 2, G or A at base position 3, C or G at base position 5, G or C at base position 16, respectively , A or G at base position 20, T or C at base position 32, G or A at base position 33 (position 3 (G, A), position 5 (C, G), position 16 ( G, C), position 20 (A, G), position 32 (T, C), position 33 (G, A)).

In one embodiment of the present invention, the biomarker composition is a biomarker composition for detecting a subspecies (F06) of F. prausnitzii .

The nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2, A biomarker composition for detecting subspecies (F06) of F. prausnitzii in microbiomes . F. If the disease is associated with a subspecies of prausnitzii (F06), the biomarker composition may be used regardless of the type of disease.

In another embodiment of the present invention, the biomarker composition is a biomarker composition for diagnosing atopic dermatitis.

Based on the V1-V2 sequence representing the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2, it was confirmed that the increase in the atopic dermatitis microbiome (see Figure 3a-c). In particular, the increase in F06 in atopic dermatitis microbiomes was common to all ages, but especially prominent in the one-year-old group indicates that F. prausnitzii subspecies (F06) is involved in the development of atopic dermatitis disease. . Although it has been found to be suitable for the diagnosis of atopic dermatitis disease as described above, if it can be used for the diagnosis of a disease showing the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 is not limited to atopy.

According to another aspect of the present invention, the biomarker composition is a biomarker composition comprising a nucleotide sequence having at least 97% sequence identity with SEQ ID NO: 1 or SEQ ID NO: 2 as an active ingredient.

Indeed, in Koreans, diversity was found in bases 9, 13, 24 of SEQ ID NO: 1 and in bases 3, 5, 16, 20, 32, 33 of SEQ ID NO: 2. Thus, the base positions 9, 13, 24 of SEQ ID NO: 1 and the base positions 3, 5, 16, 20, 32, 33 of SEQ ID NO: 2 may each be variously replaced. Preferably, SEQ ID NO: 1 or SEQ ID NO: 2 may each be replaced with at least 97% sequence identity of the total sequence. Specifically, G in base position 9 of SEQ ID NO: 1 may be replaced by A, C in base position 13 by T, A in base position 24 by G, and G in base position 3 of SEQ ID NO: 2 by A , C at base position 5 may be replaced with G, G at base position 16 with C, A at base position 20 with G, T at base position 32 with C, and G at base position 33 with A, respectively. . That is, the biomarker composition includes a biomarker composition comprising an nucleotide sequence having at least 97% sequence identity within the range of homogeneous diversity of the normal bacterial 16S rRNA gene with SEQ ID NO: 1 or SEQ ID NO: 2 as an active ingredient.

According to another aspect of the present invention, there is provided a diagnostic kit comprising a biomarker composition comprising the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 as an active ingredient.

When providing a nucleic acid sample isolated from an individual, a diagnostic kit for diagnosing a composition comprising a nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2, preferably a diagnostic kit for diagnosing atopic dermatitis. On the other hand, the diagnostic kit can be used irrespective of the type of disease, as long as it is associated with a subspecies of F. prausnitzii (F06). And although it was confirmed that it is suitable for the diagnosis of atopic dermatitis disease, if it can be used for the diagnosis of the disease which shows the nucleotide sequence of SEQ ID NO: 1, it is not limited to atopy.

On the other hand, it provides a diagnostic kit comprising a biomarker composition comprising a base sequence having SEQ ID NO: 1 or SEQ ID NO: 2 and more than 97% sequence identity respectively.

According to another aspect of the invention, providing an isolated nucleic acid sample; And recognizing a nucleotide sequence comprising SEQ ID NO: 1 or SEQ ID NO: 2.

After providing a nucleic acid sample isolated from an individual, the base sequence including SEQ ID NO: 1 or SEQ ID NO: 2 is recognized to provide useful information for early diagnosis and prognosis of various diseases, preferably useful information for diagnosing atopic dermatitis. Can provide.

According to one embodiment of the invention, the step of recognizing the nucleotide sequence comprising SEQ ID NO: 1 or SEQ ID NO: 2, provides a method of providing information, comprising the step of detecting the subspecies (F06) of F. prausnitzii .

A method of providing information for detecting a subspecies (F06) of F. prausnitzii by recognizing a nucleotide sequence comprising SEQ ID NO: 1 or SEQ ID NO: 2 after providing a nucleic acid sample isolated from an individual, in particular, diagnosing atopic dermatitis associated with this bacterium It can provide an information providing method for.

According to one embodiment of the present invention, the base sequence comprising SEQ ID NO: 1 or SEQ ID NO: 2 is an information providing method, which is a base sequence having 97% or more of sequence identity with SEQ ID NO: 1 or SEQ ID NO: 2.

Indeed, in Koreans, diversity was found in bases 9, 13, 24 of SEQ ID NO: 1 and in bases 3, 5, 16, 20, 32, 33 of SEQ ID NO: 2. Thus, the base positions 9, 13, 24 of SEQ ID NO: 1 and the base positions 3, 5, 16, 20, 32, 33 of SEQ ID NO: 2 may each be variously replaced. Preferably, SEQ ID NO: 1 or SEQ ID NO: 2 may each be replaced with at least 97% sequence identity of the total sequence. Specifically, G in base position 9 of SEQ ID NO: 1 may be replaced by A, C in base position 13 by T, A in base position 24 by G, and G in base position 3 of SEQ ID NO: 2 by A , C at base position 5 may be replaced with G, G at base position 16 with C, A at base position 20 with G, T at base position 32 with C, and G at base position 33 with A, respectively. . That is, the biomarker composition includes a biomarker composition comprising an nucleotide sequence having at least 97% sequence identity within the range of homogeneous diversity of the normal bacterial 16S rRNA gene with SEQ ID NO: 1 or SEQ ID NO: 2 as an active ingredient.

Biomarker composition comprising a nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 of the present invention as an active ingredient, diagnostic kit comprising such a composition, can be effectively used for the diagnosis and treatment of atopic dermatitis, which shows a high incidence in the world Seems to be.

By using the present invention, the presence or absence of a subspecies (F06) of F. prausnitzii having a specific nucleotide sequence can be usefully determined, and in particular, it is possible to easily and accurately diagnose the onset of atopic dermatitis before the onset of atopic dermatitis. It can be very useful for both individuals before and after dermatitis.

FIG. 1A shows the alpha diversity profile of the intestinal microbiome, FIG. 1B shows the beta diversity profile of the intestinal microbiome, FIG. 1C shows the enterotype analysis, and FIG. 1D shows Ruminococcus, Parabacteroides, faecalibacterium, Escherichia / shigella It is a figure which shows the relative abundance ratio (%).

FIG. 2A shows a histogram of the results of the RFE-SVM analysis, and FIG. 2B shows a list of bacterial clads containing top select OTUs.

FIG. 3A illustrates F. prausnitzii for selecting an Operational Taxonomic Unit (OTU) to distinguish atopic patients from non-patients. The schematic diagram of OTUs is shown, FIG. 3B shows the OUT abundance, and FIG. 3C shows the abundance of F06.

FIG. 4A shows the V1-V2 region in the 16S rRNA gene of the F. prausnitzii strain, FIG. 4B shows the consensus sequence of F06 V1, FIG. 4C shows the entire F06 454 analysis, and FIG. 4D shows the relative abundance of the V1 sequence .

Figure 5a shows a heat map that changes significantly in the AD microbiome, Figure 5b shows a sequence of the genes A2-165, M21 / 2, L2-6, S3L / 3, KLE1255, five strains of F. prausnitzii Indicates.

Figure 6a is a graph showing the analysis of SCFAs of the experimental group and the control group, Figure 6b is F. prausnitzii The activity of the butyryl CoA: acetate CoA-transferase gene promoter from strains is compared.

Figure 7 shows a proposed model of AD associated with dysfunction of F. prausnitzii .

FIG. 8A is a venn diagram showing common and specific genes among strains, and FIG. 8B shows the result of illumination analysis for each gene group.

Hereinafter, the present invention will be described in detail with reference to Examples.

However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited to the following examples.

The inventors of the present invention presumed that certain bacteria in the intestine may be associated with atopy disease, and studied the relationship between intestinal bacteria and atopy for a long time. To demonstrate this association, 90 atopic patients (experimental group) and 42 atopic patients (control group) participated in the study and analyzed 16S rRNA genes and metagenomes of 132 intestinal microbial communities. Reference gene data from the Human Microbiome Project and the KEGG Orthology database were used for the metagenome analysis. Atopic patients were pre-evaluated with severity through the SCORAD system, and the control group consisted of people who had never had atopic dermatitis. Both experimental and control groups were not exposed to antibiotics within 6 months prior to providing stool samples. The experimental group was provided by outpatients from Korea University Anam Hospital and was approved by Ethics Commitee. About 5 g of stool samples were obtained from the experimental and control groups and stored at -80 ° C until DNA was isolated. Short-chain fatty acids (SCFAs) of stool samples were compared using a gas chromatographic mass spectrometer.

Example  1: DNA separation

The sample was ground on liquefied nitrogen with a mortar and pestle (mortar and pestle), and 400 mg of the ground sample was transferred to four microcentrifuge tubes. Each tube contains 500 μl solution containing 0.1 mm diameter zirconia / silica beads (BioSpec, Bartlesville, OK, USA), 500 μl extraction buffer (200 mM Tris [pH 8.0], 200 mM NaCl, 20 mM). EDTA), 210 μl of 20% SDS, and a phenol: chloroform: isoamyl alcohol mixture (25: 24: 1, pH 7.9).

The sample was ground in a bead beater at room temperature for 2.5 minutes, and bacterial components flowed out as the bacterial skin broke. DNA was isolated from the supernatant with phenol / chloroform / isoamyl alcohol (25: 24: 1. Ph7.9) and precipitated with isopropanol. DNA pellets were dried and then dissolved in TE buffer (10 mM Tris [pH 8.0], 1 mM EDTA) to adjust the concentration to 100 ng / μl.

Example 2 V1-V2 region sequencing of 16S rRNA gene

PCR reactions targeting the V1-V2 region of the 16S rRNA gene consisted of 100 ng of template DNA, 5 μl of HotStar PCR buffer (Qiagen, Germantown, MD, USA), and 1 U of HotStarTaq DNA. Polymerase (Qiagen) and transcription and reverse primers were performed on each DNA sample containing 25 μl reaction mixture, each containing 0.4 μmol / l. Forward primer,

5'- CGTATCGCCTCCCTCGCGCCATCAG NNNNNNNN TC AGAGTTTGATCCTGGCTCAG -3 ', 454 Titanium adapter A (underlined nucleotide), unique 8-base barcode (denoted 8Ns), linker (dinucleotide TC ), universal bacterial primer 8F (universal bacterial primer 8F). Reverse primer, 5'- CTATGCGCCTTGCCAGCCCGCTCAG NNNNNNNN CA TGCTGCCTCCCGTAGGAGT- 3 ', 454 Titanium adapter B (underscore), unique 8-base barcode (Ns), linker ( CA ), wide range of bacteria It consists of the primer 338R (italic).

DNA amplification, was done for 15 minutes at 95 ° C, continue for 30 seconds at 95 ° C, then for one minute at 34 cycle, 72 ° C for at 52 ° C 30 seconds, at the end extension 72 ° C For 5 minutes. PCR products were obtained using a QIAquick PCR Purification Kit (Qiagen). An amplification product (amplicon) are the Pico green assay was quantified using the (PicoGreen Assay), it was diluted in TE buffer with 1 X 10 ⁹ molecules / μl. A sequencing library was created using the same amount of product for 454FLX Titanium pyrosequencing.

Example 3: 454 sequencing reads analysis

16S rRNA gene V1-V2 region sequence reads tagged with barcodes were analyzed using the QIIME pipeline. Sequences without the 5 'or 3' end or with one or more unclear sequencing were excluded.

All primer sequences were then removed and trimmed sequences less than 250 bp were also excluded. The remaining sequences were classified based on 97% sequence similarity using CD-HIT as OTUs and based on 0.5% confidence score using RDP classifier. Was classified. Chimera sequences were removed using the ChimeraSlayer and BlastFragment of the QIIME pipeline. Shannon index is used to determine the intestinal microbiota.

-Diversity(

Calculated to know -diversity, unweighted UniFrac or Bray-Curtis distance metrics for β-diversity analysis were created using QIMME scripts lost.

Enterotype analysis uses a gene-level distance matrix created by the Jensen-Shannon divergence algorithm, and uses a partitioning around medoids clustering algorithm. I did it. The Calinski-Harabasz index was calculated to know the optimal number of Enterotype clusters (see FIGS. 1A-D).

The 454 sequencing reads were analyzed by OTU using CD-HIT or by taxon-independent OTU (ESTUIT). The OTU abundance matrix made of this OTU was used to find the most characteristic OTU between atopic patients and non-patients using a recursive feature elimination support vector machine (RFE-SVM). OTUs not present in at least 30% of samples were excluded from the data to reduce noise levels. Using a selected characteristic OTU set, leave-one-out cross-validation was used to measure the prediction accuracy that distinguishes AD-microbiota.

Example  4: full genetic difference sequencing sequence  analysis

Whole-genome sequences were obtained from the eight samples (four samples in the experimental and control groups) using Illumina HiSeq2000 (Illumina HiSeq2000). A DNA library consisting of about 400 bp fragments was made to obtain 101 bp paired-end reads.

Sequence analysis was performed using the CLC Genomic Workbench. Low-quality reads were excluded by the following criteria: quality score All sequences less than 0.05 or sequences with two or more unclear sequences, sequences shorter than 15 bp were also excluded. The functional analysis of Metagenome was performed using HUMAnN v0.99. All Bacteroides and Faecalibacterium genomes (bfg, bhl, bsa, bxy, bdo, bdh, bacc, fpr, and fpl) were included in the KEGG Orthology (KO) database v54 for analysis. Illumina reads were translated BLAST search to KO database using USEARCH v8.0. The results were summarized by HUMAnN, and the averaged orthologous gene family abundances of the experimental and control groups were compared.

Example 5: 5 F. prausnitzii  Strain pangenome  analysis

Genome sequence of the five strains F. prausnitzii receives downloaded from the Human Microbiome Project (HMP) website ( http://www.hmpdacc.org/) was a pan-genome comparative analysis. Coding sequences (CDS) obtained from each strain were summarized by discrete orthologs based on amino acid similarity and matching region of 70% or more when compared to BLASTP. CDSs were compiled using a KO database based on the BLASTP hit e-value cutoff of 1e-5 of le-5.

Illumina HiSeq2000 Full Meta Genome Read was performed using five CL F genome workbenches. mapped to genome. In all, 10.14% of the Illumina leads were mapped to the F. prausnitzii genome.

Example  6: In sample SCFA  Measure

The sample was ground with a liquid nitrogen into a mortar and pestle and about 0.1 g was transferred to a 2 ml microfuge tube. An internal standard (60 μl of 0.25 mmol / l 4-methylvaleric acid) was added to a tube containing the ground sample and used for measuring SCFAs. The samples were acid treated with 20 μl of 33% hydrogen chloride (HCl), then diethyl ether was added and vortexed for 10 minutes. The diethyl ether layer was centrifuged and then transferred to a new tube. After repeating the same procedure once more, the diethyl ether phases were mixed from the two extracts. 60 μl of extract and 20 μl of N- tert- butyldimethylsilyl-N-methyltrifluoroacetamide were freed from a gas chromatography autosampler vial. After mixing in an insert (glass insert) and left at room temperature for 2 hours. Gas chromatography weight analysis was performed on the samples thus prepared. The ratio of D-lactate and L-lactate was determined using the Megazyme enzyme kit (Megazyme, Ireland).

Frozen samples (0.1 g) were dissolved in 1 ml of 0.1 M triethanolamine buffer (pH 9.15) and centrifuged at 14,000 for 10 minutes at 4 ° C. The supernatant was precipitated with 6.1N trichloroacetic acid (10% final concentration) and centrifuged at 4500g at 4 ° C for 10 minutes. The precipitated supernatant was used to measure the lactic acid level.

Example  7: Promoter Activity Assay

Butyryl CoA: acetate CoA-transferase gene in five F. prausnitzii strains (FP2_20620 for strain L2-6, FAEPRAA2165_01575 for strain A2-165, HMPREF9436_00973 for strain KLE1255, FPR_29560 for strain SL3 / 3 and FAEPRAM212_02812 for strain M21 / 2) To compare promoter activity, lacZY fusions were made to the promoters of each gene using the promoter probe vector pLKC481, and the plasmid construct was Escherichia. coli DN5

Moved to. E. coli strains containing different pLKC481 constructs were incubated in LB broth to the mid-log phase (OD600 = 0.7) and left on ice for 20 minutes. 2 ml of each sample was taken, pellets were taken again in Z buffer. Β-galactosidase activity showing promoter activity was measured using O-nitrophenyl-β-D-galactoside as a substrate, below. Miller unit was calculated using the equation.

1000 x (OD420-1.75 x OD550) / (Incubation time [min] x Capacity [ml] x OD600)

Hereinafter, the present invention will be specifically described based on the drawings.

FIG. 1A shows the alpha diversity profile of the intestinal microbiome, FIG. 1B shows the beta diversity profile of the intestinal microbiome, FIG. 1C shows the enterotype analysis, and FIG. 1D shows Ruminococcus, Parabacteroides, faecalibacterium, Escherichia / shigella It is a figure which shows the relative abundance ratio (%).

Enteric microbiome DNA was isolated from the samples from 90 experimental groups and 43 controls, and the nucleotide sequence was analyzed by 454 technology by amplifying the V1-V2 portion of the 16S rRNA gene. The sequence read was found to have an average sequencing depth of 6,604 after removing the low quality sequence. No significant differences were found in microbial alpha diversity (? -Diversity) in atopy patients and non-patient microbiomes (see graph in FIG. 1A). There was no significant difference between the patient and the non-patient even in microbial beta diversity (composition) (β-diversity) (see graph in FIG. 1B). Microbiomes can be assigned to specific enterotypes based on mainstream bacterial groups. The 132 microbiomes are either enterotypes of Bacteroides or Although classified as Prevotella type, atopic dermatitis was not biased to either side (see graph of FIG. 1C). In conclusion, the overall change of microbiome in atopic dermatitis was not significant. However, a specific bacterial group showed a significant difference between the experimental and control groups in the age-divided group (see graph of FIG. 1B). It has been reported that the increase of bacteria belonging to enterobacteriaceae and the decrease of Lactobacillus and Bifidobacterium bacteria in patients with atopic dermatitis have not been observed in this experiment. Bacteria that have been reported to be related to atopy in previous studies may include those that have had opportunistic growth in an unhealthy intestinal environment rather than directly related to atopy. Some of the bacteria associated with atopy may be directly pathogenic, or simply a damaged intestinal environment may be beneficial to growth. Pathogenic bacteria that play an important role in atopy can be in the form of a species or a group of specific bacteria and can be increased in all atopic environments. On the other hand, bacteria that simply utilize the disease environment can include a variety of species. They may appear to be increased in an atopic environment overall, but may not be present in individual samples. Given this pattern, most of the bacteria growing in the atopy microbiome (see Figures 1a-d graph) are likely to be simply bacteria that utilize the atopy environment. Even if the atopy-causing organisms are among them, they may be small, so they may be buried in many other bacteria and difficult to distinguish.

Figure 2a is a histogram showing the results of the RFE-SVM analysis, Figure 2b shows a list of bacterial clads containing top-selected OTUs, Figure 3a is an operational classification unit that can distinguish between atopic patients and non-patients taxonomic unit, OTU) for F. prausnitzii for screening The schematic diagram of OTUs is shown, FIG. 3B shows the OUT abundance, and FIG. 3C shows the abundance of F06.

RFE-SVM analysis was performed to select top discriminatory OUT (OTU) to distinguish atopic patients from non-patients. The analysis used an OTU (usually 0.03 distance level corresponding to species) written in ESPRIT, which is based on a taxonomy-independent hierarchical classification. A randomly selected half of the data was used as a training set for RFE-SVM analysis to screen for characteristic OTUs. The other half of the data was used to test the atopy discrimination ability of this OTU. These OTUs showed a high accuracy of 88.14% in discrimination compared to 79.92% of randomly selected OTUs (see FIG. 2A). Among the top-selected OTUs, we found that many belong to only a few clades, and that they are common to all ages (see FIG. 2B). Among these, Faecalibacterium was found to increase very much in atopy microbiomes (see graph in FIG. 1D). Faecalibacterium exists in two physiologically different phylogenies, but is now all grouped into one species, F. prausnitzii .

Atopy Related F. prausnitzii  Subspecies

F. prausnitzii is prominent in atopy microbiomes. This is one of the most important species in the RFE-SVM model, and one of the most prevalent species in human intestinal microbiomes. It can be assumed that it will play an important role in human physiology, and it will play an important role in atopic dermatitis. The experiment proceeded by guessing. Furthermore, F. prausnitzii was relatively easy to study because of the configuration of a single paper machine, large red (clade). Research has been conducted with the possibility that atopic dermatitis may be related to a specific subspecies rather than the entire species. The ESPRIT OTU, referred to as F. prausnitzii , appeared in all seven clades in the phylogenetic tree. Since this strain is based solely on the V1-V2 sequence, each clad is more likely to divide when the entire 16S rRNA gene sequence is applied. Among these clads, F06 was found to be significantly increased in the atopic dermatitis microbiome (see FIGS. 3A-C). The increase in F06 in atopic dermatitis microbiomes was common at all ages, but was particularly noticeable in the one year old group or less (see FIGS. 3A-C). Since atopic dermatitis begins much before age 1, the results show that the subspecies of F. prausnitzii is involved in the development of the disease.

Figure 4a shows the V1-V2 region in the 16S rRNA gene of the F. prausnitzii strain, Figure 4b shows the common sequence of F06 V1, Figure 4c. Shows the complete F06 454 analysis, FIG. 4D. Relative abundance of V1 sequence.

The five strains of F. prausnitzii , A2-165, M21 / 2, L2-6, S3L / 3, and KLE1255, were sequenced through the Human microbiome project (HMP). Among them, the L2-6 strain has a very unique V1-V2 region, particularly the V1 region, compared with the other four strains, and is well matched with the F06 clad (see FIGS. 4A-D). Although the V1-V2 region is only part of the 16S rRNA gene, a near perfect match (see FIGS. 4A-D) with each other indicates that L2-6 and F06 bacteria are in close proximity. F. The 15,825 predicted protein sequences of 5 strains of prausnitzii were compared to each other using BLASTP to remove overlapping genes, revealing a total of 7,253 genes in the F. prausnitzii pangeome (see FIGS. 8A-B). There were 855 unique genes in the L2-6 strain and similar numbers in other strains. To compare intestinal microbiomes and F. prausnitzii pangenome, eight of the samples (four samples from each of the experimental and control groups) were screened and whole genome shotgun sequencing using the Illumina HiSeq 2000 platform. shotgun sequencing) was performed and an average sequence of 552 Mb was obtained per sample. These eight samples were selected based on similarly high proportions of F. prausnitzii content (19-36%). When the Illumina assays were mapped to the F. prausnitzii pangenome, most (87.4%) of L2-6 specific genes were found to match the atopy assay better than the control assay (see FIGS. 8A-B). On the other hand, A2-165 and KLE1255 specific genes were better matched to the analysis of the general public. Taken together, it can be seen that bacteria belonging to F06 have a high degree of flexibility in the genome as well as V1-V2 of L2-6.

atopy Microbiome  Metabolic changes

Metabolic changes in atopic dermatitis micro biome, the Illuminati analyzes (Illumina reads) an F. prausnitzii This was confirmed by mapping to the pangenome and KO databases. F. prausnitzii The pangenome approach was effective due to the high content of F. prausnitzii in the metagenome (19-36%). F. Although the prausnitzii pangenome is made up of only five strains, it is important to include two biologically important strains, A2-165, which is known to shrink from Crohon disease, and L2-6, which has been shown to be associated with atopy in this study. To interpret the mapping results, F. prausnitzii pangenome was analyzed by KO database, and KOs with different numbers of matching reads (P <0.05) were found in the atopy and control groups. Of the total 1,332 KO of pangenome, 415 KO was significantly different between the atopy experimental group and the control group, of which 122 KO was increased in the experimental group and 293 KO was increased in the control group (see FIGS. 5A-B).

KO increase in micro biome of atopic dermatitis, the oxidative stress (oxidative stress; peroxiredoxin, DMSO reductase, and sufBC operon, etc.) metabolic functions and various paths (pathway) of the transition metal transporter (transition metal transporters to respond to; Fe , Ni, Zn, and Mn), and GalNAc, which is a major component of mucin, is capable of transporting and degrading metabolism (see FIGS. 5A-B). On the other hand, the reduced genes in the atopy microbiome were biosynthetic genes of various amino acids, nucleotides, peptidoglycans, cofactors (see FIGS. 5A-B). The damaged intestinal environment may be accompanied by general nutrients, such as amino acids, cofactors, and coenzymes from the host, as well as increased special nutrients such as the mucin component GalNAc. An increase in general nutrients results in a decrease in biosynthetic genes in the microbiome, and an increase in special nutrients such as GalNAc will result in a selective increase in auxotrophic specialists or pathobionts that can utilize these substances. It may be. This intestinal environment can in turn promote intestinal epidermal damage, form cycles, and accelerate dysbiosis of the intestinal microbiome. F. prausnitzii Among the five strains, only L2-6 has a gene cluster utilizing GalNAc (see FIGS. 5A-B).

In the second method of mapping Illumina reads to the KO database, 122 KO out of a total of 5,832 KOs showed a difference between the metagenome of the atopy experimental group and that of the general control group. 66 KOs in atopy and 56 KOs in control metagenome were increased. KO analysis, but the results are less than F. prausnitzii fan genome analysis, the results are valuable because they contain meta-genome other than F. prausnitzii. F. Like the prausnitzii pangenome analysis, KO analysis showed increased metal transporter, GalNAc utilization, oxidative stress response and decreased biosynthetic function of amino acids, nucleotides, and cofactors in the atopy metagenome. However, new genes, such as those associated with L-fuculokinase and L-fucose isomerase, have also emerged. L-fucose is released from mucin glycoproteins, along with GalNAc Bacteroides It is used as an important nutrient for intestinal bacteria such as thetaiotaomicron . Glutathione S-transferase family, glucose-6-phosphate 1-dehydrogenase, glutamate decarboxylase, glyoxylate Newly discovered genes related to glycoxy and dicarboxylate metabolism have been discovered. Glutathione is a tripeptide of cysteine and glutamate, and bacteria are able to withstand the oxidative stress induced by free radicals and nitrogen metabolites generated by inflammatory cascades. to maintain homeostasis. Glutathione-S-transferase conjugates endogenous compounds such as reduced glutathione and peroxidized lipids to the detoxification process. E. In coli , the glucose-6-phosphate 1-dehydrogenase level was increased under oxidative stress, resulting in antioxidant activity of glutathione and nicotinamide adenine dinucleotide phosphate. It has been reported that this led to an increase in antioxidant molecules. Glutamate decarboxylase contains E. coli O157: H7 and Saccharomyces It is known to play an important role as an antioxidant in cerevisiae . Glyoxylate and dicaboxylate metabolism are also known to be involved in the antioxidant process. Taken together, this pattern of gene presence is more evidence that the intestinal epidermis of patients with atopic dermatitis is more likely to cause tissue damage due to inflammation (see FIGS. 5A-B).

Looked at a variety of different nutritional needs body (auxotroph) and harmful bacteria (pathobiont) have been judged to be increased in atopic dermatitis micro biome, they GalNAc-specific IIA component genes (agaF, K02744) of the PTS system have, as a result, It has been found that genes exist in many different forms. Increasing mucin utilization genes in various species indicates that the intestinal environment of atopic dermatitis thrives in a variety of auxotrophs and pathobions in addition to L2-6 type bacteria, which is associated with the progression and chronicization of atopic diseases. This can be seen.

Figure 6a is a graph showing the analysis of SCFAs of the experimental group and the control group, Figure 6b is F. prausnitzii The activity of the butyryl CoA: acetate CoA-transferase gene promoter from strains is compared.

F. prausnitzii Increase in F06 subspecies Butylate and Propionate  decrease

The production of SCFAs in intestinal microbiomes has great health benefits. Gas chromatographic-mass spectrometric was performed to see the difference in SCFAs production between the experimental and control microbiomes of atopic dermatitis (see FIGS. 6A-B). The main SCFSs, acetate, propionate, butylate, D and L-lactate, were compared in pairs by selecting experimental and control samples with similar amounts of F. prausnitzii but with significant differences in F06 OTU levels (Fig. 6a-b). All the samples are the amount of F. prausnitzii Eubacterium It is much higher than the total of other SCFAs producing bacteria such as rectale , Eubacterium hallii and Rosburia , so the small effect of other bacteria is negligible and can be interpreted as the effect of F. prausnitzii . As a result of comparative analysis of 12 pairs, a sample having a low F06 level showed higher amounts of butyrate and propionate than a sample having a high F06 level (see FIGS. 6A-B). The significant difference in the amount of these SCFAs suggests a very different intestinal environment between the experimental and control groups, which is important data. Differences other than atopic dermatitis, such as age, had no significant effect on the SCFAs profile, indicating that F06 level is the most important factor.

Since the L2-6 strain associated with the F06 clad and the other four strains all have the same butyrate biosynthetic pathway, the key Enzyme Beautiyl CoA: The gene of acetate CoA-transferase (key enzyme butyryl CoA: acetate CoA-transferase) was examined. Promoters of this gene in each strain were synthesized and cloned in front of the lacZ reporter to a promoter-probe vector to compare the gene expression in E. coli (FIGS. 6A-B). Reference). Although not compared in F. prausnitzii host, relative promoter strengths can be compared because they are all compared under the same conditions. As a result, it was found that the promoter of the A2-165 strain was considerably more powerful than the L2-6 and other strains (see FIGS. 6A-B). Indeed, these results are consistent with papers that report differences in butylate productivity of the A2-165 and L2-6 strains. These results indicate that the butylate level of the sample is F. prausnitzii. It is determined by the subspecies composition. Thus, in relation to atopic dermatitis, the dysbiosis of F. prausnitzii shrinks high butyrate producers like bacteria of type A2-165, resulting in lower butyrate production. It can be seen that.

Figure 7 shows a proposed model of AD associated with dysfunction of F. prausnitzii .

F. prausnitzii , a dominant species among human intestinal microorganisms, has been known to play a role in gut health through the production of SCFAs. Butylates, in particular, have anti-inflammatory properties and are used as direct energy to intestinal surface cells. F. reduction of SCFAs prausnitzii levels and productivity are associated with Crohn's disease (Crohn disease). F. It has been found that the balance between prausnitzii subspecies, especially between L2-6 and A2-165 type bacteria, affects SCFAs productivity. Atopic dermatitis metagenome showed an increase in genes that utilize components of mucins such as GalNAc and L-fucose and various nutrients that can flow out of damaged intestinal epidermal cells (see FIGS. 5A-B). This means an increase in inflammation of the intestinal epidermal cells, which is generically equivalent to "leakey gut syndrome". If such damage to the intestinal surface is caused by a mismatch of F. prausnitzii or other causes, it will promote the mismatch of F. prausnitzii and at the same time promote the growth of various auxotrophs and pathobionts. Eventually, a feedback loop is formed between the mismatch of F. prausnitzii and dysregulation of intestinal epidermal inflammation.

Although the embodiments have been described by the limited embodiments and the drawings as described above, various modifications and variations are possible to those skilled in the art from the above description. For example, the techniques described may be performed in a different order than the described method, and / or the components described may be combined or combined in a different form than the described method, or replaced or substituted by other components or equivalents. Appropriate results can be achieved.

Therefore, other implementations, other embodiments, and equivalents to the claims are within the scope of the claims that follow.

Claims (9)

1. Biomarker composition comprising the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 as an active ingredient.
2. The method of claim 1,

   Wherein said composition detects a subspecies (F06) of F. prausnitzii .
3. The method of claim 1,

   The composition is for diagnosing atopic dermatitis, biomarker composition.
4. The method of claim 1,

   Biomarker composition comprising a nucleotide sequence having at least 97% sequence identity with SEQ ID NO: 1 or SEQ ID NO: 2 as an active ingredient.
5. A diagnostic kit comprising the composition of any one of claims 1 to 4.
6. Providing an isolated nucleic acid sample; And

   Recognizing a nucleotide sequence comprising SEQ ID NO: 1 or SEQ ID NO: 2, information providing method.
7. The method of claim 6,

   Recognizing the base sequence comprising SEQ ID NO: 1 or SEQ ID NO: 2, comprising the step of detecting a subspecies (F06) of F. prausnitzii , information providing method.
8. The method of claim 6,

   Recognizing the base sequence comprising the SEQ ID NO: 1 or SEQ ID NO: 2, An information providing method for diagnosing atopic dermatitis.
9. The method of claim 6,

   The base sequence including SEQ ID NO: 1 or SEQ ID NO: 2,

   And a base sequence having at least 97% sequence identity with SEQ ID NO: 1 or SEQ ID NO: 2.

Images