WO2017049136A1 - Nucleic acid frameworks for structural determination - Google Patents

Nucleic acid frameworks for structural determination Download PDF

Info

Publication number
WO2017049136A1
WO2017049136A1 PCT/US2016/052209 US2016052209W WO2017049136A1 WO 2017049136 A1 WO2017049136 A1 WO 2017049136A1 US 2016052209 W US2016052209 W US 2016052209W WO 2017049136 A1 WO2017049136 A1 WO 2017049136A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
target
nanostructure
rna
kit
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2016/052209
Other languages
French (fr)
Inventor
Peng Yin
Nicolas GARREAU DE LOUBRESSE
Andres LESCHZINER
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Harvard University
Original Assignee
Harvard University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Harvard University filed Critical Harvard University
Publication of WO2017049136A1 publication Critical patent/WO2017049136A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • C07H21/04Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B82NANOTECHNOLOGY
    • B82YSPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y15/00Nanotechnology for interacting, sensing or actuating, e.g. quantum dots as markers in protein assays or molecular motors
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B82NANOTECHNOLOGY
    • B82YSPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y5/00Nanobiotechnology or nanomedicine, e.g. protein engineering or drug delivery

Definitions

  • Biological macromolecules perform numerous functions in vivo including being the structural elements of the cell, catalyzing metabolism, regulating various cellular functions, and transcribing and repairing DNA. Various of these functions are tightly related to their physical shapes and conformations which are commonly referred to as atomic structures. For example, the precise mechanisms of several important proteins and macromolecular complexes have been elucidated based on their atomic structures such as for example DNA polymerases, RNA polymerases and ribosomes. Similarly, the pharmaceutical industry has implemented the use of atomic structures of protein-ligand complexes to guide the rational development of lead compounds. While there has been tremendous effort to determine the structure of proteins, only a small fraction of protein structures have so far been elucidated. In most cases, results from experiments are not sufficient to build the atomic model of a macromolecule in its totality and/or de novo.
  • cryo-EM Single particle cryo-electron microscopy
  • cryo-EM is an alternative to X-ray crystallography.
  • Cryo-EM is gaining popularity among structural biologists. In comparison to X-ray crystallography, cryo-EM does not require crystals and only uses a small amount of sample.
  • cryo-EM does not require crystals and only uses a small amount of sample.
  • the technique is still limited to large biological targets such as large protein complexes or ribosome structures.
  • the ion channel TRPV1 300-400 kDa
  • TRPV1 300-400 kDa
  • Cryo-EM is limited to large biological targets because the signal-to-noise ratio (SNR) in the recorded images drops with particle size. Accurate alignment for class averaging and orientation determination is thus an even more challenging task for smaller targets due to their inherent lower SNR. As a result, the low SNR compromises the 3D reconstruction process resulting in a low-resolution cryo-EM map that does not provide sufficient information for atomic structure determination. Importantly, the vast majority of human proteins have a molecular weight lower than 200 kDa, and have therefore not been considered suitable candidates for cryo-EM.
  • the present disclosure is based, generally, on the application of nucleic acid nanotechnology to structural determination.
  • This disclosure contemplates and provides the use of nucleic acid nanostructures as scaffolds for targets to be studied using a variety of imaging modalities, such as cryo-electron microscopy (cryo-EM).
  • imaging modalities such as cryo-electron microscopy (cryo-EM).
  • cryo-EM cryo-electron microscopy
  • the nucleic acid nanostructures serve to increase the size of the imaged moiety (i.e. , the nanostructure-target complex), thereby increasing the SNR and yielding an image having detectable features, thereby facilitating particle detection (as a result of larger size), class averaging and orientation determination (as a result of asymmetric features).
  • This renders small targets (e.g. , those less than 300 kDa or less than 200 kDa) amenable to cryo-EM.
  • Targets of particular but not exclusive interest include proteins.
  • the disclosure also provides repeating unit nanostructure-target complexes for use in X-ray and electron diffraction based imaging modalities.
  • These imaging modalities typically require targets in crystalline forms.
  • not all targets readily yield to crystallization and not all crystals yield to high resolution diffraction.
  • the disclosure overcomes this limitation through the provision of a repeating unit nanostructure-target complex that essentially acts as a crystal due to its periodicity.
  • these complexes can be generated in both 2 dimensional (2D) and 3 dimensional (3D) forms (referred to herein as 2D and 3D crystals).
  • cryo-EM, X-ray and electron diffraction studies can be carried out using 2D and 3D crystals provided herein to determine the structure of targets of interest, including targets that are not readily crystalized.
  • Targets of interest include but are not limited to proteins.
  • one aspect of this disclosure provides an asymmetric or low symmetry nucleic acid nanostructure conjugated to a target.
  • the nanostructure has a cylindrical or spherical shape. In some embodiments, the nanostructure has a cylindrical shape. In some embodiments, the nanostructure comprises 16-64 double-stranded nucleic acid helices. In some embodiments, the nucleic acid nanostructure is a DNA nanostructure.
  • the nucleic acid nanostructure comprises a nucleotide sequence to which the target specifically binds directly. In some embodiments, the nucleic acid nanostructure comprises a nucleotide sequence to which the target specifically binds indirectly.
  • the nanostructure is conjugated to a single target. In some embodiments, the nanostructure is conjugated to two or more targets, and such targets may be identical or different from each other. In some embodiments, each nanostructure is conjugated to multiple copies of the same target or multiple copies of different targets, thus enabling multiplex analysis, for example.
  • the target is a biological molecule.
  • the target is a synthetic macromolecule (e.g. , designed de novo).
  • Biological complex targets for example, those that include proteins, RNA, DNA or a combination thereof are encompassed herein.
  • the target is a non-biological molecule.
  • the target is a chemical molecule, such as a small molecule drug (or other small molecule) or chemical compound.
  • molecules are conjugated to single- stranded nucleic acids (oligonucleotides) and incorporated into a nucleic acid nanostructure.
  • the target is a protein. In some embodiments, the target has a molecular weight of about 200 kDa or less. In some embodiments, the target is a nucleic acid binding protein. In some embodiments, the target is a transcription factor. In some embodiments, the target is fused to a nucleic acid binding protein or a nucleic acid binding domain.
  • the target is an RNA.
  • the target is DNA (e.g. , a DNA nanostructure).
  • Another aspect provides a plurality of the foregoing asymmetric or low symmetry nucleic acid nanostructures.
  • the plurality is deposited on a carbon film.
  • the plurality is deposited on a holey grid.
  • the plurality is vitrified on an electron microscope (EM) grid.
  • EM electron microscope
  • the plurality is monodisperse.
  • the plurality is polydisperse.
  • the plurality comprises at least two monodisperse sub- populations, wherein the two monodisperse sub-populations differ from each other in shape and bound target.
  • kits comprising a plurality of nucleic acids that self- assemble to form an asymmetric or low symmetry nucleic acid nanostructure, wherein one of the nucleic acids comprises a binding sequence for nucleic acid binding protein, a nucleic acid binding domain, an RNA, or a linker.
  • one or more of the nucleic acids comprises a binding sequence for nucleic acid binding protein, a nucleic acid binding domain, or an RNA. In some embodiments, one or more of the nucleic acids comprises a binding sequence for a nucleic acid binding protein or a nucleic acid binding domain. In some embodiments, two of the nucleic acids comprise a binding sequence for a nucleic acid binding protein or a nucleic acid binding domain. In some embodiments, one or more of the nucleic acids comprises a binding sequence for an RNA.
  • the nucleic acid binding protein is a DNA binding protein. In some embodiments, the nucleic acid binding protein is a transcription factor.
  • the kit further comprises the nucleic acid binding protein. In some embodiments, the kit further comprises a fusion protein comprising the nucleic acid binding protein or a nucleic acid binding domain thereof.
  • the plurality of nucleic acids comprises a plurality of single- stranded tile oligonucleotides. In some embodiments, the plurality of nucleic acids comprises a scaffold DNA and a plurality of single stranded oligonucleotides. In some embodiments, the nanostructure is cylindrical or spherical in shape. In some embodiments, the nanostructure is cylindrical in shape and comprises 16-64 double- stranded nucleic acid helices.
  • kits comprising a pre-formed nucleic acid nanostructure, such as any of the asymmetric or low symmetry or helically shaped nanostructures described herein.
  • the kits may further comprise handle oligonucleotides which bind to particular positions on the nanostructure.
  • the kits may comprise nucleic acid binding domains or proteins or linkers to be used to bind the target to the nanostructure.
  • the kits may comprise plasmids that encode such nucleic acid binding proteins or domains.
  • Another aspect provides a method of imaging a target comprising exposing a plurality of targets to an electron source, each target bound to a separate asymmetric or low symmetry nucleic acid scaffold, obtaining two-dimensional projections of the plurality of targets, and reconstructing the two-dimensional projections into a three-dimensional image of the target.
  • the target is a biological molecule. In some embodiments, the target is a protein. In some embodiments, the target has a molecular weight of about 200 kDa or less. In some embodiments, the target is a nucleic acid binding protein. In some embodiments, the target is a transcription factor. In some embodiments, the target is fused to a nucleic acid binding protein or a nucleic acid binding domain. In some embodiments, the target is an RNA.
  • the asymmetric or low symmetry nucleic acid scaffold is an asymmetric nucleic acid scaffold. In some embodiments, the asymmetric or low symmetry nucleic acid scaffold is a low symmetry scaffold. In some embodiments, the asymmetric or low symmetry nucleic acid scaffold is a DNA scaffold.
  • the asymmetric or low symmetry nucleic acid scaffold comprises a nucleotide sequence to which the target specifically binds directly or indirectly.
  • the imaging is cryo-electron microscope imaging.
  • Another aspect provides a cylindrical nucleic acid nanostructure conjugated to a plurality of targets, wherein the targets are arranged in a helical manner on the surface of the nanostructure.
  • the cylindrical nucleic acid nanostructure comprises 5-50 targets per helical turn or 10-20 targets per helical turn.
  • the nucleic acid nanostructure is a DNA nanostructure.
  • a helical nanostructure is designed to display different target molecules in a helical manner on the same nanostructure. For example, different targets may be arranged in rings along a helical axis. As another example, double helices may be designed for two targets, triple helices for three targets, etc.
  • the target is a biological molecule.
  • the target is a protein. In some embodiments, the target has a molecular weight of about 200 kDa or less. In some embodiments, the target has a molecular weight in the range of 200 kDa to 5 MDa. In some embodiments, the target is a nucleic acid binding protein. In some embodiments, the target is a transcription factor. In some embodiments, the target is fused to a nucleic acid binding protein or a nucleic acid binding domain.
  • the target is an RNA.
  • the nucleic acid nanostructure comprises a nucleotide sequence to which the target specifically binds directly or indirectly.
  • Another aspect provides a plurality of the foregoing cylindrical nucleic acid nanostructures.
  • the plurality of the cylindrical nucleic acid nanostructures is deposited on a carbon film.
  • the cylindrical nucleic acid nanostructures are vitrified on an electron microscope (EM) grid.
  • the cylindrical nucleic acid nanostructures are vitrified on an electron microscope (EM) grid in an amorphous ice layer having a depth of about 50 nm or less.
  • kits comprising a plurality of nucleic acids that self- assemble to form any of the foregoing cylindrical nucleic acid nanostructures, wherein the nanostructure comprises a plurality of binding sequences for a nucleic acid binding protein, a nucleic acid binding domain, an RNA, or a linker.
  • the nanostructure comprises a plurality of binding sequences for a nucleic acid binding protein, a nucleic acid binding domain, or an RNA.
  • the nanostructure comprises a plurality of binding sequences for a nucleic acid binding protein.
  • the nucleic acid binding protein is a DNA binding protein.
  • the nucleic acid binding protein is a transcription factor.
  • the kit further comprises the nucleic acid binding protein. In some embodiments, the kit further comprises a fusion protein comprising the nucleic acid binding protein or a nucleic acid binding domain thereof. In some embodiments, the kit further comprises the RNA. In some embodiments, the nanostructure comprises 5-50 target binding sites per helical turn, or 10-20 target binding sites per helical turn.
  • the nanostructure comprises a plurality of binding sequences for an RNA.
  • the plurality of nucleic acids comprises a scaffold DNA and a plurality of single stranded oligonucleotides.
  • the plurality of nucleic acids comprises a plurality of single stranded tile oligonucleotides.
  • two or more of the nucleic acids comprise binding sequence for the nucleic acid binding protein.
  • Another aspect provides a method of imaging a target comprising exposing a plurality of complexes to an electron source, wherein each complex comprises a plurality of targets bound in a helical manner to a surface of a cylindrical nucleic acid scaffold, obtaining two- dimensional projections of the plurality of complexes, and reconstructing the two- dimensional projections into a three-dimensional image of the target.
  • 5-50 targets or 10-20 targets are bound to the surface of the cylindrical nucleic acid scaffold per helical turn.
  • the surface is an external surface of the cylindrical nucleic acid scaffold.
  • the target is a biological molecule. In some embodiments, the target is a protein. In some embodiments, the target is an RNA. In some embodiments, the target has a molecular weight of about 200 kDa or less. In some embodiments, the target has a molecular weight of about 200 kDa to about 5 MDa. In some embodiments, the target is a nucleic acid binding protein. In some embodiments, the target is a transcription factor. In some embodiments, the target is fused to a nucleic acid binding protein or a nucleic acid binding domain.
  • the cylindrical nucleic acid scaffold is a cylindrical DNA scaffold. In some embodiments, the cylindrical nucleic acid scaffold comprises a nucleotide sequence to which the target specifically binds.
  • the imaging is cryo-electron microscope imaging.
  • One aspect of this disclosure provides a two-dimensional array of nucleic acid nanostructures, each nanostructure conjugated to a target, wherein the two-dimensional array comprises a plurality of single stranded tile oligonucleotides.
  • Another aspect provides a two-dimensional array of nucleic acid nanostructures, each nanostructure conjugated to a target, wherein each nucleic acid nanostructure comprises a cavity having a dimensions of 5 x 5 x 5 nm, ⁇ ⁇ lO x 10 nm, or 50 x 50 x 50 nm.
  • the two-dimensional array is deposited on a carbon film. In some embodiments, the two-dimensional array is deposited on an electron microscope (EM) grid and vitrified.
  • EM electron microscope
  • kits comprising a first plurality of nucleic acids that self- assemble to form a nucleic acid nanostructure having a cavity, wherein one of the nucleic acids comprises a binding sequence for a nucleic acid binding protein or an RNA, wherein the nucleic acid binding protein or the RNA bind to the cavity, and a second plurality of nucleic acids that attach the nucleic acid nanostructures to each other to form a two- dimensional array of nucleic acid nanostructures.
  • one of the nucleic acids comprises a binding sequence for a nucleic acid binding protein. In some embodiments, one of the nucleic acids comprises a binding sequence for an RNA.
  • the nucleic acid binding protein is a DNA binding protein. In some embodiments, the nucleic acid binding protein is a transcription factor.
  • the kit further comprises the nucleic acid binding protein. In some embodiments, the kit further comprises a fusion protein comprising the nucleic acid binding protein or a nucleic acid binding domain thereof. In some embodiments, the kit further comprises the RNA.
  • the first plurality of nucleic acids comprises a scaffold DNA and a plurality of single stranded oligonucleotides. In some embodiments, the first plurality of nucleic acids comprise a plurality of single stranded tile oligonucleotides.
  • Another aspect provides a method of imaging a target comprising (1) exposing a repeating unit nucleic acid nanostructure-target complex, deposited on a solid support, to an electron source, (2) incrementally changing the angle of the solid support relative to the electron source, (3) obtaining a two-dimensional projection of the repeating unit nucleic acid nanostructure-target complex, (4) repeating steps (l)-(3) one or more times, and (5) reconstructing the two-dimensional projections into a three-dimensional image of the target.
  • a 2D framework that binds the target in different prescribed orientations, for example, by shifting the DNA binding site of a DNA binding protein by one base pair. This shift would result in the rotation of the binding site and, therefore, of the DNA binding protein by approximately 30 degrees per shift. Analyzing (viewing) the 2D framework from the top view provides multiple views of the target without tilting the grid.
  • Another aspect provides a method of imaging a target comprising exposing a plurality of targets to an electron source, each target bound to a single nucleic acid nanostructure arranged in a two-dimensional array of nanostructures, obtaining two-dimensional projections of the plurality of targets, and reconstructing the two-dimensional projections into a three- dimensional image of the target.
  • the target is a biological molecule. In some embodiments, the target is a protein. In some embodiments, the target is an RNA.
  • the target has a molecular weight of about 200 kDa or less. In some embodiments, the target has a molecular weight of about 200 kDa to about 5 MDa.
  • the target is a nucleic acid binding protein. In some embodiments, the target is a transcription factor. In some embodiments, the target is fused to a nucleic acid binding protein or a nucleic acid binding domain.
  • the nucleic acid nanostructure is a DNA nanostructure. In some embodiments, the nucleic acid nanostructure comprises a nucleotide sequence to which the target specifically binds. In some embodiments, each nanostructure is conjugated to a single target.
  • the imaging is cryo-electron microscope imaging. In some embodiments, the imaging is X-ray diffraction based imaging. In some embodiments, the imaging is electron diffraction based imaging.
  • Another aspect provides a three-dimensional array of nucleic acid nanostructures, each conjugated to a target, wherein the three-dimensional array comprises a plurality of single stranded tile oligonucleotides.
  • Another aspect provides a three-dimensional array of nucleic acid nanostructures, each nanostructure conjugated to a target, wherein each nucleic acid nanostructure comprises a cavity having a dimensions of 5 x 5 x 5 nm, ⁇ ⁇ lO x 10 nm, or 50 x 50 x 50 nm.
  • kits comprising a first plurality of nucleic acids that self- assemble to form a nucleic acid nanostructure having a cavity, wherein one of the nucleic acids comprises a binding sequence for a nucleic acid binding protein or an RNA, wherein the nucleic acid binding protein or the RNA bind to the cavity, and a second plurality of nucleic acids that attach the nucleic acid nanostructures to each other to form a three- dimensional array of nucleic acid nanostructures.
  • one of the nucleic acids comprises a binding sequence for a nucleic acid binding protein. In some embodiments, one of the nucleic acids comprises a binding sequence for an RNA
  • the nucleic acid binding protein is a DNA binding protein. In some embodiments, the nucleic acid binding protein is a transcription factor.
  • the kit further comprises the nucleic acid binding protein. In some embodiments, the kit further comprises a fusion protein comprising the nucleic acid binding protein or a nucleic acid binding domain thereof.
  • the first plurality of nucleic acids comprises a scaffold DNA and a plurality of single stranded oligonucleotides. In some embodiments, the first plurality of nucleic acids comprise a plurality of single stranded tile oligonucleotides.
  • the kit further comprises the RNA.
  • Another aspect provides a method of imaging a target comprising (1) exposing a three-dimensional repeating unit nucleic acid nano structure-target complex, deposited on a solid support, to an electron or X-ray source, (2) obtaining electron or X-ray diffraction images of the three-dimensional repeating unit nucleic acid nano structure-target complex, and (3) identifying the structure of the target from the diffraction images.
  • the target is a biological molecule. In some embodiments, the target is a protein. In some embodiments, the target is an RNA.
  • the target has a molecular weight of about 200 kDa or less. In some embodiments, the target has a molecular weight of about 200 kDa to about 5 MDa.
  • the target is a nucleic acid binding protein. In some embodiments, the target is a transcription factor. In some embodiments, the target is fused to a nucleic acid binding protein or a nucleic acid binding domain.
  • the nucleic acid nanostructure is an DNA nanostructure. In some embodiments, the nucleic acid nanostructure comprises a nucleotide sequence to which the target specifically binds. In some embodiments, each nucleic acid nanostructure is conjugated to a single target. In some embodiments, the imaging is X-ray diffraction based imaging. In some embodiments, the imaging is electron diffraction based imaging.
  • Another aspect provides an asymmetric or low symmetry nucleic acid nanostructure conjugated to a target.
  • the nanostructure has a cylindrical or spherical shape. In some embodiments, the nanostructure has a cylindrical shape. In some embodiments, the nanostructure comprises 16-64 double-stranded nucleic acid helices. In some embodiments, the nucleic acid nanostructure is a DNA nanostructure.
  • the nucleic acid nanostructure comprises a nucleotide sequence to which the target specifically binds directly. In some embodiments, the nucleic acid nanostructure comprises a nucleotide sequence to which the target specifically binds indirectly.
  • the nanostructure is conjugated to a single target. In some embodiments, the nanostructure is conjugated to two or more targets, and such targets may be identical or different from each other.
  • Fig. 1 provides an example of a cylindrical (left) and cuboid (right) asymmetric scaffolds made of DNA.
  • Fig. 2 illustrates a nucleic acid (e.g. , DNA) scaffold (shown as a central cylinder) designed to position targets (shown as spheres) at its surface in a helical manner.
  • Several scaffolds can be connected together to form long filaments.
  • Fig. 3A illustrates a 2D crystal made of nucleic acids and engineered to display, in a periodic manner, targets (shown as spheres) in two dimensions (or a 2D array).
  • Fig. 3B illustrates the projections obtained from prescribed orientations using 2D crystals and deliberately tilting the cryo-EM grid incrementally.
  • Fig. 4 illustrates a 3D crystal made of nucleic acids and engineered to display, in a periodic manner, targets (shown as spheres) in three dimensions (or a 3D array).
  • Fig. 5 is a schematic depicting the proof-of-concept study's overall design.
  • Fig. 6 shows an in silico model of the protein CRISPR/Cas9 bound to the dsDNA linker of the framework (left) and scheme of the dsDNA linker (right).
  • Fig. 7 is a blueprint of the DNA framework with the dsDNA linker (the figure was generated using CADnano). The square highlights the dsDNA linker that contains the CRISPR/Cas9 binding elements.
  • Fig. 8 shows agarose gel electrophoresis analysis of the sample after folding.
  • Fig. 9 shows an agarose gel analysis of the glycerol gradients fractions.
  • Fig. 10 shows agarose gel electrophoresis analysis of the reactions to detect a band shift corresponding to the formation of the complex.
  • Fig. 11 shows a TEM micrograph (40,000X magnification) of the complex.
  • Figs. 12A-12B show individual particles (Fig. 12B) from the TEM micrograph (Fig. 12A). The location of CRISPR/Cas9 is indicated by a triangle.
  • Fig. 13 shows other examples of individual particles from TEM micrographs at higher magnification (with or without the protein bound) compared to the theoretical model.
  • Fig. 14 shows single -particle averaging from TEM micrographs. Four different views are represented.
  • the white sphere is the protein.
  • Figs. 15A-15B show individual particles selected from cryo-EM micrographs.
  • Fig. 16 shows a different DNA framework visualized by cryo-EM (without proteins).
  • compositions and methods for improving the efficacy and thus broadening the use of various imaging modalities such as cryo-EM.
  • This disclosure provides broadly for the use of nucleic acid nanostructures as scaffolds to which targets of interest are associated, for example, for the purpose of imaging using cryo-EM.
  • the targets of interest may be covalently or non-covalently bound to the nano structure.
  • the use of the nanostructures as scaffolds has several advantages.
  • the scaffold effectively increases the size of the imaged moiety which increases the SNR, which in turn improves or facilitates particle detection, class averaging and orientation that yields to better resolution of the final reconstructed map. This is particularly important for small targets having a molecular weight on the order of 250 kDa or less, which heretofore have not been accessible by cryo-EM.
  • the nanostructure can be designed to be asymmetric which facilitates the process of class averaging, orientation determination, and ultimately 3D reconstruction of 2D projections.
  • cryo-EM involves the direct imaging of targets randomly deposited on a grid. The random deposition results in random orientation of the targets on the grid (e.g., each target adopts one of a number of different orientations).
  • the nanostructure can be designed to be asymmetric (or to have low or limited symmetry) in order to facilitate class averaging, orientation determination, and ultimately 3D reconstruction of 2D projections.
  • cryo-EM involves the direct imaging of targets randomly deposited on a grid. The random deposition results in random orientation of the targets on the grid (i.e., each target adopts one of a number of different orientations).
  • This disclosure contemplates the use of asymmetric (or low or limited symmetry) nanostructures in order to simplify orientation determination.
  • the nanostructure therefore acts as a scaffold of known asymmetric shape that serves to (1) increase SNR and thereby improve detection of the target, and (2) facilitate alignment for class averaging and orientation determination of the 2D class averages, thereby simplifying image analysis and ultimate 3D reconstruction of the target, resulting in more highly resolved cryo-EM maps.
  • a repeating unit scaffold is provided in the form of a 2D or 3D array of nanostructures, each nanostructure bound to the target of interest. Such repeating unit complexes are illustrated in FIGs. 3 and 4. These structures are referred to herein as 2D and 3D crystals. It is to be understood that the repeating unit comprises both nucleic acid nanostructure (scaffold) and target.
  • the 2D arrayed scaffold is useful in cryo-EM as it allows a number of targets having the same orientation to be visualized simultaneously. It also allows the end user to change the orientation of the plurality of targets simultaneously and in an identical manner, in order to obtain additional views of the target. This can be done by deliberately adjusting the angle of the EM grid.
  • the scaffold may also be a repeating unit scaffold, wherein each repeating unit comprises the target of interest.
  • the resultant repeating unit nanostructure- target complex can be used in a manner similar to the crystalline forms of targets traditionally used in diffraction studies such as X-ray crystallography. Scaffolds
  • a scaffold refers to a nucleic acid nanostructure comprising a plurality of nucleic acids, including single-stranded oligonucleotides, engineered to self-assemble into a prescribed 3 dimensional (3D) shape.
  • the shape and features of the nanostructure will vary depending on the embodiment described herein. This disclosure contemplates the use of a variety of 3D shapes as scaffolds including but not limited to cuboid, cylindrical, spherical, triangular and hexagonal shapes in certain embodiments.
  • the nanostructure has a shape that does not have a preferred orientation on a flat surface such as a cryo-EM grid.
  • the orientations assumed by the nanostructure upon deposition onto the cryo-EM grid are not biased towards one or a few orientations.
  • Cylindrical or spherical nanostructures are less likely to have preferred orientations when deposited on the cryo-EM grid such as a carbon-coated grid.
  • the nanostructure has a cylindrical shape, or a spherical shape, or a near spherical shape. (See He et al., Nature, 452: 198-201, 2008, for methodology relating to the generation of polyhedral structures that approximate near spherical shape.) Scaffolds having these shapes may be preferred in some embodiments.
  • the illustrated cylindrical scaffold is comprised of 24 double stranded nucleic acid ⁇ e.g. , DNA) helices, although it is to be understood that the disclosure contemplates cylindrical scaffolds that comprise a wider range of helices including for example 6-64 helices. In some instances, the cylindrical scaffolds comprise 24 or more helices. In some embodiments, the cylindrical scaffold is hollow. In other embodiments, the cylindrical scaffold is not hollow.
  • a cuboidal scaffold which has roughly 6 sides will come to rest on those sides or on a subset of those sides, thereby yielding a maximum of 6 different orientations of the structure.
  • cuboid nanostructures may have a tendency to deposit on the cryo- EM grid in a preferred orientation, and this reduces the number of orientations that contribute to the overall structural determination of the target.
  • the nanostructure is not cuboid (or cuboidal) in shape. If a cuboid nanostructure is used in a cryo-EM method, a holey cryo-EM grid may be used in order to enhance random orientation of the nanostructure on the grid.
  • Certain other embodiments tolerate preferred orientations of the nanostructures and could be performed using any shape including cuboid.
  • Various scaffolds provided herein are also useful because they allow for greater control of thickness of the amorphous ice on the cryo-EM grid. This is due to the fact that when the nanostructures come to rest on the cryo-EM grid, their height (i.e. , distance from the grid surface) will be essentially the same regardless of how they come to rest (i.e. , regardless of what orientation they adopt). This can be illustrated with a spherical or nearly spherical nanostructure. Regardless of how such a spherical or near spherical nanostructure comes to rest on the cryo-EM grid, its height will be about the same. This is true for cylindrical nanostructures, including those having a length that is greater than its diameter.
  • the height of the cylindrical nanostructure will be about the same as the diameter of the nanostructure, as it has been observed experimentally that these structures come to rest on their sides rather than their ends. In some instances involving cylindrical nanostructures, it is preferred to use cylindrical shapes having a length that is greater than its diameter for this reasons. Additionally, there are many orientations that can be adopted if the cylinder is on its side as compared to on its end.
  • the size e.g. , diameter
  • the diameter may be adjusted by, for example, changing the number of double helices that contribute to the nanostructure, with nanostructures having for example 16 helices having a smaller diameter than those having 64 helices.
  • the scaffold has a diameter of about 15 nm or more. In some instances, the scaffold has a diameter of about 15- 100 nm, or 15-80 nm, or 15-50 nm, or 15-30 nm.
  • a nanostructure-target complex refers to the complex formed upon association (e.g. , covalent or non-covalent, direct or indirect, binding) of the target with nanostructure. It is to be understood that one or more than one target may be associated per nanostructure. If more than one target is bound to the nanostructure, those targets may be identical to each other or they may be different from each other.
  • the nanostructure-target complexes are provided as a monodisperse population, intending that all or nearly all (e.g. , greater than 95%, or greater than 99%) of the nanostructure-target complexes are identical to each other with respect to size, shape and target bound.
  • the population of nanostructure scaffolds may be
  • the nanostructure-target complexes are provided as a polydisperse population, intending the presence of at least two sub-populations of complexes, wherein those sub-populations differ from each other with respect to size and/or shape as well as target bound.
  • a polydisperse population an end user may be able to concurrently determine the structure of two or more targets, wherein each target is identified by the nanostructure scaffold to which it is bound (e.g. , the shape or nature of the nanostructure may be used to classify structures and thus targets).
  • a single nanostructure is associated with a single target and a plurality of nanostructures are joined together to form a 2D or 3D array.
  • Such arrays may be viewed in this manner, or they may be viewed as a single nanostructure having a plurality of repeating units, each unit comprising a binding site for a target of interest.
  • This disclosure provides for the use of asymmetric or low symmetry scaffolds in various imaging modalities, such as cryo-EM.
  • the asymmetric and low symmetry scaffolds facilitate particle detection, class averaging, and orientation determination.
  • the scaffold is an asymmetric scaffold. This means that the scaffold does not have an axis of symmetry.
  • Fig. 1 illustrates nucleic acid nanostructures having cylindrical (left) and cuboid (right) 3D shapes that can be used as scaffolds.
  • the illustrated nanostructures are "asymmetric", intending that they do not have an axis of symmetry.
  • the scaffold is a low symmetry scaffold. Scaffolds having low symmetry are those which yield few (a limited number of) possible solutions for a given view (e.g. , 2 or 4). The determination of such structures is facilitated by the limited number of possible solutions. This is in contrast to structures having greater degrees of symmetry (e.g., a typical non-asymmetric structure), which can give rise to 30,000 projections which in turn can be consolidated into 50-100 class averages.
  • Suitable scaffolds are referred to herein generally as asymmetric for convenience and brevity. It is to be understood however that the various aspects and embodiments relating to asymmetric scaffolds apply equally to low symmetry scaffolds unless explicitly stated otherwise.
  • an asymmetric scaffold comprises one or more structural features that impart asymmetry to the scaffold. Such features may be referred to herein as asymmetric features. They may be achieved by designing the nanostructure to have structural
  • Fig. 1 the lengths and relative positions of the double-stranded helices (each represented as a cylinder) can be varied to render the nanostructure asymmetric.
  • An example of an asymmetric nucleic acid nanostructure is also provided in Bai et al. PNAS, 109(49):20012-20017, 2012.
  • non-nucleic acid moieties may be incorporated into the nanostructure during synthesis or added to the nanostructure post- synthesis. They may be selected from a variety of moieties provided they do not interfere with the signal from the target yet are sufficiently electron dense to contribute signal and render the nanostructure asymmetric.
  • markers include but are not limited to metals such as metallic particles (e.g. , gold nanoparticles), inorganic compounds,
  • Carbon-rich markers may also be used. They should, however, be stably associated with the nanostructure such that their position and conformation is stable and static.
  • the asymmetric features may be located in or on the nanostructure.
  • the feature may be located on a surface of the nanostructure, and such surface may be an external surface or an internal surface.
  • the target being studied can also serve as the asymmetric feature. If the
  • nanostructure is bound to two or more targets (whether identical or different from each other), then such targets may be positioned to create asymmetry (e.g. , the position of such targets can be pre-determined in order to avoid creating an axis of symmetry).
  • cylindrical, spherical, or near spherical scaffolds including polyhedral scaffolds that are asymmetric or have low symmetry are particularly useful for cryo-EM structural
  • the 3D reconstruction from the 2D cryo-EM projections is simplified. This is because the asymmetric features provide key a priori information used to align the 2D projections for class averaging and to determine the orientation of each class average since each orientation provides a unique projection. As described herein, the use of asymmetric nanostructures or complexes facilitates the step of alignment and clustering of images and orientation determination.
  • the scaffold When a target of interest is attached to a large and asymmetric nucleic acid nanostructure scaffold, the scaffold provides enough a priori information to reconstruct the structure of the entire complex, including the target of interest, at high resolution regardless of the size of the target.
  • the use of a nucleic acid nanostructure as a scaffold overcomes the current limitations associated with smaller targets including for example (i) better particle detection due to the large size of the scaffold, (ii) better projection alignment for class averaging due to the prescribed geometry of the scaffold, and (iii) better orientation determination of class averages due to the asymmetric features encoded on the framework.
  • Targets to be analyzed using the asymmetric scaffolds provided herein may range from kiloDa (kDa) to megaDa (MDa) in size. In some embodiments they may have a molecular weight of less than or about 500 kDa, or less than or about 400 kDa, or less than or about 300 kDa, or less than or about 200 kDa, less than or about 100 kDa, or less than or about 50 kDa.
  • Nucleic acid scaffold for helical display of targets including macromolecules including macromolecules
  • the scaffold is a structure that approximates a cylindrical shape.
  • Macromolecules of interest may be positioned at the surface of the scaffold following a helical arrangement, as illustrated in Fig. 2. This strategy allows an end user to reconstitute a synthetic helical 3D arrangement of macromolecules that naturally do not form such structures.
  • the synthetic helical assembly can be analyzed by cryo-EM and processed as a regular helical structure.
  • the targets are displayed along the helical axis, thereby forming a helical filament, the respective orientations of each target is known because the overall geometry of the helix (e.g. , number of targets per turn, width and length of each turn, etc.) is known.
  • the arrangement of the targets in 3D provides information on their respective orientation.
  • Helical reconstruction approaches have been used in conjunction with cryo-EM to investigate biological targets that are inherently helical such as biological filaments (actin) or helical viruses.
  • This disclosure adapts that approach to study targets that are not inherently helical by creating and analyzing engineered synthetic helical filaments of targets.
  • the scaffold may be made of a plurality of single- stranded
  • DNA molecules engineered to self-assemble into a cylindrical structure are engineered to self-assemble into a cylindrical structure.
  • This disclosure therefore expands the use of single particle cryo-EM as previously applied to naturally occurring helical assemblies, such as for example helically arranged proteins, to targets that do not naturally adopt a helical form.
  • targets When such targets are displayed in a helical arrangement on a cylindrical nucleic acid nanostructure, the resulting synthetic helical complex can be analyzed by cryo-EM and the structure of the surface displayed target can be resolved by computational helical 3D reconstruction which is currently used for the structural study of naturally helical moieties such as biological filaments and helical viruses.
  • Targets to be analyzed using the helical display approach provided herein may range from kiloDa (kDa) to megaDa (MDa) in size. In some embodiments they may have a molecular weight of less than or about 200 kDa, while in other embodiments they may have a molecular weight in the range of about 200 kDa to about 10 MDa.
  • the helical nanostructure-target complex may comprise about 5-50 targets per turn of the helix, including about 10-40 targets per turn, or about 10-30 targets per turn, or about 10- 20 targets per turn.
  • the scaffold is a comprised of a plurality of repeating discrete structural units programmed to self-assemble in two dimensions.
  • the result of the assembly process is a two-dimensional array of such repeating units.
  • These repeating units may be regarded as nanostructures or the plurality of these repeating units may be regarded as the nano structure.
  • Targets, including macromolecules, of interest are positioned in or on the scaffold as illustrated in FIG. 3A.
  • the size and the shape of the repeating unit can be modified according to the particular target being studied. For example, it is possible to design cavities or trenches to facilitate the positioning of targets at the surface.
  • the scaffold may be made of a plurality of single-stranded DNA molecules engineered to self-assemble into the 2D array. See Wei et al. Nature, 485: 623-626, 2012; and Ke et al. Science, 338: 1177-1183, 2012, for methodologies relating to single stranded DNA tile based 2D and 3D nanostructures, the entire contents of which are incorporated herein by reference. Ke et al. Nature Chemistry, 6: 994-1002, 2014, demonstrate the methodology for generating 2D and 3D nanostructures using DNA brick structures. The reference demonstrates the ability to generate structures having precisely controlled depths up to 80 nm and/or having other nanoscale features such as continuous or discontinuous cavities or channels. The entire contents of this reference are incorporated by reference herein as well.
  • a 2D crystal is comprised of a plurality of repeating units each unit capable of binding at least one target.
  • Each unit may be regarded as a nucleic acid nanostructure capable of complexing with a target of interest. Such units are arranged in a periodic manner. The result is a relatively flat, single-layer structure.
  • the size of the array may vary in a controlled manner.
  • the shape and size of the contemplated nanostructures can be controlled during synthesis in a number of ways including for example the amount of nucleic acids used in the self-assembly process, including the nucleic acids used to connect individual units to each other. This is also the case for 3D crystals provided by this disclosure.
  • the 2D array may range in size from a 2x1 array or a 2x2 array to a 10x10 array or a 100x100 array or a 1000x1000 array or even larger (e.g. up to 10 5 x 10 5 ).
  • the array may be an n x n array or it may be an n x m array, wherein n and m are the number of units along the x or y dimension, and wherein m does not equal m.
  • the individual units in the 2D and 3D arrays need not have equal x and y dimensions. It is to be understood that the scaffolds used in the 2D and 3D crystal embodiments provided herein may be but need not be asymmetric.
  • These 2D crystals may be analyzed using cryo-EM by recording images in different orientations or by immobilizing the target protein in different prescribed orientations (in which case, tilting the EM grid is not needed). The crystal is placed on the EM grid and images of different views are recorded by progressively tilting the grid. The problem of orientation determination is solved because the operator knows the angle at which a given image is recorded. For each orientation, multiple projections can be recorded at the same time as the crystal contains hundreds to thousands copies of the target arranged in the same plan. This strategy is illustrated in FIG. 3B.
  • These 2D structures can also be analyzed using cryo-EM, or electron or X-ray diffraction techniques.
  • This embodiment facilitates the structural analysis of targets that do not form 2D crystals when used alone, although it is not limited to just those targets.
  • the use of a 2D array of nanostructures-target complexes creates a plurality of targets having the same orientation and allows the orientation of this plurality to be changed in an identical and coordinated manner. This simplifies the image processing required to render cryo-EM 3D reconstruction data.
  • the analysis will involve obtaining projections of a single crystal. In other instances, the analysis will involve obtaining projections of two or more crystals. Obtaining projections from more than one crystal and consolidating such projections may be performed to improve resolution.
  • the plurality of crystals may be similarly positioned on the cryo-EM grid (e.g., they have landed on the grid in an identical manner) or they may be differentially positioned on the cryo-EM grid.
  • the scaffold is comprised of a plurality of repeating discrete structural units programmed to self-assemble in three dimensions.
  • the result of the assembly process is a three-dimensional array of repeating units, which may be referred to herein as 3D crystals. These are illustrated in FIG. 4.
  • the size and the shape of the repeating unit can be modified according to the particular macromolecule being studied. For example, it is possible to design cavities in each repeating unit to host the macromolecule of interest.
  • the scaffold may be made of a plurality of single-stranded DNA molecules engineered to self-assemble into the crystal conformation.
  • This embodiment facilitates the structural analysis of targets that are not readily accessible using X-ray crystallography, thereby overcoming some of the obstacles faced when applying X-ray crystallography.
  • some targets do not form 3D crystals when used alone.
  • the conditions for forming their crystalline form are either not known or have not been sufficiently optimized for X-ray crystallography.
  • even if crystals can be formed such crystals can be fragile, difficult to produce in sufficient quantity, or difficult to reproduce, or they can contain structural defects, high solvent content, and/or high mosaicity which may alter diffraction experiments, especially at high resolution.
  • the methods provided herein overcome all of these obstacles because they do not require crystallization of the target itself. Instead, these methods use engineered crystals that are composites of nanostructures with repeating units, each unit having a binding site for a target. The repeating nature of the nanostructure-target composite is akin to a crystalline form of the target.
  • the 2D and 3D crystals of this disclosure can be used to study various targets using imaging modalities such as electron or X-ray diffraction.
  • imaging modalities such as electron or X-ray diffraction.
  • these methods lend themselves to the analysis of targets that do not readily crystallize, in a traditional sense, and thus are not ready candidates for electron diffraction or X-ray diffraction based studies when such targets are used alone.
  • targets are complexed to 2D or 3D arrayed nucleic acid nanostructures, they are essentially transformed into a crystal form that is amenable to analysis using diffraction modalities.
  • crystals provided herein may be referred to as synthetic crystals or nucleic acid based crystals. They are to be distinguished from the more traditional crystals formed typically from the target alone and used in the past for X-ray or electron diffraction studies.
  • targets may be stably complexed (or associated) to a nucleic acid nanostructure for a period of time and under conditions necessary to perform the structural analysis.
  • Targets include but are not limited to proteins and other moieties able to bind to nucleic acids, preferably at specific nucleotide sequences.
  • proteins include transcription factors, transcription activators and repressors, polymerases such as DNA polymerases, RNA polymerases, DNA repair proteins, nucleases such as restriction enzymes or CRISPR/Cas9 enzymes, integrases, histones, proteins involved in chromatin structure and/or chromatin remodeling, proteins involved in homologous recombination events, and the like.
  • polymerases such as DNA polymerases, RNA polymerases, DNA repair proteins, nucleases such as restriction enzymes or CRISPR/Cas9 enzymes, integrases, histones, proteins involved in chromatin structure and/or chromatin remodeling, proteins involved in homologous recombination events, and the like.
  • the targets may also be nucleic acids such as DNA molecules or RNA molecules.
  • the targets may be virtually any moiety that can be associated to a nucleic acid nanostructure directly (as for example is the case with the afore-mentioned targets) or indirectly (as for example is possible through the use of an intermediary moiety that can be associated to a nucleic acid nanostructure).
  • intermediary moieties include but are not limited to linkers such as bifunctional and heterobifunctional linkers or nucleic acid binding domains such as those discussed herein or otherwise known in the art.
  • Some embodiments provided herein are directed at targets having a molecular weight of about less than 200 kDa, including molecular weights in the range of 10-200 kDa, 25-200 kDa, 50-200 kDa, 75-200 kDa, and 100-200 kDa. Some embodiments provided herein are directed at targets having larger molecular weights, including molecular weights that range into MDa.
  • the target may have a molecular weight in the range of 10 kDa to 10 MDa, or 100 kDa to 10 MDa, or 200 kDa to 10 MDa, or 500 kDa to 10 MDa, or 1-10 MDa, or 1-5 MDa, or 1-3 MDa.
  • the targets may be used alone or in a complex with one or more moieties other than the nucleic acid nanostructure.
  • the targets are complexes of two or more moieties including biological and chemical molecules and compounds.
  • the target may be a complex of two binding partners of a binding partner pair such as but not limited to a receptor and ligand or a DNA binding protein and a DNA.
  • a binding partner pair such as but not limited to a receptor and ligand or a DNA binding protein and a DNA.
  • One or both of the binding partners may be naturally occurring or one or both of the binding partners may be non-naturally occurring.
  • one binding partner such as a receptor may be naturally occurring and the other binding partner such as a ligand may be a non-naturally occurring candidate ligand.
  • the target is fused to another moiety such as a protein or a protein domain.
  • fusion may facilitate the association, including binding, of the target to the nucleic acid nanostructure.
  • the target does not naturally bind to nucleic acids, and thus will not bind to the nucleic acid nanostructure normally, it can be fused to a DNA binding protein or a DNA binding domain of such a protein.
  • Methods for creating fusion proteins are known in the art as are DNA binding proteins and DNA binding domains thereof.
  • the disclosure contemplates the use of additional moieties in the nanostructure in order to render the system amenable to still other targets.
  • the disclosure contemplates use of lipids embedded in the nucleic acid nanostructure in order to study membrane proteins using this system.
  • attachment mechanisms include covalent and non- covalent means.
  • non-covalent means that take advantage of the nucleic acid binding activity of certain macromolecules, whether those
  • the attachment strategy should yield a complex of nucleic acid nanostructure and target that is sufficiently stable for the period of time required to image and under the conditions required to image.
  • the attachment strategy should also yield a complex in which the target is relatively static once bound to the nanostructure. For this reason, long or otherwise flexible linkers that allow the target to change conformation, including a change in orientation, relative to the nanostructure are to be avoided.
  • the target may be bound to a nucleic acid sequence of the nanostructure, or to a ligand that is present on the nanostructure. In either instance, the position of the target must remain constant between nanostructure-target complexes in a monodisperse plurality (or population).
  • the nucleic acid sequence to which the target or the ligand is bound is integral to the nanostructure ⁇ i.e., it is contained in an oligonucleotide that contributes to the shape and integrity of the nanostructure) or it is bound to an oligonucleotide that is integral to the nanostructure (in which case it may be referred to as a handle oligonucleotide.
  • proteins may be attached to the nanostructures through the use of heterobifunctional crosslinkers that react with the protein target on one end and an amino or thiol-modified oligonucleotide in the nanostructure (on the other end).
  • the protein of interest may be conjugated to an oligonucleotide using for example sortase based reactions.
  • nucleic acid binding proteins such as DNA binding proteins are contemplated as the macromolecules.
  • nucleic acid binding proteins include those that bind specifically to a particular nucleotide sequence, or those that can be made to bind to a particular nucleotide sequence under certain conditions.
  • the nucleotide sequence to which the macromolecule binds may be referred to herein as a target sequence.
  • the nucleic acid nanostructure is engineered to have the target sequence in a particular, known, pre-determined location that is accessible to the macromolecule.
  • the complex formed by binding the protein to its particular target should also be sufficiently stable such that it withstands the various manipulations required for the subsequent imaging process.
  • the macromolecule may be a DNA binding protein or an RNA binding protein.
  • macromolecule is used for illustration purposes only and that smaller molecules are also contemplated in such embodiments and in the disclosure as a whole unless otherwise indicated.
  • Exemplary DNA binding proteins include but are not limited to polymerases such as Dpo4 polymerase, and DNA editing proteins such as CRISPR/Cas9.
  • polymerases such as Dpo4 polymerase
  • DNA editing proteins such as CRISPR/Cas9.
  • the target DNA sequences of each protein were incorporated into the scaffold, the complex between the proteins and the scaffold were formed in solution, and the complexes were imaged independently by cryo-EM.
  • this approach is amenable to the study of a variety of targets as long as it is possible to form a stable complex between the target of interest and the nucleic acid scaffold.
  • Tables 1 and 2 attached to and incorporated herewith, provide non-limiting examples of DNA and RNA binding proteins. These proteins may be used as targets, or they may be used to bind other targets to the nanostructure. Their nucleic acid binding domains may be used in a similar manner using available genetic modification tools and methodology.
  • the nucleic acid nanostructure - target complexes provided herein may be synthesized in a variety of ways.
  • the nanostructure may be first generated, using for example one-pot synthesis methods such as those described below, and then combined with the target of interest.
  • the target may be included in the one-pot synthesis protocol, and thus may be attached to one or more oligonucleotides during formation of the nanostructure.
  • Combining the nanostructure with the target may involve non-covalent binding of the target to the nanostructure.
  • combining the oligonucleotides with the target may involve non-covalent binding of the target to one or more oligonucleotides. It is to be understood that such binding occurs at specific, pre-determined oligonucleotides or locations in the nanostructure. This will typically occur in solution and under conditions that optimize binding without negatively impacting the target or the nanostructure structural integrity.
  • the target may be "bound" to the nanostructure or oligonucleotide(s) at a temperature ranging from about 4°C to about 37°C, in buffered solution optionally comprising DNase inhibitors such as EDTA, as an example.
  • buffered solution optionally comprising DNase inhibitors such as EDTA, as an example.
  • Other conditions can be readily contemplated based on the particulars of the target of interest.
  • 2D and 3D nanostructures may be formed in a variety of ways as described below and as known in the art.
  • the individual units of the 2D nanostructures can be first formed and then joined together, or layers of 2D nanostructures can be formed and then joined together.
  • the 2D or 3D nanostructures can be formed in their totality in a one-pot synthesis method.
  • the 2D nanostructures are generated using a DNA bricks (also known as single- stranded tiles or SST).
  • a DNA brick is a 32 nucleotide oligonucleotide with four 8 nucleotide domains.
  • DNA bricks, each with a distinct sequence assemble into a prescribed structure by binding to their designated neighbours. Crystals may be formed by connecting the prescribed structures to each other. This design allows for greater control of the structure of the scaffold, including particularly the region where the target will be bound. In the 2D or 3D arrays, it may be necessary to create a depression in the surface of the scaffold, where the target binds without interfering with adjacent units or layers.
  • the DNA brick crystals are programmable, and thus it is possible to design and/or change the dimensions and the geometry of the repeating unit, to engineer the cavities, trenches or tunnels within the repeating unit to host targets, including large targets, periodically, and to insert specific target DNA sequences or other elements to facilitate target binding.
  • 2D-arrayed DNA nanostructure of the prior art were very thin, typically made of one or two layers of double stranded DNA molecules (2-4 nanometer). As a result, these crystals are prone to structural deformation and very fragile. In contrast, the 2D DNA brick crystals provided herein are thicker, more rigid, and thus more robust. The repeating unit can be as thick as 80 nm thus providing a stable and precise support for macromolecules. (Wei et al, 2014)
  • Cryo-electron microscopy (cryo-EM), generally
  • Cryo-EM is generally a process for direct, single particle imaging of a target of interest, whereby the target is deposited randomly on a solid support referred to as an EM grid, and then imaged using an electron source. 2D images of single targets, referred to as projections, are obtained and these 2D images are then clustered, aligned and used to reconstruct a 3D image of the target.
  • Cryo-EM can be distinguished from certain other imaging modalities on the basis that it detects signal from single targets (or single particles) and thus yields images of single targets (or single particles). This is in contrast to modalities detect signal from a plurality of targets such as X-ray or electron diffraction based modalities.
  • the signal intensity depends on the electron density of the target: targets that are more electron dense yield a higher SNR, while targets that are less electron dense yield a lower SNR. Since the signal is obtained from signal target, the larger the target, the more signal is detected.
  • One way of overcoming the low SNR when using cryo-EM is to increase the intensity of the electron source. However, this can also cause damage to the target, and thus is not preferred.
  • Provided herein is an alternative approach that exploits and converts a nucleic acid nanostructure into a scaffold for a target of interest that may not otherwise be sufficiently electron dense to succumb to cryo-EM.
  • cryo-EM involves a number of steps including target preparation, cryo-EM sample preparation, imaging, data collection, image processing, reconstruction, structural analysis and annotation. More specifically, in cryo-EM, moieties to be analyzed are purified (e.g. , using biochemical procedures) and loaded on a microscope grid. The grid is subsequently flash frozen to trap the moieties in a thin layer of amorphous ice.
  • Moieties on the grid are imaged using transmission electron microcopy (TEM), which generates 2D images corresponding to a projection of the structure in the direction of the electron path.
  • TEM transmission electron microcopy
  • the moieties come to rest on the EM grid in a random manner and thus adopt random orientations relative to each other on the grid.
  • projections corresponding to the same views are averaged together to increase the signal-to-noise ratio, in a process referred to as class averaging.
  • a 3D reconstruction is obtained by combining images corresponding to different views of the object.
  • 3D reconstruction relies on the ability to locate (or identify) the projections on the cryo-EM micrograph, generate class averages of identical views, and determine the respective orientations of each class. 3D reconstruction is performed using computational tools and leads to the 3D map (also referred as a cryo-EM map) that represents the physical shape of the moiety being imaged.
  • 3D map also referred as a cryo-EM map
  • a typical cryo-electron microscope is the FEI Titan Krios. This microscope as well as others may be operated in about the 300 keV range.
  • a typical electron counting direct detection camera is the Gatan K2 & FEI Falcon camera.
  • a typical image processing software is Relion.
  • the target-bound nanostructure may be resuspended in a buffered solution (e.g. , Tris, pH 8), and then applied to a thin, holey carbon film supported on an EM grid (such as Quantifoil Rl .2/1.3). Excess solution is then removed (e.g. , by blotting). The grid is then flash frozen by immersing it into liquid nitrogen or liquid ethane. This can be done using an FEI Vitrobot. The grid is then handled and analyzed at a temperature of about 4 Kelvin.
  • a buffered solution e.g. , Tris, pH 8
  • Excess solution is then removed (e.g. , by blotting).
  • the grid is then flash frozen by immersing it into liquid nitrogen or liquid ethane. This can be done using an FEI Vitrobot.
  • the grid is then handled and analyzed at a temperature of about 4 Kelvin.
  • Zero-energy loss images may be recorded at a magnification of about 142000X using a TVIPS 4k x 4k slow-scan CCD (image pixel size: 1.06 A/pixel.
  • Application of a low-pass filter to the resultant micrographs can also be used to improve contrast.
  • Reconstruction may be performed using the EMAN software package with 3D map masking. This method was adapted from that described by Kato et al. Nano. Letters, 9(7):2747-2750, 2009. Further reference can be made to Cheng et al. Cell, 161, 438-449, 2015.
  • Electron diffraction is a collective scattering phenomenon in which electrons are scattered by atoms arranged in a regular array such as a crystal. By measuring the angles and intensities of these diffracted beams, a three- dimensional image of the density of electrons within the crystal can be generated. From this electron density image, the mean positions of the atoms in the crystal can be determined, as well as their chemical bonds, their disorder, as well as various other information. For example, microED approaches have been used to study very small and thin crystals, in the nanometer range. (Iadanza and Gonen, 2014, J. Appl Crystallogr. 47(3): 1140- 1145;
  • Nannenga and Gonen Curr Opin Struct Biol, 27:24-31, 2014; Nannenga and Gonen, Nature Methods, 11(9):927, 2014)
  • X-ray crystallography shares the same principle as electron diffraction except that they different scattering sources are used.
  • atoms arranged in a crystalline formation cause a beam of incident X-rays to diffract into many specific directions.
  • angles and intensities of these diffracted beams By measuring the angles and intensities of these diffracted beams, one can produce a three-dimensional picture of the density of electrons within the crystal. From this electron density, the mean positions of the atoms in the crystal can be determined, as well as their chemical bonds, their disorder and various other information.
  • X-FEL X-ray free electron lasers
  • nucleic acid nanostructure is a rationally-designed, artificial ⁇ e.g., non-naturally occurring) structure self-assembled from individual nucleic acids.
  • nanostructure may be a structure that is between 0.1 nm and 1 ⁇ ⁇ e.g., 0.1 nm and 100 nm) in each spatial dimension, e.g., ID, 2D or 3D) and may be rationally designed to self- assemble (is programmed) into a pre-determined, defined shape that would not otherwise assemble in nature.
  • the use of nucleic acids to build nanostructures is enabled by strict nucleotide base pairing rules ⁇ e.g., A binds to T, G binds to C, A does not bind to G or C, T does not bind to G or C), which result in portions of strands with complementary base sequences binding together to form strong, sometimes rigid, structures.
  • a self-assembled nucleic acid structure may be referred to as two-dimensional or three-dimensional. 2-dimensional structures can be used in cryo-EM studies as well as X-ray and electron diffraction studies.
  • Nucleic acid nanostructures are typically nanometer- scale or micrometer-scale structures ⁇ e.g., having a length scale of 1 to 1000 nanometers (nm), or 1 to 10 micrometers ( ⁇ )). In some instances, a micrometer- scale structures is assembled from more than one nanometer- scale or micrometer-scale structure. In some embodiments, a nucleic acid nanostructure has a length scale of 1 to 1000 nm, 1 to 900 nm, 1 to 800 nm, 1 to 700 nm, 1 to 600 nm, 1 to 500 nm, 1 to 400 nm, 1 to 300 nm, 1 to 200 nm, 1 to 100 nm or 1 to 50 nm.
  • a nucleic acid nanostructure has a length scale of 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 ⁇ . In some embodiments, a nucleic acid nanostructure has a length scale of greater than 1000 nm. In some embodiments, a nucleic acid nanostructure has a length scale of 1 ⁇ to 2 ⁇ . In some embodiments, a nucleic acid nanostructure has a length scale of 200 nm to 2 ⁇ , or more. In some embodiments, a nucleic acid nanostructure is the product of a self-assembly process involving a plurality of different nucleic acids (e.g. , single-stranded nucleic acids).
  • a nucleic acid nanostructure may assemble from at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90 or at least 100 nucleic acids.
  • a nucleic acid nanostructure assembles from at least 100, at least 200, at least 300, at least 400, at least 500, or more, nucleic acids.
  • the term "nucleic acid” encompasses "oligonucleotides,” which are short, single- stranded nucleic acids (e.g. , DNA) having a length of 10 nucleotides to 100 nucleotides.
  • an oligonucleotide has a length of 10 to 20 nucleotides, 10 to 30 nucleotides, 10 to 40 nucleotides, 10 to 50 nucleotides, 10 to 60 nucleotides, 10 to 70 nucleotides, 10 to 80 nucleotides or 10 to 90 nucleotides.
  • an oligonucleotide has a length of 20 to 50, 20 to 75 or 20 to 100 nucleotides.
  • an oligonucleotide has a length of 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
  • a nucleic acid nanostructure is assembled from single- stranded nucleic acids, double- stranded nucleic acids, or a combination of single- stranded and double- stranded nucleic acids.
  • Nucleic acid nanostructures may assemble, in some embodiments, from a plurality of heterogeneous nucleic acids (e.g. , oligonucleotides).
  • "Heterogeneous" nucleic acids may differ from each other with respect to nucleotide sequence.
  • the nucleotide sequence of nucleic acid A differs from the nucleotide sequence of nucleic acid B, which differs from the nucleotide sequence of nucleic acid C.
  • Heterogeneous nucleic acids may also differ with respect to length and chemical compositions (e.g. , isolated versus synthetic).
  • the fundamental principle for designing self-assembled nucleic acid nanostructures is that sequence complementarity in nucleic acid strands is encoded such that, by pairing up complementary segments, the nucleic acid strands self-organize into a predefined
  • nucleic acid (e.g. , DNA) nanostructures examples include, without limitation, lattices (see, e.g., Winfree E. et al. Nature 394: 539, 1998; Yan H. et al. Science 301: 1882, 2003; Yan H. et al. Proc. Natl.
  • Nucleic acid nanostructures of the present disclosure may be two-dimensional or three-dimensional.
  • Two-dimensional nucleic acid nanostructure arrays are single-layer planar arrays that can be measured along an x-axis and a y-axis.
  • a nucleic acid layer has x and y dimensions that are each in the range of 3 nm to 10 microns in length.
  • a The planar arrangement of repeating units is typically relatively uniform in size.
  • Non-limiting examples of two-dimensional nucleic acid nanostructure arrays include nucleic acid lattices, tiles and nanoribbons (see, e.g., Wei et al. Nature, 485: 623-626, 2012;
  • Three-dimensional nucleic acid nanostructure arrays can be measured along an x-axis, a y-axis and a z-axis.
  • the 3D structure has x, y and z dimensions that are each in the range of 3 nm to 10 microns in length.
  • a three-dimensional nucleic acid nanostructure array in some embodiments, has a maximum height equal to or greater than 3 nm. In some embodiments, a three-dimensional nucleic acid nanostructure array has a maximum height of greater than 4 nm, greater than 5 nm, greater than 6 nm, greater than 7 nm, greater than 8 nm, greater than 9 nm or greater than 10 nm.
  • a three-dimensional nucleic acid nanostructure array has a maximum height of 3 nm to 50 nm, 3 nm to 100 nm, 3 nm to 250 nm or 3 nm to 500 nm. In some embodiments, a three- dimensional nucleic acid nanostructure array comprises 2 to 200, or more, nanostructure layers. In some embodiments, a three-dimensional nucleic acid nanostructure array includes greater than 2, greater than 3, greater than 4, or greater than 5 nucleic acid layers. In some embodiments, a three-dimensional nucleic acid nanostructure array comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 35, 40, 45 or 50 or more nucleic acid layers.
  • a three-dimensional nanostructure array may be uniform in height or it may be non-uniform in height.
  • Non- limiting examples of three-dimensional nucleic acid nanostructure arrays include nucleic acid cubes and other abstract and/or irregular three-dimensional shapes (see, e.g. , Wei et al.
  • a single-layer two-dimensional nucleic acid nanostructure array in some embodiments, can be constructed by "extraction" of a layer from a three-dimensional nucleic acid nanostructure array (see, e.g. , Ke Y. et al. , 2012; see also Wei B., et al. Nature 485: 623, 2012, each of which is incorporated by reference herein).
  • a three-dimensional nucleic acid nanostructure array in some embodiments, may be assembled from more than one two-dimensional nucleic acid nanostructure array or more than one nucleic acid nanostructure (e.g. , more than one "pre-assembled" nucleic acid nanostructure that is linked to one or more other "pre-assembled” nucleic acid nanostructures).
  • a composite nucleic acid nanostructure comprises nucleic acid nanostructures linked to each other using linkers.
  • the linkers are typically not integral to the nucleic acid nanostructures, although they may be attached to the nanostructures through suitable functional groups.
  • the ability to attach two or more nucleic acid nanostructures together allows structures of greater size (e.g. , micrometer size) and complexity to be made.
  • the dimensions of these composite structures may range, for example, from 500 nm to 100 ⁇ , 1 ⁇ to 1000 ⁇ , 1 ⁇ to 5 ⁇ , 1 ⁇ to 10 ⁇ , 1 ⁇ to 20 ⁇ , or more.
  • composite nanostructures encompass microstructures.
  • the linkers may involve click chemistry or coordinating interaction (Ni2+/polyhistidine) .
  • a nucleic acid nanostructure is assembled using a nucleic acid (e.g. , DNA) origami approach.
  • a nucleic acid e.g. , DNA
  • a DNA origami approach for example, a long
  • a single- stranded nucleic acid for assembly of a nucleic acid nanostructure has a length of at least 500 base pairs, at least 1 kilobase, at least 2 kilobases, at least 3 kilobases, at least 4 kilobases, at least 5 kilobases, at least 6 kilobases, at least 7 kilobases, at least 8 kilobases, at least 9 kilobases, or at least 10 kilobases.
  • a single-stranded nucleic acid for assembly of a nucleic acid nanostructure has a length of 500 base pairs to 10 kilobases, or more. In some embodiments, a single-stranded nucleic acid for assembly of a nucleic acid nanostructure has a length of 7 to 8 kilobases. In some embodiments, a single-stranded nucleic acid for assembly of a nucleic acid nanostructure comprises the M13 viral genome.
  • a nucleic acid nanostructure is assembled from single- stranded tiles (SSTs) or DNA bricks (see, e.g. , Wei B. et al. Nature 485: 626, 2012, incorporated by reference herein) or nucleic acid "bricks" (see, e.g. , Ke Y. et al. Science 388: 1177, 2012; International Publication Number WO 2014/018675 Al, published January 30, 2014, each of which is incorporated by reference herein).
  • single-stranded 2- or 4-domain oligonucleotides self-assemble, through sequence- specific annealing, into two- and/or three- dimensional nanostructures in a predetermined (e.g. , predicted) manner.
  • a nucleic acid nanostructure may be modified, for example, by adding, removing or replacing
  • oligonucleotides at particular positions.
  • the nanostructure may also be modified, for example, by attachment of moieties, at particular positions. This may be accomplished by using a modified oligonucleotide as a starting material or by modifying a particular oligonucleotide after the nanostructure is formed. Therefore, knowing the position of each of the starting oligonucleotides in the resultant nanostructure provides addressability to the nanostructure.
  • Self-assembly refers to the ability of nucleic acids (and, in some instances, preformed nucleic acid nanostructures) to anneal to each other, in a sequence- specific manner, in a predicted manner and without external control.
  • nucleic acid nanostructure self-assembly methods include combining nucleic acids (e.g. , single-stranded nucleic acids, or oligonucleotides) in a single vessel and allowing the nucleic acids to anneal to each other, based on sequence complementarity. In some embodiments, this annealing process involves placing the nucleic acids at an elevated temperature and then reducing the temperature gradually in order to favor sequence- specific binding.
  • nucleic acid nanostructures or self-assembly methods are known and described herein.
  • Nucleic acids of the present disclosure include DNA such as D-form DNA and Inform DNA and RNA, as well as various modifications thereof.
  • Nucleic acid modifications include base modifications, sugar modifications, and backbone modifications. Non-limiting examples of such modifications are provided below.
  • modified DNA nucleic acids e.g. , DNA variants
  • DNA nucleic acids include, without limitation, L-DNA (the backbone enantiomer of DNA, known in the literature), peptide nucleic acids (PNA) bisPNA clamp, a pseudocomplementary PNA, locked nucleic acid (LNA), and co-nucleic acids of the above such as DNA-LNA co-nucleic acids.
  • L-DNA the backbone enantiomer of DNA, known in the literature
  • PNA peptide nucleic acids
  • LNA locked nucleic acid
  • co-nucleic acids of the above such as DNA-LNA co-nucleic acids.
  • nucleic acids used in methods and compositions of the present disclosure may be homogeneous or heterogeneous in nature.
  • nucleic acids may be completely DNA in nature or they may be comprised of DNA and non-DNA (e.g. , LNA) monomers or sequences.
  • non-DNA e.g. , LNA
  • any combination of nucleic acid elements may be used.
  • the nucleic acid modification may render the nucleic acid more stable and/or less susceptible to degradation under certain conditions.
  • nucleic acids are nuclease-resistant.
  • Nucleic acids of the present disclosure in some embodiments, have a homogenous backbone (e.g. , entirely phosphodiester or entirely phosphorothioate) or a heterogeneous (or chimeric) backbone. Phosphorothioate backbone modifications may render an
  • nucleic acids have non-naturally occurring backbones.
  • nucleic acids of the present disclosure do not encode a product (e.g. , a protein).
  • Nucleic acids of the present disclosure additionally or alternatively comprise modifications in their sugars.
  • a ⁇ -ribose unit or a ⁇ - ⁇ -2'- deoxyribose unit can be replaced by a modified sugar unit, wherein the modified sugar unit is, for example, selected from ⁇ -D-ribose, oc-D-2'-deoxyribose, L-2'-deoxyribose, 2'-F-2'- deoxyribose, arabinose, 2'-F-arabinose, 2'-0-(Ci-C 6 )alkyl-ribose, preferably 2'-0-(Ci-C 6 )alkyl-ribose, preferably 2'-0-(Ci-C 6 )alkyl-ribose, preferably 2'-0-(Ci-
  • C 6 )alkyl-ribose is 2'-0-methylribose, 2'-0-(C 2 -C 6 )alkenyl-ribose, 2'-[0-(Ci-C 6 )alkyl-0-(Ci- C 6 )alkyl]-ribose, 2'-NH 2 -2'-deoxyribose, ⁇ -D-xylo-furanose, a-arabinofuranose, 2,4-dideoxy- ⁇ -D-erythro-hexo-pyranose, and carbocyclic (see, e.g. , Froehler J. Am. Chem. Soc. 114:8320, 1992, incorporated by reference herein) and/or open-chain sugar analogs (see, e.g. ,
  • Nucleic acids of the present disclosure comprise modifications in their bases.
  • Modified bases include, without limitation, modified cytosines (such as 5- substituted cytosines (e.g. , 5-methyl-cytosine, 5-fluoro-cytosine, 5-chloro-cytosine, 5-bromo- cytosine, 5-iodo-cytosine, 5-hydroxy-cytosine, 5-hydroxymethyl-cytosine, 5-difluoromethyl- cytosine, and unsubstituted or substituted 5-alkynyl-cytosine), 6-substituted cytosines, N4- substituted cytosines (e.g.
  • N4-ethyl-cytosine 5-aza-cytosine, 2-mercapto-cytosine, isocytosine, pseudo-isocytosine, cytosine analogs with condensed ring systems (e.g. , ⁇ , ⁇ '- propylene cytosine or phenoxazine), and uracil and its derivatives (e.g. , 5-fluoro-uracil, 5- bromo-uracil, 5-bromovinyl-uracil, 4-thio-uracil, 5-hydroxy-uracil, 5-propynyl-uracil), modified guanines such as 7-deazaguanine, 7-deaza-7-substituted guanine (such as
  • the nucleic acids may comprise universal bases (e.g. 3-nitropyrrole, P-base, 4-methyl-indole, 5-nitro-indole, and K-base) and/or aromatic ring systems (e.g. fluorobenzene, difluorobenzene, benzimidazole or dichloro-benzimidazole, 1 -methyl- 1H-[1, 2,4] triazole-3-carboxylic acid amide).
  • a particular base pair that may be incorporated into the oligonucleotides of the present disclosure is a dZ and dP non-standard nucleobase pair reported by Yang et al.
  • dZ the pyrimidine analog
  • dP the purine analog
  • nucleic acids of the present disclosure are synthesized in vitro.
  • nucleic acids are synthetic (e.g., not naturally-occurring).
  • Methods for synthesizing nucleic acids including automated nucleic acid synthesis, are known.
  • nucleic acids having modified backbones such as backbones comprising phosphorothioate linkages, and including those comprising chimeric modified backbones, may be synthesized using automated techniques employing either
  • alkyl-phosphonate linkages are also contemplated (see, e.g., U.S. Patent No. 4,469,863).
  • nucleic acids with alkylphosphotriester linkages in which the charged oxygen moiety is alkylated, e.g., as described in U.S. Patent No. 5,023,243 and European Patent No. 092,574) are prepared by automated solid phase synthesis using commercially available reagents. Methods for making other DNA backbone modifications and
  • nucleic acids are combined, in a single vessel such as, but not limited to, a tube, a well or a vial.
  • the molar amounts of nucleic acids that are used may depend on the frequency of each nucleic acid in the nanostructure desired and the amount of nanostructure desired.
  • the nucleic acids may be present in equimolar concentrations.
  • each nucleic acid e.g. , oligonucleotide
  • the nucleic acids are placed in a solution.
  • the solution may be buffered, although the annealing reaction can also occur in the absence of buffer.
  • the solution may further comprise divalent cations such as, but not limited, to Mg 2+ .
  • the cation or salt concentration may vary. An exemplary concentration is about 490 mM.
  • the solution may also comprise EDTA or other nuclease inhibitors in order to prevent degradation of the nucleic acids.
  • An annealing reaction is carried out, in some embodiments, by heating the solution containing nucleic acids and then allowing the solution to slowly cool down (e.g. , heated and then placed in a room temperature environment).
  • the temperature of the reaction should be sufficiently high to melt any undesirable secondary structure such as hairpin structures and to ensure that the nucleic acids are not bound incorrectly to other non-complementary nucleic acids.
  • the temperature therefore, may be initially raised to any temperature below or equal to 100 °C. For example, the temperature may be initially raised to 100 °C, 95 °C, 90 °C, 85 °C, 80 °C, 75 °C, 70 °C, 65 °C or 60 °C.
  • the temperature may be raised by placing the vessel in a hot water bath, heating block or a device capable of temperature control, such as a thermal cycler (e.g. , polymerase chain reaction (PCR) machine).
  • a thermal cycler e.g. , polymerase chain reaction (PCR) machine.
  • the vessel may be kept in that environment for seconds or minutes. In some embodiments, an incubation time of about 1-10 minutes is sufficient.
  • the temperature may be dropped in a number of ways.
  • the temperature may be dropped, for example, in an automated manner using a computer algorithm that drops the temperature by a certain amount and maintains that temperature for a certain period of time before dropping the temperature again.
  • Such automated methods may involve dropping the temperature by a degree in each step or by a number of degrees at each step.
  • the vessel may thus be heated and cooled in the same device.
  • the heated solution may be placed at room temperature to cool.
  • An exemplary process for dropping temperature is as follows.
  • the temperature is changed from 80 °C to 61 °C in one degree increments at a rate of 3 minutes per degree (e.g. , 80 °C for 3 minutes, 79 °C for 3 minutes, etc.).
  • the temperature is then changed from 60 °C to 24 °C in one degree increments and at a rate of about 120 minutes per degree (e.g. , 60 °C for 120 minutes, 59 °C for 210 minutes, etc.).
  • the total annealing time for this process is about 17 hours.
  • nucleic acids e.g. , oligonucleotides
  • An example of a specific annealing process uses one hundred different 200 nM oligonucleotides in solution (e.g. , 5 mM Tris- 1 mM EDTA (TE), 40 mM MgCi 2 ) and the solution is heated to about 90 °C and then cooled to about 24 °C over a period of about 73 hours, as described above with a 3 minute per degree drop between 80 °C and 61 °C, and a 120 minute per degree drop between 60 °C and 24 °C. It should be understood that the foregoing annealing process is exemplary and that other annealing processes may be used in accordance with the present disclosure.
  • nucleic acid nanostructure of paragraph 1 wherein the nanostructure has a cylindrical or spherical shape.
  • nucleic acid nanostructure of any one of paragraphs 1-6 or 8 wherein the target is a nucleic acid binding protein. 10. The nucleic acid nanostructure of any one of paragraphs 1-6, 8 or 9, wherein the target is a transcription factor.
  • nucleic acid nanostructure of any one of the foregoing paragraphs, wherein the nucleic acid nanostructure is a DNA nanostructure.
  • nucleic acid nanostructure of any one of the foregoing paragraphs wherein the nucleic acid nanostructure comprises a nucleotide sequence to which the target specifically binds directly.
  • a kit comprising a plurality of nucleic acids that self-assemble to form an asymmetric or low symmetry nucleic acid nanostructure, wherein one of the nucleic acids comprises a binding sequence for nucleic acid binding protein, a nucleic acid binding domain, an RNA, or a linker.
  • one of the nucleic acids comprises a binding sequence for a nucleic acid binding protein or a nucleic acid binding domain.
  • kits of paragraph 23, wherein two of the nucleic acids comprise a binding sequence for a nucleic acid binding protein or a nucleic acid binding domain.
  • one of the nucleic acids comprises a binding sequence for an RNA.
  • kits of any one of paragraphs 23-30, wherein the plurality of nucleic acids comprises a plurality of single-stranded tile oligonucleotides.
  • kits of any one of paragraphs 23-30, wherein the plurality of nucleic acids comprises a scaffold DNA and a plurality of single stranded oligonucleotides.
  • a method of imaging a target comprising exposing a plurality of targets to an electron source, each target bound to a separate asymmetric or low symmetry nucleic acid scaffold, obtaining two-dimensional projections of the plurality of targets, and reconstructing the two-dimensional projections into a three-dimensional image of the target.
  • asymmetric or low symmetry nucleic acid scaffold comprises a nucleotide sequence to which the target specifically binds directly or indirectly.
  • the target is a transcription factor
  • nucleic acid nanostructure of any one of paragraphs 48-57, wherein the nucleic acid nanostructure comprises a nucleotide sequence to which the target specifically binds directly or indirectly.
  • a kit comprising a plurality of nucleic acids that self-assemble to form a cylindrical nucleic acid nanostructure, wherein the nanostructure comprises a plurality of binding sequences for a nucleic acid binding protein, a nucleic acid binding domain, an RNA, or a linker.
  • the nanostructure comprises a plurality of binding sequences for a nucleic acid binding protein, a nucleic acid binding domain, or an RNA.
  • the nanostructure comprises 3-50 (e.g., 5-50) target binding sites per helical turn, or 10-20 target binding sites per helical turn.
  • the nanostructure comprises a plurality of binding sequences for a nucleic acid binding protein.
  • kit of any one of paragraphs 64-69 further comprising a fusion protein comprising the nucleic acid binding protein or a nucleic acid binding domain thereof.
  • kit of paragraph 64 or 72 further comprising the RNA.
  • kits of any one of paragraphs 64-73, wherein the plurality of nucleic acids comprises a scaffold DNA and a plurality of single stranded oligonucleotides.
  • kits of any one of paragraphs 64-73, wherein the plurality of nucleic acids comprises a plurality of single stranded tile oligonucleotides.
  • a method of imaging a target comprising exposing a plurality of complexes to an electron source, wherein each complex comprises a plurality of targets bound in a helical manner to a surface of a cylindrical nucleic acid scaffold, obtaining two-dimensional projections of the plurality of complexes, and reconstructing the two-dimensional projections into a three-dimensional image of the target.
  • each nucleic acid nanostructure comprises a cavity having a dimensions of 5 x 5 x 5 nm, 10 x 10 x 10 nm, or 50 x 50 x 50 nm.
  • nucleic acid nanostructures are DNA nanostructures.
  • each of the nucleic acid nanostructures comprises a nucleotide sequence to which the target specifically binds.
  • a kit comprising
  • nucleic acid nanostructure having a cavity
  • one of the nucleic acids comprises a binding sequence for a nucleic acid binding protein or an RNA, wherein the nucleic acid binding protein or the RNA bind to the cavity
  • nucleic acid nanostructures attach the nucleic acid nanostructures to each other to form a two-dimensional array of nucleic acid nanostructures.
  • one of the nucleic acids comprises a binding sequence for a nucleic acid binding protein.
  • one of the nucleic acids comprises a binding sequence for an RNA.
  • nucleic acid binding protein is a DNA binding protein
  • kit of paragraph 106, 107, 109, 110 or 111 further comprising a fusion protein comprising the nucleic acid binding protein or a nucleic acid binding domain thereof.
  • the kit of any one of paragraphs 106-112, wherein the first plurality of nucleic acids comprises a scaffold DNA and a plurality of single stranded oligonucleotides.
  • a method of imaging a target comprising (1) exposing a repeating unit nucleic acid nanostructure-target complex, deposited on a solid support, to an electron source, (2) incrementally changing the angle of the solid support relative to the electron source, (3) obtaining a two-dimensional projection of the repeating unit nucleic acid nanostructure-target complex, (4) repeating steps (l)-(3) one or more times, and (5) reconstructing the two- dimensional projections into a three-dimensional image of the target.
  • a method of imaging a target comprising exposing a plurality of targets to an electron source, each target bound to a single nucleic acid nanostructure arranged in a two- dimensional array of nanostructures, obtaining two-dimensional projections of the plurality of targets, and reconstructing the two-dimensional projections into a three-dimensional image of the target.
  • nucleic acid nanostructure is a DNA nanostructure.
  • nucleic acid nanostructure comprises a nucleotide sequence to which the target specifically binds.
  • each nucleic acid nanostructure comprises a cavity having a dimensions of 5 x 5 x 5 nm, 10 x 10 x 10 nm, or 50 x 50 x 50 nm.
  • nucleic acid nanostructures are DNA nanostructures.
  • nucleic acid nanostructures comprise a nucleotide sequence to which the target specifically binds.
  • a kit comprising a first plurality of nucleic acids that self-assemble to form a nucleic acid nanostructure having a cavity, wherein one of the nucleic acids comprises a binding sequence for a nucleic acid binding protein or an RNA, wherein the nucleic acid binding protein or the RNA bind to the cavity, and a second plurality of nucleic acids that attach the nucleic acid nanostructures to each other to form a three-dimensional array of nucleic acid nanostructures.
  • one of the nucleic acids comprises a binding sequence for a nucleic acid binding protein.
  • one of the nucleic acids comprises a binding sequence for an RNA
  • kit of paragraph 144, 145, 147 or 148 further comprising the nucleic acid binding protein.
  • kit of paragraph 144, 145, 147, 148 or 149 further comprising a fusion protein comprising the nucleic acid binding protein or a nucleic acid binding domain thereof.
  • the kit of any one of paragraphs 144-150, wherein the first plurality of nucleic acids comprises a scaffold DNA and a plurality of single stranded oligonucleotides.
  • a method of imaging a target comprising (1) exposing a three-dimensional repeating unit nucleic acid nanostructure-target complex, deposited on a solid support, to an electron or X-ray source, (2) obtaining electron or X-ray diffraction images of the three- dimensional repeating unit nucleic acid nanostructure-target complex, and (3) identifying the structure of the target from the diffraction images.
  • nucleic acid nanostructure is an DNA nano structure.
  • nucleic acid nanostructure comprises a nucleotide sequence to which the target specifically binds.
  • the DNA framework has a cylindrical shape with a size of about 15 nm x 25 nm.
  • the target protein chosen for that study is CRISPR/Cas9, an RNA-guided DNA endonuclease.
  • a mutated version of CRISPR/Cas9 that does not cleave the target DNA also known as D10A/H840A dCas9 was used.
  • the linker is a double-stranded DNA (dsDNA) that protrudes from the asymmetric features and contains essential elements for the binding of the CRISPR/Cas9 (i.e. target sequence and PAM motif).
  • dsDNA double-stranded DNA
  • An in silico model of the protein CRISPR/Cas9 bound to the dsDNA linker of the framework and a scheme of the dsDNA linker are given in Fig. 6.
  • the DNA framework was designed using the DNA Bricks design principles. Started from a 24 DNA helix bundle in honeycomb lattice, asymmetric features were designed by removing parts of DNA helices on one side in order to create different "steps" (Fig. 1). Fig. 7 is a blueprint of the DNA framework with the dsDNA linker (the figure was generated using CADnano). The square highlights the dsDNA linker that contains the CRISPR/Cas9 binding elements.
  • DNA oligonucleotides were generated and synthetized by the company IDT DNA.
  • the DNA framework was assembled in one pot reaction by mixing the DNA oligonucleotides at a final concentration of 1 uM in the presence of 10 mM MgC12, 5 mM Tris and 1 mM EDTA.
  • the folding reaction was performed in a thermocycler using thermal annealing:
  • the sample was analyzed by agarose gel electrophoresis (Fig. 8).
  • the right lane (CAS 1) corresponds the DNA framework.
  • Step 2 Glycerol gradient purification
  • glycerol gradient separation by rate-zonal centrifugation was performed.
  • Glycerol gradients were prepared using a Gradient Master from BioComp. The final composition of the gradient was 15-45% glycerol, 5 mM Tris-HCl, 10-20 mM MgC12, 1 mM EDTA. Up to 200 uL of samples were deposited carefully at the top of the gradient. The gradients were then centrifuged at 55000 rpm for 1 hour at 4 °C using a Beckman Coulter SW55 Ti rotor.
  • the gradients were fractionated manually by pipetting fractions of 200 uL from the top to the bottom of the tubes.
  • the fractions were subsequently analyzed by agarose gel electrophoresis to identify which ones contain the DNA framework (Fig. 9). Only the fractions containing the monomeric DNA framework were pooled together.
  • PEG precipitation was used in order to exchange the buffer (especially to remove the glycerol) and to concentrate the DNA framework.
  • the pooled fractions were mixed with the PEG precipitation solution 1: 1 (v/v): 10% PEG 8,000, 255 mM NaCl, 5 mM Tris, 10 mM Mg, 1 mM EDTA.
  • the solution was homogenized by pipetting gently the solution 20 times, incubated at room temperature for 30-60 min and centrifuged during 30 min at 16,000g, RT. The supernatant was removed carefully and the pellet of DNA framework was dissolved in 5 mM Tris pH 8.0, 10 mM MgC12, 1 mM EDTA. The final concentration was adjusted to 150 nM.
  • the samples were incubated few hours at room temperature and then stored at 4c. Complex formation
  • the DNA framework-CRISPR/Cas9-gRNA complex was then formed in vitro.
  • the CRISPR/Cas9 protein was purchased from the company PNA bio.
  • the nuclease deficient Cas9 mutant D10A/H840A dCas9 was used.
  • the guide RNA (gRNA) complementary to the dsDNA linker sequence was synthesized in vitro using the MEGAscript T7 transcription kit from Ambion and following their recommendations. Step 1. Formation of the Cas9-gRNA complex
  • CRISPR/Cas9-gRNA alone other conditions: DNA framework + Cas9-gRNA (DNA framework:Cas9-gRNA ratios: 1: 1, 1:5, 1:5, 1: 10, 1:50 and 1: 100).
  • FIG. 11 A TEM micrograph (40,000X magnification) of the complex is shown in Fig. 11.
  • DNA frameworks grey rods
  • CRISPR/Cas9 proteins white dots
  • Fig. 12A Most DNA frameworks appear to be bound to CRISPR/Cas9.
  • Fig. 13 Other examples of individual particles from TEM micrographs at higher magnification (with or without the protein bound) compared to the theoretical model are shown in Fig. 13.
  • Fig. 14 shows single-particle averaging from TEM micrographs. Four different views are represented. The protein (white sphere) is clearly visible.
  • Cryo-EM imaging The complex was also analyzed by cryo-EM using 300 kV FEI Polara equipped with K2 direct detector (Figs. 15A-15B). The location of CRISPR/Cas9 is indicated by a yellow triangle. Importantly, the DNA framework-CRISPR/Cas9-gRNA complex remains intact after the preparation of the grids.
  • An additional DNA framework visualized by cryo-EM (without proteins) is shown in Fig. 16. 2D class averages of single particles collected from cryo-EM micrographs are shown. DNA helices are visible indicating that high-resolution features can be obtained from structural analysis of DNA frameworks.
  • flanking DNA- binding domain a- helix and an extended
  • HMG1 HMG-box domains (A bind without sequence and B); a long acidic C-specificity terminal domain
  • FACTOR HRFX1 recognize DNA GTNRCC(0- 3N)RGYAAC-3', where N is any nucleotide, R is a purine and Y is a pyrimidine) (SEQ ID NO: 4)
  • KAPPA-B P52 Factor 3' (in which R is a purine, Y is a pyrimidine, and N is any nucleotide) (SEQ ID NO: 6)
  • FACTOR NF-KB P65 Factor 3' (in which R is a purine, Y is a pyrimidine, and N is any nucleotide) (SEQ ID NO: 6)
  • GCN4 Consensus sequence 5 '-TG A j CG j TC A-3 ' .
  • PROLINE Zn(2)-C6 fungal-type > ⁇ ⁇ -( ; ⁇ : - : ⁇ ( i n s- re ⁇ ( : ⁇ - UTILIZATION 3'
  • RNA-recognition motif RNA BP Nucleic Acid Domain
  • inventive embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, inventive embodiments may be practiced otherwise than as specifically described and claimed.
  • inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and/or method described herein.
  • a reference to "A and/or B", when used in conjunction with open-ended language such as “comprising” can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.
  • the phrase "at least one,” in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements.
  • This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase "at least one" refers, whether related or unrelated to those elements specifically identified.
  • At least one of A and B can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present disclosure relates, in some embodiments, to the use of nucleic acid nanostructures for structural determination of targets such as proteins and other biological molecules of interest.

Description

NUCLEIC ACID FRAMEWORKS FOR STRUCTURAL DETERMINATION
RELATED APPLICATION
This application claims the benefit under 35 U.S.C. § 119(e) of U.S. provisional application number 62/220,954, filed September 18, 2015, and U.S. provisional application number 62/220,960, filed September 18, 2015, each of which is incorporated by reference herein in its entirety.
FEDERALLY SPONSORED RESEARCH
This invention was made with Government support under R01EB018659 awarded by National Institutes of Health, and under CCF-1317291 awarded by National Science
Foundation. The Government has certain rights in the invention.
BACKGROUND
Biological macromolecules perform numerous functions in vivo including being the structural elements of the cell, catalyzing metabolism, regulating various cellular functions, and transcribing and repairing DNA. Various of these functions are tightly related to their physical shapes and conformations which are commonly referred to as atomic structures. For example, the precise mechanisms of several important proteins and macromolecular complexes have been elucidated based on their atomic structures such as for example DNA polymerases, RNA polymerases and ribosomes. Similarly, the pharmaceutical industry has implemented the use of atomic structures of protein-ligand complexes to guide the rational development of lead compounds. While there has been tremendous effort to determine the structure of proteins, only a small fraction of protein structures have so far been elucidated. In most cases, results from experiments are not sufficient to build the atomic model of a macromolecule in its totality and/or de novo.
Single particle cryo-electron microscopy (cryo-EM) is an alternative to X-ray crystallography. Cryo-EM is gaining popularity among structural biologists. In comparison to X-ray crystallography, cryo-EM does not require crystals and only uses a small amount of sample. However, while several groups recently reported a series of high-resolution cryo-EM structures, the technique is still limited to large biological targets such as large protein complexes or ribosome structures. For instance, the ion channel TRPV1 (300-400 kDa) is so far the smallest protein structure solved by cryo-EM at atomic resolution (3.4 A).
Cryo-EM is limited to large biological targets because the signal-to-noise ratio (SNR) in the recorded images drops with particle size. Accurate alignment for class averaging and orientation determination is thus an even more challenging task for smaller targets due to their inherent lower SNR. As a result, the low SNR compromises the 3D reconstruction process resulting in a low-resolution cryo-EM map that does not provide sufficient information for atomic structure determination. Importantly, the vast majority of human proteins have a molecular weight lower than 200 kDa, and have therefore not been considered suitable candidates for cryo-EM.
SUMMARY
The present disclosure is based, generally, on the application of nucleic acid nanotechnology to structural determination. This disclosure contemplates and provides the use of nucleic acid nanostructures as scaffolds for targets to be studied using a variety of imaging modalities, such as cryo-electron microscopy (cryo-EM). The use of such scaffolds overcomes limitations of various imaging modalities including cryo-EM, X-ray
crystallography, and electron diffraction, thereby expanding the applicability of these modalities to a broader range of targets.
With respect to cryo-EM, the nucleic acid nanostructures (optionally referred to herein as nanostructures or scaffolds) serve to increase the size of the imaged moiety (i.e. , the nanostructure-target complex), thereby increasing the SNR and yielding an image having detectable features, thereby facilitating particle detection (as a result of larger size), class averaging and orientation determination (as a result of asymmetric features). This renders small targets (e.g. , those less than 300 kDa or less than 200 kDa) amenable to cryo-EM. Targets of particular but not exclusive interest include proteins.
Various limitations of other imaging modalities are also addressed and overcome using the compositions and methods described herein. For example, in addition to the nanostructure-target complexes discussed above for cryo-EM, the disclosure also provides repeating unit nanostructure-target complexes for use in X-ray and electron diffraction based imaging modalities. These imaging modalities typically require targets in crystalline forms. However, not all targets readily yield to crystallization and not all crystals yield to high resolution diffraction. The disclosure overcomes this limitation through the provision of a repeating unit nanostructure-target complex that essentially acts as a crystal due to its periodicity. In addition, these complexes can be generated in both 2 dimensional (2D) and 3 dimensional (3D) forms (referred to herein as 2D and 3D crystals). Thus, cryo-EM, X-ray and electron diffraction studies can be carried out using 2D and 3D crystals provided herein to determine the structure of targets of interest, including targets that are not readily crystalized. Targets of interest include but are not limited to proteins.
Thus, one aspect of this disclosure provides an asymmetric or low symmetry nucleic acid nanostructure conjugated to a target.
In some embodiments, the nanostructure has a cylindrical or spherical shape. In some embodiments, the nanostructure has a cylindrical shape. In some embodiments, the nanostructure comprises 16-64 double-stranded nucleic acid helices. In some embodiments, the nucleic acid nanostructure is a DNA nanostructure.
In some embodiments, the nucleic acid nanostructure comprises a nucleotide sequence to which the target specifically binds directly. In some embodiments, the nucleic acid nanostructure comprises a nucleotide sequence to which the target specifically binds indirectly.
In some embodiments, the nanostructure is conjugated to a single target. In some embodiments, the nanostructure is conjugated to two or more targets, and such targets may be identical or different from each other. In some embodiments, each nanostructure is conjugated to multiple copies of the same target or multiple copies of different targets, thus enabling multiplex analysis, for example.
In some embodiments, the target is a biological molecule. In some embodiments, the target is a synthetic macromolecule (e.g. , designed de novo). Biological complex targets, for example, those that include proteins, RNA, DNA or a combination thereof are encompassed herein.
In some embodiments, the target is a non-biological molecule. In some embodiments, the target is a chemical molecule, such as a small molecule drug (or other small molecule) or chemical compound. In some embodiments, molecules are conjugated to single- stranded nucleic acids (oligonucleotides) and incorporated into a nucleic acid nanostructure.
In some embodiments, the target is a protein. In some embodiments, the target has a molecular weight of about 200 kDa or less. In some embodiments, the target is a nucleic acid binding protein. In some embodiments, the target is a transcription factor. In some embodiments, the target is fused to a nucleic acid binding protein or a nucleic acid binding domain.
In some embodiments, the target is an RNA. In some embodiments, the target is DNA (e.g. , a DNA nanostructure).
Another aspect provides a plurality of the foregoing asymmetric or low symmetry nucleic acid nanostructures. In some embodiments, the plurality is deposited on a carbon film. In some embodiments, the plurality is deposited on a holey grid. In some
embodiments, the plurality is vitrified on an electron microscope (EM) grid. In some embodiments, the plurality is monodisperse. In some embodiments, the plurality is polydisperse. In some embodiments, the plurality comprises at least two monodisperse sub- populations, wherein the two monodisperse sub-populations differ from each other in shape and bound target.
Another aspect provides a kit comprising a plurality of nucleic acids that self- assemble to form an asymmetric or low symmetry nucleic acid nanostructure, wherein one of the nucleic acids comprises a binding sequence for nucleic acid binding protein, a nucleic acid binding domain, an RNA, or a linker.
In some embodiments, one or more of the nucleic acids comprises a binding sequence for nucleic acid binding protein, a nucleic acid binding domain, or an RNA. In some embodiments, one or more of the nucleic acids comprises a binding sequence for a nucleic acid binding protein or a nucleic acid binding domain. In some embodiments, two of the nucleic acids comprise a binding sequence for a nucleic acid binding protein or a nucleic acid binding domain. In some embodiments, one or more of the nucleic acids comprises a binding sequence for an RNA.
In some embodiments, the nucleic acid binding protein is a DNA binding protein. In some embodiments, the nucleic acid binding protein is a transcription factor.
In some embodiments, the kit further comprises the nucleic acid binding protein. In some embodiments, the kit further comprises a fusion protein comprising the nucleic acid binding protein or a nucleic acid binding domain thereof.
In some embodiments, the plurality of nucleic acids comprises a plurality of single- stranded tile oligonucleotides. In some embodiments, the plurality of nucleic acids comprises a scaffold DNA and a plurality of single stranded oligonucleotides. In some embodiments, the nanostructure is cylindrical or spherical in shape. In some embodiments, the nanostructure is cylindrical in shape and comprises 16-64 double- stranded nucleic acid helices.
Other aspects provide kits comprising a pre-formed nucleic acid nanostructure, such as any of the asymmetric or low symmetry or helically shaped nanostructures described herein. The kits may further comprise handle oligonucleotides which bind to particular positions on the nanostructure. Alternatively or additionally, the kits may comprise nucleic acid binding domains or proteins or linkers to be used to bind the target to the nanostructure. The kits may comprise plasmids that encode such nucleic acid binding proteins or domains.
Another aspect provides a method of imaging a target comprising exposing a plurality of targets to an electron source, each target bound to a separate asymmetric or low symmetry nucleic acid scaffold, obtaining two-dimensional projections of the plurality of targets, and reconstructing the two-dimensional projections into a three-dimensional image of the target.
In some embodiments, the target is a biological molecule. In some embodiments, the target is a protein. In some embodiments, the target has a molecular weight of about 200 kDa or less. In some embodiments, the target is a nucleic acid binding protein. In some embodiments, the target is a transcription factor. In some embodiments, the target is fused to a nucleic acid binding protein or a nucleic acid binding domain. In some embodiments, the target is an RNA.
In some embodiments, the asymmetric or low symmetry nucleic acid scaffold is an asymmetric nucleic acid scaffold. In some embodiments, the asymmetric or low symmetry nucleic acid scaffold is a low symmetry scaffold. In some embodiments, the asymmetric or low symmetry nucleic acid scaffold is a DNA scaffold.
In some embodiments, the asymmetric or low symmetry nucleic acid scaffold comprises a nucleotide sequence to which the target specifically binds directly or indirectly.
In some embodiments, the imaging is cryo-electron microscope imaging.
Another aspect provides a cylindrical nucleic acid nanostructure conjugated to a plurality of targets, wherein the targets are arranged in a helical manner on the surface of the nanostructure.
In some embodiments, the cylindrical nucleic acid nanostructure comprises 5-50 targets per helical turn or 10-20 targets per helical turn. In some embodiments, the nucleic acid nanostructure is a DNA nanostructure. In some embodiments, a helical nanostructure is designed to display different target molecules in a helical manner on the same nanostructure. For example, different targets may be arranged in rings along a helical axis. As another example, double helices may be designed for two targets, triple helices for three targets, etc.
In some embodiments, the target is a biological molecule.
In some embodiments, the target is a protein. In some embodiments, the target has a molecular weight of about 200 kDa or less. In some embodiments, the target has a molecular weight in the range of 200 kDa to 5 MDa. In some embodiments, the target is a nucleic acid binding protein. In some embodiments, the target is a transcription factor. In some embodiments, the target is fused to a nucleic acid binding protein or a nucleic acid binding domain.
In some embodiments, the target is an RNA.
In some embodiments, the nucleic acid nanostructure comprises a nucleotide sequence to which the target specifically binds directly or indirectly.
Another aspect provides a plurality of the foregoing cylindrical nucleic acid nanostructures. In some embodiments, the plurality of the cylindrical nucleic acid nanostructures is deposited on a carbon film. In some embodiments, the cylindrical nucleic acid nanostructures are vitrified on an electron microscope (EM) grid. In some embodiments, the cylindrical nucleic acid nanostructures are vitrified on an electron microscope (EM) grid in an amorphous ice layer having a depth of about 50 nm or less.
Another aspect provides a kit comprising a plurality of nucleic acids that self- assemble to form any of the foregoing cylindrical nucleic acid nanostructures, wherein the nanostructure comprises a plurality of binding sequences for a nucleic acid binding protein, a nucleic acid binding domain, an RNA, or a linker. In some embodiments, the nanostructure comprises a plurality of binding sequences for a nucleic acid binding protein, a nucleic acid binding domain, or an RNA. In some embodiments, the nanostructure comprises a plurality of binding sequences for a nucleic acid binding protein. In some embodiments, the nucleic acid binding protein is a DNA binding protein. In some embodiments, the nucleic acid binding protein is a transcription factor.
In some embodiments, the kit further comprises the nucleic acid binding protein. In some embodiments, the kit further comprises a fusion protein comprising the nucleic acid binding protein or a nucleic acid binding domain thereof. In some embodiments, the kit further comprises the RNA. In some embodiments, the nanostructure comprises 5-50 target binding sites per helical turn, or 10-20 target binding sites per helical turn.
In some embodiments, the nanostructure comprises a plurality of binding sequences for an RNA. In some embodiments, the plurality of nucleic acids comprises a scaffold DNA and a plurality of single stranded oligonucleotides. In some embodiments, the plurality of nucleic acids comprises a plurality of single stranded tile oligonucleotides.
In some embodiments, two or more of the nucleic acids comprise binding sequence for the nucleic acid binding protein.
Another aspect provides a method of imaging a target comprising exposing a plurality of complexes to an electron source, wherein each complex comprises a plurality of targets bound in a helical manner to a surface of a cylindrical nucleic acid scaffold, obtaining two- dimensional projections of the plurality of complexes, and reconstructing the two- dimensional projections into a three-dimensional image of the target.
In some embodiments, 5-50 targets or 10-20 targets are bound to the surface of the cylindrical nucleic acid scaffold per helical turn. In some embodiments, the surface is an external surface of the cylindrical nucleic acid scaffold.
In some embodiments, the target is a biological molecule. In some embodiments, the target is a protein. In some embodiments, the target is an RNA. In some embodiments, the target has a molecular weight of about 200 kDa or less. In some embodiments, the target has a molecular weight of about 200 kDa to about 5 MDa. In some embodiments, the target is a nucleic acid binding protein. In some embodiments, the target is a transcription factor. In some embodiments, the target is fused to a nucleic acid binding protein or a nucleic acid binding domain.
In some embodiments, the cylindrical nucleic acid scaffold is a cylindrical DNA scaffold. In some embodiments, the cylindrical nucleic acid scaffold comprises a nucleotide sequence to which the target specifically binds.
In some embodiments, the imaging is cryo-electron microscope imaging.
One aspect of this disclosure provides a two-dimensional array of nucleic acid nanostructures, each nanostructure conjugated to a target, wherein the two-dimensional array comprises a plurality of single stranded tile oligonucleotides. Another aspect provides a two-dimensional array of nucleic acid nanostructures, each nanostructure conjugated to a target, wherein each nucleic acid nanostructure comprises a cavity having a dimensions of 5 x 5 x 5 nm, ΙΟ χ lO x 10 nm, or 50 x 50 x 50 nm.
In some embodiments, the two-dimensional array is deposited on a carbon film. In some embodiments, the two-dimensional array is deposited on an electron microscope (EM) grid and vitrified.
Another aspect provides a kit comprising a first plurality of nucleic acids that self- assemble to form a nucleic acid nanostructure having a cavity, wherein one of the nucleic acids comprises a binding sequence for a nucleic acid binding protein or an RNA, wherein the nucleic acid binding protein or the RNA bind to the cavity, and a second plurality of nucleic acids that attach the nucleic acid nanostructures to each other to form a two- dimensional array of nucleic acid nanostructures.
In some embodiments, one of the nucleic acids comprises a binding sequence for a nucleic acid binding protein. In some embodiments, one of the nucleic acids comprises a binding sequence for an RNA.
In some embodiments, the nucleic acid binding protein is a DNA binding protein. In some embodiments, the nucleic acid binding protein is a transcription factor.
In some embodiments, the kit further comprises the nucleic acid binding protein. In some embodiments, the kit further comprises a fusion protein comprising the nucleic acid binding protein or a nucleic acid binding domain thereof. In some embodiments, the kit further comprises the RNA.
In some embodiments, the first plurality of nucleic acids comprises a scaffold DNA and a plurality of single stranded oligonucleotides. In some embodiments, the first plurality of nucleic acids comprise a plurality of single stranded tile oligonucleotides.
Another aspect provides a method of imaging a target comprising (1) exposing a repeating unit nucleic acid nanostructure-target complex, deposited on a solid support, to an electron source, (2) incrementally changing the angle of the solid support relative to the electron source, (3) obtaining a two-dimensional projection of the repeating unit nucleic acid nanostructure-target complex, (4) repeating steps (l)-(3) one or more times, and (5) reconstructing the two-dimensional projections into a three-dimensional image of the target. In other embodiments, for cryo-EM analysis, instead of tilting the cryo-EM, one could use a 2D framework that binds the target in different prescribed orientations, for example, by shifting the DNA binding site of a DNA binding protein by one base pair. This shift would result in the rotation of the binding site and, therefore, of the DNA binding protein by approximately 30 degrees per shift. Analyzing (viewing) the 2D framework from the top view provides multiple views of the target without tilting the grid.
Another aspect provides a method of imaging a target comprising exposing a plurality of targets to an electron source, each target bound to a single nucleic acid nanostructure arranged in a two-dimensional array of nanostructures, obtaining two-dimensional projections of the plurality of targets, and reconstructing the two-dimensional projections into a three- dimensional image of the target.
In some embodiments, the target is a biological molecule. In some embodiments, the target is a protein. In some embodiments, the target is an RNA.
In some embodiments, the target has a molecular weight of about 200 kDa or less. In some embodiments, the target has a molecular weight of about 200 kDa to about 5 MDa.
In some embodiments, the target is a nucleic acid binding protein. In some embodiments, the target is a transcription factor. In some embodiments, the target is fused to a nucleic acid binding protein or a nucleic acid binding domain.
In some embodiments, the nucleic acid nanostructure is a DNA nanostructure. In some embodiments, the nucleic acid nanostructure comprises a nucleotide sequence to which the target specifically binds. In some embodiments, each nanostructure is conjugated to a single target.
In some embodiments, the imaging is cryo-electron microscope imaging. In some embodiments, the imaging is X-ray diffraction based imaging. In some embodiments, the imaging is electron diffraction based imaging.
Another aspect provides a three-dimensional array of nucleic acid nanostructures, each conjugated to a target, wherein the three-dimensional array comprises a plurality of single stranded tile oligonucleotides.
Another aspect provides a three-dimensional array of nucleic acid nanostructures, each nanostructure conjugated to a target, wherein each nucleic acid nanostructure comprises a cavity having a dimensions of 5 x 5 x 5 nm, ΙΟ χ lO x 10 nm, or 50 x 50 x 50 nm.
Another aspect provides a kit comprising a first plurality of nucleic acids that self- assemble to form a nucleic acid nanostructure having a cavity, wherein one of the nucleic acids comprises a binding sequence for a nucleic acid binding protein or an RNA, wherein the nucleic acid binding protein or the RNA bind to the cavity, and a second plurality of nucleic acids that attach the nucleic acid nanostructures to each other to form a three- dimensional array of nucleic acid nanostructures.
In some embodiments, one of the nucleic acids comprises a binding sequence for a nucleic acid binding protein. In some embodiments, one of the nucleic acids comprises a binding sequence for an RNA
In some embodiments, the nucleic acid binding protein is a DNA binding protein. In some embodiments, the nucleic acid binding protein is a transcription factor.
In some embodiments, the kit further comprises the nucleic acid binding protein. In some embodiments, the kit further comprises a fusion protein comprising the nucleic acid binding protein or a nucleic acid binding domain thereof.
In some embodiments, the first plurality of nucleic acids comprises a scaffold DNA and a plurality of single stranded oligonucleotides. In some embodiments, the first plurality of nucleic acids comprise a plurality of single stranded tile oligonucleotides.
In some embodiments, the kit further comprises the RNA.
Another aspect provides a method of imaging a target comprising (1) exposing a three-dimensional repeating unit nucleic acid nano structure-target complex, deposited on a solid support, to an electron or X-ray source, (2) obtaining electron or X-ray diffraction images of the three-dimensional repeating unit nucleic acid nano structure-target complex, and (3) identifying the structure of the target from the diffraction images.
In some embodiments, the target is a biological molecule. In some embodiments, the target is a protein. In some embodiments, the target is an RNA.
In some embodiments, the target has a molecular weight of about 200 kDa or less. In some embodiments, the target has a molecular weight of about 200 kDa to about 5 MDa.
In some embodiments, the target is a nucleic acid binding protein. In some embodiments, the target is a transcription factor. In some embodiments, the target is fused to a nucleic acid binding protein or a nucleic acid binding domain.
In some embodiments, the nucleic acid nanostructure is an DNA nanostructure. In some embodiments, the nucleic acid nanostructure comprises a nucleotide sequence to which the target specifically binds. In some embodiments, each nucleic acid nanostructure is conjugated to a single target. In some embodiments, the imaging is X-ray diffraction based imaging. In some embodiments, the imaging is electron diffraction based imaging.
Another aspect provides an asymmetric or low symmetry nucleic acid nanostructure conjugated to a target.
In some embodiments, the nanostructure has a cylindrical or spherical shape. In some embodiments, the nanostructure has a cylindrical shape. In some embodiments, the nanostructure comprises 16-64 double-stranded nucleic acid helices. In some embodiments, the nucleic acid nanostructure is a DNA nanostructure.
In some embodiments, the nucleic acid nanostructure comprises a nucleotide sequence to which the target specifically binds directly. In some embodiments, the nucleic acid nanostructure comprises a nucleotide sequence to which the target specifically binds indirectly.
In some embodiments, the nanostructure is conjugated to a single target. In some embodiments, the nanostructure is conjugated to two or more targets, and such targets may be identical or different from each other.
BRIEF DESCRIPTION OF THE DRAWINGS
The accompanying drawings are not intended to be drawn to scale. For purposes of clarity, not every component may be labeled in every drawing.
Fig. 1 provides an example of a cylindrical (left) and cuboid (right) asymmetric scaffolds made of DNA.
Fig. 2 illustrates a nucleic acid (e.g. , DNA) scaffold (shown as a central cylinder) designed to position targets (shown as spheres) at its surface in a helical manner. Several scaffolds can be connected together to form long filaments.
Fig. 3A illustrates a 2D crystal made of nucleic acids and engineered to display, in a periodic manner, targets (shown as spheres) in two dimensions (or a 2D array).
Fig. 3B illustrates the projections obtained from prescribed orientations using 2D crystals and deliberately tilting the cryo-EM grid incrementally.
Fig. 4 illustrates a 3D crystal made of nucleic acids and engineered to display, in a periodic manner, targets (shown as spheres) in three dimensions (or a 3D array).
Fig. 5 is a schematic depicting the proof-of-concept study's overall design. Fig. 6 shows an in silico model of the protein CRISPR/Cas9 bound to the dsDNA linker of the framework (left) and scheme of the dsDNA linker (right).
Fig. 7 is a blueprint of the DNA framework with the dsDNA linker (the figure was generated using CADnano). The square highlights the dsDNA linker that contains the CRISPR/Cas9 binding elements.
Fig. 8 shows agarose gel electrophoresis analysis of the sample after folding.
Fig. 9 shows an agarose gel analysis of the glycerol gradients fractions.
Fig. 10 shows agarose gel electrophoresis analysis of the reactions to detect a band shift corresponding to the formation of the complex.
Fig. 11 shows a TEM micrograph (40,000X magnification) of the complex.
Figs. 12A-12B show individual particles (Fig. 12B) from the TEM micrograph (Fig. 12A). The location of CRISPR/Cas9 is indicated by a triangle.
Fig. 13 shows other examples of individual particles from TEM micrographs at higher magnification (with or without the protein bound) compared to the theoretical model.
Fig. 14 shows single -particle averaging from TEM micrographs. Four different views are represented. The white sphere is the protein.
Figs. 15A-15B show individual particles selected from cryo-EM micrographs.
Fig. 16 shows a different DNA framework visualized by cryo-EM (without proteins). DETAILED DESCRIPTION
Provided herein are compositions and methods for improving the efficacy and thus broadening the use of various imaging modalities, such as cryo-EM. This disclosure provides broadly for the use of nucleic acid nanostructures as scaffolds to which targets of interest are associated, for example, for the purpose of imaging using cryo-EM. The targets of interest may be covalently or non-covalently bound to the nano structure.
The use of the nanostructures as scaffolds has several advantages. In the context of cryo-EM, for example, the scaffold effectively increases the size of the imaged moiety which increases the SNR, which in turn improves or facilitates particle detection, class averaging and orientation that yields to better resolution of the final reconstructed map. This is particularly important for small targets having a molecular weight on the order of 250 kDa or less, which heretofore have not been accessible by cryo-EM. Also, the nanostructure can be designed to be asymmetric which facilitates the process of class averaging, orientation determination, and ultimately 3D reconstruction of 2D projections. As will be described in greater detail below, cryo-EM involves the direct imaging of targets randomly deposited on a grid. The random deposition results in random orientation of the targets on the grid (e.g., each target adopts one of a number of different orientations).
In addition, the nanostructure can be designed to be asymmetric (or to have low or limited symmetry) in order to facilitate class averaging, orientation determination, and ultimately 3D reconstruction of 2D projections. As will be described in greater detail below, cryo-EM involves the direct imaging of targets randomly deposited on a grid. The random deposition results in random orientation of the targets on the grid (i.e., each target adopts one of a number of different orientations). This disclosure contemplates the use of asymmetric (or low or limited symmetry) nanostructures in order to simplify orientation determination.
The nanostructure therefore acts as a scaffold of known asymmetric shape that serves to (1) increase SNR and thereby improve detection of the target, and (2) facilitate alignment for class averaging and orientation determination of the 2D class averages, thereby simplifying image analysis and ultimate 3D reconstruction of the target, resulting in more highly resolved cryo-EM maps.
In other aspects, a repeating unit scaffold is provided in the form of a 2D or 3D array of nanostructures, each nanostructure bound to the target of interest. Such repeating unit complexes are illustrated in FIGs. 3 and 4. These structures are referred to herein as 2D and 3D crystals. It is to be understood that the repeating unit comprises both nucleic acid nanostructure (scaffold) and target.
The 2D arrayed scaffold is useful in cryo-EM as it allows a number of targets having the same orientation to be visualized simultaneously. It also allows the end user to change the orientation of the plurality of targets simultaneously and in an identical manner, in order to obtain additional views of the target. This can be done by deliberately adjusting the angle of the EM grid.
In the context of X-ray and electron diffraction modalities (e.g., X-ray
crystallography, microED), the scaffold may also be a repeating unit scaffold, wherein each repeating unit comprises the target of interest. The resultant repeating unit nanostructure- target complex can be used in a manner similar to the crystalline forms of targets traditionally used in diffraction studies such as X-ray crystallography. Scaffolds
As used herein, a scaffold refers to a nucleic acid nanostructure comprising a plurality of nucleic acids, including single-stranded oligonucleotides, engineered to self-assemble into a prescribed 3 dimensional (3D) shape. The shape and features of the nanostructure will vary depending on the embodiment described herein. This disclosure contemplates the use of a variety of 3D shapes as scaffolds including but not limited to cuboid, cylindrical, spherical, triangular and hexagonal shapes in certain embodiments. In some embodiments, the nanostructure has a shape that does not have a preferred orientation on a flat surface such as a cryo-EM grid. In other words, the orientations assumed by the nanostructure upon deposition onto the cryo-EM grid are not biased towards one or a few orientations. Cylindrical or spherical nanostructures are less likely to have preferred orientations when deposited on the cryo-EM grid such as a carbon-coated grid. Thus, in some embodiments, the nanostructure has a cylindrical shape, or a spherical shape, or a near spherical shape. (See He et al., Nature, 452: 198-201, 2008, for methodology relating to the generation of polyhedral structures that approximate near spherical shape.) Scaffolds having these shapes may be preferred in some embodiments.
An example of a suitable structure is schematically shown in Fig. 1, on the left. The illustrated cylindrical scaffold is comprised of 24 double stranded nucleic acid {e.g. , DNA) helices, although it is to be understood that the disclosure contemplates cylindrical scaffolds that comprise a wider range of helices including for example 6-64 helices. In some instances, the cylindrical scaffolds comprise 24 or more helices. In some embodiments, the cylindrical scaffold is hollow. In other embodiments, the cylindrical scaffold is not hollow.
As discussed herein and as may be understood based on this disclosure, the greater the number of helices contributing to the cylinder, the more orientations that can be imaged because the cylinders will come to rest on the cryoEM grid in a variety of ways. Spherical, or near-spherical, nanostructures, on the other hand, may come to rest in an almost infinite number of orientations.
In contrast, a cuboidal scaffold, which has roughly 6 sides will come to rest on those sides or on a subset of those sides, thereby yielding a maximum of 6 different orientations of the structure. In addition, cuboid nanostructures may have a tendency to deposit on the cryo- EM grid in a preferred orientation, and this reduces the number of orientations that contribute to the overall structural determination of the target. Thus, in some instances, the nanostructure is not cuboid (or cuboidal) in shape. If a cuboid nanostructure is used in a cryo-EM method, a holey cryo-EM grid may be used in order to enhance random orientation of the nanostructure on the grid.
Certain other embodiments tolerate preferred orientations of the nanostructures and could be performed using any shape including cuboid.
Various scaffolds provided herein are also useful because they allow for greater control of thickness of the amorphous ice on the cryo-EM grid. This is due to the fact that when the nanostructures come to rest on the cryo-EM grid, their height (i.e. , distance from the grid surface) will be essentially the same regardless of how they come to rest (i.e. , regardless of what orientation they adopt). This can be illustrated with a spherical or nearly spherical nanostructure. Regardless of how such a spherical or near spherical nanostructure comes to rest on the cryo-EM grid, its height will be about the same. This is true for cylindrical nanostructures, including those having a length that is greater than its diameter. Typically the height of the cylindrical nanostructure will be about the same as the diameter of the nanostructure, as it has been observed experimentally that these structures come to rest on their sides rather than their ends. In some instances involving cylindrical nanostructures, it is preferred to use cylindrical shapes having a length that is greater than its diameter for this reasons. Additionally, there are many orientations that can be adopted if the cylinder is on its side as compared to on its end.
It is also important to minimize the thickness of the ice layer formed during cryo-EM grid preparation as this decreases the noise in the recorded micrographs. This disclosure contemplates the ability to control ice thickness by adjusting the size (e.g. , diameter) of the scaffold. For example, in the case of a cylindrical scaffold, the diameter may be adjusted by, for example, changing the number of double helices that contribute to the nanostructure, with nanostructures having for example 16 helices having a smaller diameter than those having 64 helices. In some instances, the scaffold has a diameter of about 15 nm or more. In some instances, the scaffold has a diameter of about 15- 100 nm, or 15-80 nm, or 15-50 nm, or 15-30 nm. In some instances, once the amorphous ice layer is formed, it has a relatively uniform depth (+/- 10% or +/- 20%) of about 100 nm or less, or 90 nm or less, or 80 nm or less, or 70 nm or less, or 60 nm or less, or 50 nm or less, or 40 nm or less, or 30 nm or less, or 20 nm or less. As used herein, a nanostructure-target complex refers to the complex formed upon association (e.g. , covalent or non-covalent, direct or indirect, binding) of the target with nanostructure. It is to be understood that one or more than one target may be associated per nanostructure. If more than one target is bound to the nanostructure, those targets may be identical to each other or they may be different from each other.
In some embodiments, the nanostructure-target complexes are provided as a monodisperse population, intending that all or nearly all (e.g. , greater than 95%, or greater than 99%) of the nanostructure-target complexes are identical to each other with respect to size, shape and target bound. The population of nanostructure scaffolds may be
monodisperse, with each of the nanostructures bound to two or more targets. The location of the bound targets will remain the same between complexes.
In some embodiments, the nanostructure-target complexes are provided as a polydisperse population, intending the presence of at least two sub-populations of complexes, wherein those sub-populations differ from each other with respect to size and/or shape as well as target bound. Using a polydisperse population, an end user may be able to concurrently determine the structure of two or more targets, wherein each target is identified by the nanostructure scaffold to which it is bound (e.g. , the shape or nature of the nanostructure may be used to classify structures and thus targets).
In some embodiments, a single nanostructure is associated with a single target and a plurality of nanostructures are joined together to form a 2D or 3D array. Such arrays may be viewed in this manner, or they may be viewed as a single nanostructure having a plurality of repeating units, each unit comprising a binding site for a target of interest.
Asymmetric or low symmetry scaffolds
This disclosure provides for the use of asymmetric or low symmetry scaffolds in various imaging modalities, such as cryo-EM. The asymmetric and low symmetry scaffolds facilitate particle detection, class averaging, and orientation determination.
In some embodiments, the scaffold is an asymmetric scaffold. This means that the scaffold does not have an axis of symmetry. Fig. 1 illustrates nucleic acid nanostructures having cylindrical (left) and cuboid (right) 3D shapes that can be used as scaffolds.
Importantly, the illustrated nanostructures are "asymmetric", intending that they do not have an axis of symmetry. In some embodiments, the scaffold is a low symmetry scaffold. Scaffolds having low symmetry are those which yield few (a limited number of) possible solutions for a given view (e.g. , 2 or 4). The determination of such structures is facilitated by the limited number of possible solutions. This is in contrast to structures having greater degrees of symmetry (e.g., a typical non-asymmetric structure), which can give rise to 30,000 projections which in turn can be consolidated into 50-100 class averages.
Suitable scaffolds are referred to herein generally as asymmetric for convenience and brevity. It is to be understood however that the various aspects and embodiments relating to asymmetric scaffolds apply equally to low symmetry scaffolds unless explicitly stated otherwise.
Typically an asymmetric scaffold comprises one or more structural features that impart asymmetry to the scaffold. Such features may be referred to herein as asymmetric features. They may be achieved by designing the nanostructure to have structural
irregularities. For example, in Fig. 1 the lengths and relative positions of the double-stranded helices (each represented as a cylinder) can be varied to render the nanostructure asymmetric. An example of an asymmetric nucleic acid nanostructure is also provided in Bai et al. PNAS, 109(49):20012-20017, 2012.
It is also possible to attach non-nucleic acid moieties (or markers) at specific locations in or on the nanostructure to achieve asymmetry. The non-nucleic acid moieties may be incorporated into the nanostructure during synthesis or added to the nanostructure post- synthesis. They may be selected from a variety of moieties provided they do not interfere with the signal from the target yet are sufficiently electron dense to contribute signal and render the nanostructure asymmetric. Examples of markers include but are not limited to metals such as metallic particles (e.g. , gold nanoparticles), inorganic compounds,
macromolecules such as proteins, and the like. Carbon-rich markers may also be used. They should, however, be stably associated with the nanostructure such that their position and conformation is stable and static.
The asymmetric features, whether inherent or extrinsic to the nanostructure, may be located in or on the nanostructure. For example, the feature may be located on a surface of the nanostructure, and such surface may be an external surface or an internal surface.
The target being studied can also serve as the asymmetric feature. If the
nanostructure is bound to two or more targets (whether identical or different from each other), then such targets may be positioned to create asymmetry (e.g. , the position of such targets can be pre-determined in order to avoid creating an axis of symmetry).
It will therefore be appreciated based on this disclosure that in some instances cylindrical, spherical, or near spherical scaffolds including polyhedral scaffolds that are asymmetric or have low symmetry are particularly useful for cryo-EM structural
determination.
By rendering the scaffold asymmetric, the 3D reconstruction from the 2D cryo-EM projections is simplified. This is because the asymmetric features provide key a priori information used to align the 2D projections for class averaging and to determine the orientation of each class average since each orientation provides a unique projection. As described herein, the use of asymmetric nanostructures or complexes facilitates the step of alignment and clustering of images and orientation determination.
When a target of interest is attached to a large and asymmetric nucleic acid nanostructure scaffold, the scaffold provides enough a priori information to reconstruct the structure of the entire complex, including the target of interest, at high resolution regardless of the size of the target. The use of a nucleic acid nanostructure as a scaffold overcomes the current limitations associated with smaller targets including for example (i) better particle detection due to the large size of the scaffold, (ii) better projection alignment for class averaging due to the prescribed geometry of the scaffold, and (iii) better orientation determination of class averages due to the asymmetric features encoded on the framework.
Targets to be analyzed using the asymmetric scaffolds provided herein may range from kiloDa (kDa) to megaDa (MDa) in size. In some embodiments they may have a molecular weight of less than or about 500 kDa, or less than or about 400 kDa, or less than or about 300 kDa, or less than or about 200 kDa, less than or about 100 kDa, or less than or about 50 kDa.
Nucleic acid scaffold for helical display of targets including macromolecules
In some embodiments, the scaffold is a structure that approximates a cylindrical shape. Macromolecules of interest may be positioned at the surface of the scaffold following a helical arrangement, as illustrated in Fig. 2. This strategy allows an end user to reconstitute a synthetic helical 3D arrangement of macromolecules that naturally do not form such structures. The synthetic helical assembly can be analyzed by cryo-EM and processed as a regular helical structure. When the targets are displayed along the helical axis, thereby forming a helical filament, the respective orientations of each target is known because the overall geometry of the helix (e.g. , number of targets per turn, width and length of each turn, etc.) is known. Thus, the arrangement of the targets in 3D provides information on their respective orientation. Helical reconstruction approaches have been used in conjunction with cryo-EM to investigate biological targets that are inherently helical such as biological filaments (actin) or helical viruses. This disclosure adapts that approach to study targets that are not inherently helical by creating and analyzing engineered synthetic helical filaments of targets.
It is to be understood that the scaffold may be made of a plurality of single- stranded
DNA molecules engineered to self-assemble into a cylindrical structure.
This disclosure therefore expands the use of single particle cryo-EM as previously applied to naturally occurring helical assemblies, such as for example helically arranged proteins, to targets that do not naturally adopt a helical form. When such targets are displayed in a helical arrangement on a cylindrical nucleic acid nanostructure, the resulting synthetic helical complex can be analyzed by cryo-EM and the structure of the surface displayed target can be resolved by computational helical 3D reconstruction which is currently used for the structural study of naturally helical moieties such as biological filaments and helical viruses.
Targets to be analyzed using the helical display approach provided herein may range from kiloDa (kDa) to megaDa (MDa) in size. In some embodiments they may have a molecular weight of less than or about 200 kDa, while in other embodiments they may have a molecular weight in the range of about 200 kDa to about 10 MDa.
The helical nanostructure-target complex may comprise about 5-50 targets per turn of the helix, including about 10-40 targets per turn, or about 10-30 targets per turn, or about 10- 20 targets per turn.
Nucleic acid scaffold for 2D display of targets including macromolecules
In some embodiments, the scaffold is a comprised of a plurality of repeating discrete structural units programmed to self-assemble in two dimensions. The result of the assembly process is a two-dimensional array of such repeating units. These repeating units may be regarded as nanostructures or the plurality of these repeating units may be regarded as the nano structure. Targets, including macromolecules, of interest are positioned in or on the scaffold as illustrated in FIG. 3A. The size and the shape of the repeating unit can be modified according to the particular target being studied. For example, it is possible to design cavities or trenches to facilitate the positioning of targets at the surface. As with other embodiments described herein, it is to be understood that the scaffold may be made of a plurality of single-stranded DNA molecules engineered to self-assemble into the 2D array. See Wei et al. Nature, 485: 623-626, 2012; and Ke et al. Science, 338: 1177-1183, 2012, for methodologies relating to single stranded DNA tile based 2D and 3D nanostructures, the entire contents of which are incorporated herein by reference. Ke et al. Nature Chemistry, 6: 994-1002, 2014, demonstrate the methodology for generating 2D and 3D nanostructures using DNA brick structures. The reference demonstrates the ability to generate structures having precisely controlled depths up to 80 nm and/or having other nanoscale features such as continuous or discontinuous cavities or channels. The entire contents of this reference are incorporated by reference herein as well.
As used herein, a 2D crystal is comprised of a plurality of repeating units each unit capable of binding at least one target. Each unit may be regarded as a nucleic acid nanostructure capable of complexing with a target of interest. Such units are arranged in a periodic manner. The result is a relatively flat, single-layer structure. The size of the array may vary in a controlled manner. As will be clear from this disclosure, the shape and size of the contemplated nanostructures can be controlled during synthesis in a number of ways including for example the amount of nucleic acids used in the self-assembly process, including the nucleic acids used to connect individual units to each other. This is also the case for 3D crystals provided by this disclosure. The 2D array may range in size from a 2x1 array or a 2x2 array to a 10x10 array or a 100x100 array or a 1000x1000 array or even larger (e.g. up to 105 x 105). The array may be an n x n array or it may be an n x m array, wherein n and m are the number of units along the x or y dimension, and wherein m does not equal m. The individual units in the 2D and 3D arrays need not have equal x and y dimensions. It is to be understood that the scaffolds used in the 2D and 3D crystal embodiments provided herein may be but need not be asymmetric.
These 2D crystals may be analyzed using cryo-EM by recording images in different orientations or by immobilizing the target protein in different prescribed orientations (in which case, tilting the EM grid is not needed). The crystal is placed on the EM grid and images of different views are recorded by progressively tilting the grid. The problem of orientation determination is solved because the operator knows the angle at which a given image is recorded. For each orientation, multiple projections can be recorded at the same time as the crystal contains hundreds to thousands copies of the target arranged in the same plan. This strategy is illustrated in FIG. 3B. These 2D structures can also be analyzed using cryo-EM, or electron or X-ray diffraction techniques.
This embodiment facilitates the structural analysis of targets that do not form 2D crystals when used alone, although it is not limited to just those targets. As discussed herein, the use of a 2D array of nanostructures-target complexes creates a plurality of targets having the same orientation and allows the orientation of this plurality to be changed in an identical and coordinated manner. This simplifies the image processing required to render cryo-EM 3D reconstruction data.
In some instances, the analysis will involve obtaining projections of a single crystal. In other instances, the analysis will involve obtaining projections of two or more crystals. Obtaining projections from more than one crystal and consolidating such projections may be performed to improve resolution.
The plurality of crystals may be similarly positioned on the cryo-EM grid (e.g., they have landed on the grid in an identical manner) or they may be differentially positioned on the cryo-EM grid.
Nucleic acid scaffold for 3D display of targets including macromolecules
In some embodiments, the scaffold is comprised of a plurality of repeating discrete structural units programmed to self-assemble in three dimensions. The result of the assembly process is a three-dimensional array of repeating units, which may be referred to herein as 3D crystals. These are illustrated in FIG. 4. The size and the shape of the repeating unit can be modified according to the particular macromolecule being studied. For example, it is possible to design cavities in each repeating unit to host the macromolecule of interest. It is to be understood that the scaffold may be made of a plurality of single-stranded DNA molecules engineered to self-assemble into the crystal conformation.
This embodiment facilitates the structural analysis of targets that are not readily accessible using X-ray crystallography, thereby overcoming some of the obstacles faced when applying X-ray crystallography. For example, some targets do not form 3D crystals when used alone. For other targets, the conditions for forming their crystalline form are either not known or have not been sufficiently optimized for X-ray crystallography. In addition, for other targets, even if crystals can be formed, such crystals can be fragile, difficult to produce in sufficient quantity, or difficult to reproduce, or they can contain structural defects, high solvent content, and/or high mosaicity which may alter diffraction experiments, especially at high resolution. The methods provided herein overcome all of these obstacles because they do not require crystallization of the target itself. Instead, these methods use engineered crystals that are composites of nanostructures with repeating units, each unit having a binding site for a target. The repeating nature of the nanostructure-target composite is akin to a crystalline form of the target.
Thus, the 2D and 3D crystals of this disclosure can be used to study various targets using imaging modalities such as electron or X-ray diffraction. Importantly, these methods lend themselves to the analysis of targets that do not readily crystallize, in a traditional sense, and thus are not ready candidates for electron diffraction or X-ray diffraction based studies when such targets are used alone. When such targets are complexed to 2D or 3D arrayed nucleic acid nanostructures, they are essentially transformed into a crystal form that is amenable to analysis using diffraction modalities.
For the avoidance of doubt and for the purpose of clarity, the crystals provided herein may be referred to as synthetic crystals or nucleic acid based crystals. They are to be distinguished from the more traditional crystals formed typically from the target alone and used in the past for X-ray or electron diffraction studies.
Targets
The methods provided herein may be used for structural determination of a variety of targets provided such targets can be stably complexed (or associated) to a nucleic acid nanostructure for a period of time and under conditions necessary to perform the structural analysis. Targets include but are not limited to proteins and other moieties able to bind to nucleic acids, preferably at specific nucleotide sequences. Examples of such proteins include transcription factors, transcription activators and repressors, polymerases such as DNA polymerases, RNA polymerases, DNA repair proteins, nucleases such as restriction enzymes or CRISPR/Cas9 enzymes, integrases, histones, proteins involved in chromatin structure and/or chromatin remodeling, proteins involved in homologous recombination events, and the like.
The targets may also be nucleic acids such as DNA molecules or RNA molecules. The targets may be virtually any moiety that can be associated to a nucleic acid nanostructure directly (as for example is the case with the afore-mentioned targets) or indirectly (as for example is possible through the use of an intermediary moiety that can be associated to a nucleic acid nanostructure). Such intermediary moieties include but are not limited to linkers such as bifunctional and heterobifunctional linkers or nucleic acid binding domains such as those discussed herein or otherwise known in the art.
Some embodiments provided herein are directed at targets having a molecular weight of about less than 200 kDa, including molecular weights in the range of 10-200 kDa, 25-200 kDa, 50-200 kDa, 75-200 kDa, and 100-200 kDa. Some embodiments provided herein are directed at targets having larger molecular weights, including molecular weights that range into MDa. For example, the target may have a molecular weight in the range of 10 kDa to 10 MDa, or 100 kDa to 10 MDa, or 200 kDa to 10 MDa, or 500 kDa to 10 MDa, or 1-10 MDa, or 1-5 MDa, or 1-3 MDa.
The targets may be used alone or in a complex with one or more moieties other than the nucleic acid nanostructure. In some embodiments, the targets are complexes of two or more moieties including biological and chemical molecules and compounds. For example, the target may be a complex of two binding partners of a binding partner pair such as but not limited to a receptor and ligand or a DNA binding protein and a DNA. One or both of the binding partners may be naturally occurring or one or both of the binding partners may be non-naturally occurring. For example, one binding partner such as a receptor may be naturally occurring and the other binding partner such as a ligand may be a non-naturally occurring candidate ligand.
In some embodiments, the target is fused to another moiety such as a protein or a protein domain. Such fusion may facilitate the association, including binding, of the target to the nucleic acid nanostructure. For example, if the target does not naturally bind to nucleic acids, and thus will not bind to the nucleic acid nanostructure normally, it can be fused to a DNA binding protein or a DNA binding domain of such a protein. Methods for creating fusion proteins are known in the art as are DNA binding proteins and DNA binding domains thereof. In addition, the disclosure contemplates the use of additional moieties in the nanostructure in order to render the system amenable to still other targets. For example, the disclosure contemplates use of lipids embedded in the nucleic acid nanostructure in order to study membrane proteins using this system.
The methods provided herein achieve resolutions on the order of Angstroms including
10 A or less, about 5-10 A, or less than 5 A, including 3-4 A resolution.
Attachment Strategies
Various modes of attaching macromolecules to nanostructures are contemplated and encompassed by this disclosure. These attachment mechanisms include covalent and non- covalent means. Of particular interest is the use of non-covalent means that take advantage of the nucleic acid binding activity of certain macromolecules, whether those
macromolecules are the target of interest or are the attachment means for a target of interest {e.g., such as in a fusion protein as described herein). These are described in greater detail below. Typically, the attachment strategy should yield a complex of nucleic acid nanostructure and target that is sufficiently stable for the period of time required to image and under the conditions required to image. The attachment strategy should also yield a complex in which the target is relatively static once bound to the nanostructure. For this reason, long or otherwise flexible linkers that allow the target to change conformation, including a change in orientation, relative to the nanostructure are to be avoided.
In some embodiments, the target may be bound to a nucleic acid sequence of the nanostructure, or to a ligand that is present on the nanostructure. In either instance, the position of the target must remain constant between nanostructure-target complexes in a monodisperse plurality (or population).
The nucleic acid sequence to which the target or the ligand is bound is integral to the nanostructure {i.e., it is contained in an oligonucleotide that contributes to the shape and integrity of the nanostructure) or it is bound to an oligonucleotide that is integral to the nanostructure (in which case it may be referred to as a handle oligonucleotide.
In still other embodiments, proteins may be attached to the nanostructures through the use of heterobifunctional crosslinkers that react with the protein target on one end and an amino or thiol-modified oligonucleotide in the nanostructure (on the other end). Alternatively, the protein of interest may be conjugated to an oligonucleotide using for example sortase based reactions.
Reference can also be made to Yang et al., Bioconjugate Chem., 2015, 26: 1381-1395, for teachings relating to protein-DNA conjugation methods, the contents of which are incorporated by reference herein.
Nucleic acid binding proteins
In one embodiment, nucleic acid binding proteins such as DNA binding proteins are contemplated as the macromolecules. Such nucleic acid binding proteins include those that bind specifically to a particular nucleotide sequence, or those that can be made to bind to a particular nucleotide sequence under certain conditions. The nucleotide sequence to which the macromolecule binds may be referred to herein as a target sequence. In these
embodiments, the nucleic acid nanostructure is engineered to have the target sequence in a particular, known, pre-determined location that is accessible to the macromolecule. The complex formed by binding the protein to its particular target should also be sufficiently stable such that it withstands the various manipulations required for the subsequent imaging process.
The macromolecule may be a DNA binding protein or an RNA binding protein.
It is also to be understood that in this and other embodiments described herein, the term macromolecule is used for illustration purposes only and that smaller molecules are also contemplated in such embodiments and in the disclosure as a whole unless otherwise indicated.
Exemplary DNA binding proteins include but are not limited to polymerases such as Dpo4 polymerase, and DNA editing proteins such as CRISPR/Cas9. To bind the proteins onto the framework, the target DNA sequences of each protein were incorporated into the scaffold, the complex between the proteins and the scaffold were formed in solution, and the complexes were imaged independently by cryo-EM. Importantly, this approach is amenable to the study of a variety of targets as long as it is possible to form a stable complex between the target of interest and the nucleic acid scaffold.
Tables 1 and 2, attached to and incorporated herewith, provide non-limiting examples of DNA and RNA binding proteins. These proteins may be used as targets, or they may be used to bind other targets to the nanostructure. Their nucleic acid binding domains may be used in a similar manner using available genetic modification tools and methodology.
Synthesis methods
The nucleic acid nanostructure - target complexes provided herein may be synthesized in a variety of ways. The nanostructure may be first generated, using for example one-pot synthesis methods such as those described below, and then combined with the target of interest. Alternatively, the target may be included in the one-pot synthesis protocol, and thus may be attached to one or more oligonucleotides during formation of the nanostructure.
Combining the nanostructure with the target may involve non-covalent binding of the target to the nanostructure. Similarly, combining the oligonucleotides with the target may involve non-covalent binding of the target to one or more oligonucleotides. It is to be understood that such binding occurs at specific, pre-determined oligonucleotides or locations in the nanostructure. This will typically occur in solution and under conditions that optimize binding without negatively impacting the target or the nanostructure structural integrity. For example, if the target is or is fused to a protein that binds DNA, then the target may be "bound" to the nanostructure or oligonucleotide(s) at a temperature ranging from about 4°C to about 37°C, in buffered solution optionally comprising DNase inhibitors such as EDTA, as an example. Other conditions can be readily contemplated based on the particulars of the target of interest.
2D and 3D nanostructures may be formed in a variety of ways as described below and as known in the art. For example, the individual units of the 2D nanostructures can be first formed and then joined together, or layers of 2D nanostructures can be formed and then joined together. As another example, the 2D or 3D nanostructures can be formed in their totality in a one-pot synthesis method.
In important embodiments, the 2D nanostructures are generated using a DNA bricks (also known as single- stranded tiles or SST). As used herein, a DNA brick is a 32 nucleotide oligonucleotide with four 8 nucleotide domains. DNA bricks, each with a distinct sequence, assemble into a prescribed structure by binding to their designated neighbours. Crystals may be formed by connecting the prescribed structures to each other. This design allows for greater control of the structure of the scaffold, including particularly the region where the target will be bound. In the 2D or 3D arrays, it may be necessary to create a depression in the surface of the scaffold, where the target binds without interfering with adjacent units or layers. Unlike previous attempts to form 2D and 3D DNA crystals, the DNA brick crystals are programmable, and thus it is possible to design and/or change the dimensions and the geometry of the repeating unit, to engineer the cavities, trenches or tunnels within the repeating unit to host targets, including large targets, periodically, and to insert specific target DNA sequences or other elements to facilitate target binding.
2D-arrayed DNA nanostructure of the prior art were very thin, typically made of one or two layers of double stranded DNA molecules (2-4 nanometer). As a result, these crystals are prone to structural deformation and very fragile. In contrast, the 2D DNA brick crystals provided herein are thicker, more rigid, and thus more robust. The repeating unit can be as thick as 80 nm thus providing a stable and precise support for macromolecules. (Wei et al, 2014)
It is also possible to control the size of the crystals using the DNA brick approach. Various new developments in electron and X-ray diffraction, known as microED or serial femtosecond X-ray crystallography using X-FEL respectively, require nano- to microscale crystals. Crystals of this size can be readily generated using the DNA brick approach.
Cryo-electron microscopy (cryo-EM), generally
Cryo-EM has been used for a number of years to elucidate the structure of
macromolecules. Cryo-EM is generally a process for direct, single particle imaging of a target of interest, whereby the target is deposited randomly on a solid support referred to as an EM grid, and then imaged using an electron source. 2D images of single targets, referred to as projections, are obtained and these 2D images are then clustered, aligned and used to reconstruct a 3D image of the target. Cryo-EM can be distinguished from certain other imaging modalities on the basis that it detects signal from single targets (or single particles) and thus yields images of single targets (or single particles). This is in contrast to modalities detect signal from a plurality of targets such as X-ray or electron diffraction based modalities. The signal intensity depends on the electron density of the target: targets that are more electron dense yield a higher SNR, while targets that are less electron dense yield a lower SNR. Since the signal is obtained from signal target, the larger the target, the more signal is detected. One way of overcoming the low SNR when using cryo-EM is to increase the intensity of the electron source. However, this can also cause damage to the target, and thus is not preferred. Provided herein is an alternative approach that exploits and converts a nucleic acid nanostructure into a scaffold for a target of interest that may not otherwise be sufficiently electron dense to succumb to cryo-EM.
Cryo-EM is described in detail in Cheng et al. Cell, 161 :438-449, 2015, and reference should be made thereto for the basics and improvements of the modality. The entire contents of Cheng et al. are incorporated by reference herein. Briefly, cryo-EM involves a number of steps including target preparation, cryo-EM sample preparation, imaging, data collection, image processing, reconstruction, structural analysis and annotation. More specifically, in cryo-EM, moieties to be analyzed are purified (e.g. , using biochemical procedures) and loaded on a microscope grid. The grid is subsequently flash frozen to trap the moieties in a thin layer of amorphous ice. Moieties on the grid are imaged using transmission electron microcopy (TEM), which generates 2D images corresponding to a projection of the structure in the direction of the electron path. Significantly, the moieties come to rest on the EM grid in a random manner and thus adopt random orientations relative to each other on the grid. This makes reconstruction of the 3D image from the 2D projections of random orientations challenging. To facilitate the process, projections corresponding to the same views are averaged together to increase the signal-to-noise ratio, in a process referred to as class averaging. Ultimately, a 3D reconstruction is obtained by combining images corresponding to different views of the object.
3D reconstruction relies on the ability to locate (or identify) the projections on the cryo-EM micrograph, generate class averages of identical views, and determine the respective orientations of each class. 3D reconstruction is performed using computational tools and leads to the 3D map (also referred as a cryo-EM map) that represents the physical shape of the moiety being imaged.
A typical cryo-electron microscope is the FEI Titan Krios. This microscope as well as others may be operated in about the 300 keV range. A typical electron counting direct detection camera is the Gatan K2 & FEI Falcon camera. A typical image processing software is Relion.
As a non-limiting example, the target-bound nanostructure may be resuspended in a buffered solution (e.g. , Tris, pH 8), and then applied to a thin, holey carbon film supported on an EM grid (such as Quantifoil Rl .2/1.3). Excess solution is then removed (e.g. , by blotting). The grid is then flash frozen by immersing it into liquid nitrogen or liquid ethane. This can be done using an FEI Vitrobot. The grid is then handled and analyzed at a temperature of about 4 Kelvin. This can be done using a JEOL JEM-3200FSC electron microscope, equipped with a liquid-helium cooled specimen stage, an omega-type energy filter, and a field emission electron gun operated at an accelerating voltage of about 200 kV. Zero-energy loss images may be recorded at a magnification of about 142000X using a TVIPS 4k x 4k slow-scan CCD (image pixel size: 1.06 A/pixel. Application of a low-pass filter to the resultant micrographs can also be used to improve contrast. Reconstruction may be performed using the EMAN software package with 3D map masking. This method was adapted from that described by Kato et al. Nano. Letters, 9(7):2747-2750, 2009. Further reference can be made to Cheng et al. Cell, 161, 438-449, 2015.
Electron diffraction studies
In contrast to single particle analysis that relies on direct imaging of the target, electron crystallography uses the electron beam produced by the cryo-EM to perform diffraction experiments of 2D and 3D crystals. Electron diffraction is a collective scattering phenomenon in which electrons are scattered by atoms arranged in a regular array such as a crystal. By measuring the angles and intensities of these diffracted beams, a three- dimensional image of the density of electrons within the crystal can be generated. From this electron density image, the mean positions of the atoms in the crystal can be determined, as well as their chemical bonds, their disorder, as well as various other information. For example, microED approaches have been used to study very small and thin crystals, in the nanometer range. (Iadanza and Gonen, 2014, J. Appl Crystallogr. 47(3): 1140- 1145;
Nannenga and Gonen, Curr Opin Struct Biol, 27:24-31, 2014; Nannenga and Gonen, Nature Methods, 11(9):927, 2014)
X-ray diffraction studies
X-ray crystallography shares the same principle as electron diffraction except that they different scattering sources are used. In X-ray crystallography, atoms arranged in a crystalline formation cause a beam of incident X-rays to diffract into many specific directions. By measuring the angles and intensities of these diffracted beams, one can produce a three-dimensional picture of the density of electrons within the crystal. From this electron density, the mean positions of the atoms in the crystal can be determined, as well as their chemical bonds, their disorder and various other information.
The recent development of X-ray free electron lasers (X-FEL) renders X-ray crystallography useful for the study of very small crystals, in the nanometer to micrometer range. The combination of X-FEL with X-ray crystallography is known as serial
femtosecond X-ray nanocrystallography.
Nucleic acid nanostructures
A "nucleic acid nanostructure" is a rationally-designed, artificial {e.g., non-naturally occurring) structure self-assembled from individual nucleic acids. A nucleic acid
nanostructure may be a structure that is between 0.1 nm and 1 μηι {e.g., 0.1 nm and 100 nm) in each spatial dimension, e.g., ID, 2D or 3D) and may be rationally designed to self- assemble (is programmed) into a pre-determined, defined shape that would not otherwise assemble in nature. The use of nucleic acids to build nanostructures is enabled by strict nucleotide base pairing rules {e.g., A binds to T, G binds to C, A does not bind to G or C, T does not bind to G or C), which result in portions of strands with complementary base sequences binding together to form strong, sometimes rigid, structures. This allows for the rational design of nucleotide base sequences that will selectively assemble (self-assemble) to form nanostructures. In some embodiments, a self-assembled nucleic acid structure may be referred to as two-dimensional or three-dimensional. 2-dimensional structures can be used in cryo-EM studies as well as X-ray and electron diffraction studies.
Nucleic acid nanostructures are typically nanometer- scale or micrometer-scale structures {e.g., having a length scale of 1 to 1000 nanometers (nm), or 1 to 10 micrometers (μηι)). In some instances, a micrometer- scale structures is assembled from more than one nanometer- scale or micrometer-scale structure. In some embodiments, a nucleic acid nanostructure has a length scale of 1 to 1000 nm, 1 to 900 nm, 1 to 800 nm, 1 to 700 nm, 1 to 600 nm, 1 to 500 nm, 1 to 400 nm, 1 to 300 nm, 1 to 200 nm, 1 to 100 nm or 1 to 50 nm. In some embodiments, a nucleic acid nanostructure has a length scale of 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 μηι. In some embodiments, a nucleic acid nanostructure has a length scale of greater than 1000 nm. In some embodiments, a nucleic acid nanostructure has a length scale of 1 μηι to 2 μηι. In some embodiments, a nucleic acid nanostructure has a length scale of 200 nm to 2 μηι, or more. In some embodiments, a nucleic acid nanostructure is the product of a self-assembly process involving a plurality of different nucleic acids (e.g. , single-stranded nucleic acids). For example, a nucleic acid nanostructure may assemble from at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90 or at least 100 nucleic acids. In some embodiments, a nucleic acid nanostructure assembles from at least 100, at least 200, at least 300, at least 400, at least 500, or more, nucleic acids. The term "nucleic acid" encompasses "oligonucleotides," which are short, single- stranded nucleic acids (e.g. , DNA) having a length of 10 nucleotides to 100 nucleotides. In some embodiments, an oligonucleotide has a length of 10 to 20 nucleotides, 10 to 30 nucleotides, 10 to 40 nucleotides, 10 to 50 nucleotides, 10 to 60 nucleotides, 10 to 70 nucleotides, 10 to 80 nucleotides or 10 to 90 nucleotides. In some embodiments, an oligonucleotide has a length of 20 to 50, 20 to 75 or 20 to 100 nucleotides. In some embodiments, an oligonucleotide has a length of 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
In some embodiments, a nucleic acid nanostructure is assembled from single- stranded nucleic acids, double- stranded nucleic acids, or a combination of single- stranded and double- stranded nucleic acids.
Nucleic acid nanostructures may assemble, in some embodiments, from a plurality of heterogeneous nucleic acids (e.g. , oligonucleotides). "Heterogeneous" nucleic acids may differ from each other with respect to nucleotide sequence. For example, in a heterogeneous plurality that includes nucleic acids A, B and C, the nucleotide sequence of nucleic acid A differs from the nucleotide sequence of nucleic acid B, which differs from the nucleotide sequence of nucleic acid C. Heterogeneous nucleic acids may also differ with respect to length and chemical compositions (e.g. , isolated versus synthetic).
The fundamental principle for designing self-assembled nucleic acid nanostructures is that sequence complementarity in nucleic acid strands is encoded such that, by pairing up complementary segments, the nucleic acid strands self-organize into a predefined
nanostructure under appropriate physical conditions. From this basic principle (see, e.g. , Seeman N.C. J. Theor. Biol. 99: 237, 1982, incorporated by reference herein), diverse synthetic nucleic acid nanostructures have been generated (see, e.g. , Seeman N.C. Nature 421 : 427, 2003; Shih W.M. et al. Curr. Opin. Struct. Biol. 20: 276, 2010, each of which is incorporated by reference herein). Examples of nucleic acid (e.g. , DNA) nanostructures, and methods of producing such structures, that may be used in accordance with the present disclosure are known and include, without limitation, lattices (see, e.g., Winfree E. et al. Nature 394: 539, 1998; Yan H. et al. Science 301: 1882, 2003; Yan H. et al. Proc. Natl.
Acad. ofSci. USA 100; 8103, 2003; Liu D. et al. J. Am. Chem. Soc. 126: 2324, 2004;
Rothemund P.W.K. et al. PLoS Biology 2: 2041, 2004, each of which is incorporated by reference herein), ribbons (see, e.g., Park S.H. et al. Nano Lett. 5: 729, 2005; Yin P. et al. Science 321: 824, 2008, each of which is incorporated by reference herein), tubes (see, e.g., Yan H. Science, 2003; P. Yin, 2008, each of which is incorporated by reference herein), finite two-dimensional and three dimensional objects with defined shapes (see, e.g., Chen J. et al. Nature 350: 631, 1991; Rothemund P. W. K., Nature, 2006; He Y. et al. Nature 452: 198, 2008; Ke Y. et al. Nano. Lett. 9: 2445, 2009; Douglas S. M. et al. Nature 459: 414, 2009; Dietz H. et al. Science 325: 725, 2009; Andersen E. S. et al. Nature 459: 73, 2009; Liedl T. et al. Nature Nanotech. 5: 520, 2010; Han D. et al. Science 332: 342, 2011, each of which is incorporated by reference herein), and macroscopic crystals (see, e.g., Meng J. P. et al.
Nature 461: 74, 2009, incorporated by reference herein).
Nucleic acid nanostructures of the present disclosure may be two-dimensional or three-dimensional. Two-dimensional nucleic acid nanostructure arrays are single-layer planar arrays that can be measured along an x-axis and a y-axis. In some embodiments, a nucleic acid layer has x and y dimensions that are each in the range of 3 nm to 10 microns in length. A The planar arrangement of repeating units is typically relatively uniform in size. Non-limiting examples of two-dimensional nucleic acid nanostructure arrays include nucleic acid lattices, tiles and nanoribbons (see, e.g., Wei et al. Nature, 485: 623-626, 2012;
Rothemund P.W.K., Nature 440: 297, 2006; and Jungmann R. et al., Nanotechnology 22(27): 275301, 2011, each of which is incorporated by reference herein in its entirety).
Three-dimensional nucleic acid nanostructure arrays can be measured along an x-axis, a y-axis and a z-axis. In some embodiments, the 3D structure has x, y and z dimensions that are each in the range of 3 nm to 10 microns in length. A three-dimensional nucleic acid nanostructure array, in some embodiments, has a maximum height equal to or greater than 3 nm. In some embodiments, a three-dimensional nucleic acid nanostructure array has a maximum height of greater than 4 nm, greater than 5 nm, greater than 6 nm, greater than 7 nm, greater than 8 nm, greater than 9 nm or greater than 10 nm. In some embodiments, a three-dimensional nucleic acid nanostructure array has a maximum height of 3 nm to 50 nm, 3 nm to 100 nm, 3 nm to 250 nm or 3 nm to 500 nm. In some embodiments, a three- dimensional nucleic acid nanostructure array comprises 2 to 200, or more, nanostructure layers. In some embodiments, a three-dimensional nucleic acid nanostructure array includes greater than 2, greater than 3, greater than 4, or greater than 5 nucleic acid layers. In some embodiments, a three-dimensional nucleic acid nanostructure array comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 35, 40, 45 or 50 or more nucleic acid layers. A three-dimensional nanostructure array may be uniform in height or it may be non-uniform in height. Non- limiting examples of three-dimensional nucleic acid nanostructure arrays include nucleic acid cubes and other abstract and/or irregular three-dimensional shapes (see, e.g. , Wei et al.
Nature, 485: 623-626, 2012; Ke et al. Science, 338: 1177- 1183, 2012; Ke et al. Nature
Chemistry, 6: 994- 1002, 2014; Douglas S. M, et al. Nature 459: 414, 2009; Andersen E.D. et al. Nature 459: 73, 2009; Han D. et al. Science 332: 342, 2011 ; Ke Y. et al. , 2011 ; each of which is incorporated by reference herein).
Conceptually, a single-layer two-dimensional nucleic acid nanostructure array, in some embodiments, can be constructed by "extraction" of a layer from a three-dimensional nucleic acid nanostructure array (see, e.g. , Ke Y. et al. , 2012; see also Wei B., et al. Nature 485: 623, 2012, each of which is incorporated by reference herein). A three-dimensional nucleic acid nanostructure array, in some embodiments, may be assembled from more than one two-dimensional nucleic acid nanostructure array or more than one nucleic acid nanostructure (e.g. , more than one "pre-assembled" nucleic acid nanostructure that is linked to one or more other "pre-assembled" nucleic acid nanostructures).
Thus, contemplated herein are composite nucleic acid nanostructures. In some embodiments, a composite nucleic acid nanostructure comprises nucleic acid nanostructures linked to each other using linkers. The linkers are typically not integral to the nucleic acid nanostructures, although they may be attached to the nanostructures through suitable functional groups. The ability to attach two or more nucleic acid nanostructures together allows structures of greater size (e.g. , micrometer size) and complexity to be made. The dimensions of these composite structures may range, for example, from 500 nm to 100 μιη, 1 μιη to 1000 μιη, 1 μιη to 5 μιη, 1 μιη to 10 μιη, 1 μιη to 20 μιη, or more. Thus, in some embodiments, composite nanostructures encompass microstructures. Examples of linkers for use in accordance with the present disclosure include, without limitation, chemical crosslinkers (e.g. , glutaraldehyde), biomolecules (e.g. , avidin-biotin), and ligand- functionalized nanoparticles/moieties (e.g. , single- stranded-nucleic acid-functionalized nanoparticles). In some instances, the linkers may involve click chemistry or coordinating interaction (Ni2+/polyhistidine) .
In some embodiments, a nucleic acid nanostructure is assembled using a nucleic acid (e.g. , DNA) origami approach. With a DNA origami approach, for example, a long
"scaffold" nucleic acid strand is folded to a predesigned shape through interactions with relatively shorter "staple" strands (e.g., having a length of 200 nucleotides or less, or 100 nucleotides or less). Thus, in some embodiments, a single- stranded nucleic acid for assembly of a nucleic acid nanostructure has a length of at least 500 base pairs, at least 1 kilobase, at least 2 kilobases, at least 3 kilobases, at least 4 kilobases, at least 5 kilobases, at least 6 kilobases, at least 7 kilobases, at least 8 kilobases, at least 9 kilobases, or at least 10 kilobases. In some embodiments, a single-stranded nucleic acid for assembly of a nucleic acid nanostructure has a length of 500 base pairs to 10 kilobases, or more. In some embodiments, a single-stranded nucleic acid for assembly of a nucleic acid nanostructure has a length of 7 to 8 kilobases. In some embodiments, a single-stranded nucleic acid for assembly of a nucleic acid nanostructure comprises the M13 viral genome.
In some embodiments, a nucleic acid nanostructure is assembled from single- stranded tiles (SSTs) or DNA bricks (see, e.g. , Wei B. et al. Nature 485: 626, 2012, incorporated by reference herein) or nucleic acid "bricks" (see, e.g. , Ke Y. et al. Science 388: 1177, 2012; International Publication Number WO 2014/018675 Al, published January 30, 2014, each of which is incorporated by reference herein). For example, single-stranded 2- or 4-domain oligonucleotides self-assemble, through sequence- specific annealing, into two- and/or three- dimensional nanostructures in a predetermined (e.g. , predicted) manner. As a result, the position of each oligonucleotide in the nanostructure is known. In this way, a nucleic acid nanostructure may be modified, for example, by adding, removing or replacing
oligonucleotides at particular positions. The nanostructure may also be modified, for example, by attachment of moieties, at particular positions. This may be accomplished by using a modified oligonucleotide as a starting material or by modifying a particular oligonucleotide after the nanostructure is formed. Therefore, knowing the position of each of the starting oligonucleotides in the resultant nanostructure provides addressability to the nanostructure. "Self-assembly" refers to the ability of nucleic acids (and, in some instances, preformed nucleic acid nanostructures) to anneal to each other, in a sequence- specific manner, in a predicted manner and without external control. In some embodiments, nucleic acid nanostructure self-assembly methods include combining nucleic acids (e.g. , single-stranded nucleic acids, or oligonucleotides) in a single vessel and allowing the nucleic acids to anneal to each other, based on sequence complementarity. In some embodiments, this annealing process involves placing the nucleic acids at an elevated temperature and then reducing the temperature gradually in order to favor sequence- specific binding. Various nucleic acid nanostructures or self-assembly methods are known and described herein.
Nucleic acids of the present disclosure include DNA such as D-form DNA and Inform DNA and RNA, as well as various modifications thereof. Nucleic acid modifications include base modifications, sugar modifications, and backbone modifications. Non-limiting examples of such modifications are provided below.
Examples of modified DNA nucleic acids (e.g. , DNA variants) that may be used in accordance with the present disclosure include, without limitation, L-DNA (the backbone enantiomer of DNA, known in the literature), peptide nucleic acids (PNA) bisPNA clamp, a pseudocomplementary PNA, locked nucleic acid (LNA), and co-nucleic acids of the above such as DNA-LNA co-nucleic acids. Thus, the present disclosure contemplates
nanostructures that comprise DNA, RNA, LNA, PNA or combinations thereof. It is to be understood that the nucleic acids used in methods and compositions of the present disclosure may be homogeneous or heterogeneous in nature. As an example, nucleic acids may be completely DNA in nature or they may be comprised of DNA and non-DNA (e.g. , LNA) monomers or sequences. Thus, any combination of nucleic acid elements may be used. The nucleic acid modification may render the nucleic acid more stable and/or less susceptible to degradation under certain conditions. For example, in some embodiments, nucleic acids are nuclease-resistant.
Nucleic acids of the present disclosure, in some embodiments, have a homogenous backbone (e.g. , entirely phosphodiester or entirely phosphorothioate) or a heterogeneous (or chimeric) backbone. Phosphorothioate backbone modifications may render an
oligonucleotide less susceptible to nucleases and thus more stable (as compared to a native phosphodiester backbone nucleic acid) under certain conditions. Other linkages that may provide more stability to a nucleic acid of the present disclosure include, without limitation, phosphorodithioate linkages, methylphosphonate linkages, methylphosphorothioate linkages, boranophosphonate linkages, peptide linkages, alkyl linkages and dephospho-type linkages. Thus, in some embodiments, nucleic acids have non-naturally occurring backbones.
In some embodiments, nucleic acids of the present disclosure do not encode a product (e.g. , a protein).
Nucleic acids of the present disclosure, in some embodiments, additionally or alternatively comprise modifications in their sugars. For example, a β-ribose unit or a β-ϋ-2'- deoxyribose unit can be replaced by a modified sugar unit, wherein the modified sugar unit is, for example, selected from β-D-ribose, oc-D-2'-deoxyribose, L-2'-deoxyribose, 2'-F-2'- deoxyribose, arabinose, 2'-F-arabinose, 2'-0-(Ci-C6)alkyl-ribose, preferably 2'-0-(Ci-
C6)alkyl-ribose is 2'-0-methylribose, 2'-0-(C2-C6)alkenyl-ribose, 2'-[0-(Ci-C6)alkyl-0-(Ci- C6)alkyl]-ribose, 2'-NH2-2'-deoxyribose, β-D-xylo-furanose, a-arabinofuranose, 2,4-dideoxy- β-D-erythro-hexo-pyranose, and carbocyclic (see, e.g. , Froehler J. Am. Chem. Soc. 114:8320, 1992, incorporated by reference herein) and/or open-chain sugar analogs (see, e.g. ,
Vandendriessche et al. Tetrahedron 49:7223, 1993, incorporated by reference herein) and/or bicyclosugar analogs (see, e.g. , Tarkov M. et al. Helv. Chim. Acta. 76:481 , 1993,
incorporated by reference herein).
Nucleic acids of the present disclosure, in some embodiments, comprise modifications in their bases. Modified bases include, without limitation, modified cytosines (such as 5- substituted cytosines (e.g. , 5-methyl-cytosine, 5-fluoro-cytosine, 5-chloro-cytosine, 5-bromo- cytosine, 5-iodo-cytosine, 5-hydroxy-cytosine, 5-hydroxymethyl-cytosine, 5-difluoromethyl- cytosine, and unsubstituted or substituted 5-alkynyl-cytosine), 6-substituted cytosines, N4- substituted cytosines (e.g. , N4-ethyl-cytosine), 5-aza-cytosine, 2-mercapto-cytosine, isocytosine, pseudo-isocytosine, cytosine analogs with condensed ring systems (e.g. , Ν,Ν'- propylene cytosine or phenoxazine), and uracil and its derivatives (e.g. , 5-fluoro-uracil, 5- bromo-uracil, 5-bromovinyl-uracil, 4-thio-uracil, 5-hydroxy-uracil, 5-propynyl-uracil), modified guanines such as 7-deazaguanine, 7-deaza-7-substituted guanine (such as
7-deaza-7-(C2-C6)alkynylguanine), 7-deaza-8-substituted guanine, hypoxanthine, N2- substituted guanines (e.g. N2-methyl-guanine), 5-amino-3-methyl-3H,6H-thiazolo[4,5- d]pyrimidine-2,7-dione, 2,6-diaminopurine, 2-aminopurine, purine, indole, adenine, substituted adenines (e.g. N6-methyl-adenine, 8-oxo-adenine) 8-substituted guanine (e.g. 8-hydroxyguanine and 8-bromoguanine), and 6-thioguanine. The nucleic acids may comprise universal bases (e.g. 3-nitropyrrole, P-base, 4-methyl-indole, 5-nitro-indole, and K-base) and/or aromatic ring systems (e.g. fluorobenzene, difluorobenzene, benzimidazole or dichloro-benzimidazole, 1 -methyl- 1H-[1, 2,4] triazole-3-carboxylic acid amide). A particular base pair that may be incorporated into the oligonucleotides of the present disclosure is a dZ and dP non-standard nucleobase pair reported by Yang et al. NAR, 2006, 34(21):6095-6101. dZ, the pyrimidine analog, is 6-amino-5-nitro-3-(l'-P-D-2'-deoxyribofuranosyl)-2(lH)- pyridone, and its Watson-Crick complement dP, the purine analog, is 2-amino-8-( -P-D-l'- deoxyribofuranosyl)-imidazo[ 1 ,2-a] - 1 ,3 ,5-triazin-4(8H)-one.
Nucleic acids of the present disclosure, in some embodiments, are synthesized in vitro. Thus, in some embodiments, nucleic acids are synthetic (e.g., not naturally-occurring). Methods for synthesizing nucleic acids, including automated nucleic acid synthesis, are known. For example, nucleic acids having modified backbones, such as backbones comprising phosphorothioate linkages, and including those comprising chimeric modified backbones, may be synthesized using automated techniques employing either
phosphoramidate or H-phosphonate chemistries (see, e.g., F. E. Eckstein, "Oligonucleotides and Analogues - A Practical Approach" IRL Press, Oxford, UK, 1991; and Matteucci M. D. et al. Tetrahedron Lett. 21: 719, 1980). Synthesis of nucleic acids with aryl- and
alkyl-phosphonate linkages are also contemplated (see, e.g., U.S. Patent No. 4,469,863). In some embodiments, nucleic acids with alkylphosphotriester linkages (in which the charged oxygen moiety is alkylated, e.g., as described in U.S. Patent No. 5,023,243 and European Patent No. 092,574) are prepared by automated solid phase synthesis using commercially available reagents. Methods for making other DNA backbone modifications and
substitutions have been described (see, e.g., Uhlmann E. et al. Chem. Rev. 90:544, 1990; Goodchild J. Bioconjugate Chem. 1: 165, 1990; Crooke S.T. et al. Annu. Rev. Pharmacol.
Toxicol. 36: 107, 1996; and Hunziker J. et al. Mod Synth Methods 7:331, 1995, each of which is incorporated by reference) and may be used in accordance with the present disclosure.
Some aspects of the present disclosure are directed to assembling nucleic acid nanostructures using annealing processes. In some embodiments, nucleic acids are combined, in a single vessel such as, but not limited to, a tube, a well or a vial. The molar amounts of nucleic acids that are used may depend on the frequency of each nucleic acid in the nanostructure desired and the amount of nanostructure desired. In some embodiments, the nucleic acids may be present in equimolar concentrations. In some embodiments, each nucleic acid (e.g. , oligonucleotide) may be present at a concentration of about 200 nM. In some embodiments, the nucleic acids are placed in a solution. The solution may be buffered, although the annealing reaction can also occur in the absence of buffer. The solution may further comprise divalent cations such as, but not limited, to Mg2+. The cation or salt concentration may vary. An exemplary concentration is about 490 mM. The solution may also comprise EDTA or other nuclease inhibitors in order to prevent degradation of the nucleic acids.
An annealing reaction is carried out, in some embodiments, by heating the solution containing nucleic acids and then allowing the solution to slowly cool down (e.g. , heated and then placed in a room temperature environment). The temperature of the reaction should be sufficiently high to melt any undesirable secondary structure such as hairpin structures and to ensure that the nucleic acids are not bound incorrectly to other non-complementary nucleic acids. The temperature, therefore, may be initially raised to any temperature below or equal to 100 °C. For example, the temperature may be initially raised to 100 °C, 95 °C, 90 °C, 85 °C, 80 °C, 75 °C, 70 °C, 65 °C or 60 °C. The temperature may be raised by placing the vessel in a hot water bath, heating block or a device capable of temperature control, such as a thermal cycler (e.g. , polymerase chain reaction (PCR) machine). The vessel may be kept in that environment for seconds or minutes. In some embodiments, an incubation time of about 1-10 minutes is sufficient.
Once nucleic acid incubation at an elevated temperature is complete, the temperature may be dropped in a number of ways. The temperature may be dropped, for example, in an automated manner using a computer algorithm that drops the temperature by a certain amount and maintains that temperature for a certain period of time before dropping the temperature again. Such automated methods may involve dropping the temperature by a degree in each step or by a number of degrees at each step. The vessel may thus be heated and cooled in the same device. As another example, the heated solution may be placed at room temperature to cool. An exemplary process for dropping temperature is as follows. To effect a drop in temperature from about 80 °C to about 24 °C, the temperature is changed from 80 °C to 61 °C in one degree increments at a rate of 3 minutes per degree (e.g. , 80 °C for 3 minutes, 79 °C for 3 minutes, etc.). The temperature is then changed from 60 °C to 24 °C in one degree increments and at a rate of about 120 minutes per degree (e.g. , 60 °C for 120 minutes, 59 °C for 210 minutes, etc.). The total annealing time for this process is about 17 hours. In accordance with the present disclosure, under these conditions, nucleic acids (e.g. , oligonucleotides) self-assemble into a nanostructure (crystal) of predetermined and desired shape and size.
An example of a specific annealing process uses one hundred different 200 nM oligonucleotides in solution (e.g. , 5 mM Tris- 1 mM EDTA (TE), 40 mM MgCi2) and the solution is heated to about 90 °C and then cooled to about 24 °C over a period of about 73 hours, as described above with a 3 minute per degree drop between 80 °C and 61 °C, and a 120 minute per degree drop between 60 °C and 24 °C. It should be understood that the foregoing annealing process is exemplary and that other annealing processes may be used in accordance with the present disclosure.
The present disclosure also encompasses embodiments respresented by the following numbered paragraphs:
1. An asymmetric or low symmetry nucleic acid nanostructure conjugated to a target.
2. The nucleic acid nanostructure of paragraph 1, wherein the nanostructure has a cylindrical or spherical shape.
3. The nucleic acid nanostructure of paragraph 1, wherein the nanostructure has a cylindrical shape.
4. The nucleic acid nanostructure of paragraph 1 or 3, wherein the nanostructure comprises 16-64 double- stranded nucleic acid helices.
5. The nucleic acid nanostructure of any one of the foregoing paragraphs, wherein the target is a biological molecule.
6. The nucleic acid nanostructure of any one of paragraphs 1-5, wherein the target is a protein.
7. The nucleic acid nanostructure of any one of paragraphs 1-5, wherein the target is an RNA.
8. The nucleic acid nanostructure of any one of paragraphs 1-6, wherein the target has a molecular weight of about 200 kDa or less.
9. The nucleic acid nanostructure of any one of paragraphs 1-6 or 8, wherein the target is a nucleic acid binding protein. 10. The nucleic acid nanostructure of any one of paragraphs 1-6, 8 or 9, wherein the target is a transcription factor.
11. The nucleic acid nanostructure of any one of the foregoing paragraphs, wherein the target is fused to a nucleic acid binding protein or a nucleic acid binding domain.
12. The nucleic acid nanostructure of any one of the foregoing paragraphs, wherein the nucleic acid nanostructure is a DNA nanostructure.
13. The nucleic acid nanostructure of any one of the foregoing paragraphs, wherein the nucleic acid nanostructure comprises a nucleotide sequence to which the target specifically binds directly.
14. The nucleic acid nanostructure of any one of paragraphs 1-12, wherein the nucleic acid nanostructure comprises a nucleotide sequence to which the target specifically binds indirectly.
15. The nucleic acid nanostructure of any one of the foregoing paragraphs, wherein each nanostructure is conjugated to a single target.
16. A plurality of the asymmetric or low symmetry nucleic acid nanostructures of any one of paragraphs 1-15.
17. The plurality of paragraph 16, wherein the plurality is deposited on a carbon film.
18. The plurality of paragraph 16, wherein the plurality is deposited on a holey grid.
19. The plurality of paragraph 16, 17 or 18, wherein the plurality is vitrified on an electron microscope (EM) grid.
20. The plurality of any one of paragraphs 16-19, wherein the plurality is monodisperse.
21. The plurality of any one of paragraphs 16-19, wherein the plurality is polydisperse.
22. The plurality of paragraph 21, wherein the plurality comprises at least two monodisperse sub-populations, wherein the two monodisperse sub-populations differ from each other in shape and bound target.
23. A kit comprising a plurality of nucleic acids that self-assemble to form an asymmetric or low symmetry nucleic acid nanostructure, wherein one of the nucleic acids comprises a binding sequence for nucleic acid binding protein, a nucleic acid binding domain, an RNA, or a linker.
24. The kit of paragraph 23, wherein one of the nucleic acids comprises a binding sequence for a nucleic acid binding protein or a nucleic acid binding domain.
25. The kit of paragraph 23, wherein two of the nucleic acids comprise a binding sequence for a nucleic acid binding protein or a nucleic acid binding domain.
26. The kit of paragraph 23, wherein one of the nucleic acids comprises a binding sequence for an RNA.
27. The kit of any one of paragraphs 23-25, wherein the nucleic acid binding protein is a DNA binding protein.
28. The kit of any one of paragraphs 23-25 or 27, wherein the nucleic acid binding protein is a transcription factor.
29. The kit of any one of paragraphs 23-25 or 27, further comprising the nucleic acid binding protein.
30. The kit of any one of paragraphs 23-25 or 27, further comprising a fusion protein comprising the nucleic acid binding protein or a nucleic acid binding domain thereof.
31. The kit of any one of paragraphs 23-30, wherein the plurality of nucleic acids comprises a plurality of single-stranded tile oligonucleotides.
32. The kit of any one of paragraphs 23-30, wherein the plurality of nucleic acids comprises a scaffold DNA and a plurality of single stranded oligonucleotides.
33. The kit of any one of paragraphs 23-32, wherein the nanostructure is cylindrical or spherical in shape.
34. The kit of any one of paragraphs 23-33, wherein the nanostructure is cylindrical in shape and comprises 6-64 (e.g., 16-64) double- stranded nucleic acid helices.
35. A method of imaging a target comprising exposing a plurality of targets to an electron source, each target bound to a separate asymmetric or low symmetry nucleic acid scaffold, obtaining two-dimensional projections of the plurality of targets, and reconstructing the two-dimensional projections into a three-dimensional image of the target.
36. The method of paragraph 35, wherein the target is a biological molecule. 37. The method of paragraph 35, wherein the target is a protein.
38. The method of paragraph 35, wherein the target is an RNA. 39. The method of any one of paragraphs 35-37, wherein the target has a molecular weight of about 200 kDa or less.
40. The method of paragraph any one of paragraphs 35-37 or 39, wherein the target is a nucleic acid binding protein.
41. The method of any one of paragraphs 35-37 or 39, wherein the target is a transcription factor.
42. The method of any one of paragraphs 35-37 or 39, wherein the target is fused to a nucleic acid binding protein or a nucleic acid binding domain.
43. The method of any one of paragraphs 35-42, wherein the asymmetric or low symmetry nucleic acid scaffold is an asymmetric nucleic acid scaffold.
44. The method of any one of paragraphs 35-42, wherein the asymmetric or low symmetry nucleic acid scaffold is a low symmetry scaffold.
45. The method of any one of paragraphs 35-44, wherein the asymmetric or low symmetry nucleic acid scaffold is a DNA scaffold.
46. The method of any one of paragraphs 35-45, wherein the asymmetric or low symmetry nucleic acid scaffold comprises a nucleotide sequence to which the target specifically binds directly or indirectly.
47. The method of any one of paragraphs 35-46, wherein the imaging is cryo- electron microscope imaging.
48. A cylindrical nucleic acid nanostructure conjugated to a plurality of targets, wherein the targets are arranged in a helical manner on the surface of the nanostructure.
49. The cylindrical nucleic acid nanostructure of paragraph 48, comprising 5-50 targets per helical turn or 10-20 targets per helical turn.
50. The cylindrical nucleic acid nanostructure of paragraph 48 or 49, wherein the target is a biological molecule.
51. The cylindrical nucleic acid nanostructure of any one of paragraphs 48-50, wherein the target is a protein.
52. The cylindrical nucleic acid nanostructure of any one of paragraphs 48-50, wherein the target is an RNA.
53. The cylindrical nucleic acid nanostructure of any one of paragraphs 48-51 , wherein the target has a molecular weight of about 200 kDa or less. 54. The cylindrical nucleic acid nanostructure of any one of paragraphs 48-51, wherein the target has a molecular weight in the range of 200 kDa to 5 MDa.
55. The cylindrical nucleic acid nanostructure of any one of paragraphs 48-51 or 53-54, wherein the target is a nucleic acid binding protein.
56. The cylindrical nucleic acid nanostructure of any one of paragraphs 48-51 or
53-55, wherein the target is a transcription factor.
57. The cylindrical nucleic acid nanostructure of any one of paragraphs 48-51 or 53-56, wherein the target is fused to a nucleic acid binding protein or a nucleic acid binding domain.
58. The cylindrical nucleic acid nanostructure of any one of paragraphs 48-57, wherein the nucleic acid nanostructure is a DNA nanostructure.
59. The cylindrical nucleic acid nanostructure of any one of paragraphs 48-57, wherein the nucleic acid nanostructure comprises a nucleotide sequence to which the target specifically binds directly or indirectly.
60. A plurality of the cylindrical nucleic acid nanostructures of any one of paragraphs 48-59.
61. The plurality of paragraph 60, wherein the plurality of the cylindrical nucleic acid nanostructures is deposited on a carbon film.
62. The plurality of paragraph 60 or 61, wherein the cylindrical nucleic acid nanostructures are vitrified on an electron microscope (EM) grid.
63. The plurality of paragraph 60 or 61, wherein the cylindrical nucleic acid nanostructures are vitrified on an electron microscope (EM) grid in an amorphous ice layer having a depth of about 50 nm or less.
64. A kit comprising a plurality of nucleic acids that self-assemble to form a cylindrical nucleic acid nanostructure, wherein the nanostructure comprises a plurality of binding sequences for a nucleic acid binding protein, a nucleic acid binding domain, an RNA, or a linker.
65. The kit of paragraph 64, wherein the nanostructure comprises a plurality of binding sequences for a nucleic acid binding protein, a nucleic acid binding domain, or an RNA.
66. The kit of paragraph 64 or 65, wherein the nanostructure comprises 3-50 (e.g., 5-50) target binding sites per helical turn, or 10-20 target binding sites per helical turn. 67. The kit of paragraph 64, 65 or 66, wherein the nanostructure comprises a plurality of binding sequences for a nucleic acid binding protein.
68. The kit of any one of paragraphs 64, 65 and 67, wherein the nucleic acid binding protein is a DNA binding protein.
69. The kit of any one of paragraphs 64, 65 and 67, wherein the nucleic acid binding protein is a transcription factor.
70. The kit of any one of paragraphs 64-69, further comprising the nucleic acid binding protein.
71. The kit of any one of paragraphs 64-69, further comprising a fusion protein comprising the nucleic acid binding protein or a nucleic acid binding domain thereof.
72. The kit of paragraph 64, wherein the nanostructure comprises a plurality of binding sequences for an RNA.
73. The kit of paragraph 64 or 72, further comprising the RNA.
74. The kit of any one of paragraphs 64-73, wherein the plurality of nucleic acids comprises a scaffold DNA and a plurality of single stranded oligonucleotides.
75. The kit of any one of paragraphs 64-73, wherein the plurality of nucleic acids comprises a plurality of single stranded tile oligonucleotides.
76. The kit of any one of paragraphs 64-75, wherein two or more of the nucleic acids comprise binding sequence for the nucleic acid binding protein.
77. A method of imaging a target comprising exposing a plurality of complexes to an electron source, wherein each complex comprises a plurality of targets bound in a helical manner to a surface of a cylindrical nucleic acid scaffold, obtaining two-dimensional projections of the plurality of complexes, and reconstructing the two-dimensional projections into a three-dimensional image of the target.
78. The method of paragraph 77, wherein 3-50 (e.g., 5-50) targets or 10-20 targets are bound to the surface of the cylindrical nucleic acid scaffold per helical turn.
79. The method of paragraph 77 or 78, wherein the surface is an external surface of the cylindrical nucleic acid scaffold.
80. The method of any one of paragraphs 77-78, wherein the target is a biological molecule.
81. The method of any one of paragraphs 77-80, wherein the target is a protein.
82. The method of any one of paragraphs 77-80, wherein the target is an RNA. 83. The method of any one of paragraphs 77-81, wherein the target has a molecular weight of about 200 kDa or less.
84. The method of any one of paragraphs 77-81, wherein the target has a molecular weight of about 200 kDa to about 5 MDa.
85. The method of any one of paragraphs 77-81, 83 and 84, wherein the target is a nucleic acid binding protein.
86. The method of any one of paragraphs 77-81 and 83-85, wherein the target is a transcription factor.
87. The method of any one of paragraphs 77-81 and 83-85, wherein the target is fused to a nucleic acid binding protein or a nucleic acid binding domain.
88. The method of any one of paragraphs 77-87, wherein the cylindrical nucleic acid scaffold is a cylindrical DNA scaffold.
89. The method of any one of paragraphs 77-88, wherein the cylindrical nucleic acid scaffold comprises a nucleotide sequence to which the target specifically binds.
90. The method of any one of paragraphs 77-89, wherein the imaging is cryo- electron microscope imaging.
91. A two-dimensional array of nucleic acid nanostructures, each nanostructure conjugated to a target, wherein the two-dimensional array comprises a plurality of single stranded tile oligonucleotides.
92. A two-dimensional array of nucleic acid nanostructures, each nanostructure conjugated to a target, wherein each nucleic acid nanostructure comprises a cavity having a dimensions of 5 x 5 x 5 nm, 10 x 10 x 10 nm, or 50 x 50 x 50 nm.
93. The two-dimensional array of paragraph 91 or 92, wherein the target is a biological molecule.
94. The two-dimensional array of any one of paragraphs 91-93, wherein the target is a protein.
95. The two-dimensional array of any one of paragraphs 91-93, wherein the target is an RNA.
96. The two-dimensional array of any one of paragraphs 91-94, wherein the target has a molecular weight of about 200 kDa or less.
97. The two-dimensional array of any one of paragraphs 91-94, wherein the target has a molecular weight of about 200 kDa to about 5 MDa. 98. The two-dimensional array of any one of paragraphs 91-93 and 96-97, wherein the target is a nucleic acid binding protein.
99. The two-dimensional array of any one of paragraphs 91-93 and 96-98, wherein the target is a transcription factor.
100. The two-dimensional array of any one of paragraphs 91-93 and 96-99, wherein the target is fused to a nucleic acid binding protein or a nucleic acid binding domain.
101. The two-dimensional array of any one of paragraphs 91-100, wherein the nucleic acid nanostructures are DNA nanostructures.
102. The two-dimensional array of any one of paragraphs 91-101, wherein each of the nucleic acid nanostructures comprises a nucleotide sequence to which the target specifically binds.
103. The two-dimensional array of any one of paragraphs 91-102, wherein each nanostructure is conjugated to a single target.
104. The two-dimensional array of any one of paragraphs 91-103, deposited on a carbon film.
105. The two-dimensional array of any one of paragraphs 91-104, deposited on an electron microscope (EM) grid and vitrified.
106. A kit comprising
a first plurality of nucleic acids that self-assemble to form a nucleic acid nanostructure having a cavity, wherein one of the nucleic acids comprises a binding sequence for a nucleic acid binding protein or an RNA, wherein the nucleic acid binding protein or the RNA bind to the cavity, and
a second plurality of nucleic acids that attach the nucleic acid nanostructures to each other to form a two-dimensional array of nucleic acid nanostructures.
107. The kit of paragraph 106, wherein one of the nucleic acids comprises a binding sequence for a nucleic acid binding protein.
108. The kit of paragraph 106, wherein one of the nucleic acids comprises a binding sequence for an RNA.
109. The kit of paragraph 106 or 107, wherein the nucleic acid binding protein is a DNA binding protein.
110. The kit of paragraph 106, 107 or 109, wherein the nucleic acid binding protein is a transcription factor. 111. The kit of paragraph 106, 107, 109 or 110, further comprising the nucleic acid binding protein.
112. The kit of paragraph 106, 107, 109, 110 or 111, further comprising a fusion protein comprising the nucleic acid binding protein or a nucleic acid binding domain thereof.
113. The kit of any one of paragraphs 106-112, wherein the first plurality of nucleic acids comprises a scaffold DNA and a plurality of single stranded oligonucleotides.
114. The kit of paragraph 106 or 108, further comprising the RNA.
115. The kit of any one of paragraphs 106-114, wherein the first plurality of nucleic acids comprise a plurality of single stranded tile oligonucleotides.
116. A method of imaging a target comprising (1) exposing a repeating unit nucleic acid nanostructure-target complex, deposited on a solid support, to an electron source, (2) incrementally changing the angle of the solid support relative to the electron source, (3) obtaining a two-dimensional projection of the repeating unit nucleic acid nanostructure-target complex, (4) repeating steps (l)-(3) one or more times, and (5) reconstructing the two- dimensional projections into a three-dimensional image of the target.
117. A method of imaging a target comprising exposing a plurality of targets to an electron source, each target bound to a single nucleic acid nanostructure arranged in a two- dimensional array of nanostructures, obtaining two-dimensional projections of the plurality of targets, and reconstructing the two-dimensional projections into a three-dimensional image of the target.
118. The method of paragraph 117, wherein the target is a biological molecule.
119. The method of paragraph 117 or 118, wherein the target is a protein.
120. The method of paragraph 117 or 118, wherein the target is an RNA.
121. The method of paragraph 117, 118 or 119, wherein the target has a molecular weight of about 200 kDa or less.
122. The method of paragraph 117, 118 or 119, wherein the target has a molecular weight of about 200 kDa to about 5 MDa
123. The method of paragraph 117, 118 or 119, 121 or 122, wherein the target is a nucleic acid binding protein.
124. The method of any one of paragraphs 117-119 and 121-123, wherein the target is a transcription factor. 125. The method of any one of paragraphs 117-119 and 121-124, wherein the target is fused to a nucleic acid binding protein or a nucleic acid binding domain.
126. The method of any one of paragraphs 117-125, wherein the nucleic acid nanostructure is a DNA nanostructure.
127. The method of any one of paragraphs 117-126, wherein the nucleic acid nanostructure comprises a nucleotide sequence to which the target specifically binds.
128. The method of any one of paragraphs 117-127, wherein the imaging is cryo- electron microscope imaging.
129. The method of any one of paragraphs 117-127, wherein the imaging is X-ray diffraction based imaging.
130. The method of any one of paragraphs 117-127, wherein the imaging is electron diffraction based imaging.
131. A three-dimensional array of nucleic acid nanostructures, each conjugated to a target, wherein the three-dimensional array comprises a plurality of single stranded tile oligonucleotides.
132. A three-dimensional array of nucleic acid nanostructures, each nanostructure conjugated to a target, wherein each nucleic acid nanostructure comprises a cavity having a dimensions of 5 x 5 x 5 nm, 10 x 10 x 10 nm, or 50 x 50 x 50 nm.
133. The three-dimensional array of paragraph 131 or 132, wherein the target is a biological molecule.
134. The three-dimensional array of any one of paragraphs 131-133, wherein the target is a protein.
135. The three-dimensional array of any one of paragraphs 131-133, wherein the target is an RNA.
136. The three-dimensional array of any one of paragraphs 131-134, wherein the target has a molecular weight of about 200 kDa or less.
137. The three-dimensional array of any one of paragraphs 131-134, wherein the target has a molecular weight of about 200 kDa to about 5 MDa.
138. The three-dimensional array of any one of paragraphs 131-134 and 136-137, wherein the target is a nucleic acid binding protein.
139. The three-dimensional array of any one of paragraphs 131-134 and 136-138, wherein the target is a transcription factor. 140. The three-dimensional array of any one of paragraphs 131-134 and 136-139, wherein the target is fused to a nucleic acid binding protein or a nucleic acid binding domain.
141. The three-dimensional array of any one of paragraphs 131-140, wherein the nucleic acid nanostructures are DNA nanostructures.
142. The three-dimensional array of any one of paragraphs 131-141, wherein the nucleic acid nanostructures comprise a nucleotide sequence to which the target specifically binds.
143. The three-dimensional array of any one of paragraphs 131-142, wherein each nucleic acid nanostructure is conjugated to a single target.
144. A kit comprising a first plurality of nucleic acids that self-assemble to form a nucleic acid nanostructure having a cavity, wherein one of the nucleic acids comprises a binding sequence for a nucleic acid binding protein or an RNA, wherein the nucleic acid binding protein or the RNA bind to the cavity, and a second plurality of nucleic acids that attach the nucleic acid nanostructures to each other to form a three-dimensional array of nucleic acid nanostructures.
145. The kit of paragraph 144, wherein one of the nucleic acids comprises a binding sequence for a nucleic acid binding protein.
146. The kit of paragraph 144, wherein one of the nucleic acids comprises a binding sequence for an RNA
147. The kit of paragraph 144 or 145, wherein the nucleic acid binding protein is a
DNA binding protein.
148. The kit of paragraph 144, 145 or 147, wherein the nucleic acid binding protein is a transcription factor.
149. The kit of paragraph 144, 145, 147 or 148, further comprising the nucleic acid binding protein.
150. The kit of paragraph 144, 145, 147, 148 or 149, further comprising a fusion protein comprising the nucleic acid binding protein or a nucleic acid binding domain thereof.
151. The kit of any one of paragraphs 144-150, wherein the first plurality of nucleic acids comprises a scaffold DNA and a plurality of single stranded oligonucleotides.
152. The kit of paragraph 144 or 146, further comprising the RNA.
153. The kit of any one of paragraphs 144-152, wherein the first plurality of nucleic acids comprise a plurality of single stranded tile oligonucleotides. 154. A method of imaging a target comprising (1) exposing a three-dimensional repeating unit nucleic acid nanostructure-target complex, deposited on a solid support, to an electron or X-ray source, (2) obtaining electron or X-ray diffraction images of the three- dimensional repeating unit nucleic acid nanostructure-target complex, and (3) identifying the structure of the target from the diffraction images.
155. The method of paragraph 154, wherein the target is a biological molecule.
156. The method of paragraph 154 or 155, wherein the target is a protein.
157. The method of paragraph 154 or 155, wherein the target is an RNA.
158. The method of any one of paragraphs 154-156, wherein the target has a molecular weight of about 200 kDa or less.
159. The method of any one of paragraphs 154-156, wherein the target has a molecular weight of about 200 kDa to about 5 MDa.
160. The method of any one of paragraphs 154-156 and 158-159, wherein the target is a nucleic acid binding protein.
161. The method of any one of paragraphs 154-156 and 158-160, wherein the target is a transcription factor.
162. The method of any one of paragraphs 154-161, wherein the target is fused to a nucleic acid binding protein or a nucleic acid binding domain.
163. The method of any one of paragraphs 154-162, wherein the nucleic acid nanostructure is an DNA nano structure.
164. The method of any one of paragraphs 154-163, wherein the nucleic acid nanostructure comprises a nucleotide sequence to which the target specifically binds.
165. The method of any one of paragraphs 154-164, wherein the imaging is X-ray diffraction based imaging.
166. The method of any one of paragraphs 154-165, wherein the imaging is electron diffraction based imaging.
EXAMPLES
A study was conducted to demonstrate that DNA frameworks can be used to immobilize and characterize proteins by TEM and cryo-EM. The overall design of the study is given in Fig. 5. The DNA framework has a cylindrical shape with a size of about 15 nm x 25 nm. The target protein chosen for that study is CRISPR/Cas9, an RNA-guided DNA endonuclease. A mutated version of CRISPR/Cas9 that does not cleave the target DNA (also known as D10A/H840A dCas9) was used. The linker is a double-stranded DNA (dsDNA) that protrudes from the asymmetric features and contains essential elements for the binding of the CRISPR/Cas9 (i.e. target sequence and PAM motif). An in silico model of the protein CRISPR/Cas9 bound to the dsDNA linker of the framework and a scheme of the dsDNA linker are given in Fig. 6.
Design of the DNA framework
The DNA framework was designed using the DNA Bricks design principles. Started from a 24 DNA helix bundle in honeycomb lattice, asymmetric features were designed by removing parts of DNA helices on one side in order to create different "steps" (Fig. 1). Fig. 7 is a blueprint of the DNA framework with the dsDNA linker (the figure was generated using CADnano). The square highlights the dsDNA linker that contains the CRISPR/Cas9 binding elements.
Sequence of the dsDNA linker:
5' AATACCATGATTTTCAGTTTTCTTGCCTGGCATCCTT 3' (SEQ ID NO: 1)
3' TTATGGTACTAAAAGTCAAAAGAACGGACCGTAGGAA 5' (SEQ ID NO: 2) Assembly and purification of the DNA framework
Step 1. Assembly
From the blueprint, DNA oligonucleotides were generated and synthetized by the company IDT DNA. The DNA framework was assembled in one pot reaction by mixing the DNA oligonucleotides at a final concentration of 1 uM in the presence of 10 mM MgC12, 5 mM Tris and 1 mM EDTA. The folding reaction was performed in a thermocycler using thermal annealing:
Increasing temperature to 80°C
Decreasing temperature to 60°C (2-5 minutes per degree)
Decreasing temperature to 25 °C (2 hours per degree)
After folding, the sample was analyzed by agarose gel electrophoresis (Fig. 8). The right lane (CAS 1) corresponds the DNA framework.
Step 2. Glycerol gradient purification In order to remove aggregates and non-incorporated strands and to purify just the monomeric DNA framework, glycerol gradient separation by rate-zonal centrifugation was performed.
Glycerol gradients were prepared using a Gradient Master from BioComp. The final composition of the gradient was 15-45% glycerol, 5 mM Tris-HCl, 10-20 mM MgC12, 1 mM EDTA. Up to 200 uL of samples were deposited carefully at the top of the gradient. The gradients were then centrifuged at 55000 rpm for 1 hour at 4 °C using a Beckman Coulter SW55 Ti rotor.
After centrifugation, the gradients were fractionated manually by pipetting fractions of 200 uL from the top to the bottom of the tubes. The fractions were subsequently analyzed by agarose gel electrophoresis to identify which ones contain the DNA framework (Fig. 9). Only the fractions containing the monomeric DNA framework were pooled together.
Fractions 6 and 7 were pooled together and used in the subsequent steps.
Step 3. PEG precipitation
PEG precipitation was used in order to exchange the buffer (especially to remove the glycerol) and to concentrate the DNA framework. In practice, the pooled fractions were mixed with the PEG precipitation solution 1: 1 (v/v): 10% PEG 8,000, 255 mM NaCl, 5 mM Tris, 10 mM Mg, 1 mM EDTA. The solution was homogenized by pipetting gently the solution 20 times, incubated at room temperature for 30-60 min and centrifuged during 30 min at 16,000g, RT. The supernatant was removed carefully and the pellet of DNA framework was dissolved in 5 mM Tris pH 8.0, 10 mM MgC12, 1 mM EDTA. The final concentration was adjusted to 150 nM. The samples were incubated few hours at room temperature and then stored at 4c. Complex formation
The DNA framework-CRISPR/Cas9-gRNA complex was then formed in vitro. The CRISPR/Cas9 protein was purchased from the company PNA bio. The nuclease deficient Cas9 mutant D10A/H840A dCas9 was used. The guide RNA (gRNA) complementary to the dsDNA linker sequence was synthesized in vitro using the MEGAscript T7 transcription kit from Ambion and following their recommendations. Step 1. Formation of the Cas9-gRNA complex
2.7 μΐ. 5X Buffer (100 niM HEPES, 750 niM KC1, 50 niM MgC12)
4.75 μΐ, H20
6.2 μΐ, gRNA (2 μΜ final)
6.4 μΐ, Cas9 (2 μΜ final)
Incubation: 15' @ 37 °C
Step 2. Formation of the DNA framework-Cas9-gRNA complex
1.6 μΐ, 5X Buffer (100 niM HEPES, 750 niM KC1, 50 niM MgC12)
4.4 μΕ Η20
2 μ\^ purified cylindrical framework (10 nM final)
8 μΐ^ Cas9-gRNA complex // Concentration gradient: 0-1 μΜ final
Incubation: 30' @ 37 °C The reactions were analyzed by agarose gel electrophoresis (agarose 1.5%, 0.5X TBE,
11 mM MgC12) in order to detect a band shift corresponding to the formation of the complex (Fig. 10).
The band shift was visible (square) indicating the formation of the DNA framework- CRISPR/Cas-gRNA complex. FMWK = DNA framework alone; Cas9-gRNA:
CRISPR/Cas9-gRNA alone; other conditions: DNA framework + Cas9-gRNA (DNA framework:Cas9-gRNA ratios: 1: 1, 1:5, 1:5, 1: 10, 1:50 and 1: 100).
TEM imaging
A TEM micrograph (40,000X magnification) of the complex is shown in Fig. 11. DNA frameworks (grey rods) and CRISPR/Cas9 proteins (white dots) are visible (Fig. 12A). Most DNA frameworks appear to be bound to CRISPR/Cas9. Other examples of individual particles from TEM micrographs at higher magnification (with or without the protein bound) compared to the theoretical model are shown in Fig. 13. Fig. 14 shows single-particle averaging from TEM micrographs. Four different views are represented. The protein (white sphere) is clearly visible.
Cryo-EM imaging The complex was also analyzed by cryo-EM using 300 kV FEI Polara equipped with K2 direct detector (Figs. 15A-15B). The location of CRISPR/Cas9 is indicated by a yellow triangle. Importantly, the DNA framework-CRISPR/Cas9-gRNA complex remains intact after the preparation of the grids. An additional DNA framework visualized by cryo-EM (without proteins) is shown in Fig. 16. 2D class averages of single particles collected from cryo-EM micrographs are shown. DNA helices are visible indicating that high-resolution features can be obtained from structural analysis of DNA frameworks.
Table 1. DNA Binding Proteins
DNA BP Nucleic Acid Domains Sub Category Binding Sequence
INTRON 3 (I-PPO) Zinc -binding loop 5'-
ENCODED region of homing D(P*GP*AP*GP*AP
ENDONUCLEASE endonuclease *GP*TP*CP*A)-3'
PVUII Restriction Endonuclease 5'-CAGCTG-3'
ENDONUCLEASE endonuclease
ANTENNAPEDIA Homeobox (5'- HOMEODOMAIN D(*AP*GP*AP*AP*
AP*GP*CP*CP*AP* rpp*rpp*AP*GP*AP*
G)-3' (SEQ ID NO: 3)
REVERBA ORPHAN Nuclear receptor 5'-[A/G]GGTCA-3'
NUCLEAR RECEPTOR preceded by an A/T- rich 5'
SS07D non-specific sequence
binding
ENGRAILED Homeobox
HOMEODOMAIN
NUCLEAR PROTEIN Doesn't have a normal
EBNA1 Nucleic acid domain.
Contains a core DNA- binding domain (which
contains an eight- stranded antiparallel β- barrel and two a-helices
) and a flanking DNA- binding domain (a- helix and an extended
chain)
TRANSCRIPTION Palindromic core motif TTCN2-4GAA
FACTOR STAT3B
PROTEIN Restriction Endonuclease 5'-GGATCC-3'
(ENDONUCLEASE endonuclease
BAMHI)
CYTOSINE-SPECIFIC Restriction/methylation 5'-GCGC-3'
METHYLTRANSFERAS site
E HHAI
HOMEOBOX PROTEIN Homeobox
EXTRADENTICLE DNA BP Nucleic Acid Domains Sub Category Binding Sequence
TRANSCRIPTION Winged-helix c/gGCGCg/c FACTOR DP-2
CRE RECOMBINASE Loxp sites
PAX-6 Paired domain (two
helix-turn-helix
motifs) and the paired- type homeodomain (one
helix-turn-helix motif)
HMG1 HMG-box domains (A bind without sequence and B); a long acidic C- specificity terminal domain
ECO RI Restriction Endonuclease 5'-GAATTC-3'
ENDONCULEASE endonuclease
HEAT SHOCK Variant of the helix-
TRANSCRIPTION turn-helix (a three-helix
FACTOR bundle that is capped by
a four-stranded
antiparallel beta sheet)
HOMEOBOX PROTEIN Homeobox
HOX-B 1
INTERFERON Interferon regulatory
REGULATORY factor tryptophan
FACTOR 2 pentad repeat domain:
alpha/beta architecture
comprising a cluster of
three alpha-helices
(alpha l-alpha3) flanked
on one side by a mixed
four-stranded beta-sheet
(betal-beta4). Subset of
helix-turn-helix motif
HEME ACTIVATOR C6 zinc cluster motif, a
PROTEIN coiled-coil dimerization
element, and an acidic
activation domain
3 -METH YLADENINE Domain 1 : α-β
DNA GLYCOSYLASE II sandwich structure: [31- α!-β2-β3-β4-β5-α2
(one-half of the DNA- binding domain of die
TATA box. Domain 2:
six helicies, Domain 3:
4 helicies
ENDONUCLEASE Restriction Endonuclease 5'-AGATCT-3' BGLII endonuclease
REPLICATION Extended loop and an a
INITIATION PROTEIN helix
HIGH MOBILITY HMG-box (interacts
GROUP PROTEIN D both sequence non- specifically and
sequence speicifically) DNA BP Nucleic Acid Domains Sub Category Binding Sequence
MHC CLASS II Winged-helix: uses a X-box: DNA of the
TRANSCRIPTION beta-hairpin to sequence 5'-
FACTOR HRFX1 recognize DNA GTNRCC(0- 3N)RGYAAC-3', where N is any nucleotide, R is a purine and Y is a pyrimidine) (SEQ ID NO: 4)
HOMEOTIC PROTEIN
ENGRAILED
RETINOIC ACID Raralpha DNA binding
RECEPTOR ALPHA domain, 2 zinc fingers
ETS -DOMAIN ETS- binding domain
PROTEIN ELK- 1
8-OXOGUANINE DNA Helix-hairpin-helix Base Excision
GLYCOSYLASE Repair DNA
Glycosylases, 3
Subfamilies
MADS BOX MADS-box and Mef2
TRANSCRIPTION binding domain
ENHANCER FACTOR
2, POLYPEPTIDE A
DNA 4 domains: The N-
TOPOISOMERASE I terminal Toprim
domain, domain 3
(beta-barrel), domains 2
& 4 (winged-helix-like)
DNA MISMATCH Non-specific binding bindings to a G:T
REPAIR PROTEIN domains mismatch
MUTS
TYPE II RESTRICTION Palindronmic sequences
ENZYME of 4-8 bp
RESTRICTION Restriction Endonuclease AGATCT
ENDONUCLEASE endonuclease
BGLII
REPLICATION 'Winged helix' domain
TERMINATION
PROTEIN
TYPE II RESTRICTION Restriction Endonuclease
ENZYME NGOMI endonuclease
TRANSCRIPTION Basic leucine zipper
FACTOR PAP1 domain
TATA BOX ZINC TATA Box binding TATA box
FINGER PROTEIN domain/ zing finger
domain
ADENINE-N6-DNA- Taqi-like C-terminal
METHYLTRANSFERAS specificity domain
E TAQI
DNA ENDONUCLEASE Restriction Endonuclease
I-CREI endonuclease
MAJOR CENTROMERE Helix-loop-helix and
AUTO ANTIGEN B dimerization domain
INTRON- ASSOCIATED A Zn finger, an a-helix, Endonuclease
ENDONUCLEASE 1 and a helix-turn-helix DNA BP Nucleic Acid Domains Sub Category Binding Sequence
REVERSE TRANSCRIPTASE
TYPE II RESTRICTION Restriction Endonuclease
ENZYME NAEI endonuclease
CORE-BINDING RUNT domain
FACTOR ALPHA SUBUNIT1
HOMEOTIC PROTEIN Homeobox/homeodoma TATA box
MSX-1 in: they consist of three
alpha-helices and one
flexible N-terminal arm
DNA POLYMERASE
NITRATE/NITRITE Helix-turn-helix motif
RESPONSE
REGULATOR PROTEIN NARL
ATP-DEPENDENT DNA Sequence-independent
HELICASE II, 70 KDA but has a high affinity
SUBUNIT to nicks in double- stranded D A and to
the ends of duplex
DNA
TRANSCRIPTION TATA binging
REGULATOR NC2 promoter
OCTAMER-BINDING Homeobox ATTTGCAT TRANSCRIPTION FACTOR 1
REGULATORY Sequence specific 5'- PROTEIN E2 binding domain ACCNNNNNNGGT- 3'
ZIF268 Zinc finger sequences GCG(T/G)GGGCG.
DNA-INVERTASE HIN Helix-turn helix motif
DNA POLYMERASE IV
(FAMILY Y)
C-ETS-1 PROTEIN Consensus sequence GGAA/T core
element
FORMAMIDOPYRIMID Helix-turn-helix motif DNA
INE-DNA Glycosylase
GLYCOSYLASE
TYPE II RESTRICTION Restriction Endonuclease 5'-GTYRAC-3' ENZYME HINCII endonuclease
MUTM Zinc-finger
TRANSCRIPTIONAL Helix-turn-helix motif
ACTIVATOR PROTEIN TRAR
T-BOX T-box TCACACCT
TRANSCRIPTION FACTOR TBX3
STAGE 0 Helix-turn-helix motif 5'-TGNCGAA-3' SPORULATION PROTEIN A DNA BP Nucleic Acid Domains Sub Category Binding Sequence
DNA BETA-
GLUCOSYLTRANSFER
ASE
DNA ENDONUCLEASE Endonuclease Endonuclease
I-MSOI
NDT80 PROTEIN Consensus sequence middle sp culation element (MSE) 5'- C[AG]CAAA[AT]-3'
DEOXYRIBONUCLEAS
E I (DNASE I)
(E.C.3.1.21.1)
HIN RECOMBINASE Helix-turn helix motif
DNA POLYMERASE
BETA
TC3 TRANSPOSASE TC3 inverted repeat
DNA POLYMERASE I
ENDONUCLEASE Restriction Endonuclease 5'-GATATC-3'
ECORV (3.1.21.4) endonuclease
SEGMENTATION Homeobox
PROTEIN PAIRED
434 CRO Helix-turn-helix motif
ARC REPRESSOR Basic region leucine
zipper and the basic
region Helix-Loop- Helix zipper
PRD PAIRED Homeobox and paired
box
P53 TUMOR B-sandwich scaffold, RRRCWWGYYY (R
SUPPRESSOR loop-sheet-helix motif = A, G; W = A, T; Y and two large loops = C, T) (SEQ ID NO:
5)
NUCLEAR FACTOR Consensus sequence Transcription 5'-GGGRNYY YCC-
KAPPA-B P52 Factor 3' (in which R is a purine, Y is a pyrimidine, and N is any nucleotide) (SEQ ID NO: 6)
PIT-1 MUTANT Homeobox 5'-TAAAT-3'
MAT ALPHA-2 Homeobox
TRANSCRIPTIONAL
REPRESSOR
SAC7D non-specific sequence
TRANSCRIPTION Consensus sequence Transcription 5'-GGGRNYY YCC-
FACTOR NF-KB P65 Factor 3' (in which R is a purine, Y is a pyrimidine, and N is any nucleotide) (SEQ ID NO: 6)
MULTIPLE Helix-turn helix marr-
ANTIBIOTIC type
RESISTANCE PROTEIN DNA BP Nucleic Acid Domains Sub Category Binding Sequence
ESTROGEN Estrogen response Transcription 5 'AGGTC AnnnTG A RECEPTOR element - palindromic Factor CCT'3 (SEQ ID NO:
sequence 7)
FIVE-FINGER GLI Zinc-finger
HNF-3/FORK HEAD Fork-head
DNA-RECOGNITION
MOTIF
MAT Al Homeobox
HOMEODOMAIN
GCN4 Consensus sequence 5 '-TG A j CG j TC A-3 ' .
SEGMENTATION Homeobox
PROTEIN EVEN- SKIPPED
TRANSCRIPTION PU-Box, ETS domain 5'-GAGGAA-3' FACTOR PU. l (TF
PU. l)
RAP1 Helix-turn-helix motif
TATA BINDING TATA Box binding 5'-TATAAA-3' PROTEIN (TBP) domain
ZIF268 ZINC FINGER Zinc-finger
PEPTIDE
INTEGRATION HOST Integration host factorsequence specific FACTOR like DNA binding
domain
PROLINE Zn(2)-C6 fungal-type > · < -( ;< : - :· ( i n s- re ·( :· - UTILIZATION 3'
TRANSCRIPTION ACTIVATOR
T DOMAIN FROM T-box
XENOPUS LAEVIS
GA BINDING PROTEINS ALPHA and
BETA 1
CATABOLITE GENE Helix-turn-helix motif 5'- ACTIVATOR PROTEIN AAATGTGATCTAG ATC AC ATTT-3 ' (SEQ ID NO: 8)
DNA-BINDING Helix-turn-helix motif Transcription
DOMAIN OF SKN-1 Factor
CONSENSUS ZINC FINGER
E2 E2RE response element 5'-
ACCNNNNNNGGT-
3'
Table 2. RNA Binding Proteins
RNA BP Nucleic Acid Domains
A2BP1
RNA-recognition motif RNA BP Nucleic Acid Domains
ACF RNA-recognition motif
BOLL RNA-recognition motif
BRUNOL4 RNA-recognition motif
BRUNOL5 RNA-recognition motif
BRUNOL6 RNA-recognition motif
CCBL2 RNA-recognition motif
CGI-96 RNA-recognition motif
CIRBP RNA-recognition motif
CNOT4 RNA-recognition motif
CPEB2 RNA-recognition motif
CPEB3 RNA-recognition motif
CPEB4 RNA-recognition motif
CPSF7 RNA-recognition motif
CSTF2 RNA-recognition motif
CSTF2T RNA-recognition motif
CUGBP1 RNA-recognition motif
CUGBP2 RNA-recognition motif
D10S 102 RNA-recognition motif
DAZ1 RNA-recognition motif
DAZ2 RNA-recognition motif
DAZ3 RNA-recognition motif
DAZ4 RNA-recognition motif
DAZAP1 RNA-recognition motif
DAZL RNA-recognition motif
DNAJC17 RNA-recognition motif
DND1 RNA-recognition motif
EIF3S4 RNA-recognition motif
EIF3S9 RNA-recognition motif
EIF4B RNA-recognition motif
EIF4H RNA-recognition motif
ELAVL1 RNA-recognition motif
ELAVL2 RNA-recognition motif
ELAVL3 RNA-recognition motif
ELAVL4 RNA-recognition motif
ENOX1 RNA-recognition motif
ENOX2 RNA-recognition motif
EWSR1 RNA-recognition motif
FUS RNA-recognition motif
FUSIP1 RNA-recognition motif RNA BP Nucleic Acid Domains
G3BP RNA-recognition motif
G3BP1 RNA-recognition motif
G3BP2 RNA-recognition motif
GRSF1 RNA-recognition motif
HNRNPL RNA-recognition motif
HNRPAO RNA-recognition motif
HNRPA1 RNA-recognition motif
HNRPA2B 1 RNA-recognition motif
HNRPA3 RNA-recognition motif
HNRPAB RNA-recognition motif
HNRPC RNA-recognition motif
HNRPCL1 RNA-recognition motif
HNRPD RNA-recognition motif
HNRPDL RNA-recognition motif
HNRPF RNA-recognition motif
HNRPH1 RNA-recognition motif
HNRPH2 RNA-recognition motif
HNRPH3 RNA-recognition motif
HNRPL RNA-recognition motif
HNRPLL RNA-recognition motif
HNRPM RNA-recognition motif
HNRPR RNA-recognition motif
HRNBP1 RNA-recognition motif
HSU53209 RNA-recognition motif
HTATSF1 RNA-recognition motif
IGF2BP1 RNA-recognition motif
IGF2BP2 RNA-recognition motif
IGF2BP3 RNA-recognition motif
LARP7 RNA-recognition motif
MKI67IP RNA-recognition motif
MSI1 RNA-recognition motif
MSI2 RNA-recognition motif
MSSP-2 RNA-recognition motif
MTHFSD RNA-recognition motif
MYEF2 RNA-recognition motif
NCBP2 RNA-recognition motif
NCL RNA-recognition motif
NOL8 RNA-recognition motif
NONO RNA-recognition motif RNA BP Nucleic Acid Domains
P14 RNA-recognition motif
PABPC1 RNA-recognition motif
PABPC1L RNA-recognition motif
PABPC3 RNA-recognition motif
PABPC4 RNA-recognition motif
PABPC5 RNA-recognition motif
PABPN1 RNA-recognition motif
POLDIP3 RNA-recognition motif
PPARGC1 RNA-recognition motif
PPARGC1A RNA-recognition motif
PPARGC1B RNA-recognition motif
PPIE RNA-recognition motif
PPIL4 RNA-recognition motif
PPRC1 RNA-recognition motif
PSPC1 RNA-recognition motif
PTBP1 RNA-recognition motif
PTBP2 RNA-recognition motif
PUF60 RNA-recognition motif
RALY RNA-recognition motif
RALYL RNA-recognition motif
RAVER 1 RNA-recognition motif
RAVER2 RNA-recognition motif
RBM10 RNA-recognition motif
RBM1 1 RNA-recognition motif
RBM12 RNA-recognition motif
RBM12B RNA-recognition motif
RBM14 RNA-recognition motif
RBM15 RNA-recognition motif
RBM15B RNA-recognition motif
RBM16 RNA-recognition motif
RBM17 RNA-recognition motif
RBM18 RNA-recognition motif
RBM19 RNA-recognition motif
RBM22 RNA-recognition motif
RBM23 RNA-recognition motif
RBM24 RNA-recognition motif
RBM25 RNA-recognition motif
RBM26 RNA-recognition motif
RBM27 RNA-recognition motif RNA BP Nucleic Acid Domains
RBM28 RNA-recognition motif
RBM3 RNA-recognition motif
RBM32B RNA-recognition motif
RBM33 RNA-recognition motif
RBM34 RNA-recognition motif
RBM35A RNA-recognition motif
RBM35B RNA-recognition motif
RBM38 RNA-recognition motif
RBM39 RNA-recognition motif
RBM4 RNA-recognition motif
RBM41 RNA-recognition motif
RBM42 RNA-recognition motif
RBM44 RNA-recognition motif
RBM45 RNA-recognition motif
RBM46 RNA-recognition motif
RBM47 RNA-recognition motif
RBM4B RNA-recognition motif
RBM5 RNA-recognition motif
RBM7 RNA-recognition motif
RBM8A RNA-recognition motif
RBM9 RNA-recognition motif
RBMS1 RNA-recognition motif
RBMS2 RNA-recognition motif
RBMS3 RNA-recognition motif
RBMX RNA-recognition motif
RBMX2 RNA-recognition motif
RBMXL2 RNA-recognition motif
RBMY1A1 RNA-recognition motif
RBMY1B RNA-recognition motif
RBMY1E RNA-recognition motif
RBMY1F RNA-recognition motif
RBMY2FP RNA-recognition motif
RBPMS RNA-recognition motif
RBPMS2 RNA-recognition motif
RDBP RNA-recognition motif
RNPC3 RNA-recognition motif
RNPC4 RNA-recognition motif
RNPS 1 RNA-recognition motif
ROD1 RNA-recognition motif RNA BP Nucleic Acid Domains
SAFB RNA-recognition motif
SAFB2 RNA-recognition motif
SART3 RNA-recognition motif
SETD 1A RNA-recognition motif
SF3B 14 RNA-recognition motif
SF3B4 RNA-recognition motif
SFPQ RNA-recognition motif
SFRS 1 RNA-recognition motif
SFRS 10 RNA-recognition motif
SFRS 11 RNA-recognition motif
SFRS 12 RNA-recognition motif
SFRS 15 RNA-recognition motif
SFRS2 RNA-recognition motif
SFRS2B RNA-recognition motif
SFRS3 RNA-recognition motif
SFRS4 RNA-recognition motif
SFRS5 RNA-recognition motif
SFRS6 RNA-recognition motif
SFRS7 RNA-recognition motif
SFRS9 RNA-recognition motif
SLIRP RNA-recognition motif
SLTM RNA-recognition motif
SNRP70 RNA-recognition motif
SNRPA RNA-recognition motif
SNRPB2 RNA-recognition motif
SPEN RNA-recognition motif
SR140 RNA-recognition motif
SRRP35 RNA-recognition motif
SSB RNA-recognition motif
SYNCRIP RNA-recognition motif
TAF15 RNA-recognition motif
TARDBP RNA-recognition motif
THOC4 RNA-recognition motif
TIA1 RNA-recognition motif
TIAL1 RNA-recognition motif
TNRC4 RNA-recognition motif
TNRC6C RNA-recognition motif
TRA2A RNA-recognition motif
TRSPAP 1 RNA-recognition motif RNA BP Nucleic Acid Domains
TUT1 RNA-recognition motif
U1SNRNPBP RNA-recognition motif
U2AF1 RNA-recognition motif
U2AF2 RNA-recognition motif
UHMK1 RNA-recognition motif
ZCRB 1 RNA-recognition motif
ZNF638 RNA-recognition motif
ZRSR1 RNA-recognition motif
ZRSR2 RNA-recognition motif
ZC3H3 CCCH-Zinc Finger
RC3H2 CCCH-Zinc Finger
ZC3H11A CCCH-Zinc Finger
PARP12 CCCH-Zinc Finger
ZC3H15 CCCH-Zinc Finger
MKRN2 CCCH-Zinc Finger
MBNL3 CCCH-Zinc Finger
RBM22 CCCH-Zinc Finger
RBM27 CCCH-Zinc Finger
ZMAT5 CCCH-Zinc Finger
ZCH14 CCCH-Zinc Finger
ZCH12B CCCH-Zinc Finger
TRMT1 CCCH-Zinc Finger
ZC3H7A CCCH-Zinc Finger
ZC3H13 CCCH-Zinc Finger
RNF113A CCCH-Zinc Finger
HNRNPH2 CCCH-Zinc Finger
ZFP36 CCCH-Zinc Finger
ZC3H4 CCCH-Zinc Finger
UNK CCCH-Zinc Finger
TOE1 CCCH-Zinc Finger
MKRN1 CCCH-Zinc Finger
ZC3H10 CCCH-Zinc Finger
RC3H1 CCCH-Zinc Finger
NUPL2 CCCH-Zinc Finger
RBM26 CCCH-Zinc Finger
MBNL2 CCCH-Zinc Finger
RNF113B CCCH-Zinc Finger
DUS3L CCCH-Zinc Finger
ZC3H8 CCCH-Zinc Finger
ZC3H12C CCCH-Zinc Finger RNA BP Nucleic Acid Domains
ZFP36L2 CCCH-Zinc Finger
PAN3 CCCH-Zinc Finger
MBNL1 CCCH-Zinc Finger
ZC3H18 CCCH-Zinc Finger
U2AF1L4 CCCH-Zinc Finger
DHX57 CCCH-Zinc Finger
TIPARP CCCH-Zinc Finger
ZRSR2 CCCH-Zinc Finger
ZC3H12D CCCH-Zinc Finger
MKRN3 CCCH-Zinc Finger
LENG9 CCCH-Zinc Finger
ZFP36L1 CCCH-Zinc Finger
CPSF4L CCCH-Zinc Finger
ZC3H6 CCCH-Zinc Finger
PUA (PseudoUridine synthase and
DKC1 Archaeosine transglycosylase) domain
NIP7 PUA Domain
LGTN PUA Domain
MCTS 1 PUA Domain
NSUN6 PUA Domain
Mcts2 PUA Domain
CG5941 PUA Domain
CGI 1109 PUA Domain
CG7006 PUA Domain
ligatin PUA Domain
Nop60B PUA Domain
Cbf5 PUA Domain
pps-1 PUA Domain
K01G5.5 PUA Domain
C11D2.7 PUA Domain
C25H3.4 PUA Domain
C4E11.9 PUA Domain
PRPF3 PWI Domain
RBM25 PWI Domain
SRRM1 PWI Domain
rsr-1 PWI Domain
W04D2.6 PWI Domain
YBX2 Cold-shock domain
CSDE1 Cold-shock domain
CSDA Cold-shock domain
YBX1 Cold-shock domain RNA BP Nucleic Acid Domains
LIN28 Cold-shock domain
CARHSP1 Cold-shock domain
yps Cold-shock domain
MOV10L1 Cold-shock domain
CCAR1 Cold-shock domain
cey-1 Cold-shock domain
THUMPD1 THUMP domain
THUMPD3 THUMP domain
CG15014 THUMP domain
M04B2.2 THUMP domain
W02G9.3 THUMP domain
SAMD4A Sterile Alpha Motif
BICC1 Sterile Alpha Motif
SAMD14 Sterile Alpha Motif
Vtsl Sterile Alpha Motif
bbc-1 Sterile Alpha Motif
EQUIVALENTS
While several inventive embodiments have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and/or structures for performing the function and/or obtaining the results and/or one or more of the advantages described herein, and each of such variations and/or modifications is deemed to be within the scope of the inventive embodiments described herein. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and/or configurations will depend upon the specific application or applications for which the inventive teachings is/are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific inventive embodiments described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, inventive embodiments may be practiced otherwise than as specifically described and claimed. Inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and/or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and/or methods, if such features, systems, articles, materials, kits, and/or methods are not mutually inconsistent, is included within the inventive scope of the present disclosure.
All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and/or ordinary meanings of the defined terms.
All references, patents and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may encompass the entirety of the document.
The indefinite articles "a" and "an," as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean "at least one."
The phrase "and/or," as used herein in the specification and in the claims, should be understood to mean "either or both" of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with "and/or" should be construed in the same fashion, i.e., "one or more" of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the "and/or" clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to "A and/or B", when used in conjunction with open-ended language such as "comprising" can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.
As used herein in the specification and in the claims, the phrase "at least one," in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase "at least one" refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, "at least one of A and B" (or, equivalently, "at least one of A or B," or, equivalently "at least one of A and/or B") can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.
It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.
In the claims, as well as in the specification above, all transitional phrases such as "comprising," "including," "carrying," "having," "containing," "involving," "holding," "composed of," and the like are to be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases "consisting of and "consisting essentially of shall be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03.

Claims

What is claimed is: CLAIMS
I. An asymmetric or low symmetry nucleic acid nanostructure conjugated to a target.
2. The nucleic acid nanostructure of claim 1, wherein the nanostructure has a cylindrical or spherical shape.
3. The nucleic acid nanostructure of claim 1, wherein the nanostructure has a cylindrical shape.
4. The nucleic acid nanostructure of claim 1, wherein the nanostructure comprises 6-64 double-stranded nucleic acid helices.
5. The nucleic acid nanostructure of any one of the foregoing claims, wherein the target is a biological molecule.
6. The nucleic acid nanostructure of claim 1, wherein the target is a protein.
7. The nucleic acid nanostructure of claim 1, wherein the target is an RNA.
8. The nucleic acid nanostructure of claim 1, wherein the target has a molecular weight of about 200 kDa or less.
9. The nucleic acid nanostructure of claim 1, wherein the target is a nucleic acid binding protein.
10. The nucleic acid nanostructure of claim 1, wherein the target is a transcription factor.
I I. The nucleic acid nanostructure of claim 1, wherein the target is fused to a nucleic acid binding protein or a nucleic acid binding domain.
12. The nucleic acid nanostructure of claim 1, wherein the nucleic acid nanostructure is a DNA nanostructure.
13. The nucleic acid nanostructure of claim 1, wherein the nucleic acid
nanostructure comprises a nucleotide sequence to which the target specifically binds directly.
14. The nucleic acid nanostructure of claim 1, wherein the nucleic acid
nanostructure comprises a nucleotide sequence to which the target specifically binds indirectly.
15. The nucleic acid nanostructure of claim 1, wherein each nanostructure is conjugated to a single target.
16. A plurality of the asymmetric or low symmetry nucleic acid nanostructures of claim 1.
17. The plurality of claim 16, wherein the plurality is deposited on a carbon film.
18. The plurality of claim 16, wherein the plurality is deposited on a holey grid.
19. The plurality of claim 16, wherein the plurality is vitrified on an electron microscope (EM) grid.
20. The plurality of claim 16, wherein the plurality is monodisperse.
21. The plurality of claim 16, wherein the plurality is polydisperse.
22. The plurality of claim 21, wherein the plurality comprises at least two monodisperse sub-populations, wherein the two monodisperse sub-populations differ from each other in shape and bound target.
23. A kit comprising a plurality of nucleic acids that self-assemble to form an asymmetric or low symmetry nucleic acid nanostructure, wherein one of the nucleic acids comprises a binding sequence for nucleic acid binding protein, a nucleic acid binding domain, an RNA, or a linker.
24. The kit of claim 23, wherein one of the nucleic acids comprises a binding sequence for a nucleic acid binding protein or a nucleic acid binding domain.
25. The kit of claim 23, wherein two of the nucleic acids comprise a binding sequence for a nucleic acid binding protein or a nucleic acid binding domain.
26. The kit of claim 23, wherein one of the nucleic acids comprises a binding sequence for an RNA.
27. The kit of claim 23, wherein the nucleic acid binding protein is a DNA binding protein.
28. The kit of claim 23, wherein the nucleic acid binding protein is a transcription factor.
29. The kit of claim 23, further comprising the nucleic acid binding protein.
30. The kit of claim 23, further comprising a fusion protein comprising the nucleic acid binding protein or a nucleic acid binding domain thereof.
31. The kit of claim 23, wherein the plurality of nucleic acids comprises a plurality of single-stranded tile oligonucleotides.
32. The kit of claim 23, wherein the plurality of nucleic acids comprises a scaffold DNA and a plurality of single stranded oligonucleotides.
33. The kit of claim 23, wherein the nanostructure is cylindrical or spherical in shape.
34. The kit of claim 23, wherein the nanostructure is cylindrical in shape and comprises 16-64 double- stranded nucleic acid helices.
35. A method of imaging a target comprising exposing a plurality of targets to an electron source, each target bound to a separate asymmetric or low symmetry nucleic acid scaffold, obtaining two-dimensional projections of the plurality of targets, and reconstructing the two-dimensional projections into a three-dimensional image of the target.
36. The method of claim 35, wherein the target is a biological molecule.
37. The method of claim 35, wherein the target is a protein.
38. The method of claim 35, wherein the target is an RNA.
39. The method of claim 35, wherein the target has a molecular weight of about 200 kDa or less.
40. The method of claim 35, wherein the target is a nucleic acid binding protein.
41. The method of claim 35, wherein the target is a transcription factor.
42. The method of claim 35, wherein the target is fused to a nucleic acid binding protein or a nucleic acid binding domain.
43. The method of claim 35, wherein the asymmetric or low symmetry nucleic acid scaffold is an asymmetric nucleic acid scaffold.
44. The method of claim 35, wherein the asymmetric or low symmetry nucleic acid scaffold is a low symmetry scaffold.
45. The method of claim 35, wherein the asymmetric or low symmetry nucleic acid scaffold is a DNA scaffold.
46. The method of claim 35, wherein the asymmetric or low symmetry nucleic acid scaffold comprises a nucleotide sequence to which the target specifically binds directly or indirectly.
47. The method of claim 35, wherein the imaging is cryo-electron microscope imaging.
48. A cylindrical nucleic acid nanostructure conjugated to a plurality of targets, wherein the targets are arranged in a helical manner on the surface of the nanostructure.
49. The cylindrical nucleic acid nanostructure of claim 48, comprising 3-50 targets per helical turn or 10-20 targets per helical turn.
50. The cylindrical nucleic acid nanostructure of claim 48, wherein the target is a biological molecule.
51. The cylindrical nucleic acid nanostructure of claim 48, wherein the target is a protein.
52. The cylindrical nucleic acid nanostructure of claim 48, wherein the target is an
RNA.
53. The cylindrical nucleic acid nanostructure of claim 48, wherein the target has a molecular weight of about 200 kDa or less.
54. The cylindrical nucleic acid nanostructure of claim 48, wherein the target has a molecular weight in the range of 200 kDa to 5 MDa.
55. The cylindrical nucleic acid nanostructure of claim 48, wherein the target is a nucleic acid binding protein.
56. The cylindrical nucleic acid nanostructure of claim 48, wherein the target is a transcription factor.
57. The cylindrical nucleic acid nanostructure of claim 48, wherein the target is fused to a nucleic acid binding protein or a nucleic acid binding domain.
58. The cylindrical nucleic acid nanostructure of claim 48, wherein the nucleic acid nanostructure is a DNA nanostructure.
59. The cylindrical nucleic acid nanostructure of claim 48, wherein the nucleic acid nanostructure comprises a nucleotide sequence to which the target specifically binds directly or indirectly.
60. A plurality of the cylindrical nucleic acid nanostructures of claim 48.
61. The plurality of claim 60, wherein the plurality of the cylindrical nucleic acid nanostructures is deposited on a carbon film.
62. The plurality of claim 60, wherein the cylindrical nucleic acid nanostructures are vitrified on an electron microscope (EM) grid.
63. The plurality of claim 60, wherein the cylindrical nucleic acid nanostructures are vitrified on an electron microscope (EM) grid in an amorphous ice layer having a depth of about 50 nm or less.
64. A kit comprising a plurality of nucleic acids that self-assemble to form a cylindrical nucleic acid nanostructure, wherein the nanostructure comprises a plurality of binding sequences for a nucleic acid binding protein, a nucleic acid binding domain, an RNA, or a linker.
65. The kit of claim 64, wherein the nanostructure comprises a plurality of binding sequences for a nucleic acid binding protein, a nucleic acid binding domain, or an RNA.
66. The kit of claim 645, wherein the nanostructure comprises 5-50 target binding sites per helical turn, or 10-20 target binding sites per helical turn.
67. The kit of claim 64, wherein the nanostructure comprises a plurality of binding sequences for a nucleic acid binding protein.
68. The kit of claim 64, wherein the nucleic acid binding protein is a DNA binding protein.
69. The kit of claim 64, wherein the nucleic acid binding protein is a transcription factor.
70. The kit of claim 64, further comprising the nucleic acid binding protein.
71. The kit of claim 64, further comprising a fusion protein comprising the nucleic acid binding protein or a nucleic acid binding domain thereof.
72. The kit of claim 64, wherein the nanostructure comprises a plurality of binding sequences for an RNA.
73. The kit of claim 64, further comprising the RNA.
74. The kit of claim 64, wherein the plurality of nucleic acids comprises a scaffold DNA and a plurality of single stranded oligonucleotides.
75. The kit of claim 64, wherein the plurality of nucleic acids comprises a plurality of single stranded tile oligonucleotides.
76. The kit of claim 64, wherein two or more of the nucleic acids comprise binding sequence for the nucleic acid binding protein.
77. A method of imaging a target comprising
exposing a plurality of complexes to an electron source, wherein each complex comprises a plurality of targets bound in a helical manner to a surface of a cylindrical nucleic acid scaffold,
obtaining two-dimensional projections of the plurality of complexes, and
reconstructing the two-dimensional projections into a three-dimensional image of the target.
78. The method of claim 77, wherein 5-50 targets or 10-20 targets are bound to the surface of the cylindrical nucleic acid scaffold per helical turn.
79. The method of claim 77, wherein the surface is an external surface of the cylindrical nucleic acid scaffold.
80. The method of claim 77, wherein the target is a biological molecule.
81. The method of claim 77, wherein the target is a protein.
82. The method of claim 77, wherein the target is an RNA.
83. The method of claim 77, wherein the target has a molecular weight of about 200 kDa or less.
84. The method of claim 77, wherein the target has a molecular weight of about 200 kDa to about 5 MDa.
85. The method of claim 77, wherein the target is a nucleic acid binding protein.
86. The method of claim 77, wherein the target is a transcription factor.
87. The method of claim 77, wherein the target is fused to a nucleic acid binding protein or a nucleic acid binding domain.
88. The method of claim 77, wherein the cylindrical nucleic acid scaffold is a cylindrical DNA scaffold.
89. The method of claim 77, wherein the cylindrical nucleic acid scaffold comprises a nucleotide sequence to which the target specifically binds.
90. The method of claim 77, wherein the imaging is cryo-electron microscope imaging.
91. A two-dimensional array of nucleic acid nanostructures, each nanostructure conjugated to a target, wherein the two-dimensional array comprises a plurality of single stranded tile oligonucleotides.
92. A two-dimensional array of nucleic acid nanostructures, each nanostructure conjugated to a target, wherein each nucleic acid nanostructure comprises a cavity having a dimensions of 5 x 5 x 5 nm, 10 x 10 x 10 nm, or 50 x 50 x 50 nm.
93. The two-dimensional array of claim 91, wherein the target is a biological molecule.
94. The two-dimensional array of claim 91, wherein the target is a protein.
95. The two-dimensional array of claim 91, wherein the target is an RNA.
96. The two-dimensional array of claim 91, wherein the target has a molecular weight of about 200 kDa or less.
97. The two-dimensional array of claim 91, wherein the target has a molecular weight of about 200 kDa to about 5 MDa.
98. The two-dimensional array of claim 91, wherein the target is a nucleic acid binding protein.
99. The two-dimensional array of claim 91, wherein the target is a transcription factor.
100. The two-dimensional array of claim 91, wherein the target is fused to a nucleic acid binding protein or a nucleic acid binding domain.
101. The two-dimensional array of claim 91, wherein the nucleic acid
nanostructures are DNA nanostructures.
102. The two-dimensional array of claim 91, wherein each of the nucleic acid nanostructures comprises a nucleotide sequence to which the target specifically binds.
103. The two-dimensional array of claim 91, wherein each nanostructure is conjugated to a single target.
104. The two-dimensional array of claim 91, deposited on a carbon film.
105. The two-dimensional array of claim 91, deposited on an electron microscope (EM) grid and vitrified.
106. A kit comprising
a first plurality of nucleic acids that self-assemble to form a nucleic acid nanostructure having a cavity, wherein one of the nucleic acids comprises a binding sequence for a nucleic acid binding protein or an RNA, wherein the nucleic acid binding protein or the RNA bind to the cavity, and
a second plurality of nucleic acids that attach the nucleic acid nanostructures to each other to form a two-dimensional array of nucleic acid nanostructures.
107. The kit of claim 106, wherein one of the nucleic acids comprises a binding sequence for a nucleic acid binding protein.
108. The kit of claim 106, wherein one of the nucleic acids comprises a binding sequence for an RNA.
109. The kit of claim 106, wherein the nucleic acid binding protein is a DNA binding protein.
110. The kit of claim 106, wherein the nucleic acid binding protein is a transcription factor.
111. The kit of claim 106, further comprising the nucleic acid binding protein.
112. The kit of claim 106, further comprising a fusion protein comprising the nucleic acid binding protein or a nucleic acid binding domain thereof.
113. The kit of claim 106, wherein the first plurality of nucleic acids comprises a scaffold DNA and a plurality of single stranded oligonucleotides.
114. The kit of claim 106, further comprising the RNA.
115. The kit of claim 106, wherein the first plurality of nucleic acids comprise a plurality of single stranded tile oligonucleotides.
116. A method of imaging a target comprising
(a) exposing a repeating unit nucleic acid nano structure-target complex, deposited on a solid support, to an electron source,
(b) incrementally changing the angle of the solid support relative to the electron source,
(c) obtaining a two-dimensional projection of the repeating unit nucleic acid nanostructure-target complex,
(d) repeating steps (a)-(c) one or more times, and
(e) reconstructing the two-dimensional projections into a three-dimensional image of the target.
117. A method of imaging a target comprising
exposing a plurality of targets to an electron source, each target bound to a single nucleic acid nanostructure arranged in a two-dimensional array of nanostructures,
obtaining two-dimensional projections of the plurality of targets, and
reconstructing the two-dimensional projections into a three-dimensional image of the target.
118. The method of claim 117, wherein the target is a biological molecule.
119. The method of claim 117, wherein the target is a protein.
120. The method of claim 117, wherein the target is an RNA.
121. The method of claim 117, wherein the target has a molecular weight of about 200 kDa or less.
122. The method of claim 117, wherein the target has a molecular weight of about
200 kDa to about 5 MDa
123. The method of claim 117, wherein the target is a nucleic acid binding protein.
124. The method of claim 117, wherein the target is a transcription factor.
125. The method of claim 117, wherein the target is fused to a nucleic acid binding protein or a nucleic acid binding domain.
126. The method of claim 117, wherein the nucleic acid nanostructure is a DNA nano structure.
127. The method of claim 117, wherein the nucleic acid nanostructure comprises a nucleotide sequence to which the target specifically binds.
128. The method of claim 117, wherein the imaging is cryo-electron microscope imaging.
129. The method of claim 117, wherein the imaging is X-ray diffraction based imaging.
130. The method of claim 117, wherein the imaging is electron diffraction based imaging.
131. A three-dimensional array of nucleic acid nanostructures, each conjugated to a target, wherein the three-dimensional array comprises a plurality of single stranded tile oligonucleotides.
132. A three-dimensional array of nucleic acid nanostructures, each nanostructure conjugated to a target, wherein each nucleic acid nanostructure comprises a cavity having a dimensions of 5 x 5 x 5 nm, 10 x 10 x 10 nm, or 50 x 50 x 50 nm.
133. The three-dimensional array of claim 131, wherein the target is a biological molecule.
134. The three-dimensional array of claim 131, wherein the target is a protein.
135. The three-dimensional array of claim 131, wherein the target is an RNA.
136. The three-dimensional array of claim 131, wherein the target has a molecular weight of about 200 kDa or less.
137. The three-dimensional array of claim 131, wherein the target has a molecular weight of about 200 kDa to about 5 MDa.
138. The three-dimensional array of claim 131, wherein the target is a nucleic acid binding protein.
139. The three-dimensional array of claim 131, wherein the target is a transcription factor.
140. The three-dimensional array of claim 131, wherein the target is fused to a nucleic acid binding protein or a nucleic acid binding domain.
141. The three-dimensional array of claim 131, wherein the nucleic acid nanostructures are DNA nanostructures.
142. The three-dimensional array of claim 131, wherein the nucleic acid nanostructures comprise a nucleotide sequence to which the target specifically binds.
143. The three-dimensional array of claim 131, wherein each nucleic acid nanostructure is conjugated to a single target.
144. A kit comprising
a first plurality of nucleic acids that self-assemble to form a nucleic acid nanostructure having a cavity, wherein one of the nucleic acids comprises a binding sequence for a nucleic acid binding protein or an RNA, wherein the nucleic acid binding protein or the RNA bind to the cavity, and
a second plurality of nucleic acids that attach the nucleic acid nanostructures to each other to form a three-dimensional array of nucleic acid nanostructures.
145. The kit of claim 144, wherein one of the nucleic acids comprises a binding sequence for a nucleic acid binding protein.
146. The kit of claim 144, wherein one of the nucleic acids comprises a binding sequence for an RNA
147. The kit of claim 144, wherein the nucleic acid binding protein is a DNA binding protein.
148. The kit of claim 144, wherein the nucleic acid binding protein is a
transcription factor.
149. The kit of claim 144, further comprising the nucleic acid binding protein.
150. The kit of claim 144, further comprising a fusion protein comprising the nucleic acid binding protein or a nucleic acid binding domain thereof.
151. The kit of claim 144, wherein the first plurality of nucleic acids comprises a scaffold DNA and a plurality of single stranded oligonucleotides.
152. The kit of claim 144, further comprising the RNA.
153. The kit of claim 144, wherein the first plurality of nucleic acids comprise a plurality of single stranded tile oligonucleotides.
154. A method of imaging a target comprising
(1) exposing a three-dimensional repeating unit nucleic acid nanostructure-target complex, deposited on a solid support, to an electron or X-ray source, (2) obtaining electron or X-ray diffraction images of the three-dimensional repeating unit nucleic acid nanostructure-target complex, and
(3) identifying the structure of the target from the diffraction images.
155. The method of claim 154, wherein the target is a biological molecule.
156. The method of claim 154, wherein the target is a protein.
157. The method of claim 154, wherein the target is an RNA.
158. The method of claim 154, wherein the target has a molecular weight of about 200 kDa or less.
159. The method of claim 154, wherein the target has a molecular weight of about 200 kDa to about 5 MDa.
160. The method of claim 154, wherein the target is a nucleic acid binding protein.
161. The method of claim 154, wherein the target is a transcription factor.
162. The method of claim 154, wherein the target is fused to a nucleic acid binding protein or a nucleic acid binding domain.
163. The method of claim 154, wherein the nucleic acid nanostructure is an DNA nanostructure.
164. The method of claim 154, wherein the nucleic acid nanostructure comprises a nucleotide sequence to which the target specifically binds.
165. The method of claim 154, wherein the imaging is X-ray diffraction based imaging.
166. The method of claim 154, wherein the imaging is electron diffraction based imaging.
PCT/US2016/052209 2015-09-18 2016-09-16 Nucleic acid frameworks for structural determination Ceased WO2017049136A1 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201562220960P 2015-09-18 2015-09-18
US201562220954P 2015-09-18 2015-09-18
US62/220,954 2015-09-18
US62/220,960 2015-09-18

Publications (1)

Publication Number Publication Date
WO2017049136A1 true WO2017049136A1 (en) 2017-03-23

Family

ID=58289692

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/052209 Ceased WO2017049136A1 (en) 2015-09-18 2016-09-16 Nucleic acid frameworks for structural determination

Country Status (1)

Country Link
WO (1) WO2017049136A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108460217A (en) * 2018-03-13 2018-08-28 西北工业大学 A kind of unstable state three-dimensional icing method for numerical simulation
EP3868893A1 (en) * 2020-02-20 2021-08-25 Technische Universität München Programmable shells for virus encapsulation
WO2025117814A1 (en) * 2023-11-28 2025-06-05 The Regents Of The University Of California Method for high-resolution cryo-electron microscopy structure determination of rna

Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040253623A1 (en) * 1997-05-23 2004-12-16 Gendaq Limited Nucleic acid binding proteins
US20060120579A1 (en) * 2002-07-08 2006-06-08 Ulf Skoglund Imaging apparatus and method
WO2007114772A1 (en) * 2006-04-04 2007-10-11 Sidec Technologies Ab Extended electron tomography
US20120142014A1 (en) * 2010-03-08 2012-06-07 California Institute Of Technology Molecular indicia of cellular constituents and resolving the same by super-resolution technologies in single cells
WO2012151537A2 (en) * 2011-05-04 2012-11-08 Parabon Nanolabs, Inc. Finite fully addressable nucleic acid nanostructures as nanocarriers for delivery of pharmaceuticals
WO2013034160A1 (en) * 2011-09-06 2013-03-14 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e. V. Methods for analyzing biological macromolecular complexes and use thereof
WO2013148186A1 (en) * 2012-03-26 2013-10-03 President And Fellows Of Harvard College Lipid-coated nucleic acid nanostructures of defined shape
WO2015017586A1 (en) * 2013-07-30 2015-02-05 President And Fellows Of Harvard College Quantitative dna-based imaging and super-resolution imaging
US20150218204A1 (en) * 2012-07-24 2015-08-06 President And Fellows Of Harvard College Self-assembly of nucleic acid nanostructures

Patent Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040253623A1 (en) * 1997-05-23 2004-12-16 Gendaq Limited Nucleic acid binding proteins
US20060120579A1 (en) * 2002-07-08 2006-06-08 Ulf Skoglund Imaging apparatus and method
WO2007114772A1 (en) * 2006-04-04 2007-10-11 Sidec Technologies Ab Extended electron tomography
US20120142014A1 (en) * 2010-03-08 2012-06-07 California Institute Of Technology Molecular indicia of cellular constituents and resolving the same by super-resolution technologies in single cells
WO2012151537A2 (en) * 2011-05-04 2012-11-08 Parabon Nanolabs, Inc. Finite fully addressable nucleic acid nanostructures as nanocarriers for delivery of pharmaceuticals
WO2013034160A1 (en) * 2011-09-06 2013-03-14 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e. V. Methods for analyzing biological macromolecular complexes and use thereof
WO2013148186A1 (en) * 2012-03-26 2013-10-03 President And Fellows Of Harvard College Lipid-coated nucleic acid nanostructures of defined shape
US20150218204A1 (en) * 2012-07-24 2015-08-06 President And Fellows Of Harvard College Self-assembly of nucleic acid nanostructures
WO2015017586A1 (en) * 2013-07-30 2015-02-05 President And Fellows Of Harvard College Quantitative dna-based imaging and super-resolution imaging

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
MIAO, J ET AL.: "Atomic Resolution Three-Dimensional Electron Diffraction Microscopy.", PHYSICAL REVIEW LETTERS., vol. 89, no. 15, 7 October 2002 (2002-10-07), pages 1 - 4, XP055371174 *
MUDALIGE, TK ET AL.: "A Zwitterion-DNA Coating Stabilizes Nanoparticles against Mg2+ Driven Aggregation Enabling Attachment to Dna Nanoassemblies.", NANOSCALE, vol. 4, no. 9, February 2012 (2012-02-01), pages 2855 - 2858, XP055371176 *
QUISPE, J ET AL.: "An Improved Holey Carbon Film for Cryo-Electron Microscopy.", MICROSCOPY AND MICROANALYSIS., vol. 13, 2007, pages 365 - 371, XP009136062 *
RINKER, S ET AL.: "Self-assembled DNA Nanostructures for Distance Dependent Multivalent Ligand-protein Binding.", NATURE NANOTECHNOLOGY., vol. 3, no. 7, July 2008 (2008-07-01), pages 418 - 422, XP055371153 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108460217A (en) * 2018-03-13 2018-08-28 西北工业大学 A kind of unstable state three-dimensional icing method for numerical simulation
EP3868893A1 (en) * 2020-02-20 2021-08-25 Technische Universität München Programmable shells for virus encapsulation
WO2021165528A1 (en) 2020-02-20 2021-08-26 Technische Universität München Programmable shells for virus encapsulation
JP2023514404A (en) * 2020-02-20 2023-04-05 テクニッシェ ウニベルシタット ミュンヘン Programmable shell for virus encapsulation
WO2025117814A1 (en) * 2023-11-28 2025-06-05 The Regents Of The University Of California Method for high-resolution cryo-electron microscopy structure determination of rna

Similar Documents

Publication Publication Date Title
US9796749B2 (en) Compositions and methods relating to nucleic acid nano- and micro-technology
US9975916B2 (en) Compositions and methods relating to complex nucleic acid nanostructures
Kohlberger et al. SELEX: Critical factors and optimization strategies for successful aptamer selection
EP2877600B1 (en) Self-assembly of nucleic acid nanostructures
JP6808617B2 (en) Dislocations that maintain continuity
KR20160138579A (en) Systems and methods for clonal replication and amplification of nucleic acid molecules for genomic and therapeutic applications
US20140038241A1 (en) Genomic enrichment method, composition, and reagent kit
US12571802B2 (en) Nanoswitch caliper trains for high-throughput, high-resolution structural analysis of biomolecules
WO2017100251A1 (en) Target detection using barcode conjugates and nucleic acid nanoarrays
Makhov et al. Visualization of the annealing of complementary single-stranded DNA catalyzed by the herpes simplex virus type 1 ICP8 SSB/recombinase
US20190276876A1 (en) Method of detecting a nucleic acid
US7622252B2 (en) Generation of minicircle DNA with physiological supercoiling
WO2012083845A1 (en) Methods for removal of vector fragments in sequencing library and uses thereof
Müller Nucleic Acids from A to Z
JP5965398B2 (en) Novel method for isolating proteins that bind to any type of nucleic acid sequence of interest
JP6781883B2 (en) Aptamer selection method
Yi Structural approaches to targeting RNA terminal uridylytransferases
JP2026500188A (en) Retrotransposon compositions and methods of use
CN117295816A (en) Compositions containing variant polypeptides and uses thereof
EP2141249A1 (en) Method for the detection of specific nucleic acid hybridization
HK1198038A (en) Compositions and methods relating to nucleic acid nano-and micro-technology
HK1210628B (en) Self-assembly of nucleic acid nanostructures
Class et al. Patent application title: Multidimensional Supramolecular Structures Essentially Made of Assembled I-Motif Tetramers Inventors: Denis Pompon (Gif Sur Yvette, FR) Jean-Louis Leroy (Antony, FR) Aude Laisne (Gif-Sur-Yvette, FR) Assignees: CENTRE NATIONAL DE LA RECHERCHE SCIENTIFIQUE

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16847425

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16847425

Country of ref document: EP

Kind code of ref document: A1