WO2017048843A1 - Compositions and methods for inhibiting expression of the alas1 gene - Google Patents

Compositions and methods for inhibiting expression of the alas1 gene Download PDF

Info

Publication number
WO2017048843A1
WO2017048843A1 PCT/US2016/051737 US2016051737W WO2017048843A1 WO 2017048843 A1 WO2017048843 A1 WO 2017048843A1 US 2016051737 W US2016051737 W US 2016051737W WO 2017048843 A1 WO2017048843 A1 WO 2017048843A1
Authority
WO
WIPO (PCT)
Prior art keywords
dsrna
antisense
sequence
once
nucleotides
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2016/051737
Other languages
French (fr)
Inventor
William Querbes
Amy Chan
Amy SIMON
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Alnylam Pharmaceuticals Inc
Original Assignee
Alnylam Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Alnylam Pharmaceuticals Inc filed Critical Alnylam Pharmaceuticals Inc
Publication of WO2017048843A1 publication Critical patent/WO2017048843A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00

Definitions

  • the invention relates to the specific inhibition of the expression of the ALASl gene.
  • the inherited porphyrias are a family of disorders resulting from the deficient activity of specific enzymes in the heme biosynthetic pathway, also referred to herein as the porphyrin pathway. Deficiency in the enzymes of the porphyrin pathway leads to insufficient heme production and to an accumulation of porphyrin precursors and porphyrins, which are toxic to tissue in high concentrations.
  • AIP acute intermittent porphyria
  • VP variegate porphyria
  • HCP copropophyria or HCP, e.g., autosomal dominant HCP
  • 5' aminolevulinic acid also known as ⁇ - aminolevulinic acid or ALA
  • ADP autohydratase deficiency porphyria
  • hepatic 5 '-aminolevulinic acid synthase 1 (ALAS1 ), the first and rate-limiting enzyme of the heme biosynthetic pathway.
  • AIP hepatic 5 '-aminolevulinic acid synthase 1
  • HCP hepatic 5 '-aminolevulinic acid synthase 1
  • the respective enzyme deficiencies result in hepatic production and accumulation of one or more substances (e.g., porphyrins and/or porphyrin precursors, e.g., ALA and/or PBG) that can be neurotoxic and can result in the occurrence of acute attacks. See, e.g., Balwani, M and Desnick, .J., Blood, 120:4496-4504, 2012.
  • Hemin Panhematin®, Lundbeck or Normosang®, Orphan Europe
  • ALAS 1 ALAS 1
  • hemin is used for the treatment during an acute attack and for prevention of attacks, particularly in women with the actue porphyrias who experience frequent attacks with the hormonal changes during their menstrual cycles. While patients generally respond well, its effect is slow, typically taking two to four days or longer to normalize urinary ALA and PBG concentrations towards normal levels.
  • the intravenous hemin is rapidly metabolized, three to four infusions are usually necessary to effectively treat or prevent an acute attack.
  • AIP also referred to as porphobilinogen deaminase (PBGD) deficiency, or
  • HMBS hydroxymethylbilane synthase
  • AIP hydroxymethylbilane synthase
  • is an autosomal dominant disorder caused by mutations in the HMBS gene that result in reduced, e.g., half-normal activity of the enzyme.
  • a mouse model of ⁇ that has -30% of wiidtype HMBS activity was generated by homologous recombination. Like human patients, these mice increase hepatic ALAS 1 activity and accumulate large quantities of plasma and urinary ALA and PBG when administered porphyrinogenic drugs, such as phenobarbital. Thus, they serve as an excellent model to evaluate the efficacy of novel therapeutics for the acute hepatic porphyrias.
  • the present invention describes methods and iRNA compositions for modulating the expression of an ALAS l gene.
  • expression of an ALAS l gene is reduced or inhibited using an ALAS l -specific iRNA. Such inhibition can be useful in treating disorders related to ALAS l expression, such as porphyrias.
  • compositions and methods that effect the RNA- induced silencing complex (RlSC)-mediated cleavage of RNA transcripts of the ALASl gene, such as in a cell or in a subject (e.g., in a mammal, such as a human subject).
  • RlSC RNA- induced silencing complex
  • compositions and methods for treating a disorder related to expression of an ALAS l gene such as a porphyria, e.g., X-linked sideroblastic anemia (XLS A), ALA deyhdratase deficiency porphyria (Doss porphyria or ADP), acute intermittent porphyria (AIP), congenital erythropoietic porphyria (CEP), prophyria cutanea tarda (PCT), hereditary coproporphyria (coproporphyria, or HCP), variegate porphyria (VP), erythropoietic protoporphyria (EPP), or transient
  • a porphyria e.g., X-linked sideroblastic anemia (XLS A), ALA deyhdratase deficiency porphyria (Doss porphyria or ADP), acute intermittent porphyria (AIP), con
  • the disorder is an acute hepatic porphyria, e.g. , ALA deyhdratase deficiency porphyria (ADP), AIP, HCP, or VP.
  • the disorder is ALA deyhdratase deficiency porphyria (ADP) or ATP.
  • the porphyria is a hepatic porphyria, e.g., a porphyria selected from acute intermittent porphyria (AIP) hereditary coproporphyria (HCP), variegate porphyria (VP), ALA deyhdratase deficiency porphyria (ADP), and hepatoerythropoietic porphyria.
  • AIP acute intermittent porphyria
  • HCP hereditary coproporphyria
  • VP variegate porphyria
  • ADP ALA deyhdratase deficiency porphyria
  • the porphyria is a homozygous dominant hepatic porphyria (e.g. , homozygous dominant AIP, HCP, or VP) or hepatoerythropoietic porphyria.
  • the porphyria is a dual porphyria.
  • RNAi RNA-induced silencing complex
  • RISC RNA-induced silencing complex
  • the iRNAs included in the compositions featured herein encompass a dsR A having an RNA strand (the antisense strand) having a region, e.g., a region that is 30 nucleotides or less, generally 19-24 nucleotides in length, that is substantially complementary to at least part of an mRNA transcript of an ALAS 1 gene (e.g., a mouse or human ALAS 1 gene) (also referred to herein as an "ALAS 1 -specific iRNA").
  • ALAS 1 gene e.g., a mouse or human ALAS 1 gene
  • iRNAs encompass a dsRNA having an RNA strand (the antisense strand) having a region that is 30 nucleotides or less, generally 19-24 nucleotides in length, that is substantially complementary to at least part of an mRNA transcript of an ALAS 1 gene (e.g., a human variant 1 or 2 of an ALAS1 gene) (also referred to herein as a "ALAS 1 -specific iRNA").
  • ALAS 1 gene e.g., a human variant 1 or 2 of an ALAS1 gene
  • the iRNA (e.g, dsRNA) described herein comprises an antisense strand having a region that is substantially complementary to a region of a human ALAS 1.
  • the human ALAS 1 has the sequence of NM_0()0688.4 (SEQ ID NO: l ) or
  • NM_000688.5 (SEQ ID NO:382).
  • the human ALAS 1 has the sequence of NMJ 99166.1.
  • the antisense sequence of the iRNA targets within the region 871 to 895 (plus or minus 5, 4, 3, 2, or 1 nucleotides in either or both directions on the 5' and/or 3' end) on the ALAS 1 transcript NM_0()0688.4.
  • the antisense sequence targets the nucleotides 871 to 893, 871 to 892, or 873 to 895 on the ALAS 1 transcript
  • the antisense sequence comprises or consists of a sequence that is fully complementary or substantially complementary to nucleotides 871 to 893, 871 to 892, or 873 to 895 on the ALAS1 transcript NM_000688.4.
  • a method of treating a porphyria comprises administering to a subject in need of such treatment a therapeutically effective amount of a double-stranded ribonucleic acid (dsRNA), e.g. , for inhibiting expression of ALAS 1, wherein said dsRNA is administered at a dose of 0.02 to 10 mg/kg, e.g., 0.5 to 10 mg/kg, e.g., 0.5 to 5 mg/kg, 0.5 to 3 mg/kg, or 0.5 to 2 mg/kg, bodyweight of the subject once every four weeks or once every twelve weeks, thereby treating the porphyria.
  • dsRNA double-stranded ribonucleic acid
  • said dsRNA is administered at a dose of 0.5 to 1.5, 0.5 to 1, 1 to 1.5, 1.5 to 2 mg kg, 2 to 2.5 mg kg, 2.5 to 3 mg/kg, or 2.5 to 5 mg/kg, e.g., 0.5, 1, 1.5, 2. 2.5. 3, or 5 mg/kg, bodyweight of the subject once every four weeks or once every twelve weeks.
  • said dsRNA is administered at a dose of 0.5 to 2 mg/kg once every four weeks.
  • said dsRNA is administered at a dose of 0.5 to 2 mg/kg once ever ⁇ ? twelve weeks.
  • said dsRNA is administered at a dose of 2 to 3 mg/kg (e.g., 2.5 mg/kg) once every four weeks. In some embodiments, said dsRNA is administered at a dose of 2 to 3 mg/kg (e.g., 2.5 mg kg) once every twelve weeks. In some embodiments, said dsRNA is administered at a dose of 4 to 6 mg/kg (e.g., 5 mg/kg) once every twelve weeks.
  • said dsRNA is administered to the subject subcutaneously.
  • said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALAS 1 RNA transcript (e.g., SEQ ID NO: l), which antisense strand comprises at least 20 contiguous nucleotides from the antisense sequence of UAAGAUGAGACACUCUUUCUGGU (SEQ ID NO: 4153) or
  • said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALAS 1 RNA transcript (e.g.,
  • SEQ ID NO: l which antisense strand comprises at least 20 contiguous nucleotides from (i) an antisense sequence listed in any one of Tables 21 to 40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g. , an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237), or (ii) an unmodified version of an antisense sequence listed in any one of Tables 21 to 40 of WO
  • said dsRNA comprises at least one modified nucleotide.
  • at least one modified nucleotide is chosen from a 2'-0-methyl, a 2'-fluoro modified nucleotide, and optionally one or more 5'-phosphorothioate groups, or any combination thereof.
  • the duplex region is 17-23 nucleotide pairs in length. In some embodiments, at least one strand comprises a 3' overhang of at least 2 nucleotides. In some embodiments, each strand is no more than 26 nucleotides in length.
  • the dsRNA further comprises a ligand, optionally wherein the ligand is conjugated to the 3' end of the sense strand of the dsRNA. In some embodiments, the ligand comprises a carbohydrate, optionally wherein the ligand is a GalNAc ligand.
  • the ligand is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N
  • the ligand is attached via a bivalent or trivalent branched linker.
  • the ligand and linker are as shown in Formula XXIV:
  • the dsRNA is conjugated to ligand L96 via a linker as shown below
  • the ligand targets the dsRNA to hepatocytes.
  • the dsRNA comprises a sense strand consisting of a sense sequence selected from the sense sequences listed in Tables 21 to 40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., an sense sequence corresponding to SEQ ID NO: 4149 or 4151 , or one of the even numbered sequences identified as SEQ ID NOs: 4172 to 5236), and an antisense strand consisting of an antisense sequence selected from the antisense sequences listed in Tables 21 to 40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g. , an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237).
  • the dsRNA has an IC5 of less than 1 nM, less than 0.05 nM, less than 0.02 nM, or less than 0.01 nM. In some embodiments, the dsRNA has a single dose ED50 of less than about 10 mg/kg or less than about 5 mg/kg.
  • the dsRNA shows improved activity compared with AD-58632 or AD-60489, optionally wherein the dsRNA is selected from the dsRNAs listed in Tables 21 to 40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., comprising or consisting of a sense sequence corresponding to SEQ ID NO: 4149 and an antisense sequence
  • the sense strand comprises or consists of the sequence of CAGAAAGAGUGUCUCAUCUUA (SEQ ID NO: 4155).
  • the antisense strand comprises the antisense sequence of AD- 60519, wherein the antisense sequence comprises all of the modified nucleotides of AD-60519. In some embodiments, the antisense strand consists of the antisense sequence of AD-60519, wherein the antisense sequence comprises all of the modified nucleotides of AD-60519. In some embodiments, the sense strand comprises the sense sequence of AD-60519, wherein the sense sequence comprises all of the modified nucleotides of AD-60519. In some embodiments, the sense strand consists of the sense sequence of AD-60519, wherein the sense sequence comprises all of the modified nucleotides of AD-60519.
  • the sense strand comprises the sense sequence of AD-60519
  • the antisense strand comprises the antisense sequence of AD-60519, wherein the sense and antisense sequences comprise all of the modified nucleotides of AD-60519.
  • the sense strand consists of the sense sequence of AD- 60519
  • the antisense strand consists of the antisense sequence of AD-60519, wherein the sense and antisense sequences comprise all of the modified nucleotides of AD-60519.
  • the antisense strand comprises the antisense sequence of AD-
  • the sense strand comprises the sense sequence of AD-60489, wherein the antisense and/or sense sequence comprises all of the modified nucleotides of AD-60489.
  • the antisense strand consists of the antisense sequence of AD-60489, and/or the sense strand consists of the sense sequence of AD-60489, wherein the antisense and/or sense sequence comprises all of the modified nucleotides of AD-60489.
  • the antisense strand comprises the antisense sequence of AD-
  • the sense strand comprises the sense sequence of AD-61 193, wherein the antisense and/or sense sequence comprises all of the modified nucleotides of AD-61193.
  • the antisense strand consists of the antisense sequence of AD-61 193, and/or the sense strand consists of the sense sequence of AD-61 193, wherein the antisense and/or sense sequence comprises all of the modified nucleotides of AD-61 193.
  • the antisense strand comprises the antisense sequence of AD- 60819, and/or the sense strand comprises the sense sequence of AD-60819, wherein the antisense and/or sense sequence comprises all of the modified nucleotides of AD-60819.
  • the antisense strand consists of the antisense sequence of AD-60819, and/or the sense strand consists of the sense sequence of AD-60819, wherein the antisense and/or sense sequence comprises all of the modified nucleotides of AD-60819.
  • said dsRNA is administered in an unbuffered saline or water solution.
  • the subject is at risk for developing, or is diagnosed with, a porphyria.
  • the porphyria is acute intermittent porphyria or ALA- dehydratase deficiency porphyria.
  • the dsRNA is administered after an acute attack of porphyria. In some embodiments, the dsRNA is administered during an acute attack of porphyria. In some embodiments, the dsRNA is administered prophylactically to prevent an acute attack of porphyria.
  • the method decreases a level of a porphyrin or a porphyrin precursor (e.g., ⁇ -aminolevulinic acid (ALA) or porphopilinogen (PBG)) and/or inhibits ALAS l expression in the subject.
  • a level of a porphyrin or a porphyrin precursor e.g., ⁇ -aminolevulinic acid (ALA) or porphopilinogen (PBG)
  • the level of ALA and/or PBG e.g., urine ALA and/or PBG
  • the level of ALA and/or PBG is decreased by 30% or more, 35% or more, 40% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, or 95% or more, in the subject, compared to the level before the treatment.
  • the method inhibits ALAS l expression, e.g., by 40% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, or 95% or more, in the subject, compared to the level before the treatment.
  • the method (i) ameliorates a symptom associated with an ALAS l related disorder (e.g., a porphyria), (ii) decreases frequency of acute attacks of symptoms associated with a porphyria in the subject, and/or (iii) decreases incidence of acute attacks of symptoms associated with a porphyria in the subject when the subject is exposed to a precipitating factor, e.g., the premenstrual phase.
  • an ALAS l related disorder e.g., a porphyria
  • decreases frequency of acute attacks of symptoms associated with a porphyria in the subject and/or
  • iii) decreases incidence of acute attacks of symptoms associated with a porphyria in the subject when the subject is exposed to a precipitating factor, e.g., the premenstrual phase.
  • the dsRNA is administered before an acute attack of porphyria, e.g., during a prodrome.
  • the subject has an elevated level (e.g., plasma or urine level) of ALA and/or PBG, compared to a nomial subject. In some embodiments, the subject suffers from chronic pain. In some embodiments, the method decreases the elevated level of ALA and/or PBG, e.g., by 30% or more, 35% or more, 40% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, or 95% or more.
  • an elevated level e.g., plasma or urine level
  • the subject suffers from chronic pain.
  • the method decreases the elevated level of ALA and/or PBG, e.g., by 30% or more, 35% or more, 40% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, or 95%
  • the subject has an elevated level of ALAS l (e.g., liver or serum ALAS l level, e.g., ALASl mRNA level) that is at least 2, 3, 4, or 5 fold higher compared to the level of ALAS l in a normal subject.
  • ALAS l e.g., liver or serum ALAS l level, e.g., ALASl mRNA level
  • the method decreases or prevents pain, neuropathy, and/or nerve damage. In some embodiments, the method prevents acute attacks of porphyria.
  • the dsRNA is administered repeatedly, e.g., every four weeks or every twelve weeks, for twenty-four or more weeks.
  • a method of treating a subject with an elevated level of ALA and/or PBG comprises administering to a subject in need of such treatment a therapeutically effective amount of a dsRNA, e.g., for inhibiting expression of ALAS l, and wherein said dsRNA is administered at a dose of 0.02 to 10 mg/kg, e.g., 0.5 to 10 mg kg, e.g., 0.5 to 5 mg kg, 0.5 to 3 mg/kg, or 0.5 to 2 mg/kg bodyweight of the subject once every four weeks or once every twelve weeks.
  • a dsRNA e.g., for inhibiting expression of ALAS l
  • said dsRNA is administered at a dose of 0.02 to 10 mg/kg, e.g., 0.5 to 10 mg kg, e.g., 0.5 to 5 mg kg, 0.5 to 3 mg/kg, or 0.5 to 2 mg/kg bodyweight of the subject once every four weeks or once every twelve weeks.
  • said dsRNA is administered at a dose of 0.5 to 1.5, 0.5 to 1, 1 to 1.5, 1.5 to 2 mg/kg, 2 to 2.5 mg kg, 2.5 to 3 mg/kg, or 2.5 to 5 mg kg, e.g., about 0.5, 1 , 1.5, 2, 2.5, 3, or 5 mg/kg, bodyweight of the subject once every four weeks or once every twelve weeks.
  • said dsRNA is administered at a dose of 0.5 to 2 mg/kg once every four weeks.
  • said dsRNA is administered at a dose of 0.5 to 2 mg/kg once every twelve weeks.
  • said dsRNA is administered at a dose of 2 to 3 mg/kg (e.g., 2.5 mg/kg) once every four weeks. In some embodiments, said dsRNA is administered at a dose of 2 to 3 mg/kg (e.g., 2.5 mg/kg) once every twelve weeks. In some embodiments, said dsRNA is administered at a dose of 4 to 6 mg/kg (e.g., 5 mg/kg) once every twelve weeks.
  • the method is effective to decrease the level of ALA and/or PBG.
  • said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALAS 1 RNA transcript (e.g., SEQ ID NO: l ), which antisense strand comprises at least 20 contiguous nucleotides from (i) an antisense sequence listed in any one of Tables 21 to 40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237), or (ii) an unmodified version of an antisense sequence listed in any one of Tables 21 to 40 of WO
  • the level of ALA and/or PBG is decreased by 30% or more, 35 or more, 40% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80%' or more, 85% or more, 90% or more, or 95% or more, compared to the level before the treatment.
  • a method of treating a subject having an increased level of ALA and/or PBG comprises administering to the subject a dsRNA, e.g., for inhibiting expression of ALAS 1, and wherein said dsRNA is administered at a dose of about 0.5, 1 , 1.5, 2, 2.5, or 5 mg/kg bodyweight of the subject once every four weeks or once every twelve weeks, e.g., for at least twenty-four weeks, thereby reducing the level of ALA and/or PBG in said subject.
  • a dsRNA e.g., for inhibiting expression of ALAS 1
  • said dsRNA is administered at a dose of about 0.5, 1 , 1.5, 2, 2.5, or 5 mg/kg bodyweight of the subject once every four weeks or once every twelve weeks, e.g., for at least twenty-four weeks, thereby reducing the level of ALA and/or PBG in said subject.
  • said dsRNA is administered at a dose of 0.5 to 1.5, 0.5 to 1 , 1 to 1.5, 1.5 to 2 mg/kg, 2 to 2,5 mg/kg, 2.5 to 3 mg kg, or 2.5 to 5 mg/kg, e.g., about 0.5, 1 , 1.5, 2, 2.5, 3, or 5 mg/kg, bodyweight of the subject once every four weeks or once every twelve weeks.
  • said dsRNA is administered at a dose of 0.5 to 2 mg/kg once every four weeks.
  • said dsRNA is administered at a dose of 0.5 to 2 mg/kg once every twelve weeks.
  • said dsRNA is administered at a dose of 2 to 3 mg/kg (e.g., 2.5 mg/kg) once every four weeks. In some embodiments, said dsRNA is administered at a dose of 2 to 3 mg/kg (e.g., 2.5 mg/kg) once every twelve weeks. In some embodiments, said dsRNA is administered at a dose of 4 to 6 mg/kg (e.g., 5 mg/kg) once every twelve weeks.
  • the dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALASl RNA transcript (e.g., SEQ ID NO: l), which antisense strand comprises at least 20 contiguous nucleotides from (i) an antisense sequence listed in any one of Tables 21 to 40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237), or (ii) an unmodified version of an antisense sequence listed in any one of Tables 21 to 40 of WO
  • a method of treating a human patient with AIP who has suffered from multiple recurrent attacks comprises administering a dsRNA, e.g., for inhibiting expression of ALASl, and wherein said dsRNA is administered at a dose of 0.02- 10 mg kg, e.g., 0.5 to 10 mg/kg, e.g., 0.5 to 5 mg/kg, 0.5 to 3 mg/kg, or 0.5 to 2 mg kg bodyweight of the patient once every four weeks or once every twelve weeks, e.g., for at least twenty-four weeks, thereby treating said patient.
  • a dsRNA e.g., for inhibiting expression of ALASl
  • said dsRNA is administered at a dose of 0.02- 10 mg kg, e.g., 0.5 to 10 mg/kg, e.g., 0.5 to 5 mg/kg, 0.5 to 3 mg/kg, or 0.5 to 2 mg kg bodyweight of the patient once every four weeks or once every twelve weeks, e.g., for
  • said dsRNA is administered at a dose of 0.5 to 1.5, 0.5 to 1 , 1 to
  • said dsRNA is administered at a dose of 0.5 to 2 mg/kg once every four weeks. In some embodiments, said dsRNA is administered at a dose of 0.5 to 2 mg kg once every twelve weeks. In some embodiments, said dsRNA is administered at a dose of 2 to 3 mg kg (e.g., 2.5 mg/kg) once every four weeks.
  • said dsRNA is administered at a dose of 2 to 3 mg/kg (e.g., 2.5 mg/kg) once every twelve weeks. In some embodiments, said dsRNA is administered at a dose of 4 to 6 mg/kg (e.g., 5 mg/kg) once every twelve weeks.
  • the dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALAS 1 RNA transcript (e.g.,
  • SEQ ID NO: l which antisense strand comprises at least 20 contiguous nucleotides from (i) an antisense sequence listed in any one of Tables 21 to 40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237), or (ii) an unmodified version of an antisense sequence listed in any one of Tables 21 to 40 of WO
  • said method reduces the frequency of attacks, (ii) reduces hematin use, (iii) reduces hospitalization, and/or (iv) improves quality of life.
  • a method of treating a subject having a porphyria (e.g., AIP) or an elevated level of ALA and/or PBG comprises subcutaneously administering to the subject a composition (e.g., a pharmaceutical composition) comprising a dsRNA, e.g., for inhibiting expression of ALAS 1, and wherein said composition is administered at a dsRNA dose of 0.02-10 mg/kg, e.g., 0.5 to 10 mg/kg, e.g., 0.5 to 5 mg/kg, 0.5 to 3 mg/kg, or 0.5 to 2 mg/kg bodyweight of the subject once every four weeks or once every twelve weeks, thereby treating the subject.
  • a composition e.g., a pharmaceutical composition
  • a dsRNA e.g., for inhibiting expression of ALAS 1
  • said composition is administered at a dsRNA dose of 0.02-10 mg/kg, e.g., 0.5 to 10 mg/kg, e.g., 0.5 to 5
  • the composition is administered at a dsRNA dose of 0.5 to 1.5, 0.5 to 1 , 1 to 1.5, 1.5 to 2, 2 to 2.5, or 2.5 to 5 mg/kg, e.g., about 0.5, 1 , 1.5, 2, 2.5, 3, or 5 mg/kg, bodyweight of the subject once every four weeks or once every twelve weeks.
  • the composition is administered at a dsRNA dose of 0.5 to 2 mg/kg once every four weeks.
  • the composition is administered at a dsRNA dose of 0.5 to 2 mg/kg once every twelve weeks.
  • the composition is administered at a dsRNA dose of 2 to 3 mg/kg (e.g., 2.5 mg/kg) once every four weeks.
  • the composition is administered at a dsRNA dose of 2 to 3 mg/kg (e.g., 2.5 mg/kg) once every twelve weeks, hi some embodiments, the composition is administered at a dsRNA dose of 4 to 6 mg kg (e.g., 5 mg/kg) once every twelve weeks.
  • said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALAS 1 RNA transcript (e.g., SEQ ID NO: l ), which antisense strand comprises at least 20 contiguous nucleotides from (i) an antisense sequence chosen from listed in any one of Tables 21 to 40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237), or (ii) an unmodified version of an antisense sequence listed in any one of Tables 21 to 40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237).
  • a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS l wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALAS l RNA transcript, which antisense strand comprises at least 15 (e.g., at least 16, 17, 18, 19, 20, 21 , 22, or 23) contiguous nucleotides differing by no more than 3, 2 or 1 nucleotides from the sequence of
  • the antisense strand comprises the sequence of UAAGAUGAGACACUCUUUCUGGU (SEQ ID NO: 4153) or UAAGAUGAGACACUCTUUCUGGU (SEQ ID NO: 4154).
  • the sense strand comprises the sequence of CAGAAAGAGUGUCUCAUCUUA (SEQ ID NO: 4155).
  • one or more nucleotides of the antisense strand and/or sense strand are modified as described herein.
  • the dsRNA comprises (i) an antisense strand that comprises, or consists of, the antisense sequence of AD-60489, AD-60519, or AD-61 193 and/or (ii) a sense strand that comprises, or consists of, the sense sequence of AD-60489, AD-60519, or AD-61193 (including one or more (e.g. , all) of the modifications of the antisense strand and/or antisense strand of AD-60489, AD-60519, or AD-61193).
  • the method comprises administering to a subject said dsRNA at a dose of 0.02-10 mg/kg, e.g., 0.5 to 10 mg kg, e.g., 0.5 to 5 mg kg, 0.5 to 3 mg/kg, or 0.5 to 2 mg kg bodyweight of the patient once every four weeks or once every twelve weeks, e.g., for at least twenty- four weeks, thereby treating said patient.
  • a dose of 0.02-10 mg/kg e.g., 0.5 to 10 mg kg, e.g., 0.5 to 5 mg kg, 0.5 to 3 mg/kg, or 0.5 to 2 mg kg bodyweight of the patient once every four weeks or once every twelve weeks, e.g., for at least twenty- four weeks, thereby treating said patient.
  • said dsRNA is administered at a dose of 0.5 to 1.5, 0.5 to 1 , 1 to 1.5, 1.5 to 2 mg/kg, 2 to 2.5 mg/kg, 2.5 to 3 mg/kg, or 2.5 to 5 mg/kg, e.g. , about 0.5, 1, 1.5, 2, 2.5, 3, or 5 mg/kg, bodyweight of the subject once every four weeks or once every twelve weeks.
  • said dsRNA is administered at a dose of 0.5 to 2 mg/kg once every four weeks.
  • said dsRNA is administered at a dose of 0.5 to 2 mg kg once every twelve weeks.
  • said dsRNA is administered at a dose of 2 to 3 mg kg (e.g., 2.5 mg/kg) once every four weeks. In some embodiments, said dsRNA is administered at a dose of 2 to 3 mg/kg (e.g., 2.5 mg/kg) once every twelve weeks. In some embodiments, said dsRNA is administered at a dose of 4 to 6 mg/kg (e.g., 5 mg/kg) once every twelve weeks.
  • a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS l comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALAS l RNA transcript, which antisense strand comprises at least 15 (e.g., at least 16, 17, 18, 19, 20, 21 , 22, or 23) contiguous nucleotides differing by no more than 3 (e.g., by no more than 0, 1 or 2) nucleotides from an antisense sequence listed in any one of Tables 21 to 40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237), or an unmodified version of an antisense sequence (e.g., a version having the same nucleotide sequence
  • the antisense sequence comprises at least 15 (e.g., at least 16, 17, 18, 19, 20, 21 , 22, or 23) contiguous nucleotides differing by no more than 3 (e.g., by no more than 0, 1 or 2) nucleotides from (i) the antisense sequence of AD- 60489, AD-60519, or AD-61 193 or (ii) an unmodified version of any one of these sequences.
  • the antisense strand comprises at least 15 (e.g., at least 16, 17, 18, 19, 20, 21 , 22, or 23) contiguous nucleotides differing by no more than 3 (e.g., by no more than 0, 1 or 2) nucleotides from the sequence of UAAGAUGAGACACUCUUUCUGGU (SEQ ID NO: 4153) or UAAGAUGAGACACUCTUUCUGGU (SEQ ID NO: 4154).
  • the antisense sequence targets positions 871 -893 of NM_000688.4 (SEQ ID NO: l).
  • the sense strand comprises the sequence of CAGAAAGAGUGUCUCAUCUUA (SEQ ID NO: 4155).
  • one or more nucleotides of the antisense strand and/or sense strand are modified as described herein.
  • the dsRNA is not a sense and/or antisense sequence listed in any one of Tables 2, 3, 6, 7, 8, 9, 14, 15, 18 or 20 of WO 2015/051318 and the Sequence Listing attached herewith.
  • a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS l comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALAS l RNA transcript, which antisense strand comprises at least 15 (e.g., at least 16, 17, 18, 19, 20, 21 , 22, or 23) contiguous nucleotides differing by no more than 3 nucleotides, no more than 2 nucleotides, or no more than one nucleotide, from the antisense sequence of AD-60519.
  • one or more nucleotides are modified as described herein.
  • a double- stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS l wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALAS l RNA transcript, which antisense strand comprises at least 15 (e.g. , at least 16, 17, 18, 19, 20, 21, 22, or 23) contiguous nucleotides differing by no more than 3 (e.g., by no more than 0, 1 or 2) nucleotides from the antisense sequence of AD-60489, or a derivative of AD-60489 as described herein.
  • dsRNA double- stranded ribonucleic acid
  • one or more nucleotides are modified as described herein, e.g., one or more (or all) nucleotides of AD-60489 are modified as described herein.
  • the derivative of AD-60489 is AD-60501, AD-60519, AD-60901 , AD-60495, AD-60900, AD-
  • the derivative of AD-60489 is AD-60519. In embodiments, the derivative of AD-60489 is AD-61 193.
  • a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS l comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALAS l RNA transcript, which antisense strand comprises at least 15 (e.g., at least 16, 17, 18, 19, 20, 21 , 22, or 23) contiguous nucleotides differing by no more than 3 (e.g., by no more than 0, 1 or 2) nucleotides from a derivative of AD-58632 described herein.
  • dsRNA double-stranded ribonucleic acid
  • one or more nucleotides are modified as described herein, e.g., one or more (or all) nucleotides of AD-58632 are modified as described herein.
  • the derivative of AD-58632 is AD-60405, AD-60887, AD-60923, AD-60434, AD-60892, AD-60419, AD-60924, AD-60445, AD-60925, and AD-60926, AD-60820, AD-60843, AD-60819, AD-61 140, AD-61141 , AD-61142, AD- 60835, AD-60839, AD-61 143, AD-61 144, AD-61 145, AD-61 146, AD-60892, or AD-60419.
  • the derivative of AD-58632 is AD-60819.
  • the dsRNA has an IC5 0 of less than InM. In some embodiments, the dsRNA has an IC 5 0 in the range of 0.01-lnM. In embodiments, the dsRNA has an IC5 of less than 0.05 nM. hi embodiments, the dsRNA has an IC50 of less than 0.02 nM. In
  • the dsRNA has an IC 5 0 of less than 0.01 nM.
  • the IC 5 0 is determined as described herein in the Examples.
  • the dsRNA has a single dose ED 5 of less than about 10 mg/kg. In some embodiments, the dsRNA has a single dose ED 5 0 of less than about 5 mg/kg. In embodiments, the EC 5 0 i determined as described herein in the Examples.
  • the dsRNA shows improved activity compared with AD-58632. In some embodiments, the dsRNA shows improved activity compared with AD-60489. In some embodiments, the dsRNA shows improved activity compared with AD-58632 and AD-60489.
  • the dsRNA is AD-60501, AD-60519, AD-60901, AD-60495, AD- 60900, AD-60935, AD-60879, AD-61 190, AD-61 191, AD-60865, AD-60861, AD-60876, AD- 61 193, AD-60519, AD-60519, AD-60901 , AD-60405, AD-60887. AD-60923.
  • the dsRNA comprises an antisense strand that comprises, or consists of, an antisense sequence (and/or one or more (e.g..
  • AD-60501 AD-60519, AD-60901 , AD- 60495, AD-60900, AD-60935, AD-60879, AD-61 190, AD-61 191, AD-60865, AD-60861 , AD- 60876, AD-61 193, AD-60519, AD-60519, AD-60901 , AD-60405. AD-60887.
  • the dsRNA comprises a sense strand that comprises, or consists of, a sense sequence (and/or one or more (e.g., all) of the modifications)) selected from AD-60501 , AD-60519, AD-60901 , AD-60495, AD-60900, AD-60935, AD-60879, AD-61 190, AD-61 191 , AD-60865, AD-60861 , AD-60876, AD-61193, AD-60519, AD-60519, AD-60901, AD-60405, AD-60887, AD-60923, AD-60434, AD-60892, AD-60419, AD-60924, AD-60445, AD-60925, AD-60926, AD-60820, AD-60843, AD-60819, AD-61 140, AD-61 141, AD-61 142, AD-60835, AD-60839, AD-61143, AD-61144, AD-61 145, AD-61 146, AD-60892, or AD-60419.
  • a sense sequence and/or one or more (e.g.,
  • a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS 1 comprises (i) an antisense strand that comprises, or consists of, the sequence of UAAGAUGAGACACUCUUUCUGGU (SEQ ID NO: 4153) or UAAGAUGAGACACUCTUUCUGGU (SEQ ID NO: 4154) and/or (ii) a sense strand that comprises, or consists of, the sequence of CAGAAAGAGUGUCUCAUCUUA (SEQ ID NO: 4155).
  • one or more nucleotides of the antisense strand and/or sense strand are modified as described herein.
  • a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS l comprises (i) an antisense strand that comprises, or consists of, the antisense sequence of AD-60489 and/or (ii) a sense strand that comprises, or consists of, the sense sequence of AD-60489 (wherein the sense and/or antisense sequence includes one or more (e.g., all) of the modifications of the sense strand and/or antisense strand of AD-60489).
  • a double -stranded ribonucleic acid (dsRNA) for inhibiting expression of ALASl comprises (i) an antisense strand that comprises, or consists of, the antisense sequence of AD-60519 and/or (ii) a sense strand that comprises, or consists of, the sense sequence of AD-60519 (wherein the sense and/or antisense sequence includes one or more (e.g., all) of the modifications of the sense strand and/or antisense strand of AD-60519).
  • a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS l comprises (i) an antisense strand that comprises, or consists of, the antisense sequence of AD-61 193 and/or (ii) a sense strand that comprises, or consists of, the sense sequence of AD-61 193 (wherein the sense and/or antisense sequence includes one or more (e.g., all) of the modifications of the sense strand and/or antisense strand of AD-61 193).
  • dsRNA double-stranded ribonucleic acid
  • ALAS l is provided, wherein the dsRNA comprises (i) an antisense strand that comprises, or consists of, the antisense sequence of AD-60819 and/or (ii) a sense sequence that comprises, or consists of, the sense sequence of AD-60819 (wherein the sense and/or antisense sequence includes one or more (e.g., all) of the modifications of the sense strand and/or antisense strand of AD-60819).
  • a dsRNA for inhibiting expression of ALAS 1 comprises (i) an antisense strand that comprises, or consists of, the antisense sequence of AD-60489, AD-60519, AD-61 193, or AD-60819 (or a corresponding unmodified antisense sequence) and/or (ii) a sense strand that comprises, or consists of, the sense sequence of AD- 60489, AD-60519, AD-61 193, or AD-60819 (or a corresponding unmodified antisense sequence).
  • the dsRNA comprises (i) an antisense strand that consists of the antisense sequence of AD-60489, AD-60519, AD-61 193, or AD-60819 and/or (ii) a sense strand that consists of the sense sequence of AD-60489, AD-60519, AD-61193, or AD-60819, except that the antisense strand and/or sense strand of the dsRNA differs by 1 , 2, or 3 nucleotides from the corresponding antisense and/or sense sequence of AD-60489, AD-60519, AD-61 193, or AD- 60819.
  • AD-60489, AD-60519, AD-61 193, and AD-60819 are shown in Table 2 below.
  • Table 2 Sequences and Modifications of AD-60489, AD-60519, AD-61193, AD-60819
  • a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS l comprises (i) an antisense strand that comprises, or consists of, the antisense sequence of AD-60489, AD-60519, or AD-61 193 and/or (ii) a sense strand that comprises, or consists of, the sense sequence of AD-60489, AD-60519, or AD-61 193 (including the nucleotide sequence and one or more (e.g., all) of the modifications of the sense strand and/or antisense strand of AD-60489, AD-60519, or AD-61193).
  • the dsRNA comprises (i) an antisense strand that comprises, or consists of, the antisense sequence of AD-60489, AD-60519, or AD-61 193 and/or (ii) a sense strand that comprises, or consists of, the sense sequence of AD-60489, AD-60519, or AD-61 193 (including the nucle
  • dsRNA double-stranded ribonucleic acid
  • ALAS l is provided, wherein the dsRNA is AD-60489, AD-60519, AD-61 193, or AD-60819.
  • a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALASl is provided, wherein the dsRNA is AD-60489, AD-60519, or AD-61 193 (e.g., including the nucleotide sequence and/or one or more (e.g., all) of the modifications of AD-60489, AD-60519, or AD-61 193).
  • the dsRNA is, comprises, or consists of, AD-60489 (e.g., including the nucleotide sequence and/or one or more (e.g., all) of the modifications of AD-60489).
  • the dsRNA is, comprises, or consists of, AD-60519 (e.g., including the nucleotide sequence and/or one or more (e.g., all) of the modifications of AD-60519).
  • the dsRNA is, comprises, or consists of, AD-61 193 (e.g., including the nucleotide sequence and/or one or more (e.g. , all) of the modifications of AD-61193).
  • the dsRNA is, comprises, or consists of, AD-60819 (e.g., including the nucleotide sequence and/or one or more (e.g., all) of the modifications of AD-60819).
  • the dsRNA (e.g., AD-60489, AD-60519, AD-61 193, AD-60819, or another dsRNA disclosed herein in any one of Tables 21 to 40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., comprising or consisting of a sense sequence corresponding to SEQ ID NO: 4149 and an antisense sequence corresponding to SEQ ID NO: 4150; a sense sequence corresponding to SEQ ID NO: 4151 and an antisense sequence corresponding to SEQ ID NO: 4152; or a sense sequence corresponding to SEQ ID NO: X and an antisense sequence corresponding to SEQ ID NO: X+l , where X is any of the even numbers between 4172 and 5236)) is effective to suppress the liver level of ALAS l mRNA, e.g., to achieve silencing of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, or 80% (e.g., such that ALAS l mRNA,
  • the dsRNA (e.g., AD-60489, AD-60519, AD-61 193, AD-60819, or another dsRNA disclosed herein in any one of Tables 21 to 40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., comprising or consisting of a sense sequence corresponding to SEQ ID NO: 4149 and an antisense sequence corresponding to SEQ ID NO: 4150; a sense sequence corresponding to SEQ ID NO: 4151 and an antisense sequence corresponding to SEQ ID NO: 4152; or a sense sequence corresponding to SEQ ID NO: X and an antisense sequence corresponding to SEQ ID NO: X+l, where X is any of the even numbers between 4172 and 5236)) is effective to suppress the circulating level of ALAS l mRNA, e.g., to achieve silencing of at least 10%, 20%, 30%, 40%, 50%, 60%.
  • ALAS l mRNA e.g., to achieve silencing of
  • the effectiveness of the dsRNA in suppressing the circulating level of ALASl mRNA is assessed using a non-human primate model, e.g., as described herein in the Examples.
  • the circulating level of ALASl mRNA is assessed using a circulating extracellular RNA detection (cERD) assay, e.g., as described herein or in Sehgal, A. et al. Quantitation of tissue-specific target gene modulation using circulating RNA (Poster presented on February 9, 2012 at the Keystone Gene Silencing by small RNAs symposium (Vancouver, February 7-12, 2012) or Sehgal, A. et al. Tissue-specific gene silencing monitored in circulating RNA, RNA, 20: 1-7, published online December 19, 2013, or Chan et al.
  • cERD circulating extracellular RNA detection
  • the cERD method can be applied to any appropriate biological sample.
  • the circulating level of ALASl mRNA is assessed using a blood sample, e.g., a serum sample.
  • the circulating level of ALAS l mRNA is assessed using a urine sample.
  • the dsRNA is a derivative of AD-60489 that is disclosed herein, e.g., in any one of the tables of WO 2015/051318.
  • the dsRNA shows improved activity compared with AD-60489.
  • the dsRNA is AD-60519.
  • the dsRNA is a derivative of AD-58632 that is disclosed herein, e.g., in any one of the tables of WO 2015/051318. In embodiments, the dsRNA shows improved activity compared with AD-58632.
  • improved activity is indicated by a lower IC 5 0, e-g., as determined based on in vitro assays, e.g., as described herein, e.g., in the Examples.
  • improved activity is indicated by a lower effective dose.
  • the effective dose may be determined based on the administration of a single dose or multiple repeated doses. In embodiments, the effective dose is determined based on the single dose ED5 0 . In
  • the effective dose or the single dose ED 5 0 is determined based on an in vivo assay .
  • the in vivo assay is conducted in a non-human animal, e.g., in a rat, in a non- human primate, or in a mouse.
  • the effective dose is determined based on the dose required to obtain a reduction of in a level of ALAS l mRNA (e.g., a liver level of ALASl mRNA and/or a circulating level of ALASl mRNA), e.g., as described herein in the Examples.
  • circulating mRNA is assessed using the cERD assay.
  • the effective dose is determined based on the dose required to obtain a reduction of a level (e.g., a urine and/or plasma level) of ALA and/or PBG.
  • the effective dose is determined based on the dose required to obtain a particular treatment effect described herein, e.g., prevention or reduction of symptoms associated with a porphyria.
  • improved activity is indicated by the achievement of a higher liver level of the dsRNA.
  • a higher liver level is obtained after a single dose of dsRNA ⁇ e.g., a dose of about 0.02, 0.035, 0.1 , 0.35, 0.5, 1, 1.5, 2, 2.5, 3, or 5 mg/kg, or a dose of 0.3 to 2.5, 0.5 to 2, 0.5 to 1.5, 0.5 to 1, 1 to 1.5, 1.5 to 2, 2 to 2.5, or 2.5 to 5 mg/kg).
  • a higher liver level is obtained after multiple doses of dsRNA have been administered (e.g., once every two weeks, once every four weeks, once a month, once every eight weeks, one two months, once every twelve weeks, once every three months, once every sixteen weeks, once every twenty weeks, or once every twenty-four weeks) at doses of 0.02, 0.035, 0.1, 0.35, 0.5, 1 , 1.5, 2, 2.5, 3, or 5 mg/kg, or 0.3 to 2.5, 0.5 to 2, 0.5 to 1.5, 0.5 to 1 , 1 to 1.5, 1.5 to 2, 2 to 2.5, or 2.5 to 5 mg/kg).
  • a higher liver level is obtained after said dsRNA is administered at a dose of 0.5 to 2 mg/kg once every four weeks.
  • a higher liver level is obtained after said dsRNA is administered at a dose of 0.5 to 2 mg/kg once every twelve weeks. In embodiments, a higher liver level is obtained after said dsRNA is administered at a dose of 2 to 3 mg/kg (e.g., 2.5 mg/kg) once every four weeks. In embodiments, a higher liver level is obtained after said dsRNA is administered at a dose of 2 to 3 mg kg (e.g., 2.5 mg/kg) once every twelve weeks. In embodiments, a higher liver level is obtained after said dsRNA is administered at a dose of 4 to 6 mg/kg (e.g., 5 mg/kg) once every twelve weeks. In
  • a higher liver level is obtained after said dsRNA is administered at a dose of 0.5 to 2 mg/kg once every month. In embodiments, a higher liver level is obtained after said dsRNA is administered at a dose of 0.5 to 2 mg/kg once every three months. In embodiments, a higher liver level is obtained after said dsRNA is administered at a dose of 2 to 3 mg/kg (e.g., 2.5 mg/kg) once every month. In embodiments, a higher liver level is obtained after said dsRNA is administered at a dose of 2 to 3 mg/kg (e.g., 2.5 mg kg) once every three months. In
  • the iRNA encompasses a dsRNA having an RNA strand (the antisense strand) having a region that is substantially complementary to a portion of an ALAS l mRNA, e.g., a human ALAS l mRNA (e.g., a human ALASl mRNA as provided in SEQ ID NO: l or SEQ ID NO:382).
  • an iRNA for inhibiting expression of an ALAS l gene includes at least two sequences that are complementary to each other.
  • the iRNA includes a sense strand having a first sequence and an antisense strand having a second sequence.
  • the antisense strand includes a nucleotide sequence that is substantially complementary to at least part of an mRNA encoding an ALAS l transcript, and the region of complementarity is 30 nucleotides or less, and at least 15 nucleotides in length.
  • the iRNA is 19 to 24 nucleotides in length.
  • the iRNA is 19-21 nucleotides in length. In some embodiments, the iRNA is 19-21 nucleotides in length and is in a lipid formulation, e.g. a lipid nanoparticle (LNP) formulation (e.g., an LNP1 1 formulation).
  • a lipid formulation e.g. a lipid nanoparticle (LNP) formulation (e.g., an LNP1 1 formulation).
  • the iRNA is 21-23 nucleotides in length. In some embodiments, the iRNA is 21-23 nucleotides in length and is in the form of a conjugate, e.g., conjugated to one or more GalNAc derivatives as described herein.
  • the iRNA is from about 15 to about 25 nucleotides in length, and in other embodiments the iRNA is from about 25 to about 30 nucleotides in length.
  • An iRNA targeting ALAS l upon contact with a cell expressing ALASl , inhibits the expression of an ALAS l gene by at least 10%, at least 20%, at least 25%, at least 30%, at least 35% or at least 40% or more, such as when assayed by a method as described herein.
  • the iRNA targeting ALAS l is formulated in a stable nucleic acid lipid particle (SNALP).
  • an iRNA e.g., a dsRNA
  • a first sequence of a dsRNA that is selected from the group consisting of the sense sequences of Tables 21 to 40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., an sense sequence corresponding to SEQ ID NO: 4149 or 4151 , or one of the even numbered sequences identified as SEQ ID NOs: 4172 to 5236) and a second sequence that is selected from the group consisting of the corresponding antisense sequences of Tables 21 to 40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237).
  • the iRNA molecules featured herein can include naturally occurring nucleotides or can include at least one modified nucleotide.
  • the at least one modified nucleotide include one or more of a modification on the nucleotide chosen from the group consisting of a locked nucleic acid (LNA), an acyclic nucleotide, a hexitol or hexose nucleic acid (HNA), a cyclohexene nucleic acid (CeNA), 2'-methoxyethyl, 2'-0-alkyl, 2'-0-ailyl, 2'-C- allyl, 2 ⁇ fluoro, 2'-deoxy, 2'-hydroxyl, or any combination thereof.
  • LNA locked nucleic acid
  • HNA hexitol or hexose nucleic acid
  • CeNA cyclohexene nucleic acid
  • the at least one modified nucleotide includes, but is not limited to a 2'-0-methyl modified nucleotide, 2'-fluoro modified nucleotide, a nucleotide having a 5'-phosphorothioate group, and a terminal nucleotide linked to a ligand, e.g., an N- acetylgalactosamine (GalNAc) or a cholesteryl derivative.
  • a ligand e.g., an N- acetylgalactosamine (GalNAc) or a cholesteryl derivative.
  • the modified nucleotide may be chosen from the group of: a 2'-deoxy-2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an acyclic nucleotide, an abasic nucleotide, 2'-amino-modified nucleotide, 2'-alkyl-modified nucleotide, morpholino nucleotide, a phosphoramidate, and a non-natural base comprising nucleotide.
  • Such a modified sequence can be based, e.g., on a first sequence of said iRNA selected from the group consisting of the sense sequences of disclosed in Tables 21-40 of WO 2015/051318 and the Sequence
  • an iRNA as described herein targets a wildtype ALAS 1 RNA transcript variant, and in another embodiment, the iRNA targets a mutant transcript (e.g., an ALAS l RNA carrying an allelic variant).
  • a mutant transcript e.g., an ALAS l RNA carrying an allelic variant.
  • an iRNA featured in the invention can target a polymorphic variant, such as a single nucleotide polymorphism (SNP), of ALAS 1 .
  • the iRNA targets both a wildtype and a mutant ALASl transcript.
  • the iRNA targets a particular transcript variant of ALAS l (e.g., human ALAS l variant 1).
  • the iRNA agent targets multiple transcript variants (e.g., both variant 1 and variant 2 of human ALAS l ).
  • an iRNA featured in the invention targets a non-coding region of an iRNA
  • an iRNA as described herein is in the form of a conjugate, e.g., a carbohydrate conjugate, which may serve as a targeting moiety and/or ligand, as described herein.
  • the conjugate is attached to the 3' end of the sense strand of the dsRNA.
  • the conjugate is attached via a linker, e.g., via a bivalent or trivalent branched linker.
  • the conjugate comprises one or more N-acetylgalactosamine (GalNAc) derivatives.
  • GalNAc N-acetylgalactosamine
  • the conjugate targets the R Ai agent to a particular cell, e.g., a liver cell, e.g., a hepatocyte.
  • the GalNAc derivatives can be attached via a linker, e.g., a bivalent or trivalent branched linker.
  • the conjugate is
  • the RNAi agent is attached to the carbohydrate conjugate via a linker, e.g., a linker as shown in the following schematic, wherein X is O or S
  • X is O. hi some embodiments, X is S.
  • the RNAi agent is conjugated to L96 as defined in Table 1 and shown below
  • the dsRNA has one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen or all of the following:
  • (i) is chemically synthesized, e.g., is synthesized by solid phase oligonucleotide synthesis
  • all the nucleotides in the dsRNA are modified, e.g., all the nucleotides are 2'-OMe or 2'-F modified, or a combination of 2'-OMe and 2' ⁇ F modified;
  • the sense strand comprises or consists of 21 nucleotides
  • the antisense sense strand comprises or consists of 23 nucleotides
  • (vii) has a 3'-overhang, e.g., has a two-nucleotide overhang, at the 3'-end of the antisense strand;
  • (viii) is covalently attached to a ligand containing three N-acetylgalactosamine (GalNAc) moieties;
  • the 3 " -end of the sense strand is conjugated to the triantennary GalNAc moiety (e.g., referred to herein as L96 as defined in Table 1 ).
  • the 3'-end is linked to the triantennary GalNAc moiety through a phosphodiester linkage;
  • (x) has an antisense strand that comprises one or more (e.g., four) phosphorothioate linkages, hi one embodiment, the phosphorothioate linkages are located at the 3' end and at the 5' end of the antisense strand. In one embodiment, two phosphorothioate linkages are located at the 3' end and two phosphorothioate linkages are located at the 5' end of the antisense strand;
  • (xi) has a sense strand that comprises one or more (e.g., two) phosphorothioate linkages.
  • the one or more (e.g., two) phosphorothioate linkages are located at the 5 ' end of the sense strand;
  • (xii) 21 nucleotides of the sense strand hybridize to the complementary 21 nucleotides of the antisense strand;
  • (xiii) forms 21 nucleotide base pairs and a two-base overhang at the 3'-end of the antisense strand;
  • (xiv) comprises, or consists of, a sense and antisense strand having the sequence of AD-
  • (xv) has a sense strand with 10, 12, 14, 16, 18, 19, 20 or all of the modifications of the sense strand of AD-60519;
  • the dsRNA is in the form of a conjugate having the following structure (also referred to herein as AD-60519 or ALN-60519) (SEQ ID NOs: 5238-5239, respectively, in order of appearance):
  • compositions e.g., a pharmaceutical composition, that includes one or more of the iRNAs described herein and a phamiaceuticaily acceptable carrier or delivery vehicle.
  • the composition is used for inhibiting the expression of an ALAS l gene in an organism, generally a human subject.
  • the composition is used for treating a porphyria, e.g., AIP.
  • an iRNA provided herein is a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALASl, wherein said dsRNA comprises a sense strand and a antisense strand 15-30 base pairs in length and the antisense strand is complementary to at least 15 contiguous nucleotides of SEQ ID NO: 1 or 382.
  • dsRNA double-stranded ribonucleic acid
  • an iRNA provided herein is a double stranded RNAi (dsRNA) comprising a sense strand complementaiy to an antisense strand, wherein said antisense strand comprises a region of complementarity to an ALASl RNA transcript, wherein each strand has about 14 to about 30 nucleotides, wherein said double stranded RNAi agent is represented by formula (III):
  • i, j, k, and 1 are each independently 0 or 1 ;
  • p, p', q, and q' are each independently 0-6;
  • each N a and N a ' independently represents an oligonucleotide sequence comprising 0-25 nucleotides which are either modified or unmodified or combinations thereof, each sequence comprising at least two differently modified nucleotides;
  • each N b and N b ' independently represents an oligonucleotide sequence comprising
  • nucleotides which are either modified or unmodified or combinations thereof;
  • each n p , n p ', n q , and n q ' independently represents an overhang nucleotide
  • XXX, YYY, ZZZ, ⁇ ' ⁇ ' ⁇ ', ⁇ ', and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides
  • the sense strand is conjugated to at least one ligand.
  • k is 1; 1 is 1 ; or both k and 1 are 1.
  • XXX is complementary to X'X'X'
  • YYY is complementary to ⁇ '
  • ZZZ is complementary to Z'Z'Z'.
  • the Y'Y'Y' motif occurs at the 11, 12 and 13 positions of the antisense strand from the 5 '-end.
  • the Y' is 2'-0-methyl.
  • the duplex region is 15-30 nucleotide pairs in length.
  • the duplex region is 17-23 nucleotide pairs in length. In embodiments, the duplex region is 19-21 nucleotide pairs in length.
  • the duplex region is 21-23 nucleotide pairs in length.
  • the modification on the nucleotide is selected from the group consisting of a locked nucleic acid (LNA), an acyclic nucleotide, a hexitol or hexose nucleic acid (HNA), a cyclohexene nucleic acid (CeNA), 2'-methoxyethyl, 2'-0 ⁇ alkyl, 2'-0 ⁇ allyl, 2' ⁇ C- allyl, 2'-fluoro, 2'-deoxy, 2'-hydroxyl, and any combination thereof.
  • LNA locked nucleic acid
  • HNA hexitol or hexose nucleic acid
  • CeNA cyclohexene nucleic acid
  • the modifications on the nucleotides are selected from the group consisting of LNA, HNA, CeNA, 2'-methoxyethyl, 2'-0-alkyl, 2'-0-allyl, 2'-C- allyl, 2'-fluoro, 2'-deoxy, 2'-hydroxyl, and combinations thereof.
  • the modifications on the nucleotides are 2'-0-methyl, 2'-fluoro or both.
  • the ligand comprises a carbohydrate.
  • the ligand is attached via a linker.
  • the linker is a bivalent or trivalent branched linker.
  • the ligand is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N
  • the ligand and linker are as shown in Formula XXIV:
  • the ligand is attached to the 3' end of the sense strand.
  • the dsRNA consists of or comprises a nucleotide sequence selected from the group of sequences provided in Tables 21-40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., an sense sequence corresponding to SEQ ID NO: 4149 or 4151, or one of the even numbered sequences identified as SEQ ID NOs: 4172 to 5236, and an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237).
  • a nucleotide sequence selected from the group of sequences provided in Tables 21-40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., an sense sequence corresponding to SEQ ID NO: 4149 or 4151, or one of the even numbered sequences identified as SEQ ID NOs: 4172 to 5236, and an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ
  • an iRNA provided herein is a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALASl, wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALAS l RNA transcript, which antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from one of the antisense sequences listed in any one of Tables 21- 40.
  • dsRNA double-stranded ribonucleic acid
  • the nucleotides of the antisense strand have fewer modifications, more modifications, or different modifications compared with the antisense sequences listed in any one of Tables 21-40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237).
  • the sense and antisense sequences are those of a duplex disclosed herein that suppresses ALAS 1 mRNA expression by at least 50%, 60%, 70%, 80%, 85% or 90%, e.g., as assessed using an assay disclosed in the Examples provided herein.
  • ALASl mRNA expression is assessed based on an ALAS l mRNA level in the liver, e.g., as assessed using a liver biopsy sample. In embodiments, ALASl mRNA expression is assessed based on an ALASl mRNA level in a biological fluid, e.g., blood, serum, plasma, cerebrospinal fluid, or urine. In embodiments, ALASl mRNA expression is assessed using a circulating extracellular RNA detection (cERD) assay, e.g., a cERD assay as described herein or in Sehgal, A. et al.
  • cERD circulating extracellular RNA detection
  • the dsRNA comprises at least one modified nucleotide.
  • At least one of the modified nucleotides is chosen from the group consisting of: a 2 -O-methyl modified nucleotide, a nucleotide comprising a 5'-phosphorothioate group, and a terminal nucleotide linked to a cholesteryl derivative or dodecanoic acid
  • the modified nucleotide is chosen from the group consisting of: a 2'-deoxy-2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an acyclic nucleotide, an abasic nucleotide, 2'-amino-modified nucleotide, 2'-alkyl-modified nucleotide, morpholino nucleotide, a phosphoramidate, and a non-natural base comprising nucleotide.
  • the region of complementarity is at least 17 nucleotides in length. In some embodiments, the region of complementarity is between 19 and 21 nucleotides in length. In some embodiments, the region of complementarity is 19 nucleotides in length. In some embodiments, each strand is no more than 30 nucleotides in length. In some embodiments, at least one strand comprises a 3' overhang of at least 1 nucleotide. In embodiments, the antisense strand comprises a 3' overhang of at least 1 nucleotide. In some embodiments, at least one strand comprises a 3' overhang of at least 2 nucleotides. In embodiments, the antisense strand comprises a 3' overhang.of at least 2 nucleotides. In embodiments, the antisense strand comprises a 3' overhang.of 2 nucleotides.
  • a dsRNA described herein further comprises a ligand.
  • the ligand is a GalNAc ligand.
  • the ligand targets the dsRNA to hepatocytes.
  • the ligand is conjugated to the 3' end of the sense strand of the dsRNA.
  • the region of complementarity consists of an antisense sequence selected from the antisense sequences listed in Tables 21-40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237), or a corresponding antisense sequence in which some or all of the nucleotides are unmodified.
  • the region of complementarity consists of the sequence UAAGAUGAGACACUCUUUCUGGU (SEQ ID NO: 4153) or
  • the region of complementarity consists of the antisense sequence of the duplex AD-60489. In some embodiments, the region of complementarity consists of the antisense sequence of the duplex AD-60519.
  • the region of complementarity consists of an antisense sequence selected from a duplex disclosed herein that suppresses ALAS 1 mRNA expression by at least 50%, 60%, 70%, 80%, 85% or 90%, e.g., as assessed using an assay disclosed in the Examples provided herein.
  • the dsRNA comprises a sense strand consisting of a sense strand sequence selected from Tables 21-40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g. , an sense sequence corresponding to SEQ ID NO: 4149 or 4151 , or one of the even numbered sequences identified as SEQ ID NOs: 4172 to 5236), and an antisense strand consisting of an antisense sequence selected from Tables 21-40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237).
  • the dsRNA comprises a pair of corresponding sense and antisense sequences selected from those of the duplexes disclosed in Tables 21-40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., a sense sequence corresponding to SEQ ID NO: 4149 and an antisense sequence corresponding to SEQ ID NO: 4150; a sense sequence corresponding to SEQ ID NO: 4151 and an antisense sequence corresponding to SEQ ID NO: 4152; or a sense sequence corresponding to SEQ ID NO: X and an antisense sequence corresponding to SEQ ID NO: X+l, where X is any of the even numbers between 4172 and 5236).
  • a sense sequence corresponding to SEQ ID NO: 4149 and an antisense sequence corresponding to SEQ ID NO: 4150 e.g., a sense sequence corresponding to SEQ ID NO: 4151 and an antisense sequence corresponding to SEQ ID NO: 4152; or a sense sequence corresponding to SEQ ID NO: X and an
  • the method comprises administering to a subject said dsRNA at a dose of 0.02-10 mg/kg, e.g. , 0.5 to 10 mg/kg, e.g., 0.5 to 5 mg/kg, 0.5 to 3 mg/kg, or 0.5 to 2 mg/kg bodyweight of the patient once every four weeks or once every twelve weeks, e.g., for at least twenty-four weeks, thereby treating said patient.
  • a dose of 0.02-10 mg/kg e.g. , 0.5 to 10 mg/kg, e.g., 0.5 to 5 mg/kg, 0.5 to 3 mg/kg, or 0.5 to 2 mg/kg bodyweight of the patient once every four weeks or once every twelve weeks, e.g., for at least twenty-four weeks, thereby treating said patient.
  • said dsRNA is administered at a dose of 0.5 to 1.5, 0.5 to 1, 1 to 1.5, 1.5 to 2 mg/kg, 2 to 2.5 mg/kg, 2.5 to 3 mg/kg, or 2.5 to 5 mg/kg, e.g., about 0.5, 1, 1.5, 2, 2.5, 3, or 5 mg/kg, bodyweight of the subject once every four weeks or once every twelve weeks.
  • said dsRNA is administered at a dose of 0.5 to 2 mg/kg once every four weeks.
  • said dsRNA is administered at a dose of 0.5 to 2 mg/kg once every twelve weeks.
  • said dsRNA is administered at a dose of 2 to 3 mg kg (e.g., 2.5 mg/kg) once every four weeks. In some embodiments, said dsRNA is administered at a dose of 2 to 3 mg/kg (e.g., 2.5 mg/kg) once every twelve weeks. In some embodiments, said dsRNA is administered at a dose of 4 to 6 mg kg (e.g., 5 mg/kg) once every twelve weeks.
  • the invention provides a cell containing at least one of the iRNAs (e.g., dsRNAs) featured herein.
  • the cell is generally a mammalian cell, such as a human cell.
  • the cell is an erythroid cell.
  • the cell is a liver cell (e.g., a hepatocyte).
  • compositions for inhibiting expression of an ALAS l gene comprising an iRNA (e.g., a dsRNA) described herein, e.g., for use in a method described herein.
  • an iRNA e.g., a dsRNA
  • the iRNA e.g., dsRNA
  • the unbuffered solution is saline or water, e.g., water for injection.
  • the pharmaceutical composition comprises AD-60519 and water for injection.
  • the composition comprises about 100 to 300 mg mL, e.g., 200 mg/mL, of AD-60519.
  • the composition has a pH of 6.0-7.5, e.g. , about 7.0.
  • the composition is for subcutaneous injection.
  • the composition is for subcutaneous injection.
  • composition is packaged in a container (e.g., a glass vial, e.g., a 2 mL glass vial,) at a volume of about 0.3 to 1 mL, e.g., 0.55 mL.
  • a container e.g., a glass vial, e.g., a 2 mL glass vial,
  • the pharmaceutical composition is packaged in a container (e.g., a glass vial, e.g., a 2 mL glass vial,) at a volume of about 0.3 to 1 mL, e.g., 0.55 mL.
  • a container e.g., a glass vial, e.g., a 2 mL glass vial,
  • the pharmaceutical composition is packaged in a container at a volume of about 0.3 to 1 mL, e.g., 0.55 mL.
  • the pharmaceutical composition is packaged in a container (e.g., a glass vial,
  • composition is ALN-AS 1 as described herein in the examples.
  • the iRNA e.g., dsRNA is administered with a buffer solution.
  • the buffer solution comprises acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof.
  • the buffer solution is phosphate buffered saline (PBS).
  • the iRNA e.g., dsRNA
  • the composition is administered intravenously.
  • the composition is administered subcutaneously.
  • a pharmaceutical composition comprises an iRNA (e.g., a dsRNA) described herein that comprises a ligand (e.g., a GalNAc ligand) that targets the iRNA (e.g., dsRNA) to hepatocytes.
  • a pharmaceutical composition comprises an iRNA (e.g., a dsRNA) described herein that comprises a ligand (e.g., a GalNAc ligand), and the pharmaceutical composition is administered subcutaneously.
  • the ligand targets the iRNA (e.g., dsRNA) to hepatocytes.
  • a pharmaceutical composition e.g., a composition described herein, includes a lipid formulation
  • the RNAi agent is in a LNP formulation, e.g., a MC3 formulation.
  • the LNP formulation targets the RNAi agent to a particular ceil, e.g., a liver cell, e.g., a hepatocyte.
  • the lipid formulation is a LNP1 1 formulation.
  • the composition is administered intravenously.
  • the pharmaceutical composition is formulated for administration according to a dosage regimen described herein, e.g., not more than once every four weeks, not more than once every three weeks, not more than once every two weeks, or not more than once every week.
  • the administration of the pharmaceutical composition can be maintained for a month or longer, e.g., one, two, three, or six months, or one year or longer.
  • a composition containing an iRNA featured in the invention is administered with a non-iRNA therapeutic agent, such as an agent known to treat a porphyria (e.g. , AW), or a symptom of a porphyria (e.g., pain).
  • a composition containing an iRNA featured in the invention e.g. , a dsRNA targeting AIP, is administered along with a non-iRNA therapeutic regimen, such as hemin or glucose (e.g., glucose infusion (e.g., IV glucose)).
  • an iRNA featured in the invention can be administered before, after, or concurrent with glucose, dextrose, or a similar treatment that serves to restore energy balance (e.g. , total parenteral nutrition).
  • An iRNA featured in the invention can also be administered before, after, or concurrent with the administration of a heme product (e.g., hemin, heme arginate, or heme albumin), and optionally also in combination with a glucose (e.g., IV glucose) or the like.
  • a heme product e.g., hemin, heme arginate, or heme albumin
  • a glucose e.g., IV glucose
  • glucose administered for the treatment of a porphyria is administered intravenously (IV).
  • IV glucose administration of glucose intravenously is referred to herein as "IV glucose.”
  • alternative embodiments in which glucose is administered by other means are also encompassed.
  • an ALAS1 iRNA is administered to a patient, and then the non- iRNA agent or therapeutic regimen (e.g., glucose and/or a heme product) is administered to the patient (or vice versa).
  • the non- iRNA agent or therapeutic regimen e.g., glucose and/or a heme product
  • an ALAS 1 iRNA and the non-iRNA therapeutic agent or therapeutic regimen are administered at the same time.
  • a method of inhibiting ALAS 1 expression in a cell comprising: (a) introducing into the cell an iRNA (e.g. a dsRNA) described herein and (b) maintaining the cell of step (a) for a time sufficient to obtain degradation of the mRNA transcript of an ALAS1 gene, thereby inhibiting expression of the ALASl gene in the cell.
  • an iRNA e.g. a dsRNA
  • a method for reducing or inhibiting the expression of an ALASl gene in a cell e.g., an erythroid cell or a liver cell, such as, e.g., a hepatocyte.
  • the method includes:
  • dsRNA double-stranded ribonucleic acid
  • the dsRNA has a sense strand having a first sequence and an antisense strand having a second sequence; the antisense strand has a region of complementarity that is substantially complementary to at least a part of an mRNA encoding ALASl, and where the region of complementarity is 30 nucleotides or less, i.e., 15-30 nucleotides in length, and generally 19-24 nucleotides in length, and where the dsRNA upon contact with a cell expressing ALASl, inhibits expression of an ALASl gene by at least 10%, e.g., at least 20%, at least 30%, at least 40% or more; and
  • step (b) maintaining the cell of step (a) for a time sufficient to obtain degradation of the mRNA transcript of the ALASl gene, thereby reducing or inhibiting expression of an ALASl gene in the cell.
  • the cell is treated ex vivo, in vitro, or in vivo.
  • the cell is a hepatocyte.
  • the cell is present in a subject in need of treatment, prevention and/or management of a disorder related to ALAS 1 expression.
  • the disorder is a porphyria.
  • the porphyria is acute intermittent porphyria or ALA-dehydratase deficiency porphyria.
  • the porphyria is a hepatic porphyria, e.g., a porphyria selected from acute intermittent porphyria (AIP) hereditary coproporphyria (HCP), variegate porphyria (VP), ALA deyhdratase deficiency porphyria (ADP), and hepatoerythropoietic porphyria.
  • AIP acute intermittent porphyria
  • HCP hereditary coproporphyria
  • VP variegate porphyria
  • ADP ALA deyhdratase deficiency porphyria
  • the porphyria is a homozygous dominant hepatic porphyria (e.g., homozygous dominant AIP, HCP, or VP) or hepatoerythropoietic porphyria.
  • the porphyria is a dual porphyria.
  • the expression of ALAS 1 is inhibited by at least 30%.
  • the iRNA e.g., dsRNA
  • the iRNA has an ⁇ 3 ⁇ 4 0 in the range of 0.01-lnM.
  • the cell e.g., the hepatocyte
  • the cell is a mammalian cell (e.g., a human, non-human primate, or rodent cell).
  • the cell is treated ex vivo, in vitro, or in vivo (e.g., the cell is present in a subject (e.g., a patient in need of treatment, prevention and/or management of a disorder related to ALAS 1 expression).
  • a subject e.g., a patient in need of treatment, prevention and/or management of a disorder related to ALAS 1 expression.
  • the subject is a mammal (e.g., a human) at risk, or diagnosed with a porphyria, e.g., X-linked sideroblastic anemia (XLSA), ALA deyhdratase deficiency porphyria (ADP or Doss porphyria), acute intermittent porphyria (AIP), congenital erythropoietic porphyria (CEP), prophyria cutanea tarda (PCT), hereditary coproporphyria (coproporphyria, or HCP), variegate porphyria (VP), erythropoietic protoporphyria (EPP), or transient erythroporphyria of infancy.
  • a porphyria e.g., X-linked sideroblastic anemia (XLSA), ALA deyhdratase deficiency porphyria (ADP or Doss por
  • the disorder is ALA deyhdratase deficiency porphyria (ADP) or ⁇ .
  • the porphyria is a hepatic porphyria, e.g., a porphyria selected from acute intermittent porphyria (AIP) hereditary coproporphyria (HCP), variegate porphyria (VP), ALA deyhdratase deficiency porphyria (ADP), and hepatoerythropoietic porphyria.
  • AIP acute intermittent porphyria
  • HCP hereditary coproporphyria
  • VP variegate porphyria
  • ADP ALA deyhdratase deficiency porphyria
  • the porphyria is a homozygous dominant hepatic porphyria (e.g., homozygous dominant AIP, HCP, or VP) or hepatoerythropoietic porphyria.
  • the porphyria is a dual porphyria.
  • the dsRNA introduced reduces or inhibits expression of an ALAS 1 gene in the cell.
  • the dsRNA introduced reduces or inhibits expression of an ALASl gene, or the level of one or more porphyrins or porphyrin precursors (e.g., ⁇ - aminolevulinic acid (ALA), porphopilinogen (PBG), hydroxymethylbilane (HMB),
  • ALA ⁇ - aminolevulinic acid
  • PBG porphopilinogen
  • HMB hydroxymethylbilane
  • protoporphyrin IX or porphyrin products or metabolites, by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% or more compared to a reference, (e.g., an untreated cell or a cell treated with a non-targeting control dsRNA).
  • a reference e.g., an untreated cell or a cell treated with a non-targeting control dsRNA.
  • ALASl is the first enzyme of the porphyrin pathway.
  • reducing expression of the ALASl gene is likely to reduce the level of one or more porphyrin precursors, porphyrins or porphyrin products or metabolites.
  • the invention provides methods for treating, preventing or managing pathological processes related to ALAS l expression (e.g., pathological processes involving porphyrins, porphyrin precuorsors, or defects in the porphyrin pathway, such as, for example, porphyrias).
  • the method includes administering to a subject, e.g., a patient in need of such treatment, prevention or management, an effective (e.g. , a therapeutically or prophylactically effective) amount of one or more of the iRNAs featured herein.
  • a method of treating and/or preventing a disorder related to ALASl expression comprising administering to a subject in need of such treatment a therapeutically effective amount of an iRNA (e.g., a dsRNA) described herein, or a composition comprising an iRNA (e.g., a dsRNA) described herein.
  • an iRNA e.g., a dsRNA
  • a composition comprising an iRNA (e.g., a dsRNA) described herein.
  • a method of treating and/or preventing a porphyria comprising administering to a subject in need of such treatment a double- stranded ribonucleic acid (dsRNA), wherein said dsRNA comprises a sense strand and an antisense strand 15-30 base pairs in length and the antisense strand is complementary to at least 15 contiguous nucleotides of SEQ JD NO: l or SEQ ID NO:382.
  • dsRNA double- stranded ribonucleic acid
  • subject e.g., the patient
  • the subject e.g., patient
  • administration of the iRNA targeting ALAS l alleviates or relieves the severity of at least one symptom of a disorder related to ALAS l in the patient.
  • the subject is a mammal (e.g., a human) at risk, or that has been diagnosed with, a disorder related to ALAS 1 expression, e.g., a porphyria, e.g., X-linked sideroblastic anemia (XLSA), ALA devhdratase deficiency porphyria (Doss porphyria), acute intermittent porphyria (AIP), congenital erythropoietic porphyria (CEP), prophyria cutanea tarda (PCT), hereditary coproporphyria (coproporphyria, or HCP), variegate porphyria (VP), erythropoietic protoporphyria (EPP), or transient erythroporphyria of infancy.
  • a porphyria e.g., X-linked sideroblastic anemia (XLSA), ALA devhdratase
  • the porphyria is an acute hepatic porphyria, e.g. , ALA deyhdratase deficiency porphyria (ADP), AIP, HCP, or VP.
  • the disorder is ALA deyhdratase deficiency porphyria (ADP) or AIP.
  • the subject has, or is at risk for developing, a porphyria.
  • the porphyria is a hepatic porphyria, e.g., a porphyria selected from acute intermittent porphyria (AIP) hereditary coproporphyria (HCP), variegate porphyria (VP), ALA deyhdratase deficiency porphyria (ADP), and hepatoerythropoietic porphyria.
  • AIP acute intermittent porphyria
  • HCP hereditary coproporphyria
  • VP variegate porphyria
  • ADP ALA deyhdratase deficiency porphyria
  • the porphyria is a homozygous dominant hepatic porphyria (e.g., homozygous dominant ⁇ , HCP, or VP) or hepatoerythropoietic porphyria.
  • the porphyria is a dual porphyria.
  • a porphyria, a symptom of porphyria, a prodrome, or an attack of porphyria is induced by exposure to a precipitating factor, as described herein.
  • the precipitating factor is a chemical exposure.
  • the precipitating factor is a drug, e.g., a prescription drug or an over the counter drug.
  • the precipitating factor is the menstrual cycle, e.g., a particular phase of the menstrual cycle, e.g., the luteal phase.
  • the iRNA (e.g., dsRNA) or composition comprising the iRNA is administered after an acute attack of porphyria. In embodiments, the iRNA (e.g., dsRNA) or composition comprising the iRNA is administered during an acute attack of porphyria. In embodiments, the iRNA (e.g., dsRNA) or composition comprising the iRNA is administered prophylactically to prevent an acute attack of porphyria.
  • the iRNA (e.g., dsRNA) is formulated as an LNP formulation.
  • the iRNA e.g., dsRNA
  • the iRNA is in the form of a GalNAc conjugate.
  • the iRNA (e.g., dsRNA) is administered at a dose of 0.02-10 mg/kg, e.g., 0.02-5 mg/kg or 0.02-3 mg/kg, e.g., about 0.02, 0.035, 0.1 , 0.35, 0.5, 1 , 1.5, 2, 2.5, 3, or 5 mg/kg, or 0.3-2.5, 0.5-1, 0.5-1.5, 1-1.5, 1-2.5, 1.5-2, 0.5-2, 2-2.5, or 2,5-5 mg/kg.
  • the iRNA (e.g., dsRNA) is administered once every two weeks, once every four weeks, once every eight weeks, once every twelve weeks, once every sixteen weeks, once every twenty weeks, or once every twenty-four weeks.
  • the iRNA (e.g., dsRNA) is administered once every month, once every two months, once every three months, once every four months, once every five months, or once every six months.
  • the iRNA e.g., dsRNA
  • the iRNA is administered at a concentration of
  • the iRNA e.g., dsRNA
  • the iRNA is administered once every four weeks, once every eight weeks, or once every tweleve weeks
  • the iRNA e.g., dsRNA
  • the iRNA is administered once every month, once every two months, or once every three months
  • the iRNA is administered at a concentration of 0.5 mg kg to 2 mg/kg bodyweight of the subject once every four weeks or once every twelve weeks.
  • the iRNA e.g., dsRNA
  • the iRNA is administered at a concentration of 0.5 mg/kg to 2 mg kg bodyweight of the subject once every month or once every three months.
  • the iRNA (e.g., dsRNA) is administered at a concentration of 2 to 3 mg/kg (e.g., 2,5 mg/kg) bodyweight of the subject, hi embodiments, the iRNA (e.g., dsRNA) is administered once every four weeks, once every eight weeks, or once every tweleve weeks. In embodiments, the iRNA (e.g., dsRNA) is administered once every month, once every two months, or once every three months. In embodiments, the iRNA (e.g., dsRNA) is administered at a concentration of 2 to 3 mg/kg (e.g., 2.5 mg kg) mg/kg bodyweight of the subject once every four weeks or once every twelve weeks. In embodiments, the iRNA (e.g., dsRNA) is administered at a concentration of 2 to 3 mg/kg (e.g., 2.5 mg kg) bodyweight of the subject once every month or once every three months.
  • the iRNA e.g., ds
  • the iRNA (e.g., dsRNA) is administered at a concentration of 4 to 6 mg/kg (e.g., 5 mg/kg) bodyweight of the subject.
  • the iRNA e.g., dsRNA
  • the iRNA is administered once every four weeks, once every eight weeks, or once every tweleve weeks.
  • the iRNA e.g., dsRNA
  • the iRNA is administered once every month, once every two months, or once every three months.
  • the iRNA (e.g., dsRNA) is administered at a concentration of 4 to 6 mg/kg (e.g., 5 mg kg) mg/kg bodyweight of the subject once every four weeks or once every twelve weeks.
  • the iRNA e.g., dsRNA
  • the iRNA (e.g., dsRNA) is formulated as an LNP formulation and is administered at a dose of 0.02-10 mg/kg, e.g., 0.02-5 mg/kg or 0.02-3 mg/kg, e.g., 0.02, 0.035, 0.1, 0.35, 0.5, 1.5, 2, 2.5, 3, or 5 mg/kg. or 0.3-2.5, 0.5-2, 2-2.5. or 2.5-5 mg/kg.
  • the iRNA e.g., dsRNA
  • the iRNA is administered once every two weeks, once every four weeks, once every eight weeks, once every twelve weeks, once every sixteen weeks, once every twenty weeks, or once every twenty-four weeks.
  • the iRNA (e.g., dsRNA) is administered once every month, once every two months, once every three months, once every four months, once every five months, or once every six months.
  • the iRNA (e.g., dsRNA) is in the form of a GalNAc conjugate and is administered at a dose of 0.02-10 mg kg, e.g., 0.02-5 mg kg or 0.02-3 mg kg, e.g., at a dose of 0.3-2.5, 0.5-1 , 0.5-1.5, 1-1.5, 1-2.5, 1.5-2, 0.5-2, 2-2,5, or 2.5-5 mg/kg.
  • the iRNA in the GalNAc conjugate is administered at a dose of 5 mg kg or less, e.g., 2.5 mg kg or less than 2.5 mg/kg (e.g., 2 mg/kg or less) e.g., once every four weeks, once every eight weeks, or once every twelve weeks, or once every month, once every two months, or once every three months; e.g., a dose of 1.5 mg/kg or less, 1 mg/kg or less, or 0.5 mg/kg or less, e.g., once every four weeks, once every eight weeks, once every twelve weeks, or once every month, once every two months, or once every three months.
  • a dose of 5 mg kg or less e.g., 2.5 mg kg or less than 2.5 mg/kg (e.g., 2 mg/kg or less) e.g., once every four weeks, once every eight weeks, or once every twelve weeks, or once every month, once every two months, or once every three months.
  • the iRNA in the GalNAc conjugate is administered at a dose of about 1 mg/kg or less, e.g., once every four weeks, once ever ⁇ ? eight weeks, or once every twelve weeks, or once every month, once every two months, or once every three months.
  • the iRNA in the GalNAc onjugate is administered at a dose of about 2 to 3 mg kg (e.g. , 2.5 mg/kg) once every four weeks, once every twelve weeks, once every month, or once every three months.
  • the iRNA in the GalNAc onjugate is administered at a dose of about 4 to 6 mg/kg (e.g., 5 mg kg) once every twelve weeks or once every three months.
  • the administration of the iRNA in the GalNAc conjugate is subcutaneous.
  • the iRNA (e.g., dsRNA) is in the form of a GalNAc conjugate and is administered, e.g., subcutaneously, at a dose of 0.5-2 mg/kg, e.g. 0.5-1.5, 0.5-1 mg kg, 1 to 1.5 mg kg, or 1.5-2 mg kg.
  • the iRNA is administered once every four weeks, once every eight weeks, or once every twelve months.
  • the iRNA is administered once every month, once every two months, or once every three months.
  • the iRNA (e.g., dsRNA) is in the form of a GalNAc conjugate and is administered, e.g.,
  • the iRNA (e.g., dsRNA) is in the form of a GalNAc conjugate and is administered, e.g., subcutaneously, at a dose of 4-6 mg/kg, e.g. 5 mg/kg, e.g., once every twelve weeks or once every three months.
  • the iRNA is administered as a composition comprising the iRNA and water for injection.
  • the iRNA is AD-60519.
  • the composition comprises the iRNA, e.g. , AD-60519, at a concentration of about 200 mg/mL.
  • the method decreases a level of a porphyrin or a porphyrin precursor in the subject.
  • the level is decreased by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%.
  • the level is decreased by at least 30%.
  • the porphyrin precursor is ⁇ -aminolevulinic acid (ALA) or porphopilinogen (PBG).
  • the iRNA e.g., dsRNA
  • the iRNA has an IC 5 in the range of 0.01-lnM.
  • an ALAS 1 related disorder e.g., a symptom associated with an ALAS 1 related disorder
  • (v) decreases incidence of acute attacks of symptoms associated with a porphyria in the subject when the subject is exposed to a precipitating factor (e.g., the premenstrual phase or the luteal phase).
  • a precipitating factor e.g., the premenstrual phase or the luteal phase.
  • the method ameliorates pain and/or progressive neuropathy.
  • the iRNA e.g., dsRNA
  • composition comprising the iRNA is administered according to a dosing regimen.
  • the iRNA (e.g., dsRNA) or composition comprising the iRNA is administered before or during an acute attack of porphyria. In some embodiments, the iRNA is administered before an acute attack of porphyria. In some embodiments, the iRNA (e.g., dsRNA) or composition comprising the iRNA is administered during a prodrome. In
  • the prodrome is characterized by abdominal pain, nausea, psychological symptoms (e.g., anxiety), restlessness and/or insomnia.
  • the iRNA e.g., dsRNA
  • composition comprising the iRNA is administered during a particular phase of the menstrual cycle, e.g., during the luteal phase.
  • the method ameliorates or prevents cyclical attacks of porphyria, e.g., by reducing the severity, duration, or frequency of attacks.
  • the cyclical attacks are associated with a precipitating factor.
  • the precipitating factor is the menstrual cycle, e.g., a particular phase of the menstrual cycle, e.g., the luteal phase.
  • the subject has an elevated level of ALA and/or PBG.
  • the level of ALA and/or PBG is elevated in plasma or urine from the subject.
  • the subject has or is at risk for developing a porphyria, e.g., a hepatic porphyria.
  • the subject is asymptomatic.
  • the subject carries a genetic alteration (e.g., a gene mutation) associated with a porphyria, as described herein.
  • a genetic alteration e.g., a gene mutation
  • the subject has or is at risk for developing a porphyria and suffers from pain (e.g., chronic pain, e.g., chronic neuropathic pain) and/or neuropathy (e.g., progressive neuropathy).
  • pain e.g., chronic pain, e.g., chronic neuropathic pain
  • neuropathy e.g., progressive neuropathy
  • the subject does not suffer from acute attacks but suffers from pain (e.g., chronic pain, e.g., chronic neuropathic pain) and/or neuropathy (e.g., progressive neuropathy).
  • the pain is abdominal pain.
  • the subject (a) has an elevated level of ALA and/or PBG and (b) suffers from pain (e.g., chronic pain, e.g., chronic neuropathic pain) and/or neuropathy (e.g., progressive neuropathy).
  • pain e.g., chronic pain, e.g., chronic neuropathic pain
  • neuropathy e.g., progressive neuropathy
  • the pain is abdominal pain.
  • the subject has a plasma level and/ or a urine level of ALA and/or PBG that is elevated.
  • the elevated level of ALA and/or PBG is accompanied by other symptoms, e.g., pain (e.g., chronic pain, e.g., chronic neuropathic pain) or neuropathy (e.g., progressive neuropathy).
  • the pain is abdominal pain, hi embodiments, the subject is asymptomatic.
  • the subject has a genetic mutation associated with a porphyria, e.g., a mutation as described herein.
  • the subject has a level (e.g., a plasma level or a urine level) of a porphyrin precursor, e.g., ALA and/or PBG, that is elevated, e.g., the level is greater than, or greater than or equal to, a reference value.
  • a reference value e.g., ALA and/or PBG
  • the level is greater than the reference value.
  • the reference value is two standard deviations above the mean level in a sample of healthy individuals.
  • the reference value is an upper reference limit.
  • the subject has a plasma level and/or a urine level of ALA and/or PBG that is greater than, or greater than or or equal to, 2 times, 3 times, 4 times, or 5 times that of an upper reference limit.
  • an ''upper reference limit refers to a level that is the upper limit of the 95% confidence interval for a reference sample, e.g., a sample of normal (e.g., wild type) or healthy individuals, e.g., individuals who do not carry a genetic mutation associated with a porphyria and/or individuals who do not suffer from a porphyria.
  • the subject has a urine level of ALA and/or PBG that is greater than 2 to 4 times that of an upper reference limit. In embodiments, the subject has a urine level of ALA and/or PBG that is greater than 4 times that of an upper reference limit.
  • the reference value for plasma PBG is 0.12 ⁇ /L.
  • the subject is a human and has a plasma PBG level that is greater than, or greater than or equal to, 0.12 ⁇ /L, 0.24 mol/L, 0.36 ⁇ /L, 0.48 ⁇ /L, or 0.60 ⁇ /L.
  • the subject is a human and has a plasma level of PBG that is greater than, or greater than or equal to, 0.48 ⁇ /L.
  • the reference value for urine PBG is 1.2 mmol/mol creatinine.
  • the subject is a human and has a urine PBG level that is greater than, or greater than or equal to, 1.2 mmol/mol creatinine, 2.4 mmol/mol creatinine, 3.6 mmol/mol creatinine, 4.8 mmol/mol creatinine, or 6.0 mmol mol creatinine.
  • the subject is a human and has a urine level of PBG that is greater than, or greater than or equal to, 4.8 mmol/mol creatinine.
  • the reference value for plasma ALA is 0.12 ⁇ L.
  • the subject is a human and has a plasma ALA level that is greater than, or greater than or equal to, 0.12 ⁇ /L, 0.24 ⁇ ⁇ /L, 0.36 ⁇ /L, 0.48 ⁇ /L, or 0.60 ⁇ /L.
  • the subject is a human and has a plasma ALA level that is greater than, or greater than or equal to 0.48 ⁇ /L.
  • the reference value for urine ALA is 3.1 mmol/mol creatinine.
  • the subject is a human and has a urine ALA level that is greater than, or greater than or equal to, 3.1 mmol/mol creatinine, 6.2 mmol/mol creatinine, 9.3 mmol/mol creatinine, 12.4 mmol/mol creatinine, or 15.5 mmol/mol creatinine.
  • the method decreases one or more signs or symptoms of a porphyria. In embodiments, the method decreases an elevated level of ALA and/or PBG. In embodiments, the method decreases pain (e.g., chronic pain, e.g. chronic neuropathic pain) and/or neuropathy (e.g., progressive neuropathy). In embodiments, the pain is abdominal pain. In embodiments, the pain is neuropathic pain (e.g., pain associated with the progressive neuropathy of acute porphyrias). The decrease in pain can include, e.g., prevention of pain, delay in the onset of pain, reduction in the frequency of pain, and/or reduction in severity of pain. In embodiments, the decrease in pain is assessed based on the subject's use of pain medication.
  • pain e.g., chronic pain, e.g. chronic neuropathic pain
  • neuropathy e.g., progressive neuropathy
  • the pain is abdominal pain.
  • the pain is neuropathic pain (e.g., pain associated with
  • the method ameliorates or prevents acute attacks of porphyria, e.g., by reducing the severity, duration, or frequency of attacks. In embodiments, the method decreases or prevents nerve damage.
  • the method prevents deterioration (e.g., prevents development of abnormalities) of or results in an improvement of clinical measures, e.g., clinical measures of muscle and/or nerve function, e.g., EMG and/or nerve conduction velocities.
  • clinical measures e.g., clinical measures of muscle and/or nerve function, e.g., EMG and/or nerve conduction velocities.
  • the method decreases heme use by the subject. In embodiments, the method decreases pain medication use by the subject. In embodiments, the method reduces hospitalization.
  • the method is effective to reduce a level of ALA and/or PBG (e.g., a plasma or urine level of ALA and/or PBG). In embodiments, the method is effective to produce a predetermined reduction in the elevated level of ALA and/or PBG.
  • a level of ALA and/or PBG e.g., a plasma or urine level of ALA and/or PBG.
  • the predetermined reduction is a reduction to a value that is less than or equal to a reference value.
  • the reference value is an upper reference limit.
  • the reference value is the value that is two standard deviations above the mean level in a reference sample.
  • the method is effective to reduce the level of ALA and/or PBG in a subject to a level that is below two times the upper reference limit. In embodiments, the method is effective to reduce the level of ALA to below two times the upper reference limit. In embodiments, the method is effective to reduce the level of PBG to below two times the upper reference limit.
  • the iRNA (e.g., dsRNA) or composition comprising the iRNA is administered as a single dose or at multiple doses, e.g., according to a dosing regimen. For example, the iRNA (e.g., dsRNA) or composition comprising the iRNA is administered once every four weeks, once every twelve weeks, once every month, once every three months.
  • the iRNA (e.g., dsRNA) or composition comprising the iRNA is administered prophylactically to a subject who is at risk for developing a porphyria.
  • the iRNA (e.g., dsRNA) or composition comprising the iRNA is administered prophylactically beginning at puberty.
  • the subject carries a genetic mutation associated with a porphyria and/or has an elevated level of ALA and/or PBG (e.g., an elevated plasma or urine level of ALA and/or PBG).
  • the mutation makes an individual susceptible to an acute attack (e.g., upon exposure to a precipitating factor, e.g., a drug, dieting or other precipitating factor, e.g., a precipitating factor as disclosed herein).
  • a precipitating factor e.g., a drug, dieting or other precipitating factor, e.g., a precipitating factor as disclosed herein.
  • the mutation is associated with elevated levels of a porphyrin or a porphyrin precursor (e.g., ALA and/or PBG).
  • the mutation is associated with chronic pain (e.g., chronic neuropathic pain) and/or neuropathy (e.g., progressive neuropathy).
  • the mutation is a mutation in the ALAS l gene. In embodiments, the mutation is a mutation in the ALASl gene promoter, or in regions upstream or downstream from the ALAS l gene. In embodiments, the mutation is a mutation in transcription factors or other genes that interact with ALAS l . In embodiments, the mutation is a mutation in a gene that encodes an enzyme in the heme biosynthetic pathway.
  • the iRNA e.g., dsRNA or a conjugate thereof
  • composition comprising the iRNA is administered subcutaneousiy.
  • the iRNA is in the form of a GalNAc conjugate.
  • the iRNA e.g., the dsRNA
  • the iRNA is administered at a dose of 0.02-10 mg/kg, e.g., 0.02-5 mg/kg or 0.02-3 mg/kg, e.g., at a dose of 0.3-2.5, 0.5-2, 0.5-1.5, 0.5- 1, 1-1.5, 1-2.5, 2.5-5, or 1.5-2 mg/kg.
  • the iRNA is administered at a dose of 5 mg kg or less, e.g., 2.5 mg/kg or less than 2.5 mg/kg (e.g., 2 mg/kg or less) once every four weeks, once every eight weeks, or once every twelve weeks, or once every month, once every two months, or once every three months; e.g., a dose of 1.5 mg/kg or less, 1 mg kg or less, or 0.5 mg kg or less, e.g., once every four weeks, once every eight weeks, or once every twelve weeks, or once every month, once every two months, or once every three months.
  • a dose of 5 mg kg or less e.g., 2.5 mg/kg or less than 2.5 mg/kg (e.g., 2 mg/kg or less) once every four weeks, once every eight weeks, or once every twelve weeks, or once every month, once every two months, or once every three months.
  • the iRNA is administered at a dose of about 1 mg/kg or less, e.g., once every four weeks, once every eight weeks, or once every twelve weeks, or once every month, once every two months, or once every three months.
  • the iRNA is administered is administered at a dose of 0.5 to 2 mg/kg once every four weeks.
  • the iRNA is administered at a dose of 0.5 to 2 mg kg once every twelve weeks.
  • the iRNA is administered at a dose of 2 to 3 mg/kg (e.g., 2.5 mg kg) once every four weeks.
  • the iRNA is administered at a dose of 2 to 3 mg/kg (e.g., 2.5 mg/kg) once every twelve weeks.
  • the iRNA is administered at a dose of 4 to 6 mg/kg (e.g., 5 mg/kg) once every twelve weeks. In embodiments, the iRNA is administered at a dose of 0.5 to 2 mg/kg once every month. In embodiments, the iRNA is administered at a dose of 0.5 to 2 mg/kg once every three months. In embodiments, the iRNA is administered at a dose of 2 to 3 mg/kg (e.g., 2.5 mg/kg) once every month. In embodiments, the iRNA is administered at a dose of 2 to 3 mg/kg (e.g., 2.5 mg/kg) once every three months. In embodiments, the iRNA is administered at a dose of 4 to 6 mg/kg (e.g., 5 mg/kg) once every three months.
  • 4 to 6 mg/kg e.g., 5 mg/kg
  • the subject to be treated is asymptomatic and has an elevated level of ALA and/or PBG.
  • the subject has a porphyria, e.g., AIP.
  • the patient suffers from recurrent porphyric attacks.
  • the iRNA (e.g., AD-60519) is administered at a dose of less than 10 mg/kg, e.g., less than 6 mg/kg or 3 mg/kg, e.g., at about 0.02, 0.035, 0.1 , 0.35, 0.5, 1 , 1.5, 2, 2.5, 3, or 5 mg/kg, or at a dose of 0.3-2.5, 0.5-2, 0.5-1.5, 0.5-1, 1-1.5, 1 -2.5. 2.5-5, or 1.5-2 mg/kg.
  • the iRNA (e.g., AD-60519) is administered in repeated doses, e.g., once every four weeks, once every eight weeks, or once every twelve weeks, or once every month, once every two months, or once every three months.
  • the subject is asymptomatic and has an elevated level of ALA and/or PBG, and the iRNA (e.g., AD-60519) is administered at single doses, e.g., at about 0.02, 0.035, 0.1 , 0.35, 0.5, 1, 1.5, 2, 2.5, 3, or 5 mg/kg, or at a dose of 0.3-2.5, 0.5-2, 0.5-1.5, 0.5-1, 1-1.5, 1- 2.5, 2.5-5, or 1.5-2 mg/kg; or in repeatedly once every four weeks, once every eight weeks, or once every twelve weeks, or once every month, once every two months, or once every three months, e.g., of 0.5 and 2 mg/kg for several months (e.g., for 3, 6, 9, 12, 18, 24, 36, 48, or more months).
  • the iRNA e.g., AD-60519
  • the iRNA (e.g., AD-60519) is administered once every four weeks, once every twelve weeks, once every month, or once every three months.
  • the subject has AIP, e.g., is an A i P patient, the iRNA (e.g., AD- 60519) is administered at a dose of 0.02- 10 mg/kg, e.g., 0.02-5 mg/kg or 0.02-3 mg/kg, e.g., 0.3- 2.5, 0.5-2, 0.5-1.5, 0.5-1 , 1-1.5, 1.5-2, 2-2.5, or 2.5-5 mg kg, once every four weeks, once every eight weeks, or once every twelve weeks, or once every month, once every two months, or once every three months.
  • the iRNA (e.g., AD-60519) is administered is administered at a dose of 0.5 to 2 mg/kg once every four weeks. In embodiments, the iRNA (e.g., AD-60519) is administered at a dose of 0.5 to 2 mg/kg once every twelve weeks. In embodiments, the iRNA (e.g., AD-60519) is administered at a dose of 2 to 3 mg/kg (e.g., 2.5 mg/kg) once every four weeks. In embodiments, the iRNA (e.g., AD-60519) is administered at a dose of 2 to 3 mg/kg (e.g., 2.5 mg/kg) once every twelve weeks. In embodiments, the iRNA (e.g., AD-60519) is administered at a dose of 4 to 6 mg/kg (e.g., 5 mg/kg) once every twelve weeks. In
  • the iRNA (e.g., AD-60519) is administered at a dose of 0.5 to 2 mg/kg once every month. In embodiments, the iRNA (e.g. , AD-60519) is administered at a dose of 0.5 to 2 mg/kg once every three months. In embodiments, the iRNA (e.g., AD-60519) is administered at a dose of 2 to 3 mg/kg (e.g., 2.5 mg/kg) once every month. In embodiments, the iRNA (e.g., AD- 60519) is administered at a dose of 2 to 3 mg/kg (e.g., 2.5 mg/kg) once every three months.
  • the iRNA (e.g., AD-60519) is administered at a dose of 4 to 6 mg/kg (e.g. , 5 mg kg) once every three months.
  • a treatment regimen is employed in which the iRNA is initially administered more frequently, followed by less frequent administration.
  • the iRNA is initially administered once per day for multiple days (e.g., for 2-14 days, e.g., for 2, 3, 4, 5, 6, or 7 days).
  • the iRNA is subsequently administered once per week.
  • the iRNA is subsequently administered once every two weeks.
  • the iRNA is subsequently administered once every two weeks.
  • the iRNA is subsequently administered once every four weeks. In embodiments, the iRNA is subsequently administered once every eight weeks. In embodiments, the iRNA is subsequently administered once every twelve weeks. In embodiments, the iRNA is subsequently administered once every sixteen weeks. In embodiments, the iRNA is subsequently administered once every twenty weeks, hi embodiments, the iRNA is subsequently administered once every twenty-four weeks. In embodiments, the iRNA is subsequently administered once every month. In embodiments, the iRNA is subsequently administered once every two months, hi embodiments, the iRNA is subsequently administered once every three months. In embodiments, the iRNA is subsequently administered once every four months. In embodiments, the iRNA is subsequently administered once every five months. In embodiments, the iRNA is subsequently administered once every six months. In embodiments, the iRNA is subsequently administered at a frequency that is effecti e to reduce one or more signs or symptoms of a porphyria.
  • a method of treating a subject with an elevated level of ALA and/or PBG comprising administering to the subject a double-stranded ribonucleic acid (dsRNA), wherein said dsRNA comprises a sense strand and an antisense strand 15-30 base pairs in length and the antisense strand is complementary to at least 15 contiguous nucleotides of SEQ ID NO: l or SEQ ID NO:382.
  • dsRNA double-stranded ribonucleic acid
  • a method of treating a subject with an elevated level of ALA and/or PBG comprising administering to the subject a therapeutically effective amount of a dsRNA or a composition comprising a dsRNA, as described herein.
  • the methods described herein are effective to decrease the level of ALA and/or PBG.
  • the level of ALA and/or PBG is decreased such that it is less than, or less than or equal to, a reference value, e.g., an upper reference limit.
  • the subject to be treated is asymptomatic and has an elevated level of ALA and/or PBG.
  • the subject has a porphyria, e.g., AIP.
  • the iRNA is administered at a dose of less than 10 mg/kg, e.g., less than 6 mg kg or 3 mg/kg, e.g., at about 0.02. 0.035, 0.1 , 0.35, 0.5, 1 , 1.5, 2, 2.5, 3, or 5 mg/kg, or at a dose of 0.3-2,5, 0.5-2, 0.5-1.5, 0.5-1, 1 -1.5, 1-2.5, 2.5-5, or 1.5-2 mg/kg.
  • the iRNA is administered in repeated doses, e.g., once every four weeks, once every eight weeks, once every twelve months, once every sixteen weeks, once every twenty months, or once every twenty- four months.
  • the iRNA is administered in repeated doses, e.g., , once every month, once every two months, once every three months, once every four months, once every five months, or once every six months.
  • the invention provides methods for decreasing a level of a porphyrin or a porphyrin precursor in a cell (e.g., an erythroid cell or a liver cell, such as, e.g., a hepatocyte).
  • a cell e.g., an erythroid cell or a liver cell, such as, e.g., a hepatocyte.
  • the cell is treated ex vivo, in vitro, or in vivo (e.g., the cell is present in a subject (e.g., a patient in need of treatment, prevention and/or management of a disorder related to ALAS l expression).
  • the method includes contacting the cell with an effective amount of one or more of the iRNAs targeting ALASl, e.g., one or more of the iRNAs disclosed herein, thereby decreasing the level of a porphyrin or a porphyrin precursor in the cell; or decreasing the level of a porphyrin or a porphyrin precursor in other cells, tissues, or fluids within a subject in which the cell is located; relative to the level prior to contacting.
  • Such methods can be used to treat (e.g., ameliorate the severity) of disorders related to ALASl expression, such as porphyrias, e.g., ⁇ or ALA dehydratase deficiency porphyria.
  • the contacting step is effected ex vivo, in vitro, or in vivo.
  • the cell can be present in a subject, e.g., a mammal (e.g., a human) at risk, or that has been diagnosed with, a porphyria.
  • the porphyria is an acute hepatic porphyria.
  • the porphyria is a hepatic porphyria, e.g., a porphyria selected from acute intermittent porphyria (AIP), hereditary coproporphyria (HCP), variegate porphyria (VP), ALA deyhdratase deficiency porphyria (ADP), and hepatoerythropoietic porphyria.
  • AIP acute intermittent porphyria
  • HCP hereditary coproporphyria
  • VP variegate porphyria
  • ADP ALA deyhdratase deficiency porphyria
  • the porphyria is a homozygous dominant hepatic porphyria (e.g., homozygous dominant ⁇ , HCP, or VP) or hepatoerythropoietic porphyria.
  • the porphyria is a dual porphyria.
  • a method for decreasing a level of a porphyrin or a porphyrin precursor (e.g., ALA or PBG) in a cell comprising contacting the cell with an iRNA (e.g., a dsRNA), as described herein, in an amount effective to decrease the level of the porphyrin or the porphyrin precursor in the cell.
  • an iRNA e.g., a dsRNA
  • the cell is a hepatocyte.
  • the porphyrin or porphyrin precursor is ⁇ - aminolevulinic acid (ALA), porphopilinogen (PBG), hydroxymethylbilane (HMB), uroporphyrinogen I or ⁇ , coproporphyrinogen I or III, protoporphrinogen IX, or protoporphyrin IX.
  • the porphyrin precursor is ALA or PBG.
  • the cell is an erythroid cell. In a further embodiment, the cell is a liver cell (e.g., a hepatocyte).
  • a vector encoding at least one strand of an iRNA (e.g., a dsRNA) as described herein.
  • an iRNA e.g., a dsRNA
  • a vector encoding at least one strand of a dsRNA, wherein said dsRNA comprises a region of complementarity to at least a part of an mRNA encoding ALAS l , wherein said dsRNA is 30 base pairs or less in length, and wherein said dsR A targets said mRNA for cleavage.
  • the region of complementarity is at least 15 nucleotides in length. In embodiments, the region of complementarity is 19 to 21 nucleotides in length.
  • the invention provides a vector for inhibiting the expression of an ALASl gene in a cell.
  • the vector comprises an iRNA as described herein.
  • the vector includes at least one regulatory sequence operably linked to a nucleotide sequence that encodes at least one strand of an iRNA as described herein.
  • the vector comprises at least one strand of an ALAS 1 iRNA.
  • a cell comprising a vector as described herein.
  • a cell containing a vector for inhibiting the expression of an ALAS l gene in a cell.
  • the vector includes a regulatory sequence operably linked to a nucleotide sequence that encodes at least one strand of one of the iRNAs as described herein.
  • the cell is a liver ceil (e.g., a hepatocyte).
  • the cell is an erythroid cell.
  • a method for assaying the level of circulating extracellular
  • ALAS l mRNA in a subject comprising detecting (e.g. , measuring) the level of
  • ALAS l mRNA in a biological fluid sample e.g. , a blood sample (e.g., a serum or plasma
  • ALASl mRNA a biological fluid sample comprising the ALASl mRNA, thereby assaying the level of circulating extracellular ALASl mRNA in the subject.
  • RNA e.g., extracellular
  • RNA from a biological fluid sample (e.g. , blood or plasma sample) from the subject, said
  • a biological fluid sample comprising the ALAS l mRNA; (ii) obtaining an ALASl cDNA from the ALAS l mRNA; (iii) contacting the ALAS l cDNA with a nucleic acid complementary (e.g., probe and/or primer) to the ALASl cDNA or a portion thereof, thereby producing a reaction
  • a nucleic acid complementary e.g., probe and/or primer
  • said biological fluid sample is a blood sample.
  • said biological fluid sample is a serum sample.
  • said biological fluid sample is a urine sample.
  • the method comprises PCR, qPCR or 5 '-RACE.
  • said nucleic acid is a probe or primer.
  • said nucleic acid comprises a detectable moiety and the level of ALAS 1 mRNA is detemiined by detection of the amount of the detectable moiety.
  • said method further comprises obtaining the biological fluid sample from the subject.
  • the biological fluid sample is separate from the tissue and contains exosomes.
  • the efficacy of a porphyria treatment is assessed based on a comparison of the level of circulating extracellular ALASl mRNA in the subject relative to a reference value.
  • a decrease in the level of circulating extracellular ALAS 1 mRNA in the subject in response to the porphyria treatment, relative to the reference value, indicates that the porphyria treatment is efficacious.
  • the reference value is the level of circulating extracellular ALASl mRNA in the subject prior to the porphyria treatment.
  • FIG. 1 is a graph that shows percentages of ALASl mRNA levels in ASHE patients compared to normal healthy volunteers.
  • FIG. 2A is a graph that shows mean (SEM) % changes in ALASl mRNA levels from baseline in patients treated with placebo, or 0.035 mg/kg, 0.1 mg/kg, or 0.35 mg/kg ALN-AS 1.
  • FIG. 2B is a graph that shows mean (SEM) % changes in serum ALASl mRNA levels from baseline in patients treated with placebo, or 0.035 mg/kg, 0.1 mg/kg, 0.35 mg/kg, 1.0 mg kg, or 2.5 mg/kg ALN-AS 1.
  • FIG. 2C is a graph that shows mean (SEM) % changes in urinary ALASl mRNA levels from baseline in patients treated with placebo, or 0.035 mg/kg, 0.1 mg/kg, 0.35 mg/kg, 1.0 mg kg, or 2.5 mg/kg ALN-ASl .
  • FIG. 3A is a graph that shows mean (SEM) % changes in ALA levels from baseline in patients treated with placebo, or 0.035 mg kg, 0.1 mg/kg, 0.35 mg kg, or 1.0 mg kg ALN-AS 1.
  • FIG. 3B is a graph that shows mean (SEM) % changes in ALA levels from baseline in patients treated with placebo, or 0.035 mg/kg, 0.1 mg/kg, 0.35 mg/kg, 1.0 mg/kg, or 2.5 mg/kg ALN-ASl.
  • FIG. 4A is a graph that shows mean (SEM) % changes in PBG levels from baseline in patients treated with placebo, or 0.035 mg/kg, 0.1 mg/kg, 0.35 mg/kg, or 1.0 mg/kg ALN-AS 1.
  • FIG. 4B is a graph that shows mean (SEM) % changes in PBG levels from baseline in patients treated with placebo, or 0.035 mg/kg, 0.1 mg/kg, 0.35 mg/kg, 1.0 mg kg, or 2.5 mg kg ALN-ASl.
  • FIG. 5A is a graph that shows the correlation between % changes in liver ALASl mRNA levels from baseline and % changes in urine ALA levels from baseline in patients treated with placebo, or 0.035 mg kg, 0.1 mg/kg, or 0.35 mg/kg ALN-ASl.
  • FIG. 5B is a graph that shows the correlation between % changes in liver ALASl mRNA levels from baseline and % changes in urine ALA levels from baseline in patients treated with placebo, or 0.035 mg kg, 0.1 mg kg, 0.35 mg kg, 1.0 mg kg, or 2.5 mg/kg ALN-ASl .
  • FIG. 6A is a graph that shows the correlation between % changes in liver ALAS 1 mRNA levels from baseline and % changes in urine PBG levels from baseline in patients treated with placebo, or 0.035 mg/kg, 0.1 mg/kg, or 0.35 mg/kg ALN-ASl.
  • FIG. 6B is a graph that shows the correlation between % changes in liver ALASl mRNA levels from baseline and % changes in urine PBG levels from baseline in patients treated with placebo, or 0.035 mg kg, 0.1 mg/kg, 0.35 mg kg, 1.0 mg/kg, or 2.5 mg/kg ALN-AS 1.
  • FIG. 7 is a graph that shows mean (SEM) % changes in serum ALASl mRNA levels from baseline in patients treated with multiple (2) doses of placebo, or 0.35 mg/kg or 1.0 mg/kg ALN-ASl .
  • FIG. 8 is a graph that shows mean (SEM) % changes in ALA levels from baseline in patients treated with multiple (2) doses of placebo, or 0.35 mg kg or 1.0 mg/kg ALN-ASl .
  • FIG. 9 is a graph that shows mean (SEM) % changes in PBG levels from baseline in patients treated with with multiple (2) doses of placebo, or 0.35 mg/kg or 1.0 mg kg ALN-AS 1.
  • compositions and Methods for Inhibiting Expression of the ALAS l Gene are incorporated by reference herein in their entirety.
  • iRNA directs the sequence-specific degradation of mRNA through a process known as RNA interference (RNAi). Described herein are iRNAs and methods of using them for inhibiting the expression of an ALAS 1 gene in a cell or a mammal where the iRNA targets an ALAS 1 gene.
  • RNAi RNA interference
  • compositions and methods for disorders related to ALAS 1 expression such as porphyrias (e.g., ALA deyhdratase deficiency porphyria (ADP or Doss porphyria), acute intermittent porphyria, congenital erythropoietic porphyria, prophyria cutanea tarda, hereditary coproporphyria (coproporphyria), variegate porphyria, erythropoietic protoporphyria (EPP), X-linked sideroblastic anemia (XLS A), and transient
  • Porphyrias are inherited or acquired disorders that can be caused by decreased or enhanced activity of specific enzymes in the heme biosynthetic pathway, also referred to herein as the porphyrin pathway (See FIG. 1 of WO 2015/051318). Porphyrins are the main precursors of heme. Porphyrins and porphyrin precursors include ⁇ -aminolevulinic acid (ALA), porphopilinogen (PBG), hydroxymethylbilane (HMB), uroporphyrinogen I or III,
  • ALA ⁇ -aminolevulinic acid
  • PBG porphopilinogen
  • HMB hydroxymethylbilane
  • uroporphyrinogen I or III include ⁇ -aminolevulinic acid (ALA), porphopilinogen (PBG), hydroxymethylbilane (HMB), uroporphyrinogen I or III,
  • Heme is an essential part of hemoglobin, myoglobin, catalases, peroxidases, and cytochromes, the latter including the respiratory and P450 liver cytochromes. Heme is synthesized in most or all human cells. About 85% of heme is made in erythroid cells, primarily for hemoglobin. Most of the remaining heme is made in the liver, 80% of which is used for the synthesis of cytochromes. Deficiency of specific enzymes in the porphyrin pathway leads to insufficient heme production and also to an accumulation of porphyrin precursors and/or porphyrins, which can be toxic to cell or organ function in high concentrations.
  • Porphyrias may manifest with neurological complications ("acute"), skin problems
  • Porphyrias may be classified by the primary site of the overproduction and accumulation of porphyrins or their precursors. In hepatic porphyrias, porphyrins and porphyrin precursors are overproduced predominantly in the liver, whereas in erythropoietic porphyrias, porphyrins are overproduced in the erythroid cells in the bone.
  • the acute or hepatic porphyrias lead to dysfunction of the nervous system and neurologic manifestations that can affect both the central and peripheral nervous system, resulting in symptoms such as, for example, pain (e.g., abdominal pain and/or chronic neuropathic pain), vomiting, neuropathy (e.g., acute neuropathy, progressive neuropathy), muscle weakness, seizures, mental disturbances (e.g., hallucinations, depression anxiety, paranoia), cardiac arrhythmias, tachycardia,
  • pain e.g., abdominal pain and/or chronic neuropathic pain
  • neuropathy e.g., acute neuropathy, progressive neuropathy
  • muscle weakness e.g., depression anxiety, paranoia
  • seizures e.g., depression anxiety, paranoia
  • mental disturbances e.g., hallucinations, depression anxiety, paranoia
  • cardiac arrhythmias e.g., tachycardia
  • the cutaneous or erythropoietic porphyrias primarily affect the skin, causing symptoms such as photosensitivity that can be painful, blisters, necrosis, itching, swelling, and increased hair growth on areas such as the forehead. Subsequent infection of skin lesions can lead to bone and tissue loss, as well as scarring, disfigurement, and loss of digits (e.g., fingers, toes). Most porphyrias are caused by mutations that encode enzymes in the heme biosynthetic pathway. A summary of porphyrias associated with genetic errors in heme metabolism is provided in FIG. 2 of WO 2015/051318.
  • porphyrias are genetic.
  • patients with liver disease may develop porphyria as a result of liver dysfunction, and a transient form of erythroporphria (transient erythroporphyria of infancy) has been described in infancy (see Crawford, R.I. et al, J Am Acad Dermatol. 1995 Aug; 33(2 Pt 2):333-6.)
  • Patients with PCT can acquire the deficient activity of uroporphyrinogen decarboxylase (URO-D), due to the formation of a ORO-D enzyme with lower than normal enzymatic activity (see Phillips et al. Blood, 98:3179-3185, 2001.)
  • URO-D uroporphyrinogen decarboxylase
  • Acute intermittent porphyria (also be referred to as porphobilinogen (PBG) deaminase deficiency, or hydroxymethylbilane synthase (HMBS) deficiency), is the most common type of acute hepatic porphyria.
  • Other types of acute hepatic porphyrias include hereditary coproporphyria (HCP), variegate porphyria (VP), and ALA deyhdratase deficiency porphyria (ADP).
  • HCP hereditary coproporphyria
  • VP variegate porphyria
  • ADP ALA deyhdratase deficiency porphyria
  • AIP is typically an autosomal dominant disease that is characterized by a deficiency of the enzyme porphobilinogen deaminase (PBG deaminase); this enzyme is also known as hydroxymethylbilane synthase (HMB synthase or HMBS).
  • PBG deaminase is the third enzyme of the heme biosynthetic pathway (see FIG. 1 of WO 2015/051318) and catalyzes the head to tail condensation of four porphobilinogen molecules into the linear tetrapyrrole,
  • HMB hydroxymethylbilane
  • spliced transcript variants encoding different isoforms of PBG deaminase have been described. Mutations in the PBG deaminase gene are associated with AIP. Such mutations may lead to decreased amounts of PBG deaminase and/or decreased activity of PBG deaminase (affected individuals typically have a -50% reduction in PBG deaminase activity).
  • AIP has been found to have a prevalence as high as 1 in 10,000 in certain populations (e.g., in Northern Sweden; see Floderus Y, et al. Clin Genet. 2002; 62:288-97). The prevalence in the general population in United States and Europe, excluding the U.K., is estimated to be about 1 in 10,000 to 1 in 20,000. Clinical disease manifests itself in only approximately 10-15% of individuals who carry mutations that are known to be associated with AIP. However, the penetrance is as high as 40% in individuals with certain mutations (e.g. , the W198X mutation). AIP is typically latent prior to puberty. Symptoms are more common in females than in males.
  • AIP affects, for example, the visceral, peripheral, autonomic, and central nervous systems.
  • Symptoms of AIP are variable and include gastrointestinal symptoms (e.g., severe and poorly localized abdominal pain, na sea/ vomiting, constipation, diarrhea, ileus), urinary symptoms (dysuria, urinary retention/incontinence, or dark urine, e.g., dark red urine), neurologic symptoms (e.g., sensory neuropathy, motor neuropathy (e.g., affecting the cranial nerves and/or leading to weakness in the arms or legs), seizures, neuropathic pain (e.g., pain associated with progressive neuropathy, e.g., chronic neuropathic pain), neuropsychiatric symptoms (e.g., mental confusion, anxiety, agitation, hallucination, hysteria, delirium, apathy, depression, phobias, psychosis, insomnia, somnolence, coma), autonomic nervous system involvement (resulting e.g.,
  • Neurological manifestations include motor and autonomic neuropathy and seizures. Patients frequently have chronic neuropathic pain and develop a progressive neuropathy. Patients with recurring attacks often have a prodrome. Permanent paralysis may occur after a severe attack. Recovery from severe attacks that are not promptly treated may take weeks or months. An acute attack may be fatal, for example, due to paralysis of respiratory muscles or cardiovascular failure from electrolyte imbalance. (See, e.g., Thunell S. Hydroxymethylbilane Synthase Deficiency. 2005 Sep 27
  • Attacks of acute porphyria may be precipitated by endogenous or exogenous factors.
  • the mechanisms by which such factors induce attacks may include, for example, increased demand for hepatic P450 enzymes and/or induction of ALASl activity in the liver.
  • Increased demand for hepatic P450 enzymes results in decreased hepatic free heme, thereby inducing the synthesis of hepatic ALASl.
  • Precipitating factors include fasting (or other forms of reduced or inadequate caloric intake, due to crash diets, long-distance athletics, etc), metabolic stresses (e.g., infections, surgery, international air travel, and psychological stress), endogenous hormones (e.g., progesterone), cigarette smoking, lipid-soluble foreign chemicals (including, e.g., chemicals present in tobacco smoke, certain prescription drugs, organic solvents, biocides, components in alcoholic beverages), endocrine factors (e.g., reproductive hormones (women may experience exacerbations during the premenstrual period), synthetic estrogens, progesterones, ovulation stimulants, and hormone replacement therapy). See, for example, Thunell (1993).
  • Over 1000 drugs are contraindicated in the acute hepatic porphyrias (e.g., AIP, HCP, ADP, and VP) including, for example, alcohol, barbiturates, Carbamazepine, Carisoprodol, Clonazepam (high doses), Danazol, Diclofenac and possibly other NSAIDS, Ergots, estrogens, Ethvclorvynol, Glutethimide, Griseofulvin, Mephenytoin, Meprobamate (also mebutamate and tybutamate), Methyprylon, Metodopramide, Phenytoin, Primidone, progesterone and synthetic progestins, Pyrazinamide, Pyrazolones (aminopyrine and antipyrine), Rifampin, Succinimides (ethosuximide and methsuximide), sulfonamide antibiotics, and Valproic acid.
  • AIP acute hepatic
  • Objective signs of AIP include discoloration of the urine during an acute attack (the urine may appear red or red-brown), and increased concentrations of PBG and ALA in urine during an acute attack.
  • Molecular genetic testing identifies mutations in the PBG deaminase (also known as HMBS) gene in more than 98% of affected individuals. See, for example, Thunell (1993). See also, Lundin et al. Two new mutations in the porphobilinogen deaminase gene and a screening method using PCR amplification of specific alleles. Hum Genet. 1994 Jan; 93( 1 ):59- 62, Lundin et al. Four mutations in the porphobilinogen deaminase gene in patients with acute intermittent porphyria. Med Genet. 1995 Dec; 32(12): 979-81.
  • Diagnosis of porphria can involve assessment of family history, assessment of porphyrin precursor levels in urine, blood, or stool, and/or assessment of enzyme activity and DNA mutation analysis.
  • the differential diagnosis of porphyrias may involve determining the type of porphyria by measuring individual levels of porphyrins or porphyrin precursors (e.g., ALA, PBG) in the urine, feces, and/or plasma (e.g., by chromatography and fluorometry) during an attack.
  • the diagnosis of ⁇ can be confirmed by establishing that erythrocyte PBG deaminase activity is at 50% or less of the normal level.
  • DNA testing for mutations may be carried out in patients and at-risk family members.
  • the diagnosis of ⁇ is typically confirmed by DNA testing to identify a specific caustative gene mutation (e.g., an HMBS mutation).
  • Treatment of acute attacks of AIP involves hospitalization, monitoring of symptoms, and removal of unsafe drugs.
  • Treatment of acute attacks typically requires hospitalization to control and treat acute sysmptoms, including, e.g., abdominal pain, seizures, dehydration/hyponatremia, nausea/vomiting, tachycardia/hypertension, urinary retention/ileus.
  • abdominal pain may be treated, e.g., with narcotic analgesics
  • seizures may be treated with seizure precautions and possibly medications (although many anti-seizure medications are contraindicated)
  • nausea/vomiting may be treated, e.g., with phenothiazines
  • tachycardia/hypertension may be treated, e.g., with beta blockers.
  • Treatment may include withdrawal of unsafe medications, monitoring of respiratory function, as well as muscle strength and neurological status.
  • Mild attacks e.g. , those with no paresis or hyponatremia
  • Severe attacks are typically treated as soon as possible with intravenous hemin (3-4 mg/kg daily for 4- 14 days) and with IV glucose while waiting for the IV hemin to take effect.
  • attacks are treated with IV hemin for 4 days and with IV glucose while waiting for administration of the IV hemin.
  • Within 3-4 days following the start of hemin administration there is usually clinical improvement accompanying by lowering of ALA and PBG levels.
  • Hemin (Panhematin® or hemin for injection, previously known as hematin) is the only heme product approved for use in the United States and was the first drug approved under the Orphan Drug Act.
  • Panhematin® is hemin derived from processed red blood cells (PRBCs), and is Protoporphyrin IX containing a feme iron ion (Heme B) with a chloride ligand. Heme acts to limit the hepatic and/or marrow synthesis of porphyrin.
  • hemin produces symptomatic improvement in patients with acute episodes of the hepatic porphyrias
  • its action is likely due to the (feedback) inhibition of ⁇ - aminolevulinic acid (ALA) synthase, the enzyme which limits the rate of the porphyrin/heme biosynthetic pathway.
  • ALA ⁇ - aminolevulinic acid
  • Inhibition of ALA synthase should result in reduced production of ALA and PBG as well as porphyrins and porphyrin intermediates.
  • Drawbacks of heme products include delayed impact on clinical symptoms and failure to prevent the recurrence of attacks.
  • Adverse reactions associated with heme (e.g., hemin) administration may include phlebitis (e.g., thrombophlebitis), difficulty with venous access, anticoagulation (or coagulopathies), thrombocytopenia, renal shut down, or iron overload, which is particularly likely in patients requiring multiple courses of hemin treatment for recurrent attacks.
  • phlebitis e.g., thrombophlebitis
  • difficulty with venous access e.g., anticoagulation (or coagulopathies)
  • thrombocytopenia thrombocytopenia
  • renal shut down or iron overload
  • iron overload which is particularly likely in patients requiring multiple courses of hemin treatment for recurrent attacks.
  • an indwelling venous catheter is needed for access in patients with recurrent attacks. Renal damage can occur with high doses.
  • Heme is difficult to prepare in a stable form for intravenous administration. It is insoluble at neutral pH but can be prepared as heme hydroxide at pH 8 or higher.
  • Panhematin is a lyophilized hemin preparation. When lyophilized hemin is solubilized for intravenous administration, degradation products form rapidly; these degradation products are responsible for a transient anticoagulant effect and for phlebitis at the site of infusion.
  • Heme albumin and heme arginate Normal-ang, the European version of hemin
  • heme arginate is not approved for use in the United States.
  • Panhemin may be stabilized by solubilizing it for infusion in 30% human albumin rather than in sterile water; however, albumin adds intravascular volume- expanding effects and increases the cost of treatment as well as risk of pathogens since it is isolated from human blood. See, e.g., Anderson supra.
  • liver transplantation can restore normal excretion of ALA and PBG and prevent acute attacks. See, e.g., Dar, F.S. et al. Hepatobiliary Pancreat. Dis. Int., 9(l):93-96 (2010). Furthermore, if the liver of a patient with ⁇ is transplanted into another patient ("domino transplant"), the patient receiving the transplant may develop ALP.
  • neuropathic pain that may result from a progressive neuropathy due to neurotoxic effects, e.g., of elevated porphyrin precursors ⁇ e.g., ALA and/or PBG).
  • the neurotoxic effects can be associated with toxic heme intermediate production, for example, altered GABA signaling and/or production of iron- mediated oxidation and reactive oxygen species (ROS).
  • ROS reactive oxygen species
  • Patients may suffer from neuropathic pain prior to or during an acute attack. Older patients may experience increased neuropathic pain with age for which various narcotic drugs are typically prescribed. Electromyogram abnormalities and decreased conduction times have been documented in patients with acute hepatic porphyrias.
  • Treatment e.g., chronic treatment (e.g., periodic treatment with iRNA as described herein, e.g., treatment according to a dosing regimen as described herein, e.g., weekly or biweekly treatment) can continuously reduce the ALAS 1 expression in acute porphyria patients who have elevated levels of porphyrin precursors, porphyrins, porphyrin products or their metabolites.
  • Such treatment may be provided as needed to prevent or reduce the frequency or severity of an individual patient's symptoms (e.g., pain and/or neuropathy) and/or to reduce a level of a porphyrin precursor, porphyrin, porphyrin product or metabolite.
  • Novel therapeutics such as those described herein can address these drawbacks and the unmet needs of patients acting faster, not inducing phlebitis, providing the convenience of subcutaneous administration, successfully preventing recurrent attacks, preventing or ameliorating pain (e.g., chronic neuropathic pain) and/or progressive neuropathy, and/or not causing certain adverse effects associated with hemin (e.g., iron overload, increased risk of hepatocellular cancer).
  • pain e.g., chronic neuropathic pain
  • progressive neuropathy e.g., progressive neuropathy
  • Patients with AIA include those who suffer from recurrent attacks and those who suffer from acute, sporadic attacks. In the pateints who suffer from recurrent attacks, about 5-10% have recurrent intermittent attacks (2-3 attacks per year) or recurrent attacks (>4 attacks per year). These patients are most likely to consider liver transplant or to receive prophylactic heme (e.g., heniin) infusions. The recurrent attack patients are likely to have poor quality of life due to long hospital stays, opiate addiction, and/or venous network toxicity. Chronic heme
  • heme oxygenase heme oxygenase
  • HO-1 heme oxygenase
  • ALAS1 mRNA is strongly upregulated during an attack; panhematin down modulates ALAS-1 ; and addition of heme to liver cells in culture leads to reduced ALAS-1 mRNA.
  • Several findings also indicate that suppression of ALAS 1 mRNA can be achieved by targeting the liver. For example, liver transplant has been shown to be curative; and liver derived metabolites drive attacks (see e.g., Dar et al. Hepatobiliaij Pancreat Dis Int. 9:93-6 (2010); Dowman et al. Ann Intern Med 154:571-2 (2011); and Wu et al. Genes Dev 23:2201-2209 (2009).
  • iRNA compositions can be used for prophylaxis and acute treatment of porphyrias.
  • iRNA compositions can be used prophylactically in a recurrent attack setting to induce long-term or chronic suppression of ALASl expression (leading to long-term or chronic suppression of ALA/PBG), and thus blunting the recurrent ALASl upregulation that drives the attacks.
  • prophylactic treatment can reduce the number and the severity of the attacks.
  • administration of an iRNA composition can treat an acute attack, e.g., by reducing the levels of ALA/PBG.
  • the present disclosure provides methods and iRNA compositions for modulating the expression of an ALAS 1 gene.
  • expression of ALAS1 is reduced or inhibited using an ALAS 1 -specific iRNA, thereby leading to a decreased expression of an ALAS 1 gene.
  • Reduced expression of an ALAS 1 gene may reduce the level of one or more porphyrin precursors, porphyrins, or porphyrin products or metabolites.
  • Decreased expression of an ALASl gene, as well as related decreases in the level of one or more porphyrin precursors and/or porphyrins can be useful in treating disorders related to ALAS l expression, e.g., porphyrias.
  • the iRNAs of the compositions featured herein include an RNA strand (the antisense strand) having a region which is 30 nucleotides or less in length, i.e., 15-30 nucleotides in length, generally 19-24 nucleotides in length, which region is substantially complementary to at least part of an mRNA transcript of an ALASl gene (also referred to herein as an "ALAS 1 -specific iRNA").
  • iRNA enables the targeted degradation of mRNAs of genes that are implicated in pathologies associated with ALASl expression in mammals, e.g., porphyrias such as ALA dehydratase deficiency porphyria (also known as Doss porphyria or plumboporphyria) or acute intermittent porphyria.
  • porphyrias such as ALA dehydratase deficiency porphyria (also known as Doss porphyria or plumboporphyria) or acute intermittent porphyria.
  • Very low dosages of ALASl -specific iRNAs can specifically and efficiently mediate RNAi, resulting in significant inhibition of expression of an ALASl gene.
  • iRNAs targeting ALAS l can specifically and efficiently mediate RNAi, resulting in significant inhibition of expression of an ALASl gene, e.g., in cell based assays.
  • porphyrias e.g. , X-linked sideroblastic anemia (XLS A), ALA deyhdratase deficiency porphyria (Doss porphyria), acute intermittent porphyria (AIP), congenital erythropoietic porphyria, prophyria cutanea tarda, hereditary coproporphyria
  • XLS A X-linked sideroblastic anemia
  • Doss porphyria ALA deyhdratase deficiency porphyria
  • AIP acute intermittent porphyria
  • congenital erythropoietic porphyria prophyria cutanea tarda
  • compositions containing iRNAs to inhibit the expression of an ALAS l gene, as well as compositions and methods for treating diseases and disorders caused by or modulated by the expression of this gene.
  • Embodiments of the pharmaceutical compositions featured in the invention include an iRNA having an antisense strand comprising a region which is 30 nucleotides or less in length, generally 19-24 nucleotides in length, which region is substantially complementary to at least part of an RNA transcript of an ALAS1 gene, together with a pharmaceutically acceptable carrier.
  • Embodiments of compositions featured in the invention also include an iRNA having an antisense strand having a region of complementarity which is 30 nucleotides or less in length, generally 19-24 nucleotides in length, and is substantially complementary to at least part of an RNA transcript of an ALAS 1 gene.
  • compositions containing an ALASl iRNA and a pharmaceutically acceptable carrier methods of using the compositions to inhibit expression of an ALASl gene, and methods of using the pharmaceutical compositions to treat disorders related to ALASl expression are featured in the invention.
  • G,” “C,” “A,” “T” and “U” each generally stand for a nucleotide that contains guanine, cytosine, adenine, thymidine and uracil as a base, respectively.
  • ribonucleotide or “nucleotide” can also refer to a modified nucleotide, as further detailed below, or a surrogate replacement moiety.
  • guanine, cytosine, adenine, and uracil may be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide comprising a nucleotide bearing such replacement moiety.
  • a nucleotide comprising inosine as its base may base pair with nucleotides containing adenine, cytosine, or uracil.
  • nucleotides containing uracil, guanine, or adenine may be replaced in the nucleotide sequences of dsRNA featured in the invention by a nucleotide containing, for example, inosine.
  • adenine and cytosine anywhere in the oligonucleotide can be replaced with guanine and uracil, respectively to form G-U Wobble base pairing with the target mRNA. Sequences containing such replacement moieties are suitable for the compositions and methods featured in the invention.
  • ALASl also known as ALAS-1 ; ⁇ -aminolevulinate synthase 1; ⁇ -ALA synthase 1; 5 '-aminolevulinic acid synthase 1 ; ALAS-H; ALASH; ALAS-N; ALAS3;
  • OTTHUMP00000212622 refers to a nuclear-encoded mitochondrial enzyme that is the first and typically rate-limiting enzyme in the mammalian heme biosynthetic pathway.
  • ALASl catalyzes the condensation of glycine with succinyl-CoA to form ⁇ -aminolevulinic acid (ALA).
  • ALA ⁇ -aminolevulinic acid
  • the human ALASl gene is expressed ubiquitously, is found on chromosome 3p21.1 and typically encodes a sequence of 640 amino acids.
  • an "ALASl protein” means any protein variant of ALASl from any species (e.g., human, mouse, non-human primate), as well as any mutants and fragments thereof that retain an ALAS 1 activity.
  • an "ALASl transcript” refers to any transcript variant of ALASl , from any species (e.g., human, mouse, non-human primate).
  • a sequence of a human ALAS 1 mRNA transcript can be found at NM_000688.4 (FIG. 3A and FIG.
  • ALASl mRNA transcript can be found at NM_00()688.5 (FIG. 4A and FIG. 4B of WO 2015/051318; SEQ ID NO:382).
  • the level of the mature encoded ALAS l protein is regulated by heme: high levels of heme down-regulate the mature enzyme in mitochondria while low heme levels up-regulate. Multiple alternatively spliced valiants, encoding the same protein, have been identified.
  • RNAi RNAi agent
  • RNAi agent an agent that contains RNA as that term is defined herein, and which mediates the targeted cleavage of an RNA transcript, e.g., via an RNA-induced silencing complex (RISC) pathway.
  • RISC RNA-induced silencing complex
  • an iRNA as described herein effects inhibition of ALASl expression. Inhibition of ALASl expression may be assessed based on a reduction in the level of ALASl mRNA or a reduction in the level of the ALAS l protein.
  • target sequence refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of an ALAS 1 gene, including mRNA that is a product of RNA processing of a primary transcription product.
  • the target portion of the sequence will be at least long enough to serve as a substrate for iRNA-directed cleavage at or near that portion.
  • the target sequence will generally be from 9-36 nucleotides in length, e.g., 15-30 nucleotides in length, including all sub-ranges therebetween.
  • the target sequence can be from 15-30 nucleotides, 15-26 nucleotides, 15-23 nucleotides, 15-22 nucleotides, 15-21 nucleotides, 15-20 nucleotides, 15-19 nucleotides, 15-18 nucleotides, 15-17 nucleotides, 18-30 nucleotides, 18-26 nucleotides, 18-23 nucleotides, 18-22 nucleotides, 18-21 nucleotides, 18-20 nucleotides, 19-30 nucleotides, 19-26 nucleotides, 19-23 nucleotides, 19-22 nucleotides, 19-21 nucleotides, 19-20 nucleotides, 20-30 nucleotides, 20-26 nucleotides, 20-25 nucleotides, 20-24 nucleotides,2()-23 nucleotides, 20-22 nucleotides, 20-21 nucleotides, 21-30 nucleotides, 21-26 nucleotides
  • strand comprising a sequence refers to an oligonucleotide comprising a chain of nucleotides that is described by the sequence referred to using the standard nucleotide nomenclature.
  • the term "complementary,” when used to describe a first nucleotide sequence in relation to a second nucleotide sequence, refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide comprising the second nucleotide sequence, as will be understood by the skilled person.
  • Such conditions can, for example, be stringent conditions, where stringent conditions may include: 400 mM NaCl, 40 mM PIPES pH 6.4. 1 mM EDTA, 50°C or 70°C for 12-16 hours followed by washing.
  • Complementary sequences within an iRNA include base-pairing of the oligonucleotide or polynucleotide comprising a first nucleotide sequence to an oligonucleotide or polynucleotide comprising a second nucleotide sequence over the entire length of one or both nucleotide sequences.
  • Such sequences can be referred to as "fully complementary” with respect to each other herein.
  • first sequence is referred to as “substantially complementary” with respect to a second sequence herein
  • the two sequences can be fully complementary, or they may form one or more, but generally not more than 5, 4, 3 or 2 mismatched base pairs upon hybridization for a duplex up to 30 base pairs, while retaining the ability to hybridize under the conditions most relevant to their ultimate application, e.g., inhibition of gene expression via a RISC pathway.
  • two oligonucleotides are designed to form, upon hybridization, one or more single stranded overhangs, such overhangs shall not be regarded as mismatches with regard to the determination of complementarity.
  • a dsRNA comprising one oligonucleotide 21 nucleotides in length and another oligonucleotide 23 nucleotides in length, wherein the longer oligonucleotide comprises a sequence of 21 nucleotides that is fully complementary to the shorter oligonucleotide, may yet be referred to as "fully complementary" for the purposes described herein.
  • “Complementary” sequences may also include, or be formed entirely from, non -Watson-Crick base pairs and/or base pairs formed from non -natural and modified nucleotides, in as far as the above requirements with respect to their ability to hybridize are fulfilled.
  • Such non-Watson-Crick base pairs includes, but are not limited to, G:U Wobble or Hoogstein base pairing.
  • a polynucleotide that is "substantially complementary to at least part of" a messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to a contiguous portion of the mRNA of interest (e.g., an mRNA encoding an ALAS 1 protein).
  • mRNA messenger RNA
  • a polynucleotide is complementary to at least a part of an ALAS 1 mRNA if the sequence is substantially complementary to a non -interrupted portion of an mRNA encoding ALAS 1.
  • a polynucleotide is complementary to at least a part of an ALAS 1 mRNA if the sequence is substantially complementary to a non-interrupted portion of an mRNA encoding ALAS 1.
  • double-stranded RNA refers to an iRNA that includes an RNA molecule or complex of molecules having a hybridized duplex region that comprises two anti-parallel and substantially complementary nucleic acid strands, which will be referred to as having "sense” and “antisense” orientations with respect to a target RNA.
  • the duplex region can be of any length that permits specific degradation of a desired target RNA, e.g., through a RISC pathway, but will typically range from 9 to 36 base pairs in length, e.g., 15- 30 base pairs in length.
  • the duplex can be any length in this range, for example, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, or 36 and any sub-range therein between, including, but not limited to 15-30 base pairs, 15-26 base pairs, 15-23 base pairs, 15-22 base pairs, 15-21 base pairs, 15-20 base pairs, 15-19 base pairs, 15-18 base pairs, 15-17 base pairs, 18-30 base pairs, 18-26 base pairs, 18-23 base pairs, 18-22 base pairs, 18-21 base pairs, 18-20 base pairs, 19-30 base pairs, 19-26 base pairs, 19-23 base pairs, 19-22 base pairs, 19-21 base pairs, 19-20 base pairs, 20-30 base pairs, 20-26 base pairs, 20-25 base pairs, 20-24 base pairs, 20-23 base pairs, 20-22 base pairs, 20-21 base pairs, 21-30 base pairs, 21-26 base pairs, 21-25 base pairs, 21-24 base pairs, 21-23 base pairs, or 21-22 base
  • the two strands forming the duplex structure can be from a single RNA molecule having at least one self-complementary region, or can be formed from two or more separate RNA molecules. Where the duplex region is formed from two strands of a single molecule, the molecule can have a duplex region separated by a single stranded chain of nucleotides (herein referred to as a "hairpin loop") between the 3'-end of one strand and the 5 '-end of the respective other strand forming the duplex structure.
  • a single stranded chain of nucleotides herein referred to as a "hairpin loop
  • the hairpin loop can comprise at least one unpaired nucleotide; in some embodiments the hairpin loop can comprise at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 23 or more unpaired nucleotides.
  • the two substantially complementary strands of a dsRNA are comprised by separate RNA molecules, those molecules need not, but can be covalently connected.
  • the connecting structure is referred to as a "linker.”
  • the term "siRNA” is also used herein to refer to a dsRNA as described above.
  • the iRNA agent may be a "single-stranded siRNA" that is introduced into a cell or organism to inhibit a target mRNA.
  • Single -stranded RNAi agents bind to the RISC endonuclease Argonaute 2, which then cleaves the target mRNA.
  • the single- stranded siRNAs are generally 15-30 nucleotides and are chemically modified. The design and testing of single-stranded siRNAs are described in U.S. Patent No. 8,101,348 and in Lima et al, (2012) Cell 150: 883-894, the entire contents of each of which are hereby incorporated herein by reference.
  • any of the antisense nucleotide sequences described herein may be used as a single-stranded siRNA as described herein or as chemically modified by the methods described in Lima et al, (2012) Cell 150:883-894.
  • the RNA agent is a "single-stranded antisense RNA molecule".
  • An single-stranded antisense RNA molecule is complementary to a sequence within the target mRNA.
  • Single-stranded antisense RNA molecules can inhibit translation in a stoichiometric manner by base pairing to the mRNA and physically obstructing the translation machinery, see Dias, N. et al., (2002) Mol Cancer Ther 1 :347-355.
  • the single-stranded antisense molecules inhibit a target mRNA by hydridizing to the target and cleaving the target through an RNaseH cleavage event.
  • the single-stranded antisense RNA molecule may be about 10 to about 30 nucleotides in length and have a sequence that is complementary to a target sequence.
  • the single-stranded antisense RNA molecule may comprise a sequence that is at least about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more contiguous nucleotides from any one of the antisense nucleotide sequences described herein, e.g., sequences provided in any one of Tables 2, 3, 6, 7, 8, 9, 14, 15, 18 and 20 of WO 2015/051318 and the Sequence Listing attached herewith or in Tables 21-40 of WO 2015/051318 and the Sequence Listing attached herewith.
  • RNA molecule or "ribonucleic acid molecule” encompasses not only RNA molecules as expressed or found in nature, but also analogs and derivatives of RNA comprising one or more ribonucleotide/ribonucleoside analogs or derivatives as described herein or as known in the art.
  • a "ribonucleoside” includes a nucleoside base and a ribose sugar
  • a “ribonucleotide” is a ribonucleoside with one, two or three phosphate moieties.
  • the terms “ribonucleoside” and “ribonucleotide” can be considered to be equivalent as used herein.
  • RNA can be modified in the nucleobase structure, in the ribose structure, or in the ribose-phosphate backbone structure, e.g., as described herein below.
  • the molecules comprising ribonucleoside analogs or derivatives must retain the ability to form a duplex.
  • an RNA molecule can also include at least one modified ribonucleoside including but not limited to a 2'-0-methyl modified nucleostide, a nucleoside comprising a 5' phosphorothioate group, a terminal nucleoside linked to a cholesteryl derivative or dodecanoic acid bisdecylamide group, a locked nucleoside, an abasic nucleoside, an acyclic nucleoside, a 2'-deoxy-2'-fluoro modified nucleoside, a 2'-amino- modified nucleoside, 2'-alkyl-modified nucleoside, moipholino nucleoside, a phosphoramidate or a non-natural base comprising nucleoside, or any combination thereof.
  • a modified ribonucleoside including but not limited to a 2'-0-methyl modified nucleostide, a nucleoside comprising a 5' phosphorothioate group, a
  • an RNA molecule can comprise at least two modified ribonucleosides, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20 or more, up to the entire length of the dsRNA molecule.
  • the modifications need not be the same for each of such a plurality of modified ribonucleosides in an RNA molecule.
  • modified RNAs contemplated for use in methods and compositions described herein are peptide nucleic acids (PNAs) that have the ability to form the required duplex structure and that permit or mediate the specific degradation of a target RNA, e.g., via a RISC pathway.
  • PNAs peptide nucleic acids
  • a modified ribonucleoside includes a deoxyribonucleoside.
  • an iRNA agent can comprise one or more deoxynucleosides, including, for example, a deoxynucleoside overhang(s), or one or more deoxynucleosides within the double stranded portion of a dsRNA.
  • the RNA molecule comprises a percentage of deoxyribonucleoses of at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95% or higher (but not 100%) deoxyribonucleosides, e.g., in one or both strands.
  • an RNA interference agent includes a single stranded RNA that interacts with a target RNA sequence to direct the cleavage of the target RNA.
  • long double stranded RNA introduced into cells is broken down into siRNA by a Type III endonuclease known as Dicer (Sharp et al., Genes Dev. 2001, 15:485).
  • Dicer a ribonuclease-III-like enzyme, processes the dsRNA into 19-23 base pair short interfering RNAs with characteristic two base 3' overhangs (Bernstein, et al., (2001) Nature 409:363).
  • the siRNAs are then incorporated into an RNA-induced silencing complex (RISC) where one or more helicases unwind the siRNA duplex, enabling the complementary anti sense strand to guide target recognition (Nykanen, et al., (2001 ) Cell 107:309).
  • RISC RNA-induced silencing complex
  • the invention Upon binding to the appropriate target mRNA, one or more endonucleases within the RISC cleaves the target to induce silencing (Elbashir, et al., (2001) Genes Dev. 15: 188).
  • the invention relates to a single stranded RNA that promotes the formation of a RISC complex to effect silencing of the target gene.
  • nucleotide overhang refers to at least one unpaired nucleotide that protrudes from the duplex structure of an iRNA, e.g., a dsRNA.
  • a dsRNA can comprise an overhang of at least one nucleotide
  • the overhang can comprise at least two nucleotides, at least three nucleotides, at least four nucleotides, at least five nucleotides or more.
  • a nucleotide overhang can comprise or consist of a nucleotide/nucleoside analog, including a deoxymicleotide/nucleoside.
  • the overhang(s) may be on the sense strand, the anti sense strand or any combination thereof.
  • nucleotide(s) of an overhang can be present on the 5' end , 3' end or both ends of either an antisense or sense strand of a dsRNA.
  • the antisense strand of a dsRNA has a 1-10 nucleotide overhang at the 3' end and/or the 5' end. In one embodiment, the sense strand of a dsRNA has a 1-10 nucleotide overhang at the 3' end and/or the 5' end. In another embodiment, one or more of the nucleotides in the overhang is replaced with a nucleoside thiophosphate.
  • dsRNA dsRNA that there are no unpaired nucleotides or nucleotide analogs at a given terminal end of a dsRNA, i.e., no nucleotide overhang.
  • One or both ends of a dsRNA can be blunt. Where both ends of a dsRNA are blunt, the dsRNA is said to be blunt ended.
  • a "blunt ended" dsRNA is a dsRNA that is blunt at both ends, i.e., no nucleotide overhang at either end of the molecule. Most often such a molecule will be double-stranded over its entire length.
  • antisense strand or "guide strand” refers to the strand of an iRNA, e.g., a dsRNA, which includes a region that is substantially complementary to a target sequence.
  • region of complementarity refers to the region on the antisense strand that is substantially complementary to a sequence, for example a target sequence, as defined herein. Where the region of complementarity is not fully complementary to the target sequence, the mismatches may be in the internal or terminal regions of the molecule. Generally, the most tolerated mismatches are in the terminal regions, e.g., within 5, 4, 3, or 2 nucleotides of the 5' and/or 3' terminus.
  • SNALP refers to a stable nucleic acid-lipid particle.
  • a SNALP represents a vesicle of lipids coating a reduced aqueous interior comprising a nucleic acid such as an iRNA or a plasmid from which an iRNA is transcribed. SNALPs are described, e.g., in U.S. Patent Application Publication Nos. 2006/0240093, 2007/0135372, and in
  • iRNA when referring to an iRNA, means facilitating or effecting uptake or absorption into the cell, as is understood by those skilled in the art. Absorption or uptake of an iRNA can occur through unaided diffusive or active cellular processes, or by auxiliary agents or devices. The meaning of this term is not limited to cells in vitro; an iRNA may also be "introduced into a cell," wherein the cell is part of a living organism. In such an instance, introduction into the cell will include the delivery to the organism.
  • iRNA can be injected into a tissue site or administered systemically. In vivo delivery can also be by a ⁇ -glucan delivery system, such as those described in U.S.
  • In vitro introduction into a cell includes methods known in the art such as electroporation and lipofection. Further approaches are described herein below or known in the art.
  • the term "modulate the expression of,” refers to at an least partial “inhibition” or partial “activation” of an ALAS1 gene expression in a cell treated with an iRNA composition as described herein compared to the expression of ALAS 1 in a control cell.
  • a control cell includes an untreated cell, or a ceil treated with a non-targeting control iRNA.
  • activate activate
  • increase p-regulate the expression of
  • increase in so far as they refer to an ALAS1 gene
  • herein refer to the at least partial activation of the expression of an ALAS 1 gene, as manifested by an increase in the amount of ALAS 1 mRNA, which may be isolated from or detected in a first cell or group of cells in which an ALAS 1 gene is transcribed and which has or have been treated such that the expression of an ALAS l gene is increased, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has or have not been so treated (control cells).
  • expression of an ALASl gene is activated by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% by administration of an iRNA as described herein.
  • an ALASl gene is activated by at least about 60%, 70%, or 80% by administration of an iRNA featured in the invention, hi some embodiments, expression of an ALASl gene is activated by at least about 85%, 90%, or 95% or more by administration of an iRNA as described herein, hi some embodiments, the ALASl gene expression is increased by at least 1-fold, at least 2-fold, at least 5-fold, at least 10-fold, at least 50-fold, at least 100-fold, at least 500-fold, at least 1000 fold or more in cells treated with an iRNA as described herein compared to the expression in an untreated cell.
  • ALASl gene refers to the at least partial suppression of the expression of an ALASl gene, as assessed, e.g., based on on ALASl mRNA expression, ALAS 1 protein expression, or another parameter functionally linked to ALASl gene expression (e.g., ALA or PBG concentrations in plasma or urine).
  • inhibition of ALASl expression may be manifested by a reduction of the amount of ALAS l mRNA which may be isolated from or detected in a first cell or group of cells in which an ALASl gene is transcribed and which has or have been treated such that the expression of an ALAS l gene is inhibited, as compared to a control.
  • the control may be a second cell or group of cells substantially identical to the first cell or group of cells, except that the second cell or group of cells have not been so treated (control cells).
  • the degree of inhibition is usually expressed as a percentage of a control level, e.g.,
  • the degree of inhibition may be given in terms of a reduction of a parameter that is functionally linked to ALASl gene expression, e.g., the amount of protein encoded by an ALAS 1 gene, or the level of one or more porphyrins.
  • the reduction of a parameter functionally linked to ALASl gene expression may similarly be expressed as a percentage of a control level.
  • ALAS l gene silencing may be determined in any cell expressing ALAS l , either constitutively or by genomic engineering, and by any appropriate assay.
  • the assays provided in the Examples below shall serve as such reference.
  • expression of an ALAS 1 gene is suppressed by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% by administration of an iRNA featured in the invention.
  • an ALAS 1 gene is suppressed by at least about 60%, 65%, 70%, 75%, or 80% by administration of an iRNA featured in the invention.
  • an ALASl gene is suppressed by at least about 85%, 90%, 95%, 98%, 99%, or more by administration of an iRNA as described herein.
  • the terms “treat,” “treating,” “treatment,” and the like refer to relief from or alleviation of pathological processes related to ALAS l expression (e.g., pathological processes involving porphyrins or defects in the porphyrin pathway, such as, for example, porphyrias).
  • pathological processes related to ALAS l expression e.g., pathological processes involving porphyrins or defects in the porphyrin pathway, such as, for example, porphyrias.
  • the terms “treat,” “treatment,” and the like mean to prevent, relieve or alleviate at least one symptom associated with such condition, or to slow or reverse the progression or anticipated progression of such condition.
  • the methods featured herein when employed to treat porphyria, may serve to reduce or prevent one or more symptoms associated with porphyria (e.g., pain), to reduce the severity or frequency of attacks associated with porphyria, to reduce the likelihood that an attack of one or more symptoms associated with porphyria will occur upon exposure to a precipitating condition, to shorten an attack associated with porphyria, and/or to reduce the risk of developing conditions associated with porphyria (e.g., hepatocellular cancer or neuropathy (e.g., progressive neuropathy)).
  • the terms "treat,” “treatment,” and the like are intended to encompass prophylaxis, e.g., prevention of disorders and/or symptoms of disorders related to ALAS l expression.
  • lower in the context of a disease marker or symptom is meant a statistically or clinically significant decrease in such level.
  • the decrease can be, for example, at least 10%, at least 20%, at least 30%, at least 40% ⁇ or more, and is typically down to a level accepted as within the range of normal for an individual without such disorder.
  • therapeutically effective amount refers to an amount that provides a therapeutic benefit in the treatment, prevention, or management of pathological processes related to ALAS 1 expression.
  • the specific amount that is therapeutically effective can be readily determined by an ordinary medical practitioner, and may vary depending on factors known in the art, such as, for example, the type of pathological process, the patient's history and age, the stage of pathological process, and the administration of other agents.
  • a “pharmaceutical composition” comprises a pharmacologically effective amount of an iRNA and a pharmaceutically acceptable carrier.
  • pharmacologically effective amount refers to that amount of an iRNA effective to produce the intended pharmacological, therapeutic or preventive result. For example, in a method of treating a disorder related to ALAS !
  • an effective amount includes an amount effective to reduce one or more symptoms associated with a porphyria, an amount effective to reduce the frequency of attacks, an amount effective to reduce the likelihood that an attack of one or more symptoms associated with porphyria will occur upon exposure to a precipitating factor, or an amount effective to reduce the risk of developing conditions associated with porphyria (e.g., neuropathy (e.g., progressive neuropathy), hepatocellular cancer).
  • an effective amount includes an amount effective to reduce one or more symptoms associated with a porphyria, an amount effective to reduce the frequency of attacks, an amount effective to reduce the likelihood that an attack of one or more symptoms associated with porphyria will occur upon exposure to a precipitating factor, or an amount effective to reduce the risk of developing conditions associated with porphyria (e.g., neuropathy (e.g., progressive neuropathy), hepatocellular cancer).
  • neuropathy e.g., progressive neuropathy
  • a therapeutically effective amount of a drug for the treatment of that disease or disorder is the amount necessary to effect at least a 10% reduction in that parameter.
  • a therapeutically effective amount of an iRNA targeting ALASl can reduce ALAS 1 protein levels by any measurable amount, e.g., by at least 10%, 20%, 30%, 40% or 50%.
  • pharmaceutically acceptable carrier refers to a carrier for administration of a therapeutic agent.
  • Such carriers include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof.
  • the term specifically excludes cell culture medium.
  • pharmaceutically acceptable carriers include, but are not limited to pharmaceutically acceptable excipients such as inert diluents, disintegrating agents, binding agents, lubricating agents, sweetening agents, flavoring agents, coloring agents and preservatives.
  • suitable inert diluents include sodium and calcium carbonate, sodium and calcium phosphate, and lactose, while corn starch and alginic acid are suitable disintegrating agents.
  • Binding agents may include starch and gelatin, while the lubricating agent, if present, will generally be magnesium stearate, stearic acid or talc. If desired, the tablets may be coated with a material such as glyceryl monostearate or glyceryl distearate, to delay absorption in the gastrointestinal tract. Agents included in drug formulations are described further herein below.
  • the iRNA agent includes double-stranded ribonucleic acid (dsRNA) molecules for inhibiting the expression of an ALAS l gene in a cell or in a subject (e.g., in a mammal, e.g., in a human having a porphyria), where the dsRNA includes an antisense strand having a region of complementarity which is complementary to at least a part of an mRNA formed in the expression of an ALAS l gene, and where the region of complementarity is 30 nucleotides or less in length, generally 19-24 nucleotides in length, and where the dsRNA, upon contact with a cell expressing the ALAS l gene, inhibits the expression of the ALAS l gene by at least 10% as assayed by, for example, a PCR or branched DNA (bDNA)-based method, or by a protein-based method, such
  • dsRNA double-stranded ribonucleic acid
  • the iRNA agent activates the expression of an ALAS l gene in a cell or mammal.
  • Expression of an ALASl gene in cell culture such as in COS cells, HeLa cells, primary hepatocytes, HepG2 cells, primary cultured cells or in a biological sample from a subject can be assayed by measuring ALAS l mRNA levels, such as by bDNA or TaqMan assay, or by measuring protein levels, such as by immunofluorescence analysis, using, for example, Western Blotting or flow cytometric techniques.
  • a dsRNA includes two RNA strands that are sufficiently complementary to hybridize to form a duplex structure under conditions in which the dsRNA will be used.
  • One strand of a dsRNA (the antisense strand) includes a region of complementarity that is substantially complementary, and generally fully complementary, to a target sequence, derived from the sequence of an mRNA formed during the expression of an ALAS1 gene.
  • the other strand (the sense strand) includes a region that is complementary to the antisense strand, such that the two strands hybridize and form a duplex structure when combined under suitable conditions.
  • the duplex structure is between 15 and 30 inclusive, more generally between 18 and 25 inclusive, yet more generally between 19 and 24 inclusive, and most generally between 19 and 21 base pairs in length, inclusive.
  • the region of complementarity to the target sequence is between 15 and 30 inclusive, more generally between 18 and 25 inclusive, yet more generally between 19 and 24 inclusive, and most generally between 19 and 21 nucleotides in length, inclusive.
  • the dsRNA is between 15 and 20 nucleotides in length, inclusive, and in other embodiments, the dsRNA is between 25 and 30 nucleotides in length, inclusive.
  • RNA targeted for cleavage will most often be part of a larger RNA molecule, often an mRNA molecule.
  • a ''part" of an mRNA target is a contiguous sequence of an mRNA target of sufficient length to be a substrate for RNAi-directed cleavage (i.e., cleavage through a RISC pathway).
  • dsRNAs having duplexes as short as 9 base pairs can, under some
  • RNAi-directed RNA cleavage Most often a target will be at least 15 nucleotides in length, e.g., 15-30 nucleotides in length.
  • the duplex region is a primary functional portion of a dsRNA, e.g., a duplex region of 9 to 36, e.g., 15-30 base pairs.
  • a dsRNA RNA molecule or complex of RNA molecules having a duplex region greater than 30 base pairs.
  • an miRNA is a dsRNA.
  • a dsRNA is not a naturally occurring miRNA.
  • an iRNA agent useful to target ALASl expression is not generated in the target cell by cleavage of a larger dsR A.
  • a dsRNA as described herein may further include one or more single-stranded nucleotide overhangs.
  • the dsRNA can be synthesized by standard methods known in the art as further discussed below, e.g., by use of an automated DNA synthesizer, such as are commercially available from, for example, Biosearch, Applied Biosystems, Inc.
  • an ALAS 1 gene is a human ALAS 1 gene.
  • the ALAS 1 gene is a mouse or a rat ALAS 1 gene.
  • the first sequence is a sense strand of a dsRNA that includes a sense sequence disclosed herein, e.g., in Tables 21-40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., an sense sequence corresponding to SEQ ID NO: 4149 or 4151 , or one of the even numbered sequences identified as SEQ ID NOs: 4172 to 5236), and the second sequence is an antisense strand of a dsRNA that includes an antisense sequence disclosed herein, e.g., in Tables 21 -40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237).
  • the first sequence is a sense strand of a dsRNA that includes a sense sequence from Table 2 or Table 3 of WO 2015/051318 and the Sequence Listing attached herewith
  • the second sequence is an antisense strand of a dsRNA that includes an antisense sequence from Table 2 or Table 3 of WO 2015/051318 and the Sequence Listing attached herewith
  • the first sequence is a sense strand of a dsRNA that includes a sense sequence from Table 2, 3, 6, 7, 8, 9, 14, or 15 of WO 2015/051318 and the Sequence Listing attached herewith
  • the second sequence is an antisense strand of a dsRNA that includes an antisense sequence from Table 2, 3, 6, 7, 8, 9, 14, or 15 of WO 2015/051318 and the Sequence Listing attached herewith.
  • the first sequence is a sense strand of a dsRNA that includes a sense sequence from Table 2, 3, 6, 7, 8, 9, 14, 15, 18 or 20 of WO 2015/051318 and the Sequence Listing attached herewith
  • the second sequence is an antisense strand of a dsRNA that includes an antisense sequence from Table 2, 3, 6, 7, 8, 9, 14, 15, 18 or 20 of WO 2015/051318 and the Sequence Listing attached herewith.
  • a dsRNA can include at least sense and antisense nucleotide sequences, whereby the sense strand is selected from the sense sequences provided herein, e.g., in Tables 21-40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237), and the corresponding antisense strand of the sense strand is selected from the antisense sequences provided herein, e.g., in Tables 21-40 of WO 2015/051318 and the Sequence Listing attached herewith(e.g., an sense sequence corresponding to SEQ ID NO: 4149 or 4151, or one of the even numbered sequences identified as SEQ ID NOs: 4172 to 5236).
  • the sense strand is selected from the sense sequences provided herein, e.g., in Tables 21-40 of WO 2015/051318 and the Sequ
  • a dsRNA can include at least sense and antisense nucleotide sequences, whereby the sense strand is selected from the groups of sequences provided in Tables 2 and 3 of WO 2015/051318 and the Sequence Listing attached herewith, and the corresponding antisense strand of the sense strand is selected from Tables 2 and 3 of WO 2015/051318 and the Sequence Listing attached herewith.
  • a dsRNA can include at least sense and antisense nucleotide sequences, whereby the sense strand is selected from the groups of sequences provided in Tables 2, 3, 6, 7, 8, 9, 14, and 15 of WO 2015/051318 and the Sequence Listing attached herewith, and the corresponding antisense strand of the sense strand is selected from Tables 2, 3, 6, 7, 8, 9, 14, and 15 of WO 2015/051318 and the Sequence Listing attached herewith.
  • a dsRNA can include at least sense and antisense nucleotide sequences, whereby the sense strand is selected from the groups of sequences provided in Tables 2, 3, 6, 7.
  • the iRNA is AD-60501 , AD-60519, AD-60901, AD-60495, AD-60900, AD-60935, AD-60879, AD-61190, AD-61191 , AD-60865, AD-60861, AD-60876, AD-61193, AD-60519, AD-60519, AD-60901, AD-60405, AD-60887, AD-60923, AD-60434.
  • AD-60419 e.g., including the nucleotide sequence and/or one or more (e.g., all) of the modifications of the aforesaid dsRNAs).
  • the iRNA comprises an antisense strand that comprises, or consists of, an antisense sequence (including one or more (e.g., all the modifications)) selected from the antisense sequence of AD-60501 , AD-60519, AD- 60901 , AD-60495, AD-60900, AD-60935, AD-60879, AD-61 190, AD-61 191 , AD-60865, AD- 60861 , AD-60876, AD-61 193, AD-60519, AD-60519, AD-60901, AD-60405, AD-60887, AD- 60923, AD-60434, AD-60892, AD-60419, AD-60924, AD-60445. AD-60925.
  • an antisense sequence including one or more (e.g., all the modifications) selected from the antisense sequence of AD-60501 , AD-60519, AD- 60901 , AD-60495, AD-60900, AD-60935, AD-60879, AD-61 190, AD-61 191 , AD-60865, AD- 60861
  • the iRNA comprises a sense strand that comprises, or consists of, a sense sequence (and/or one or more (e.g., all) of the modifications)) selected from AD-60501, AD-60519, AD-60901, AD- 60495, AD-60900, AD-60935, AD-60879, AD-61 190, AD-61191, AD-60865, AD-60861 , AD- 60876, AD-61193, AD-60519.
  • the iRNA comprises (i) an antisense strand that comprises, or consists of, the sequence of UAAGAUGAG ACACUCUUUCUGGU or
  • one or more nucleotides of the antisense strand and/or sense strand are modified as described herein.
  • the iRNA comprises (i) an antisense strand that comprises, or consists of, the antisense sequence of AD-60489 and/or (ii) a sense strand that comprises, or consists of, the sense sequence of AD-60489 (and/or one or more (e.g., all) of the modifications of the sense strand and/or antisense strand of AD-60489).
  • the iRNA comprises (i) an antisense strand that comprises, or consists of, the antisense sequence of AD-60519 and/or (ii) a sense strand that comprises, or consists of, the sense sequence of AD-60519 (and/or one or more (e.g., all) of the modifications of the sense strand and/or antisense strand of AD-60489).
  • the iRNA comprises (i) an antisense strand that comprises, or consists of, the antisense sequence of AD-61 193 and/or (ii) a sense strand that comprises, or consists of, the sense sequence of AD-61 193 (and/or one or more (e.g., all) of the modifications of the sense strand and/or antisense strand of AD-60489).
  • the iRNA comprises (i) an antisense strand that comprises, or consists of, the antisense sequence of AD-60819 and/or (ii) a sense sequence that comprises, or consists of, the sense sequence of AD-60819 (and/or one or more (e.g., all) of the modifications of the sense strand and/or antisense strand of AD-60489).
  • the iRNA for inhibiting expression of ALAS 1 comprises (i) an antisense strand that comprises, or consists of, the antisense sequence of AD-60489, AD-60519, AD-61193. or AD-60819 (or a corresponding unmodified antisense sequence) and/or (ii) a sense strand that comprises, or consists of, the sense sequence of AD- 60489, AD-60519, AD-61 193, or AD-60819 (or a corresponding unmodified antisense sequence).
  • the iRNA comprises (i) an antisense strand that consists of the antisense sequence of AD-60489, AD-60519, AD-61 193, or AD-60819 and/or (ii) a sense strand that consists of the sense sequence of AD-60489, AD-60519, AD-61 193, or AD-60819, except that the antisense strand and/or sense strand of the dsRNA differs by 1, 2, or 3 nucleotides from the corresponding antisense and/or sense sequence of AD-60489, AD-60519, AD-61193, or AD- 60819.
  • AD-60489, AD-60519, AD-61193, and AD-60819 are shown in Table 2 disclosed herein.
  • the iRNA is ALN-60519.
  • ALN-60519 is a chemically synthesized double stranded oligonucleotide covalently linked to a ligand containing three N- acetylgalactosamine (GalNAc) residues (depicted in FIG. 57 of WO 2015/051318).
  • all nucleotides of ALN-60519 are 2'-OMe or 2'-F modified and are connected through 3 '-5' phosphodiester linkages, thus forming the sugar-phosphate backbone of the oligonucleotide.
  • the sense strand and the antisense strand of ALN-60519 contain 21 and 23 nucleotides, respectively.
  • the 3'-end of the sense strand of ALN-60519 is conjugated to the triantennary GalNAc moiety (referred to as L96) through a phosphodiester linkage.
  • the antisense strand contains four phosphorothioate linkages - two at the 3' end and two at the 5' end.
  • the sense strand of ALN-60519 contains two phosphorothioate linkages at the 5' end.
  • the 21 nucleotides of the sense strand of ALN-60519 hybridize with the complementary 21 nucleotides of the antisense strand, thus forming 21 nucleotide base pairs and a two-base overhang at the 3'-end of the antisense strand.
  • the two single strands, the sense strand and the antisense strand, of ALN-60519 can be synthesized by conventional solid phase oligonucleotide synthesis, employing standard phosphoramidite chemistry with the 5 '-hydroxy! group protected as dimethoxytriphenylmethyl (DMT) ether. Each strand can be assembled from the 3' to the 5' terminus by sequential addition of protected nucleoside phosphoramidites.
  • one of the two sequences is complementary to the other of the two sequences, with one of the sequences being substantially complementary to a sequence of an mRNA generated by the expression of an ALAS 1 gene gene.
  • a dsRNA will include two oligonucleotides, where one oligonucleotide is described herein as the sense strand, and the second oligonucleotide is described as the corresponding antisense strand.
  • the complementary sequences of a dsRNA can also be contained as self-complementary regions of a single nucleic acid molecule, as opposed to being on separate oligonucleotides.
  • dsRNAs having a duplex structure of between 20 and 23, but specifically 21 , base pairs have been hailed as particularly effective in inducing RNA interference (Elbashir et al, EMBO . 2001, 20:6877-6888).
  • RNA duplex structures can be effective as well.
  • dsRNAs described herein can include at least one strand of a length of minimally 21 nucleotides.
  • dsRNAs having a partial sequence of at least 15, 16, 17, 18, 19, 20, or more contiguous nucleotides from one of the sequences disclosed herein, and differing in their ability to inhibit the expression of an ALAS 1 gene by not more than 5, 10, 15, 20, 25, or 30 % inhibition from a dsRNA comprising the full sequence are contemplated according to the invention.
  • RNAs provided in the tables of WO 2015/051318 and the Sequence Listing attached herewith identify a site in an ALAS1 transcript that is susceptible to RISC- mediated cleavage.
  • the present invention further features iRNAs that target within one of such sequences.
  • an iRNA is said to target within a particular site of an RNA transcript if the iRNA promotes cleavage of the transcript anywhere within that particular site.
  • Such an iRNA will generally include at least 15 contiguous nucleotides from one of the sequences provided herein, e.g., in Tables 2, 3, 6, 7, 8, 9, 14, 15, 18, 20 of WO 2015/051318 and the Sequence Listing attached herewith, and in Tables 21-40 of WO 2015/051318 and the Sequence Listing attached herewith, coupled to additional nucleotide sequences taken from the region contiguous to the selected sequence in an ALAS 1 gene.
  • target sequence is generally 15-30 nucleotides in length, there is wide variation in the suitability of particular sequences in this range for directing cleavage of any given target RNA.
  • Various software packages and the guidelines set out herein provide guidance for the identification of optimal target sequences for any given gene target, but an empirical approach can also be taken in which a "window” or “mask” of a given size (as a non-limiting example, 21 nucleotides) is literally or figuratively (including, e.g., in silico) placed on the target RNA sequence to identify sequences in the size range that may serve as target sequences.
  • the next potential target sequence can be identified, until the complete set of possible sequences is identified for any given target size selected.
  • This process coupled with systematic synthesis and testing of the identified sequences (using assays as described herein or as known in the art) to identify those sequences that perform optimally can identify those RNA sequences that, when targeted with an iRNA agent, mediate the best inhibition of target gene expression.
  • sequences identified for example, in the tables of WO 2015/051318 and the Sequence Listing attached herewith, represent effective target sequences, it is
  • optimized sequences can be adjusted by, e.g., the introduction of modified nucleotides as described herein or as known in the ait, addition or changes in overhang, or other modifications as known in the art and/or discussed herein to further optimize the molecule (e.g., increasing serum stability or circulating half-life, increasing thermal stability, enhancing transmembrane delivery, targeting to a particular location or cell type, increasing interaction with silencing pathway enzymes, increasing release from endosomes, etc.) as an expression inhibitor.
  • modified nucleotides as described herein or as known in the ait, addition or changes in overhang, or other modifications as known in the art and/or discussed herein to further optimize the molecule (e.g., increasing serum stability or circulating half-life, increasing thermal stability, enhancing transmembrane delivery, targeting to a particular location or cell type, increasing interaction with silencing pathway enzymes, increasing release from endosomes, etc.) as an expression inhibitor.
  • an iRNA as described herein can contain one or more mismatches to the target sequence. In one embodiment, an iRNA as described herein contains no more than 3 mismatches. If the antisense strand of the iRNA contains mismatches to a target sequence, it is preferable that the area of mismatch not be located in the center of the region of complementarity. If the antisense strand of the iRNA contains mismatches to the target sequence, it is preferable that the mismatch be restricted to be within the last 5 nucleotides from either the 5' or 3' end of the region of complementarity. For example, for a 23 nucleotide iRNA agent RNA strand which is
  • the RNA strand generally does not contain any mismatch within the central 13 nucleotides.
  • the methods described herein or methods known in the art can be used to determine whether an iRNA containing a mismatch to a target sequence is effective in inhibiting the expression of an ALAS1 gene. Consideration of the efficacy of iRNAs with mismatches in inhibiting expression of an ALAS1 gene is important, especialiy if the particular region of complementarity in an ALAS 1 gene is known to have polymorphic sequence variation within the population.
  • a dsRNA has a single-stranded nucleotide overhang of 1 to 4, generally 1 or 2 nucleotides. dsRNAs having at least one nucleotide overhang have unexpectedly superior inhibitory properties relative to their blunt-ended counterparts.
  • the RNA of an iRNA e.g., a dsRNA
  • the nucleic acids featured in the invention may be synthesized and/or modified by methods well established in the art, such as those described in "Current protocols in nucleic acid chemistry," Beaucage, S.L. et al.
  • Modifications include, for example, (a) end modifications, e.g., 5' end modifications (phosphorylation, conjugation, inverted linkages, etc.) 3' end modifications (conjugation, DNA nucleotides, inverted linkages, etc.), (b) base modifications, e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, removal of bases (abasic nucleotides), or conjugated bases, (c) sugar modifications ⁇ e.g., at the 2' position or 4' position, or having an acyclic sugar) or replacement of the sugar, as well as (d) backbone modifications, including modification or replacement of the phosphodiester linkages.
  • end modifications e.g., 5' end modifications (phosphorylation, conjugation, inverted linkages, etc.) 3' end modifications (conjugation, DNA nucleotides, inverted linkages, etc.
  • base modifications e.g., replacement with stabilizing bases, destabilizing bases, or
  • RNA compounds useful in this invention include, but are not limited to RNAs containing modified backbones or no natural internucleoside linkages.
  • RNAs having modified backbones include, among others, those that do not have a phosphorus atom in the backbone.
  • modified RNAs that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides.
  • the modified RNA will have a phosphorus atom in its intemucieoside backbone.
  • Modified RNA backbones include, for example, phosphorothioates, chiral
  • phosphorothioates phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and
  • aminoalkylphosphoramidates aminoalkylphosphoramidates , thionophosphoramidates, thionoalkylphosphonates ,
  • thionoalkylphosphotriesters having normal 3 -5' linkages, 2'-5' linked analogs of these, and those) having inverted polaiity wherein the adjacent pairs of nucleoside units are linked 3 -5' to 5'-3' or 2 -5' to 5 -2'.
  • Various salts, mixed salts and free acid forms are also included.
  • Modified RNA backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl intemucieoside linkages, mixed heteroatoms and alkyl or cycloalkyl intemucieoside linkages, or one or more short chain heteroatomic or heterocyclic intemucieoside linkages.
  • morpholino linkages formed in part from the sugar portion of a nucleoside
  • siioxane backbones siioxane backbones
  • sulfide, sulfoxide and sulfone backbones formacetyl and thiotormacetyl backbones
  • methylene formacetyl and thioformacetyl backbones alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH 2 component parts.
  • RNA mimetics suitable or contemplated for use in iRNAs both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups.
  • the base units are maintained for hybridization with an appropriate nucleic acid target compound.
  • One such oligomeric compound, an RNA mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA).
  • PNA peptide nucleic acid
  • the sugar backbone of an RNA is replaced with an amide containing backbone, in particular an aminoethylglycine backbone.
  • the nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone.
  • Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat.
  • RNAs with phosphorothioate backbones and oligonucleosides with heteroatom backbones and in particular— CH 2 ⁇ NH— CH 2 ⁇ , --CH 2 --N(CH 3 )--0--CH 2 --[known as a methylene (methylimino) or MMI backbone], ⁇ CH 2 -0- -N(CH 3 ) ⁇ CH 2 ⁇ , -CH2-N(CH 3 ) ⁇ N(CH 3 ) ⁇ CH2 ⁇ and -N(CH 3 )-CH2-CH 2 ⁇ fwherein the native phosphodiester backbone is represented as ⁇ 0— P—O—CH?—] of the above-referenced U.S. Pat. No.
  • RNAs featured herein have morpholino backbone structures of the above-referenced U.S. Pat. No. 5,034,506.
  • Modified RNAs may also contain one or more substituted sugar moieties.
  • the iRNAs, e.g., dsRNAs, featured herein can include one of the following at the 2' position: OH; F; 0-, S-, or N-alkyl; 0-, S-, or N-alkenyl; 0-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted Ci to Cio alkyl or C 2 to Cio alkenyl and alkynyl.
  • Exemplary suitable modifications include Of(CH?) n O] m CH 3 , 0(CH 2 ).,iOCH3,
  • n and m are from 1 to about 10.
  • dsRNAs include one of the following at the 2' position: Q to Cjo lower alkyl, substituted lower alkyl, aikaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH 3 , OCN, CI, Br, CN, CF 3 , OCF 3 , SOCH 3 , S0 2 CH 3 , ON0 2 , N0 2 , N 3 , NH 2 ,
  • heterocycloalkyl heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the
  • the modification includes a 2'-methoxyethoxy (2'-0— CH 2 CH 2 OCH , also known as 2'-0-(2- methoxyethyl) or 2'-MOE) (Martin et al, Helv. Chim. Acta, 1995, 78:486-504) i.e., an alkoxy- alkoxy group.
  • a 2'-methoxyethoxy 2'-0— CH 2 CH 2 OCH , also known as 2'-0-(2- methoxyethyl) or 2'-MOE) (Martin et al, Helv. Chim. Acta, 1995, 78:486-504)
  • Another exemplary modification is 2'-dimethylaminooxyethoxy, i.e., a
  • 0(CH 2 ) 2 ON(CFi 3 )2 group also known as 2'-DMAOE, as described in examples herein below
  • 2'-dimethylaminoethoxyethoxy also known in the art as 2'-0-dimethylaminoethoxyethyl or 2 -DMAEOE
  • 2'-0--CH 2 --0--CH 2 --N(CH 2 ) 2 also described in examples herein below.
  • an iRNA agent comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) acyclic nucleotides (or nucleosides).
  • the sense strand or the antisense strand, or both sense strand and antisense strand include less than five acyclic nucleotides per strand (e.g., four, three, two or one acyclic nucleotides per strand).
  • the one or more acyclic nucleotides can be found, for example, in the double-stranded region, of the sense or antisense strand, or both strands; at the 5'-end, the 3'-end, both of the 5' and 3'-ends of the sense or antisense strand, or both strands, of the iRNA agent. In one embodiment, one or more acyclic nucleotides are present at positions 1 to 8 of the sense or antisense strand, or both. In one embodiment, one or more acyclic nucleotides are found in the antisense strand at positions 4 to 10 (e.g., positions 6-8) from the 5'-end of the antisense strand. In another embodiment, the one or more acyclic nucleotides are found at one or both 3'-terminai overhangs of the iRNA agent.
  • acyclic nucleotide or "acyclic nucleoside” as used herein refers to any nucleotide or nucleoside having an acyclic sugar, e.g., an acyclic ribose.
  • An exemplary acyclic nucleotide or nucleoside can include a nucleobase, e.g., a naturally-occurring or a modified nucleobase (e.g., a nucleobase as described herein).
  • a bond between any of the ribose carbons (CI, C2, C3, C4, or C5), is independently or in combination absent from the nucleotide.
  • the bond between C2-C3 carbons of the ribose ring is absent, e.g., an acyclic 2'-3'-seco-nucleotide monomer.
  • the bond between C1-C2, C3-C4, or C4-C5 is absent ⁇ e.g., a V- , 3 -4' or 4'-5'-seco nucleotide monomer).
  • Exemplary acyclic nucleotides are disclosed in US 8,314,227, incorporated herein by reference in its entirely.
  • an acyclic nucleotide can include any of monomers D-J in Figures 1-2 of US 8,314,227.
  • the acyclic nucleotide includes the following monomer:
  • Base is a nucleobase, e.g., a naturally-occurring or a modified nucleobase (e.g., a nucleobase as described herein).
  • the acyclic nucleotide can be modified or derivatized, e.g., by coupling the acyclic nucleotide to another moiety, e.g., a ligand (e.g. , a GalNAc, a cholesterol ligand), an alkyl, a polyamine, a sugar, a polypeptide, among others.
  • a ligand e.g. , a GalNAc, a cholesterol ligand
  • the iRNA agent includes one or more acyclic nucleotides and one or more LNAs (e.g., an LNA as described herein).
  • one or more acyclic nucleotides and/or one or more LNAs can be present in the sense strand, the antisense strand, or both.
  • the number of acyclic nucleotides in one strand can be the same or different from the number of LNAs in the opposing strand.
  • the sense strand and/or the antisense strand comprises less than five LNAs (e.g., four, three, two or one LNAs) located in the double- stranded region or a 3' -overhang, In other embodiments, one or two LNAs are located in the double stranded region or the 3 '-overhang of the sense strand.
  • the sense strand and/or antisense strand comprises less than five acyclic nucleotides (e.g., four, three, two or one acyclic nucleotides) in the double-stranded region or a 3 '-overhang.
  • the sense strand of the iRNA agent comprises one or two LNAs in the 3'-overhang of the sense strand, and one or two acyclic nucleotides in the double- standed region of the antisense strand (e.g., at positions 4 to 10 (e.g., positions 6-8) from the 5'-end of the antisense strand) of the iRNA agent.
  • inclusion of one or more acyclic nucleotides (alone or in addition to one or more LNAs) in the iRNA agent results in one or more (or ali) of: (i) a reduction in an off-target effect; (ii) a reduction in passenger strand participation in RNAi; (iii) an increase in specificity of the guide strand for its target mRNA; (iv) a reduction in a microRNA off-target effect; (v) an increase in stability; or (vi) an increase in resistance to degradation, of the iRNA molecule.
  • RNA of an iRNA may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar.
  • An iRNA may also include nucleobase (often referred to in the art simply as “base”) modifications or substitutions.
  • nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
  • Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2- aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5- halouracii and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5- uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyi, 8-hydroxyl anal other 8- substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyi and other 5- substituted
  • nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley- VCH, 2008; those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. L, ed. John Wiley & Sons, 1990, these disclosed by Englisch et al, Angewandte Chemie, International Edition, 1991, 30, 613, and those disclosed by Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., Ed., CRC Press, 1993.
  • nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds featured in the invention.
  • These include 5- substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2- aminopropyladenine, 5-propynyluracil and 5-propynylcytosine.
  • 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., Eds., dsRNA Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are exemplary base substitutions, even more particularly when combined with 2'-0-methoxyethyl sugar modifications.
  • RNA of an iRNA can also be modified to include one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) locked nucleic acids (LNA), (also referred to herein as "locked nucleotides”)-
  • LNA locked nucleic acids
  • a locked nucleic acid is a nucleotide having a modified ribose moiety in which the ribose moiety comprises an extra bridge connecting, e.g., the 2' and 4' carbons. This structure effectively "locks" the ribose in the 3'-endo stiaictural conformation.
  • U.S. Patents that teach the preparation of locked nucleic acid nucleotides include, but are not limited to, the following: U.S. Pat. Nos. 6,268,490; 6,670,461 ; 6,794,499; 6,998,484; 7,053.207; 7,084,125; 7,399,845; and 8,314,227, each of which is herein incorporated by reference in its entirety.
  • Exemplary LNAs include but are not limited to, a 2', 4'-C methylene bicyclo nucleotide (see for example Wengel et a!., International PCT Publication No. WO
  • the iRNA agents include one or more (e.g., about 1 , 2, 3, 4, 5, 6, 7,
  • G-clamp nucleotides 8 9, 10, or more G-clamp nucleotides.
  • a G-clamp nucleotide is a modified cytosine analog wherein the modifications confer the ability to hydrogen bond both Watson-Crick and Hoogsteen faces of a complementary guanine within a duplex, see for example Lin and Matteucci, 1998, J.
  • oligonucleotide can result in substantially enhanced helical thermal stability and mismatch discrimination when hybridized to complementary oligonucleotides.
  • the inclusion of such nucleotides in the iRNA molecules can result in enhanced affinity and specificity to nucleic acid targets, complementary sequences, or template strands.
  • RNA molecules can include N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N
  • the sense strand sequence may be represented by formula (I):
  • i and j are each independently 0 or 1;
  • p and q are each independently 0-6;
  • each N a independently represents an oligonucleotide sequence comprising 0-25 modified nucleotides, each sequence comprising at least two differently modified nucleotides;
  • each Nb independently represents an oligonucleotide sequence comprising 0-10 modified nucleotides
  • each li p and n q independently represent an overhang nucleotide
  • Nb and Y do not have the same modification; and XXX, YYY and ZZZ each independently represent one motif of three identical modifications on three consecutive nucleotides.
  • YYY is all 2'-F modified
  • the N a and/or Nb comprise modifications of alternating pattern.
  • the YYY motif occurs at or near the cleavage site of the sense strand.
  • the YYY motif can occur at or the vicinity of the cleavage site (e.g. : can occur at positions 6, 7, 8; 7, 8, 9; 8, 9, 10; 9, 10, 1 1; 10, 1 1 ,12 or 11, 12, 13) of - the sense strand, the count starting from the 1 st nucleotide, from the 5' -end; or optionally, the count starting at the 1 st paired nucleotide within the duplex region, from the 5'- end.
  • the cleavage site e.g. : can occur at positions 6, 7, 8; 7, 8, 9; 8, 9, 10; 9, 10, 1 1; 10, 1 1 ,12 or 11, 12, 13
  • i is 1 and j is 0, or i is 0 and j is 1, or both i and j are 1.
  • the sense strand can therefore be represented by the following formulas:
  • N b represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides.
  • Each N a independently can represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
  • N b represents an oligonucleotide sequence comprising 0- 10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides.
  • Each N a can
  • oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
  • each N b independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides.
  • N b is 0, 1, 2, 3, 4, 5 or 6.
  • Each N a can independently represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
  • Each of X, Y and Z may be the same or different from each other.
  • each N a independently can represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
  • the antisense strand sequence of the RNAi may be represented by formula (II):
  • k and 1 are each independently 0 or 1 ;
  • p' and q' are each independently 0-6;
  • each N a ' independently represents an oligonucleotide sequence comprising 0-25 modified nucleotides, each sequence comprising at least two differently modified nucleotides;
  • each Nb' independently represents an oligonucleotide sequence comprising 0-10 modified nucleotides
  • each n p ' and n q ' independently represent an overhang nucleotide
  • N b ' and Y' do not have the same modification
  • ⁇ ' ⁇ ' ⁇ ', ⁇ ' and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides.
  • the N a ' and/or N ' comprise modifications of alternating pattern.
  • the Y'Y'Y' motif occurs at or near the cleavage site of the antisense strand.
  • the ⁇ ' motif can occur at positions 9, 10, 11 ;10, 1 1, 12; 1 1, 12, 13; 12, 13, 14 ; or 13, 14, 15 of the antisense strand, with the count starting from the 1 nucleotide, from the 5 '-end; or optionally, the count starting at the 1 st paired nucleotide within the duplex region, from the 5'- end.
  • the ⁇ ' ⁇ ' mot j occurs a t positions 11, 12, 13.
  • Y'Y'Y' motif is all 2'-OMe modified nucleotides.
  • k is 1 and 1 is 0, or k is 0 and 1 is 1, or both k and 1 are 1.
  • the antisense strand can therefore be represented by the following formulas:
  • N b represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides.
  • Each N a ' independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
  • N b ' represents an
  • oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides.
  • Each N a ' independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
  • each N b ' independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides.
  • Each N a ' independently represents an oligonucleotide sequence comprising 2-20, 2- 15, or 2-10 modified nucleotides.
  • N b is 0, 1, 2, 3, 4, 5 or 6.
  • k is 0 and 1 is 0 and the antisense strand may be represented by the formula:
  • each N a ' independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
  • Each of X', Y' and Z' may be the same or different from each other.
  • Each nucleotide of the sense strand and antisense strand may be independently modified with LNA, HNA, CeNA, 2'-methoxyethyl, 2'-0-methyI, 2'-0-allyI, 2'-C- allyl, 2'-hydroxyl, or 2'-fluoro.
  • each nucleotide of the sense strand and antisense strand is independently modified with 2'-0-methyI or 2'-fluoro.
  • Each X, Y, Z, X', Y' and Z' in particular, may represent a 2'-0-methyl modification or a 2'-fluoro modification.
  • the sense strand of the RNAi agent may contain YYY motif occurring at 9, 10 and 11 positions of the strand when the duplex region is 21 nt, the count starting from the 1 st nucleotide from the 5 '-end, or optionally, the count starting at the 1 st paired nucleotide within the duplex region, from the 5'- end; and Y represents 2'-F modification.
  • the sense strand may additionally contain XXX motif or ZZZ motifs as wing modifications at the opposite end of the duplex region; and XXX and ZZZ each independently represents a 2'-OMe modification or 2'-F modification.
  • the antisense strand may contain ⁇ ' ⁇ ' motif occurring at positions 11, 12, 13 of the strand, the count starting from the 1 nucleotide from the 5'-end, or optionally, the count starting at the 1 st paired nucleotide within the duplex region, from the 5'- end; and Y' represents 2'-0-methyI modification.
  • the antisense strand may additionally contain X'X3 ⁇ 4' motif or Z'Z'Z' motifs as wing modifications at the opposite end of the duplex region; and X3 ⁇ 4'X' and Z'Z'Z' each independently represents a 2'-OMe modification or 2'-F modification.
  • the sense strand represented by any one of the above formulas (la), (lb), (Ic), and (Id) forms a duplex with a antisense strand being represented by any one of formulas (Ila), (lib), (lie), and (lid), respectively.
  • RNAi agents for use in the methods of the invention may comprise a sense strand and an antisense strand, each strand having 14 to 30 nucleotides, the RNAi duplex represented by formula (III):
  • i, j, k, and 1 are each independently 0 or 1;
  • p, p', q, and q' are each independently 0-6:
  • each N a and N a independently represents an oligonucleotide sequence comprising 0-25 modified nucleotides, each sequence comprising at least two differently modified nucleotides; each N and N b independently represents an oligonucleotide sequence comprising 0-10 modified nucleotides;
  • each n p ', n p , n q ', and n q independently represents an overhang nucleotide
  • XXX, YYY, ZZZ, ⁇ ' ⁇ ' ⁇ ', ⁇ ' ⁇ ', and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides.
  • i is 0 and j is 0; or i is 1 and j is 0; or i is 0 and j is 1 ; or both i and j are 0; or both i and j are 1.
  • k is 0 and I is 0; or k is 1 and I is 0; k is 0 and l is 1 ; or both k and 1 are 0; or both k and 1 are 1.
  • Exemplary combinations of the sense strand and antisense strand forming a RNAi duplex include the formulas below:
  • each N a independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
  • each N b independently represents an oligonucleotide sequence comprising 1-10, 1-7, 1-5 or 1-4 modified nucleotides.
  • Each N a independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
  • each N b , N b ' independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or Omodified nucleotides.
  • Each N a independently represents an oligonucleotide sequence compiising 2-20, 2- 15, or 2-10 modified nucleotides.
  • each N b , N b ' independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or Omodified nucleotides.
  • Each N a , N a independently represents an oligonucleotide sequence comprising 2- 20, 2-15, or 2-10 modified nucleotides.
  • Each of N a , N a ⁇ N b and N independently comprises modifications of alternating pattern.
  • Each of X, Y and Z in formulas (III), (Ilia), (Hlb), (IIIc), and (Hid) may be the same or different from each other.
  • the RNAi agent is represented by formula (III), (Ilia), (IHb), (HIc), and (Hid)
  • at least one of the Y nucleotides may form a base pair with one of the Y' nucleotides.
  • At least two of the Y nucleotides form base pairs with the corresponding Y' nucleotides; or all three of the Y nucleotides all form base pairs with the corresponding Y' nucleotides.
  • RNAi agent When the RNAi agent is represented by formula (IHb) or (Hid), at least one of the Z nucleotides may form a base pair with one of the Z' nucleotides. Alternatively, at least two of the Z nucleotides form base pairs with the corresponding Z' nucleotides; or all three of the Z nucleotides all form base pairs with the corresponding Z' nucleotides.
  • RNAi agent When the RNAi agent is represented as formula (IIIc) or (Hid), at least one of the X nucleotides may form a base pair with one of the X' nucleotides. Alternatively, at least two of the X nucleotides form base pairs with the corresponding X' nucleotides; or all three of the X nucleotides all form base pairs with the corresponding X' nucleotides.
  • the modification on the Y nucleotide is different than the
  • the modification on the Y' nucleotide is different than the modification on the Z' nucleotide
  • the modification on the X nucleotide is different than the modification on the X' nucleotide.
  • the N a modifications are 2 -0-methyl or 2 -fluoro modifications.
  • the N a modifications are 2'-0-methyl or 2'-fluoro modifications and n p ' >0 and at least one n p ' is linked to a neighboring nucleotide a via phosphorothioate linkage.
  • the N a modifications are 2'-0-methyl or 2'-fluoro modifications , n p ' >0 and at least one n p ' is linked to a neighboring nucleotide via phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives attached through a bivalent or trivalent branched linker.
  • the N a modifications are 2'-0-methyl or 2'-fluoro modifications , n p ' >0 and at least one n p ' is linked to a neighboring nucleotide via phosphorothioate linkage, the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives attached through a bivalent or trivalent branched linker.
  • the N u modifications are 2'-0-methyl or 2'-fluoro modifications , n p ' >0 and at least one n p ' is linked to a neighboring nucleotide via phosphorothioate linkage, the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives attached through a bivalent or trivalent branched linker.
  • the RNAi agent is a multimer containing at least two duplexes represented by formula (III), (Ilia), (Illb), (111c), and (Illd), wherein the duplexes are connected by a linker.
  • the linker can be cieavable or non-cleavable.
  • the multimer further comprises a ligand.
  • Each of the duplexes can target the same gene or two different genes; or each of the duplexes can target same gene at two different target sites.
  • the RNAi agent is a multimer containing three, four, five, six or more duplexes represented by formula (III), (Ilia), (Illb), (IIIc), and (IHd), wherein the duplexes are connected by a linker.
  • the linker can be cieavable or non-cleavable.
  • the multimer further comprises a ligand.
  • Each of the duplexes can target the same gene or two different genes; or each of the duplexes can target same gene at two different target sites.
  • two RNAi agents represented by formula (111), (Ilia), (Illb), (IIIc), and (Illd) are linked to each other at the 5' end, and one or both of the 3' ends and are optionally conjugated to to a ligand.
  • Each of the agents can target the same gene or two different genes; or each of the agents can target same gene at two different target sites.
  • the iRNA agents disclosed herein can be in the form of conj gates.
  • the conjugate may be attached at any suitable location in the iRNA molecule, e.g., at the 3' end or the 5' end of the sense or the antisense strand.
  • the conjugates are optionally attached via a linker.
  • an iRNA agent described herein is chemically linked to one or more ligands, moieties or conjugates, which may confer functionality, e.g., by affecting (e.g., enhancing) the activity, cellular distribution or cellular uptake of the iRNA.
  • moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acid. Sci, USA, 1989, 86: 6553-6556), cholic acid (Manoharan et al., Biorg. Med, Chem.
  • a thioether e.g., beryi-S-tritylthiol (Manoharan et al, Ann, N. Y. Acad. Sci, 1992, 660:306-309; Manoharan et al, Biorg. Med. Chem. Let., 1993, 3:2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533-538), an aliphatic chain, e.g., dodecandioi or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10: 1111-1118;
  • a phospholipid e.g., di-hexadecyl-rac-glycerol or trie thyl- ammonium 1,2-di-O-hexadecyl-rac- glycero-3-phosphonate (Manoharan et al.. Tetrahedron Lett., 1995, 36:3651 -3654; Shea et al., Nucl.
  • Acids Res., 1990, 18:3777-3783 a olyamine or a polyethylene glycol chain (Manoharan et al, Nucleosides & Nucleotides, 1995, 14:969-973), or adamantane acetic acid (Manoharan et al.. Tetrahedron Lett., 1995, 36:36 1 -3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229-237), or an octadecylamine or hexyiamino-carbonyloxycholesterol moiety (Crooke et al, ./. Pharmacol. Exp. Ther. , 1996, 277:923-937).
  • a ligand alters the distribution, targeting or lifetime of an iRNA agent into which it is incorporated.
  • a ligand provides an enhanced affinity for a selected target, e.g, molecule, cell or cell type, compartment, e.g., a cellular or organ compartment, tissue, organ or region of the body, as, e.g., compared to a species absent such a ligand.
  • Typical ligands will not take part in duplex pairing in a duplexed nucleic acid.
  • Ligands can include a naturally occurring substance, such as a protein (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulin); carbohydrate (e.g., a dextran, potulan, chitin, chitosan, inulin, cyciodextrin or hyaluronic acid); or a lipid.
  • HSA human serum albumin
  • LDL low-density lipoprotein
  • globulin carbohydrate
  • carbohydrate e.g., a dextran, memelulan, chitin, chitosan, inulin, cyciodextrin or hyaluronic acid
  • the ligand may also be a recombinant or synthetic molecule, such as a synthetic polymer, e.g., a synthetic polyamino acid.
  • polyamino acids examples include polyamino acid is a polylysine (PLL), poly L-aspartic acid, poly L-glutamic acid, styrene-maleic acid anhydride copolymer, poly(L- lactide-co-glycolied) copolymer, divinyl ether-maleic anhydride copolymer, N-(2- hydroxypropyi)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacryliic acid), N-isopropylacrylamide polymers, or polyphosphazine.
  • PLL polylysine
  • poly L-aspartic acid poly L-glutamic acid
  • styrene-maleic acid anhydride copolymer poly(L- lactide-co-glycolied) copolymer
  • divinyl ether-maleic anhydride copolymer divinyl
  • Example of poiyamines include: polyeth lenimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, quaternary salt of a polyamine, or an a helical peptide.
  • PLL polylysine
  • spermine spermine
  • spermidine polyamine
  • polyamine pseudopeptide-polyamine
  • peptidomimetic polyamine dendrimer polyamine
  • arginine amidine
  • protamine cationic lipid
  • cationic porphyrin quaternary salt of a polyamine
  • quaternary salt of a polyamine or an a helical peptide.
  • Ligands can also include targeting groups, e.g., a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody, that binds to a specified cell type such as a kidney cell.
  • a cell or tissue targeting agent e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody, that binds to a specified cell type such as a kidney cell.
  • a targeting group can be a thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, Mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl- gaiactos amine, N-acetyl-gulucosamine multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate, polyglutamate,
  • polyaspartate a lipid, cholesterol, a steroid, bile acid, folate, vitamin B 12, biotin, or an RGD peptide or RGD peptide mimetic.
  • the ligand is a GalNAc ligand that comprises one or more N- acetylgaiactosamine (GalNAc) derivatives. Additional description of GalNAc ligands is provided in the section titled Carbohydrate Conjugates.
  • ligands include dyes, intercalating agents (e.g. acridines), cross-linkers (e.g. psoralene, mitomycin C), porphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g.
  • intercalating agents e.g. acridines
  • cross-linkers e.g. psoralene, mitomycin C
  • porphyrins TPPC4, texaphyrin, Sapphyrin
  • polycyclic aromatic hydrocarbons e.g., phenazine, dihydrophenazine
  • artificial endonucleases e.g.
  • EDTA lipophilic molecules, e.g, cholesterol, cholic acid, adamantane acetic acid, 1 -pyrene butyric acid, dihydrotestosterone, l,3-Bis-0(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglvcerol, borneol, menthol, 1 ,3-propanediol, heptadecyl group, palmitic acid, myristic acid,03- (oleoyl)lithocholic acid, 03-(oleoyl)cholenic acid, dimethoxytntyl, or phenoxazine)and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG] 2 , polyamino
  • biotin e.g., aspirin, vitamin E, folic acid
  • transport/absorption facilitators e.g., aspirin, vitamin E, folic acid
  • synthetic ribonucleases e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl, HRP, or AP.
  • Ligands can be proteins, e.g., glycoproteins, or peptides, e.g., molecules having a specific affinity for a co-ligand, or antibodies e.g. , an antibody, that binds to a specified cell type such as a cancer cell, endothelial cell, or bone cell.
  • Ligands may also include hormones and hormone receptors. They can also include non-peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl- gulucosamine multivalent mannose, or multivalent fucose.
  • the ligand can be, for example, a lipopolysaccharide, an activator of p38 MAP kinase, or an activator of NF- B.
  • the ligand can be a substance, e.g, a ding, which can increase the uptake of the iRNA agent into the cell, for example, by disrupting the cell's cytoskeleton, e.g., by disrupting the cell's microtubules, microfilaments, and/or intermediate filaments.
  • the drug can be, for example, taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin.
  • a ligand attached to an iRNA as described herein acts as a pharmacokinetic modulator (PK modulator).
  • PK modulators include lipophiles, bile acids, steroids, phospholipid analogues, peptides, protein binding agents, PEG, vitamins etc.
  • Exemplary PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglyceride, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin etc.
  • Oligonucleotides that comprise a number of phosphorothioate linkages are also known to bind to serum protein, thus short oligonucleotides, e.g., oligonucleotides of about 5 bases, 10 bases, 15 bases or 20 bases, comprising multiple of phosphorothioate linkages in the backbone are also amenable to the present invention as ligands (e.g. as PK modulating ligands).
  • ligands e.g. as PK modulating ligands
  • aptamers that bind serum components are also suitable for use as PK modulating ligands in the embodiments described herein.
  • Ligand-conjugated oligonucleotides of the invention may be synthesized by the use of an oligonucleotide that bears a pendant reactive functionality, such as that derived from the attachment of a linking molecule onto the oligonucleotide (described below).
  • This reactive oligonucleotide may be reacted directly with commercially-available ligands, ligands that are synthesized bearing any of a variety of protecting groups, or ligands that have a linking moiety attached thereto.
  • oligonucleotides used in the conjugates of the present invention may be conveniently and routinely made through the well-known technique of solid-phase synthesis.
  • Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is also known to use similar techniques to prepare other
  • oligonucleotides such as the phosphorothioates and alkylated derivatives.
  • the oligonucleotides and oligonucleosides may be assembled on a suitable DNA synthesizer utilizing standard nucleotide or nucleoside precursors, or nucleotide or nucleoside conj gate precursors that already bear the linking moiety, ligand- nucleotide or nucleoside-conj gate precursors that already bear the ligand molecule, or non- nucleoside ligand-bearing building blocks.
  • the oligonucleotides or linked nucleosides of the present invention are synthesized by an automated synthesizer using phosphoramidites derived from ligand-nucleoside conjugates in addition to the standard phosphoramidites and non-standard phosphoramidites that are commercially available and routinely used in oligonucleotide synthesis.
  • the ligand is a lipid or Mpid-based molecule.
  • a lipid or lipid- based molecule can typically bind a serum protein, such as human serum albumin (HSA).
  • HSA human serum albumin
  • An HSA binding ligand allows for distribution of the conjugate to a target tissue, e.g., a non-kidney target tissue of the body.
  • the target tissue can be the liver, including parenchymal cells of the liver.
  • Other molecules that can bind HSA can also be used as ligands. For example, neproxin or aspirin can be used.
  • a lipid or lipid-based ligand can (a) increase resistance to degradation of the conjugate, (b) increase targeting or transport into a target cell or cell membrane, and/or (c) can be used to adjust binding to a serum protein, e.g., HSA.
  • a serum protein e.g., HSA.
  • a lipid based ligand can be used to modulate, e.g., control (e.g., inhibit) the binding of the conjugate to a target tissue.
  • control e.g., inhibit
  • a lipid or lipid-based ligand that binds to HSA more strongly will be less likely to be targeted to the kidney and therefore less likely to be cleared from the body.
  • a lipid or lipid-based ligand that binds to HSA less strongly can be used to target the conjugate to the kidney.
  • the lipid based ligand binds HSA.
  • the ligand can bind HSA with a sufficient affinity such that distribution of the conjugate to a non-kidney tissue is enhanced.
  • the affinity is typically not so strong that the HSA-ligand binding cannot be reversed.
  • the lipid based ligand binds HSA weakly or not at all, such that distribution of the conjugate to the kidney is enhanced.
  • Other moieties that target to kidney cells can also be used in place of or in addition to the lipid based ligand.
  • the ligand is a moiety, e.g., a vitamin, which is taken up by a target cell, e.g., a proliferating cell.
  • a target cell e.g., a proliferating cell.
  • vitamins include vitamin A, E, and K.
  • Other exemplary vitamins include are B vitamin, e.g., folic acid, B12, riboflavin, biotin, pyridoxal or other vitamins or nutrients taken up by cancer cells.
  • the iigand is a cell-permeation agent, such as a helical cell-permeation agent.
  • the agent is amphipathic.
  • An exemplary agent is a peptide such as tat or antennopedia. If the agent is a peptide, it can be modified, including a peptidylmimetic, invertomers, non-peptide or pseudo-peptide linkages, and use of D-amino acids.
  • the helical agent is typically an -helical agent, and can have a lipophilic and a lipophobic phase.
  • the ligand can be a peptide or peptidomimetic.
  • a peptidomimetic also referred to herein as an oligopeptidomimetic is a molecule capable of folding into a defined three- dimensional structure similar to a natural peptide. The attachment of peptide and
  • peptidomimetics to iRNA agents can affect pharmacokinetic distribution of the iRNA, such as by enhancing cellular recognition and absorption.
  • the peptide or peptidomimetic moiety can be about 5-50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long.
  • a peptide or peptidomimetic can be, for example, a cell permeation peptide, cationic peptide, amphipathic peptide, or hydrophobic peptide (e.g., consisting primarily of Tyr, Tip or Phe).
  • the peptide moiety can be a dendrimer peptide, constrained peptide or crosslinked peptide.
  • the peptide moiety can include a hydrophobic membrane translocation sequence (MTS).
  • An exemplary hydrophobic MTS-containing peptide is RFGF having the amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO:3367).
  • An RFGF analogue e.g., amino acid sequence AALLPVLLAAP (SEQ ID NO:3368)
  • a hydrophobic MTS can also be a targeting moiety.
  • the peptide moiety can be a "delivery' * peptide, which can carry large polar molecules including peptides, oligonucleotides, and protein across cell membranes. For example, sequences from the HIV Tat protein
  • a peptide or peptidomimetic can be encoded by a random sequence of DNA, such as a peptide identified from a phage -display library, or one-bead-one-compound (OBOC) combinatorial library (Lam et al., Nature, 354:82-84, 1991).
  • OBOC one-bead-one-compound
  • the peptide or peptidomimetic tethered to a dsRNA agent via an incorporated monomer unit is a cell targeting peptide such as an arginine-glycine-aspartic acid (RGD)-peptide, or RGD mimic.
  • RGD arginine-glycine-aspartic acid
  • a peptide moiety can range in length from about 5 amino acids to about 40 amino acids.
  • the peptide moieties can have a structural modification, such as to increase stability or direct conformational properties. Any of the structural modifications described below can be utilized.
  • RGD peptide for use in the compositions and methods of the invention may be linear or cyclic, and may be modified, e.g., glycosylated or methylated, to facilitate targeting to a specific tissue(s).
  • RGD-containing peptides and peptidiomimemtics may include D-amino acids, as well as synthetic RGD mimics.
  • An RGD peptide moiety can be used to target a particular cell type, e.g., a tumor cell, such as an endothelial tumor cell or a breast cancer tumor cell (Zitzmann et al., Cancer Res., 62:5139-43, 2002).
  • a tumor cell such as an endothelial tumor cell or a breast cancer tumor cell
  • An RGD peptide can facilitate targeting of a dsRNA agent to tumors of a variety of other tissues, including the lung, kidney, spleen, or liver (Aoki et al., Cancer Gene Therapy 8:783-787, 2001).
  • the RGD peptide will facilitate targeting of an iRNA agent to the kidney.
  • the RGD peptide can be linear or cyclic, and can be modified, e.g., glycosylated or methylated to facilitate targeting to specific tissues.
  • a glycosylated RGD peptide can deliver an iRNA agent to a tumor cell expressing ⁇ (Haubner et al.. Jour. Nucl. Med., 42:326-336, 2001).
  • a "cell permeation peptide” is capable of permeating a cell, e.g., a microbial cell, such as a bacterial or fungal cell, or a mammalian cell, such as a human cell.
  • a microbial cell- permeating peptide can be, for example, an a-helical linear peptide (e.g., LL-37 or Ceropin PI), a disulfide bond-containing peptide (e.g., -defensin, ⁇ -defensin or bactenecin), or a peptide containing only one or two dominating amino acids (e.g., PR-39 or indolicidin).
  • a cell permeation peptide can also include a nuclear localization signal (NLS).
  • NLS nuclear localization signal
  • a cell permeation peptide can be a bipartite amphipathic peptide, such as MPG, which is derived from the fusion peptide domain of HIV- 1 gp41 and the NLS of SV40 large T antigen (Simeoni et al., Nucl. Acids Res. 31 :2717-2724, 2003).
  • MPG nuclear localization signal
  • an iRNA oligonucleotide further comprises a carbohydrate.
  • the carbohydrate conjugated iRNA are advantageous for the in vivo delivery of nucleic acids, as well as compositions suitable for in vivo therapeutic use, as described herein.
  • carbohydrate refers to a compound which is either a carbohydrate per se made up of one or more monosaccharide units having at least 6 carbon atoms (which can be linear, branched or cyclic) with an oxygen, nitrogen or sulfur atom bonded to each carbon atom; or a compound having as a part thereof a carbohydrate moiety made up of one or more monosaccharide units each having at least six carbon atoms (which can be lineai", branched or cyclic), with an oxygen, nitrogen or sulfur atom bonded to each carbon atom.
  • Representative carbohydrates include the sugars (mono-, di-, tri- and oligosaccharides containing from about 4, 5, 6, 7, 8, or 9 monosaccharide units), and polysaccharides such as starches, glycogen, cellulose and polysaccharide gums.
  • Specific monosaccharides include C5 and above (e.g., C5, C6, C7, or C8) sugars; di- and trisaccharides include sugars having two or three monosaccharide units (e.g., C5, C6, C7, or C8).
  • a carbohydrate conjugate comprises a monosaccharide.
  • the monosaccharide is an N-acetylgalactosamine (GalNAc).
  • GalNAc conjugates are described, for example, in U.S. Patent No. 8,106,022, the entire content of which is hereby incorporated herein by reference.
  • the GalNAc conjugate serves as a ligand that targets the iRNA to particular cells.
  • the GalNAc conjugate targets the iRNA to liver cells, e.g., by serving as a ligand for the asialoglycoprotein receptor of liver cells (e.g., hepatocytes).
  • the carbohydrate conjugate comprises one or more GalNAc derivatives.
  • the GalNAc derivatives may be attached via a linker, e.g., a bivalent or trivalent branched linker.
  • the GalNAc conjugate is conjugated to the 3' end of the sense strand,
  • the GalNAc conjugate is conjugated to the iRNA agent (e.g., to the 3' end of the sense strand) via a linker, e.g., a linker as described herein.
  • the GalNAc conjugate is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl
  • the RNAi agent is attached to the carbohydrate conjugate via a linker as shown in the following schematic, wherein X is O or S
  • the RNAi agent is conjugated to L96 as defined in Table 1 and shown below
  • a carbohydrate conjugate for use in the compositions and methods of the invention is selected from the group consisting of:
  • Formula XIX, Formula XX, Another representative carbohydrate conjugate for use in the embodiments described herein includes, but is not limited to.
  • the carbohydrate conjugate further comprises one or more additionai ligands as described above, such as, but not limited to, a PK modulator and/or a cell permeation peptide.
  • an iRNA of the invention is conjugated to a carbohydrate through a linker.
  • iRNA carbohydrate conjugates with linkers of the compositions and methods of the invention include, but are not limited to,
  • the conj gate or ligand described herein can be attached to an iRNA oligonucleotide with various linkers that can be cleavable or non-cleavable.
  • linker or “linking group” means an organic moiety that connects two parts of a compound, e.g., covalentiy attaches two parts of a compound.
  • Linkers typically comprise a direct bond or an atom such as oxygen or sulfur, a unit such as NR8, C(O), C(0)NH, SO, S0 2 , S0 2 NH or a chain of atoms, such as, but not limited to, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arvlalkyl, aryl alkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl,
  • alkylheteroarylalkyl aikylheteroarylalkenyl, alkylheteroarylalkynyl, aikenylheteroarylalkyl, alkenylheteroarylalkenyl, alkenylheteroarylalkynyl, alkynylheteroarylalkyl, aikynylheteroarylaikenyi , alkynylheteroaryl alkynyl , alkylheterocyclylalkyl ,
  • alkenylheterocyclylalkenyl alkenylheterocyclylalkynyl, alkynylheterocyc alkyl,
  • alkynylheterocyclylalkenyi alkynylheterocyclylalkynyl, alkylaryl, alkenylaryl, alkynylaryl, alkylheteroaryl, alkenylheteroaryl, alkynylhereroaryl, which one or more methylenes can be interrupted or terminated by O, S, S(O), S0 2 , N(R8), C(O), substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocyclic; where R8 is hydrogen, acyl, aliphatic or substituted aliphatic, hi one embodiment, the linker is between about 1-24 atoms, 2-24, 3-24, 4-24, 5-24, 6-24, 6-18, 7-18, 8-18 atoms, 7-17, 8-17, 6-16, 7-16, or 8-16 atoms.
  • a dsRNA of the invention is conjugated to a bivalent or trivalent branched linker selected from the group of structures shown in any of formula (XXXI) - (XXXIV):
  • q2A, q2B, q3A, q3B, q4A, q4B, q5A, q5B and q5C represent independently for each occurrence 0-20 and wherein the repeating unit can be the same or different; 2B n 3A T,3B ⁇ ->4 ⁇ n 4B ⁇ n 5B n 5C 2. ⁇ ⁇ 2 ⁇ rp3A rp3B rp4A rp4B
  • P 2 , P B , P JA , ⁇ , ⁇ , P 4A , ⁇ 4 ⁇ , P 3A , P JB , P ⁇ , T / ⁇ T ts , T JA , r", A , ⁇ 4 ⁇ , A , n5B rp5C are each independently for each occurrence absent, CO, NH, O, S, OC(O), NHC(O), CH 2 , CH 2 NH or CH 2 0;
  • Q 2 ⁇ Q 2B , Q 'A , Q 3B , Q 4A , Q 4B , Q 5A , Q 5B , Q 5C are independently for each occurrence absent, alkylene, substituted alkylene wherin one or more methylenes can be interrupted or terminated by one or more of O, S, S(O), S0 2 , N(R N ), C(R C(R"), C ⁇ C or C(O);
  • R 2A , R 2B , R 3A , R 3B , R 4A , R 4B , R 5A , R 5B , R 5C are each independently for each occurrence absent,
  • L 2A , L 2B , L 3A , L 3B , L 4A , L 4B , L 5A , L 5B and L 5C represent the ligand; i. e. each independently for each occurrence a monosaccharide (such as GalNAc), disaccharide, trisaccharide,
  • RNAi agents for inhibiting the expression of a target gene, such as those of formula (XXXV):
  • L , L and L represent a monosaccharide, such as GalNAc derivative.
  • suitable bivalent and trivalent branched linker groups conjugating GalNAc derivatives include, but are not limited to, the structures recited above as formulas II, VII, XI, X, and XIII.
  • a cleavable linking group is one which is sufficiently stable outside the cell, but which upon entry into a target cell is cleaved to release the two parts the linker is holding together.
  • the cleavable linking group is cleaved at least about 10 times, 20, times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times or more, or at least about 100 times faster in a target cell or under a first reference condition (which can, e.g., be selected to mimic or represent intracellular conditions) than in the blood of a subject, or under a second reference condition (which can, e.g., be selected to mimic or represent conditions found in the blood or serum).
  • a first reference condition which can, e.g., be selected to mimic or represent intracellular conditions
  • a second reference condition which can, e.g., be selected to mimic or represent conditions found in the blood or serum.
  • Cleavable linking groups are susceptible to cleavage agents, e.g., pH, redox potential or the presence of degradative molecules. Generally, cleavage agents are more prevalent or found at higher levels or activities inside cells than in serum or blood. Examples of such degradative agents include: redox agents which are selected for particular substrates or which have no substrate specificity, including, e.g., oxidative or reductive enzymes or reductive agents such as mercaptans, present in cells, that can degrade a redox cleavable linking group by reduction; esterases; endosomes or agents that can create an acidic environment, e.g., those that result in a pH of five or lower; enzymes that can hydrolyze or degrade an acid cleavable linking group by acting as a general acid, peptidases (which can be substrate specific), and phosphatases.
  • redox agents which are selected for particular substrates or which have no substrate specificity, including, e.g.,
  • a cleavable linkage group such as a disulfide bond can be susceptible to pH.
  • the pH of human serum is 7.4, while the average intracellular pH is slightly lower, ranging from about 7.1 - 7.3.
  • Endosomes have a more acidic pH, in the range of 5.5-6.0, and lysosomes have an even more acidic pH at around 5.0.
  • Some linkers will have a cleavable linking group that is cleaved at a preferred pH, thereby releasing a cationic lipid from the ligand inside the cell, or into the desired compartment of the cell.
  • a linker can include a cleavable linking group that is cleavable by a particular enzyme.
  • the type of cleavable linking group incorporated into a linker can depend on the cell to be targeted.
  • a liver-targeting ligand can be linked to a cationic lipid through a linker that includes an ester group.
  • Liver cells are rich in esterases, and therefore the linker will be cleaved more efficiently in liver cells than in cell types that are not esterase-rich.
  • Other cell- types rich in esterases include cells of the lung, renal cortex, and testis.
  • Linkers that contain peptide bonds can be used when targeting cell types rich in peptidases, such as liver cells and synoviocytes.
  • the suitability of a candidate cleavable linking group can be evaluated by testing the ability of a degradative agent (or condition) to cleave the candidate linking group. It will also be desirable to also test the candidate cleavable linking group for the ability to resist cleavage in the blood or when in contact with other non-target tissue.
  • a degradative agent or condition
  • the candidate cleavable linking group for the ability to resist cleavage in the blood or when in contact with other non-target tissue.
  • the evaluations can be carried out in cell free systems, in cells, in cell culture, in organ or tissue culture, or in whole animals.
  • useful candidate compounds are cleaved at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood or serum (or under in vitro conditions selected to mimic extracellular conditions).
  • a cleavable linking group is a redox cleavable linking group that is cleaved upon reduction or oxidation.
  • An example of reductivelv cleavable linking group is a disulphide linking group (-S-S-).
  • a candidate can be evaluated by incubation with dithiothreitol (DTT), or other reducing agent using reagents know in the art, which mimic the rate of cleavage which would be observed in a cell, e.g., a target cell.
  • the candidates can also be evaluated under conditions which are selected to mimic blood or serum conditions.
  • candidate compounds are cleaved by at most about 10% in the blood.
  • useful candidate compounds are degraded at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood (or under in vitro conditions selected to mimic extracellular conditions).
  • the rate of cleavage of candidate compounds can be determined using standard enzyme kinetics assays under conditions chosen to mimic intracellular media and compared to conditions chosen to mimic extracellular media. Phosphate-based cleavabie linking groups
  • a cleavabie linker comprises a phosphate-based cleavabie linking group.
  • a phosphate-based cleavabie linking group is cleaved by agents that degrade or hydrolyze the phosphate group.
  • An example of an agent that cleaves phosphate groups in cells are enzymes such as phosphatases in cells.
  • phosphate-based linking groups are -O- P(0)(ORk)-0-, -0-P(S)(ORk)-0-, -0-P(S)(SRk)-0, -S-P(0)(ORk)-0-, -0-P(0)(ORk)-S-, -S- P(0)(ORk)-S-, -0-P(S)(ORk)-S-, -S-P(S)(ORk)-0-, -0-P(0)(Rk)-0-, -0-P(S)(Rk)-0-, -S- P(0)(Rk)-CK -S-P(S)(Rk)-0-, -S-P(0)(Rk)-S-, -0-P(S)( Rk)-S-.
  • Preferred embodiments are -O- P(0)(OH)-0-, -0-P(S)(OH)-0-, -0-P(S)(SH)-0-, -S-P(0)(OH)-0-, -0-P(0)(OH)-S-, -S- P(0)(OH)-S-, -0-P(S)(OH)-S-, -S-P(S)(OH)-0-, -0- ⁇ (0)( ⁇ )-0-, -0-P(S)(H)-0-, -S-P(0)(H)-0, -S-P(S)(H)-0-, -S-P(0)(H)-S-, -0-P(S)(H)-S-.
  • a preferred embodiment is -0-P(0)(OH)-0-.
  • a cleavabie linker comprises an acid cleavabie linking group.
  • An acid cleavabie linking group is a linking group that is cleaved under acidic conditions.
  • acid cleavabie linking groups are cleaved in an acidic environment with a pH of about 6.5 or lower (e.g., about 6.0, 5.75, 5.5, 5.25, 5.0, or lower), or by agents such as enzymes that can act as a general acid.
  • specific low pH organelles such as endosomes and lysosomes can provide a cleaving environment for acid cleavabie linking groups.
  • Acid cleavabie linking groups include but are not limited to hydrazones, esters, and esters of amino acids.
  • a preferred embodiment is when the carbon attached to the oxygen of the ester (the aikoxy group) is an aryi group, substituted alkyl group, or tertiary alkyl group such as dimethyl pentyl or t-butyl.
  • a cleavabie linker comprises an ester-based cleavabie linking group.
  • An ester-based cleavabie linking group is cleaved by enzymes such as esterases and amidases in cells.
  • Examples of ester-based cleavabie linking groups include but are not limited to esters of alkylene, alkenylene and aikynylene groups.
  • Ester cleavabie linking groups have the general formula -C(0)0-, or -OC(O)-. These candidates can be evaluated using methods analogous to those described above. Peptide- based cleavable linking groups
  • a cleavable linker comprises a peptide-based cleavable linking group.
  • a peptide-based cleavable linking group is cleaved by enzymes such as peptidases and proteases in cells.
  • Peptide-based cleavable linking groups are peptide bonds formed between amino acids to yield oligopeptides (e.g., dipeptides, tripeptides etc.) and polypeptides.
  • Peptide-based cleavable groups do not include the amide group (-C(O)NH-).
  • the amide group can be formed between any alkylene, alkenylene or alkynelene.
  • a peptide bond is a special type of amide bond formed between amino acids to yield peptides and proteins.
  • the peptide based cleavage group is generally limited to the peptide bond (i.e., the amide bond) formed between amino acids yielding peptides and proteins and does not include the entire amide functional group.
  • Peptide-based cleavable linking groups have the general formula - NHCHRAC(0)NHCHRBC(0)-, where RA and RB are the R groups of the two adjacent amino acids. These candidates can be evaluated using methods analogous to those described above.
  • RNA conjugates include, but are not limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541 ,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731 ; 5,591 ,584; 5, 109,124; 5,118,802; 5, 138,045; 5,414,077;
  • the present invention also includes iRNA compounds that are chimeric compounds.
  • iRNA compounds e.g., dsRNAs, that contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of a dsRNA compound.
  • dsRNAs typically contain at least one region wherein the RNA is modified so as to confer upon the iRNA increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid.
  • An additional region of the iRNA may serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids.
  • RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of iRNA inhibition of gene expression. Consequently, comparable results can often be obtained with shorter iRNAs when chimeric dsRNAs are used, compared to phosphorothioate deoxy dsRNAs hybridizing to the same target region. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.
  • the RNA of an iRNA can be modified by a non-ligand group.
  • non-ligand molecules have been conjugated to iRNAs in order to enhance the activity, cellular distribution or cellular uptake of the iRNA, and procedures for performing such conjugations are available in the scientific literature.
  • Such non-ligand moieties have included lipid moieties, such as cholesterol (Kubo, T. et al, Biochem. Biophys. Res. Comm., 2007, 365(1 ):54-61; Letsinger et al, Proc. Natl Acad, Sci. USA, 1989, 86:6553), cholic acid
  • a thiocholesterol (Oberhauser et al, Nucl Acids Res., 1992, 20:533), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al, EMBO J., 1991, 10: 111; Kabanov et al, FEBS Lett., 1990, 259:327; Svinarchuk et al, Biochimie, 1993, 75:49), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac- glycero-3-H-phosphonate (Manoharan et al.
  • RNA conjugates have been listed above. Typical conjugation protocols involve the synthesis of an RNAs bearing an aminolinker at one or more positions of the sequence. The amino group is then reacted with the molecule being conjugated using appropriate coupling or activating reagents. The conjugation reaction may be performed either with the RNA still bound to the solid support or following cleavage of the RNA, in solution phase. Purification of the RNA conjugate by HPLC typically affords the pure conjugate.
  • an iRNA to a subject in need thereof can be achieved in a number of different ways. In vivo delivery can be performed directly by administering a composition comprising an iRNA, e.g. a dsRNA, to a subject. Alternatively, delivery can be performed indirectly by administering one or more vectors that encode and direct the expression of the iRNA. These alternatives are discussed further below.
  • any method of delivering a nucleic acid molecule can be adapted for use with an iRNA (see e.g., Akhtar S. and Julian RL. (1992) Trends Cell. Biol. 2(5): 139-144 and
  • WO94/02595 which are incorporated herein by reference in their entireties.
  • the non-specific effects of an iRNA can be minimized by local administration, for example by direct injection or implantation into a tissue (as a non-limiting example, a tumor) or topically administering the preparation.
  • Local administration to a treatment site maximizes local concentration of the agent, limits the exposure of the agent to systemic tissues that may otherwise be harmed by the agent or that may degrade the agent, and permits a lower total dose of the iRNA molecule to be administered.
  • VEGF dsRNA intraocular delivery of a VEGF dsRNA by intra vitreal injection in cynomolgus monkeys (Tolentino, MJ et al (2004) Retina 24: 132-138) and subretinai injections in mice (Reich, SJ., et al (2003) Mol. Vis. 9:210-216) were both shown to prevent neovascularization in an experimental model of age-related macular degeneration, in addition, direct intratumoral injection of a dsRNA in mice reduces tumor volume (Pille, J., et al (2005) Mol.
  • RNA interference has also shown success with local delivery to the CNS by direct injection (Dom, G., et al. (2004) Nucleic Acids 32:e49; Tan, PH., et al (2005) Gene Ther. 12:59-66; Makimura, H., et al (2002) BMC Neurosci.
  • RNA can be modified or alternatively delivered using a drug delivery system; both methods act to prevent the rapid degradation of the dsRNA by endo- and exo-nucleases in vivo.
  • RNA or the pharmaceutical carrier can also permit targeting of the iRNA composition to the target tissue and avoid undesirable off-target effects.
  • iRNA molecules can be modified by chemical conjugation to other groups, e.g., a lipid or carbohydrate group as described herein. Such conjugates can be used to target iRNA to particular cells, e.g., liver cells, e.g., hepatocytes.
  • Such conjugates can be used to target iRNA to particular cells, e.g., liver cells, e.g., hepatocytes.
  • GalNAc conjugates or lipid (e.g., LNP) formulations can be used to target iRNA to particular cells, e.g., liver cells, e.g., hepatocytes.
  • Lipophilic groups such as cholesterol to enhance cellular uptake and prevent degradation.
  • an iRNA directed against ApoB conjugated to a lipophilic cholesterol moiety was injected systemically into mice and resulted in knockdown of apoB mRNA in both the liver and jejunum (Soutschek, J., et al (2004) Nature 432: 173-178).
  • Conjugation of an iRNA to an aptamer has been shown to inliibit tumor growth and mediate tumor regression in a mouse model of prostate cancer (McNamara, JO., et al (2006) Nat. Biotechnol, 24: 1005-1015).
  • the iRNA can be delivered using drug delivery systems such as a nanoparticle, a dendrimer, a polymer, liposomes, or a cationic delivery system.
  • Positively charged cationic delivery systems facilitate binding of an iRNA molecule (negatively charged) and also enhance interactions at the negatively charged cell membrane to permit efficient uptake of an iRNA by the cell.
  • Cationic lipids, dendrimers, or polymers can either be bound to an iRNA, or induced to form a vesicle or micelle (see e.g., Kim SH., et al (2008) Journal of Controlled Release 129(2): 107-116) that encases an iRNA.
  • vesicles or micelles further prevents degradation of the iRNA when administered systemically.
  • Methods for making and administering cationic- iRNA complexes are well within the abilities of one skilled in the art (see e.g., Sorensen, DR., et al (2003) J. Mol, Biol 327:761-766; Vemia, UN., et al (2003) Clin.
  • RNA delivery systems useful for systemic delivery of iRNAs include DOTAP (Sorensen, DR., et al (2003), supra; Verma, UN., et al (2003), supra), Oligofectamine, "solid nucleic acid lipid particles” (Zimmermann, TS., et al (2006) Nature 441: 111-114), cardiolipin (Chien, PY., et al (2005) Cancer Gene Ther. 12:321-328; Pal, A., et al (2005) Int J. Oncol. 26: 1087-1091 ),
  • an iRNA forms a complex with cyclodextrin for systemic administration.
  • Methods for administration and pharmaceutical compositions of iRNAs and cyclodextrins can be found in U.S. Patent No. 7, 427, 605, which is herein incorporated by reference in its entirety.
  • iRNA targeting the ALAS 1 gene can be expressed from transcription units inserted into DNA or RNA vectors ⁇ see, e.g.. Couture, A, et al, TIG. (1996), 12:5-10; Skillern, A., et al, International PCT Publication No. WO 00/22113, Conrad, International PCT Publication No. WO 00/22114. and Conrad, U.S. Pat. No. 6,054,299). Expression can be transient (on the order of hours to weeks) or sustained (weeks to months or longer), depending upon the specific construct used and the target tissue or cell type.
  • transgenes can be introduced as a linear construct, a circular plasmid, or a viral vector, which can be an integrating or non-integrating vector.
  • the transgene can also be constructed to permit it to be inherited as an extrachromosomal plasmid (Gassmann, et al, Proc. Natl. Acad. Set USA ( 1995) 92: 1292).
  • the individual strand or strands of an iRNA can be transcribed from a promoter on an expression vector.
  • two separate strands are to be expressed to generate, for example, a dsRNA
  • two separate expression vectors can be co-introduced (e.g., by transfection or infection) into a target cell.
  • each individual strand of a dsRNA can be transcribed by promoters both of which are located on the same expression plasmid.
  • a dsRNA is expressed as an inverted repeat joined by a linker polynucleotide sequence such that the dsRNA has a stem and loop structure.
  • An iRNA expression vector is typically a DNA plasmid or viral vector.
  • An expression vector compatible with eukaryotic cells e.g., with vertebrate cells, can be used to produce recombinant constructs for the expression of an iRNA as described herein.
  • Eukaryotic cell expression vectors are well known in the art and are available from a number of commercial sources. Typically, such vectors contain convenient restriction sites for insertion of the desired nucleic acid segment. Delivery of iRNA expressing vectors can be systemic, such as by intravenous or intramuscular administration, by administration to target cells ex-planted from the patient followed by reintroduction into the patient, or by any other means that allows for introduction into a desired target cell.
  • An iRNA expression plasmid can be transfected into a target cell as a complex with a cationic lipid carrier (e.g., Oligofectamine) or a non-cationic lipid-based carrier (e.g.,
  • Transit-TKOTM Multiple lipid transfections for iRNA-mediated knockdowns targeting different regions of a target RNA over a period of a week or more are also contemplated by the invention.
  • Successful introduction of vectors into host cells can be monitored using various known methods.
  • transient transfection can be signaled with a reporter, such as a fluorescent marker, such as Green Fluorescent Protein (GFP).
  • GFP Green Fluorescent Protein
  • Stable transfection of cells ex vivo can be ensured using markers that provide the transfected cell with resistance to specific environmental factors (e.g., antibiotics and drugs), such as hygromycin B resistance.
  • Viral vector systems which can be utilized with the methods and compositions described herein include, but are not limited to, (a) adenovirus vectors; (b) retrovirus vectors, including but not limited to lentiviral vectors, moloney murine leukemia virus, etc.; (c) adeno- associated virus vectors; (d) herpes simplex virus vectors; (e) SV40 vectors; (f) polyoma virus vectors;
  • papilloma virus vectors (g) papilloma virus vectors; (h) picornavirus vectors; (i) pox virus vectors such as an orthopox, e.g., vaccinia virus vectors or avipox, e.g., canary pox or fowl pox; and (j) a helper-dependent or gutless adenovirus.
  • Replication-defective viruses can also be advantageous. Different vectors will or will not become incorporated into the cells' genome.
  • the constructs can include viral sequences for transfection, if desired. Alternatively, the construct may be incorporated into vectors capable of episomal replication, e.g EPV and EBV vectors.
  • Constructs for the recombinant expression of an iRNA will generally require regulatory elements, e.g., promoters, enhancers, etc., to ensure the expression of the iRNA in target cells.
  • regulatory elements e.g., promoters, enhancers, etc.
  • Other aspects to consider for vectors and constructs are further described below.
  • Vectors useful for the delivery of an iRNA will include regulatory elements (promoter, enhancer, etc.) sufficient for expression of the iRNA in the desired target cell or tissue.
  • the regulatory elements can be chosen to provide either constitutive or regulated/inducible expression.
  • Expression of the iRNA can be precisely regulated, for example, by using an inducible regulatory sequence that is sensitive to certain physiological regulators, e.g., circulating glucose levels, or hormones (Dochert et al., 1994, FASEB J. 8:20-24).
  • inducible expression systems suitable for the control of dsRNA expression in cells or in mammals include, for example, regulation by ecdysone, by estrogen, progesterone, tetracycline, chemical inducers of dimerization, and isopropyl-P-Dl-thiogalactopyranoside (IPTG).
  • IPTG isopropyl-P-Dl-thiogalactopyranoside
  • viral vectors that contain nucleic acid sequences encoding an iRNA can be used.
  • a retroviral vector can be used (see Miller et al., Meth.
  • retroviral vectors contain the components necessary for the correct packaging of the viral genome and integration into the host cell DNA.
  • the nucleic acid sequences encoding an iRNA are cloned into one or more vectors, which facilitates delivery of the nucleic acid into a patient. More detail about retroviral vectors can be found, for example, in Boesen et al., Biotherapy 6:291-302 (1994), which describes the use of a retroviral vector to deliver the mdrl gene to hematopoietic stem cells in order to make the stem cells more resistant to chemotherapy.
  • Other references illustrating the use of retroviral vectors in gene therapy are: Clowes et al, J. Clin. Invest. 93:644-651 (1994); Kiem et al. Blood 83: 1467-1473 (1994);
  • Lentiviral vectors contemplated for use include, for example, the HIV based vectors described in U.S. Patent Nos. 6,143,520; 5,665,557; and 5,981,276, which are herein incorporated by reference.
  • Adenoviruses are also contemplated for use in delivery of iRNAs.
  • Adenoviruses are especially attractive vehicles, e.g., for delivering genes to respiratory epithelia. Adenoviruses naturally infect respiratory epithelia where they cause a mild disease. Other targets for adenovirus-based delivery systems are liver, the central nervous system, endothelial cells, and muscle. Adenoviruses have the advantage of being capable of infecting non-dividing cells.
  • a suitable AV vector for expressing an iRNA featured in the invention a method for constructing the recombinant AV vector, and a method for delivering the vector into target cells, are described in Xia H et al (2002), Nat. Biotech. 20: 1006-1010.
  • Adeno-associated virus AAV
  • the iRNA can be expressed as two separate, complementary single-stranded RNA molecules from a recombinant AAV vector having, for example, either the U6 or HI RNA promoters, or the cytomegalovirus (CMV) promoter.
  • a recombinant AAV vector having, for example, either the U6 or HI RNA promoters, or the cytomegalovirus (CMV) promoter.
  • CMV cytomegalovirus
  • a pox virus such as a vaccinia virus, for example an attenuated vaccinia such as Modified Virus Ankara (MVA) or NYVAC, an avipox such as fowl pox or canary pox.
  • a pox virus such as a vaccinia virus, for example an attenuated vaccinia such as Modified Virus Ankara (MVA) or NYVAC, an avipox such as fowl pox or canary pox.
  • viral vectors can be modified by pseudotyping the vectors with envelope proteins or other surface antigens from other viruses, or by substituting different viral capsid proteins, as appropriate.
  • lentiviral vectors can be pseudotyped with surface proteins from vesicular stomatitis vims (VSV), rabies, Ebola, Mokola, and the like.
  • AAV vectors can be made to target different cells by engineering the vectors to express different capsid protein serotypes; see, e.g., Rabinowitz J E et al. (2002), ./ Virol 76:791-801 , the entire disclosure of which is herein incorporated by reference.
  • the pharmaceutical preparation of a vector can include the vector in an acceptable diluent, or can include a slow release matrix in which the gene delivery vehicle is imbedded.
  • the complete gene delivery vector can be produced intact from recombinant cells, e.g., retroviral vectors
  • the phai'maceutical prepai'ation can include one or more cells which produce the gene delivery system.
  • the invention provides pharmaceutical compositions containing an iRNA, as described herein, and a pharmaceutically acceptable carrier.
  • the pharmaceutical composition containing the iRNA is useful for treating a disease or disorder related to the expression or activity of an ALAS 1 gene (e.g., a disorder involving the porphyrin pathway).
  • Such pharmaceutical compositions are formulated based on the mode of delivery.
  • compositions can be formulated for systemic administration via parenteral delivery, e.g., by intravenous (IV) delivery.
  • a composition provided herein e.g., an LNP formulation
  • a composition provided herein e.g., a composition comprising a GaiNAc conjugate
  • subcutaneous delivery e.g., a composition comprising a GaiNAc conjugate
  • compositions featured herein are administered in a dosage sufficient to inhibit expression of an ALASl gene.
  • a suitable dose of iRNA will be in the range of 0.01 to 200.0 milligrams per kilogram body weight of the recipient per day, generally in the range of 1 to 50 mg per kilogram body weight per day.
  • the dsRNA can be administered at 0.035 mg/kg, 0.05 mg/kg, 0.35 mg/kg, 0.5 mg/kg, 1 mg/kg, 1.5 mg/kg, 2 mg/kg, 2.5 mg/kg, 3 mg/kg, 5 mg kg, 10 mg/kg, 20 mg/kg, 30 mg/kg, 40 mg kg, or 50 mg/kg per single dose.
  • the dsRNA can be administered at 0.02-3 mg/kg, e.g., 0.03-0.1 mg/kg, 0.1-0.5 mg kg, 0.3-1 mg/kg, 0.3-2.5 mg/kg, 0.5-2 mg/kg, 0.5-1.5 mg/kg, 0.1-0.2 mg/kg, 0.2-0.5 mg/kg, 0.5-1 mg kg, 1-1.5 mg/kg, 1.5-2 mg/kg, 1-2.5 mg kg, 2-2.5 mg/kg, 2.5-3 mg/kg, or 3-5 mg/kg, per single dose.
  • the pharmaceutical composition may be administered once daily, or the iRNA may be administered as two, three, or more sub-doses at appropriate intervals throughout the day or even using continuous infusion or delivery through a controlled release formulation.
  • the iRNA contained in each sub-dose must be correspondingly smaller in order to achieve the total daily dosage.
  • the dosage unit can also be compounded for delivery over several days, e.g., using a conventional sustained release formulation which provides sustained release of the iRNA over a several day period. Sustained release formulations are well known in the art and are particularly useful for delivery of agents at a particular site, such as can be used with the agents of the present invention. In this embodiment, the dosage unit contains a corresponding multiple of the daily dose.
  • compositions may be administered once every two weeks, once every four weeks, once every eight weeks, once every twelve weeks, once every sixteen weeks, once every twenty weeks, or once every twenty-four weeks. In certain embodiments, the pharmaceutical composition is administered once every four weeks or once every twelve weeks. In some embodiments, the pharmaceutical compositions may be administered once every month, once every two months, once every three months, once every four months, once every five months, or once every six months. In certain embodiments, the pharmaceutical composition is administered once every month or once every three months.
  • the effect of a single dose on ALAS 1 levels can be long lasting, such that subsequent doses are administered at not more than 3, 4, or 5 day intervals, at not more than I, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 week intervals, or at not more than 1, 2, 3, 4, 5, or 6 months interval.
  • treatment of a subject with a therapeutically effective amount of a composition can include a single treatment or a series of treatments.
  • Estimates of effective dosages and in vivo half-lives for the individual iRNAs encompassed by the invention can be made using conventional methodologies or on the basis of in vivo testing using an appropriate animal model, as described elsewhere herein.
  • Advances in mouse genetics have generated a number of mouse models for the study of various human diseases, such as pathological processes related to ALAS 1 expression (e.g., pathological processes involving porphyrins or defects in the poiphyrin pathway, such as, for example, porphyrias).
  • pathological processes related to ALAS 1 expression e.g., pathological processes involving porphyrins or defects in the poiphyrin pathway, such as, for example, porphyrias.
  • Such models can be used for in vivo testing of iRNA, as well as for determining a therapeutically effective dose and/or an effective dosing regimen.
  • a suitable mouse model is, for example, a mouse containing a transgene expressing human ALAS 1.
  • Mice that have knock-in mutations e.g., mutations that are associated with acute hepatic porphwias in humans
  • the present invention also includes pharmaceutical compositions and formulations that include the iRNA compounds featured in the invention.
  • the pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated.
  • Administration may be topical (e.g., by a transdermal patch), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal, oral or parenteral.
  • Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; subdermal, e.g., via an implanted device; or intracranial, e.g., by intraparenchymal, intrathecal or intraventricular, administration.
  • the iRNA can be delivered in a manner to target a particular tissue, such as a tissue that produces erythrocytes.
  • a tissue that produces erythrocytes can be delivered to bone marrow, liver (e.g., hepatocyes of liver), lymph glands, spleen, lungs (e.g., pleura of lungs) or spine.
  • the iRNA is delivered to bone marrow.
  • compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders.
  • Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable.
  • Coated condoms, gloves and the like may also be useful.
  • Suitable topical formulations include those in which the iRNAs featured in the invention are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants.
  • Suitable lipids and liposomes include neutral (e.g., dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC,
  • distearolyphosphatidyl choline) negative e.g., dimyristoylphosphatidyl glycerol DMPG
  • cationic e.g., dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidyl ethanolamine DOTMA
  • iRNAs featured in the invention may be encapsulated within liposomes or may form complexes thereto, in particular to cationic liposomes. Alternatively, iRNAs may be complexed to lipids, in particular to cationic lipids.
  • Suitable fatty acids and esters include but are not limited to arachidonic acid, oleic acid, eicosanoic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1 -monocaprate, l-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or a C1.20 ail yl ester (e.g., isopropylmyristate IPM), monoglyceride, diglyceride or pharmaceutically acceptable salt thereof.
  • Topical formulations are described in detail in U.S. Patent No. 6,747,014, which is incorporated herein by reference.
  • liposome means a vesicle composed of amphophilic lipids arranged in a spherical bilayer or bilayers.
  • Liposomes are unilamellar or multilamellar vesicles which have a membrane formed from a lipophilic material and an aqueous interior. The aqueous portion contains the composition to be delivered. Cationic liposomes possess the advantage of being able to fuse to the cell wall. Non-cationic liposomes, although not able to fuse as efficiently with the cell wall, are taken up by macrophages in vivo.
  • lipid vesicles In order to traverse intact mammalian skin, lipid vesicles must pass through a series of fine pores, each with a diameter less than 50 nm, under the influence of a suitable transdermal gradient. Therefore, it is desirable to use a liposome which is highly deformable and able to pass through such fine pores.
  • liposomes obtained from natural phospholipids are biocompatible and biodegradable; liposomes can incorporate a wide range of water and lipid soluble drugs; liposomes can protect encapsulated drugs in their internal compartments from metabolism and degradation (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245).
  • Important considerations in the preparation of liposome formulations are the lipid surface charge, vesicle size and the aqueous volume of the liposomes. Liposomes are useful for the transfer and delivery of active ingredients to the site of action.
  • the liposomal membrane is structurally similar to biological membranes, when liposomes are applied to a tissue, the liposomes start to merge with the cellular membranes and as the merging of the liposome and cell progresses, the liposomal contents are emptied into the cell where the active agent may act.
  • Liposomes present several advantages over other formulations. Such advantages include reduced side- effects related to high systemic absorption of the administered drug, increased accumulation of the administered drug at the desired target, and the ability to administer a wide variety of drugs, both hydrophilic and hydrophobic, into the skin.
  • liposomes to deliver agents including high- molecular weight DNA into the skin.
  • Compounds including analgesics, antibodies, hormones and high-molecular weight DNAs have been administered to the skin. The majority of applications resulted in the targeting of the upper epidermis.
  • Liposomes fall into two broad classes. Cationic liposomes are positively charged liposomes which interact with the negatively charged DNA molecules to form a stable complex. The positively charged DNA/liposome complex binds to the negatively charged cell surface and is internalized in an endosome. Due to the acidic pH within the endosome, the liposomes are ruptured, releasing their contents into the cell cytoplasm (Wang et ah, Biochem. Biophys. Res. Commun., 1987, 147, 980-985).
  • Liposomes which are pH-sensitive or negatively-charged, entrap DNA rather than complex with it. Since both the DNA and the lipid are similarly charged, repulsion rather than complex formation occurs. Nevertheless, some DNA is entrapped within the aqueous interior of these liposomes. pH-sensitive liposomes have been used to deliver DNA encoding the thymidine kinase gene to cell monolayers in culture. Expression of the exogenous gene was detected in the target cells (Zhou et al, Journal of Controlled Release, 1992, 19, 269-274).
  • liposomal composition includes phospholipids other than naturally- derived phosphatidylcholine.
  • Neutral liposome compositions can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC).
  • Anionic liposome compositions generally are formed from dimyristoyl phosphatidylglycerol, while anionic fusogenic liposomes are formed primarily from dioleoyl phosphatidylethanol amine (DOPE).
  • Another type of liposomal composition is formed from phosphatidylcholine (PC) such as, for example, soybean PC, and egg PC.
  • PC phosphatidylcholine
  • Another type is formed from mixtures of phospholipid and/or phosphatidylcholine and/or cholesterol.
  • Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drugs to the skin, in particular systems comprising non-ionic surfactant and cholesterol.
  • Non-ionic liposomal formulations comprising NovasomeTM I (glyceryl)
  • Liposomes also include "sterically stabilized'" liposomes, a term which, as used herein, refers to liposomes comprising one or more specialized lipids that, when incorporated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids.
  • sterically stabilized liposomes are those in which part of the vesicle -forming lipid portion of the liposome (A) comprises one or more glycoiipids, such as
  • monosialoganglioside GM I is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety.
  • PEG polyethylene glycol
  • the enhanced circulation half-life of these sterically stabilized liposomes derives from a reduced uptake into cells of the reticuloendothelial system (RES) (Allen et al, FEBS Letters, 1987, 223, 42; Wu et al. Cancer Research, 1993, 53, 3765).
  • RES reticuloendothelial system
  • Various liposomes comprising one or more glycolipids are known in the art. Papahadjopoulos et al. (Ann. N.Y. Acad. Sci., 1987, 507, 64) reported the ability of
  • Liposomes comprising sphingomyelin. Liposomes comprising 1 ,2-sn-dimyristoylphosphatidylcholine are disclosed in WO 97/13499 (Lim et al).
  • liposomes comprising lipids derivatized with one or more hydrophilic polymers, and methods of preparation thereof, are known in the art.
  • Sunamoto et al. (Bull. Chem, Soc. Jpn., 1980, 53, 2778) described liposomes comprising a nonionic detergent, 2C I 2 1 5G, that contains a PEG moiety.
  • Ilium et al. (FEBS Lett., 1984, 167, 79) noted that hydrophilic coating of polystyrene particles with polymeric glycols results in significantly enhanced blood half-lives.
  • Liposomes comprising a number of other lipid-polymer conjugates are disclosed in WO 91/05545 and U.S. Pat. No. 5,225,212 (both to Martin et al.) and in WO 94/20073 (Zalipsky et al.) Liposomes comprising PEG-modified ceramide lipids are described in WO 96/10391 (Choi et al). U.S. Pat. No. 5,540,935 (Miyazaki et al.) and U.S. Pat. No.
  • 5,556,948 (Tagawa et al.) describe PEG-containing liposomes that can be further derivatized with functional moieties on their surfaces.
  • a number of liposomes comprising nucleic acids are known in the art.
  • WO 96/40062 to Thierry et al. discloses methods for encapsulating high molecular weight nucleic acids in liposomes.
  • U.S. Pat. No. 5,264,221 to Tagawa et al. discloses protein-bonded liposomes and asserts that the contents of such liposomes may include a dsRNA.
  • U.S. Pat. No. 5,665,710 to Rahman et al. describes certain methods of encapsulating oligodeoxynucleotides in liposomes.
  • WO 97/04787 to Love et al. discloses liposomes comprising dsRNAs targeted to the raf gene.
  • Transfersomes are yet another type of liposomes, and are highly deformable lipid aggregates which are attractive candidates for drug delivery vehicles. Transfersomes may be described as lipid droplets which are so highly deformable that they are easily able to penetrate through pores which are smaller than the droplet. Transfersomes are adaptable to the
  • transfersomes it is possible to add surface edge -activators, usually surfactants, to a standard liposomal composition. Transfersomes have been used to deliver serum albumin to the skin. The transfersome-mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of a solution containing serum albumin.
  • HLB hydrophile/lipophile balance
  • Nonionic surfactants find wide application in pharmaceutical and cosmetic products and are usable over a wide range of pH values. In general their HLB values range from 2 to about 18 depending on their structure.
  • Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters.
  • Nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated/propoxylated block polymers are also included in this class.
  • the polyoxyethylene surfactants are the most popular members of the nonionic surfactant class.
  • Anionic surfactants include carboxylates such as soaps, acyl lactylates, acyl amides of amino acids, esters of sulfuric acid such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates, acyl taurates and sulfosuccinates, and phosphates.
  • the most important members of the anionic surfactant class are the alkyl sulfates and the soaps.
  • Cationic surfactants include quaternary ammonium salts and ethoxylated amines. The quaternary ammonium salts are the most used members of this class.
  • amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N-alkylbetaines and phosphatides.
  • an ALAS 1 dsRNA featured in the invention is fully encapsulated in the lipid formulation, e.g., to form a SPLP, pSPLP, SNALP, or other nucleic acid-lipid particle.
  • SNALP refers to a stable nucleic acid-lipid particle, including SPLP.
  • SPLP refers to a nucleic acid-lipid particle comprising plasmid DNA encapsulated within a lipid vesicle.
  • SNALPs and SPLPs typically contain a cationic lipid, a non- cationic lipid, and a lipid that prevents aggregation of the particle (e.g., a PEG-lipid conjugate).
  • SNALPs and SPLPs are extremely useful for systemic applications, as they exhibit extended circulation lifetimes following intravenous (i.v.) injection and accumulate at distal sites (e.g., sites physically separated from the administration site).
  • SPLPs include "pSPLP," which include an encapsulated condensing agent-nucleic acid complex as set forth in PCT Publication No. WO 00/03683.
  • the particles of the present invention typically have a mean diameter of about 50 nm to about 150 nm, more typically about 60 nm to about 130 nm, more typically about 70 nm to about 110 nm, most typically about 70 nm to about 90 nm, and are substantially nontoxic.
  • the nucleic acids when present in the nucleic acid- lipid particles of the present invention are resistant in aqueous solution to degradation with a nuclease. Nucleic acid- lipid particles and their method of preparation are disclosed in, e.g., U.S. Patent Nos. 5,976,567; 5,981 ,501 ; 6,534,484; 6,586,410; 6,815,432; and PCT Publication No. WO 96/40964.
  • the lipid to drug ratio (mass/mass ratio) (e.g., lipid to dsRNA ratio) will be in the range of from about 1: 1 to about 50: 1 , from about 1 : 1 to about 25: 1, from about 3: 1 to about 15: 1, from about 4: 1 to about 10: 1 , from about 5: 1 to about 9: 1 , or about 6: 1 to about 9: 1.
  • the cationic lipid may be, for example, N,N-dioleyl-N,N-dimethylammonium chloride
  • DODAC N,N-distearyl-N,N-dimethylammonium bromide
  • DDAB N-(I -(2,3- dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride
  • DOTAP N-(I -(2,3- dioleyloxy)propyl)-N,N,N-trimethylammonium chloride
  • DODMA N,N-dimethyl-2,3- dioleyloxy)propylamine
  • DODMA N,2-DiLinoleyloxy-N,N-dimethylaminopropane
  • Dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP), 1 ,2-Dilinoleyoxy-3- (dimethylamino)acetoxypropane (DLin-DAC), 1 ,2-Dilmoleyoxy-3-morpholinopropane (DLin- MA), l,2-Dilinoleoyl-3-dimethylaminopropane (DLinDAP), l,2-Dilinoieylthio-3- dimethylaminopropane (DLin-S-DMA), l-Linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP), l ,2-Dilinoleyloxy-3-trimethylaminopropane chloride salt (DLin-TMA.Cl), l,2-Dilinoleoyl-3-trimethylaminopropane chloride salt (DLin-TAP.
  • the compound 2,2-Dilinoleyl-4-dimethylaminoethyl-f 1 ,3]- dioxolane can be used to prepare lipid-siRNA nanoparticles. Synthesis of 2,2-Dilinoleyl-4- dimethylaminoethyl-[l,3]-dioxolane is described in United States provisional patent application number 61/107,998 filed on October 23, 2008, which is herein incorporated by reference.
  • the lipid-siRNA particle includes 40% 2, 2-Dilinoleyl-4- dimethylaminoethyl-[l ,3]-dioxolane: 10% DSPC: 40% Cholesterol: 10% PEG-C-DOMG (mole percent) with a particle size of 63.0 ⁇ 20 nm and a 0.027 siRNA Lipid Ratio.
  • the non-cationic lipid may be an anionic lipid or a neutral lipid including, but not limited to, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC),
  • DSPC distearoylphosphatidylcholine
  • DOPC dioleoylphosphatidylcholine
  • DPPC dipalmitoylphosphatidylcholine
  • DOPG dioleoylphosphatidylglycerol
  • dipalmitoylphosphatidylglycerol DPPG
  • dioleoyl-phosphatidylethanolamine DOPE
  • palmitoyloleoylphosphatidylcholine POPC
  • palmitoyloleoylphosphatidylethanolamine POPE
  • dipalmitoyl phosphatidyl ethanolamine DPPE
  • dimyristoylphosphoethanolamine dimyristoylphosphoethanolamine
  • the non-cationic lipid may be from about 5 mol % to about 90 mol %, about 10 mol %, or about 58 mol % if cholesterol is included, of the total lipid present in the particle.
  • the conjugated lipid that inhibits aggregation of particles may be, for example, a polyethyleneglycol (PEG)-lipid including, without limitation, a PEG-diacylglycerol (DAG), a PEG-dialkyloxypropyl (DAA), a PEG-phospholipid, a PEG-ceramide (Cer), or a mixture thereof.
  • PEG-DAA conjugate may be, for example, a PEG-dilauryloxypropyl (Ci?), a PEG- dimyiistyloxypropyl (Ci 4 ), a PEG-dipalmityloxypropyl (Ci ⁇ ,), or a PEG- distearyloxypropyl
  • the conjugated lipid that prevents aggregation of particles may be from 0 mol % to about 20 mol % or about 2 mol % of the total lipid present in the particle.
  • the nucleic acid-lipid particle further includes cholesterol at, e.g., about 10 mol % to about 60 mol % or about 48 mol % of the total lipid present in the particle.
  • the iRNA is formulated in a lipid nanoparticle (LNP).
  • LNP01 lipid nanoparticle
  • the lipidoid ND98-4HC1 (MW 1487) (see U.S. Patent Application No. 12/056,230, filed 3/26/2008, which is herein incorporated by reference), Cholesterol (Sigma- Aldrich), and PEG-Ceramide C 16 (Avanti Polar Lipids) can be used to prepare lipid-dsRNA nanoparticles (e.g., LNP01 particles).
  • Stock solutions of each in ethanol can be prepared as follows: ND98, 133 mg/ml; Cholesterol, 25 mg/ml, PEG-Ceramide C16, 100 mg/ml.
  • the ND98, Cholesterol, and PEG-Ceramide C16 stock solutions can then be combined in a, e.g., 42:48: 10 molar ratio.
  • the combined lipid solution can be mixed with aqueous dsRNA (e.g., in sodium acetate pH 5) such that the final ethanol concentration is about 35-45% and the final sodium acetate concentration is about 100-300 mM.
  • aqueous dsRNA e.g., in sodium acetate pH 5
  • Lipid-dsRNA nanoparticles typically form spontaneously upon mixing.
  • the resultant nanoparticle mixture can be extruded through a polycarbonate membrane (e.g., 100 nm cut-off) using, for example, a thermobarrel extruder, such as Lipex Extruder (Northern Lipids, Inc). in some cases, the extrusion step can be omitted. Ethanol removal and simultaneous buffer exchange can be accomplished by, for example, dialysis or tangential flow filtration. Buffer can be exchanged with, for example, phosphate buffered saline (PBS) at about pH 7, e.g., about pH 6.9, about pH 7.0, about pH 7.1, about pH 7.2, about pH 7.3, or about pH 7.4.
  • PBS phosphate buffered saline
  • LNPOl formulations are described, e.g., in International Application Publication
  • PEG-DMG PEG-didimyristoyi glycerol (C14-PEG, or PEG-C14) (PEG with avg mol wt of 2000)
  • PEG-DSG PEG-distyryl glycerol (C 18-PEG, or PEG-C 18) (PEG with avg mol wt of 2000)
  • PEG-cDMA PEG-carbamoyl-l,2-dimyristyloxypropylamine (PEG with avg mol wt of 2000)
  • SNALP l,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLinDMA)
  • DLinDMA l,2-Dilinolenyloxy-N,N-dimethylaminopropane
  • XTC comprising formulations are described, e.g., in U.S. Provisional Serial No.
  • MC3 comprising formulations are described, e.g., in U.S. Provisional Serial No.
  • ALNY-100 comprising formulations are described, e.g., International Application Publication No. WO 2010/054406 (International Application No. PCT/US09/63933, filed on November 10, 2009), which is hereby incorporated by reference.
  • any of the compounds, e.g., cationic lipids and the like, used in the nucleic acid-lipid particles featured in the invention may be prepared by known organic synthesis techniques, including the methods described in more detail in the Examples. All substituents are as defined below unless indicated otherwise.
  • Alkyl means a straight chain or branched, noncyclic or cyclic, saturated aliphatic hydrocarbon containing from 1 to 24 carbon atoms.
  • Representative saturated straight chain alkyls include methyl, ethyl, n-propyi, n-butyl, n-pentyl, n-hexyl, and the like; while saturated branched alkyls include isopropyl, sec-butyl, isobutyl, tert-butyl, isopentyl, and the like.
  • saturated cyclic alkyls include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and the like; while unsaturated cyclic alkyls include cyclopentenyl and cyclohexenyl, and the like.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Epidemiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biochemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The invention relates to double-stranded ribonucleic acid (dsRNA) compositions targeting the ALAS1 gene, and methods of using such dsRNA compositions to alter (e.g., inhibit) expression of ALAS1.

Description

COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF THE
ALAS1 GENE
Cross Reference to Related Applications
This application claims priority to U.S. Application Serial No. 62/218,470 filed on September 14, 2015 and U.S. Application Serial No. 62/383,968 filed on September 6, 2016. The entire contents of the aforesaid applications are hereby incorporated herein by reference.
Sequence Listing
The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCn copy, created on September 13, 2016, is named A2038-7222WO_SL.txt and is 1.107,445 bytes in size. Field of the Invention
The invention relates to the specific inhibition of the expression of the ALASl gene.
Background of the Invention
The inherited porphyrias are a family of disorders resulting from the deficient activity of specific enzymes in the heme biosynthetic pathway, also referred to herein as the porphyrin pathway. Deficiency in the enzymes of the porphyrin pathway leads to insufficient heme production and to an accumulation of porphyrin precursors and porphyrins, which are toxic to tissue in high concentrations.
Of the inherited porphyrias, acute intermittent porphyria (AIP, e.g., autosomal dominant AIP), variegate porphyria (VP, e.g., autosomal dominant VP), hereditary coproporphyria
(copropophyria or HCP, e.g., autosomal dominant HCP), and 5' aminolevulinic acid (also known as δ- aminolevulinic acid or ALA) dehydratase deficiency porphyria (ADP, e.g., autosomal recessive ADP) are classified as acute hepatic porphyrias and are manifested by acute neurological attacks that can be life threatening. The acute attacks are characterized by autonomic, peripheral, and central nervous symptoms, including severe abdominal pain, hypertension, tachycardias, constipation, motor weakness, paralysis, and seizures. If not treated properly, quadriplegia, respiratory impairment, and death may ensue. Various factors, including cytochrome P450-inducing drugs, dieting, and hormonoal changes can precipitate acute attacks by increasing the activity of hepatic 5 '-aminolevulinic acid synthase 1 (ALAS1 ), the first and rate-limiting enzyme of the heme biosynthetic pathway. In the acute porphyrias, e.g., AIP, VP, HCP and ADP, the respective enzyme deficiencies result in hepatic production and accumulation of one or more substances (e.g., porphyrins and/or porphyrin precursors, e.g., ALA and/or PBG) that can be neurotoxic and can result in the occurrence of acute attacks. See, e.g., Balwani, M and Desnick, .J., Blood, 120:4496-4504, 2012.
The current therapy for the acute neurologic attacks is the intravenous administration of hemin (Panhematin®, Lundbeck or Normosang®, Orphan Europe), which provides exogenous heme for the negative feedback inhibition of ALAS 1 , and thereby, decreases production of ALA and PBG. Hemin is used for the treatment during an acute attack and for prevention of attacks, particularly in women with the actue porphyrias who experience frequent attacks with the hormonal changes during their menstrual cycles. While patients generally respond well, its effect is slow, typically taking two to four days or longer to normalize urinary ALA and PBG concentrations towards normal levels. As the intravenous hemin is rapidly metabolized, three to four infusions are usually necessary to effectively treat or prevent an acute attack. In addition, repeated infusions may cause iron overload and phlebitis, which may compromise peripheral venous access. Although orthotrophic liver transplantation is curative, this procedure has significant morbidity and mortality and the availability of liver donors is limited. Therefore, an alternative therapeutic approach that is more effective, fast-acting, and safe is needed. It would be particularly advantageous if such treatment could be delivered by subcutaneous
administration, as this would preclude the need for infusions and prolonged hospitalization.
AIP, also referred to as porphobilinogen deaminase (PBGD) deficiency, or
hydroxymethylbilane synthase (HMBS) deficiency, is the most common of the acute hepatic prophyrias. The prevalence of AIP is estimated to be 5-10 in 100,000, with about 5-10% of patients being symptomatic. ΑΓΡ is an autosomal dominant disorder caused by mutations in the HMBS gene that result in reduced, e.g., half-normal activity of the enzyme. Previously, a mouse model of ΑΓΡ that has -30% of wiidtype HMBS activity was generated by homologous recombination. Like human patients, these mice increase hepatic ALAS 1 activity and accumulate large quantities of plasma and urinary ALA and PBG when administered porphyrinogenic drugs, such as phenobarbital. Thus, they serve as an excellent model to evaluate the efficacy of novel therapeutics for the acute hepatic porphyrias.
Summary of the Invention
The present invention describes methods and iRNA compositions for modulating the expression of an ALAS l gene. In certain embodiments, expression of an ALAS l gene is reduced or inhibited using an ALAS l -specific iRNA. Such inhibition can be useful in treating disorders related to ALAS l expression, such as porphyrias.
Accordingly, described herein are compositions and methods that effect the RNA- induced silencing complex (RlSC)-mediated cleavage of RNA transcripts of the ALASl gene, such as in a cell or in a subject (e.g., in a mammal, such as a human subject). Also described are compositions and methods for treating a disorder related to expression of an ALAS l gene, such as a porphyria, e.g., X-linked sideroblastic anemia (XLS A), ALA deyhdratase deficiency porphyria (Doss porphyria or ADP), acute intermittent porphyria (AIP), congenital erythropoietic porphyria (CEP), prophyria cutanea tarda (PCT), hereditary coproporphyria (coproporphyria, or HCP), variegate porphyria (VP), erythropoietic protoporphyria (EPP), or transient
erythroporphyria of infancy. In some embodiments, the disorder is an acute hepatic porphyria, e.g. , ALA deyhdratase deficiency porphyria (ADP), AIP, HCP, or VP. In certain embodiments, the disorder is ALA deyhdratase deficiency porphyria (ADP) or ATP.
In embodiments, the porphyria is a hepatic porphyria, e.g., a porphyria selected from acute intermittent porphyria (AIP) hereditary coproporphyria (HCP), variegate porphyria (VP), ALA deyhdratase deficiency porphyria (ADP), and hepatoerythropoietic porphyria. In embodiments, the porphyria is a homozygous dominant hepatic porphyria (e.g. , homozygous dominant AIP, HCP, or VP) or hepatoerythropoietic porphyria. In embodiments, the porphyria is a dual porphyria.
As used herein, the term "iRNA," "RNAi", "iRNA agent," "RNAi agent," or "iRNA molecule," refers to an agent that contains RNA as that term is defined herein, and which mediates the targeted cleavage of an RNA transcript, e.g., via an RNA-induced silencing complex (RISC) pathway, hi one embodiment, an iRNA as described herein effects inliibition of ALASl expression in a cell or mammal. The iRNAs included in the compositions featured herein encompass a dsR A having an RNA strand (the antisense strand) having a region, e.g., a region that is 30 nucleotides or less, generally 19-24 nucleotides in length, that is substantially complementary to at least part of an mRNA transcript of an ALAS 1 gene (e.g., a mouse or human ALAS 1 gene) (also referred to herein as an "ALAS 1 -specific iRNA"). Alternatively, or in combination, iRNAs encompass a dsRNA having an RNA strand (the antisense strand) having a region that is 30 nucleotides or less, generally 19-24 nucleotides in length, that is substantially complementary to at least part of an mRNA transcript of an ALAS 1 gene (e.g., a human variant 1 or 2 of an ALAS1 gene) (also referred to herein as a "ALAS 1 -specific iRNA").
In embodiments, the iRNA (e.g, dsRNA) described herein comprises an antisense strand having a region that is substantially complementary to a region of a human ALAS 1. In embodiments, the human ALAS 1 has the sequence of NM_0()0688.4 (SEQ ID NO: l ) or
NM_000688.5 (SEQ ID NO:382). In embodiments, the human ALAS 1 has the sequence of NMJ 99166.1.
In embodiments, the antisense sequence of the iRNA (e.g., dsRNA) targets within the region 871 to 895 (plus or minus 5, 4, 3, 2, or 1 nucleotides in either or both directions on the 5' and/or 3' end) on the ALAS 1 transcript NM_0()0688.4. In embodiments, the antisense sequence targets the nucleotides 871 to 893, 871 to 892, or 873 to 895 on the ALAS 1 transcript
NM_000688.4. In embodiments, the antisense sequence comprises or consists of a sequence that is fully complementary or substantially complementary to nucleotides 871 to 893, 871 to 892, or 873 to 895 on the ALAS1 transcript NM_000688.4.
In one aspect, a method of treating a porphyria is provided, wherein the method comprises administering to a subject in need of such treatment a therapeutically effective amount of a double-stranded ribonucleic acid (dsRNA), e.g. , for inhibiting expression of ALAS 1, wherein said dsRNA is administered at a dose of 0.02 to 10 mg/kg, e.g., 0.5 to 10 mg/kg, e.g., 0.5 to 5 mg/kg, 0.5 to 3 mg/kg, or 0.5 to 2 mg/kg, bodyweight of the subject once every four weeks or once every twelve weeks, thereby treating the porphyria.
In some embodiments, said dsRNA is administered at a dose of 0.5 to 1.5, 0.5 to 1, 1 to 1.5, 1.5 to 2 mg kg, 2 to 2.5 mg kg, 2.5 to 3 mg/kg, or 2.5 to 5 mg/kg, e.g., 0.5, 1, 1.5, 2. 2.5. 3, or 5 mg/kg, bodyweight of the subject once every four weeks or once every twelve weeks. In some embodiments, said dsRNA is administered at a dose of 0.5 to 2 mg/kg once every four weeks. In some embodiments, said dsRNA is administered at a dose of 0.5 to 2 mg/kg once ever\? twelve weeks. In some embodiments, said dsRNA is administered at a dose of 2 to 3 mg/kg (e.g., 2.5 mg/kg) once every four weeks. In some embodiments, said dsRNA is administered at a dose of 2 to 3 mg/kg (e.g., 2.5 mg kg) once every twelve weeks. In some embodiments, said dsRNA is administered at a dose of 4 to 6 mg/kg (e.g., 5 mg/kg) once every twelve weeks.
In some embodiments, said dsRNA is administered to the subject subcutaneously.
In some embodiment, said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALAS 1 RNA transcript (e.g., SEQ ID NO: l), which antisense strand comprises at least 20 contiguous nucleotides from the antisense sequence of UAAGAUGAGACACUCUUUCUGGU (SEQ ID NO: 4153) or
UAAGAUGAGACACUCTUUCUGGU (SEQ ID NO: 4154).
In some embodiments, said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALAS 1 RNA transcript (e.g.,
SEQ ID NO: l), which antisense strand comprises at least 20 contiguous nucleotides from (i) an antisense sequence listed in any one of Tables 21 to 40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g. , an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237), or (ii) an unmodified version of an antisense sequence listed in any one of Tables 21 to 40 of WO
2015/051318 and the Sequence Listing attached herewith (e.g., an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237).
In some embodiments, said dsRNA comprises at least one modified nucleotide. In some embodiments, at least one modified nucleotide is chosen from a 2'-0-methyl, a 2'-fluoro modified nucleotide, and optionally one or more 5'-phosphorothioate groups, or any combination thereof.
In some embodiments, the duplex region is 17-23 nucleotide pairs in length. In some embodiments, at least one strand comprises a 3' overhang of at least 2 nucleotides. In some embodiments, each strand is no more than 26 nucleotides in length. In some embodiments, the dsRNA further comprises a ligand, optionally wherein the ligand is conjugated to the 3' end of the sense strand of the dsRNA. In some embodiments, the ligand comprises a carbohydrate, optionally wherein the ligand is a GalNAc ligand.
In some embodiments, the ligand is
Figure imgf000007_0001
In some embodiments, the ligand is attached via a bivalent or trivalent branched linker. In some embodiments, the ligand and linker are as shown in Formula XXIV:
Figure imgf000007_0002
In some embodiments, the dsRNA is conjugated to ligand L96 via a linker as shown below
Triantennary GalNAc
Figure imgf000007_0003
In some embodiments, the ligand targets the dsRNA to hepatocytes.
In some embodiments, the dsRNA comprises a sense strand consisting of a sense sequence selected from the sense sequences listed in Tables 21 to 40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., an sense sequence corresponding to SEQ ID NO: 4149 or 4151 , or one of the even numbered sequences identified as SEQ ID NOs: 4172 to 5236), and an antisense strand consisting of an antisense sequence selected from the antisense sequences listed in Tables 21 to 40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g. , an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237).
In some embodiments, the dsRNA has an IC5 of less than 1 nM, less than 0.05 nM, less than 0.02 nM, or less than 0.01 nM. In some embodiments, the dsRNA has a single dose ED50 of less than about 10 mg/kg or less than about 5 mg/kg.
In some embodiments, the dsRNA shows improved activity compared with AD-58632 or AD-60489, optionally wherein the dsRNA is selected from the dsRNAs listed in Tables 21 to 40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., comprising or consisting of a sense sequence corresponding to SEQ ID NO: 4149 and an antisense sequence
corresponding to SEQ ID NO: 4150; a sense sequence corresponding to SEQ ID NO: 4151 and an antisense sequence corresponding to SEQ ID NO: 4152; or a sense sequence corresponding to SEQ ID NO: X and an antisense sequence corresponding to SEQ ID NO: X+1, where X is any of the even numbers between 4172 and 5236). In some embodiments, the sense strand comprises or consists of the sequence of CAGAAAGAGUGUCUCAUCUUA (SEQ ID NO: 4155).
In some embodiments, the antisense strand comprises the antisense sequence of AD- 60519, wherein the antisense sequence comprises all of the modified nucleotides of AD-60519. In some embodiments, the antisense strand consists of the antisense sequence of AD-60519, wherein the antisense sequence comprises all of the modified nucleotides of AD-60519. In some embodiments, the sense strand comprises the sense sequence of AD-60519, wherein the sense sequence comprises all of the modified nucleotides of AD-60519. In some embodiments, the sense strand consists of the sense sequence of AD-60519, wherein the sense sequence comprises all of the modified nucleotides of AD-60519. In some embodiments, the sense strand comprises the sense sequence of AD-60519, and the antisense strand comprises the antisense sequence of AD-60519, wherein the sense and antisense sequences comprise all of the modified nucleotides of AD-60519. In some embodiments, the sense strand consists of the sense sequence of AD- 60519, and the antisense strand consists of the antisense sequence of AD-60519, wherein the sense and antisense sequences comprise all of the modified nucleotides of AD-60519.
In some embodiments, the antisense strand comprises the antisense sequence of AD-
60489, and/or the sense strand comprises the sense sequence of AD-60489, wherein the antisense and/or sense sequence comprises all of the modified nucleotides of AD-60489. In some embodiments, the antisense strand consists of the antisense sequence of AD-60489, and/or the sense strand consists of the sense sequence of AD-60489, wherein the antisense and/or sense sequence comprises all of the modified nucleotides of AD-60489.
In some embodiments, the antisense strand comprises the antisense sequence of AD-
61 193, and/or the sense strand comprises the sense sequence of AD-61 193, wherein the antisense and/or sense sequence comprises all of the modified nucleotides of AD-61193. In some embodiments, the antisense strand consists of the antisense sequence of AD-61 193, and/or the sense strand consists of the sense sequence of AD-61 193, wherein the antisense and/or sense sequence comprises all of the modified nucleotides of AD-61 193.
In some embodiments, the antisense strand comprises the antisense sequence of AD- 60819, and/or the sense strand comprises the sense sequence of AD-60819, wherein the antisense and/or sense sequence comprises all of the modified nucleotides of AD-60819. In some embodiments, the antisense strand consists of the antisense sequence of AD-60819, and/or the sense strand consists of the sense sequence of AD-60819, wherein the antisense and/or sense sequence comprises all of the modified nucleotides of AD-60819.
In some embodiments, said dsRNA is administered in an unbuffered saline or water solution.
In some embodiments, the subject is at risk for developing, or is diagnosed with, a porphyria. In some embodiments, the porphyria is acute intermittent porphyria or ALA- dehydratase deficiency porphyria.
In some embodiments, the dsRNA is administered after an acute attack of porphyria. In some embodiments, the dsRNA is administered during an acute attack of porphyria. In some embodiments, the dsRNA is administered prophylactically to prevent an acute attack of porphyria.
In some embodiments, the method decreases a level of a porphyrin or a porphyrin precursor (e.g., δ-aminolevulinic acid (ALA) or porphopilinogen (PBG)) and/or inhibits ALAS l expression in the subject. In some embodiments, the level of ALA and/or PBG (e.g., urine ALA and/or PBG) is decreased by 30% or more, 35% or more, 40% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, or 95% or more, in the subject, compared to the level before the treatment. In some embodiments, the method inhibits ALAS l expression, e.g., by 40% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, or 95% or more, in the subject, compared to the level before the treatment.
In some embodiments, the method (i) ameliorates a symptom associated with an ALAS l related disorder (e.g., a porphyria), (ii) decreases frequency of acute attacks of symptoms associated with a porphyria in the subject, and/or (iii) decreases incidence of acute attacks of symptoms associated with a porphyria in the subject when the subject is exposed to a precipitating factor, e.g., the premenstrual phase.
In some embodiments, the dsRNA is administered before an acute attack of porphyria, e.g., during a prodrome.
In some embodiments, the subject has an elevated level (e.g., plasma or urine level) of ALA and/or PBG, compared to a nomial subject. In some embodiments, the subject suffers from chronic pain. In some embodiments, the method decreases the elevated level of ALA and/or PBG, e.g., by 30% or more, 35% or more, 40% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, or 95% or more.
In some embodiments, the subject has an elevated level of ALAS l (e.g., liver or serum ALAS l level, e.g., ALASl mRNA level) that is at least 2, 3, 4, or 5 fold higher compared to the level of ALAS l in a normal subject.
In some embodiments the method decreases or prevents pain, neuropathy, and/or nerve damage. In some embodiments, the method prevents acute attacks of porphyria.
In some embodiments, the dsRNA is administered repeatedly, e.g., every four weeks or every twelve weeks, for twenty-four or more weeks.
In another aspect, a method of treating a subject with an elevated level of ALA and/or PBG is provide, wherein the method comprises administering to a subject in need of such treatment a therapeutically effective amount of a dsRNA, e.g., for inhibiting expression of ALAS l, and wherein said dsRNA is administered at a dose of 0.02 to 10 mg/kg, e.g., 0.5 to 10 mg kg, e.g., 0.5 to 5 mg kg, 0.5 to 3 mg/kg, or 0.5 to 2 mg/kg bodyweight of the subject once every four weeks or once every twelve weeks. In some embodiments, said dsRNA is administered at a dose of 0.5 to 1.5, 0.5 to 1, 1 to 1.5, 1.5 to 2 mg/kg, 2 to 2.5 mg kg, 2.5 to 3 mg/kg, or 2.5 to 5 mg kg, e.g., about 0.5, 1 , 1.5, 2, 2.5, 3, or 5 mg/kg, bodyweight of the subject once every four weeks or once every twelve weeks. In some embodiments, said dsRNA is administered at a dose of 0.5 to 2 mg/kg once every four weeks. In some embodiments, said dsRNA is administered at a dose of 0.5 to 2 mg/kg once every twelve weeks. In some embodiments, said dsRNA is administered at a dose of 2 to 3 mg/kg (e.g., 2.5 mg/kg) once every four weeks. In some embodiments, said dsRNA is administered at a dose of 2 to 3 mg/kg (e.g., 2.5 mg/kg) once every twelve weeks. In some embodiments, said dsRNA is administered at a dose of 4 to 6 mg/kg (e.g., 5 mg/kg) once every twelve weeks.
In some embodiments, the method is effective to decrease the level of ALA and/or PBG. In some embodiments, said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALAS 1 RNA transcript (e.g., SEQ ID NO: l ), which antisense strand comprises at least 20 contiguous nucleotides from (i) an antisense sequence listed in any one of Tables 21 to 40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237), or (ii) an unmodified version of an antisense sequence listed in any one of Tables 21 to 40 of WO
2015/051318 and the Sequence Listing attached herewith (e.g., an antisense sequence
corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237) .
In some embodiments, the level of ALA and/or PBG is decreased by 30% or more, 35 or more, 40% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80%' or more, 85% or more, 90% or more, or 95% or more, compared to the level before the treatment.
In yet another aspect, a method of treating a subject having an increased level of ALA and/or PBG is provided, wherein the method comprises administering to the subject a dsRNA, e.g., for inhibiting expression of ALAS 1, and wherein said dsRNA is administered at a dose of about 0.5, 1 , 1.5, 2, 2.5, or 5 mg/kg bodyweight of the subject once every four weeks or once every twelve weeks, e.g., for at least twenty-four weeks, thereby reducing the level of ALA and/or PBG in said subject.
In some embodiments, said dsRNA is administered at a dose of 0.5 to 1.5, 0.5 to 1 , 1 to 1.5, 1.5 to 2 mg/kg, 2 to 2,5 mg/kg, 2.5 to 3 mg kg, or 2.5 to 5 mg/kg, e.g., about 0.5, 1 , 1.5, 2, 2.5, 3, or 5 mg/kg, bodyweight of the subject once every four weeks or once every twelve weeks. In some embodiments, said dsRNA is administered at a dose of 0.5 to 2 mg/kg once every four weeks. In some embodiments, said dsRNA is administered at a dose of 0.5 to 2 mg/kg once every twelve weeks. In some embodiments, said dsRNA is administered at a dose of 2 to 3 mg/kg (e.g., 2.5 mg/kg) once every four weeks. In some embodiments, said dsRNA is administered at a dose of 2 to 3 mg/kg (e.g., 2.5 mg/kg) once every twelve weeks. In some embodiments, said dsRNA is administered at a dose of 4 to 6 mg/kg (e.g., 5 mg/kg) once every twelve weeks.
In some embodiments, the dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALASl RNA transcript (e.g., SEQ ID NO: l), which antisense strand comprises at least 20 contiguous nucleotides from (i) an antisense sequence listed in any one of Tables 21 to 40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237), or (ii) an unmodified version of an antisense sequence listed in any one of Tables 21 to 40 of WO
2015/051318 and the Sequence Listing attached herewith (e.g., an antisense sequence
corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237).
In still another aspect, a method of treating a human patient with AIP who has suffered from multiple recurrent attacks is provided, wherein the method comprises administering a dsRNA, e.g., for inhibiting expression of ALASl, and wherein said dsRNA is administered at a dose of 0.02- 10 mg kg, e.g., 0.5 to 10 mg/kg, e.g., 0.5 to 5 mg/kg, 0.5 to 3 mg/kg, or 0.5 to 2 mg kg bodyweight of the patient once every four weeks or once every twelve weeks, e.g., for at least twenty-four weeks, thereby treating said patient.
In some embodiments, said dsRNA is administered at a dose of 0.5 to 1.5, 0.5 to 1 , 1 to
1.5, 1.5 to 2 mg/kg, 2 to 2,5 mg/kg, 2.5 to 3 mg/kg, or 2.5 to 5 mg/kg, e.g., about 0.5, 1 , 1.5, 2, 2.5, 3, or 5 mg/kg, bodyweight of the subject once every four weeks or once every twelve weeks. In some embodiments, said dsRNA is administered at a dose of 0.5 to 2 mg/kg once every four weeks. In some embodiments, said dsRNA is administered at a dose of 0.5 to 2 mg kg once every twelve weeks. In some embodiments, said dsRNA is administered at a dose of 2 to 3 mg kg (e.g., 2.5 mg/kg) once every four weeks. In some embodiments, said dsRNA is administered at a dose of 2 to 3 mg/kg (e.g., 2.5 mg/kg) once every twelve weeks. In some embodiments, said dsRNA is administered at a dose of 4 to 6 mg/kg (e.g., 5 mg/kg) once every twelve weeks.
In some embodiment, the dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALAS 1 RNA transcript (e.g.,
SEQ ID NO: l), which antisense strand comprises at least 20 contiguous nucleotides from (i) an antisense sequence listed in any one of Tables 21 to 40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237), or (ii) an unmodified version of an antisense sequence listed in any one of Tables 21 to 40 of WO
2015/051318 and the Sequence Listing attached herewith (e.g., an antisense sequence
corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237) .
In some embodiments, said method (i) reduces the frequency of attacks, (ii) reduces hematin use, (iii) reduces hospitalization, and/or (iv) improves quality of life.
In another aspect, a method of treating a subject having a porphyria (e.g., AIP) or an elevated level of ALA and/or PBG is provided, wherein the method comprises subcutaneously administering to the subject a composition (e.g., a pharmaceutical composition) comprising a dsRNA, e.g., for inhibiting expression of ALAS 1, and wherein said composition is administered at a dsRNA dose of 0.02-10 mg/kg, e.g., 0.5 to 10 mg/kg, e.g., 0.5 to 5 mg/kg, 0.5 to 3 mg/kg, or 0.5 to 2 mg/kg bodyweight of the subject once every four weeks or once every twelve weeks, thereby treating the subject.
In some embodiments, the composition is administered at a dsRNA dose of 0.5 to 1.5, 0.5 to 1 , 1 to 1.5, 1.5 to 2, 2 to 2.5, or 2.5 to 5 mg/kg, e.g., about 0.5, 1 , 1.5, 2, 2.5, 3, or 5 mg/kg, bodyweight of the subject once every four weeks or once every twelve weeks. In some embodiments, the composition is administered at a dsRNA dose of 0.5 to 2 mg/kg once every four weeks. In some embodiments, the composition is administered at a dsRNA dose of 0.5 to 2 mg/kg once every twelve weeks. In some embodiments, the composition is administered at a dsRNA dose of 2 to 3 mg/kg (e.g., 2.5 mg/kg) once every four weeks. In some embodiments, the composition is administered at a dsRNA dose of 2 to 3 mg/kg (e.g., 2.5 mg/kg) once every twelve weeks, hi some embodiments, the composition is administered at a dsRNA dose of 4 to 6 mg kg (e.g., 5 mg/kg) once every twelve weeks.
In some embodiments, said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALAS 1 RNA transcript (e.g., SEQ ID NO: l ), which antisense strand comprises at least 20 contiguous nucleotides from (i) an antisense sequence chosen from listed in any one of Tables 21 to 40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237), or (ii) an unmodified version of an antisense sequence listed in any one of Tables 21 to 40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237).
In one aspect, a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS l is provided, wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALAS l RNA transcript, which antisense strand comprises at least 15 (e.g., at least 16, 17, 18, 19, 20, 21 , 22, or 23) contiguous nucleotides differing by no more than 3, 2 or 1 nucleotides from the sequence of
UAAGAUGAGACACUCUUUCUGGU (SEQ ID NO: 4153) or
UAAGAUGAGACACUCTUUCUGGU (SEQ ID NO: 4154). In embodiments, the antisense strand comprises the sequence of UAAGAUGAGACACUCUUUCUGGU (SEQ ID NO: 4153) or UAAGAUGAGACACUCTUUCUGGU (SEQ ID NO: 4154). In embodiments, the sense strand comprises the sequence of CAGAAAGAGUGUCUCAUCUUA (SEQ ID NO: 4155). In embodiments, one or more nucleotides of the antisense strand and/or sense strand are modified as described herein. In embodiments, the dsRNA comprises (i) an antisense strand that comprises, or consists of, the antisense sequence of AD-60489, AD-60519, or AD-61 193 and/or (ii) a sense strand that comprises, or consists of, the sense sequence of AD-60489, AD-60519, or AD-61193 (including one or more (e.g. , all) of the modifications of the antisense strand and/or antisense strand of AD-60489, AD-60519, or AD-61193).
In embodiments, the method comprises administering to a subject said dsRNA at a dose of 0.02-10 mg/kg, e.g., 0.5 to 10 mg kg, e.g., 0.5 to 5 mg kg, 0.5 to 3 mg/kg, or 0.5 to 2 mg kg bodyweight of the patient once every four weeks or once every twelve weeks, e.g., for at least twenty- four weeks, thereby treating said patient.
In some embodiments, said dsRNA is administered at a dose of 0.5 to 1.5, 0.5 to 1 , 1 to 1.5, 1.5 to 2 mg/kg, 2 to 2.5 mg/kg, 2.5 to 3 mg/kg, or 2.5 to 5 mg/kg, e.g. , about 0.5, 1, 1.5, 2, 2.5, 3, or 5 mg/kg, bodyweight of the subject once every four weeks or once every twelve weeks. In some embodiments, said dsRNA is administered at a dose of 0.5 to 2 mg/kg once every four weeks. In some embodiments, said dsRNA is administered at a dose of 0.5 to 2 mg kg once every twelve weeks. In some embodiments, said dsRNA is administered at a dose of 2 to 3 mg kg (e.g., 2.5 mg/kg) once every four weeks. In some embodiments, said dsRNA is administered at a dose of 2 to 3 mg/kg (e.g., 2.5 mg/kg) once every twelve weeks. In some embodiments, said dsRNA is administered at a dose of 4 to 6 mg/kg (e.g., 5 mg/kg) once every twelve weeks.
In one aspect, a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS l is provided, wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALAS l RNA transcript, which antisense strand comprises at least 15 (e.g., at least 16, 17, 18, 19, 20, 21 , 22, or 23) contiguous nucleotides differing by no more than 3 (e.g., by no more than 0, 1 or 2) nucleotides from an antisense sequence listed in any one of Tables 21 to 40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237), or an unmodified version of an antisense sequence (e.g., a version having the same nucleotide sequence except that some or all of the nucleotides are unmodified) listed in any one of Tables 21 to 40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237). In one embodiment, the antisense sequence comprises at least 15 (e.g., at least 16, 17, 18, 19, 20, 21 , 22, or 23) contiguous nucleotides differing by no more than 3 (e.g., by no more than 0, 1 or 2) nucleotides from (i) the antisense sequence of AD- 60489, AD-60519, or AD-61 193 or (ii) an unmodified version of any one of these sequences. In embodiments, the antisense strand comprises at least 15 (e.g., at least 16, 17, 18, 19, 20, 21 , 22, or 23) contiguous nucleotides differing by no more than 3 (e.g., by no more than 0, 1 or 2) nucleotides from the sequence of UAAGAUGAGACACUCUUUCUGGU (SEQ ID NO: 4153) or UAAGAUGAGACACUCTUUCUGGU (SEQ ID NO: 4154). In an embodiment, the antisense sequence targets positions 871 -893 of NM_000688.4 (SEQ ID NO: l). In
embodiments, the sense strand comprises the sequence of CAGAAAGAGUGUCUCAUCUUA (SEQ ID NO: 4155). hi embodiments, one or more nucleotides of the antisense strand and/or sense strand are modified as described herein.
In some embodiments, the dsRNA is not a sense and/or antisense sequence listed in any one of Tables 2, 3, 6, 7, 8, 9, 14, 15, 18 or 20 of WO 2015/051318 and the Sequence Listing attached herewith.
In one embodiment, a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS l is provided, wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALAS l RNA transcript, which antisense strand comprises at least 15 (e.g., at least 16, 17, 18, 19, 20, 21 , 22, or 23) contiguous nucleotides differing by no more than 3 nucleotides, no more than 2 nucleotides, or no more than one nucleotide, from the antisense sequence of AD-60519. In embodiments, one or more nucleotides are modified as described herein.
In one embodiment, a double- stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS l is provided, wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALAS l RNA transcript, which antisense strand comprises at least 15 (e.g. , at least 16, 17, 18, 19, 20, 21, 22, or 23) contiguous nucleotides differing by no more than 3 (e.g., by no more than 0, 1 or 2) nucleotides from the antisense sequence of AD-60489, or a derivative of AD-60489 as described herein. In embodiments, one or more nucleotides are modified as described herein, e.g., one or more (or all) nucleotides of AD-60489 are modified as described herein. In embodiments, the derivative of AD-60489 is AD-60501, AD-60519, AD-60901 , AD-60495, AD-60900, AD-
60935, AD-60879, AD-61190, AD-61 191, AD-60865, AD-60861, AD-60876, AD-61193, AD- 60519, AD-60519, or AD-60901. In embodiments, the derivative of AD-60489 is AD-60519. In embodiments, the derivative of AD-60489 is AD-61 193.
In one embodiment, a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS l is provided, wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALAS l RNA transcript, which antisense strand comprises at least 15 (e.g., at least 16, 17, 18, 19, 20, 21 , 22, or 23) contiguous nucleotides differing by no more than 3 (e.g., by no more than 0, 1 or 2) nucleotides from a derivative of AD-58632 described herein. In embodiments, one or more nucleotides are modified as described herein, e.g., one or more (or all) nucleotides of AD-58632 are modified as described herein. In embodiments, the derivative of AD-58632 is AD-60405, AD-60887, AD-60923, AD-60434, AD-60892, AD-60419, AD-60924, AD-60445, AD-60925, and AD-60926, AD-60820, AD-60843, AD-60819, AD-61 140, AD-61141 , AD-61142, AD- 60835, AD-60839, AD-61 143, AD-61 144, AD-61 145, AD-61 146, AD-60892, or AD-60419. In embodiments, the derivative of AD-58632 is AD-60819.
In some embodiments, the dsRNA has an IC50 of less than InM. In some embodiments, the dsRNA has an IC50 in the range of 0.01-lnM. In embodiments, the dsRNA has an IC5 of less than 0.05 nM. hi embodiments, the dsRNA has an IC50 of less than 0.02 nM. In
embodiments, the dsRNA has an IC50 of less than 0.01 nM. In embodiments, the IC50 is determined as described herein in the Examples.
In some embodiments, the dsRNA has a single dose ED5 of less than about 10 mg/kg. In some embodiments, the dsRNA has a single dose ED50 of less than about 5 mg/kg. In embodiments, the EC50 i determined as described herein in the Examples.
In some embodiments, the dsRNA shows improved activity compared with AD-58632. In some embodiments, the dsRNA shows improved activity compared with AD-60489. In some embodiments, the dsRNA shows improved activity compared with AD-58632 and AD-60489.
In embodiments, the dsRNA is AD-60501, AD-60519, AD-60901, AD-60495, AD- 60900, AD-60935, AD-60879, AD-61 190, AD-61 191, AD-60865, AD-60861, AD-60876, AD- 61 193, AD-60519, AD-60519, AD-60901 , AD-60405, AD-60887. AD-60923. AD-60434, AD- 60892, AD-60419, AD-60924, AD-60445, AD-60925, AD-60926, AD-60820, AD-60843, AD- 60819, AD-61140, AD-61141 , AD-61 142, AD-60835, AD-60839, AD-61 143, AD-61144, AD- 61145, AD-61146, AD-60892, or AD-60419 (e.g., including the nucleotide sequence and/or one or more (e.g., all) of the modifications of the aforesaid dsRNAs). In embodiments, the dsRNA comprises an antisense strand that comprises, or consists of, an antisense sequence (and/or one or more (e.g.. all) of the modifications)) selected from AD-60501 , AD-60519, AD-60901 , AD- 60495, AD-60900, AD-60935, AD-60879, AD-61 190, AD-61 191, AD-60865, AD-60861 , AD- 60876, AD-61 193, AD-60519, AD-60519, AD-60901 , AD-60405. AD-60887. AD-60923, AD- 60434, AD-60892, AD-60419, AD-60924, AD-60445, AD-60925, AD-60926, AD-60820, AD- 60843, AD-60819, AD-61140, AD-61 141, AD-61 142, AD-60835, AD-60839, AD-61143, AD- 61144, AD-61145, AD-61146, AD-60892, or AD-60419. In embodiments, the dsRNA comprises a sense strand that comprises, or consists of, a sense sequence (and/or one or more (e.g., all) of the modifications)) selected from AD-60501 , AD-60519, AD-60901 , AD-60495, AD-60900, AD-60935, AD-60879, AD-61 190, AD-61 191 , AD-60865, AD-60861 , AD-60876, AD-61193, AD-60519, AD-60519, AD-60901, AD-60405, AD-60887, AD-60923, AD-60434, AD-60892, AD-60419, AD-60924, AD-60445, AD-60925, AD-60926, AD-60820, AD-60843, AD-60819, AD-61 140, AD-61 141, AD-61 142, AD-60835, AD-60839, AD-61143, AD-61144, AD-61 145, AD-61 146, AD-60892, or AD-60419.
In embodiments, a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS 1 is provided, wherein the dsRNA comprises (i) an antisense strand that comprises, or consists of, the sequence of UAAGAUGAGACACUCUUUCUGGU (SEQ ID NO: 4153) or UAAGAUGAGACACUCTUUCUGGU (SEQ ID NO: 4154) and/or (ii) a sense strand that comprises, or consists of, the sequence of CAGAAAGAGUGUCUCAUCUUA (SEQ ID NO: 4155). In embodiments, one or more nucleotides of the antisense strand and/or sense strand are modified as described herein.
In embodiments, a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS l is provided, wherein the dsRNA comprises (i) an antisense strand that comprises, or consists of, the antisense sequence of AD-60489 and/or (ii) a sense strand that comprises, or consists of, the sense sequence of AD-60489 (wherein the sense and/or antisense sequence includes one or more (e.g., all) of the modifications of the sense strand and/or antisense strand of AD-60489).
In embodiments, a double -stranded ribonucleic acid (dsRNA) for inhibiting expression of ALASl is provided, wherein the dsRNA comprises (i) an antisense strand that comprises, or consists of, the antisense sequence of AD-60519 and/or (ii) a sense strand that comprises, or consists of, the sense sequence of AD-60519 (wherein the sense and/or antisense sequence includes one or more (e.g., all) of the modifications of the sense strand and/or antisense strand of AD-60519).
In embodiments, a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS l is provided, wherein the dsRNA comprises (i) an antisense strand that comprises, or consists of, the antisense sequence of AD-61 193 and/or (ii) a sense strand that comprises, or consists of, the sense sequence of AD-61 193 (wherein the sense and/or antisense sequence includes one or more (e.g., all) of the modifications of the sense strand and/or antisense strand of AD-61 193).
In embodiments, a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of
ALAS l is provided, wherein the dsRNA comprises (i) an antisense strand that comprises, or consists of, the antisense sequence of AD-60819 and/or (ii) a sense sequence that comprises, or consists of, the sense sequence of AD-60819 (wherein the sense and/or antisense sequence includes one or more (e.g., all) of the modifications of the sense strand and/or antisense strand of AD-60819).
In embodiments, a dsRNA for inhibiting expression of ALAS 1 is provided, wherein the dsRNA comprises (i) an antisense strand that comprises, or consists of, the antisense sequence of AD-60489, AD-60519, AD-61 193, or AD-60819 (or a corresponding unmodified antisense sequence) and/or (ii) a sense strand that comprises, or consists of, the sense sequence of AD- 60489, AD-60519, AD-61 193, or AD-60819 (or a corresponding unmodified antisense sequence). In embodiments, the dsRNA comprises (i) an antisense strand that consists of the antisense sequence of AD-60489, AD-60519, AD-61 193, or AD-60819 and/or (ii) a sense strand that consists of the sense sequence of AD-60489, AD-60519, AD-61193, or AD-60819, except that the antisense strand and/or sense strand of the dsRNA differs by 1 , 2, or 3 nucleotides from the corresponding antisense and/or sense sequence of AD-60489, AD-60519, AD-61 193, or AD- 60819.
The sequences and modifications of AD-60489, AD-60519, AD-61 193, and AD-60819 are shown in Table 2 below. Table 2: Sequences and Modifications of AD-60489, AD-60519, AD-61193, AD-60819
Figure imgf000020_0001
wherein c, a, g, u = 2'-OMe ribonucleosides; Af, Cf, G, Uf - 2'F ribonucleosides; S - phosphorothioate; L96 has the structure depicted in Table 1.
In embodiments, a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS l is provided, wherein the dsRNA comprises (i) an antisense strand that comprises, or consists of, the antisense sequence of AD-60489, AD-60519, or AD-61 193 and/or (ii) a sense strand that comprises, or consists of, the sense sequence of AD-60489, AD-60519, or AD-61 193 (including the nucleotide sequence and one or more (e.g., all) of the modifications of the sense strand and/or antisense strand of AD-60489, AD-60519, or AD-61193).
In embodiments, a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of
ALAS l is provided, wherein the dsRNA is AD-60489, AD-60519, AD-61 193, or AD-60819. In embodiments, a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALASl is provided, wherein the dsRNA is AD-60489, AD-60519, or AD-61 193 (e.g., including the nucleotide sequence and/or one or more (e.g., all) of the modifications of AD-60489, AD-60519, or AD-61 193).
In embodiments, the dsRNA is, comprises, or consists of, AD-60489 (e.g., including the nucleotide sequence and/or one or more (e.g., all) of the modifications of AD-60489).
In embodiments, the dsRNA is, comprises, or consists of, AD-60519 (e.g., including the nucleotide sequence and/or one or more (e.g., all) of the modifications of AD-60519). In embodiments, the dsRNA is, comprises, or consists of, AD-61 193 (e.g., including the nucleotide sequence and/or one or more (e.g. , all) of the modifications of AD-61193).
In embodiments, the dsRNA is, comprises, or consists of, AD-60819 (e.g., including the nucleotide sequence and/or one or more (e.g., all) of the modifications of AD-60819).
In embodiments, the dsRNA (e.g., AD-60489, AD-60519, AD-61 193, AD-60819, or another dsRNA disclosed herein in any one of Tables 21 to 40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., comprising or consisting of a sense sequence corresponding to SEQ ID NO: 4149 and an antisense sequence corresponding to SEQ ID NO: 4150; a sense sequence corresponding to SEQ ID NO: 4151 and an antisense sequence corresponding to SEQ ID NO: 4152; or a sense sequence corresponding to SEQ ID NO: X and an antisense sequence corresponding to SEQ ID NO: X+l , where X is any of the even numbers between 4172 and 5236)) is effective to suppress the liver level of ALAS l mRNA, e.g., to achieve silencing of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, or 80% (e.g., such that ALAS l mRNA levels are decreased to 90% or less, 80% or less, 70% or less, 60% or less, 50% or less, 40% or less, 30% or less, or 20%' or less of a control level of liver ALASl mRNA, e.g., the level in an untreated individual or group of individuals, e.g., an individual or group of individuals treated with PBS only). In embodiments, the effectiveness of the dsRNA in suppressing the liver level of ALAS l mRNA is assessed using a non-human primate model, e.g., as described herein in the Examples.
In embodiments, the dsRNA (e.g., AD-60489, AD-60519, AD-61 193, AD-60819, or another dsRNA disclosed herein in any one of Tables 21 to 40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., comprising or consisting of a sense sequence corresponding to SEQ ID NO: 4149 and an antisense sequence corresponding to SEQ ID NO: 4150; a sense sequence corresponding to SEQ ID NO: 4151 and an antisense sequence corresponding to SEQ ID NO: 4152; or a sense sequence corresponding to SEQ ID NO: X and an antisense sequence corresponding to SEQ ID NO: X+l, where X is any of the even numbers between 4172 and 5236)) is effective to suppress the circulating level of ALAS l mRNA, e.g., to achieve silencing of at least 10%, 20%, 30%, 40%, 50%, 60%. 70%, or 80% (e.g., such that ALAS l mRNA levels are decreased to 90% or less, 80% or less, 70% or less, 60% or less, 50% or less, 40% or less, 30% or less, or 20% or less of a control level of circulating ALAS l mRNA, e.g., the level prior to treatment with the dsRNA, or the level in an untreated individual or group of individuals). In embodiments, the effectiveness of the dsRNA in suppressing the circulating level of ALASl mRNA is assessed using a non-human primate model, e.g., as described herein in the Examples. In embodiments, the circulating level of ALASl mRNA is assessed using a circulating extracellular RNA detection (cERD) assay, e.g., as described herein or in Sehgal, A. et al. Quantitation of tissue-specific target gene modulation using circulating RNA (Poster presented on February 9, 2012 at the Keystone Gene Silencing by small RNAs symposium (Vancouver, February 7-12, 2012) or Sehgal, A. et al. Tissue-specific gene silencing monitored in circulating RNA, RNA, 20: 1-7, published online December 19, 2013, or Chan et al.
Preclinical development of a subcutaneous ALASl RNAi therapeutic for treatment of hepatic porphyrias using circulating RNA quantification. Mol Ther Nucleic Acids. 2015 Nov 3; 4:e263.
The cERD method can be applied to any appropriate biological sample. In embodiments, the circulating level of ALASl mRNA is assessed using a blood sample, e.g., a serum sample. In embodiments, the circulating level of ALAS l mRNA is assessed using a urine sample.
In embodiments, the dsRNA is a derivative of AD-60489 that is disclosed herein, e.g., in any one of the tables of WO 2015/051318. In embodiments, the dsRNA shows improved activity compared with AD-60489. In some such embodiments, the dsRNA is AD-60519.
In embodiments, the dsRNA is a derivative of AD-58632 that is disclosed herein, e.g., in any one of the tables of WO 2015/051318. In embodiments, the dsRNA shows improved activity compared with AD-58632.
In embodiments, improved activity is indicated by a lower IC50, e-g., as determined based on in vitro assays, e.g., as described herein, e.g., in the Examples.
In embodiments, improved activity is indicated by a lower effective dose. The effective dose may be determined based on the administration of a single dose or multiple repeated doses. In embodiments, the effective dose is determined based on the single dose ED50. In
embodiments, the effective dose or the single dose ED50 is determined based on an in vivo assay . In embodiments, the in vivo assay is conducted in a non-human animal, e.g., in a rat, in a non- human primate, or in a mouse.
In embodiments, the effective dose is determined based on the dose required to obtain a reduction of in a level of ALAS l mRNA (e.g., a liver level of ALASl mRNA and/or a circulating level of ALASl mRNA), e.g., as described herein in the Examples. In embodiments, circulating mRNA is assessed using the cERD assay. In embodiments, the effective dose is determined based on the dose required to obtain a reduction of a level (e.g., a urine and/or plasma level) of ALA and/or PBG.
In embodiments, the effective dose is determined based on the dose required to obtain a particular treatment effect described herein, e.g., prevention or reduction of symptoms associated with a porphyria.
In embodiments, improved activity is indicated by the achievement of a higher liver level of the dsRNA. In embodiments, a higher liver level is obtained after a single dose of dsRNA {e.g., a dose of about 0.02, 0.035, 0.1 , 0.35, 0.5, 1, 1.5, 2, 2.5, 3, or 5 mg/kg, or a dose of 0.3 to 2.5, 0.5 to 2, 0.5 to 1.5, 0.5 to 1, 1 to 1.5, 1.5 to 2, 2 to 2.5, or 2.5 to 5 mg/kg). In embodiments, a higher liver level is obtained after multiple doses of dsRNA have been administered (e.g., once every two weeks, once every four weeks, once a month, once every eight weeks, one two months, once every twelve weeks, once every three months, once every sixteen weeks, once every twenty weeks, or once every twenty-four weeks) at doses of 0.02, 0.035, 0.1, 0.35, 0.5, 1 , 1.5, 2, 2.5, 3, or 5 mg/kg, or 0.3 to 2.5, 0.5 to 2, 0.5 to 1.5, 0.5 to 1 , 1 to 1.5, 1.5 to 2, 2 to 2.5, or 2.5 to 5 mg/kg). In embodiments, a higher liver level is obtained after said dsRNA is administered at a dose of 0.5 to 2 mg/kg once every four weeks. In embodiments, a higher liver level is obtained after said dsRNA is administered at a dose of 0.5 to 2 mg/kg once every twelve weeks. In embodiments, a higher liver level is obtained after said dsRNA is administered at a dose of 2 to 3 mg/kg (e.g., 2.5 mg/kg) once every four weeks. In embodiments, a higher liver level is obtained after said dsRNA is administered at a dose of 2 to 3 mg kg (e.g., 2.5 mg/kg) once every twelve weeks. In embodiments, a higher liver level is obtained after said dsRNA is administered at a dose of 4 to 6 mg/kg (e.g., 5 mg/kg) once every twelve weeks. In
embodiments, a higher liver level is obtained after said dsRNA is administered at a dose of 0.5 to 2 mg/kg once every month. In embodiments, a higher liver level is obtained after said dsRNA is administered at a dose of 0.5 to 2 mg/kg once every three months. In embodiments, a higher liver level is obtained after said dsRNA is administered at a dose of 2 to 3 mg/kg (e.g., 2.5 mg/kg) once every month. In embodiments, a higher liver level is obtained after said dsRNA is administered at a dose of 2 to 3 mg/kg (e.g., 2.5 mg kg) once every three months. In
embodiments, a higher liver level is obtained after said dsRNA is administered at a dose of 4 to 6 mg kg (e.g., 5 mg kg) once every three months. In one embodiment, the iRNA encompasses a dsRNA having an RNA strand (the antisense strand) having a region that is substantially complementary to a portion of an ALAS l mRNA, e.g., a human ALAS l mRNA (e.g., a human ALASl mRNA as provided in SEQ ID NO: l or SEQ ID NO:382).
In one embodiment, an iRNA for inhibiting expression of an ALAS l gene includes at least two sequences that are complementary to each other. The iRNA includes a sense strand having a first sequence and an antisense strand having a second sequence. The antisense strand includes a nucleotide sequence that is substantially complementary to at least part of an mRNA encoding an ALAS l transcript, and the region of complementarity is 30 nucleotides or less, and at least 15 nucleotides in length. Generally, the iRNA is 19 to 24 nucleotides in length.
In some embodiments, the iRNA is 19-21 nucleotides in length. In some embodiments, the iRNA is 19-21 nucleotides in length and is in a lipid formulation, e.g. a lipid nanoparticle (LNP) formulation (e.g., an LNP1 1 formulation).
In some embodiments, the iRNA is 21-23 nucleotides in length. In some embodiments, the iRNA is 21-23 nucleotides in length and is in the form of a conjugate, e.g., conjugated to one or more GalNAc derivatives as described herein.
In some embodiments the iRNA is from about 15 to about 25 nucleotides in length, and in other embodiments the iRNA is from about 25 to about 30 nucleotides in length. An iRNA targeting ALAS l , upon contact with a cell expressing ALASl , inhibits the expression of an ALAS l gene by at least 10%, at least 20%, at least 25%, at least 30%, at least 35% or at least 40% or more, such as when assayed by a method as described herein. In one embodiment, the iRNA targeting ALAS l is formulated in a stable nucleic acid lipid particle (SNALP).
In one embodiment, an iRNA (e.g., a dsRNA) featured herein includes a first sequence of a dsRNA that is selected from the group consisting of the sense sequences of Tables 21 to 40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., an sense sequence corresponding to SEQ ID NO: 4149 or 4151 , or one of the even numbered sequences identified as SEQ ID NOs: 4172 to 5236) and a second sequence that is selected from the group consisting of the corresponding antisense sequences of Tables 21 to 40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237). The iRNA molecules featured herein can include naturally occurring nucleotides or can include at least one modified nucleotide. In embodiments, the at least one modified nucleotide include one or more of a modification on the nucleotide chosen from the group consisting of a locked nucleic acid (LNA), an acyclic nucleotide, a hexitol or hexose nucleic acid (HNA), a cyclohexene nucleic acid (CeNA), 2'-methoxyethyl, 2'-0-alkyl, 2'-0-ailyl, 2'-C- allyl, 2 ~fluoro, 2'-deoxy, 2'-hydroxyl, or any combination thereof. In one embodiment, the at least one modified nucleotide includes, but is not limited to a 2'-0-methyl modified nucleotide, 2'-fluoro modified nucleotide, a nucleotide having a 5'-phosphorothioate group, and a terminal nucleotide linked to a ligand, e.g., an N- acetylgalactosamine (GalNAc) or a cholesteryl derivative.
Alternatively, the modified nucleotide may be chosen from the group of: a 2'-deoxy-2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an acyclic nucleotide, an abasic nucleotide, 2'-amino-modified nucleotide, 2'-alkyl-modified nucleotide, morpholino nucleotide, a phosphoramidate, and a non-natural base comprising nucleotide. Such a modified sequence can be based, e.g., on a first sequence of said iRNA selected from the group consisting of the sense sequences of disclosed in Tables 21-40 of WO 2015/051318 and the Sequence
Listing attached herewith (e.g., an sense sequence corresponding to SEQ ID NO: 4149 or 4151 , or one of the even numbered sequences identified as SEQ ID NOs: 4172 to 5236), and a second sequence selected from the group consisting of the corresponding antisense sequences disclosed in Tables 21-40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., an sense sequence corresponding to SEQ ID NO: 4149 or 4151 , or one of the even numbered sequences identified as SEQ ID NOs: 4172 to 5236).
In one embodiment, an iRNA as described herein targets a wildtype ALAS 1 RNA transcript variant, and in another embodiment, the iRNA targets a mutant transcript (e.g., an ALAS l RNA carrying an allelic variant). For example, an iRNA featured in the invention can target a polymorphic variant, such as a single nucleotide polymorphism (SNP), of ALAS 1 . In another embodiment, the iRNA targets both a wildtype and a mutant ALASl transcript. In yet another embodiment, the iRNA targets a particular transcript variant of ALAS l (e.g., human ALAS l variant 1). In yet another embodiment, the iRNA agent targets multiple transcript variants (e.g., both variant 1 and variant 2 of human ALAS l ).
In one embodiment, an iRNA featured in the invention targets a non-coding region of an
ALAS l RNA transcript, such as the 5' or 3' untranslated region of a transcript. In some embodiments, an iRNA as described herein is in the form of a conjugate, e.g., a carbohydrate conjugate, which may serve as a targeting moiety and/or ligand, as described herein. In one embodiment, the conjugate is attached to the 3' end of the sense strand of the dsRNA. In some embodiments, the conjugate is attached via a linker, e.g., via a bivalent or trivalent branched linker.
In some embodiments, the conjugate comprises one or more N-acetylgalactosamine (GalNAc) derivatives. Such a conjugate is also referred to herein as a GalNAc conjugate. In some embodiments, the conjugate targets the R Ai agent to a particular cell, e.g., a liver cell, e.g., a hepatocyte. The GalNAc derivatives can be attached via a linker, e.g., a bivalent or trivalent branched linker. In particular embodiments, the conjugate is
Figure imgf000026_0001
In some embodiments, the RNAi agent is attached to the carbohydrate conjugate via a linker, e.g., a linker as shown in the following schematic, wherein X is O or S
Figure imgf000026_0002
In some embodiments, X is O. hi some embodiments, X is S.
In some embodiments, the RNAi agent is conjugated to L96 as defined in Table 1 and shown below
Figure imgf000027_0001
In one embodiment, the dsRNA has one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen or all of the following:
(i) is chemically synthesized, e.g., is synthesized by solid phase oligonucleotide synthesis;
(ii) all the nucleotides in the dsRNA are modified, e.g., all the nucleotides are 2'-OMe or 2'-F modified, or a combination of 2'-OMe and 2'~F modified;
(iii) all nucleotides are connected through 3'-5' phosphodiester linkages;
(iv) the sense strand comprises or consists of 21 nucleotides;
(v) the antisense sense strand comprises or consists of 23 nucleotides;
(vi) has a blunt-end at the 3 '-end of sense strand;
(vii) has a 3'-overhang, e.g., has a two-nucleotide overhang, at the 3'-end of the antisense strand;
(viii) is covalently attached to a ligand containing three N-acetylgalactosamine (GalNAc) moieties;
(ix) the 3"-end of the sense strand is conjugated to the triantennary GalNAc moiety (e.g., referred to herein as L96 as defined in Table 1 ). In one embodiment, the 3'-end is linked to the triantennary GalNAc moiety through a phosphodiester linkage;
(x) has an antisense strand that comprises one or more (e.g., four) phosphorothioate linkages, hi one embodiment, the phosphorothioate linkages are located at the 3' end and at the 5' end of the antisense strand. In one embodiment, two phosphorothioate linkages are located at the 3' end and two phosphorothioate linkages are located at the 5' end of the antisense strand;
(xi) has a sense strand that comprises one or more (e.g., two) phosphorothioate linkages. In one embodiment, the one or more (e.g., two) phosphorothioate linkages are located at the 5' end of the sense strand; (xii) 21 nucleotides of the sense strand hybridize to the complementary 21 nucleotides of the antisense strand;
(xiii) forms 21 nucleotide base pairs and a two-base overhang at the 3'-end of the antisense strand;
(xiv) comprises, or consists of, a sense and antisense strand having the sequence of AD-
60519;
(xv) has a sense strand with 10, 12, 14, 16, 18, 19, 20 or all of the modifications of the sense strand of AD-60519;
(xvi) has an antisense strand with 10, 12, 14, 16, 18, 19, 20 or all of the modifications of the antisense strand of AD-60519; or
(xvii) has the duplex sequence and all the modifications of AD-60519.
In embodiments, the dsRNA is in the form of a conjugate having the following structure (also referred to herein as AD-60519 or ALN-60519) (SEQ ID NOs: 5238-5239, respectively, in order of appearance):
21
Figure imgf000029_0001
Figure imgf000029_0002
Af, Cf, Sf, Uf « 2'-F fibon cteosides
Am, Cm, 6m, Urn - 2'-0Me r!b nu eos!des
S= phosphorothioate
Figure imgf000029_0003
In an aspect provided herein is a composition, e.g., a pharmaceutical composition, that includes one or more of the iRNAs described herein and a phamiaceuticaily acceptable carrier or delivery vehicle. In one embodiment, the composition is used for inhibiting the expression of an ALAS l gene in an organism, generally a human subject. In one embodiment, the composition is used for treating a porphyria, e.g., AIP.
In one aspect, an iRNA provided herein is a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALASl, wherein said dsRNA comprises a sense strand and a antisense strand 15-30 base pairs in length and the antisense strand is complementary to at least 15 contiguous nucleotides of SEQ ID NO: 1 or 382. In a further aspect, an iRNA provided herein is a double stranded RNAi (dsRNA) comprising a sense strand complementaiy to an antisense strand, wherein said antisense strand comprises a region of complementarity to an ALASl RNA transcript, wherein each strand has about 14 to about 30 nucleotides, wherein said double stranded RNAi agent is represented by formula (III):
sense: 5' np -Na -(X X X)rNb -Y Y Y -Nb -(Z Z Z¾ -Na - ¾ 3'
antisense: 3' np'-N3'-(X'X'X')k-Nb'-Y'Y'Y'-Nb'-(Z'Z'Z')i-Na'- nq' 5'
(III)
wherein:
i, j, k, and 1 are each independently 0 or 1 ;
p, p', q, and q' are each independently 0-6;
each Na and Na' independently represents an oligonucleotide sequence comprising 0-25 nucleotides which are either modified or unmodified or combinations thereof, each sequence comprising at least two differently modified nucleotides;
each Nb and Nb' independently represents an oligonucleotide sequence comprising
0-10 nucleotides which are either modified or unmodified or combinations thereof;
each np, np', nq, and nq' independently represents an overhang nucleotide;
XXX, YYY, ZZZ, Χ'Χ'Χ', ΥΎΎ', and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides;
modifications on Nb differ from the modification on Y and modifications on Nb' differ from the modification on Y'.
In embodiments, the sense strand is conjugated to at least one ligand.
In embodiments, i is 1; j is 1; or both i and j are 1.
In embodiments, k is 1; 1 is 1 ; or both k and 1 are 1.
In embodiments, XXX is complementary to X'X'X', YYY is complementary to ΥΎΎ', and ZZZ is complementary to Z'Z'Z'.
In embodiments, the Y'Y'Y' motif occurs at the 11, 12 and 13 positions of the antisense strand from the 5 '-end.
In embodiments, the Y' is 2'-0-methyl.
In embodiments, the duplex region is 15-30 nucleotide pairs in length.
In embodiments, the duplex region is 17-23 nucleotide pairs in length. In embodiments, the duplex region is 19-21 nucleotide pairs in length.
In embodiments, the duplex region is 21-23 nucleotide pairs in length.
In embodiments, the modification on the nucleotide is selected from the group consisting of a locked nucleic acid (LNA), an acyclic nucleotide, a hexitol or hexose nucleic acid (HNA), a cyclohexene nucleic acid (CeNA), 2'-methoxyethyl, 2'-0~alkyl, 2'-0~allyl, 2'~C- allyl, 2'-fluoro, 2'-deoxy, 2'-hydroxyl, and any combination thereof.
In embodiments, the modifications on the nucleotides are selected from the group consisting of LNA, HNA, CeNA, 2'-methoxyethyl, 2'-0-alkyl, 2'-0-allyl, 2'-C- allyl, 2'-fluoro, 2'-deoxy, 2'-hydroxyl, and combinations thereof.
In embodiments, the modifications on the nucleotides are 2'-0-methyl, 2'-fluoro or both.
In embodiments, the ligand comprises a carbohydrate.
In embodiments, the ligand is attached via a linker.
In embodiments, the linker is a bivalent or trivalent branched linker.
In embodiments, the ligand is
Figure imgf000031_0001
In embodiments, the ligand and linker are as shown in Formula XXIV:
Figure imgf000031_0002
In embodiments, the ligand is attached to the 3' end of the sense strand.
In embodiments, the dsRNA consists of or comprises a nucleotide sequence selected from the group of sequences provided in Tables 21-40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., an sense sequence corresponding to SEQ ID NO: 4149 or 4151, or one of the even numbered sequences identified as SEQ ID NOs: 4172 to 5236, and an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237).
In a further aspect, an iRNA provided herein is a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALASl, wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALAS l RNA transcript, which antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from one of the antisense sequences listed in any one of Tables 21- 40. In embodiments, the nucleotides of the antisense strand have fewer modifications, more modifications, or different modifications compared with the antisense sequences listed in any one of Tables 21-40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237).
In embodiments, the sense and antisense sequences are those of a duplex disclosed herein that suppresses ALAS 1 mRNA expression by at least 50%, 60%, 70%, 80%, 85% or 90%, e.g., as assessed using an assay disclosed in the Examples provided herein.
In embodiments, ALASl mRNA expression is assessed based on an ALAS l mRNA level in the liver, e.g., as assessed using a liver biopsy sample. In embodiments, ALASl mRNA expression is assessed based on an ALASl mRNA level in a biological fluid, e.g., blood, serum, plasma, cerebrospinal fluid, or urine. In embodiments, ALASl mRNA expression is assessed using a circulating extracellular RNA detection (cERD) assay, e.g., a cERD assay as described herein or in Sehgal, A. et al. Quantitation of tissue-specific target gene modulation using circulating RNA (Poster presented on February 9, 2012 at the Keystone Gene Silencing by small RNAs symposium (Vancouver, February 7-12, 2012), Sehgal, A. et al. Tissue-specific gene silencing monitored in circulating RNA, RNA, 20: 1-7, published online December 19, 2013, or Chan et al. Preclinical development of a subcutaneous ALASl RNAi therapeutic for treatment of hepatic porphyrias using circulating RNA quantification. Mol Ther Nucleic Acids. 2015 Nov 3; 4:e263.
In some embodiments, the dsRNA comprises at least one modified nucleotide.
In some embodiments, at least one of the modified nucleotides is chosen from the group consisting of: a 2 -O-methyl modified nucleotide, a nucleotide comprising a 5'-phosphorothioate group, and a terminal nucleotide linked to a cholesteryl derivative or dodecanoic acid
bisdecylamide group.
In some embodiments, the modified nucleotide is chosen from the group consisting of: a 2'-deoxy-2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an acyclic nucleotide, an abasic nucleotide, 2'-amino-modified nucleotide, 2'-alkyl-modified nucleotide, morpholino nucleotide, a phosphoramidate, and a non-natural base comprising nucleotide.
In some embodiments, the region of complementarity is at least 17 nucleotides in length. In some embodiments, the region of complementarity is between 19 and 21 nucleotides in length. In some embodiments, the region of complementarity is 19 nucleotides in length. In some embodiments, each strand is no more than 30 nucleotides in length. In some embodiments, at least one strand comprises a 3' overhang of at least 1 nucleotide. In embodiments, the antisense strand comprises a 3' overhang of at least 1 nucleotide. In some embodiments, at least one strand comprises a 3' overhang of at least 2 nucleotides. In embodiments, the antisense strand comprises a 3' overhang.of at least 2 nucleotides. In embodiments, the antisense strand comprises a 3' overhang.of 2 nucleotides.
In some embodiments, a dsRNA described herein further comprises a ligand. In some embodiments, the ligand is a GalNAc ligand. In some embodiments, the ligand targets the dsRNA to hepatocytes. In some embodiments, the ligand is conjugated to the 3' end of the sense strand of the dsRNA.
In some embodiments, the region of complementarity consists of an antisense sequence selected from the antisense sequences listed in Tables 21-40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237), or a corresponding antisense sequence in which some or all of the nucleotides are unmodified. In embodiments, the region of complementarity consists of the sequence UAAGAUGAGACACUCUUUCUGGU (SEQ ID NO: 4153) or
UAAGAUGAGACACUCTUUCUGGU (SEQ ID NO: 4154). In some embodiments, the region of complementarity consists of the antisense sequence of the duplex AD-60489. In some embodiments, the region of complementarity consists of the antisense sequence of the duplex AD-60519.
In embodiments, the region of complementarity consists of an antisense sequence selected from a duplex disclosed herein that suppresses ALAS 1 mRNA expression by at least 50%, 60%, 70%, 80%, 85% or 90%, e.g., as assessed using an assay disclosed in the Examples provided herein.
In some embodiments, the dsRNA comprises a sense strand consisting of a sense strand sequence selected from Tables 21-40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g. , an sense sequence corresponding to SEQ ID NO: 4149 or 4151 , or one of the even numbered sequences identified as SEQ ID NOs: 4172 to 5236), and an antisense strand consisting of an antisense sequence selected from Tables 21-40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237). In embodiments, the dsRNA comprises a pair of corresponding sense and antisense sequences selected from those of the duplexes disclosed in Tables 21-40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., a sense sequence corresponding to SEQ ID NO: 4149 and an antisense sequence corresponding to SEQ ID NO: 4150; a sense sequence corresponding to SEQ ID NO: 4151 and an antisense sequence corresponding to SEQ ID NO: 4152; or a sense sequence corresponding to SEQ ID NO: X and an antisense sequence corresponding to SEQ ID NO: X+l, where X is any of the even numbers between 4172 and 5236).
In embodiments, the method comprises administering to a subject said dsRNA at a dose of 0.02-10 mg/kg, e.g. , 0.5 to 10 mg/kg, e.g., 0.5 to 5 mg/kg, 0.5 to 3 mg/kg, or 0.5 to 2 mg/kg bodyweight of the patient once every four weeks or once every twelve weeks, e.g., for at least twenty-four weeks, thereby treating said patient.
In some embodiments, said dsRNA is administered at a dose of 0.5 to 1.5, 0.5 to 1, 1 to 1.5, 1.5 to 2 mg/kg, 2 to 2.5 mg/kg, 2.5 to 3 mg/kg, or 2.5 to 5 mg/kg, e.g., about 0.5, 1, 1.5, 2, 2.5, 3, or 5 mg/kg, bodyweight of the subject once every four weeks or once every twelve weeks. In some embodiments, said dsRNA is administered at a dose of 0.5 to 2 mg/kg once every four weeks. In some embodiments, said dsRNA is administered at a dose of 0.5 to 2 mg/kg once every twelve weeks. In some embodiments, said dsRNA is administered at a dose of 2 to 3 mg kg (e.g., 2.5 mg/kg) once every four weeks. In some embodiments, said dsRNA is administered at a dose of 2 to 3 mg/kg (e.g., 2.5 mg/kg) once every twelve weeks. In some embodiments, said dsRNA is administered at a dose of 4 to 6 mg kg (e.g., 5 mg/kg) once every twelve weeks.
In one aspect, the invention provides a cell containing at least one of the iRNAs (e.g., dsRNAs) featured herein. The cell is generally a mammalian cell, such as a human cell. In some embodiments, the cell is an erythroid cell. In other embodiments, the cell is a liver cell (e.g., a hepatocyte).
In an aspect provided herein is a pharmaceutical composition for inhibiting expression of an ALAS l gene, the composition comprising an iRNA (e.g., a dsRNA) described herein, e.g., for use in a method described herein.
In embodiments of the pharmaceutical compositions described herein, the iRNA (e.g., dsRNA) is administered in an unbuffered solution. In embodiments, the unbuffered solution is saline or water, e.g., water for injection.
In embodiments, the pharmaceutical composition comprises AD-60519 and water for injection. In embodiments, the composition comprises about 100 to 300 mg mL, e.g., 200 mg/mL, of AD-60519. In embodiments, the composition has a pH of 6.0-7.5, e.g. , about 7.0. In embodiments, the composition is for subcutaneous injection. In embodiments, the
pharmaceutical composition is packaged in a container (e.g., a glass vial, e.g., a 2 mL glass vial,) at a volume of about 0.3 to 1 mL, e.g., 0.55 mL. In embodiments, the pharmaceutical
composition is ALN-AS 1 as described herein in the examples.
In embodiments of the pharmaceutical compositions described herein, the iRNA (e.g., dsRNA is administered with a buffer solution. In embodiments, the buffer solution comprises acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof. In embodiments, the buffer solution is phosphate buffered saline (PBS).
In embodiments of the pharmaceutical compositions described herein, the iRNA (e.g., dsRNA) is targeted to hepatocytes. In embodiments of the pharmaceutical compositions described herein, the composition is administered intravenously. In embodiments of the pharmaceutical compositions described herein, the composition is administered subcutaneously.
In embodiments, a pharmaceutical composition comprises an iRNA (e.g., a dsRNA) described herein that comprises a ligand (e.g., a GalNAc ligand) that targets the iRNA (e.g., dsRNA) to hepatocytes. In embodiments, a pharmaceutical composition comprises an iRNA (e.g., a dsRNA) described herein that comprises a ligand (e.g., a GalNAc ligand), and the pharmaceutical composition is administered subcutaneously. In embodiments, the ligand targets the iRNA (e.g., dsRNA) to hepatocytes.
In certain embodiments, a pharmaceutical composition, e.g., a composition described herein, includes a lipid formulation, hi some embodiments, the RNAi agent is in a LNP formulation, e.g., a MC3 formulation. In some embodiments, the LNP formulation targets the RNAi agent to a particular ceil, e.g., a liver cell, e.g., a hepatocyte. In embodiments, the lipid formulation is a LNP1 1 formulation. In embodiments, the composition is administered intravenously.
In another embodiment, the pharmaceutical composition is formulated for administration according to a dosage regimen described herein, e.g., not more than once every four weeks, not more than once every three weeks, not more than once every two weeks, or not more than once every week. In another embodiment, the administration of the pharmaceutical composition can be maintained for a month or longer, e.g., one, two, three, or six months, or one year or longer.
In another embodiment, a composition containing an iRNA featured in the invention, e.g. , a dsRNA targeting ALAS l, is administered with a non-iRNA therapeutic agent, such as an agent known to treat a porphyria (e.g. , AW), or a symptom of a porphyria (e.g., pain). In another embodiment, a composition containing an iRNA featured in the invention, e.g. , a dsRNA targeting AIP, is administered along with a non-iRNA therapeutic regimen, such as hemin or glucose (e.g., glucose infusion (e.g., IV glucose)). For example, an iRNA featured in the invention can be administered before, after, or concurrent with glucose, dextrose, or a similar treatment that serves to restore energy balance (e.g. , total parenteral nutrition). An iRNA featured in the invention can also be administered before, after, or concurrent with the administration of a heme product (e.g., hemin, heme arginate, or heme albumin), and optionally also in combination with a glucose (e.g., IV glucose) or the like. Typically, glucose administered for the treatment of a porphyria is administered intravenously (IV). Administration of glucose intravenously is referred to herein as "IV glucose." However, alternative embodiments in which glucose is administered by other means are also encompassed.
In one embodiment, an ALAS1 iRNA is administered to a patient, and then the non- iRNA agent or therapeutic regimen (e.g., glucose and/or a heme product) is administered to the patient (or vice versa). In another embodiment, an ALAS 1 iRNA and the non-iRNA therapeutic agent or therapeutic regimen are administered at the same time.
In an aspect provided herein is a method of inhibiting ALAS 1 expression in a cell, the method comprising: (a) introducing into the cell an iRNA (e.g. a dsRNA) described herein and (b) maintaining the cell of step (a) for a time sufficient to obtain degradation of the mRNA transcript of an ALAS1 gene, thereby inhibiting expression of the ALASl gene in the cell.
In an aspect provided herein is a method for reducing or inhibiting the expression of an ALASl gene in a cell (e.g., an erythroid cell or a liver cell, such as, e.g., a hepatocyte). The method includes:
(a) introducing into the cell a double-stranded ribonucleic acid (dsRNA), wherein the dsRNA includes at least two sequences that are complementary to each other. The dsRNA has a sense strand having a first sequence and an antisense strand having a second sequence; the antisense strand has a region of complementarity that is substantially complementary to at least a part of an mRNA encoding ALASl, and where the region of complementarity is 30 nucleotides or less, i.e., 15-30 nucleotides in length, and generally 19-24 nucleotides in length, and where the dsRNA upon contact with a cell expressing ALASl, inhibits expression of an ALASl gene by at least 10%, e.g., at least 20%, at least 30%, at least 40% or more; and
(b) maintaining the cell of step (a) for a time sufficient to obtain degradation of the mRNA transcript of the ALASl gene, thereby reducing or inhibiting expression of an ALASl gene in the cell.
In embodiments of the foregoing methods of inhibiting ALAS 1 expression in a cell, the cell is treated ex vivo, in vitro, or in vivo. In embodiments, the cell is a hepatocyte. In embodiments, the cell is present in a subject in need of treatment, prevention and/or management of a disorder related to ALAS 1 expression.
In embodiments, the disorder is a porphyria. In embodiments, the porphyria is acute intermittent porphyria or ALA-dehydratase deficiency porphyria.
In embodiments, the porphyria is a hepatic porphyria, e.g., a porphyria selected from acute intermittent porphyria (AIP) hereditary coproporphyria (HCP), variegate porphyria (VP), ALA deyhdratase deficiency porphyria (ADP), and hepatoerythropoietic porphyria. In embodiments, the porphyria is a homozygous dominant hepatic porphyria (e.g., homozygous dominant AIP, HCP, or VP) or hepatoerythropoietic porphyria. In embodiments, the porphyria is a dual porphyria.
In embodiments, the expression of ALAS 1 is inhibited by at least 30%. In embodiments, the iRNA (e.g., dsRNA) has an Κ¾0 in the range of 0.01-lnM.
In certain embodiments, the cell (e.g., the hepatocyte) is a mammalian cell (e.g., a human, non-human primate, or rodent cell).
In one embodiment, the cell is treated ex vivo, in vitro, or in vivo (e.g., the cell is present in a subject (e.g., a patient in need of treatment, prevention and/or management of a disorder related to ALAS 1 expression).
In one embodiment, the subject is a mammal (e.g., a human) at risk, or diagnosed with a porphyria, e.g., X-linked sideroblastic anemia (XLSA), ALA deyhdratase deficiency porphyria (ADP or Doss porphyria), acute intermittent porphyria (AIP), congenital erythropoietic porphyria (CEP), prophyria cutanea tarda (PCT), hereditary coproporphyria (coproporphyria, or HCP), variegate porphyria (VP), erythropoietic protoporphyria (EPP), or transient erythroporphyria of infancy. In some embodiments, the disorder is an acute hepatic porphyria, e.g. , ALA
deyhdratase deficiency porphyria (ADP), AIP, HCP, or VP. In specific embodiments, the disorder is ALA deyhdratase deficiency porphyria (ADP) or ΑΓΡ.
In embodiments, the porphyria is a hepatic porphyria, e.g., a porphyria selected from acute intermittent porphyria (AIP) hereditary coproporphyria (HCP), variegate porphyria (VP), ALA deyhdratase deficiency porphyria (ADP), and hepatoerythropoietic porphyria. In embodiments, the porphyria is a homozygous dominant hepatic porphyria (e.g., homozygous dominant AIP, HCP, or VP) or hepatoerythropoietic porphyria. In embodiments, the porphyria is a dual porphyria. In one embodiment, the dsRNA introduced reduces or inhibits expression of an ALAS 1 gene in the cell. In one embodiment, the dsRNA introduced reduces or inhibits expression of an ALASl gene, or the level of one or more porphyrins or porphyrin precursors (e.g., δ- aminolevulinic acid (ALA), porphopilinogen (PBG), hydroxymethylbilane (HMB),
uroporphyrinogen I or III, coproporphyrinogen I or III, protoporphrinogen IX, and
protoporphyrin IX) or porphyrin products or metabolites, by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% or more compared to a reference, (e.g., an untreated cell or a cell treated with a non-targeting control dsRNA). Without being bound by theory, ALASl is the first enzyme of the porphyrin pathway. Thus, reducing expression of the ALASl gene is likely to reduce the level of one or more porphyrin precursors, porphyrins or porphyrin products or metabolites.
In other aspects, the invention provides methods for treating, preventing or managing pathological processes related to ALAS l expression (e.g., pathological processes involving porphyrins, porphyrin precuorsors, or defects in the porphyrin pathway, such as, for example, porphyrias). In one embodiment, the method includes administering to a subject, e.g., a patient in need of such treatment, prevention or management, an effective (e.g. , a therapeutically or prophylactically effective) amount of one or more of the iRNAs featured herein.
In an aspect provided herein is a method of treating and/or preventing a disorder related to ALASl expression comprising administering to a subject in need of such treatment a therapeutically effective amount of an iRNA (e.g., a dsRNA) described herein, or a composition comprising an iRNA (e.g., a dsRNA) described herein.
In an aspect provided herein is a method of treating and/or preventing a porphyria comprising administering to a subject in need of such treatment a double- stranded ribonucleic acid (dsRNA), wherein said dsRNA comprises a sense strand and an antisense strand 15-30 base pairs in length and the antisense strand is complementary to at least 15 contiguous nucleotides of SEQ JD NO: l or SEQ ID NO:382.
In one embodiment, subject (e.g., the patient) has a porphyria. In another embodiment, the subject (e.g., patient) is at risk for developing a porphyria. In some embodiments, administration of the iRNA targeting ALAS l alleviates or relieves the severity of at least one symptom of a disorder related to ALAS l in the patient. In one embodiment, the subject is a mammal (e.g., a human) at risk, or that has been diagnosed with, a disorder related to ALAS 1 expression, e.g., a porphyria, e.g., X-linked sideroblastic anemia (XLSA), ALA devhdratase deficiency porphyria (Doss porphyria), acute intermittent porphyria (AIP), congenital erythropoietic porphyria (CEP), prophyria cutanea tarda (PCT), hereditary coproporphyria (coproporphyria, or HCP), variegate porphyria (VP), erythropoietic protoporphyria (EPP), or transient erythroporphyria of infancy. In a further embodiment, the porphyria is an acute hepatic porphyria, e.g. , ALA deyhdratase deficiency porphyria (ADP), AIP, HCP, or VP. In some such embodiments, the disorder is ALA deyhdratase deficiency porphyria (ADP) or AIP.
In embodiments the subject has, or is at risk for developing, a porphyria. In
embodiments, the porphyria is a hepatic porphyria, e.g., a porphyria selected from acute intermittent porphyria (AIP) hereditary coproporphyria (HCP), variegate porphyria (VP), ALA deyhdratase deficiency porphyria (ADP), and hepatoerythropoietic porphyria. In embodiments, the porphyria is a homozygous dominant hepatic porphyria (e.g., homozygous dominant ΑΓΡ, HCP, or VP) or hepatoerythropoietic porphyria. In embodiments, the porphyria is a dual porphyria.
In embodiments, a porphyria, a symptom of porphyria, a prodrome, or an attack of porphyria is induced by exposure to a precipitating factor, as described herein. In some embodiments, the precipitating factor is a chemical exposure. In some embodiments, the precipitating factor is a drug, e.g., a prescription drug or an over the counter drug. In some embodiments, the precipitating factor is the menstrual cycle, e.g., a particular phase of the menstrual cycle, e.g., the luteal phase.
In embodiments, the iRNA (e.g., dsRNA) or composition comprising the iRNA is administered after an acute attack of porphyria. In embodiments, the iRNA (e.g., dsRNA) or composition comprising the iRNA is administered during an acute attack of porphyria. In embodiments, the iRNA (e.g., dsRNA) or composition comprising the iRNA is administered prophylactically to prevent an acute attack of porphyria.
In embodiments, the iRNA (e.g., dsRNA) is formulated as an LNP formulation. In emtodiments, the iRNA (e.g., dsRNA) is in the form of a GalNAc conjugate.
In embodiments, the iRNA (e.g., dsRNA) is administered at a dose of 0.02-10 mg/kg, e.g., 0.02-5 mg/kg or 0.02-3 mg/kg, e.g., about 0.02, 0.035, 0.1 , 0.35, 0.5, 1 , 1.5, 2, 2.5, 3, or 5 mg/kg, or 0.3-2.5, 0.5-1, 0.5-1.5, 1-1.5, 1-2.5, 1.5-2, 0.5-2, 2-2.5, or 2,5-5 mg/kg. In embodiments, the iRNA (e.g., dsRNA) is administered once every two weeks, once every four weeks, once every eight weeks, once every twelve weeks, once every sixteen weeks, once every twenty weeks, or once every twenty-four weeks. In embodiments, the iRNA (e.g., dsRNA) is administered once every month, once every two months, once every three months, once every four months, once every five months, or once every six months.
In embodiments, the iRNA (e.g., dsRNA) is administered at a concentration of
0.5 mg/kg-2 mg/kg, e.g., about 0.5-1.5, 0.5-1 , 1 -1.5, or 1.5-2 mg/kg bodyweight of the subject. In embodiments, the iRNA (e.g., dsRNA) is administered once every four weeks, once every eight weeks, or once every tweleve weeks, hi embodiments, the iRNA (e.g., dsRNA) is administered once every month, once every two months, or once every three months, hi embodiments, the iRNA (e.g., dsRNA) is administered at a concentration of 0.5 mg kg to 2 mg/kg bodyweight of the subject once every four weeks or once every twelve weeks. In embodiments, the iRNA (e.g., dsRNA) is administered at a concentration of 0.5 mg/kg to 2 mg kg bodyweight of the subject once every month or once every three months.
In embodiments, the iRNA (e.g., dsRNA) is administered at a concentration of 2 to 3 mg/kg (e.g., 2,5 mg/kg) bodyweight of the subject, hi embodiments, the iRNA (e.g., dsRNA) is administered once every four weeks, once every eight weeks, or once every tweleve weeks. In embodiments, the iRNA (e.g., dsRNA) is administered once every month, once every two months, or once every three months. In embodiments, the iRNA (e.g., dsRNA) is administered at a concentration of 2 to 3 mg/kg (e.g., 2.5 mg kg) mg/kg bodyweight of the subject once every four weeks or once every twelve weeks. In embodiments, the iRNA (e.g., dsRNA) is administered at a concentration of 2 to 3 mg/kg (e.g., 2.5 mg kg) bodyweight of the subject once every month or once every three months.
In embodiments, the iRNA (e.g., dsRNA) is administered at a concentration of 4 to 6 mg/kg (e.g., 5 mg/kg) bodyweight of the subject. In embodiments, the iRNA (e.g., dsRNA) is administered once every four weeks, once every eight weeks, or once every tweleve weeks. In embodiments, the iRNA (e.g., dsRNA) is administered once every month, once every two months, or once every three months. In embodiments, the iRNA (e.g., dsRNA) is administered at a concentration of 4 to 6 mg/kg (e.g., 5 mg kg) mg/kg bodyweight of the subject once every four weeks or once every twelve weeks. In embodiments, the iRNA (e.g., dsRNA) is administered at a concentration of 4 to 6 mg/kg (e.g., 5 mg/kg) bodyweight of the subject once every month or once every three months.
In embodiments, the iRNA (e.g., dsRNA) is formulated as an LNP formulation and is administered at a dose of 0.02-10 mg/kg, e.g., 0.02-5 mg/kg or 0.02-3 mg/kg, e.g., 0.02, 0.035, 0.1, 0.35, 0.5, 1.5, 2, 2.5, 3, or 5 mg/kg. or 0.3-2.5, 0.5-2, 2-2.5. or 2.5-5 mg/kg. In embodiments, the iRNA (e.g., dsRNA) is administered once every two weeks, once every four weeks, once every eight weeks, once every twelve weeks, once every sixteen weeks, once every twenty weeks, or once every twenty-four weeks. In embodiments, the iRNA (e.g., dsRNA) is administered once every month, once every two months, once every three months, once every four months, once every five months, or once every six months.
In embodiments, the iRNA (e.g., dsRNA) is in the form of a GalNAc conjugate and is administered at a dose of 0.02-10 mg kg, e.g., 0.02-5 mg kg or 0.02-3 mg kg, e.g., at a dose of 0.3-2.5, 0.5-1 , 0.5-1.5, 1-1.5, 1-2.5, 1.5-2, 0.5-2, 2-2,5, or 2.5-5 mg/kg. In certain embodiments, the iRNA in the GalNAc conjugate is administered at a dose of 5 mg kg or less, e.g., 2.5 mg kg or less than 2.5 mg/kg (e.g., 2 mg/kg or less) e.g., once every four weeks, once every eight weeks, or once every twelve weeks, or once every month, once every two months, or once every three months; e.g., a dose of 1.5 mg/kg or less, 1 mg/kg or less, or 0.5 mg/kg or less, e.g., once every four weeks, once every eight weeks, once every twelve weeks, or once every month, once every two months, or once every three months. In one embodiment, the iRNA in the GalNAc conjugate is administered at a dose of about 1 mg/kg or less, e.g., once every four weeks, once ever\? eight weeks, or once every twelve weeks, or once every month, once every two months, or once every three months. In one embodiment, the iRNA in the GalNAc onjugate is administered at a dose of about 2 to 3 mg kg (e.g. , 2.5 mg/kg) once every four weeks, once every twelve weeks, once every month, or once every three months. In one embodiment, the iRNA in the GalNAc onjugate is administered at a dose of about 4 to 6 mg/kg (e.g., 5 mg kg) once every twelve weeks or once every three months. In one embodiment, the administration of the iRNA in the GalNAc conjugate is subcutaneous.
In embodiments, the iRNA (e.g., dsRNA) is in the form of a GalNAc conjugate and is administered, e.g., subcutaneously, at a dose of 0.5-2 mg/kg, e.g. 0.5-1.5, 0.5-1 mg kg, 1 to 1.5 mg kg, or 1.5-2 mg kg. In embodiments, the iRNA is administered once every four weeks, once every eight weeks, or once every twelve months. In embodiments, the iRNA is administered once every month, once every two months, or once every three months. In embodiments, the iRNA (e.g., dsRNA) is in the form of a GalNAc conjugate and is administered, e.g.,
subcutaneously, at a dose of 2-3 mg kg, e.g. 2.5 mg kg, e.g., once every four weeks, once every twelve weeks, once every month, or once every three months. In embodiments, the iRNA (e.g., dsRNA) is in the form of a GalNAc conjugate and is administered, e.g., subcutaneously, at a dose of 4-6 mg/kg, e.g. 5 mg/kg, e.g., once every twelve weeks or once every three months. In embodiments, the iRNA is administered as a composition comprising the iRNA and water for injection. In embodiments, the iRNA is AD-60519. hi embodiments, the composition comprises the iRNA, e.g. , AD-60519, at a concentration of about 200 mg/mL.
In embodiments, the method decreases a level of a porphyrin or a porphyrin precursor in the subject. In embodiments, the level is decreased by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%. In an embodiment, the level is decreased by at least 30%. In embodiments, the porphyrin precursor is δ-aminolevulinic acid (ALA) or porphopilinogen (PBG).
In embodiments, the iRNA (e.g., dsRNA) has an IC5 in the range of 0.01-lnM.
In embodiments, a method described herein
(i) ameliorates a symptom associated with an ALAS 1 related disorder (e.g., a
porphyria)
(ii) inhibits ALAS 1 expression in the subject (e.g., as assessed using the cERD
assay),
(iii) decreases a level of a porphyrin precursor (e.g., ALA or PBG) or a porphyrin in the subject,
(iv) decreases frequency of acute attacks of symptoms associated with a porphyria in the subject, or
(v) decreases incidence of acute attacks of symptoms associated with a porphyria in the subject when the subject is exposed to a precipitating factor (e.g., the premenstrual phase or the luteal phase).
In embodiments, the method ameliorates pain and/or progressive neuropathy.
In embodiments, the iRNA (e.g., dsRNA) or composition comprising the iRNA is administered according to a dosing regimen.
In some embodiments, the iRNA (e.g., dsRNA) or composition comprising the iRNA is administered before or during an acute attack of porphyria. In some embodiments, the iRNA is administered before an acute attack of porphyria. In some embodiments, the iRNA (e.g., dsRNA) or composition comprising the iRNA is administered during a prodrome. In
embodiments, the prodrome is characterized by abdominal pain, nausea, psychological symptoms (e.g., anxiety), restlessness and/or insomnia.
In embodiments, the iRNA (e.g., dsRNA) or composition comprising the iRNA is administered during a particular phase of the menstrual cycle, e.g., during the luteal phase.
In embodiments, the method ameliorates or prevents cyclical attacks of porphyria, e.g., by reducing the severity, duration, or frequency of attacks. In embodiments, the cyclical attacks are associated with a precipitating factor. In embodiments, the precipitating factor is the menstrual cycle, e.g., a particular phase of the menstrual cycle, e.g., the luteal phase.
In embodiments, the subject has an elevated level of ALA and/or PBG. In embodiments, the level of ALA and/or PBG is elevated in plasma or urine from the subject. In embodiments, the subject has or is at risk for developing a porphyria, e.g., a hepatic porphyria. In
embodiments, the subject is asymptomatic. In embodiments, the subject carries a genetic alteration (e.g., a gene mutation) associated with a porphyria, as described herein. In
embodiments, the subject has or is at risk for developing a porphyria and suffers from pain (e.g., chronic pain, e.g., chronic neuropathic pain) and/or neuropathy (e.g., progressive neuropathy). In embodiments, the subject does not suffer from acute attacks but suffers from pain (e.g., chronic pain, e.g., chronic neuropathic pain) and/or neuropathy (e.g., progressive neuropathy). In embodiments, the pain is abdominal pain.
In embodiments, the subject (a) has an elevated level of ALA and/or PBG and (b) suffers from pain (e.g., chronic pain, e.g., chronic neuropathic pain) and/or neuropathy (e.g., progressive neuropathy). In embodiments, the pain is abdominal pain.
In embodiments, the subject has a plasma level and/ or a urine level of ALA and/or PBG that is elevated. In embodiments, the elevated level of ALA and/or PBG is accompanied by other symptoms, e.g., pain (e.g., chronic pain, e.g., chronic neuropathic pain) or neuropathy (e.g., progressive neuropathy). In embodiments, the pain is abdominal pain, hi embodiments, the subject is asymptomatic. In embodiments, the subject has a genetic mutation associated with a porphyria, e.g., a mutation as described herein.
In embodiments, the subject has a level (e.g., a plasma level or a urine level) of a porphyrin precursor, e.g., ALA and/or PBG, that is elevated, e.g., the level is greater than, or greater than or equal to, a reference value. In embodiments, the level is greater than the reference value. In embodiments, the reference value is two standard deviations above the mean level in a sample of healthy individuals. In embodiments, the reference value is an upper reference limit.
In embodiments, the subject has a plasma level and/or a urine level of ALA and/or PBG that is greater than, or greater than or or equal to, 2 times, 3 times, 4 times, or 5 times that of an upper reference limit. As used herein, an ''upper reference limit" refers to a level that is the upper limit of the 95% confidence interval for a reference sample, e.g., a sample of normal (e.g., wild type) or healthy individuals, e.g., individuals who do not carry a genetic mutation associated with a porphyria and/or individuals who do not suffer from a porphyria. In embodiments, the subject has a urine level of ALA and/or PBG that is greater than 2 to 4 times that of an upper reference limit. In embodiments, the subject has a urine level of ALA and/or PBG that is greater than 4 times that of an upper reference limit.
In embodiments, the reference value for plasma PBG is 0.12 μιηοΙ/L. In embodiments, the subject is a human and has a plasma PBG level that is greater than, or greater than or equal to, 0.12 μηιοΙ/L, 0.24 mol/L, 0.36 μηιοΙ/L, 0.48 μιτιοΙ/L, or 0.60 μιηοΙ/L. In embodiments, the subject is a human and has a plasma level of PBG that is greater than, or greater than or equal to, 0.48 μηιοΙ/L.
In embodiments, the reference value for urine PBG is 1.2 mmol/mol creatinine. In embodiments, the subject is a human and has a urine PBG level that is greater than, or greater than or equal to, 1.2 mmol/mol creatinine, 2.4 mmol/mol creatinine, 3.6 mmol/mol creatinine, 4.8 mmol/mol creatinine, or 6.0 mmol mol creatinine. In embodiments, the subject is a human and has a urine level of PBG that is greater than, or greater than or equal to, 4.8 mmol/mol creatinine.
In embodiments, the reference value for plasma ALA is 0.12 μιηοΙ L. In embodiments, the subject is a human and has a plasma ALA level that is greater than, or greater than or equal to, 0.12 μιηοΙ/L, 0.24 μη οΙ/L, 0.36 μιηοΙ/L, 0.48 μηιοΙ/L, or 0.60 μπιοΙ/L. In embodiments, the subject is a human and has a plasma ALA level that is greater than, or greater than or equal to 0.48 μηιοΙ/L.
In embodiments, the reference value for urine ALA is 3.1 mmol/mol creatinine. In embodiments, the subject is a human and has a urine ALA level that is greater than, or greater than or equal to, 3.1 mmol/mol creatinine, 6.2 mmol/mol creatinine, 9.3 mmol/mol creatinine, 12.4 mmol/mol creatinine, or 15.5 mmol/mol creatinine.
In embodiments, the method decreases one or more signs or symptoms of a porphyria. In embodiments, the method decreases an elevated level of ALA and/or PBG. In embodiments, the method decreases pain (e.g., chronic pain, e.g. chronic neuropathic pain) and/or neuropathy (e.g., progressive neuropathy). In embodiments, the pain is abdominal pain. In embodiments, the pain is neuropathic pain (e.g., pain associated with the progressive neuropathy of acute porphyrias). The decrease in pain can include, e.g., prevention of pain, delay in the onset of pain, reduction in the frequency of pain, and/or reduction in severity of pain. In embodiments, the decrease in pain is assessed based on the subject's use of pain medication.
In embodiments, the method ameliorates or prevents acute attacks of porphyria, e.g., by reducing the severity, duration, or frequency of attacks. In embodiments, the method decreases or prevents nerve damage.
In embodiments, the method prevents deterioration (e.g., prevents development of abnormalities) of or results in an improvement of clinical measures, e.g., clinical measures of muscle and/or nerve function, e.g., EMG and/or nerve conduction velocities.
In embodiments, the method decreases heme use by the subject. In embodiments, the method decreases pain medication use by the subject. In embodiments, the method reduces hospitalization.
In embodiments, the method is effective to reduce a level of ALA and/or PBG (e.g., a plasma or urine level of ALA and/or PBG). In embodiments, the method is effective to produce a predetermined reduction in the elevated level of ALA and/or PBG.
In embodiments, the predetermined reduction is a reduction to a value that is less than or equal to a reference value. In some embodiments, the reference value is an upper reference limit. In some embodiments, the reference value is the value that is two standard deviations above the mean level in a reference sample.
In embodiments, the method is effective to reduce the level of ALA and/or PBG in a subject to a level that is below two times the upper reference limit. In embodiments, the method is effective to reduce the level of ALA to below two times the upper reference limit. In embodiments, the method is effective to reduce the level of PBG to below two times the upper reference limit. In embodiments, the iRNA (e.g., dsRNA) or composition comprising the iRNA is administered as a single dose or at multiple doses, e.g., according to a dosing regimen. For example, the iRNA (e.g., dsRNA) or composition comprising the iRNA is administered once every four weeks, once every twelve weeks, once every month, once every three months.
In embodiments, the iRNA (e.g., dsRNA) or composition comprising the iRNA is administered prophylactically to a subject who is at risk for developing a porphyria. In embodiments, the iRNA (e.g., dsRNA) or composition comprising the iRNA is administered prophylactically beginning at puberty. In embodiments, the subject carries a genetic mutation associated with a porphyria and/or has an elevated level of ALA and/or PBG (e.g., an elevated plasma or urine level of ALA and/or PBG). In embodiments, the mutation makes an individual susceptible to an acute attack (e.g., upon exposure to a precipitating factor, e.g., a drug, dieting or other precipitating factor, e.g., a precipitating factor as disclosed herein). In embodiments, the mutation is associated with elevated levels of a porphyrin or a porphyrin precursor (e.g., ALA and/or PBG). In embodiments, the mutation is associated with chronic pain (e.g., chronic neuropathic pain) and/or neuropathy (e.g., progressive neuropathy).
In embodiments, the mutation is a mutation in the ALAS l gene. In embodiments, the mutation is a mutation in the ALASl gene promoter, or in regions upstream or downstream from the ALAS l gene. In embodiments, the mutation is a mutation in transcription factors or other genes that interact with ALAS l . In embodiments, the mutation is a mutation in a gene that encodes an enzyme in the heme biosynthetic pathway.
In embodiments, the iRNA (e.g., dsRNA or a conjugate thereof) or composition comprising the iRNA is administered subcutaneousiy. In embodiments, the iRNA is in the form of a GalNAc conjugate. In embodiments, the iRNA (e.g., the dsRNA) is administered at a dose of 0.02-10 mg/kg, e.g., 0.02-5 mg/kg or 0.02-3 mg/kg, e.g., at a dose of 0.3-2.5, 0.5-2, 0.5-1.5, 0.5- 1, 1-1.5, 1-2.5, 2.5-5, or 1.5-2 mg/kg. In certain embodiments, the iRNA is administered at a dose of 5 mg kg or less, e.g., 2.5 mg/kg or less than 2.5 mg/kg (e.g., 2 mg/kg or less) once every four weeks, once every eight weeks, or once every twelve weeks, or once every month, once every two months, or once every three months; e.g., a dose of 1.5 mg/kg or less, 1 mg kg or less, or 0.5 mg kg or less, e.g., once every four weeks, once every eight weeks, or once every twelve weeks, or once every month, once every two months, or once every three months. In one embodiment, the iRNA is administered at a dose of about 1 mg/kg or less, e.g., once every four weeks, once every eight weeks, or once every twelve weeks, or once every month, once every two months, or once every three months. In embodiments, the iRNA is administered is administered at a dose of 0.5 to 2 mg/kg once every four weeks. In embodiments, the iRNA is administered at a dose of 0.5 to 2 mg kg once every twelve weeks. In embodiments, the iRNA is administered at a dose of 2 to 3 mg/kg (e.g., 2.5 mg kg) once every four weeks. In embodiments, the iRNA is administered at a dose of 2 to 3 mg/kg (e.g., 2.5 mg/kg) once every twelve weeks. In embodiments, the iRNA is administered at a dose of 4 to 6 mg/kg (e.g., 5 mg/kg) once every twelve weeks. In embodiments, the iRNA is administered at a dose of 0.5 to 2 mg/kg once every month. In embodiments, the iRNA is administered at a dose of 0.5 to 2 mg/kg once every three months. In embodiments, the iRNA is administered at a dose of 2 to 3 mg/kg (e.g., 2.5 mg/kg) once every month. In embodiments, the iRNA is administered at a dose of 2 to 3 mg/kg (e.g., 2.5 mg/kg) once every three months. In embodiments, the iRNA is administered at a dose of 4 to 6 mg/kg (e.g., 5 mg/kg) once every three months.
In embodiments, the subject to be treated is asymptomatic and has an elevated level of ALA and/or PBG. In embodiments, the subject has a porphyria, e.g., AIP. In embodiments, the patient suffers from recurrent porphyric attacks.
In embodiments, the iRNA (e.g., AD-60519) is administered at a dose of less than 10 mg/kg, e.g., less than 6 mg/kg or 3 mg/kg, e.g., at about 0.02, 0.035, 0.1 , 0.35, 0.5, 1 , 1.5, 2, 2.5, 3, or 5 mg/kg, or at a dose of 0.3-2.5, 0.5-2, 0.5-1.5, 0.5-1, 1-1.5, 1 -2.5. 2.5-5, or 1.5-2 mg/kg. In embodiments, the iRNA (e.g., AD-60519) is administered in repeated doses, e.g., once every four weeks, once every eight weeks, or once every twelve weeks, or once every month, once every two months, or once every three months.
In one embodiment, the subject is asymptomatic and has an elevated level of ALA and/or PBG, and the iRNA (e.g., AD-60519) is administered at single doses, e.g., at about 0.02, 0.035, 0.1 , 0.35, 0.5, 1, 1.5, 2, 2.5, 3, or 5 mg/kg, or at a dose of 0.3-2.5, 0.5-2, 0.5-1.5, 0.5-1, 1-1.5, 1- 2.5, 2.5-5, or 1.5-2 mg/kg; or in repeatedly once every four weeks, once every eight weeks, or once every twelve weeks, or once every month, once every two months, or once every three months, e.g., of 0.5 and 2 mg/kg for several months (e.g., for 3, 6, 9, 12, 18, 24, 36, 48, or more months). In embodiments, the iRNA (e.g., AD-60519) is administered once every four weeks, once every twelve weeks, once every month, or once every three months. In one embodiment, the subject has AIP, e.g., is an A i P patient, the iRNA (e.g., AD- 60519) is administered at a dose of 0.02- 10 mg/kg, e.g., 0.02-5 mg/kg or 0.02-3 mg/kg, e.g., 0.3- 2.5, 0.5-2, 0.5-1.5, 0.5-1 , 1-1.5, 1.5-2, 2-2.5, or 2.5-5 mg kg, once every four weeks, once every eight weeks, or once every twelve weeks, or once every month, once every two months, or once every three months.
In embodiments, the iRNA (e.g., AD-60519) is administered is administered at a dose of 0.5 to 2 mg/kg once every four weeks. In embodiments, the iRNA (e.g., AD-60519) is administered at a dose of 0.5 to 2 mg/kg once every twelve weeks. In embodiments, the iRNA (e.g., AD-60519) is administered at a dose of 2 to 3 mg/kg (e.g., 2.5 mg/kg) once every four weeks. In embodiments, the iRNA (e.g., AD-60519) is administered at a dose of 2 to 3 mg/kg (e.g., 2.5 mg/kg) once every twelve weeks. In embodiments, the iRNA (e.g., AD-60519) is administered at a dose of 4 to 6 mg/kg (e.g., 5 mg/kg) once every twelve weeks. In
embodiments, the iRNA (e.g., AD-60519) is administered at a dose of 0.5 to 2 mg/kg once every month. In embodiments, the iRNA (e.g. , AD-60519) is administered at a dose of 0.5 to 2 mg/kg once every three months. In embodiments, the iRNA (e.g., AD-60519) is administered at a dose of 2 to 3 mg/kg (e.g., 2.5 mg/kg) once every month. In embodiments, the iRNA (e.g., AD- 60519) is administered at a dose of 2 to 3 mg/kg (e.g., 2.5 mg/kg) once every three months. In embodiments, the iRNA (e.g., AD-60519) is administered at a dose of 4 to 6 mg/kg (e.g. , 5 mg kg) once every three months. In embodiments, a treatment regimen is employed in which the iRNA is initially administered more frequently, followed by less frequent administration. In embodiments, the iRNA is initially administered once per day for multiple days (e.g., for 2-14 days, e.g., for 2, 3, 4, 5, 6, or 7 days). In embodiments, the iRNA is subsequently administered once per week. In embodiments, the iRNA is subsequently administered once every two weeks. In embodiments, the iRNA is subsequently administered once every two weeks. In
embodiments, the iRNA is subsequently administered once every four weeks. In embodiments, the iRNA is subsequently administered once every eight weeks. In embodiments, the iRNA is subsequently administered once every twelve weeks. In embodiments, the iRNA is subsequently administered once every sixteen weeks. In embodiments, the iRNA is subsequently administered once every twenty weeks, hi embodiments, the iRNA is subsequently administered once every twenty-four weeks. In embodiments, the iRNA is subsequently administered once every month. In embodiments, the iRNA is subsequently administered once every two months, hi embodiments, the iRNA is subsequently administered once every three months. In embodiments, the iRNA is subsequently administered once every four months. In embodiments, the iRNA is subsequently administered once every five months. In embodiments, the iRNA is subsequently administered once every six months. In embodiments, the iRNA is subsequently administered at a frequency that is effecti e to reduce one or more signs or symptoms of a porphyria.
In one aspect provided herein is a method of treating a subject with an elevated level of ALA and/or PBG, the method comprising administering to the subject a double-stranded ribonucleic acid (dsRNA), wherein said dsRNA comprises a sense strand and an antisense strand 15-30 base pairs in length and the antisense strand is complementary to at least 15 contiguous nucleotides of SEQ ID NO: l or SEQ ID NO:382.
In one aspect provided herein is a method of treating a subject with an elevated level of ALA and/or PBG, the method comprising administering to the subject a therapeutically effective amount of a dsRNA or a composition comprising a dsRNA, as described herein.
In some embodiments, the methods described herein are effective to decrease the level of ALA and/or PBG. In some embodiments, the level of ALA and/or PBG is decreased such that it is less than, or less than or equal to, a reference value, e.g., an upper reference limit.
In embodiments, the subject to be treated is asymptomatic and has an elevated level of ALA and/or PBG. In embodiments, the subject has a porphyria, e.g., AIP.
In embodiments, the iRNA is administered at a dose of less than 10 mg/kg, e.g., less than 6 mg kg or 3 mg/kg, e.g., at about 0.02. 0.035, 0.1 , 0.35, 0.5, 1 , 1.5, 2, 2.5, 3, or 5 mg/kg, or at a dose of 0.3-2,5, 0.5-2, 0.5-1.5, 0.5-1, 1 -1.5, 1-2.5, 2.5-5, or 1.5-2 mg/kg. In embodiments, the iRNA is administered in repeated doses, e.g., once every four weeks, once every eight weeks, once every twelve months, once every sixteen weeks, once every twenty months, or once every twenty- four months. In embodiments, the iRNA is administered in repeated doses, e.g., , once every month, once every two months, once every three months, once every four months, once every five months, or once every six months.
In another aspect, the invention provides methods for decreasing a level of a porphyrin or a porphyrin precursor in a cell (e.g., an erythroid cell or a liver cell, such as, e.g., a hepatocyte). In one embodiment, the cell is treated ex vivo, in vitro, or in vivo (e.g., the cell is present in a subject (e.g., a patient in need of treatment, prevention and/or management of a disorder related to ALAS l expression). The method includes contacting the cell with an effective amount of one or more of the iRNAs targeting ALASl, e.g., one or more of the iRNAs disclosed herein, thereby decreasing the level of a porphyrin or a porphyrin precursor in the cell; or decreasing the level of a porphyrin or a porphyrin precursor in other cells, tissues, or fluids within a subject in which the cell is located; relative to the level prior to contacting. Such methods can be used to treat (e.g., ameliorate the severity) of disorders related to ALASl expression, such as porphyrias, e.g., ΑΓΡ or ALA dehydratase deficiency porphyria.
In one embodiment, the contacting step is effected ex vivo, in vitro, or in vivo. For example, the cell can be present in a subject, e.g., a mammal (e.g., a human) at risk, or that has been diagnosed with, a porphyria. In an embodiment, the porphyria is an acute hepatic porphyria. In embodiments, the porphyria is a hepatic porphyria, e.g., a porphyria selected from acute intermittent porphyria (AIP), hereditary coproporphyria (HCP), variegate porphyria (VP), ALA deyhdratase deficiency porphyria (ADP), and hepatoerythropoietic porphyria. In embodiments, the porphyria is a homozygous dominant hepatic porphyria (e.g., homozygous dominant ΑΓΡ, HCP, or VP) or hepatoerythropoietic porphyria. In embodiments, the porphyria is a dual porphyria.
In an aspect provided herein is a method for decreasing a level of a porphyrin or a porphyrin precursor (e.g., ALA or PBG) in a cell, comprising contacting the cell with an iRNA (e.g., a dsRNA), as described herein, in an amount effective to decrease the level of the porphyrin or the porphyrin precursor in the cell.
In embodiments, the cell is a hepatocyte. In embodiments, the porphyrin or porphyrin precursor is δ- aminolevulinic acid (ALA), porphopilinogen (PBG), hydroxymethylbilane (HMB), uroporphyrinogen I or ΙΠ, coproporphyrinogen I or III, protoporphrinogen IX, or protoporphyrin IX. In embodiments, the porphyrin precursor is ALA or PBG.
In one embodiment, the cell is an erythroid cell. In a further embodiment, the cell is a liver cell (e.g., a hepatocyte).
In an aspect provided herein is a vector encoding at least one strand of an iRNA (e.g., a dsRNA) as described herein.
In an aspect provided herein is a vector encoding at least one strand of a dsRNA, wherein said dsRNA comprises a region of complementarity to at least a part of an mRNA encoding ALAS l , wherein said dsRNA is 30 base pairs or less in length, and wherein said dsR A targets said mRNA for cleavage.
In embodiments, the region of complementarity is at least 15 nucleotides in length. In embodiments, the region of complementarity is 19 to 21 nucleotides in length.
In one aspect, the invention provides a vector for inhibiting the expression of an ALASl gene in a cell. In one embodiment, the vector comprises an iRNA as described herein. In one embodiment, the vector includes at least one regulatory sequence operably linked to a nucleotide sequence that encodes at least one strand of an iRNA as described herein. In one embodiment the vector comprises at least one strand of an ALAS 1 iRNA.
In an aspect provided herein is a cell comprising a vector as described herein.In an aspect provided herein is a cell containing a vector for inhibiting the expression of an ALAS l gene in a cell. The vector includes a regulatory sequence operably linked to a nucleotide sequence that encodes at least one strand of one of the iRNAs as described herein. In one embodiment, the cell is a liver ceil (e.g., a hepatocyte). In another embodiment, the cell is an erythroid cell.
In another aspect, a method is provided for assaying the level of circulating extracellular
ALAS l mRNA in a subject, said method comprising detecting (e.g. , measuring) the level of
ALAS l mRNA in a biological fluid sample (e.g. , a blood sample (e.g., a serum or plasma
sample), a cerebrospinal fluid sample, or a urine from the subject, said biological fluid sample comprising the ALASl mRNA, thereby assaying the level of circulating extracellular ALASl mRNA in the subject.
In another aspect, a method is provided for assaying the level of circulating extracellular ALAS l mRNA in a subject, said method comprising (i) providing RNA (e.g., extracellular
RNA) from a biological fluid sample (e.g. , blood or plasma sample) from the subject, said
biological fluid sample comprising the ALAS l mRNA; (ii) obtaining an ALASl cDNA from the ALAS l mRNA; (iii) contacting the ALAS l cDNA with a nucleic acid complementary (e.g., probe and/or primer) to the ALASl cDNA or a portion thereof, thereby producing a reaction
mix; and (iv) detecting (e.g., measuring) the level of ALAS l cDNA in the reaction mix, wherein the ALASl cDNA level is indicative of the ALAS l mRNA level, thereby assaying the level of circulating extracellular ALAS l mRNA in the subject. In embodiments, said biological fluid sample is a blood sample. In embodiments, said biological fluid sample is a serum sample. In embodiments, said biological fluid sample is a urine sample.
In embodiments, the the method comprises PCR, qPCR or 5 '-RACE. In embodiments, said nucleic acid is a probe or primer. In embodiments, said nucleic acid comprises a detectable moiety and the level of ALAS 1 mRNA is detemiined by detection of the amount of the detectable moiety.
In embodiments, said method further comprises obtaining the biological fluid sample from the subject. In embodiments, the biological fluid sample is separate from the tissue and contains exosomes. In embodiments of these methods, the efficacy of a porphyria treatment is assessed based on a comparison of the level of circulating extracellular ALASl mRNA in the subject relative to a reference value.
In embodiments, a decrease in the level of circulating extracellular ALAS 1 mRNA in the subject in response to the porphyria treatment, relative to the reference value, indicates that the porphyria treatment is efficacious. In embodiments, the reference value is the level of circulating extracellular ALASl mRNA in the subject prior to the porphyria treatment.
All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety.
The details of various embodiments of the invention are set forth in the description below. Other features, objects, and advantages of the invention will be apparent from the description and the drawings, and from the claims.
Brief Description of the Drawings
FIG. 1 is a graph that shows percentages of ALASl mRNA levels in ASHE patients compared to normal healthy volunteers.
FIG. 2A is a graph that shows mean (SEM) % changes in ALASl mRNA levels from baseline in patients treated with placebo, or 0.035 mg/kg, 0.1 mg/kg, or 0.35 mg/kg ALN-AS 1.
FIG. 2B is a graph that shows mean (SEM) % changes in serum ALASl mRNA levels from baseline in patients treated with placebo, or 0.035 mg/kg, 0.1 mg/kg, 0.35 mg/kg, 1.0 mg kg, or 2.5 mg/kg ALN-AS 1. FIG. 2C is a graph that shows mean (SEM) % changes in urinary ALASl mRNA levels from baseline in patients treated with placebo, or 0.035 mg/kg, 0.1 mg/kg, 0.35 mg/kg, 1.0 mg kg, or 2.5 mg/kg ALN-ASl .
FIG. 3A is a graph that shows mean (SEM) % changes in ALA levels from baseline in patients treated with placebo, or 0.035 mg kg, 0.1 mg/kg, 0.35 mg kg, or 1.0 mg kg ALN-AS 1.
FIG. 3B is a graph that shows mean (SEM) % changes in ALA levels from baseline in patients treated with placebo, or 0.035 mg/kg, 0.1 mg/kg, 0.35 mg/kg, 1.0 mg/kg, or 2.5 mg/kg ALN-ASl.
FIG. 4A is a graph that shows mean (SEM) % changes in PBG levels from baseline in patients treated with placebo, or 0.035 mg/kg, 0.1 mg/kg, 0.35 mg/kg, or 1.0 mg/kg ALN-AS 1.
FIG. 4B is a graph that shows mean (SEM) % changes in PBG levels from baseline in patients treated with placebo, or 0.035 mg/kg, 0.1 mg/kg, 0.35 mg/kg, 1.0 mg kg, or 2.5 mg kg ALN-ASl.
FIG. 5A is a graph that shows the correlation between % changes in liver ALASl mRNA levels from baseline and % changes in urine ALA levels from baseline in patients treated with placebo, or 0.035 mg kg, 0.1 mg/kg, or 0.35 mg/kg ALN-ASl.
FIG. 5B is a graph that shows the correlation between % changes in liver ALASl mRNA levels from baseline and % changes in urine ALA levels from baseline in patients treated with placebo, or 0.035 mg kg, 0.1 mg kg, 0.35 mg kg, 1.0 mg kg, or 2.5 mg/kg ALN-ASl .
FIG. 6A is a graph that shows the correlation between % changes in liver ALAS 1 mRNA levels from baseline and % changes in urine PBG levels from baseline in patients treated with placebo, or 0.035 mg/kg, 0.1 mg/kg, or 0.35 mg/kg ALN-ASl.
FIG. 6B is a graph that shows the correlation between % changes in liver ALASl mRNA levels from baseline and % changes in urine PBG levels from baseline in patients treated with placebo, or 0.035 mg kg, 0.1 mg/kg, 0.35 mg kg, 1.0 mg/kg, or 2.5 mg/kg ALN-AS 1.
FIG. 7 is a graph that shows mean (SEM) % changes in serum ALASl mRNA levels from baseline in patients treated with multiple (2) doses of placebo, or 0.35 mg/kg or 1.0 mg/kg ALN-ASl .
FIG. 8 is a graph that shows mean (SEM) % changes in ALA levels from baseline in patients treated with multiple (2) doses of placebo, or 0.35 mg kg or 1.0 mg/kg ALN-ASl . FIG. 9 is a graph that shows mean (SEM) % changes in PBG levels from baseline in patients treated with with multiple (2) doses of placebo, or 0.35 mg/kg or 1.0 mg kg ALN-AS 1.
FIGs 1 -58 of Internationl Application Publication No. WO 2015/051318, titled
"Compositions and Methods for Inhibiting Expression of the ALAS l Gene," are incorporated by reference herein in their entirety.
Detailed Description of the Invention
iRNA directs the sequence-specific degradation of mRNA through a process known as RNA interference (RNAi). Described herein are iRNAs and methods of using them for inhibiting the expression of an ALAS 1 gene in a cell or a mammal where the iRNA targets an ALAS 1 gene. Also provided are compositions and methods for disorders related to ALAS 1 expression, such as porphyrias (e.g., ALA deyhdratase deficiency porphyria (ADP or Doss porphyria), acute intermittent porphyria, congenital erythropoietic porphyria, prophyria cutanea tarda, hereditary coproporphyria (coproporphyria), variegate porphyria, erythropoietic protoporphyria (EPP), X-linked sideroblastic anemia (XLS A), and and transient
erythroporphyria of infancy).
Porphyrias are inherited or acquired disorders that can be caused by decreased or enhanced activity of specific enzymes in the heme biosynthetic pathway, also referred to herein as the porphyrin pathway (See FIG. 1 of WO 2015/051318). Porphyrins are the main precursors of heme. Porphyrins and porphyrin precursors include δ-aminolevulinic acid (ALA), porphopilinogen (PBG), hydroxymethylbilane (HMB), uroporphyrinogen I or III,
coproporphyrinogen I or III, protoporphrinogen IX, and protoporphyrin IX. Heme is an essential part of hemoglobin, myoglobin, catalases, peroxidases, and cytochromes, the latter including the respiratory and P450 liver cytochromes. Heme is synthesized in most or all human cells. About 85% of heme is made in erythroid cells, primarily for hemoglobin. Most of the remaining heme is made in the liver, 80% of which is used for the synthesis of cytochromes. Deficiency of specific enzymes in the porphyrin pathway leads to insufficient heme production and also to an accumulation of porphyrin precursors and/or porphyrins, which can be toxic to cell or organ function in high concentrations.
Porphyrias may manifest with neurological complications ("acute"), skin problems
("cutaneous") or both. Porphyrias may be classified by the primary site of the overproduction and accumulation of porphyrins or their precursors. In hepatic porphyrias, porphyrins and porphyrin precursors are overproduced predominantly in the liver, whereas in erythropoietic porphyrias, porphyrins are overproduced in the erythroid cells in the bone. The acute or hepatic porphyrias lead to dysfunction of the nervous system and neurologic manifestations that can affect both the central and peripheral nervous system, resulting in symptoms such as, for example, pain (e.g., abdominal pain and/or chronic neuropathic pain), vomiting, neuropathy (e.g., acute neuropathy, progressive neuropathy), muscle weakness, seizures, mental disturbances (e.g., hallucinations, depression anxiety, paranoia), cardiac arrhythmias, tachycardia,
constipation, and diarrhea. The cutaneous or erythropoietic porphyrias primarily affect the skin, causing symptoms such as photosensitivity that can be painful, blisters, necrosis, itching, swelling, and increased hair growth on areas such as the forehead. Subsequent infection of skin lesions can lead to bone and tissue loss, as well as scarring, disfigurement, and loss of digits (e.g., fingers, toes). Most porphyrias are caused by mutations that encode enzymes in the heme biosynthetic pathway. A summary of porphyrias associated with genetic errors in heme metabolism is provided in FIG. 2 of WO 2015/051318.
Not all porphyrias are genetic. For example, patients with liver disease may develop porphyria as a result of liver dysfunction, and a transient form of erythroporphria (transient erythroporphyria of infancy) has been described in infancy (see Crawford, R.I. et al, J Am Acad Dermatol. 1995 Aug; 33(2 Pt 2):333-6.) Patients with PCT can acquire the deficient activity of uroporphyrinogen decarboxylase (URO-D), due to the formation of a ORO-D enzyme with lower than normal enzymatic activity (see Phillips et al. Blood, 98:3179-3185, 2001.)
Acute intermittent porphyria (AIP) (also be referred to as porphobilinogen (PBG) deaminase deficiency, or hydroxymethylbilane synthase (HMBS) deficiency), is the most common type of acute hepatic porphyria. Other types of acute hepatic porphyrias include hereditary coproporphyria (HCP), variegate porphyria (VP), and ALA deyhdratase deficiency porphyria (ADP). Acute hepatic porphyrias are described, e.g., in Balwani, M and Desnick, R.J., Blood, 120:4496-4504, 2012.
AIP is typically an autosomal dominant disease that is characterized by a deficiency of the enzyme porphobilinogen deaminase (PBG deaminase); this enzyme is also known as hydroxymethylbilane synthase (HMB synthase or HMBS). PBG deaminase is the third enzyme of the heme biosynthetic pathway (see FIG. 1 of WO 2015/051318) and catalyzes the head to tail condensation of four porphobilinogen molecules into the linear tetrapyrrole,
hydroxymethylbilane (HMB). Alternatively spliced transcript variants encoding different isoforms of PBG deaminase have been described. Mutations in the PBG deaminase gene are associated with AIP. Such mutations may lead to decreased amounts of PBG deaminase and/or decreased activity of PBG deaminase (affected individuals typically have a -50% reduction in PBG deaminase activity).
There are at least two different models of the pathophysiology of AIP and other acute hepatic porphyrias (see, e.g., Lin CS-Y et al., Clinical Neurophysiology, 201 1 ; 122:2336-44). According to one model, the decreased heme production resulting from PBG deaminase deficiency causes energy failure and axonal degeneration. According to the other, currently more favored model, the buildup of porphyrin precursors (e.g., ALA and PBG) results in neurotoxicity.
AIP has been found to have a prevalence as high as 1 in 10,000 in certain populations (e.g., in Northern Sweden; see Floderus Y, et al. Clin Genet. 2002; 62:288-97). The prevalence in the general population in United States and Europe, excluding the U.K., is estimated to be about 1 in 10,000 to 1 in 20,000. Clinical disease manifests itself in only approximately 10-15% of individuals who carry mutations that are known to be associated with AIP. However, the penetrance is as high as 40% in individuals with certain mutations (e.g. , the W198X mutation). AIP is typically latent prior to puberty. Symptoms are more common in females than in males. The prevalence of the disease is probably underestimated due to its incomplete penetrance and long periods of latency. In the United States, it is estimated that there are about 2000 patients who have suffered at least one attack. It is estimated that there are about 150 active recurrent cases in France, Sweden, the U.K., and Poland; these patients are predominantly young women, with a median age of 30. See, e.g., Elder et al, J Inherit Me tab Dis., published online Nov I, 2012.
AIP affects, for example, the visceral, peripheral, autonomic, and central nervous systems. Symptoms of AIP are variable and include gastrointestinal symptoms (e.g., severe and poorly localized abdominal pain, na sea/ vomiting, constipation, diarrhea, ileus), urinary symptoms (dysuria, urinary retention/incontinence, or dark urine, e.g., dark red urine), neurologic symptoms (e.g., sensory neuropathy, motor neuropathy (e.g., affecting the cranial nerves and/or leading to weakness in the arms or legs), seizures, neuropathic pain (e.g., pain associated with progressive neuropathy, e.g., chronic neuropathic pain), neuropsychiatric symptoms (e.g., mental confusion, anxiety, agitation, hallucination, hysteria, delirium, apathy, depression, phobias, psychosis, insomnia, somnolence, coma), autonomic nervous system involvement (resulting e.g., in cardiovascular sysmptoms such as tachycardia, hypertension, and/or arrhythmias, as well as other symptoms, such as, e.g., increased circulating catecholamine levels, sweating, restlessness, and/or tremor), dehydration, and electrolyte abnormalities. The most common symptoms are abdominal pain and tachycardia. Neurological manifestations include motor and autonomic neuropathy and seizures. Patients frequently have chronic neuropathic pain and develop a progressive neuropathy. Patients with recurring attacks often have a prodrome. Permanent paralysis may occur after a severe attack. Recovery from severe attacks that are not promptly treated may take weeks or months. An acute attack may be fatal, for example, due to paralysis of respiratory muscles or cardiovascular failure from electrolyte imbalance. (See, e.g., Thunell S. Hydroxymethylbilane Synthase Deficiency. 2005 Sep 27
[Updated 2011 Sep 1]. In: Pagon RA, Bird TD, Dolan CR, et al, editors. GeneReviews™
[Internet]. Seattle (WA): Umversity of Washington, Seattle; 1993- (hereinafter Thunell (1993)), which is hereby incorporated by reference in its entirety.) Prior to the availability of Hemin treatments, up to 20% of patients with ATP died from the disease,
In individuals who carry genes for ΑΓΡ, the risk of hepatocellular cancer is increased. In those with recurrent attacks, the risk of hepatocellular cancer is particularly grave: after the age of 50, the risk is nearly 100-fold greater than in the general population.
Attacks of acute porphyria may be precipitated by endogenous or exogenous factors. The mechanisms by which such factors induce attacks may include, for example, increased demand for hepatic P450 enzymes and/or induction of ALASl activity in the liver. Increased demand for hepatic P450 enzymes results in decreased hepatic free heme, thereby inducing the synthesis of hepatic ALASl.
Precipitating factors include fasting (or other forms of reduced or inadequate caloric intake, due to crash diets, long-distance athletics, etc), metabolic stresses (e.g., infections, surgery, international air travel, and psychological stress), endogenous hormones (e.g., progesterone), cigarette smoking, lipid-soluble foreign chemicals (including, e.g., chemicals present in tobacco smoke, certain prescription drugs, organic solvents, biocides, components in alcoholic beverages), endocrine factors (e.g., reproductive hormones (women may experience exacerbations during the premenstrual period), synthetic estrogens, progesterones, ovulation stimulants, and hormone replacement therapy). See, for example, Thunell (1993).
Over 1000 drugs are contraindicated in the acute hepatic porphyrias (e.g., AIP, HCP, ADP, and VP) including, for example, alcohol, barbiturates, Carbamazepine, Carisoprodol, Clonazepam (high doses), Danazol, Diclofenac and possibly other NSAIDS, Ergots, estrogens, Ethvclorvynol, Glutethimide, Griseofulvin, Mephenytoin, Meprobamate (also mebutamate and tybutamate), Methyprylon, Metodopramide, Phenytoin, Primidone, progesterone and synthetic progestins, Pyrazinamide, Pyrazolones (aminopyrine and antipyrine), Rifampin, Succinimides (ethosuximide and methsuximide), sulfonamide antibiotics, and Valproic acid.
Objective signs of AIP include discoloration of the urine during an acute attack (the urine may appear red or red-brown), and increased concentrations of PBG and ALA in urine during an acute attack. Molecular genetic testing identifies mutations in the PBG deaminase (also known as HMBS) gene in more than 98% of affected individuals. See, for example, Thunell (1993). See also, Lundin et al. Two new mutations in the porphobilinogen deaminase gene and a screening method using PCR amplification of specific alleles. Hum Genet. 1994 Jan; 93( 1 ):59- 62, Lundin et al. Four mutations in the porphobilinogen deaminase gene in patients with acute intermittent porphyria. Med Genet. 1995 Dec; 32(12): 979-81.
Diagnosis of porphria can involve assessment of family history, assessment of porphyrin precursor levels in urine, blood, or stool, and/or assessment of enzyme activity and DNA mutation analysis. The differential diagnosis of porphyrias may involve determining the type of porphyria by measuring individual levels of porphyrins or porphyrin precursors (e.g., ALA, PBG) in the urine, feces, and/or plasma (e.g., by chromatography and fluorometry) during an attack. The diagnosis of ΑΓΡ can be confirmed by establishing that erythrocyte PBG deaminase activity is at 50% or less of the normal level. DNA testing for mutations may be carried out in patients and at-risk family members. The diagnosis of ΑΓΡ is typically confirmed by DNA testing to identify a specific caustative gene mutation (e.g., an HMBS mutation).
Current management of acute attacks of AIP involves hospitalization, monitoring of symptoms, and removal of unsafe drugs. Treatment of acute attacks typically requires hospitalization to control and treat acute sysmptoms, including, e.g., abdominal pain, seizures, dehydration/hyponatremia, nausea/vomiting, tachycardia/hypertension, urinary retention/ileus. For example, abdominal pain may be treated, e.g., with narcotic analgesics, seizures may be treated with seizure precautions and possibly medications (although many anti-seizure medications are contraindicated), nausea/vomiting may be treated, e.g., with phenothiazines, and tachycardia/hypertension may be treated, e.g., with beta blockers. Treatment may include withdrawal of unsafe medications, monitoring of respiratory function, as well as muscle strength and neurological status. Mild attacks (e.g. , those with no paresis or hyponatremia) may be treated with at least 300 g intravenous 10% glucose per day, although increasingly hemin is provided immediately. Severe attacks are typically treated as soon as possible with intravenous hemin (3-4 mg/kg daily for 4- 14 days) and with IV glucose while waiting for the IV hemin to take effect. Typically, attacks are treated with IV hemin for 4 days and with IV glucose while waiting for administration of the IV hemin. Within 3-4 days following the start of hemin administration, there is usually clinical improvement accompanying by lowering of ALA and PBG levels.
Hemin (Panhematin® or hemin for injection, previously known as hematin) is the only heme product approved for use in the United States and was the first drug approved under the Orphan Drug Act. Panhematin® is hemin derived from processed red blood cells (PRBCs), and is Protoporphyrin IX containing a feme iron ion (Heme B) with a chloride ligand. Heme acts to limit the hepatic and/or marrow synthesis of porphyrin. The exact mechanism by which hemin produces symptomatic improvement in patients with acute episodes of the hepatic porphyrias has not been elucidated; however, its action is likely due to the (feedback) inhibition of δ- aminolevulinic acid (ALA) synthase, the enzyme which limits the rate of the porphyrin/heme biosynthetic pathway. See Panhematin® product label, Lundbeck, Inc., October 2010.
Inhibition of ALA synthase should result in reduced production of ALA and PBG as well as porphyrins and porphyrin intermediates.
Drawbacks of heme products (e.g., hemin) include delayed impact on clinical symptoms and failure to prevent the recurrence of attacks. Adverse reactions associated with heme (e.g., hemin) administration may include phlebitis (e.g., thrombophlebitis), difficulty with venous access, anticoagulation (or coagulopathies), thrombocytopenia, renal shut down, or iron overload, which is particularly likely in patients requiring multiple courses of hemin treatment for recurrent attacks. To prevent phlebitis, an indwelling venous catheter is needed for access in patients with recurrent attacks. Renal damage can occur with high doses. Uncommonly reported side effects include fever, aching, malaise, hemolysis, anaphalaxis, and circulatory collapse. See Anderson, K.E., Approaches to Treatment and Prevention of Human Porphyrias, in The
Porphyrin Handbook: Medical Aspects of Porphyrins, Edited by Karl M. Kadish, Kevin M. Smith, Roger Guilard (2003) (hereinafter Anderson).
Heme is difficult to prepare in a stable form for intravenous administration. It is insoluble at neutral pH but can be prepared as heme hydroxide at pH 8 or higher. Anderson. Panhematin is a lyophilized hemin preparation. When lyophilized hemin is solubilized for intravenous administration, degradation products form rapidly; these degradation products are responsible for a transient anticoagulant effect and for phlebitis at the site of infusion. Anderson. Heme albumin and heme arginate (Normosang, the European version of hemin) are more stable and may potentially cause less thrombophlebitis. However, heme arginate is not approved for use in the United States. Panhemin may be stabilized by solubilizing it for infusion in 30% human albumin rather than in sterile water; however, albumin adds intravascular volume- expanding effects and increases the cost of treatment as well as risk of pathogens since it is isolated from human blood. See, e.g., Anderson supra.
The successful treatment of an acute attack does not prevent or delay recurrence. There is a question of whether hemin itself can trigger recurring attacks due to induction of heme oxygenase. Nonetheless, in some areas (especially France), young women with multiply recurrent attacks are being treated with weekly hemin with the goal of achieving prophylaxis. Limited experience with liver transplantation suggests that if successful, it is an effective treatment for AIP. There have been approximately 12 transplants in Europe in human patients, with curative or varying effects. Liver transplantation can restore normal excretion of ALA and PBG and prevent acute attacks. See, e.g., Dar, F.S. et al. Hepatobiliary Pancreat. Dis. Int., 9(l):93-96 (2010). Furthermore, if the liver of a patient with ΑΓΡ is transplanted into another patient ("domino transplant"), the patient receiving the transplant may develop ALP.
Among the long-term clinical effects of acute porphyrias is chronic neuropathic pain that may result from a progressive neuropathy due to neurotoxic effects, e.g., of elevated porphyrin precursors {e.g., ALA and/or PBG). The neurotoxic effects can be associated with toxic heme intermediate production, for example, altered GABA signaling and/or production of iron- mediated oxidation and reactive oxygen species (ROS). Patients may suffer from neuropathic pain prior to or during an acute attack. Older patients may experience increased neuropathic pain with age for which various narcotic drugs are typically prescribed. Electromyogram abnormalities and decreased conduction times have been documented in patients with acute hepatic porphyrias. Of note, untreated, uninduced mice with AIP (PBG deaminase deficiency) develop a progressive motor neuropathy that has been shown to cause progressive quadriceps nerve axon degeneration and loss presumably due to constitutively elevated porphyrin precursor (ALA & PBG) levels, porphyrins and/or heme deficiency (Lindberg et at, J. Clin. Invest.,
103(8): 1 127-1 134, 1999). In patients with acute porphyria (e.g., ADP, AIP, HCP, or VP), levels of porphyrin precursors (ALA & PBG) are often elevated in asymptomatic patients and in symptomatic patients between attacks. Thus, reduction of the porphyrin precursors and resumption of normal heme biosynthesis by reducing the level of ALAS 1 expression and/or activity is expected to prevent and/or minimize development of chronic and progressive neuropathy. Treatment, e.g., chronic treatment (e.g., periodic treatment with iRNA as described herein, e.g., treatment according to a dosing regimen as described herein, e.g., weekly or biweekly treatment) can continuously reduce the ALAS 1 expression in acute porphyria patients who have elevated levels of porphyrin precursors, porphyrins, porphyrin products or their metabolites. Such treatment may be provided as needed to prevent or reduce the frequency or severity of an individual patient's symptoms (e.g., pain and/or neuropathy) and/or to reduce a level of a porphyrin precursor, porphyrin, porphyrin product or metabolite.
The need exists for identifying novel therapeutics that can be used for the treatment of porphyrias. As discussed above, existing treatments such as heme products (e.g., hemin) have numerous drawbacks. For example, the impact of hemin on clinical symptoms is delayed, it is expensive, and it may have side effects (e.g., thrombophlebitis, anticoagulation,
thrombocytopenia, iron overload, renal shutdown). Novel therapeutics such as those described herein can address these drawbacks and the unmet needs of patients acting faster, not inducing phlebitis, providing the convenience of subcutaneous administration, successfully preventing recurrent attacks, preventing or ameliorating pain (e.g., chronic neuropathic pain) and/or progressive neuropathy, and/or not causing certain adverse effects associated with hemin (e.g., iron overload, increased risk of hepatocellular cancer).
Patients with AIA include those who suffer from recurrent attacks and those who suffer from acute, sporadic attacks. In the pateints who suffer from recurrent attacks, about 5-10% have recurrent intermittent attacks (2-3 attacks per year) or recurrent attacks (>4 attacks per year). These patients are most likely to consider liver transplant or to receive prophylactic heme (e.g., heniin) infusions. The recurrent attack patients are likely to have poor quality of life due to long hospital stays, opiate addiction, and/or venous network toxicity. Chronic heme
administration can induce heme oxygenase (HO-1 ). Thus, it can be difficult to wean patients off heme and some require more frequent treatment. Some clinicials are therefore restricting heme use to the most serious attacks. Accordingly, there is an unmet need for convenient, effective prophylaxis and treatments with better tolerability. For patients who suffer from acute attacks, clinical guidelines suggest administration of heme as early as possible. However, given the challenges of diagnosis and lack of immediate drug availability, administration may be delayed. The slow onset of the effects of heme (e.g., hemin) and its poor tolerability slow the time to improvement. Persistence of severe abdominal pain, even after administration of heme, can require that patients receive opiates for multiple days.
Delayed administration of heme or continued exposure to precipitating factors can lead to more serious complications, including motor neuropathy and accompanying symptoms (e.g., weakness, paresis). Respiratory failure and paralysis can occur in severe cases. Recovery from neurological symptoms can take much longer to resolve. Accordingly, in the context of acute attacks, treatments that have a faster onset of action and better tolerability are needed.
Pharmacological validation of ALAS 1 as a target for mRNA silencing is supported by at least the following findings: ALAS1 mRNA is strongly upregulated during an attack; panhematin down modulates ALAS-1 ; and addition of heme to liver cells in culture leads to reduced ALAS-1 mRNA. Several findings also indicate that suppression of ALAS 1 mRNA can be achieved by targeting the liver. For example, liver transplant has been shown to be curative; and liver derived metabolites drive attacks (see e.g., Dar et al. Hepatobiliaij Pancreat Dis Int. 9:93-6 (2010); Dowman et al. Ann Intern Med 154:571-2 (2011); and Wu et al. Genes Dev 23:2201-2209 (2009). Thus, reducing expression of ALAS 1, e.g., in the liver, using iRNA compositions can be used to treat a porphyria. In certain embodiments, iRNA compositions can be used for prophylaxis and acute treatment of porphyrias. For example, iRNA compositions can be used prophylactically in a recurrent attack setting to induce long-term or chronic suppression of ALASl expression (leading to long-term or chronic suppression of ALA/PBG), and thus blunting the recurrent ALASl upregulation that drives the attacks. Such prophylactic treatment can reduce the number and the severity of the attacks. During an acute attack setting, administration of an iRNA composition can treat an acute attack, e.g., by reducing the levels of ALA/PBG.
The present disclosure provides methods and iRNA compositions for modulating the expression of an ALAS 1 gene. In certain embodiments, expression of ALAS1 is reduced or inhibited using an ALAS 1 -specific iRNA, thereby leading to a decreased expression of an ALAS 1 gene. Reduced expression of an ALAS 1 gene may reduce the level of one or more porphyrin precursors, porphyrins, or porphyrin products or metabolites. Decreased expression of an ALASl gene, as well as related decreases in the level of one or more porphyrin precursors and/or porphyrins, can be useful in treating disorders related to ALAS l expression, e.g., porphyrias.
The iRNAs of the compositions featured herein include an RNA strand (the antisense strand) having a region which is 30 nucleotides or less in length, i.e., 15-30 nucleotides in length, generally 19-24 nucleotides in length, which region is substantially complementary to at least part of an mRNA transcript of an ALASl gene (also referred to herein as an "ALAS 1 -specific iRNA"). The use of such an iRNA enables the targeted degradation of mRNAs of genes that are implicated in pathologies associated with ALASl expression in mammals, e.g., porphyrias such as ALA dehydratase deficiency porphyria (also known as Doss porphyria or plumboporphyria) or acute intermittent porphyria. Very low dosages of ALASl -specific iRNAs can specifically and efficiently mediate RNAi, resulting in significant inhibition of expression of an ALASl gene. iRNAs targeting ALAS l can specifically and efficiently mediate RNAi, resulting in significant inhibition of expression of an ALASl gene, e.g., in cell based assays. Thus, methods and compositions including these iRNAs are useful for treating pathological processes related to ALASl expression, such as porphyrias (e.g. , X-linked sideroblastic anemia (XLS A), ALA deyhdratase deficiency porphyria (Doss porphyria), acute intermittent porphyria (AIP), congenital erythropoietic porphyria, prophyria cutanea tarda, hereditary coproporphyria
(coproporphyria), variegate porphyria, erythropoietic protoporphyria (EPP), and transient erythroporphyria of infancy).
The following description discloses how to make and use compositions containing iRNAs to inhibit the expression of an ALAS l gene, as well as compositions and methods for treating diseases and disorders caused by or modulated by the expression of this gene.
Embodiments of the pharmaceutical compositions featured in the invention include an iRNA having an antisense strand comprising a region which is 30 nucleotides or less in length, generally 19-24 nucleotides in length, which region is substantially complementary to at least part of an RNA transcript of an ALAS1 gene, together with a pharmaceutically acceptable carrier. Embodiments of compositions featured in the invention also include an iRNA having an antisense strand having a region of complementarity which is 30 nucleotides or less in length, generally 19-24 nucleotides in length, and is substantially complementary to at least part of an RNA transcript of an ALAS 1 gene.
Accordingly, in some aspects, pharmaceutical compositions containing an ALASl iRNA and a pharmaceutically acceptable carrier, methods of using the compositions to inhibit expression of an ALASl gene, and methods of using the pharmaceutical compositions to treat disorders related to ALASl expression are featured in the invention.
I. Definitions
For convenience, the meaning of certain terms and phrases used in the specification, examples, and appended claims, are provided below. If there is an apparent discrepancy between the usage of a term in other parts of this specification and its definition provided in this section, the definition in this section shall prevail.
"G," "C," "A," "T" and "U" each generally stand for a nucleotide that contains guanine, cytosine, adenine, thymidine and uracil as a base, respectively. However, it will be understood that the term "ribonucleotide" or "nucleotide" can also refer to a modified nucleotide, as further detailed below, or a surrogate replacement moiety. The skilled person is well aware that guanine, cytosine, adenine, and uracil may be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide comprising a nucleotide bearing such replacement moiety. For example, without limitation, a nucleotide comprising inosine as its base may base pair with nucleotides containing adenine, cytosine, or uracil. Hence, nucleotides containing uracil, guanine, or adenine may be replaced in the nucleotide sequences of dsRNA featured in the invention by a nucleotide containing, for example, inosine. In another example, adenine and cytosine anywhere in the oligonucleotide can be replaced with guanine and uracil, respectively to form G-U Wobble base pairing with the target mRNA. Sequences containing such replacement moieties are suitable for the compositions and methods featured in the invention. As used herein, "ALASl " (also known as ALAS-1 ; δ-aminolevulinate synthase 1; δ-ALA synthase 1; 5 '-aminolevulinic acid synthase 1 ; ALAS-H; ALASH; ALAS-N; ALAS3;
EC2.3.1.37; 5-aminolevulinate synthase, nonspecific, mitochondrial; ALAS; MIG4;
OTTHUMP00000212619; OTTHUMP00000212620; OTTHUMP00000212621 ;
OTTHUMP00000212622; migration-inducing protein 4; EC 2.3.1 ) refers to a nuclear-encoded mitochondrial enzyme that is the first and typically rate-limiting enzyme in the mammalian heme biosynthetic pathway. ALASl catalyzes the condensation of glycine with succinyl-CoA to form δ-aminolevulinic acid (ALA). The human ALASl gene is expressed ubiquitously, is found on chromosome 3p21.1 and typically encodes a sequence of 640 amino acids. In contrast, the ALAS-2 gene, which encodes an isozyme, is expressed only in erythrocytes, is found on chromoxome Xpl 1.21 , and typicallyencodes a sequence of 550 amino acids. As used herein an "ALASl protein" means any protein variant of ALASl from any species (e.g., human, mouse, non-human primate), as well as any mutants and fragments thereof that retain an ALAS 1 activity. Similarly, an "ALASl transcript" refers to any transcript variant of ALASl , from any species (e.g., human, mouse, non-human primate). A sequence of a human ALAS 1 mRNA transcript can be found at NM_000688.4 (FIG. 3A and FIG. 3B of WO 2015/051318; SEQ ID NO: l). Another human ALASl mRNA transcript, can be found at NM_00()688.5 (FIG. 4A and FIG. 4B of WO 2015/051318; SEQ ID NO:382). The level of the mature encoded ALAS l protein is regulated by heme: high levels of heme down-regulate the mature enzyme in mitochondria while low heme levels up-regulate. Multiple alternatively spliced valiants, encoding the same protein, have been identified.
As used herein, the term "iRNA," "RNAi", "iRNA agent," or "RNAi agent" refers to an agent that contains RNA as that term is defined herein, and which mediates the targeted cleavage of an RNA transcript, e.g., via an RNA-induced silencing complex (RISC) pathway. In one embodiment, an iRNA as described herein effects inhibition of ALASl expression. Inhibition of ALASl expression may be assessed based on a reduction in the level of ALASl mRNA or a reduction in the level of the ALAS l protein. As used herein, "target sequence" refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of an ALAS 1 gene, including mRNA that is a product of RNA processing of a primary transcription product. The target portion of the sequence will be at least long enough to serve as a substrate for iRNA-directed cleavage at or near that portion. For example, the target sequence will generally be from 9-36 nucleotides in length, e.g., 15-30 nucleotides in length, including all sub-ranges therebetween. As non-limiting examples, the target sequence can be from 15-30 nucleotides, 15-26 nucleotides, 15-23 nucleotides, 15-22 nucleotides, 15-21 nucleotides, 15-20 nucleotides, 15-19 nucleotides, 15-18 nucleotides, 15-17 nucleotides, 18-30 nucleotides, 18-26 nucleotides, 18-23 nucleotides, 18-22 nucleotides, 18-21 nucleotides, 18-20 nucleotides, 19-30 nucleotides, 19-26 nucleotides, 19-23 nucleotides, 19-22 nucleotides, 19-21 nucleotides, 19-20 nucleotides, 20-30 nucleotides, 20-26 nucleotides, 20-25 nucleotides, 20-24 nucleotides,2()-23 nucleotides, 20-22 nucleotides, 20-21 nucleotides, 21-30 nucleotides, 21-26 nucleotides, 21-25 nucleotides, 21-24 nucleotides, 21-23 nucleotides, or 21-22 nucleotides.
As used herein, the term "strand comprising a sequence" refers to an oligonucleotide comprising a chain of nucleotides that is described by the sequence referred to using the standard nucleotide nomenclature.
As used herein, and unless otherwise indicated, the term "complementary," when used to describe a first nucleotide sequence in relation to a second nucleotide sequence, refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide comprising the second nucleotide sequence, as will be understood by the skilled person. Such conditions can, for example, be stringent conditions, where stringent conditions may include: 400 mM NaCl, 40 mM PIPES pH 6.4. 1 mM EDTA, 50°C or 70°C for 12-16 hours followed by washing. Other conditions, such as physiologically relevant conditions as may be encountered inside an organism, can apply. The skilled person will be able to determine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the hybridized nucleotides.
Complementary sequences within an iRNA, e.g., within a dsRNA as described herein, include base-pairing of the oligonucleotide or polynucleotide comprising a first nucleotide sequence to an oligonucleotide or polynucleotide comprising a second nucleotide sequence over the entire length of one or both nucleotide sequences. Such sequences can be referred to as "fully complementary" with respect to each other herein. However, where a first sequence is referred to as "substantially complementary" with respect to a second sequence herein, the two sequences can be fully complementary, or they may form one or more, but generally not more than 5, 4, 3 or 2 mismatched base pairs upon hybridization for a duplex up to 30 base pairs, while retaining the ability to hybridize under the conditions most relevant to their ultimate application, e.g., inhibition of gene expression via a RISC pathway. However, where two oligonucleotides are designed to form, upon hybridization, one or more single stranded overhangs, such overhangs shall not be regarded as mismatches with regard to the determination of complementarity. For example, a dsRNA comprising one oligonucleotide 21 nucleotides in length and another oligonucleotide 23 nucleotides in length, wherein the longer oligonucleotide comprises a sequence of 21 nucleotides that is fully complementary to the shorter oligonucleotide, may yet be referred to as "fully complementary" for the purposes described herein.
"Complementary" sequences, as used herein, may also include, or be formed entirely from, non -Watson-Crick base pairs and/or base pairs formed from non -natural and modified nucleotides, in as far as the above requirements with respect to their ability to hybridize are fulfilled. Such non-Watson-Crick base pairs includes, but are not limited to, G:U Wobble or Hoogstein base pairing.
The terms "complementary," "fully complementary" and "substantially complementary" herein may be used with respect to the base matching between the sense strand and the antisense strand of a dsRNA, or between the antisense strand of an iRNA agent and a target sequence, as will be understood from the context of their use.
As used herein, a polynucleotide that is "substantially complementary to at least part of" a messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to a contiguous portion of the mRNA of interest (e.g., an mRNA encoding an ALAS 1 protein). For example, a polynucleotide is complementary to at least a part of an ALAS 1 mRNA if the sequence is substantially complementary to a non -interrupted portion of an mRNA encoding ALAS 1. As another example, a polynucleotide is complementary to at least a part of an ALAS 1 mRNA if the sequence is substantially complementary to a non-interrupted portion of an mRNA encoding ALAS 1.
The term "double-stranded RNA" or "dsRNA," as used herein, refers to an iRNA that includes an RNA molecule or complex of molecules having a hybridized duplex region that comprises two anti-parallel and substantially complementary nucleic acid strands, which will be referred to as having "sense" and "antisense" orientations with respect to a target RNA. The duplex region can be of any length that permits specific degradation of a desired target RNA, e.g., through a RISC pathway, but will typically range from 9 to 36 base pairs in length, e.g., 15- 30 base pairs in length. Considering a duplex between 9 and 36 base pairs, the duplex can be any length in this range, for example, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, or 36 and any sub-range therein between, including, but not limited to 15-30 base pairs, 15-26 base pairs, 15-23 base pairs, 15-22 base pairs, 15-21 base pairs, 15-20 base pairs, 15-19 base pairs, 15-18 base pairs, 15-17 base pairs, 18-30 base pairs, 18-26 base pairs, 18-23 base pairs, 18-22 base pairs, 18-21 base pairs, 18-20 base pairs, 19-30 base pairs, 19-26 base pairs, 19-23 base pairs, 19-22 base pairs, 19-21 base pairs, 19-20 base pairs, 20-30 base pairs, 20-26 base pairs, 20-25 base pairs, 20-24 base pairs, 20-23 base pairs, 20-22 base pairs, 20-21 base pairs, 21-30 base pairs, 21-26 base pairs, 21-25 base pairs, 21-24 base pairs, 21-23 base pairs, or 21-22 base pairs. dsRNAs generated in the cell by processing with Dicer and similar enzymes are generally in the range of 19-22 base pairs in length. One strand of the duplex region of a dsDNA comprises a sequence that is substantially
complementary to a region of a target RNA. The two strands forming the duplex structure can be from a single RNA molecule having at least one self-complementary region, or can be formed from two or more separate RNA molecules. Where the duplex region is formed from two strands of a single molecule, the molecule can have a duplex region separated by a single stranded chain of nucleotides (herein referred to as a "hairpin loop") between the 3'-end of one strand and the 5 '-end of the respective other strand forming the duplex structure. The hairpin loop can comprise at least one unpaired nucleotide; in some embodiments the hairpin loop can comprise at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 23 or more unpaired nucleotides. Where the two substantially complementary strands of a dsRNA are comprised by separate RNA molecules, those molecules need not, but can be covalently connected. Where the two strands are connected covalently by means other than a hairpin loop, the connecting structure is referred to as a "linker." The term "siRNA" is also used herein to refer to a dsRNA as described above.
In another embodiment, the iRNA agent may be a "single-stranded siRNA" that is introduced into a cell or organism to inhibit a target mRNA. Single -stranded RNAi agents bind to the RISC endonuclease Argonaute 2, which then cleaves the target mRNA. The single- stranded siRNAs are generally 15-30 nucleotides and are chemically modified. The design and testing of single-stranded siRNAs are described in U.S. Patent No. 8,101,348 and in Lima et al, (2012) Cell 150: 883-894, the entire contents of each of which are hereby incorporated herein by reference. Any of the antisense nucleotide sequences described herein (e.g., sequences provided in Tables 2, 3, 6, 7, 8, 9, 14, 15, 18 and 20 of WO 2015/051318 or in Tables 21-40 of WO 2015/051318) may be used as a single-stranded siRNA as described herein or as chemically modified by the methods described in Lima et al, (2012) Cell 150:883-894.
In another aspect, the RNA agent is a "single-stranded antisense RNA molecule". An single-stranded antisense RNA molecule is complementary to a sequence within the target mRNA. Single-stranded antisense RNA molecules can inhibit translation in a stoichiometric manner by base pairing to the mRNA and physically obstructing the translation machinery, see Dias, N. et al., (2002) Mol Cancer Ther 1 :347-355. Alternatively, the single-stranded antisense molecules inhibit a target mRNA by hydridizing to the target and cleaving the target through an RNaseH cleavage event. The single-stranded antisense RNA molecule may be about 10 to about 30 nucleotides in length and have a sequence that is complementary to a target sequence. For example, the single-stranded antisense RNA molecule may comprise a sequence that is at least about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more contiguous nucleotides from any one of the antisense nucleotide sequences described herein, e.g., sequences provided in any one of Tables 2, 3, 6, 7, 8, 9, 14, 15, 18 and 20 of WO 2015/051318 and the Sequence Listing attached herewith or in Tables 21-40 of WO 2015/051318 and the Sequence Listing attached herewith.
The skilled artisan will recognize that the term "RNA molecule" or "ribonucleic acid molecule" encompasses not only RNA molecules as expressed or found in nature, but also analogs and derivatives of RNA comprising one or more ribonucleotide/ribonucleoside analogs or derivatives as described herein or as known in the art. Strictly speaking, a "ribonucleoside" includes a nucleoside base and a ribose sugar, and a "ribonucleotide" is a ribonucleoside with one, two or three phosphate moieties. However, the terms "ribonucleoside" and "ribonucleotide" can be considered to be equivalent as used herein. The RNA can be modified in the nucleobase structure, in the ribose structure, or in the ribose-phosphate backbone structure, e.g., as described herein below. However, the molecules comprising ribonucleoside analogs or derivatives must retain the ability to form a duplex. As non-limiting examples, an RNA molecule can also include at least one modified ribonucleoside including but not limited to a 2'-0-methyl modified nucleostide, a nucleoside comprising a 5' phosphorothioate group, a terminal nucleoside linked to a cholesteryl derivative or dodecanoic acid bisdecylamide group, a locked nucleoside, an abasic nucleoside, an acyclic nucleoside, a 2'-deoxy-2'-fluoro modified nucleoside, a 2'-amino- modified nucleoside, 2'-alkyl-modified nucleoside, moipholino nucleoside, a phosphoramidate or a non-natural base comprising nucleoside, or any combination thereof. Alternatively, an RNA molecule can comprise at least two modified ribonucleosides, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20 or more, up to the entire length of the dsRNA molecule. The modifications need not be the same for each of such a plurality of modified ribonucleosides in an RNA molecule. In one embodiment, modified RNAs contemplated for use in methods and compositions described herein are peptide nucleic acids (PNAs) that have the ability to form the required duplex structure and that permit or mediate the specific degradation of a target RNA, e.g., via a RISC pathway.
In one aspect, a modified ribonucleoside includes a deoxyribonucleoside. In such an instance, an iRNA agent can comprise one or more deoxynucleosides, including, for example, a deoxynucleoside overhang(s), or one or more deoxynucleosides within the double stranded portion of a dsRNA. In certain embodiments, the RNA molecule comprises a percentage of deoxyribonucleoses of at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95% or higher (but not 100%) deoxyribonucleosides, e.g., in one or both strands. In other embodiments, the term "iRNA" does not encompass a double stranded DNA molecule (e.g., a naturally-occurring double stranded DNA molecule or a 100% deoxynucleoside-containing DNA molecule). In one aspect, an RNA interference agent includes a single stranded RNA that interacts with a target RNA sequence to direct the cleavage of the target RNA. Without wishing to be bound by theory, long double stranded RNA introduced into cells is broken down into siRNA by a Type III endonuclease known as Dicer (Sharp et al., Genes Dev. 2001, 15:485). Dicer, a ribonuclease-III-like enzyme, processes the dsRNA into 19-23 base pair short interfering RNAs with characteristic two base 3' overhangs (Bernstein, et al., (2001) Nature 409:363). The siRNAs are then incorporated into an RNA-induced silencing complex (RISC) where one or more helicases unwind the siRNA duplex, enabling the complementary anti sense strand to guide target recognition (Nykanen, et al., (2001 ) Cell 107:309). Upon binding to the appropriate target mRNA, one or more endonucleases within the RISC cleaves the target to induce silencing (Elbashir, et al., (2001) Genes Dev. 15: 188). Thus, in one aspect the invention relates to a single stranded RNA that promotes the formation of a RISC complex to effect silencing of the target gene. As used herein, the term "nucleotide overhang" refers to at least one unpaired nucleotide that protrudes from the duplex structure of an iRNA, e.g., a dsRNA. For example, when a 3'-end of one strand of a dsRNA extends beyond the 5'-end of the other strand, or vice versa, there is a nucleotide overhang. A dsRNA can comprise an overhang of at least one nucleotide;
alternatively the overhang can comprise at least two nucleotides, at least three nucleotides, at least four nucleotides, at least five nucleotides or more. A nucleotide overhang can comprise or consist of a nucleotide/nucleoside analog, including a deoxymicleotide/nucleoside. The overhang(s) may be on the sense strand, the anti sense strand or any combination thereof.
Furthermore, the nucleotide(s) of an overhang can be present on the 5' end , 3' end or both ends of either an antisense or sense strand of a dsRNA.
In one embodiment, the antisense strand of a dsRNA has a 1-10 nucleotide overhang at the 3' end and/or the 5' end. In one embodiment, the sense strand of a dsRNA has a 1-10 nucleotide overhang at the 3' end and/or the 5' end. In another embodiment, one or more of the nucleotides in the overhang is replaced with a nucleoside thiophosphate.
The terms "blunt" or "blunt ended" as used herein in reference to a dsRNA mean that there are no unpaired nucleotides or nucleotide analogs at a given terminal end of a dsRNA, i.e., no nucleotide overhang. One or both ends of a dsRNA can be blunt. Where both ends of a dsRNA are blunt, the dsRNA is said to be blunt ended. To be clear, a "blunt ended" dsRNA is a dsRNA that is blunt at both ends, i.e., no nucleotide overhang at either end of the molecule. Most often such a molecule will be double-stranded over its entire length.
The term "antisense strand" or "guide strand" refers to the strand of an iRNA, e.g., a dsRNA, which includes a region that is substantially complementary to a target sequence. As used herein, the term "region of complementarity" refers to the region on the antisense strand that is substantially complementary to a sequence, for example a target sequence, as defined herein. Where the region of complementarity is not fully complementary to the target sequence, the mismatches may be in the internal or terminal regions of the molecule. Generally, the most tolerated mismatches are in the terminal regions, e.g., within 5, 4, 3, or 2 nucleotides of the 5' and/or 3' terminus.
The term "sense strand," or "passenger strand" as used herein, refers to the strand of an iRNA that includes a region that is substantially complementary to a region of the antisense strand as that term is defined herein. As used herein, the term "SNALP" refers to a stable nucleic acid-lipid particle. A SNALP represents a vesicle of lipids coating a reduced aqueous interior comprising a nucleic acid such as an iRNA or a plasmid from which an iRNA is transcribed. SNALPs are described, e.g., in U.S. Patent Application Publication Nos. 2006/0240093, 2007/0135372, and in
International Application Publication No. WO 2009/082817. These applications are incorporated herein by reference in their entirety.
''Introducing into a cell," when referring to an iRNA, means facilitating or effecting uptake or absorption into the cell, as is understood by those skilled in the art. Absorption or uptake of an iRNA can occur through unaided diffusive or active cellular processes, or by auxiliary agents or devices. The meaning of this term is not limited to cells in vitro; an iRNA may also be "introduced into a cell," wherein the cell is part of a living organism. In such an instance, introduction into the cell will include the delivery to the organism. For example, for in vivo delivery, iRNA can be injected into a tissue site or administered systemically. In vivo delivery can also be by a β-glucan delivery system, such as those described in U.S. Patent Nos. 5,032,401 and 5,607,677, and U.S. Publication No. 2005/0281781, which are hereby incorporated by reference in their entirety. In vitro introduction into a cell includes methods known in the art such as electroporation and lipofection. Further approaches are described herein below or known in the art.
As used herein, the term "modulate the expression of," refers to at an least partial "inhibition" or partial "activation" of an ALAS1 gene expression in a cell treated with an iRNA composition as described herein compared to the expression of ALAS 1 in a control cell. A control cell includes an untreated cell, or a ceil treated with a non-targeting control iRNA.
The terms "activate," "enhance," " p-regulate the expression of," "increase the expression of," and the like, in so far as they refer to an ALAS1 gene, herein refer to the at least partial activation of the expression of an ALAS 1 gene, as manifested by an increase in the amount of ALAS 1 mRNA, which may be isolated from or detected in a first cell or group of cells in which an ALAS 1 gene is transcribed and which has or have been treated such that the expression of an ALAS l gene is increased, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has or have not been so treated (control cells). In one embodiment, expression of an ALASl gene is activated by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% by administration of an iRNA as described herein. In some embodiments, an ALASl gene is activated by at least about 60%, 70%, or 80% by administration of an iRNA featured in the invention, hi some embodiments, expression of an ALASl gene is activated by at least about 85%, 90%, or 95% or more by administration of an iRNA as described herein, hi some embodiments, the ALASl gene expression is increased by at least 1-fold, at least 2-fold, at least 5-fold, at least 10-fold, at least 50-fold, at least 100-fold, at least 500-fold, at least 1000 fold or more in cells treated with an iRNA as described herein compared to the expression in an untreated cell. Activation of expression by small dsRNAs is described, for example, in Li et a!., 2006 Proc. Natl, Acad, Sci. U.S.A. 103:17337-42, and in US20070111963 and US2005226848, each of which is incorporated herein by reference.
The terms "silence," "inhibit expression of," "down-regulate expression of," "suppress expression of," and the like, in so far as they refer to an ALASl gene, herein refer to the at least partial suppression of the expression of an ALASl gene, as assessed, e.g., based on on ALASl mRNA expression, ALAS 1 protein expression, or another parameter functionally linked to ALASl gene expression (e.g., ALA or PBG concentrations in plasma or urine). For example, inhibition of ALASl expression may be manifested by a reduction of the amount of ALAS l mRNA which may be isolated from or detected in a first cell or group of cells in which an ALASl gene is transcribed and which has or have been treated such that the expression of an ALAS l gene is inhibited, as compared to a control. The control may be a second cell or group of cells substantially identical to the first cell or group of cells, except that the second cell or group of cells have not been so treated (control cells). The degree of inhibition is usually expressed as a percentage of a control level, e.g.,
(mRNA in control cells) - (mRNA in treated cells)
· 100%
(mRNA in control cells)
Alternatively, the degree of inhibition may be given in terms of a reduction of a parameter that is functionally linked to ALASl gene expression, e.g., the amount of protein encoded by an ALAS 1 gene, or the level of one or more porphyrins. The reduction of a parameter functionally linked to ALASl gene expression may similarly be expressed as a percentage of a control level. In principle, ALAS l gene silencing may be determined in any cell expressing ALAS l , either constitutively or by genomic engineering, and by any appropriate assay. However, when a reference is needed in order to determine whether a given iRNA inhibits the expression of the ALAS 1 gene by a certain degree and therefore is encompassed by the instant invention, the assays provided in the Examples below shall serve as such reference.
For example, in certain instances, expression of an ALAS 1 gene is suppressed by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% by administration of an iRNA featured in the invention. In some embodiments, an ALAS 1 gene is suppressed by at least about 60%, 65%, 70%, 75%, or 80% by administration of an iRNA featured in the invention. In some embodiments, an ALASl gene is suppressed by at least about 85%, 90%, 95%, 98%, 99%, or more by administration of an iRNA as described herein.
As used herein in the context of ALAS l expression, the terms "treat," "treating," "treatment," and the like, refer to relief from or alleviation of pathological processes related to ALAS l expression (e.g., pathological processes involving porphyrins or defects in the porphyrin pathway, such as, for example, porphyrias). In the context of the present invention insofar as it relates to any of the other conditions recited herein below (other than pathological processes related to ALAS l expression), the terms "treat," "treatment," and the like mean to prevent, relieve or alleviate at least one symptom associated with such condition, or to slow or reverse the progression or anticipated progression of such condition. For example, the methods featured herein, when employed to treat porphyria, may serve to reduce or prevent one or more symptoms associated with porphyria (e.g., pain), to reduce the severity or frequency of attacks associated with porphyria, to reduce the likelihood that an attack of one or more symptoms associated with porphyria will occur upon exposure to a precipitating condition, to shorten an attack associated with porphyria, and/or to reduce the risk of developing conditions associated with porphyria (e.g., hepatocellular cancer or neuropathy (e.g., progressive neuropathy)). Thus, unless the context clearly indicates otherwise, the terms "treat," "treatment," and the like are intended to encompass prophylaxis, e.g., prevention of disorders and/or symptoms of disorders related to ALAS l expression.
By "lower" in the context of a disease marker or symptom is meant a statistically or clinically significant decrease in such level. The decrease can be, for example, at least 10%, at least 20%, at least 30%, at least 40%· or more, and is typically down to a level accepted as within the range of normal for an individual without such disorder.
As used herein, the phrases "therapeutically effective amount" and "prophylactically effective amount" refer to an amount that provides a therapeutic benefit in the treatment, prevention, or management of pathological processes related to ALAS 1 expression. The specific amount that is therapeutically effective can be readily determined by an ordinary medical practitioner, and may vary depending on factors known in the art, such as, for example, the type of pathological process, the patient's history and age, the stage of pathological process, and the administration of other agents.
As used herein, a "pharmaceutical composition" comprises a pharmacologically effective amount of an iRNA and a pharmaceutically acceptable carrier. As used herein,
"pharmacologically effective amount," "therapeutically effective amount" or simply "effective amount" refers to that amount of an iRNA effective to produce the intended pharmacological, therapeutic or preventive result. For example, in a method of treating a disorder related to ALAS ! expression (e.g., in a method of treating a porphyria), an effective amount includes an amount effective to reduce one or more symptoms associated with a porphyria, an amount effective to reduce the frequency of attacks, an amount effective to reduce the likelihood that an attack of one or more symptoms associated with porphyria will occur upon exposure to a precipitating factor, or an amount effective to reduce the risk of developing conditions associated with porphyria (e.g., neuropathy (e.g., progressive neuropathy), hepatocellular cancer). For example, if a given clinical treatment is considered effective when there is at least a 10% reduction in a measurable parameter associated with a disease or disorder, a therapeutically effective amount of a drug for the treatment of that disease or disorder is the amount necessary to effect at least a 10% reduction in that parameter. For example, a therapeutically effective amount of an iRNA targeting ALASl can reduce ALAS 1 protein levels by any measurable amount, e.g., by at least 10%, 20%, 30%, 40% or 50%.
The term "pharmaceutically acceptable carrier" refers to a carrier for administration of a therapeutic agent. Such carriers include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The term specifically excludes cell culture medium. For drugs administered orally, pharmaceutically acceptable carriers include, but are not limited to pharmaceutically acceptable excipients such as inert diluents, disintegrating agents, binding agents, lubricating agents, sweetening agents, flavoring agents, coloring agents and preservatives. Suitable inert diluents include sodium and calcium carbonate, sodium and calcium phosphate, and lactose, while corn starch and alginic acid are suitable disintegrating agents. Binding agents may include starch and gelatin, while the lubricating agent, if present, will generally be magnesium stearate, stearic acid or talc. If desired, the tablets may be coated with a material such as glyceryl monostearate or glyceryl distearate, to delay absorption in the gastrointestinal tract. Agents included in drug formulations are described further herein below.
The term "about" when referring to a number or a numerical range means that the number or numerical range referred to is an approximation within experimental variability (or within statistical experimental error), and thus the number or numerical range may vary from, for example, between 1 % and 15% of the stated number or numerical range.
11. iRNA Agents
Described herein are iRNA agents that inhibit the expression of an ALAS 1 gene. In one embodiment, the iRNA agent includes double-stranded ribonucleic acid (dsRNA) molecules for inhibiting the expression of an ALAS l gene in a cell or in a subject (e.g., in a mammal, e.g., in a human having a porphyria), where the dsRNA includes an antisense strand having a region of complementarity which is complementary to at least a part of an mRNA formed in the expression of an ALAS l gene, and where the region of complementarity is 30 nucleotides or less in length, generally 19-24 nucleotides in length, and where the dsRNA, upon contact with a cell expressing the ALAS l gene, inhibits the expression of the ALAS l gene by at least 10% as assayed by, for example, a PCR or branched DNA (bDNA)-based method, or by a protein-based method, such as by Western blot. In one embodiment, the iRNA agent activates the expression of an ALAS l gene in a cell or mammal. Expression of an ALASl gene in cell culture, such as in COS cells, HeLa cells, primary hepatocytes, HepG2 cells, primary cultured cells or in a biological sample from a subject can be assayed by measuring ALAS l mRNA levels, such as by bDNA or TaqMan assay, or by measuring protein levels, such as by immunofluorescence analysis, using, for example, Western Blotting or flow cytometric techniques.
A dsRNA includes two RNA strands that are sufficiently complementary to hybridize to form a duplex structure under conditions in which the dsRNA will be used. One strand of a dsRNA (the antisense strand) includes a region of complementarity that is substantially complementary, and generally fully complementary, to a target sequence, derived from the sequence of an mRNA formed during the expression of an ALAS1 gene. The other strand (the sense strand) includes a region that is complementary to the antisense strand, such that the two strands hybridize and form a duplex structure when combined under suitable conditions.
Generally, the duplex structure is between 15 and 30 inclusive, more generally between 18 and 25 inclusive, yet more generally between 19 and 24 inclusive, and most generally between 19 and 21 base pairs in length, inclusive. Similarly, the region of complementarity to the target sequence is between 15 and 30 inclusive, more generally between 18 and 25 inclusive, yet more generally between 19 and 24 inclusive, and most generally between 19 and 21 nucleotides in length, inclusive. In some embodiments, the dsRNA is between 15 and 20 nucleotides in length, inclusive, and in other embodiments, the dsRNA is between 25 and 30 nucleotides in length, inclusive. As the ordinarily skilled person will recognize, the targeted region of an RNA targeted for cleavage will most often be part of a larger RNA molecule, often an mRNA molecule. Where relevant, a ''part" of an mRNA target is a contiguous sequence of an mRNA target of sufficient length to be a substrate for RNAi-directed cleavage (i.e., cleavage through a RISC pathway). dsRNAs having duplexes as short as 9 base pairs can, under some
circumstances, mediate RNAi-directed RNA cleavage. Most often a target will be at least 15 nucleotides in length, e.g., 15-30 nucleotides in length.
One of skill in the art will also recognize that the duplex region is a primary functional portion of a dsRNA, e.g., a duplex region of 9 to 36, e.g., 15-30 base pairs. Thus, in one embodiment, to the extent that it becomes processed to a functional duplex of e.g., 15-30 base pairs that targets a desired RNA for cleavage, an RNA molecule or complex of RNA molecules having a duplex region greater than 30 base pairs is a dsRNA. Thus, an ordinarily skilled artisan will recognize that in one embodiment, then, an miRNA is a dsRNA. hi another embodiment, a dsRNA is not a naturally occurring miRNA. In another embodiment, an iRNA agent useful to target ALASl expression is not generated in the target cell by cleavage of a larger dsR A.
A dsRNA as described herein may further include one or more single-stranded nucleotide overhangs. The dsRNA can be synthesized by standard methods known in the art as further discussed below, e.g., by use of an automated DNA synthesizer, such as are commercially available from, for example, Biosearch, Applied Biosystems, Inc. In one embodiment, an ALAS 1 gene is a human ALAS 1 gene. In another embodiment the ALAS 1 gene is a mouse or a rat ALAS 1 gene.
In specific embodiments, the first sequence is a sense strand of a dsRNA that includes a sense sequence disclosed herein, e.g., in Tables 21-40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., an sense sequence corresponding to SEQ ID NO: 4149 or 4151 , or one of the even numbered sequences identified as SEQ ID NOs: 4172 to 5236), and the second sequence is an antisense strand of a dsRNA that includes an antisense sequence disclosed herein, e.g., in Tables 21 -40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237).
hi specific embodiments, the first sequence is a sense strand of a dsRNA that includes a sense sequence from Table 2 or Table 3 of WO 2015/051318 and the Sequence Listing attached herewith, and the second sequence is an antisense strand of a dsRNA that includes an antisense sequence from Table 2 or Table 3 of WO 2015/051318 and the Sequence Listing attached herewith, In embodiments, the first sequence is a sense strand of a dsRNA that includes a sense sequence from Table 2, 3, 6, 7, 8, 9, 14, or 15 of WO 2015/051318 and the Sequence Listing attached herewith, and the second sequence is an antisense strand of a dsRNA that includes an antisense sequence from Table 2, 3, 6, 7, 8, 9, 14, or 15 of WO 2015/051318 and the Sequence Listing attached herewith. In embodiments, the first sequence is a sense strand of a dsRNA that includes a sense sequence from Table 2, 3, 6, 7, 8, 9, 14, 15, 18 or 20 of WO 2015/051318 and the Sequence Listing attached herewith, and the second sequence is an antisense strand of a dsRNA that includes an antisense sequence from Table 2, 3, 6, 7, 8, 9, 14, 15, 18 or 20 of WO 2015/051318 and the Sequence Listing attached herewith.
In one aspect, a dsRNA can include at least sense and antisense nucleotide sequences, whereby the sense strand is selected from the sense sequences provided herein, e.g., in Tables 21-40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237), and the corresponding antisense strand of the sense strand is selected from the antisense sequences provided herein, e.g., in Tables 21-40 of WO 2015/051318 and the Sequence Listing attached herewith(e.g., an sense sequence corresponding to SEQ ID NO: 4149 or 4151, or one of the even numbered sequences identified as SEQ ID NOs: 4172 to 5236).
In one aspect, a dsRNA can include at least sense and antisense nucleotide sequences, whereby the sense strand is selected from the groups of sequences provided in Tables 2 and 3 of WO 2015/051318 and the Sequence Listing attached herewith, and the corresponding antisense strand of the sense strand is selected from Tables 2 and 3 of WO 2015/051318 and the Sequence Listing attached herewith. In a further aspect, a dsRNA can include at least sense and antisense nucleotide sequences, whereby the sense strand is selected from the groups of sequences provided in Tables 2, 3, 6, 7, 8, 9, 14, and 15 of WO 2015/051318 and the Sequence Listing attached herewith, and the corresponding antisense strand of the sense strand is selected from Tables 2, 3, 6, 7, 8, 9, 14, and 15 of WO 2015/051318 and the Sequence Listing attached herewith. In a further aspect, a dsRNA can include at least sense and antisense nucleotide sequences, whereby the sense strand is selected from the groups of sequences provided in Tables 2, 3, 6, 7. 8, 9, 14, 15, 18 and 20 of WO 2015/051318 and the Sequence Listing attached herewith, and the corresponding antisense strand of the sense strand is selected from Tables 2, 3, 6, 7, 8, 9, 14, 15, 18 and 20 of WO 2015/051318 and the Sequence Listing attached herewith.
In embodiments, the iRNA is AD-60501 , AD-60519, AD-60901, AD-60495, AD-60900, AD-60935, AD-60879, AD-61190, AD-61191 , AD-60865, AD-60861, AD-60876, AD-61193, AD-60519, AD-60519, AD-60901, AD-60405, AD-60887, AD-60923, AD-60434. AD-60892, AD-60419, AD-60924, AD-60445, AD-60925, AD-60926, AD-60820, AD-60843, AD-60819, AD-61140, AD-61141 , AD-61142, AD-60835, AD-60839, AD-61 143, AD-61 144, AD-61 145, AD-61 146, AD-60892, or AD-60419 (e.g., including the nucleotide sequence and/or one or more (e.g., all) of the modifications of the aforesaid dsRNAs). In embodiments, the iRNA comprises an antisense strand that comprises, or consists of, an antisense sequence (including one or more (e.g., all the modifications)) selected from the antisense sequence of AD-60501 , AD-60519, AD- 60901 , AD-60495, AD-60900, AD-60935, AD-60879, AD-61 190, AD-61 191 , AD-60865, AD- 60861 , AD-60876, AD-61 193, AD-60519, AD-60519, AD-60901, AD-60405, AD-60887, AD- 60923, AD-60434, AD-60892, AD-60419, AD-60924, AD-60445. AD-60925. AD-60926, AD- 60820, AD-60843, AD-60819, AD-61 140, AD-61 141 , AD-61 142, AD-60835, AD-60839, AD- 61143, AD-61144, AD-61145, AD-61 146, AD-60892, or AD-60419. In embodiments, the iRNA comprises a sense strand that comprises, or consists of, a sense sequence (and/or one or more (e.g., all) of the modifications)) selected from AD-60501, AD-60519, AD-60901, AD- 60495, AD-60900, AD-60935, AD-60879, AD-61 190, AD-61191, AD-60865, AD-60861 , AD- 60876, AD-61193, AD-60519. AD-60519, AD-60901, AD-60405, AD-60887, AD-60923, AD- 60434, AD-60892, AD-60419, AD-60924, AD-60445, AD-60925, AD-60926, AD-60820, AD- 60843, AD-60819, AD-61 140, AD-61141 , AD-61142, AD-60835, AD-60839. AD-61 143, AD- 61 144, AD-61 145, AD-61 146, AD-60892, or AD-60419.
In embodiments, the iRNA comprises (i) an antisense strand that comprises, or consists of, the sequence of UAAGAUGAG ACACUCUUUCUGGU or
UAAGAUGAGACACUCTUUCUGGU and/or (ii) a sense strand that comprises, or consists of, the sequence of CAGAAAGAGUGUCUCAUCUUA. In embodiments, one or more nucleotides of the antisense strand and/or sense strand are modified as described herein.
In embodiments, the iRNA comprises (i) an antisense strand that comprises, or consists of, the antisense sequence of AD-60489 and/or (ii) a sense strand that comprises, or consists of, the sense sequence of AD-60489 (and/or one or more (e.g., all) of the modifications of the sense strand and/or antisense strand of AD-60489).
In embodiments, the iRNA comprises (i) an antisense strand that comprises, or consists of, the antisense sequence of AD-60519 and/or (ii) a sense strand that comprises, or consists of, the sense sequence of AD-60519 (and/or one or more (e.g., all) of the modifications of the sense strand and/or antisense strand of AD-60489).
In embodiments, the iRNA comprises (i) an antisense strand that comprises, or consists of, the antisense sequence of AD-61 193 and/or (ii) a sense strand that comprises, or consists of, the sense sequence of AD-61 193 (and/or one or more (e.g., all) of the modifications of the sense strand and/or antisense strand of AD-60489).
In embodiments, the iRNA comprises (i) an antisense strand that comprises, or consists of, the antisense sequence of AD-60819 and/or (ii) a sense sequence that comprises, or consists of, the sense sequence of AD-60819 (and/or one or more (e.g., all) of the modifications of the sense strand and/or antisense strand of AD-60489).
In embodiments, the iRNA for inhibiting expression of ALAS 1 is provided, wherein the dsRNA comprises (i) an antisense strand that comprises, or consists of, the antisense sequence of AD-60489, AD-60519, AD-61193. or AD-60819 (or a corresponding unmodified antisense sequence) and/or (ii) a sense strand that comprises, or consists of, the sense sequence of AD- 60489, AD-60519, AD-61 193, or AD-60819 (or a corresponding unmodified antisense sequence). In embodiments, the iRNA comprises (i) an antisense strand that consists of the antisense sequence of AD-60489, AD-60519, AD-61 193, or AD-60819 and/or (ii) a sense strand that consists of the sense sequence of AD-60489, AD-60519, AD-61 193, or AD-60819, except that the antisense strand and/or sense strand of the dsRNA differs by 1, 2, or 3 nucleotides from the corresponding antisense and/or sense sequence of AD-60489, AD-60519, AD-61193, or AD- 60819.
The sequences and modifications of AD-60489, AD-60519, AD-61193, and AD-60819 are shown in Table 2 disclosed herein.
In one embodiment, the iRNA is ALN-60519. ALN-60519 is a chemically synthesized double stranded oligonucleotide covalently linked to a ligand containing three N- acetylgalactosamine (GalNAc) residues (depicted in FIG. 57 of WO 2015/051318). In one embodiment, all nucleotides of ALN-60519 are 2'-OMe or 2'-F modified and are connected through 3 '-5' phosphodiester linkages, thus forming the sugar-phosphate backbone of the oligonucleotide. The sense strand and the antisense strand of ALN-60519 contain 21 and 23 nucleotides, respectively. The 3'-end of the sense strand of ALN-60519 is conjugated to the triantennary GalNAc moiety (referred to as L96) through a phosphodiester linkage. The antisense strand contains four phosphorothioate linkages - two at the 3' end and two at the 5' end. The sense strand of ALN-60519 contains two phosphorothioate linkages at the 5' end. The 21 nucleotides of the sense strand of ALN-60519 hybridize with the complementary 21 nucleotides of the antisense strand, thus forming 21 nucleotide base pairs and a two-base overhang at the 3'-end of the antisense strand. The two single strands, the sense strand and the antisense strand, of ALN-60519 can be synthesized by conventional solid phase oligonucleotide synthesis, employing standard phosphoramidite chemistry with the 5 '-hydroxy! group protected as dimethoxytriphenylmethyl (DMT) ether. Each strand can be assembled from the 3' to the 5' terminus by sequential addition of protected nucleoside phosphoramidites.
In these aspects, one of the two sequences is complementary to the other of the two sequences, with one of the sequences being substantially complementary to a sequence of an mRNA generated by the expression of an ALAS 1 gene gene. As such, a dsRNA will include two oligonucleotides, where one oligonucleotide is described herein as the sense strand, and the second oligonucleotide is described as the corresponding antisense strand. As described elsewhere herein and as known in the art, the complementary sequences of a dsRNA can also be contained as self-complementary regions of a single nucleic acid molecule, as opposed to being on separate oligonucleotides.
The skilled person is well aware that dsRNAs having a duplex structure of between 20 and 23, but specifically 21 , base pairs have been hailed as particularly effective in inducing RNA interference (Elbashir et al, EMBO . 2001, 20:6877-6888). However, others have found that shorter or longer RNA duplex structures can be effective as well. In the embodiments described above, by virtue of the nature of the oligonucleotide sequences provided in the tables of WO 2015/051318 and the Sequence Listing attached herewith, dsRNAs described herein can include at least one strand of a length of minimally 21 nucleotides. It can be reasonably expected that shorter duplexes having one of the sequences of disclosed herein minus only a few nucleotides on one or both ends may be similarly effective as compared to the dsRNAs described above. Hence, dsRNAs having a partial sequence of at least 15, 16, 17, 18, 19, 20, or more contiguous nucleotides from one of the sequences disclosed herein, and differing in their ability to inhibit the expression of an ALAS 1 gene by not more than 5, 10, 15, 20, 25, or 30 % inhibition from a dsRNA comprising the full sequence, are contemplated according to the invention.
In addition, the RNAs provided in the tables of WO 2015/051318 and the Sequence Listing attached herewith, identify a site in an ALAS1 transcript that is susceptible to RISC- mediated cleavage. As such, the present invention further features iRNAs that target within one of such sequences. As used herein, an iRNA is said to target within a particular site of an RNA transcript if the iRNA promotes cleavage of the transcript anywhere within that particular site. Such an iRNA will generally include at least 15 contiguous nucleotides from one of the sequences provided herein, e.g., in Tables 2, 3, 6, 7, 8, 9, 14, 15, 18, 20 of WO 2015/051318 and the Sequence Listing attached herewith, and in Tables 21-40 of WO 2015/051318 and the Sequence Listing attached herewith, coupled to additional nucleotide sequences taken from the region contiguous to the selected sequence in an ALAS 1 gene.
While a target sequence is generally 15-30 nucleotides in length, there is wide variation in the suitability of particular sequences in this range for directing cleavage of any given target RNA. Various software packages and the guidelines set out herein provide guidance for the identification of optimal target sequences for any given gene target, but an empirical approach can also be taken in which a "window" or "mask" of a given size (as a non-limiting example, 21 nucleotides) is literally or figuratively (including, e.g., in silico) placed on the target RNA sequence to identify sequences in the size range that may serve as target sequences. By moving the sequence "window'" progressively one nucleotide upstream or downstream of an initial target sequence location, the next potential target sequence can be identified, until the complete set of possible sequences is identified for any given target size selected. This process, coupled with systematic synthesis and testing of the identified sequences (using assays as described herein or as known in the art) to identify those sequences that perform optimally can identify those RNA sequences that, when targeted with an iRNA agent, mediate the best inhibition of target gene expression. Thus, while the sequences identified, for example, in the tables of WO 2015/051318 and the Sequence Listing attached herewith, represent effective target sequences, it is
contemplated that further optimization of inhibition efficiency can be achieved by progressively "walking the window" one nucleotide upstream or downstream of the given sequences to identify sequences with equal or better inhibition characteristics.
Further, it is contemplated that for any sequence identified, e.g., in the tables of WO 2015/051318 and the Sequence Listing attached herewith, further optimization can be achieved by systematically either adding or removing nucleotides to generate longer or shorter sequences and testing those and sequences generated by walking a window of the longer or shorter size up or down the target RNA from that point. Again, coupling this approach to generating new candidate targets with testing for effectiveness of iRNAs based on those target sequences in an inhibition assay as known in the art or as described herein can lead to further improvements in the efficiency of inhibition. Further still, such optimized sequences can be adjusted by, e.g., the introduction of modified nucleotides as described herein or as known in the ait, addition or changes in overhang, or other modifications as known in the art and/or discussed herein to further optimize the molecule (e.g., increasing serum stability or circulating half-life, increasing thermal stability, enhancing transmembrane delivery, targeting to a particular location or cell type, increasing interaction with silencing pathway enzymes, increasing release from endosomes, etc.) as an expression inhibitor.
An iRNA as described herein can contain one or more mismatches to the target sequence. In one embodiment, an iRNA as described herein contains no more than 3 mismatches. If the antisense strand of the iRNA contains mismatches to a target sequence, it is preferable that the area of mismatch not be located in the center of the region of complementarity. If the antisense strand of the iRNA contains mismatches to the target sequence, it is preferable that the mismatch be restricted to be within the last 5 nucleotides from either the 5' or 3' end of the region of complementarity. For example, for a 23 nucleotide iRNA agent RNA strand which is
complementary to a region of an ALAS1 gene, the RNA strand generally does not contain any mismatch within the central 13 nucleotides. The methods described herein or methods known in the art can be used to determine whether an iRNA containing a mismatch to a target sequence is effective in inhibiting the expression of an ALAS1 gene. Consideration of the efficacy of iRNAs with mismatches in inhibiting expression of an ALAS1 gene is important, especialiy if the particular region of complementarity in an ALAS 1 gene is known to have polymorphic sequence variation within the population.
hi one embodiment, at least one end of a dsRNA has a single-stranded nucleotide overhang of 1 to 4, generally 1 or 2 nucleotides. dsRNAs having at least one nucleotide overhang have unexpectedly superior inhibitory properties relative to their blunt-ended counterparts. In yet another embodiment, the RNA of an iRNA, e.g., a dsRNA, is chemically modified to enhance stability or other beneficial characteristics. The nucleic acids featured in the invention may be synthesized and/or modified by methods well established in the art, such as those described in "Current protocols in nucleic acid chemistry," Beaucage, S.L. et al. (Edrs.), John Wiley & Sons, Inc., New York, NY, USA, which is hereby incorporated herein by reference. Modifications include, for example, (a) end modifications, e.g., 5' end modifications (phosphorylation, conjugation, inverted linkages, etc.) 3' end modifications (conjugation, DNA nucleotides, inverted linkages, etc.), (b) base modifications, e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, removal of bases (abasic nucleotides), or conjugated bases, (c) sugar modifications {e.g., at the 2' position or 4' position, or having an acyclic sugar) or replacement of the sugar, as well as (d) backbone modifications, including modification or replacement of the phosphodiester linkages. Specific examples of RNA compounds useful in this invention include, but are not limited to RNAs containing modified backbones or no natural internucleoside linkages. RNAs having modified backbones include, among others, those that do not have a phosphorus atom in the backbone. For the puiposes of this specification, and as sometimes referenced in the art, modified RNAs that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides. In particular embodiments, the modified RNA will have a phosphorus atom in its intemucieoside backbone.
Modified RNA backbones include, for example, phosphorothioates, chiral
phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and
aminoalkylphosphoramidates , thionophosphoramidates, thionoalkylphosphonates ,
thionoalkylphosphotriesters, and boranophosphates having normal 3 -5' linkages, 2'-5' linked analogs of these, and those) having inverted polaiity wherein the adjacent pairs of nucleoside units are linked 3 -5' to 5'-3' or 2 -5' to 5 -2'. Various salts, mixed salts and free acid forms are also included.
Representative U.S. patents that teach the preparation of the above phosphorus- containing linkages include, but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863;
4,476,301 ; 5,023,243; 5,177,195; 5,188,897; 5,264,423; 5,276,019; 5,278.302; 5,286,717;
5,321,131 ; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126;
5,536,821; 5,541,316; 5,550, 111 ; 5,563,253; 5,571,799; 5,587,361; 5,625,050; 6,028,188;
6,124,445; 6,160,109; 6,169,170; 6,172,209; 6, 239,265; 6,277,603; 6,326,199; 6,346,614; 6,444,423; 6,531,590; 6,534,639; 6,608,035; 6,683,167; 6,858,715; 6,867,294; 6,878,805;
7,015,315; 7,041,816; 7,273,933; 7,321 ,029; and US Pat RE39464, each of which is herein incorporated by reference.
Modified RNA backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl intemucieoside linkages, mixed heteroatoms and alkyl or cycloalkyl intemucieoside linkages, or one or more short chain heteroatomic or heterocyclic intemucieoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siioxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thiotormacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts.
Representative U.S. patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141 ; 5,235,033; 5,64,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967;
5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704;
5,623,070; 5,663.312; 5,633,360; 5,677,437; and, 5,677,439. each of which is herein
incorporated by reference.
In other RNA mimetics suitable or contemplated for use in iRNAs, both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an RNA mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of an RNA is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat.
Nos. 5,539,082; 5,714,331; and 5,719,262, each of which is herein incorporated by reference. Further teaching of PNA compounds can be found, for example, in Nielsen et al., Science, 1991 ,
254, 1497-1500.
Some embodiments featured in the invention include RNAs with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular— CH2~ NH— CH2~ , --CH2--N(CH3)--0--CH2--[known as a methylene (methylimino) or MMI backbone], ~CH2-0- -N(CH3)~CH2~, -CH2-N(CH3)~N(CH3)~CH2~ and -N(CH3)-CH2-CH2~fwherein the native phosphodiester backbone is represented as ~0— P—O—CH?—] of the above-referenced U.S. Pat. No. 5,489,677, and the amide backbones of the above-referenced U.S. Pat. No. 5,602,240. In some embodiments, the RNAs featured herein have morpholino backbone structures of the above-referenced U.S. Pat. No. 5,034,506.
Modified RNAs may also contain one or more substituted sugar moieties. The iRNAs, e.g., dsRNAs, featured herein can include one of the following at the 2' position: OH; F; 0-, S-, or N-alkyl; 0-, S-, or N-alkenyl; 0-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted Ci to Cio alkyl or C2 to Cio alkenyl and alkynyl. Exemplary suitable modifications include Of(CH?)nO] mCH3, 0(CH2).,iOCH3,
0(CH2)nNH2, 0(CH2) nCH3, 0(CH2)nONH2, and 0(CH2)nON[(CH2)nCH3)]2, where n and m are from 1 to about 10. In other embodiments, dsRNAs include one of the following at the 2' position: Q to Cjo lower alkyl, substituted lower alkyl, aikaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, CI, Br, CN, CF3, OCF3, SOCH3, S02CH3, ON02, N02, N3, NH2,
heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the
pharmacokinetic properties of an iRNA, or a group for improving the pharmacodynamic properties of an iRNA, and other substituents having similai' properties. In some embodiments, the modification includes a 2'-methoxyethoxy (2'-0— CH2CH2OCH , also known as 2'-0-(2- methoxyethyl) or 2'-MOE) (Martin et al, Helv. Chim. Acta, 1995, 78:486-504) i.e., an alkoxy- alkoxy group. Another exemplary modification is 2'-dimethylaminooxyethoxy, i.e., a
0(CH2)2ON(CFi3)2 group, also known as 2'-DMAOE, as described in examples herein below, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-0-dimethylaminoethoxyethyl or 2 -DMAEOE), i.e., 2'-0--CH2--0--CH2--N(CH2)2, also described in examples herein below.
In other embodiments, an iRNA agent comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) acyclic nucleotides (or nucleosides). In certain embodiments, the sense strand or the antisense strand, or both sense strand and antisense strand, include less than five acyclic nucleotides per strand (e.g., four, three, two or one acyclic nucleotides per strand). The one or more acyclic nucleotides can be found, for example, in the double-stranded region, of the sense or antisense strand, or both strands; at the 5'-end, the 3'-end, both of the 5' and 3'-ends of the sense or antisense strand, or both strands, of the iRNA agent. In one embodiment, one or more acyclic nucleotides are present at positions 1 to 8 of the sense or antisense strand, or both. In one embodiment, one or more acyclic nucleotides are found in the antisense strand at positions 4 to 10 (e.g., positions 6-8) from the 5'-end of the antisense strand. In another embodiment, the one or more acyclic nucleotides are found at one or both 3'-terminai overhangs of the iRNA agent.
The term "acyclic nucleotide" or "acyclic nucleoside" as used herein refers to any nucleotide or nucleoside having an acyclic sugar, e.g., an acyclic ribose. An exemplary acyclic nucleotide or nucleoside can include a nucleobase, e.g., a naturally-occurring or a modified nucleobase (e.g., a nucleobase as described herein). In certain embodiments, a bond between any of the ribose carbons (CI, C2, C3, C4, or C5), is independently or in combination absent from the nucleotide. In one embodiment, the bond between C2-C3 carbons of the ribose ring is absent, e.g., an acyclic 2'-3'-seco-nucleotide monomer. In other embodiments, the bond between C1-C2, C3-C4, or C4-C5 is absent {e.g., a V- , 3 -4' or 4'-5'-seco nucleotide monomer). Exemplary acyclic nucleotides are disclosed in US 8,314,227, incorporated herein by reference in its entirely. For example, an acyclic nucleotide can include any of monomers D-J in Figures 1-2 of US 8,314,227. In one embodiment, the acyclic nucleotide includes the following monomer:
Figure imgf000089_0001
wherein Base is a nucleobase, e.g., a naturally-occurring or a modified nucleobase (e.g., a nucleobase as described herein).
In certain embodiments, the acyclic nucleotide can be modified or derivatized, e.g., by coupling the acyclic nucleotide to another moiety, e.g., a ligand (e.g. , a GalNAc, a cholesterol ligand), an alkyl, a polyamine, a sugar, a polypeptide, among others.
In other embodiments, the iRNA agent includes one or more acyclic nucleotides and one or more LNAs (e.g., an LNA as described herein). For example, one or more acyclic nucleotides and/or one or more LNAs can be present in the sense strand, the antisense strand, or both. The number of acyclic nucleotides in one strand can be the same or different from the number of LNAs in the opposing strand. In certain embodiments, the sense strand and/or the antisense strand comprises less than five LNAs (e.g., four, three, two or one LNAs) located in the double- stranded region or a 3' -overhang, In other embodiments, one or two LNAs are located in the double stranded region or the 3 '-overhang of the sense strand. Alternatively, or in combination, the sense strand and/or antisense strand comprises less than five acyclic nucleotides (e.g., four, three, two or one acyclic nucleotides) in the double-stranded region or a 3 '-overhang. In one embodiment, the sense strand of the iRNA agent comprises one or two LNAs in the 3'-overhang of the sense strand, and one or two acyclic nucleotides in the double- standed region of the antisense strand (e.g., at positions 4 to 10 (e.g., positions 6-8) from the 5'-end of the antisense strand) of the iRNA agent.
In other embodiments, inclusion of one or more acyclic nucleotides (alone or in addition to one or more LNAs) in the iRNA agent results in one or more (or ali) of: (i) a reduction in an off-target effect; (ii) a reduction in passenger strand participation in RNAi; (iii) an increase in specificity of the guide strand for its target mRNA; (iv) a reduction in a microRNA off-target effect; (v) an increase in stability; or (vi) an increase in resistance to degradation, of the iRNA molecule.
Other modifications include 2'-methoxy (2'-OCH3), 2'-aminopropoxy (2'-
OCH2CH2CH2NH2) and 2'-fluoro (2'-F). Similar modifications may also be made at other positions on the RNA of an iRNA, particularly the 3' position of the sugar on the 3' terminal nucleotide or in 2 -5' linked dsRNAs and the 5' position of 5' terminal nucleotide. iRNAs may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar.
Representative U.S. patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466.786; 5,514,785; 5,519,134; 5.567.811; 5,576,427; 5,591,722; 5,597,909;
5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920, certain of which are commonly owned with the instant application, and each of which is herein
incorporated by reference.
An iRNA may also include nucleobase (often referred to in the art simply as "base") modifications or substitutions. As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2- aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5- halouracii and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5- uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyi, 8-hydroxyl anal other 8- substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyi and other 5- substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8- azaadenine, 7-deazaguanine and 7-daazaadenine and 3-deazaguanine and 3-deazaadenine.
Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley- VCH, 2008; those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. L, ed. John Wiley & Sons, 1990, these disclosed by Englisch et al, Angewandte Chemie, International Edition, 1991, 30, 613, and those disclosed by Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., Ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds featured in the invention. These include 5- substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2- aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., Eds., dsRNA Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are exemplary base substitutions, even more particularly when combined with 2'-0-methoxyethyl sugar modifications.
Representative U.S. patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include, but are not limited to, the above noted U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos. 4,845,205; 5,130,30; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502.177; 5,525,71 1 ;
5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,681 ,941 ; 6,015,886; 6,147,200;
6,166,197; 6,222,025; 6,235,887; 6,380,368; 6,528,640; 6,639,062; 6,617,438; 7,045,610;
7,427,672; and 7,495,088, each of which is herein incorporated by reference, and U.S. Pat. No. 5,750,692, also herein incorporated by reference.
The RNA of an iRNA can also be modified to include one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) locked nucleic acids (LNA), (also referred to herein as "locked nucleotides")- In one embodiment, a locked nucleic acid is a nucleotide having a modified ribose moiety in which the ribose moiety comprises an extra bridge connecting, e.g., the 2' and 4' carbons. This structure effectively "locks" the ribose in the 3'-endo stiaictural conformation. The addition of locked nucleic acids to siRNAs has been shown to increase siRNA stability in serum, increase thermal stability, and to reduce off-target effects (Elmen, J. et al, (2005) Nucleic Acids Research 33(l):439-447; Mook, OR. et al, (2007) Mol Cane Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193).
Representative U.S. Patents that teach the preparation of locked nucleic acid nucleotides include, but are not limited to, the following: U.S. Pat. Nos. 6,268,490; 6,670,461 ; 6,794,499; 6,998,484; 7,053.207; 7,084,125; 7,399,845; and 8,314,227, each of which is herein incorporated by reference in its entirety. Exemplary LNAs include but are not limited to, a 2', 4'-C methylene bicyclo nucleotide (see for example Wengel et a!., International PCT Publication No. WO
00/66604 and WO 99/14226).
In other embodiments, the iRNA agents include one or more (e.g., about 1 , 2, 3, 4, 5, 6, 7,
8, 9, 10, or more) G-clamp nucleotides. A G-clamp nucleotide is a modified cytosine analog wherein the modifications confer the ability to hydrogen bond both Watson-Crick and Hoogsteen faces of a complementary guanine within a duplex, see for example Lin and Matteucci, 1998, J.
Am. Chem, Soc, 120, 8531-8532. A single G-clamp analog substitution within an
oligonucleotide can result in substantially enhanced helical thermal stability and mismatch discrimination when hybridized to complementary oligonucleotides. The inclusion of such nucleotides in the iRNA molecules can result in enhanced affinity and specificity to nucleic acid targets, complementary sequences, or template strands.
Potentially stabilizing modifications to the ends of RNA molecules can include N-
(acetylaminocaproyl)-4-hydiOxyprolinol (Hyp-C6-NHAc), N-(capiOyl-4-hydroxyprolinol (Hyp-
C6), N-(acetyl-4-hydroxyprolinol (Hyp-NHAc), thymidine-2'-0-deoxythymidine (ether), N- (aminocaproyl)-4-hydroxyprolinol (Hyp-C6- amino), 2-docosanoyl-uridine-3"- phosphate, inverted base dT(idT) and others. Disclosure of this modification can be found in PCT
Publication No. WO 2011/005861. iRNA Motifs
hi one embodiment, the sense strand sequence may be represented by formula (I):
5' np-Na-(X X X )i-Nb-Y Y Y -Nb-(Z Z Z )rNa-nq 3' (I)
wherein:
i and j are each independently 0 or 1;
p and q are each independently 0-6;
each Na independently represents an oligonucleotide sequence comprising 0-25 modified nucleotides, each sequence comprising at least two differently modified nucleotides;
each Nb independently represents an oligonucleotide sequence comprising 0-10 modified nucleotides;
each lip and nq independently represent an overhang nucleotide;
wherein Nb and Y do not have the same modification; and XXX, YYY and ZZZ each independently represent one motif of three identical modifications on three consecutive nucleotides. Preferably YYY is all 2'-F modified
nucleotides.
In one embodiment, the Na and/or Nb comprise modifications of alternating pattern.
In one embodiment, the YYY motif occurs at or near the cleavage site of the sense strand.
For example, when the RNAi agent has a duplex region of 17-23 nucleotides in length, the YYY motif can occur at or the vicinity of the cleavage site (e.g. : can occur at positions 6, 7, 8; 7, 8, 9; 8, 9, 10; 9, 10, 1 1; 10, 1 1 ,12 or 11, 12, 13) of - the sense strand, the count starting from the 1st nucleotide, from the 5' -end; or optionally, the count starting at the 1st paired nucleotide within the duplex region, from the 5'- end.
hi one embodiment, i is 1 and j is 0, or i is 0 and j is 1, or both i and j are 1. The sense strand can therefore be represented by the following formulas:
5' np-Na-YYY-Nb-ZZZ-Na-nq 3' (lb);
5' np-Na-XXX-Nb-YYY-Na-nq 3' (Ic); or
5' np-Na-XXX-Nb-YYY-N -ZZZ-Na-Hq 3' (Id).
When the sense strand is represented by formula (lb), Nb represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each Na independently can represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
When the sense strand is represented as formula (lc), Nb represents an oligonucleotide sequence comprising 0- 10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each Na can
independently represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
When the sense strand is represented as formula (Id), each Nb independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides.
Preferably, Nb is 0, 1, 2, 3, 4, 5 or 6. Each Na can independently represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
Each of X, Y and Z may be the same or different from each other.
In other embodiments, i is 0 and j is 0, and the sense strand may be represented by the formula:
5' np-Na-YYY- Na-nq 3' (la). When the sense strand is represented by formula (la), each Na independently can represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
In one embodiment, the antisense strand sequence of the RNAi may be represented by formula (II):
5' nq-N3'-(Z'Z'Z')k-Nb'-Y'Y'Y'-Nb'-(X'X'X')i-N'a-np' 3' (Π)
wherein:
k and 1 are each independently 0 or 1 ;
p' and q' are each independently 0-6;
each Na' independently represents an oligonucleotide sequence comprising 0-25 modified nucleotides, each sequence comprising at least two differently modified nucleotides;
each Nb' independently represents an oligonucleotide sequence comprising 0-10 modified nucleotides;
each np' and nq' independently represent an overhang nucleotide;
wherein Nb' and Y' do not have the same modification;
and
Χ'Χ'Χ', ΥΎΎ' and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides.
In one embodiment, the Na' and/or N ' comprise modifications of alternating pattern. The Y'Y'Y' motif occurs at or near the cleavage site of the antisense strand. For example, when the RNAi agent has a duplex region of 17-23nucleotidein length, the ΥΎΎ' motif can occur at positions 9, 10, 11 ;10, 1 1, 12; 1 1, 12, 13; 12, 13, 14 ; or 13, 14, 15 of the antisense strand, with the count starting from the 1 nucleotide, from the 5 '-end; or optionally, the count starting at the 1st paired nucleotide within the duplex region, from the 5'- end. Preferably, the ΥΎ'Υ' motj occurs at positions 11, 12, 13.
In one embodiment, Y'Y'Y' motif is all 2'-OMe modified nucleotides.
In one embodiment, k is 1 and 1 is 0, or k is 0 and 1 is 1, or both k and 1 are 1.
The antisense strand can therefore be represented by the following formulas:
5' nq--Na'-Z'Z'Z'-Nb'-Y'Y'Y'-Na'-np> 3' (lib);
5' iv-Ny-Y'Y'Y'-Nb'-Χ'Χ'Χ'-ηρ· 3' (lie); or
5' nq>-Na'- Z'Z'Z'-Nb'-Y'Y'Y'-Nb'- X'XX'-Na'-iy 3' (lid). When the antisense strand is represented by formula (lib), Nb represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each Na' independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
When the antisense strand is represented as formula (lie), Nb' represents an
oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each Na' independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
When the antisense strand is represented as formula (lid), each Nb' independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each Na' independently represents an oligonucleotide sequence comprising 2-20, 2- 15, or 2-10 modified nucleotides. Preferably, Nb is 0, 1, 2, 3, 4, 5 or 6.
In other embodiments, k is 0 and 1 is 0 and the antisense strand may be represented by the formula:
5' ly-NV-Y'Y'Y'- Na-nq» 3' (la).
When the antisense strand is represented as formula (Ha), each Na' independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
Each of X', Y' and Z' may be the same or different from each other.
Each nucleotide of the sense strand and antisense strand may be independently modified with LNA, HNA, CeNA, 2'-methoxyethyl, 2'-0-methyI, 2'-0-allyI, 2'-C- allyl, 2'-hydroxyl, or 2'-fluoro. For example, each nucleotide of the sense strand and antisense strand is independently modified with 2'-0-methyI or 2'-fluoro. Each X, Y, Z, X', Y' and Z', in particular, may represent a 2'-0-methyl modification or a 2'-fluoro modification.
In one embodiment, the sense strand of the RNAi agent may contain YYY motif occurring at 9, 10 and 11 positions of the strand when the duplex region is 21 nt, the count starting from the 1st nucleotide from the 5 '-end, or optionally, the count starting at the 1st paired nucleotide within the duplex region, from the 5'- end; and Y represents 2'-F modification. The sense strand may additionally contain XXX motif or ZZZ motifs as wing modifications at the opposite end of the duplex region; and XXX and ZZZ each independently represents a 2'-OMe modification or 2'-F modification. In one embodiment the antisense strand may contain γ'ΥΎ' motif occurring at positions 11, 12, 13 of the strand, the count starting from the 1 nucleotide from the 5'-end, or optionally, the count starting at the 1st paired nucleotide within the duplex region, from the 5'- end; and Y' represents 2'-0-methyI modification. The antisense strand may additionally contain X'X¾' motif or Z'Z'Z' motifs as wing modifications at the opposite end of the duplex region; and X¾'X' and Z'Z'Z' each independently represents a 2'-OMe modification or 2'-F modification.
The sense strand represented by any one of the above formulas (la), (lb), (Ic), and (Id) forms a duplex with a antisense strand being represented by any one of formulas (Ila), (lib), (lie), and (lid), respectively.
Accordingly, the RNAi agents for use in the methods of the invention may comprise a sense strand and an antisense strand, each strand having 14 to 30 nucleotides, the RNAi duplex represented by formula (III):
sense: 5' np -Na-(X X X)i -Nb- Y Y Y -Nb -(Z Z Z)rNa-nq 3'
antisense: 3' np '-Na '-(X'X'X')k-N '-Y'Y'Y'-Nb^(Z'Z'Z')rNa '-nq 5'
(HI)
wherein:
i, j, k, and 1 are each independently 0 or 1;
p, p', q, and q' are each independently 0-6:
each Na and Na independently represents an oligonucleotide sequence comprising 0-25 modified nucleotides, each sequence comprising at least two differently modified nucleotides; each N and Nb independently represents an oligonucleotide sequence comprising 0-10 modified nucleotides;
wherein
each np', np, nq', and nq, each of which may or may not be present, independently represents an overhang nucleotide; and
XXX, YYY, ZZZ, Χ'Χ'Χ', Υ'ΥΎ', and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides.
In one embodiment, i is 0 and j is 0; or i is 1 and j is 0; or i is 0 and j is 1 ; or both i and j are 0; or both i and j are 1. hi another embodiment, k is 0 and I is 0; or k is 1 and I is 0; k is 0 and l is 1 ; or both k and 1 are 0; or both k and 1 are 1. Exemplary combinations of the sense strand and antisense strand forming a RNAi duplex include the formulas below:
5' np - Na -Y Y Y -Na-nq 3'
3' np '-Na '-ΥΎΎ' -Na ¾1 ' 5'
(Ilia)
5' np -Na -Y Y Y -Nb -Z Z Z -Na-nq 3'
3' np -Na -Y'Y'Y'-Nb '-Z'Z'Z'-Na nq 5'
(Hlb)
5' np-Na- X X X -Nb -Y Y Y - Na-nq 3'
3' np -N.'-X'X'X'-Nb -Y'Y'Y'-Na '-nq 5'
(Die)
5' np -Na -X X X -Nb-Y Y Y -Nb- Z Z Z -Na-nq 3'
3' np '-Na '-X'X'X'-Nb -Y'Y'Y'-Nb '-Z'Z'Z'-Na-nq ' 5'
(Hid)
When the RNAi agent is represented by formula (Ilia), each Na independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
When the RNAi agent is represented by formula (Illb), each Nb independently represents an oligonucleotide sequence comprising 1-10, 1-7, 1-5 or 1-4 modified nucleotides. Each Na independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
When the RNAi agent is represented as formula (IIIc), each Nb, Nb' independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or Omodified nucleotides. Each Na independently represents an oligonucleotide sequence compiising 2-20, 2- 15, or 2-10 modified nucleotides.
When the RNAi agent is represented as formula (Hid), each Nb, Nb' independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or Omodified nucleotides. Each Na, Na independently represents an oligonucleotide sequence comprising 2- 20, 2-15, or 2-10 modified nucleotides. Each of Na, Na\ Nb and N independently comprises modifications of alternating pattern.
Each of X, Y and Z in formulas (III), (Ilia), (Hlb), (IIIc), and (Hid) may be the same or different from each other. When the RNAi agent is represented by formula (III), (Ilia), (IHb), (HIc), and (Hid), at least one of the Y nucleotides may form a base pair with one of the Y' nucleotides.
Alternatively, at least two of the Y nucleotides form base pairs with the corresponding Y' nucleotides; or all three of the Y nucleotides all form base pairs with the corresponding Y' nucleotides.
When the RNAi agent is represented by formula (IHb) or (Hid), at least one of the Z nucleotides may form a base pair with one of the Z' nucleotides. Alternatively, at least two of the Z nucleotides form base pairs with the corresponding Z' nucleotides; or all three of the Z nucleotides all form base pairs with the corresponding Z' nucleotides.
When the RNAi agent is represented as formula (IIIc) or (Hid), at least one of the X nucleotides may form a base pair with one of the X' nucleotides. Alternatively, at least two of the X nucleotides form base pairs with the corresponding X' nucleotides; or all three of the X nucleotides all form base pairs with the corresponding X' nucleotides.
In one embodiment, the modification on the Y nucleotide is different than the
modification on the Y' nucleotide, the modification on the Z nucleotide is different than the modification on the Z' nucleotide, and/or the modification on the X nucleotide is different than the modification on the X' nucleotide.
In one embodiment, when the RNAi agent is represented by formula (Hid), the Na modifications are 2 -0-methyl or 2 -fluoro modifications. In another embodiment, when the RNAi agent is represented by formula (Hid), the Na modifications are 2'-0-methyl or 2'-fluoro modifications and np' >0 and at least one np' is linked to a neighboring nucleotide a via phosphorothioate linkage. In yet another embodiment, when the RNAi agent is represented by formula (Hid), the Na modifications are 2'-0-methyl or 2'-fluoro modifications , np' >0 and at least one np' is linked to a neighboring nucleotide via phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives attached through a bivalent or trivalent branched linker. In another embodiment, when the RNAi agent is represented by formula (Hid), the Na modifications are 2'-0-methyl or 2'-fluoro modifications , np' >0 and at least one np' is linked to a neighboring nucleotide via phosphorothioate linkage, the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives attached through a bivalent or trivalent branched linker. In one embodiment, when the RNAi agent is represented by formula (Ilia), the Nu modifications are 2'-0-methyl or 2'-fluoro modifications , np' >0 and at least one np' is linked to a neighboring nucleotide via phosphorothioate linkage, the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives attached through a bivalent or trivalent branched linker.
In one embodiment, the RNAi agent is a multimer containing at least two duplexes represented by formula (III), (Ilia), (Illb), (111c), and (Illd), wherein the duplexes are connected by a linker. The linker can be cieavable or non-cleavable. Optionally, the multimer further comprises a ligand. Each of the duplexes can target the same gene or two different genes; or each of the duplexes can target same gene at two different target sites.
In one embodiment, the RNAi agent is a multimer containing three, four, five, six or more duplexes represented by formula (III), (Ilia), (Illb), (IIIc), and (IHd), wherein the duplexes are connected by a linker. The linker can be cieavable or non-cleavable. Optionally, the multimer further comprises a ligand. Each of the duplexes can target the same gene or two different genes; or each of the duplexes can target same gene at two different target sites.
In one embodiment, two RNAi agents represented by formula (111), (Ilia), (Illb), (IIIc), and (Illd) are linked to each other at the 5' end, and one or both of the 3' ends and are optionally conjugated to to a ligand. Each of the agents can target the same gene or two different genes; or each of the agents can target same gene at two different target sites. iRNA Conjugates
The iRNA agents disclosed herein can be in the form of conj gates. The conjugate may be attached at any suitable location in the iRNA molecule, e.g., at the 3' end or the 5' end of the sense or the antisense strand. The conjugates are optionally attached via a linker.
In some embodiments, an iRNA agent described herein is chemically linked to one or more ligands, moieties or conjugates, which may confer functionality, e.g., by affecting (e.g., enhancing) the activity, cellular distribution or cellular uptake of the iRNA. Such moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acid. Sci, USA, 1989, 86: 6553-6556), cholic acid (Manoharan et al., Biorg. Med, Chem. Let., 1994, 4: 1053-1060), a thioether, e.g., beryi-S-tritylthiol (Manoharan et al, Ann, N. Y. Acad. Sci, 1992, 660:306-309; Manoharan et al, Biorg. Med. Chem. Let., 1993, 3:2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533-538), an aliphatic chain, e.g., dodecandioi or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10: 1111-1118;
Kabanov et al., FEBS Lett., 1990, 259:327-330; Svinarchuk et al, Biochimie, 1993, 75:49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or trie thyl- ammonium 1,2-di-O-hexadecyl-rac- glycero-3-phosphonate (Manoharan et al.. Tetrahedron Lett., 1995, 36:3651 -3654; Shea et al., Nucl. Acids Res., 1990, 18:3777-3783), a olyamine or a polyethylene glycol chain (Manoharan et al, Nucleosides & Nucleotides, 1995, 14:969-973), or adamantane acetic acid (Manoharan et al.. Tetrahedron Lett., 1995, 36:36 1 -3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229-237), or an octadecylamine or hexyiamino-carbonyloxycholesterol moiety (Crooke et al, ./. Pharmacol. Exp. Ther. , 1996, 277:923-937).
In one embodiment, a ligand alters the distribution, targeting or lifetime of an iRNA agent into which it is incorporated. In some embodiments, a ligand provides an enhanced affinity for a selected target, e.g, molecule, cell or cell type, compartment, e.g., a cellular or organ compartment, tissue, organ or region of the body, as, e.g., compared to a species absent such a ligand. Typical ligands will not take part in duplex pairing in a duplexed nucleic acid.
Ligands can include a naturally occurring substance, such as a protein (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulin); carbohydrate (e.g., a dextran, puilulan, chitin, chitosan, inulin, cyciodextrin or hyaluronic acid); or a lipid. The ligand may also be a recombinant or synthetic molecule, such as a synthetic polymer, e.g., a synthetic polyamino acid. Examples of polyamino acids include polyamino acid is a polylysine (PLL), poly L-aspartic acid, poly L-glutamic acid, styrene-maleic acid anhydride copolymer, poly(L- lactide-co-glycolied) copolymer, divinyl ether-maleic anhydride copolymer, N-(2- hydroxypropyi)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacryliic acid), N-isopropylacrylamide polymers, or polyphosphazine. Example of poiyamines include: polyeth lenimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, quaternary salt of a polyamine, or an a helical peptide.
Ligands can also include targeting groups, e.g., a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody, that binds to a specified cell type such as a kidney cell. A targeting group can be a thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, Mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl- gaiactos amine, N-acetyl-gulucosamine multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate, polyglutamate,
polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin B 12, biotin, or an RGD peptide or RGD peptide mimetic.
In some embodiments, the ligand is a GalNAc ligand that comprises one or more N- acetylgaiactosamine (GalNAc) derivatives. Additional description of GalNAc ligands is provided in the section titled Carbohydrate Conjugates.
Other examples of ligands include dyes, intercalating agents (e.g. acridines), cross-linkers (e.g. psoralene, mitomycin C), porphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g. EDTA), lipophilic molecules, e.g, cholesterol, cholic acid, adamantane acetic acid, 1 -pyrene butyric acid, dihydrotestosterone, l,3-Bis-0(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglvcerol, borneol, menthol, 1 ,3-propanediol, heptadecyl group, palmitic acid, myristic acid,03- (oleoyl)lithocholic acid, 03-(oleoyl)cholenic acid, dimethoxytntyl, or phenoxazine)and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g. biotin), transport/absorption facilitators (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl, HRP, or AP.
Ligands can be proteins, e.g., glycoproteins, or peptides, e.g., molecules having a specific affinity for a co-ligand, or antibodies e.g. , an antibody, that binds to a specified cell type such as a cancer cell, endothelial cell, or bone cell. Ligands may also include hormones and hormone receptors. They can also include non-peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl- gulucosamine multivalent mannose, or multivalent fucose. The ligand can be, for example, a lipopolysaccharide, an activator of p38 MAP kinase, or an activator of NF- B.
The ligand can be a substance, e.g, a ding, which can increase the uptake of the iRNA agent into the cell, for example, by disrupting the cell's cytoskeleton, e.g., by disrupting the cell's microtubules, microfilaments, and/or intermediate filaments. The drug can be, for example, taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin.
In some embodiments, a ligand attached to an iRNA as described herein acts as a pharmacokinetic modulator (PK modulator). PK modulators include lipophiles, bile acids, steroids, phospholipid analogues, peptides, protein binding agents, PEG, vitamins etc. Exemplary PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglyceride, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin etc. Oligonucleotides that comprise a number of phosphorothioate linkages are also known to bind to serum protein, thus short oligonucleotides, e.g., oligonucleotides of about 5 bases, 10 bases, 15 bases or 20 bases, comprising multiple of phosphorothioate linkages in the backbone are also amenable to the present invention as ligands (e.g. as PK modulating ligands). In addition, aptamers that bind serum components (e.g. serum proteins) are also suitable for use as PK modulating ligands in the embodiments described herein.
Ligand-conjugated oligonucleotides of the invention may be synthesized by the use of an oligonucleotide that bears a pendant reactive functionality, such as that derived from the attachment of a linking molecule onto the oligonucleotide (described below). This reactive oligonucleotide may be reacted directly with commercially-available ligands, ligands that are synthesized bearing any of a variety of protecting groups, or ligands that have a linking moiety attached thereto.
The oligonucleotides used in the conjugates of the present invention may be conveniently and routinely made through the well-known technique of solid-phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is also known to use similar techniques to prepare other
oligonucleotides, such as the phosphorothioates and alkylated derivatives.
In the ligand-conjugated oligonucleotides and ligand-molecule bearing sequence-specific linked nucleosides of the present invention, the oligonucleotides and oligonucleosides may be assembled on a suitable DNA synthesizer utilizing standard nucleotide or nucleoside precursors, or nucleotide or nucleoside conj gate precursors that already bear the linking moiety, ligand- nucleotide or nucleoside-conj gate precursors that already bear the ligand molecule, or non- nucleoside ligand-bearing building blocks. When using nucleoli de-conjugate precursors that already bear a linking moiety, the synthesis of the sequence-specific linked nucleosides is typically completed, and the ligand molecule is then reacted with the linking moiety to form the ligand-conju gated oligonucleotide. In some embodiments, the oligonucleotides or linked nucleosides of the present invention are synthesized by an automated synthesizer using phosphoramidites derived from ligand-nucleoside conjugates in addition to the standard phosphoramidites and non-standard phosphoramidites that are commercially available and routinely used in oligonucleotide synthesis.
Lipid Conjugates
In one embodiment, the ligand is a lipid or Mpid-based molecule. Such a lipid or lipid- based molecule can typically bind a serum protein, such as human serum albumin (HSA). An HSA binding ligand allows for distribution of the conjugate to a target tissue, e.g., a non-kidney target tissue of the body. For example, the target tissue can be the liver, including parenchymal cells of the liver. Other molecules that can bind HSA can also be used as ligands. For example, neproxin or aspirin can be used. A lipid or lipid-based ligand can (a) increase resistance to degradation of the conjugate, (b) increase targeting or transport into a target cell or cell membrane, and/or (c) can be used to adjust binding to a serum protein, e.g., HSA.
A lipid based ligand can be used to modulate, e.g., control (e.g., inhibit) the binding of the conjugate to a target tissue. For example, a lipid or lipid-based ligand that binds to HSA more strongly will be less likely to be targeted to the kidney and therefore less likely to be cleared from the body. A lipid or lipid-based ligand that binds to HSA less strongly can be used to target the conjugate to the kidney.
In one embodiment, the lipid based ligand binds HSA. For example, the ligand can bind HSA with a sufficient affinity such that distribution of the conjugate to a non-kidney tissue is enhanced. However, the affinity is typically not so strong that the HSA-ligand binding cannot be reversed.
In another embodiment, the lipid based ligand binds HSA weakly or not at all, such that distribution of the conjugate to the kidney is enhanced. Other moieties that target to kidney cells can also be used in place of or in addition to the lipid based ligand.
In another aspect, the ligand is a moiety, e.g., a vitamin, which is taken up by a target cell, e.g., a proliferating cell. These are particularly useful for treating disorders characterized by unwanted cell proliferation, e.g., of the malignant or non-malignant type, e.g., cancer cells. Exemplary vitamins include vitamin A, E, and K. Other exemplary vitamins include are B vitamin, e.g., folic acid, B12, riboflavin, biotin, pyridoxal or other vitamins or nutrients taken up by cancer cells. Also included are HSA and low density lipoprotein (LDL).
Cell Permeation Agents
In another aspect, the iigand is a cell-permeation agent, such as a helical cell-permeation agent. In one embodiment, the agent is amphipathic. An exemplary agent is a peptide such as tat or antennopedia. If the agent is a peptide, it can be modified, including a peptidylmimetic, invertomers, non-peptide or pseudo-peptide linkages, and use of D-amino acids. The helical agent is typically an -helical agent, and can have a lipophilic and a lipophobic phase.
The ligand can be a peptide or peptidomimetic. A peptidomimetic (also referred to herein as an oligopeptidomimetic) is a molecule capable of folding into a defined three- dimensional structure similar to a natural peptide. The attachment of peptide and
peptidomimetics to iRNA agents can affect pharmacokinetic distribution of the iRNA, such as by enhancing cellular recognition and absorption. The peptide or peptidomimetic moiety can be about 5-50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long.
A peptide or peptidomimetic can be, for example, a cell permeation peptide, cationic peptide, amphipathic peptide, or hydrophobic peptide (e.g., consisting primarily of Tyr, Tip or Phe). The peptide moiety can be a dendrimer peptide, constrained peptide or crosslinked peptide. In another alternative, the peptide moiety can include a hydrophobic membrane translocation sequence (MTS). An exemplary hydrophobic MTS-containing peptide is RFGF having the amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO:3367). An RFGF analogue (e.g., amino acid sequence AALLPVLLAAP (SEQ ID NO:3368)) containing a hydrophobic MTS can also be a targeting moiety. The peptide moiety can be a "delivery'* peptide, which can carry large polar molecules including peptides, oligonucleotides, and protein across cell membranes. For example, sequences from the HIV Tat protein
(GRKK RQRRRPPQ (SEQ ID NO:3369)) and the Drosophila Antennopedia protein
(RQIKIWFQNRRMKWKK (SEQ ID NO: 3370)) have been found to be capable of functioning as delivery peptides. A peptide or peptidomimetic can be encoded by a random sequence of DNA, such as a peptide identified from a phage -display library, or one-bead-one-compound (OBOC) combinatorial library (Lam et al., Nature, 354:82-84, 1991). Typically, the peptide or peptidomimetic tethered to a dsRNA agent via an incorporated monomer unit is a cell targeting peptide such as an arginine-glycine-aspartic acid (RGD)-peptide, or RGD mimic. A peptide moiety can range in length from about 5 amino acids to about 40 amino acids. The peptide moieties can have a structural modification, such as to increase stability or direct conformational properties. Any of the structural modifications described below can be utilized.
An RGD peptide for use in the compositions and methods of the invention may be linear or cyclic, and may be modified, e.g., glycosylated or methylated, to facilitate targeting to a specific tissue(s). RGD-containing peptides and peptidiomimemtics may include D-amino acids, as well as synthetic RGD mimics. In addition to RGD, one can use other moieties that target the integrin ligand. Preferred conjugates of this ligand target PEC AM- 1 or VEGF.
An RGD peptide moiety can be used to target a particular cell type, e.g., a tumor cell, such as an endothelial tumor cell or a breast cancer tumor cell (Zitzmann et al., Cancer Res., 62:5139-43, 2002). An RGD peptide can facilitate targeting of a dsRNA agent to tumors of a variety of other tissues, including the lung, kidney, spleen, or liver (Aoki et al., Cancer Gene Therapy 8:783-787, 2001). Typically, the RGD peptide will facilitate targeting of an iRNA agent to the kidney. The RGD peptide can be linear or cyclic, and can be modified, e.g., glycosylated or methylated to facilitate targeting to specific tissues. For example, a glycosylated RGD peptide can deliver an iRNA agent to a tumor cell expressing αγβ (Haubner et al.. Jour. Nucl. Med., 42:326-336, 2001).
A "cell permeation peptide" is capable of permeating a cell, e.g., a microbial cell, such as a bacterial or fungal cell, or a mammalian cell, such as a human cell. A microbial cell- permeating peptide can be, for example, an a-helical linear peptide (e.g., LL-37 or Ceropin PI), a disulfide bond-containing peptide (e.g., -defensin, β-defensin or bactenecin), or a peptide containing only one or two dominating amino acids (e.g., PR-39 or indolicidin). A cell permeation peptide can also include a nuclear localization signal (NLS). For example, a cell permeation peptide can be a bipartite amphipathic peptide, such as MPG, which is derived from the fusion peptide domain of HIV- 1 gp41 and the NLS of SV40 large T antigen (Simeoni et al., Nucl. Acids Res. 31 :2717-2724, 2003). Carbohydrate Conjugates
In some embodiments of the compositions and methods of the invention, an iRNA oligonucleotide further comprises a carbohydrate. The carbohydrate conjugated iRNA are advantageous for the in vivo delivery of nucleic acids, as well as compositions suitable for in vivo therapeutic use, as described herein. As used herein, "carbohydrate" refers to a compound which is either a carbohydrate per se made up of one or more monosaccharide units having at least 6 carbon atoms (which can be linear, branched or cyclic) with an oxygen, nitrogen or sulfur atom bonded to each carbon atom; or a compound having as a part thereof a carbohydrate moiety made up of one or more monosaccharide units each having at least six carbon atoms (which can be lineai", branched or cyclic), with an oxygen, nitrogen or sulfur atom bonded to each carbon atom. Representative carbohydrates include the sugars (mono-, di-, tri- and oligosaccharides containing from about 4, 5, 6, 7, 8, or 9 monosaccharide units), and polysaccharides such as starches, glycogen, cellulose and polysaccharide gums. Specific monosaccharides include C5 and above (e.g., C5, C6, C7, or C8) sugars; di- and trisaccharides include sugars having two or three monosaccharide units (e.g., C5, C6, C7, or C8).
In one embodiment, a carbohydrate conjugate comprises a monosaccharide. In one embodiment, the monosaccharide is an N-acetylgalactosamine (GalNAc). GalNAc conjugates are described, for example, in U.S. Patent No. 8,106,022, the entire content of which is hereby incorporated herein by reference. In some embodiments, the GalNAc conjugate serves as a ligand that targets the iRNA to particular cells. In some embodiments, the GalNAc conjugate targets the iRNA to liver cells, e.g., by serving as a ligand for the asialoglycoprotein receptor of liver cells (e.g., hepatocytes).
In some embodiments, the carbohydrate conjugate comprises one or more GalNAc derivatives. The GalNAc derivatives may be attached via a linker, e.g., a bivalent or trivalent branched linker. In some embodiments the GalNAc conjugate is conjugated to the 3' end of the sense strand, In some embodiments, the GalNAc conjugate is conjugated to the iRNA agent (e.g., to the 3' end of the sense strand) via a linker, e.g., a linker as described herein.
In some embodiments, the GalNAc conjugate is
Figure imgf000107_0001
Formula II.
In some embodiments, the RNAi agent is attached to the carbohydrate conjugate via a linker as shown in the following schematic, wherein X is O or S
Figure imgf000107_0002
In some embodiments, the RNAi agent is conjugated to L96 as defined in Table 1 and shown below
Figure imgf000107_0003
In some embodiments, a carbohydrate conjugate for use in the compositions and methods of the invention is selected from the group consisting of:
Figure imgf000108_0001
NHAc Formula IV,
Figure imgf000108_0002
V,
Figure imgf000109_0001
Figure imgf000109_0002
Formula VII.
Figure imgf000109_0003
Figure imgf000110_0001
109
Figure imgf000111_0001
Formula XIV,
Figure imgf000111_0002
Formula XVI,
Figure imgf000111_0003
Formula XVII,
Formula XIX,
Figure imgf000112_0001
Formula XX,
Figure imgf000112_0002
Another representative carbohydrate conjugate for use in the embodiments described herein includes, but is not limited to.
Figure imgf000113_0001
(Formula ΧΧΠΙ), when one of X or Y is an oligonucleotide, the other is a hydrogen. In some embodiments, the carbohydrate conjugate further comprises one or more additionai ligands as described above, such as, but not limited to, a PK modulator and/or a cell permeation peptide.
In one embodiment, an iRNA of the invention is conjugated to a carbohydrate through a linker. Non-limiting examples of iRNA carbohydrate conjugates with linkers of the compositions and methods of the invention include, but are not limited to,
Figure imgf000113_0002
(Formula XXIV), 843
PCT/US2016/051737
Figure imgf000114_0001
(Formula XXVI),
Figure imgf000114_0002
(Formula XXVII),
Figure imgf000114_0003
(Formula XXVIII),
Figure imgf000115_0001
(Formula XXIX), and
Figure imgf000115_0002
(Formula XXX), when one of X or Y is an oligonucleotide, the other is a hydrogen.
Linkers
In some embodiments, the conj gate or ligand described herein can be attached to an iRNA oligonucleotide with various linkers that can be cleavable or non-cleavable.
The term "linker" or "linking group" means an organic moiety that connects two parts of a compound, e.g., covalentiy attaches two parts of a compound. Linkers typically comprise a direct bond or an atom such as oxygen or sulfur, a unit such as NR8, C(O), C(0)NH, SO, S02, S02NH or a chain of atoms, such as, but not limited to, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arvlalkyl, aryl alkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl,
heterocyclylalkenyl, heterocyclylalkynvl, aryl, heteroaryl, heterocyclyl, cvcloalkyl, cycloalkenyl, aikylarylalkyl, alkylarylalkenyl, alkylarylalkynyl, alkenylarylalkyl, alkenylarylalkenyl, alkenylarylalkynyl, alkynylarylalkyl, alkynylarylalkenyl, alkynylarylalkynyl,
alkylheteroarylalkyl, aikylheteroarylalkenyl, alkylheteroarylalkynyl, aikenylheteroarylalkyl, alkenylheteroarylalkenyl, alkenylheteroarylalkynyl, alkynylheteroarylalkyl, aikynylheteroarylaikenyi , alkynylheteroaryl alkynyl , alkylheterocyclylalkyl ,
aikyiheterocyciylalkenyl, aikylhererocyclylalkynyi, alkenylheterocyclylalkyl,
alkenylheterocyclylalkenyl, alkenylheterocyclylalkynyl, alkynylheterocyc alkyl,
alkynylheterocyclylalkenyi, alkynylheterocyclylalkynyl, alkylaryl, alkenylaryl, alkynylaryl, alkylheteroaryl, alkenylheteroaryl, alkynylhereroaryl, which one or more methylenes can be interrupted or terminated by O, S, S(O), S02, N(R8), C(O), substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocyclic; where R8 is hydrogen, acyl, aliphatic or substituted aliphatic, hi one embodiment, the linker is between about 1-24 atoms, 2-24, 3-24, 4-24, 5-24, 6-24, 6-18, 7-18, 8-18 atoms, 7-17, 8-17, 6-16, 7-16, or 8-16 atoms.
h one embodiment, a dsRNA of the invention is conjugated to a bivalent or trivalent branched linker selected from the group of structures shown in any of formula (XXXI) - (XXXIV):
Formula XXXI Formula XXXII
Figure imgf000116_0001
Figure imgf000116_0002
Formula XXXIII Formula XXXIV wherein:
q2A, q2B, q3A, q3B, q4A, q4B, q5A, q5B and q5C represent independently for each occurrence 0-20 and wherein the repeating unit can be the same or different; 2B n3A T,3B τ->4Α n4B τόΑ n5B n5C 2.\ ^2Β rp3A rp3B rp4A rp4B
P2 , P B, PJA, Ρ·, P4A, Ρ, P3A, PJB, P^, T /\ T ts, TJA, r", A, Τ, A, n5B rp5C are each independently for each occurrence absent, CO, NH, O, S, OC(O), NHC(O), CH2, CH2NH or CH20;
Q2\ Q2B, Q 'A, Q3B, Q4A, Q4B, Q5A, Q5B, Q5C are independently for each occurrence absent, alkylene, substituted alkylene wherin one or more methylenes can be interrupted or terminated by one or more of O, S, S(O), S02, N(RN), C(R C(R"), C≡C or C(O);
R2A, R2B, R3A, R3B, R4A, R4B, R5A, R5B, R5C are each independently for each occurrence absent,
NH, O, S, CH2, C(0)0, C(0)NH, NHCH(Ra)C(0), -C(0)-CH(Ra)-NH-, CO, CH=N-0,
Figure imgf000117_0001
heterocyciyl;
L2A, L2B, L3A, L3B, L4A, L4B, L5A, L5B and L5C represent the ligand; i. e. each independently for each occurrence a monosaccharide (such as GalNAc), disaccharide, trisaccharide,
tetrasaccharide, oligosaccharide, or polysaccharide; andRa is H or amino acid side
chain.Trivalent conjugating GalNAc derivatives are particularly useful for use with RNAi agents for inhibiting the expression of a target gene, such as those of formula (XXXV):
Formula XXXV
Figure imgf000117_0002
wherein L , L and L represent a monosaccharide, such as GalNAc derivative. Examples of suitable bivalent and trivalent branched linker groups conjugating GalNAc derivatives include, but are not limited to, the structures recited above as formulas II, VII, XI, X, and XIII.
A cleavable linking group is one which is sufficiently stable outside the cell, but which upon entry into a target cell is cleaved to release the two parts the linker is holding together. In a preferred embodiment, the cleavable linking group is cleaved at least about 10 times, 20, times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times or more, or at least about 100 times faster in a target cell or under a first reference condition (which can, e.g., be selected to mimic or represent intracellular conditions) than in the blood of a subject, or under a second reference condition (which can, e.g., be selected to mimic or represent conditions found in the blood or serum).
Cleavable linking groups are susceptible to cleavage agents, e.g., pH, redox potential or the presence of degradative molecules. Generally, cleavage agents are more prevalent or found at higher levels or activities inside cells than in serum or blood. Examples of such degradative agents include: redox agents which are selected for particular substrates or which have no substrate specificity, including, e.g., oxidative or reductive enzymes or reductive agents such as mercaptans, present in cells, that can degrade a redox cleavable linking group by reduction; esterases; endosomes or agents that can create an acidic environment, e.g., those that result in a pH of five or lower; enzymes that can hydrolyze or degrade an acid cleavable linking group by acting as a general acid, peptidases (which can be substrate specific), and phosphatases.
A cleavable linkage group, such as a disulfide bond can be susceptible to pH. The pH of human serum is 7.4, while the average intracellular pH is slightly lower, ranging from about 7.1 - 7.3. Endosomes have a more acidic pH, in the range of 5.5-6.0, and lysosomes have an even more acidic pH at around 5.0. Some linkers will have a cleavable linking group that is cleaved at a preferred pH, thereby releasing a cationic lipid from the ligand inside the cell, or into the desired compartment of the cell.
A linker can include a cleavable linking group that is cleavable by a particular enzyme. The type of cleavable linking group incorporated into a linker can depend on the cell to be targeted. For example, a liver-targeting ligand can be linked to a cationic lipid through a linker that includes an ester group. Liver cells are rich in esterases, and therefore the linker will be cleaved more efficiently in liver cells than in cell types that are not esterase-rich. Other cell- types rich in esterases include cells of the lung, renal cortex, and testis.
Linkers that contain peptide bonds can be used when targeting cell types rich in peptidases, such as liver cells and synoviocytes.
In general, the suitability of a candidate cleavable linking group can be evaluated by testing the ability of a degradative agent (or condition) to cleave the candidate linking group. It will also be desirable to also test the candidate cleavable linking group for the ability to resist cleavage in the blood or when in contact with other non-target tissue. Thus, one can determine the relative susceptibility to cleavage between a first and a second condition, where the first is selected to be indicative of cleavage in a target cell and the second is selected to be indicative of cleavage in other tissues or biological fluids, e.g., blood or serum. The evaluations can be carried out in cell free systems, in cells, in cell culture, in organ or tissue culture, or in whole animals. It can be useful to make initial evaluations in ceil-free or culture conditions and to confirm by further evaluations in whole animals, hi preferred embodiments, useful candidate compounds are cleaved at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood or serum (or under in vitro conditions selected to mimic extracellular conditions).
Redox cleavable linking groups
In one embodiment, a cleavable linking group is a redox cleavable linking group that is cleaved upon reduction or oxidation. An example of reductivelv cleavable linking group is a disulphide linking group (-S-S-). To determine if a candidate cleavable linking group is a suitable "reductivelv cleavable linking group," or for example is suitable for use with a particular iRNA moiety and particular targeting agent one can look to methods described herein. For example, a candidate can be evaluated by incubation with dithiothreitol (DTT), or other reducing agent using reagents know in the art, which mimic the rate of cleavage which would be observed in a cell, e.g., a target cell. The candidates can also be evaluated under conditions which are selected to mimic blood or serum conditions. In one, candidate compounds are cleaved by at most about 10% in the blood. In other embodiments, useful candidate compounds are degraded at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood (or under in vitro conditions selected to mimic extracellular conditions). The rate of cleavage of candidate compounds can be determined using standard enzyme kinetics assays under conditions chosen to mimic intracellular media and compared to conditions chosen to mimic extracellular media. Phosphate-based cleavabie linking groups
In another embodiment, a cleavabie linker comprises a phosphate-based cleavabie linking group. A phosphate-based cleavabie linking group is cleaved by agents that degrade or hydrolyze the phosphate group. An example of an agent that cleaves phosphate groups in cells are enzymes such as phosphatases in cells. Examples of phosphate-based linking groups are -O- P(0)(ORk)-0-, -0-P(S)(ORk)-0-, -0-P(S)(SRk)-0, -S-P(0)(ORk)-0-, -0-P(0)(ORk)-S-, -S- P(0)(ORk)-S-, -0-P(S)(ORk)-S-, -S-P(S)(ORk)-0-, -0-P(0)(Rk)-0-, -0-P(S)(Rk)-0-, -S- P(0)(Rk)-CK -S-P(S)(Rk)-0-, -S-P(0)(Rk)-S-, -0-P(S)( Rk)-S-. Preferred embodiments are -O- P(0)(OH)-0-, -0-P(S)(OH)-0-, -0-P(S)(SH)-0-, -S-P(0)(OH)-0-, -0-P(0)(OH)-S-, -S- P(0)(OH)-S-, -0-P(S)(OH)-S-, -S-P(S)(OH)-0-, -0-Ρ(0)(Η)-0-, -0-P(S)(H)-0-, -S-P(0)(H)-0, -S-P(S)(H)-0-, -S-P(0)(H)-S-, -0-P(S)(H)-S-. A preferred embodiment is -0-P(0)(OH)-0-. These candidates can be evaluated using methods analogous to those described above.
Acid cleavabie linking groups
In another embodiment, a cleavabie linker comprises an acid cleavabie linking group. An acid cleavabie linking group is a linking group that is cleaved under acidic conditions. In preferred embodiments acid cleavabie linking groups are cleaved in an acidic environment with a pH of about 6.5 or lower (e.g., about 6.0, 5.75, 5.5, 5.25, 5.0, or lower), or by agents such as enzymes that can act as a general acid. In a ceil, specific low pH organelles, such as endosomes and lysosomes can provide a cleaving environment for acid cleavabie linking groups. Examples of acid cleavabie linking groups include but are not limited to hydrazones, esters, and esters of amino acids. Acid cleavabie groups can have the general formula -C=NN-, C(0)0, or -OC(O). A preferred embodiment is when the carbon attached to the oxygen of the ester (the aikoxy group) is an aryi group, substituted alkyl group, or tertiary alkyl group such as dimethyl pentyl or t-butyl. These candidates can be evaluated using methods analogous to those described above.
Ester-based cleavabie linking groups
In another embodiment, a cleavabie linker comprises an ester-based cleavabie linking group. An ester-based cleavabie linking group is cleaved by enzymes such as esterases and amidases in cells. Examples of ester-based cleavabie linking groups include but are not limited to esters of alkylene, alkenylene and aikynylene groups. Ester cleavabie linking groups have the general formula -C(0)0-, or -OC(O)-. These candidates can be evaluated using methods analogous to those described above. Peptide- based cleavable linking groups
In yet another embodiment, a cleavable linker comprises a peptide-based cleavable linking group. A peptide-based cleavable linking group is cleaved by enzymes such as peptidases and proteases in cells. Peptide-based cleavable linking groups are peptide bonds formed between amino acids to yield oligopeptides (e.g., dipeptides, tripeptides etc.) and polypeptides. Peptide-based cleavable groups do not include the amide group (-C(O)NH-). The amide group can be formed between any alkylene, alkenylene or alkynelene. A peptide bond is a special type of amide bond formed between amino acids to yield peptides and proteins. The peptide based cleavage group is generally limited to the peptide bond (i.e., the amide bond) formed between amino acids yielding peptides and proteins and does not include the entire amide functional group. Peptide-based cleavable linking groups have the general formula - NHCHRAC(0)NHCHRBC(0)-, where RA and RB are the R groups of the two adjacent amino acids. These candidates can be evaluated using methods analogous to those described above.
Representative U.S. patents that teach the preparation of RNA conjugates include, but are not limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541 ,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731 ; 5,591 ,584; 5, 109,124; 5,118,802; 5, 138,045; 5,414,077;
5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779;
4,789,737; 4,824,941 ; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5, 112,963;
5,214,136; 5,082,830; 5, 112,963; 5,214,136; 5,245,022; 5,254,469; 5,258.506; 5,262,536;
5,272,250; 5,292,873; 5,317,098; 5,371 ,241 , 5,391 ,723; 5,416,203, 5,451,463; 5,510,475;
5,512,667; 5,514.785; 5,565,552; 5,567,810; 5.574.142; 5,585,481 ; 5,587,371; 5,595,726;
5,597,696; 5,599,923; 5,599,928 and 5,688,941 ; 6,294,664; 6,320,017; 6,576,752; 6,783,931 ; 6,900,297; 7,037,646; 8, 106,022, the entire contents of each of which is herein incorporated by reference.
It is not necessary for all positions in a given compound to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single compound or even at a single nucleoside within an iRNA. The present invention also includes iRNA compounds that are chimeric compounds.
"Chimeric" iRNA compounds, or "chimeras," in the context of the present invention, are iRNA compounds, e.g., dsRNAs, that contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of a dsRNA compound. These iRNAs typically contain at least one region wherein the RNA is modified so as to confer upon the iRNA increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid. An additional region of the iRNA may serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of iRNA inhibition of gene expression. Consequently, comparable results can often be obtained with shorter iRNAs when chimeric dsRNAs are used, compared to phosphorothioate deoxy dsRNAs hybridizing to the same target region. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.
In certain instances, the RNA of an iRNA can be modified by a non-ligand group. A number of non-ligand molecules have been conjugated to iRNAs in order to enhance the activity, cellular distribution or cellular uptake of the iRNA, and procedures for performing such conjugations are available in the scientific literature. Such non-ligand moieties have included lipid moieties, such as cholesterol (Kubo, T. et al, Biochem. Biophys. Res. Comm., 2007, 365(1 ):54-61; Letsinger et al, Proc. Natl Acad, Sci. USA, 1989, 86:6553), cholic acid
(Manoharan et al, Bioorg. Med. Chem, Lett,, 1994, 4: 1053), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al, Ann, N. Y. Acad. Sci,, 1992, 660:306; Manoharan et al, Bioorg. Med. Chem, Let., 1993, 3:2765), a thiocholesterol (Oberhauser et al, Nucl Acids Res., 1992, 20:533), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al, EMBO J., 1991, 10: 111; Kabanov et al, FEBS Lett., 1990, 259:327; Svinarchuk et al, Biochimie, 1993, 75:49), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac- glycero-3-H-phosphonate (Manoharan et al. Tetrahedron Lett., 1995, 36:3651; Shea et al, Nucl. Acids Res., 1990, 18:3777), a polyamine or a polyethylene glycol chain (Manoharan et al, Nucleosides & Nucleotides, 1995, 14:969), or adamantane acetic acid (Manoharan et al, Tetrahedron Lett., 1995, 36:3651), a palmityl moiety (Mishra et al, Biochim. Biophys. Acta, 1995, 1264:229), or an octadecyl amine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al, . Pharmacol. Exp. Ther., 1996, 277:923). Representative United States patents that teach the preparation of such RNA conjugates have been listed above. Typical conjugation protocols involve the synthesis of an RNAs bearing an aminolinker at one or more positions of the sequence. The amino group is then reacted with the molecule being conjugated using appropriate coupling or activating reagents. The conjugation reaction may be performed either with the RNA still bound to the solid support or following cleavage of the RNA, in solution phase. Purification of the RNA conjugate by HPLC typically affords the pure conjugate.
Delivery of iRNA
The delivery of an iRNA to a subject in need thereof can be achieved in a number of different ways. In vivo delivery can be performed directly by administering a composition comprising an iRNA, e.g. a dsRNA, to a subject. Alternatively, delivery can be performed indirectly by administering one or more vectors that encode and direct the expression of the iRNA. These alternatives are discussed further below.
Direct delivery
In general, any method of delivering a nucleic acid molecule can be adapted for use with an iRNA (see e.g., Akhtar S. and Julian RL. (1992) Trends Cell. Biol. 2(5): 139-144 and
WO94/02595, which are incorporated herein by reference in their entireties). However, there are three factors that are important to consider in order to successfully deliver an iRNA molecule in vivo: (a) biological stability of the delivered molecule, (2) preventing non-specific effects, and (3) accumulation of the delivered molecule in the target tissue. The non-specific effects of an iRNA can be minimized by local administration, for example by direct injection or implantation into a tissue (as a non-limiting example, a tumor) or topically administering the preparation. Local administration to a treatment site maximizes local concentration of the agent, limits the exposure of the agent to systemic tissues that may otherwise be harmed by the agent or that may degrade the agent, and permits a lower total dose of the iRNA molecule to be administered. Several studies have shown successful knockdown of gene products when an iRNA is administered locally. For example, intraocular delivery of a VEGF dsRNA by intra vitreal injection in cynomolgus monkeys (Tolentino, MJ et al (2004) Retina 24: 132-138) and subretinai injections in mice (Reich, SJ., et al (2003) Mol. Vis. 9:210-216) were both shown to prevent neovascularization in an experimental model of age-related macular degeneration, in addition, direct intratumoral injection of a dsRNA in mice reduces tumor volume (Pille, J., et al (2005) Mol. Ther.1 1 :267-274) and can prolong survival of tumor-bearing mice (Kim, WJ., et al (2006) Mol. Ther. 14:343-350; Li, S., et al (2007) Mol Ther. 15:515-523). RNA interference has also shown success with local delivery to the CNS by direct injection (Dom, G., et al. (2004) Nucleic Acids 32:e49; Tan, PH., et al (2005) Gene Ther. 12:59-66; Makimura, H., et al (2002) BMC Neurosci. 3: 18; Shishkina, GT., et al (2004) Neuroscience 129:521-528; Thakker, ER., et al (2004) Proc. Natl. Acad. Sci. U.S.A. 101 : 17270-17275; Akaneya,Y., et al (2005) J.
Neurophysiol. 93:594-602) and to the lungs by intranasal administration (Howard, A., et al (2006) Mol. Ther. 14:476-484; Zhang, X., et al (2004) J. Biol, Chem. 279: 10677-10684; Bitko, V., et al (2005) Nat. Med. 11 :50-55). For administering an iRNA systemically for the treatment of a disease, the RNA can be modified or alternatively delivered using a drug delivery system; both methods act to prevent the rapid degradation of the dsRNA by endo- and exo-nucleases in vivo.
Modification of the RNA or the pharmaceutical carrier can also permit targeting of the iRNA composition to the target tissue and avoid undesirable off-target effects. iRNA molecules can be modified by chemical conjugation to other groups, e.g., a lipid or carbohydrate group as described herein. Such conjugates can be used to target iRNA to particular cells, e.g., liver cells, e.g., hepatocytes. For example, GalNAc conjugates or lipid (e.g., LNP) formulations can be used to target iRNA to particular cells, e.g., liver cells, e.g., hepatocytes.
Lipophilic groups such as cholesterol to enhance cellular uptake and prevent degradation. For example, an iRNA directed against ApoB conjugated to a lipophilic cholesterol moiety was injected systemically into mice and resulted in knockdown of apoB mRNA in both the liver and jejunum (Soutschek, J., et al (2004) Nature 432: 173-178). Conjugation of an iRNA to an aptamer has been shown to inliibit tumor growth and mediate tumor regression in a mouse model of prostate cancer (McNamara, JO., et al (2006) Nat. Biotechnol, 24: 1005-1015). In an alternative embodiment, the iRNA can be delivered using drug delivery systems such as a nanoparticle, a dendrimer, a polymer, liposomes, or a cationic delivery system. Positively charged cationic delivery systems facilitate binding of an iRNA molecule (negatively charged) and also enhance interactions at the negatively charged cell membrane to permit efficient uptake of an iRNA by the cell. Cationic lipids, dendrimers, or polymers can either be bound to an iRNA, or induced to form a vesicle or micelle (see e.g., Kim SH., et al (2008) Journal of Controlled Release 129(2): 107-116) that encases an iRNA. The formation of vesicles or micelles further prevents degradation of the iRNA when administered systemically. Methods for making and administering cationic- iRNA complexes are well within the abilities of one skilled in the art (see e.g., Sorensen, DR., et al (2003) J. Mol, Biol 327:761-766; Vemia, UN., et al (2003) Clin.
Cancer Res. 9: 1291-1300; Arnold, AS et al (2007) /. Hypertens. 25:197-205, which are incorporated herein by reference in their entirety). Some non-limiting examples of drug delivery systems useful for systemic delivery of iRNAs include DOTAP (Sorensen, DR., et al (2003), supra; Verma, UN., et al (2003), supra), Oligofectamine, "solid nucleic acid lipid particles" (Zimmermann, TS., et al (2006) Nature 441: 111-114), cardiolipin (Chien, PY., et al (2005) Cancer Gene Ther. 12:321-328; Pal, A., et al (2005) Int J. Oncol. 26: 1087-1091 ),
poiyethyleneimine (Bonnet ME., et al (2008) Pharm, Res. Aug 16 Epub ahead of print; Aigner, A. (2006) ./. Biomed. Biotechnol. 71659), Arg-Gly-Asp (RGD) peptides (Liu, S. (2006) Mol. Pharm. 3:472-487), and polyamidoamines (Tomalia, DA., et al (2007) Biochem. Soc. Trans. 35:61-67; Yoo, H., et al (1999) Pharm. Res. 16: 1799-1804). In some embodiments, an iRNA forms a complex with cyclodextrin for systemic administration. Methods for administration and pharmaceutical compositions of iRNAs and cyclodextrins can be found in U.S. Patent No. 7, 427, 605, which is herein incorporated by reference in its entirety.
Vector encoded iRNAs
In another aspect, iRNA targeting the ALAS 1 gene can be expressed from transcription units inserted into DNA or RNA vectors {see, e.g.. Couture, A, et al, TIG. (1996), 12:5-10; Skillern, A., et al, International PCT Publication No. WO 00/22113, Conrad, International PCT Publication No. WO 00/22114. and Conrad, U.S. Pat. No. 6,054,299). Expression can be transient (on the order of hours to weeks) or sustained (weeks to months or longer), depending upon the specific construct used and the target tissue or cell type. These transgenes can be introduced as a linear construct, a circular plasmid, or a viral vector, which can be an integrating or non-integrating vector. The transgene can also be constructed to permit it to be inherited as an extrachromosomal plasmid (Gassmann, et al, Proc. Natl. Acad. Set USA ( 1995) 92: 1292).
The individual strand or strands of an iRNA can be transcribed from a promoter on an expression vector. Where two separate strands are to be expressed to generate, for example, a dsRNA, two separate expression vectors can be co-introduced (e.g., by transfection or infection) into a target cell. Alternatively each individual strand of a dsRNA can be transcribed by promoters both of which are located on the same expression plasmid. In one embodiment, a dsRNA is expressed as an inverted repeat joined by a linker polynucleotide sequence such that the dsRNA has a stem and loop structure.
An iRNA expression vector is typically a DNA plasmid or viral vector. An expression vector compatible with eukaryotic cells, e.g., with vertebrate cells, can be used to produce recombinant constructs for the expression of an iRNA as described herein. Eukaryotic cell expression vectors are well known in the art and are available from a number of commercial sources. Typically, such vectors contain convenient restriction sites for insertion of the desired nucleic acid segment. Delivery of iRNA expressing vectors can be systemic, such as by intravenous or intramuscular administration, by administration to target cells ex-planted from the patient followed by reintroduction into the patient, or by any other means that allows for introduction into a desired target cell.
An iRNA expression plasmid can be transfected into a target cell as a complex with a cationic lipid carrier (e.g., Oligofectamine) or a non-cationic lipid-based carrier (e.g.,
Transit-TKO™). Multiple lipid transfections for iRNA-mediated knockdowns targeting different regions of a target RNA over a period of a week or more are also contemplated by the invention. Successful introduction of vectors into host cells can be monitored using various known methods. For example, transient transfection can be signaled with a reporter, such as a fluorescent marker, such as Green Fluorescent Protein (GFP). Stable transfection of cells ex vivo can be ensured using markers that provide the transfected cell with resistance to specific environmental factors (e.g., antibiotics and drugs), such as hygromycin B resistance.
Viral vector systems which can be utilized with the methods and compositions described herein include, but are not limited to, (a) adenovirus vectors; (b) retrovirus vectors, including but not limited to lentiviral vectors, moloney murine leukemia virus, etc.; (c) adeno- associated virus vectors; (d) herpes simplex virus vectors; (e) SV40 vectors; (f) polyoma virus vectors;
(g) papilloma virus vectors; (h) picornavirus vectors; (i) pox virus vectors such as an orthopox, e.g., vaccinia virus vectors or avipox, e.g., canary pox or fowl pox; and (j) a helper-dependent or gutless adenovirus. Replication-defective viruses can also be advantageous. Different vectors will or will not become incorporated into the cells' genome. The constructs can include viral sequences for transfection, if desired. Alternatively, the construct may be incorporated into vectors capable of episomal replication, e.g EPV and EBV vectors. Constructs for the recombinant expression of an iRNA will generally require regulatory elements, e.g., promoters, enhancers, etc., to ensure the expression of the iRNA in target cells. Other aspects to consider for vectors and constructs are further described below.
Vectors useful for the delivery of an iRNA will include regulatory elements (promoter, enhancer, etc.) sufficient for expression of the iRNA in the desired target cell or tissue. The regulatory elements can be chosen to provide either constitutive or regulated/inducible expression.
Expression of the iRNA can be precisely regulated, for example, by using an inducible regulatory sequence that is sensitive to certain physiological regulators, e.g., circulating glucose levels, or hormones (Dochert et al., 1994, FASEB J. 8:20-24). Such inducible expression systems, suitable for the control of dsRNA expression in cells or in mammals include, for example, regulation by ecdysone, by estrogen, progesterone, tetracycline, chemical inducers of dimerization, and isopropyl-P-Dl-thiogalactopyranoside (IPTG). A person skilled in the art would be able to choose the appropriate regulatory/promoter sequence based on the intended use of the iRNA transgene.
In a specific embodiment, viral vectors that contain nucleic acid sequences encoding an iRNA can be used. For example, a retroviral vector can be used (see Miller et al., Meth.
Enzymol. 217:581-599 (1993)). These retroviral vectors contain the components necessary for the correct packaging of the viral genome and integration into the host cell DNA. The nucleic acid sequences encoding an iRNA are cloned into one or more vectors, which facilitates delivery of the nucleic acid into a patient. More detail about retroviral vectors can be found, for example, in Boesen et al., Biotherapy 6:291-302 (1994), which describes the use of a retroviral vector to deliver the mdrl gene to hematopoietic stem cells in order to make the stem cells more resistant to chemotherapy. Other references illustrating the use of retroviral vectors in gene therapy are: Clowes et al, J. Clin. Invest. 93:644-651 (1994); Kiem et al. Blood 83: 1467-1473 (1994);
Salmons and Gunzberg, Human Gene Therapy 4: 129-141 (1993); and Grossman and Wilson, Curr. Opin, in Genetics and Devel. 3: 110-1 14 (1993). Lentiviral vectors contemplated for use include, for example, the HIV based vectors described in U.S. Patent Nos. 6,143,520; 5,665,557; and 5,981,276, which are herein incorporated by reference.
Adenoviruses are also contemplated for use in delivery of iRNAs. Adenoviruses are especially attractive vehicles, e.g., for delivering genes to respiratory epithelia. Adenoviruses naturally infect respiratory epithelia where they cause a mild disease. Other targets for adenovirus-based delivery systems are liver, the central nervous system, endothelial cells, and muscle. Adenoviruses have the advantage of being capable of infecting non-dividing cells.
Kozarsky and Wilson, Current Opinion in Genetics and Development 3:499-503 (1993) present a review of adenovirus-based gene therapy. Bout et al, Human Gene Therapy 5:3-10 (1994) demonstrated the use of adenovirus vectors to transfer genes to the respiratory epithelia of rhesus monkeys. Other instances of the use of adenoviruses in gene therapy can be found in Rosenfeld et al, Science 252:431-434 (1991); Rosenfeld et al, Cell 68: 143-155 (1992); Mastrangeli et al, J. Clin. Invest. 91:225-234 (1993); PCT Publication W094/12649; and Wang, et al, Gene Therapy 2:775-783 (1995). A suitable AV vector for expressing an iRNA featured in the invention, a method for constructing the recombinant AV vector, and a method for delivering the vector into target cells, are described in Xia H et al (2002), Nat. Biotech. 20: 1006-1010.
Use of Adeno-associated virus (AAV) vectors is also contemplated (Walsh et al, Proc. Soc. Exp. Biol. Med. 204:289-300 (1993); U.S. Pat. No. 5,436,146). In one embodiment, the iRNA can be expressed as two separate, complementary single-stranded RNA molecules from a recombinant AAV vector having, for example, either the U6 or HI RNA promoters, or the cytomegalovirus (CMV) promoter. Suitable AAV vectors for expressing the dsRNA featured in the invention, methods for constructing the recombinant AV vector, and methods for delivering the vectors into target cells are described in Samuiski R et al. (1987) J. Virol, 61: 3096-3101; Fisher K J et al (1996). J. Virol. 70: 520-532; Samuiski R et al (1989) J. Virol 63: 3822-3826; U.S. Pat. No. 5,252,479; U.S. Pat. No. 5,139,941; International Patent Application No. WO 94/13788; and International Patent Application No. WO 93/24641 , the entire disclosures of which are herein incorporated by reference.
Another typical viral vector is a pox virus such as a vaccinia virus, for example an attenuated vaccinia such as Modified Virus Ankara (MVA) or NYVAC, an avipox such as fowl pox or canary pox.
The tropism of viral vectors can be modified by pseudotyping the vectors with envelope proteins or other surface antigens from other viruses, or by substituting different viral capsid proteins, as appropriate. For example, lentiviral vectors can be pseudotyped with surface proteins from vesicular stomatitis vims (VSV), rabies, Ebola, Mokola, and the like. AAV vectors can be made to target different cells by engineering the vectors to express different capsid protein serotypes; see, e.g., Rabinowitz J E et al. (2002), ./ Virol 76:791-801 , the entire disclosure of which is herein incorporated by reference.
The pharmaceutical preparation of a vector can include the vector in an acceptable diluent, or can include a slow release matrix in which the gene delivery vehicle is imbedded. Alternatively, where the complete gene delivery vector can be produced intact from recombinant cells, e.g., retroviral vectors, the phai'maceutical prepai'ation can include one or more cells which produce the gene delivery system.
III. Pharmaceutical compositions containing iRNA
In one embodiment, the invention provides pharmaceutical compositions containing an iRNA, as described herein, and a pharmaceutically acceptable carrier. The pharmaceutical composition containing the iRNA is useful for treating a disease or disorder related to the expression or activity of an ALAS 1 gene (e.g., a disorder involving the porphyrin pathway). Such pharmaceutical compositions are formulated based on the mode of delivery. For example, compositions can be formulated for systemic administration via parenteral delivery, e.g., by intravenous (IV) delivery. In some embodiments, a composition provided herein (e.g., an LNP formulation) is formulated for intravenous delivery. In some embodiments, a composition provided herein (e.g., a composition comprising a GaiNAc conjugate) is formulated for subcutaneous delivery.
The pharmaceutical compositions featured herein are administered in a dosage sufficient to inhibit expression of an ALASl gene. In general, a suitable dose of iRNA will be in the range of 0.01 to 200.0 milligrams per kilogram body weight of the recipient per day, generally in the range of 1 to 50 mg per kilogram body weight per day. For example, the dsRNA can be administered at 0.035 mg/kg, 0.05 mg/kg, 0.35 mg/kg, 0.5 mg/kg, 1 mg/kg, 1.5 mg/kg, 2 mg/kg, 2.5 mg/kg, 3 mg/kg, 5 mg kg, 10 mg/kg, 20 mg/kg, 30 mg/kg, 40 mg kg, or 50 mg/kg per single dose. As another example, the dsRNA can be administered at 0.02-3 mg/kg, e.g., 0.03-0.1 mg/kg, 0.1-0.5 mg kg, 0.3-1 mg/kg, 0.3-2.5 mg/kg, 0.5-2 mg/kg, 0.5-1.5 mg/kg, 0.1-0.2 mg/kg, 0.2-0.5 mg/kg, 0.5-1 mg kg, 1-1.5 mg/kg, 1.5-2 mg/kg, 1-2.5 mg kg, 2-2.5 mg/kg, 2.5-3 mg/kg, or 3-5 mg/kg, per single dose. The pharmaceutical composition may be administered once daily, or the iRNA may be administered as two, three, or more sub-doses at appropriate intervals throughout the day or even using continuous infusion or delivery through a controlled release formulation. In that case, the iRNA contained in each sub-dose must be correspondingly smaller in order to achieve the total daily dosage. The dosage unit can also be compounded for delivery over several days, e.g., using a conventional sustained release formulation which provides sustained release of the iRNA over a several day period. Sustained release formulations are well known in the art and are particularly useful for delivery of agents at a particular site, such as can be used with the agents of the present invention. In this embodiment, the dosage unit contains a corresponding multiple of the daily dose. In some embodiments, the pharmaceutical
compositions may be administered once every two weeks, once every four weeks, once every eight weeks, once every twelve weeks, once every sixteen weeks, once every twenty weeks, or once every twenty-four weeks. In certain embodiments, the pharmaceutical composition is administered once every four weeks or once every twelve weeks. In some embodiments, the pharmaceutical compositions may be administered once every month, once every two months, once every three months, once every four months, once every five months, or once every six months. In certain embodiments, the pharmaceutical composition is administered once every month or once every three months.
The effect of a single dose on ALAS 1 levels can be long lasting, such that subsequent doses are administered at not more than 3, 4, or 5 day intervals, at not more than I, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 week intervals, or at not more than 1, 2, 3, 4, 5, or 6 months interval.
The skilled artisan will appreciate that certain factors may influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present. Moreover, treatment of a subject with a therapeutically effective amount of a composition can include a single treatment or a series of treatments. Estimates of effective dosages and in vivo half-lives for the individual iRNAs encompassed by the invention can be made using conventional methodologies or on the basis of in vivo testing using an appropriate animal model, as described elsewhere herein.
Advances in mouse genetics have generated a number of mouse models for the study of various human diseases, such as pathological processes related to ALAS 1 expression (e.g., pathological processes involving porphyrins or defects in the poiphyrin pathway, such as, for example, porphyrias). Such models can be used for in vivo testing of iRNA, as well as for determining a therapeutically effective dose and/or an effective dosing regimen.
A suitable mouse model is, for example, a mouse containing a transgene expressing human ALAS 1. Mice that have knock-in mutations (e.g., mutations that are associated with acute hepatic porphwias in humans) can be used to determine the therapeutically effective dosage and/or duration of administration of ALAS 1 siRNA .The present invention also includes pharmaceutical compositions and formulations that include the iRNA compounds featured in the invention. The pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (e.g., by a transdermal patch), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal, oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; subdermal, e.g., via an implanted device; or intracranial, e.g., by intraparenchymal, intrathecal or intraventricular, administration.
The iRNA can be delivered in a manner to target a particular tissue, such as a tissue that produces erythrocytes. For example, the iRNA can be delivered to bone marrow, liver (e.g., hepatocyes of liver), lymph glands, spleen, lungs (e.g., pleura of lungs) or spine. In one embodiment, the iRNA is delivered to bone marrow.
Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable. Coated condoms, gloves and the like may also be useful. Suitable topical formulations include those in which the iRNAs featured in the invention are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants. Suitable lipids and liposomes include neutral (e.g., dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC,
distearolyphosphatidyl choline) negative (e.g., dimyristoylphosphatidyl glycerol DMPG) and cationic (e.g., dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidyl ethanolamine DOTMA). iRNAs featured in the invention may be encapsulated within liposomes or may form complexes thereto, in particular to cationic liposomes. Alternatively, iRNAs may be complexed to lipids, in particular to cationic lipids. Suitable fatty acids and esters include but are not limited to arachidonic acid, oleic acid, eicosanoic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1 -monocaprate, l-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or a C1.20 ail yl ester (e.g., isopropylmyristate IPM), monoglyceride, diglyceride or pharmaceutically acceptable salt thereof. Topical formulations are described in detail in U.S. Patent No. 6,747,014, which is incorporated herein by reference.
Liposomal formulations
There are many organized surfactant structures besides microemulsions that have been studied and used for the formulation of drugs. These include monolayers, micelles, bilayers and vesicles. Vesicles, such as liposomes, have attracted great interest because of their specificity and the duration of action they offer from the standpoint of drug delivery. As used in the present invention, the term "liposome" means a vesicle composed of amphophilic lipids arranged in a spherical bilayer or bilayers.
Liposomes are unilamellar or multilamellar vesicles which have a membrane formed from a lipophilic material and an aqueous interior. The aqueous portion contains the composition to be delivered. Cationic liposomes possess the advantage of being able to fuse to the cell wall. Non-cationic liposomes, although not able to fuse as efficiently with the cell wall, are taken up by macrophages in vivo.
In order to traverse intact mammalian skin, lipid vesicles must pass through a series of fine pores, each with a diameter less than 50 nm, under the influence of a suitable transdermal gradient. Therefore, it is desirable to use a liposome which is highly deformable and able to pass through such fine pores.
Further advantages of liposomes include; liposomes obtained from natural phospholipids are biocompatible and biodegradable; liposomes can incorporate a wide range of water and lipid soluble drugs; liposomes can protect encapsulated drugs in their internal compartments from metabolism and degradation (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245). Important considerations in the preparation of liposome formulations are the lipid surface charge, vesicle size and the aqueous volume of the liposomes. Liposomes are useful for the transfer and delivery of active ingredients to the site of action. Because the liposomal membrane is structurally similar to biological membranes, when liposomes are applied to a tissue, the liposomes start to merge with the cellular membranes and as the merging of the liposome and cell progresses, the liposomal contents are emptied into the cell where the active agent may act.
Liposomal formulations have been the focus of extensive investigation as the mode of delivery for many drugs. There is growing evidence that for topical administration, liposomes present several advantages over other formulations. Such advantages include reduced side- effects related to high systemic absorption of the administered drug, increased accumulation of the administered drug at the desired target, and the ability to administer a wide variety of drugs, both hydrophilic and hydrophobic, into the skin.
Several reports have detailed the ability of liposomes to deliver agents including high- molecular weight DNA into the skin. Compounds including analgesics, antibodies, hormones and high-molecular weight DNAs have been administered to the skin. The majority of applications resulted in the targeting of the upper epidermis.
Liposomes fall into two broad classes. Cationic liposomes are positively charged liposomes which interact with the negatively charged DNA molecules to form a stable complex. The positively charged DNA/liposome complex binds to the negatively charged cell surface and is internalized in an endosome. Due to the acidic pH within the endosome, the liposomes are ruptured, releasing their contents into the cell cytoplasm (Wang et ah, Biochem. Biophys. Res. Commun., 1987, 147, 980-985).
Liposomes which are pH-sensitive or negatively-charged, entrap DNA rather than complex with it. Since both the DNA and the lipid are similarly charged, repulsion rather than complex formation occurs. Nevertheless, some DNA is entrapped within the aqueous interior of these liposomes. pH-sensitive liposomes have been used to deliver DNA encoding the thymidine kinase gene to cell monolayers in culture. Expression of the exogenous gene was detected in the target cells (Zhou et al, Journal of Controlled Release, 1992, 19, 269-274).
One major type of liposomal composition includes phospholipids other than naturally- derived phosphatidylcholine. Neutral liposome compositions, for example, can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC). Anionic liposome compositions generally are formed from dimyristoyl phosphatidylglycerol, while anionic fusogenic liposomes are formed primarily from dioleoyl phosphatidylethanol amine (DOPE). Another type of liposomal composition is formed from phosphatidylcholine (PC) such as, for example, soybean PC, and egg PC. Another type is formed from mixtures of phospholipid and/or phosphatidylcholine and/or cholesterol.
Several studies have assessed the topical delivery of liposomal drug formulations to the skin. Application of liposomes containing interferon to guinea pig skin resulted in a reduction of skin herpes sores while delivery of interferon via other means (e.g., as a solution or as an emulsion) were ineffective (Weiner et al., Journal of Drug Targeting, 1992, 2, 405-410).
Further, an additional study tested the efficacy of interferon administered as part of a liposomal formulation to the administration of interferon using an aqueous system, and concluded that the liposomal formulation was superior to aqueous administration (du Plessis et al, Antiviral Research, 1992, 18, 259-265).
Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drugs to the skin, in particular systems comprising non-ionic surfactant and cholesterol. Non-ionic liposomal formulations comprising Novasome™ I (glyceryl
dilaurate/cholesterol/polyoxyethylene-10-stearyi ether) and Novasome™ II (glyceryl distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver cyclosporin- A into the dermis of mouse skin. Results indicated that such non-ionic liposomal systems were effective in facilitating the deposition of cyclosporin-A into different layers of the skin (Hu et al.
S.T.P.Pharma. Sci., 1994, 4, 6, 466).
Liposomes also include "sterically stabilized'" liposomes, a term which, as used herein, refers to liposomes comprising one or more specialized lipids that, when incorporated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are those in which part of the vesicle -forming lipid portion of the liposome (A) comprises one or more glycoiipids, such as
monosialoganglioside GMI, or (B) is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. While not wishing to be bound by any particular theory, it is thought in the art that, at least for sterically stabilized liposomes containing gangliosides, sphingomyelin, or PEG-derivatized lipids, the enhanced circulation half-life of these sterically stabilized liposomes derives from a reduced uptake into cells of the reticuloendothelial system (RES) (Allen et al, FEBS Letters, 1987, 223, 42; Wu et al. Cancer Research, 1993, 53, 3765). Various liposomes comprising one or more glycolipids are known in the art. Papahadjopoulos et al. (Ann. N.Y. Acad. Sci., 1987, 507, 64) reported the ability of
monosialoganglioside GMI, galactocerebroside sulfate and phosphatidylinositol to improve blood half-lives of liposomes. These findings were expounded upon by Gabizon et al. (Proc. Natl. Acad. Sci, U.S.A., 1988, 85. 6949). U.S. Pat. No. 4,837,028 and WO 88/04924, both to Allen et al., disclose liposomes comprising (1) sphingomyelin and (2) the ganglioside GMI or a galactocerebroside sulfate ester. U.S. Pat. No. 5,543,152 (Webb et al.) discloses liposomes comprising sphingomyelin. Liposomes comprising 1 ,2-sn-dimyristoylphosphatidylcholine are disclosed in WO 97/13499 (Lim et al).
Many liposomes comprising lipids derivatized with one or more hydrophilic polymers, and methods of preparation thereof, are known in the art. Sunamoto et al. (Bull. Chem, Soc. Jpn., 1980, 53, 2778) described liposomes comprising a nonionic detergent, 2CI215G, that contains a PEG moiety. Ilium et al. (FEBS Lett., 1984, 167, 79) noted that hydrophilic coating of polystyrene particles with polymeric glycols results in significantly enhanced blood half-lives. Synthetic phospholipids modified by the attachment of carboxyiic groups of polyaikyiene glycols (e.g., PEG) are described by Sears (U.S. Pat. Nos. 4,426,330 and 4,534,899). Klibanov et al. (FEBS Lett., 1990, 268, 235) described experiments demonstrating that liposomes comprising phosphatidylethanolamine (PE) derivatized with PEG or PEG stearate have significant increases in blood circulation half-lives. Blume et al. (Biochimica et Biophysica Acta, 1990, 1029, 91 ) extended such observations to other PEG-derivatized phospholipids, e.g., DSPE-PEG, formed from the combination of distearoylphosphatidylethanolamine (DSPE) and PEG. Liposomes having covalently bound PEG moieties on their external surface are described in European Patent No. EP 0 445 131 Bl and WO 90/04384 to Fisher. Liposome compositions containing 1- 20 mole percent of PE derivatized with PEG, and methods of use thereof, are described by Woodle et al. (U.S. Pat. Nos. 5,013,556 and 5,356,633) and Martin et al. (U.S. Pat. No.
5,213,804 and European Patent No. EP 0 496 813 Bl ). Liposomes comprising a number of other lipid-polymer conjugates are disclosed in WO 91/05545 and U.S. Pat. No. 5,225,212 (both to Martin et al.) and in WO 94/20073 (Zalipsky et al.) Liposomes comprising PEG-modified ceramide lipids are described in WO 96/10391 (Choi et al). U.S. Pat. No. 5,540,935 (Miyazaki et al.) and U.S. Pat. No. 5,556,948 (Tagawa et al.) describe PEG-containing liposomes that can be further derivatized with functional moieties on their surfaces. A number of liposomes comprising nucleic acids are known in the art. WO 96/40062 to Thierry et al. discloses methods for encapsulating high molecular weight nucleic acids in liposomes. U.S. Pat. No. 5,264,221 to Tagawa et al. discloses protein-bonded liposomes and asserts that the contents of such liposomes may include a dsRNA. U.S. Pat. No. 5,665,710 to Rahman et al. describes certain methods of encapsulating oligodeoxynucleotides in liposomes. WO 97/04787 to Love et al. discloses liposomes comprising dsRNAs targeted to the raf gene.
Transfersomes are yet another type of liposomes, and are highly deformable lipid aggregates which are attractive candidates for drug delivery vehicles. Transfersomes may be described as lipid droplets which are so highly deformable that they are easily able to penetrate through pores which are smaller than the droplet. Transfersomes are adaptable to the
environment in which they are used, e.g., they are self-optimizing (adaptive to the shape of pores in the skin), self-repairing, frequently reach their targets without fragmenting, and often self- loading. To make transfersomes it is possible to add surface edge -activators, usually surfactants, to a standard liposomal composition. Transfersomes have been used to deliver serum albumin to the skin. The transfersome-mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of a solution containing serum albumin.
Surfactants find wide application in formulations such as emulsions (including microemulsions) and liposomes. The most common way of classifying and ranking the properties of the many different types of surfactants, both natural and synthetic, is by the use of the hydrophile/lipophile balance (HLB). The nature of the hydrophilic group (also known as the "head") provides the most useful means for categorizing the different surfactants used in formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).
If the surfactant molecule is not ionized, it is classified as a nonionic surfactant. Nonionic surfactants find wide application in pharmaceutical and cosmetic products and are usable over a wide range of pH values. In general their HLB values range from 2 to about 18 depending on their structure. Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated/propoxylated block polymers are also included in this class. The polyoxyethylene surfactants are the most popular members of the nonionic surfactant class.
If the surfactant molecule carries a negative charge when it is dissolved or dispersed in water, the surfactant is classified as anionic. Anionic surfactants include carboxylates such as soaps, acyl lactylates, acyl amides of amino acids, esters of sulfuric acid such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates, acyl taurates and sulfosuccinates, and phosphates. The most important members of the anionic surfactant class are the alkyl sulfates and the soaps.
If the surfactant molecule carries a positive charge when it is dissolved or dispersed in water, the surfactant is classified as cationic. Cationic surfactants include quaternary ammonium salts and ethoxylated amines. The quaternary ammonium salts are the most used members of this class.
If the surfactant molecule has the ability to carry either a positive or negative charge, the surfactant is classified as amphoteric. Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N-alkylbetaines and phosphatides.
The use of surfactants in drug products, formulations and in emulsions has been reviewed (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).
Nucleic acid lipid particles
hi one embodiment, an ALAS 1 dsRNA featured in the invention is fully encapsulated in the lipid formulation, e.g., to form a SPLP, pSPLP, SNALP, or other nucleic acid-lipid particle. As used herein, the term "SNALP" refers to a stable nucleic acid-lipid particle, including SPLP. As used herein, the term "SPLP" refers to a nucleic acid-lipid particle comprising plasmid DNA encapsulated within a lipid vesicle. SNALPs and SPLPs typically contain a cationic lipid, a non- cationic lipid, and a lipid that prevents aggregation of the particle (e.g., a PEG-lipid conjugate). SNALPs and SPLPs are extremely useful for systemic applications, as they exhibit extended circulation lifetimes following intravenous (i.v.) injection and accumulate at distal sites (e.g., sites physically separated from the administration site). SPLPs include "pSPLP," which include an encapsulated condensing agent-nucleic acid complex as set forth in PCT Publication No. WO 00/03683. The particles of the present invention typically have a mean diameter of about 50 nm to about 150 nm, more typically about 60 nm to about 130 nm, more typically about 70 nm to about 110 nm, most typically about 70 nm to about 90 nm, and are substantially nontoxic. In addition, the nucleic acids when present in the nucleic acid- lipid particles of the present invention are resistant in aqueous solution to degradation with a nuclease. Nucleic acid- lipid particles and their method of preparation are disclosed in, e.g., U.S. Patent Nos. 5,976,567; 5,981 ,501 ; 6,534,484; 6,586,410; 6,815,432; and PCT Publication No. WO 96/40964.
hi one embodiment, the lipid to drug ratio (mass/mass ratio) (e.g., lipid to dsRNA ratio) will be in the range of from about 1: 1 to about 50: 1 , from about 1 : 1 to about 25: 1, from about 3: 1 to about 15: 1, from about 4: 1 to about 10: 1 , from about 5: 1 to about 9: 1 , or about 6: 1 to about 9: 1.
The cationic lipid may be, for example, N,N-dioleyl-N,N-dimethylammonium chloride
(DODAC), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(I -(2,3- dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP), N-(I -(2,3- dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), N,N-dimethyl-2,3- dioleyloxy)propylamine (DODMA), 1 ,2-DiLinoleyloxy-N,N-dimethylaminopropane
(DLinDMA), l,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA), 1 ,2-
Dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP), 1 ,2-Dilinoleyoxy-3- (dimethylamino)acetoxypropane (DLin-DAC), 1 ,2-Dilmoleyoxy-3-morpholinopropane (DLin- MA), l,2-Dilinoleoyl-3-dimethylaminopropane (DLinDAP), l,2-Dilinoieylthio-3- dimethylaminopropane (DLin-S-DMA), l-Linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP), l ,2-Dilinoleyloxy-3-trimethylaminopropane chloride salt (DLin-TMA.Cl), l,2-Dilinoleoyl-3-trimethylaminopropane chloride salt (DLin-TAP.Cl), l,2-Dilinoleyloxy-3-(N- methylpiperazino)propane (DLin-MPZ), or 3-(N,N-Dilmoleylammo)- l,2-propanediol (DLinAP), 3-(N,N-Dioieylamino)-l,2-propanedio (DOAP), l,2-Dilinoleyloxo-3-(2-N,N- dimethylamino)ethoxypropane (DLin-EG-DMA), l,2-Dilinolenyloxy-N,N- dimethylaminopropane (DLinDMA), 2,2-Diiinoleyl-4-dimethylaminomethyl-[ 1 ,3]-dioxoiane (DLin-K-DMA) or analogs thereof, (3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9, 12- dienyl)tetrahydro-3aH-cyclopenta[d][l ,3]dioxol-5-amine (ALN100), (6Z,9Z,28Z,31Z)- heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate (MC3), 1 ,T-(2-(4-(2-((2- (bis(2 iydroxydodecyl)amiiio)ethyl)(2-hydroxydodecyl)amino)etliyl)piperazin-l- yl)efhylazanediyl)didodecan-2-ol (Tech Gl ), or a mixture thereof. The cationic lipid may comprise from about 20 mol % to about 50 mol % or about 40 mol % of the total lipid present in the particle.
In another embodiment, the compound 2,2-Dilinoleyl-4-dimethylaminoethyl-f 1 ,3]- dioxolane can be used to prepare lipid-siRNA nanoparticles. Synthesis of 2,2-Dilinoleyl-4- dimethylaminoethyl-[l,3]-dioxolane is described in United States provisional patent application number 61/107,998 filed on October 23, 2008, which is herein incorporated by reference.
In one embodiment, the lipid-siRNA particle includes 40% 2, 2-Dilinoleyl-4- dimethylaminoethyl-[l ,3]-dioxolane: 10% DSPC: 40% Cholesterol: 10% PEG-C-DOMG (mole percent) with a particle size of 63.0 ± 20 nm and a 0.027 siRNA Lipid Ratio.
The non-cationic lipid may be an anionic lipid or a neutral lipid including, but not limited to, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC),
dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG),
dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), dioleovl- phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-l- carboxylate (DOPE- mal), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine
(DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1 -trans PE, 1 -stearoyl-2-oleoyi- phosphatidyethanolamine (SOPE), cholesterol, or a mixture thereof. The non-cationic lipid may be from about 5 mol % to about 90 mol %, about 10 mol %, or about 58 mol % if cholesterol is included, of the total lipid present in the particle.
The conjugated lipid that inhibits aggregation of particles may be, for example, a polyethyleneglycol (PEG)-lipid including, without limitation, a PEG-diacylglycerol (DAG), a PEG-dialkyloxypropyl (DAA), a PEG-phospholipid, a PEG-ceramide (Cer), or a mixture thereof. The PEG-DAA conjugate may be, for example, a PEG-dilauryloxypropyl (Ci?), a PEG- dimyiistyloxypropyl (Ci4), a PEG-dipalmityloxypropyl (Ci<,), or a PEG- distearyloxypropyl
(C]s). The conjugated lipid that prevents aggregation of particles may be from 0 mol % to about 20 mol % or about 2 mol % of the total lipid present in the particle.
In some embodiments, the nucleic acid-lipid particle further includes cholesterol at, e.g., about 10 mol % to about 60 mol % or about 48 mol % of the total lipid present in the particle.
In some embodiments, the iRNA is formulated in a lipid nanoparticle (LNP). LNP01
In one embodiment, the lipidoid ND98-4HC1 (MW 1487) (see U.S. Patent Application No. 12/056,230, filed 3/26/2008, which is herein incorporated by reference), Cholesterol (Sigma- Aldrich), and PEG-Ceramide C 16 (Avanti Polar Lipids) can be used to prepare lipid-dsRNA nanoparticles (e.g., LNP01 particles). Stock solutions of each in ethanol can be prepared as follows: ND98, 133 mg/ml; Cholesterol, 25 mg/ml, PEG-Ceramide C16, 100 mg/ml. The ND98, Cholesterol, and PEG-Ceramide C16 stock solutions can then be combined in a, e.g., 42:48: 10 molar ratio. The combined lipid solution can be mixed with aqueous dsRNA (e.g., in sodium acetate pH 5) such that the final ethanol concentration is about 35-45% and the final sodium acetate concentration is about 100-300 mM. Lipid-dsRNA nanoparticles typically form spontaneously upon mixing. Depending on the desired particle size distribution, the resultant nanoparticle mixture can be extruded through a polycarbonate membrane (e.g., 100 nm cut-off) using, for example, a thermobarrel extruder, such as Lipex Extruder (Northern Lipids, Inc). in some cases, the extrusion step can be omitted. Ethanol removal and simultaneous buffer exchange can be accomplished by, for example, dialysis or tangential flow filtration. Buffer can be exchanged with, for example, phosphate buffered saline (PBS) at about pH 7, e.g., about pH 6.9, about pH 7.0, about pH 7.1, about pH 7.2, about pH 7.3, or about pH 7.4.
Figure imgf000140_0001
Formula 1
LNPOl formulations are described, e.g., in International Application Publication
No. WO 2008/042973, which is hereby incorporated by reference.
Additional exemplary lipid-dsRNA formulations are provided in the following table. Table 3: Exemplary lipid formulations
Figure imgf000141_0001
MC3/DSPC/Chol/PEG-DSG/GalNAc-
PEG-DSG
L P 15 MC3
50/ 10/35/4.5/0.5
Lipid:siRNA: 1 1 :1
MC3/DSPC/Chol/PEG-DMG
LNP16 MC3 50/ 10/38.5/1.5
Lipid:siRNA: 7: 1
MC3/DSPC/Chol/PEG-DSG
LNP17 MC3 50/ 10/38.5/1.5
Lipid:siR A: 10: 1
MC3/DSPC/Chol/PEG-DMG
LNP18 MC3 50/10/38.5/1.5
Lipid:si NA: 12: 1
MC3/DSPC/Chol/PEG-DMG
LNP19 MC3 50/10/35/5
Lipid:si NA: 8: 1
MC3/DSPC/Chol/PEG-DPG
LNP20 MC3 50/10/38.5/1.5
Lipid:siR A: 10: 1
C 12-200/DSPC/Chol PEG-DSG
L P21 C 12-200 50/10/38.5/1.5
Lipid:siRNA: 7:1
XTC/DSPC/Chol/PEG-DSG
L P22 XTC 50/10/38.5/1.5
Lipid:siRNA: 10: 1
DSPC: distearoylphosphatidylcholine
DPPC: dipaimitoylphosphatidylcholine
PEG-DMG PEG-didimyristoyi glycerol (C14-PEG, or PEG-C14) (PEG with avg mol wt of 2000)
PEG-DSG: PEG-distyryl glycerol (C 18-PEG, or PEG-C 18) (PEG with avg mol wt of 2000) PEG-cDMA: PEG-carbamoyl-l,2-dimyristyloxypropylamine (PEG with avg mol wt of 2000)
SNALP (l,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLinDMA)) comprising formulations are described in International Application Publication No. WO2009/127060, filed April 15, 2009, which is hereby incorporated by reference.
XTC comprising formulations are described, e.g., in U.S. Provisional Serial No.
61/148,366, filed January 29, 2009; U.S. Provisional Serial No. 61/156,851 , filed March 2, 2009; U.S. Provisional Serial No. filed June 10, 2009; U.S. Provisional Serial No. 61/228,373, filed July 24, 2009; U.S. Provisional Serial No. 61/239,686, filed September 3, 2009, and International Application Publication No. WO 2010/088537 (International Application No. PCT US2010/022614, filed January 29, 2010), which are hereby incoiporated by reference.
MC3 comprising formulations are described, e.g., in U.S. Provisional Serial No.
61/244,834, filed September 22, 2009, U.S. Provisional Serial No. 61/185,800, filed June 10, 2009, and International Application Publication No. WO 2010/111212 (International
Application No. PCT/US 10/28224, filed June 10, 2010), which are hereby incorporated by reference.
ALNY-100 comprising formulations are described, e.g., International Application Publication No. WO 2010/054406 (International Application No. PCT/US09/63933, filed on November 10, 2009), which is hereby incorporated by reference.
CI 2-200 comprising formulations are described in U.S. Provisional Serial No.
61/175.770. filed May 5, 2009 and International Application Publication No. WO 2010/129709 (International Application No. PCT/US 10/33777, filed May 5, 2010), which are hereby incorporated by reference.
Synthesis of cationic lipids
Any of the compounds, e.g., cationic lipids and the like, used in the nucleic acid-lipid particles featured in the invention may be prepared by known organic synthesis techniques, including the methods described in more detail in the Examples. All substituents are as defined below unless indicated otherwise.
"Alkyl" means a straight chain or branched, noncyclic or cyclic, saturated aliphatic hydrocarbon containing from 1 to 24 carbon atoms. Representative saturated straight chain alkyls include methyl, ethyl, n-propyi, n-butyl, n-pentyl, n-hexyl, and the like; while saturated branched alkyls include isopropyl, sec-butyl, isobutyl, tert-butyl, isopentyl, and the like.
Representative saturated cyclic alkyls include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and the like; while unsaturated cyclic alkyls include cyclopentenyl and cyclohexenyl, and the like.
"Alkenyl" means an alkyl, as defined above, containing at least one double bond between adjacent carbon atoms. Alkenyls include both cis and trans isomers. Representative straight chain and branched alkenyls include ethylenyl, propylenyl, l-butenyl, 2-butenyl, isobutylenyl, 1- pentenyl, 2-pentenyl, 3-methyl-l -butenyL 2-methyl-2-butenyl, 2,3-dimethyl-2-butenyl, and the like.
"Alkynyl" means any alkyl or alkenyl, as defined above, which additionally contains at least one triple bond between adjacent carbons. Representative straight chain and branched alkynyls include acetylenyl, propynyl, 1 -butynyl, 2-butynyl, 1-pentynyl, 2-pentynyl, 3-methyl-l butynyl, and the like.
"Acyl" means any alkyl, alkenyl, or alkynyl wherein the carbon at the point of attachment is substituted with an oxo group, as defined below. For example, -C(=0)alkyl, -C(=0)alkenyL and -C(=0)alkynyl are acyl groups.
"Heterocycle" means a 5- to 7-membered monocyclic, or 7- to 10-membered bicyclic, heterocyclic ring which is either saturated, unsaturated, or aromatic, and which contains from 1 or 2 heteroatoms independently selected from nitrogen, oxygen and sulfur, and wherein the nitrogen and sulfur heteroatoms may be optionally oxidized, and the nitrogen heteroatom may be optionally quaternized, including bicyclic rings in which any of the above heterocycles are fused to a benzene ring. The heterocycle may be attached via any heteroatom or carbon atom.
Heterocycles include heteroaryls as defined below. Heterocycles include morpholinyl, pyrrolidinonyl, pyrrolidinyl, piperidinyl, piperizynyl, hydantoinyl, valerolactamyl, oxiranyl, oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, tetrahydropyiidinyl, tetrahydroprimidinyl, tetrahydrothiophenyl, tetrahydrothiopyranyl, tetrahydropyrimidinyl, tetrahydrofhiophenyl, tetrahydrothiopyranyl, and the like.
The terms "optionally substituted alkyl", "optionally substituted alkenyl", "optionally substituted alkynyl", "optionally substituted acyl", and "optionally substituted heterocycle" means that, when substituted, at least one hydrogen atom is replaced with a substituent. In the case of an oxo substituent (=0) two hydrogen atoms are replaced. In this regard, substituents include oxo, halogen, heterocycle, -CN, -ORx, -NRxRy, -NRxC(=0)Ry -NRxS02Ry, -C(=0)R\ -C(=0)OR\ -C(=0)NRxRy, -SOnRx and -SOnNRxRy, wherein n is 0, 1 or 2, Rx and Ry are the same or different and independently hydrogen, alkyl or heterocycle, and each of said alkyl and heterocycle substituents may be further substituted with one or more of oxo, halogen, -OH, -CN, alkyl, -ORx, heterocycle, -NRxRy, -NRxC(=0)Ry -NRxS02Ry, -C(=0)Rx, -C(=0)ORx,
-C(=0)NRxRy. -SOnRx and -SO„NRxRy.
"Halogen" means fluoro, chloro, bromo and iodo. In some embodiments, the methods featured in the invention may require the use of protecting groups. Protecting group methodology is well known to those skilled in the art (see, or example, PROTECTIVE GROUPS tN ORGANIC SYNTHESIS, Green, T.W. et al, Wiley- Interscience, New York City, 1999). Briefly, protecting groups within the context of this invention are any group that reduces or eliminates unwanted reactivity of a functional group. A protecting group can be added to a functional group to mask its reactivity during certain reactions and then removed to reveal the original functional group. In some embodiments an "alcohol protecting group" is used. An "alcohol protecting group" is any group which decreases or eliminates unwanted reactivity of an alcohol functional group. Protecting groups can be added and removed using techniques well known in the art.
Synthesis of Formula A
In one embodiments, nucleic acid-lipid particles featured in the invention are formulated using a cationic lipid of formula A:
Figure imgf000145_0001
where Rl and R2 are independently alkyl, alkenyl or alkynyl, each can be optionally substituted, and R3 and R4 are independently lower alkyl or R3 and R4 can be taken together to form an optionally substituted heterocyclic ring. In some embodiments, the cationic lipid is XTC (2,2- Dilinoleyl-4-dimethylaminoethyl-[l ,3]-dioxolane). In general the lipid of formula A above may be made by the following Reaction Schemes 1 or 2, wherein all substituents are as defined above unless indicated otherwise. Scheme 1
Figure imgf000146_0001
Lipid A, where Ri and R2 are independently alkyl, alkenyl or alkynyl, each can be optionally substituted, and R3 and R4 are independently lower alkyl or R3 and R4 can be taken together to form an optionally substituted heterocyclic ring, can be prepared according to Scheme 1. Ketone 1 and bromide 2 can be purchased or prepared according to methods known to those of ordinary skill in the art. Reaction of 1 and 2 yields ketai 3. Treatment of ketal 3 with amine 4 yields lipids of formula A. The lipids of formula A can be converted to the
corresponding ammonium salt with an organic salt of formula 5, where X is anion counter ion selected from halogen, hydroxide, phosphate, sulfate, or the like.
Scheme 2
BrMg— R1 + R2-CN ^L. 0=<R2
Figure imgf000146_0002
Alternatively, the ketone 1 starting material can be prepared according to Scheme 2. Grignard reagent 6 and cyanide 7 can be purchased or prepared according to methods known to those of ordinary skill in the ait. Reaction of 6 and 7 yields ketone 1. Conversion of ketone 1 to the corresponding lipids of formula A is as described in Scheme 1.
Synthesis of MC3
Preparation of DLin-M-C3-DMA (i.e., (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31- tetraen-19-yl 4-(dimethylamino)butanoate) was as follows. A solution of (6Z,9Z,28Z,31Z)- heptatriaconta-6,9,28,31 -tetraen- 19-ol (0.53 g), 4-N,N-dimethylaminobutyric acid hydrochloride (0.51 g), 4-N,N-dimethylaminopyridine (0.61 g) and l-ethyl-3-(3- dimethylaminopropyl)carbodiimide hydrochloride (0.53 g) in dichloromethane (5 mL) was stirred at room temperature overnight. The solution was washed with dilute hydrochloric acid followed by dilute aqueous sodium bicarbonate. The organic fractions were dried over anhydrous magnesium sulphate, filtered and the solvent removed on a rotovap. The residue was passed down a silica gel column (20 g) using a 1-5% methanoi/dichloromethane elution gradient.
Fractions containing the purified product were combined and the solvent removed, yielding a colorless oil (0.54 g).
Synthesis of ALNY-100
Synthesis of ketal 519 [ALNY-100] was performed using the following scheme 3:
Figure imgf000147_0001
519 518
Synthesis of 515: To a stirred suspension of L1A1H4 (3.74 g, 0.09852 mol) in 200 ml anhydrous THF in a two neck RBF (1L), was added a solution of 514 (lOg, 0.04926mol) in 70 mL of THF slowly at 0 OC under nitrogen atmosphere. After complete addition, reaction mixture was warmed to room temperature and then heated to reflux for 4 h. Progress of the reaction was monitored by TLC. After completion of reaction (by TLC) the mixture was cooled to 0 0C and quenched with careful addition of saturated Na2S04 solution. Reaction mixture was stirred for 4 h at room temperature and filtered off. Residue was washed well with THF. The filtrate and washings were mixed and diluted with 400 mL dioxane and 26 mL cone. HCl and stirred for 20 minutes at room temperature. The volatilities were stripped off under vacuum to furnish the hydrochloride salt of 515 as a white solid. Yield: 7.12 g 1 H-NMR (DMSO, 400MHz): δ= 9.34 (broad, 2H), 5.68 (s, 2H), 3.74 (m, 1H), 2.66-2.60 (m, 2H), 2.50-2.45 (m, 5H).
Synthesis of 516:
To a stirred solution of compound 515 in 100 mL dry DCM in a 250 mL two neck RBF, was added NEt3 (37.2 mL, 0.2669 mol) and cooled to 0 OC under nitrogen atmosphere. After a slow addition of N-(benzyioxy-carbonyloxy)-succinimide (20 g, 0.08007 mol) in 50 mL dry DCM, reaction mixture was allowed to warm to room temperature. After completion of the reaction (2-3 h by TLC) mixture was washed successively with IN HCl solution (1 x 100 mL) and saturated NaHC03 solution (1 x 50 mL). The organic layer was then dried over anhyd. Na2S04 and the solvent was evaporated to give crude material which was purified by silica gel column chromatography to get 516 as sticky mass. Yield: l lg (89%). 1 H-NMR (CDC13, 400MHz): δ = 7.36-7.27(m, 5H), 5.69 (s, 2H), 5.12 (s, 2H), 4.96 (br., 1 H) 2.74 (s, 3H), 2.60(m, 2H), 2.30-2.25(m, 2H). LC-MS [M+H] -232.3 (96.94%). Synthesis of 517 A and 517B:
The cyclopentene 516 (5 g, 0.02164 mol) was dissolved in a solution of 220 mL acetone and water (10: 1 ) in a single neck 500 mL RBF and to it was added N- methyl morpholine-N- oxide (7.6 g, 0.06492 mol) followed by 4.2 mL of 7.6% solution of Os04 (0.275 g, 0.00108 mol) in tert-butanol at room temperature. After completion of the reaction (~ 3 h), the mixture was quenched with addition of solid Na2S03 and resulting mixture was stirred for 1.5 h at room temperature. Reaction mixture was diluted with DCM (300 mL) and washed with water (2 x 100 niL) followed by saturated NaHC03 (1 x 50 mL) solution, water (1 x 30 mL) and finally with brine (Ix 50 mL). Organic phase was dried over an.Na2S04 and solvent was removed in vacuum. Silica gel column chromatographic purification of the crude material was afforded a mixture of diastereomers, which were separated by prep HPLC. Yield: - 6 g crude
517A - Peak-1 (white solid), 5.13 g (96%). 1H-NMR (DMSO, 4()0MHz): δ= 7.39-
7.31(m, 5H), 5.04(s, 2H), 4.78-4.73 (m, 1H), 4.48-4.47(d, 2H), 3.94-3.93(m, 2H), 2.7 l(s, 3H), 1.72- 1.67(m, 4H). LC-MS - [M+Hj-266.3, [M+NH4 +J-283.5 present, HPLC-97.86%.
Stereochemistry confirmed by X-ray. Synthesis of 518:
Using a procedure analogous to that described for the synthesis of compound 505, compound 518 (1.2 g. 41 %) was obtained as a colorless oil. 1H-NMR (CDC13, 400MHz): δ= 7.35-7.33(m, 4H), 7.30-7.27(m, 1H), 5.37-5.27(m, 8H), 5.12(s, 2H), 4.75(m,lH), 4.58- 4.57(m,2H), 2.78-2.74(m,7H), 2.06-2.00(m,8H), 1.96-1.91(m, 2H), 1.62(m, 4H), 1.48(m, 2H), 1.37-1.25(br m, 36H), 0.87(m, 6H). HPLC-98.65%.
General Procedure for the Synthesis of Compound 519:
A solution of compound 518 (1 eq) in hexane (15 mL) was added in a drop- wise fashion to an ice-cold solution of LAH in THF (1 M, 2 eq). After complete addition, the mixture was heated at 40°C over 0.5 h then cooled again on an ice bath. The mixture was carefully hydrolyzed with saturated aqueous Na2S04 then filtered through celite and reduced to an oil. Column chromatogi'aphy provided the pure 519 ( 1.3 g, 68%) which was obtained as a colorless oil. 13C NMR = 130.2, 130.1 (x2), 127.9 (x3), 112.3, 79.3, 64.4, 44.7, 38.3, 35.4, 31.5, 29.9 (x2), 29.7, 29.6 (x2), 29.5 (x3), 29.3 (x2), 27.2 (x3), 25.6, 24.5, 23.3, 226, 14.1 ; Electrospray MS (+ve): Molecular weight for C44H80NO2 (M + H)+ Calc. 654.6, Found 654.6.
Formulations prepared by either the standard or extrusion-free method can be characterized in similar manners. For example, formulations are typically characterized by visual inspection. They should be whitish translucent solutions free from aggregates or sediment. Paiticle size and paiticle size distribution of lipid-nanoparticles can be measured by light scattering using, for example, a Malvern Zetasizer Nano ZS (Malvern, USA). Particles should be about 20-300 nm, such as 40-100 nm in size. The paiticle size distribution should be unimodal. The total dsRNA concentration in the formulation, as well as the entrapped fraction, is estimated using a dye exclusion assay. A sample of the formulated dsRNA can be incubated with an RNA-binding dye, such as Ribogreen (Molecular Probes) in the presence or absence of a formulation disrupting surfactant, e.g., 0.5% Triton-XlOO. The total dsRNA in the formulation can be determined by the signal from the sample containing the surfactant, relative to a standard curve. The entrapped fraction is determined by subtracting the "free" dsRNA content (as measured by the signal in the absence of surfactant) from the total dsRNA content. Percent entrapped dsRNA is typically >85%. For SNALP formulation, the particle size is at least 30 nm, at least 40 nm, at least 50 nm, at least 60 nm, at least 70 nm, at least 80 nm, at least 90 nm, at least 100 nm, at least 1 10 nm, and at least 120 nm. The suitable range is typically about at least 50 nm to about at least 10 nm, about at least 60 nm to about at least 100 nm, or about at least 80 nm to about at least 90 nm.
Compositions and formulations for oral administration include powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable. In some embodiments, oral
formulations are those in which dsRNAs featured in the invention are administered in
conjunction with one or more penetration enhancers surfactants and chelators. Suitable surfactants include fatty acids and/or esters or salts thereof, bile acids and/or salts thereof.
Suitable bile acids/salts include chenodeoxycholic acid (CDC A) and
ursodeoxychenodeoxycholic acid (UDCA), cholic acid, dehydrocholic acid, deoxycholic acid, glucholic acid, glycholic acid, glycodeoxycholic acid, taurocholic acid, taurodeoxycholic acid, sodium tauro-24,25-dihydro-fusidate and sodium glycodihydrofusidate. Suitable fatty acids include arachidonic acid, undecanoic acid, oleic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1 -monocaprate, l-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or a monoglyceride, a diglyceride or a pharmaceutically acceptable salt thereof (e.g., sodium), hi some embodiments, combinations of penetration enhancers are used, for example, fatty acids/salts in combination with bile acids/salts. One exemplary combination is the sodium salt of lauric acid, capric acid and UDCA. Further penetration enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether. DsRNAs featured in the invention may be delivered orally, in granular form including sprayed dried particles, or complexed to form micro or nanoparticles. DsRNA complexing agents include poly- amino acids; polyimines; polyacrylates; polyalkylacrylates, polyoxethanes, polyalkylcyanoacrylates;
cationized gelatins, albumins, starches, acrylates, polyethyleneglycols (PEG) and starches;
polyalkylcyanoacrylates; DEAE-derivatized polyimines, pollulans, celluloses and starches.
Suitable complexing agents include chitosan, N-trimethylchitosan, poly-L-lysine, polyhistidine, polyornithine, polyspermines, protamine, polyvinylpyridine,
polythiodiethylaminomethylethylene P(TDAE), polyaminostyrene (e.g., p-amino),
poiy(methylcyanoacrylate), poly(ethylcyanoacrylate), poiy(butyicyanoacrylate),
poly(isobutylcyanoacrylate), poly(isohexylcynaoacrylate), DEAE-methacrylate, DEAE- hexylacrylate, DEAE-acrylamide, DEAE-albumin and DEAE-dextran, polymethylacrylate, polyhexylacrylate, poly(D,L-lactic acid), poly(DL-lactic-co-glycolic acid (PLGA), alginate, and polyethyleneglycol (PEG). Oral formulations for dsRNAs and their preparation are described in detail in U.S. Patent 6.887.906, US Application Publication No. 2003/0027780, and U.S. Patent No. 6,747,014, each of which is incorporated herein by reference.
Compositions and formulations for parenteral, intraparenchymal (into the brain), intrathecal, intraventricular or intrahepatic administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.
Pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions may be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids and self-emulsifying semisolids.
The pharmaceutical formulations featured in the present invention, which may
conveniently be presented in unit dosage form, may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product. The compositions featured in the present invention may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions may also be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions may further contain substances which increase the viscosity of the suspension including, for example, sodium
carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers.
Additional Formulations
Emulsions
The compositions of the present invention may be prepared and formulated as emulsions.
Emulsions are typically heterogeneous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 μιη in diameter (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC, 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Idson, in Pharmaceutical Dosage Forms,
Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., Volume 1, p. 245; Block in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 2, p. 335; Higuchi et al., in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 301). Emulsions are often biphasic systems comprising two immiscible liquid phases intimately mixed and dispersed with each other. In general, emulsions may be of either the water-in-oil (w/o) or the oil-in-water (o/w) variety. When an aqueous phase is finely divided into and dispersed as minute droplets into a bulk oily phase, the resulting composition is called a water-in-oil (w/o) emulsion. Alternatively, when an oily phase is finely divided into and dispersed as minute droplets into a bulk aqueous phase, the resulting composition is called an oil- in-water (o/w) emulsion. Emulsions may contain additional components in addition to the dispersed phases, and the active drug which may be present as a solution in either the aqueous phase, oily phase or itself as a separate phase. Pharmaceutical excipients such as emulsifiers, stabilizers, dyes, and anti-oxidants may also be present in emulsions as needed. Pharmaceutical emulsions may also be multiple emulsions that are comprised of more than two phases such as, for example, in the case of oil-in-water-in-oil (o/w/o) and water-in-oil-in-water (w/o/w) emulsions. Such complex formulations often provide certain advantages that simple binary emulsions do not. Multiple emulsions in which individual oil droplets of an o/w emulsion enclose small water droplets constitute a w/o/w emulsion. Likewise a system of oil droplets enclosed in globules of water stabilized in an oily continuous phase provides an o/w/o emulsion.
Emulsions are characterized by little or no thermodynamic stability. Often, the dispersed or discontinuous phase of the emulsion is well dispersed into the external or continuous phase and maintained in this form through the means of emulsifiers or the viscosity of the formulation. Either of the phases of the emulsion may be a semisolid or a solid, as is the case of emulsion- style ointment bases and creams. Other means of stabilizing emulsions entail the use of emulsifiers that may be incorporated into either phase of the emulsion. Emulsifiers may broadly be classified into four categories: synthetic surfactants, naturally occurring emulsifiers, absorption bases, and finely dispersed solids (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC, 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).
Synthetic surfactants, also known as surface active agents, have found wide applicability in the formulation of emulsions and have been reviewed in the literature (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC, 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Rieger, in
Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1 , p. 285; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), Marcel Dekker, Inc., New York, N.Y., 1988, volume 1 , p. 199).
Surfactants are typically amphiphilic and comprise a hydrophilic and a hydrophobic portion. The ratio of the hydrophilic to the hydrophobic nature of the surfactant has been termed the hydrophile/iipophile balance (HLB) and is a valuable tool in categorizing and selecting surfactants in the preparation of formulations. Surfactants may be classified into different classes based on the nature of the hydrophilic group: nonionic, anionic, cationic and amphoteric (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC, 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1 , p. 285). Naturally occurring emulsifiers used in emulsion formulations include lanolin, beeswax, phosphatides, lecithin and acacia. Absoiption bases possess hydrophilic properties such that they can soak up water to form w/o emulsions yet retain their semisolid consistencies, such as anhydrous lanolin and hydrophilic petrolatum. Finely divided solids have also been used as good emulsifiers especially in combination with surfactants and in viscous preparations. These include polar inorganic solids, such as heavy metal hydroxides, nonsweiiing clays such as bentonite, attapulgite, hectorite, kaolin, montmorilionite, colloidal aluminum silicate and colloidal magnesium aluminum silicate, pigments and nonpolar solids such as carbon or glyceryl tristearate.
A large variety of non-emulsifying materials are also included in emulsion formulations and contribute to the properties of emulsions. These include fats, oils, waxes, fatty acids, fatty alcohols, fatty esters, humectants, hydrophilic colloids, preservatives and antioxidants (Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).
Hydrophilic colloids or hydrocolloids include naturally occurring gums and synthetic polymers such as polysaccharides (for example, acacia, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth), cellulose derivatives (for example, carboxymethylceliulose and carboxypropylcellulose), and synthetic polymers (for example, carbomers, cellulose ethers, and carboxyvinyl polymers). These disperse or swell in water to form colloidal solutions that stabilize emulsions by forming strong interfacial films around the dispersed-phase droplets and by increasing the viscosity of the external phase.
Since emulsions often contain a number of ingredients such as carbohydrates, proteins, sterols and phosphatides that may readily support the growth of microbes, these formulations often incorporate preservatives. Commonly used preservatives included in emulsion formulations include methyl paraben, propyl paraben, quaternary ammonium salts, benzalkonium chloride, esters of p-hydroxybenzoic acid, and boric acid. Antioxidants are also commonly added to emulsion formulations to prevent deterioration of the formulation. Antioxidants used may be free radical scavengers such as tocopherols, alkyl gallates, butyl ated hydroxyanisoie, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulfite, and antioxidant synergists such as citric acid, tartaric acid, and lecithin. The application of emulsion formulations via dermatological, oral and parenteral routes and methods for their manufacture have been reviewed in the literature (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC, 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Idson, in
Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker,
Inc., New York, N.Y., volume 1, p. 199). Emulsion formulations for oral delivery have been very widely used because of ease of formulation, as well as efficacy from an absoiption and bioavailability standpoint (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC, 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). Mineral-oil base laxatives, oil-soluble vitamins and high fat nutritive preparations are among the materials that have commonly been administered orally as o/w emulsions.
In one embodiment of the present invention, the compositions of iRNAs and nucleic acids are formulated as microemulsions. A microemulsion may be defined as a system of water, oil and amphiphile which is a single optically isotropic and thermodynamicaily stable liquid solution (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC, 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245). Typically microemulsions are systems that are prepared by first dispersing an oil in an aqueous surfactant solution and then adding a sufficient amount of a fourth component, generally an intermediate chain-length alcohol to form a transparent system. Therefore, microemulsions have also been described as theraiodynamicaliy stable, isotropically clear dispersions of two immiscible liquids that are stabilized by interfacial films of surface- active molecules (Leung and Shall, in: Controlled Release of Drugs: Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH Publishers, New York, pages 185-215). Microemulsions commonly are prepared via a combination of three to five components that include oil, water, surfactant, cosurfactant and electrolyte. Whether the microemulsion is of the water-in-oil (w/o) or an oil-in-water (o/w) type is dependent on the properties of the oil and surfactant used and on the structure and geometric packing of the polar heads and hydrocarbon tails of the surfactant molecules (Schott, in Remington's Pharmaceutical Sciences, Mack
Publishing Co., Easton. Pa., 1985, p. 271 ).
The phenomenological approach utilizing phase diagrams has been extensively studied and has yielded a comprehensive knowledge, to one skilled in the art, of how to formulate microemulsions (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC, 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245; Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335). Compared to conventional emulsions, microemulsions offer the advantage of solubilizing water-insoluble drugs in a formulation of fhermodynamically stable droplets that are formed spontaneously.
Surfactants used in the preparation of microemulsions include, but are not limited to, ionic surfactants, non-ionic surfactants, Brij 96, polyoxyethyiene oleyl ethers, polyglycerol fatty acid esters, tetraglycerol monoiaurate (ML310), tetraglycerol monooleate (MO310),
hexaglycerol monooleate (PO310), hexaglycerol pentaoieate (PO500), decaglycerol monocaprate (MCA750), decaglycerol monooleate (MO750), decaglycerol sequioleate (SO750), decaglycerol decaoleate (DAO750), alone or in combination with cosurfactants. The cosurfactant, usually a short-chain alcohol such as ethanol, 1-propanol, and 1 -butanol, serves to increase the interfacial fluidity by penetrating into the surfactant film and consequently creating a disordered film because of the void space generated among surfactant molecules. Microemulsions may, however, be prepared without the use of cosurfactants and alcohol-free self-emulsifying microemulsion systems are known in the art. The aqueous phase may typically be, but is not limited to, water, an aqueous solution of the drug, glycerol, PEG300, PEG400, poly glycerols, propylene glycols, and derivatives of ethylene glycol. The oil phase may include, but is not limited to, materials such as Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium chain (C8-C12) mono, di, and tri-glycerides, polyoxyethylated glyceryl fatty acid esters, fatty alcohols, polyglycolized glycerides, saturated polyglycolized C8-C10 glycerides, vegetable oils and silicone oil.
Microemulsions are particularly of interest from the standpoint of drug solubilization and the enhanced absorption of drugs. Lipid based microemulsions (both o/w and w/o) have been proposed to enhance the oral bioavailability of drugs, including peptides (see e.g., U.S. Patent Nos. 6,191,105; 7,063,860; 7,070,802; 7,157,099; Constantinides et al, Pharmaceutical
Research, 1994, 1 1, 1385-1390; Ritschel, Meth. Find. Exp. Clin. Pharmacol. 1993, 13, 205). Microemulsions afford advantages of improved drug solubilization, protection of drug from enzymatic hydrolysis, possible enhancement of drug absorption due to surfactant-induced alterations in membrane fluidity and permeability, ease of preparation, ease of oral
administration over solid dosage forms, improved clinical potency, and decreased toxicity (see e.g., U.S. Patent Nos. 6,191,105; 7,063,860; 7,070,802; 7,157,099; Constantinides et al, Pharmaceutical Research, 1994, 11, 1385; Ho et al, J. Pharm. Sci., 1996, 85, 138-143). Often microemulsions may form spontaneously when their components are brought together at ambient temperature. This may be particularly advantageous when formulating thermolabile drugs, peptides or iRNAs. Microemulsions have also been effective in the transdermal delivery of active components in both cosmetic and pharmaceutical applications. It is expected that the microemulsion compositions and formulations of the present invention will facilitate the increased systemic absorption of iRNAs and nucleic acids from the gastrointestinal tract, as well as improve the local cellular uptake of iRNAs and nucleic acids.
Microemulsions of the present invention may also contain additional components and additives such as sorbitan monostearate (Grill 3), Labrasol, and penetration enhancers to improve the properties of the formulation and to enhance the absoiption of the iRNAs and nucleic acids of the present invention. Penetration enhancers used in the microemulsions of the present invention may be classified as belonging to one of five broad categories— surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (Lee et al. Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of these classes has been discussed above. Penetration Enhancers
In one embodiment, the present invention employs various penetration enhancers to effect the efficient delivery of nucleic acids, particularly iRNAs, to the skin of animals. Most drugs are present in solution in both ionized and nonionized forms. However, usually only lipid soluble or lipophilic drugs readily cross cell membranes. It has been discovered that even non- lipophilic drugs may cross cell membranes if the membrane to be crossed is treated with a penetration enhancer. In addition to aiding the diffusion of non-lipophilic drugs across cell membranes, penetration enhancers also enhance the permeability of lipophilic drugs.
Penetration enhancers may be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non-chelating non- surfactants (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92). Each of the above mentioned classes of penetration enhancers are described below in greater detail.
Surfactants: In connection with the present invention, surfactants (or "surface-active agents") are chemical entities which, when dissolved in an aqueous solution, reduce the surface tension of the solution or the interfacial tension between the aqueous solution and another liquid, with the result that absorption of iRNAs through the mucosa is enhanced. In addition to bile salts and fatty acids, these penetration enhancers include, for example, sodium lauryl sulfate, poIyoxyethyIene-9-lauryl ether and polyoxyethylene-20-cetyl ether) (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92); and perfluorochemical emulsions, such as FC-43. Takahashi et al., J. Pharm. Pharmacol., 1988, 40, 252).
Fatty acids: Various fatty acids and their derivatives which act as penetration enhancers include, for example, oleic acid, lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein (1-monooleoyl- rac-giycerol), dilaurin, caprylic acid, arachidonic acid, glycerol 1-monocaprate, 1- dodecylazacycloheptan-2-one, acylcarnitines, acylcholines, C1-2o alkyl esters thereof (e.g., methyl, isopropyl and t-butyl), and mono- and di-glycerides thereof (i.e., oleate, laurate, caprate, myristate, paimitate, stearate, linoleate, etc.) (see e.g., Touitou, E., et al. Enhancement in Drug Delivery, CRC Press, Danvers, MA, 2006; Lee et al.. Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92; Muranishi, Critical Reviews in Therapeutic Drag Carrier Systems, 1990, 7, 1-33; El Hariri et al., J. Pharm. Pharmacol., 1992, 44, 651-654).
Bile salts: The physiological role of bile includes the facilitation of dispersion and absoiption of lipids and fat-soluble vitamins (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Brunton, Chapter 38 in: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al. Eds., McGraw- Hill, New York, 1996, pp. 934-935). Various natural bile salts, and their synthetic derivatives, act as penetration enhancers. Thus the term "bile salts" includes any of the naturally occurring components of bile as well as any of their synthetic derivatives. Suitable bile salts include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate), dehydrocholic acid (sodium dehydrochoiate), deoxycholic acid (sodium deoxycholate), giuchoiic acid (sodium glucholate), glycholic acid (sodium glycocholate), glycodeoxycholic acid (sodium glycodeoxycholate), taurocholic acid (sodium taurocholate), taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA), sodium tauro-24,25-dihydro-fusidate (STDHF), sodium glycodihydrofusidate and poiyoxyethyiene-9-lauryl ether (POE) {see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991 , page 92; Swinyard, Chapter 39 In: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990, pages 782-783;
Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Yamamoto et al, J. Pharm. Exp. Ther., 1992, 263, 25; Yamashita et al., J. Pharm. Sci., 1990, 79, 579-583).
Chelating Agents: Chelating agents, as used in connection with the present invention, can be defined as compounds that remove metallic ions from solution by forming complexes therewith, with the result that absorption of iRN As through the mucosa is enhanced. With regards to their use as penetration enhancers in the present invention, chelating agents have the added advantage of also serving as DNase inhibitors, as most characterized DNA nucleases require a divalent metal ion for catalysis and are thus inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618, 315-339). Suitable chelating agents include but are not limited to disodium ethylenediaminetetraacetate (EDTA), citric acid, salicylates {e.g., sodium salicylate, 5- methoxysalicylate and homovanilate), N-acyl derivatives of collagen, laureth-9 and N-amino acyl derivatives of β-diketones (enamines)(lvef> e.g., Katdare, A. et al, Excipient development for pharmaceutical, biotechnology, and drug delivery, CRC Press, Danvers, MA, 2006; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Buur et al., J. Control Rel., 1990, 14, 43-51 ).
N on- chelating non-surfactants: As used herein, non-chelating non-surfactant penetration enhancing compounds can be defined as compounds that demonstrate insignificant activity as chelating agents or as surfactants but that nonetheless enhance absorption of iRNAs through the alimentary mucosa (see e.g., Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33). This class of penetration enhancers include, for example, unsaturated cyclic ureas, 1-alkyl- and 1-alkenylazacyclo-alkanone derivatives (Lee et al.. Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92); and non-steroidal anti-inflammatory agents such as diclofenac sodium, indomethacin and phenylbutazone (Yamashita et al., J. Pharm.
Pharmacol., 1987, 39, 621-626).
Agents that enhance uptake of iRNAs at the cellular level may also be added to the pharmaceutical and other compositions of the present invention. For example, cationic lipids, such as lipofectin (Junichi et al, U.S. Pat. No. 5,705,188), cationic glycerol derivatives, and polycationic molecules, such as polylysine (Lollo et al, PCT Application WO 97/30731 ), are also known to enhance the cellular uptake of dsRNAs. Examples of commercially available transfection reagents include, for example Lipofectamine™ (Invitrogen; Carlsbad, CA), Lipofectamine 2000™ (Invitrogen; Carlsbad, CA), 293fectin™ (Invitrogen; Carlsbad, CA), Cellfectin™ (Invitrogen; Carlsbad, CA). DMRIE-C™ (Invitrogen; Carlsbad, CA), FreeStyle™ MAX (Invitrogen; Carlsbad, CA), Lipofectamine™ 2000 CD (Invitrogen; Carlsbad, CA), Lipofectamine™ (Invitrogen; Carlsbad, CA), RNAiMAX (Invitrogen; Carlsbad, CA),
Oligofectamine™ (Invitrogen; Carlsbad, CA), Optifect™ (Invitrogen; Carlsbad, CA), X- tremeGENE Q2 Transfection Reagent (Roche; Grenzacherstrasse, Switzerland), DOTAP Liposomal Transfection Reagent (Grenzacherstrasse, Switzerland), DOSPER Liposomal Transfection Reagent (Grenzacherstrasse, Switzerland), or Fugene (Grenzacherstrasse,
Switzerland), Transfectam® Reagent (Promega; Madison, Wl), TransFast™ Transfection Reagent (Promega; Madison, WI), Tfx™-20 Reagent (Promega; Madison, WI), Tfx™-50 Reagent (Promega; Madison, WI), DreamFect™ (OZ Biosciences; Marseille, France),
EcoTransfect (OZ Biosciences; Marseille, France), TransPass3 Dl Transfection Reagent (New England Biolabs; Ipswich, MA, USA), LyoVec™/LipoGen™ (Invivogen; San Diego, CA, USA), PerFectin Transfection Reagent (Genlantis; San Diego, CA, USA), NeuroPORTER Transfection Reagent (Genlantis; San Diego, CA, USA), GenePORTER Transfection reagent (Genlantis; San Diego, CA, USA), GenePORTER 2 Transfection reagent (Genlantis; San Diego, CA, USA), Cytofectin Transfection Reagent (Genlantis; San Diego, CA, USA), BaculoPORTER Transfection Reagent (Genlantis; San Diego, CA, USA), TroganPORTER™ transfection
Reagent (Genlantis; San Diego, CA, USA ), RiboFect (Bioline; Taunton, MA, USA), PlasFect (Bioline; Taunton, MA, USA), UniFECTOR (B-Bridge International; Mountain View, CA, USA), SureFECTOR (B-Bridge International; Mountain View, CA, USA), or HiFect™ (B- Bridge International, Mountain View, CA, USA), among others.
Other agents may be utilized to enhance the penetration of the administered nucleic acids, including glycols such as ethylene glycol and propylene glycol, pyrrols such as 2-pyrrol, azones, and terpenes such as iimonene and menthone.
Carriers
Certain compositions of the present invention also incorporate carrier compounds in the formulation. As used herein, "carrier compound" or "carrier" can refer to a nucleic acid, or analog thereof, which is inert (i.e., does not possess biological activity per se) but is recognized as a nucleic acid by in vivo processes that reduce the bioavailability of a nucleic acid having biological activity by, for example, degrading the biologically active nucleic acid or promoting its removal from circulation. The coadministration of a nucleic acid and a carrier compound, typically with an excess of the latter substance, can result in a substantial reduction of the amount of nucleic acid recovered in the liver, kidney or other extracircuiatory reservoirs, presumably due to competition between the carrier compound and the nucleic acid for a common receptor. For example, the recovery of a partially phosphorothioate dsRNA in hepatic tissue can be reduced when it is coadministered with polyinosinic acid, dextran sulfate, polycytidic acid or 4-acetamido-4'isothiocyano-stilbene-2,2'-disulfonic acid (Miyao et al., DsRNA Res. Dev., 1995, 5, 115-121; Takakura et al, DsRNA & Nucl. Acid Drug Dev., 1996, 6, 177-183.
Excipients
In contrast to a carrier compound, a "pharmaceutical carrier" or "excipient" is a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal. The excipient may be liquid or solid and is selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition. Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, macrocrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulphate, etc).
Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration which do not deleteriously react with nucleic acids can also be used to formulate the compositions of the present invention. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.
Formulations for topical administration of nucleic acids may include sterile and non- sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions of the nucleic acids in liquid or solid oil bases. The solutions may also contain buffers, diluents and other suitable additives. Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration which do not deleteriously react with nucleic acids can be used.
Suitable pharmaceutically acceptable excipients include, but are not limited to, water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.
Other Components
The compositions of the present invention may additionally contain other adj nct components conventionally found in pharmaceutical compositions, at their art-established usage levels. Thus, for example, the compositions may contain additional, compatible,
pharmaceutically-active materials such as, for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents, or may contain additional materials useful in physically formulating various dosage forms of the compositions of the present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers.
However, such materials, when added, should not unduly interfere with the biological activities of the components of the compositions of the present invention. The formulations can be sterilized and, if desired, mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings and/or aromatic substances and the like which do not deleteriously interact with the nucleic acid(s) of the formulation.
Aqueous suspensions may contain substances that increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers.
In some embodiments, pharmaceutical compositions featured in the invention include
(a) one or more iRNA compounds and (b) one or more biologic agents which function by a non- RNAi mechanism. Examples of such biologic agents include agents that interfere with an interaction of ALAS 1 and at least one ALAS 1 binding partner.
Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the
LD5 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. Compounds that exhibit high therapeutic indices are typical.
The data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of compositions featured in the invention lies generally within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the methods featured in the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range of the compound or, when appropriate, of the polypeptide product of a target sequence (e.g., achieving a decreased concentration of the polypeptide) that includes the IC50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography. In addition to their administration, as discussed above, the iRNAs featured in the invention can be administered in combination with other known agents effective in treatment of diseases or disorders related to ALAS l expression. In any event, the administering physician can adjust the amount and timing of iRNA administration on the basis of results observed using standard measures of efficacy known in the art or described herein.
Methods for treating diseases related to expression of an ALASl gene
The invention relates in particular to the use of an iRNA targeting ALAS l to inhibit ALAS l expression and/or to treat a disease, disorder, or pathological process that is related to ALAS l expression.
As used herein, "a disorder related to ALAS l expression," a "disease related to ALAS l expression, a "pathological process related to ALASl expression," or the like includes any condition, disorder, or disease in which ALAS l expression is altered (e.g., elevated), the level of one or more porphyrins is altered (e.g., elevated), the level or activity of one or more enzymes in the heme biosynthetic pathway (porphyrin pathway) is altered, or other mechisms that lead to pathological changes in the heme biosynthetic pathway. For example, an iRNA targeting an ALAS 1 gene, or a combination thereof, may be used for treatment of conditions in which levels of a porphyrin or a porphyrin precursor (e.g., ALA or PBG) are elevated (e.g., certain
porphyrias), or conditions in which there are defects in the enzymes of the heme biosynthetic pathway (e.g. , certain porphyrias). Disorders related to ALAS l expression include, for example, X-linked sideroblastic anemia (XLSA), ALA deyhdratase deficiency porphyria (Doss porphyria), acute intermittent porphyria (AIP), congenital erythropoietic porphyria, prophyria cutanea tarda, hereditary coproporphyria (coproporphyria), variegate porphyria, erythropoietic protoporphyria (EPP), and transient erythroporphyria of infancy.
As used herein, a "subject" to be treated according to the methods described herein, includes a human or non-human animal, e.g., a mammal. The mammal may be, for example, a rodent (e.g., a rat or mouse) or a primate (e.g. , a monkey). In some embodiments, the subject is a human.
In some embodiments, the subject is suffering from a disorder related to ALAS l expression (e.g. , has been diagnosed with a poiphyria or has suffered from one or more symptoms of poiphyria and is a carrier of a mutation associated with porphyria) or is at risk of developing a disorder related to ALAS1 expression (e.g., a subject with a family history of porphyria, or a subject who is a carrier of a genetic mutation associated with porphyria).
Classifications of porphyrias, including acute hepatic porphyrias, are described, e.g., in Balwani, M. & Desnick, R.J., Blood, 120(23), published online as Blood First Edition paper, July 12, 102; DOI 10.1182/blood-2012-05-423186. As described in Balwain & Desnick, acute intermittent porphyria (AIP) hereditary coproporphyria (HCP), variegate porphyria (VP) are autosomal dominant poiphyrias and ALA devhdratase deficiency poiphyria (ADP) is autosomal recessive. In rare cases, AIP, HCP, and VP occur as homozygous dominant forms. In addition, there is a rare homozygous recessive form of porphyria cutanea tarda (PCT), which is the single hepatic cutaneous porphyria, and is also known as hepatoerythropoietic porphyria. The clinical and laboratory features of these poiphyrias are described in Table 4 below.
Table 4: Human hepatic porphyrias; clinical and laboratory features
Figure imgf000165_0001
AR indicates autosomal recessive; AD, autosomal dominant; NV, neurovisceral; CP, cutaneous photosensitivity; -, not applicable.
increases that may be important for diagnosis.
In some embodiments, the subject has or is at risk for developing a porphyria, e.g., a hepatic porphyria, e.g., AIP, HCP, VP, ADP, or hepatoerythropoietic porphyria. In some embodiments, the porphyria is an acute hepatic porphyria, e.g., an acute hepatic porphyria iseiected from acute intermittent poiphyria (AIP), hereditary coproporphyria (HCP), variegate porphyria (VP), and ALA deyhdratase deficiency porphyria (ADP).
In some embodiments, the porphyria is a dual porphyria, e.g., at least two porphyrias. In some embodiments, the dual porphyria comprises two or more porphyrias selected from acute intermittent porphyria (AIP) hereditary coproporphyria (HCP), variegate porphyria (VP), and ALA deyhdratase deficiency poiphyria (ADP).
In some embodiments, the porphyria is a homozygous dominant hepatic poiphyria (e.g., homozygous dominant AIP, HCP, or VP) or hepatoerythropoietic porphyriajn some
embodiments, the poiphyria is AIP, HCP, VP, or hepatoerythropoietic poiphyria, or a combination thereof (e.g., a dual porphyria). In embodiments, the AIP, HCP, or VP is either heterozygous dominant or homozygous dominant.
In embodiments, the subject has or is at risk for developing a porphyria, e.g., ADP, and shows an elevated level (e.g., an elevated urine level) of ALA and/or coproporphyrin III. In embodiments, the subject has or is at risk for developing a porphyria, e.g., ADP, and shows an elevated level of erythrocyte Zn-protoporphyrin.
In embodiments, the subject has or is at risk for developing a porphyria, e.g., AIP, and shows an elevated level (e.g., an elevated urine level) of ALA, PBG, and/or uroporphyrin.
In embodiments, the subject has or is at risk for developing a porphyria, e.g., HCP, and shows an elevated level (e.g., an elevated urine level) of ALA, PBG, and/or coproporphyrin III. In embodiments, the subject has or is at risk for developing a porphyria, e.g., HCP, and shows an elevated level (e.g., an elevated stool level) of coproporphyrin III.
In embodiments, the subject has or is at risk for developing a porphyria, e.g., VP, and shows an elevated level (e.g., an elevated urine level) of ALA, PBG, and/or coproporphyrin III.
In embodiments, the subject has or is at risk for developing a poiphyria, e.g., HCP, and shows an elevated level (e.g., an elevated stool level) of coproporphyrin III and/or
protoporphyrin.
In embodiments, the subject has or is at risk for developing a porphyria, e.g., PCT, (e.g., hepatoerythropoietic porphyria) and shows an elevated level (e.g., an elevated urine level) of uroporphyrin and/or 7-carboxylate poiphyrin. In embodiments, the subject has or is at risk for developing a porphyria, e.g., PCT, (e.g., hepatoerythropoietic porphyria) and shows an elevated level (e.g., an elevated stool level) of uroporphyrin and/or 7-carbox late porphyrin.
A mutation associated with porphyria includes any mutation in a gene encoding an enzyme in the heme biosynthetic pathway (porphyrin pathway) or a gene which alters the expression of a gene in the heme biosynthetic pathway . In many embodiments, the subject carries one or more mutations in an enzyme of the porphyrin pathway (e.g., a mutation in ALA deydratase or PBG deaminase). In some embodiments, the subject is suffereing from an acute porphyria (e.g., AIP, ALA deydratase deficiency porphyria).
In some cases, patients with an acute hepatic porphyria (e.g., AIP), or patients who carry mutations associated with an acute hepatic porphyria (e.g., AIP) but who are asymptomatic, have elevated ALA and/or PBG levels compared with healthy individuals. See, e.g., Floderus, Y. et al, Clinical Chemistry, 52(4): 701-707, 2006; Sardh et al. Clinical Pharmacokinetics, 46(4): 335-349, 2007. In such cases, the level of ALA and/or PBG can be elevated even when the patient is not having, or has never had, an attack. In some such cases, the patient is otherwise completely asymptomatic. In some such cases, the patient suffers from pain, e.g., neuropathic pain, which can be chronic pain (e.g., chronic neuropathic pain). In some cases, the patient has a neuropathy. In some cases, the patient has a progressive neuropathy.
In some embodiments, the subject to be treated according to the methods described herein has an elevated level of a porphyrin or a porphyrin precursor, e.g., ALA and/or PBG. Levels of a porphyrin or a porphyrin precursor can be assessed using methods known in the art or methods described herein. For example, methods of assessing uring and plasma ALA and PBG levels, as well as urine and plasma porphyrin levels, are disclosed in Floderus, Y. et al, Clinical Chemistry, 52(4): 701-707, 2006; and Sardh et al, Clinical Pharmacokinetics, 46(4): 335-349, 2007, the entire contents of which are hereby incorporated in their entirety.
In some embodiments, the subject is an animal model of a porphyria, e.g., a mouse model of a porphyria (e.g., a mutant mouse as described in Lindberg et al. Nature Genetics, 12: 195- 199, 1996). In some embodiments, the subject is a human, e.g., a human who has or is at risk for developing a porphyria, as described herein. In some embodiments, the subject is not having an acute attack of porphyria. In some embodiments, the subject has never had an attack, hi some embodiments, the patient suffers from chronic pain. In some embodiments, the patient has nerve damage. In embodiments, the subject has EMG changes and/or changes in nerve conduction velocity. In some embodiments, the subject is asymptomatic. In some embodiments, the subject is at risk for developing a porphyria (e.g., carries a gene mutation associated with a porphyria) and is asymptomatic. In some embodiments, the subject has previously had an acute attack but is asymptomatic at the time of treatment.
In some embodiments, the subject is at risk for developing a porphyria and is treated prophylacticaliy to prevent the development of a porphyria. In some embodiments the subject has an elevated level of a poiphyrin or a porphyrin precursor, e.g., ALA and/or PBG. In some embodiments, the prophylactic treatment begins at puberty. In some embodiments the treatment lowers the level (e.g., the plasma level or the urine level) of a poiphyrin or a poiphyrin precursor, e.g., ALA and/or PBG. In some embodiments, the treatment prevents the development of an elevated level of a porphyrin or a porphyrin precursor, e.g., ALA and/or PBG. In some embodiments, the treatment prevents the development of, or decreases the frequency or severity of, a symptom associated with a porphyria, e.g., pain or nerve damage.
In some embodiments, the level of a porphyrin or a porphyrin precursor, e.g., ALA or PBG, is elevated, e.g., in a sample of plasma or urine from the subject. In some embodiments, the level of a porphyrin or a poiphyrin precursor, e.g., ALA or PBG, in the subject is assessed based on the absolute level of the poiphyrin or the porphyrin precursor, e.g., ALA or PBG in a sample from the subject. In some embodiments, the level of a poiphyrin or a poiphyrin precursor, e.g., ALA or PBG, in the subject is assessed based on the relative level of the porphyrin or porphyrin precursor, e.g., ALA or PBG, in a sample from the subject. In some embodiments, the relative level is relative to the level of another protein or compound, e.g., the level of creatinine, in a sample from the subject. In some embodiments, the sample is a urine sample. In some embodiments, the sample is a plasma sample. In some embodiments, the sample is a stool sample.
An elevated level of a porphyrin or a poiphyrin precursor, e.g., ALA and/or PBG, can be established, e.g., by showing that the subject has a level of a porphyrin or a porphyrin precursor, e.g., ALA and/or PBG (e.g., a plasma or urine level of ALA and/or PBG) that is greater than, or greater than or equal to, a reference value. A physician with expertise in the treatment of porphyrias would be able to determine whether the level of a poiphyrin or a porphyrin precursor, (e.g., ALA and/or PBG) is elevated, e.g., for the purpose of diagnosing a porphyria or for determining whether a subject is at risk for developing a porphyria, e.g., a subject may be predisposed to an acute attack or to pathology associated with a porphyria, such as, e.g., chronic pain (e.g., neuropathic pain) and neuropathy (e.g., progressive neuropathy).
As used herein, a "reference value" refers to a value from the subject when the subject is not in a disease state, or a value from a normal or healthy subject, or a value from a reference sample or population, e.g., a group of normal or healthy subjects (e.g., a group of subjects that does not carry a mutation associated with a porphyria and/or a group of subjects that does not suffer from symptoms associated with a porphyria).
In some embodiments, the reference value is a pre-disease level in the same individual. In some embodiments, the reference value is a level in a reference sample or population. In some embodiments, the reference value is the mean or median value in a reference sample or population. In some embodiments, the reference value the value that is is two standard deviations above the mean in a reference sample or population. In some embodiments, the reference value is the value that is 2.5, 3, 3.5, 4, 4.5, or 5 standard deviations above the mean in a reference sample or population.
In some embodiments, wherein the subject has an elevated level of a porphyrin or a porphyrin precursor, e.g., ALA and/or PBG, the subject has a level of ALA and/or PBG that is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% higher than a reference value. In some embodiments, the subject has a level of a porphyrin or a porphyrin precursor, e.g., ALA and/or PBG, that is at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 fold higher than a reference value.
hi some embodiments, the reference value is an upper reference limit. As used herein, an
"upper reference limit" refers to a level that is the upper limit of the 95% confidence interval for a reference sample or population, e.g., a group of normal (e.g., wild type) or healthy individuals, e.g. , individuals who do not carry a genetic mutation associated with a porphyria and/or individuals who do not suffer from a porphyria. Accordingly, a lower reference limit refers to a level that is the lower limit of the same 95% confidence interval.
In some embodiments wherein the subject has an elevated level, e.g., a plasma level or a urine level, of a porphyrin or a porphyrin precursor, e.g., ALA or PBG, the level is greater than or equal to 2 times, 3 times, 4 times, or 5 times that of a reference value, e.g., an upper reference limit. In some embodiments, the subject has a urine level of a porphyrin or a porphyrin precursor, e.g., ALA or PBG, that is greater than 4 times that of an upper reference limit. In some embodiments, the reference value is a value provided in Floderus, Y. et al, Clinical Chemistry, 52(4): 701-707, 2006 or Sardh et al, Clinical Pharmacokinetics, 46(4): 335- 349, 2007. In some embodiments, the reference value is a value provided in Table 1 of Sardh et al.
In some embodiments, the subject is a human and has a urine level of PBG that is greater than or equal to 4.8 mmol/mol creatinine. In certain embodiments, the subject is a human and has a urine level of PBG that is greater than, or greater than or equal to, about 3, 4, 5, 6, 7, or 8 mmol/mol creatinine.
In embodiments, the reference value for plasma PBG is 0.12 μιηοΙ L. In embodiments, the subject is a human and has a plasma PBG level that is greater than, or greater than or equal to, 0.10 μη οΙ/L, 0.12 μιηοΙ/L, 0.24 μη οΙ/L, 0.36 μιηοΙ/L, 0.48 μηιοΙ/L, or 0.60 μΐΉθΙ/L. In embodiments, the subject is a human and has a plasma level of PBG that is greater than, or greater than or equal to, 0.48 μη οΙ/L.
In embodiments, the reference value for urine PBG is 1.2 mmol/mol creatinine. In embodiments, the subject is a human and has a urine PBG level that is greater than, or greater than or equal to, 1.0 mmol/mol creatinine, 1.2 mmol/mol creatinine, 2.4 mmol/mol creatinine, 3.6 mmol/mol creatinine, 4.8 mmol/mol creatinine, or 6.0 mmol/mol creatinine. In
embodiments, the subject is a human and has a urine level of PBG that is greater than, or greater than or equal to, 4.8 mmol/mol creatinine.
hi embodiments, the reference value for plasma ALA is 0.12 μη οΙ/L. In embodiments, the subject is a human and has a plasma ALA level that is greater than, or greater than or equal to, 0.10 μιηοΙ/L, 0.12 μη οΙ/L, 0.24 μιηοΙ/L, 0.36 μη οΙ/L, 0.48 μιηοΙ/L, or 0.60 μη οΙ L. hi embodiments, the subject is a human and has a plasma ALA level that is greater than, or greater than or equal to 0.48 μηιοΙ/L.
In embodiments, the reference value for urine ALA is 3.1 mmol/mol creatinine. In embodiments, the subject is a human and has a urine ALA level that is greater than, or greater than or equal to, 2.5 mmol/mol creatinine, 3.1 mmol/mol creatinine, 6.2 mmol/mol creatinine, 9.3 mmol/mol creatinine, 12.4 mmol/mol creatinine, or 15.5 mmol/mol creatinine.
hi embodiments, the reference value for plasma porphyrin is 10 nmol/L. In
embodiments, the subject is a human and has a plasma porphyrin level that is greater than, or greater than or equal to, 10 nmol/L. In embodiments, the subject is a human and has a plasma porphyrin level that is greater than, or greater than or equal to, 8, 10, 15, 20, 25, 30, 35, 40, 45, or 50 nmol/L. In embodiments, the subject is a human and has a plasma porphyrin level that is greater than, or greater than or equal to 40 nmol/L. In embodiments, the reference value for urine porphyrin is 25 μηιοΐ/mol creatinine. In embodiments, the subject is a human and has a urine porphyrin level that is greater than, or greater than or equal to, 25 μιηοΐ/mol creatinine. In embodiments, the subject is a human and has a urine porphyrin level that is greater than, or equal to, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, or 80 μιηοΐ/mol creatinine.
In some embodiments, the subject has a level, e.g., a plasma level or a urine level, of a porphyrin or a porphyrin precursor, e.g., ALA or PBG, that is greater than that of 99% of individuals in a sample of healthy individuals.
hi some embodiments, the subject has a level, e.g., a plasma level or a urine level, of ALA or PBG that is greater than two standard deviations above the mean level in a sample of healthy individuals.
In some embodiments, the subject has a urine level of ALA that is 1.6 or more times that of the mean level in a normal subject (e.g., a subject that does not carry a mutation associated with a porphyria). In some embodiments, the subject has a plasma level of ALA that is 2 or 3 times that of the mean level in a normal subject. In some embodiments, the subject has a urine level of PBG that is four or more times that of the mean level in a normal subject. In some embodiments, the subject has a plasma level of PBG that is four or more times that of the mean level in a normal subject.
In some embodiments, the method is effective to decrease the level of a porphyrin or a porphyrin precursor, e.g., ALA and/or PBG. In embodiments, the method is effective to produce a predetermined reduction in the elevated level of the porphyrin or porphyrin precursor, e.g., ALA or PBG. In some embodiments, the predetermined reduction is a decrease of at least 10%, 20%, 30%, 40%, or 50%. In some embodiments, the predetermined reduction is a reduction that is effective to prevent or ameliorate symptoms, e.g., pain or recurring attacks.
In some embodiments, the predetermined reduction is a reduction that is at least 1, 2, 3, or more standard deviations, wherein the standard deviation is determined based on the values from a reference sample, e.g., a reference sample as described herein. In some embodiments, the predetermined reduction is a reduction that brings the level of the porphyrin or porphyrin precursor to a level that is less than, or to a level that is less than or equal to, a reference value (e.g., a reference value as described herein).
In some embodiments, the subject to be treated according to the methods described suffers from pain, e.g., chronic pain. In some embodiments, the subject has or is at risk for developing a porphyria, e.g. an acute hepatic porphyria, e.g., AIP. In embodiments, the method is effective to treat the pain, e.g., by reducing the severity of the pain or curing the pain. In embodiments, the method is effective to decrease or prevent nerve damage.
In some embodiments, the subject to be treated according to the methods described herein (a) has an elevated level of ALA and/or PBG and (b) suffers from pain, e.g., chronic pain. In embodiments, the method is effective to decrease an elevated level of ALA and/or PBG and/or to treat the pain, e.g., by reducing the severity of the pain or curing the pain.
In some embodiments, the subject is an animal that serves as a model for a disorder related to ALAS1 expression.
In some embodiments the subject is an animal that serves as a model for porphyria (e.g., a genetically modified animal with one or more mutations. In some embodiments, the porphyria is ΑΓΡ and the subject is an animal model of AIP. In one such embodiment, the subject is a genetically modified mouse that is deficient in porphobilinogen deaminase , such as, for example, the mouse described in Lindberg et ah. Nature Genetics, 12: 195-199, 1996, or the homozygous R167Q mouse described in Yasuda, M., Yu, C. Zhang, J., Clavero, S., Edelmann, W., Gan, L., Phillips, J.D., & Desnick, R.J. Acute intermittent porphyria: A severely affected knock-in mouse that mimics the human homozygous dominant phenotype. (Abstract of
Presentation on October 14, 2011 at the American Society of Human Genetics; Program No. 1308F; accessed online on April 4, 2012 at ichg201 1.org/cgi-bin/showdetail.pl?absno=21167); both of these references are hereby incorporated herein in their entirety. Several knock-in models for mutations causing homozygous dominant AIP in humans have been generated. The mutations employed include, e.g., R167Q, R173Q, and R173W in PBG deaminase. Viable homozygotes included the R167Q/R176Q and R167Q/R173Q, both of which exhibit
constitutively elevated ALA and PBG levels analogous to the phenotype in human homozygous dominant AIP; in some embodiments, such a viable homozygous AIP mouse model is the subject. In one embodiment, a subject to be treated according to the methods described herein, (e.g., a human subject or patient), is at risk of developing, or has been diagnosed, with a disorder related to ALASl expression, e.g. a porphyria. In some embodiments, the subject is a subject who has suffered one or more acute attacks of one or more porphyric symptoms. In other embodiments, the subject is a subject who has suffered chronically from one or more symptoms of porphyria (e.g., pain, e.g., neuropathic pain and or neuropathy, e.g., progressive neuropathy). In some embodiments, the subject carries a genetic alteration (e.g., a mutation) as described herein but is otherwise asymptomatic, hi some embodiments, the subject has previously been treated with a heme product (e.g., hemin, heme arginate, or heme albumin), as described herein.
In some embodiments, a subject (e.g. , a subject with a porphyria, such as, e.g. , AIP) to be treated according to the methods described herein has recently experienced or is currently experiencing a prodrome. In some such embodiments, the subject is administered a combination treatment, e.g., an iRNA as described herein, and one or more additional treatments known to be effective against porphyria (e.g. , glucose and/or a heme product such as hemin, as described herein) or its associated symptoms.
In one embodiment, an iRNA as described herein is administered in combination with glucose or dextrose. For example, 10-20% dextrose in normal saline may be provided intravenously. Typically, when glucose is administered, at least 300 g of 10% glucose is administered intravenously daily. The iRNA (e.g., an iRNA in an LNP formulation) may also be administered intravenously, as part of the same infusion that is used to administer the glucose or dextrose, or as a separate infusion that is administered before, concurrently, or after the administration of the glucose or dextrose. In some embodiments, the iRNA is administered via a different route of administration (e.g. , subcutaneously). In yet another embodiment, the iRNA is administered in combination with total parenteral nutrition. The iRNA may be administered before, concurrent with, or after the administration of total parenteral nutrition.
In one embodiment, the iRNA is administered in combination with a heme product (e.g., hemin, heme arginate, or heme albumin), h a further embodiment, the iRNA is administered in combination with a heme product and glucose, a heme product and dextrose, or a heme product and total parenteral nutrition.
A "prodrome," as used herein, includes any symptom that the individual subject has previously experienced immediately prior to developing an acute attack. Typical symptoms of a prodrome include, e.g., abdominal pain, nausea, headaches, psychological symptoms (e.g., anxiety), restlessness and/or insomnia. In some embodiments, the subject experiences pain (e.g. , abdominal pain and/or a headache) during the prodrome. In some embodiments, the subject experiences nausea during the prodrome. In some embodiments, the subject experiences psychological symptoms (e.g., anxiety) during the prodrome. In some embodiments, the subject becomes restless and/or suffers from insomnia during the prodrome.
An acute "attack" of porphyria involves the onset of one or more symptoms of porphyria, typically in a patient who carries a mutation associated with porphyria (e.g. , a mutation in a gene that encodes an enzyme in the porphyrin pathway).
In certain embodiments, administration of an ALAS1 iRNA results in a decrease in the level of one or more porphyrins or porphyrin precursors, as described herein (e.g., ALA and/or PBG). The decrease may be measured relative to any appropriate control or reference value. For example, the decrease in the level of one or more porphyrins or porphyrin precursors may be established in an individual subject, e.g. , as a decrease of at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% or more compared with the level prior to treatment (e.g. ,
immediately prior to treatment). A decrease in the level of a porphyrin precursor, a porphyrin, or or a porphyrin metabolite may be measured using any method known in the art. For example, the level of PBG and/or ALA in urine or plasma may be assessed, using the Watson-Schwartz test, ion exchange chromatography, or high-performance liquid chromatography - mass spectrometry. See, e.g., Thunell ( 1993).
In some embodiments, administration of an ALAS 1 siRN A is effective to reduce the level of ALA and/or PBG in the subject. The level of ALA or PBG in the subject can be assessed, e.g. , based on the absolute level of ALA or PBG, or based on the relative level of ALA or PBG (e.g., relative to the level of another protein or compound, e.g., the level of creatinine) in a sample from the subject. In some embodiments, the sample is a urine sample. In some embodiments, the sample is a plasma sample.
In certain embodiments, an iRNA that targets ALAS 1 is administered in combination one or more additional treatments, e.g. , another treatment known to be effective in treating porphyria or symptoms of porphyria. For example, the other treatment may be glucose (e.g., IV glucose) or a heme product (e.g., hemin, heme arginate, or heme albumin). The additional treatment(s) may be administered before, after, or concurrent with the administration of iRNA. The iRNA and an additional therapeutic agent can be administered in combination in the same composition, e.g., intravenously, or the additional therapeutic agent can be administered as part of a separate composition or by another method described herein.
In some embodiments, administration of iRNA, or administration of iRNA in
combination one or more additional treatments (e.g., glucose, dextrose or the like), decreases the frequency of acute attacks (e.g., by preventing acute attacks so that they no longer occur, or by reducing the number of attacks that occur in a certain time period, e.g., fewer attacks occur per year). In some such embodiments, the iRNA is administered according to a regular dosing regimen, e.g., daily, weekly, biweekly, or monthly.
In some embodiments, the iRNA is administered after an acute attack of porphyria. In some such embodiments, the iRNA is in a composition, e.g. a composition comprising a lipid formulation, e.g. an LNP formulation.
In some embodiments, the iRNA is administered during an acute attack of poiphyria. In some such embodiments, the iRNA is in a composition, e.g. a composition comprising a lipid formulation (e.g., an LNP formulation) or a composition comprising a GalNAc conjugate.
In some embodiments, administration of an ALAS 1 siRNA is effective to lessen the severity of the attack (e.g., by ameliorating one or more signs or symptoms associated with the attack). In some embodiments, administration of an ALAS l siRNA is effective to shorten the duration of an attack. In some embodiments, administration of an ALASl siRNA is effective to stop an attack. In some embodiments, the iRNA is administered prophylactically to prevent an acute attack of porphyria. In some such embodiments, the iRNA is in the form of a GalNAc conjugate, e.g., in a composition comprising a GalNAc conjugate, hi some embodiments, the prophylactic administration is before, during, or after exposure to or occurrence of a precipitating factor. In some embodiments, the subject is at risk of developing porphyria.
In some embodiments, the siRNA is administered during a prodrome. In some embodiments, the prodrome is characterized by pain (e.g., headache and/or abdominal pain), nausea, psychological symptoms (e.g., anxiety), restlessness and/or insomnia. In some embodiments, the siRNA is administered during a particular phase of the menstrual cycle, e.g., during the luteal phase.
In some embodiments, administration of an ALAS 1 siRNA is effective to prevent attacks
(e.g., recurrent attacks that are associated with a prodrome and/or with a precipitating factor, e.g., with a particular phase of the menstrual cycle, e.g., the luteal phase). In some embodiments, administration of an ALAS l siRNA is effective to reduce the frequency of attacks. In embodiments, administration of an ALASl siRNA is effective to lessen the severity of the attack (e.g., by ameliorating one or more signs or symptoms associated with the attack), hi some embodiments, administration of an ALASl siRNA is effective to shorten the duration of an attack. In some embodiments, administration of an ALASl siRNA is effective to stop an attack.
In some embodiments administration of an ALASl siRNA is effective to prevent or decrease the frequency or severity of pain, e.g., neuropathic pain. In some embodiments administration of an ALASl siRNA is effective to prevent or decrease the frequency or severity of neuropathy
Effects of administration of an ALASl siRNA can be established, for example, by comparison with an appropriate control. For example, a decrease in the frequency of acute attacks, as well as a decrease in the level of one or more porphyrins or porphyrin precursors, may be established, for example, in a group of patients with AIP, as a decreased frequency compared with an appropriate control group. A control group (e.g., a group of similar individuals or the same group of individuals in a crossover design) may include, for example, an untreated population, a population that has been treated with a conventional treatment for porphyria (e.g., a conventional treatment for AIP may include glucose, hemin, or both); a population that has been treated with placebo, or a non-targeting iRNA, optionally in combination with one or more conventional treatments for porphyria (e.g., glucose, e.g., IV glucose), and the like.
A subject "at risk" of developing poiphyria, as used herein, includes a subject with a family history of porphyria and/or a history of one or more recurring or chronic porphyric symptoms, and/or a subject who carries a genetic alteration (e.g., a mutation) in a gene encoding an enzyme of the heme biosynthetic pathway, and a subject who carries a genetic alteration, e.g., a mutation, known to be associated with porphyria.
In embodiments, the alteration, e.g., the mutation, makes an individual susceptible to an acute attack (e.g., upon exposure to a precipitating factor, e.g., a drug, dieting or other precipitating factor, e.g., a precipitating factor as disclosed herein). In embodiments, the alteration, e.g., the mutation, is associated with elevated levels of a porphyrin or a porphyrin precursor (e.g., ALA and/or PBG). In embodiments, the alteration, e.g., the mutation, is associated with chronic pain (e.g., chronic neuropathic pain) and/or neuropathy (e.g., progressive neuropathy). In embodiments, the , the alteration, e.g., the mutation, is associated with changes in EMG and/or nerve conduction velocities.
In embodiments, the alteration is a mutation in the ALAS1 gene. In embodiments, the alteration is a mutation in the ALAS 1 gene promoter, or in regions upstream or downstream from the ALASl gene. In embodiments, the alteration is a mutation in transcription factors or other genes that interact with ALASl . In embodiments, the alteration is an alteration, e.g., a mutation, in a gene that encodes an enzyme in the heme biosynthetic pathway.
In some embodiments, the subject has a genetic alteration as described herein (e.g., a genetic mutation known to be associated with a porphyria). In some such embodiments, the subject has an elevated level (e.g., urine or plasma level) of ALA and/or PBG. In some such embodiments, the subject does not have an elevated level of ALA and/or PBG. hi embodiments, the subject has a genetic alteration as described herein and has other symptoms, e.g., chronic pain, EMG changes, changes in nerve conduction velocity, and/or other symptoms associated with a porphyria. In embodiments, the subject has a genetic alteration but does not suffer from acute attacks.
In embodiments, the subject has a mutation associated with AIP, HCP, VP, or ADP.
In some embodiments, the porphyria is AIP. In some such embodiments, the subject has an alteration, e.g., at least one mutation, in the PBG deaminase gene. Many PBG deaminase mutations are known in the art, for example, as reported in Hrdinka, M. et al. Physiological Research, 55 (Suppl 2):S1 19- 136 (2006). In some embodiments, the subject is heterozygous for a PBG deaminase mutation. In other embodiments, the subject is homozygous for a PBG deaminase mutation. A homozygous subject may carry two identical mutations or two different mutations in the PBG deaminase gene.
In some embodiments, the porphyria is HCP. In some such embodiments, the subject has an alteration, e.g., at least one mutation, in the gene that encodes the enzyme
coproporphyrinogen III oxidase.
In some embodiments, the porphyria is VP. In some such embodiments, the subject has an alteration, e.g., at least one mutation, in the gene that encodes protoporphrinogen oxidase. hi embodiments, the porphyria is ADP, e.g., autosomal recessive ADP. In some such embodiments, the subject has an alteration, e.g., at least one mutation, in the gene that encodes ALA deydratase. Methods of treatment provided herein may serve to ameliorate one or more symptoms associated with porphyria, to reduce the frequency of attacks associated with porphyria, to reduce the likelihood that an attack of one or more symptoms associated with porphyria will occur upon exposure to a precipitating factor, or to reduce the risk of developing conditions associated with porphyria (e.g., neuropathy (e.g., progressive neuropathy), hepatocellular cancer). Additionally, the methods provided herein may serve to decrease the level of one or more porphyrin precursors, porphyrins and/or related porphyrin products or metabolites. The level of a porphyrin precursor or a porhyrin may be measured in any biological sample, such as, e.g. , urine, blood, feces, cerebrospinal fluid, or a tissue sample. The sample may be present within a subject or may be obtained or extracted from the subject. In some embodiments, the porphyria is AIP, and the level of PBG and/or ALA is decreased, hi some embodiments, the porphyrin product or metabolite is porphobilin, porphobilinogen, or uroporphyrin. A decrease in the level of a porphyrin product or metabolite may be measured using any method known in the art. For example, the level of PBG and/or ALA in urine or plasma may be assessed, using the Watson-Schwartz test, ion exchange chromatography, or high-performance liquid
chromatography - mass spectrometry. See, e.g., Thunell (1993).
Methods described herein may also serve to reduce chronically elevated levels of porphyrin precursors (e.g., ALA and/or PBG) in subjects suffering from a porphyria (e.g., an acute hepatic porphyria, e.g., AIP) or at risk for developing a porphyria. Methods for assessing plasma and urine levels (e.g., chronically elevated levels) of porphyrin precursors include, e.g., HPLC-mass spectrometry and ion-exchange chromatography. The levels of porphyrin precursors may be expressed as the level relative to another protein or compound, e.g., creatinine. See, e.g., Floderus, Y. et al, Clinical Chemistry, 52(4): 701-707, 2006; Sardh et al., Clinical Pharmacokinetics, 46(4): 335-349, 2007
A "precipitating factor" as used herein, refers to an endogenous or exogenous factor that may induce an acute attack of one or more symptoms associated with porphyria. Precipitating factors include fasting (or other forms of reduced or inadequate caloric intake, due to crash diets, long-distance athletics, etc.), metabolic stresses (e.g., infections, surgery, international air travel, and psychological stress), endogenous hormones (e.g., progesterone), cigarette smoking, lipid- soluble foreign chemicals (including, e.g., chemicals present in tobacco smoke, certain prescription drugs, organic solvents, biocides, components in alcoholic beverages), endocrine factors (e.g., reproductive hormones (women may experience exacerbations during the premenstrual period), synthetic estrogens, progesterones, ovulation stimulants, and hormone replacement therapy). See, for example, Thunell (1993). Common precipitating factors include cytochrome P450 inducing drugs and phenobarbital.
Symptoms associated with porphyria may include abdominal pain or cramping, headaches, effects caused by nervous system abnormalities, and light sensitivity, causing rashes, blistering, and scarring of the skin (photodermatitis). In certain embodiments, the porphyria is AIP. Symptoms of AIP include gastrointestinal symptoms (e.g., severe and poorly localized abdominal pain, nausea/vomiting, constipation, diarrhea, ileus), urinary symptoms (dysuria, urinary retention/incontinence, or dark urine), neurologic symptoms (e.g., sensory neuropathy, motor neuropathy (e.g., affecting the cranial nerves and/or leading to weakness in the arms or legs), seizures, neuropathic pain, progressive neuropathy, headaches, neuropsychiatric symptoms (e.g., mental confusion, anxiety, agitation, hallucination, hysteria, delirium, apathy, depression, phobias, psychosis, insomnia, somnolence, coma), autonomic nervous system involvement (resulting e.g., in cardiovascular sysmptoms such as tachycardia, hypertension, and/or arrhythmias, as well as other symptoms, such as, e.g. , increased circulating catecholamine levels, sweating, restlessness, and/or tremor), dehydration, and electrolyte abnormalities.
In some embodiments, an iRNA targeting ALAS 1 is administered together with (e.g. , before, after, or concurrent with) another treatment that may serve to alleviate one or more of the above symptoms. For example, abdominal pain may be treated, e.g. , with narcotic analgesics, seizures may be treated, e.g. , with anti-seizure medications, nausea/vomiting may be treated, e.g. , with phenothiazines, and tachycardia/hypertension may be treated, e.g. , with beta blockers.
The term "decrease" (or "increase") is intended to refer to a measurable change, e.g., a statistically significant change. The change may be, for example, at least 5%, 10%, 20%, 30%, 40%, 50% or more change (e.g., decrease (or increase) relative to a reference value, e.g., a reference where no iRNA is provided).
The invention further relates to the use of an iRNA or a pharmaceutical composition thereof, e.g., for treating a disorder related to ALAS 1 expression, in combination with other pharmaceuticals and/or other therapeutic methods, e.g., with known pharmaceuticals and/or known therapeutic methods, such as, for example, those which are currently employed for treating the disorder. In one embodiment, the iRNA or pharmaceutical composition thereof can be administered in conjunction with a heme product (e.g. , hemin, heme arginate, or heme albumin, as described herein) and/or in conjunction with intravenous glucose infusions. In some embodiments, the iRNA or pharmaceutical composition thereof is used prophylactically, e.g., to prevent or ameliorate symptoms of an anticipated attack of acute porphyria. The prophylactic use may be timed according to the exposure or anticipated exposure of the subject to a precipitating factor. As described herein, a precipitating factor may be any endogenous or exogenous factor known to precipitate an acute attack. For example, the premenstrual phase is an endogenous precipitating factor, and a cytochrome P450 inducing drug is an exogenous precipitating factor.
The effective amount for the treatment of a disorder related to ALAS l expression (e.g., a porphyria such as AIP) depends on the type of disorder to be treated, the severity of the symptoms, the subject being treated, the sex, age and general condition of the subject, the mode of administration and so forth. For any given case, an appropriate "effective amount" can be determined by one of ordinary skill in the art using routine experimentation. It is well within the ability of one skilled in the art to monitor efficacy of treatment or prevention by measuring any one of such parameters, or any combination of parameters. In connection with the administration of an iRNA targeting ALAS l or pharmaceutical composition thereof, "effective against" a disorder related to ALAS 1 expression indicates that administration in a clinically appropriate manner results in a beneficial effect, e.g., for an individual patient or for at least a fraction of patients, e.g., a statistically significant fraction of patients. Beneficial effects include, e.g., prevention of or reduction of symptoms or other effects. For example, beneficial effects include, e.g., an improvement (e.g., decrease in the severity or frequency) of symptoms, a reduction in the severity or frequency of attacks, a reduced risk of developing associated disease (e.g., neuropathy (e.g., progressive neuropathy), hepatocellular cancer), an improved ability to tolerate a precipitating factor, an improvement in quality of life, a reduction in the expression of ALAS l , a reduction in a level (e.g., a plasma or urine level) of a porphyrin or a porphyrin precursor (e.g., ALA and/or PBG) or other effect generally recognized as positive by medical doctors familiar with treating the particular type of disorder.
A treatment or preventive effect is evident when there is an improvement, e.g., a statistically significant improvement in one or more parameters of disease status, or by a failure to worsen or to develop symptoms where they would otherwise be anticipated. As an example, a favorable change of at least 10% in a measurable parameter of disease, e.g., at least 20%, 30%·, 40%, 50% or more can be indicative of effective treatment. Efficacy for a given iRNA drug or formulation of that drug can also be judged using an experimental animal model for the given disease as known in the art. When using an experimental animal model, efficacy of treatment is evidenced when a statistically significant reduction in a marker (e.g., plasma or urinary ALA or PBG) or symptom is observed.
Patients can be administered a therapeutic amount of iRNA. The therapeutic amount can be, e.g., 0.02-10 mg/kg, e.g., 0.02-5 mg/kg or 0.02-3 mg/kg, e.g., 0.1 -1, 0.3-1, 0.3-2.5, 1-2.5, 0.5- 2, 2-2.5, or 2.5-5 mg/kg. For example, the therapeutic amount can be 0.02, 0.035, 0.1, 0.35, 0.5, 1 , 1.5, 2, 2.5, or 3 mg/kg, or 0.3-2.5, 0.5-2, 0.5-1, 0.5-1.5, 1-1.5, 1-2.5, 1.5-2, 2-2.5, or 2.5-5 mg/kg dsRNA.
In some embodiments, the iRNA is formulated as a lipid formulation, e.g., an LNP formulation as described herein. In some such embodiments, the therapeutic amount is 0.02-10 mg kg, e.g., 0.02-5 mg/kg or 0.02-3 mg kg. e.g., 0.02, 0.035, 0.1 , 0.35, 0.5, 1, 1.5, 2, 2.5, or 3 mg/kg, or 0.3-2.5, 0.5-2, 0.5-1, 0.5-1.5, 1-1.5, 1-2.5, 1.5-2, or 2.5-5 mg/kg dsRNA. hi some embodiments, the lipid formulation, e.g., LNP formulation, is administered intravenously.
In some embodiments, the iRNA is administered by intravenous infusion over a period of time, such as over a 5 minute, 10 minute, 15 minute, 20 minute, or 25 minute period.
In some embodiments, the iRNA is in the form of a GalNAc conjugate as described herein. In some such embodiments, the therapeutic amount is 0.02-10 mg kg, e.g., 0.02-5 mg kg or 0.02-3 mg/kg. e.g., 0.02, 0.035, 0.1 , 0.35, 0.5, 1, 1.5, 2, 2.5, or 3 mg/kg, or 0.3-2.5, 0.5-2. 0.5- 1, 1-1.5, 1-2.5, 1.5-2, 2.5-5, or 2-2.5 mg/kg dsRNA. In some embodiments, the GalNAc conjugate is administered subcutaneously.
In some embodiments, the administration is repeated, for example, on a regular basis, such as, once every two weeks, once every four weeks, once every eight weeks, once every twelve weeks, once every sixteen weeks, or once every twenty weeks, or once every twenty-four weeks, or once every month, once every two months, once every three months, once every four months, once every five months, or once every six months, or longer. In some embodiments, the administration is once every four weeks or once every month. After an initial treatment regimen, the treatments can be administered on a less frequent basis. For example, after administration biweekly for three months, administration can be repeated once per four weeks, once per eight weeks, or once per twelve weeks, or once per month, once per two months, or once per three months, for six months or a year or longer. In some embodiments, the administration is repeated monthly. In other embodiments, the administration is repeated bi-monthly. In other
embodiments, the administration is repeated quarterly.
In embodiments, the iRNA is administered is administered at a dose of 0.5 to 2 mg/kg
(e.g., 1 mg/kg) once every four weeks. In embodiments, the iRNA is administered is
administered at a dose of 1 mg/kg once every four weeks. In embodiments, the iRNA is administered at a dose of 0.5 to 2 mg/kg (e.g., 1 mg/kg) once every twelve weeks. In
embodiments, the iRNA is administered at a dose of 1 mg/kg once every twelve weeks. In embodiments, the iRNA is administered at a dose of 2 to 3 mg/kg (e.g., 2.5 mg/kg) once every four weeks. In embodiments, the iRNA is administered at a dose of 2.5 mg/kg once every four weeks. In embodiments, the iRNA is administered at a dose of 2 to 3 mg/kg (e.g., 2.5 mg/kg) once every twelve weeks, hi embodiments, the iRNA is administered at a dose of 2.5 mg/kg once every twelve weeks. In embodiments, the iRNA is administered at a dose of 2.5 mg/kg once every twelve weeks. In embodiments, the iRNA is administered at a dose of 4 to 6 mg/kg (e.g., 5 mg kg) once every twelve weeks. In embodiments, the iRNA is administered at a dose of 5 mg/kg once every twelve weeks.
In embodiments, the iRNA is administered at a dose of 0.5 to 2 mg/kg (e.g., 1 mg/kg) once every month. In embodiments, the iRNA is administered at a dose of 1 mg/kg once every month, hi embodiments, the iRNA is administered at a dose of 0.5 to 2 mg/kg (e.g., 1 mg/kg) once every three months, hi embodiments, the iRNA is administered at a dose of 1 mg/kg once every three months. In embodiments, the iRNA is administered at a dose of 2 to 3 mg kg (e.g., 2.5 mg/kg) once every month. In embodiments, the iRNA is administered at a dose of 2.5 mg/kg once every month. In embodiments, the iRNA is administered at a dose of 2 to 3 mg/kg (e.g., 2.5 mg/kg) once every three months. In embodiments, the iRNA is administered at a dose of 2.5 mg/kg once every three months. In embodiments, the iRNA is administered at a dose of 4 to 6 mg/kg (e.g., 5 mg/kg) once every three months. In embodiments, the iRNA is administered at a dose of 5 mg/kg once every three months.
hi some embodiments, the iRNA agent is administered in two or more doses. In some embodiments, the number or amount of subsequent doses is dependent on the achievement of a desired effect, e.g., suppression of a ALAS gene, reduction of a level of a porphyrin or porphyrin precursor (e.g., ALA and/or PBG), or the achievement of a therapeutic or prophylactic effect, e.g., reduction or prevention of one or more symptoms associated with porphyria (e.g., pain, e.g., neuropathic pain), and/or prevention of attacks or reduction in the frequency and/or severity of attacks associated with porphyria.
In some embodiments, the iRNA agent is administered according to a schedule. For example, the iRNA agent may be administered once every two weeks, once every four weeks, once every eight weeks, once every twelve weeks, once every sixteen weeks, once every twenty weeks, or once every twenty-four weeks. As another example, the iRNA agent may be administered once every month, once every two months, once every three months, once every four months, once every five months, or once every six months. In some embodiments, the iRNA agent is administered once every four weeks. In some embodiments, the iRNA agent is administered once every twelve weeks. In some embodiments, the iRNA agent is administered once every month. In some embodiments, the iRNA agent is administered once every three months. In some embodiments, the schedule involves regularly spaced administrations, e.g. , weekly, biweekly, monthly, bimonthly, or quarterly. In embodiments, the iRNA agent is administered weekly or biweekly to achieve a desired effect, e.g., to decrease the level of ALA and/or PBG, to decrease pain, and/or to prevent acute attacks.
In embodiments, the schedule involves closely spaced administrations followed by a longer period of time during which the agent is not administered. For example, the schedule may involve an initial set of doses that are administered in a relatively short period of time (e.g., about every 6 hours, about every 12 hours, about every 24 hours, about every 48 hours, or about every 72 hours) followed by a longer time period (e.g., about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, or about 8 weeks) during which the iRNA agent is not administered. In one embodiment, the iRNA agent is initially
administered hourly and is later administered at a longer interval (e.g., daily, weekly, biweekly, or monthly). In another embodiment, the iRNA agent is initially administered daily and is later administered at a longer interval (e.g., weekly, biweekly, or monthly), hi certain embodiments, the longer interval increases over time or is determined based on the achievement of a desired effect. In a specific embodiment, the iRNA agent is administered once daily during an acute attack, followed by weekly dosing starting on the eighth day of administration. In another specific embodiment, the iRNA agent is administered every other day during a first week followed by weekly dosing starting on the eighth day of administration.
In one embodiment, the iRNA agent is administered to prevent or reduce the severity or frequency of recurring attacks, e.g., cyclical attacks associated with a precipitating factor. In some embodiments, the precipitating factor is the menstrual cycle. In some embodiments, the iRNA is administered repeatedly, e.g., at regular intervals to prevent or reduce the severity or frequency of recurring attacks, e.g., cyclical attacks associated with a precipitating factor, e.g., the menstrual cycle, e.g., a particular phase of the menstrual cycle, e.g., the luteal phase. In some embodiments, the iRNA is administered during a particular phase of the menstrual cycle or based on hormone levels of the patient being treated (e.g., based on hormone levels that are associated with a pai'ticulai' phase of the menstrual cycle). In some embodiments, the iRNA is administered on one or more particular days of the menstrual cycle, e.g., on day 1, 2, 3, 4, 5, 6, 7, 8. 9. 10. 11. 12. 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, or on day 28 (or later day for subjects who have a longer menstrual cycle). In some embodiments, the iRNA is administered during the luteal phase, e.g., on one or more days between days 14-28 of the menstrual cycle (or later, in subjects who have a menstrual cycle longer than 28 days). In some embodiments, ovulation of the subject is assessed (e.g., using a blood or urine test that detects a hormone associated with ovulation, e.g., LH) and the iRNA is administered at a predetermined interval after ovulation. In some embodiments, the iRNA is administered immediately after ovulation. In some embodiments, the iRNA is administered 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, or 18 days after ovulation. Any of these schedules may optionally be repeated for one or more iterations. The number of iterations may depend on the achievement of a desired effect, e.g. , the suppression of an ALAS 1 gene and/or the achievement of a therapeutic or prophylactic effect, e.g., reduce or prevent one or more symptoms associated with porphyria, to reduce the frequency of attacks associated with porphyria.
In some embodiments, an initial dose of the iRNA agent is administered and the level of ALA or PBG is tested, e.g., 1-48 hours, e.g., 2, 4, 8, 12, or 24 hours following administration of the initial dose. In some embodiments, if the level of ALA and/or PBG has decreased (e.g., to achieve a predetermined reduction, e.g., a normalization), and/or if the symptoms associated with porphyria (e.g., pain) have improved (e.g., such that the patient is asymptomatic), no further dose is administered, whereas if the level of ALA and/or PBG has not decreased (e.g., has not achieved a predetermined reduction, e.g., has not normalized), a further dose of ALA or PBG is administered. In some embodiments, the further dose is administered 12, 24, 36, 48, 60, or 72 hours after the initial dose. In some embodiments, if the initial dose is not effective to decrease the level of ALA and/or PBG, the further dose is modified, e.g., increased to achieve a desired decrease (e.g., a predetermined reduction, e.g. , a normalization) in ALA or PBG levels.
hi some embodiments, the predetermined reduction is a decrease of at least 10%, 20%, 30%, 40%, or 50%. In some embodiments, the predetermined reduction is a reduction that is effective to prevent or ameliorate symptoms, e.g., pain, prodromal symptoms, or recurring attacks.
In some embodiments, the predetermined reduction is a reduction of at least 1 , 2, 3, or more standard deviations, wherein the standai'd deviation is determined based on the values from a reference sample, e.g., a reference sample as described herein.
In some embodiments, the predetermined reduction is a reduction that brings the level of the poiphyrin or porphyrin precursor to a level that is less than, or to a level that is less than or equal to, a reference value (e.g., a reference value as described herein).
As used herein, a ''normalization" in ALA or PBG levels (or a "normal" or '"normalized" level) refers to a level (e.g., a urine and/or plasma level) of either ALA, or PBG, or both, that is within the expected range for a healthy individual, an individual who is asymptomatic (e.g., an individual who does not experience pain and/or suffer from neuropathy), or an individual who does not have a mutation associated with a porphyria. For example, in some embodiments, a normalized level is within two standard deviations of the normal mean. In some embodiments, a normalized level is within normal reference limits, e.g., within the 95% confidence interval for an appropriate control sample, e.g., a sample of healthy individuals or individuals who do not carry a gene mutation associated with a porphyria. In some embodiments, the ALA and/or PBG level of the subject (e.g., the urine and/or plasma ALA and/or PBG level) is monitored at intervals, a further dose of the iRNA agent is administered when the level increases above the reference value.
Administration of the iRNA may reduce ALAS1 mRNA or protein levels, e.g., in a cell, tissue, blood, urine or other compartment of the patient by at least 10%, at least 15%, at least 20%. at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80 % or at least 90% or more. Administration of the iRNA may reduce levels of products associated with ALASl gene expression, e.g., levels of one or more porphyrins or porphyrin precursors (e.g., the level of ALA and/or PBG). Administration of the iRNA agent may also inhibit or prevent the upregulation of ALASl mRNA or protein levels during an acute attack of AIP.
Before administration of a full dose of the iRNA, patients can be administered a smaller dose, such as a 5% infusion dose, and monitored for adverse effects, such as an allergic reaction, or for elevated lipid levels or blood pressure. In another example, the patient can be monitored for unwanted effects. Methods for modulating expression of an ALASl gene
h yet another aspect, the invention provides a method for modulating (e.g., inhibiting or activating) the expression of an ALASl gene, e.g., in a cell or in a subject. In some
embodiments, the cell is ex vivo, in vitro, or in vivo. In some embodiments, the cell is an erythroid cell or a hepatocyte. In some embodiments, the cell is in a subject (e.g., a mammal, such as, for example, a human), hi some embodiments, the subject (e.g., the human) is at risk, or is diagnosed with a disease related to ALASl expression, as described above.
In one embodiment, the method includes contacting the cell with an iRNA as described herein, in an amount effective to decrease the expression of an ALAS 1 gene in the cell.
"Contacting," as used herein, includes directly contacting a cell, as well as indirectly contacting a cell. For example, a cell within a subject (e.g., an erythroid cell or a liver ceil, such as a hepatocyte) may be contacted when a composition comprising an iRNA is administered (e.g., intravenously or subcutaneously) to the subject.
The expression of an ALASl gene may be assessed based on the level of expression of an ALASl mRNA, an ALASl protein, or the level of a parameter functionally linked to the level of expression of an ALAS 1 gene (e.g., the level of a porphyrin or the incidence or severity of a symptom related to a porphyria). In some embodiments, the expression of ALAS l is inhibited by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%. In some embodiments, the iRNA has an IC50 in the range of 0.001-0.01 nM, 0.001-0.10 nM. 0.001-1.0 nM, 0.001-10 nM, 0.01-0.05 nM, 0.01-0.50 nM, 0.02-0.60 nM, 0.01-1.0 nM, 0.01-1.5 nM, 0.01-10 nM. The IC50 value may be normalized relative to an appropriate control value, e.g., the IC50 of a no -targeting iRNA.
In some embodiments, the method includes introducing into the cell an iRNA as described herein and maintaining the cell for a time sufficient to obtain degradation of the mRNA transcript of an ALASl gene, thereby inhibiting the expression of the ALASl gene in the cell.
In one embodiment, the method includes administering a composition described herein, e.g., a composition comprising an iRNA that targets ALASl, to the mammal such that expression of the target ALAS 1 gene is decreased, such as for an extended duration, e.g. , at least two, three, four days or more, e.g., one week, two weeks, three weeks, or four weeks or longer. In some embodiments, the decrease in expression of ALAS 1 is detectable within 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, or 24 hours of the first administration.
In another embodiment, the method includes administering a composition as described herein to a mammal such that expression of the target ALAS l gene is increased by e.g., at least 10% compared to an untreated animal. In some embodiments, the activation of ALASl occurs over an extended duration, e.g., at least two, three, four days or more, e.g., one week, two weeks, three weeks, four weeks, or more. Without wishing to be bound by theory, an iRNA can activate ALAS 1 expression by stabilizing the ALAS 1 mRNA transcript, interacting with a promoter in the genome, and/or inhibiting an inhibitor of ALASl expression.
The iRNAs useful for the methods and compositions featured in the invention specifically target RNAs (primary or processed) of an ALASl gene. Compositions and methods for inhibiting the expression of an ALAS 1 gene using iRNAs can be prepared and performed as described elsewhere herein.
In one embodiment, the method includes administering a composition containing an iRNA, where the iRNA includes a nucleotide sequence that is complementary to at least a part of an RN A transcript of the ALAS 1 gene of the mammal to be treated. When the organism to be treated is a mammal such as a human, the composition may be administered by any means known in the art including, but not limited to oral, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal and intrathecal), intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), nasal, rectal, and topical (including buccal and sublingual) administration. In certain embodiments, the compositions are administered by intravenous infusion or injection. In some such embodiments, the compositions comprise a lipid formulated siRNA (e.g., an LNP formulation, such as an LNPl 1 formulation) for intravenous infusion. In particular embodiments, such compositions may be used to treat acute attacks of poiphyria and/or for prophylaxis (e.g. , to decrease the severity or frequency of attacks).
In other embodiments, the compositions are administered subcutaneously. In some such embodiments, the compositions comprise an iRNA conjugated to a GalNAc ligand. In particular embodiments, such compositions may be used to treat acute attacks of poiphyria or for prophylaxis (e.g. , to decrease the severity or frequency of attacks).
Methods for decreasing a level of a porphyrin or porphyrin precursor
In another aspect, the invention provides a method for decreasing a level of a porphyrin or a porphyrin precursor, e.g., in a cell or in a subject.
In some embodiments, the cell is ex vivo, in vitro, or in vivo. In some embodiments, the cell is an erythroid cell or a hepatocyte. In some embodiments, the cell is a hepatocyte. hi some embodiments, the cell is in a subject (e.g. , a mammal, such as, for example, a human).
In some embodiments, the subject (e.g., the human) is at risk, or is diagnosed with a poiphyria, as described herein. In some embodiments, the method is effective to treat a poiphyria as described herein (e.g., by ameliorating one or more symptoms associated with a porphyria, reducing the frequency of attacks associated with a porphyria, reducing the likelihood that an attack of one or more symptoms associated with poiphyria will occur upon exposure to a precipitating factor, or reducing the risk of developing conditions associated with a poiphyria (e.g. , neuropathy (e.g., progressive neuropathy), hepatocellular cancer). In one embodiment, the method includes contacting the cell with an RNAi, as described herein, in an amount sufficient to decrease the level of the porphyrin or porphyrin precursor (e.g., ALA or PBG) in the cell, or in another related cell or group of cells, or in the subject. "Contacting," as used herein, includes directly contacting a cell, as well as indirectly contacting a cell. For example, a cell within a subject (e.g., an erythroid cell or a liver cell, such as a hepatocyte) may be contacted when a composition comprising an RNAi is administered (e.g. , intravenously or subcutaneously) to the subject. "Another related cell or group of cells," as used herein, includes any cell or group of celis in which the level of the porphyrin or porphyrin precursor decreases as a result of the contacting. For example, the cell may be part of a tissue present within a subject (e.g. , a liver cell present within a subject), and contacting the cell within the subject (e.g., contacting one or more liver cells present within a subject) with the RNAi may result in a decrease in the level of the porphyrin or porphyrin precursor in another related cell or group of cells (e.g., nerve cells of the subject), or in a tissue or fluid of the subject (e.g. , in the urine, blood, plasma, or
cerebrospinal fluid of the subject).
In some embodiments, the porphyrin or porphyrin precursor is selected from the group consisting of δ-aminolevulinic acid (ALA), porphopilinogen (PBG), hydroxymethylbilane (HMB), uroporphyrinogen III, coproporphyrinogen III, protoporphrinogen IX, and
protoporphyrin IX In some embodiments the porphyrin precursor is ALA. In some
embodiments, the porphyrin precursor is PBG. In some embodiments, the method decreases the level of ALA and PBG. The level of a porphyrin or a porphyrin precursor may be measured as described herein and as known in the art. Assavs and Methods for Monitoring RNAi activity
In another aspect, the invention provides assays and methods for monitoring ALAS 1 mRNA levels. RNAi activity in the liver can be monitored by detecting mRNA levels or 5'RACE product in tissue, or by detecting the level of circulating secreted protein.
Alternatively, or in combination, circulating extracellular levels of ALAS1 mRNA can be detected, e.g., by cERD assays (Circulating Extracellular RNA Detection). In some
embodiments, the ALAS1 mRNA level can be detected in a bodily fluid sample, e.g., a serum or urine sample. In some embodiments, exosomes are shed into bodily fluids from different cells types, which contain mRNA and miRNA derived from a tissue of origin. Such exosomes can be used to monitor the level of RNAi in circulation. In one embodiment, a sample, e.g., a serum or urine sample from a subject treated with an iRNA described herein can be purified with low speed spin, foliowed by a spin at about 160,000g for about 2 hours to form a peliet. RNA can be extracted and analyzed to measure the levels of ALAS 1 mRNA. Exemplary methods and assays are disclosed in PCT/US2012/043584, published as WO 2012/177906, the contents of which are incorporated by reference.
Accordingly, an assay, or method, is provided for detecting the level of circulating extracellular ALAS 1 mRNA in a subject. The assay, or method includes providing RNA (e.g., extracellular RNA) from a biological fluid sample (e.g., urine, blood or plasma sample) from the subject, said biological fluid sample comprising the ALAS l mRNA; and detecting the level of circulating extracellular ALAS 1 mRNA in the sample.
In one embedment, the assay or method includes the step of obtaining an ALAS 1 cDNA from the ALAS 1 mRNA; and contacting the ALAS 1 cDN A with a nucleic acid complementary (e.g., probe and/or primer) to the ALAS l cDNA or a portion thereof, thereby producing a reaction mix; and detecting (e.g., measuring) the level of ALAS l cDNA in the reaction mix, wherein the ALAS l cDNA level is indicative of the ALAS l mRNA level, thereby assaying the level of circulating extracellular ALAS l mRNA in the subject.
In one embodiment, the assay or method includes acquiring a biological fluid sample from a subject, where the biological sample is separate from the tissue, and where the biological sample contains exosomes. The assay or method can further include detecting the levels of an RNA in the biological sample, where the RNA is expressed from the gene in the tissue of the subject, where the exosomes are not purified from the biological sample prior to detecting levels of RNA in the biological sample.
In embodiments, said biological fluid sample is a blood sample. In embodiments, said biological fluid sample is a serum sample. In another embodiment, the biological fluid sample is a urine sample.
In embodiments, the the method comprises PGR, qPCR or 5 '-RACE. In embodiments, said nucleic acid is a probe or primer. In embodiments, said nucleic acid comprises a detectable moiety and the level of ALAS 1 mRNA is determined by detection of the amount of the detectable moiety.
In embodiments, said method further comprises obtaining the biological fluid sample from the subject.
In embodiments of these methods, the efficacy of a porphyria treatment is assessed based on a comparison of the level of circulating extracellular ALAS l mRNA in the subject relative to a reference value.
In embodiments, a decrease in the level of circulating extracellular ALAS l mRNA in the subject in response to the porphyria treatment, relative to the reference value, indicates that the porphyria treatment is efficacious. In embodiments, the reference value is the level of circulating extracellular ALAS l mRNA in the subject prior to the porphyria treatment. The entire contents of Intemationl Application Publication No. WO 2015/051318 are incorporated herein by reference. Tables 2, 3, 6, 7, 8, 9, 14, 15, 18, and 20-40 of WO
2015/051318 are also disclosed in U.S. Application Serial No. 62/218,470 filed on September 14, 2015 and U.S. Application Serial No. 62/383,968 filed on September 6, 2016, the entire contents of which are hereby incorporated herein by reference.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the ait to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the iRNAs and methods featured in the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
EXAMPLES
Examples 1-39 are also disclosed in Intemationl Application Publication No. WO 2015/051318, titled "Compositions and Methods for Inhibiting Expression of the ALASl Gene,' which is incorporated by reference herein in its entirety.
Example 1. siR A synthesis
Source of reagents
Where the source of a reagent is not specifically given herein, such reagent may be obtained from any supplier of reagents for molecular biology at a quality/purity standard for application in molecular biology.
Oligonucleotide Synthesis
All oligonucleotides are synthesized on an AKTAoligopilot synthesizer. Commercially available controlled pore glass solid support (dT-CPG, 500A, Prime Synthesis) and RNA phosphoramidites with standard protecting groups, 5'-0-dimethoxytrityl N6-benzoyl-2'-i- butyldimethyIsiIyl-adenosine-3' -Ο-Ν,Ν' -dii sopropyI-2-cyanoethylphosphoramidite, 5 ' -O- dimethoxytrityl-N4-acetyl-2'-t-butyldi^
cyanoethylphosphoramidite, 5'-0-dimethoxytrityl-N2— isobutryl-2'-i-butyldimethylsilyl- guanosine-3'-0-N,N'-diisopropyl-2-cyanoethylphosphoramidite, and 5'- -dimethoxytrityl-2'-i- butyldimethylsilyl-uridine-3,-0-N,N'-diisopropyl-2-cyanoeihylphosphoramidite (Pierce Nucleic Acids Technologies) were used for the oligonucleotide synthesis. The 2'-F phosphoramidites, 5'- 0-dimethoxytrityl-N4-acetyl-2'-iluro-cytidine-3'-0-N,N,-diisopropyl-2-cyanoeth
phosphoramidite and 5 ' -O-dimethoxytrityl-2' -fluro-uridine-3' -Ο-Ν,Ν' -diisopropyl-2- cyanoethyl-phosphoramidite are purchased from (Promega). All phosphoramidites are used at a concentration of 0.2M in acetonitriie (C¾CN) except for guanosine which is used at 0.2M concentration in 10% THF/ANC (v/v). Coupling/recycling time of 16 minutes is used. The activator is 5-ethyl thiotetrazole (0.75M, American International Chemicals); for the PO- oxidation iodine/water/pyridine is used and for the PS-oxidation PADS (2%) in 2,6- lutidine/ACN (1: 1 v/v) is used.
3'-ligand conjugated strands are synthesized using solid support containing the corresponding ligand. For example, the introduction of cholesterol unit in the sequence is performed from a hydroxyproiinol-cholesterol phosphoramidite. Cholesterol is tethered to trans- 4-hydroxyprolinol via a 6-aminohexanoate linkage to obtain a hydroxyproiinol-cholesterol moiety. 5 '-end Cy-3 and Cy-5.5 (fluorophore) labeled iRNAs are synthesized from the corresponding Quasar-570 (Cy-3) phosphoramidite are purchased from Biosearch Technologies. Conjugation of ligands to 5' -end and or internal position is achieved by using appropriately protected ligand-phosphoramidite building block. An extended 15 min coupling of 0.1 M solution of phosphoramidite in anhydrous CH3CN in the presence of 5-(ethylthio)-lH-tetrazole activator to a solid-support-bound oligonucleotide. Oxidation of the internucleotide phosphite to the phosphate is carried out using standard iodine-water as reported (1) or by treatment with tert- butyl hydroperoxide/acetonitrile/water (10: 87: 3) with 10 min oxidation wait time conjugated oligonucleotide. Phosphorothioate is introduced by the oxidation of phosphite to
phosphorothioate by using a sulfur transfer reagent such as DDTT (purchased from AM
Chemicals), PADS and or Beaucage reagent. The cholesterol phosphoramidite is synthesized in house and used at a concentration of 0.1 M in dichloromethane. Coupling time for the cholesterol phosphoramidite is 16 minutes. Deprotection I ( ucieobase Deprotection)
After completion of synthesis, the support is transferred to a 100 mL glass bottle (VWR). The oligonucleotide is cleaved from the support with simultaneous deprotection of base and phosphate groups with 80 mL of a mixture of ethanolic ammonia [ammonia: ethanol (3: 1)] for 6.5 h at 55°C. The bottle is cooled briefly on ice and then the ethanolic ammonia mixture is filtered into a new 250-mL bottle. The CPG is washed with 2 x 40 mL portions of ethanol/water (1: 1 v/v). The volume of the mixture is then reduced to ~ 30 mL by roto-vap. The mixture is then frozen on dry ice and dried under vacuum on a speed vac.
Deprotection II (Removal of 2'-TBDMS group)
The dried residue is resuspended in 26 mL of triethyl amine, triethylamine
trihydiOfluoride (TEA»3HF) or pyridine-HF and DMSO (3:4:6) and heated at 60°C for 90 minutes to remove the ieri-butyldimethylsilyl (TBDMS) groups at the 2' position. The reaction is then quenched with 50 mL of 20 mM sodium acetate and the pH is adjusted to 6.5.
Oligonucleotide is stored in a freezer until purification.
Analysis
The oligonucleotides are analyzed by high-performance liquid chromatography (HPLC) prior to purification and selection of buffer and column depends on nature of the sequence and or conjugated ligand.
HPLC Purification
The ligand-conjugated oligonucleotides are purified by reverse-phase preparative HPLC.
The unconjugated oligonucleotides are purified by anion-exchange HPLC on a TSK gel column packed in house. The buffers are 20 mM sodium phosphate (pH 8.5) in 10% CH3CN (buffer A) and 20 mM sodium phosphate (pH 8.5) in 10% C¾CN, 1M NaBr (buffer B). Fractions containing full-length oligonucleotides are pooled, desalted, and lyophilized. Approximately 0.15 OD of desalted oligonucieotidess are diluted in water to 150 and then pipetted into special vials for CGE and LC/MS analysis. Compounds are then analyzed by LC-ESMS and CGE.
siRNA preparation
For the general preparation of siRNA, equimolar amounts of sense and antisense strand are heated in l PBS at 95°C for 5 min and slowly cooled to room temperature. Integrity of the duplex is confirmed by HPLC analysis. Nucleic acid sequences are represented below using standard nomenclature, and specificalJy the abbreviations of Table 1.
Table 1: Abbreviations of nucleotide monomers used in nucleic acid sequence
representation. It will be understood that these monomers, when present in an oligonucleotide, are mutually linked by 5'-3'-phosphodiester bonds.
Figure imgf000194_0001
Tf 2' -deoxy-2' -fluoro-5-methyluridine-3' -phosphate, 2' -deoxy-2' - fluoro-5-methyluridine-3' -phosphate or 2' -deoxy-2 '-fluoro-5- methyluridine
Tfs 2' -deoxy-2' -fluoro-5-methyluridine-3 ' -phosphorothioate
Ts 5-methyluridine-3'-phosphorothioate
u Uridine-3' -phosphate, uridine-5' -phosphate or uridine-
Ub beta-L-uridine-3 -phosphate, beta-L-uridine-5 -phosphate or beta-L- uridine
Ubs beta-L-uridine-3 -phosphorothioate
Uf 2' -deoxy-2' -fluorouridine-3 ' -phosphate, 2 ' -deoxy-2' -fluoroiiridine or 2' -deoxy-2' -fluorouridine-3' -phosphate
Ufs 2 ' -deoxy-2' -fluoroiiridine -3 ' -phosphorothioate
(Uhd) 2'-0-hexadecyl-uridine-3'-phosphate, 2'-0-hexadecyl-uridine-6'- phosphate or 2'-0-hexadecyl-uridine
(Uhds) 2'-0-hexadecyl-uiidine-3'-phosphorothioate
Us uridine -3 '-phosphorothioate
N any nucleotide (G, A, C, T or U)
a 2'-0-methyladenosine-3 ' -phosphate , 2'-0-methyladenosine-5 ' - phosphate or 2'-0-methyladenosine
as 2'-0-methyladenosine-3 ' - phosphorothioate
c 2'-0-methylcytidine-3 ' -phosphate, 2'-0-methylcytidine-5 ' -phosphate or 2'-0-methylcytidine
cs 2'-0-methylcytidine-3 ' - phosphorothioate
g 2'-0-methylguanosine-3 ' -phosphate, 2'-0-methylguanosine-5 ' - phosphate or 2'-0-methylguanosine
gs 2'-0-methylguanosine-3 ' - phosphorothioate
t 2'-0-methyl-5-methyhiridine-3'-phosphate, 2'-0-methyl-5- methyluridine-5' -phosphate or 2'-0-methyl-5-methyluridine ts 2 ' -O-methyl-5 -methy luridine-3 ' -phosphorothioate
u 2'-0-methyluridine-3 ' -phosphate, 2'-0-methyluridine-5 ' -phosphate or 2'-0-methyluridine
us 2'-0-methyluridine-3 ' -phosphorothioate
dA 2" -deoxyadenosine-3 -phosphate, 2v-deoxyadenosine-5¾ -phosphate or 2'-deoxyadenosine
dAs 2 -deoxy adenosine- 3 -phosphorothioate
dC 2 -deoxycytidine-3" -phosphate, 2 -deoxycytidine-5 -phosphate or T - deoxycytidine
dCs T -deoxycytidine-3 -phosphorothioate dG 2" -deoxyguanosine-3 -phosphate, 2" -deoxyguanosine-5" -phosphate or 2"-deoxyguanosine
dGs 2" -deoxyguanosine-3v -phosphorothioate or 2" -deoxyguanosine dT 2'-deoxythymidine-3 ' -phosphate, 2'-deoxythymidine-5 ' -phosphate or
2'-deoxythymidine
dTs 2"-deoxythymidine-3"-phosphorothioate
dU 2" -deoxyuridine-3' -phosphate, 2 -deoxyuridine-5' -phosphate or 2'- deoxyuridine
s phosphorothioate linkage
L961 N-[tris(GalNAc-alkyl)-amidodecanoyl)]-4-hydroxyprolinol Hyp- (GalNAc-alkyl)3
(Aeo) 2 ' -O-methoxyethyladenosine-3 ' -phosphate, 2 '-0- methoxyethyladenosine-5' -phosphate or 2'-0- methoxyethyladenosine
(Aeos) 2'-0-methoxyethyladenosine-3'-phosphorothioate
(Ceo) 2' -O-methoxyethylcytidine-3 ' -phosphate, 2 ' -0- methoxyethyleytidine-5' -phosphate or 2'-0-methoxyethylcytidine
(Ceos) 2' -O-methoxyethylcytidine-3 ' -phosphorothioate
(Geo) 2' -O-methoxyethylguanosine-3 ' -phosphate, 2 ' -0- methoxyethylguanosine-5' -phosphate or 2'-0- methoxyethylguanosine
(Geos) 2 ' -O-methoxyethylguanosine-3 ' - phosphorothioate
(Teo) 2 ' -O-methoxyethyl-5 -methyluridine-3 ' -phosphate, 2' -O- methoxyethyl-5-methyluridine-5'-phosphate or 2' -O-methoxyethyl- 5 -methyl uridine
(Teos) 2 ' -O-methoxyethyl-5 -methyluridine-3 ' - phosphorothioate
(m5Ceo) -0-methoxyethyl-5-methylcytidine-3' -phosphate, 2' -O- methoxyethyl-5-methylcytidine-5' -phosphate or 2'-0-methoxyethyl- 5-methylcytidine
(mSCeos) 2'-0-methoxyethyl-5-methylcytidine-3'- phosphorothioate
(Agn) 1 -(2,3-Dihydroxypropyl)adenine-2-phosphate, 1 -(2,3- Dihydroxypropyl)adenine-3-phosphate or 1 -(2,3-Dihydroxypropyl) adenine
(Agns) l-(2,3-Dihydroxypropyl)adenine-2-phosphorothioate
(Cgn) l-(2,3-Dihydroxypropyl)cytosine-2-phosphate, l-(2,3- Dihydroxypropyl)cytosine-3-phosphate or 1 -(2,3-Dihydroxypropyl) cytosine
(Cgns) l-(2,3-Dihydroxypropyl)cytosine-2-phosphorothioate
ion
Figure imgf000197_0001
Example 2. ALAS1 siRNA Design and Synthesis
Experimental Methods
Bioinformatics
Transcripts
siRNA design was carried out to identify siRNAs targeting human, rhesus (Macaca mulatto), mouse, and rat ALAS 1 transcripts annotated in the NCBI Gene database
(http://www.ncbi.nlm.nih.gov/gene/). Design used the following transcripts from the NCBI RefSeq collection: Human -NM_000688.4 (see FIG. 3 of WO 2015/051318), NMJ 99166.1; Rhesus - XM_001090440.2, XM_001090675.2; Mouse - NM_020559.2; Rat -NM_024484.2. Due to high primate/ rodent sequence divergence, siRNA duplexes were designed in several separate batches, including but not limited to batches containing duplexes matching human and rhesus transcripts only; human, rhesus, mouse, and rat transcripts only; and mouse and rat transcripts only. Most siRNA duplexes were designed that shared 100% identity the listed human transcript and other species transcripts considered in each design batch (above). In some instances, (see Table 8) mismatches between duplex and mRNA target were allowed at the first antisense (last sense) position when the antisense strand:target mRNA complementary basepair was a GC or CG pair. In these cases, duplexes were designed with UA or AU pairs at the first antisense: last sense pair. Thus the duplexes maintained complementarity but were mismatched with respect to target (U:C, U:G, A:C, or A:G). Eighteen of these "UA-swap'" duplexes were designed as part of the human/rhesus/mouse/rat set (see duplexes in Table 8 with "C19U", "G19U", "C19A", or "G19A" labels in the Position column).
siRNA Design, Specificity, and Efficacy Prediction
The predicted specificity of all possible 19mers was predicted from each sequence.
Candidate 19mers were then selected that lacked repeats longer than 7 nucleotides. These 1510 candidate human/rhesus, 114 human/rhesus/mouse/rat, and 717 mouse/rat siRNAs were used in comprehensive searches against the appropriate transcriptomes (defined as the set of NM_ and XM_ records within the human, rhesus, dog, mouse, or rat NCBI Refseq sets) using an exhaustive ''brute-force" algorithm implemented in the python script 'BruteForce.py'. The script next parsed the transcript-oligo alignments to generate a score based on the position and number of mismatches between the siRNA and any potential 'off -target' transcript. The off-target score is weighted to emphasize differences in the 'seed' region of siRNAs, in positions 2-9 from the 5' end of the molecule. Each oligo-transcript pair from the brute-force search was given a mismatch score by summing the individual mismatch scores; mismatches in the position 2-9 were counted as 2.8, mismatches in the cleavage site positions 10-11 were counted as 1.2, and mismatches in region 12-19 counted as 1.0. An additional off -target prediction was carried out by comparing the frequency of heptamers and octomers derived from 3 distinct, seed-derived hexamers of each oligo. The hexamers from positions 2-7 relative to the 5' start is used to create 2 heptamers and one octomer. We create 'heptamerl ' by adding a 3' A to the hexamer; we create heptamer2 by adding a 5' A to the hexamer; we create the octomer by adding an A to both 5' and 3' ends of the hexamer. The frequency of octomers and heptamers in the human, rhesus, mouse, or rat
3'UTRome (defined as the subsequence of the transcriptome from NCBFs Refseq database where the end of the coding region, the 'CDS', is clearly defined) was pre-calculated. The octomer frequency was normalized to the heptamer frequency using the median value from the range of octomer frequencies. A 'mirSeedScore' was then calculated by calculating the sum of ( (3 X normalized octomer count ) + ( 2 X heptamer2 count) + (1 X heptamerl count)). Both siR As strands were assigned to a category of specificity according to the calculated scores: a score above 3 qualifies as highly specific, equal to 3 as specific and between 2.2 and 2.8 as moderately specific. We sorted by the specificity of the antisense strand. We then selected duplexes whose antisense oligos lacked GC at the first position, lacked G at both positions 13 and 14, and had 3 or more Us or As in the seed region (characteristics of duplexes with high predicted efficacy)
Candidate GalNac-conjugated duplexes, 21 and 23 nucleotides long on the sense and antisense strands respectively, were designed by extending antisense 19mers 4 additional nucleotides in the 3' direction (preserving perfect complementarity with the target transcript). The sense strand was specified as the reverse complement of the first 21 nucleotides of the antisense 23mer. Duplexes were selected that maintained perfect matches to all selected species transcripts across all 23 nucleotides.
siRNA sequence selection
A total of 90 sense and 90 antisense derived human/rhesus, 40 sense and 40 antisense derived human/rhesus/mouse/mouse/rat, and 40 sense and 40 antisense derived mouse/rat siRNA 19mer oligos were synthesized and formed into duplexes. A total of 45 sense and 45 antisense derived human/rhesus 21/23mer oligos were synthesized to yield 45 GalNac-conjugated duplexes.
The sequences of the sense and antisense strands of the modified duplexes are shown in Table 2 of WO 2015/051318 and the Sequence Listing attached herewith, and the sequences of the sense and antisense strands of the unmodified duplexes are shown in Table 3 of W
2015/051318 and the Sequence Listing attached herewith.
Synthesis of ALAS 1 Sequences
ALAS 1 sequences were synthesized on MerMade 192 synthesizer at either 1 or 0.2umol scale. Single strands were made with 2'O-methyl modifications for in vitro screening using transfection reagents. 3' GalNAc conjugates were made with sequences containing 2'F and 2'-0- methyl modifications on the sense strand in the 21 -23 mer designs for free uptake in cells. For all the 21mer sequences in the list, 'endolight' chemistry was applied as detailed below.
• All pyrimidines (cytosine and uridine) in the sense strand contained 2'-0-Methyl bases (2' O-Methyl C and 2'-0-Methyl U) • In the antisense strand, pyrimi dines adjacent to( to wards 5' position) ribo A nucleoside were replaced with their corresponding 2-O-Methyl nucleosides
• A two base dTsdT extension at 3' end of both sense and anti sense sequences was introduced
· The sequence file was converted to a text file to make it compatible for loading in the MerMade 192 synthesis software
For GalNAc conjugated sense strands and complementary antisense sequences, 2'F and other modified nucleosides were introduced in combination with ribo with 2'O-Methyl nucleosides. The synthesis was performed on a GalNAc modified CPG support for the sense strand and CPG modified with universal support on the antisense sequence.
Synthesis. Cleavage and deprotection:
The synthesis of ALASl sequences used solid supported oligonucleotide synthesis using phosphoramidite chemistry. For 21 mer endolight sequences, a deoxy thymidine CPG was used as the solid support while for the GalNAc conjugates, GalNAc solid support for sense strand and an universal CPG for the antisesense strand were used.
The synthesis of the above sequences was performed at either 1 or 0.2um scale in 96 well plates. The amidite solutions were prepared at 0.1M concentration and ethyl thio tetrazole (0.6M in Acetonitrile) was used as activator.
The synthesized sequences were cleaved and deprotected in 96 well plates, using methylamine in the first step and fluoride reagent in the second step. For GalNAc and 2'F nucleoside containing sequences, deprotection conditions were modified. Sequences after cleavage and deprotection were precipitated using acetone: ethanol (80:20) mix and the pellet were re-suspended in 0.2M sodium acetate buffer. Samples from each sequence were analyzed by LC-MS to confirm the identity, UV for quantification and a selected set of samples by IEX chromatography to determine purity.
Purification and desalting:
ALAS 1 sequences were precipitated and purified on AKTA Purifier system using Sephadex column. The ALAS less was run at ambient temperature. Sample injection and collection was performed in 96 well (1.8mL -deep well) plates. A single peak corresponding to the full length sequence was collected in the el ent. The desalted ALASl sequences were analyzed for concentration (by UV measurement at A260) and purity (by ion exchange HPLC). The complementary single strands were then combined in a 1: 1 stoichiometric ratio to form siRNA duplexes.
Exemplary human ALAS 1 modified single strands and duplex sequences are provided in Table 2 of of WO 2015/051318 and the Sequence Listing attached herewith (e.g., a sense sequence corresponding to one of the even numbered sequences identified as SEQ ID NOs: 2 to 190, and an antisense sequence corresponding to one of the odd numbered sequences identified as SEQ ID NOs: 3 to 191).
Exemplary human ALAS 1 unmodified single strands and duplex sequences are provided in Table 3 of of WO 2015/051318 and the Sequence Listing attached herewith (e.g., a sense sequence corresponding to one of the even numbered sequences identified as SEQ ID NOs: 192 to 380, and an antisense sequence corresponding to one of the odd numbered sequences identified as SEQ ID NOs: 193 to 381 ).
Example 3. In vitro screening of ALAS1 siRNA duplexes for ALAS1 knockdown activity.
ALAS l siRNA duplexes were screened for the ability to knockdown ALAS 1 expression in vitro.
In vitro screening
Cell culture and transfections
Hep3B cells (ATCC, Manassas, VA) were grown to near confluence at 37°C in an atmosphere of 5% CO? in MEM (ATCC) supplemented with 10% FBS, before being released from the plate by trypsinization. Transfection was carried out by adding 14.8μ1 of Opti-MEM plus 0.2μ1 of Lipofectamine RNAiMax per well (Invitrogen, Carlsbad CA. cat # 13778- 150) to 5μ1 of siRNA duplexes per well into a 96-well plate and incubated at room temperature for 15 minutes. 80μ1 of complete growth media containing ~2 xlO4 Hep3B cells were then added to the siRNA mixture. Cells were incubated for either 24 or 120 hours prior to RNA purification. Single dose experiments were performed at Ι ΟηΜ and 0.1 nM final duplex concentration and dose response experiments were done at 10, 1.67, 0.27, 0.046, 0.0077, 0.0013, 0.00021 , 0.00004 nM final duplex concentration. Total RNA isolation using DYNABEADS mRNA Isolation Kit (I vitrogen, part #: 610-
12]
Cells were harvested and lysed in 150μ1 of Lysis/Binding Buffer then mixed for 5 minutes at 85()rpm using an Eppendorf Thermomixer (the mixing speed was the same throughout the process). Ten microliters of magnetic beads and 80μ1 Lysis/Binding Buffer mixture were added to a round bottom plate and mixed for 1 minute. Magnetic beads were captured using magnetic stand and the supernatant was removed without disturbing the beads. After removing supernatant, the lysed cells were added to the remaining beads and mixed for 5 minutes. After removing supernatant, magnetic beads were washed 2 times with 150μ1 Wash Buffer A and mixed for 1 minute. Beads were captured again and supernatant removed. Beads were then washed with 150μ1 Wash Buffer B, captured and supernatant was removed. Beads were next washed with 150μ1 Elution Buffer, captured and supernatant removed. Beads were allowed to dry for 2 minutes. After drying, 50μ1 of Elution Buffer was added and mixed for 5 minutes at 70°C. Beads were captured on magnet for 5 minutes. 40μ1 of supernatant was removed and added to another 96 well plate.
cDNA synthesis using ABI High capacity cDNA reverse transcription kit (Applied Biosystems. Foster City. CA. Cat #4368813)
A master mix of 2μ1 10X Buffer, 0.8μ1 25X dNTPs, 2μ1 Random primers, Ι ΐ Reverse Transcriptase, Ι ΐ RNase inhibitor and 3.2μ1 of H20 per reaction were added into ΙΟμΙ total RNA. cDNA was generated using a Bio-Rad C- 1000 or S-1000 thermal cycler (Hercules, CA) through the following steps: 25°C 10 min, 37°C 120 min, 85°C 5 sec, 4°C hold.
Real time PCR
2μ1 of cDNA were added to a master mix containing 0.5μ1 GAPDH TaqMan Probe (Applied Biosystems Cat #4326317E), 0.5μ1 ALASl TaqMan probe (Applied Biosystems cat # Hs00167441_ml) and 5μ1 Lightcycler 480 probe master mix (Roche Cat #04887301001) per well in a 384 well plates (Roche cat # 04887301001 ). Real time PCR was done in a Roche LC480 Real Time PCR system (Roche) using the AACt(RQ) assay. Each duplex was tested in two independent transfections with two biological replicates each, and each transfection was assayed in duplicate, unless otherwise noted in the summary tables. To calculate relative fold change, real time data were analyzed using the ΔΔΟ method and normalized to assays performed with cells transfected with lOnM AD-1955, or mock transfected cells. IC50s were calculated using a 4 parameter fit model using XLFit and normalized to cells transfected with AD- 1955 or na'ive ceils over the same dose range, or to its own lowest dose.
In vitro knockdown of endogenous ALAS l expression by ALAS l siRNA duplexes
The knockdown of ALAS 1 in Hep3B cells by ALAS 1 modified siRNA duplexes (see Table 2 of WO 2015/051318 and the Sequence Listing attached herewith) is illustrated in Table 4 of WO 2015/051318. Silencing is expressed as the fraction RNA message remaining relative to the negative (luciferase) control siRNA AD-1955. Data were generated as described above following transfection of 10 nM or 0.1 nM of each siRNA. qPCR was run using the ALAS l TaqMan probe Hs00167441_ml .
ICsnS of select ALASl siRNA duplexes in in vitro screen
The IC5 S of select ALAS 1 siRNA duplexes determined from the knockdown of endogenously expressed ALAS l in the Hep3B cell line, by ALASl modified siRNA duplexes (see Table 2 of WO 2015/051318) are illustrated in Table 5 of WO 2015/051318. Data were generated as described above, at 24 or 120 hours following transfection of each siRNA duplex. In this example, silencing of ALAS l is expressed as the fraction mRNA message remaining relative to the siRNA AD-1955, a non-targeting siRNA that was used as a negative control. Data from replicate transfection experiments were used to fit a single line to determine the ½ο·
Several of the duplexes (e.g., AD-53541.1 , AD-53542.1, and AD-53547.1 ) had an IC50 as low as about 0.03 nM at 24 hours. Numerous duplexes had an ICso of less than 0.1 nM (e.g., AD- 53534.1 , AD-53536.1, AD-53540.1, AD-53541.1 , AD-53542.1, AD-53547.1 , AD-53548.1, AD- 53550.1 , AD-53552.1 ) at 24 hours, and some of these also had an IC50 of less than 0.1 nM (e.g., AD-53534.1 , AD-53540.1, AD-53541.1 , AD-53542.1, AD-53547.1 , AD-53552.1) at 120 hours.
Example 4. In Vivo Silencing using a mouse/rat ALASl siRNA formulated as a LNP
The sequences of the modified duplex AD-53558 are shown in Table 6 of WO
2015/051318 and the Sequence Listing attached herewith (e.g., a sense sequence of
cuGuGAAAuuuAcucuGAudTsdT (SEQ ID NO: 383) and an antisense sequence of
AUc AG AG u AA AUUUc Ac AGdTsdT (SEQ ID NO: 384). This duplex was formulated as a LNP1 1 formulation (see Table 10 of WO 2015/051318 or Table 3 herein). The LNP-formulated AD-53558 siRNA was tested in in vivo in mice (N=25 animals; 5 animals per group) and rats (N=20 animals; 4 animals per group) and was confirmed to silence ALASl mRNA in vivo. The results are shown in FIG. 5 and FIG. 6 of WO
2015/051318.
FIG. 5 of WO 2015/051318 shows that the siRNA demonstrated a dose-response effect in mice. The expression of mouse ALASl (mALAS l) mRNA was reduced by about 78% when the siRNA was administered at 1 mg/kg; mouse ALAS 1 mRNA was reduced by about 60% when the siRNA was administered at 0.3 mg/kg; and mouse ALASl mRNA was reduced by about 49% when the siRNA was administered at 0.1 mg/kg. These reductions are expressed relative to a PBS control. An AD-1955 LUC control was also employed, as shown in FIG. 5 of WO 2015/051318.
Similarly, FIG. 6 of WO 2015/051318 shows that the siRNA demonstrated a dose- response effect in rats. The expression of ALAS l RNA was reduced by about 70% when the when the siRNA was administered at lmg/kg; ALASl mRNA was reduced by about 62% when the siRNA was administered at 0.3 mg/kg; and ALASl mRNA was reduced by about 34% when the siRNA was administered at 0.1 mg/kg.
The durability of silencing was also tested in mice (N=15; 3 animals per timepoint. The results are shown in FIG. 7 of WO 2015/051318, which shows that AD-53558 suppressed mALASl mRNA by about 80% for at least 9 days. Suppression of at least about 50% persisted for at least 14 days.
Example 5. Efficacy of ALASl siRNA in an Animal Model of AIP
The effects of the AD-53558 LNP11 formulation (a mouse/rat ALASl siRNA described in the previous example) were investigated in a mouse model of AIP. The PBGD knockout is not viable (-/-, 0% activity). Heterozygous PBGD knockout mice (+/-, -50% activity) are available but do not have the full biochemical phenotype and thus do not recapitulate the human disease phenotype. Thus, a mouse model of AIP has been developed that is a compound heterozygote with T1/T2 alleles, including Tl (+/-) promoter disruption and T2 (-/-) splice-site alteration. These mice have been shown to have hepatic residual PBGD activity that is about -30% of the wild-type level and normal or slightly elevated baseline plasma ALA and PBG levels. The mice have been found to appear normal early in life and to become slightly slower and ataxic with age. By six months of age, the mice have been documented to develop impaired motor coordination and muscular performance and axonal degeneration on pathological examination. Investigation of the pathology of the mouse model has shown axonal degeneration, impaired motor coordination and muscular performance in older mice. Urinary and plasma ALA and PBG have been found to markedly increase with serial i.p. administration of phenobarbital (see Lindberg et al, (1996), Nature Genetics, 12: 195-219 and Lindberg et al , (1999), Journal of Clinical Investigation, 103:1 127-34). The mice were rescued by AAV-mediated expression of PBGD in the liver (Yasuda et al (2010), Molecular Medicine, 1 : 17-22 and Unzu et al. (2011), Molecular Medicine, 2:243-50).
On day 1, the mice were administered 1 mg/kg ALAS 1 siRNA (n=5) or LUC AD- 1955 control (n=3) by i.v. injection. Three phenobarbital injections were given (1 injection per day on days 2, 3, and 4) to induce hepatic ALAS1 and the porphyrin precursors, ALA and PBG. Plasma and overnight urine specimens were collected on day 5 and metabolite levels were measured by LC-MS. Metabolite levels were measured in plasma by LC-MS and were also measured in urine. Baseline levels of metabolites were measured prior to the first treatment on day 1. The results are shown in FIGs. 8-12 of WO 2015/051318 and in Tables 12 and 13 of WO
2015/051318.
FIG. 8 and FIG. 9 of WO 2015/051318 show the plasma ALA levels in μΜ. Baseline ALA levels were low, (n=4), and phenobarbital treatment induced significant increases in plasma ALA levels in the control LUC siRNA treated animals (n=3). Treatment with ALASl siRNA inhibited the induction of plasma ALA (n=5), as shown in FIG. 8 of WO 2015/051318. The ALASl siRNA was consistently effective in blocking the induction of plasma ALA in each of the individual animals studied (see FIG. 9 of WO 2015/051318 ). These results indicate that ALASl siRNA treatment was effective in preventing the increases in plasma ALA associated with the phenobarbital-induced acute attacks in this AIP animal model.
FIG. 10 and FIG. 1 1 of WO 2015/051318 show the plasma PBG levels in μΜ. Baseline PBG levels were low (n=4), and phenobarbital treatment induced significant increases in plasma PBG levels in the control LUC siRNA treated animals (n=3). Treatment with ALASl siRNA inhibited the induction of plasma PBG (n=5), as shown in FIG. 10 of WO 2015/051318. The ALASl siRNA was consistently effective in blocking the induction of plasma PBG in each of the individual animals studied (see FIG. 11 of WO 2015/051318). These results indicate that ALASl siRNA treatment was effective in preventing the increases in plasma PBG associated with the phenobarbital-induced acute attacks in this AIP animal model.
Urine ALA and PBG levels at baseline and after phenobarbital treatment in LUC siRNA (n=2) control (CTR, which refers to a PBS buffer treated animal, n=l) and ALASl siRNA (n=5) treated animals are shown in Tables 12 and 13 of WO 2015/051318.
Phenobarbital treatment induced strong increases (-25-30 fold increases) in urine ALA (~9-fold over baseline levels) and PBG (~ 19-fold over baseline levels) in the LUC siRNA treated mice, control, whereas such increases were not observed in the ALASl siRNA treated animals. Thus, ALAS l siRNA blocked phenobarbital-induced increases in urinary ALA and PBG. These results are consistent with the plasma measurements and show that ALASl siRNA treatment was effective in preventing increases in urinary metabolites (ALA and PBG) associated with the phenobarbital-induced acute attacks in this AIP animal model.
In further experiments (FIG. 12 of WO 2015/051318), it was found that phenobarbital treatment induced large increases (-25 fold) in ALASl mRNA expression in the liver of the mouse model. Administration of ALASl siRNA completely blocked this ALASl mRNA induction. These results provide further evidence that ALASl siRNA is effective in an animal model of AIP.
Collectively, the results provided in this Example show that ALASl siRNA was effective in treating acute attacks in an animal model of the acute hepatic porphyria AIP. Multiple outcome measures support this conclusion, including plasma ALA levels, plasma PBG levels, urine ALA levels, urine PBG levels, and liver ALASl mRNA expression levels.
Example 6. In Vivo Silencing using GalNAc-Coniugated Mouse ALASl siRNA
The experiments described in this example investigated the in vivo efficacy of three
GalNAc-conjugated siR As (see Table 7 of WO 2015/051318). The sequences of AD-56211 have a sense sequence of AfaGfuCfuGfuUfUfCfcAfcUfuUfuCfaAfL96 (SEQ ID NO: 385) and an antisense sequence of uUfgAfaAfaGfuGfgaaAfcAfgAfcUfusUfsg (SEQ ID NO: 386). The sequences of AD-56173 have a sense sequence of AfcAfuAfgUfaGfCfCfaGfaAfuUfgUfcUfL96 (SEQ ID NO: 387) and an antisense sequence of aGfaCfaAfuUfcUfggcUfaCfuAfuGfusGfsg (SEQ ID NO: 388). The sequences of AD-57929have a sense sequence of AfsasGfuCfuGfuUfUfCfc cUfuUfuCfaAfL96 (SEQ ID NO: 389) and an antisense sequence of usUfsgAfaAfaGfuGfgaaAfcAfgAfcUfususg (SEQ ID NO: 390). These siRNAs were designed and produced with methods such as those described in Example 2.
The mice (n=40; n=4 per experimental condition) were divided into groups that received PBS or doses of 3 mg/kg, 10 mg kg, or 30 mg kg of siRNA administered subcutaneously. The level of mALAS 1/mGAPDH mRNA, relative to the PBS control, was determined in liver cells at 72 hours post-administration. The results are shown in FIG. 13 of WO 2015/051318. There was not a clear dose-response effect for the siRNAs AD-56211 and AD-56173. In contrast, the ALAS1 siRNA AD-57929 showed a dose-response effect in inhibiting mALAS 1 expression. These results demonstrate that an ALAS1 Gal Ac conjugate was effective in inhibiting expression of ALAS 1 mRNA in vivo and showed a dose-response effect.
Example 7. Human siRNAs
Additional human siRNAs were designed and produced as described in Example 2. The top 45 siRNAs were selected based on their predicted efficacy. The sequences of these 45 siRNAs are provided in Table 8 of International Publication No. WO2013/155204A2 and the Sequence Listing attached herewith (e.g., a sense sequence corresponding to one of the odd numbered sequences identified as SEQ ID NOs: 391 to 551, and an antisense sequence corresponding to one of the even numbered sequences identified as SEQ ID NOs: 392 to 552, respectively). The contents of WO 2013/155204 and the Sequence Listing, including Table 8, are expressly incorporated by reference.
Example 8. Human siRNAs
Additional 19mer human siRNAs were generated. The sequences of these siRNAs are provided in Table 9 of International Publication No. WO2013/155204 A2 and the Sequence Listing attached herewith (e.g., a sense sequence corresponding to one of the odd numbered sequences identified as SEQ ID NOs: 553 to 3365, and an antisense sequence corresponding to one of the even numbered sequences identified as SEQ ID NOs: 554 to 3366, respectively). The contents of WO 2013/155204 and the Sequence Listing, includingTable 9, are expressly incorporated by reference. These siRNAs can be tested for efficacy using methods described herein and/or methods known in the art. Example 9. Suppression of Porphyrin Precursors Using ALAS1 siRNA in an Acute
Treatment Paradigm
The AIP mouse model (see Example 5) was used to investigate whether ALAS1 siRNA would work an an acute treatment paradigm to lower already elevated levels of ALA and PBG, as would be present, for example, when a human porphyria patient suffers from an acute attack. Administration of the AD-53558 LNP11 formulation siRNA at a 1 mg/kg dose 12 hours after the last dose of phenobarbital rapidly decreased the levels of both ALA and PBG in mouse plasma, whereas in Luc control treated animals the levels continued to rise (FIG. 14 of WO
2015/051318). These results indicate that ALAS siRNA is effective for treating an acute attack. The ALAS 1 siRNA was effective to lower and prevent further increases in ALA and PBG levels.
As can be observed in FIG. 14 of WO 2015/051318, ALAS siRNA had a rapid onset effect in reducing ALA and PBG levels. The onset of the effect occurred within hours after administration of the siRNA. The effect on plasma ALA could be observed within 4 hours of administration of the siRNA (see FIG. 14 of WO 2015/051318; the siRNA was administered at 12 hours after the last dose of phenobarbital, and a reduction in plasma ALA relative to control can be observed at 16 hours after the last dose of phenobarbital). The effect on plasma PBG could be observed within 8 hours of administration of the siRNA (see FIG. 14 of WO
2015/051318; the siRNA was administered at 12 hours after the last dose of phenobarbital, and a reduction in plasma ALA relative to control can be observed at 20 hours after the last dose of phenobarbital).
Example 10. siR As that target ALAS1
Further unmodified and modified siRNA sequences that target ALAS 1 siRNA were designed and produced as described in Example 2. The in vitro activity of the modified duplexes was tested as described below.
Methods
Lipid mediated transfection
For Hep3B, PMH, and primary Cynomolgus hepatoc tes, transfection was carried out by adding 14.8 μΐ of Opti-MEM plus 0.2 μΐ of Lipofectamine RNAiMax per well (Invitrogen,
Carlsbad CA. catalog numberl 3778-150) to 5 μΐ of each siRNA duplex to an individual well in a 96-well plate. The mixture was then incubated at room temperature for 20 minutes. Eighty μΐ of complete growth media without antibiotic containing the appropriate cell number were then added to the siRNA mixture. Cells were incubated for 24 hours prior to RNA purification.
Single dose experiments were performed at 1 uM, 500nM, 20nM, lOnM and 0.2nM final duplex concentration for GalNAc modified.
Free uptake transfection
Cryopreserved Primary Cynomolgus Hepatocytes (Celsis hi Vitro Technologies,
M003055-P) were thawed at 37°C water bath immediately prior to usage and re-suspended at 0.26x106 cells/ml in InVitroGRO CP (plating) medium (Celsis In Vitro Technologies, catalog number Z99029). During transfections, cells were plated onto a BD BioCoat 96 well collagen plate (BD, 356407) at 25,000 cells per well and incubated at 37°C in an atmosphere of 5% C02. Free Uptake experiments were performed by adding ΙΟμΙ of siRNA duplexes in PBS per well into a 96 well (96w) plate. Ninety μΐ of complete growth media containing appropriate cell number for the cell type was then added to the siRNA. Cells were incubated for 24 hours prior to RNA purification. Single dose experiments were performed at 1 uM, 500nM, 20nM and lOnM final duplex.
Total RNA isolation using DYNABEADS mRNA Isolation Kit (Itivitrogen, part #: 610-12) Ceils were harvested and lysed in 150 μΐ of Lysis/Binding Buffer then mixed for 5 minutes at 850 rpm using an Eppendorf Thermomixer (the mixing speed was the same throughout the process). Ten microliters of magnetic beads and 80 μΐ Lysis/Binding Buffer mixture were added to a round bottom plate and mixed for 1 minute. Magnetic beads were captured using a magnetic stand and the supernatant was removed without disturbing the beads. After removing the supernatant, the lysed cells were added to the remaining beads and mixed for 5 minutes. After removing the supernatant, magnetic beads were washed 2 times with 150 μΐ Wash Buffer A and mixed for 1 minute. The beads were capturedagain and the supernatant was removed. The beads were then washed with 150 μΐ Wash Buffer B, captured and the supernatant was removed. The beads were next washed with 150 μΐ Elution Buffer, captured and the supernatant removed. Finally, the beads were allowed to dry for 2 minutes. After drying, 50 μΐ of Elution Buffer was added and mixed for 5 minutes at 70°C. The beads were captured on magnet for 5 minutes. Forty-five μΐ of supernatant was removed and added to another 96 well plate.
cDNA synthesis using ABI High capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, CA, Cat #4368813)
A master mix of 2 μΐ 10X Buffer, 0.8 μΐ 25X dNTPs, 2 μΐ Random primers, 1 μΐ Reverse
Transcriptase, 1 μΐ RNase inhibitor and 3.2 μΐ of H20 per reaction as prepared. Equal volumes master mix and RNA were mixed for a final volume of 12μ1 for in vitro screened or 20μ1 for in vivo screened samples. cDNA was generated using a Bio-Rad C-1000 or S-1000 thermal cycler (Hercules, CA) through the following steps: 25°C for 10 minutes, 37°C for 120 minutes, 85°C for 5 seconds, and 4°C hold.
Real time PCR
Two μΐ of cDNA were added to a master mix containing 2μ1 of H?0, 0.5μ1 GAPDH TaqMan Probe (Life Technologies catalog number 4326317E for Hep3B cells, catalog number 352339E for primary mouse hepatocytes or custom probe for cynomolgus primary hepatocytes), 0.5μ1 C5 TaqMan probe (Life Technologies catalog number Hs00167441_ml for Hep3B cells or Mm00457879_ml for Primary Mouse Hepatoctyes or custom probe for cynomolgus primary hepatocytes) and 5μ1 Lightcycler 480 probe master mix (Roche catalog number 04887301001 ) per well in a 384 well (384 w) plates (Roche catalog number 04887301001 ). Real time PCR was performed in an Roche LC480 Real Time PCR system (Roche) using the AACt(RQ) assay. For i vitro screening, each duplex was tested with two biological replicates unless otherwise noted and each Real Time PCR was performed in duplicate technical replicates. For in vivo screening, each duplex was tested in one or more experiments (3 mice per group) and each Real Time PCR was run in duplicate technical replicates.
To calculate relative fold change in ALAS1 mRNA levels, real time data were analyzed using the AACt method and normalized to assays performed with cells transfected with 10 nM AD-1955, or mock transfected cells. IC5 s were calculated using a 4 parameter fit model using XLFit and normalized to cells transfected with AD-1955 over the same dose range, or to its own lowest dose.
The sense and antisense sequences of AD-1955 are:
SENSE: cuuAcGcuGAGuAcuucGAdTsdT (SEQ ID NO:3682) ANTISENSE: UCG AAGuACUcAGCG uA AGdTsdT (SEQ ID NO:3683).
The single strand and duplex sequences of the modified and unmodified siRNAs are provided in Table 14 and Table 15, respectively, of WO 2015/051318, and the Sequence Listing attached herewith (e.g., a modified sense sequence corresponding to one of the odd numbered sequences identified as SEQ ID NOs: 3371 to 3525, and a modified antisense sequence corresponding to one of the even numbered sequences identified as SEQ ID NOs: 3372 to 3526, or an unmodified sense sequence corresponding to one of the even numbered sequences identified as SEQ ID NOs: 3528 to 3680 or 3684, and an unmodified antisense sequence corresponding to one of the odd numbered sequences identified as SEQ ID NOs: 3527 to 3681).
The results of the in vitro assays are provided in Table 16 of WO 2015/051318. Table 16 of WO 2015/051318 also notes the target species of each of the siRNAs.
The IC5os of select ALAS1 siRNA duplexes are illustrated in Table 17 of of WO
2015/051318. The IC50S were determined from the knockdown of endogenously expressed ALASl in the Hep3B cell line, at 24 hours following transfection of each ALASl modified siRNA duplex (see Table 14 of WO 2015/051318). At least seven duplexes, including AD-
58882, AD-58878, AD-58886, AD-58877, AD-59115, AD-58856, and AD-59129, consistently demonstrated IC50 of less than 0.1 n , indicating that these duplexes were particularly effective in suppressing ALASl expression. Example 11. ALASl-GatNAc activity in AIP Phenobarbitat induction mouse model
The AIP mouse model was used to investigate the effect of an siRNA that was an ALASl-GalNAc conjugate. The siRNA had the sequence of duplex AD-58632 (see Table 20 of WO 2015/051318, e.g., a sense sequence of GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfuUfL96 (SEQ ID NO: 4149), and an antisense sequence of asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg (SEQ ID NO: 4150)).
AIP mice were untreated (baseline), or injected subcutaneously on day 1 with saline or the ALASl-GalNAc conjugate at a dose of 20 mg/kg. On Days 2, 3, and 4 they were left untreated (baseline) or they were treated with IP injections of Phenobarbital. On Day 5 plasma was taken and levels of ALA and PBG were measured using an LC-MS assay. As shown in FIG. 15 of W 2015/051318, the ALASl-GalNAc conjugate blunted the production of plasma ALA and PBG by about 84 and 80% respectively. These results indicate that treatment with an ALASl -GalNAc conjugate was effective in preventing increases in both plasma ALA and PBG associated with phenobarbital-induced acute attacks in this AIP animal model.
Example 12. Further siR As that Target ALASl and Inhibit ALASl Expression
Modified siRNA sequences that target ALASl siRNA were designed and produced as described in Example 2. The sequences are provided in Table 18 of WO 2015/051318 (e.g., a sense sequence corresponding to one of the odd numbered sequences identified as SEQ ID NOs: 3685 to 4147, and an antisense sequence corresponding to one of the even numbered sequences identified as SEQ ID NOs: 3686 to 4148). The in vitro activity of the modified duplexes was tested as described below.
The in vitro activity of the siRNAs in suppressing ALAS 1 mRNA was tested in a single dose screen in Hep3B cells that were transfected using Lipofectamine2000 as a transfection reagent. Single dose experiments were performed at ΙΟηΜ duplex concentration and analyzed by branched DNA (bDNA) assay. The results are shown in Table 19 of WO 2015/051318 and are expressed as percent remaining mRNA.
The two hundred thirty-two duplexes that were tested suppressed ALASl mRNA to varying extents in this single dose assay. According to this assay, at least four of the duplexes (AD-59453, AD-59395, AD-59477, and AD-59492) suppressed ALASl mRNA by 85% or more, 39 of the duplexes suppressed ALAS l mRNA by 80% or more, 101 of the duplexes suppressed ALASl mRNA by 70% or more, and 152 of the duplexes suppressed ALASl mRNA by 50% or more. In contrast, some duplexes did not show appreciable suppression in this assay.
Example 13; Dose responsive inhibition of porphyrin precursors ALA and PBG using ALASl siRNA
The dose response effects of an ALASl siRNA were investigated in a mouse model of
AIP (see Example 5). This model shows -30% residual PBGD activity, ~2 fold increase in basal ALA and PBG levels, -30-100 fold increase in ALA and PBG levels following induction by injections of Phenobarbital once per day for 3-4 days. Older animals have axonal degeneration and impaired motor function.
The ALASl siRNA used in this example was the AD-53558 duplex in the AF11 formulation. On day 1, the mice were administered 1 mg/kg, 0.5 mg/kg, 0.1 mg/kg, or 0.05 mg/kg of ALASl siRNA or LUC AD- 1955 control by i.v. injection. Three phenobarbital injections were given (1 injection per day on days 2, 3, and 4) to induce hepatic ALAS l and the porphyrin precursors, ALA and PBG. Plasma and overnight urine specimens were collected on day 5 and metabolite levels were measured by LC-MS. Baseline levels of ALA and PBG were measured prior to the first treatment on day 1. The results are shown in FIG. 16 of WO
2015/051318. The ALAS l siRNA inhibited ALA and PBG levels in a dose dependent manner. The inhibitory effect on plasma ALA levels was observed at ALAS 1 siRNA doses as low as 0.05 mg/kg, and the inhibitory effect on plasma PBG levels was seen at siRNA doses as low as 0.1 mg/kg.
Example 14: Durable inhibition of porphyrin precursors ALA and PBG using ALASl siRNA
The durability of the effects of an ALASl siRNA was investigated in a mouse model of AIP (see Example 5). The ALASl siRNA used in this example was the AD-53558 duplex in the AF1 1 formulation. The experimental design and results of this experiment are shown in FIG. 17 of WO 2015/051318. On day 1, mice were administered 1 mg/kg of ALASl siRNA or LUC AD-1955 control by i.v. injection. Three phenobarbital injections were given in week 0 (1 injection per day on days 2, 3, and 4), week 2 (1 injection per day on days 15, 16, and 17), and week 4 (1 injection per day on days 29, 30, and 31 ) to induce hepatic ALASl and porphyrin precursors ALA and PBG. Plasma and overnight urine specimens were collected on days 5, 18, and 32 and metabolite levels were measured by LC-MS. Baseline levels of ALA and PBG were measured prior to the first treatment on day 1.
As is shown in FIG. 17 of WO 2015/051318, the ALAS l siRNA had a durable effect in reducing plasma ALA and PBG levels. Administration of the ALASl siRNA suppressed plasma ALA and PBG levels for at least 2 weeks. These results indicate that ALASl siRNA is an effective treatment for lowering elevated levels of ALA and PBG and thus can be used in prophylaxis, e.g., to lower chronically elevated ALA and PBG levels and to prevent recurrent porphyric attacks. Example 15: ALAS1 siRNA provides more rapid onset of action compared with hemin treatment
The effects of treatment with an ALAS1 siRNA were compared with the effects of hemin treatment in a mouse model of AIP (see Example 5). The ALAS1 siRNA used in this example was the AD-53558 duplex in the AFl 1 formulation. The experimental design and results of this experiment are shown in FIG. 18 of WO 2015/051318. Phenobarbital (PB) and
diethyldithiocarbamate (DDC) were administered on days 1, 2, and 3. DDC is another p450 inducer that, like Phenobarbital, increases the demand for heme and helps extend the induction of ALA/PBG metabolites.
Hemin at a dose of 4 mg/kg, ALAS 1 siRNA at a dose of 2 mg kg, or control treatment was administered intravenously at 8 hours after the last administration of PB and DDC.
As is shown in FIG. 18 of WO 2015/051318, the onset of treatment effects was faster with ALAS 1 siRNA treatment compared with hemin treatment. The rapid reduction of ALA and PBG with siRNA treatment indicates that siRNA is an effective treatment for acute attacks, because a rapid improvement in clinical symptoms is expected to accompany the reduction in ALA and PBG levels.
Example 16: Effects of ALAS1 siRNA GalNAc conjugate AD-58632
AD-58632 is a 21/23mer disclosed in Example 11. AD-58632 targets the human transcript NM_ 000688.4 and is also cross reactive with mouse, rat, and cynomolgous monkey mRNA transcripts. AD-58632 was the only cross reactive 21/23mer identified from a screen of about 45 compounds. Further experiments with this duplex are described in this example.
Dose dependent effects of AD-58632 in suppressing ALAS1 mRNA
The dose response effect of AD-58632 in suppressing ALAS1 mRNA, relative to
GAPDH mRNA, was investigated in rats. Doses of 30 mg kg, 10 mg/kg, and 3 mg/kg were tested. The levels of ALAS 1 mRNA were measured in liver at 72 hours after the last dose. AD- 58632, compared with PBS control, suppressed ALAS1 mRNA in a dose dependent manner (see FIG. 19 of WO 2015/051318). AD-58632 had a single dose ED50 of about 10 mg kg.
Effects of AD-58632 in Rat AIP Model
The dose response effect of the AD-58632 ALAS 1 GalNAc conjugate siRNA was further investigated in a rat AIP model. In this model, siRNA in an LNP is used to knock down the level of PBGD specifically in liver prior to inducing heme demaind with phenobarbitol. The rat AIP model shows transient PBGD siRNA knockdown in the liver, has -15% residual PBGD mRNA, and shows about a 10-50 fold increase in ALA and PBG levels upon induction by daily
Phenobarbital injection for three days.
The experimental design is depicted in FIG. 20 of WO 2015/051318. Four groups of rats were studied. One group was treated with phenobarbital (PB) only at the indicated timepoints. A second group was treated with phenobarbital and porphobilinogen deaminase (PBGD) siRNA. A third group received phenobarbital, PBGD siRNA, and a dose of 30 mg/kg of the ALAS 1 siRNA. A fourth group received phenobarbital, PBGD siRNA, and a dose of 10 mg/kg of the ALAS 1 siRNA. As is shown in FIG. 20 of WO 2015/051318, the PBGD siRNA was administered intravenously on day 1. The ALAS l GalNAc siRNA was administered on day 4. Phenobarbital injections were given on days 4, 5, 6, and 7. Urine was collected for a 24 hour period starting on day 7 and ending on day 8. Levels of liver PBGD mRNA, GAPDH mRNA, and ALAS-1 mRNA were assessed on day 8 using a bDNA assay. PBG and ALA levels in urine were determined using LC -MS.
The mRNA results are shown in FIG. 21 of WO 2015/051318. PBGD siRNA decreased PBGD mRNA level but did not decrease ALASl mRNA level. The ALAS l siRNA decreased ALAS l mRNA levels in a dose-dependent manner (see FIG. 21 of WO 2015/051318). The ALA and PBG results are shown in FIG. 22 of WO 2015/051318. ALASl siRNA decreased ALA and PBG levels in a dose-dependent manner (see FIG . 22 of WO 2015/051318).
Example 17; Split Dosing with AD-58632
The efficacy of the ALAS l siRNA GalNAc conjugate AD-58632 was investigated in two separate split dosing paradigms. For each of these studies, female Sprague Daw ey rats were used. The rats were housed in SCLR (a light cycle room that is 12 hours light on and 12 hours light off) and were sacrificed at 72 hours following the last injection. ALASl and GAPDH mRNA levels in the liver were measured using branched DNA (bDNA) assay.
Five daily doses versus one bolus dose paradigm
In the first paradigm, groups of rats were given either five doses of siRNA (one dose each day) or a single bolus dose that had the same total concentration as the sum of the five individual doses. Specifically, rats were assigned to one of the following treatment conditions: (1 ) subcutaneous injection of 6 mg/kg siRNA once per day for five days (2) subcutaneous injection of 2 mg/kg siRNA once per day for five days, (3) subcutaneous injection of 1 mg kg siRNA once per day for five days, (4) subcutaneous injection of a single bolus dose of 30 mg kg siRNA (5) subcutaneous injection of a single bolus dose of 10 mg/kg siRNA, (6) subcutaneous injection of a single bolus dose of 5 mg kg siRNA, or (7) PBS control treatment.
The results are shown in FIG. 23 of WO 2015/051318. In this paradigm, a single bolus dose of siRNA provided greater suppression of ALAS 1 mRNA than did repeated dosing of the same concentration of siRNA over the course of five days. This was true for all doses studied.
Once per week dosing for four weeks
In the second paradigm, rats were given subcutaneous injections of siRNA at one of three doses ( 10 mg/kg, 5 mg/kg, or 2.5 mg/kg) once per week for four weeks. A control group received PBS injections.
The results are shown in FIG. 24 of WO 2015/051318. Compared with single dosing, providing four weekly doses at 10 mg/kg improved the maximal knockdown achieved (ED5 is 10 mg/kg at single dose). In contrast, multiple dosing at 5 and 2.5 mg/kg per week did not improve silencing in this paradigm.
Example 18; Identification and testing of ALASl siRNAs with shorter sense and antisense strands
Further experiments were conducted to explore the effects of shortening the siRNA duplexes to 19-19mers. Five more new cross-reactive 19~19mer duplexes that bind to human (h) (NM_000688.4), rhesus monkey (rh) (XM_001090440.2), mouse (m) (NM_020559.2), and rat (r) (NM_024484.2) ALASl mRNA transcripts were identified. None of these duplexes showed results as good as the 21/23 mer AD-58632 (see FIG. 25 of WO 2015/051318).
The effects of modifying the length and overhangs on the best two 19-19mers (AD-59115 and AD-59125) were investigated (FIG. 26 and 27 of WO 2015/051318). The modified sequences are shown in Table 21 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., a modified sense sequence corresponding to one of the even numbered sequences identified as SEQ ID NOs: 4172 to 4190, and an antisense sequence corresponding to one of the even numbered sequences identified as SEQ ID NOs: 4173 to 4191 ). AD-60091 (sense and antisense sequences corresponding to SEQ ID NOs: 4176 and 4177, respectively), AD-60092 (sense and antisense sequences corresponding to SEQ ID NOs: 4180 and 4181, respectively), and AD60094 (sense and antisense sequences corresponding to SEQ ID NOs: 4186 and 4187, respectively) have non-complementary overhangs.
Overhangs improved potency. They also provided a further derivative sequence (AD-60489, which was based on AD-60095) for further structure activity relationship (SAR) studies (1 mismatch at pos23 to rodent).
Example 19; Effects of ALAS1 siRNA GalNAc conjugates AD-60489 and AD-58632
The effects of a further GalNAc conjugate ALAS 1 siRNA duplex AD-60489 were investigated and compared with the effects of AD-58632. The sequences of these duplexes are shown in Table 22 A of WO 2015/051318 and the Sequence Listing attached herewith. AD- 58632 has a sense sequence of GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfuUfL96 (SEQ ID NO: 4149) and an antisense sequence of asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg (SEQ ID NO: 4150). AD-60489 has a sense sequence of CfsasGfaAfaGfaGfUfGfuCfuCfaUfcUfuAfL96 (SEQ ID NO: 4151) and an antisense sequence of usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu (SEQ ID NO: 4152).
AD-60489 has a single mismatch to rodent ALAS1 mRNA at the 3' end of the antisense sequence. Thus, whereas AD-58632 is fully complementary with human, cynomolgous monkey, mouse, and rat sequences, AD-60489 is fully complementary only with human and cynomolgous monkey sequences.
The suppression of ALAS1 mRNA is shown in FIG. 28 of WO 2015/051318. Compared with AD-58632, AD-60489 provided more effective suppression at 3 mg/kg and 10 mg/kg and exhibited about a two fold improvement in ED50. The single dose ED50 of AD-60489 was about 5 mg/kg.
Example 20; Effects of ALAS1 siRNA GalNAc conjugates AD-60489 and AD-58632 in non-human primate studies
The effectiveness of AD-58632 and AD-60489 in suppressing liver mRNA was investigated in non-human primates. The experimental design is shown in FIG. 29 of WO
2015/051318. Doses of siRNA (5 mg/kg, 2.5 mg/kg, or 1.25 mg/kg) or PBS control in a volume of 2 mL/kg were administered subcutaneously every day for 5 days, then every 2 days for 3 weeks. ALAS l mRNA silencing was evaluated in liver tissue obtained from a liver biopsy taken on day 15. The biopsy was taken after a serum draw and prior to the administration of dose 10 (see FIG. 29 of WO 2015/051318).
Serum samples for the circulating extracellular RNA detection (cERD) method (see
Example 21 ) were collected on days -10, -3, 7, 15, 23, 31, and 43. Serum was collected for a clinical chemistry panel on days -3, 6, 30, and 43. The clinical chemistry panel included assessment of the levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), and alkaline phosphatase (ALP).
AD-58632 and AD-60489 suppressed ALASl mRNA in liver in a dose-dependent manner (see FIG. 30 of WO 2015/051318). AD-60489 showed greater efficacy than did AD- 58632. For example, at the lowest dose studied (1.25 mg/kg), AD-60489 suppressed the relative ALASl message to about 42% of the control level, whereas AD-58632 showed little suppression at this dose. At 2.5 mg kg, AD-60489 suppressed the relative ALASl message to about 26% of the control level, whereas AD-58632 suppressed the relative ALAS l message to about 64% of the control level. At 5 mg/kg, AD-60489 suppresed the relative ALAS l message to about 21% of the control level, and AD-58632 suppressed the relative ALAS l message to about 55% of the control level.
Clinical chemistry results indicated that the sustained knockdown of ALASl using the ALAS l siRNAs was safe and well tolerated. No elevations in ALT, AST, or ALP were observed.
Example 21; Effects of ALASl siRNA GalNAc conjugates AD-60489 and AD-58632 in non-human primate studies as assessed using the cERD assay
The effects of ALAS 1 siRNA GalNAc conj ugates AD-60489 and AD-58632 were assessed in non-numan primates using the circulating extracellular RNA detection (cERD) method. This method is described, e.g., in Sehgal, A. et al. Quantitation of tissue-specific target gene modulation using circulating RNA (Poster presented on February 9, 2012 at the Keystone Gene Silencing by small RNAs symposium (Vancouver, February 7-12, 2012) and in Sehgal, A. et al. Tissue-specific gene silencing monitored in circulating RNA, RNA, 20: 1 -7, published online December 19, 2013. As is shown in FIG. 29 of WO 2015/051318, serum samples for the circulating extracellular RNA detection (cERD) method were collected on days -10, -3, 7, 15, 23, 31, and 43.
For the cERD assay, serum samples were thawed on ice. 375-400 L of 8M LiCl was added to 3-3.5 mL of serum in ultracentrifuge (UC) tubes, and incubated at a temperature of 4°C for at least 1 hour. PBS was added to the top of each UC tube, leaving about 1 cm of dry space at the top of the tube to prevent walls of tubes from collapsing during spin. The tubes were dried to remove any condensation from being incubated on ice. Samples were loaded into an MC 55 Rotor under a hood, and the samples were spun at 150,(KK)-200,000g for 100-120 minutes. The supernatant was discarded from the pellet. 1 mL Trizol was added to the pellet in the UC tube, the tube was vortexed, and the contents were transferred to a 1.5 mL microcentrifuge tube. To each tube, 200 of chlorofomi was added, and the tube was inverted several times to mix. One sample was prepared at a time. The samples were spun at 13,000 RPM for 10-20 minutes at 4°C. The upper aqueous phase was transferred to a fresh 1.5 mL tube (-500 μΕ volume). An equal volume of 100% isopropanol, 1 μL· of linear acrylamind (4°), and 1710th volume of 3M NaoAc pH 5.5 or less was added to each sample (typically 500 L of isopropanol and 50 μΕ NaoAc). The sample was spun at 13,000 RPM for 10 min at 4°C. Supematants were reserved. The pellet was washed twice with ice cold 70% EtOH (500 L each wash) and spun at 13,000 RPM for ~5 min. at 4°C after each wash. The pellet was allowed to air dry for ~5 minutes and then resuspended in 2(tyh NF H20. 10 was used in cDNA reaction. The resuspended RNA was stored at -80°C.
Results
The serum mRNA knockdown as assessed using the cERD assay correlated with the results obtained from the liver biopsy. See FIG. 31 of WO 2015/051318. This is a surprising result, because ALAS l is not a serum protein. The cERD assay provided herein allows monitoring of circulating ALASl mRNA. This has the advantage, for example, that the levels of ALASl mRNA can be measured over time without doing serial liver biopsies, which would be technically difficult and expensive.
The kinetics of mRNA knockdown were determined using the cERD assay results. See FIG. 32 of WO 2015/051318. AD-60489 achieved greater than 50% knockdown, even at a dose of only 1.25 mg kg. Example 22: Safety studies of ALASl siRNAs
The following safety studies indicate that sustained knockdown of ALAS l is safe and well tolerated.
Non-human primate studies
As described above (see Example 20), in non-human primate studies, no ALT, AST, or
ALP elevations were observed after administration of AD-60489 and AD-58632.
Rat studies
In rats, a four week study was carried out with AD-58632. The siRNA was administered every day for 5 days at 10 mg kg in the first week, then every other day at 10 mg/kg for weeks 2- 4 of the study. The total exposure was 140 mg. No adverse clinical signs or body weight changes were observed. No test article related changes in hematology or coagulation parameters were observed. Furthermore, no adverse histopathology was observed. There was minimal vacuolation in spleen and minimal subcapsular" fibrosis in kidney.
Mouse studies
In mice, P450 mRNAs were assessed after ALAS 1 knockdown. Minor dose dependent increases in Cyp2bl0 were observed at 48 hours after administration of an ALASl LNP formulation. This resolved by 168 hours.
Example 23: Identification of further effective ALASl siRNAs using structure activity relationship studies
Structure activity relationship (SAR) studies, including studies described in other examples herein, were carried out to identify further effective ALAS l siRNAs derived from those that have already been identified, e.g., AD-58632 and AD-60489. Effects of chemical modifications were investigated. Chemical modifications include 1 ) 2'-0-methyl versus 2'- fluoro modifications, 2) Decrease in 2'Uf (2'fluoro modifications), 3) Add PS
(phosphorothioate), 4) Use internal dTs, and/or 5) glycol nucleic acids (GNAs). Without wishing to be bound by theory, modifications can enhance potency, e.g., through 1) better unwinding or enhanced RISC loading, or 2) better catalytic target engagement. Modifications can also enhance stability so that compounds can accumulate and perform better when multiple doses are administered. Improved activity relative to other duplexes (e.g., AD-58632 and/or AD-60489) was observed in some instances (see Table 22B of WO 2015/051318), whereas similar activity (see Table 23 of WO 2015/051318) or reduced activity (see Table 24 of WO 2015/051318) was observed in other instances. These instances are merely presented as examples based on the screening of more than 150 siRNAs. Further exemplification of SAR studies is provided herein.
Example 24: In vifro structure activity relationship studies of AD-58632
AD-58632 and siRNA derivatives of AD-58632 were generated, and some siRNAs were screened in vitro for activity. Abbreviations for chemical modifications are provided in Table 1. In vitro activity at 10 nM and 0.1 nM siRNA
The in vitro activity of the siRNAs in suppressing ALAS 1 mRNA was tested in in Hep3B cells that were transfected using Lipofectamine-2000 as a transfection reagent. Experiments were performed at the indicated siRNA concentrations (e.g., 0.1 nM, 10 nM) and analyzed by branched DNA (bDNA) assay at 24 hours post-transfection. The results are expressed as percent remaining mRNA relative to the siRNA AD-1955, a non-targeting siRNA that was used as a negative control.
Sequences of siRNAs and results of in vitro testing are provided in Table 25, Table 26, and Table 27 of W 2015/051318 and the Sequence Listing attached herewith (e.g., an sense sequence corresponding to one of the even numbered sequences identified as SEQ ID NOs: 4208 to 4396 (Table 25), SEQ ID NOs: 4398 to 4506 (Table 26), and SEQ ID NOs: 4508 to 4534 (Table 27), and an antisense sequence corresponding to one of the odd numbered sequences identified as SEQ ID NOs: 4209 to 4397 (Table 25), SEQ ID NOs: 4399 to 4507 (Table 26), and SEQ ID NOs: 4509 to 4535 (Table 27)).
As is shown in Table 25 of WO 2015/051318, in this in vitro screen, the siRNAs that provided the greatest ALAS1 mRNA suppression (greater than 80% suppression, such that less than 20% mRNA was remaining) at 10 nM concentration included AD-58632, AD-60472, AD- 60423, AD-60445, AD-60423, AD-60417, AD-60466, AD-60473, AD-60434, AD-60448, AD- 60460, AD-6041 1 , AD-60481 , AD-60486, and AD-60453, AD-60480, AD-60405, AD-60477, AD-60461, AD-60470, AD-60467, AD-60482, AD-60446, AD-60555, AD-60454, AD-60469 and AD-60463. Furthermore, in this in vitro screen, the siRNAs that provided the greatest
ALAS1 mRNA suppression (greater than 30 suppression, such that less than 70% mRNA was remaining) at 0.1 nM concentration included AD-60423, AD-58632, AD-60434, AD-60423, AD-60466, AD-60419, AD-60438, AD-60448, AD-60460, AD-60473, AD-60411, AD-60405, AD-60472, AD-60477, AD-60417. AD-60480, AD-60482, AD-60421, AD-60560, AD-60433, AD-60481 , AD-60475, AD-60555, AD-60437, AD-60550, AD-60415, AD-60463, and AD- 60443.
As is shown in Table 26 of WO 2015/051318, testing of further siRNAs revealed that the following duplexes provided greater than 80% suppression at 10 nM concentration: AD-58632, AD-60405, AD-60423, AD-60434, AD-60445, AD-60480, AD-60460, and AD-60466, and the following duplexes provided greater than 30% suppression at 0.1 nM concentration: AD-58632, AD-60405, AD-60423, AD-60434, AD-60419, AD-60480, AD-60460, and AD-60466.
ICjoS based on in vitro activity
Similar to the experiments described above, further dose-response experiments were done at 10 nM, 1.66667 nM, 0.277778 nM, 0.046296 nM, 0.007716 nM, 0.001286 nM, 0.000214 nM, and 3.57E-05 nM final duplex concentration, and IC50 values were calculated. Further sequences and ICsos of AD-58632 and AD-58632 derivative siRNAs are shown in Table 28 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., a sense sequence corresponding to one of the even numbered sequences identified as SEQ ID NOs: 4536 to 4642, and an antisense sequence corresponding to one of the odd numbered sequences identified as SEQ ID NOs: 4537 to 4643).
As is shown in Table 28 WO 2015/051318, the following duplexes had an IC50 of less than O.OlnM: AD-60845, AD-60843, AD-60849, AD-60820, AD-60848. AD-60822, AD- 60826, AD-60819, and AD-60460.
The following duplexes had an IC50 of less than 0.02 nM: AD-60845 , AD-60843, AD- 60849, AD-60820, AD-60848, AD-60822, AD-60826, AD-60819, and AD-60460, AD-60841 , AD-60842, AD-60846, AD-60847, AD-60838, AD-60419, AD-60839, AD-60835, AD- 586320, AD-60844, AD-60850, and AD-60830.
The following duplexes had an IC50 of less than 0.05 nM: AD-60845 , AD-60843, AD- 60849, AD-60820, AD-60848, AD-60822, AD-60826, AD-60819, and AD-60460, AD-60841 , AD-60842, AD-60846, AD-60847, AD-60838, AD-60419, AD-60839, AD-60835, AD- 586320, AD-60844, AD-60850, AD-60830, AD-60423, AD-60834, AD-60419, AD-60434, AD- 60825, AD-60837, AD-60823, AD-60824, AD-60840, AD-60829, AD-60893, AD-60832, and AD-60827.
Example 25; In vivo structure activity relationship studies of AD-58632
Derivatives of the AD-58632 parent siRNA were generated and screened in vivo in rats.
The sequences of siRNAs that were screened are provided in Table 29 of WO 2015/051318 (e.g., a sense sequence corresponding to one of the even numbered sequences identified as SEQ ID NOs: 4644 to 4664, and an anti sense sequence corresponding to one of the odd numbered sequences identified as SEQ ID NOs: 4645 to 4665).
A single dose of 5 mg/kg of siRNA was administered. At 5 days following
administration of the siRNA, mRNA measurements of rat ALAS l (rALAS 1) mRNA and rat GAPDH (rGAPDH) mRNA were made using bDNA assay, and tissue levels of drug were determined using qPCR. The results are provided in FIG. 33 and FIG. 34 of WO 2015/0 1318. As is shown in FIG. 33 of WO 2015/051318, at least ten duplexes (AD-60405, AD-60887, AD- 60923, AD-60434, AD-60892, AD-60419, AD-60924, AD-60445, AD-60925, and AD-60926) that were screened showed improved suppression of ALASl mRNA compared with AD-58632. Furthermore, as is shown FIG. 34 of WO 2015/051318, these duplexes (with the exception of AD-60926) achieved higher liver concentrations than did AD-58632. Example 26: Efficacy of AD-60925 and AD-60926 in a rat AIP model
The therapeutic efficacy of AD-60925 and AD-60926 (described in the previous example) was investigated in a rat AIP model. The experimental design is shown in the top of FIG. 35 of WO 2015/051318. Rats were treated with PBS or 3 mg/kg ALAS 1 -GalNAc siRNA t.i.w., Phenobarbitai (PB), and a PBGD siRNA in an AF11 LNP formulation (API 1 -PBGD) at the times indicated in FIG. 35 of WO 2015/051318. Control rats received the PBGD siRNA only, without Phenobarbitai induction.
The results are shown in FIG. 35, FIG. 36 and FIG. 37 of WO 2015/051318.
Administering Phenobarbitai induced ALASl mRNA expression and increased levels of PBG and ALA in urine, compared with the control. Treatment with a total of eight doses of 3 mg/kg of AD-60925 or AD-60926 three times per week suppressed ALAS 1 mRNA (FIG. 35 of WO 2015/051318), urine PBG (FIG. 36 and FIG. 37 of WO 2015/051318, top), and urine ALA (FIG. 36 and FIG. 37 of WO 2015/051318, bottom) Phenobarbital induced increases in ALASl mRNA, urine PBG, and ALA. The time course of treatment effects is shown in FIG. 37 of WO 2015/051318. The arrows indicate the timepoints when PB was administered. The siRNA treatment prevented phenobarbital induced increases in in ALAS 1 mRNA, urine PBG, and ALA.
Both AD-60925 and AD-60926 showed therapeutic efficacy treatment of AIP. AD-
60925 was even more effective than AD-60926 in suppressing ALASl mRNA, urine ALA, and urine PBG.
Example 27; Further in vivo structure activity relationship studies of AD-58632
Derivatives of the AD-58632 parent siRNA were generated and screened in vivo in rats.
In vivo screen, part I
The sequences of siRNAs that were screened are provided in Table 30 of WO
2015/051318 and the Sequence Listing attached herewith (e.g., a sense sequence corresponding to one of the even numbered sequences identified as SEQ ID NOs: 4666 to 4686, and an antisense sequence corresponding to one of the odd numbered sequences identified as SEQ ID NOs: 4667 to 4687).
Rats were administered four doses of 2.5 mg/kg of siRNA biweekly (two times per week) for two weeks. At 72 hours following administration of the last dose of siRNA, the animals were sacrificed and measurements of rat ALAS l (rALASl ) mRNA and rat GAPDH (rGAPDH) mRNA levels were made using bDNA assay.
As is shown in FIG. 38 of WO 2015/051318, at least four of the siRNAs (AD-60820, AD-60843, AD-60819, and AD-61 140) that were tested showed improved suppression of ALASl mRNA compared with AD-58632.
In vivo screen, part II
The sequences of the siRNAs that were screened are provided in Table 31 of WO
2015/051318 and the Sequence Listing attached herewith (e.g., a sense sequence corresponding to one of the even numbered sequences identified as SEQ ID NOs: 4688 to 4704, and an antisense sequence corresponding to one of the odd numbered sequences identified as SEQ ID NOs; 4689 to 4705. Rats were administered a single dose of 2.5 mg/kg of siRNA. At 72 hours following administration of the siRNA, mRNA measurements of rat ALASl (rALAS l) mRNA and rat GAPDH (rGAPDH) mRNA were made using bDNA assay.
As is shown in FIG. 39 of WO 2015/051318, the siRNAs AD-61141, AD-61142, AD- 60835, AD-60839, AD-61 143, AD-61144, AD-61145, and AD-61146 showed improved suppression of ALASl mRNA compared with AD-58632. The siRNA that provided the greatest suppression in this experiment was AD-60835.
Example 28; la vitro structure activity relationship studies of AD-60489
AD-60489 and siRNA derivatives of AD-60489 were generated, and some siRNAs were screened in vitro for activity. The in vitro activity of the siRNAs in suppressing ALASl mRNA was tested as described in Example 24. Sequences of siRNAs and results of in vitro testing are provided in Table 32 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., a sense sequence corresponding to one of the even numbered sequences identified as SEQ ID NOs: 4706 to 4866, and an antisense sequence corresponding to one of the odd numbered sequences identified as SEQ ID NOs: 4707 to 4867.
In the in vitro screen for which the results are shown in Table 32 of WO 2015/051318 , the siRNAs that provided the greatest ALASl mRNA suppression (greater than 80%
suppression, such that less than 20% mRNA was remaining) at 10 nM concentration included AD-60501, AD-60592, AD-60591, AD-60513, AD-60507, AD-60587, AD-60519, AD-60593, AD-60583, AD-60524, AD-60489. AD-60495, AD-60506, and AD-60582.
In the in vitro screen for which the results are shown in Table 32 of WO 2015/051318, the siRNAs that provided the greatest ALASl mRNA suppression (greater than 30%
suppression, such that less than 70% mRNA was remaining) at 0.1 nM concentration included AD-60592, AD-60591, AD-60593, AD-60587, AD-60583, AD-60589, AD-60501, AD-60507, AD-60585, AD-60489, AD-60513, AD-60582, AD-60519, AD-60541, AD-60570, AD-60584, AD-60569, AD-60558, AD-60573, AD-60556, AD-60495, AD-60523, AD-60566, and AD- 60544.
As is shown in Table 33 of WO 2015/051318 , testing of further siRNAs (e.g., a sense sequence corresponding to one of the even numbered sequences identified as SEQ ID NOs: 4868 to 4988, and an antisense sequence corresponding to one of the odd numbered sequences identified as SEQ ID NOs: 4869 to 4989) revealed that the following duplexes provided greater than 80% suppression at 10 nM concentration: AD-60489, AD-60495, AD-60501, AD-60507, AD-60513, AD-60519, AD-60583. AD-60591, AD-60592, and AD-60593, and the following duplexes provided greater than 30% suppression at 0.1 nM concentration: AD-60489, AD- 60495, AD-60501 , AD-60507, AD-60513, AD-60519, AD-60583. AD-60591. AD-60592, and AD-60593.
Further sequences of AD-60489 derivative siRNAs are provided in Table 34 of WO 2015/051318 and the Sequence Listing submitted herewith (e.g., a sense sequence corresponding to one of the even numbered sequences identified as SEQ ID NOs: 4990 to 5004, and an antisense sequence corresponding to one of the odd numbered sequences identified as SEQ ID NOs: 4991 to 5005).
As is shown inTable 35 of WO 2015/051318, a number of duplexes (e.g., a sense sequence cou'esponding to one of the even numbered sequences identified as SEQ ID NOs: 5006 to 5124, and an antisense sequence corresponding to one of the odd numbered sequences identified as SEQ ID NOs: 5007 to 5125) showed efficacy in suppressing ALAS 1 mRNA. The following duplexes had an IC50 of less than 0.01 nM: AD-60879, AD-60859, AD-60863, AD- 60854, AD-60882, AD-60874, AD-60883, AD-60875, AD-60501 , AD-60593, AD-60853, AD- 60877, AD-60878, AD-60871, and AD-60873. The following duplexes had an IC50 of less than 0.02 nM: AD-60879, AD-60859, AD-60863. AD-60854, AD-60882, AD-60874 , AD-60883. AD-60875, AD-60501, AD-60593, AD-60853, AD-60877, AD-60878, AD-60871, AD-60873, AD-60489, AD-60592, AD-60894, AD-60489, AD-60870, AD-60862, AD-60858, AD-60592, AD-60591 , AD-60872, AD-60866, AD-60905, AD-60857, AD-60513, and AD-60861. The following duplexes had an IC50 of less than 0.05 nM: AD-60879, AD-60859, AD-60863, AD- 60854, AD-60882, AD-60874 , AD-60883, AD-60875, AD-60501, AD-60593, AD-60853, AD-60877, AD-60878, AD-60871, AD-60873, AD-60489, AD-60592, AD-60894, AD-60489, AD-60870, AD-60862, AD-60858, AD-60592, AD-60591, AD-60872, AD-60866, AD-60905, AD-60857, AD-60513, AD-60861, AD-60583.2, AD-60902.1, AD-60881.1, AD-60519.2, AD- 60507.2, AD-60591.3, AD-60851.1. AD-60896.1, and AD-60537.2. Example 29: /// vivo structure activity relationship studies of AD-60489
Derivatives of the AD-60489 parent siRNA were generated and screened in vivo in rats. In vivo screen 1 of AD-60489 derivatives
The sequences of the siRNAs that were screened are provided in Table 36 of WO
2015/051318 and the Sequence Listing attached herewith (e.g., a sense sequence corresponding to one of the even numbered sequences identified as SEQ ID NOs: 5126 to 5140, and an antisense sequence corresponding to one of the odd numbered sequences identified as SEQ ID NOs: 5127 to 5141 ).
Rats were administered a single dose of 3 mg/kg of siRNA. At 5 days following administration of the siRNA, mRNA measurements of rat ALAS 1 (rALAS 1 ) mRNA and rat GAPDH (rGAPDH) mRNA were made using bDNA assay, and tissue levels of drug (siRNA) were determined using qPCR.
As is shown in FIG. 40 of WO 2015/051318 (top), the siRNAs AD-60501 , AD-60519, AD-60901 , AD-60495, AD-60900, and AD-60935 showed improved suppression of ALASl mRNA compared with AD-60489. The siRNAs AD-60519, AD-60901, AD-60495, and AD- 60935 achieved higher liver levels than did AD-60489 (see FIG. 40 of WO 2015/051318, bottom). Thus, most of the duplexes that provided improved suppression of ALAS l mRNA also achieved higher liver levels.
At least for the duplexes AD-60489, AD-60519, and AD-60901, efficacy correlated with liver levels of the siRNA (see FIG. 41 of WO 2015/051318), such that a higher level of siRNA in liver was associated with greater ALASl mRNA suppression.
In vivo screen 2 of AD-60489 derivatives
The sequences of the siRNAs that were screened are provided in Table 37 of WO
2015/051318 and the Sequence Listing attached herewith (e.g., a sense sequence corresponding to one of the even numbered sequences identified as SEQ ID NOs: 5142 to 5162, and an antisense sequence corresponding to one of the odd numbered sequences identified as SEQ ID NOs: 5143 to 5163).
Rats were administered a single dose of 2.5 mg/kg of siRNA. At 5 days following administration of the siRNA, mRNA measurements of rat ALAS 1 (rALAS 1 ) mRNA and rat GAPDH (rGAPDH) mRNA were made using bDNA assay.
As is shown in FIG. 42 of WO 2015/051318, the siRNAs AD-60879, AD-61190, AD- 61191 , AD-60865, AD-60861, AD-60876, AD-61 193, and AD-60519 showed improved suppression of ALAS l mRNA compared with AD-60489. Example 30: Multidosing improves potency
To investigate the effects of administering multiple doses of siRNA, rats (n=3 per group) were administered PBS or an siRNA (AD-58632, AD-60925, AD-60419, AD-60445, AD-60892, AD-60489, AD-60519, or AD-60901 ) at a dose of 2.5 mg/kg twice per week for 2 weeks. The levels of rat ALAS l (r ALAS l) mRNA and rat GAPDH (rGAPDH) mRNA were assessed using bDNA assay. The sequences of the siRNAs that were investigated are provided in Table 38 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., a sense sequence
corresponding to one of the even numbered sequences identified as SEQ ID NOs: 5164 to 5178, and an antisense sequence corresponding to one of the odd numbered sequences identified as SEQ ID NOs: 5165 to 5179).
As is shown in FIG. 43 of WO 2015/051318, the AD-58632 derivative siRNAs AD- 60892, AD-60419, AD-60445, and AD-60925 showed improved suppression of ALAS l mRNA compared with the parent AD-58632. In addition, the AD-60489 derivative siRNAs AD-60519 and AD-60901 showed improved suppression of ALASl mRNA compared with the parent AD- 60489.
Example 31; Multidosing studies with AD-60519 and AD-60489
The therapeutic efficacy of AD-60519 was investigated in a rat AEP model. The experimental design is shown in FIG. 44 of WO 2015/051318 (top). Rats were treated with PBS or ALASl-GalNAc siRNA at either 2.5 mg/kg or 5 mg/kg two times per week for three weeks. Phenobarbital (Phenobarb) and a PBGD siRNA in an AFl 1 LNP formulation was administered at the times indicated in FIG. 44 of WO 2015/051318. A control group received PBS and the PBGD siRNA only, without Phenobarbital induction. Urine was collected at days 18-19 of the study.
The results are shown in FIG. 44 of WO 2015/051318 (bottom). Administering phenobarbital and PBS induced ALAS l mRNA expression and increased levels of PBG and ALA in urine (see FIG. 44 of WO 2015/051318), compared with PBS only. Treatment with a total of six doses of 2.5 or 5 mg/kg of AD-60519 twice per week suppressed the phenobarbital induced increases in urine PBG and urine ALA (FIG. 44 of WO 2015/051318). These results demonstrate that AD-60519 is effective in suppressing ALA and PBG when repeated doses as low as 2.5 mg/kg are administered. In particular, AD-60519 was effective in reducing increases in urine levels of PBG and ALA associated with acute attacks in the rat AIP model.
In further studies using the same experimental design but in a mouse model (see schematic at top of FIG. 44 of WO 2015/051318), the therapeutic efficacy of AD-60519 and AD-60489 in suppressing phenobarbital induced increases in serum PBG and ALA was investigated. In the PBS ("Saline") control group, administration of phenobarbital increased levels of PBG and ALA in serum (see FIG. 45 of WO 2015/051318), compared with PBS only. Treatment with a total of six doses of 2.5 or 5 mg/kg of AD-60519 or AD-60489 twice per week suppressed the phenobarbital induced increases in serum PBG and serum ALA (FIG. 44 of WO 2015/051318). These results demonstrate that both AD-60519 and AD-60489 are effective in suppressing ALA and PBG when repeated doses as low as 2.5 mg/kg are administered. In particular, AD-60519 and AD-60489 were effective in reducing increases in serum PBG and ALA associated with acute attacks.
Because treatments in this example were administered prior to the phenobarbital induction, these results indicate that AD-60519 and AD-60489 have prophylactic effects.
Example 32: Further siRNA sequences
The following AD-58632 derivative (Table 39 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., a sense sequence corresponding to one of the even numbered sequences identified as SEQ ID NOs: 5180 to 5214, and an antisense sequence corresponding to one of the odd numbered sequences identified as SEQ ID NOs: 5181 to 5215) and AD-60489 derivative (Table 40 of WO 2015/051318 and the Sequence Listing attached herewith (e.g., a sense sequence corresponding to one of the even numbered sequences identified as SEQ ID NOs: 5216 to 5236, and an antisense sequence corresponding to one of the odd numbered sequences identified as SEQ ID NOs: 5217 to 5237) siRNA sequences have also been generated.
Example 33: Further muttidose studies with AD-60519
The therapeutic efficacy of AD-60519 was investigated in a rat ΑΓΡ model like that used in Example 31. The experimental design is shown in FIG. 46 of WO 2015/051318 (top). Rats were treated with PBS or ALASl -GalNAc siRNA at 3 mg kg, 1 mg kg, or 0.3 mg/kg once per week for four weeks (treatment on day 0, day 7, day 14, and day 21). Phenobarbital (Phenobarb) and a PBGD siRNA in an AF1 1 LNP formulation were administered at the times indicated in FIG. 46 of WO 2015/051318. A control group received PBS and the PBGD siRNA only, without phenobarbital induction. Urine was collected at day 25 of the study.
The results are shown in FIG. 46 of WO 2015/051318 (bottom) and in FIG. 47 of WO 2015/051318. Administering phenobarbital and PBS induced ALAS1 mRNA expression and increased levels of PBG and ALA in urine, compai'ed with PBS only. Treatment with a total of four doses of 3 mg/kg, 1 mg/kg, or 0.3 mg/kg of AD-60519 once per week suppressed phenobarbital induced increases in levels of rat ALAS1 mRNA in liver in a dose-dependent manner (see FIG. 46 of WO 2015/051318). (The levels of rat liver ALAS 1 (rALAS l) mRNA are expressed relative to the levels of rat GAPDH mRNA.) The levels of urine PBG and urine ALA also showed dose-dependent treatment effects.
Repeated weekly doses of AD-60519 were effective in suppressing ALAS1 mRNA expression and in reducing elevated levels of ALA and PBG associated with induced acute attacks in a rat AIP model. These treatment effects were dose dependent. These results illustrate that AD-60519 can act prophylactically when dosed prior to an attack.
Example 34: Multidose effects of ALAS1 siRNA GalNAc conjugates in non-human primates
The effects of ALAS l siRNA GalNAc conjugates in suppressing liver ALASl mRNA and circulating ALAS l mRNA was investigated in a non-human primate (NHP) study. The GalNAc conjugates AD-58632. AD-60519, AD-61 193, and AD-60819 were employed. The study design is shown in Table 41 of WO 2015/051318 and in FIG. 48 of WO 2015/051318.
Each group received multiple subcutaneous doses of an ALAS l siRNA GalNAc conjugate at a dose volume of 2 mg/ml. Group 1 (n=3) received 2.5 mg/kg of 1.25 mg/ml AD- 58632 on days 1, 2, 3, 4, 5, 8, 1 1 , 15, 18, 22, and 25. Group 2 (n=3) received 1.25 mg/kg of 0.625 mg/ml AD-60519 on 1 , 2, 3, 4, 5, 8, 11 , 15, 18, 22, and 25. Group 3 (n=3) received 2.5 mg/kg of 1.25 mg/ml AD-60519 on days 1, 2, 3, 4, 5, 8, 1 1 , 15, 18, 22, and 25. Group 4 (n=3) received 2.5 mg/kg of 1.25 mg/ml AD-60519 on days 1 , 2, 3, 4, 5, 1 1 , 18, and 25. Group 5 (n=3) received 5 mg/kg of 2.5 mg ml AD-60519 on days 1, 2, 3, 4, 5, 1 1, 18, and 25. Group 6 (n=3) received 2.5 mg/kg of 1.25 mg/ml AD-61193 on days 1, 2, 3, 4, 5, 8, 1 1 , 15, 18. 22, and 25. Group 7 (n=3) received 2.5 mg kg of 1.25 mg/ml of AD-60819 on days 1 , 2, 3, 4, 5, 8, 11 , 15, 18, 22, and 25.
Serum samples for the circulating extracellular RNA detection (cERD) assay (see Example 21) were collected on days -3, 7, 13, 21, 27, 39, 46, and 60 (in FIG. 48 of WO
2015/051318, "PD Draws" indicates the days on which serum was collected). Serum was collected for a clinical chemistry panel on days -3 and 6. The clinical chemistry panel included assessment of the levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), and alkaline phosphatase (ALP). ALAS 1 mRNA silencing was evaluated in liver tissue obtained from a liver biopsy taken on day 21 {see FIG. 48 of WO 2015/051318). The biopsy was taken after a serum draw.
Suppression of ALASl mRNA levels in liver
The liver ALAS 1 mRNA levels at study day 21 are shown in FIG. 49 of WO
2015/051318. The results are shown as a percentage of the average level observed in a control group treated with PBS. Results are shown as the average values for each treatment group.
These results presented in FIG. 49 of WO 2015/051318 demonstrate that compared with control animals that received PBS treatment, all of the treatment conditions were effective in suppressing liver levels of ALASl mRNA. The treatments achieved mRNA silencing ranging from about 20% to 80% (corresponding to ALASl mRNA levels ranging from about 80% to 20% of control levels). Individual animals that received AD-58632 showed silencing of about 20-50%, with the average level of silencing being about 40% (ALAS 1 mRNA levels were on average about 60% of control levels). With all of the dosing schedules employed, AD-60519 was highly effective in suppressing ALAS l mRNA levels. Individual animals that received AD- 60519 showed silencing of between about 60% and 80% (ALASl mRNA levels were about 20% to 40% of control levels). On average, AD-60519 treatment regimens achieved silencing of between about 65% and 75%. As is disclosed herein AD-60519 is a derivative of AD-60489. Similar results for AD-60489 are described in Example 20 and shown in FIG. 30 of WO
2015/051318. Furthermore, AD-61193 (a derivative of AD-60489) and AD-60819 (a derivative of AD-58632) also achieved silencing of more than 50%. It is noteworthy that the levels of silencing reported in this example and in Example 20 {e.g., about 20% to 80%) were achieved even in a "non-induced" state; it is anticipated that in an induced state, e.g., when levels of ALASl are acutely or chronically elevated {e.g., in a patient having or at risk for a porphyria, e.g., an acute hepatic porphyria, e.g., AIP), lower levels of silencing, e.g., reduction of ALASl mRNA levels to normal or pre- attack levels, can suffice to achieve therapeutic efficacy.
Suppression of circulating extracellular ALASl mRNA levels
FIG. 50 of WO 2015/051318 shows circulating extracellular ALAS 1 mRNA levels (means and standard deviations) at each timepoint throughout the study when serum samples were obtained. The circulating extracellular ALAS l mRNA results demonstrate efficacy of mRNA silencing following multidose treatment with each of the siRNAs studied (AD60519, AD-61193, AD-60819, and AD-58632). In all groups, the greatest suppression effect on circulating ALASl mRNA was observed on day 27, following the final dose of siRNA on day 25. In all treatment groups, during the weeks after the treatment ceased, ALASl mRNA levels gradually increased and returned to baseline by the final measurement on day 60.
The most pronounced suppression of circulating ALAS 1 mRNA (maximal silencing of nearly 80%) was observed in Group 3 (2.5 mg/kg AD-60519 QDx5, BIWx3) and Group 5 (5 mg kg AD-60519, QDx5, QWx3). Group 2 (1.25 mg/kg AD-60519, QDx5, BIWx3), Group 4 (2.5 mg/kg AD-60519, QDx5, QWx3), Group 7 (2.5 mg/kg AD-60819, QDx5, BIWx3), and Group 6 (2.5 mg/kg AD-61193, QDx5, BIWx3) also showed excellent suppression, with maximal silencing (day 27) of greater than 50%. In group 1, notable silencing (more than 30% on day 27) was also achieved.
These results are consistent with the liver ALASl mRNA results and confirm the potent activity of AD-60519. At dose levels as low as 1.25 mg/kg, AD-60519 provided 65-75% silencing.
Correlation between circulating and liver ALASl mRNA levels
FIG. 27 of WO 2015/051318shows the levels of the ALASl mRNA in liver (left bars) and in serum (right bars). There is a good correlation between the relative ALAS l mRNA levels measured in liver and in serum, indicating that these measurements provide consistent results.
Example 35; Rat single dose study of AD-60519 and AD-60589 using a urine cERD assay to monitor the duration of ALASl mRNA suppression
A single dose study was conducted in rats using the ALAS l siRNA GalNAc conjugates AD-60489 and AD-60519. The efficacy of these GalNAc conjugates in inhibiting expression of ALASl mRNA was monitored using assessments of urine with a circulating extracellular RNA detection assay. The assay was similar to the assay used in Examples 21 and 34, except that urine samples were used. The urine samples were lyophilized to concentrate it. Lyophilized urine was resuspended in 4 ml d¾0 and vortexed. Then the sample was centrifuged at 4,()00xg for 10-20 minutes to pellet any debris. Remaining steps were similar to those described in Example 21.
Groups of rats were administered a single dose of 10 mg/kg of AD-60489 or AD-60519. The normalized levels of ALASl mRNA at various timepoints throughout the study are shown in FIG. 51 of WO 2015/051318. The timepoint indicated as "0 hours" is for the baseline pre-dose urine sample drawn just prior to administration of the ALASl mRNA. Results for subsequent timepoints are expressed as a fraction of the pre-dose level.
As can be seen from the results shown in FIG. 51 of WO 2015/051318, AD-60519 provided improved potency compared with AD-60489. At its maximum, the single dose of AD- 60519 provided a suppression of up to about 80%, whereas the suppression provided by AD- 60489 was about 60%. The effect of a single 10 mg kg dose of these ALASl siRNAs in suppressing ALASl mRNA lasted about 21 days. These results demonstrate the validity of the urine cERD assay for monitoring ALASl mRNA levels.
Example 36; Pharmacological effects of AD-60519 in non-human primates
A further study of the effects of the ALASl siRNA GalNAc conjugate AD-60519 was conducted in non-human primates. The study investigated the effect of weeky versus biweekly dosing, use of a loading dose versus no loading dose, and the kinetics of ALAS l mRNA silencing following a single dose. The design of the study is shown in Table 42 of WO
2015/051318 and in FIG. 52 of WO 2015/051318.
Each group received one or more subcutaneous doses of AD-60519 as provided in Table 42. Group 1 (n=3) received 2.5 mg/kg at a dose volume of 0.125 ml/kg once per week for 8 weeks (doses were administered on dose days 1, 8, 15, 22, 29, 36, 43, and 50). Group 2 (n=3) received 5 mg/kg at a dose volume of 0.25 mg/ml once per week for 8 weeks (doses were administered on dose days 1, 8, 15, 22, 29, 36, 43, and 50). Group 3 (n=3) received a loading dose of 5 mg/kg at a dose volume of 0.25 ml/kg once per day for three days followed by a maintenance dose of 5 mg/kg at a dose volume of 0.25 ml/kg once per week for 7 weeks (doses were administered on days 1, 2, 3, 8, 15, 22, 29, 36, 43, and 50). Group 4 (n=3) received a loading dose of 5 mg/kg at a dose volume of 0.25 ml/kg once per day for three days followed by a maintenance dose of 2.5 mg/kg at a dose volume of 0.125 ml/kg once per week for 7 weeks (doses were administered on days 1 , 2, 3, 8, 15, 22, 29, 36, 43, and 50). Group 5 (n=3) received 5 mg/kg at a dose volume of 0.25 ml/kg twice per week for 8 weeks (doses were administered on dose days 1 , 4, 8, 11 , 15, 18. 22, 25, 29, 32, 36, 39, 43, 46. 50, and 53). Group 6 (n=3) received a single dose of 1 mg/kg at a dose volume of 0.05 ml/kg on day 1. Group 7 (n=3) received a single dose of 10 mg kg at a dose volume of 0.5 ml/kg on day 1.
Serum samples (listed as "PD draws" in FIG 52 of WO 2015/051318), plasma samples (listed as "PK draws" in FIG 52 of WO 2015/051318) and urine samples were collected as indicated in FIG. 52 of WO 2015/051318 and in Table 43 of WO 2015/051318. The urine and serum samples were subjected to the cERD assay. All blood and urine samples collected on the day of a liver biopsy were collected prior to the liver biopsy.
The liver ALASl mRNA results are shown in FIG. 53 of WO 2015/051318. Significant ALASl mRNA suppression was achieved in all study conditions. Up to 75-80% ALASl silencing was achieved across multi-dose regimens using AD-60519. At three days after a single dose, silencing of about 15% was achieved with a single dose of 1 mg kg, and silencing of about 70% was achieved with a single dose of 10 mg/kg (see FIG. 53 of WO 2015/051318).
Comparison of the data from groups 1 and 7 reveals a slight difference in kinetics after a single dose (in group 7) versus multiple doses (group 1 ) of the same cumulative amount (30 mg administered), as assessed 3 days post-dose in group 7 and at two days after the fourth dose in group 1. In particular, greater silencing was observed after a single dose (silencing of about 70% on average in group 7 versus silencing of about 45% on average in group 1). See FIG. 54 of WO 2015/051318. This type of result was also observed in rat studies.
The serum ALASl mRNA results through day 22 are shown in FIG. 54 of WO
2015/051318 (top). The correlation between liver ALAS 1 mRNA, serum ALAS 1 mRNA, and plasma ALASl mRNA is shown in FIG. 55 of WO 2015/051318. These results demonstrate a good correlation between liver, serum, and urine ALASl mRNA levels. The results also provide further evidence demonstrating potent activity of AD-60519. Silencing of 55-75% was observed at at all dose levels across all multi-dose dosing regimens. Administering loading doses (once per day for 3 days, as in groups 3 and 4) resulted in slightly more rapid down-regulation of
ALASl mRNA. The groups that received weekly (groups 1 and 2) or biweekly doses (group 5) doses ultimately showed comparable levels of ALAS 1 mRNA suppression, indicating that accumulation over time provides sustained knockdown.
Results showing the kinetics of ALASl mRNA silencing after a single dose are shown in FIG. 54 of WO 2015/051318 (bottom). In the 1 mg/kg group, an ALASl mRNA suppression of about 20% was observed by day 6. In the 10 mg/kg group, there was a rapid, about 70% ALAS l mRNA reduction by day 4, with recovery to within 20% of baseline at day 22 (21 days post- dose). Levels of serum ALASl mRNA returned to baseline after about 2 weeks or 4 weeks following a lmg/kg or lOmg/kg single dose, respectively.
The full time course of the serum ALAS mRNA up to 8 weeks after administration of the AD-60519 is shown in FIG. 56 of WO 2015/051318. All groups reached a maximum of 80% ALAS 1 mRNA suppression following 5 to 8 weeks of ALN-AS 1 dosing. Groups with three daily doses in week 1 (QDx3) had a faster onset of ALASl mRNA suppression than those just dosed once in the first week (QWx8). All animals returned to baseline ALAS l levels, approximately 30-40 days post the last dose.
Example 37: Production of an siRNA Drug Product
ALN-60519 (FIG. 57 of WO 2015/051318) is a chemically synthesized double stranded oligonucleotide covalently linked to a ligand containing three N-acetylgalactosamine (GalNAc) residues. All nucleotides are 2'-OMe or 2'~F modified and are connected through 3 '-5' phosphodiester linkages, thus forming the sugar-phosphate backbone of the oligonucleotide. The sense strand and the antisense strand contain 21 and 23 nucleotides, respectively. The 3'-end of the sense strand is conj gated to the triantennary GalNAc moiety (referred to as L96) through a phosphodiester linkage. The antisense strand contains four phosphorothioate linkages - two at the 3' end and two at the 5' end. The sense strand contains two phosphorothioate linkages at the 5' end. The 21 nucleotides of the sense strand hybridize with the complementary 21 nucleotides of the antisense strand, thus forming 21 nucleotide base pairs and a two-base overhang at the 3'- end of the antisense strand. The two single strands, the sense strand and the antisense strand, were synthesized by conventional solid phase oligonucleotide synthesis, employing standard phosphoramidite chemistry with the 5'-hydroxyl group protected as dimethoxytriphenylmethyl (DMT) ether. Each strand was assembled from the 3' to the 5' terminus by sequential addition of protected nucleoside phosphoramidites. AD-60519, also referred to herein as ALN-60519, was formulated as a solution for Injection for subcutaneous use, referred to herein as ALN-AS1. ALN-60519 was dissolved in water for injection (WFI) and the pH was adjusted (target 7.0). The concentration of ALN- 60519 was determined and adjusted by adding WFI. The solution with a final concentration of approximately 200 mg/mL was then filter sterilized and filled into 2 mL Type I glass vials. A fill volume of approximately 0.55 mL was chosen to permit complete withdrawal of 0.5 mL of drug product.
Example 38; Measurement of Serum or Urine ALASl mRNA Levels in AIP Patients or Healthy Volunteers Using cERD Method
Non-human primate pharmacology studies with ALN -AS 1 indicated that the circulating extracellular RNA detection (cERD) method for measuring the ALASl mRNA in serum or urine was robust and reproducible. The cERD assay was also used to measure ALASl mRNA levels in serum and urine from AIP patients and healthy volunteers. Serum ALASl mRNA levels were generally increased in AIP patients relative to healthy volunteers, consistent with the role
ALASl induction plays in disease pathophysiology (FIG. 58 of WO 2015/051318). Importantly, levels of ALAS l in serum and urine within the same patient correlated with each other. In two patients that had repeat collections of urine and serum the ALAS 1 mRNA level was consistent over time. Collectively, these data indicate that ALASl mRNA can be measured in serum and urine samples from human subjects including AIP patients, and the cERD method is useful for tracking the pharmacodynamic activity of ALN- AS 1.
Example 39; Exemplary Clinical Studies
A human study can be conducted to determine the safety and tolerability of ALN- AS 1 when administered as a single dose and multiple doses to AIP patients that are asymptomatic high excreters (ASHE) (patients who have elevated levels of ALA and/or PBG, as described herein) or AIP patients who have recurrent attacks.
Secondary objectives include the characterization of plasma and urine PK for ALN-AS 1 as well as post-dose assessment of the impact of ALN-AS 1 on both plasma and urinary ALA and PBG levels. The cERD assay that measures mRNA in exosomes is used to measure serum (or plasma) and urinary 5-aminolevulinate synthase (ALAS-1 mRNA). In the asymptomatic high excreters, ALN-ASl is administered at single doses, e.g., at 0.1 , 0.35 1.0, or 2.5 mg/kg, or in repeated weekly doses, e.g., of 1 and 2.5 mg/kg, for several weeks (e.g., for 4 weeks). As a comparison, a control (e.g., placebo) treatment is administered. The safety, pharmacokinetics and effects of the drug on ALA and PBG levels is assessed. A dose of ALN-AS l that lowers ALA and PBG to within the normal reference range (e.g., a dose that normalizes ALA and/or PBG to levels below 2x the upper reference value ) can be selected for subsequent studies, e.g., in AIP patients.
In the AIP patients, the attack rate and baseline symptoms are assessed during a pre- dosing run-in period (e.g., of 12 weeks). Patients are administered ALN-AS l , e.g., at a dose of 1 -2.5 mg/kg weekly.The safety, pharmacokinetics and effects of the drug on ALA and PBG levels are assessed. In addition, changes in attack number, heme use, pain medication use, and hospitalization are monitored.
Example 40: A Randomized, Placebo Controlled, Phase I Study of ALN-ASl
Increased expression of hepatic 5-aminolevulinic acid synthase (ALAS 1) can result in overproduction of the neurotoxic porphyrin precursors 5-aminolevulinic acid (ALA) and porphobilinogen (PBG), which induces porphyria symptoms. Knockdown of ALAS 1 by ALN- AS l aims to reduce ALA/PBG production, thereby preventing attacks.
Patient Populations
The acute intermittent porphyria (AIP) patient populations included in this study are asymptomatic high excreters (ASHE) and recurrent attack patients. ASHE patients have persistenly elecated ALA/PBG and are more clinically relevant than healthy volunteers. Key biomarkers can be measured in ASHE patients and these patients are medically stable patient population (used in prior enzyme replacement trial). Recurrent attack patients have the highest unmet medical need and safety and dose regimen can be evaluated in this small subset of popublition.
Design and Objectives
Parts A and B (single ascending dose (ASD) and multiple ascending dose (MAD)) of the study are randomized, single- blinded, placebo-controlled single and multiple ascending dose studies in ASHE patients. The primary objective is to test the safety and tolerability of ALN- AS 1. The secondary objectives are characterization of ALN-AS l pharmacokinetics (PK) and pharmacodynamics (PD), e.g., lowering of ALA and PBG. The exploratory objective is to characterize circulating ALASl mRNA from the liver in urine and serum.
Part C (multiple-dose (MD)) of the study is an open label multiple dose study in recurrent attacks patients. The primary objective is to test the safety and tolerability of ALN-AS1. The secondary objective is characterization of ALN-ASl PK and PD. The exploratory objectives are to study the clinical activity of ALN-AS 1 on attack characteristics and treatment, as well as patient quality of life, and to characterize circulating ALASl mRNA from the liver in urine and serum.
Key Eligibility Criteria
The inclustion criteria for Parts A and B are, e.g., male or female, ages 18-65 years; acute intermittent porphyria (AIP), with genetic diagnosis of PBGD mutation; and urine PBG > 4 mmol/mol creatinine at screening.
The exclustion criteria for Parts A and B are, e.g., attack within 6 months of screening; heme use in past 6 months; and subjects with new prescription medication regimen within 3 months of screen. In this study, attack is defined as intense abdominal or back pain requiring hospitalization, heme use or treatment consisting of increased carbohydrate intake or pain medication.
The inclusion criteria for Part C only are, e.g., experienced at least 2 porphyria attacks in past 6 months or 1 breakthrough attack while on heme prophylaxis (or on heme prophylaxis to prevent attacks); and not currently on heme prophylaxis, or if on heme prophylaxis, willing to stop during study. Attack is defined as intense abdominal or back pain requiring hospitalization, heme use or treatment including increased carbohydrate intake or pain medication.
Design and Doses
Part A (single-ascending dose (SAD); randomized 3:1 , single-blinded, placebo- controlled, in ASHE patients): 0.035 mg/kg x 1 SC, N=4; 0.10 mg/kg x 1 SC, N=4; 0.35 mg/kg x 1 SC, N=4; 1.0 mg/kg x 1 SC, N=4; 2.5 mg/kg x 1 SC, N=4. The 0.035 mg/kg SAD cohort was dosed after the 0.10 and 0.35 mg/kg cohorts.
Part B (multiple-ascending dose (MAD); randomized 3: 1, single-blinded, placebo- controlled, in ASHE patients): Cohort 1, 0.35 mg/kg, qMx2 SC, N=4; Cohort 2, 1.0 mg/kg, qMx2 SC, N=4.
There are 4 additional cohorts for Parts A and B. Part A (single-ascending dose (SAD); randomized 3:1 , single-blinded, placebo- controlled, in ASHE patients): 0.035 mg/kg x 1 SC, N=4; 0.10 mg/kg x 1 SC, N=4; 0.35 mg/kg x 1 SC. N=4; 1.0 mg/kg x 1 SC, N=4. The 0.035 mg kg SAD cohort was dosed after the 0.10 and 0.35 mg/kg cohorts.
Part C (multiple-dose (MD); randonmized 3: 1, double-blinded, placebo controlled in AIP patients with recurrent attacks): run-in observation (4 to 24 weeks (or 1 to 6 months)); Cohort 1 x 12 weeks SC, N=4-6; Cohort 2 x 12 weeks SC, N=4-6; Cohort 3, N=4.
Results: Demographics and Baseline Disease Characteristics
Figure imgf000239_0001
* Upper Limit of Normal: ALA < 3.9 mmol/mol Cr: PBG < 1.6 mmol/mol Cr
†5 patients had >1 treatment assignment: 2 patients repeated Part A and 3 patients participated in both Part A and Part B
Results: Safety and Tolerability
ALN-AS 1 was generally well tolerated in Parts A and B of the study. No drug-related serious adverse events (SAEs) related to study drug and no discontinuations due to adverse events (AEs) were observed. Two SAD subjects (one patient in 0.035 mg kg dose group and one patient in 0.10 mg kg dose group) were hospitalized for SAE of "abdominal pain." Both events were assessed as unlikely related to ALN-AS1 by the
investigators.
The initial results indicate that 8 AEs occurred in 4 placebo-treated patients and 19 AEs occurred in 12 ALN-AS 1 -treated patients. No dose-related trend was observed. No event occurred in more than one treated subject. One patient (1 mg/kg dose) experienced a mild, transient injection site reaction (erythema). Further results indicate that in the SAD group, a total of 49 AEs were reported, including 10 AEs in 5 placebo-treated subjects and 39 AEs in 11 ALN- AS1 -treated subjects. All AEs reported were all mild-moderate in severity with the exception of one severe AE of abdominal pain (same subject noted above with the SAE at 0.10 mg/kg dose). AEs reported in >2 subjects were abdominal pain, diarrhea, and hypoesthesia. Eight related or possibly related AEs were reported in 6 subjects (1 subject each). These AEs include diarrhea, dyspepsia, hematochezia, hypoesthesia, injection site erythema, injection site pain, decreased glomerular filtration rate (GFR), and elevated creatinine (Cr). Injection site reactions (erythema and pain), both mild and transient, were seen in 2 subjects.
In the MAD group, a total of 29 AEs were reported, including 4 AEs in 1 placebo-treated subject and 25 AEs in 6 ALN- AS 1 -treated subjects. All reported AEs were mild or moderate in severity. AEs reported in >2 subjects were nasopharyngitis, pruritus, and rash. Eight related or possibly related AEs were reported in three subjects, including pruritus only (1 subject), rash only (1 subject), and pruritus and rash (1 subject). No injection site reactions were reported.
No clinically significant changes in vital signs, electrocardiogram (EKG), clinical laboratory or physical examination, or laboratory abnormalities related to study drug, were observed. One patient (0.35 mg/kg dose) had increased aspartate transaminase (AST), alanine transaminase (ALT), creatine phosphokinase (CPK) and myoglobin, which was attributed to stalling intensive weight lifting program that resolved with cessation of exercise.
Results: Pharmacodynamic Data - Liver ALAS1 mRNA from Serum
As shown in FIG. 1, ALAS l mRNA increased approximately 3 -fold in ASHE patients compared to normal healthy volunteers. Rapid, dose-dependent, and durable ALASl mRNA reduction was observed after single dose administration of ALA-AS1. As shown in FIG. 2A, initial results indicate 44 ± 8% mean (SEM) maximal reduction in the 0.35 mg/kg group (P < 0.01 vs. Placebo (Pairwise comparison vs. Placebo under baseline-adjusted ANCOVA model)). Up to 59% reduction was observed in the 0.35 mg/kg group. As shown in FIG. 2B, further results indicate 66 ± 1% mean (SEM) maximal reduction in the 2.5 mg/kg dose group. Remaining ALAS l mRNA levels after highest dose were similar to levels in normal healthy individuals. Essentially identical ALASl mRNA changes were detected in urine.
Results: SAD Pharmacodynamic Data - Urinary ALASl mRNA
As shown in FIG. 2C, rapid, dose-dependent, and durable ALASl mRNA reduction was observed after single dose administration of ALA- AS 1. Prolonged ALAS l lowering supports monthly or quarterly dosing.
Results: Pharmacodynamic Data: Urineary ALA and PBG
Rapid, dose-dependent, and durable lowering of ALA and PBG levels was observed after single dose administration of ALA-AS1. As shown in FIGs. 3 A and 4A, initial results indicate that mean (SEM) maximal reductions in the 0.35 mg/kg group were: 77 ± 7% (ALA) and 73 ± 6% (PBG); P = 0.03 and 0.06 vs. Placebo, respectively (Pairwise comparison vs. Placebo under baseline-adjusted ANCOVA model). Ongoing study in the 1.0 mg/kg group showed up to 82% (ALA) and 93% (PBG) reductions. As shown in FIGs. 3B and 4B, further results indicate that mean (SEM) maximal reductions in the 2.5 mg/kg group were: 91 ± 2% (ALA) and 96 ± 0.4% (PBG). Prolonged ALA and PBG lowering with single dose supports monthly or quarterly dosing. Normalization of ALA/PBG achieved at higher dose levels.
Results: Changes in ALASl mRNA and Urinary ALA PBG Highly Correlated
As shown in FIGs. 5A-6B, initial and further results indicate that changes in liver ALASl mRNA levels from baseline was highly correlated with changes in urine ALA and PBG levels from baseline in various patient groups.
Results: MAD Pharmacodynamic Data-Serum ALASl mRNA
Rapid, dose-dependent, and durable reduction of ALASl mRNA levels was observed. FIG. 7 shows 57 ± 2% mean (SEM) maximal reduction relative to baseline in the 1.0 mg/kg dose group. ALASl mRNA reduction was seen with administration of two doses similar to single dose. Results: MAD Pharmacodynamic Data-Urinary ALA and PBG
Rapid, dose-dependent, and durable reduction of ALA and PBG levels was observed after administration of multiple doses of ALA -AS 1. FIGs. 8 and 9 show mean (SEM) maximal reduction in the 1 mg/kg group: 86 + 2% (ALA) and 97 ± 5% (PBG). There was no additive effect for multiple doses in either 0.35 mg kg or 1.0 mg/kg dose group. Normalization of ALA PBG achieved at higher dose levels.
Summary
ALN-ASl was generally well tolerated with single or multiple (2) doses in this study. Initial results indicate that no significant AEs or laboratory abnormalities associated with drug were observed. Further results indicate that no drug-related SAEs or discontinuations due to AEs were seen. No dose-dependent AEs or clinically significant changes in vital signs, EKG, clinical laboratory or physical examination were observed.
Non-invasive method to quantify liver ALAS 1 mRNA expression demonstrated that ASHE patients had 3-fold induced ALASl mRNA compared to normal healthy subjects. Rapid, dose-dependent, and durable lowering of ALASl mRNA levels with single and multiple doses of ALN-ASl (up to 59% according to initial results; 66% with a single 2.5 mg/kg dose and 57% with multiple 1.0 mg kg dose according to further results) was observed and changes in ALASl mRNA levels were correlated with changes in ALA and PBG levels.
Rapid, dose-dependent, and durable lowering of urinary ALA and PBG levels with single and multiple doses of ALN-ASl (up to 82% and 93%, respectively, in patients administered with single 1 mg/kg dose of ALN-ASl , according to initial results) was observed in patients. Mean maximal reductions in patients administered with 0.35 mg/kg dose of ALN-ASl were 77% (ALA) and 73% (PBG). Further results indicate 91% reduction of ALA and 96% reduction of PBG in patients with a single 2.5 mg/kg dose, and 86% reduction of ALA and 97% reduction of PBG in patients with multiple 1.0 mg/kg doses. INCORPORATION BY REFERENCE
All publications, patents, and Accession numbers mentioned herein are hereby incorporated by reference in their entirety as if each individual publication or patent was specifically and individually indicated to be incorporated by reference.
EQUIVALENTS
Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

Claims

We claim:
1. A double-stranded ribonucleic acid (dsRNA) for use in a method of treating a porphyria, the method comprising administering to a subject in need of such treatment a therapeutically effective amount of said dsRNA,
wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALAS 1 RNA transcript (e.g. , SEQ ID NO: l ), which antisense strand comprises at least 20 contiguous nucleotides from the antisense sequence of UAAGAUGAGACACUCUUUCUGGU (SEQ ID NO: 4153) or
UAAGAUGAGACACUCTUUCUGGU (SEQ ID NO: 4154); and
wherein said dsRNA is administered at a dose of 0.5 to 2 mg/kg body weight of the subject once every four weeks or once every twelve weeks.
2. A double-stranded ribonucleic acid (dsRNA) for use in a method of treating a porphyria, the method comprising administering to a subject in need of such treatment a therapeutically effective amount of said dsRNA,
wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALAS 1 RNA transcript (e.g., SEQ ID NO: l ), which antisense strand comprises at least 20 contiguous nucleotides from (i) an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237, or (ii) an unmodified version of an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237; and
wherein said dsRNA is administered at a dose of 0.5 to 2 mg/kg bodyweight of the subject once every four weeks or once every twelve weeks.
3. The dsRNA for use of claim 1 or 2, wherein said dsRNA is administered at a dose of 0.5 to 2 mg/kg bodyweight of the subject once every four weeks.
4. The dsRNA for use of any of claims 1-3, wherein said dsRNA is administered at a dose of 0.5 to 2.5 g/kg bodyweight of the subject once every twelve weeks.
5. The dsRNA for use of any of the preceding claims, wherein said dsRNA is administered at a dose of 0.5 to 1.5, 0.5 to 1 , 1 to 1 .5, or 1.5 to 2 mg/kg (e.g., about 0.5, 1, 1.5, or 2 mg/kg) bodyweight of the subject once every four weeks or once every twelve weeks.
6. The dsRNA for use of any of the preceding claims, wherein said dsRNA is administered to the subject subcutaneously.
7. The dsRNA for use of any of the preceding claims, wherein the duplex region is 17-23 nucleotide pairs in length.
8. The dsRNA for use of any of the preceding claims, wherein at least one strand comprises a 3' overhang of at least 2 nucleotides.
9. The dsRNA for use of any of the preceding claims, wherein each strand is no more than 26 nucleotides in length.
10. The dsRNA for use of any of the preceding claims, wherein said dsRNA comprises at least one modified nucleotide.
1 1. The dsRNA for use of claim 10, wherein at least one modified nucleotide is chosen from a 2 -0-methyl, a 2'-fluoro modified nucleotide, and optionally one or more 5'-phosphorothioate groups, or any combination thereof.
12. The dsRNA for use of any of the preceding claims, wherein the dsRNA further comprises ligand, optionally wherein the ligand is conjugated to the 3' end of the sense strand of the dsRNA.
13. The dsRNA for use of claim 12, wherein the ligand comprises a carbohydrate, optionally wherein the ligand is a GalNAc ligand.
14. The dsRNA for use of claim 13, wherein the ligand is
Figure imgf000246_0001
15. The dsRNA for use of any of claims 12-14, wherein the ligand is attached via a bivalent trivalent branched linker.
16. The dsRNA for use of claim 15, wherein the ligand and linker are as shown in Formula XXIV:
Figure imgf000246_0002
17. The dsRNA for use of any of claims 12-16, wherein the dsRNA is conjugated to ligand L96 via a linker as shown below
Figure imgf000247_0001
18. The dsRNA for use of any of claims 12 to 17. wherein the ligand targets the dsRNA to hepatocytes.
19. The dsRNA for use of any one of the preceding claims, wherein the dsRNA comprises a sense strand consisting of a sense sequence corresponding to SEQ ID NO: 4149 or 4151, or one of the even numbered sequences identified as SEQ ID NOs: 4172 to 5236, and an antisense strand consisting of an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237.
20. The dsRNA for use of any one of the preceding claims, wherein the dsRNA has an IC5 of less than 1 nM, less than 0.05 nM, less than 0.02 nM, or less than 0.01 nM.
21. The dsRNA for use of any one of the preceding claims, wherein the dsRNA has a single dose ED50 of less than about 10 mg/kg or less than about 5 mg/kg.
22. The dsRNA for use of any one of the preceding claims, wherein the dsRNA shows improved activity compared with AD-58632 or AD-60489, optionally wherein the dsRNA is selected from the dsRNAs comprising or consisting of a sense sequence corresponding to SEQ ID NO: 4149 or 4151, or one of the even numbered sequences identified as SEQ ID NOs: 4172 to 5236; and an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237.
23. The dsRNA for use of any one of the preceding claims, wherein the sense strand comprises or consists of the sequence of CAGAAAGAGUGUCUCAUCUUA (SEQ ID NO: 4155).
24. The dsRNA for use of any of claims 1 -23, wherein:
(i) the antisense strand comprises the antisense sequence of AD-60519, wherein the antisense sequence comprises all of the modified nucleotides of AD-60519;
(ii) the antisense strand consists of the antisense sequence of AD-60519, wherein the antisense sequence comprises all of the modified nucleotides of AD-60519;
(iii) the sense strand comprises the sense sequence of AD-60519, wherein the sense sequence comprises all of the modified nucleotides of AD-60519;
(iv) the sense strand consists of the sense sequence of AD-60519, wherein the sense sequence comprises all of the modified nucleotides of AD-60519;
(v) the sense strand comprises the sense sequence of AD-60519, and the antisense strand comprises the antisense sequence of AD-60519, wherein the sense and antisense sequences comprise all of the modified nucleotides of AD-60519, or
(vi) the sense strand consists of the sense sequence of AD-60519, and the antisense strand consists of the antisense sequence of AD-60519, wherein the sense and antisense sequences comprise all of the modified nucleotides of AD-60519.
The dsRNA for use of any of claims 1-23, wherein:
(i) the antisense strand comprises the antisense sequence of AD-60489, and/or the sense strand comprises the sense sequence of AD-60489, wherein the antisense and/or sense sequence comprises all of the modified nucleotides of AD-60489, or
(ii) the antisense strand consists of the antisense sequence of AD-60489, and/or the sense strand consists of the sense sequence of AD-60489, wherein the antisense and/or sense sequence comprises all of the modified nucleotides of AD-60489.
The dsRNA for use of any of claims 1-23, wherein:
(i) the antisense strand comprises the antisense sequence of AD-61 193, and/or the sense strand comprises the sense sequence of AD-61193, wherein the antisense and/or sense sequence comprises all of the modified nucleotides of AD-61193, or (ii) the antisense strand consists of the antisense sequence of AD-61193, and/or the sense strand consists of the sense sequence of AD-61193, wherein the antisense and/or sense sequence comprises all of the modified nucleotides of AD-61193.
27. The dsRNA for use of any of claims 2-23, wherein:
(i) the antisense strand comprises the antisense sequence of AD-60819, and/or the sense strand comprises the sense sequence of AD-60819, wherein the antisense and/or sense sequence comprises all of the modified nucleotides of AD-60819, or
(ii) the antisense strand consists of the antisense sequence of AD-60819, and/or the sense strand consists of the sense sequence of AD-60819, wherein the antisense and/or sense sequence comprises all of the modified nucleotides of AD-60819.
28. The dsRNA for use of any of the preceding claims, wherein said dsRNA is administered in an unbuffered saline or water solution.
29. The dsRNA for use of any one of the preceding claims, wherein the subject is at risk for developing, or is diagnosed with, a porphyria.
30. The dsRNA for use of any one of the preceding claims, wherein the porphyria is acute intermittent porphyria or ALA-dehydratase deficiency porphyria.
31. The dsRNA for use of any one of the preceding claims, wherein (i) the dsRNA is administered after an acute attack of porphyria, (ii) the dsRNA is administered during an acute attack of porphyria, or (iii) the dsRNA is administered prophylactically to prevent an acute attack of porphyria.
32. The dsRNA for use of any one of the preceding claims, wherein the method
(i) decreases a level of a porphyrin or a porphyrin precursor (e.g., δ-aminolevulinic acid (ALA) or porphopilinogen (PBG)) in the subject, optionally wherein the level is decreased by 30% or more, 35% or more, 40% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, or 95% or more, in the subject, compared to the level before treatment, and/or
(ii) inhibits ALAS 1 expression, e.g., by 40% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, or 95% or more, in the subject, compared to the level before treatment.
33. The dsRNA for use of any one of the preceding claims, wherein said method (i) ameliorates a symptom associated with an ALAS 1 related disorder (e.g., a porphyria), (ii) decreases frequency of acute attacks of symptoms associated with a porphyria in the subject, and/or (iii) decreases incidence of acute attacks of symptoms associated with a porphyria in the subject when the subject is exposed to a precipitating factor, e.g., the premenstrual phase.
34. The dsRNA for use of any one of the preceding claims, wherein the dsRNA is administered before an acute attack of porphyria, e.g., during a prodrome.
35. The dsRNA for use of claim any one of the preceding claims, wherein the subject has an elevated level (e.g., plasma or urine level) of ALA and/or PBG and optionally wherein the subject suffers from chronic pain.
36. The dsRNA for use of any one of the preceding claims, wherein the method decreases the elevated level of ALA and/or PBG, e.g., by 30% or more, 35% or more, 40% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, or 95% or more, compared to the level before treatment.
37. The dsRNA for use of any one of the preceding claims, wherein the method decreases or prevents pain, neuropathy, and/or nerve damage.
38. The dsRNA for use of any one of the preceding claims, wherein the method prevents acute attacks of porphyria.
39. The dsRNA for use of any one of the preceding claims, wherein the dsRNA or composition comprising the dsRNA is administered repeatedly, e.g., every four weeks or every twelve weeks, for at least twenty- four weeks.
40. A dsRNA for use in a method of treating a subject with an elevated level of ALA and/or PBG, the method comprising administering to a subject in need of such treatment a
therapeutically effective amount of said dsRNA,
wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALAS 1 RNA transcript (e.g., SEQ ID NO: l), which antisense strand comprises at least 20 contiguous nucleotides from (i) an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237, or (ii) an unmodified version of an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 41 3 to 5237; and
wherein said dsRNA is administered at a dose of 0.5 to 2 mg/kg bodyweight of the subject once every four weeks or once every twelve weeks,
optionally, wherein the method is effective to decrease the level of ALA and/or PBG.
41. The dsRNA for use of claim 40, wherein the level of ALA and/or PBG is decreased by 30% or more, 35% or more, 40%' or more, 45% or more, 50% or more, 55% or more, 60%' or more,
65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, or 95% or more, compared to the level before treatment.
42. A dsRNA for use in a method of treating a subject having an increased level of ALA and/or PBG, the method comprising administering to the subject said dsRNA,
wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALAS 1 RNA transcript (e.g., SEQ ID NO: l), which antisense strand comprises at least 20 contiguous nucleotides from (i) an antisense sequence corresponding to SEQ ED NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237, or (ii) an unmodified version of an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237 ; and
wherein said dsRNA is administered at a dose of about 0.5, 1 , 1.5, or 2 mg/kg
body weight of the subject once every four weeks or once every twelve weeks, e.g., for at least twenty-four weeks, thereby reducing the level of ALA and/or PBG in said subject.
43. A dsRNA for use in a method of treating a human patient with AIP who has suffered from multiple recurrent attacks, the method comprising administering to the patient said dsRNA, wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALAS 1 RNA transcript (e.g. , SEQ ID
NO: 1 ), which antisense strand comprises at least 20 contiguous nucleotides from (i) an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237, or (ii) an unmodified version of an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237,
wherein said dsRNA is administered at a dose of 0.5 to 2 mg/kg bodyweight of the patient once every four weeks or once every twelve weeks, e.g., for at least twenty-four weeks, thereby treating said patient,
optionally wherein said method
(i) reduces the frequency of attacks,
(ii) reduces hematin use,
(iii) reduces hospitalization, and/or
(iv) improves quality of life.
44. A dsRNA for use in a method of treating a subject having a porphyria (e.g., AIP) or an elevated level of ALA and/or PBG, the method comprising subcutaneously administering to the subject a composition (e.g., a pharmaceutical composition) comprising said dsRNA,
wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALAS l RNA transcript (e.g. , SEQ ID NO: l ), which antisense strand comprises at least 20 contiguous nucleotides from (i) an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237, or (ii) an unmodified version of an antisense sequence corresponding to SEQ ID NO: 4150 or 4152, or one of the odd numbered sequences identified as SEQ ID NOs: 4173 to 5237 ; and
wherein said composition is administered at a dsRNA dose of 0.5 to 2 mg/kg bodyweight of the subject once every four weeks or once every twelve weeks.
45. The dsRNA for use of claim 44, wherein the composition is administered at a dsR A dose of 0.5 to 1.5, 0.5 to 1 , 1 to 1.5, or 1.5 to 2 mg/kg body weight, once every four weeks or once every twelve weeks.
46. The dsRNA for use of any of the preceding claims, wherein the dsRNA has one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen or all of the following:
(i) is chemically synthesized, e.g., is synthesized by solid phase oligonucleotide synthesis;
(ii) all the nucleotides in the dsRNA are modified, e.g., all the nucleotides are 2'-OMe or 2'-F modified, or a combination of 2'-OMe and 2'-F modified;
(iii) all nucleotides are connected through 3'-5' phosphodiester linkages;
(iv) the sense strand comprises or consists of 21 nucleotides;
(v) the antisense sense strand comprises or consists of 23 nucleotides;
(vi) has a blunt-end at the 3' -end of sense strand;
(vii) has a 3'-overhang, e.g., has a two-nucleotide overhang, at the 3'-end of the antisense strand;
(viii) is covalently attached to a ligand containing three N-acetylgalactosamine (GalNAc) moieties;
(ix) the 3'-end of the sense strand is conjugated to the triantennary GalNAc moiety (e.g., referred to herein as L96 as defined in Table 1 ). In one embodiment, the 3'-end is linked to the triantennary GalNAc moiety through a phosphodiester linkage;
(x) has an antisense strand that comprises one or more (e.g., four) phosphorothioate linkages, hi one embodiment, the phosphorothioate linkages are located at the 3' end and at the 5' end of the antisense strand. In one embodiment, two phosphorothioate linkages are located at the 3' end and two phosphorothioate linkages are located at the 5' end of the antisense strand;
(xi) has a sense strand that comprises one or more (e.g., two) phosphorothioate linkages. In one embodiment, the one or more (e.g., two) phosphorothioate linkages are located at the 5' end of the sense strand;
(xii) 21 nucleotides of the sense strand hybridize to the complementary 21 nucleotides of the antisense strand;
(xiii) forms 21 nucleotide base pairs and a two-base overhang at the 3'-end of the antisense strand;
(xiv) comprises, or consists of, a sense and antisense strand having the sequence of AD-
60519;
(xv) has a sense strand with 10, 12, 14, 16, 18, 19, 20 or all of the modifications of the sense strand of AD-60519;
(xvi) has an antisense strand with 10, 12, 14, 16, 18, 19, 20 or all of the modifications of the antisense strand of AD-60519; or
(xvii) has the duplex sequence and all the modifications of AD-60519.
47. A dsRNA for use in a method of treating a porphyria, the method comprising administering to a subject in need of such treatment a therapeutically effective amount of said dsRNA, wherein said dsRNA has one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen or all of the following:
(i) is chemically synthesized, e.g., is synthesized by solid phase oligonucleotide synthesis;
(ii) all the nucleotides in the dsRNA are modified, e.g., all the nucleotides are 2'-OMe or 2'-F modified, or a combination of 2'-OMe and 2'-F modified;
(iii) all nucleotides are connected through 3'-5' phosphodiester linkages;
(iv) the sense strand comprises or consists of 21 nucleotides;
(v) the antisense sense strand comprises or consists of 23 nucleotides;
(vi) has a blunt-end at the 3 '-end of sense strand;
(vii) has a 3'-overhang, e.g., has a two-nucleotide overhang, at the 3'-end of the antisense strand; (viii) is covalently attached to a ligand containing three N-acetylgalactosamine (GalNAc) moieties;
(ix) the 3'-end of the sense strand is conjugated to the triantennary GalNAc moiety (e.g., referred to herein as L96 as defined in Table 1 ). In one embodiment, the 3'-end is linked to the triantennary GalNAc moiety through a phosphodiester linkage;
(x) has an antisense strand that comprises one or more (e.g., four) phosphorothioate linkages, hi one embodiment, the phosphorothioate linkages are located at the 3' end and at the 5' end of the antisense strand. In one embodiment, two phosphorothioate linkages are located at the 3' end and two phosphorothioate linkages are located at the 5' end of the antisense strand;
(xi) has a sense strand that comprises one or more (e.g., two) phosphorothioate linkages.
In one embodiment, the one or more (e.g., two) phosphorothioate linkages are located at the 5' end of the sense strand;
(xii) 21 nucleotides of the sense strand hybridize to the complementary 21 nucleotides of the antisense strand;
(xiii) forms 21 nucleotide base pairs and a two-base overhang at the 3 '-end of the antisense strand;
(xiv) comprises, or consists of, a sense and antisense strand having the sequence of AD-
60519;
(xv) has a sense strand with 10, 12, 14, 16, 18, 19, 20 or all of the modifications of the sense strand of AD-60519;
(xvi) has an antisense strand with 10, 12, 14, 16, 18, 19, 20 or all of the modifications of the antisense strand of AD-60519; or
(xvii) has the duplex sequence and all the modifications of AD-60519,
wherein said dsRNA is administered at a dose chosen from 0.5 to 2 mg kg once every four weeks, 0.5 to 2 mg/kg once every twelve weeks, 2 to 3 mg/kg once every four weeks, 2 to 3 mg kg once every twelve weeks, or 4 to 6 mg/kg once every twelve weeks.
48. The dsRNA for use of claim 47, wherein said dsRNA is aministered at a dose chosen from about 1 mg/kg once every four weeks, about 1 mg/kg once every twelve weeks, about 2.5 mg/kg once every four weeks, about 2.5 mg/kg once every twelve weeks, or about 5 mg/kg once every twelve weeks.
49. The dsRNA for use of claim 47 or 48, wherein the dsRNA is in the form of a conjugate having the following structure:
Figure imgf000256_0001
3
Figure imgf000256_0002
Af, Cf, 6f, Uf = 2'-F fi onudeojidas
Am, Cm, 6m, Urn ~ 2'-0Me ribonucieosides
5 - phosphor ihioate
Figure imgf000256_0003
PCT/US2016/051737 2015-09-14 2016-09-14 Compositions and methods for inhibiting expression of the alas1 gene Ceased WO2017048843A1 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201562218470P 2015-09-14 2015-09-14
US62/218,470 2015-09-14
US201662383968P 2016-09-06 2016-09-06
US62/383,968 2016-09-06

Publications (1)

Publication Number Publication Date
WO2017048843A1 true WO2017048843A1 (en) 2017-03-23

Family

ID=57068201

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/051737 Ceased WO2017048843A1 (en) 2015-09-14 2016-09-14 Compositions and methods for inhibiting expression of the alas1 gene

Country Status (2)

Country Link
TW (1) TW201718857A (en)
WO (1) WO2017048843A1 (en)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10119143B2 (en) 2013-10-04 2018-11-06 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of the ALAS1 gene
US10125364B2 (en) 2012-04-10 2018-11-13 Alynylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of the ALAS1 gene
US10968452B2 (en) 2014-10-17 2021-04-06 Alnylam Pharmaceuticals, Inc. Polynucleotide agents targeting aminolevulinic acid synthase-1 (ALAS1) and uses thereof
EP3651775A4 (en) * 2017-07-13 2021-04-07 Alnylam Pharmaceuticals, Inc. METHODS OF INHIBITIONING THE GENE EXPRESSION OF HAO1 (HYDROXYACIDE OXYDASE 1 (GLYCOLATE OXYDASE))
CN113453727A (en) * 2019-02-22 2021-09-28 国立大学法人东京医科齿科大学 Optimal PS modification patterns for heterologous nucleic acids
WO2025022290A1 (en) * 2023-07-21 2025-01-30 Crispr Therapeutics Ag Modulating expression of alas1 (5'-aminolevulinate synthase 1) gene

Citations (36)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4426330A (en) 1981-07-20 1984-01-17 Lipid Specialties, Inc. Synthetic phospholipid compounds
US4534899A (en) 1981-07-20 1985-08-13 Lipid Specialties, Inc. Synthetic phospholipid compounds
WO1988004924A1 (en) 1986-12-24 1988-07-14 Liposome Technology, Inc. Liposomes with enhanced circulation time
US4837028A (en) 1986-12-24 1989-06-06 Liposome Technology, Inc. Liposomes with enhanced circulation time
WO1990004384A1 (en) 1988-10-20 1990-05-03 Royal Free Hospital School Of Medicine Liposomes
WO1991005545A1 (en) 1989-10-20 1991-05-02 Liposome Technology, Inc. Liposome microreservoir composition and method
US5225212A (en) 1989-10-20 1993-07-06 Liposome Technology, Inc. Microreservoir liposome composition and method
US5264221A (en) 1991-05-23 1993-11-23 Mitsubishi Kasei Corporation Drug-containing protein-bonded liposome
WO1994012649A2 (en) 1992-12-03 1994-06-09 Genzyme Corporation Gene therapy for cystic fibrosis
WO1994020073A1 (en) 1993-03-03 1994-09-15 Liposome Technology, Inc. Lipid-polymer conjugates and liposomes
US5356633A (en) 1989-10-20 1994-10-18 Liposome Technology, Inc. Method of treatment of inflamed tissues
WO1996010391A1 (en) 1994-09-30 1996-04-11 The University Of British Columbia Polyethylene glycol modified ceramide lipids and liposome uses thereof
US5540935A (en) 1993-12-06 1996-07-30 Nof Corporation Reactive vesicle and functional substance-fixed vesicle
US5543152A (en) 1994-06-20 1996-08-06 Inex Pharmaceuticals Corporation Sphingosomes for enhanced drug delivery
US5556948A (en) 1993-01-22 1996-09-17 Mitsubishi Chemical Corporation Phospholipid derivatized with PEG bifunctional linker and liposome containing it
WO1996040062A1 (en) 1995-06-07 1996-12-19 Georgetown University A method of transfection of cells using liposomally encapsulated nucleic acids
WO1996040964A2 (en) 1995-06-07 1996-12-19 Inex Pharmaceuticals Corporation Lipid-nucleic acid particles prepared via a hydrophobic lipid-nucleic acid complex intermediate and use for gene transfer
WO1997004787A1 (en) 1995-08-01 1997-02-13 Novartis Ag Liposomal oligonucleotide compositions
WO1997013499A1 (en) 1995-10-11 1997-04-17 The University Of British Columbia Liposomal formulations of mitoxantrone
WO1997030731A2 (en) 1996-02-21 1997-08-28 The Immune Response Corporation Method of preparing polynucleotide-carrier complexes for delivery to cells
US5665710A (en) 1990-04-30 1997-09-09 Georgetown University Method of making liposomal oligodeoxynucleotide compositions
US5705188A (en) 1993-02-19 1998-01-06 Nippon Shinyaku Company, Ltd. Drug composition containing nucleic acid copolymer
WO1999014226A2 (en) 1997-09-12 1999-03-25 Exiqon A/S Bi- and tri-cyclic nucleoside, nucleotide and oligonucleotide analogues
US5981501A (en) 1995-06-07 1999-11-09 Inex Pharmaceuticals Corp. Methods for encapsulating plasmids in lipid bilayers
WO2000003683A2 (en) 1998-07-20 2000-01-27 Inex Pharmaceuticals Corporation Liposomal encapsulated nucleic acid-complexes
WO2000022114A1 (en) 1998-10-09 2000-04-20 Ingene, Inc. PRODUCTION OF ssDNA $i(IN VIVO)
WO2000022113A1 (en) 1998-10-09 2000-04-20 Ingene, Inc. ENZYMATIC SYNTHESIS OF ssDNA
US6054299A (en) 1994-04-29 2000-04-25 Conrad; Charles A. Stem-loop cloning vector and method
WO2000066604A2 (en) 1999-05-04 2000-11-09 Exiqon A/S L-ribo-lna analogues
US6586410B1 (en) 1995-06-07 2003-07-01 Inex Pharmaceuticals Corporation Lipid-nucleic acid particles prepared via a hydrophobic lipid-nucleic acid complex intermediate and use for gene transfer
US7063860B2 (en) 2001-08-13 2006-06-20 University Of Pittsburgh Application of lipid vehicles and use for drug delivery
US7070802B1 (en) 1996-01-22 2006-07-04 Pliva, Inc. Pharmaceutical compositions for lipophilic drugs
US7157099B2 (en) 2000-05-26 2007-01-02 Italfarmaco S.P.A. Sustained release pharmaceutical compositions for the parenteral administration of hydrophilic compounds
WO2011005861A1 (en) 2009-07-07 2011-01-13 Alnylam Pharmaceuticals, Inc. Oligonucleotide end caps
WO2013155204A2 (en) * 2012-04-10 2013-10-17 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of the alas1 gene
WO2015051318A1 (en) 2013-10-04 2015-04-09 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of the alas1 gene

Patent Citations (43)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4534899A (en) 1981-07-20 1985-08-13 Lipid Specialties, Inc. Synthetic phospholipid compounds
US4426330A (en) 1981-07-20 1984-01-17 Lipid Specialties, Inc. Synthetic phospholipid compounds
WO1988004924A1 (en) 1986-12-24 1988-07-14 Liposome Technology, Inc. Liposomes with enhanced circulation time
US4837028A (en) 1986-12-24 1989-06-06 Liposome Technology, Inc. Liposomes with enhanced circulation time
EP0445131B1 (en) 1988-10-20 1994-04-27 PolyMASC Pharmaceuticals plc Liposomes
WO1990004384A1 (en) 1988-10-20 1990-05-03 Royal Free Hospital School Of Medicine Liposomes
WO1991005545A1 (en) 1989-10-20 1991-05-02 Liposome Technology, Inc. Liposome microreservoir composition and method
US5356633A (en) 1989-10-20 1994-10-18 Liposome Technology, Inc. Method of treatment of inflamed tissues
US5225212A (en) 1989-10-20 1993-07-06 Liposome Technology, Inc. Microreservoir liposome composition and method
EP0496813B1 (en) 1989-10-20 1994-12-14 SEQUUS PHARMACEUTICALS, INC. (a Delaware Corporation) Liposome microreservoir composition and method
US5013556A (en) 1989-10-20 1991-05-07 Liposome Technology, Inc. Liposomes with enhanced circulation time
US5213804A (en) 1989-10-20 1993-05-25 Liposome Technology, Inc. Solid tumor treatment method and composition
US5665710A (en) 1990-04-30 1997-09-09 Georgetown University Method of making liposomal oligodeoxynucleotide compositions
US5264221A (en) 1991-05-23 1993-11-23 Mitsubishi Kasei Corporation Drug-containing protein-bonded liposome
WO1994012649A2 (en) 1992-12-03 1994-06-09 Genzyme Corporation Gene therapy for cystic fibrosis
US5556948A (en) 1993-01-22 1996-09-17 Mitsubishi Chemical Corporation Phospholipid derivatized with PEG bifunctional linker and liposome containing it
US5705188A (en) 1993-02-19 1998-01-06 Nippon Shinyaku Company, Ltd. Drug composition containing nucleic acid copolymer
WO1994020073A1 (en) 1993-03-03 1994-09-15 Liposome Technology, Inc. Lipid-polymer conjugates and liposomes
US5540935A (en) 1993-12-06 1996-07-30 Nof Corporation Reactive vesicle and functional substance-fixed vesicle
US6054299A (en) 1994-04-29 2000-04-25 Conrad; Charles A. Stem-loop cloning vector and method
US5543152A (en) 1994-06-20 1996-08-06 Inex Pharmaceuticals Corporation Sphingosomes for enhanced drug delivery
WO1996010391A1 (en) 1994-09-30 1996-04-11 The University Of British Columbia Polyethylene glycol modified ceramide lipids and liposome uses thereof
WO1996040964A2 (en) 1995-06-07 1996-12-19 Inex Pharmaceuticals Corporation Lipid-nucleic acid particles prepared via a hydrophobic lipid-nucleic acid complex intermediate and use for gene transfer
WO1996040062A1 (en) 1995-06-07 1996-12-19 Georgetown University A method of transfection of cells using liposomally encapsulated nucleic acids
US6815432B2 (en) 1995-06-07 2004-11-09 Inex Pharmaceuticals Corp. Methods for encapsulating plasmids in lipid bilayers
US5976567A (en) 1995-06-07 1999-11-02 Inex Pharmaceuticals Corp. Lipid-nucleic acid particles prepared via a hydrophobic lipid-nucleic acid complex intermediate and use for gene transfer
US5981501A (en) 1995-06-07 1999-11-09 Inex Pharmaceuticals Corp. Methods for encapsulating plasmids in lipid bilayers
US6586410B1 (en) 1995-06-07 2003-07-01 Inex Pharmaceuticals Corporation Lipid-nucleic acid particles prepared via a hydrophobic lipid-nucleic acid complex intermediate and use for gene transfer
US6534484B1 (en) 1995-06-07 2003-03-18 Inex Pharmaceuticals Corp. Methods for encapsulating plasmids in lipid bilayers
WO1997004787A1 (en) 1995-08-01 1997-02-13 Novartis Ag Liposomal oligonucleotide compositions
WO1997013499A1 (en) 1995-10-11 1997-04-17 The University Of British Columbia Liposomal formulations of mitoxantrone
US7070802B1 (en) 1996-01-22 2006-07-04 Pliva, Inc. Pharmaceutical compositions for lipophilic drugs
WO1997030731A2 (en) 1996-02-21 1997-08-28 The Immune Response Corporation Method of preparing polynucleotide-carrier complexes for delivery to cells
WO1999014226A2 (en) 1997-09-12 1999-03-25 Exiqon A/S Bi- and tri-cyclic nucleoside, nucleotide and oligonucleotide analogues
WO2000003683A2 (en) 1998-07-20 2000-01-27 Inex Pharmaceuticals Corporation Liposomal encapsulated nucleic acid-complexes
WO2000022113A1 (en) 1998-10-09 2000-04-20 Ingene, Inc. ENZYMATIC SYNTHESIS OF ssDNA
WO2000022114A1 (en) 1998-10-09 2000-04-20 Ingene, Inc. PRODUCTION OF ssDNA $i(IN VIVO)
WO2000066604A2 (en) 1999-05-04 2000-11-09 Exiqon A/S L-ribo-lna analogues
US7157099B2 (en) 2000-05-26 2007-01-02 Italfarmaco S.P.A. Sustained release pharmaceutical compositions for the parenteral administration of hydrophilic compounds
US7063860B2 (en) 2001-08-13 2006-06-20 University Of Pittsburgh Application of lipid vehicles and use for drug delivery
WO2011005861A1 (en) 2009-07-07 2011-01-13 Alnylam Pharmaceuticals, Inc. Oligonucleotide end caps
WO2013155204A2 (en) * 2012-04-10 2013-10-17 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of the alas1 gene
WO2015051318A1 (en) 2013-10-04 2015-04-09 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of the alas1 gene

Non-Patent Citations (183)

* Cited by examiner, † Cited by third party
Title
"Current protocols in nucleic acid chemistry", JOHN WILEY & SONS, INC.
"dsRNA Research and Applications", 1993, CRC PRESS, pages: 276 - 278
"Modified Nucleosides in Biochemistry, Biotechnology and Medicine", 2008, WILEY-VCH
"The Concise Encyclopedia Of Polymer Science And Engineering", 1990, JOHN WILEY & SONS, pages: 858 - 859
AIGNER, A., J. BIOMED. BIOTECHNOL., vol. 71, 2006, pages 659
AKANEYA,Y. ET AL., J. NEUROPHYSIOL., vol. 93, 2005, pages 594 - 602
AKHTAR S.; JULIAN RL., TRENDS CELL. BIOL., vol. 2, no. 5, 1992, pages 139 - 144
ALLEN ET AL., FEBS LETTERS, vol. 223, 1987, pages 42
ALLEN, LV.; POPOVICH NG.; ANSEL HC.: "Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems", 2004, LIPPINCOTT WILLIAMS & WILKINS
ALLEN, LV; POPOVICH NG.; ANSEL HC.: "Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems", 2004, LIPPINCOTT WILLIAMS & WILKINS
ANDERSON, K.E.: "The Porphyrin Handbook: Medical Aspects of Porphyrins", 2003, article "Approaches to Treatment and Prevention of Human Porphyrias"
AOKI ET AL., CANCER GENE THERAPY, vol. 8, 2001, pages 783 - 787
ARNOLD, AS ET AL., J. HYPERTENS, vol. 25, 2007, pages 197 - 205
BALWANI, M.; DESNICK, R.J.: "Blood", vol. 120
BALWANI, M; DESNICK, R.J., BLOOD, vol. 120, 2012, pages 4496 - 4504
BERNSTEIN, NATURE, vol. 409, 2001, pages 363
BITKO, V. ET AL., NAT. MED., vol. 11, 2005, pages 50 - 55
BLOCK: "Pharmaceutical Dosage Forms", vol. 1, 1988, MARCEL DEKKER, INC., pages: 335
BLOCK: "Pharmaceutical Dosage Forms", vol. 2, 1988, MARCEL DEKKER, INC., pages: 335
BLUME ET AL., BIOCHIMICA ET BIOPHYSICA ACTA, vol. 1029, 1990, pages 91
BOESEN ET AL., BIOTHERAPY, vol. 6, 1994, pages 291 - 302
BONNET ME. ET AL., PHARM. RES., 2008
BOUT ET AL., HUMAN GENE THERAPY, vol. 5, 1994, pages 3 - 10
BRUNTON ET AL.: "Goodman & Gilman's The Pharmacological Basis of Therapeutics", 1996, MCGRAW-HILL, pages: 934 - 935
BUUR ET AL., J. CONTROL REL., vol. 14, 1990, pages 43 - 51
CHAN: "Preclinical development of a subcutaneous ALAS 1 RNAi therapeutic for treatment of hepatic porphyrias using circulating RNA quantification", MOL THER NUCLEIC ACIDS, vol. 4, 3 November 2015 (2015-11-03), pages E263
CHAN: "Preclinical development of a subcutaneous ALAS1 RNAi therapeutic for treatment of hepatic porphyrias using circulating RNA quantification", MOL THER NUCLEIC ACIDS, vol. 4, 3 November 2015 (2015-11-03), pages E263
CHIEN, PY. ET AL., CANCER GENE THER., vol. 12, 2005, pages 321 - 328
CLOWES ET AL., J. CLIN. INVEST, vol. 93, 1994, pages 644 - 651
CONSTANTINIDES ET AL., PHARMACEUTICAL RESEARCH, vol. 11, 1994, pages 1385
CONSTANTINIDES ET AL., PHARMACEUTICAL RESEARCH, vol. 11, 1994, pages 1385 - 1390
COUTURE, A ET AL., TIG, vol. 12, 1996, pages 5 - 10
CRAWFORD, R.I. ET AL., JAM ACAD DERMAFOL., vol. 33, August 1995 (1995-08-01), pages 333 - 336
CROOKE ET AL., I. PHARMACOL. EXP. THER., vol. 277, 1996, pages 923
CROOKE ET AL., J. PHARMACOL. EXP. THER., vol. 277, 1996, pages 923 - 937
DAR ET AL., HEPATOBILIARY PANCREAT DIS INT., vol. 9, 2010, pages 93 - 96
DAR, F.S. ET AL., HEPATOBILIARY PANCREAT. DIS. INT., vol. 9, no. 1, 2010, pages 93 - 96
DIAS, N., MOL CANCER TITER, vol. 1, 2002, pages 347 - 355
DOCHERTY ET AL., FASEB J., vol. 8, 1994, pages 20 - 24
DOM, G. ET AL., NUCLEIC ACIDS, vol. 32, 2004, pages E49
DOWMAN ET AL., ANN INTERN MED, vol. 154, 2011, pages 571 - 572
DU PLESSIS ET AL., ANTIVIRAL RESEARCH, vol. 18, 1992, pages 259 - 265
EL HARIRI ET AL., J. PHARM. PHARMACOL., vol. 44, 1992, pages 651 - 654
ELBASHIR ET AL., EMBO J., vol. 20, 2001, pages 6877 - 6888
ELBASHIR ET AL., GENES DE ., vol. 15, 2001, pages 188
ELDER ET AL., I INHERIT METTIB DIS., 1 November 2012 (2012-11-01)
ELMEN, J. ET AL., NUCLEIC ACIDS RESEARCH, vol. 33, no. 1, 2005, pages 439 - 447
ENGLISCH ET AL.: "Angewandte Chemie", vol. 30, 1991, pages: 613
FISHER K J ET AL., J. VIROL, vol. 70, 1996, pages 520 - 532
FLODERUS Y ET AL., CLIN GENET, vol. 62, 2002, pages 288 - 297
FLODERUS, Y. ET AL., CLINICAL CHEMISTIY, vol. 52, no. 4, 2006, pages 701 - 707
FLODERUS, Y. ET AL., CLINICAL CHEMISTRY, vol. 52, no. 4, 2006, pages 701 - 707
GABIZON ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 85, 1988, pages 6949
GASSMANN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 92, 1995, pages 1292
GNMWELLER, A. ET AL., NUCLEIC ACIDS RESEARCH, vol. 31, no. 12, 2003, pages 3185 - 3193
GREEN, T.W.: "PROTECTIVE GROUPS IN ORGANIC SYNTHESIS", 1999, WILEY-INTERSCIENCE
GROSSMAN; WILSON, CURR. OPIN. IN GENETICS AND DEVEL., vol. 3, 1993, pages 110 - 114
HAUBNER ET AL., JOUR. NUCL. MED., vol. 42, 2001, pages 326 - 336
HIGUCHI ET AL.: "Remington's Pharmaceutical Sciences", 1985, MACK PUBLISHING CO., pages: 301
HO ET AL., J. PHARM. SCI., vol. 85, 1996, pages 138 - 143
HOWARD, KA. ET AL., MOL. THER., vol. 14, 2006, pages 476 - 484
HRDINKA, M. ET AL., PHYSIOLOGICAL RESEARCH, vol. 55, no. 2, 2006, pages 119 - 136
HU, Z. S.T.P.PHARMA. SCI., vol. 4, no. 6, 1994, pages 466
IDSON: "Pharmaceutical Dosage Forms", vol. 1, 1988, MARCEL DEKKER, INC., pages: 199
ILIUM ET AL., FEBS LETT., vol. 167, 1984, pages 79
JARRETT, J., CHROMATOGR., vol. 618, 1993, pages 315 - 339
KABANOV ET AL., FEBS LETT., vol. 259, 1990, pages 327
KABANOV ET AL., FEBS LETT., vol. 259, 1990, pages 327 - 330
KATDARE, A. ET AL.: "Excipient development for pharmaceutical, biotechnology, and drug delivery", 2006, CRC PRESS
KIEM ET AL., BLOOD, vol. 83, 1994, pages 1467 - 1473
KIM SH. ET AL., JOURNAL OF CONTROLLED RELEASE, vol. 129, no. 2, 2008, pages 107 - 116
KIM, WJ. ET AL., MOL. THER., vol. 14, 2006, pages 343 - 350
KLIBANOV ET AL., FEBS LETT., vol. 268, 1990, pages 235
KOZARSKY; WILSON, CURRENT OPINION IN GENETICS AND DEVELOPMENT, vol. 3, 1993, pages 499 - 503
KUBO, T. ET AL., BIOCHEM. BIOPHYS. RES. COMM., vol. 365, no. 1, 2007, pages 54 - 61
LAM ET AL., NATURE, vol. 354, 1991, pages 82 - 84
LEE ET AL., CRITICAL REVIEWS IN THERAPEUTIC DRUG CARRIER SYSTEMS, 1991, pages 92
LETSINGER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 86, 1989, pages 6553
LETSINGER ET AL., PROC. NATL. ACID. SCI. USA, vol. 86, 1989, pages 6553 - 6556
LEUNG; SHALL: "Controlled Release of Drugs: Polymers and Aggregate Systems", 1989, VCH PUBLISHERS, pages: 185 - 215
LI ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 103, 2006, pages 17337 - 17342
LI, S. ET AL., MOL. THER., vol. 15, 2007, pages 515 - 523
LIMA ET AL., CELL, vol. 150, 2012, pages 883 - 894
LIMA, CELL, vol. 150, 2012, pages 883 - 894
LIN CS-Y ET AL., CLINICAL NEUROPHYSIOLOGY, vol. 122, 2011, pages 2336 - 2344
LIN; MATTEUCCI, J. AM. CHEM. SOC., vol. 120, 1998, pages 8531 - 8532
LINDBERG ET AL., JOURNAL OF CLINICAL INVESTIGATION, vol. 103, 1999, pages 1127 - 1134
LINDBERG ET AL., NATURE GENETICS, vol. 12, 1996, pages 195 - 199
LINDBERG ET AL., NATURE GENETICS, vol. 12, 1996, pages 195 - 219
LINDBERG, J. C/IN. INVEST., vol. 103, no. 8, 1999, pages 1127 - 1134
LIU, S., MOL. PHARM., vol. 3, 2006, pages 472 - 487
LUNDIN ET AL.: "Four mutations in the porphobilinogen deaminase gene in patients with acute intermittent porphyria..", MED GENET., vol. 32, no. 12, December 1995 (1995-12-01), pages 979 - 981
LUNDIN ET AL.: "Two new mutations in the porphobilinogen deaminase gene and a screening method using PCR amplification of specific alleles", HUM GENET., vol. 93, no. 1, January 1994 (1994-01-01), pages 59 - 62
M. BALWANI ET AL: "The porphyrias: advances in diagnosis and treatment", BLOOD, vol. 120, no. 23, 29 November 2012 (2012-11-29), pages 4496 - 4504, XP055093645, ISSN: 0006-4971, DOI: 10.1182/blood-2012-05-423186 *
M. YASUDA ET AL: "RNAi-mediated silencing of hepatic Alas1 effectively prevents and treats the induced acute attacks in acute intermittent porphyria mice", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 111, no. 21, 12 May 2014 (2014-05-12), pages 7777 - 7782, XP055165224, ISSN: 0027-8424, DOI: 10.1073/pnas.1406228111 *
MAKIMURA, H. ET AL., BMC NEUROSCI., vol. 3, 2002, pages 18
MALMSTEN, M.: "Surfactants and polymers in drug delivery", 2002, INFORMA HEALTH CARE
MANOHARAN ET AL., ANN. N. Y. ACAD. SCI., vol. 660, 1992, pages 306
MANOHARAN ET AL., ANN. N.Y. ACAD. SCI., vol. 660, 1992, pages 306 - 309
MANOHARAN ET AL., BIOORG. MED. CHEM. LET., vol. 3, 1993, pages 2765
MANOHARAN ET AL., BIOORG. MED. CHEM. LETT., vol. 4, 1994, pages 1053
MANOHARAN ET AL., BIORG. MED. CHEM, LET., vol. 4, 1994, pages 1053 - 1060
MANOHARAN ET AL., BIORG. MED. CHEM. LET., vol. 3, 1993, pages 2765 - 2770
MANOHARAN ET AL., NUCLEOSIDES & NUCLEOTIDES, vol. 14, 1995, pages 969
MANOHARAN ET AL., NUCLEOSIDES & NUCLEOTIDES, vol. 14, 1995, pages 969 - 973
MANOHARAN ET AL., TETRAHEDRON LETT., vol. 36, 1995, pages 3651
MANOHARAN ET AL., TETRAHEDRON LETT., vol. 36, 1995, pages 3651 - 3654
MARTIN ET AL., HELV. CHIM. ACTA, vol. 78, 1995, pages 486 - 504
MASTRANGELI ET AL., J. CLIN. INVEST., vol. 91, 1993, pages 225 - 234
MCNAMARA, JO. ET AL., NAT. BIOTECHNOL., vol. 24, 2006, pages 1005 - 1015
MILLER ET AL., METH. ENZYMOL., vol. 217, 1993, pages 581 - 599
MISHRA ET AL., BIOCHIM. BIOPHYS. ACTA, vol. 1264, 1995, pages 229
MISHRA ET AL., BIOCHIM. BIOPHYS. ACTA, vol. 1264, 1995, pages 229 - 237
MIYAO ET AL., DSRNA RES. DEV., vol. 5, 1995, pages 115 - 121
MOOK, OR. ET AL., MOL CANE THER, vol. 6, no. 3, 2007, pages 833 - 843
MURANISHI, CRITICAL REVIEWS IN THERAPEUTIC DRUG CARRIER SYSTEMS, vol. 7, 1990, pages 1 - 33
NARESH KUMAR ET AL: "Regulation of Adipogenesis by Natural and Synthetic REV-ERB Ligands", ENDOCRINOLOGY, vol. 151, no. 7, 1 July 2010 (2010-07-01), pages 3015 - 3025, XP055100265, ISSN: 0013-7227, DOI: 10.1210/en.2009-0800 *
NIELSEN ET AL., SCIENCE, vol. 254, 1991, pages 1497 - 1500
NYKANEN ET AL., CELL, vol. 107, 2001, pages 309
OBERHAUSER ET AL., NUCL. ACIDS RES., vol. 20, 1992, pages 533
OBERHAUSER ET AL., NUCL. ACIDS RES., vol. 20, 1992, pages 533 - 538
PAGON RA; BIRD TD; DOLAN CR ET AL.: "GeneReviews", 1993
PAL, A. ET AL., INT J. ONCOL., vol. 26, 2005, pages 1087 - 1091
PAPAHADJOPOULOS ET AL., ANN. N.Y. ACAD. SCI., vol. 507, 1987, pages 64
PHILLIPS ET AL., BLOOD, vol. 98, 2001, pages 3179 - 3185
PILLE, J. ET AL., MOL. TLIER., vol. 11, 2005, pages 267 - 274
RABINOWITZ J E ET AL., J VIROL, vol. 76, 2002, pages 791 - 801
REICH, SJ. ET AL., MOL. VIS., vol. 9, 2003, pages 210 - 216
RIEGER: "Pharmaceutical Dosage Forms", 1988, MARCEL DEKKER, INC., pages: 285
RIEGER: "Pharmaceutical Dosage Forms", vol. 1, 1988, MARCEL DEKKER, INC., pages: 285
RITSCHEL, METH. FIND. EXP. CLIN. PHARMACOL., vol. 13, 1993, pages 205
ROSENFELD ET AL., CELL, vol. 68, 1992, pages 143 - 155
ROSENFELD ET AL., SCIENCE, vol. 252, 1991, pages 431 - 434
ROSOFF: "Pharmaceutical Dosage Forms", vol. 1, 1988, MARCEL DEKKER, INC., pages: 245
SAISON-BEHMOARAS ET AL., EMBO J, vol. 10, 1991, pages 1111 - 1118
SAISON-BEHMOARAS ET AL., EMBO J., vol. 10, 1991, pages 111
SALMONS; GUNZBERG, HUMAN GENE THERAPY, vol. 4, 1993, pages 129 - 141
SAMULSKI R ET AL., J. VIROL., vol. 61, 1987, pages 3096 - 3101
SAMULSKI R ET AL., J. VIROL., vol. 63, 1989, pages 3822 - 3826
SANGHVI, Y S.: "dsRNA Research and Applications", 1993, CRC PRESS, pages: 289 - 302
SARDH ET AL., CLINICAL PHARMACOKINETICS, vol. 46, no. 4, 2007, pages 335 - 349
SCHOTT: "Remington's Pharmaceutical Sciences", 1985, MACK PUBLISHING CO., pages: 271
SEHGAL, A. ET AL.: "Quantitation of tissue-specific target gene modulation using circulating RNA", FEBRUARY 9, 2012 AT THE KEYSTONE GENE SILENCING BY SMALL RNAS SYMPOSIUM, 7 February 2012 (2012-02-07)
SEHGAL, A. ET AL.: "Quantitation of tissue-specific target gene modulation using circulating RNA", KEYSTONE GENE SILENCING BY SMALL RNAS SYMPOSIUM, 7 February 2012 (2012-02-07)
SEHGAL, A. ET AL.: "Tissue-specific gene silencing monitored in circulating RNA", RNA, vol. 20, 19 December 2013 (2013-12-19), pages 1 - 7
SHARP ET AL., GENES DEV., vol. 15, 2001, pages 485
SHEA ET AL., NUCL. ACIDS RES., vol. 18, 1990, pages 3777
SHEA ET AL., NUCL. ACIDS RES., vol. 18, 1990, pages 3777 - 3783
SHISHKINA, GT. ET AL., NEUROSCIENCE, vol. 129, 2004, pages 521 - 528
SIMEONI ET AL., NUCL. ACIDS RES., vol. 31, 2003, pages 2717 - 2724
SORENSEN, DR. ET AL., J. MOL. BIOL, vol. 327, 2003, pages 761 - 766
SOUTSCHEK, J. ET AL., NATURE, vol. 432, 2004, pages 173 - 178
SUNAMOTO ET AL., BULL. CHEM. SOC. JPN., vol. 53, 1980, pages 2778
SVINARCHUK ET AL., BIOCHIMIE, vol. 75, 1993, pages 49
SVINARCHUK ET AL., BIOCHIMIE, vol. 75, 1993, pages 49 - 54
SWINYARD: "Remington's Pharmaceutical Sciences", 1990, MACK PUBLISHING CO., pages: 782 - 783
TAKAHASHI ET AL., J. PHARM. PHARMACOL., vol. 40, 1988, pages 252
TAKAKURA ET AL., DSRNA & NUCL. ACID DRUG DEV., vol. 6, 1996, pages 177 - 183
TAN, PH ET AL., GENE THER., vol. 12, 2005, pages 59 - 66
THAKKER, ER. ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 101, 2004, pages 17270 - 17275
THUNELL S., HYDROXYMETHYLBILANE SYNTHASE DEFICIENCY, 27 September 2005 (2005-09-27)
TOLENTINO, MJ ET AL., RETINA, vol. 24, 2004, pages 132 - 138
TOMALIA, DA. ET AL., BIOCHEM. SOC. TRANS., vol. 35, 2007, pages 61 - 67
TOUITOU, E. ET AL.: "Enhancement in Drug Delivery", 2006, CRC PRESS
UNZU ET AL., MOLECULAR MEDICINE, vol. 2, 2011, pages 243 - 250
VERMA, UN. ET AL., CLIN. CANCER RES., vol. 9, 2003, pages 1291 - 1300
WALSH ET AL., PROC. SOC. EXP. BIOL. MED., vol. 204, 1993, pages 289 - 300
WANG ET AL., BIOCHEM. BIOPHYS. RES. COMMUN., vol. 147, 1987, pages 980 - 985
WANG ET AL., GENE THERAPY, vol. 2, 1995, pages 775 - 783
WEINER ET AL., JOURNAL OF DRUG TARGETING, vol. 2, 1992, pages 405 - 410
WU ET AL., CANCER RESEARCH, vol. 53, 1993, pages 3765
WU ET AL., GENES DEV, vol. 23, 2009, pages 2201 - 2209
XIA H ET AL., NAT. BIOTECH., vol. 20, 2002, pages 1006 - 1010
YAMAMOTO ET AL., J. PHARM. EXP. THER., vol. 263, 1992, pages 25
YAMASHITA ET AL., J. PHANN. SCI., vol. 79, 1990, pages 579 - 583
YAMASHITA ET AL., J. PHARM. PHARMACOL., vol. 39, 1987, pages 621 - 626
YASUDA ET AL., MOLECULAR MEDICINE, vol. 1, 2010, pages 17 - 22
YASUDA, M.; YU, C.; ZHANG, J.; CLAVERO, S.; EDELMANN, W.; GAN, L.; PHILLIPS, J.D.; DESNICK, R.J.: "Abstract of Presentation", 14 October 2011, AMERICAN SOCIETY OF HUMAN GENETICS, article "Acute intermittent porphyria: A severely affected knock-in mouse that mimics the human homozygous dominant phenotype"
YOO, H. ET AL., PHARM. RES., vol. 16, 1999, pages 1799 - 1804
ZHANG, X. ET AL., J. BIOL. CHEM., vol. 279, 2004, pages 10677 - 10684
ZHOU ET AL., JOURNAL OF CONTROLLED RELEASE, vol. 19, 1992, pages 269 - 274
ZIMMERMANN, TS. ET AL., NATURE, vol. 441, 2006, pages 111 - 114
ZITZMANN ET AL., CANCER RES., vol. 62, 2002, pages 5139 - 43

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10125364B2 (en) 2012-04-10 2018-11-13 Alynylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of the ALAS1 gene
US10400239B2 (en) 2012-04-10 2019-09-03 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of the ALAS1 gene
US10119143B2 (en) 2013-10-04 2018-11-06 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of the ALAS1 gene
US11028392B2 (en) 2013-10-04 2021-06-08 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of the ALAS1 gene
US10968452B2 (en) 2014-10-17 2021-04-06 Alnylam Pharmaceuticals, Inc. Polynucleotide agents targeting aminolevulinic acid synthase-1 (ALAS1) and uses thereof
EP3651775A4 (en) * 2017-07-13 2021-04-07 Alnylam Pharmaceuticals, Inc. METHODS OF INHIBITIONING THE GENE EXPRESSION OF HAO1 (HYDROXYACIDE OXYDASE 1 (GLYCOLATE OXYDASE))
CN113453727A (en) * 2019-02-22 2021-09-28 国立大学法人东京医科齿科大学 Optimal PS modification patterns for heterologous nucleic acids
EP3928799A4 (en) * 2019-02-22 2023-10-18 National University Corporation Tokyo Medical and Dental University OPTIMAL PS MODIFICATION PATTERN FOR HETEROPOLY ACIDS
WO2025022290A1 (en) * 2023-07-21 2025-01-30 Crispr Therapeutics Ag Modulating expression of alas1 (5'-aminolevulinate synthase 1) gene

Also Published As

Publication number Publication date
TW201718857A (en) 2017-06-01

Similar Documents

Publication Publication Date Title
AU2020202970B2 (en) Compositions and methods for inhibiting expression of the alas1 gene
US20250122505A1 (en) Compositions and methods for inhibiting expression of the alas1 gene
WO2017048843A1 (en) Compositions and methods for inhibiting expression of the alas1 gene
HK40058083A (en) Compositions and methods for inhibiting expression of the alas1 gene
HK1221738B (en) Compositions and methods for inhibiting expression of the alas1 gene
OA17746A (en) Compositions and methods for inhibiting expression of the ALAS1 gene.

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16775917

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16775917

Country of ref document: EP

Kind code of ref document: A1