OA17746A - Compositions and methods for inhibiting expression of the ALAS1 gene. - Google Patents

Compositions and methods for inhibiting expression of the ALAS1 gene. Download PDF

Info

Publication number
OA17746A
OA17746A OA1201600120 OA17746A OA 17746 A OA17746 A OA 17746A OA 1201600120 OA1201600120 OA 1201600120 OA 17746 A OA17746 A OA 17746A
Authority
OA
OAPI
Prior art keywords
dsrna
alas1
sequence
antisense
nucléotides
Prior art date
Application number
OA1201600120
Inventor
Brian Bettencourt
Kevin Fitzgerald
William Querbes
Robert J. Desnick
Makiko YASUDA
Original Assignee
Alnylam Pharmaceuticals, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Alnylam Pharmaceuticals, Inc. filed Critical Alnylam Pharmaceuticals, Inc.
Publication of OA17746A publication Critical patent/OA17746A/en

Links

Abstract

The invention relates to double-stranded ribonucleic acid (dsRNA) compositions targeting the ALAS1 gene, and methods of using such dsRNA compositions to alter (e.g., inhibit) expression of ALAS1.

Description

COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF THE
ALAS1 GENE
Related Applications
This application daims priority to U.S. provisional application number 61/887288 filed on October 4, 2013 and to U.S. provisional application number 61/983720 filed on April 24, 2014. The entire content of each of the foregoing applications is hereby incorporated herein by reference.
Sequence Listing
The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on October 2, 2014, is named A2038-7202WO_SL.txt and is 1,107,486 bytes in size.
Field of the Invention
The invention relates to the spécifie inhibition ofthe expression of the ALAS1 gene.
Background of the Invention
The inherited porphyrias are a family of disorders resulting from the déficient activity of spécifie enzymes in the heme biosynthetic pathway, also referred to herein as the poiphyrin pathway. Deficiency in the enzymes of the poiphyrin pathway leads to insufficient heme production and to an accumulation of porphyrin precursors and porphyrins, which are toxic to tissue in high concentrations.
Ofthe inherited porphyrias, acute intermittent porphyria (AIP, e.g., autosomal dominant AEP), variegate porphyria (VP, e.g., autosomal dominant VP), hereditary coproporphyria (copropophyria or HCP, e.g., autosomal dominant HCP), and 5’ aminolevulinic acid (also known as δ- aminolevulinic acid or ALA) dehydratase deficiency porphyria (ADP, e.g., autosomal récessive ADP) are classified as acute hepatic porphyrias and are manifested by acute neurological attacks that can be life threatening. The acute attacks are characterized by autonomie, peripheral, and central nervous symptoms, including severe abdominal pain, hypertension, tachycardias, constipation, motor weakness, paralysis, and seizures. If not treated properly, quadriplegia, respiratory impairment, and death may ensue. Various factors, including cytrochrome P450-inducing drugs, dieting, and hormonoal changes can precipitate acute attacks by increasing the activity of hepatic 5’-aminolevulinic acid synthase 1 (ALAS1) , the first and rate-limiting enzyme of the heme biosynthetic pathway. In the acute porphyrias, e.g., AIP, VP, HCP and ADP, the respective enzyme deficiencies resuit in hepatic production and accumulation of one or more substances (e.g., porphyrins and/or porphyrin precursors, e.g., ALA and/or PBG) that can be neurotoxic and can resuit in the occurrence of acute attacks. See, e.g., Balwani, M and Desnick, R.J., Blood, 120:4496-4504, 2012.
The current therapy for the acute neurologie attacks is the intravenous administration of hemin (Panhematin®, Lundbeck or Normosang®, Orphan Europe), which provides exogenous heme for the négative feedback inhibition of ALAS1, and thereby, decreases production of ALA and PBG. Hemin is used for the treatment during an acute attack and for prévention of attacks, particularly in women with the actue porphyrias who expérience frequent attacks with the hormonal changes during their menstrual cycles. While patients generally respond well, its effect is slow, typically taking two to four days or longer to normalize urinary ALA and PBG concentrations towards normal levels. As the intravenous hemin is rapidly metabolized, three to four infusions are usually necessary to effectively treat or prevent an acute attack. In addition, repeated infusions may cause iron overload and phlebitis, which may compromise peripheral venous access. Although orthotrophic liver transplantation is curative, this procedure has significant morbidity and mortality and the availability of liver donors is limited. Therefore, an alternative therapeutic approach that is more effective, fast-acting, and safe is needed. It would be particularly advantageous if such treatment could be delivered by subcutaneous administration, as this would preclude the need for infusions and prolonged hospitalization.
AIP, also referred to as porphobilinogen deaminase (PBGD) deficiency, or hydroxymethylbilane synthase (HMBS) deficiency, is the most common of the acute hepatic prophyrias. The prevalence of AIP is estimated to be 5-10 in 100,000, with about 5-10% of patients being symptomatic. AIP is an autosomal dominant disorder caused by mutations in the HMBS gene that resuit in reduced, e.g., half-normal activity of the enzyme. Previously, a mouse model of AIP that has -30% of wildtype HMBS activity was generated by homologous recombination. Like human patients, these mice increase hepatic ALAS1 activity and accumulate large quantities of plasma and urinary ALA and PB G when administered poiphyiinogenic drugs, such as phénobarbital. Thus, they serve as an excellent model to evaluate the efficacy of novel therapeutics for the acute hepatic porphyrias.
Summary of the Invention
The présent invention describes methods and iRNA compositions for modulating the expression of an ALAS1 gene. In certain embodiments, expression of an ALAS1 gene is reduced or inhibited using an ALAS1-spécifie iRNA. Such inhibition can be useful in treating disorders related to ALAS1 expression, such as porphyrias.
Accordingly, described herein are compositions and methods that effect the RNAinduced silencing complex (RlSC)-mediated cleavage ofRNA transcripts ofthe ALAS1 gene, such as in a cell or in a subject (e.g., in a mammal, such as a human subject). Also described are compositions and methods for treating a disorder related to expression of an ALAS1 gene, such as aporphyria, e.g., X-linked sideroblastic anémia (XLSA), ALA deyhdratase deficiency porphyria (Doss porphyria or ADP), acute intermittent porphyria (AIP), congénital erythropoietic porphyria (CEP), prophyria cutanea tarda (PCT), hereditary coproporphyria (coproporphyria, or HCP), variegate poiphyria (VP), erythropoietic protoporphyria (EPP), or transient erythroporphyria of infancy. In some embodiments, the disorder is an acute hepatic porphyria, e.g., ALA deyhdratase deficiency porphyria (ADP), AIP, HCP, or VP. In certain embodiments, the disorder is ALA deyhdratase deficiency poiphyria (ADP) or AIP.
In embodiments, the porphyria is a hepatic porphyria, e.g., a porphyria selected from acute intermittent porphyria (AIP) hereditary copropoiphyria (HCP), variegate poiphyria (VP), ALA deyhdratase deficiency porphyria (ADP), and hepatoerythropoietic porphyria. In embodiments, the porphyria is a homozygous dominant hepatic porphyria (e.g., homozygous dominant AIP, HCP, or VP) or hepatoerythropoietic porphyria, In embodiments, the porphyria is a dual porphyria.
As used herein, the term “iRNA,” “RNAi”, “iRNA agent,” “RNAi agent,” or “iRNA molécule,” refers to an agent that contains RNA as that term is defined herein, and which médiates the targeted cleavage of an RNA transcript, e.g., via an RNA-induced silencing complex (RISC) pathway. In one embodiment, an iRNA as described herein effects inhibition of ALAS1 expression in a cell or mammal.
The iRNAs included in the compositions featured herein encompass a dsRNA having an RNA strand (the antisense strand) having a région, e.g., a région that is 30 nucléotides or less, generally 19-24 nucléotides in length, that is substantially complementary to at least part of an mRNA transcript of an ALAS1 gene (e.g., a mouse or human ALAS1 gene) (also referred to herein as an “ALAS1-spécifie iRNA”). Altematively, or in combination, iRNAs encompass a dsRNA having an RNA strand (the antisense strand) having a région that is 30 nucléotides or less, generally 19-24 nucléotides in length, that is substantially complementary to at least part of an mRNA transcript of an ALAS1 gene (e.g., a human variant 1 or 2 of an ALAS1 gene) (also referred to herein as a “ALAS1-spécifie iRNA”).
In embodiments, the iRNA (e.g, dsRNA) described herein comprises an antisense strand having a région that is substantially complementary to a région of a human ALAS1. In embodiments, the human ALAS1 has the sequence of NM_000688.4 (SEQ ID NO:1) or NM_000688.5 (SEQ ID NO:382). In embodiments, the human ALAS1 has the sequence of NM_199166.1.
In embodiments, the antisense sequence of the iRNA (e.g., dsRNA) targets within the région 871 to 895 (plus or minus 5, 4, 3, 2, or 1 nucléotides in either or both directions on the 5’ and/or 3’ end) on the ALAS1 transcript NM_000688.4. In embodiments, the antisense sequence targets the nucléotides 871 to 893, 871 to 892, or 873 to 895 on the ALAS1 transcript NM_000688.4. In embodiments, the antisense sequence comprises or consists of a sequence that is fully complementary or substantially complementary to nucléotides 871 to 893, 871 to 892, or 873 to 895 on the ALAS1 transcript NM_000688.4.
In one aspect, a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1 is provided, wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a région of complementarity to an ALAS1 RNA transcript, which antisense strand comprises at least 15 (e.g., at least 16, 17, 18, 19, 20, 21, 22, or 23) contiguous nucléotides differing by no more than 3, 2 or 1 nucléotides from the sequence of UAAGAUGAGACACUCUUUCUGGU (SEQ ID NO: 4153) or UAAGAUGAGACACUCTUUCUGGU (SEQ ID NO: 4154). In embodiments, the antisense strand comprises the sequence of UAAGAUGAGACACUCUUUCUGGU (SEQ ID NO: 4153) or UAAGAUGAGACACUCTUUCUGGU (SEQ ID NO: 4154). In embodiments, the sense strand comprises the sequence of CAGAAAGAGUGUCUCAUCUUA (SEQ ID NO: 4155). In embodiments, one or more nucléotides of the antisense strand and/or sense strand are modified as described herein. In embodiments, the dsRNA comprises (i) an antisense strand that comprises, or consists of, the antisense sequence of AD-60489, AD-60519, or AD-61193 and/or (ii) a sense strand that comprises, or consists of, the sense sequence of AD-60489, AD-60519, or AD-61193 (including one or more (e.g., ail) of the modifications of the antisense strand and/or antisense strand of AD-60489, AD-60519, or AD-61193).
In one aspect, a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1 is provided, wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a région of complementarity to an ALAS1 RNA transcript, which antisense strand comprises at least 15 (e.g., at least 16, 17, 18, 19, 20, 21, 22, or 23) contiguous nucléotides differing by no more than 3 (e.g., by no more than 0, 1 or 2) nucléotides from an antisense sequence listed in any one of Tables 21 to 40, or an unmodifîed version of an antisense sequence (e.g., a version having the same nucléotide sequence except that some or ail of the nucléotides are unmodifîed) listed in any one of Tables 21 to 40. In one embodiment, the antisense sequence comprises at least 15 (e.g., at least 16, 17, 18, 19, 20, 21, 22, or 23) contiguous nucléotides differing by no more than 3 (e.g., by no more than 0, 1 or 2) nucléotides from (i) the antisense sequence of AD-60489, AD-60519, or AD-61193 or (ii) an unmodifîed version of any one of these sequences. In embodiments, the antisense strand comprises at least (e.g., at least 16, 17, 18, 19, 20, 21, 22, or 23) contiguous nucléotides differingby no more than 3 (e.g., by no more than 0, 1 or 2) nucléotides from the sequence of UAAGAUGAGACACUCUUUCUGGU (SEQ ID NO: 4153) or UAAGAUGAGACACUCTUUCUGGU (SEQ ID NO: 4154). In an embodiment, the antisense sequence targets positions 871-893 of NM_000688.4 (SEQ ID NO:1). In embodiments, the sense strand comprises the sequence of CAGAAAGAGUGUCUCAUCUUA (SEQ ID NO: 4155). In embodiments, one or more nucléotides of the antisense strand and/or sense strand are modified as described herein.
In some embodiments, the dsRNA is not a sense and/or antisense sequence listed in any one of Tables 2, 3, 6, 7, 8, 9, 14, 15, 18 or 20.
In one embodiment, a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1 is provided, wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a région of complementarity to an ALAS1 RNA transcript, which antisense strand comprises at least 15 (e.g., at least 16, 17, 18, 19, 20, 21, 22, or 23) contiguous nucléotides differing by no more than 3 nucléotides, no more than 2 nucléotides, or no more than one nucléotide, from the antisense sequence of AD-60519. In embodiments, one or more nucléotides are modified as described herein.
In one embodiment, a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1 is provided, wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a région of complementarity to an ALAS1 RNA transcript, which antisense strand comprises at least 15 (e.g., at least 16, 17, 18, 19, 20, 21, 22, or 23) contiguous nucléotides differing by no more than 3 (e.g., by no more than 0, 1 or 2) nucléotides from the antisense sequence of AD-60489, or a dérivative of AD-60489 as described herein. In embodiments, one or more nucléotides are modified as described herein, e.g., one or more (or ail) nucléotides of AD-60489 are modified as described herein. In embodiments, the dérivative of AD-60489 is AD-60501, AD-60519, AD-60901, AD-60495, AD-60900, AD60935, AD-60879, AD-61190, AD-61191, AD-60865, AD-60861, AD-60876, AD-61193, AD60519, AD-60519, or AD-60901. In embodiments, the dérivative of AD-60489 is AD-60519. In embodiments, the dérivative of AD-60489 is AD-61193.
In one embodiment, a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1 is provided, wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a région of complementarity to an ALAS1 RNA transcript, which antisense strand comprises at least 15 (e.g., at least 16, 17, 18, 19, 20, 21, 22, or 23) contiguous nucléotides differing by no more than 3 (e.g., by no more than 0, 1 or 2) nucléotides from a dérivative of AD-58632 described herein. In embodiments, one or more nucléotides are modified as described herein, e.g., one or more (or ail) nucléotides of AD-58632 are modified as described herein. In embodiments, the dérivative of AD-58632 is AD-60405, AD-60887, AD-60923, AD-60434, AD-60892, AD-60419, AD-60924, AD-60445, AD-60925, and AD-60926, AD-60820, AD-60843, AD-60819, AD-61140, AD-61141, AD-61142, AD60835, AD-60839, AD-61143, AD-61144, AD-61145, AD-61146, AD-60892, or AD-60419. In embodiments, the dérivative of AD-58632 is AD-60819.
In some embodiments, the dsRNA has an IC50 of less than lnM. In some embodiments, the dsRNA has an IC50 in the range of 0.01-lnM. In embodiments, the dsRNA has an IC50 of less than 0.05 nM. In embodiments, the dsRNA has an IC50 of less than 0.02 nM. In embodiments, the dsRNA has an IC50 of less than 0.01 nM. In embodiments, the IC50 is determined as described herein in the Examples.
In some embodiments, the dsRNA has a single dose ED50 of less than about 10 mg/kg. In some embodiments, the dsRNA has a single dose ED50 of less than about 5 mg/kg. In embodiments, the EC50 is determined as described herein in the Examples.
In some embodiments, the dsRNA shows improved activity compared with AD-58632. In some embodiments, the dsRNA shows improved activity compared with AD-60489. In some embodiments, the dsRNA shows improved activity compared with AD-58632 and AD-60489.
In embodiments, the dsRNA is AD-60501, AD-60519, AD-60901, AD-60495, AD60900, AD-60935, AD-60879, AD-61190, AD-61191, AD-60865, AD-60861, AD-60876, AD61193, AD-60519, AD-60519, AD-60901, AD-60405, AD-60887, AD-60923, AD-60434, AD60892, AD-60419, AD-60924, AD-60445, AD-60925, AD-60926, AD-60820, AD-60843, AD60819, AD-61140, AD-61141, AD-61142, AD-60835, AD-60839, AD-61143, AD-61144, AD61 145, AD-61146, AD-60892, or AD-60419 (e.g., including the nucléotide sequence and/or one or more (e.g., ail) of the modifications of the aforesaid dsRNAs). In embodiments, the dsRNA comprises an antisense strand that comprises, or consists of, an antisense sequence (and/or one or more (e.g., ail) of the modifications)) selected from AD-60501, AD-60519, AD-60901, AD60495, AD-60900, AD-60935, AD-60879, AD-61190, AD-61191, AD-60865, AD-60861, AD60876, AD-61193, AD-60519, AD-60519, AD-60901, AD-60405, AD-60887, AD-60923, AD60434, AD-60892, AD-60419, AD-60924, AD-60445, AD-60925, AD-60926, AD-60820, AD60843, AD-60819, AD-61140, AD-61141, AD-61142, AD-60835, AD-60839, AD-61143, AD61 144, AD-61145, AD-61146, AD-60892, or AD-60419. In embodiments, the dsRNA comprises a sense strand that comprises, or consists of, a sense sequence (and/or one or more (e.g., ail) of the modifications)) selected from AD-60501, AD-60519, AD-60901, AD-60495, AD-60900, AD-60935, AD-60879, AD-61190, AD-61191, AD-60865, AD-60861, AD-60876, AD-61193, AD-60519, AD-60519, AD-60901, AD-60405, AD-60887, AD-60923, AD-60434, AD-60892, AD-60419, AD-60924, AD-60445, AD-60925, AD-60926, AD-60820, AD-60843, AD-60819, AD-61140, AD-61141, AD-61142, AD-60835, AD-60839, AD-61143, AD-61144, AD-61145, AD-61146, AD-60892, or AD-60419.
In embodiments, a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1 is provided, wherein the dsRNA comprises (i) an antisense strand that comprises, or consists of, the sequence of UAAGAUGAGACACUCUUUCUGGU (SEQ ID NO: 4153) or UAAGAUGAGACACUCTUUCUGGU (SEQ ID NO: 4154) and/or (ii) a sense strand that comprises, or consists of, the sequence of CAGAAAGAGUGUCUCAUCUUA (SEQ ID NO: 4155). In embodiments, one or more nucléotides of the antisense strand and/or sense strand are modified as described herein.
In embodiments, a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1 is provided, wherein the dsRNA comprises (i) an antisense strand that comprises, or consists of, the antisense sequence of AD-60489 and/or (ii) a sense strand that comprises, or consists of, the sense sequence of AD-60489 (wherein the sense and/or antisense sequence includes one or more (e.g., ail) ofthe modifications ofthe sense strand and/or antisense strand of AD-60489).
In embodiments, a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1 is provided, wherein the dsRNA comprises (i) an antisense strand that comprises, or consists of, the antisense sequence of AD-60519 and/or (ii) a sense strand that comprises, or consists of, the sense sequence of AD-60519 (wherein the sense and/or antisense sequence includes one or more (e.g., ail) of the modifications of the sense strand and/or antisense strand of AD-60519).
In embodiments, a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1 is provided, wherein the dsRNA comprises (i) an antisense strand that comprises, or consists of, the antisense sequence of AD-61193 and/or (ii) a sense strand that comprises, or consists of, the sense sequence of AD-61193 (wherein the sense and/or antisense sequence includes one or more (e.g., ail) of the modifications of the sense strand and/or antisense strand of AD-61193).
In embodiments, a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1 is provided, wherein the dsRNA comprises (i) an antisense strand that comprises, or consists of, the antisense sequence of AD-60819 and/or (ii) a sense sequence that comprises, or consists of, the sense sequence of AD-60819 (wherein the sense and/or antisense sequence includes one or more (e.g., ail) of the modifications of the sense strand and/or antisense strand of AD-60819).
In embodiments, a dsRNA for inhibiting expression of ALAS1 is provided, wherein the dsRNA comprises (i) an antisense strand that comprises, or consists of, the antisense sequence of AD-60489, AD-60519, AD-61193, or AD-60819 (or a corresponding unmodified antisense sequence) and/or (ii) a sense strand that comprises, or consists of, the sense sequence of AD60489, AD-60519, AD-61193, or AD-60819 (or a corresponding unmodified antisense sequence). In embodiments, the dsRNA comprises (i) an antisense strand that consists of the antisense sequence of AD-60489, AD-60519, AD-61193, or AD-60819 and/or (ii) a sense strand that consists ofthe sense sequence of AD-60489, AD-60519, AD-61193, or AD-60819, except that the antisense strand and/or sense strand of the dsRNA differs by 1, 2, or 3 nucléotides from the corresponding antisense and/or sense sequence of AD-60489, AD-60519, AD-61193, or AD60819.
The sequences and modifications of AD-60489, AD-60519, AD-61193, and AD-60819 are shown in Table 44 below.
Table 44: Sequences and Modifications of AD-60489, AD-60519, AD-61193, AD-60819
Target sites of antisense sequence on NM_0006 88.4 Duplex Name Sense Sequence (5'-3') Antisense Sequence (5'-3') Corresponding unmodified sense sequence Corresponding unmodified antisense sequence
871-893 AD- 60489 CfsasGfaAfaGfaGfUfGfuCfuC faUfcUfuAfL96 (SEQ ID NO: 4156) us AfsaGfa UfgAfgAfca cUfcUfu Ufcllfgsgsu (SEQID NO: 4157) CAGAAAGAGUGUCUC AUCUUA (SEQIDNO: 4158) UAAGAUGAGACACUC UUUCUGGU (SEQID NO: 4159)
871-893 AD- 60519 csasgaaaGfaGfuGfuCfuCfauc uuaL96 (SEQIDNO: 4160) usAfsAfGfa UfgAfgAfcAfcUfcUf ullfcllfgsgsu (SEQID NO: 4161) CAGAAAGAGUGUCUC AUCUUA (SEQID NO: 4162) UAAGAUGAGACACUC UUUCUGGU (SEQID NO: 4163)
871-893 AD- 61193 csasgaaaGfaGfuGfuCfuCfauc uuaL96 (SEQID NO: 4164) usAfsaGfaUfgAfgAfcacUfcdTu UfcUfgsgsu (SEQID NO: 4165) CAGAAAGAGUGUCUC AUCUUA (SEQID NO: 4166) UAAGAUGAGACACUC TUUCUGGU (SEQID NO: 4167)
873-895 AD- 60819 GfsasAfaGfaGfuGfuCfuCfauc uuCfuuL96 (SEQID NO: 4168) as Afsg Af a Gf a u gAf gAf cAf eu eu uucsusg (SEQID NO: 4169) GAAAGAGUGUCUCAU CUUCUU (SEQID NO: 4170) AAGAAGAUGAGACAC UCUUUCUG (SEQID NO: 4171)
wherein c, a, g, u = 2’-OMe ri lonucleosides; Af, Cf, G, Uf = 2’F ribonucleosides; S =
phosphorothioate; L96 has the structure depicted in Table 1.
In embodiments, a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1 is provided, wherein the dsRNA comprises (i) an antisense strand that comprises, or consists of, the antisense sequence of AD-60489, AD-60519, or AD-61193 and/or (ii) a sense strand that comprises, or consists of, the sense sequence of AD-60489, AD-60519, or AD-61193 10 (including the nucléotide sequence and one or more (e.g., ail) of the modifications of the sense strand and/or antisense strand of AD-60489, AD-60519, or AD-61193).
In embodiments, a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1 is provided, wherein the dsRNA is AD-60489, AD-60519, AD-61193, or AD-60819. In embodiments, a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1 is provided, wherein the dsRNA is AD-60489, AD-60519, or AD-61193 (e.g., including the nucléotide sequence and/or one or more (e.g., ail) ofthe modifications of AD-60489, AD-60519, or AD-61193).
In embodiments, the dsRNA is, comprises, or consists of, AD-60489 (e.g., including the nucléotide sequence and/or one or more (e.g., ail) of the modifications of AD-60489).
In embodiments, the dsRNA is, comprises, or consists of, AD-60519 (e.g., including the nucléotide sequence and/or one or more (e.g., ail) of the modifications of AD-60519).
In embodiments, the dsRNA is, comprises, or consists of, AD-61193 (e.g., including the nucléotide sequence and/or one or more (e.g., ail) of the modifications of AD-61193).
In embodiments, the dsRNA is, comprises, or consists of, AD-60819 (e.g., including the nucléotide sequence and/or one or more (e.g., ail) of the modifications of AD-60819).
In embodiments, the dsRNA (e.g., AD-60489, AD-60519, AD-61193, AD-60819, or another dsRNA disclosed herein in any one of Tables 21 to 40) is effective to suppress the liver level of ALAS1 mRNA, e.g., to achieve silencing of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, or 80% (e.g., such that ALAS1 mRNA levels are decreased to 90% or less, 80% or less, 70% or less, 60% or less, 50% or less, 40% or less, 30% or less, or 20% or less of a control level of liver ALAS1 mRNA, e.g., the level in an untreated individual or group of individuals, e.g., an individual or group of individuals treated with PBS only). In embodiments, the effectiveness of the dsRNA in suppressing the liver level of ALAS1 mRNA is assessed using a non-human primate model, e.g., as described herein in the Examples.
In embodiments, the dsRNA (e.g., AD-60489, AD-60519, AD-61193, AD-60819, or another dsRNA disclosed herein in any one of Tables 21 to 40) is effective to suppress the circulating level of ALAS1 mRNA, e.g., to achieve silencing of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, or 80% (e.g., such that ALAS1 mRNA levels are decreased to 90% or less, 80% or less, 70% or less, 60% or less, 50% or less, 40% or less, 30% or less, or 20% or less of a control level of circulating ALAS1 mRNA, e.g., the level prior to treatment with the dsRNA, or the level in an untreated individual or group of individuals). In embodiments, the effectiveness of the dsRNA in suppressing the circulating level of ALAS1 mRNA is assessed using a nonhuman primate model, e.g., as described herein in the Examples. In embodiments, the circulating level of ALAS1 mRNA is assessed using a circulating extracellular RNA détection (cERJD) assay, e.g., as desciibed herein or in Sehgal, A. et al. Quantitation of tissue-specific target gene modulation using circulating RNA (Poster presented on February 9, 2012 at the
Keystone Gene Silencing by small RNAs symposium (Vancouver, February 7-12, 2012) or
Sehgal, A. et al. Tissue-specific gene silencing monitored in circulating RNA, RNA, 20: 1-7, published online December 19, 2013.
The cERD method can be applied to any appropriate biological sample. In embodiments, the circulating level of ALAS1 mRNA is assessed using a blood sample, e.g., a sérum sample. In embodiments, the circulating level of ALAS1 mRNA is assessed using a urine sample.
In embodiments, the dsRNA is a dérivative of AD-60489 that is disclosed herein, e.g., in any one of the tables herein. In embodiments, the dsRNA shows improved activity compared with AD-60489. In some such embodiments, the dsRNA is AD-60519.
In embodiments, the dsRNA is a dérivative of AD-58632 that is disclosed herein, e.g., in any one of the tables herein. In embodiments, the dsRNA shows improved activity compared with AD-58632.
In embodiments, improved activity is indicated by a lower IC50, e.g., as determined based on in vitro assays, e.g., as described herein, e.g., in the Examples.
In embodiments, improved activity is indicated by a lower effective dose. The effective dose may be determined based on the administration of a single dose or multiple repeated doses. In embodiments, the effective dose is determined based on the single dose ED50. In embodiments, the effective dose or the single dose ED50 is determined based on an in vivo assay. In embodiments, the in vivo assay is conducted in a non-human animal, e.g., in a rat, in a non-human primate, or in a mouse.
In embodiments, the effective dose is determined based on the dose required to obtain a réduction of in a level of ALAS1 mRNA (e.g., a liver level of ALAS1 mRNA and/or a circulating level of ALAS1 mRNA), e.g., as described herein in the Examples. In embodiments, circulating mRNA is assessed using the cERD assay.
In embodiments, the effective dose is determined based on the dose required to obtain a réduction of a level (e.g., a urine and/or plasma level) of ALA and/or PB G.
In embodiments, the effective dose is determined based on the dose required to obtain a particular treatment effect described herein, e.g., prévention or réduction of symptoms associated with a porphyria.
In embodiments, improved activity is indicated by the achievement of a higher liver level of the dsRNA. In embodiments, a higher liver level is obtained after a single dose of dsRNA (e.g., a dose of 1, 2.5, 3, 5, or 10 mg/kg). In embodiments, a higher liver level is obtained after multiple doses of dsRNA hâve been administered (e.g., 2-10 daily or weekly doses of 1, 2.5, 3, 5, or 10 mg/kg).
In one embodiment, the iRNA encompasses a dsRNA having an RNA strand (the antisense strand) having a région that is substantially complementary to a portion of an ALAS1 mRNA, e.g., a human ALAS1 mRNA (e.g., a human ALAS1 mRNA as provided in SEQ ID NO:1 or SEQ ID NO:382).
In one embodiment, an iRNA for inhibiting expression of an ALAS1 gene includes at least two sequences that are complementary to each other. The iRNA includes a sense strand having a first sequence and an antisense strand having a second sequence. The antisense strand includes a nucléotide sequence that is substantially complementary to at least part of an mRNA encoding an ALAS1 transcript, and the région of complementarity is 30 nucléotides or less, and at least 15 nucléotides in length. Generally, the iRNA is 19 to 24 nucléotides in length.
In some embodiments, the iRNA is 19-21 nucléotides in length. In some embodiments, the iRNA is 19-21 nucléotides in length and is in a lipid formulation, e.g. a lipid nanoparticle (LNP) formulation (e.g., an LNP11 formulation).
In some embodiments, the iRNA is 21-23 nucléotides in length. In some embodiments, the iRNA is 21-23 nucléotides in length and is in the form of a conjugate, e.g., conjugated to one or more GalNAc dérivatives as described herein.
In some embodiments the iRNA is from about 15 to about 25 nucléotides in length, and in other embodiments the iRNA is from about 25 to about 30 nucléotides in length. An iRNA targeting ALAS1, upon contact with a cell expressing ALAS1, inhibits the expression of an ALAS1 gene by at least 10%, at least 20%, at least 25%, at least 30%, at least 35% or at least
40% or more, such as when assayed by a method as described herein. In one embodiment, the iRNA targeting ALAS1 is formulated in a stable nucleic acid lipid particle (SNALP).
In one embodiment, an iRNA (e.g., a dsRNA) featured herein includes a first sequence of a dsRNA that is selected from the group consisting of the sense sequences of Tables 21 to 40 and a second sequence that is selected from the group consisting of the corresponding antisense sequences of Tables 21 to 40.
The iRNA molécules featured herein can include naturally occumng nucléotides or can include at least one modified nucléotide. In embodiments, the at least one modified nucléotide include one or more of a modification on the nucléotide chosen from the group consisting of a locked nucleic acid (LNA), an acyclic nucléotide, a hexitol or hexose nucleic acid (HNA), a cyclohexene nucleic acid (CeNA), 2'-methoxyethyl, 2'-O-alkyl, 2'-O-allyl, 2'-C- allyl, 2'-fluoro, 2'-deoxy, 2’-hydroxyl, or any combination thereof. In one embodiment, the at least one modified nucléotide includes, but is not limited to a 2'-O-methyl modified nucléotide, 2'-fluoro modified nucléotide, a nucléotide having a 5'-phosphorothioate group, and a terminal nucléotide linked to a ligand, e.g., an N-acetylgalactosamine (GalNAc) or a cholesteryl dérivative. Alternatively, the modified nucléotide may be chosen from the group of: a 2'-deoxy-2'-fluoro modifiednucléotide, a2-deoxy-modifiednucléotide, alockednucléotide, anacyclicnucléotide, an abasic nucléotide, 2’-amino-modifîed nucléotide, 2’-alkyl-modified nucléotide, morpholino nucléotide, a phosphoramidate, and a non-natural base comprising nucléotide. Such a modified sequence can be based, e.g., on a first sequence of said iRNA selected from the group consisting of the sense sequences of disclosed in Tables 21-40, and a second sequence selected from the group consisting of the corresponding antisense sequences disclosed in Tables 21-40.
In one embodiment, an iRNA as described herein targets a wildtype ALAS1 RNA transcript variant, and in another embodiment, the iRNA targets a mutant transcript (e.g., an ALAS1 RNA carrying an allelic variant). For example, an iRNA featured in the invention can target a polymorphie variant, such as a single nucléotide polymoiphism (SNP), of ALAS1. In another embodiment, the iRNA targets both a wildtype and a mutant ALAS1 transcript. In yet another embodiment, the iRNA targets a particular transcript variant of ALAS1 (e.g., human
ALAS1 variant 1). In yet another embodiment, the iRNA agent targets multiple transcript variants (e.g., both variant 1 and variant 2 of human ALAS1).
In one embodiment, an iRNA featured in the invention targets a non-coding région of an ALAS1 RNA transcript, such as the 5’ or 3’ untranslated région of a transcript.
In some embodiments, an iRNA as described herein is in the form of a conjugate, e.g., a carbohydrate conjugate, which may serve as a targeting moiety and/or ligand, as described herein. In one embodiment, the conjugate is attached to the 3’ end of the sense strand of the dsRNA. In some embodiments, the conjugate is attached via a linker, e.g., via a bivalent or trivalent branched linker.
In some embodiments, the conjugate comprises one or more N-acetylgalactosamine (GalNAc) dérivatives. Such a conjugate is also referred to herein as a GalNAc conjugate. In some embodiments, the conjugate targets the RNAi agent to a particular cell, e.g., a liver cell, e.g., a hépatocyte. The GalNAc dérivatives can be attached via a linker, e.g., a bivalent or trivalent branched linker. In particular embodiments, the conjugate is
AcHN H H
In some embodiments, the RNAi agent is attached to the carbohydrate conjugate via a linker, e.g., a linker as shown in the following schematic, wherein X is O or S
3'
In some embodiments, X is O. In some embodiments, X is S.
In some embodiments, the RNAi agent is conjugated to L96 as defined in Table 1 and shown below
Triantennary GalNAc
irans-4-Hydroxyprolinol
C12 - Diacroboxylic Acid Tether
Site of Conjugation
In one embodiment, the dsRNA has one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen or ail of the following:
(i) is chemically synthesized, e.g., is synthesized by solid phase oligonucleotide synthesis;
(ii) ail the nucléotides in the dsRNA are modified, e.g., ail the nucléotides are 2’-OMe or 2’-F modified, or a combination of 2’-OMe and 2’-F modified;
(iii) ail nucléotides are connected through 3’-5’ phosphodiester linkages;
(iv) the sense strand comprises or consists of 21 nucléotides;
(v) the antisense sense strand comprises or consists of 23 nucléotides;
(vi) has a blunt-end at the 3’-end of sense strand;
(vii) has a 3’-overhang, e.g., has a two-nucleotide overhang, at the 3’-end of the antisense strand;
(viii) is covalently attached to a ligand containing three N-acetylgalactosamine (GalNAc) moieties;
(ix) the 3’-end of the sense strand is conjugated to the triantennary GalNAc moiety (e.g., referred to herein as L96 as defined in Table 1). In one embodiment, the 3’-end is linked to the triantennary GalNAc moiety through a phosphodiester linkage;
(x) has an antisense strand that comprises one or more (e.g., four) phosphorothioate linkages. In one embodiment, the phosphorothioate linkages are located at the 3 ’ end and at the 5’ end of the antisense strand. In one embodiment, two phosphorothioate linkages are located at the 3’ end and two phosphorothioate linkages are located at the 5’ end of the antisense strand;
(xi) has a sense strand that comprises one or more (e.g., two) phosphorothioate linkages. In one embodiment, the one or more (e.g., two) phosphorothioate linkages are located at the 5’ end of the sense strand;
(xii) 21 nucléotides ofthe sense strand hybridize to the complementary 21 nucléotides of the antisense strand;
(xiii) forms 21 nucléotide base pairs and a two-base overhang at the 3’-end of the antisense strand;
(xiv) comprises, or consists of, a sense and antisense strand having the sequence of AD60519;
(xv) has a sense strand with 10, 12, 14, 16, 18, 19, 20 or ail ofthe modifications ofthe sense strand of AD-60519;
(xvi) has an antisense strand with 10, 12, 14, 16, 18, 19, 20 or ail of the modifications of the antisense strand of AD-60519; or (xvii) has the duplex sequence and ail the modifications of AD-60519.
In embodiments, the dsRNA is in the form of a conjugate having the following structure (also referred to herein as AD-60519 or ALN-60519) (SEQ ID NOS 5238-5239, respectively, in order of appearance):
I I J
I t t l
I t
J J
I
I
I I t t t
I >
I t
I t t t t
Antisense
Strand
ALN-60519
Af, Cf, Gf, Uf = 2'-F ribonucleosides
Am, Cm, Gm, Um = 2'-0Me ribonucleosides
S = phosphorothioate
OH OH
H
H ..
AcHN OH OH
L96
AcHN
OH OH
In an aspect provided herein is a composition, e.g., a pharmaceutical composition, that includes one or more of the iRNAs described herein and a pharmaceutically acceptable carrier or 5 delivery vehicle. In one embodiment, the composition is used for inhibiting the expression of an
ALAS1 gene in an organism, generally a human subject. In one embodiment, the composition is used for treating a porphyria, e.g., AIP.
In one aspect, an iRNA provided herein is a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1, wherein said dsRNA comprises a sense strand and an antisense strand 15-30 base pairs in length and the antisense strand is complementary to at least 15 contiguous nucléotides of SEQ ID NO: 1 or 382.
In a further aspect, an iRNA provided herein is a double stranded RNAi (dsRNA) comprising a sense strand complementary to an antisense strand, wherein said antisense strand comprises a région of complementarity to an ALAS1 RNA transcript, wherein each strand has about 14 to about 30 nucléotides, wherein said double stranded RNAi agent is represented by formula (III):
sense: 5' np -Na -(X X X);-Nb -Y Y Y -Nb -(Z Z Z)j -Na - n, 3' antisense: 3' np'-Na'-(X'X'X')k-Nb'-Y'Y'Y'-Nb'-(Z'Z'Z')i-Na'- nq' 5’ (III) wherein:
i, j, k, and 1 are each independently 0 or 1 ;
p, p’, q, and q' are each independently 0-6;
each Na and Na' independently represents an oligonucleotide sequence comprising 0-25 nucléotides which are either modified or unmodified or combinations thereof, each sequence comprising at least two differently modified nucléotides;
each Nb and Nb' independently represents an oligonucleotide sequence comprising 0-10 nucléotides which are either modified or unmodified or combinations thereof;
each np, np', nq, and nq' independently represents an overhang nucléotide;
XXX, ΥΎΎ, ΖΖΖ, Χ'Χ'Χ', ΥΎΎ', and Ζ'Ζ'Ζ' each independently represent one motif of three identical modifications on three consecutive nucléotides;
modifications on Nb differ from the modification on Y and modifications on Nb' differ from the modification on Y'.
In embodiments, the sense strand is conjugated to at least one ligand.
In embodiments, i is 1; j is 1; or both i and j are 1.
In embodiments, k is 1 ; 1 is 1 ; or both k and 1 are 1.
In embodiments, XXX is complementary to Χ'Χ'Χ', YYY is complementary to ΥΎΎ', and ZZZ is complementary to ZjZjZ'.
In embodiments, the ΥΎΎ motif occurs at the 11, 12 and 13 positions of the antisense strand from the 5'-end.
In embodiments, the Y' is 2'-O-methyl.
In embodiments, the duplex région is 15-30 nucléotide pairs in length.
In embodiments, the duplex région is 17-23 nucléotide pairs in length.
In embodiments, the duplex région is 19-21 nucléotide pairs in length.
In embodiments, the duplex région is 21-23 nucléotide pairs in length.
In embodiments, the modification on the nucléotide is selected from the group consisting of a locked nucleic acid (LNA), an acyclic nucléotide, a hexitol or hexose nucleic acid (HNA), a cyclohexene nucleic acid (CeNA), 2'-methoxyethyl, 2'-O-alkyl, 2'-O-allyl, 2'-C- allyl, 2'-fluoro, 2'-deoxy, 2’-hydroxyl, and any combination thereof.
In embodiments, the modifications on the nucléotides are selected from the group consisting of LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-alkyl, 2'-O-allyl, 2'-C- allyl, 2'-fluoro,
2'-deoxy, 2’-hydroxyl, and combinations thereof.
In embodiments, the modifications on the nucléotides are 2'-O-methyl, 2'-fluoro or both. 5
In embodiments, the ligand comprises a carbohydrate.
In embodiments, the ligand is attached via a linker.
In embodiments, the linker is a bivalent or trivalent branched linker.
In embodiments, the ligand is
In embodiments, the ligand and linker are as shown in Formula XXIV:
FL
In embodiments, the ligand is attached to the 3’ end of the sense strand.
In embodiments, the dsRNA consists of or comprises a nucléotide sequence selected from the group of sequences provided in Tables 21-40.
In a further aspect, an iRNA provided herein is a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1, wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a région of complementarity to an ALAS1 RNA transcript, which antisense strand comprises at least 15 contiguous nucléotides differing by no more than 3 nucléotides from one of the antisense sequences listed in any one of Tables 2140. In embodiments, the nucléotides of the antisense strand hâve fewer modifications, more modifications, or different modifications compared with the antisense sequences listed in any one of Tables 21-40.
In embodiments, the sense and antisense sequences are those of a duplex disclosed herein that suppresses ALAS1 mRNA expression by at least 50%, 60%, 70%, 80%, 85% or 90%, e.g., as assessed using an assay disclosed in the Examples provided herein.
In embodiments, ALAS1 mRNA expression is assessed based on an ALAS1 mRNA level in the liver, e.g., as assessed using a liver biopsy sample. In embodiments, ALAS1 mRNA expression is assessed based on an ALAS1 mRNA level in a biological fluid, e.g., blood, sérum, plasma, cerebrospinal fluid, or urine. In embodiments, ALAS1 mRNA expression is assessed using a circulating extracellular RNA détection (cERD) assay, e.g., a cERD assay as described herein or in Sehgal, A. et al. Quantitation of tissue-specifïc target gene modulation using circulating RNA (Poster presented on February 9, 2012 at the Keystone Gene Silencing by small RNAs symposium (Vancouver, February 7-12, 2012) or Sehgal, A. et al. Tissue-specifïc gene silencing monitored in circulating RNA, RNA, 20: 1-7, published online December 19, 2013.
In some embodiments, the dsRNA comprises at least one modified nucléotide.
In some embodiments, at least one of the modified nucléotides is chosen from the group consisting of: a 2'-O-methyl modified nucléotide, a nucléotide comprising a 5'-phosphorothioate group, and a terminal nucléotide linked to a cholesteryl dérivative or dodecanoic acid bisdecylamide group.
τ.
In some embodiments, the modified nucléotide is chosen from the group consisting of: a
2,-deoxy-2'-fluoro modified nucléotide, a 2'-deoxy-modified nucléotide, a locked nucléotide, an acyclic nucléotide, an abasic nucléotide, 2’-amino-modified nucléotide, 2’-alkyl-modified nucléotide, morpholino nucléotide, a phosphoramidate, and a non-natural base comprising nucléotide.
In some embodiments, the région of complementarity is at least 17 nucléotides in length.
In some embodiments, the région of complementarity is between 19 and 21 nucléotides in length.
In some embodiments, the région of complementarity is 19 nucléotides in length.
In some embodiments, each strand is no more than 30 nucléotides in length.
In some embodiments, at least one strand comprises a 3’ overhang of at least 1 nucléotide. In embodiments, the antisense strand comprises a 3’ overhang of at least 1 nucléotide.
In some embodiments, at least one strand comprises a 3’ overhang of at least 2 nucléotides. In embodiments, the antisense strand comprises a 3’ overhang.of at least 2 nucléotides. In embodiments, the antisense strand comprises a 3’ overhang.of 2 nucléotides.
In some embodiments, a dsRNA described herein further comprises a ligand.
In some embodiments, the ligand is a GalNAc ligand.
In some embodiments, the ligand targets the dsRNA to hépatocytes.
In some embodiments, the ligand is conjugated to the 3’ end of the sense strand of the dsRNA.
In some embodiments, the région of complementarity consists of an antisense sequence selected from the antisense sequences listed in Tables 21-40, or a corresponding antisense sequence in which some or ail of the nucléotides are unmodifîed. In embodiments, the région of complementarity consists of the sequence UAAGAUGAGACACUCUUUCUGGU (SEQ ID NO: 4153) or UAAGAUGAGACACUCTUUCUGGU (SEQ JD NO: 4154). In some embodiments, the région of complementarity consists of the antisense sequence of the duplex
AD-60489. In some embodiments, the région of complementarity consists of the antisense sequence of the duplex AD-60519.
In embodiments, the région of complementarity consists of an antisense sequence selected from a duplex disclosed herein that suppresses ALAS1 mRNA expression by at least 50%, 60%, 70%, 80%, 85% or 90%, e.g., as assessed using an assay disclosed in the Examples provided herein.
In some embodiments, the dsRNA comprises a sense strand consisting of a sense strand sequence selected from Tables 21-40, and an antisense strand consisting of an antisense sequence selected from Tables 21-40. In embodiments, the dsRNA comprises a pair of corresponding sense and antisense sequences selected from those of the duplexes disclosed in Tables 21-40.
In one aspect, the invention provides a cell containing at least one of the iRNAs (e.g., dsRNAs) featured herein. The cell is generally a mammalian cell, such as a human cell. In some embodiments, the cell is an erythroid cell. In other embodiments, the cell is a liver cell (e.g., a hépatocyte).
In an aspect provided herein is a pharmaceutical composition for inhibiting expression of an ALAS1 gene, the composition comprising an iRNA (e.g., a dsRNA) described herein.
In embodiments of the pharmaceutical compositions described herein, the iRNA (e.g., dsRNA) is administered in an unbuffered solution. In embodiments, the unbuffered solution is saline or water, e.g., water for injection.
In embodiments, the pharmaceutical composition comprises AD-60519 and water for injection. In embodiments, the composition comprises about 100 to 300 mg/mL, e.g., 200 mg/mL, of AD-60519. In embodiments, the composition has a pH of 6.0-7.5, e.g., about 7.0. In embodiments, the composition is for subcutaneous injection. In embodiments, the pharmaceutical composition is packaged in a container (e.g., a glass vial, e.g., a 2 mL glass vial,) at a volume of about 0.3 to 1 mL, e.g., 0.55 mL. In embodiments, the pharmaceutical composition is ALN-AS1 as described herein in the examples.
In embodiments of the pharmaceutical compositions described herein, the iRNA (e.g., dsRNA is administered with a buffer solution. In embodiments, the buffer solution comprises acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof. In embodiments, the buffer solution is phosphate buffered saline (PBS).
In embodiments of the pharmaceutical compositions described herein, the iRNA (e.g., dsRNA) is targeted to hépatocytes.
In embodiments of the pharmaceutical compositions described herein, the composition is administered intravenously.
In embodiments of the pharmaceutical compositions described herein, the composition is administered subcutaneously.
In embodiments, a pharmaceutical composition comprises an iRNA (e.g., a dsRNA) described herein that comprises a ligand (e.g., a GalNAc ligand) that targets the iRNA (e.g., dsRNA) to hépatocytes.
In embodiments, a pharmaceutical composition comprises an iRNA (e.g., a dsRNA) described herein that comprises a ligand (e.g., a GalNAc ligand), and the pharmaceutical composition is administered subcutaneously. In embodiments, the ligand targets the iRNA (e.g., dsRNA) to hépatocytes.
In certain embodiments, a pharmaceutical composition, e.g., a composition described herein, includes a lipid formulation. In some embodiments, the RNAi agent is in a LNP formulation, e.g., a MC3 formulation. In some embodiments, the LNP formulation targets the RNAi agent to a particular cell, e.g., a liver cell, e.g., a hépatocyte. In embodiments, the lipid formulation is a LNP11 formulation. In embodiments, the composition is administered intravenously.
In another embodiment, the pharmaceutical composition is formulated for administration according to a dosage regimen described herein, e.g., not more than once every four weeks, not more than once every three weeks, not more than once every two weeks, or not more than once every week. In another embodiment, the administration of the pharmaceutical composition can be maintained for a month or longer, e.g., one, two, three, or six months, or one year or longer.
In another embodiment, a composition containing an iRNA featured in the invention, e.g., a dsRNA targeting ALAS1, is administered with a non-iRNA therapeutic agent, such as an agent known to treat a porphyria (e.g., AIP), or a symptom of a porphyria (e.g., pain). In another embodiment, a composition containing an iRNA featured in the invention, e.g., a dsRNA targeting AIP, is administered along with a non-iRNA therapeutic regimen, such as hemin or glucose {e.g., glucose infusion (e.g., IV glucose)). For example, an iRNA featured in the invention can be administered before, after, or concurrent with glucose, dextrose, or a similar treatment that serves to restore energy balance {e.g, total parentéral nutrition). An iRNA featured in the invention can also be administered before, after, or concurrent with the administration of a heme product {e.g., hemin, heme arginate, or heme albumin), and optionally also in combination with a glucose (e.g. IV glucose) or the like.
Typically, glucose administered for the treatment of a porphyria is administered intravenously (IV). Administration of glucose intravenously is referred to herein as “IV glucose.” However, alternative embodiments in which glucose is administered by other means are also encompassed.
In one embodiment, an ALAS1 iRNA is administered to a patient, and then the noniRNA agent or therapeutic regimen {e.g., glucose and/or a heme product) is administered to the patient (or vice versa). In another embodiment, an ALAS1 iRNA and the non-iRNA therapeutic agent or therapeutic regimen are administered at the same time.
In an aspect provided herein is a method of inhibiting ALAS1 expression in a cell, the method comprising: (a) introducing into the cell an iRNA (e.g. a dsRNA) described herein and (b) maintaining the cell of step (a) for a time sufficient to obtain dégradation of the mRNA transcript of an ALAS1 gene, thereby inhibiting expression of the ALAS1 gene in the cell.
In an aspect provided herein is a method for reducing or inhibiting the expression of an ALAS1 gene in a cell {e.g., an erythroid cell or a liver cell, such as, e.g., a hépatocyte). The method includes:
(a) introducing into the cell a double-stranded ribonucleic acid (dsRNA), wherein the dsRNA includes at least two sequences that are complementary to each other. The dsRNA has a sense strand having a first sequence and an antisense strand having a second sequence; the antisense strand has a région of complementarity that is substantially complementary to at least a part of an mRNA encoding ALAS1, and where the région of complementarity is 30 nucléotides or less, i.e., 15-30 nucléotides in length, and generally 19-24 nucléotides in length, and where the dsRNA upon contact with a cell expressing ALAS1, inhibits expression of an ALAS1 gene by at least 10%, e.g., at least 20%, at least 30%, at least 40% or more; and (b) maintaining the cell of step (a) for a time sufficient to obtain dégradation of the mRNA transcript of the ALAS1 gene, thereby reducing or inhibiting expression of an ALASlgene in the cell.
In embodiments of the foregoing methods of inhibiting ALAS1 expression in a cell, the cell is treated ex vivo, in vitro, or in vivo. In embodiments, the cell is a hépatocyte.
In embodiments, the cell is présent in a subject in need of treatment, prévention and/or management of a disorder related to ALAS1 expression.
In embodiments, the disorder is a porphyria. In embodiments, the porphyria is acute intermittent porphyria or ALA-dehydratase defîciency porphyria.
In embodiments, the porphyria is a hepatic poiphyria, e.g., a porphyria selected from acute intermittent porphyria (AIP) hereditary coproporphyria (HCP), variegate porphyria (VP), ALA deyhdratase defîciency porphyria (ADP), and hepatoerythropoietic porphyria. In embodiments, the porphyria is a homozygous dominant hepatic porphyria (e.g., homozygous dominant AIP, HCP, or VP) or hepatoerythropoietic poiphyria. In embodiments, the porphyria is a dual porphyria.
In embodiments, the expression of ALAS1 is inhibited by at least 30%.
In embodiments, the iRNA (e.g., dsRNA) has an IC50 in the range of 0.01-lnM.
In certain embodiments, the cell (e.g., the hépatocyte) is a mammalian cell (e.g., a human, non-human primate, or rodent cell).
In one embodiment, the cell is treated ex vivo, in vitro, or in vivo (e.g., the cell is présent in a subject (e.g., a patient in need of treatment, prévention and/or management of a disorder related to ALAS1 expression).
In one embodiment, the subject is a mammal (e.g., a human) at risk, or diagnosed with a porphyria, e.g., X-linked sideroblastic anémia (XLSA), ALA deyhdratase defîciency porphyria (ADP or Doss porphyria), acute intermittent porphyria (AIP), congénital erythropoietic poiphyria (CEP), prophyria cutanea tarda (PCT), hereditary coproporphyria (copropoiphyria, or HCP), variegate porphyria (VP), erythropoietic protoporphyria (EPP), or transient erythroporphyria of infancy. In some embodiments, the disorder is an acute hepatic porphyria, e.g., ALA deyhdratase deficiency poiphyria (ADP), AIP, HCP, or VP. In spécifie embodiments, the disorder is ALA deyhdratase deficiency poiphyria (ADP) or AIP.
In embodiments, the porphyria is a hepatic porphyria, e.g., a porphyria selected from acute intermittent porphyria (AIP) hereditary coproporphyria (HCP), variegate poiphyria (VP), ALA deyhdratase deficiency porphyria (ADP), and hepatoerythropoietic porphyria. In embodiments, the porphyria is a homozygous dominant hepatic porphyria (e.g., homozygous dominant AIP, HCP, or VP) or hepatoerythropoietic poiphyria, In embodiments, the poiphyria is a dual poiphyria.
In one embodiment, the dsRNA introduced reduces or inhibits expression of an ALAS1 gene in the cell.
In one embodiment, the dsRNA introduced reduces or inhibits expression of an ALAS1 gene, or the level of one or more poiphyrins or porphyrin precursors (e.g., δ-aminolevulinic acid (ALA), porphopilinogen (PB G), hydroxymethylbilane (HMB), uroporphyrinogen I or III, coproporphyrinogen I or III, protopoiphrinogen IX, and protopoiphyrin IX) or porphyrin products or métabolites, by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% or more compared to a reference, (e.g., an untreated cell or a cell treated with a non-targeting control dsRNA). Without being bound by theory, ALAS1 is the first enzyme of the porphyrin pathway. Thus, reducing expression of the ALAS1 gene is likely to reduce the level of one or more porphyrin precursors, porphyrins or porphyrin products or métabolites.
In other aspects, the invention provides methods for treating, preventing or managing pathological processes related to ALAS1 expression (e.g., pathological processes involving poiphyrins, porphyrin precuorsors, or defects in the porphyrin pathway, such as, for example, porphyrias). In one embodiment, the method includes administering to a subject, e.g., a patient in need of such treatment, prévention or management, an effective (e.g., a therapeutically or prophylactically effective) amount of one or more of the iRNAs featured herein.
In an aspect provided herein is a method of treating and/or preventing a disorder related to ALAS1 expression comprising administering to a subject in need of such treatment a therapeutically effective amount of an iRNA (e.g., a dsRNA) described herein, or a composition comprising an iRNA (e.g., a dsRNA) described herein.
In an aspect provided herein is a method of treating and/or preventing a porphyria comprising administering to a subject in need of such treatment a double-stranded ribonucleic acid (dsRNA), wherein said dsRNA comprises a sense strand and an antisense strand 15-30 base pairs in length and the antisense strand is complementary to at least 15 contiguous nucléotides of SEQ ID NO:1 or SEQ ID NO:382.
In one embodiment, subject (e.g., the patient) has a porphyria. In another embodiment, the subject (e.g., patient) is at risk for developing a porphyria. In some embodiments, administration of the iRNA targeting ALAS1 alleviates or relieves the severity of at least one symptom of a disorder related to ALAS1 in the patient.
In one embodiment, the subject is a mammal (e.g., a human) at risk, or that has been diagnosed with, a disorder related to ALAS1 expression, e.g., a porphyria, e.g., X-linked sideroblastic anémia (XLSA), ALA deyhdratase deficiency porphyria (Doss porphyria), acute intermittent porphyria (AIP), congénital erythropoietic porphyria (CEP), prophyria cutanea tarda (PCT), hereditary coproporphyria (coproporphyria, or HCP), variegate porphyria (VP), erythropoietic protoporphyria (EPP), or transient erythroporphyria of infancy. In a further embodiment, the porphyria is an acute hepatic porphyria, e.g., ALA deyhdratase deficiency porphyria (ADP), AIP, HCP, or VP. In some such embodiments, the disorder is ALA deyhdratase deficiency porphyria (ADP) or AIP.
In embodiments the subject has, or is at risk for developing, a porphyria. In embodiments, the porphyria is a hepatic porphyria, e.g., a porphyria selected from acute intermittent porphyria (AIP) hereditary coproporphyria (HCP), variegate porphyria (VP), ALA deyhdratase deficiency porphyria (ADP), and hepatoerytbropoietic porphyria. In embodiments, the porphyria is a homozygous dominant hepatic porphyria (e.g., homozygous dominant AIP, HCP, or VP) or hepatoerythropoietic porphyria, In embodiments, the porphyria is a dual porphyria.
In embodiments, a porphyria, a symptom of porphyria, a prodrome, or an attack of poiphyria is induced by exposure to a precipitating factor, as described herein. In some embodiments, the precipitating factor is a chemical exposure. In some embodiments, the precipitating factor is a diug, e.g., a prescription drug or an over the counter drug. In some embodiments, the precipitating factor is the menstrual cycle, e.g., a particular phase of the menstrual cycle, e.g., the luteal phase.
In embodiments, the iRNA (e.g., dsRNA) or composition comprising the iRNA is administered after an acute attack of porphyria.
In embodiments, the iRNA (e.g., dsRNA) or composition comprising the iRNA is administered during an acute attack of poiphyria.
In embodiments, the iRNA (e.g., dsRNA) or composition comprising the iRNA is administered prophylactically to prevent an acute attack of porphyria.
In embodiments, the iRNA (e.g., dsRNA) is formulated as an LNP formulation.
In emtodiments, the iRNA (e.g., dsRNA) is in the form of a GalNAc conjugate.
In embodiments, iRNA (e.g., dsRNA) is administered at a dose of 0.05-50 mg/kg.
In embodiments, the iRNA (e.g., dsRNA) is administered at a concentration of
0.01 mg/kg-5 mg/kg bodyweight of the subject.
In embodiments, the iRNA (e.g., dsRNA) is formulated as an LNP formulation and is administered at a dose of 0.05-5 mg/kg.
In embodiments, the iRNA (e.g., dsRNA) is in the form of a GalNAc conjugate and is administered at a dose of 0.5-50 mg/kg. In certain embodiments, the iRNA in the GalNAc conjugate is administered at a dose of less than 10 mg/kg (e.g., 5 mg/kg or less) e.g., once per week; e.g., a dose of 1 mg/kg or less, 2.5 mg/kg or less, or 5 mg/kg or less, e.g., once per week. In one embodiment, iRNA in the GalNAc conjugate is administered at a dose of about 2.5 mg/kg or less, e.g., once per week. In one embodiment, the administration of the iRNA in the GalNAc conjugate is subcutaneous.
In embodiments, the iRNA (e.g., dsRNA) is in the form of a GalNAc conjugate and is administered, e.g., subcutaneously, at a dose of 0-5 mg/kg, e.g. 0-2.5 mg/kg or 1-2.5 mg/kg. In embodiments, the iRNA is administered weekly. In embodiments, the iRNA is administered as a composition comprising the iRNA and water for injection. In embodiments, the iRNA is AD60519. In embodiments, the composition comprises the iRNA, e.g., AD-60519, at a concentration of about 200 mg/mL.
In embodiments, the method decreases a level of a porphyrin or a porphyrin precursor in the subject.
In embodiments, the level is decreased by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%. In an embodiment, the level is decreased by at least 30%.
In embodiments, the porphyrin precursor is δ-aminolevulinic acid (ALA) or porphopilinogen (PBG).
In embodiments, the iRNA (e.g., dsRNA) has an IC50 in the range of 0.01-lnM.
In embodiments, a method described herein (i) améliorâtes a symptom associated with an ALAS1 related disorder (e.g., a porphyria) (ii) inhibits ALAS1 expression in the subject (e.g., as assessed using the cERD assay), (iii) decreases a level of a porphyrin precursor (e.g., ALA or PBG) or a porphyrin in the subject, (iv) decreases frequency of acute attacks of symptoms associated with a porphyria in the subject, or (v) decreases incidence of acute attacks of symptoms associated with a porphyria in the subject when the subject is exposed to a precipitating factor (e.g., the premenstrual phase or the luteal phase).
In embodiments, the method améliorâtes pain and/or progressive neuropathy.
In embodiments, the iRNA (e.g., dsRNA) or composition comprising the iRNA is administered according to a dosing regimen.
In some embodiments, the iRNA (e.g., dsRNA) or composition comprising the iRNA is administered before or during an acute attack of porphyria. In some embodiments, the iRNA is administered before an acute attack of porphyria.
In some embodiments, the iRNA (e.g., dsRNA) or composition comprising the iRNA is administered during a prodrome. In embodiments, the prodrome is characterized by abdominal pain, nausea, psychological symptoms (e.g., anxiety), restlessness and/or insomnia.
In embodiments, the iRNA (e.g., dsRNA) or composition comprising the iRNA is administered during a particular phase of the menstrual cycle, e.g., during the luteal phase. In embodiments, the method améliorâtes or prevents cyclical attacks of porphyria, e.g., by reducing the severity, duration, or frequency of attacks. In embodiments, the cyclical attacks are associated with a precipitating factor. In embodiments, the precipitating factor is the menstrual cycle, e.g., a particular phase of the menstrual cycle, e.g., the luteal phase.
In embodiments, the subject has an elevated level of ALA and/or PBG. In embodiments, the level of ALA and/or PBG is elevated in plasma or urine from the subject. In embodiments, the subject has or is at risk for developing a porphyria, e.g., a hepatic porphyria. In embodiments, the subject is asymptomatic. In embodiments, the subject carries a genetic alteration (e.g., a gene mutation) associated with a popphyria, as described herein. In embodiments, the subject has or is at risk for developing a poiphyria and suffers from pain (e.g., chronic pain, e.g., chronic neuropathie pain) and/or neuropathy (e.g., progressive neuropathy). In embodiments, the subject does not suffer from acute attacks but suffers from pain (e.g., chronic pain, e.g., chronic neuropathie pain) and/or neuropathy (e.g., progressive neuropathy). In embodiments, the pain is abdominal pain.
In embodiments, the subject (a) has an elevated level of ALA and/or PBG and (b) suffers from pain (e.g., chronic pain, e.g., chronic neuropathie pain) and/or neuropathy (e.g., progressive neuropathy). In embodiments, the pain is abdominal pain.
In embodiments, the subject has a plasma level and/ or a urine level of ALA and/or PBG that is elevated. In embodiments, the elevated level of ALA and/or PBG is accompanied by other symptoms, e.g., pain (e.g., chronic pain, e.g., chronic neuropathie pain) or neuropathy (e.g., progressive neuropathy). In embodiments, the pain is abdominal pain. In embodiments, the subject is asymptomatic. In embodiments, the subject has a genetic mutation associated with a porphyria, e.g., a mutation as described herein.
In embodiments, the subject has a level (e.g., a plasma level or a urine level) of a porphyrin precursor, e.g., ALA and/or PBG, that is elevated, e.g., the level is greater than, or greater than or equal to, a reference value. In embodiments, the level is greater than the reference value. In embodiments, the reference value is two standard déviations above the mean level in a sample of healthy individuals. In embodiments, the reference value is an upper reference limit.
In embodiments, the subject has a plasma level and/or a urine level of ALA and/or PBG that is greater than, or greater than or or equal to, 2 times, 3 times, 4 times, or 5 times that of an upper reference limit. As used herein, an “upper reference limit” refers to a level that is the upper limit of the 95% confidence interval for a reference sample, e.g., a sample of normal (e.g., wild type) or healthy individuals, e.g., individuals who do not carry a genetic mutation associated with a porphyria and/or individuals who do not suffer from a poiphyria. In embodiments, the subject has a mine level of ALA and/or PBG that is greater than 2 to 4 times that of an upper reference limit. In embodiments, the subject has a urine level of ALA and/or PBG that is greater than 4 times that of an upper reference limit.
In embodiments, the reference value for plasma PBG is 0.12 pmol/L. In embodiments, the subject is a human and has a plasma PBG level that is greater than, or greater than or equal to, 0.12 pmol/L, 0.24 pmol/L, 0.36 pmol/L, 0.48 pmol/L, or 0.60 pmol/L. In embodiments, the subject is a human and has a plasma level of PBG that is greater than, or greater than or equal to, 0.48 pmol/L.
In embodiments, the reference value for urine PBG is 1.2 mmol/mol créatinine. In embodiments, the subject is a human and has a urine PBG level that is greater than, or greater than or equal to, 1.2 mmol/mol créatinine, 2.4 mmol/mol créatinine, 3.6 mmol/mol créatinine, 4.8 mmol/mol créatinine, or 6.0 mmol/mol créatinine. In embodiments, the subject is a human and has a urine level of PBG that is greater than, or greater than or equal to, 4.8 mmol/mol créatinine.
In embodiments, the reference value for plasma ALA is 0.12 pmol/L. In embodiments, the subject is a human and has a plasma ALA level that is greater than, or greater than or equal to, 0.12 pmol/L, 0.24 pmol/L, 0.36 pmol/L, 0.48 pmol/L, or 0.60 pmol/L. In embodiments, the subject is a human and has a plasma ALA level that is greater than, or greater than or equal to 0.48 pmol/L.
In embodiments, the reference value for urine ALA is 3.1 mmol/mol créatinine. In embodiments, the subject is a human and has a urine ALA level that is greater than, or greater than or equal to, 3.1 mmol/mol créatinine, 6.2 mmol/mol créatinine, 9.3 mmol/mol créatinine, 12.4 mmol/mol créatinine, or 15.5 mmol/mol créatinine.
In embodiments, the method decreases one or more signs or symptoms of a poiphyria. In embodiments, the method decreases an elevated level of ALA and/or PBG. In embodiments, the method decreases pain (e.g., chronic pain, e.g. chronic neuropathie pain) and/or neuropathy (e.g., progressive neuropathy). In embodiments, the pain is abdominal pain. In embodiments, the pain is neuropathie pain (e.g., pain associated with the progressive neuropathy of acute porphyrias). The decrease in pain can include, e.g., prévention of pain, delay in the onset of pain, réduction in the frequency of pain, and/or réduction in severity of pain. In embodiments, the decrease in pain is assessed based on the subject’s use of pain médication.
In embodiments, the method améliorâtes or prevents acute attacks of porphyria, e.g., by reducing the severity, duration, or frequency of attacks.
In embodiments, the method decreases or prevents nerve damage.
In embodiments, the method prevents détérioration (e.g., prevents development of abnormalities) of or results in an improvement of clinical measures, e.g., clinical measures of muscle and/or nerve function, e.g., EMG and/or nerve conduction velocities.
In embodiments, the method decreases heme use by the subject.
In embodiments, the method decreases pain médication use by the subject.
In embodiments, the method reduces hospitalization.
In embodiments, the method is effective to reduce a level of ALA and/or PBG (e.g., a plasma or urine level of ALA and/or PBG). In embodiments, the method is effective to produce a predetermined réduction in the elevated level of ALA and/or PBG.
In embodiments, the predetermined réduction is a réduction to a value that is less than or equal to a reference value. In some embodiments, the reference value is an upper reference limit.
In some embodiments, the reference value is the value that is two standard déviations above the mean level in a reference sample.
In embodiments, the method is effective to reduce the level of ALA and/or PBG in a subject to a level that is below two times the upper reference limit. In embodiments, the method is effective to reduce the level of ALA to below two times the upper reference limit. In embodiments, the method is effective to reduce the level of PBG to below two times the upper reference limit.
In embodiments, the iRNA (e.g., dsRNA) or composition comprising the iRNA is administered as a single dose or at multiple doses, e.g., according to a dosing regimen.
In embodiments, the iRNA (e.g., dsRNA) or composition comprising the iRNA is administered prophylactically to a subject who is at risk for developing a porphyria. In embodiments, the iRNA (e.g., dsRNA) or composition comprising the iRNA is administered prophylactically beginning at puberty. In embodiments, the subject carries a genetic mutation associated with a porphyria and/or has an elevated level of ALA and/or PBG (e.g., an elevated plasma or urine level of ALA and/or PBG). In embodiments, the mutation makes an individual susceptible to an acute attack (e.g., upon exposure to a precipitating factor, e.g., a drug, dieting or other precipitating factor, e.g., a precipitating factor as disclosed herein). In embodiments, the mutation is associated with elevated levels of a porphyrin or a porphyrin precursor (e.g., ALA and/or PBG). In embodiments, the mutation is associated with chronic pain (e.g., chronic neuropathie pain) and/or neuropathy (e.g., progressive neuropathy).
In embodiments, the mutation is a mutation in the ALAS1 gene. In embodiments, the mutation is a mutation in the ALAS1 gene promoter, or in régions upstream or downstream from the ALAS1 gene. In embodiments, the mutation is a mutation in transcription factors or other genes that interact with ALAS1. In embodiments, the mutation is a mutation in a gene that encodes an enzyme in the heme biosynthetic pathway.
In embodiments, the iRNA (e.g., dsRNA or a conjugate thereof) or composition comprising the iRNA is administered subcutaneously. In embodiments, the iRNA is in the form of a GalNAc conjugate. In embodiments, the iRNA (e.g., the dsRNA) is administered at a dose of 0.5-50 mg/kg. In certain embodiments, the iRNA is administered at a dose of less than 10 mg/kg (e.g., 5 mg/kg or less) once per week; e.g., a dose of 1 mg/kg or less, 2.5 mg/kg or less, or mg/kg or less, e.g., once per week. In one embodiment, iRNA is administered at a dose of about 2.5 mg/kg or less, e.g., once per week.
In embodiments, the subject to be treated is asymptomatic and has an elevated level of ALA and/or PBG. In embodiments, the subject has a porphyria, e.g., AIP. In embodiments, the patient suffers from récurrent porphyric attacks.
In embodiments, the iRNA (e.g., AD-60519) is administered at a dose of less than 5 mg/kg, e.g., at 0.1, 0.35, 1.0, or 2.5 mg/kg. In embodiments, the iRNA (e.g., AD-60519) is administered in repeated doses, e.g., weekly doses.
In one embodiment, the subject is asymptomatic and has an elevated level of ALA and/or PBG, and the iRNA (e.g., AD-60519) is administered at single doses, e.g., at 0.1, 0.35, 1.0, or 2.5 mg/kg; or in repeatedly weekly dosages, e.g., of 1 and 2.5 mg/kg for several weeks (e.g., for 4 weeks).
In one embodiment, the subject has AIP, e.g., is an AIP patient, the iRNA (e.g., AD60519) is administered at a dose of 1-2.5 mg/kg weekly.
In embodiments, a treatment regimen is employed in which the iRNA is initially administered more frequently, followed by less frequent administration. In embodiments, the iRNA is initially administered once per day for multiple days (e.g., for 2-14 days, e.g., for 2, 3, 4, 5, 6, or 7 days). In embodiments, the iRNA is subsequently administered once per week. In embodiments, the iRNA is subsequently administered once every two weeks. In embodiments, the iRNA is subsequently administered at a frequency that is effective to reduce one or more signs or symptoms of a porphyria.
In one aspect provided herein is a method of treating a subject with an elevated level of ALA and/or PBG, the method comprising administering to the subject a double-stranded ribonucleic acid (dsRNA), wherein said dsRNA comprises a sense strand and an antisense strand 15-30 base pairs in length and the antisense strand is complementary to at least 15 contiguous nucléotides of SEQ ID NO:1 or SEQ ID NO:382.
In one aspect provided herein is a method of treating a subject with an elevated level of
ALA and/or PBG, the method comprising administering to the subject a therapeutically effective amount of an dsRNA or a composition comprising a dsRNA, as described herein.
In some embodiments, the methods described herein are effective to decrease the level of ALA and/or PBG. In some embodiments, the level of ALA and/or PBG is decreased such that it is less than, or less than or equal to, a reference value, e.g., an upper reference limit.
In embodiments, the subject to be treated is asymptomatic and has an elevated level of ALA and/or PBG. In embodiments, the subject has a porphyria, e.g., AIP.
In embodiments, the iRNA is administered at a dose of less than 5 mg/kg, e.g., at 0.1, 0.35 1.0, or 2.5 mg/kg. In embodiments, the iRNA is administered in repeated doses, e.g., weekly doses.
In another aspect, the invention provides methods for decreasing a level of a porphyrin or a porphyrin precursor in a cell (e.g., an erythroid cell or a liver cell, such as, e.g., a hépatocyte). In one embodiment, the cell is treated ex vivo, in vitro, or in vivo (e.g., the cell is présent in a subject (e.g., a patient in need of treatment, prévention and/or management of a disorder related to ALAS1 expression). The method includes contacting the cell with an effective amount of one or more of the iRNAs targeting ALAS1, e.g., one or more ofthe iRNAs disclosed herein, thereby decreasing the level of a porphyrin or a porphyrin precursor in the cell; or decreasing the level of a porphyrin or a porphyrin precursor in other cells, tissues, or fluids within a subject in which the cell is located; relative to the level prior to contacting. Such methods can be used to treat (e.g., ameliorate the severity) of disorders related to ALAS1 expression, such as porphyrias, e.g., AIP or ALA dehydratase deficiency poiphyria.
In one embodiment, the contacting step is effected ex vivo, in vitro, or in vivo. For example, the cell can be présent in a subject, e.g., a mammal (e.g., a human) at risk, or that has been diagnosed with, a poiphyria. In an embodiment, the porphyria is an acute hepatic porphyria. In embodiments, the porphyria is a hepatic porphyria, e.g., a porphyria selected from acute intermittent porphyria (AIP), hereditary coproporphyria (HCP), variegate poiphyria (VP), ALA deyhdratase deficiency porphyria (ADP), and hepatoerythropoietic porphyria. In embodiments, the porphyria is a homozygous dominant hepatic porphyria (e.g., homozygous dominant AIP, HCP, or VP) or hepatoerythropoietic porphyria, In embodiments, the poiphyria is a dual poiphyria.
In an aspect provided herein is a method for decreasing a level of a porphyrin or a porphyrin precursor (e.g., ALA or PBG) in a cell, comprising contacting the cell with an iRNA (e.g. a dsRNA), as described herein, in an amount effective to decrease the level of the porphyrin or the porphyrin precursor in the cell.
In embodiments, the cell is a hépatocyte. In embodiments, the porphyrin or porphyrin precursor is δ-aminolevulinic acid (ALA), porphopilinogen (PBG), hydroxymethylbilane (HMB), uropoiphyrinogen I or III, coproporphyrinogen I or III, protoporphrinogen IX, or protopoiphyrin IX. In embodiments, the poiphyrin precursor is ALA or PBG.
In one embodiment, the cell is an erythroid cell. In a further embodiment, the cell is a liver cell (e.g., a hépatocyte).
In an aspect provided herein is a vector encoding at least one strand of an iRNA (e.g., a dsRNA) as described herein.
In an aspect provided herein is a vector encoding at least one strand of a dsRNA, wherein said dsRNA comprises a région of complementarity to at least a part of an mRNA encoding ALAS1, wherein said dsRNA is 30 base pairs or less in length, and wherein said dsRNA targets said mRNA for cleavage.
In embodiments, the région of complementarity is at least 15 nucléotides in length.
In embodiments, the région of complementarity is 19 to 21 nucléotides in length.In one aspect, the invention provides a vector for inhibiting the expression of an ALAS1 gene in a cell. In one embodiment, the vector comprises an iRNA as described herein. In one embodiment, the vector includes at least one regulatory sequence operably linked to a nucléotide sequence that encodes at least one strand of an iRNA as described herein. In one embodiment the vector comprises at least one strand of an ALAS1 iRNA.
In an aspect provided herein is a cell comprising a vector as described herein.In an aspect provided herein is a cell containing a vector for inhibiting the expression of an ALAS1 gene in a cell. The vector includes a regulatory sequence operably linked to a nucléotide sequence that encodes at least one strand of one of the iRNAs as described herein. In one embodiment, the cell is a liver cell (e.g., a hépatocyte). In another embodiment, the cell is an erythroid cell.
In another aspect, a method is provided for assaying the level of circulating extracellular ALAS1 mRNA in a subject, said method comprising detecting (e.g., measuring) the level of ALAS1 mRNA in a biological fluid sample (e.g., a blood sample (e.g., a sérum or plasma sample), a cerebrospinal fluid sample, or a urine from the subject, said biological fluid sample comprising the ALAS1 mRNA, thereby assaying the level of circulating extracellular ALAS1 mRNA in the subject.
In another aspect, a method is provided for assaying the level of circulating extracellular ALAS1 mRNA in a subject, said method comprising (i) providing RNA (e.g., extracellular RNA) from a biological fluid sample (e.g., blood or plasma sample) from the subject, said biological fluid sample comprising the ALAS1 mRNA; (ii) obtaining an ALAS1 cDNA from the ALAS1 mRNA; (iii) contacting the ALAS1 cDNA with a nucleic acid complementary (e.g., probe and/or primer) to the ALAS1 cDNA or a portion thereof, thereby producing a reaction mix; and (iv) detecting (e.g., measuring) the level of ALAS1 cDNA in the reaction mix, wherein the ALAS1 cDNA level is indicative of the ALAS1 mRNA level, thereby assaying the level of circulating extracellular ALAS1 mRNA in the subject.
In embodiments, said biological fluid sample is a blood sample. In embodiments, said biological fluid sample is a sérum sample. In embodiments, said biological fluid sample is a urine sample.
In embodiments, the the method comprises PCR, qPCR or 5’-RACE.
In embodiments, said nucleic acid is a probe or primer.
In embodiments, said nucleic acid comprises a détectable moiety and the level of ALAS1 mRNA is determined by détection of the amount of the détectable moiety.
In embodiments, said method further comprises obtaining the biological fluid sample from the subject. In embodiments, the biological fluid sample is separate from the tissue and contains exosomes. In embodiments of these methods, the efficacy of a porphyria treatment is assessed based on a comparison of the level of circulating extracellular ALAS1 mRNA in the subject relative to a reference value.
In embodiments, a decrease in the level of circulating extracellular ALAS1 mRNA in the subject in response to the porphyria treatment, relative to the reference value, indicates that the porphyria treatment is effïcacious. In embodiments, the reference value is the level of circulating extracellular ALAS1 mRNA in the subject prior to the porphyria treatment.
Ail publications, patent applications, patents, and other references mentioned herein are incoiporated by reference in their entirety.
The details of various embodiments of the invention are set forth in the description below. Other features, objects, and advantages of the invention will be apparent from the description and the drawings, and from the claims.
Description of the Drawings
FIG. 1 depicts the heme biosynthetic pathway.
FIG. 2A and FIG. 2B show a table summarizing certain porphyrias associated with genetic errors in heme metabolism.
FIG. 3 A and FIG. 3B depict a human ALAS1 mRNA sequence transcript (Ref. Seq. NM_000688.4 (GI:40316942, record dated November 19, 2011), SEQ ID NO: 1).
FIG. 4A and FIG. 4B depict a human ALAS1 mRNA sequence transcript (Ref. Seq. NM_000688.5 (GI: 362999011, record dated April 1, 2012), SEQ ID NO: 382).
FIG. 5 shows the dose-response of the siRNA AD-53558 in suppressing mouse ALAS1 (mALASl) mRNA relative to a PBS control. Results for a luciferase (LUC) AD-1955 control are also shown.
FIG. 6 shows the dose-response of the siRNA AD-53558 in suppressing ALAS1 mRNA in rats relative to a PBS control. Results for a luciferase (LUC) AD-1955 control are also shown.
FIG. 7 shows the durability of suppression of mouse ALAS1 (mALASl) mRNA by the siRNA AD-53558 relative to a PBS control.
FIG. 8 shows means ± standard déviations of plasma ALA levels (in μΜ) at baseline, and after phénobarbital treatment in the experimental (ALAS1 siRNA) and control (LUC siRNA) groups.
FIG. 9 shows the plasma ALA levels (in μΜ) of individual animais at baseline, and after phénobarbital treatment in animais that received ALAS1 siRNA and control (LUC siRNA) treatment.
FIG. 10 shows means ± standard déviations of plasma PBG levels (in μΜ) at baseline, and after phénobarbital treatment in animais that received ALAS1 siRNA and control (LUC siRNA) treatment.
FIG. 11 shows the plasma PBG levels (in μΜ) of individual animais at baseline, and after phénobarbital treatment in animais that received ALAS1 siRNA and control (LUC siRNA) treatment.
FIG. 12 shows the relative mALASlmRNA level in liver at baseline, and after phénobarbital treatment in select représentative experimental (ALAS1 siRNA) and control (PB S) animais.
FIG. 13 shows the effects of three GalNAc conjugated mALASl siRNAs on mALASl expression (relative to a PBS control) in mouse liver tissue.
FIG. 14 shows plasma ALA and PBG levels over time after phénobarbital administration and treatment with ALAS1 siRNA or control LUC siRNA.
FIG. 15 shows the effects of a GalNAc conjugated ALAS1 siRNA on plasma ALA and plasma PBG levels in the mouse AIP phénobarbital induction model.
FIG. 16 shows dose-dependent effects of an ALAS1 siRNA on plasma ALA and PBG levels in the mouse AIP phénobarbital induction model. For the animais that received ALAS1 siRNA, the dose of siRNA administered (0.05 mg/kg, 0.1 mg/kg, 0.5 mg/kg, or 1.0 mg/kg) is shown on the horizontal axis.
FIG. 17, top panel shows the experimental design used to study suppression of ALA and PBG with an ALAS1 siRNA. The bottom panel shows the plasma ALA and PBG levels at baseline, in the control (Luc) condition, and following treatment with an ALAS1 siRNA at week 0, week 2, and week 4.
FIG. 18 shows the experimental design used to compare the effects of treatment with ALAS1 siRNA or hemin in an animal model of AIP (top) and the results for plasma ALA (pmol/L) levels (middle) and plasma PBG (pmol/L) levels (bottom).
FIG. 19 shows relative mRNA levels (ALAS1/GAPDH) in animais treated with 30 mg/kg, 10 mg/kg, or 3 mg/kg of AD-58632 compared with animais treated with PBS control.
FIG. 20 shows the experimental design used to investigate the dose response effect of the
AD-58632 ALAS1 GalNAc conjugate in a rat AIP model.
FIG. 21 shows relative levels of liver PBGD mRNA (top graph) and relative levels of liver ALAS1 mRNA (bottom graph) in a rat model of AIP. Groups of animais were subjected to one of four treatments: (1) phénobarbital (PB) treatment only, (2) phénobarbital and porphobilinogen deaminase (PBGD) siRNA treatment, (3) phénobarbital, PBGD siRNA, and 30 mg/kg of ALAS1 siRNA, (4) phénobarbital, PBGD siRNA, and 10 mg/kg of ALAS1 siRNA.
FIG. 22 shows urinary PBG (top panel) and ALA (bottom panel) levels relative to créatinine levels in a rat model of AIP. Groups of animais were subjected to one of four treatments: (1) phénobarbital (PB) treatment only, (2) phénobarbital and porphobilinogen deaminase (PBGD) siRNA treatment, (3) phénobarbital, PBGD siRNA, and 30 mg/kg of ALAS1 siRNA, (4) phénobarbital, PBGD siRNA, and 10 mg/kg of ALAS1 siRNA.
FIG. 23 shows the suppression of ALAS-1 mRNA by AD-58632, compared with PBS control, in groups of rats that received five daily doses of siRNA at 6 mg/kg, 2 mg/kg, or 1 mg/kg versus single bolus doses of siRNA at 30 mg/kg, 10 mg/kg, or 5 mg/kg.
FIG. 24 shows the suppression of ALAS-1 mRNA by AD-58632, compared with PBS control, in groups of rats that received four weekly doses of siRNA at 10 mg/kg, 5 mg/kg, or 2.5 mg/kg.
FIG. 25 shows the suppression of ALAS-1 mRNA by AD-58632 and by five 19/19mer duplexes.
FIG. 26 shows the results of an évaluation of the effect of strand length and overhangs on the best two 19mers.
FIG. 27 is a graph that shows the levels of ALAS1 mRNA in liver (lefit bars) and in sérum (right bars) for each treatment group in the NHP study described in Example 34.
FIG. 28 shows the suppression of ALAS-1 mRNA, compared with PBS control, in groups of rats that received 3 mg/kg or 10 mg/kg of AD-58632 or AD-60489.
FIG. 29 shows the experimental design used to investigate the effectiveness of ALAS1 siRNAs AD-58632 and AD-60489 in suppressing liver mRNA in non-human primates.
FIG. 30 shows the dose-dependent suppression of liver mRNA in non-human primates following treatment with 1.25 mg/kg, 2.5 mg/kg, or 5 mg/kg of AD-58632 or AD-60489.
FIG. 31 shows a comparison of the mRNA suppression results obtained from liver biopsies and from the cERD assay in a non-human primate study.
FIG. 32 shows the time course of suppression of mRNA as assessed using the cERD assay in a non-human primate study. The horizontal axis shows the time according to the study day.
FIG. 33 shows the suppression of ALAS1 mRNA in rats that received PB S or a single dose of 5 mg/kg of one of the indicated siRNA duplexes.
FIG. 34 shows the liver concentrations of the siRNA in rats that received a single dose of 5 mg/kg of the indicated siRNA.
FIG. 35 (top) shows the experimental design used to investigate the therapeutic efficacy of AD-60925 and AD-60926. FIG. 35(bottom) shows the relative levels of rat ALAS1/GAPDH mRNA in rats treated with (1) AF11-PBGD, (2) AF11-PBGD and PB, (3) AF-11PBGD, PB, and 3 mg/kg AD-60925, or (4) AF11-PBGD, PB, and AD-60926.
FIG. 36 shows the relative levels of urine PBG (top) and uiine ALA (bottom) in rats treated with (1) AF11-PBGD, (2) AF11-PBGD and PB, (3) AF-11PBGD, PB, and 3 mg/kg AD60925, or (4) AF11-PBGD, PB, and AD-60926.
FIG. 37 shows the relative levels of urine PBG (top) and urine ALA (bottom) over time in rats treated with (1) AF11-PBGD, (2) AF11-PBGD and PB, (3) AF-11PBGD, PB, and 3 mg/kg AD-60925, or (4) AF11-PBGD, PB, and AD-60926. The arrows indicate the timepoints when PB was administered.
FIG. 38 shows the relative levels of rat ALAS1 (rALASl) mRNA in rats that received 4 doses of PBS or 2.5 mg/kg of one of the indicated siRNAs.
FIG. 39 shows the relative levels of rat ALAS1 (rALASl) mRNA in rats that received a single dose of PBS or 2.5 mg/kg of one of the indicated siRNAs.
FIG. 40 (top) shows the relative levels of rat ALAS1 (rALASl) mRNA in rats that received a single dose of PBS or 3 mg/kg of one of the indicated siRNAs. FIG. 40 (bottom) shows the concentration of siRNA in liver.
FIG. 41 (top) shows the suppression of rat ALAS1 (rALASl) mRNA by AD-60489, AD60519, and AD-60901. FIG. 41 (bottom) shows the concentration of siRNA in liver.
FIG. 42 shows the relative levels of rat ALAS1 (rALASl) mRNA in rats that were treated with a single dose of PBS or 2.5 mg/kg of one of the indicated siRNAs.
FIG. 43 shows the relative levels of rat ALAS1 (rALASl) mRNA in rats that were treated with PBS or one of the indicated siRNAs at a dose of 2.5 mg/kg twice per week for 2 weeks.
FIG. 44 (top) shows a schematic of the experimental design used to investigate the therapeutic efficacy of multiple biweekly doses of AD-60519. FIG. 44 (bottom) shows graphs depicting the suppression of urine PBG and urine ALA in rats that were treated with (i) PBGD siRNA and six doses of PBS, (ii) PBGD siRNA, PB, and six doses of PBS, (iii) PBGD siRNA, PB, and six doses of 2.5 mg/kg AD-60519, or (iv) PBGD siRNA, PB, and six doses of 5 mg/kg AD-60519.
FIG. 45 shows graphs depicting the suppression of sérum PBG (upper graph) and sérum ALA (lower graph) in a mouse AIP model that were treated with (i) PBGD siRNA and six doses of PBS (Baseline), (ii) PBGD siRNA, PB, and six doses of PBS (Saline), (iii) PBGD siRNA, PB, and six doses of 2.5 mg/kg AD-60519, or (iv) PBGD siRNA, PB, and six doses of 5 mg/kg AD60519.
FIG. 46 (top) shows a schematic of the experimental design used to investigate the therapeutic efficacy of multiple weekly doses of AD-60519. FIG. 46 (bottom) shows a graph depicting the relative levels of rat ALAS1 mRNA (rALASl/GAPDH) in rats that were treated with (i) PBGD siRNA and four doses of PBS, (ii) PBGD siRNA, PB, and four doses of PBS, (iii) PBGD siRNA, PB, and four doses of 3 mg/kg AD-60519, (iv) PBGD siRNA, PB, and four doses of 1 mg/kg AD-60519, or (v) PBGD siRNA, PB, and four doses of 0.3 mg/kg AD-60519.
FIG. 47 shows graphs depicting the levels of urine PBG (upper graph) and urine ALA (lower graph) in rats that were treated with (i) PBGD siRNA and four doses of PBS, (ii) PBGD siRNA, PB, and four doses of PBS, (iii) PBGD siRNA, PB, and four doses of 3 mg/kg AD60519, (iv) PBGD siRNA, PB, and four doses of 1 mg/kg AD-60519, or (v) PBGD siRNA, PB, and four doses of 0.3 mg/kg AD-60519.
FIG. 48 is a schematic that shows the design of a non-human primate study in which effects of ALAS1 siRNA GalNAc conjugates in suppressing liver ALAS1 mRNA and circulating ALAS1 mRNA were investigated
FIG. 49 is a graph that shows suppression of liver mRNA in non-human primates (NHPs) following treatment with ALAS1 siRNA GalNAc conjugates.
FIG. 50 is a graph that shows the normalized sérum levels of ALAS1 mRNA in nonhuman primates (NHPs) at various times during the course of a study in which effects of treatment with ALAS1 siRNA GalNAc conjugates was investigated. The days on the horizontal axis correspond to the days in the schematic in FIG. 48.
FIG. 51 shows the normalized ALAS1 mRNA levels (shown as a fraction of the pre-dose level) as assessed in a rat single dose study that used urine cERD to monitor ALAS 1 suppression.
FIG. 52 is a schematic that shows the design of a non-human primate study in which multidose and single dose effects of AD-60519 in suppressing liver ALAS 1 mRNA and circulating ALAS1 mRNA were investigated.
FIG. 53 is a bar graph that shows the average relative liver ALAS1 mRNA levels (% of PBS control) at study day 24 (multidose groups) or at study day 4 (single dose groups). .
FIG. 54 is a graph that shows normalized sérum ALAS1 mRNA levels (shown as a fraction of the pre-dose level) as assessed using cERD for the multidose groups (top graph, showing results up to day 24) and single dose groups (bottom graph, showing results up to day 22).
FIG. 55 is a graph that shows the liver mRNA, sérum mRNA, and urine mRNA levels at study day 4 (in the single dose groups) or at study day 24 (in the multidose groups). Data for individual animais and the averages for each group are shown.
FIG. 56 is a graph that shows normalized sérum ALAS1 mRNA levels (shown as a fraction of the pre-dose level) after 8 weeks as assessed using cERD for the multidose groups.
Each graphical data point represents the remaining ALAS1 mRNA for the group average of 3 animal samples ± the standard déviation of the group.
FIG. 57 is a schematic of the structure of ALN-60519 (also referred to herein as AD60519). FIG. 57 discloses SEQ ID NOS 5238-5239, respectively, in order of appearance.
FIG. 58 shows ALAS1 mRNA levels as assessed in matching sérum or urine samples obtained from either AIP patients or normal healthy volunteers (NHV). ALAS1 mRNA levels in sérum or urine were measured using the cERD method. In AIP patients A and B, a second set of senim and urine samples were collected to access ALAS1 mRNA variability over time.
Detailed Description of the Invention iRNA directs the sequence-specific dégradation of mRNA through a process known as RNA interférence (RNAi). Described herein are iRNAs and methods of using them for inhibiting the expression of an ALAS1 gene in a cell or a mammal where the iRNA targets an ALAS1 gene. Also provided are compositions and methods for disorders related to ALAS1 expression, such as porphyrias (e.g., ALA deyhdratase deficiency porphyria (ADP or Doss poiphyria), acute intermittent porphyria, congénital erythropoietic porphyria, prophyria cutanea tarda, hereditary coproporphyria (coproporphyria), variegate poiphyria, erythropoietic protoporphyria (EPP), X-linked sideroblastic anémia (XLSA), and and transient erythroporphyria of infancy).
Poiphyrias are inherited or acquired disorders that can be caused by decreased or enhanced activity of spécifie enzymes in the heme biosynthetic pathway, also referred to herein as the poiphyrin pathway (See FIG. 1). Porphyrins are the main precursors of heme. Porphyrins and porphyrin precursors include δ-aminolevulinic acid (ALA), porphopilinogen (PBG), hydroxymethylbilane (HMB), uroporphyrinogen I or III, coproporphyrinogen I or III, protoporphrinogen IX, and protoporphyrin IX. Heme is an essential part of hemoglobin, myoglobin, catalases, peroxidases, and cytochromes, the latter including the respiratory and P450 liver cytochromes. Heme is synthesized in most or ail human cells. About 85% of heme is made in erythroid cells, primarily for hemoglobin. Most of the remaining heme is made in the liver, 80% of which is used for the synthesis of cytochromes. Deficiency of spécifie enzymes in the porphyrin pathway leads to insufficient heme production and also to an accumulation of porphyrin precursors and/or porphyrins, which can be toxic to cell or organ fonction in high concentrations.
Porphyrias may manifest with neurological complications (“acute”), skin problems (“cutaneous”) or both. Porphyrias may be classified by the primary site of the overproduction and accumulation of porphyrins or their precursors. In hepatic porphyrias, porphyrins and porphyrin precursors are overproduced predominantly in the liver, whereas in erythropoietic porphyrias, porphyrins are oveiproduced in the erythroid cells in the bone. The acute or hepatic porphyrias lead to dysfonction of the nervous system and neurologie manifestations that can affect both the central and peripheral nervous system, resulting in symptoms such as, for example, pain (e.g., abdominal pain and/or chronic neuropathie pain), vomiting, neuropathy (e.g., acute neuropathy, progressive neuropathy), muscle weakness, seizures, mental disturbances (e.g., hallucinations, dépréssion anxiety, paranoïa), cardiac arrhythmias, tachycardia, constipation, and diarrhea. The cutaneous or erythropoietic porphyrias primarily affect the skin, causing symptoms such as photosensitivity that can be painfol, blisters, necrosis, itching, swelling, and increased hair growth on areas such as the forehead. Subséquent infection of skin lésions can lead to bone and tissue loss, as well as scarring, disfigurement, and loss of digits (e.g., fingers, toes). Most poiphyrias are caused by mutations that encode enzymes in the heme biosynthetic pathway. A summary of porphyrias associated with genetic errors in heme metabolism is provided in FIG. 2.
Not ail porphyrias are genetic. For example, patients with liver disease may develop porphyria as a resuit of liver dysfonction, and a transient form of erythroporphria (transient erythropoiphyria of infancy) has been described in infancy (see Crawford, R.I. et al, J Am Acad Dermatol. 1995 Aug; 33(2 Pt 2):333-6.) Patients with PCT can acquire the déficient activity of uroporphyrinogen decarboxylase (URO-D), due to the formation of a ORO-D enzyme with lower than normal enzymatic activity (see Phillips et al. Blood, 98:3179-3185, 2001.)
Acute intermittent porphyria (AIP) (also be referred to as porphobilinogen (PBG) deaminase deficiency, or hydroxymethylbilane synthase (HMBS) deficiency), is the most common type of acute hepatic porphyria. Other types of acute hepatic porphyrias include hereditary copropoiphyria (HCP), variegate porphyria (VP), and ALA deyhdratase deficiency porphyria (ADP). Acute hepatic porphyrias are described, e.g., in Balwani, M and Desnick, R.J.,
Blood, 120:4496-4504, 2012.
AIP is typically an autosomal dominant disease that is characterized by a deficiency of the enzyme porphobilinogen deaminase (PBG deaminase); this enzyme is also known as hydroxymethylbilane synthase (HMB synthase or HMBS). PBG deaminase is the third enzyme of the heme biosynthetic pathway (see FIG. 1) and catalyzes the head to tail condensation of four porphobilinogen molécules into the linear tetrapyrrole, hydroxymethylbilane (HMB). Alternatively spliced transcript variants encoding different isoforms of PBG deaminase hâve been described. Mutations in the PBG deaminase gene are associated with AIP. Such mutations may lead to decreased amounts of PBG deaminase and/or decreased activity of PBG deaminase (affected individuals typically hâve a ~50% réduction in PBG deaminase activity).
There are at least two different models of the pathophysiology of AIP and other acute hepatic porphyrias (see, e.g., Lin CS-Y et al., Clinical Neurophysiology, 2011; 122:2336-44). According to one model, the decreased heme production resulting from PBG deaminase deficiency causes energy failure and axonal degeneration. According to the other, currently more favored model, the buildup of porphyrin precursors (e.g., ALA and PBG) results in neurotoxicity.
AIP has been found to hâve a prevalence as high as 1 in 10,000 in certain populations (e.g., in Northem Sweden; see Floderus Y, et al. Clin Genet. 2002;62:288-97). The prevalence in the general population in United States and Europe, excluding the U.K., is estimated to be about 1 in 10,000 to 1 in 20,000. Clinical disease manifests itself in only approximately 10-15% of individuals who carry mutations that are known to be associated with AIP. However, the penetrance is as high as 40% in individuals with certain mutations (e.g., the W198X mutation). AIP is typically latent prior to puberty. Symptoms are more common in females than in males. The prevalence of the disease is probably underestimated due to its incomplète penetrance and long periods of latency. In the United States, it is estimated that there are about 2000 patients who hâve suffered at least one attack. It is estimated that there are about 150 active récurrent cases in France, Sweden, the U.K., and Poland; these patients are predominantly young women, with a médian âge of 30. See, e.g., Elder et al, J Inherit Metab Dis., published online Nov 1,
2012.
AIP affects, for example, the viscéral, peripheral, autonomie, and central nervous Systems. Symptoms of AIP are variable and include gastrointestinal symptoms (e.g., severe and poorly localized abdominal pain, nausea/vomiting, constipation, diarrhea, iléus), urinary symptoms (dysuria, urinary retention/incontinence, or dark urine, e.g., dark red mine), neurologie symptoms (e.g., sensory neuropathy, motor neuropathy (e.g., affecting the cranial nerves and/or leading to weakness in the aims or legs), seizures, neuropathie pain (e.g., pain associated with progressive neuropathy, e.g., chronic neuropathie pain), neuropsychiatrie symptoms (e.g., mental confusion, anxiety, agitation, hallucination, hysteria, delirium, apathy, dépréssion, phobias, psychosis, insomnia, somnolence, coma), autonomie nervous System involvement (resulting e.g., in cardiovascular sysmptoms such as tachycardia, hypertension, and/or arrhythmias, as well as other symptoms, such as, e.g., increased circulating catecholamine levels, sweating, restlessness, and/or tremor), déhydration, and electrolyte abnormalities. The most common symptoms are abdominal pain and tachycardia. Neurological manifestations include motor and autonomie neuropathy and seizures. Patients frequently hâve chronic neuropathie pain and develop a progressive neuropathy. Patients with recurring attacks often hâve a prodrome. Permanent paralysis may occur after a severe attack. Recovery from severe attacks that are not promptly treated may take weeks or months. An acute attack may be fatal, for example, due to paralysis of respiratory muscles or cardiovascular failure ffom electrolyte imbalance. (See, e.g., Thunell S. Hydroxymethylbilane Synthase Deficiency. 2005 Sep 27 [Updated 2011 Sep 1]. In: Pagon RA, Bird TD, Dolan CR, et al., editors. GeneReviews™ [Internet]. Seattle (WA): University of Washington, Seattle; 1993- (hereinafter Thunell (1993)), which is hereby incorporated by reference in its entirety.) Prior to the availability of Hemin treatments, up to 20% of patients with AIP died from the disease.
In individuals who carry genes for AIP, the risk of hepatocellular cancer is increased. In those with récurrent attacks, the risk of hepatocellular cancer is particularly grave: after the âge of 50, the risk is nearly 100-fold greater than in the general population.
Attacks of acute poiphyria may be precipitated by endogenous or exogenous factors. The mechanisms by which such factors induce attacks may include, for example, increased demand for hepatic P450 enzymes and/or induction of ALAS1 activity in the liver. Increased demand for hepatic P450 enzymes results in decreased hepatic free heme, thereby inducing the synthesis of hepatic ALAS1.
Precipitating factors include fasting (or other forms of reduced or inadéquate calorie intake, due to crash diets, long-distance athletics, etc.), metabolic stresses (e.g., infections, surgery, international air travel, and psychological stress), endogenous hormones (e.g., progestérone), cigarette smoking, lipid-soluble foreign chemicals (including, e.g., chemicals présent in tobacco smoke, certain prescription drugs, organic solvents, biocides, components in alcoholic beverages), endocrine factors (e.g., reproductive hormones (women may expérience exacerbations during the premenstrual period), synthetic estrogens, progestérones, ovulation stimulants, and hormone replacement therapy). See, for example, Thunell (1993).
Over 1000 diugs are contraindicated in the acute hepatic porphyrias (e.g., AIP, HCP, ADP, and VP) including, for example, alcohol, barbiturates, Carbamazepine, Carisoprodol, Clonazepam (high doses), Danazol, Diclofenac and possibly other NSAIDS, Ergots, estrogens, Ethyclorvynol, Glutethimide, Griseofulvin, Mephenytoin, Meprobamate (also mebutamate and tybutamate), Methyprylon, Metodopramide, Phenytoin, Primidone, progestérone and synthetic progestins, Pyrazinamide, Pyrazolones (aminopyrine and antipyrine), Rifampin, Succinimides (ethosuximide and methsuximide), sulfonamide antibiotics, and Valproic acid.
Objective signs of AIP include discoloration of the urine during an acute attack (the urine may appear red or red-brown), and increased concentrations of PBG and ALA in urine during an acute attack. Molecular genetic testing identifies mutations in the PBG deaminase (also known as HMBS) gene in more than 98% of affected individuals. Thunell (1993).
Diagnosis of porphria can involve assessment of family history, assessment of porphyrin precursor levels in urine, blood, or stool, and/or assessment of enzyme activity and DNA mutation analysis. The differential diagnosis of porphyrias may involve determining the type of porphyria by measuring individual levels of porphyrins or porphyrin precursors (e.g., ALA, PBG) in the urine, feces, and/or plasma (e.g., by chromatography and fluorometry) during an attack. The diagnosis of AIP can be confirmed by establishing that érythrocyte PBG deaminase activity is at 50% or less of the normal level. DNA testing for mutations may be carried out in patients and at-risk family members. The diagnosis of AIP is typically confirmed by DNA testing to identify a spécifie caustative gene mutation (e.g., an HMBS mutation).
Current management of acute attacks of AIP involves hospitalization, monitoring of symptoms, and removal of unsafe drugs. Treatment of acute attacks typically requires hospitalization to control and treat acute sysmptoms, including, e.g., abdominal pain, seizures, dehydration/hyponatremia, nausea/vomiting, tachycardia/hypertension, urinary retention/ileus. For example, abdominal pain may be treated, e.g., with narcotic analgésies, seizures may be treated with seizure précautions and possibly médications (although many anti-seizure médications are contraindicated), nausea/vomiting may be treated, e.g., with phenothiazines, and tachycardia/hypertension may be heated, e.g., with beta blockers. Treatment may include withdrawal of unsafe médications, monitoring of respiratory function, as well as muscle strength and neurological status. Mild attacks (e.g., those with no paresis or hyponatremia) may be heated with at least 300 g inhavenous 10% glucose per day, although increasingly hemin is provided immediately. Severe attacks are typically treated as soon as possible with inhavenous hemin (3-4 mg/kg daily for 4-14 days) and with IV glucose while waiting for the IV hemin to take effect. Typically, attacks are heated with IV hemin for 4 days and with IV glucose while waiting for adminishation of the IV hemin. Within 3-4 days following the start of hemin administration, there is usually clinical improvement accompanying by lowering of ALA and PBG levels.
Hemin (Panhematin® or hemin for injection, previously known as hematin) is the only heme product approved for use in the United States and was the first drug approved under the Orphan Drug Act. Panhematin® is hemin derived from processed red blood cells (PRBCs), and is Protoporphyrin IX containing a ferrie iron ion (Heme B) with a chloride ligand. Heme acts to limit the hepatic and/or marrow synthesis of porphyrin. The exact mechanism by which hemin produces symptomatic improvement in patients with acute épisodes of the hepatic porphyrias has not been elucidated; however, its action is likely due to the (feedback) inhibition of δaminolevulinic acid (ALA) synthase, the enzyme which limits the rate of the porphyrin/heme biosynthetic pathway. See Panhematin® product label, Lundbeck, Inc., October 2010.
Inhibition of ALA synthase should resuit in reduced production of ALA and PBG as well as porphyrins and porphyrin intermediates.
Drawbacks of heme products (e.g., hemin) include delayed impact on clinical symptoms and failure to prevent the recuirence of attacks. Adverse reactions associated with heme (e.g., hemin) administration may include phlebitis (e.g., thrombophlebitis), difficulty with venous access, anticoagulation (or coagulopathies), thrombocytopenia, rénal shut down, or iron overload, which is particularly likely in patients requiring multiple courses of hemin treatment for récurrent attacks. To prevent phlebitis, an indwelling venous cathéter is needed for access in patients with récurrent attacks. Rénal damage can occur with high doses. Uncommonly reported side effects include fever, aching, malaise, hemolysis, anaphalaxis, and circulatory collapse. See Anderson, K.E., Approaches to Treatment and Prévention of Human Poiphyrias, in The Porphyrin Handbook: Medical Aspects of Porphyrins, Edited by Karl M. Kadish, Kevin M. Smith, Roger Guilard (2003) (hereinafter Anderson).
Heme is difficult to préparé in a stable form for intravenous administration. It is insoluble at neutral pH but can be prepared as heme hydroxide at pH 8 or higher. Anderson. Panhematin is a lyophilized hemin préparation. When lyophilized hemin is solubilized for intravenous administration, dégradation products form rapidly; these dégradation products are responsible for a transient anticoagulant effect and for phlebitis at the site of infusion. Anderson. Heme albumin and heme arginate (Normosang, the European version of hemin) are more stable and may potentially cause less thrombophlebitis. However, heme arginate is not approved for use in the United States. Panhemin may be stabilized by solubilizing it for infusion in 30% human albumin rather than in stérile water; however, albumin adds intravascular volumeexpanding effects and increases the cost of treatment as well as risk of pathogens since it is isolated from human blood. See, e.g., Anderson supra.
The successful treatment of an acute attack does not prevent or delay récurrence. There is a question of whether hemin itself can trigger recurring attacks due to induction of heme oxygenase. Nonetheless, in some areas (especially France), young women with multiply récurrent attacks are being treated with weekly hemin with the goal of achieving prophylaxis. Limited expérience with liver transplantation suggests that if successful, it is an effective treatment for AIP. There hâve been approximately 12 transplants in Europe in human patients, with curative or varying effects. Liver transplantation can restore normal excrétion of ALA and PBG and prevent acute attacks. See, e.g., Dar, F.S. et al. Hepatobiliary Pancreat. Dis. Int., 9(1):93-96 (2010). Furthermore, if the liver of a patient with AIP is transplanted into another patient (“domino transplant”), the patient receiving the transplant may develop AIP.
Among the long-term clinical effects of acute porphyrias is chronic neuropathie pain that may resuit from a progressive neuropathy due to neurotoxic effects, e.g., of elevated porphyrin precursors (e.g., ALA and/or PBG). The neurotoxic effects can be associated with toxic heme intermediate production, for example, altered GABA signaling and/or production of ironmediated oxidation and reactive oxygen species (ROS). Patients may suffer from neuropathie pain prior to or during an acute attack. Older patients may expérience increased neuropathie pain with âge for which various narcotic drugs are typically prescribed. Electromyogram abnormalities and decreased conduction times hâve been documented in patients with acute hepatic porphyrias. Of note, untreated, uninduced mice with AIP (PBG deaminase deficiency) develop a progressive motor neuropathy that has been shown to cause progressive quadriceps nerve axon degeneration and loss presumably due to constitutively elevated porphyrin precursor (ALA & PBG) levels, porphyrins and/or heme deficiency (Lindberg et al., J. Clin. Invest., 103(8): 1127-1134, 1999). In patients with acute porphyria (e.g., ADP, AIP, HCP, or VP), levels of porphyrin precursors (ALA & PBG) are often elevated in asymptomatic patients and in symptomatic patients between attacks. Thus, réduction of the porphyrin precursors and resumption of normal heme biosynthesis by reducing the level of ALAS1 expression and/or activity is expected to prevent and/or minimize development of chronic and progressive neuropathy. Treatment, e.g., chronic treatment (e.g., periodic treatment with iRNA as described herein, e.g., treatment according to a dosing regimen as described herein, e.g., weekly or biweekly treatment) can continuously reduce the ALAS1 expression in acute porphyria patients who hâve elevated levels of porphyrin precursors, porphyrins, porphyrin products or their métabolites. Such treatment may be provided as needed to prevent or reduce the frequency or severity of an individual patient’s symptoms (e.g., pain and/or neuropathy) and/or to reduce a level of a porphyrin precursor, porphyrin, porphyrin product or métabolite.
The need exists for identifying novel therapeutics that can be used for the treatment of porphyrias. As discussed above, existing treatments such as heme products (e.g., hemin) hâve numerous drawbacks. For example, the impact of hemin on clinical symptoms is delayed, it is expensive, and it may hâve side effects (e.g., thrombophlebitis, anticoagulation, thrombocytopenia, iron overload, rénal shutdown). Novel therapeutics such as those described herein can address these drawbacks and the unmet needs of patients acting faster, not inducing phlebitis, providing the convenience of subcutaneous administration, successfully preventing récurrent attacks, preventing or ameliorating pain (e.g., chronic neuropathie pain) and/or progressive neuropathy, and/or not causing certain adverse effects associated with hemin (e.g., iron overload, increased risk of hepatocellular cancer).
Patients with AIA include those who suffer from récurrent attacks and those who suffer from acute, sporadic attacks. In the pateints who suffer from récurrent attacks, about 5-10% hâve récurrent intermittent attacks (2-3 attacks per year) or récurrent attacks (>4 attacks per yeaij. These patients are most likely to consider liver transplant or to receive prophylactic heme (e.g., hemin) infusions. The récurrent attack patients are likely to hâve poor quality of life due to long hospital stays, opiate addiction, and/or venous network toxicity. Chronic heme administration can induce heme oxygenase (HO-1). Thus, it can be diffïcult to wean patients off heme and some require more frequent treatment. Some clinicials are therefore restricting heme use to the most serious attacks. Accordingly, there is an unmet need for convenient, effective prophylaxis and treatments with better tolerability.
For patients who suffer from acute attacks, clinical guidelines suggest administration of heme as early as possible. However, given the challenges of diagnosis and lack of immédiate drug availability, administration may be delayed. The slow onset of the effects of heme (e.g., hemin) and its poor tolerability slow the time to improvement. Persistence of severe abdominal pain, even after administration of heme, can require that patients receive opiates for multiple days.
Delayed administration of heme or continued exposure to precipitating factors can lead to more serious complications, including motor neuropathy and accompanying symptoms (e.g., weakness, paresis). Respiratory failure and paralysis can occur in severe cases. Recovery from neurological symptoms can take much longer to résolve. Accordingly, in the context of acute attacks, treatments that hâve a faster onset of action and better tolerability are needed. Pharmacological validation of ALAS1 as a target for mRNA silencing is supported by at least the following findings: ALAS1 mRNA is strongly upregulated during an attack; panhematin down modulâtes ALAS-1; and addition of heme to liver cells in culture leads to reduced ALAS-1 mRNA. Several findings also indicate that suppression of ALAS1 mRNA can be achieved by targeting the liver. For example, liver transplant has been shown to be curative; and liver derived métabolites drive attacks (see e.g., Dar et al. Hepatobiliary Pancreat Dis Int. 9:93-6 (2010); Dowman et al. Ann Intern Med 154:571-2 (2011); and Wu et al. Genes Dev 23:2201-2209 (2009). Thus, reducing expression of ALAS1, e.g., in the liver, using iRNA compositions can be used to treat a porphyria. In certain embodiments, iRNA compositions can be used for prophylaxis and acute treatment of porphyrias. For example, iRNA compositions can be used prophylactically in a récurrent attack setting to induce long-term or chronic suppression of ALAS1 expression (leading to long-term or chronic suppression of ALA/PBG), and thus blunting the récurrent ALAS1 upregulation that drives the attacks. Such prophylactic treatment can reduce the number and the severity of the attacks. During an acute attack setting, administration of an iRNA composition can treat an acute attack, e.g., by reducing the levels of ALA/PBG.
The présent disclosure provides methods and iRNA compositions for modulating the expression of an ALAS1 gene. In certain embodiments, expression of ALAS1 is reduced or inhibited using an ALAS 1-spécifie iRNA, thereby leading to a decreased expression of an ALAS1 gene. Reduced expression of an ALAS1 gene may reduce the level of one or more porphyrin precursors, porphyrins, or porphyrin products or métabolites. Decreased expression of an ALAS1 gene, as well as related decreases in the level of one or more porphyrin precursors and/or porphyrins, can be useful in treating disorders related to ALAS1 expression, e.g., poiphyrias.
The iRNAs of the compositions featured herein include an RNA strand (the antisense strand) having a région which is 30 nucléotides or less in length, i.e., 15-30 nucléotides in length, generally 19-24 nucléotides in length, which région is substantially complementary to at least part of an mRNA transcript of an ALAS1 gene (also referred to herein as an “ALAS1-spécifie iRNA”). The use of such an iRNA enables the targeted dégradation of mRNAs of genes that are implicated in pathologies associated with ALAS1 expression in mammals, e.g., porphyrias such as ALA dehydratase deficiency poiphyria (also known as Doss porphyria or plumboporphyria) or acute intermittent porphyria. Very low dosages of ALAS1-spécifie iRNAs can specifïcally and efficiently médiate RNAi, resulting in signifïcant inhibition of expression of an ALAS1 gene. iRNAs targeting ALAS1 can specifïcally and efficiently médiate RNAi, resulting in signifïcant inhibition of expression of an ALAS1 gene, e.g., in cell based assays. Thus, methods and compositions including these iRNAs are useful for treating pathological processes related to ALAS1 expression, such as porphyrias (e.g., X-linked sideroblastic anémia (XLSA), ALA deyhdratase deficiency porphyria (Doss poiphyria), acute intermittent porphyria (AIP), congénital erythropoietic porphyria, prophyria cutanea tarda, hereditary coproporphyria (coproporphyria), variegate porphyria, erythropoietic protoporphyria (EPP), and transient erythroporphyria of infancy).
The following description discloses how to make and use compositions containing iRNAs to inhibit the expression of an ALAS1 gene, as well as compositions and methods for treating diseases and disorders caused by or modulated by the expression of this gene. Embodiments of the pharmaceutical compositions featured in the invention include an iRNA having an antisense strand comprising a région which is 30 nucléotides or less in length, generally 19-24 nucléotides in length, which région is substantially complementary to at least part of an RNA transcript of an ALAS1 gene, together with a pharmaceutically acceptable carrier. Embodiments of compositions featured in the invention also include an iRNA having an antisense strand having a région of complementarity which is 30 nucléotides or less in length, generally 19-24 nucléotides in length, and is substantially complementary to at least part of an RNA transcript of an ALAS1 gene.
Accordingly, in some aspects, pharmaceutical compositions containing an ALAS1 iRNA and a pharmaceutically acceptable carrier, methods of using the compositions to inhibit expression of an ALAS1 gene, and methods of using the pharmaceutical compositions to treat disorders related to ALAS1 expression are featured in the invention.
I. Définitions
For convenience, the meaning of certain terms and phrases used in the spécification, examples, and appended claims, are provided below. If there is an apparent discrepancy between the usage of a term in other parts of this spécification and its définition provided in this section, the définition in this section shall prevail.
“G,” “C,” “A,” “T” and “U” each generally stand for a nucléotide that contains guanine, cytosine, adenine, thymidine and uracil as a base, respectively. However, it will be understood that the term “ribonucleotide” or “nucléotide” can also refer to a modified nucléotide, as further detailed below, or a surrogate replacement moiety. The skilled person is well aware that guanine, cytosine, adenine, and uracil may be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide comprising a nucléotide bearing such replacement moiety. For example, without limitation, a nucléotide comprising inosine as its base may base pair with nucléotides containing adenine, cytosine, or uracil. Hence, nucléotides containing uracil, guanine, or adenine may be replaced in the nucléotide sequences of dsRNA featured in the invention by a nucléotide containing, for example, inosine. In another example, adenine and cytosine anywhere in the oligonucleotide can be replaced with guanine and uracil, respectively to form G-U Wobble base pairing with the target mRNA. Sequences containing such replacement moieties are suitable for the compositions and methods featured in the invention.
As used herein, “ALAS1” (also known as ALAS-1; δ-aminolevulinate synthase 1; δ-ALA synthase 1; 5’-aminolevulinic acid synthase 1; ALAS-H; ALASH; ALAS-N; ALAS3; EC2.3.1.37; 5-aminolevulinate synthase, nonspecific, mitochondrial; ALAS; MIG4; OTTHUMP00000212619; OTTHUMP00000212620; OTTHUMP00000212621; OTTHUMP00000212622; migration-inducing protein 4; EC 2.3.1 ) refers to a nuclear-encoded mitochondrial enzyme that is the first and typically rate-limiting enzyme in the mammalian heme biosynthetic pathway. ALAS1 catalyzes the condensation of glycine with succinyl-CoA to form δ-aminolevulinic acid (ALA). The human ALAS1 gene is expressed ubiquitously, is found on chromosome 3p21.1 and typically encodes a sequence of 640 amino acids. In contrast, the ALAS-2 gene, which encodes an isozyme, is expressed only in érythrocytes, is found on chromoxome Xpl 1.21, and typicallyencodes a sequence of 550 amino acids. As used herein an “ALAS1 protein” means any protein variant of ALAS1 from any species (e.g., human, mouse, non-human primate), as well as any mutants and fragments thereof that retain an ALAS1 activity. Similarly, an “ALAS1 transcript” refers to any transcript variant of ALAS1, from any species (e.g., human, mouse, non-human primate). A sequence of a human ALAS1 mRNA transcript can be found at NM_000688.4 (FIG. 3A and FIG. 3B; SEQ ID NO:1). Another human ALAS1 mRNA transcript, can be found at NM_000688.5 (FIG. 4A and FIG. 4B; SEQ ID NO:382). The level of the mature encoded ALAS1 protein is regulated by heme: high levels of heme down-regulate the mature enzyme in mitochondria while low heme levels up-regulate. Multiple altematively spliced variants, encoding the same protein, hâve been identified.
As used herein, the term “iRNA,” “RNAi”, “iRNA agent,” or “RNAi agent” refers to an agent that contains RNA as that tenu is defined herein, and which médiates the targeted cleavage of an RNA transcript, e.g., via an RNA-induced silencing complex (RISC) pathway. In one embodiment, an iRNA as described herein effects inhibition of ALAS1 expression. Inhibition of ALAS1 expression may be assessed based on a réduction in the level of ALAS1 mRNA or a réduction in the level of the ALAS1 protein. As used herein, “target sequence” refers to a contiguous portion of the nucléotide sequence of an mRNA molécule formed during the transcription of an ALAS1 gene, including mRNA that is a product of RNA processing of a primary transcription product. The target portion of the sequence will be at least long enough to serve as a substrate for iRNA-directed cleavage at or near that portion. For example, the target sequence will generally be from 9-36 nucléotides in length, e.g., 15-30 nucléotides in length, including ail sub-ranges therebetween. As non-limiting examples, the target sequence can be from 15-30 nucléotides, 15-26 nucléotides, 15-23 nucléotides, 15-22 nucléotides, 15-21 nucléotides, 15-20 nucléotides, 15-19 nucléotides, 15-18 nucléotides, 15-17 nucléotides, 18-30 nucléotides, 18-26 nucléotides, 18-23 nucléotides, 18-22 nucléotides, 18-21 nucléotides, 18-20 nucléotides, 19-30 nucléotides, 19-26 nucléotides, 19-23 nucléotides, 19-22 nucléotides, 19-21 nucléotides, 19-20 nucléotides, 20-30 nucléotides, 20-26 nucléotides, 20-25 nucléotides, 20-24 nucléotides,20-23 nucléotides, 20-22 nucléotides, 20-21 nucléotides, 21-30 nucléotides, 21-26 nucléotides, 21-25 nucléotides, 21-24 nucléotides, 21-23 nucléotides, or 21-22 nucléotides.
As used herein, the tenu “strand comprising a sequence” refers to an oligonucleotide comprising a chain of nucléotides that is described by the sequence referred to using the standard nucléotide nomenclature.
As used herein, and unless otherwise indicated, the term “complementary,” when used to describe a first nucléotide sequence in relation to a second nucléotide sequence, refers to the ability of an oligonucleotide or polynucleotide comprising the first nucléotide sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide comprising the second nucléotide sequence, as will be understood by the skilled person. Such conditions can, for example, be stringent conditions, where stringent conditions may include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50°C or 70°C for 12-16 hours followed by washing. Other conditions, such as physiologically relevant conditions as may be encountered inside an organism, can apply. The skilled person will be able to détermine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the hybridized nucléotides.
Complementary sequences within an iRNA, e.g., within a dsRNA as described herein, include base-pairing of the oligonucleotide or polynucleotide comprising a first nucléotide sequence to an oligonucleotide or polynucleotide comprising a second nucléotide sequence over the entire length of one or both nucléotide sequences. Such sequences can be referred to as “fully complementary” with respect to each other herein. However, where a first sequence is referred to as “substantially complementary” with respect to a second sequence herein, the two sequences can be fully complementary, or they may form one or more, but generally not more than 5, 4, 3 or 2 mismatched base pairs upon hybridization for a duplex up to 30 base pairs, while retaining the ability to hybridize under the conditions most relevant to their ultimate application, e.g., inhibition of gene expression via a RISC pathway. However, where two oligonucleotides are désignée! to form, upon hybridization, one or more single stranded overhangs, such overhangs shall not be regarded as mismatches with regard to the détermination of complementarity. For example, a dsRNA comprising one oligonucleotide 21 nucléotides in length and another oligonucleotide 23 nucléotides in length, wherein the longer oligonucleotide comprises a sequence of 21 nucléotides that is fully complementary to the shorter oligonucleotide, may yet be referred to as “fully complementary” for the purposes described herein.
“Complementary” sequences, as used herein, may also include, or be formed entirely from, non-Watson-Crick base pairs and/or base pairs formed from non-natural and modified nucléotides, in as far as the above requirements with respect to their ability to hybridize are fulfilled. Such non-Watson-Crick base pairs includes, but are not limited to, G:U Wobble or Hoogstein base pairing.
The terms “complementary,” “fully complementary” and “substantially complementary” herein may be used with respect to the base matching between the sense strand and the antisense strand of a dsRNA, or between the antisense strand of an iRNA agent and a target sequence, as will be understood from the context of their use.
As used herein, a polynucleotide that is “substantially complementary to at least part of ’ a messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to a contiguous portion of the mRNA of interest (e.g., an mRNA encoding an ALAS1 protein). For example, a polynucleotide is complementary to at least a part of an ALAS1 mRNA if the sequence is substantially complementary to a non-interrupted portion of an mRNA encoding ALAS1. As another example, a polynucleotide is complementary to at least a part of an ALAS1 mRNA if the sequence is substantially complementary to a non-interrupted portion of an mRNA encoding ALAS1.
The term “double-stranded RNA” or “dsRNA,” as used herein, refers to an iRNA that includes an RNA molécule or complex of molécules having a hybridized duplex région that comprises two anti-parallel and substantially complementary nucleic acid strands, which will be referred to as having “sense” and “antisense” orientations with respect to a target RNA. The duplex région can be of any length that permits spécifie dégradation of a desired target RNA, e.g., through a RISC pathway, but will typically range from 9 to 36 base pairs in length, e.g., 15 base pairs in length. Considering a duplex between 9 and 36 base pairs, the duplex can be any length in this range, for example, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 and any sub-range therein between, including, but not limited to 15-30 base pairs, 15-26 base pairs, 15-23 base pairs, 15-22 base pairs, 15-21 base pairs, 15-20 base pairs, 15-19 base pairs, 15-18 base pairs, 15-17 base pairs, 18-30 base pairs, 18-26 base pairs, 18-23 base pairs, 18-22 base pairs, 18-21 base pairs, 18-20 base pairs, 19-30 base pairs, 19-26 base pairs, 19-23 base pairs, 19-22 base pairs, 19-21 base pairs, 19-20 base pairs, 20-30 base pairs, 20-26 base pairs, 20-25 base pairs, 20-24 base pairs, 20-23 base pairs, 20-22 base pairs, 20-21 base pairs, 21-30 base pairs, 21-26 base pairs, 21-25 base pairs, 21-24 base pairs, 21-23 base pairs, or 21-22 base pairs. dsRNAs generated in the cell by processing with Dicer and similar enzymes are generally in the range of 19-22 base pairs in length. One strand of the duplex région of a dsDNA comprises a sequence that is substantially complementary to a région of a target RNA. The two strands forming the duplex structure can be from a single RNA molécule having at least one self-complementary région, or can be formed from two or more separate RNA molécules. Where the duplex région is formed from two strands of a single molécule, the molécule can hâve a duplex région separated by a single stranded chain of nucléotides (herein referred to as a hairpin loop) between the 3’-end of one strand and the 5’-end of the respective other strand forming the duplex structure. The hairpin loop can comprise at least one unpaired nucléotide; in some embodiments the hairpin loop can comprise at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 23 or more unpaired nucléotides. Where the two substantially complementary strands of a dsRNA are comprised by separate RNA molécules, those molécules need not, but can be covalently connected. Where the two strands are connected covalently by means other than a hairpin loop, the connecting structure is referred to as a “linker.” The term “siRNA” is also used herein to refer to a dsRNA as described above.
In another embodiment, the iRNA agent may be a “single-stranded siRNA” that is introduced into a cell or organism to inhibit a target mRNA. Single-stranded RNAi agents bind to the RISC endonuclease Argonaute 2, which then cleaves the target mRNA. The singlestranded siRNAs are generally 15-30 nucléotides and are chemically modified. The design and testing of single-stranded siRNAs are described in U.S. Patent No. 8,101,348 and in Lima et al., (2012) Cell 150: 883-894, the entire contents of each of which are hereby incorporated herein by reference. Any of the antisense nucléotide sequences described herein (e.g., sequences provided in Tables 2, 3, 6, 7, 8, 9, 14, 15, 18 and 20 or in Tables 21-40) may be used as a single-stranded siRNA as described herein or as chemically modified by the methods described in Lima et al., (2012) Cell 150:883-894.
In another aspect, the RNA agent is a “single-stranded antisense RNA molécule”. An single-stranded antisense RNA molécule is complementary to a sequence within the target mRNA. Single-stranded antisense RNA molécules can inhibit translation in a stoichiometric manner by base pairing to the mRNA and physically obstructing the translation machinery, see Dias, N. et al., (2002) Mol Cancer Ther 1:347-355. Altematively, the single-stranded antisense molécules inhibit a target mRNA by hydridizing to the target and cleaving the target through an RNaseH cleavage event. The single-stranded antisense RNA molécule may be about 10 to about 30 nucléotides in length and hâve a sequence that is complementary to a target sequence. For example, the single-stranded antisense RNA molécule may comprise a sequence that is at least about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more contiguous nucléotides from any one of the antisense nucléotide sequences described herein, e.g., sequences provided in any one of Tables 2, 3, 6, 7, 8, 9, 14, 15, 18 and 20 or in Tables 21-40.
The skilled artisan will recognize that the term “RNA molécule” or “ribonucleic acid molécule” encompasses not only RNA molécules as expressed or found in nature, but also analogs and dérivatives of RNA comprising one or more ribonucleotide/ribonucleoside analogs or dérivatives as described herein or as known in the art. Strictly speaking, a “ribonucleoside” includes a nucleoside base and a ribose sugar, and a “ribonucleotide” is a ribonucleoside with one, two or three phosphate moieties. However, the terms “ribonucleoside” and “ribonucleotide” can be considered to be équivalent as used herein. The RNA can be modified in the nucleobase structure, in the ribose structure, or in the ribose-phosphate backbone structure, e.g., as described herein below. However, the molécules comprising ribonucleoside analogs or dérivatives must retain the ability to form a duplex. As non-limiting examples, an RNA molécule can also include at least one modified ribonucleoside including but not limited to a 2'-O-methyl modified nucleostide, a nucleoside comprising a 5' phosphorothioate group, a terminal nucleoside linked to a cholesteryl dérivative or dodecanoic acid bisdecylamide group, a locked nucleoside, an abasic nucleoside, an acyclic nucleoside, a 2'-deoxy-2'-fluoro modified nucleoside, a 2'-aminomodifîed nucleoside, 2'-alkyl-modified nucleoside, moipholino nucleoside, a phosphoramidate or a non-natural base comprising nucleoside, or any combination thereof. Alternatively, an RNA molécule can comprise at least two modified ribonucleosides, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20 or more, up to the entire length of the dsRNA molécule. The modifications need not be the same for each of such a plurality of modified ribonucleosides in an RNA molécule. In one embodiment, modified RNAs contemplated for use in methods and compositions described herein are peptide nucleic acids (PNAs) that hâve the ability to form the required duplex structure and that permit or médiate the spécifie dégradation of a target RNA, e.g., via a RISC pathway.
In one aspect, a modified ribonucleoside includes a deoxyribonucleoside. In such an instance, an iRNA agent can comprise one or more deoxynucleosides, including, for example, a deoxynucleoside overhang(s), or one or more deoxynucleosides within the double stranded portion of a dsRNA. In certain embodiments, the RNA molécule comprises a percentage of deoxyribonucleoses of at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95% or higher (but not 100%) deoxyribonucleosides, e.g., in one or both strands. In other embodiments, the teim “iRNA” does not encompass a double stranded DNA molécule (e.g., a naturally-occurring double stranded DNA molécule or a 100% deoxynucleoside-containing DNA molécule). In one aspect, an RNA interférence agent includes a single stranded RNA that interacts with a target RNA sequence to direct the cleavage of the target RNA. Without wishing to be bound by theory, long double stranded RNA introduced into cells is broken down into siRNA by a Type III endonuclease known as Dicer (Sharp et al., Genes Dev. 2001, 15:485). Dicer, a ribonuclease-III-like enzyme, processes the dsRNA into 19-23 base pair short interfering RNAs with characteristic two base 3' overhangs (Bernstein, et al., (2001) Nature 409:363). The siRNAs are then incorporated into an RNA-induced silencing complex (RISC) where one or more helicases unwind the siRNA duplex, enabling the complementary antisense strand to guide target récognition (Nykanen, et al., (2001) Cell 107:309). Upon binding to the appropriate target mRNA, one or more endonucleases within the RISC cleaves the target to induce silencing (Elbashir, et al., (2001) Genes Dev. 15:188). Thus, in one aspect the invention relates to a single stranded RNA that promûtes the formation of a RISC complex to effect silencing of the target gene.
As used herein, the term “nucléotide overhang” refers to at least one unpaired nucléotide that protrudes from the duplex structure of an iRNA, e.g., a dsRNA. For example, when a 3'-end of one strand of a dsRNA extends beyond the 5'-end of the other strand, or vice versa, there is a nucléotide overhang. A dsRNA can comprise an overhang of at least one nucléotide; alternatively the overhang can comprise at least two nucléotides, at least three nucléotides, at least four nucléotides, at least fïve nucléotides or more. A nucléotide overhang can comprise or consist of a nucleotide/nucleoside analog, including a deoxynucleotide/nucleoside. The overhang(s) may be on the sense strand, the antisense strand or any combination thereof. Furthermore, the nucleotide(s) of an overhang can be présent on the 5' end, 3' end or both ends of either an antisense or sense strand of a dsRNA.
In one embodiment, the antisense strand of a dsRNA has a 1-10 nucléotide overhang at the 3’ end and/or the 5’ end. In one embodiment, the sense strand of a dsRNA has a 1-10 nucléotide overhang at the 3 ’ end and/or the 5’ end. In another embodiment, one or more of the nucléotides in the overhang is replaced with a nucleoside thiophosphate.
The terms “blunf ’ or “blunt ended” as used herein in reference to a dsRNA mean that there are no unpaired nucléotides or nucléotide analogs at a given terminal end of a dsRNA, i.e., no nucléotide overhang. One or both ends of a dsRNA can be blunt. Where both ends of a dsRNA are blunt, the dsRNA is said to be blunt ended. To be clear, a “blunt ended” dsRNA is a dsRNA that is blunt at both ends, i.e., no nucléotide overhang at either end of the molécule. Most often such a molécule will be double-stranded over its entire length.
The term “antisense strand” or “guide strand” refers to the strand of an iRNA, e.g., a dsRNA, which includes a région that is substantially complementary to a target sequence. As used herein, the term “région of complementarity” refers to the région on the antisense strand that is substantially complementary to a sequence, for example a target sequence, as defined herein. Where the région of complementarity is not fully complementary to the target sequence, the mismatches may be in the internai or terminal régions of the molécule. Generally, the most tolerated mismatches are in the terminal régions, e.g., within 5, 4, 3, or 2 nucléotides of the 5’ and/or 3’ terminus.
The term “sense strand,” or “passenger strand” as used herein, refers to the strand of an iRNA that includes a région that is substantially complementary to a région of the antisense strand as that tenu is defined herein.
As used herein, the term SNALP refers to a stable nucleic acid-lipid particle. A SNALP represents a vesicle of lipids coating a reduced aqueous interior comprising a nucleic acid such as an iRNA or a plasmid from which an iRNA is transcribed. SNALPs are described, e.g., in U.S. Patent Application Publication Nos. 20060240093, 20070135372, and in International Application No. WO 2009082817. These applications are incorporated herein by reference in their entirety.
“Introducing into a cell,” when referring to an iRNA, means facilitating or effecting uptake or absorption into the cell, as is understood by those skilled in the art. Absorption or uptake of an iRNA can occur through unaided diffusive or active cellular processes, or by auxiliary agents or devices. The meaning of this tenu is not limited to cells in vitro', an iRNA may also be introduced into a cell,” wherein the cell is part of a living organism. In such an instance, introduction into the cell will include the delivery to the organism. For example, for in vivo delivery, iRNA can be injected into a tissue site or administered systemically. In vivo delivery can also be by a β-glucan delivery system, such as those described in U.S. Patent Nos. 5,032,401 and 5,607,677, and U.S. Publication No. 2005/0281781, which are hereby incorporated by reference in their entirety. In vitro introduction into a cell includes methods known in the art such as electroporation and lipofection. Further approaches are described herein below or known in the art.
As used herein, the term “modulate the expression of,” refers to at an least partial “inhibition” or partial “activation” of an ALAS1 gene expression in a cell treated with an iRNA composition as described herein compared to the expression of ALAS1 in a control cell. A control cell includes an untreated cell, or a cell treated with a non-targeting control iRNA.
The tenus “activate,” “enhance,” “up-regulate the expression of,” “increase the expression of,” and the like, in so far as they refer to an ALAS1 gene, herein refer to the at least partial activation of the expression of an ALAS1 gene, as manifested by an increase in the amount of ALAS1 mRNA, which may be isolated from or detected in a first cell or group of cells in which an ALAS1 gene is transcribed and which has or hâve been treated such that the expression of an ALAS1 gene is increased, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has or hâve not been so treated (control cells).
In one embodiment, expression of an ALAS1 gene is activated by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% by administration of an iRNA as described herein. In some embodiments, an ALAS1 gene is activated by at least about 60%, 70%, or 80% by administration of an iRNA featured in the invention. In some embodiments, expression of an ALAS1 gene is activated by at least about 85%, 90%, or 95% or more by administration of an iRNA as described herein. In some embodiments, the ALAS1 gene expression is increased by at least 1-fold, at least 2-fold, at least 5-fold, at least 10-fold, at least 50-fold, at least 100-fold, at least 500-fold, at least 1000 fold or more in cells treated with an iRNA as described herein compared to the expression in an untreated cell. Activation of expression by small dsRNAs is described, for example, in Li et al., 2006 Proc. Natl. Acad. Sci. U.S.A. 103:17337-42, and in US20070111963 and US2005226848, each of which is incorporated herein by reference.
The terms “silence,” “inhibit expression of,” “down-regulate expression of,” “suppress expression of,” and the like, in so far as they refer to an ALAS1 gene, herein refer to the at least partial suppression ofthe expression of an ALAS1 gene, as assessed, e.g., based on on ALAS1 mRNA expression, ALAS1 protein expression, or another parameter functionally linked to ALAS1 gene expression (e.g., ALA or PBG concentrations in plasma or urine). For example, inhibition of ALAS1 expression may be manifested by a réduction of the amount of ALAS1 mRNA which may be isolated from or detected in a first cell or group of cells in which an ALAS1 gene is transcribed and which has or hâve been treated such that the expression of an ALAS1 gene is inhibited, as compared to a control. The control may be a second cell or group of cells substantially identical to the first cell or group of cells, except that the second cell or group of cells hâve not been so treated (control cells). The degree of inhibition is usually expressed as a percentage of a control level, e.g., (mRNA in control cells) - (mRNA in treated cells) e qq0/z (mRNAin control cells)
Alternatively, the degree of inhibition may be given in terms of a réduction of a parameter that is functionally linked to ALAS1 gene expression, e.g., the amount of protein encoded by an ALAS1 gene, or the level of one or more porphyrins. The réduction of a parameter functionally linked to ALAS1 gene expression may similarly be expressed as a percentage of a control level. In principle, ALAS1 gene silencing may be determined in any cell expressing ALAS1, either constitutively or by genomic engineering, and by any appropriate assay. However, when a reference is needed in order to détermine whether a given iRNA inhibits the expression of the ALAS1 gene by a certain degree and therefore is encompassed by the instant invention, the assays provided in the Examples below shall serve as such reference.
For example, in certain instances, expression of an ALAS1 gene is suppressed by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% by administration of an iRNA featured in the invention. In some embodiments, an ALAS1 gene is suppressed by at least about 60%, 65%, 70%, 75%, or 80% by administration of an iRNA featured in the invention. In some embodiments, an ALAS1 gene is suppressed by at least about 85%, 90%, 95%, 98%, 99%, or more by administration of an iRNA as described herein.
As used herein in the context of ALAS1 expression, the terms “treat,” “treating,” “treatment,” and the like, refer to relief from or alleviation of pathological processes related to ALAS1 expression (e.g., pathological processes involving porphyrins or defects in the porphyrin pathway, such as, for example, porphyrias). In the context of the présent invention insofar as it relates to any of the other conditions recited herein below (other than pathological processes related to ALAS1 expression), the terms “treat,” “treatment,” and the like mean to prevent, relieve or alleviate at least one symptom associated with such condition, or to slow or reverse the progression or anticipated progression of such condition. For example, the methods featured herein, when employed to treat porphyria, may serve to reduce or prevent one or more symptoms associated with porphyria (e.g., pain), to reduce the severity or frequency of attacks associated with porphyria, to reduce the likelihood that an attack of one or more symptoms associated with porphyria will occur upon exposure to a precipitating condition, to shorten an attack associated with porphyria, and/or to reduce the risk of developing conditions associated with porphyria (e.g., hepatocellular cancer or neuropathy (e.g., progressive neuropathy),). Thus, unless the context clearly indicates otherwise, the terms “treat,” “treatment,” and the like are intended to encompass prophylaxis, e.g., prévention of disorders and/or symptoms of disorders related to ALAS1 expression.
By “lower” in the context of a disease marker or symptom is meant a statistically or clinically significant decrease in such level. The decrease can be, for example, at least 10%, at least 20%, at least 30%, at least 40% or more, and is typically down to a level accepted as within the range of normal for an individual without such disorder.
As used herein, the phrases “therapeutically effective amount” and “prophylactically effective amount” refer to an amount that provides a therapeutic benefit in the treatment, prévention, or management of pathological processes related to ALAS1 expression. The spécifie amount that is therapeutically effective can be readily determined by an ordinary medical practitioner, and may vary depending on factors known in the art, such as, for example, the type of pathological process, the patient’s history and âge, the stage of pathological process, and the administration of other agents.
As used herein, a “pharmaceutical composition” comprises a pharmacologically effective amount of an iRNA and a pharmaceutically acceptable carrier. As used herein, “pharmacologically effective amount,” “therapeutically effective amount” or simply “effective amount” refers to that amount of an iRNA effective to produce the intended pharmacological, therapeutic or préventive resuit. For example, in a method of treating a disorder related to ALAS1 expression (e.g., in a method of treating a porphyria), an effective amount includes an amount effective to reduce one or more symptoms associated with a porphyria, an amount effective to reduce the frequency of attacks, an amount effective to reduce the likelihood that an attack of one or more symptoms associated with porphyria will occur upon exposure to a precipitating factor, or an amount effective to reduce the risk of developing conditions associated with porphyria (e.g., neuropathy (e.g., progressive neuropathy), hepatocellular cancer). For example, if a given clinical treatment is considered effective when there is at least a 10% réduction in a measurable parameter associated with a disease or disorder, a therapeutically effective amount of a drug for the treatment of that disease or disorder is the amount necessary to effect at least a 10% réduction in that parameter. For example, a therapeutically effective amount of an iRNA targeting ALAS1 can reduce ALAS1 protein levels by any measurable amount, e.g., by at least 10%, 20%, 30%, 40% or 50%.
The tenu “pharmaceutically acceptable carrier” refers to a carrier for administration of a therapeutic agent. Such carriers include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, éthanol, and combinations thereof. The term specifically excludes cell culture medium. For drugs administered orally, pharmaceutically acceptable carriers include, but are not limited to pharmaceutically acceptable excipients such as inert diluents, disintegrating agents, binding agents, lubricating agents, sweetening agents, flavoring agents, coloring agents and preservatives. Suitable inert diluents include sodium and calcium carbonate, sodium and calcium phosphate, and lactose, while corn starch and alginic acid are suitable disintegrating agents. Binding agents may include starch and gelatin, while the lubricating agent, if présent, will generally be magnésium stéarate, stearic acid or talc. If desired, the tablets may be coated with a material such as glyceryl monostearate or glyceryl distearate, to delay absorption in the gastrointestinal tract. Agents included in drug formulations are described further herein below.
The term “about” when referring to a number or a numerical range means that the number or numerical range referred to is an approximation within experimental variability (or within statistical experimental error), and thus the number or numerical range may vary from, for example, between 1% and 15% of the stated number or numerical range.
II. iRNA Agents
Described herein are iRNA agents that inhibit the expression of an ALAS 1 gene. In one embodiment, the iRNA agent includes double-stranded ribonucleic acid (dsRNA) molécules for inhibiting the expression of an ALAS1 gene in a cell or in a subject (e.g., in a mammal, e.g., in a human having a poiphyria), where the dsRNA includes an antisense strand having a région of complementarity which is complementary to at least a part of an mRNA formed in the expression of an ALASlgene, and where the région of complementarity is 30 nucléotides or less in length, generally 19-24 nucléotides in length, and where the dsRNA, upon contact with a cell expressing the ALAS1 gene, inhibits the expression of the ALAS1 gene by at least 10% as assayed by, for example, a PCR or branched DNA (bDNA)-based method, or by a protein-based method, such as by Western blot. In one embodiment, the iRNA agent activâtes the expression of an ALAS1 gene in a cell or mammal. Expression of an ALAS1 gene in cell culture, such as in COS cells, HeLa cells, primary hépatocytes, HepG2 cells, primary cultured cells or in a biological sample from a subject can be assayed by measuring ALAS1 mRNA levels, such as by bDNA or TaqMan assay, or by measuring protein levels, such as by immunofluorescence analysis, using, for example, Western Blotting or flow cytométrie techniques.
A dsRNA includes two RNA strands that are sufficiently complementary to hybridize to form a duplex structure under conditions in which the dsRNA will be used. One strand of a dsRNA (the antisense strand) includes a région of complementarity that is substantially complementary, and generally fully complementary, to a target sequence, derived from the sequence of an mRNA formed during the expression of an ALAS1 gene. The other strand (the sense strand) includes a région that is complementary to the antisense strand, such that the two strands hybridize and form a duplex structure when combined under suitable conditions. Generally, the duplex structure is between 15 and 30 inclusive, more generally between 18 and 25 inclusive, yet more generally between 19 and 24 inclusive, and most generally between 19 and 21 base pairs in length, inclusive. Similarly, the région of complementarity to the target sequence is between 15 and 30 inclusive, more generally between 18 and 25 inclusive, yet more generally between 19 and 24 inclusive, and most generally between 19 and 21 nucléotides in length, inclusive. In some embodiments, the dsRNA is between 15 and 20 nucléotides in length, inclusive, and in other embodiments, the dsRNA is between 25 and 30 nucléotides in length, inclusive. As the ordinarily skilled person will recognize, the targeted région of an RNA targeted for cleavage will most often be part of a larger RNA molécule, often an mRNA molécule. Where relevant, a “part” of an mRNA target is a contiguous sequence of an mRNA target of sufficient length to be a substrate for RNAi-directed cleavage (i.e., cleavage through a
RISC pathway). dsRNAs having duplexes as short as 9 base pairs can, under some circumstances, médiate RNAi-directed RNA cleavage. Most often a target will be at least 15 nucléotides in length, e.g., 15-30 nucléotides in length.
One of skill in the art will also recognize that the duplex région is a primary functional portion of a dsRNA, e.g., a duplex région of 9 to 36, e.g., 15-30 base pairs. Thus, in one embodiment, to the extent that it becomes processed to a functional duplex of e.g., 15-30 base pairs that targets a desired RNA for cleavage, an RNA molécule or complex of RNA molécules having a duplex région greater than 30 base pairs is a dsRNA. Thus, an ordinarily skilled artisan will recognize that in one embodiment, then, an miRNA is a dsRNA. In another embodiment, a dsRNA is not a naturally occurring miRNA. In another embodiment, an iRNA agent useful to target ALAS1 expression is not generated in the target cell by cleavage of a larger dsRNA.
A dsRNA as described herein may further include one or more single-stranded nucléotide overhangs. The dsRNA can be synthesized by standard methods known in the art as further discussed below, e.g., by use of an automated DNA synthesizer, such as are commercially available from, for example, Biosearch, Applied Biosystems, Inc. In one embodiment, an ALAS1 gene is a human ALAS1 gene. In another embodiment the ALAS1 gene is a mouse or a rat ALAS1 gene.
In spécifie embodiments, the first sequence is a sense strand of a dsRNA that includes a sense sequence disclosed herein, e.g., in Tables 21-40, and the second sequence is an antisense strand of a dsRNA that includes an antisense sequence disclosed herein, e.g., in Tables 21-40.
In spécifie embodiments, the first sequence is a sense strand of a dsRNA that includes a sense sequence from Table 2 or Table 3, and the second sequence is an antisense strand of a dsRNA that includes an antisense sequence from Table 2 or Table 3. In embodiments, the first sequence is a sense strand of a dsRNA that includes a sense sequence from Table 2, 3, 6, 7, 8, 9, 14, or 15, and the second sequence is an antisense strand of a dsRNA that includes an antisense sequence from Table 2, 3, 6, 7, 8, 9, 14, or 15. In embodiments, the first sequence is a sense strand of a dsRNA that includes a sense sequence from Table 2, 3, 6, 7, 8, 9, 14, 15, 18 or 20, and the second sequence is an antisense strand of a dsRNA that includes an antisense sequence from Table 2, 3, 6, 7, 8, 9, 14, 15, 18 or 20.
In one aspect, a dsRNA can include at least sense and antisense nucléotide sequences, whereby the sense strand is selected from the sense sequences provided herein, e.g., in Tables 21-40, and the corresponding antisense strand ofthe sense strand is selected from the antisense sequences provided herein, e.g., in Tables 21-40.
In one aspect, a dsRNA can include at least sense and antisense nucléotide sequences, whereby the sense strand is selected from the groups of sequences provided in Tables 2 and 3, and the corresponding antisense strand of the sense strand is selected from Tables 2 and 3. In a further aspect, a dsRNA can include at least sense and antisense nucléotide sequences, whereby the sense strand is selected from the groups of sequences provided in Tables 2, 3, 6, 7, 8, 9, 14, and 15, and the corresponding antisense strand of the sense strand is selected from Tables 2, 3, 6, 7, 8, 9, 14, and 15. In a fuither aspect, a dsRNA can include at least sense and antisense nucléotide sequences, whereby the sense strand is selected from the groups of sequences provided in Tables 2, 3, 6, 7, 8, 9, 14, 15, 18 and 20, and the coiTesponding antisense strand of the sense strand is selected from Tables 2, 3, 6, 7, 8, 9, 14, 15, 18 and 20.
In embodiments, the iRNA is AD-60501, AD-60519, AD-60901, AD-60495, AD-60900, AD-60935, AD-60879, AD-61190, AD-61191, AD-60865, AD-60861, AD-60876, AD-61193, AD-60519, AD-60519, AD-60901, AD-60405, AD-60887, AD-60923, AD-60434, AD-60892, AD-60419, AD-60924, AD-60445, AD-60925, AD-60926, AD-60820, AD-60843, AD-60819, AD-61140, AD-61141, AD-61142, AD-60835, AD-60839, AD-61143, AD-61144, AD-61145, AD-61146, AD-60892, or AD-60419 (e.g., including the nucléotide sequence and/or one or more (e.g., ail) of the modifications of the aforesaid dsRNAs). In embodiments, the iRNA comprises an antisense strand that comprises, or consists of, an antisense sequence (including one or more (e.g., ail the modifications)) selected from the antisense sequence of AD-60501, AD-60519, AD60901, AD-60495, AD-60900, AD-60935, AD-60879, AD-61190, AD-61191, AD-60865, AD60861, AD-60876, AD-61193, AD-60519, AD-60519, AD-60901, AD-60405, AD-60887, AD60923, AD-60434, AD-60892, AD-60419, AD-60924, AD-60445, AD-60925, AD-60926, AD60820, AD-60843, AD-60819, AD-61140, AD-61141, AD-61142, AD-60835, AD-60839, AD
61143, AD-61144, AD-61145, AD-61146, AD-60892, or AD-60419. In embodiments, the iRNA comprises a sense strand that comprises, or consists of, a sense sequence (and/or one or more (e.g., ail) of the modifications)) selected from AD-60501, AD-60519, AD-60901, AD60495, AD-60900, AD-60935, AD-60879, AD-61190, AD-61191, AD-60865, AD-60861, AD60876, AD-61193, AD-60519, AD-60519, AD-60901, AD-60405, AD-60887, AD-60923, AD60434, AD-60892, AD-60419, AD-60924, AD-60445, AD-60925, AD-60926, AD-60820, AD60843, AD-60819, AD-61140, AD-61141, AD-61142, AD-60835, AD-60839, AD-61143, AD61 144, AD-61145, AD-61146, AD-60892, or AD-60419.
In embodiments, the iRNA comprises (i) an antisense strand that comprises, or consists of, the sequence of UAAGAUGAGACACUCUUUCUGGU or UAAGAUGAGACACUCTUUCUGGU and/or (ii) a sense strand that comprises, or consists of, the sequence of CAGAAAGAGUGUCUCAUCUUA. In embodiments, one or more nucléotides of the antisense strand and/or sense strand are modified as described herein.
In embodiments, the iRNA comprises (i) an antisense strand that comprises, or consists of, the antisense sequence of AD-60489 and/or (ii) a sense strand that comprises, or consists of, the sense sequence of AD-60489 (and/or one or more (e.g., ail) of the modifications of the sense strand and/or antisense strand of AD-60489).
In embodiments, the iRNA comprises (i) an antisense strand that comprises, or consists of, the antisense sequence of AD-60519 and/or (ii) a sense strand that comprises, or consists of, the sense sequence of AD-60519 (and/or one or more (e.g., ail) of the modifications of the sense strand and/or antisense strand of AD-60489).
In embodiments, the iRNA comprises (i) an antisense strand that comprises, or consists of, the antisense sequence of AD-61193 and/or (ii) a sense strand that comprises, or consists of, the sense sequence of AD-61193 (and/or one or more (e.g., ail) of the modifications of the sense strand and/or antisense strand of AD-60489).
In embodiments, the iRNA comprises (i) an antisense strand that comprises, or consists of, the antisense sequence of AD-60819 and/or (ii) a sense sequence that comprises, or consists of, the sense sequence of AD-60819 (and/or one or more (e.g., ail) of the modifications of the sense strand and/or antisense strand of AD-60489).
In embodiments, the iRNA for inhibiting expression of ALAS1 is provided, wherein the dsRNA comprises (i) an antisense strand that comprises, or consists of, the antisense sequence of AD-60489, AD-60519, AD-61193, or AD-60819 (or a corresponding unmodified antisense sequence) and/or (ii) a sense strand that comprises, or consists of, the sense sequence of AD60489, AD-60519, AD-61193, or AD-60819 (or a corresponding unmodified antisense sequence). In embodiments, the iRNA comprises (i) an antisense strand that consists of the antisense sequence of AD-60489, AD-60519, AD-61193, or AD-60819 and/or (ii) a sense strand that consists of the sense sequence of AD-60489, AD-60519, AD-61193, or AD-60819, except that the antisense strand and/or sense strand of the dsRNA differs by 1, 2, or 3 nucléotides from the corresponding antisense and/or sense sequence of AD-60489, AD-60519, AD-61193, or AD60819.
The sequences and modifications of AD-60489, AD-60519, AD-61193, and AD-60819 are shown in Table 44 disclosed herein.
In one embodiment, the iRNA is ALN-60519. ALN-60519 is a chemically synthesized double stranded oligonucleotide covalently linked to a ligand containing three Nacetylgalactosamine (GalNAc) residues (depicted in FIG. 57). In one embodiment, ail nucléotides of ALN-60519 are 2’-OMe or 2’-F modified and are connected through 3’-5’ phosphodiester linkages, thus forming the sugar-phosphate backbone of the oligonucleotide. The sense strand and the antisense strand of ALN-60519 contain 21 and 23 nucléotides, respectively. The 3’-end of the sense strand of ALN-60519 is conjugated to the triantennary GalNAc moiety (referred to as L96) through a phosphodiester linkage. The antisense strand contains four phosphorothioate linkages - two at the 3’ end and two at the 5’ end. The sense strand of ALN60519 contains two phosphorothioate linkages at the 5’ end. The 21 nucléotides of the sense strand of ALN-60519 hybridize with the complementary 21 nucléotides of the antisense strand, thus forming 21 nucléotide base pairs and a two-base overhang at the 3’-end of the antisense strand. The two single strands, the sense strand and the antisense strand, of ALN-60519 can be synthesized by conventional solid phase oligonucleotide synthesis, employing standard phosphoramidite chemistry with the 5’-hydroxyl group protected as dimethoxytriphenylmethyl (DMT) ether. Each strand can be assembled from the 3’ to the 5’ terminus by sequential addition of protected nucleoside phosphoramidites.
In these aspects, one of the two sequences is complementary to the other of the two sequences, with one of the sequences being substantially complementary to a sequence of an mRNA generated by the expression of an ALAS1 gene gene. As such, a dsRNA will include two oligonucleotides, where one oligonucleotide is described herein as the sense strand, and the second oligonucleotide is described as the corresponding antisense strand. As described elsewhere herein and as known in the art, the complementary sequences of a dsRNA can also be contained as self-complementary régions of a single nucleic acid molécule, as opposed to being on separate oligonucleotides.
The skilled person is well aware that dsRNAs having a duplex structure of between 20 and 23, but specifically 21, base pairs hâve been hailed as particularly effective in inducing RNA interférence (Elbashir et al., EMBO 2001, 20:6877-6888). However, others hâve found that shorter or longer RNA duplex structures can be effective as well. In the embodiments described above, by virtue of the nature of the oligonucleotide sequences provided in the tables herein, dsRNAs described herein can include at least one strand of a length of minimally 21 nucléotides. It can be reasonably expected that shorter duplexes having one of the sequences of disclosed herein minus only a few nucléotides on one or both ends may be similarly effective as compared to the dsRNAs described above. Hence, dsRNAs having a partial sequence of at least 15, 16, 17, 18, 19, 20, or more contiguous nucléotides from one of the sequences disclosed herein, and differing in their ability to inhibit the expression of an ALASlgene by not more than 5, 10, 15, 20, 25, or 30 % inhibition from a dsRNA comprising the full sequence, are contemplated according to the invention.
In addition, the RNAs provided in the tables herein, identify a site in an ALAS1 transcript that is susceptible to RISC-mediated cleavage. As such, the présent invention further features iRNAs that target within one of such sequences. As used herein, an iRNA is said to target within a particular site of an RNA transcript if the iRNA promûtes cleavage of the transcript anywhere within that particular site. Such an iRNA will generally include at least 15 contiguous nucléotides from one ofthe sequences provided herein, e.g., in Tables 2, 3, 6, 7, 8, 9,
14, 15, 18, 20, and in Tables 21-40, coupled to additional nucléotide sequences taken from the région contiguous to the selected sequence in an ALASlgene.
While a target sequence is generally 15-30 nucléotides in length, there is wide variation in the suitability of particular sequences in this range for directing cleavage of any given target RNA. Various software packages and the guidelines set out herein provide guidance for the identification of optimal target sequences for any given gene target, but an empirical approach can also be taken in which a “window” or “mask” of a given size (as a non-limiting example, 21 nucléotides) is literally or figuratively (including, e.g., in silico) placed on the target RNA sequence to identify sequences in the size range that may serve as target sequences. By moving the sequence “window” progressively one nucléotide upstream or downstream of an initial target sequence location, the next potential target sequence can be identifïed, until the complété set of possible sequences is identifïed for any given target size selected. This process, coupled with systematic synthesis and testing of the identifïed sequences (using assays as described herein or as known in the art) to identify those sequences that perform optimally can identify those RNA sequences that, when targeted with an iRNA agent, médiate the best inhibition of target gene expression. Thus, while the sequences identifïed, for example, in the tables herein, represent effective target sequences, it is contemplated that further optimization of inhibition efficiency can be achieved by progressively “walking the window” one nucléotide upstream or downstream of the given sequences to identify sequences with equal or better inhibition characteristics.
Further, it is contemplated that for any sequence identifïed, e.g., in the tables herein, further optimization can be achieved by systematically either adding or removing nucléotides to generate longer or shorter sequences and testing those and sequences generated by walking a window of the longer or shorter size up or down the target RNA from that point. Again, coupling this approach to generating new candidate targets with testing for effectiveness of iRNAs based on those target sequences in an inhibition assay as known in the art or as described herein can lead to further improvements in the efficiency of inhibition. Further still, such optimized sequences can be adjusted by, e.g., the introduction of modified nucléotides as described herein or as known in the art, addition or changes in overhang, or other modifications as known in the art and/or discussed herein to further optimize the molécule (e.g., increasing sérum stability or circulating half-life, increasing thermal stability, enhancing transmembrane delivery, targeting to a particular location or cell type, increasing interaction with silencing pathway enzymes, increasing release from endosomes, etc.) as an expression inhibitor.
An iRNA as described herein can contain one or more mismatches to the target sequence. In one embodiment, an iRNA as described herein contains no more than 3 mismatches. If the antisense strand of the iRNA contains mismatches to a target sequence, it is préférable that the area of mismatch not be located in the center of the région of complementarity. If the antisense strand of the iRNA contains mismatches to the target sequence, it is préférable that the mismatch be restricted to be within the last 5 nucléotides from either the 5’ or 3’ end of the région of complementarity. For example, for a 23 nucléotide iRNA agent RNA strand which is complementary to a région of an ALAS1 gene, the RNA strand generally does not contain any mismatch within the central 13 nucléotides. The methods described herein or methods known in the art can be used to détermine whether an iRNA containing a mismatch to a target sequence is effective in inhibiting the expression of an ALAS1 gene. Considération of the efficacy of iRNAs with mismatches in inhibiting expression of an ALAS1 gene is important, especially if the particular région of complementarity in an ALAS1 gene is known to hâve polymorphie sequence variation within the population.
In one embodiment, at least one end of a dsRNA has a single-stranded nucléotide overhang of 1 to 4, generally 1 or 2 nucléotides. dsRNAs having at least one nucléotide overhang hâve unexpectedly superior inhibitory properties relative to their blunt-ended counteiparts. In yet another embodiment, the RNA of an iRNA, e.g., a dsRNA, is chemically modified to enhance stability or other bénéficiai characteristics. The nucleic acids featured in the invention may be synthesized and/or modified by methods well established in the art, such as those described in “Current protocols in nucleic acid chemistry,” Beaucage, S.L. et al. (Edrs.), John Wiley & Sons, Inc., New York, NY, USA, which is hereby incoiporated herein by reference. Modifications include, for example, (a) end modifications, e.g., 5’ end modifications (phosphorylation, conjugation, inverted linkages, etc.) 3 ’ end modifications (conjugation, DNA nucléotides, inverted linkages, etc.), (b) base modifications, e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded répertoire of partners, removal of bases (abasic nucléotides), or conjugated bases, (c) sugar modifications (e.g., at the 2’ position or 4’ position, or having an acyclic sugar) or replacement of the sugar, as well as (d) backbone modifications, including modification or replacement of the phosphodiester linkages. Spécifie examples of RNA compounds useful in this invention include, but are not limited to RNAs containing modified backbones or no natural intemucleoside linkages. RNAs having modified backbones include, among others, those that do not hâve a phosphorus atom in the backbone. For the purposes of this spécification, and as sometimes referenced in the art, modified RNAs that do not hâve a phosphorus atom in their intemucleoside backbone can also be considered to be oligonucleosides. In particular embodiments, the modified RNA will hâve a phosphorus atom in its intemucleoside backbone.
Modified RNA backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3-5' linkages, 2-5' linked analogs of these, and those) having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3-5' to 5-3' or 2'-5' to 5'-2'. Various salts, mixed salts and free acid forms are also included.
Représentative U.S. patents that teach the préparation of the above phosphoruscontaining linkages include, but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,195; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,316; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,625,050; 6,028,188; 6,124,445; 6,160,109; 6,169,170; 6,172,209; 6, 239,265; 6,277,603; 6,326,199; 6,346,614; 6,444,423; 6,531,590; 6,534,639; 6,608,035; 6,683,167; 6,858,715; 6,867,294; 6,878,805; 7,015,315; 7,041,816; 7,273,933; 7,321,029; and US Pat RE39464, each of which is herein incorporated by reference.
Modified RNA backbones that do not include a phosphoms atom therein hâve backbones that are formed by short chain alkyl or cycloalkyl intemucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl intemucleoside linkages, or one or more short chain heteroatomic or heterocyclic intemucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thiofonnacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts.
Représentative U.S. patents that teach the préparation of the above oligonucleosides include, but are not limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,64,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and, 5,677,439, each of which is herein incorporated by reference.
In other RNA mimetics suitable or contemplated for use in iRNAs, both the sugar and the intemucleoside linkage, i.e., the backbone, of the nucléotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an RNA mimetic that has been shown to hâve excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of an RNA is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Représentative U.S. patents that teach the préparation of PNA compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, each of which is herein incorporated by reference. Further teaching of PNA compounds can be found, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.
Some embodiments featured in the invention include RNAs with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular —CH2—NH—CH2— , —CH2—N(CH3)—O—CH2—[known as a methylene (methylimino) or MMI backbone], —CH2—O-N(CH3)-CH2-, -CH2~N(CH3)-N(CH3)-CH2- and -N(CH3)-CH2-CH2-[wherein the native phosphodiester backbone is represented as — O—P—O—CH2—] of the above-referenced U.S. Pat. No. 5,489,677, and the amide backbones of the above-referenced U.S. Pat. No. 5,602,240. In some embodiments, the RNAs featured herein hâve morpholino backbone structures of the above-referenced U.S. Pat. No. 5,034,506.
Modified RNAs may also contain one or more substituted sugar moieties. The iRNAs, e.g., dsRNAs, featured herein can include one of the following at the 2' position: OH; F; O-, S-, orN-alkyl; O-, S-, orN-alkenyl; O-, S- orN-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted Ci to Cio alkyl or C2 to Cio alkenyl and alkynyl. Exemplary suitable modifications include O[(CH2)nO] mCH3, O(CH2).nOCH3, O(CH2)nNH2, O(CH2) nCH3, O(CH2)nONH2, and O(CH2)nON[(CH2)nCH3)]2, where n and m are from 1 to about 10. In other embodiments, dsRNAs include one of the following at the 2' position: Ci to Cio lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an iRNA, or a group for improving the pharmacodynamie properties of an iRNA, and other substituents having similar properties. In some embodiments, the modification includes a 2'-methoxyethoxy (2'-O—CH2CH2OCH3, also known as 2'-O-(2methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504) i.e., an alkoxyalkoxy group. Another exemplary modification is 2'-dimethylaminooxyethoxy, i.e., a O(CH2)2ON(CH3)2 group, also known as 2'-DMAOE, as described in examples herein below, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or
2-DMAEOE), i.e., 2'-O—CH2—O—CH2—N(CH2)2, also described in examples hereinbelow.
In other embodiments, an iRNA agent comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) acyclic nucléotides (or nucleosides). In certain embodiments, the sense strand or the antisense strand, or both sense strand and antisense strand, include less than five acyclic nucléotides per strand (e.g., four, three, two or one acyclic nucléotides per strand). The one or more acyclic nucléotides can be found, for example, in the double-stranded région, of the sense or antisense strand, or both strands; at the 5'-end, the 3'-end, both of the 5' and 3'-ends of the sense or antisense strand, or both strands, of the iRNA agent. In one embodiment, one or more acyclic nucléotides are présent at positions 1 to 8 of the sense or antisense strand, or both. In one embodiment, one or more acyclic nucléotides are found in the antisense strand at positions 4 to 10 (e.g., positions 6-8) from the 5'-end of the antisense strand. In another embodiment, the one or more acyclic nucléotides are found at one or both 3'-terminal overhangs of the iRNA agent.
The term acyclic nucléotide or “acyclic nucleoside” as used herein refers to any nucléotide or nucleoside having an acyclic sugar, e.g., an acyclic ribose. An exemplary acyclic nucléotide or nucleoside can include a nucleobase, e.g., a naturally-occurring or a modified nucleobase (e.g., a nucleobase as described herein). In certain embodiments, a bond between any of the ribose carbons (Cl, C2, C3, C4, or C5), is independently or in combination absent from the nucléotide. In one embodiment, the bond between C2-C3 carbons of the ribose ring is absent, e.g., an acyclic 2’-3’-seco-nucleotide monomer. In other embodiments, the bond between C1-C2, C3-C4, or C4-C5 is absent (e.g., a Γ-2’, 3-4' or 4’-5’-seco nucléotide monomer). Exemplary acyclic nucléotides are disclosed in US 8,314,227, incorporated herein by reference in its entirely. For example, an acyclic nucléotide can include any of monomers D-J in Figures 1-2 of US 8,314,227. In one embodiment, the acyclic nucléotide includes the following monomer:
wherein Base is a nucleobase, e.g., a naturally-occurring or a modified nucleobase (e.g., a nucleobase as described herein).
In certain embodiments, the acyclic nucléotide can be modified or derivatized, e.g., by coupling the acyclic nucléotide to another moiety, e.g., a ligand (e.g., a GalNAc, a cholestérol ligand), an alkyl, a polyamine, a sugar, a polypeptide, among others.
In other embodiments, the iRNA agent includes one or more acyclic nucléotides and one or more LNAs (e.g., an LNA as described herein). For example, one or more acyclic nucléotides and/or one or more LNAs can be présent in the sense strand, the antisense strand, or both. The number of acyclic nucléotides in one strand can be the same or different from the number of LNAs in the opposing strand. In certain embodiments, the sense strand and/or the antisense strand comprises less than five LNAs (e.g., four, three, two or one LNAs) located in the doublestranded région or a 3’-overhang. In other embodiments, one or two LNAs are located in the double stranded région or the 3’-overhang of the sense strand. Alternatively, or in combination, the sense strand and/or antisense strand comprises less than five acyclic nucléotides (e.g., four, three, two or one acyclic nucléotides) in the double-stranded région or a 3’-overhang. In one embodiment, the sense strand of the iRNA agent comprises one or two LNAs in the 3’-overhang of the sense strand, and one or two acyclic nucléotides in the double-standed région of the antisense strand (e.g., at positions 4 to 10 (e.g., positions 6-8) from the 5'-end of the antisense strand) of the iRNA agent.
In other embodiments, inclusion of one or more acyclic nucléotides (alone or in addition to one or more LNAs) in the iRNA agent results in one or more (or ail) of: (i) a réduction in an off-target effect; (ii) a réduction in passenger strand participation in RNAi; (iii) an increase in specificity of the guide strand for its target mRNA; (iv) a réduction in a microRNA off-target effect; (v) an increase in stability; or (vi) an increase in résistance to dégradation, of the iRNA molécule.
Other modifications include 2'-methoxy (2-OCH3), 2'-aminopropoxy (2OCH2CH2CH2NH2) and 2'-fluoro (2'-F). Similar modifications may also be made at other positions on the RNA of an iRNA, particularly the 3' position of the sugar on the 3' terminal nucléotide or in 2'-5' linked dsRNAs and the 5' position of 5' terminal nucléotide. iRNAs may also hâve sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Représentative U.S. patents that teach the préparation of such modified sugar structures include, but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878;
5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909;
5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference.
An iRNA may also include nucleobase (often referred to in the art simply as “base”) modifications or substitutions. As used herein, “unmodified” or “natural” nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2aminoadenine, 6-methyl and other alkyl dérivatives of adenine and guanine, 2-propyl and other alkyl dérivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5uracil (pseudouracil), 4-thiouraciI, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl anal other 8substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other 5substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8azaadenine, 7-deazaguanine and 7-daazaadenine and 3-deazaguanine and 3-deazaadenine. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. WileyVCH, 2008; those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. L, ed. John Wiley & Sons, 1990, these disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and those disclosed by Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., Ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affmity of the oligomeric compounds featured in the invention. These include 5substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions hâve been shown to increase nucleic acid duplex stability by 0.6-1.2°C (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., Eds., dsRNA Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are exemplary base substitutions, even more particularly when combined with
2'-O-methoxyethyl sugar modifications.
Représentative U.S. patents that teach the préparation of certain of the above noted modified nucleobases as well as other modified nucleobases include, but are not limited to, the above noted U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos. 4,845,205; 5,130,30; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,681,941; 6,015,886; 6,147,200; 6,166,197; 6,222,025; 6,235,887; 6,380,368; 6,528,640; 6,639,062; 6,617,438; 7,045,610; 7,427,672; and 7,495,088, each of which is herein incorporated by reference, and U.S. Pat. No. 5,750,692, also herein incorporated by reference.
The RNA of an iRNA can also be modified to include one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) locked nucleic acids (LNA), (also referred to herein as “locked nucléotides”). In one embodiment, a locked nucleic acid is a nucléotide having a modified ribose moiety in which the ribose moiety comprises an extra bridge connecting, e.g., the 2' and 4' carbons. This structure effectively locks the ribose in the 3'-endo structural conformation. The addition of locked nucleic acids to siRNAs has been shown to increase siRNA stability in sérum, increase thermal stability, and to reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(l):439-447; Mook, OR. et al., (2007) Mol Cane Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193).
Représentative U.S. Patents that teach the préparation of locked nucleic acid nucléotides include, but are not limited to, the following: U.S. Pat. Nos. 6,268,490; 6,670,461; 6,794,499; 6,998,484; 7,053,207; 7,084,125; 7,399,845; and 8,314,227, each of which is herein incorporated by reference in its entirety. Exemplary LNAs include but are not limited to, a 2', 4'-C methylene bicyclo nucléotide (see for example Wengel et al., International PCT Publication No. WO 00/66604 and WO 99/14226).
In other embodiments, the iRNA agents include one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) G-clamp nucléotides. A G-clamp nucléotide is a modified cytosine analog wherein the modifications confer the ability to hydrogen bond both Watson-Crick and Hoogsteen faces of a complementary guanine within a duplex, see for example Lin and Matteucci, 1998, J.
Am. Chem. Soc., 120, 8531-8532. A single G-clamp analog substitution within an oligonucleotide can resuit in substantially enhanced helical thermal stability and mismatch discrimination when hybridized to complementary oligonucleotides. The inclusion of such nucléotides in the iRNA molécules can resuit in enhanced affînity and specificity to nucleic acid targets, complementary sequences, or template strands.
Potentially stabilizing modifications to the ends of RNA molécules can include N(acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (HypC6), N-(acetyl-4-hydroxyprolinol (Hyp-NHAc), thymidine-2'-0-deoxythymidine (ether), N(aminocaproyl)-4-hydroxyprolinol (Hyp-C6-amino), 2-docosanoyl-uridine-3- phosphate, inverted base dT(idT) and others. Disclosure of this modification can be found in PCT Publication No. WO 2011/005861.
iRNA Motifs
In one embodiment, the sense strand sequence may be represented by formula (I):
5' np-Na-(X X X )i-Nb-Y Y Y -Nb-(Z Z Z )j-Na-nq 3' (I) wherein:
i and j are each independently 0 or 1;
p and q are each independently 0-6;
each Na independently represents an oligonucleotide sequence comprising 0-25 modified nucléotides, each sequence comprising at least two differently modified nucléotides;
eachNb independently represents an oligonucleotide sequence comprising 0-10 modified nucléotides;
each np and nq independently represent an overhang nucléotide;
wherein Nb and Y do not hâve the same modification; and
XXX, ΥΥΥ and ΖΖΖ each independently represent one motif of three identical modifications on three consecutive nucléotides. Preferably YYY is ail 2’-F modified nucléotides.
In one embodiment, the Na and/or Nb comprise modifications of altemating pattern.
In one embodiment, the YYY motif occurs at or near the cleavage site of the sense strand. For example, when the RNAi agent has a duplex région of 17-23 nucléotides in length, the YYY motif can occur at or the vicinity ofthe cleavage site (e.g.: can occur atpositions 6, 7, 8; 7, 8, 9; 8, 9, 10; 9, 10, 11; 10, 11,12 or 11, 12, 13) of - the sense strand, the count starting from the lst nucléotide, from the 5’-end; or optionally, the count starting at the lst paired nucléotide within the duplex région, from the 5’- end.
In one embodiment, i is 1 and j is 0, or i is 0 and j is 1, or both i and j are 1. The sense strand can therefore be represented by the following formulas:
5'np-Na-YYY-Nb-ZZZ-Na-nq 3' (Ib);
5' np-Na-XXX-Nb-YYY-Na-nq 3' (le); or
5' np-Na-XXX-Nb-YYY-Nb-ZZZ-Na-nq 3' (Id).
When the sense strand is represented by formula (Ib), Nb represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucléotides. EachNa independently can represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucléotides.
When the sense strand is represented as formula (le), Nb represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucléotides. EachNa can independently represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucléotides.
When the sense strand is represented as formula (Id), each Nb independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucléotides. Preferably, Nb is 0, 1, 2, 3, 4, 5 or 6. Each Na can independently represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucléotides.
Each of X, Y and Z may be the same or different from each other.
In other embodiments, i is 0 and j is 0, and the sense strand may be represented by the formula:
5' np-Na-YYY-Na-nq 3' (la).
When the sense strand is represented by formula (la), each Na independently can represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucléotides.
In one embodiment, the antisense strand sequence of the RNAi may be represented by formula (II):
5' nq>-Na'-(Z’Z'Z')k-Nb'-Y'Y'Y'-Nb'-(X'X'X')i-N'a-np' 3’ (II) wherein:
k and 1 are each independently 0 or 1;
p’ and q’ are each independently 0-6;
each Na' independently represents an oligonucleotide sequence comprising 0-25 modified nucléotides, each sequence comprising at least two differently modified nucléotides;
each N/ independently represents an oligonucleotide sequence comprising 0-10 modified nucléotides;
each np' and nq' independently represent an overhang nucléotide;
wherein Nb’ and Y’ do not hâve the same modification;
and
X'X'X', ΥΎΎ' and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucléotides.
In one embodiment, the Na’ and/or Nb’ comprise modifications of altemating pattern.
The Y'Y'Y' motif occurs at or near the cleavage site of the antisense strand. For example, when the RNAi agent has a duplex région of 17-23nucleotidein length, the ΥΎΎ' motif can occur at positions 9,10, ll;10,11,12; 11, 12, 13; 12, 13, 14 ; or 13,14,15 ofthe antisense strand, with the count starting from the lst nucléotide, from the 5’-end; or optionally, the count starting at the lst paired nucléotide within the duplex région, from the 5’- end. Preferably, the
ΥΎΎ' motif occurs at positions 11, 12, 13.
In one embodiment, ΥΎΎ' motif is ail 2’-OMe modified nucléotides.
In one embodiment, k is 1 and 1 is 0, or k is 0 and 1 is 1, or both k and 1 are 1.
The antisense strand can therefore be represented by the following formulas:
5’ nq’-Na'-Z'Z'Z'-Nb'-YYY'-Na'-np> 3' (Ilb);
5' nq’-Na'-YYY'-Nb'-X'X'X'-nP’ 3’ (Ile); or
5' nq>-Na'- Z'Z'Z'-Nb'-YYYW- X'X'X'-Na'-np> 3' (lid).
When the antisense strand is represented by formula (Ilb), Nb represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucléotides. Each Na’ independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucléotides.
When the antisense strand is represented as formula (Ile), Nb’ represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucléotides. Each Na’ independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucléotides.
When the antisense strand is represented as formula (lid), each Nb’ independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucléotides. Each Na’ independently represents an oligonucleotide sequence comprising 2-20, 215, or 2-10 modified nucléotides. Preferably, Nb is 0, 1, 2, 3, 4, 5 or 6.
In other embodiments, k is 0 and 1 is 0 and the antisense strand may be represented by the formula:
5'np>-Na>-Y’Y’Y’-Na>-nq-3' (la).
When the antisense strand is represented as formula (Ha), each Na’ independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucléotides.
Each of X', Y' and Z' may be the same or different from each other.
Each nucléotide of the sense strand and antisense strand may be independently modified with LNA, HNA, CeNA, 2’-methoxyethyl, 2’-O-methyl, 2’-O-allyl, 2’-C- allyl, 2’-hydroxyI, or
2’-fluoro. For example, each nucléotide ofthe sense strand and antisense strand is independently modified with 2’-O-methyl or 2’-fluoro. Each X, Y, Z, X', Y' and Z', in particular, may represent a 2’-O-methyl modification or a 2’-fluoro modification.
In one embodiment, the sense strand of the RNAi agent may contain ΥΥΎ motif occurring at 9, 10 and 11 positions of the strand when the duplex région is 21 nt, the count starting from the lst nucléotide from the 5’-end, or optionally, the count starting at the lst paired nucléotide within the duplex région, from the 5’- end; and Y represents 2’-F modification. The sense strand may additionally contain XXX motif or ZZZ motifs as wing modifications at the opposite end of the duplex région; and XXX and ZZZ each independently represents a 2’-OMe modification or 2’-F modification.
In one embodiment the antisense strand may contain ΥΎΎ' motif occurring at positions 11, 12, 13 of the strand, the count starting from the lst nucléotide from the 5’-end, or optionally, the count starting at the lst paired nucléotide within the duplex région, from the 5’- end; and Y' represents 2’-O-methyl modification. The antisense strand may additionally contain X'X'X' motif or Z'Z'Z' motifs as wing modifications at the opposite end of the duplex région; and X'X'X' and Z'Z'Z' each independently represents a 2’-OMe modification or 2’-F modification.
The sense strand represented by any one of the above formulas (la), (Ib), (le), and (Id) forms a duplex with a antisense strand being represented by any one of formulas (lia), (Ilb), (Ile), and (lid), respectively.
Accordingly, the RNAi agents for use in the methods of the invention may comprise a sense strand and an antisense strand, each strand having 14 to 30 nucléotides, the RNAi duplex represented by formula (III):
sense: 5' np -Na-(X X X)i-Nb- Y Y Y -Nb -(Z Z Z)j-Na-nq 3' antisense: 3’ np’-Na’-(X’X'X')k-Nb’-Y'Y'Y'-Nb’-(Z'Z'Z')i-Na’-nq’ 5’ (III) wherein:
i, j, k, and 1 are each independently 0 or 1;
p, p', q, and q' are each independently 0-6;
each Na and Na independently represents an oligonucleotide sequence comprising 0-25 modified nucléotides, each sequence comprising at least two differently modified nucléotides;
each Nb and Nb independently represents an oligonucleotide sequence comprising 0-10 modified nucléotides;
wherein each np’, np, nq’, and nq, each of which may or may not be présent, independently represents an overhang nucléotide; and
XXX, YYY, ZZZ, X'X'X', ΥΎΎ', and HUT! each independently represent one motif of three identical modifications on three consecutive nucléotides.
In one embodiment, i is 0 and j is 0; or i is 1 and j is 0; or i is 0 and j is 1; or both i and j are 0; or both i and j are 1. In another embodiment, k is 0 and 1 is 0; or k is 1 and 1 is 0; k is 0 and 1 is 1 ; or both k and 1 are 0; or both k and 1 are 1.
Exemplary combinations of the sense strand and antisense strand forming a RNAi duplex include the formulas below:
5'np-Na-Y Y Y-Na-nq 3'
3' np’-Na’-Y'Y'Y' -Na’nq 5’ (IHa)
5' np -Na -YYY -Nb -ZZZ -Na-nq 3'
3' np’-Na’-Y'Y'Y'-Nb’-Z'Z'Z'-Na’nq’ 5' (Illb)
5' np-Na- X X X -Nb -Y Y Y - Na-nq 3 '
3' np’-Na’-X'X'X'-Nb’-Y'Y'Y'-Na’-nq 5’ (IIIc)
5’ np -Na -XXX -Nb-Y Y Y -Nb- Z Z Z -Na-nq 3’
3’ np’-Na’-X'X'X'-Nb’-Y'Y'Y'-Nb’-Z'Z'Z'-Na-nq’ 5’ (Illd)
When the RNAi agent is represented by formula (Ilia), each Na independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucléotides.
When the RNAi agent is represented by formula (Illb), each Nb independently represents an oligonucleotide sequence comprising 1-10, 1-7, 1-5 or 1-4 modified nucléotides. EachNa independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucléotides.
When the RNAi agent is represented as formula (IIIc), each Nb, Nb’ independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or Omodified nucléotides. Each Na independently represents an oligonucleotide sequence comprising 2-20, 215, or 2-10 modified nucléotides.
When the RNAi agent is represented as formula (Illd), each Nb, Nb’ independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or Omodified nucléotides. Each Na, Na independently represents an oligonucleotide sequence comprising 220, 2-15, or 2-10 modified nucléotides. Each of Na, Na’, Nb and Nb independently comprises modifications of altemating pattern.
Each of X, Y and Z in formulas (III), (Ilia), (Illb), (IIIc), and (Illd) may be the same or different from each other.
When the RNAi agent is represented by formula (III), (Ilia), (Illb), (IIIc), and (Illd), at least one of the Y nucléotides may form a base pair with one of the Y' nucléotides. Altematively, at least two of the Y nucléotides form base pairs with the corresponding Y' nucléotides; or ail three of the Y nucléotides ail form base pairs with the corresponding Y' nucléotides.
When the RNAi agent is represented by formula (Illb) or (Illd), at least one of the Z nucléotides may form a base pair with one of the Z' nucléotides. Altematively, at least two of the Z nucléotides form base pairs with the corresponding Z' nucléotides; or ail three of the Z nucléotides ail form base pairs with the corresponding Z' nucléotides.
When the RNAi agent is represented as formula (IIIc) or (Illd), at least one of the X nucléotides may form a base pair with one of the X' nucléotides. Altematively, at least two of the X nucléotides form base pairs with the corresponding X' nucléotides; or ail three of the X nucléotides ail form base pairs with the corresponding X' nucléotides.
In one embodiment, the modification on the Y nucléotide is different than the modification on the Y’ nucléotide, the modification on the Z nucléotide is different than the modification on the Z’ nucléotide, and/or the modification on the X nucléotide is different than the modification on the X’ nucléotide.
In one embodiment, when the RNAi agent is represented by formula (Illd), the Na modifications are 2'-O-methyl or 2'-fluoro modifications. In another embodiment, when the RNAi agent is represented by formula (Illd), the Na modifications are 2'-O-methyl or 2'-fluoro modifications and np' >0 and at least one np' is linked to a neighboring nucléotide a via phosphorothioate linkage. In yet another embodiment, when the RNAi agent is represented by formula (Illd), the Na modifications are 2'-O-methyl or 2'-fluoro modifications , np' >0 and at least one np' is linked to a neighboring nucléotide via phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc dérivatives attached through a bivalent or trivalent branched linker. In another embodiment, when the RNAi agent is represented by formula (Illd), the Na modifications are 2'-O-methyl or 2'-fluoro modifications , np' >0 and at least one np' is linked to a neighboring nucléotide via phosphorothioate linkage, the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc dérivatives attached through a bivalent or trivalent branched linker.
In one embodiment, when the RNAi agent is represented by formula (Ilia), the Na modifications are 2'-O-methyl or 2'-fluoro modifications , np' >0 and at least one np' is linked to a neighboring nucléotide via phosphorothioate linkage, the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc dérivatives attached through a bivalent or trivalent branched linker.
In one embodiment, the RNAi agent is a multimer containing at least two duplexes represented by formula (III), (Ilia), (Illb), (IIIc), and (Illd), wherein the duplexes are connected by a linker. The linker can be cleavable or non-cleavable. Optionally, the multimer further comprises a ligand. Each of the duplexes can target the same gene or two different genes; or each of the duplexes can target same gene at two different target sites.
In one embodiment, the RNAi agent is a multimer containing three, four, fïve, six or more duplexes represented by formula (III), (Ilia), (Illb), (IIIc), and (Illd), wherein the duplexes are connected by a linker. The linker can be cleavable or non-cleavable. Optionally, the multimer further comprises a ligand. Each of the duplexes can target the same gene or two different genes; or each of the duplexes can target same gene at two different target sites.
In one embodiment, two RNAi agents represented by formula (III), (Ilia), (Illb), (IIIc), and (Illd) are linked to each other at the 5’ end, and one or both of the 3’ ends and are optionally conjugated to to a ligand. Each of the agents can target the same gene or two different genes; or each of the agents can target same gene at two different target sites.
iRNA Conjugates
The iRNA agents disclosed herein can be in the form of conjugates. The conjugate may be attached at any suitable location in the iRNA molécule, e.g., at the 3’ end or the 5’ end of the sense or the antisense strand. The conjugates are optionally attached via a linker.
In some embodiments, an iRNA agent described herein is chemically linked to one or more ligands, moieties or conjugates, which may confer functionality, e.g., by affecting (e.g., enhancing) the activity, cellular distribution or cellular uptake of the iRNA. Such moieties include but are not limited to lipid moieties such as a cholestérol moiety (Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86: 6553-6556), cholic acid (Manoharan et al., Biorg. Med. Chem. Let., 1994, 4:1053-1060), a thioether, e.g., beryl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660:306-309; Manoharan étal., Biorg. Med. Chem. Let., 1993, 3:2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10:1111-1118; Kabanov et al., FEBS Lett., 1990, 259:327-330; Svinarchuk et al., Biochimie, 1993, 75:49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-racglycero-3-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654; Shea et al., Nucl. Acids Res., 1990, 18:3777-3783), apolyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucléotides, 1995, 14:969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys.
Acta, 1995, 1264:229-237), or an octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923-937).
In one embodiment, a ligand alters the distribution, targeting or lifetime of an iRNA agent into which it is incoiporated. In some embodiments, a ligand provides an enhanced affïnity for a selected target, e.g, molécule, cell or cell type, compartment, e.g., a cellular or organ compartment, tissue, organ or région of the body, as, e.g., compared to a species absent such a ligand. Typical ligands will not take paît in duplex pairing in a duplexed nucleic acid.
Ligands can include a naturally occurring substance, such as a protein (e.g., human sérum albumin (HSA), low-density lipoprotein (LDL), or globulin); carbohydrate (e.g., a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin or hyaluronic acid); or a lipid. The ligand may also be a recombinant or synthetic molécule, such as a synthetic polymer, e.g., a synthetic polyamino acid. Examples of polyamino acids include polyamino acid is a polylysine (PLL), poly L-aspartic acid, poly L-glutamic acid, styrene-maleic acid anhydride copolymer, poly(Llactide-co-glycolied) copolymer, divinyl ether-maleic anhydride copolymer, N-(2hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyuréthane, poly(2-ethylacryllic acid), N-isopropylacrylamide polymers, or polyphosphazine. Example of polyamines include: polyethylenimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, quatemary sait of a polyamine, or an a helical peptide.
Ligands can also include targeting groups, e.g., a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody, that binds to a specified cell type such as a kidney cell. A targeting group can be a thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, Mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetylgalactosamine, N-acetyl-gulucosamine multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid, cholestérol, a steroid, bile acid, folate, vitamin B12, biotin, or an RGD peptide or RGD peptide mimetic.
In some embodiments, the ligand is a GalNAc ligand that comprises one or more Nacetylgalactosamine (GalNAc) dérivatives. Additional description of GalNAc ligands is provided in the section titled Carbohydrate Conjugates.
Other examples of ligands include dyes, intercalating agents (e.g. acridines), cross-linkers (e.g. psoralene, mitomycin C), poiphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g. EDTA), lipophilie molécules, e.g, cholestérol, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-Bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, bomeol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid,03(oleoyl)lithocholic acid, 03-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine)and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g. biotin), transport/absorption facilitators (e.g., aspirin, vitamin E, folie acid), synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl, HRP, or AP.
Ligands can be proteins, e.g., glycoproteins, or peptides, e.g., molécules having a spécifie affinity for a co-ligand, or antibodies e.g., an antibody, that binds to a specified cell type such as a cancer cell, endothélial cell, or bone cell. Ligands may also include hormones and hormone receptors. They can also include non-peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetylgulucosamine multivalent mannose, or multivalent fucose. The ligand can be, for example, a lipopolysaccharide, an activator of p38 MAP kinase, or an activator of NF-xB.
The ligand can be a substance, e.g, a drug, which can increase the uptake of the iRNA agent into the cell, for example, by disrupting the cell’s cytoskeleton, e.g., by disrupting the cell’s microtubules, microfilaments, and/or intermediate filaments. The drug can be, for example, taxon, vincristine, Vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin.
bi some embodiments, a ligand attached to an iRNA as described herein acts as a pharmacokinetic modulator (PK modulator). PK modulators include lipophiles, bile acids, steroids, phospholipid analogues, peptides, protein binding agents, PEG, vitamins etc. Exemplary PK modulators include, but are not limited to, cholestérol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglyceride, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin etc. Oligonucleotides that comprise a number of phosphorothioate linkages are also known to bind to sérum protein, thus short oligonucleotides, e.g., oligonucleotides of about 5 bases, 10 bases, 15 bases or 20 bases, comprising multiple of phosphorothioate linkages in the backbone are also amenable to the présent invention as ligands (e.g. as PK modulating ligands). In addition, aptamers that bind sérum components (e.g. seium proteins) are also suitable for use as PK modulating ligands in the embodiments described herein.
Ligand-conjugated oligonucleotides of the invention may be synthesized by the use of an oligonucleotide that bears a pendant reactive functionality, such as that derived from the attachaient of a linking molécule onto the oligonucleotide (described below). This reactive oligonucleotide may be reacted directly with commercially-available ligands, ligands that are synthesized bearing any of a variety of protecting groups, or ligands that hâve a linking moiety attached thereto.
The oligonucleotides used in the conjugates of the présent invention may be conveniently and routinely made through the well-known technique of solid-phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or altematively be employed. It is also known to use similar techniques to préparé other oligonucleotides, such as the phosphorothioates and alkylated dérivatives.
In the ligand-conjugated oligonucleotides and ligand-molecule bearing sequence-specifïc linked nucleosides of the présent invention, the oligonucleotides and oligonucleosides may be assembled on a suitable DNA synthesizer utilizing standard nucléotide or nucleoside precursors, or nucléotide or nucleoside conjugate precursors that already bear the linking moiety, ligandnucleotide or nucleoside-conjugate precursors that already bear the ligand molécule, or nonnucleoside ligand-bearing building blocks.
When using nucleotide-conjugate precursors that already bear a linking moiety, the synthesis of the sequence-specific linked nucleosides is typically completed, and the ligand molécule is then reacted with the linking moiety to form the ligand-conjugated oligonucleotide. In some embodiments, the oligonucleotides or linked nucleosides of the présent invention are synthesized by an automated synthesizer using phosphoramidites derived from ligand-nucleoside conjugates in addition to the standard phosphoramidites and non-standard phosphoramidites that are commercially available and routinely used in oligonucleotide synthesis.
Lipid Conjugates
In one embodiment, the ligand is a lipid or lipid-based molécule. Such a lipid or lipidbased molécule can typically bind a sérum protein, such as human sérum albumin (HSA). An HSA binding ligand allows for distribution of the conjugate to a target tissue, e.g., a non-kidney target tissue of the body. For example, the target tissue can be the liver, including parenchymal cells of the liver. Other molécules that can bind HSA can also be used as ligands. For example, neproxin or aspirin can be used. A lipid or lipid-based ligand can (a) increase résistance to dégradation of the conjugate, (b) increase targeting or transport into a target cell or cell membrane, and/or (c) can be used to adjust binding to a sérum protein, e.g., HSA.
A lipid based ligand can be used to modulate, e.g., control (e.g., inhibit) the binding of the conjugate to a target tissue. For example, a lipid or lipid-based ligand that binds to HSA more strongly will be less likely to be targeted to the kidney and therefore less likely to be cleared from the body. A lipid or lipid-based ligand that binds to HSA less strongly can be used to target the conjugate to the kidney.
In one embodiment, the lipid based ligand binds HSA. For example, the ligand can bind HSA with a sufficient affinity such that distribution of the conjugate to a non-kidney tissue is enhanced. However, the affinity is typically not so strong that the HSA-ligand binding cannot be revers ed.
In another embodiment, the lipid based ligand binds HSA weakly or not at ail, such that distribution of the conjugate to the kidney is enhanced. Other moieties that target to kidney cells can also be used in place of or in addition to the lipid based ligand.
In another aspect, the ligand is a moiety, e.g., a vitamin, which is taken up by a target cell, e.g., a proliferating cell. These are paiticularly useful for treating disorders characterized by unwanted cell prolifération, e.g., of the malignant or non-malignant type, e.g., cancer cells. Exemplary vitamins include vitamin A, E, and K. Other exemplary vitamins include are B vitamin, e.g., folie acid, B12, riboflavin, biotin, pyridoxal or other vitamins or nutrients taken up by cancer cells. Also included are HSA and low density lipoprotein (LDL).
Cell Perméation Agents
In another aspect, the ligand is a cell-permeation agent, such as a helical cell-permeation agent. In one embodiment, the agent is amphipathic. An exemplary agent is a peptide such as tat or antennopedia. If the agent is a peptide, it can be modified, including a peptidylmimetic, inveitomers, non-peptide or pseudo-peptide linkages, and use of D-amino acids. The helical agent is typically an α-helical agent, and can hâve a lipophilie and a lipophobic phase.
The ligand can be a peptide or peptidomimetic. A peptidomimetic (also referred to herein as an oligopeptidomimetic) is a molécule capable of folding into a defined threedimensional structure similar to a natural peptide. The attachment of peptide and peptidomimetics to iRNA agents can affect pharmacokinetic distribution of the iRNA, such as by enhancing cellular récognition and absorption. The peptide or peptidomimetic moiety can be about 5-50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long.
A peptide or peptidomimetic can be, for example, a cell perméation peptide, cationic peptide, amphipathic peptide, or hydrophobie peptide (e.g., consisting primarily of Tyr, Trp or Phe). The peptide moiety can be a dendrimer peptide, constrained peptide or crosslinked peptide. In another alternative, the peptide moiety can include a hydrophobie membrane translocation sequence (MTS). An exemplary hydrophobie MTS-containing peptide is RFGF having the amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO:3367). An RFGF analogue (e.g., amino acid sequence AALLPVLLAAP (SEQ ID NO:3368)) containing a hydrophobie MTS can also be a targeting moiety. The peptide moiety can be a “delivery” peptide, which can carry large polar molécules including peptides, oligonucleotides, and protein across cell membranes. For example, sequences from the HIV Tat protein (GRKKRRQRRRPPQ (SEQ ID NO:3369)) and the Drosophila Antennapedia protein (RQIKIWFQNRRMKWKK (SEQ ID NO: 3370)) hâve been found to be capable of functioning as delivery peptides. A peptide or peptidomimetic can be encoded by a random sequence of DNA, such as a peptide identified from a phage-display library, or one-bead-one-compound (OBOC) combinatorial library (Lam et al., Nature, 354:82-84, 1991). Typically, the peptide or peptidomimetic tethered to a dsRNA agent via an incorporated monomer unit is a cell targeting peptide such as an arginine-glycine-aspartic acid (RGD)-peptide, or RGD mimic. A peptide moiety can range in length from about 5 amino acids to about 40 amino acids. The peptide moieties can hâve a structural modification, such as to increase stability or direct conformational properties. Any of the structural modifications described below can be utilized.
An RGD peptide for use in the compositions and methods of the invention may be linear or cyclic, and may be modified, e.g., glycosylated or methylated, to facilitate targeting to a spécifie tissue(s). RGD-containing peptides and peptidiomimemtics may include D-amino acids, as well as synthetic RGD mimics. In addition to RGD, one can use other moieties that target the integrin ligand. Preferred conjugates of this ligand target PECAM-1 or VEGF.
An RGD peptide moiety can be used to target a particular cell type, e.g., a tumor cell, such as an endothélial tumor cell or a breast cancer tumor cell (Zitzmann et al., Cancer Res., 62:5139-43, 2002). An RGD peptide can facilitate targeting of an dsRNA agent to tumors of a variety of other tissues, including the lung, kidney, spleen, or liver (Aoki et al., Cancer Gene Therapy 8:783-787, 2001). Typically, the RGD peptide will facilitate targeting of an iRNA agent to the kidney. The RGD peptide can be linear or cyclic, and can be modified, e.g., glycosylated or methylated to facilitate targeting to spécifie tissues. For example, a glycosylated RGD peptide can deliver a iRNA agent to a tumor cell expressing αγββ (Haubner et al., Jour. Nucl. Med., 42:326-336, 2001).
100
A “cell perméation peptide” is capable of permeating a cell, e.g., a microbial cell, such as a bacterial or fungal cell, or a mammalian cell, such as a human cell. A microbial cellpermeating peptide can be, for example, an α-helical linear peptide (e.g., LL-37 or Ceropin PI), a disulfïde bond-containing peptide (e.g., a -defensin, β-defensin or bactenecin), or a peptide containing only one or two dominating amino acids (e.g., PR-39 or indolicidin). A cell perméation peptide can also include a nuclear localization signal (NLS). For example, a cell perméation peptide can be a bipartite amphipathic peptide, such as MPG, which is derived from the fusion peptide domain of HIV-1 gp41 and the NLS of SV40 large T antigen (Simeoni et al., Nucl. Acids Res. 31:2717-2724, 2003).
Carbohydrate Conjugates
In some embodiments of the compositions and methods of the invention, an iRNA oligonucleotide further comprises a carbohydrate. The carbohydrate conjugated iRNA are advantageous for the in vivo delivery of nucleic acids, as well as compositions suitable for in vivo therapeutic use, as described herein. As used herein, “carbohydrate” refers to a compound which is either a carbohydrate per se made up of one or more monosaccharide units having at least 6 carbon atoms (which can be linear, branched or cyclic) with an oxygen, nitrogen or sulfur atom bonded to each carbon atom; or a compound having as a part thereof a carbohydrate moiety made up of one or more monosaccharide units each having at least six carbon atoms (which can be linear, branched or cyclic), with an oxygen, nitrogen or sulfur atom bonded to each carbon atom. Représentative carbohydrates include the sugars (mono-, di-, tri- and oligosaccharides containing from about 4, 5, 6, 7, 8, or 9 monosaccharide units), and polysaccharides such as starches, glycogen, cellulose and polysaccharide gums. Spécifie monosaccharides include C5 and above (e.g., C5, C6, C7, or C8) sugars; di- and trisaccharides include sugars having two or three monosaccharide units (e.g., C5, C6, C7, or C8).
In one embodiment, a carbohydrate conjugate comprises a monosaccharide. In one embodiment, the monosaccharide is an N-acetylgalactosamine (GalNAc). GalNAc conjugates are described, for example, in U.S. Patent No. 8,106,022, the entire content of which is hereby
101 incorporated herein by reference. In some embodiments, the GalNAc conjugate serves as a ligand that targets the iRNA to particular cells. In some embodiments, the GalNAc conjugate targets the iRNA to liver cells, e.g., by seiving as a ligand for the asialoglycoprotein receptor of liver cells (e.g., hépatocytes).
In some embodiments, the carbohydrate conjugate comprises one or more GalNAc dérivatives. The GalNAc dérivatives may be attached via a linker, e.g., a bivalent or trivalent branched linker. In some embodiments the GalNAc conjugate is conjugated to the 3’ end of the sense strand. In some embodiments, the GalNAc conjugate is conjugated to the iRNA agent (e.g., to the 3’ end of the sense strand) via a linker, e.g., a linker as described herein.
In some embodiments, the GalNAc conjugate is
In some embodiments, the RNAi agent is attached to the carbohydrate conjugate via a linker as shown in the following schematic, wherein X is O or S
102
In some embodiments, the RNAi agent is conjugated to L96 as defined in Table 1 and shown below
In some embodiments, a carbohydrate conjugate for use in the compositions and methods of the invention is selected from the group consisting of:
103
NHAc
Formula IV.
104
NHAc Formula V,
^Formula VIII,
105
Formula IX,
Formula X,
Formula XI,
106
O Formula XV,
107
O Formula XX,
108
Another représentative carbohydrate conjugate for use in the embodiments described herein includes, but is not limited to,
(Formula XXIII), when one of X or Y is an oligonucleotide, the other is a hydrogen.
109
In some embodiments, the carbohydrate conjugate further comprises one or more additional ligands as described above, such as, but not limited to, a PK modulator and/or a cell perméation peptide.
In one embodiment, an iRNA of the invention is conjugated to a carbohydrate through a linker. Non-limiting examples of iRNA carbohydrate conjugates with linkers of the compositions and methods of the invention include, but are not limited to,
(Formula XXIV),
x = 1-30 y = 1-15 (Formula XXV),
x = 1-30 y = 1-15 (Formula XXVI),
110
HO-X—
AcHN
x = 0-30 y = 1-15
HO . ,1K1 AcHN
HO z0H
HO N
AcHN
(Formula XXVII),
X = 0-30 y = 1-15 z = 1-20
HO . llkl AcHN
HO . Llkl
AcHN HO zOH
HO—
AcHN (Formula XXVIII),
x= 1-30 y = 1-15 z = 1-20
HO .
AcHN
HO zOH
V^O n ?
AcHN HO zOH hoaULo^>-n
AcHN (Formula XXIX), and
111
(Formula XXX), when one of X or Y is an oligonucleotide, the other is a hydrogen.
Linkers
In some embodiments, the conjugate or ligand described herein can be attached to an iRNA oligonucleotide with various linkers that can be cleavable or non-cleavable.
The term linker or “linking group” means an organic moiety that connects two parts of a compound, e.g., covalently attaches two parts of a compound. Linkers typically comprise a direct bond or an atom such as oxygen or sulfur, a unit such as NR8, C(O), C(O)NH, SO, SO2, SO2NH or a chain of atoms, such as, but not limited to, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalkenyl, alkylarylalkynyl, alkenylarylalkyl, alkenylarylalkenyl, alkenylarylalkynyl, alkynylarylalkyl, alkynylarylalkenyl, alkynylarylalkynyl, alkylheteroarylalkyl, alkylheteroarylalkenyl, alkylheteroarylalkynyl, alkenylheteroarylalkyl, alkenylheteroarylalkenyl, alkenylheteroarylalkynyl, alkynylheteroarylalkyl, alkynylheteroarylalkenyl, alkynylheteroarylalkynyl, alkylheterocyclylalkyl, alkylheterocyclylalkenyl, alkylhererocyclylalkynyl, alkenylheterocyclylalkyl, alkenylheterocyclylalkenyl, alkenylheterocyclylalkynyl, alkynylheterocyclylalkyl, alkynylheterocyclylalkenyl, alkynylheterocyclylalkynyl, alkylaryl, alkenylaryl, alkynylaryl, alkylheteroaryl, alkenylheteroaryl, alkynylhereroaryl, which one or more methylenes can be
112 intenupted or terminated by O, S, S(O), SO2, N(R8), C(O), substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocyclic; where R8 is hydrogen, acyl, aliphatic or substituted aliphatic. In one embodiment, the linker is between about 1-24 atoms, 2-24, 3-24, 4-24, 5-24, 6-24, 6-18, 7-18, 8-18 atoms, 7-17, 8-17, 6-16, 7-16, or
8-16 atoms.
In one embodiment, a dsRNA of the invention is conjugated to a bivalent or trivalent branched linker selected from the group of structures shown in any of formula (XXXI) (XXXIV):
Formula XXXII
Formula XXXI
A
N \[ p3A_Q3A_p3A
-|-3A_|_3A
γ3Β_[_3Β
p4B_Q4B_p4B ρ4Α_θ4Α_ρ4Α
γ4Α_[_4Α
Formula XXXIII \ p3B_Q3B_p3B
wherein:
q2A, q2B, q3A, q3B, q4A, q4B, q5A, q5B and q5C represent independently for each occurrence
0-20 and wherein the repeating unit can be the same or different;
113
P2A, P2B, P3A, P3B, P4A, P4B, P5A, P5B, P5C, T2A, T2B, T3A, T3B, T4A, T4B, T4A, T5B, T5C are each independently for each occurrence absent, CO, NH, O, S, OC(O), NHC(O), CH2, CH2NH or
CH2O;
q2à, q2b, q3a, q3b, q4A, q4b, q5a, q5b, q5C jndepencjentiy for each occurrence absent, alkylene, substituted alkylene wherin one or more methylenes can be interrupted or terminated by one or more of O, S, S(O), SO2, N(Rn), C(R’)=C(R”), C=C or C(O);
R2A, R2B, R3A, R3B, R4A, R4B, R5A, R5B, R5C are each independently for each occurrence absent,
NH, O, S, CH2, C(O)O, C(O)NH, NHCH(Ra)C(O), -C(O)-CH(Ra)-NH-, CO, CH=N-O,
or heterocyclyl;
L2A, L2B, L3A, L3B, L4A, L4B, L5A, L5B and L5C represent the ligand; i.e. each independently for each occurrence a monosaccharide (such as GalNAc), disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, or polysaccharide; andRa is H or amino acid side chain.Trivalent conjugating GalNAc dérivatives are particularly useful for use with RNAi agents for inhibiting the expression of a target gene, such as those of formula (XXXV):
Formula XXXV
wherein L5A, L5B and L5C represent a monosaccharide, such as GalNAc dérivative.
114
Examples of suitable bivalent and trivalent branched linker groups conjugating GalNAc dérivatives include, but are not limited to, the structures recited above as formulas II, VII, XI, X, and XIII.
A cleavable linking group is one which is sufficiently stable outside the cell, but which upon entry into a target cell is cleaved to release the two parts the linker is holding together. In a preferred embodiment, the cleavable linking group is cleaved at least about 10 times, 20, times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times or more, or at least about 100 times faster in a target cell or under a first reference condition (which can, e.g., be selected to mimic or represent intracellular conditions) than in the blood of a subject, or under a second reference condition (which can, e.g., be selected to mimic or represent conditions found in the blood or sérum).
Cleavable linking groups are susceptible to cleavage agents, e.g., pH, redox potential or the presence of degradative molécules. Generally, cleavage agents are more prévalent or found at higher levels or activities inside cells than in sérum or blood. Examples of such degradative agents include: redox agents which are selected for particular substrates or which hâve no substrate specificity, including, e.g., oxidative or reductive enzymes or reductive agents such as mercaptans, présent in cells, that can dégradé a redox cleavable linking group by réduction; esterases; endosomes or agents that can create an acidic environment, e.g., those that resuit in a pH of five or lower; enzymes that can hydrolyze or dégradé an acid cleavable linking group by acting as a general acid, peptidases (which can be substrate spécifie), and phosphatases.
A cleavable linkage group, such as a disulfide bond can be susceptible to pH. The pH of human sérum is 7.4, while the average intracellular pH is slightly lower, ranging from about 7.17.3. Endosomes hâve a more acidic pH, in the range of 5.5-6.0, and lysosomes hâve an even more acidic pH at around 5.0. Some linkers will hâve a cleavable linking group that is cleaved at a preferred pH, thereby releasing a cationic lipid from the ligand inside the cell, or into the desired compartment of the cell.
A linker can include a cleavable linking group that is cleavable by a particular enzyme. The type of cleavable linking group incorporated into a linker can dépend on the cell to be
115 targeted. For example, a liver-targeting ligand can be linked to a cationic lipid through a linker that includes an ester group. Liver cells are rich in esterases, and therefore the linker will be cleaved more efficiently in liver cells than in cell types that are not esterase-rich. Other celltypes rich in esterases include cells of the lung, rénal cortex, and testis.
Linkers that contain peptide bonds can be used when targeting cell types rich in peptidases, such as liver cells and synoviocytes.
In general, the suitability of a candidate cleavable linking group can be evaluated by testing the ability of a degradative agent (or condition) to cleave the candidate linking group. It will also be désirable to also test the candidate cleavable linking group for the ability to resist cleavage in the blood or when in contact with other non-target tissue. Thus, one can détermine the relative susceptibility to cleavage between a first and a second condition, where the first is selected to be indicative of cleavage in a target cell and the second is selected to be indicative of cleavage in other tissues or biological fluids, e.g., blood or sérum. The évaluations can be carried out in cell free Systems, in cells, in cell culture, in organ or tissue culture, or in whole animais. It can be useful to make initial évaluations in cell-free or culture conditions and to confîrm by further évaluations in whole animais. In preferred embodiments, useful candidate compounds are cleaved at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood or sérum (or under in vitro conditions selected to mimic extracellular conditions).
Redox cleavable linking groups
In one embodiment, a cleavable linking group is a redox cleavable linking group that is cleaved upon réduction or oxidation. An example of reductively cleavable linking group is a disulphide linking group (-S-S-). To détermine if a candidate cleavable linking group is a suitable “reductively cleavable linking group,” or for example is suitable for use with a particular iRNA moiety and particular targeting agent one can look to methods described herein. For example, a candidate can be evaluated by incubation with dithiothreitol (DTT), or other reducing agent using reagents know in the art, which mimic the rate of cleavage which would be observed
116 in a cell, e.g., a target cell. The candidates can also be evaluated under conditions which are selected to mimic blood or sérum conditions. In one, candidate compounds are cleaved by at most about 10% in the blood. In other embodiments, usefùl candidate compounds are degraded at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood (or under in vitro conditions selected to mimic extracellular conditions). The rate of cleavage of candidate compounds can be determined using standard enzyme kinetics assays under conditions chosen to mimic intracellular media and compared to conditions chosen to mimic extracellular media.
Phosphate-based cleavable linking groups
In another embodiment, a cleavable linker comprises a phosphate-based cleavable linking group. A phosphate-based cleavable linking group is cleaved by agents that dégradé or hydrolyze the phosphate group. An example of an agent that cleaves phosphate groups in cells are enzymes such as phosphatases in cells. Examples of phosphate-based linking groups are -OP(O)(ORk)-O-, -O-P(S)(ORk)-O-, -O-P(S)(SRk)-O-, -S-P(O)(ORk)-O-, -O-P(O)(ORk)-S-, -SP(O)(ORk)-S-, -O-P(S)(ORk)-S-, -S-P(S)(ORk)-O-, -O-P(O)(Rk)-O-, -O-P(S)(Rk)-O-, -SP(O)(Rk)-O-, -S-P(S)(Rk)-O-, -S-P(O)(Rk)-S-, -O-P(S)( Rk)-S-. Preferred embodiments are -OP(O)(OH)-O-, -O-P(S)(OH)-O-, -O-P(S)(SH)-O-, -S-P(O)(OH)-O-, -O-P(O)(OH)-S-, -SP(O)(OH)-S-, -O-P(S)(OH)-S-, -S-P(S)(OH)-O-, -O-P(O)(H)-O-, -O-P(S)(H)-O-, -S-P(O)(H)-O, -S-P(S)(H)-O-, -S-P(O)(H)-S-, -O-P(S)(H)-S-, A preferred embodiment is -O-P(O)(OH)-O-, These candidates can be evaluated using methods analogous to those described above.
Acid cleavable linking groups
In another embodiment, a cleavable linker comprises an acid cleavable linking group. An acid cleavable linking group is a linking group that is cleaved under acidic conditions. In preferred embodiments acid cleavable linking groups are cleaved in an acidic environment with a pH of about 6.5 or lower (e.g., about 6.0, 5.75, 5.5, 5.25, 5.0, or lower), or by agents such as enzymes that can act as a general acid. In a cell, spécifie low pH organelles, such as endosomes and lysosomes can provide a cleaving environment for acid cleavable linking groups. Examples
117 of acid cleavable linking groups include but are not limited to hydrazones, esters, and esters of amino acids. Acid cleavable groups can hâve the general formula -C=NN-, C(O)O, or -OC(O).
A preferred embodiment is when the carbon attached to the oxygen of the ester (the alkoxy group) is an aryl group, substituted alkyl group, or teitiary alkyl group such as dimethyl pentyl or t-butyl. These candidates can be evaluated using methods analogous to those described above.
Ester-based cleavable linking groups
In another embodiment, a cleavable linker comprises an ester-based cleavable linking group. An ester-based cleavable linking group is cleaved by enzymes such as esterases and amidases in cells. Examples of ester-based cleavable linking groups include but are not limited to esters of alkylene, alkenylene and alkynylene groups. Ester cleavable linking groups hâve the general formula -C(O)O-, or -OC(O)-. These candidates can be evaluated using methods analogous to those described above.
Peptide-based cleavable linking groups
In yet another embodiment, a cleavable linker comprises a peptide-based cleavable linking group. A peptide-based cleavable linking group is cleaved by enzymes such as peptidases and proteases in cells. Peptide-based cleavable linking groups are peptide bonds formed between amino acids to yield oligopeptides (e.g., dipeptides, tripeptides etc} and polypeptides. Peptide-based cleavable groups do not include the amide group (-C(O)NH-). The amide group can be formed between any alkylene, alkenylene or alkynelene. A peptide bond is a spécial type of amide bond formed between amino acids to yield peptides and proteins. The peptide based cleavage group is generally limited to the peptide bond (i.e., the amide bond) formed between amino acids yielding peptides and proteins and does not include the entire amide functional group. Peptide-based cleavable linking groups hâve the general formula NHCHRAC(O)NHCHRBC(O)-, where RA and RB are the R groups of the two adjacent amino acids. These candidates can be evaluated using methods analogous to those described above.
Représentative U.S. patents that teach the préparation of RNA conjugates include, but are not limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077;
118
5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779;
4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963;
5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536;
5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475;
5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726;
5,597,696; 5,599,923; 5,599,928 and 5,688,941; 6,294,664; 6,320,017; 6,576,752; 6,783,931;
6,900,297; 7,037,646; 8,106,022, the entire contents of each of which is herein incorporated by reference.
It is not necessary for ail positions in a given compound to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single compound or even at a single nucleoside within an iRNA. The présent invention also includes iRNA compounds that are chimeric compounds.
“Chimeric” iRNA compounds, or “chimeras,” in the context of the présent invention, are iRNA compounds, e.g., dsRNAs, that contain two or more chemically distinct régions, each made up of at least one monomer unit, i.e., a nucléotide in the case of a dsRNA compound. These iRNAs typically contain at least one région wherein the RNA is modified so as to confer upon the iRNA increased résistance to nuclease dégradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid. An additional région of the iRNA may serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of iRNA inhibition of gene expression. Consequently, comparable results can often be obtained with shorter iRNAs when chimeric dsRNAs are used, compared to phosphorothioate deoxy dsRNAs hybridizing to the same target région. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.
In certain instances, the RNA of an iRNA can be modified by a non-ligand group. A number of non-ligand molécules hâve been conjugated to iRNAs in order to enhance the activity, cellular distribution or cellular uptake of the iRNA, and procedures for performing such
119 conjugations are available in the scientifîc literature. Such non-ligand moieties hâve included lipid moieties, such as cholestérol (Kubo, T. et al., Biochem. Biophys. Res. Comm., 2007, 365(1):54-61 ; Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86:6553), cholic acid (Manoharan étal., Bioorg. Med. Chem. Lett., 1994, 4:1053), athioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660:306; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3:2765), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras étal., EMBO J., 1991, 10:111; Kabanov étal., FEBS Lett., 1990, 259:327; Svinarchuk étal., Biochimie, 1993, 75:49), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-racglycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651; Shea et al., Nucl. Acids Res., 1990, 18:3777), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucléotides, 1995, 14:969), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923). Représentative United States patents that teach the préparation of such RNA conjugates hâve been listed above. Typical conjugation protocols involve the synthesis of an RNAs bearing an aminolinker at one or more positions of the sequence. The amino group is then reacted with the molécule being conjugated using appropriate coupling or activating reagents. The conjugation reaction may be performed either with the RNA still bound to the solid support or following cleavage of the RNA, in solution phase. Purification of the RNA conjugate by HPLC typically affords the pure conjugate.
Delivery of iRNA
The delivery of an iRNA to a subject in need thereof can be achieved in a number of different ways. In vivo delivery can be performed directly by administering a composition comprising an iRNA, e.g. a dsRNA, to a subject. Alternatively, delivery can be performed indirectly by administering one or more vectors that encode and direct the expression of the iRNA. These alternatives are discussed further below.
120
Direct delivery
In general, any method of delivering a nucleic acid molécule can be adapted for use with an iRNA (see e.g., Akhtar S. and Julian RL. (1992) Trends Cell. Biol. 2(5):139-144 and WO94/02595, which are incorporated herein by reference in their entireties). However, there are three factors that are important to consider in order to successfùlly deliver an iRNA molécule in vivo: (a) biological stability of the delivered molécule, (2) preventing non-specific effects, and (3) accumulation of the delivered molécule in the target tissue. The non-specific effects of an iRNA can be minimized by local administration, for example by direct injection or implantation into a tissue (as a non-limiting example, a tumor) or topically administering the préparation. Local administration to a treatment site maximizes local concentration of the agent, limits the exposure of the agent to systemic tissues that may otherwise be harmed by the agent or that may dégradé the agent, and permits a lower total dose of the iRNA molécule to be administered. Several studies hâve shown successful knockdown of gene products when an iRNA is administered locally. For example, intraocular delivery of a VEGF dsRNA by intravitreal injection in cynomolgus monkeys (Tolentino, MJ et al (2004) Retina 24:132-138) and subretinal injections in mice (Reich, SJ., et al (2003) Mol. Vis. 9:210-216) were both shown to prevent neovascularization in an experimental model of age-related macular degeneration. In addition, direct intratumoral injection of a dsRNA in mice reduces tumor volume (Pille, J., et al (2005) Mol. Ther.l 1:267-274) and can prolong survival of tumor-bearing mice (Kim, WJ., et al (2006) Mol. Ther. 14:343-350; Li, S., et al (2007) Mol. Ther. 15:515-523). RNA interférence has also shown success with local delivery to the CNS by direct injection (Dom, G., et al. (2004) Nucleic Acids 32:e49; Tan, PH., et al (2005) Gene Ther. 12:59-66; Makimura, H., et al (2002) BMC Neurosci. 3:18; Shishkina, GT., et al (2004) Neuroscience 129:521-528; Thakker, ER., et al (2004) Proc. Natl. Acad. Soi. U.S.A. 101:17270-17275; Akaneya,Y., et al (2005) J. Neurophysiol. 93:594-602) and to the lungs by intranasal administration (Howard, KA., et al (2006) Mol. Ther. 14:476-484; Zhang, X., étal (2004) J. Biol. Chem. 279:10677-10684; Bitko, V., et al (2005) Nat. Med. 11:50-55). For administering an iRNA systemically for the treatment of a disease, the RNA can be modified or altematively delivered using a drug delivery system;
121 both methods act to prevent the rapid dégradation of the dsRNA by endo- and exo-nucleases in vivo.
Modification of the RNA or the pharmaceutical carrier can also permit targeting of the iRNA composition to the target tissue and avoid undesirable off-target effects. iRNA molécules can be modified by chemical conjugation to other groups, e.g., a lipid or carbohydrate group as described herein. Such conjugates can be used to target iRNA to particular cells, e.g., liver cells, e.g., hépatocytes. For example, GalNAc conjugates or lipid (e.g., LNP) formulations can be used to target iRNA to particular cells, e.g., liver cells, e.g., hépatocytes.
Lipophilie groups such as cholestérol to enhance cellular uptake and prevent dégradation. For example, an iRNA directed against ApoB conjugated to a lipophilie cholestérol moiety was injected systemically into mice and resulted in knockdown of apoB mRNA in both the liver and jéjunum (Soutschek, J., et al (2004) Nature 432:173-178). Conjugation of an iRNA to an aptamer has been shown to inhibit tumor growth and médiate tumor régression in a mouse model of prostate cancer (McNamara, JO., et al (2006) Nat. Biotechnol. 24:1005-1015). In an alternative embodiment, the iRNA can be delivered using drug delivery Systems such as a nanoparticle, a dendrimer, a polymer, liposomes, or a cationic delivery system. Positively charged cationic delivery Systems facilitate binding of an iRNA molécule (negatively charged) and also enhance interactions at the negatively charged cell membrane to permit efficient uptake of an iRNA by the cell. Cationic lipids, dendrimers, or polymers can either be bound to an iRNA, or induced to form a vesicle or micelle (see e.g., Kim SH., et al (2008) Journal of Controlled Release 129(2): 107-116) that encases an iRNA. The formation of vesicles or micelles further prevents dégradation of the iRNA when administered systemically. Methods for making and administering cationic- iRNA complexes are well within the abilities of one skilled in the art (see e.g., Sorensen, DR., et al (2003) J. Mol. Biol 327:761-766; Verma, UN., et al (2003) Clin. Cancer Res. 9:1291-1300; Arnold, AS et al (2007) J. Hypertens. 25:197-205, which are incorporated herein by reference in their entirety). Some non-limiting examples of drug delivery Systems useful for systemic delivery of iRNAs include DOTAP (Sorensen, DR., et al (2003), supra; Verma, UN., et al (2003), supra), Oligofectamine, solid nucleic acid lipid particles (Zimmermann, TS., et al (2006) Nature 441:111-114), cardiolipin (Chien, PY., et al (2005)
122
Cancer Gene Ther. 12:321-328; Pal, A., et al (2005) Int J. Oncol. 26:1087-1091), polyethyleneimine (Bonnet ME., et al (2008) Pharm. Res. Aug 16 Epub ahead of print; Aigner, A. (2006) J. Biomed. Biotechnol. 71659), Arg-Gly-Asp (RGD) peptides (Liu, S. (2006) Mol. Pharm. 3:472-487), and polyamidoamines (Tomalia, DA., et al (2007) Biochem. Soc. Trans. 35:61-67; Yoo, H., et al (1999) Pharm. Res. 16:1799-1804). In some embodiments, an iRNA forms a complex with cyclodextrin for systemic administration. Methods for administration and pharmaceutical compositions of iRNAs and cyclodextrins can be found in U.S. Patent No. 7, 427, 605, which is herein incorporated by reference in its entirety.
Vector encoded iRNAs
In another aspect, iRNA targeting the ALAS1 gene can be expressed from transcription units inserted into DNA or RNA vectors (see, e.g., Couture, A, et al., TIG. (1996), 12:5-10; Skillem, A., étal., International PCT Publication No. WO 00/22113, Conrad, International PCT Publication No. WO 00/22114, and Conrad, U.S. Pat. No. 6,054,299). Expression canbe transient (on the order of hours to weeks) or sustained (weeks to months or longer), depending upon the spécifie construct used and the target tissue or cell type. These transgenes can be introduced as a linear construct, a circular plasmid, or a viral vector, which can be an integrating or non-integrating vector. The transgene can also be constructed to permit it to be inherited as an extrachromosomalplasmid (Gassmann, étal., Proc. Natl. Acad. Sci. USA (1995) 92:1292).
The individual strand or strands of an iRNA can be transcribed from a promoter on an expression vector. Where two separate strands are to be expressed to generate, for example, a dsRNA, two separate expression vectors can be co-introduced (e.g., by transfection or infection) into a target cell. Altematively each individual strand of a dsRNA can be transcribed by promoters both of which are located on the same expression plasmid. In one embodiment, a dsRNA is expressed as an inverted repeat joined by a linker polynucleotide sequence such that the dsRNA has a stem and loop structure.
An iRNA expression vector is typically a DNA plasmid or viral vector. An expression vector compatible with eukaryotic cells, e.g., with vertebrate cells, can be used to produce recombinant constiucts for the expression of an iRNA as described herein. Eukaryotic cell
123 expression vectors are well known in the ait and are available from a number of commercial sources. Typically, such vectors contain convenient restriction sites for insertion of the desired nucleic acid segment. Delivery of iRNA expressing vectors can be systemic, such as by intravenous or intramuscular administration, by administration to target cells ex-planted from the patient followed by réintroduction into the patient, or by any other means that allows for introduction into a desired target cell.
An iRNA expression plasmid can be transfected into a target cell as a complex with a cationic lipid carrier (e.g., Oligofectamine) or a non-cationic lipid-based carrier (e.g., Transit-TKO™). Multiple lipid transfections for iRNA-mediated knockdowns targeting different régions of a target RNA over a period of a week or more are also contemplated by the invention. Successful introduction of vectors into host cells can be monitored using various known methods. For example, transient transfection can be signaled with a reporter, such as a fluorescent marker, such as Green Fluorescent Protein (GFP). Stable transfection of cells ex vivo can be ensured using markers that provide the transfected cell with résistance to spécifie environmental factors (e.g., antibiotics and drugs), such as hygromycin B résistance.
Viral vector Systems which can be utilized with the methods and compositions described herein include, but are not limited to, (a) adenovirus vectors; (b) retrovirus vectors, including but not limited to lentiviral vectors, moloney murine leukemia virus, etc.; (c) adeno- associated virus vectors; (d) heipes simplex virus vectors; (e) SV40 vectors; (f) polyoma virus vectors;
(g) papilloma virus vectors; (h) picomavirus vectors; (i) pox virus vectors such as an orthopox, e.g., vaccinia viius vectors or avipox, e.g. canary pox or fowl pox; and (j) a helper-dependent or gutless adenovirus. Replication-defective viruses can also be advantageous. Different vectors will or will not become incorporated into the cells’ genome. The constructs can include viral sequences for transfection, if desired. Altematively, the construct may be incoiporated into vectors capable of episomal réplication, e.g EPV and EBV vectors. Constructs for the recombinant expression of an iRNA will generally require regulatory éléments, e.g., promoters, enhancers, etc., to ensure the expression of the iRNA in target cells. Other aspects to consider for vectors and constructs are further described below.
124
Vectors useful for the delivery of an iRNA will include regulatory éléments (promoter, enhancer, etc.) sufficient for expression of the iRNA in the desired target cell or tissue. The regulatory éléments can be chosen to provide either constitutive or regulated/inducible expression.
Expression of the iRNA can be precisely regulated, for example, by using an inducible regulatory sequence that is sensitive to ceitain physiological regulators, e.g., circulating glucose levels, or hormones (Docherty et al., 1994, FASEB J. 8:20-24). Such inducible expression Systems, suitable for the control of dsRNA expression in cells or in mammals include, for example, régulation by ecdysone, by estrogen, progestérone, tétracycline, chemical inducers of dimerization, and isopropyl-P-Dl-thiogalactopyranoside (IPTG). A person skilled in the art would be able to choose the appropriate regulatory/promoter sequence based on the intended use of the iRNA transgene.
In a spécifie embodiment, viral vectors that contain nucleic acid sequences encoding an iRNA can be used. For example, a retroviral vector can be used (see Miller et al., Meth. Enzymol. 217:581-599 (1993)). These retroviral vectors contain the components necessary for the correct packaging of the viral genome and intégration into the host cell DNA. The nucleic acid sequences encoding an iRNA are cloned into one or more vectors, which facilitâtes delivery of the nucleic acid into a patient. More detail about retroviral vectors can be found, for example, in Boesen et al., Biotherapy 6:291-302 (1994), which describes the use of a retroviral vector to deliver the mdrl gene to hematopoietic stem cells in order to make the stem cells more résistant to chemotherapy. Other référencés illustrating the use of retroviral vectors in gene therapy are: Clowes étal., J. Clin. Invest. 93:644-651 (1994); Kiem étal., Blood 83:1467-1473 (1994); Salmons and Gunzberg, Human Gene Therapy 4:129-141 (1993); and Grossman and Wilson, Curr. Opin. in Genetics and Devel. 3:110-114 (1993). Lentiviral vectors contemplated for use include, for example, the HIV based vectors described in U.S. Patent Nos. 6,143,520; 5,665,557; and 5,981,276, which are herein incoiporated by reference.
Adenoviruses are also contemplated for use in delivery of iRNAs. Adenoviruses are especially attractive vehicles, e.g., for delivering genes to respiratory epithelia. Adenoviruses naturally infect respiratory epithelia where they cause a mild disease. Other targets for
125 adenovirus-based delivery Systems are liver, the central neivous system, endothélial cells, and muscle. Adenoviiuses hâve the advantage of being capable of infecting non-dividing cells. Kozarsky and Wilson, Current Opinion in Genetics and Development 3:499-503 (1993) présent a review of adenovirus-based gene therapy. Bout et al., Human Gene Therapy 5:3-10 (1994) demonstrated the use of adenovirus vectors to transfer genes to the respiratory epithelia of rhésus monkeys. Other instances of the use of adenoviruses in gene therapy can be found in Rosenfeld et al., Science 252:431-434 (1991); Rosenfeld et al., Cell 68:143-155 (1992); Mastrangeli et al., J. Clin. Invest. 91:225-234 (1993); PCT Publication WO94/12649; and Wang, et al., Gene Therapy 2:775-783 (1995). A suitable AV vector for expressing an iRNA featured in the invention, a method for constructing the recombinant AV vector, and a method for delivering the vector into target cells, are described in Xia H et al. (2002), Nat. Biotech. 20: 1006-1010.
Use of Adeno-associated viius (AAV) vectors is also contemplated (Walsh et al., Proc. Soc. Exp. Biol. Med. 204:289-300 (1993); U.S. Pat. No. 5,436,146). In one embodiment, the iRNA can be expressed as two separate, complementary single-stranded RNA molécules from a recombinant AAV vector having, for example, either the U6 or HI RNA promoters, or the cytomégalovirus (CMV) promoter. Suitable AAV vectors for expressing the dsRNA featured in the invention, methods for constructing the recombinant AV vector, and methods for delivering the vectors into target cells are described in Samulski R et al. (1987), J. Virol. 61: 3096-3101; Fisher K J et al. (1996), J. Virol, 70: 520-532; Samulski R et al. (1989), J. Virol. 63: 3822-3826; U.S. Pat. No. 5,252,479; U.S. Pat. No. 5,139,941; International Patent Application No. WO 94/13788; and International Patent Application No. WO 93/24641, the entire disclosures of which are herein incorporated by reference.
Another typical viral vector is a pox virus such as a vaccinia virus, for example an attenuated vaccinia such as Modified Virus Ankara (MVA) or NYVAC, an avipox such as fowl pox or canary pox.
The tropism of viral vectors can be modified by pseudotyping the vectors with envelope proteins or other surface antigens from other viruses, or by substituting different viral capsid proteins, as appropriate. For example, lentiviral vectors can be pseudotyped with surface proteins from vesicular stomatitis virus (VSV), rabies, Ebola, Mokola, and the like. AAV vectors can be
126 made to target different cells by engineering the vectors to express different capsid protein serotypes; see, e.g., Rabinowitz J E et al. (2002), J Virol 76:791-801, the entire disclosure of which is herein incorporated by reference.
The pharmaceutical préparation of a vector can include the vector in an acceptable diluent, or can include a slow release matrix in which the gene delivery vehicle is imbedded. Alternatively, where the complété gene delivery vector can be produced intact from recombinant cells, e.g., retroviral vectors, the pharmaceutical préparation can include one or more cells which produce the gene delivery system.
III. Pharmaceutical compositions containing iRNA
In one embodiment, the invention provides pharmaceutical compositions containing an iRNA, as described herein, and a pharmaceutically acceptable carrier. The pharmaceutical composition containing the iRNA is useful for treating a disease or disorder related to the expression or activity of an ALAS1 gene (e.g., a disorder involving the porphyrin pathway). Such pharmaceutical compositions are formulated based on the mode of delivery. For example, compositions can be formulated for systemic administration via parentéral delivery, e.g., by intravenous (IV) delivery. In some embodiments, a composition provided herein (e.g., an LNP formulation) is formulated for intravenous delivery. In some embodiments, a composition provided herein (e.g., a composition comprising a GalNAc conjugate) is formulated for subcutaneous delivery.
The pharmaceutical compositions featured herein are administered in a dosage sufficient to inhibit expression of an ALAS1 gene. In general, a suitable dose of iRNA will be in the range of 0.01 to 200.0 milligrams per kilogram body weight of the récipient per day, generally in the range of 1 to 50 mg per kilogram body weight per day. For example, the dsRNA can be administered at 0.05 mg/kg, 0.5 mg/kg, 1 mg/kg, 1.5 mg/kg, 2 mg/kg, 3 mg/kg, 10 mg/kg, 20 mg/kg, 30 mg/kg, 40 mg/kg, or 50 mg/kg per single dose. The pharmaceutical composition may be administered once daily, or the iRNA may be administered as two, three, or more sub-doses at appropriate intervals throughout the day or even using continuous infusion or delivery through a controlled release formulation. In that case, the iRNA contained in each sub-dose must be
127 correspondingly smaller in order to achieve the total daily dosage. The dosage unit can also be compounded for delivery over several days, e.g., using a conventional sustained release formulation which provides sustained release of the iRNA over a several day period. Sustained release formulations are well known in the art and are particularly useful for delivery of agents at a particular site, such as can be used with the agents of the présent invention. In this embodiment, the dosage unit contains a corresponding multiple of the daily dose.
The effect of a single dose on ALAS1 levels can be long lasting, such that subséquent doses are administered at not more than 3, 4, or 5 day intervals, or at not more than 1, 2, 3, or 4 week intervals.
The skilled artisan will appreciate that certain factors may influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and/or âge of the subject, and other diseases présent. Moreover, treatment of a subject with a therapeutically effective amount of a composition can include a single treatment or a sériés of treatments. Estimâtes of effective dosages and in vivo half-lives for the individual iRNAs encompassed by the invention can be made using conventional méthodologies or on the basis of in vivo testing using an appropriate animal model, as described elsewhere herein.
Advances in mouse genetics hâve generated a number of mouse models for the study of various human diseases, such as pathological processes related to ALAS1 expression (e.g., pathological processes involving porphyrins or defects in the porphyrin pathway, such as, for example, porphyrias). Such models can be used for in vivo testing of iRNA, as well as for determining a therapeutically effective dose and/or an effective dosing regimen.
A suitable mouse model is, for example, a mouse containing a transgene expressing human ALAS1. Mice that hâve knock-in mutations (e.g., mutations that are associated with acute hepatic porphyrias in humans) can be used to détermine the therapeutically effective dosage and/or duration of administration of ALAS1 siRNA .The présent invention also includes pharmaceutical compositions and formulations that include the iRNA compounds featured in the invention. The pharmaceutical compositions of the présent invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the
128 area to be treated. Administration may be topical (e.g., by a transdermal patch), pulmonary, e.g., by inhalation or insufflation of powders or aérosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal, oral or parentéral. Parentéral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; subdermal, e.g., via an implanted device; or intracranial, e.g., by intraparenchymal, intrathecal or intraventricular, administration.
The iRNA can be delivered in a manner to target a particular tissue, such as a tissue that produces érythrocytes. For example, the iRNA can be delivered to bone marrow, liver (e.g., hepatocyes of liver), lymph glands, spleen, lungs (e.g., pleura of lungs) or spine. In one embodiment, the iRNA is delivered to bone marrow.
Phaimaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional phaimaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or désirable. Coated condoms, gloves and the like may also be useful. Suitable topical formulations include those in which the iRNAs featured in the invention are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants. Suitable lipids and liposomes include neutral (e.g., dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl choline) négative (e.g., dimyristoylphosphatidyl glycérol DMPG) and cationic (e.g., dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidyl ethanolamine DOTMA). iRNAs featured in the invention may be encapsulated within liposomes or may form complexes thereto, in particular to cationic liposomes. Altematively, iRNAs may be complexed to lipids, in particular to cationic lipids. Suitable fatty acids and esters include but are not limited to arachidonic acid, oleic acid, eicosanoic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, l-dodecylazacycloheptan-2-one, an acylcamitine, an acylcholine, or a Ci_2o alkyl ester (e.g, isopropylmyristate IPM), monoglyceride, diglyceride or pharmaceutically acceptable sait thereof. Topical formulations are described in detail in U.S. Patent No. 6,747,014, which is incorporated herein by reference.
129
Liposomal formulations
There are many organized surfactant structures besides microemulsions that hâve been studied and used for the formulation of drugs. These include monolayers, micelles, bilayers and vesicles. Vesicles, such as liposomes, hâve attracted great interest because of their specificity and the duration of action they offer from the standpoint of diug delivery. As used in the présent invention, the term liposome means a vesicle composed of amphiphilic lipids arranged in a spherical bilayer or bilayers.
Liposomes are unilamellar or multilamellar vesicles which hâve a membrane formed from a lipophilie material and an aqueous interior. The aqueous portion contains the composition to be delivered. Cationic liposomes possess the advantage of being able to fuse to the cell wall. Non-cationic liposomes, although not able to fuse as effïciently with the cell wall, are taken up by macrophages in vivo.
In order to traverse intact mammalian skin, lipid vesicles must pass through a sériés of fine pores, each with a diameter less than 50 nm, under the influence of a suitable transdermal gradient. Therefore, it is désirable to use a liposome which is highly déformable and able to pass through such fine pores.
Further advantages of liposomes include; liposomes obtained from natural phospholipids are biocompatible and biodégradable; liposomes can incorporate a wide range of water and lipid soluble drugs; liposomes can protect encapsulated drugs in their internai compartments from metabolism and dégradation (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245). Important considérations in the préparation of liposome formulations are the lipid surface charge, vesicle size and the aqueous volume of the liposomes.
Liposomes are useful for the transfer and delivery of active ingrédients to the site of action. Because the liposomal membrane is structurally similar to biological membranes, when liposomes are applied to a tissue, the liposomes start to merge with the cellular membranes and as the merging ofthe liposome and cell progresses, the liposomal contents are emptied into the cell where the active agent may act.
130
Liposomal formulations hâve been the focus of extensive investigation as the mode of delivery for many drugs. There is growing evidence that for topical administration, liposomes présent several advantages over other formulations. Such advantages include reduced sideeffects related to high systemic absorption of the administered drug, increased accumulation of the administered drug at the desired target, and the ability to administer a wide variety of drugs, both hydrophilic and hydrophobie, into the skin.
Several reports hâve detailed the ability of liposomes to deliver agents including highmolecular weight DNA into the skin. Compounds including analgésies, antibodies, hormones and high-molecular weight DNAs hâve been administered to the skin. The majority of applications resulted in the targeting of the upper epidermis
Liposomes fall into two broad classes. Cationic liposomes are positively charged liposomes which interact with the negatively charged DNA molécules to form a stable complex. The positively charged DNA/liposome complex binds to the negatively charged cell surface and is intemalized in an endosome. Due to the acidic pH within the endosome, the liposomes are ruptured, releasing their contents into the cell cytoplasm (Wang et al., Biochem. Biophys. Res. Commun., 1987, 147, 980-985).
Liposomes which are pH-sensitive or negatively-charged, entrap DNA rather than complex with it. Since both the DNA and the lipid are similarly charged, repulsion rather than complex formation occurs. Nevertheless, some DNA is entrapped within the aqueous interior of these liposomes. pH-sensitive liposomes hâve been used to deliver DNA encoding the thymidine kinase gene to cell monolayers in culture. Expression of the exogenous gene was detected in the target cells (Zhou et al., Journal of Controlled Release, 1992, 19, 269-274).
One major type of liposomal composition includes phospholipids other than naturallyderived phosphatidylcholine. Neutral liposome compositions, for example, can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC). Anionic liposome compositions generally are formed from dimyristoyl phosphatidylglycerol, while anionic fusogenic liposomes are formed primarily from dioleoyl phosphatidylethanolamine (DOPE). Another type of liposomal composition is formed from phosphatidylcholine (PC) such
131 as, for example, soybean PC, and egg PC. Another type is formed from mixtures of phospholipid and/or phosphatidylcholine and/or cholestérol.
Several studies hâve assessed the topical delivery of liposomal drug formulations to the skin. Application of liposomes containing interferon to guinea pig skin resulted in a réduction of skin herpes sores while delivery of interferon via other means (e.g., as a solution or as an émulsion) were ineffective (Weiner et al., Journal of Drug Targeting, 1992, 2, 405-410). Further, an additional study tested the efficacy of interferon administered as part of a liposomal formulation to the administration of interferon using an aqueous system, and concluded that the liposomal formulation was superior to aqueous administration (du Plessis et al., Antiviral Research, 1992, 18, 259-265).
Non-ionic liposomal Systems hâve also been examined to détermine their utility in the delivery of drugs to the skin, in particular Systems comprising non-ionic surfactant and cholestérol. Non-ionic liposomal formulations comprising Novasome™ I (glyceryl dilaurate/cholesterol/polyoxyethylene-10-stearyl ether) and Novasome™ II (glyceryl distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver cyclosporin-A into the dermis of mouse skin. Results indicated that such non-ionic liposomal Systems were effective in facilitating the déposition of cyclosporin-A into different layers of the skin (Hu et al. S.T.P.Pharma. Sci., 1994, 4, 6, 466).
Liposomes also include “sterically stabilized” liposomes, a term which, as used herein, refers to liposomes comprising one or more specialized lipids that, when incorporated into liposomes, resuit in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome (A) comprises one or more glycolipids, such as monosialoganglioside Gmi, or (B) is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. While not wishing to be bound by any particular theory, it is thought in the art that, at least for sterically stabilized liposomes containing gangliosides, sphingomyelin, or PEG-derivatized lipids, the enhanced circulation half-life of these sterically stabilized liposomes dérivés from a reduced uptake into cells ofthe réticuloendothélial system (RES) (Allen et al., FEBS Letters, 1987, 223, 42; Wu et al., Cancer Research, 1993, 53, 3765).
132
Various liposomes comprising one or more glycolipids are known in the art. Papahadjopoulos et al. (Ann. N.Y. Acad. Sci., 1987, 507, 64) reported the ability of monosialoganglioside GMi, galactocerebroside sulfate and phosphatidylinositol to improve blood half-lives of liposomes. These findings were expounded upon by Gabizon et al. (Proc. Natl. Acad. Sci. U.S.A., 1988, 85, 6949). U.S. Pat. No. 4,837,028 and WO 88/04924, both to Allen et al., disclose liposomes comprising (1) sphingomyelin and (2) the ganglioside Gmi or a galactocerebroside sulfate ester. U.S. Pat. No. 5,543,152 (Webb et al.) discloses liposomes comprising sphingomyelin. Liposomes comprising 1,2-sn-dimyristoylphosphatidylcholine are disclosed in WO 97/13499 (Lim et al).
Many liposomes comprising lipids derivatized with one or more hydrophilic polymers, and methods of préparation thereof, are known in the art. Sunamoto et al. (Bull. Chem. Soc. Jpn., 1980, 53, 2778) described liposomes comprising anonionic detergent, 2Ci2i5G> that contains a PEG moiety. Ilium et al. (FEBS Lett., 1984, 167, 79) noted that hydrophilic coating of polystyrène particles with polymeric glycols results in significantly enhanced blood half-lives. Synthetic phospholipids modified by the attachment of carboxylic groups of polyalkylene glycols (e.g., PEG) are described by Sears (U.S. Pat. Nos. 4,426,330 and 4,534,899). Klibanov et al. (FEBS Lett., 1990, 268, 235) described experiments demonstrating that liposomes comprising phosphatidylethanolamine (PE) derivatized with PEG or PEG stéarate hâve significant increases in blood circulation half-lives. Blume et al. (Biochimica et Biophysica Acta, 1990, 1029, 91) extended such observations to other PEG-derivatized phospholipids, e.g., DSPE-PEG, formed from the combination of distearoylphosphatidylethanolamine (DSPE) and PEG. Liposomes having covalently bound PEG moieties on their extemal surface are described in European Patent No. EP 0 445 131 B1 and WO 90/04384 to Fisher. Liposome compositions containing 120 mole percent of PE derivatized with PEG, and methods of use thereof, are described by Woodle et al. (U.S. Pat. Nos. 5,013,556 and 5,356,633) and Martin et al. (U.S. Pat. No. 5,213,804 and European Patent No. EP 0 496 813 Bl). Liposomes comprising a number of other lipid-polymer conjugates are disclosed in WO 91/05545 and U.S. Pat. No. 5,225,212 (both to Martin et al.) and in WO 94/20073 (Zalipsky et al.) Liposomes comprising PEG-modified ceramide lipids are described in WO 96/10391 (Choi et al). U.S. Pat. No. 5,540,935 (Miyazaki et
133 al.) and U.S. Pat. No. 5,556,948 (Tagawa et al.) describe PEG-containing liposomes that can be further derivatized with functional moieties on their surfaces.
A number of liposomes comprising nucleic acids are known in the art. WO 96/40062 to Thierry et al. discloses methods for encapsulating high molecular weight nucleic acids in liposomes. U.S. Pat. No. 5,264,221 to Tagawa et al. discloses protein-bonded liposomes and asserts that the contents of such liposomes may include a dsRNA. U.S. Pat. No. 5,665,710 to Rahman et al. describes certain methods of encapsulating oligodeoxynucleotides in liposomes. WO 97/04787 to Love et al. discloses liposomes comprising dsRNAs targeted to the raf gene.
Transfersomes are yet another type of liposomes, and are highly déformable lipid aggregates which are attractive candidates for drug delivery vehicles. Transfersomes may be described as lipid droplets which are so highly déformable that they are easily able to penetrate through pores which are smaller than the droplet. Transfersomes are adaptable to the environment in which they are used, e.g., they are self-optimizing (adaptive to the shape of pores in the skin), self-repairing, frequently reach their targets without fragmenting, and often selfloading. To make transfersomes it is possible to add surface edge-activators, usually surfactants, to a standard liposomal composition. Transfersomes hâve been used to deliver serom albumin to the skin. The transfersome-mediated delivery of sérum albumin has been shown to be as effective as subcutaneous injection of a solution containing sérum albumin.
Surfactants find wide application in formulations such as émulsions (including microemulsions) and liposomes. The most common way of classifying and ranking the properties of the many different types of surfactants, both natural and synthetic, is by the use of the hydrophile/lipophile balance (HLB). The nature of the hydrophilic group (also known as the head) provides the most useful means for categorizing the different surfactants used in formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).
If the surfactant molécule is not ionized, it is classifîed as a nonionic surfactant. Nonionic surfactants find wide application in pharmaceutical and cosmetic products and are usable over a wide range of pH values. In general their HLB values range from 2 to about 18 depending on their structure. Nonionic surfactants include nonionic esters such as ethylene glycol esters,
134 propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated/propoxylated block polymers are also included in this class. The polyoxyethylene surfactants are the most popular members of the nonionic surfactant class.
If the surfactant molécule carries a négative charge when it is dissolved or dispersed in water, the surfactant is classifîed as anionic. Anionic surfactants include carboxylates such as soaps, acyl lactylates, acyl amides of amino acids, esters of sulfuric acid such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates, acyl taurates and sulfosuccinates, and phosphates. The most important members of the anionic surfactant class are the alkyl sulfates and the soaps.
If the surfactant molécule carries a positive charge when it is dissolved or dispersed in water, the surfactant is classifîed as cationic. Cationic surfactants include quatemary ammonium salts and ethoxylated amines. The quatemary ammonium salts are the most used members of this class.
If the surfactant molécule has the ability to carry either a positive or négative charge, the surfactant is classifîed as amphoteric. Amphoteric surfactants include acrylic acid dérivatives, substituted alkylamides, N-alkylbetaines and phosphatides.
The use of surfactants in drug products, formulations and in émulsions has been reviewed (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).
Nucleic acid lipid particles
In one embodiment, an ALAS1 dsRNA featured in the invention is fully encapsulated in the lipid formulation, e.g., to form a SPLP, pSPLP, SNALP, or other nucleic acid-lipid particle. As used herein, the term “SNALP” refers to a stable nucleic acid-lipid particle, including SPLP. As used herein, the term “SPLP” refers to a nucleic acid-lipid particle comprising plasmid DNA encapsulated within a lipid vesicle. SNALPs and SPLPs typically contain a cationic lipid, a noncationic lipid, and a lipid that prevents aggregation of the particle (e.g., a PEG-lipid conjugate). SNALPs and SPLPs are extremely useful for systemic applications, as they exhibit extended
135 circulation lifetimes following intravenous (i.v.) injection and accumulate at distal sites (e.g., sites physically separated from the administration site). SPLPs include “pSPLP,” which include an encapsulated condensing agent-nucleic acid complex as set forth in PCT Publication No. WO 00/03683. The paiticles of the présent invention typically hâve a mean diameter of about 50 nm to about 150 nm, more typically about 60 nm to about 130 nm, more typically about 70 nm to about 110 nm, most typically about 70 nm to about 90 nm, and are substantially nontoxic. In addition, the nucleic acids when présent in the nucleic acid- lipid particles of the présent invention are résistant in aqueous solution to dégradation with a nuclease. Nucleic acidlipid particles and their method of préparation are disclosed in, e.g., U.S. Patent Nos. 5,976,567; 5,981,501; 6,534,484; 6,586,410; 6,815,432; and PCT Publication No. WO 96/40964.
In one embodiment, the lipid to drug ratio (mass/mass ratio) (e.g., lipid to dsRNA ratio) will be in the range of from about 1:1 to about 50:1, from about 1:1 to about 25:1, from about 3:1 to about 15:1, from about 4:1 to about 10:1, from about 5:1 to about 9:1, or about 6:1 to about 9:1.
The cationic lipid may be, for example, N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(I -(2,3dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP), N-(I -(2,3dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), N,N-dimethyl-2,3dioleyloxy)propylamine (DODMA), 1,2-DiLinoleyloxy-N,N-dimethylaminopropane (DLinDMA), l,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA), 1,2Dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP), 1,2-Dilinoleyoxy-3(dimethylamino)acetoxypropane (DLin-DAC), l,2-Dilinoleyoxy-3-morpholinopropane (DLinMA), l,2-Dilinoleoyl-3-dimethyIaminopropane (DLinDAP), l,2-Dilinoleylthio-3dimethylaminopropane (DLin-S-DMA), 1 -Linoleoyl-2-linoleyloxy-3 -dimethylaminopropane (DLin-2-DMAP), l,2-Dilinoleyloxy-3-trimethylaminopropane chloride sait (DLin-TMA.Cl), l,2-Dilinoleoyl-3-trimethylaminopropane chloride sait (DLin-TAP.Cl), l,2-Dilinoleyloxy-3-(Nmethylpiperazino)propane (DLin-MPZ), or 3-(N,N-Dilinoleylamino)-l,2-propanediol (DLinAP),
3-(N,N-Dioleylamino)-l,2-propanedio (DOAP), l,2-Dilinoleyloxo-3-(2-N,Ndimethylamino)ethoxypropane (DLin-EG-DMA), 1,2-Dilinolenyloxy-N,N17746
136 dimethylaminopropane (DLinDMA), 2,2-Dilinoleyl-4-dimethylaminomethyl-[ 1,3 ]-dioxolane (DLin-K-DMA) or analogs thereof, (3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12dienyl)tetrahydro-3 aH-cyclopenta[d] [ 1,3 ]dioxol-5-amine (ALN100), (6Z,9Z,28Z,31Z)heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate (MC3), 1,1’-(2-(4-(2-((2(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-lyl)ethylazanediyl)didodecan-2-ol (Tech Gl), or a mixture thereof. The cationic lipid may comprise from about 20 mol % to about 50 mol % or about 40 mol % of the total lipid présent in the particle.
In another embodiment, the compound 2,2-Dilinoleyl-4-dimethylaminoethyl-[l,3]dioxolane can be used to préparé lipid-siRNA nanoparticles. Synthesis of 2,2-Dilinoleyl-4dimethylaminoethyl-[l,3]-dioxolane is described in United States provisional patent application number 61/107,998 filed on October 23, 2008, which is herein incorporated by reference.
In one embodiment, the lipid-siRNA particle includes 40% 2, 2-Dilinoleyl-4dimethylaminoethyl-[l,3]-dioxolane: 10% DSPC: 40% Cholestérol: 10% PEG-C-DOMG (mole percent) with a particle size of 63.0 ± 20 nm and a 0.027 siRNA/Lipid Ratio.
The non-cationic lipid may be an anionic lipid or a neutral lipid including, but not limited to, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoyl- phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-l- carboxylate (DOPEmal), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1 -trans PE, 1 -stearoyl-2-oleoyl- phosphatidyethanolamine (SOPE), cholestérol, or a mixture thereof. The non-cationic lipid may be from about 5 mol % to about 90 mol %, about 10 mol %, or about 58 mol % if cholestérol is included, of the total lipid présent in the particle.
The conjugated lipid that inhibits aggregation of particles may be, for example, a polyethyleneglycol (PEG)-lipid including, without limitation, a PEG-diacylglycerol (DAG), a PEG-dialkyloxypropyl (DAA), a PEG-phospholipid, a PEG-ceramide (Cer), or a mixture thereof.
137
The PEG-DAA conjugate may be, for example, a PEG-dilauryloxypropyl (Ci2), a PEGdimyristyloxypropyl (C14), a PEG-dipalmityloxypropyl (Ciô), or a PEG- distearyloxypropyl (C]g). The conjugated lipid that prevents aggregation of particles may be from 0 mol % to about 20 mol % or about 2 mol % of the total lipid présent in the particle.
In some embodiments, the nucleic acid-lipid particle further includes cholestérol at, e.g., about 10 mol % to about 60 mol % or about 48 mol % ofthe total lipid présent in the particle.
In some embodiments, the iRNA is formulated in a lipid nanoparticle (LNP).
LNP01
In one embodiment, the lipidoid ND98-4HC1 (MW 1487) (see U.S. Patent Application No. 12/056,230, fïled 3/26/2008, which is herein incorporated by reference), Cholestérol (SigmaAldrich), and PEG-Ceramide Cl6 (Avanti Polar Lipids) can be used to préparé lipid-dsRNA nanoparticles (e.g., LNP01 particles). Stock solutions of each in éthanol can be prepared as follows: ND98, 133 mg/ml; Cholestérol, 25 mg/ml, PEG-Ceramide C16, 100 mg/ml. TheND98, Cholestérol, and PEG-Ceramide C16 stock solutions can then be combined in a, e.g., 42:48:10 molar ratio. The combined lipid solution can be mixed with aqueous dsRNA (e.g., in sodium acetate pH 5) such that the final éthanol concentration is about 35-45% and the final sodium acetate concentration is about 100-300 mM. Lipid-dsRNA nanoparticles typically form spontaneously upon mixing. Depending on the desired particle size distribution, the résultant nanoparticle mixture can be extruded through a polycarbonate membrane (e.g., 100 nm cut-off) using, for example, a thermobarrel extrader, such as Lipex Extrader (Northem Lipids, Inc). In some cases, the extrusion step can be omitted. Ethanol removal and simultaneous buffer exchange can be accomplished by, for example, dialysis or tangential flow filtration. Buffer can be exchanged with, for example, phosphate buffered saline (PBS) at about pH 7, e.g., about pH 6.9, about pH 7.0, about pH 7.1, about pH 7.2, about pH 7.3, or about pH 7.4.
138
Formula 1
LNP01 formulations are described, e.g., in International Application Publication
No. WO 2008/042973, which is hereby incorporated by reference.
Additional exemplary lipid-dsRNA formulations are provided in the following table.
Table 10: Exemplary lipid formulations
Cationic Lipid cationic lipid/non-cationic lipid/ choies terol/PEG-lipid conj ugate Lipid:siRNA ratio
SNALP 1,2-Dilinolenyloxy-N,Ndimethylaminopropane (DLinDMA) DLinDMA/DPPC/ChoIesterol/PEGcDMA (57.1/7.1/34.4/1.4) lipid:siRNA~7:l
S-XTC 2,2-Dilinoleyl-4-dimethylaminoethyl- [l,3]-dioxolane (XTC) XTC/DPPC/Cholesterol/PEG-cDMA 57.1/7.1/34.4/1.4 lipid:siRNA~ 7:1
LNP05 2,2-Dilmoleyl-4-dimethylaminoethyl- [l,3]-dioxolane (XTC) XTC/DSPC/Cholesterol/PEG-DMG 57.5/7.5/31.5/3.5 lipid:siRNA~ 6:1
LNP06 2,2-Dilinoleyl-4-dimethylaminoethyl- [l,3]-dioxolane (XTC) XTC/DSPC/Cholesterol/PEG-DMG 57.5/7.5/31.5/3.5 lipid:siRNA~ 11:1
LNP07 2,2-Dilinoleyl-4-dimethylaminoethyl- [l,3]-dioxolane (XTC) XTC/DSPC/Cholesterol/PEG-DMG 60/7.5/31/1.5,
139
lipid:siRNA~ 6:1
LNP08 2,2-Dilinoleyl-4-dimethylaminoethyl- [l,3]-dioxolane (XTC) XTC/DSPC/Cholesterol/PEG-DMG 60/7.5/31/1.5, lipid:siRNA~ 11:1
LNP09 2,2-Dilinoleyl-4-dimethylaminoethyl- [l,3]-dioxolane (XTC) XTC/DSPC/Cholesterol/PEG-DMG 50/10/38.5/1.5 Lipid:siRNA 10:1
LNP10 (3aR,5s,6aS)-N,N-dimethyl-2,2di((9Z, 12Z)-octadeca-9,12dienyl)tetrahydro-3 aHcyclopenta[d] [ 1,3] dioxol-5-amine (ALN100) ALN100/DSPC/Cholesterol/PEG-DMG 50/10/38.5/1.5 Lipid:siRNA 10:1
LNP11 (6Z,9Z,28Z,3 lZ)-heptatriaconta- 6,9,28,31-tetraen-19-yl 4- (dimethylamino)butanoate (MC3) MC-3/DSPC/Cholesterol/PEG-DMG 50/10/38.5/1.5 Lipid:siRNA 10:1
LNP12 l,l'-(2-(4-(2-((2-(bis(2- hydroxydodecyl)amino)ethyl)(2hydroxydodecyl)amino)ethyl)piperazinl-yl)ethylazanediyl)didodecan-2-ol (Cl 2-200) Cl 2-200/DSPC/Cholesterol/PEG-DMG 50/10/38.5/1.5 Lipid:siRNA 10:1
LNP13 XTC XTC/DSPC/Chol/PEG-DMG 50/10/38.5/1.5 Lipid:siRNA: 33:1
LNP14 MC3 MC3/DSPC/Chol/PEG-DMG 40/15/40/5 Lipid:siRNA: 11:1
LNP15 MC3 MC3/DSPC/Chol/PEG-DSG/GalNAc- PEG-DSG 50/10/35/4.5/0.5 Lipid:siRNA: 11:1
140
LNP16 MC3 MC3/DSPC/Chol/PEG-DMG 50/10/38.5/1.5 Lipid:siRNA: 7:1
LNP17 MC3 MC3/DSPC/Chol/PEG-DSG 50/10/38.5/1.5 Lipid:siRNA: 10:1
LNP18 MC3 MC3/DSPC/Chol/PEG-DMG 50/10/38.5/1.5 Lipid:siRNA: 12:1
LNP19 MC3 MC3/DSPC/Chol/PEG-DMG 50/10/35/5 Lipid:siRNA: 8:1
LNP20 MC3 MC3/DSPC/Chol/PEG-DPG 50/10/38.5/1.5 Lipid:siRNA: 10:1
LNP21 C12-200 C12-200/DSPC/Chol/PEG-DSG 50/10/38.5/1.5 Lipid:siRNA: 7:1
LNP22 XTC XTC/DSPC/Chol/PEG-DSG 50/10/38.5/1.5 Lipid:siRNA: 10:1
DSPC: distearoylphosphatidylcholine
DPPC : dipalmitoylphosphatidylcholine
PEG-DMG: PEG-didimyristoyl glycerol (C14-PEG, or PEG-C14) (PEG with avg mol wt of 5 2000)
PEG-DSG: PEG-distyryl glycerol (C 18-PEG, or PEG-C18) (PEG with avg mol wt of 2000)
PEG-cDMA: PEG-carbamoyl-l,2-dimyristyloxypropylamine (PEG with avg mol wt of 2000)
141
SNALP (l,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLinDMA)) comprising formulations are described in International Publication No. W02009/127060, fïled April 15,
2009, which is hereby incorporated by reference.
XTC comprising formulations are described, e.g., in U.S. Provisional Serial No. 61/148,366, fïled January 29, 2009; U.S. Provisional Serial No. 61/156,851, fïled March 2, 2009; U.S. Provisional Serial No. fïled June 10, 2009; U.S. Provisional Serial No. 61/228,373, fïled July 24, 2009; U.S. Provisional Serial No. 61/239,686, fïled September 3, 2009, and International Application No. PCT/US2010/022614, fïled January 29, 2010, which are hereby incorporated by reference.
MC3 comprising formulations are described, e.g., in U.S. Provisional Serial No. 61/244,834, fïled September 22, 2009, U.S. Provisional Serial No. 61/185,800, fïled June 10,
2009, and International Application No. PCT/US 10/28224, fïled June 10, 2010, which are hereby incorporated by reference.
ALNY-100 comprising foimulations are described, e.g., International patent application number PCT/US09/63933, fïled on November 10, 2009, which is hereby incorporated by reference.
C12-200 comprising formulations are described in U.S. Provisional Serial No. 61/175,770, fïled May 5, 2009 and International Application No. PCT/US 10/33777, fïled May 5,
2010, which are hereby incorporated by reference.
Synthesis of cationic lipids
Any of the compounds, e.g., cationic lipids and the like, used in the nucleic acid-lipid particles featured in the invention may be prepared by known organic synthesis techniques, including the methods described in more detail in the Examples. Ail substituents are as defined below unless indicated otherwise.
“Alkyl” means a straight chain or branched, noncyclic or cyclic, saturated aliphatic hydrocarbon containing from 1 to 24 carbon atoms. Représentative saturated straight chain alkyls include methyl, ethyl, n-propyl, n-butyl, n-pentyl, n-hexyl, and the like; while saturated branched alkyls include isopropyl, sec-butyl, isobutyl, tert-butyl, isopentyl, and the like.
142
Représentative saturated cyclic alkyls include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and the like; while unsaturated cyclic alkyls include cyclopentenyl and cyclohexenyl, and the like.
“Alkenyl” means an alkyl, as defined above, containing at least one double bond between adjacent carbon atoms. Alkenyls include both cis and trans isomers. Représentative straight chain and branched alkenyls include ethylenyl, propylenyl, 1-butenyl, 2-butenyl, isobutylenyl, 1pentenyl, 2-pentenyl, 3-methyl-1-butenyl, 2-methyl-2-butenyl, 2,3-dimethyl-2-butenyl, and the like.
“Alkynyl” means any alkyl or alkenyl, as defined above, which additionally contains at least one triple bond between adjacent carbons. Représentative straight chain and branched alkynyls include acetylenyl, propynyl, 1-butynyl, 2-butynyl, 1-pentynyl, 2-pentynyl, 3-methyl-1 butynyl, and the like.
“Acyl” means any alkyl, alkenyl, or alkynyl wherein the carbon at the point of attachaient is substituted with an oxo group, as defined below. For example, -C(=O)alkyl, -C(=O)alkenyl, and -C(=O)alkynyl are acyl groups.
“Heterocycle” means a 5- to 7-membered monocyclic, or 7- to 10-membered bicyclic, heterocyclic ring which is either saturated, unsaturated, or aromatic, and which contains from 1 or 2 heteroatoms independently selected from nitrogen, oxygen and sulfur, and wherein the nitrogen and sulfur heteroatoms may be optionally oxidized, and the nitrogen heteroatom may be optionally quatemized, including bicyclic rings in which any of the above heterocycles are fused to a benzene ring. The heterocycle may be attached via any heteroatom or carbon atom. Heterocycles include heteroaryls as defined below. Heterocycles include morpholinyl, pyrrolidinonyl, pyrrolidinyl, piperidinyl, piperizynyl, hydantoinyl, valerolactamyl, oxiranyl, oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, tetrahydropyridinyl, tetrahydroprimidinyl, tetrahydrothiophenyl, tetrahydrothiopyranyl, tetrahydropyrimidinyl, tetrahydrothiophenyl, tetrahydrothiopyranyl, and the like.
The terms “optionally substituted alkyl”, “optionally substituted alkenyl”, “optionally substituted alkynyl”, “optionally substituted acyl”, and “optionally substituted heterocycle” means that, when substituted, at least one hydrogen atom is replaced with a substituent. In the
143 case of an oxo substituent (=0) two hydrogen atoms are replaced. In this regard, substituents include oxo, halogen, heterocycle, -CN, -ORX, -NRxRy, -NRxC(=O)Ryt -NRxSO2Ry, -C(=O)RX, -C(=O)ORX, -C(=O)NRxRy, -SOnRx and -SOnNRxRy, wherein n is 0, 1 or 2, Rx and Ry are the same or different and independently hydrogen, alkyl or heterocycle, and each of said alkyl and heterocycle substituents may be further substituted with one or more of oxo, halogen, -OH, -CN, alkyl, -ORX, heterocycle, -NRxRy, -NRxC(=O)Ry, -NRxSO2Ry, -C(=O)RX, -C(=O)ORX, -C(=O)NRxRy, -SOnRx and -SOnNRxRy.
“Halogen” means fluoro, chloro, bromo and iodo.
In some embodiments, the methods featured in the invention may require the use of protecting groups. Protecting group methodology is well known to those skilled in the art (see, for example, PROTECTIVE GROUPS IN ORGANIC SYNTHESIS, Green, T.W. et al., WileyInterscience, New York City, 1999). Briefly, protecting groups within the context of this invention are any group that reduces or éliminâtes unwanted reactivity of a functional group. A protecting group can be added to a functional group to mask its reactivity during certain reactions and then removed to reveal the original functional group. In some embodiments an “alcohol protecting group” is used. An “alcohol protecting group” is any group which decreases or éliminâtes unwanted reactivity of an alcohol functional group. Protecting groups can be added and removed using techniques well known in the art.
Synthesis of Formula A
In one embodiments, nucleic acid-lipid particles featured in the invention are formulated using a cationic lipid of formula A:
r3 \
where RI and R2 are independently alkyl, alkenyl or alkynyl, each can be optionally substituted,
144 and R3 and R4 are independently lower alkyl or R3 and R4 can be taken together to form an optionally substituted heterocyclic ring. In some embodiments, the cationic lipid is XTC (2,2Dilinoleyl-4-dimethylaminoethyl-[l,3]-dioxolane). In general, the lipid of formula A above may be made by the following Reaction Schemes 1 or 2, wherein ail substituents are as defined above unless indicated otherwise.
Scheme 1
Lipid A, where Ri and R2 are independently alkyl, alkenyl or alkynyl, each can be optionally substituted, and R3 and R4 are independently lower alkyl or R3 and R4 can be taken together to form an optionally substituted heterocyclic ring, can be prepared according to Scheme 1. Ketone 1 and bromide 2 can be purchased or prepared according to methods known to those of ordinary skill in the art. Reaction of 1 and 2 yields ketal 3. Treatment of ketal 3 with amine 4 yields lipids of formula A. The lipids of formula A can be converted to the corresponding ammonium sait with an organic sait of formula 5, where X is anion cormier ion selected from halogen, hydroxide, phosphate, sulfate, or the like.
145
Scheme 2
BrMg—Rd + R2-CN
H+ .R2
O=< 2
Altematively, the ketone 1 starting material can be prepared according to Scheme 2. Grignard reagent 6 and cyanide 7 can be purchased or prepared according to methods known to those of ordinary skill in the art. Reaction of 6 and 7 yields ketone 1. Conversion of ketone 1 to the corresponding lipids of formula A is as described in Scheme 1.
Synthesis of MC3
Préparation of DLin-M-C3-DMA (i.e., (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31tetraen-19-yl 4-(dimethylamino)butanoate) was as follows. A solution of (6Z,9Z,28Z,31Z)heptatriaconta-6,9,28,31-tetraen-19-ol (0.53 g), 4-N,N-dimethylaminobutyric acid hydrochloride (0.51 g), 4-N,N-dimethylaminopyridine (0.61g) and l-ethyl-3-(3dimethylaminopropyl)carbodiimide hydrochloride (0.53 g) in dichloromethane (5 mL) was stirred at room température ovemight. The solution was washed with dilute hydrochloric acid followed by dilute aqueous sodium bicarbonate. The organic fractions were dried over anhydrous magnésium sulphate, filtered and the solvent removed on a rotovap. The residue was passed down a silica gel column (20 g) using a 1-5% methanol/dichloromethane elution gradient. Fractions containing the purified product were combined and the solvent removed, yielding a colorless oil (0.54 g).
146
Synthesis of ALNY-100
Synthesis of ketal 519 [ALNY-100] was performed using the following scheme 3:
NHBoc ά514
LAH
NHMe
Cbz-OSu, NEt3
515
NCbzMe
NMO, OsO4
516 sNCbzMe +
OH
517A
PTSA
O:
Me2N··
LAH, 1MTHF
519
MeCbzN···
O.
518
Synthesis of 515:
To a stirred suspension of LÎA1H4 (3.74 g, 0.09852 mol) in 200 ml anhydrous THF in a two neck RBF (IL), was added a solution of 514 (10g, 0.04926mol) in 70 mL of THF slowly at 0 0C under nitrogen atmosphère. After complété addition, reaction mixture was warmed to room température and then heated to reflux for 4 h. Progress of the reaction was monitored by TLC. After completion of reaction (by TLC) the mixture was cooled to 0 0C and quenched with careful addition of saturated Na2SO4 solution. Reaction mixture was stirred for 4 h at room température and filtered off. Residue was washed well with THF. The fïltrate and washings were mixed and diluted with 400 mL dioxane and 26 mL conc. HCl and stirred for 20 minutes at room température. The volatilities were stripped off under vacuum to fumish the hydrochloride sait of 515 as a white solid. Yield: 7.12 g 1H-NMR (DMSO, 400MHz): δ= 9.34 (broad, 2H), 5.68 (s, 2H), 3.74 (m, 1H), 2.66-2.60 (m, 2H), 2.50-2.45 (m, 5H).
Synthesis of 516:
To a stirred solution of compound 515 in 100 mL dry DCM in a 250 mL two neck RBF, was added NEt3 (37.2 mL, 0.2669 mol) and cooled to 0 0C under nitrogen atmosphère. After a slow addition of N-(benzyloxy-carbonyloxy)-succinimide (20 g, 0.08007 mol) in 50 mL dry DCM, reaction mixture was allowed to warm to room température. After completion of the
147 reaction (2-3 h by TLC) mixture was washed successively with IN HCl solution (1 x 100 mT,) and saturated NaHCO3 solution (1 x 50 mL). The organic layer was then dried over anhyd. Na2SO4 and the solvent was evaporated to give crade material which was purified by silica gel column chromatography to get 516 as sticky mass. Yield: 1 lg (89%). 1H-NMR (CDC13, 400MHz): δ = 7.36-7.27(m, 5H), 5.69 (s, 2H), 5.12 (s, 2H), 4.96 (br., 1H) 2.74 (s, 3H), 2.60(m, 2H), 2.30-2.25(m, 2H). LC-MS [M+H] -232.3 (96.94%).
Synthesis of 517A and 517B:
The cyclopentene 516 (5 g, 0.02164 mol) was dissolved in a solution of 220 mL acetone and water (10:1) in a single neck 500 mL RBF and to it was added N-methyl moipholine-Noxide (7.6 g, 0.06492 mol) followed by 4.2 mL of 7.6% solution of OsO4 (0.275 g, 0.00108 mol) in tert-butanol at room température. After completion of the reaction (~ 3 h), the mixture was quenched with addition of solid Na2SO3 and resulting mixture was stirred for 1.5 h at room température. Reaction mixture was diluted with DCM (300 mL) and washed with water (2 x 100 mL) followed by saturated NaHCO3 (1 x 50 mL) solution, water (1x30 mL) and finally with brine (lx 50 mL). Organic phase was dried over an.Na2SO4 and solvent was removed in vacuum. Silica gel column chromatographie purification of the crade material was afforded a mixture of diastereomers, which were separated by prep HPLC. Yield: - 6 g crade
517A - Peak-1 (white solid), 5.13 g (96%). 1H-NMR (DMSO, 400MHz): δ= 7.397.31(m, 5H), 5.04(s, 2H), 4.78-4.73 (m, 1H), 4.48-4.47(d, 2H), 3.94-3.93(m, 2H), 2.71(s, 3H), 1.72- 1.67(m, 4H). LC-MS - [M+HJ-266.3, [M+NH4 +J-283.5 présent, HPLC-97.86%. Stereochemistry confirmed by X-ray.
Synthesis of 518:
Using a procedure analogous to that described for the synthesis of compound 505, compound 518 (1.2 g, 41%) was obtained as a colorless oil. 1H-NMR (CDC13, 400MHz): δ= 7.35-7.33(m, 4H), 7.30-7.27(m, 1H), 5.37-5.27(m, 8H), 5.12(s, 2H), 4.75(m,lH), 4.584.57(m,2H), 2.78-2.74(m,7H), 2.06-2.00(m,8H), 1.96-1.91(m, 2H), 1.62(m, 4H), 1.48(m, 2H), 1.37-1.25(br m, 36H), 0.87(m, 6H). HPLC-98.65%.
148
General Procedure for the Synthesis of Compound 519:
A solution of compound 518 (1 eq) in hexane (15 mL) was added in a drop-wise fashion to an ice-cold solution of LAH in THF (1 M, 2 eq). After complété addition, the mixture was heated at 40°C over 0.5 h then cooled again on an ice bath. The mixture was carefiilly hydrolyzed with saturated aqueous Na2SO4 then filtered through celite and reduced to an oil. Column chromatography provided the pure 519 (1.3 g, 68%) which was obtained as a colorless oil. 13CNMR = 130.2, 130.1 (x2), 127.9 (x3), 112.3, 79.3, 64.4, 44.7, 38.3, 35.4, 31.5, 29.9 (x2), 29.7, 29.6 (x2), 29.5 (x3), 29.3 (x2), 27.2 (x3), 25.6, 24.5, 23.3, 226, 14.1; Electrospray MS (+ve): Molecular weight for C44H80NO2 (M + H)+ Cale. 654.6, Found 654.6.
Formulations prepared by either the standard or extrusion-free method can be characterized in similar manners. For example, formulations are typically characterized by visual inspection. They should be whitish translucent solutions free from aggregates or sédiment. Particle size and particle size distribution of lipid-nanoparticles can be measured by light scattering using, for example, a Malvem Zetasizer Nano ZS (Malvem, USA). Particles should be about 20-300 nm, such as 40-100 nm in size. The particle size distribution should be unimodal. The total dsRNA concentration in the formulation, as well as the entrapped fraction, is estimated using a dye exclusion assay. A sample of the formulated dsRNA can be incubated with an RNA-binding dye, such as Ribogreen (Molecular Probes) in the presence or absence of a formulation disrupting surfactant, e.g., 0.5% Triton-X100. The total dsRNA in the formulation can be determined by the signal from the sample containing the surfactant, relative to a standard curve. The entrapped fraction is determined by subtracting the “free” dsRNA content (as measured by the signal in the absence of surfactant) from the total dsRNA content. Percent entrapped dsRNA is typically >85%. For SNALP formulation, the particle size is at least 30 nm, at least 40 nm, at least 50 nm, at least 60 nm, at least 70 nm, at least 80 nm, at least 90 nm, at least 100 nm, at least 110 nm, and at least 120 nm. The suitable range is typically about at least 50 nm to about at least 110 nm, about at least 60 nm to about at least 100 nm, or about at least 80 nm to about at least 90 nm.
149
Compositions and formulations for oral administration include powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be désirable. In some embodiments, oral formulations are those in which dsRNAs featured in the invention are administered in conjunction with one or more pénétration enhancers surfactants and chelators. Suitable surfactants include fatty acids and/or esters or salts thereof, bile acids and/or salts thereof. Suitable bile acids/salts include chenodeoxycholic acid (CDCA) and ursodeoxychenodeoxycholic acid (UDCA), cholic acid, dehydrocholic acid, deoxycholic acid, glucholic acid, glycholic acid, glycodeoxycholic acid, taurocholic acid, taurodeoxycholic acid, sodium tauro-24,25-dihydro-fusidate and sodium glycodihydrofusidate. Suitable fatty acids include arachidonic acid, undecanoic acid, oleic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, l-dodecylazacycloheptan-2-one, an acylcamitine, an acylcholine, or a monoglyceride, a diglyceride or a pharmaceutically acceptable sait thereof (e.g., sodium). In some embodiments, combinations of pénétration enhancers are used, for example, fatty acids/salts in combination with bile acids/salts. One exemplary combination is the sodium sait of lauric acid, capric acid and UDCA. Further pénétration enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether. DsRNAs featured in the invention may be delivered orally, in granular form including sprayed dried particles, or complexed to form micro or nanoparticles. DsRNA complexing agents include poly-amino acids; polyimines; polyacrylates; polyalkylacrylates, polyoxethanes, polyalkylcyanoacrylates; cationized gelatins, albumins, starches, acrylates, polyethyleneglycols (PEG) and starches; polyalkylcyanoacrylates; DEAE-derivatized polyimines, pollulans, celluloses and starches. Suitable complexing agents include chitosan, N-trimethylchitosan, poly-L-lysine, polyhistidine, polyomithine, polyspermines, protamine, polyvinylpyridine, polythiodiethylaminomethylethylene P(TDAE), polyaminostyrene (e.g., p-amino), poly(methylcyanoacrylate), poly(ethylcyanoacrylate), poly(butylcyanoacrylate), poly(isobutylcyanoacrylate), poly(isohexylcynaoacrylate), DEAE-methacrylate, DEAE17746
150 hexylacrylate, DEAE-acrylamide, DEAE-albumin and DEAE-dextran, polymethylacrylate, polyhexylacrylate, poly(D,L-lactic acid), poly(DL-lactic-co-glycolic acid (PLGA), alginate, and polyethyleneglycol (PEG). Oral formulations for dsRNAs and their préparation are described in detail in U.S. Patent 6,887,906, US Publn. No. 20030027780, and U.S. Patent No. 6,747,014, each of which is incorporated herein by reference.
Compositions and formulations for parentéral, intraparenchymal (into the brain), intrathecal, intraventricular or intrahepatic administration may include stérile aqueous solutions which may also contain buffers, diluents and other suitable additives such as, but not limited to, pénétration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.
Pharmaceutical compositions of the présent invention include, but are not limited to, solutions, émulsions, and liposome-containing formulations. These compositions may be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids and self-emulsifying semisolids.
The pharmaceutical formulations featured in the présent invention, which may conveniently be presented in unit dosage form, may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingrédients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingrédients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.
The compositions featured in the présent invention may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions may also be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions may further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers.
151
Additional Formulations
Emulsions
The compositions of the présent invention may be prepared and formulated as émulsions. Emulsions are typically heterogeneous Systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 pm in diameter (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., Volume 1, p. 245; Block in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 2, p. 335; Higuchi et al., in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 301). Emulsions are often biphasic Systems comprising two immiscible liquid phases intimately mixed and dispersed with each other. In general, émulsions may be of either the water-in-oil (w/o) or the oil-in-water (o/w) variety. When an aqueous phase is fïnely divided into and dispersed as minute droplets into a bulk oily phase, the resulting composition is called a water-in-oil (w/o) émulsion. Alternatively, when an oily phase is fïnely divided into and dispersed as minute droplets into a bulk aqueous phase, the resulting composition is called an oilin-water (o/w) émulsion. Emulsions may contain additional components in addition to the dispersed phases, and the active drug which may be présent as a solution in either the aqueous phase, oily phase or itself as a separate phase. Pharmaceutical excipients such as emulsifiers, stabilizers, dyes, and anti-oxidants may also be présent in émulsions as needed. Pharmaceutical émulsions may also be multiple émulsions that are comprised of more than two phases such as, for example, in the case of oil-in-water-in-oil (o/w/o) and water-in-oil-in-water (w/o/w) émulsions. Such complex formulations often provide certain advantages that simple binary émulsions do not. Multiple émulsions in which individual oil droplets of an o/w émulsion enclose small water droplets constitute a w/o/w émulsion. Likewise a system of oil droplets enclosed in globules of water stabilized in an oily continuous phase provides an o/w/o émulsion.
152
Emulsions are characterized by little or no thermodynamic stability. Often, the dispersed or discontinuous phase of the émulsion is well dispersed into the external or continuous phase and maintained in this form through the means of emulsifiers or the viscosity of the formulation. Either of the phases of the émulsion may be a semisolid or a solid, as is the case of emulsionstyle ointment bases and creams. Other means of stabilizing émulsions entail the use of emulsifiers that may be incorporated into either phase of the émulsion. Emulsifiers may broadly be classified into four categories: synthetic surfactants, naturally occurring emulsifiers, absorption bases, and finely dispersed solids (see e.g., Ansel's Pharmaceutical Dosage Forrns and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Idson, in Pharmaceutical Dosage Forrns, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).
Synthetic surfactants, also known as surface active agents, hâve found wide applicability in the formulation of émulsions and hâve been reviewed in the literature (see e.g., Ansel's Pharmaceutical Dosage Forrns and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY ; Rieger, in Pharmaceutical Dosage Forrns, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285; Idson, in Pharmaceutical Dosage Forrns, Lieberman, Rieger and Banker (Eds.), Marcel Dekker, Inc., New York, N.Y., 1988, volume 1, p. 199). Surfactants are typically amphiphilic and comprise a hydrophilic and a hydrophobie portion. The ratio of the hydrophilic to the hydrophobie nature of the surfactant has been termed the hydrophile/lipophile balance (HLB) and is a valuable tool in categorizing and selecting surfactants in the préparation of formulations. Surfactants may be classified into different classes based on the nature of the hydrophilic group: nonionic, anionic, cationic and amphoteric (see e.g., Ansel's Pharmaceutical Dosage Forrns and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY Rieger, in Pharmaceutical Dosage Forrns, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285).
Naturally occurring emulsifiers used in émulsion formulations include lanolin, beeswax, phosphatides, lecithin and acacia. Absorption bases possess hydrophilic properties such that they
153 can soak up water to form w/o émulsions yet retain their semisolid consistencies, such as anhydrous lanolin and hydrophilic petrolatum. Finely divided solids hâve also been used as good emulsifîers especially in combination with surfactants and in viscous préparations. These include polar inorganic solids, such as heavy métal hydroxides, nonswelling clays such as bentonite, attapulgite, hectorite, kaolin, montmorillonite, colloïdal aluminum silicate and colloïdal magnésium aluminum silicate, pigments and nonpolar solids such as carbon or glyceryl tristearate.
A large variety of non-emulsifying materials are also included in émulsion formulations and contribute to the properties of émulsions. These include fats, oils, waxes, fatty acids, fatty alcohols, fatty esters, humectants, hydrophilic colloids, preservatives and antioxidants (Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).
Hydrophilic colloids or hydrocolloids include naturally occurring gums and synthetic polymers such as polysaccharides (for example, acacia, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth), cellulose dérivatives (for example, carboxymethylcellulose and carboxypropylcellulose), and synthetic polymers (for example, carbomers, cellulose ethers, and carboxyvinyl polymers). These disperse or swell in water to form colloïdal solutions that stabilize émulsions by forming strong interfacial films around the dispersed-phase droplets and by increasing the viscosity of the external phase.
Since émulsions often contain a number of ingrédients such as carbohydrates, proteins, sterols and phosphatides that may readily support the growth of microbes, these formulations often incorporate preservatives. Commonly used preservatives included in émulsion formulations include methyl paraben, propyl paraben, quatemary ammonium salts, benzalkonium chloride, esters of p-hydroxybenzoic acid, and boric acid. Antioxidants are also commonly added to émulsion formulations to prevent détérioration of the formulation. Antioxidants used may be free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulfite, and antioxidant synergists such as citric acid, tartaric acid, and lecithin.
154
The application of émulsion formulations via dermatological, oral and parentéral routes and methods for their manufacture hâve been reviewed in the literature (see e.g., Ansel's Pharmaceutical Dosage Foims and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). Emulsion formulations for oral delivery hâve been very widely used because of ease of formulation, as well as efficacy from an absorption and bioavailability standpoint (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245; Idson, in Pharmaceutical Dosage Foims, Liebeiman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). Mineral-oil base laxatives, oil-soluble vitamins and high fat nutritive préparations are among the materials that hâve commonly been administered orally as o/w émulsions.
In one embodiment of the présent invention, the compositions of iRNAs and nucleic acids are formulated as microemulsions. A microemulsion may be defined as a system of water, oil and amphiphile which is a single optically isotropie and thermodynamically stable liquid solution (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245). Typically microemulsions are Systems that are prepared by first dispersing an oil in an aqueous surfactant solution and then adding a sufficient amount of a fourth component, generally an intermediate chain-length alcohol to form a transparent system. Therefore, microemulsions hâve also been described as thermodynamically stable, isotropically clear dispersions of two immiscible liquids that are stabilized by interfacial films of surface-active molécules (Leung and Shah, in: Controlled Release of Drugs: Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH Publishers, New York, pages 185-215). Microemulsions commonly are prepared via a combination of three to five components that
155 include oil, water, surfactant, cosurfactant and electrolyte. Whether the microemulsion is of the water-in-oil (w/o) or an oil-in-water (o/w) type is dépendent on the properties of the oil and surfactant used and on the structure and géométrie packing of the polar heads and hydrocarbon tails of the surfactant molécules (Schott, in Remington's Pharmaceutical Sciences, Mack
Publishing Co., Easton, Pa., 1985, p. 271).
The phenomenological approach utilizing phase diagrams has been extensively studied and has yielded a comprehensive knowledge, to one skilled in the art, of how to formulate microemulsions (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245; Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335). Compared to conventional émulsions, microemulsions offer the advantage of solubilizing water-insoluble drugs in a formulation of thermodynamically stable droplets that are formed spontaneously.
Surfactants used in the préparation of microemulsions include, but are not limited to, ionic surfactants, non-ionic surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol monooleate (MO310), hexaglycerol monooleate (PO310), hexaglycerol pentaoleate (PO500), decaglycerol monocaprate (MCA750), decaglycerol monooleate (MO750), decaglycerol sequioleate (SO750), decaglycerol decaoleate (DAO750), alone or in combination with cosurfactants. The cosurfactant, usually a short-chain alcohol such as éthanol, 1-propanol, and 1-butanol, serves to increase the interfacial fluidity by penetrating into the surfactant film and consequently creating a disordered film because of the void space generated among surfactant molécules. Microemulsions may, however, be prepared without the use of cosurfactants and alcohol-free self-emulsifying microemulsion Systems are known in the art. The aqueous phase may typically be, but is not limited to, water, an aqueous solution ofthe drug, glycérol, PEG300, PEG400, polyglycerols, propylene glycols, and dérivatives of ethylene glycol. The oil phase may include, but is not limited to, materials such as Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium chain (C8-C12) mono, di, and
156 tri-glycerides, polyoxyethylated glyceryl fatty acid esters, fatty alcohols, polyglycolized glycerides, saturated polyglycolized C8-C10 glycerides, vegetable oils and silicone oil.
Microemulsions are particularly of interest from the standpoint of drug solubilization and the enhanced absorption of drugs. Lipid based microemulsions (both o/w and w/o) hâve been proposed to enhance the oral bioavailability of drugs, including peptides (see e.g., U.S. Patent Nos. 6,191,105; 7,063,860; 7,070,802; 7,157,099; Constantinides et al., Pharmaceutical Research, 1994, 11, 1385-1390; Ritschel, Meth. Find. Exp. Clin. Pharmacol., 1993, 13, 205). Microemulsions afford advantages of improved drug solubilization, protection of drug from enzymatic hydrolysis, possible enhancement of drug absolution due to surfactant-induced alterations in membrane fluidity and permeability, ease of préparation, ease of oral administration over solid dosage forms, improved clinical potency, and decreased toxicity (see e.g., U.S. Patent Nos. 6,191,105; 7,063,860; 7,070,802; 7,157,099; Constantinides et al., Pharmaceutical Research, 1994, 11, 1385; Ho et al., J. Pharm. Soi., 1996, 85, 138-143). Often microemulsions may form spontaneously when their components are brought together at ambient température. This may be particularly advantageous when formulating thermolabile drugs, peptides or iRNAs. Microemulsions hâve also been effective in the transdermal delivery of active components in both cosmetic and pharmaceutical applications. It is expected that the microemulsion compositions and formulations of the présent invention will facilitate the increased systemic absorption of iRNAs and nucleic acids from the gastrointestinal tract, as well as improve the local cellular uptake of iRNAs and nucleic acids.
Microemulsions of the présent invention may also contain additional components and additives such as sorbitan monostearate (Grill 3), Labrasol, and pénétration enhancers to improve the properties of the formulation and to enhance the absorption of the iRNAs and nucleic acids of the présent invention. Pénétration enhancers used in the microemulsions of the présent invention may be classified as belonging to one of five broad categories—surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of these classes has been discussed above.
Pénétration Enhancers
157
In one embodiment, the présent invention employs various pénétration enhancers to effect the efficient delivery of nucleic acids, particularly iRNAs, to the skin of animais. Most drugs are présent in solution in both ionized and nonionized forms. However, usually only lipid soluble or lipophilie drugs readily cross cell membranes. It has been discovered that even nonlipophilic drugs may cross cell membranes if the membrane to be crossed is treated with a pénétration enhancer. In addition to aiding the diffusion of non-lipophilic drugs across cell membranes, pénétration enhancers also enhance the permeability of lipophilie drugs.
Pénétration enhancers may be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92). Each of the above mentioned classes of pénétration enhancers are described below in greater detail.
Surfactants: In connection with the présent invention, surfactants (or surface-active agents) are chemical entities which, when dissolved in an aqueous solution, reduce the surface tension of the solution or the interfacial tension between the aqueous solution and another liquid, with the resuit that absorption of iRNAs through the mucosa is enhanced. In addition to bile salts and fatty acids, these pénétration enhancers include, for example, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether) (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92); and perfluorochemical émulsions, such as FC-43. Takahashi et al., J. Pharm. Pharmacol., 1988, 40, 252).
Fatty acids: Various fatty acids and their dérivatives which act as pénétration enhancers include, for example, oleic acid, lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein (1-monooleoylrac-glycerol), dilaurin, caprylic acid, arachidonic acid, glycerol 1-monocaprate, 1dodecylazacycloheptan-2-one, acylcamitines, acylcholines, C1.20 alkyl esters thereof (e.g., methyl, isopropyl and t-butyl), and mono- and di-glycerides thereof (i.e., oleate, laurate, caprate, myristate, palmitate, stéarate, linoleate, etc.) (see e.g., Touitou, E., et al. Enhancement in Drug Delivery, CRC Press, Danvers, MA, 2006; Lee et al., Critical Reviews in Therapeutic Drug
158
Carrier Systems, 1991, p.92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems,
1990, 7, 1-33; El Hariri étal., J. Pharm. Pharmacol., 1992, 44, 651-654).
Bile salts: The physiological rôle of bile includes the facilitation of dispersion and absorption of lipids and fat-soluble vitamins (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Brunton, Chapter 38 in: Goodman & Gilmaris The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al. Eds., McGrawHill, New York, 1996, pp. 934-935). Various natural bile salts, and their synthetic dérivatives, act as pénétration enhancers. Thus the term bile salts includes any of the naturally occumng components of bile as well as any of their synthetic dérivatives. Suitable bile salts include, for example, cholic acid (or its pharmaceutically acceptable sodium sait, sodium cholate), dehydrocholic acid (sodium dehydrocholate), deoxycholic acid (sodium deoxycholate), glucholic acid (sodium glucholate), glycholic acid (sodium glycocholate), glycodeoxycholic acid (sodium glycodeoxycholate), taurocholic acid (sodium taurocholate), taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA), sodium tauro-24,25-dihydro-fusidate (STDHF), sodium glycodihydrofasidate and polyoxyethylene-9-lauryl ether (POE) (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Swinyard, Chapter 39 In: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990, pages 782-783; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Yamamoto et al., J. Pharm. Exp. Ther., 1992, 263, 25; Yamashita et al., J. Pharm. Sci., 1990, 79, 579-583).
Chelating Agents: Chelating agents, as used in connection with the présent invention, can be defined as compounds that remove metallic ions from solution by forming complexes therewith, with the resuit that absorption of iRNAs through the mucosa is enhanced. With regards to their use as pénétration enhancers in the présent invention, chelating agents hâve the added advantage of also serving as DNase inhibitors, as most characterized DNA nucleases require a divalent métal ion for catalysis and are thus inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618, 315-339). Suitable chelating agents include but are not limited to disodium ethylenediaminetetraacetate (EDTA), citric acid, salicylates (e.g., sodium salicylate, 517746
159 methoxysalicylate and homovanilate), N-acyl dérivatives of collagen, laureth-9 and N-amino acyl dérivatives of β-diketones (enamines)(see e.g., Katdare, A. et al., Excipient development for pharmaceutical, biotechnology, and drug delivery, CRC Press, Danvers, MA, 2006; Lee et al., Critical Reviews in Therapeutic Diug Carrier Systems, 1991, page 92; Muranishi, Critical Reviews in Therapeutic Diug Carrier Systems, 1990, 7, 1-33; Buur et al., J. Control Rel., 1990, 14,43-51).
Non-chelating non-surfactants: As used herein, non-chelating non-surfactant pénétration enhancing compounds can be defined as compounds that demonstrate insignificant activity as chelating agents or as surfactants but that nonetheless enhance absorption of iRNAs through the alimentary mucosa (see e.g., Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33). This class of pénétration enhancers include, for example, unsaturated cyclic ureas, 1-alkyl- and 1-alkenylazacyclo-alkanone dérivatives (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92); and non-steroidal anti-inflammatory agents such as diclofenac sodium, indomethacin and phenylbutazone (Yamashita et al., J. Pharm. Pharmacol., 1987, 39, 621-626).
Agents that enhance uptake of iRNAs at the cellular level may also be added to the pharmaceutical and other compositions of the présent invention. For example, cationic lipids, such as lipofectin (Junichi et al, U.S. Pat. No. 5,705,188), cationic glycerol dérivatives, and polycationic molécules, such as polylysine (Lollo et al., PCT Application WO 97/30731), are also known to enhance the cellular uptake of dsRNAs. Examples of commercially available transfection reagents include, for example Lipofectamine™ (Invitrogen; Carlsbad, CA), Lipofectamine 2000™ (Invitrogen; Carlsbad, CA), 293fectin™ (Invitrogen; Carlsbad, CA), Cellfectin™ (Invitrogen; Carlsbad, CA), DMRIE-C™ (Invitrogen; Carlsbad, CA), FreeStyle™ MAX (Invitrogen; Carlsbad, CA), Lipofectamine™ 2000 CD (Invitrogen; Carlsbad, CA), Lipofectamine™ (Invitrogen; Carlsbad, CA), RNAiMAX (Invitrogen; Carlsbad, CA), Oligofectamine™ (Invitrogen; Carlsbad, CA), Optifect™ (Invitrogen; Carlsbad, CA), XtremeGENE Q2 Transfection Reagent (Roche; Grenzacherstrasse, Switzerland), DOT AP Liposomal Transfection Reagent (Grenzacherstrasse, Switzerland), DOSPER Liposomal Transfection Reagent (Grenzacherstrasse, Switzerland), or Fugene (Grenzacherstrasse,
160
Switzerland), Transfectam® Reagent (Promega; Madison, WI), TransFast™ Transfection Reagent (Promega; Madison, WI), TfxTM-20 Reagent (Promega; Madison, WI), Tfx™-50 Reagent (Promega; Madison, WI), DreamFect™ (OZ Biosciences; Marseille, France), EcoTransfect (OZ Biosciences; Marseille, France), TransPass3 DI Transfection Reagent (New England Biolabs; Ipswich, MA, USA), LyoVec™/LipoGen™ (Invivogen; San Diego, CA, USA), PerFectin Transfection Reagent (Genlantis; San Diego, CA, USA), NeuroPORTER Transfection Reagent (Genlantis; San Diego, CA, USA), GenePORTER Transfection reagent (Genlantis; San Diego, CA, USA), GenePORTER 2 Transfection reagent (Genlantis; San Diego, CA, USA), Cytofectin Transfection Reagent (Genlantis; San Diego, CA, USA), BaculoPORTER Transfection Reagent (Genlantis; San Diego, CA, USA), TroganPORTER™ transfection Reagent (Genlantis; San Diego, CA, USA ), RiboFect (Bioline; Taunton, MA, USA), PlasFect (Bioline; Taunton, MA, USA), UniFECTOR (B-Bridge International; Mountain View, CA, USA), SureFECTOR (B-Bridge International; Mountain View, CA, USA), or HiFect™ (BBridge International, Mountain View, CA, USA), among others.
Other agents may be utilized to enhance the pénétration of the administered nucleic acids, including glycols such as ethylene glycol and propylene glycol, pyrrols such as 2-pyrrol, azones, and terpenes such as limonene and menthone.
Carriers
Certain compositions of the présent invention also incoiporate carrier compounds in the formulation. As used herein, “carrier compound” or “carrier” can refer to a nucleic acid, or analog thereof, which is inert (i.e., does not possess biological activity per se) but is recognized as a nucleic acid by in vivo processes that reduce the bioavailability of a nucleic acid having biological activity by, for example, degrading the biologically active nucleic acid or promoting its removal from circulation. The coadministration of a nucleic acid and a carrier compound, typically with an excess of the latter substance, can resuit in a substantial réduction of the amount of nucleic acid recovered in the liver, kidney or other extracirculatory réservoirs, presumably due to compétition between the carrier compound and the nucleic acid for a common receptor. For example, the recovery of a partially phosphorothioate dsRNA in hepatic tissue can
161 be reduced when it is coadministered with polyinosinic acid, dextran sulfate, polycytidic acid or
4-acetamido-4'isothiocyano-stilbene-2,2'-disulfonic acid (Miyao et al., DsRNA Res. Dev., 1995,
5, 115-121; Takakura et al., DsRNA & Nucl. Acid Drug Dev., 1996, 6, 177-183.
Excipients
In contrast to a carrier compound, a “pharmaceutical carrier” or “excipient” is a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal. The excipient may be liquid or solid and is selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition. Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.)·, fïllers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, ete.); lubricants (e.g., magnésium stéarate, talc, silica, colloïdal silicon dioxide, stearic acid, metallic stéarates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.)·, disintegrants (e.g., starch, sodium starch glycolate, etc/)·, and wetting agents (e.g., sodium lauryl sulphate, etc).
Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration which do not deleteriously react with nucleic acids can also be used to formulate the compositions of the présent invention. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, sait solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnésium stéarate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.
Formulations for topical administration of nucleic acids may include stérile and nonsterile aqueous solutions, non-aqueous solutions in cornmon solvents such as alcohols, or solutions of the nucleic acids in liquid or solid oil bases. The solutions may also contain buffers, diluents and other suitable additives. Pharmaceutically acceptable organic or inorganic excipients
162 suitable for non-parenteral administration which do not deleteriously react with nucleic acids can be used.
Suitable pharmaceutically acceptable excipients include, but are not limited to, water, sait solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnésium stéarate, talc, silicic acid, viscous paraffm, hydroxymethylcellulose, polyvinylpyrrolidone and the like.
Other Components
The compositions of the présent invention may additionally contain other adjunct components conventionally found in pharmaceutical compositions, at their art-established usage levels. Thus, for example, the compositions may contain additional, compatible, pharmaceutically-active materials such as, for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents, or may contain additional materials useful in physically formulating various dosage forms of the compositions of the présent invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers. However, such materials, when added, should not unduly interfère with the biological activities of the components of the compositions of the présent invention. The formulations can be sterilized and, if desired, mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings and/or aromatic substances and the like which do not deleteriously interact with the nucleic acid(s) of the formulation.
Aqueous suspensions may contain substances that increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers.
In some embodiments, pharmaceutical compositions featured in the invention include (a) one or more iRNA compounds and (b) one or more biologie agents which fonction by a nonRNAi mechanism. Examples of such biologie agents include agents that interfère with an interaction of ALAS1 and at least one ALAS1 binding partner.
Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animais, e.g., for determining the
163
LD50 (the dose léthal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. Compounds that exhibit high therapeutic indices are typical.
The data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of compositions featured in the invention lies generally within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the methods featured in the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range of the compound or, when appropriate, of the polypeptide product of a target sequence (e.g., achieving a decreased concentration of the polypeptide) that includes the IC50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately détermine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography.
In addition to their administration, as discussed above, the iRNAs featured in the invention can be administered in combination with other known agents effective in treatment of diseases or disorders related to ALAS1 expression. In any event, the administering physician can adjust the amount and timing of iRNA administration on the basis of results observed using standard measures of efficacy known in the art or described herein.
Methods for treating diseases related to expression of an ALAS1 gene
The invention relates in particular to the use of an iRNA targeting ALAS1 to inhibit ALAS1 expression and/or to treat a disease, disorder, or pathological process that is related to ALAS1 expression.
As used herein, “a disorder related to ALAS1 expression,” a “disease related to ALAS1 expression, a “pathological process related to ALAS1 expression,” or the like includes any
164 condition, disorder, or disease in which ALAS1 expression is altered (e.g., elevated), the level of one or more porphyrins is altered (e.g., elevated), the level or activity of one or more enzymes in the heme biosynthetic pathway (porphyrin pathway) is altered, or other mechisms that lead to pathological changes in the heme biosynthetic pathway. For example, an iRNA targeting an ALAS1 gene, or a combination thereof, may be used for treatment of conditions in which levels of a poiphyrin or a porphyrin precursor (e.g., ALA or PBG) are elevated {e.g., certain porphyrias), or conditions in which there are defects in the enzymes of the heme biosynthetic pathway {e.g., certain porphyrias). Disorders related to ALAS1 expression include, for example, X-linked sideroblastic anémia (XLSA), ALA deyhdratase deficiency porphyria (Doss porphyria), acute intermittent porphyria (AIP), congénital erythropoietic porphyria, prophyria cutanea tarda, hereditary coproporphyria (coproporphyria), variegate porphyria, erythropoietic protoporphyria (EPP), and transient erythroporphyria of infancy.
As used herein, a “subject” to be treated according to the methods described herein, includes a human or non-human animal, e.g., a mammal. The mammal may be, for example, a rodent {e.g., a rat or mouse) or a primate {e.g., a monkey). In some embodiments, the subject is a human.
In some embodiments, the subject is suffering from a disorder related to ALAS1 expression {e.g., has been diagnosed with a porphyria or has suffered from one or more symptoms of porphyria and is a carrier of a mutation associated with porphyria) or is at risk of developing a disorder related to ALAS1 expression {e.g., a subject with a family history of porphyria, or a subject who is a carrier of a genetic mutation associated with porphyria).
Classifications of porphyrias, including acute hepatic porphyrias, are described, e.g., in Balwani, M. & Desnick, R.J., Blood, 120(23), published online as Blood First Edition paper, July 12, 102; DOI 10.1182/blood-2012-05-423186. As described in Balwain & Desnick, acute intermittent porphyria (AIP) hereditary coproporphyria (HCP), variegate porphyria (VP) are autosomal dominant porphyrias and ALA deyhdratase deficiency porphyria (ADP) is autosomal récessive. In rare cases, AIP, HCP, and VP occur as homozygous dominant forms. In addition, there is a rare homozygous récessive form of porphyria cutanea tarda (PCT), which is the single
165 hepatic cutaneous porphyria, and is also known as hepatoerythropoietic porphyria. The clinical and laboratory features of these porphyrias are described in Table 11 below.
Table 11: Human hepatic poiphyrias: clinical and laboratory features
Porphyria Déficient enzyme Inheritance Principal symptoms, NV or CP Enzyme activity, %of normal Increased porphyrin precursors and/or porphyrins*
Erythrocytes Urine Stool
Acute hepatic porphyrias
ADP ALAdehydratase AR NV ~5 Zn-protoporphyrin ALA, coproporphyrin III -
AIP HMBsynthase AD NV ~50 - ALA, PBG, uroporpliyrin -
HCP COPROoxidase AD NV and CP ~50 - ALA, PBG, coproporphyrin III coproporp hyrin III
VP PROTOoxidase AD NV and CP ~50 ALA, PBG coproporphyrin III coproporp hyrin III, protoporp hyrin
Hepatic cutaneous porphyrias
PCT UROdecarboxylase Sporadic or AD CP <20 uroporphyrin, 7-carboxylate porphyrin uropoiphy rin, 7carboxylat e porphyrin
AR indicates autosomal récessive; AD, autosomal dominant; NV, neurovisceral; CP, cutaneous photosensitivity; and -, not applicable.
*Increases that may be important for diagnosis.
In some embodiments, the subject has or is at risk for developing a porphyria, e.g., a hepatic porphyria, e.g., AIP, HCP, VP, ADP, or hepatoerythropoietic porphyria.
In some embodiments, the porphyria is an acute hepatic porphyria, e.g., an acute hepatic porphyria iselected from acute intermittent porphyria (AIP), hereditary coproporphyria (HCP), variegate porphyria (VP), and ALA deyhdratase defïciency porphyria (ADP).
In some embodiments, the porphyria is a dual porphyria, e.g., at least two poiphyrias. In some embodiments, the dual porphyria comprises two or more porphyrias selected from acute intermittent porphyria (AIP) hereditary coproporphyria (HCP), variegate poiphyria (VP), and ALA deyhdratase defïciency porphyria (ADP).
In some embodiments, the porphyria is a homozygous dominant hepatic porphyria (e.g., homozygous dominant AIP, HCP, or VP) or hepatoerythropoietic porphyria,In some
166 embodiments, the porphyria is AIP, HCP, VP, or hepatoerythropoietic porphyria, or a combination thereof (e.g., a dual porphyria). In embodiments, the AIP, HCP, or VP is either heterozygous dominant or homozygous dominant.
In embodiments, the subject has or is at risk for developing a porphyria, e.g., ADP, and shows an elevated level (e.g., an elevated urine level) of ALA and/or coproporphyrin III. In embodiments, the subject has or is at risk for developing a poiphyria, e.g., ADP, and shows an elevated level of érythrocyte Zn-protoporphyrin.
In embodiments, the subject has or is at risk for developing a porphyria, e.g., AIP, and shows an elevated level (e.g., an elevated urine level) of ALA, PBG, and/or uroporphyrin.
In embodiments, the subject has or is at risk for developing a poiphyria, e.g., HCP, and shows an elevated level (e.g., an elevated urine level) of ALA, PBG, and/or coproporphyrin III. In embodiments, the subject has or is at risk for developing a porphyria, e.g., HCP, and shows an elevated level (e.g., an elevated stool level) of coproporphyrin III.
In embodiments, the subject has or is at risk for developing a porphyria, e.g., VP, and shows an elevated level (e.g., an elevated urine level) of ALA, PBG, and/or coproporphyrin III.
In embodiments, the subject has or is at risk for developing a poiphyria, e.g., HCP, and shows an elevated level (e.g., an elevated stool level) of copropoiphyrin III and/or protopoiphyrin.
In embodiments, the subject has or is at risk for developing a porphyria, e.g., PCT, (e.g.,hepatoerythropoietic porphyria) and shows an elevated level (e.g., an elevated urine level) of uropoiphyrin and/or 7-carboxylate poiphyrin. In embodiments, the subject has or is at risk for developing a poiphyria, e.g., PCT, (e.g.,hepatoerythropoietic porphyria) and shows an elevated level (e.g., an elevated stool level) of uroporphyrin and/or 7-carboxylate porphyrin.
A mutation associated with porphyria includes any mutation in a gene encoding an enzyme in the heme biosynthetic pathway (poiphyrin pathway) or a gene which alters the expression of a gene in the heme biosynthetic pathway. In many embodiments, the subject carries one or more mutations in an enzyme of the porphyrin pathway (e.g., a mutation in ALA deydratase or PBG deaminase). In some embodiments, the subject is suffereing from an acute porphyria (e.g., AIP, ALA deydratase deficiency porphyria).
167
In some cases, patients with an acute hepatic porphyria (e.g., AIP), or patients who carry mutations associated with an acute hepatic porphyria (e.g., AIP) but who are asymptomatic, hâve elevated ALA and/or PBG levels compared with healthy individuals. See, e.g., Floderus, Y. et al, Clinical Chemistry, 52(4): 701-707, 2006; Sardh et al., Clinical Pharmacokinetics, 46(4): 335349, 2007. In such cases, the level of ALA and/or PBG can be elevated even when the patient is not having, or has never had, an attack. In some such cases, the patient is otherwise completely asymptomatic. In some such cases, the patient suffers from pain, e.g., neuropathie pain, which can be chronic pain (e.g., chronic neuropathie pain). In some cases, the patient has a neuropathy. In some cases, the patient has a progressive neuropathy.
In some embodiments, the subject to be treated according to the methods described herein has an elevated level of a porphyrin or a porphyrin precursor, e.g., ALA and/or PBG. Levels of a porphyrin or a porphyrin precursor can be assessed using methods known in the art or methods described herein. For example, methods of assessing uring and plasma ALA and PBG levels, as well as urine and plasma porphyrin levels, are disclosed in Floderus, Y. et al, Clinical Chemistry, 52(4): 701-707, 2006; and Sardh et al., Clinical Pharmacokinetics, 46(4): 335-349, 2007, the entire contents of which are hereby incorporated in their entirety.
In some embodiments, the subject is an animal model of a porphyria, e.g., a mouse model of a porphyria (e.g., a mutant mouse as described in Lindberg et al. Nature Genetics, 12: 195199, 1996). In some embodiments, the subject is a human, e.g., a human who has or is at risk for developing a porphyria, as described herein. In some embodiments, the subject is not having an acute attack of porphyria. In some embodiments, the subject has never had an attack. In some embodiments, the patient suffers from chronic pain. In some embodiments, the patient has nerve damage. In embodiments, the subject has EMG changes and/or changes in nerve conduction velocity. In some embodiments, the subject is asymptomatic. In some embodiments, the subject is at risk for developing a porphyria (e.g., cames a gene mutation associated with a porphyria) and is asymptomatic. In some embodiments, the subject has previously had an acute attack but is asymptomatic at the time of treatment.
168
In some embodiments, the subject is at risk for developing a porphyria and is treated prophylactically to prevent the development of a porphyria. . In some embodiments the subject has an elevated level of a porphyrin or a porphyrin precursor, e.g., ALA and/or PBG. In some embodiments, the prophylactic treatment begins at puberty. In some embodiments the treatment lowers the level (e.g., the plasma level or the urine level) of a porphyrin or a porphyrin precursor, e.g., ALA and/or PBG. In some embodiments, the treatment prevents the development of an elevated level of a porphyrin or a porphyrin precursor, e.g., ALA and/or PBG. In some embodiments, the treatment prevents the development of, or decreases the frequency or severity of, a symptom associated with a porphyria, e.g., pain or nerve damage.
In some embodiments, the level of a porphyrin or a porphyrin precursor, e.g., ALA or PBG, is elevated, e.g., in a sample of plasma or urine from the subject. In some embodiments, the level of a porphyrin or a porphyrin precursor, e.g., ALA or PBG, in the subject is assessed based on the absolute level of the porphyrin or the porphyrin precursor, e.g., ALA or PBG in a sample from the subject. In some embodiments, the level of a porphyrin or a porphyrin precursor, e.g., ALA or PBG, in the subject is assessed based on the relative level of the porphyrin or porphyrin precursor, e.g., ALA or PBG, in a sample from the subject. In some embodiments, the relative level is relative to the level of another protein or compound, e.g., the level of créatinine, in a sample from the subject. In some embodiments, the sample is a urine sample. In some embodiments, the sample is a plasma sample. In some embodiments, the sample is a stool sample.
An elevated level of a porphyrin or a porphyrin precursor, e.g., ALA and/or PBG, can be established, e.g., by showing that the subject has a level of a porphyrin or a porphyrin precursor, e.g., ALA and/or PBG (e.g., a plasma or urine level of ALA and/or PBG) that is greater than, or greater than or equal to, a reference value. A physician with expertise in the treatment of porphyrias would be able to détermine whether the level of a porphyrin or a porphyrin precursor, (e.g., ALA and/or PBG) is elevated, e.g., for the purpose of diagnosing a porphyria or for determining whether a subject is at risk for developing a porphyria, e.g., a subject may be predisposed to an acute attack or to pathology associated with a porphyria, such as, e.g., chronic pain (e.g., neuropathie pain) and neuropathy (e.g., progressive neuropathy).
169
As used herein, a “reference value” refers to a value from the subject when the subject is not in a disease state, or a value from a normal or healthy subject, or a value from a reference sample or population, e.g., a group of normal or healthy subjects (e.g., a group of subjects that does not carry a mutation associated with a porphyria and/or a group of subjects that does not suffer from symptoms associated with a porphyria).
In some embodiments, the reference value is a pre-disease level in the same individual.
In some embodiments, the reference value is a level in a reference sample or population. In some embodiments, the reference value is the mean or médian value in a reference sample or population. In some embodiments, the reference value the value that is is two standard déviations above the mean in a reference sample or population. In some embodiments, the reference value is the value that is 2.5, 3, 3.5, 4, 4.5, or 5 standard déviations above the mean in a reference sample or population.
In some embodiments, wherein the subject has an elevated level of a porphyrin or a porphyrin precursor, e.g., ALA and/or PBG, the subject has a level of ALA and/or PBG that is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% higher than a reference value. In some embodiments, the subject has a level of a porphyrin or a porphyrin precursor, e.g., ALA and/or PBG, that is at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 fold higher than a reference value.
In some embodiments, the reference value is an upper reference limit. As used herein, an “upper reference limit” refers to a level that is the upper limit of the 95% confidence interval for a reference sample or population, e.g., a group of normal (e.g., wild type) or healthy individuals, e.g., individuals who do not carry a genetic mutation associated with a poiphyria and/or individuals who do not suffer from a porphyria. Accordingly, a lower reference limit refers to a level that is the lower limit of the same 95% confidence interval.
In some embodiments wherein the subject has an elevated level, e.g., a plasma level or a urine level, of a poiphyrin or a porphyrin precursor, e.g., ALA or PBG, the level is greater than or equal to 2 times, 3 times, 4 times, or 5 times that of a reference value, e.g., an upper reference limit. In some embodiments, the subject has a urine level of a porphyrin or a porphyrin precursor, e.g., ALA or PBG, that is greater than 4 times that of an upper reference limit.
170
In some embodiments, the reference value is a value provided in Floderus, Y. et al,
Clinical Chemistry, 52(4): 701-707, 2006 or Sardh et al., Clinical Pharmacokinetics, 46(4): 335349, 2007. In some embodiments, the reference value is a value provided in Table 1 of Sardh et al.
In some embodiments, the subject is a human and has a urine level of PBG that is greater than or equal to 4.8 mmol/mol créatinine. In certain embodiments, the subject is a human and has a urine level of PBG that is greater than, or greater than or equal to, about 3, 4, 5, 6, 7, or 8 mmol/mol créatinine.
In embodiments, the reference value for plasma PBG is 0.12 pmol/L. In embodiments, the subject is a human and has a plasma PBG level that is greater than, or greater than or equal to, 0.10 pmol/L, 0.12 pmol/L, 0.24 pmol/L, 0.36 pmol/L, 0.48 pmol/L, or 0.60 pmol/L. In embodiments, the subject is a human and has a plasma level of PBG that is greater than, or greater than or equal to, 0.48 pmol/L.
In embodiments, the reference value for urine PBG is 1.2 mmol/mol créatinine. In embodiments, the subject is a human and has a urine PBG level that is greater than, or greater than or equal to, 1.0 mmol/mol créatinine, 1.2 mmol/mol créatinine, 2.4 mmol/mol créatinine, 3.6 mmol/mol créatinine, 4.8 mmol/mol créatinine, or 6.0 mmol/mol créatinine. In embodiments, the subject is a human and has a urine level of PBG that is greater than, or greater than or equal to, 4.8 mmol/mol créatinine.
In embodiments, the reference value for plasma ALA is 0.12 pmol/L. In embodiments, the subject is a human and has a plasma ALA level that is greater than, or greater than or equal to, 0.10 pmol/L, 0.12 pmol/L, 0.24 pmol/L, 0.36 pmol/L, 0.48 pmol/L, or 0.60 pmol/L. In embodiments, the subject is a human and has a plasma ALA level that is greater than, or greater than or equal to 0.48 pmol/L.
In embodiments, the reference value for urine ALA is 3.1 mmol/mol créatinine. In embodiments, the subject is a human and has a urine ALA level that is greater than, or greater than or equal to, 2.5 mmol/mol créatinine, 3.1 mmol/mol créatinine, 6.2 mmol/mol créatinine, 9.3 mmol/mol créatinine, 12.4 mmol/mol créatinine, or 15.5 mmol/mol créatinine.
171
In embodiments, the reference value for plasma porphyrin is 10 nmol/L. In embodiments, the subject is a human and has a plasma porphyrin level that is greater than, or greater than or equal to, 10 nmol/L. In embodiments, the subject is a human and has a plasma porphyrin level that is greater than, or greater than or equal to, 8, 10, 15, 20, 25, 30, 35, 40, 45, or 50 nmol/L. the subject is a human and has a plasma porphyrin level that is greater than, or greater than or equal to 40 nmol/L.In embodiments, the reference value for urine porphyrin is 25 pmol/mol créatinine. In embodiments, the subject is a human and has a urine porphyrin level that is greater than, or greater than or equal to, 25 pmol/mol créatinine. In embodiments, the subject is a human and has a urine porphyrin level that is greater than, or equal to, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, or 80 pmol/mol créatinine.
In some embodiments, the subject has a level, e.g., a plasma level or a urine level, of a porphyrin or a porphyrin precursor, e.g., ALA or PBG, that is greater than that of 99% of individuals in a sample of healthy individuals.
In some embodiments, the subject has a level, e.g., a plasma level or a urine level, of ALA or PBG that is greater than two standard déviations above the mean level in a sample of healthy individuals.
In some embodiments, the subject has a urine level of ALA that is 1.6 or more times that of the mean level in a normal subject (e.g., a subject that does not carry a mutation associated with a porphyria). In some embodiments, the subject has a plasma level of ALA that is 2 or 3 times that of the mean level in a normal subject. In some embodiments, the subject has a urine level of PBG that is four or more times that of the mean level in a normal subject. In some embodiments, the subject has a plasma level of PBG that is four or more times that of the mean level in a normal subject.
In some embodiments, the method is effective to decrease the level of a porphyrin or a porphyrin precursor, e.g., ALA and/or PBG. In embodiments, the method is effective to produce a predetermined réduction in the elevated level of the poiphyrin or porphyrin precursor, e.g., ALA or PBG. In some embodiments, the predetermined réduction is a decrease of at least 10%, 20%, 30%, 40%, or 50%. In some embodiments, the predetermined réduction is a réduction that is effective to prevent or ameliorate symptoms, e.g., pain or recurring attacks.
172
In some embodiments, the predetennined réduction is a réduction that is at least 1, 2, 3, or more standard déviations, wherein the standard déviation is determined based on the values from a reference sample, e.g., a reference sample as described herein.
In some embodiments, the predetermined réduction is a réduction that brings the level of the porphyrin or porphyrin precursor to a level that is less than, or to a level that is less than or equal to, a reference value (e.g., a reference value as described herein).
In some embodiments, the subject to be treated according to the methods described suffers from pain, e.g., chronic pain. In some embodiments, the subject has or is at risk for developing a porphyria, e.g. an acute hepatic porphyria, e.g., AIP. In embodiments, the method is effective to treat the pain, e.g., by reducing the severity of the pain or curing the pain. In embodiments, the method is effective to decrease or prevent nerve damage.
In some embodiments, the subject to be treated according to the methods described herein (a) has an elevated level of ALA and/or PBG and (b) suffers from pain, e.g., chronic pain. In embodiments, the method is effective to decrease an elevated level of ALA and/or PBG and/or to treat the pain, e.g., by reducing the severity of the pain or curing the pain.
In some embodiments, the subject is an animal that serves as a model for a disorder related to ALAS1 expression.
In some embodiments the subject is an animal that serves as a model for porphyria (e.g., a genetically modified animal with one or more mutations. In some embodiments, the poiphyria is AIP and the subject is an animal model of AIP. In one such embodiment, the subject is a genetically modified mouse that is déficient in porphobilinogen deaminase , such as, for example, the mouse described in Lindberg et al., Nature Genetics, 12:195-199, 1996, or the homozygous R167Q mouse described in Yasuda, M., Yu, C. Zhang, J., Clavero, S., Edelmann, W., Gan, L., Phillips, J.D., & Desnick, R.J. Acute intermittent porphyria: A severely affected knock-in mouse that mimics the human homozygous dominant phenotype. (Abstract of Présentation on October 14, 2011 at the American Society of Human Genetics; Program No. 1308F; accessed online on April 4, 2012 atichg2011.org/cgi-bin/showdetail.pl?absno=21167); both of these references are hereby incoiporated herein in their entirety. Several knock-in
173 models for mutations causing homozygous dominant AIP in humans hâve been generated. The mutations employed include, e.g., R167Q, R173Q, and R173W in PBG deaminase. Viable homozygotes included the R167Q/R176Q and R167Q/R173Q, both of which exhibit constitutively elevated ALA and PBG levels analogous to the phenotype in human homozygous dominant AIP; in some embodiments, such a viable homozygous AIP mouse model is the subject.
In one embodiment, a subject to be treated according to the methods described herein, (e.g., a human subject or patient), is at risk of developing, or has been diagnosed, with a disorder related to ALAS1 expression, e.g. a porphyria. In some embodiments, the subject is a subject who has suffered one or more acute attacks of one or more porphyric symptoms. In other embodiments, the subject is a subject who has suffered chronically from one or more symptoms of porphyria (e.g., pain, e.g., neuropathie pain and or neuropathy, e.g., progressive neuropathy). In some embodiments, the subject cames a genetic alteration (e.g., a mutation) as described herein but is otheiwise asymptomatic. In some embodiments, the subject has previously been treated with a heme product (e.g., hemin, heme arginate, or heme albumin), as described herein.
In some embodiments, a subject (e.g., a subject with a porphyria, such as, e.g., AIP) to be treated according to the methods described herein has recently experienced or is currently experiencing a prodrome. In some such embodiments, the subject is administered a combination treatment, e.g., an iRNA as described herein, and one or more additional treatments known to be effective against poiphyria (e.g., glucose and/or a heme product such as hemin, as described herein) or its associated symptoms.
In one embodiment, an iRNA as described herein is administered in combination with glucose or dextrose. For example, 10-20% dextrose in normal saline may be provided intravenously. Typically, when glucose is administered, at least 300 g of 10% glucose is administered intravenously daily. The iRNA (e.g., an iRNA in an LNP formulation) may also be administered intravenously, as part of the same infusion that is used to administer the glucose or dextrose, or as a separate infùsion that is administered before, concurrently, or after the administration of the glucose or dextrose. In some embodiments, the iRNA is administered via a different route of administration (e.g., subcutaneously). In yet another embodiment, the iRNA is
174 administered in combination with total parentéral nutrition. The iRNA may be administered before, concurrent with, or after the administration of total parentéral nutrition.
In one embodiment, the iRNA is administered in combination with a heme product (e.g., hemin, heme arginate, or heme albumin). In a further embodiment, the iRNA is administered in combination with a heme product and glucose, a heme product and dextrose, or a heme product and total parentéral nutrition.
A “prodrome,” as used herein, includes any symptom that the individual subject has previously experienced immediately prior to developing an acute attack. Typical symptoms of a prodrome include, e.g., abdominal pain, nausea, headaches, psychological symptoms (e.g., anxiety), restlessness and/or insomnia. In some embodiments, the subject expériences pain (e.g., abdominal pain and/or a headache) during the prodrome. In some embodiments, the subject expériences nausea during the prodrome. In some embodiments, the subject expériences psychological symptoms (e.g., anxiety) during the prodrome. In some embodiments, the subject becomes restless and/or suffers from insomnia during the prodrome.
An acute “attack” of porphyria involves the onset of one or more symptoms of porphyria, typically in a patient who cames a mutation associated with porphyria (e.g., a mutation in a gene that encodes an enzyme in the porphyrin pathway).
In certain embodiments, administration of an ALAS1 iRNA results in a decrease in the level of one or more porphyrins or porphyrin precursors, as described herein (e.g., ALA and/or PBG). The decrease may be measured relative to any appropriate control or reference value. For example, the decrease in the level of one or more porphyrins or porphyrin precursors may be established in an individual subject, e.g., as a decrease of at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% or more compared with the level prior to treatment (e.g., immediately prior to treatment). A decrease in the level of a porphyrin precursor, a porphyrin, or or a poiphyrin métabolite may be measured using any method known in the art. For example, the level of PBG and/or ALA in urine or plasma may be assessed, using the Watson-Schwartz test, ion exchange chromatography, or high-performance liquid chromatography - mass spectrometry. See, e.g., Thunell (1993).
175
In some embodiments, administration of an ALAS1 siRNA is effective to reduce the level of ALA and/or PBG in the subject. The level of ALA or PBG in the subject can be assessed, e.g., based on the absolute level of ALA or PBG, or based on the relative level of ALA or PBG (e.g., relative to the level of another protein or compound, e.g., the level of créatinine) in a sample from the subject. In some embodiments, the sample is a urine sample. In some embodiments, the sample is a plasma sample.
In certain embodiments, an iRNA that targets ALAS1 is administered in combination one or more additional treatments, e.g., another treatment known to be effective in treating porphyria or symptoms of poiphyria. For example, the other treatment may be glucose (e.g., IV glucose) or a heme product (e.g., hemin, heme arginate, or heme albumin). The additional treatment(s) may be administered before, after, or concurrent with the administration of iRNA.
The iRNA and an additional therapeutic agent can be administered in combination in the same composition, e.g., intravenously, or the additional therapeutic agent can be administered as part of a separate composition or by another method described herein.
In some embodiments, administration of iRNA, or administration of iRNA in combination one or more additional treatments (e.g., glucose, dextrose or the like), decreases the frequency of acute attacks (e.g., by preventing acute attacks so that they no longer occur, or by reducing the number of attacks that occur in a certain time period, e.g., fewer attacks occur per year). In some such embodiments, the iRNA is administered according to a regular dosing regimen, e.g., daily, weekly, biweekly, or monthly.
In some embodiments, the iRNA is administered after an acute attack of porphyria. In some such embodiments, the iRNA is in a composition, e.g. a composition comprising a lipid formulation, e.g. an LNP formulation.
In some embodiments, the iRNA is administered during an acute attack of porphyria. In some such embodiments, the iRNA is in a composition, e.g. a composition comprising a lipid formulation (e.g., an LNP formulation) or a composition comprising a GalNAc conjugate.
In some embodiments, administration of an ALAS1 siRNA is effective to lessen the severity of the attack (e.g., by ameliorating one or more signs or symptoms associated with the attack). In some embodiments, administration of an ALAS1 siRNA is effective to shorten the
176 duration of an attack. In some embodiments, administration of an ALAS1 siRNA is effective to stop an attack. In some embodiments, the iRNA is administered prophylactically to prevent an acute attack of porphyria. In some such embodiments, the iRNA is in the form of a GalNAc conjugate, e.g., in a composition comprising a GalNAc conjugate. In some embodiments, the prophylactic administration is before, during, or after exposure to or occurrence of a precipitating factor. In some embodiments, the subject is at risk of developing porphyria.
In some embodiments, the siRNA is administered during a prodrome. In some embodiments, the prodrome is characterized by pain (e.g., headache and/or abdominal pain), nausea, psychological symptoms (e.g., anxiety), restlessness and/or insomnia.
In some embodiments, the siRNA is administered during a particular phase of the menstrual cycle, e.g., during the luteal phase.
In some embodiments, administration of an ALAS1 siRNA is effective to prevent attacks (e.g., récurrent attacks that are associated with a prodrome and/or with a precipitating factor, e.g., with a particular phase of the menstrual cycle, e.g., the luteal phase). In some embodiments, administration of an ALAS1 siRNA is effective to reduce the frequency of attacks. In embodiments, administration of an ALAS1 siRNA is effective to lessen the severity of the attack (e.g., by ameliorating one or more signs or symptoms associated with the attack). In some embodiments, administration of an ALAS1 siRNA is effective to shorten the duration of an attack. In some embodiments, administration of an ALAS1 siRNA is effective to stop an attack.
In some embodiments administration of an ALAS1 siRNA is effective to prevent or decrease the frequency or severity of pain, e.g., neuropathie pain.
In some embodiments administration of an ALAS1 siRNA is effective to prevent or decrease the frequency or severity of neuropathy
Effects of administration of an ALAS1 siRNA can be established, for example, by comparison with an appropriate control. For example, a decrease in the frequency of acute attacks, as well as a decrease in the level of one or more porphyrins or porphyrin precursors, may be established, for example, in a group of patients with AIP, as a decreased frequency compared with an appropriate control group. A control group (e.g., a group of similar individuals or the
177 same group of individuals in a crossover design) may include, for example, an untreated population, a population that has been treated with a conventional treatment for porphyria (e.g., a conventional treatment for AIP may include glucose, hemin, or both); a population that has been treated with placebo, or a non-targeting iRNA, optionally in combination with one or more conventional treatments for poiphyria (e.g., glucose, e.g., IV glucose), and the like.
A subject “at risk” of developing porphyria, as used herein, includes a subject with a family history of poiphyria and/or a history of one or more recurring or chronic porphyric symptoms, and/or a subject who carries a genetic alteration (e.g., a mutation) in a gene encoding an enzyme of the heme biosynthetic pathway, and a subject who carries a genetic alteration, e.g., a mutation, known to be associated with porphyria.
In embodiments, the alteration, e.g., the mutation, makes an individual susceptible to an acute attack (e.g., upon exposure to a precipitating factor, e.g., a drug, dieting or other precipitating factor, e.g., a precipitating factor as disclosed herein). In embodiments, the alteration, e.g., the mutation, is associated with elevated levels of a porphyrin or a poiphyrin precursor (e.g., ALA and/or PBG). In embodiments, the alteration, e.g., the mutation, is associated with chronic pain (e.g., chronic neuropathie pain) and/or neuropathy (e.g., progressive neuropathy). In embodiments, the , the alteration, e.g., the mutation, is associated with changes in EMG and/or nerve conduction velocities.
In embodiments, the alteration is a mutation in the ALAS1 gene. In embodiments, the alteration is a mutation in the ALAS1 gene promoter, or in régions upstream or downstream from the ALAS1 gene. In embodiments, the alteration is a mutation in transcription factors or other genes that interact with ALAS1. In embodiments, the alteration is an alteration, e.g., a mutation, in a gene that encodes an enzyme in the heme biosynthetic pathway.
In some embodiments, the subject has an genetic alteration as described herein (e.g., a genetic mutation known to be associated with a porphyria). In some such embodiments, the subject has an elevated level (e.g., urine or plasma level) of ALA and/or PBG. In some such embodiments, the subject does not hâve an elevated level of ALA and/or PBG. In embodiments, the subject has a genetic alteration as described herein and has other symptoms, e.g., chronic pain, EMG changes, changes in nerve conduction velocity, and/or other symptoms associated
178 with a porphyria. In embodiments, the subject has a genetic alteration but does not suffer from acute attacks.
In embodiments, the subject has a mutation associated with AIP, HCP, VP, or ADP.
In some embodiments, the porphyria is AIP. In some such embodiments, the subject has an alteration, e.g., at least one mutation, in the PBG deaminase gene. Many PBG deaminase mutations are known in the art, for example, as reported in Hrdinka, M. et al. Physiological Research, 55 (Suppl 2):S119-136 (2006). In some embodiments, the subject is heterozygous for a PBG deaminase mutation. In other embodiments, the subject is homozygous for a PBG deaminase mutation. A homozygous subject may carry two identical mutations or two different mutations in the PBG deaminase gene.
In some embodiments, the poiphyria is HCP. In some such embodiments, the subject has an alteration, e.g., at least one mutation, in the gene that encodes the enzyme coproporphyrinogen III oxidase.
In some embodiments, the porphyria is VP. In some such embodiments, the subject has an alteration, e.g., at least one mutation, in the gene that encodes protoporphrinogen oxidase.
In embodiments, the porphyria is ADP, e.g., autosomal récessive ADP. In some such embodiments, the subject has an alteration, e.g., at least one mutation, in the gene that encodes ALA deydratase.
Methods of treatment provided herein may serve to ameliorate one or more symptoms associated with poiphyria, to reduce the frequency of attacks associated with porphyria, to reduce the likelihood that an attack of one or more symptoms associated with porphyria will occur upon exposure to a precipitating factor, or to reduce the risk of developing conditions associated with poiphyria (e.g., neuropathy (e.g., progressive neuropathy), hepatocellular cancer). Additionally, the methods provided herein may serve to decrease the level of one or more porphyrin precursors, poiphyrins and/or related porphyrin products or métabolites. The level of a porphyrin precursor or a porhyrin may be measured in any biological sample, such as, e.g., urine, blood, feces, cerebrospinal fluid, or a tissue sample. The sample may be présent within a subject or may be obtained or extracted from the subject. In some embodiments, the
179 porphyria is AIP, and the level of PBG and/or ALA is decreased. In some embodiments, the porphyrin product or métabolite is porphobilin, porphobilinogen, or uroporphyrin. A decrease in the level of a porphyrin product or métabolite may be measured using any method known in the art. For example, the level of PBG and/or ALA in urine or plasma may be assessed, using the Watson-Schwartz test, ion exchange chromatography, or high-performance liquid chromatography- mass spectrometry. See, e.g., Thunell (1993).
Methods described herein may also serve to reduce chronically elevated levels of porphyrin precursors (e.g., ALA and/or PBG) in subjects suffering from a porphyria (e.g., an acute hepatic porphyria, e.g., AIP) or at risk for developing a porphyria. Methods for assessing plasma and urine levels (e.g., chronically elevated levels) of porphyrin precursors include, e.g., HPLC-mass spectrometry and ion-exchange chromatography. The levels of porphyrin precursors may be expressed as the level relative to another protein or compound, e.g., créatinine. See, e.g., Floderus, Y. et al, Clinical Chemistry, 52(4): 701-707, 2006; Sardh et al., Clinical Pharmacokinetics, 46(4): 335-349, 2007
A “precipitating factor” as used herein, refers to an endogenous or exogenous factor that may induce an acute attack of one or more symptoms associated with porphyria. Precipitating factors include fasting (or other forms of reduced or inadéquate calorie intake, due to crash diets, long-distance athletics, etc.), metabolic stresses (e.g., infections, surgery, international air travel, and psychological stress), endogenous hormones (e.g., progestérone), cigarette smoking, lipidsoluble foreign chemicals (including, e.g., chemicals présent in tobacco smoke, certain prescription drugs, organic solvents, biocides, components in alcoholic beverages), endocrine factors (e.g., reproductive hormones (women may expérience exacerbations during the premenstrual period), synthetic estrogens, progestérones, ovulation stimulants, and hormone replacement therapy). See, for example, Thunell (1993). Common precipitating factors include cytochrome P450 inducing drugs and phénobarbital.
Symptoms associated with porphyria may include abdominal pain or cramping, headaches, effects caused by nervous system abnormalities, and light sensitivity, causing rashes, blistering, and scarring of the skin (photodermatitis). In certain embodiments, the porphyria is AIP. Symptoms of AIP include gastrointestinal symptoms (e.g., severe and poorly localized
180 abdominal pain, nausea/vomiting, constipation, diarrhea, iléus), urinary symptoms (dysuria, urinary retention/incontinence, or dark urine), neurologie symptoms (e.g., sensory neuropathy, motor neuropathy (e.g., affecting the cranial nerves and/or leading to weakness in the arms or legs), seizures, neuropathie pain, progressive neuropathy, headaches, neuropsychiatrie symptoms (e.g., mental confusion, anxiety, agitation, hallucination, hysteria, delirium, apathy, dépréssion, phobias, psychosis, insomnia, somnolence, coma), autonomie nervous system involvement (resulting e.g., in cardiovascular sysmptoms such as tachycardia, hypertension, and/or arrhythmias, as well as other symptoms, such as, e.g., increased circulating catecholamine levels, sweating, restlessness, and/or tremor), déhydration, and electrolyte abnormalities.
In some embodiments, an iRNA targeting ALAS1 is administered together with (e.g., before, after, or concurrent with) another treatment that may serve to alleviate one or more of the above symptoms. For example, abdominal pain may be treated, e.g., with narcotic analgésies, seizures may be treated, e.g., with anti-seizure médications, nausea/vomiting may be treated, e.g., withphenothiazines, and tachycardia/hypertension may be treated, e.g., with beta blockers.
The tenu “decrease” (or “increase”) is intended to refer to a measurable change, e.g., a statistically significant change. The change may be, for example, at least 5%, 10%, 20%, 30%, 40%, 50% or more change (e.g., decrease (or increase) relative to a reference value, e.g., a reference where no iRNA is provided).
The invention further relates to the use of an iRNA or a pharmaceutical composition thereof, e.g., for treating a disorder related to ALAS1 expression, in combination with other pharmaceuticals and/or other therapeutic methods, e.g., with known pharmaceuticals and/or known therapeutic methods, such as, for example, those which are currently employed for treating the disorder. In one embodiment, the iRNA or pharmaceutical composition thereof can be administered in conjunction with a heme product (e.g, hemin, heme arginate, or heme albumin, as described herein) and/or in conjunction with intravenous glucose infusions. In some embodiments, the iRNA or pharmaceutical composition thereof is used prophylactically, e.g., to prevent or ameliorate symptoms of an anticipated attack of acute porphyria. The prophylactic use may be timed according to the exposure or anticipated exposure of the subject to a precipitating factor. As described herein, a precipitating factor may be any endogenous or
181 exogenous factor known to precipitate an acute attack. For example, the premenstrual phase is an endogenous precipitating factor, and a cytochrome P450 inducing drug is an exogenous precipitating factor.
The effective amount for the treatment of a disorder related to ALAS1 expression (e.g., a poiphyria such as AIP) dépends on the type of disorder to be treated, the severity of the symptoms, the subject being treated, the sex, âge and general condition of the subject, the mode of administration and so forth. For any given case, an appropriate “effective amount” can be determined by one of ordinary skill in the art using routine expérimentation. It is well within the ability of one skilled in the art to monitor efficacy of treatment or prévention by measuring any one of such parameters, or any combination of parameters. In connection with the administration of an iRNA targeting ALAS1 or pharmaceutical composition thereof, “effective against” a disorder related to ALAS1 expression indicates that administration in a clinically appropriate manner results in a bénéficiai effect, e.g., for an individual patient or for at least a fraction of patients, e.g., a statistically significant fraction of patients. Bénéficiai effects include, e.g., prévention of or réduction of symptoms or other effects. For example, bénéficiai effects include, e.g., an improvement (e.g., decrease in the severity or frequency) of symptoms, a réduction in the severity or frequency of attacks, a reduced risk of developing associated disease (e.g., neuropathy (e.g., progressive neuropathy), hepatocellular cancer), an improved ability to tolerate a precipitating factor, an improvement in quality of life, a réduction in the expression of ALAS1, a réduction in a level (e.g., a plasma or urine level) of a porphyrin or a porphyrin precursor (e.g., ALA and/or PBG) or other effect generally recognized as positive by medical doctors familiar with treating the particular type of disorder.
A treatment or préventive effect is évident when there is an improvement, e.g., a statistically significant improvement in one or more parameters of disease status, or by a failure to worsen or to develop symptoms where they would otherwise be anticipated. As an example, a favorable change of at least 10% in a measurable parameter of disease, e.g., at least 20%, 30%, 40%, 50% or more can be indicative of effective treatment. Efficacy for a given iRNA drug or formulation of that drug can also be judged using an experimental animal model for the given disease as known in the art. When using an experimental animal model, efficacy of treatment is
182 evidenced when a statistically significant réduction in a marker (e.g., plasma or urinary ALA or PBG) or symptom is observed.
Patients can be administered a therapeutic amount of iRNA. The therapeutic amount can be, e.g., 0.05-50 mg/kg. For example, the therapeutic amount can be 0.05, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 2.0, or 2.5, 3.0, 3.5, 4.0, 4.5, 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 mg/kg dsRNA.
In some embodiments, the iRNA is formulated as a lipid formulation, e.g., an LNP formulation as described herein. In some such embodiments, the therapeutic amount is 0.05-5 mg/kg, e.g., 0.05, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, or 5.0 mg/kg dsRNA. In some embodiments, the lipid formulation, e.g., LNP formulation, is administered intravenously.
In some embodiments, the iRNA is administered by intravenous infusion over a period of time, such as over a 5 minute, 10 minute, 15 minute, 20 minute, or 25 minute period.
In some embodiments, the iRNA is in the form of a GalNAc conjugate as described herein. In some such embodiments, the therapeutic amount is 0.5-50 mg, e.g., 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 mg/kg dsRNA. In some embodiments, the GalNAc conjugate is administered subcutaneously.
In some embodiments, the administration is repeated, for example, on a regular basis, such as, daily, biweekly (i.e., every two weeks) for one month, two months, three months, four months or longer. After an initial treatment regimen, the treatments can be administered on a less frequent basis. For example, after administration biweekly for three months, administration can be repeated once per month, for six months or a year or longer.
In some embodiments, the iRNA agent is administered in two or more doses. In some embodiments, the number or amount of subséquent doses is dépendent on the achievement of a desired effect, e.g., suppression of a ALAS gene, réduction of a level of a porphyrin or porphyrin precursor (e.g., ALA and/or PBG), or the achievement of a therapeutic or prophylactic effect, e.g., réduction or prévention of one or more symptoms associated with porphyria (e.g., pain, e.g., neuropathie pain), and/or prévention of attacks or réduction in the frequency and/or severity of attacks associated with porphyria.
183
In some embodiments, the iRNA agent is administered according to a schedule. For example, the iRNA agent may be administered once per week, twice per week, three times per week, four times per week, or five times per week. In some embodiments, the schedule involves regularly spaced administrations, e.g., hourly, every four hours, every six hours, every eight hours, every twelve hours, daily, every 2 days, every 3 days, every 4 days, every 5 days, weekly, biweekly, or monthly. In embodiments, the iRNA agent is administered weekly or biweekly to achieve a desired effect, e.g., to decrease the level of ALA and/or PBG, to decrease pain, and/or to prevent acute attacks.
In embodiments, the schedule involves closely spaced administrations followed by a longer period of time during which the agent is not administered. For example, the schedule may involve an initial set of doses that are administered in a relatively short period of time (e.g., about every 6 hours, about every 12 hours, about every 24 hours, about every 48 hours, or about every 72 hours) followed by a longer time period (e.g., about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, or about 8 weeks) during which the iRNA agent is not administered. In one embodiment, the iRNA agent is initially administered hourly and is later administered at a longer interval (e.g., daily, weekly, biweekly, or monthly). In another embodiment, the iRNA agent is initially administered daily and is later administered at a longer interval (e.g., weekly, biweekly, or monthly). In certain embodiments, the longer interval increases over time or is determined based on the achievement of a desired effect. In a spécifie embodiment, the iRNA agent is administered once daily during an acute attack, followed by weekly dosing starting on the eighth day of administration. In another spécifie embodiment, the iRNA agent is administered every other day during a first week followed by weekly dosing starting on the eighth day of administration.
In one embodiment, the iRNA agent is administered to prevent or reduce the severity or frequency of recurring attacks, e.g., cyclical attacks associated with a precipitating factor. In some embodiments, the precipitating factor is the menstrual cycle. In some embodiments, the iRNA is administered repeatedly, e.g., at regular intervals to prevent or reduce the severity or frequency of recurring attacks, e.g., cyclical attacks associated with a precipitating factor, e.g.,
184 the menstrual cycle, e.g., a particular phase of the menstrual cycle, e.g., the luteal phase. In some embodiments, the iRNA is administered during a particular phase of the menstrual cycle or based on hormone levels ofthe patient being treated (e.g., based on hormone levels that are associated with a particular phase of the menstrual cycle). In some embodiments, the iRNA is administered on one or more particular days ofthe menstrual cycle, e.g., on day 1, 2, 3, 4, 5, 6, 7, 8. 9. 10. 11. 12. 13, 14, 15, 16, 17, 18, 19, 20,21, 22, 23, 24, 25, 26, 27, or on day 28 (or later day for subjects who hâve a longer menstrual cycle). In some embodiments, the iRNA is administered during the luteal phase, e.g., on one or more days between days 14-28 of the menstrual cycle (or later, in subjects who hâve a menstrual cycle longer than 28 days). In some embodiments, ovulation of the subject is assessed (e.g., using a blood or urine test that detects a hormone associated with ovulation, e.g., LH) and the iRNA is administered at a predetermined interval after ovulation. In some embodiments, the iRNA is administered immediately after ovulation. In some embodiments, the iRNA is administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 days after ovulation.Any of these schedules may optionally be repeated for one or more itérations. The number of itérations may dépend on the achievement of a desired effect, e.g., the suppression of a ALAS1 gene and/or the achievement of a therapeutic or prophylactic effect, e.g., reduce or prevent one or more symptoms associated with porphyria, to reduce the ffequency of attacks associated with porphyria.
In some embodiments, an initial dose of the iRNA agent is administered and the level of ALA or PBG is tested, e.g., 1-48 hours, e.g., 2, 4, 8, 12, or 24 hours following administration of the initial dose. In some embodiments, if the level of ALA and/or PBG has decreased (e.g., to achieve a predetermined réduction, e.g., a normalization), and/or if the symptoms associated with porphyria (e.g., pain) hâve improved (e.g., such that the patient is asymptomatic), no further dose is administered, whereas if the level of ALA and/or PBG has not decreased (e.g., has not achieved a predetermined réduction, e.g., has not normalized), a further dose of ALA or PBG is administered. In some embodiments, the further dose is administered 12, 24, 36, 48, 60, or 72 hours after the initial dose. In some embodiments, if the initial dose is not effective to decrease
185 the level of ALA and/or PBG, the further dose is modified, e.g., increased to achieve a desired decrease (e.g., a predetermined réduction, e.g., a noimalization) in ALA or PBG levels.
In some embodiments, the predetermined réduction is a decrease of at least 10%, 20%, 30%, 40%, or 50%. In some embodiments, the predetermined réduction is a réduction that is effective to prevent or ameliorate symptoms, e.g., pain, prodromal symptoms, or recurring attacks.
In some embodiments, the predetermined réduction is a réduction of at least 1, 2, 3, or more standard déviations, wherein the standard déviation is determined based on the values from a reference sample, e.g., a reference sample as described herein.
In some embodiments, the predetermined réduction is a réduction that brings the level of the porphyrin or porphyrin precursor to a level that is less than, or to a level that is less than or equal to, a reference value (e.g., a reference value as described herein).
As used herein, a “normalization” in ALA or PBG levels (or a “normal” or “normalized” level) refers to a level (e.g., a urine and/or plasma level) of either ALA, or PBG, or both, that is within the expected range for a healthy individual, an individual who is asymptomatic (e.g., an individual who does not expérience pain and/or suffer from neuropathy), or an individual who does not hâve a mutation associated with a porphyria. For example, in some embodiments, a normalized level is within two standard déviations of the normal mean. In some embodiments, a noimalized level is within normal reference limits, e.g., within the 95% confidence interval for an appropriate control sample, e.g., a sample of healthy individuals or individuals who do not carry a gene mutation associated with a porphyria. In some embodiments, the ALA and/or PBG level ofthe subject (e.g., the urine and/or plasma ALA and/or PBG level) is monitored at intervals, a further dose of the iRNA agent is administered when the level increases above the reference value
Administration ofthe iRNA may reduce ALAS1 mRNA or protein levels, e.g., in a cell, tissue, blood, urine or other compartment of the patient by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80
186 % or at least 90% or more. Administration of the iRNA may reduce levels of products associated with ALAS1 gene expression, e.g., levels of one or more porphyrins or porphyrin precursors (e.g., the level of ALA and/or PBG). Administration of the iRNA agent may also inhibit or prevent the upregulation of ALAS1 mRNA or protein levels during an acute attack of
AIP.
Before administration of a full dose of the iRNA, patients can be administered a smaller dose, such as a 5% infusion dose, and monitored for adverse effects, such as an allergie reaction, or for elevated lipid levels or blood pressure. In another example, the patient can be monitored for unwanted effects.
Methods for modulating expression of an ALAS1 gene
In yet another aspect, the invention provides a method for modulating (e.g., inhibiting or activating) the expression of an ALAS1 gene, e.g., in a cell or in a subject. In some embodiments, the cell is ex vivo, in vitro, or in vivo. In some embodiments, the cell is an erythroid cell or a hépatocyte. In some embodiments, the cell is in a subject (e.g., a mammal, such as, for example, a human). In some embodiments, the subject (e.g., the human) is at risk, or is diagnosed with a disease related to ALAS1 expression, as described above.
In one embodiment, the method includes contacting the cell with an iRNA as described herein, in an amount effective to decrease the expression of an ALAS1 gene in the cell. “Contacting,” as used herein, includes directly contacting a cell, as well as indirectly contacting a cell. For example, a cell within a subject (e.g., an erythroid cell or a liver cell, such as a hépatocyte) may be contacted when a composition comprising an iRNA is administered (e.g., intravenously or subcutaneously) to the subject.
The expression of an ALAS1 gene may be assessed based on the level of expression of an ALAS1 mRNA, an ALAS1 protein, or the level of a parameter functionally linked to the level of expression of an ALAS1 gene (e.g., the level of a porphyrin or the incidence or severity of a symptom related to a porphyria). In some embodiments, the expression of ALAS1 is inhibited by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at
187 least 75%, at least 80%, at least 85%, at least 90%, or at least 95%. In some embodiments, the iRNA has an IC5o in the range of 0.001-0.01 nM, 0.001-0.10 nM, 0.001-1.0 nM, 0.001-10 nM, 0.01-0.05 nM, 0.01-0.50 nM, 0.02-0.60 nM, 0.01-1.0 nM, 0.01-1.5 nM, 0.01-10 nM. The IC50 value may be normalized relative to an appropriate control value, e.g., the IC50 of a non-targeting iRNA.
In some embodiments, the method includes introducing into the cell an iRNA as described herein and maintaining the cell for a time sufficient to obtain dégradation of the mRNA transcript of an ALAS1 gene, thereby inhibiting the expression of the ALAS1 gene in the cell.
In one embodiment, the method includes administering a composition described herein, e.g., a composition comprising an iRNA that targets ALAS1, to the mammal such that expression of the target ALAS1 gene is decreased, such as for an extended duration, e.g., at least two, three, four days or more, e.g., one week, two weeks, three weeks, or four weeks or longer. In some embodiments, the decrease in expression of ALAS1 is détectable within 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, or 24 hours of the first administration.
In another embodiment, the method includes administering a composition as described herein to a mammal such that expression of the target ALAS1 gene is increased by e.g., at least 10% compared to an untreated animal. In some embodiments, the activation of ALAS1 occurs over an extended duration, e.g., at least two, three, four days or more, e.g., one week, two weeks, three weeks, four weeks, or more. Without wishing to be bound by theory, an iRNA can activate ALAS1 expression by stabilizing the ALAS1 mRNA transcript, interacting with a promoter in the genome, and/or inhibiting an inhibitor of ALAS1 expression.
The iRNAs useful for the methods and compositions featured in the invention specifically target RNAs (primary or processed) of an ALAS1 gene. Compositions and methods for inhibiting the expression of an ALAS1 gene using iRNAs can be prepared and performed as described elsewhere herein.
In one embodiment, the method includes admmistering a composition containing an iRNA, where the iRNA includes a nucléotide sequence that is complementary to at least a part of an RNA transcript of the ALAS1 gene of the mammal to be treated. When the organism to be
188 treated is a mammal such as a human, the composition may be administered by any means known in the art including, but not limited to oral, intraperitoneal, or parentéral routes, including intracranial (e.g., intraventricular, intraparenchymal and intrathecal), intravenous, intramuscular, subcutaneous, transdermal, airway (aérosol), nasal, rectal, and topical (including buccal and sublingual) administration.
In certain embodiments, the compositions are administered by intravenous infusion or injection. In some such embodiments, the compositions comprise a lipid formulated siRNA (e.g., an LNP formulation, such as an LNP11 formulation) for intravenous infusion. In particular embodiments, such compositions may be used to treat acute attacks of porphyria and/or for prophylaxis (e.g., to decrease the severity or frequency of attacks).
In othei' embodiments, the compositions are administered subcutaneously. In some such embodiments, the compositions comprise an iRNA conjugated to a GalNAc ligand. In particular embodiments, such compositions may be used to treat acute attacks of poiphyria or for prophylaxis (e.g., to decrease the severity or frequency of attacks).
Methods for decreasing a level of a porphyrin or porphyrin precursor
In another aspect, the invention provides a method for decreasing a level of a porphyrin or a poiphyrin precursor, e.g, in a cell or in a subject.
In some embodiments, the cell is ex vivo, in vitro, or in vivo. In some embodiments, the cell is an erythroid cell or a hépatocyte. In some embodiments, the cell is a hépatocyte. In some embodiments, the cell is in a subject (e.g., a mammal, such as, for example, a human).
In some embodiments, the subject (e.g., the human) is at risk, or is diagnosed with a porphyria, as described herein. In some embodiments, the method is effective to treat a poiphyria as described herein (e.g., by ameliorating one or more symptoms associated with a porphyria, reducing the frequency of attacks associated with a porphyria, reducing the likelihood that an attack of one or more symptoms associated with porphyria will occur upon exposure to a precipitating factor, or reducing the risk of developing conditions associated with a porphyria (e.g., neuropathy (e.g., progressive neuropathy), hepatocellular cancer). In one embodiment, the method includes contacting the cell with an RNAi, as described herein, in an amount sufficient to
189 decrease the level of the porphyrin or porphyrin precursor (e.g., ALA or PBG) in the cell, or in another related cell or group of cells, or in the subject. “Contacting,” as used herein, includes directly contacting a cell, as well as indirectly contacting a cell. For example, a cell within a subject (e.g., an erythroid cell or a liver cell, such as a hépatocyte) may be contacted when a composition comprising an RNAi is administered (e.g., intravenously or subcutaneously) to the subject. “Another related cell or group of cells,” as used herein, includes any cell or group of cells in which the level of the porphyrin or porphyrin precursor decreases as a resuit of the contacting. For example, the cell may be part of a tissue présent within a subject (e.g., a liver cell présent within a subject), and contacting the cell within the subject (e.g., contacting one or more liver cells présent within a subject) with the RNAi may resuit in a decrease in the level of the porphyrin or porphyrin precursor in another related cell or group of cells (e.g., nerve cells of the subject), or in a tissue or fluid ofthe subject (e.g., in the urine, blood, plasma, or cerebrospinal fluid of the subject).
In some embodiments, the porphyrin or porphyrin precursor is selected from the group consisting of δ-aminolevulinic acid (ALA), porphopilinogen (PBG), hydroxymethylbilane (HMB), uroporphyrinogen III, copropoiphyrinogen III, protopoiphrinogen IX, and protopoiphyrin IX In some embodiments the porphyrin precursor is ALA. In some embodiments, the porphyrin precursor is PBG. In some embodiments, the method decreases the level of ALA and PBG. The level of a porphyrin or a poiphyrin precursor may be measured as described herein and as known in the art.
Assays and Methods for Monitoring RNAi activity
In another aspect, the invention provides assays and methods for monitoring ALAS1 mRNA levels. RNAi activity in the liver can be monitored by detecting mRNA levels or 5’RACE product in tissue, or by detecting the level of circulating secreted protein.
Alternatively, or in combination, circulating extracellular levels of ALAS1 mRNA can be detected, e.g., by cERD assays (Circulating Extracellular RNA Détection). In some embodiments, the ALAS1 mRNA level can be detected in a bodily fluid sample, e.g., a seium or urine sample. In some embodiments, exosomes are shed into bodily fluids from different cells
190 types, which contain mRNA and miRNA derived from a tissue of origin. Such exosomes can be used to monitor the level of RNAi in circulation. In one embodiment, a sample, e.g., a sérum or urine sample from a subject treated with an iRNA described herein can be purified with low speed spin, followed by a spin at about 160,000g for about 2 hours to form a pellet. RNA can be extracted and analyzed to measure the levels of ALAS1 mRNA. Exemplary methods and assays are disclosed in PCT/US2012/043584, published as WO 2012/177906, the contents of which are incorporated by reference.
Accordingly, an assay, or method, is provided for detecting the level of circulating extracellular ALAS1 mRNA in a subject. The assay, or method includes providing RNA (e.g., extracellular RNA) from a biological fluid sample (e.g., urine, blood or plasma sample) from the subject, said biological fluid sample comprising the ALAS1 mRNA; and detecting the level of circulating extracellular ALAS1 mRNA in the sample.
In one embedment, the assay or method includes the step of obtaining an ALAS1 cDNA from the ALAS1 mRNA; and contacting the ALAS1 cDNA with a nucleic acid complementary (e.g., probe and/or primer) to the ALAS 1 cDNA or a portion thereof, thereby producing a reaction mix; and detecting (e.g., measuring) the level of ALAS1 cDNA in the reaction mix, wherein the ALAS1 cDNA level is indicative of the ALAS1 mRNA level, thereby assaying the level of circulating extracellular ALAS1 mRNA in the subject.
In one embodiment, the assay or method includes acquiring a biological fluid sample from a subject, where the biological sample is separate from the tissue, and where the biological sample contains exosomes. The assay or method can fuither include detecting the levels of an RNA in the biological sample, where the RNA is expressed from the gene in the tissue of the subject, where the exosomes are not purified from the biological sample prior to detecting levels of RNA in the biological sample.
In embodiments, said biological fluid sample is a blood sample. In embodiments, said biological fluid sample is a sérum sample. In another embodiment, the biological fluid sample is a urine sample.
In embodiments, the the method comprises PCR, qPCR or 5’-RACE.
In embodiments, said nucleic acid is a probe or primer.
191
In embodiments, said nucleic acid comprises a détectable moiety and the level of ALAS1 mRNA is determined by détection of the amount of the détectable moiety.
In embodiments, said method further comprises obtaining the biological fluid sample from the subject.
In embodiments of these methods, the efficacy of a porphyria treatment is assessed based on a comparison of the level of circulating extracellular ALAS1 mRNA in the subject relative to a reference value.
In embodiments, a decrease in the level of circulating extracellular ALAS1 mRNA in the subject in response to the porphyria treatment, relative to the reference value, indicates that the porphyria treatment is efficacious. In embodiments, the reference value is the level of circulating extracellular ALAS1 mRNA in the subject prior to the porphyria treatment.
Unless otherwise defined, ail technical and scientifîc terms used herein hâve the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or équivalent to those described herein can be used in the practice or testing of the iRNAs and methods featured in the invention, suitable methods and materials are described below. Ail publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the présent spécification, including définitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
EXAMPLES
Example 1. siRNA synthesis
Source of reagents
Where the source of a reagent is not specifically given herein, such reagent may be obtained from any supplier of reagents for molecular biology at a quality/purity standard for application in molecular biology.
192
Oligonucleotide Synthesis.
Ail oligonucleotides are synthesized on an AKTAoligopilot synthesizer. Commercially available controlled pore glass solid support (dT-CPG, 500Â, Prime Synthesis) and RNA phosphoramidites with standard protecting groups, 5’-O-dimethoxytrityl N6-benzoyl-2’-Zbutyldimethylsilyl-adenosine-3’ -O-N,N’ -diisopropyl-2-cyanoethylphosphoramidite, 5’-Odimethoxytrityl-N4-acetyl-2’-i-butyldimethylsilyl-cytidine-3’-O-N,N’-diisopropyl-2cyanoethylphosphoramidite, 5’-O-dimethoxytrityl-N2—isobutryl-2’-Tbutyldimethylsilylguanosine-3 ’-O-N,N’-diisopropyl-2-cyanoethylphosphoramidite, and 5’-O-dimethoxytrityl-2’-ibutyldimethylsilyl-uridine-3 ’-0-N,N’-diisopropyl-2-cyanoethylphosphoramidite (Pierce Nucleic Acids Technologies) were used for the oligonucleotide synthesis. The 2’-F phosphoramidites, 5’O-dimethoxytrityl-N4-acetyl-2’-fluro-cytidine-3’-(9-N,N’-diisopropyl-2-cyanoethylphosphoramidite and 5’-0-dimethoxytrityl-2’-fluro-uridine-3’-O-N,N’-diisopropyl-2cyanoethyl-phosphoramidite are purchased from (Promega). Ail phosphoramidites are used at a concentration of 0.2M in acetonitrile (CH3CN) except for guanosine which is used at 0.2M concentration in 10% THF/ANC (v/v). Coupling/recycling time of 16 minutes is used. The activator is 5-ethyl thiotetrazole (0.75M, American International Chemicals); for the POoxidation iodine/water/pyridine is used and for the PS-oxidation PADS (2%) in 2,6lutidine/ACN (1:1 v/v) isused.
3’-ligand conjugated strands are synthesized using solid support containing the corresponding ligand. For example, the introduction of cholestérol unit in the sequence is performed from a hydroxyprolinol-cholesterol phosphoramidite. Cholestérol is tethered to trans-
4-hydroxyprolinol via a 6-aminohexanoate linkage to obtain a hydroxyprolinol-cholesterol moiety. 5’-end Cy-3 and Cy-5.5 (fluorophore) labeled iRNAs are synthesized from the corresponding Quasar-570 (Cy-3) phosphoramidite are purchased from Biosearch Technologies. Conjugation of ligands to 5’-end and or internai position is achieved by using appropriately protected ligand-phosphoramidite building block. An extended 15 min coupling of 0.1 M solution of phosphoramidite in anhydrous CH3CN in the presence of 5-(ethylthio)-17/-tetrazole activator to a solid-support-bound oligonucleotide. Oxidation of the intemucleotide phosphite to the phosphate is carried out using standard iodine-water as reported (1) or by treatment with tert
193 butyl hydroperoxide/acetonitrile/water (10: 87: 3) with 10 min oxidation wait time conjugated oligonucleotide. Phosphorothioate is introduced by the oxidation of phosphite to phosphorothioate by using a sulfur transfer reagent such as DDTT (purchased from AM Chemicals), PADS and or Beaucage reagent. The cholestérol phosphoramidite is synthesized in house and used at a concentration of 0.1 M in dichloromethane. Coupling time for the cholestérol phosphoramidite is 16 minutes.
Deprotection I (Nucleobase Deprotection)
After completion of synthesis, the support is transferred to a 100 mL glass bottle (VWR). The oligonucleotide is cleaved from the support with simultaneous deprotection of base and phosphate groups with 80 mL of a mixture of ethanolic ammonia [ammonia: éthanol (3:1)] for 6.5 h at 55°C. The bottle is cooled briefly on ice and then the ethanolic ammonia mixture is fîltered into a new 250-mL bottle. The CPG is washed with 2 x 40 mL portions of ethanol/water (1:1 v/v). The volume of the mixture is then reduced to ~ 30 mL by roto-vap. The mixture is then ffozen on dry ice and dried under vacuum on a speed vac.
Deprotection II (Removal of 2’-TBDMS group)
The dried residue is resuspended in 26 mL of triethylamine, triethylamine trihydrofluoride (TEA*3HF) or pyridine-HF and DMSO (3:4:6) and heated at 60°C for 90 minutes to remove the /erAbutyldimethylsilyl (TBDMS) groups at the 2’ position. The reaction is then quenched with 50 mL of 20 mM sodium acetate and the pH is adjusted to 6.5. Oligonucleotide is stored in a freezer until purification.
Analysis
The oligonucleotides are analyzed by high-performance liquid chromatography (HPLC) prior to purification and sélection of buffer and column dépends on nature of the sequence and or conjugated ligand.
HPLC Purification
194
The ligand-conjugated oligonucleotides are purifïed by reverse-phase préparative HPLC.
The unconjugated oligonucleotides are purified by anion-exchange HPLC on a TSK gel column packed in house. The buffers are 20 mM sodium phosphate (pH 8.5) in 10% CH3CN (buffer A) and 20 mM sodium phosphate (pH 8.5) in 10% CH3CN, lMNaBr (buffer B). Fractions containing full-length oligonucleotides are pooled, desalted, and lyophilized. Approximately 0.15 OD of desalted oligonucleotidess are diluted in water to 150 pL and then pipetted into spécial vials for CGE and LC/MS analysis. Compounds are then analyzed by LC-ESMS and CGE.
siRNA préparation
For the general préparation of siRNA, equimolar amounts of sense and antisense strand are heated in lxPBS at 95 °C for 5 min and slowly cooled to room température. Integrity of the duplex is confïrmed by HPLC analysis.
Nucleic acid sequences are represented below using standard nomenclature, and specifically the 15 abbreviations of Table 1.
Table 1: Abbreviations of nucléotide monomers used in nucleic acid sequence représentation. It will be understood that these monomers, when présent in an oligonucleotide, are mutually linked by 5'-3'-phosphodiester bonds.
Abbreviation Nucleotide(s)/ Nucleosides
A Adenosine-3’-phosphate, 2’-deoxy-2’-fluorouridine-5’-phosphate or adenosine
Ab beta-L-adenosine-3'-phosphate, beta-L-adenosine-5'-phosphate or beta-L-adenosine
Abs beta-L-adenosine-3 ' -phosphorothioate
Af 2’-deoxy-2’-fluoroadenosine-3 ’-phosphate, 2’-deoxy-2’fluoroadenosine-5’-phosphate or 2’-deoxy-2’-fluoroadenosine
Afs 2 ’ -deoxy-2 ’ -fluoro adenosine-3 ’ -phosphorothio ate
As adenosine-3 ’ -phosphorothioate
C cytidine-3’-phosphate, cytidine-5’-phosphate or cytidine
Cb beta-L-cytidine-3'-phosphate or beta-L-cytidine
Cbs beta-L-cytidine-3'-phosphorothioate
Cf 2’-deoxy-2’-fluorocytidine-3’-phosphate, 2’-deoxy-2’fluorocytidine-5’-phosphate or 2’-deoxy-2’-fluorocytidine
195
Cfs 2’-deoxy-2’-fluorocytidine-3’-phosphorothioate
(Chd) 2'-O-hexadecyl-cytidine-3 '-phosphate or 2'-O-hexadecyl-cytidine
(Chds) 2'-O-hexadecyl-cytidine-3'-phosphorothioate
Cs cytidine-3 ’-phosphorothioate
G guanosine-3’-phosphate, guanosine-5’-phosphate or guanosine
Gb beta-L-guanosine-3'-phosphate, beta-L-guanosine-5'-phosphate or beta-L-guanosine
Gbs beta-L-guanosine-3 ' -phosphorothioate
Gf 2’-deoxy-2’-fluoroguanosine-3’-phosphate, 2’-deoxy-2’fluoroguanosine-5’ -phosphate or 2’-deoxy-2 ’-fluoroguanosine
Gfs 2 ’ -deoxy-2 ’-fluoroguanosine-3 ’ -phosphorothioate
Gs guanosine-3 ’-phosphorothioate
T 5’-methyluridine-3’-phosphate, 5’-methyluridine-5’-phosphate or 5’methyluridine
Tb b eta-L-thymidine-3-phosphate, beta-L-thymidine-5'-phosphate or b eta-L-thymidine
Tbs b eta-L-thymidine-3 '-phosphorothioate
Tf 2’-deoxy-2’-fluoro-5-methyluridine-3 ’-phosphate, 2’-deoxy-2’fluoro-5-methyluridine-3’-phosphate or 2’-deoxy-2’-fluoro-5methyluridine
Tfs 2 ’ -deoxy-2 ’ -fluoro-5-methyluridine-3 ’-phosphorothioate
Ts 5-methyluridine-3’-phosphorothioate
U Uridine-3’-phosphate, uridine-5’-phosphate or uridine-
Ub beta-L-uridine-3'-phosphate, beta-L-uridine-5'-phosphate or beta-Luridine
Ubs beta-L-uridine-3 ' -phosphorothio ate
Uf 2’-deoxy-2’-fluorouridine-3’-phosphate, 2’-deoxy-2’-fluorouridine or 2’-deoxy-2 ’-fIuorouridine-3 ’-phosphate
Ufs 2’-deoxy-2’-fluorouridine -3 ’-phosphorothioate
(Uhd) 2'-O-hexadecyl-uridine-3 '-phosphate, 2'-O-hexadecyl-uridine-6'phosphate or 2'-O-hexadecyl-uridine
(Uhds) 2'-O-hexadecyI-uridine-3'-phosphorothioate
Us uridine -3’-phosphorothioate
N any nucléotide (G, A, C, T or U)
a 2'-0-methyladenosine-3 ’ -phosphate, 2'-O-methyladenosine-5 ’ phosphate or 2'-O-methyladenosine
196
as 2'-O-methyladenosine-3 phosphorothioate
c 2'-O-methylcytidine-3 ’ -phosphate, 2'-O-methylcytidine-5 ’-phosphate or 2'-O-methylcytidine
CS 2'-O-methylcytidine-3 ’- phosphorothioate
g 2'-0-methylguanosine-3 ’-phosphate, 2'-O-methylguanosine-5’phosphate or 2'-O-methylguanosine
gs 2'-0-methylguanosine-3 ’- phosphorothioate
t 2’-O-methyl-5-methyluridine-3’-phosphate, 2’-O-methyl-5methyluridine-5’-phosphate or 2’-O-methyl-5-methyluridine
ts 2 ’ -O-methyl-5 -methyluridine-3 ’ -phosphorothioate
u 2'-O-methyluridine-3’-phosphate, 2'-O-methyluridine-5’-phosphate or 2'-O-methyluridine
us 2'-O-methyluridine-3 ’ -phosphorothioate
dA 2' -deoxyadenosine-3 ' -phosphate, 2' -deoxyadenosine-5' -phosphate or 2'-deoxyadenosine
dAs 2' -deoxyadenosine-3 ' -phosphorothioate
dC 2'-deoxycytidine-3'-phosphate, 2'-deoxycytidine-5'-phosphate or 2'deoxycytidine
dCs 2' -deoxycytidine-3 ' -phosphorothioate
dG 2' -deoxyguanosine-3 ' -phosphate, 2' -deoxyguanosine-5 ' -phosphate or 2'-deoxyguanosine
dGs 2'-deoxyguanosine-3'-phosphorothioate or 2'-deoxyguanosine
dT 2'-deoxythymidine-3’-phosphate, 2'-deoxythyniidine-5’-phosphate or 2'-deoxythymidine
dTs 2'-deoxythymidine-3 ' -phosphorothioate
dU 2'-deoxyuridine-3’-phosphate, 2'-deoxyuridine-5’-phosphate or 2deoxyuridine
s phosphorothioate linkage
L961 N-[tris(GalNAc-alkyl)-amidodecanoyl)]-4-hydroxyprolinol Hyp(GalNAc-alkyl)3
(Aeo) 2’-O-methoxyethyladenosine-3’-phosphate, 2’-Omethoxyethyladenosine-5’-phosphate or 2’-Omethoxyethyladenosine
(Aeos) 2’-O-methoxyethyladenosine-3’-phosphorothioate
(Ceo) 2’-O-methoxyethylcytidine-3 ’-phosphate, 2’-Omethoxyethylcytidine-5’-phosphate or 2’-O-methoxyethylcytidine
(Ceos) 2’-O-methoxyethylcytidine-3’-phosphorothioate
197
(Geo) 2’-O-methoxyethylguanosine-3 ’-phosphate, 2’-Omethoxyethylguanosine-5’-phosphate or 2’-Omethoxyethylguanosine
(Geos) 2’-O-methoxyethylguanosine-3 phosphorothioate
(Teo) 2’-O-methoxyethyl-5-methyluridine-3 ’-phosphate, 2’-Omethoxyethyl-5-methyluridine-5’-phosphate or 2’-O-methoxyethyl5-methyluridine
(Teos) 2’-O-methoxyethyl-5-methyluridine-3 ’- phosphorothioate
(m5Ceo) 2’-O-methoxyethyl-5-methylcytidine-3 ’-phosphate, 2’-Omethoxyethyl-5-methylcytidine-5’-phosphate or 2’-O-methoxyethyl5 -methylcytidine
(m5Ceos) 2’-O-methoxyethyl-5-methylcytidine-3 ’- phosphorothioate
(Agn) 1-(2,3 -Dihydroxypropyl) adenine-2-pho sphate, 1-(2,3Dihydroxypropyl)adenine-3-phosphate or l-(2,3-Dihydroxypropyl) adenine
(Agns) l-(2,3-Dihydroxypropyl)adenine-2-phosphorothioate
(Cgn) 1 -(2,3 -Dihydroxypropyl)cytosine-2-phosphate, 1 -(2,3 Dihydroxypropyl)cytosine-3-phosphate or 1-(2,3-Dihydroxypropyl) cytosine
(Cgns) 1 -(2,3 -Dihydroxypropyl)cytosine-2-phosphorothioate
(Ggn) l-(2,3-Dihydroxypropyl)guanine-2-phosphate, 1-(2,3Dihydroxypropyl)guanine-3-phosphate or l-(2,3-Dihydroxypropyl) guanine
(Ggns) l-(2,3-Dihydroxypropyl)guanine-2-phosphorothiaote
(Tgn) l-(2,3-Dihydroxypropyl)thymine-2-phosphate, 1-(2,3Dihydroxypropyl)thymine-3-phosphate or l-(2,3-Dihydroxypropyl) thymine
(Tgns) l-(2,3-Dihydroxypropyl)thymine-2-phosphorothioate
(Ugn) 1 -(2,3 -Dihydroxypropyl)uracil-2-phosphate, 1-(2,3Dihydroxypropyl)uracil-3-phosphate or l-(2,3-Dihydroxypropyl) thymine
(Ugns) l-(2,3-Dihydroxypropyl)uracil-2-phosphorothioate
'The chemical structure of L96 is as foliows:
198
Triantennary GalNAc <
frans-4-Hydroxyprolinol
C12 - Diacroboxyhc Acid Tether
Site of Conjugation
Example 2. ALAS1 siRNA Design and Synthesis
Experimental Methods
Bioinformatics
Transcripts siRNA design was carried out to identify siRNAs targeting human, rhésus (Macaca mulatta), mouse, and rat ALAS1 transcripts annotated in the NCBI Gene database (http://www.ncbi.nlm.nih.gov/gene/). Design used the following transcripts from the NCBI RefSeq collection: Human -NM_000688.4 (see FIG.3), NM_199166.1; Rhésus XM_001090440.2, XM_001090675.2; Mouse - NM_020559.2; Rat -NM_024484.2. Due to high primate/ rodent sequence divergence, siRNA duplexes were designed in several separate batches, including but not limited to batches containing duplexes matching human and rhésus transcripts only; human, rhésus, mouse, and rat transcripts only; and mouse and rat transcripts only. Most siRNA duplexes were designed that shared 100% identity the listed human transcript and other species transcripts considered in each design batch (above). In some instances, (see Table 8) mismatches between duplex and mRNA target were allowed at the first antisense (last sense) position when the antisense strand:target mRNA complementary basepair was a GC or CG pair. In these cases, duplexes were designed with UA or AU pairs at the first antisense:last sense pair. Thus the duplexes maintained complementarity but were mismatched with respect to target (U:C, U:G, A:C, or A:G). Eighteen of these “UA-swap” duplexes were designed as part of the
199 human/rhesus/mouse/rat set (see duplexes in Table 8 with “C19U”, “G19U”, “C19A”, or “G19A” labels in the Position column).
siRNA Design, Specificity, and Efficacy Prédiction
The predicted specificity of ail possible 19mers was predicted from each sequence.
Candidate 19mers were then selected that lacked repeats longer than 7 nucléotides. These 1510 candidate human/rhesus, 114 human/rhesus/mouse/rat, and 717 mouse/rat siRNAs were used in comprehensive searches against the appropriate transcriptomes (defined as the set of NM_ and XM_ records within the human, rhésus, dog, mouse, or rat NCBI Refseq sets) using an exhaustive “brute-force” algorithm implemented in the python script ‘BruteForce.py’. The script next parsed the transcript-oligo alignments to generate a score based on the position and number of mismatches between the siRNA and any potential 'off-target' transcript. The off-target score is weighted to emphasize différences in the 'seed' région of siRNAs, in positions 2-9 from the 5' end of the molécule. Each oligo-transcript pair from the brute-force search was given a mismatch score by summing the individual mismatch scores; mismatches in the position 2-9 were counted as 2.8, mismatches in the cleavage site positions 10-11 were counted as 1.2, and mismatches in région 12-19 counted as 1.0. An additional off-target prédiction was carried out by comparing the frequency of heptamers and octomers derived from 3 distinct, seed-derived hexamers of each oligo. The hexamers from positions 2-7 relative to the 5’ start is used to create 2 heptamers and one octomer. We create ‘heptamerl ’ by adding a 3 ’ A to the hexamer; we create heptamer2 by adding a 5Ά to the hexamer; we create the octomer by adding an A to both 5’ and 3 ’ ends of the hexamer. The frequency of octomers and heptamers in the human, rhésus, mouse, or rat 3’UTRome (defined as the subsequence of the transcriptome from NCBI’s Refseq database where the end of the coding région, the ‘CDS’, is clearly defined) was pre-calculated. The octomer frequency was normalized to the heptamer frequency using the médian value from the range of octomer frequencies. A ‘mirSeedScore’ was then calculated by calculating the sum of ( (3 X normalized octomer count ) + ( 2 X heptamer2 count) + (1 X heptamerl count)).
Both siRNAs strands were assigned to a category of specificity according to the calculated scores: a score above 3 qualifies as highly spécifie, equal to 3 as spécifie and between 2.2 and 2.8 as moderately spécifie. We sorted by the specificity of the antisense strand. We then
200 selected duplexes whose antisense oligos lacked GC at the first position, lacked G at both positions 13 and 14, and had 3 or more Us or As in the seed région (characteristics of duplexes with high predicted efficacy)
Candidate GalNac-conjugated duplexes, 21 and 23 nucléotides long on the sense and antisense strands respectively, were designed by extending antisense 19mers 4 additional nucléotides in the 3’ direction (preserving perfect complementarity with the target transcript). The sense strand was specified as the reverse complément of the first 21 nucléotides of the antisense 23mer. Duplexes were selected that maintained perfect matches to ail selected species transcripts across ail 23 nucléotides.
siRNA sequence sélection
A total of 90 sense and 90 antisense derived human/rhesus, 40 sense and 40 antisense derived human/rhesus/mouse/mouse/rat, and 40 sense and 40 antisense derived mouse/rat siRNA 19mer oligos were synthesized and formed into duplexes. A total of 45 sense and 45 antisense derived human/rhesus 21/23mer oligos were synthesized to yield 45 GalNac-conjugated duplexes.
The sequences of the sense and antisense strands of the modified duplexes are shown in Table 2, and the sequences of the sense and antisense strands of the unmodified duplexes are shown in Table 3.
Synthesis of ALAS1 Sequences
ALAS1 sequences were synthesized on MerMade 192 synthesizer at either 1 or 0.2umol scale. Single strands were made with 2’O-methyl modifications for in vitro screening using transfection reagents. 3’ GalNAc conjugates were made with sequences containing 2’F and 2’-Omethyl modifications on the sense strand in the 21-23 mer designs for free uptake in cells. For ail the 21mer sequences in the list, ‘endolight’ chemistry was applied as detailed below.
• Ail pyrimidines (cytosine and uridine) in the sense strand contained 2’-O-Methyl bases (2’ Ο-Methyl C and 2’-O-Methyl U) • In the antisense strand, pyrimidines adjacent to(towards 5’ position) ribo A nucleoside were replaced with their corresponding 2-O-Methyl nucleosides
201 • A two base dTsdT extension at 3’ end of both sense and anti sense sequences was introduced • The sequence file was converted to a text file to make it compatible for loading in the MerMade 192 synthesis software
For GalNAc conjugated sense strands and complementary antisense sequences, 2’F and other modified nucleosides were introduced in combination with ribo with 2’0-Methyl nucleosides. The synthesis was performed on a GalNAc modified CPG support for the sense strand and CPG modified with universal support on the antisense sequence.
Synthesis, Cleavage and deprotection:
The synthesis of ALAS1 sequences used solid supported oligonucleotide synthesis using phosphoramidite chemistry. For 21 mer endolight sequences, a deoxy thymidine CPG was used as the solid support while for the GalNAc conjugates, GalNAc solid support for sense strand and an universal CPG for the antisesense strand were used.
The synthesis of the above sequences was performed at either 1 or 0.2um scale in 96 well plates. The amidite solutions were prepared at 0.1M concentration and ethyl thio tetrazole (0.6M in Acetonitrile) was used as activator.
The synthesized sequences were cleaved and deprotected in 96 well plates, using methylamine in the first step and fluoride reagent in the second step. For GalNAc and 2’F nucleoside containing sequences, deprotection conditions were modified. Sequences after cleavage and deprotection were precipitated using acetone: éthanol (80:20) mix and the pellet were re-suspended in 0.2M sodium acetate buffer. Samples from each sequence were analyzed by LC-MS to confirm the identity, UV for quantification and a selected set of samples by IEX chromatography to détermine purity.
Purification and desalting:
ALAS1 sequences were precipitated and purified on AKTA Purifier system using Sephadex column. The ALASless was run at ambient température. Sample injection and collection was performed in 96 well (1.8mL -deep well) plates. A single peak corresponding to the fu.ll length sequence was collected in the eluent. The desalted ALAS1 sequences were
202 analyzed for concentration (by UV measurement at A260) and purity (by ion exchange HPLC).
The complementary single strands were then combined in a 1:1 stoichiometric ratio to form siRNA duplexes.
Table 2: Human ALAS1 Modified Single Strands and Duplex Sequences
SEQID NO: (sense) SEQID NO: (antisense) Position on transcri pt NM_ 000688.4 Duplex Name Sense Sequence (5'-3') Antisense Sequence (5'-3')
2 3 522-540 AD-55078.2 cuccGGccAGuGAGAAAGAdTsdT UCUUUCUcACUGGCCGGAGdTsdT
4 5 669-687 AD-55084.2 uGGcAGcAcAGAuGAAucAdTsdT UGAUUcAUCUGUGCUGCcAdTsdT
6 7 790-808 AD-55090.2 cAGuGuGGuuAGuGuGAAAdTsdT UUUcAcACuAACcAcACUGdTsdT
S 9 853-871 AD-55096.2 cAucAuGcAAAAGcAAAGAdTsdT UCUUUGCUUUUGcAUGAUGdTsdT
10 11 876-894 AD-55102.2 AAAGAGuGucucAucuucudTsdT AGAAG AU GAG AcACUCU U UdTsdT
12 13 877-895 AD-55106.2 AAGAGuGucucAucuucuudTsdT AAGAAGAUGAGAcACUCUUdTsdT
14 15 914-932 AD-55111.2 ucuGuuuccAcuuuucAGudTsdT ACUGAAAAGUGGAAAcAGAdTsdT
16 17 923-941 AD-55073.2 AcuuuucAGuAuGAucGuudTsdT AACGAUcAuACUGAAAAGUdTsdT
18 19 926-944 AD-55079.2 uuucAGuAuGAucGuuucudTsdT AGAAACGAUcAuACUGAAAdTsdT
20 21 927-945 AD-55085.2 uucAGuAuGAucGuuucuudTsdT AAGAAACGAUcAuACUGAAdTsdT
22 23 928-946 AD-55091.2 ucAGuAuGAucGuuucuuudTsdT AAAGAAACGAUcAuACUGAdTsdT
24 25 932-950 AD-55097.2 uAuGAucGuuucuuuGAGAdTsdT UCUcAAAGAAACGAUcAuAdTsdT
26 27 973-991 AD-55103.2 uGAccAcAccuAucGAGuudTsdT AACUCGAuAGGUGUGGUcAdTsdT
28 29 975-993 AD-55107.2 AccAcAccuAucGAGuuuudTsdT AAAACUCGAuAGGUGUGGUdTsdT
30 31 1029-1047 AD-55112.2 uGGcAGAuGAcuAuucAGAdTsdT UCUGAAuAGUcAUCUGCcAdTsdT
32 33 1077-1095 AD-55074.2 ucuGGuGcAGuAAuGAcuAdTsdT uAGUcAUuACUGcACcAGAdTsdT
34 35 1124-1142 AD-55080.2 uGuGGGGcAGuuAuGGAcAdTsdT UGUCcAuAACUGCCCcAcAdTsdT
36 37 1137-1155 AD-55086.2 uGGAcAcuuuGAAAcAAcAdTsdT UGUUGUUUcAAAGUGUCcAdTsdT
38 39 1182-1200 AD-55098.2 AuAuuucuGGAAcuAGuAAdTsdT UuACuAGUUCcAGAAAuAUdTsdT
40 41 1184-1202 AD-55104.2 AuuucuGGAAcuAGuAAAudTsdT AUUuACuAGUUCcAGAAAUdTsdT
42 43 1185-1203 AD-55108.2 uuucuGGAAcuAGuAAAuudTsdT AAU U u ACu AGU UCcAGAAAdTsdT
44 45 1188-1206 AD-55113.2 cuGGAAcuAGuAAAuuccAdTsdT UGGAAUUuACuAGUUCcAGdTsdT
46 47 1325-1343 AD-55075.2 uGuGAGAuuuAcucuGAuudTsdT AAUcAGAGuAAAUCUcAcAdTsdT
48 49 1364-1382 AD-55081.2 AuccAAGGGAuucGAAAcAdTsdT UGUUUCGAAUCCCUUGGAUdTsdT
50 51 1382-1400 AD-55087.2 AGccGAGuGccAAAGuAcAdTsdT UGuACUUUGGcACUCGGCUdTsdT
203
52 53 1478-1496 AD-55093.2 uuuGAAAcuGuccAuucAAdTsdT UUGAAUGGAcAGUUUcAAAdTsdT
54 55 1531-1549 AD-55099.2 uGAuGuGGcccAuGAGuuudTsdT AAACUcAUGGGCcAcAUcAdTsdT
56 57 1631-1649 AD-53573.3 GucAuGccAAAAAuGGAcAdTsdT UGUCcAUUUUUGGcAUGACdTsdT
58 59 1637-1655 AD-55109.2 ccAAAAAuGGAcAucAuuudTsdT AAAUGAUGUCcAUUUUUGGdTsdT
60 61 1706-1724 AD-55114.2 AcGAGuucucuGAuuGAcAdTsdT UGUcAAUcAGAGAACUCGUdTsdT
62 63 1962-1980 AD-55076.2 AAGucuGuGAuGAAcuAAudTsdT AUuAGUUcAUcAcAGACUUdTsdT
64 65 1967-1985 AD-55082.2 uGuGAuGAAcuAAuGAGcAdTsdT UGCUcAUuAGUUcAUcAcAdTsdT
66 67 1977-1995 AD-55088.2 uAAuGAGcAGAcAuAAcAudTsdT AUGUuAUGUCUGCUcAUuAdTsdT
68 69 2189-2207 AD-55094.2 uuuGAAGuGAuGAGuGAAAdTsdT UUUcACUcAUcACUUcAAAdTsdT
70 71 2227-2245 AD-55100.2 AGGcuuGAGcAAGuuGGuAdTsdT uACcAACUUGCUcAAGCCUdTsdT
72 73 2313-2331 AD-55105.2 ucuucAGAGuuGucuuuAudTsdT AuAAAGAcAACUCUGAAGAdTsdT
74 75 2317-2335 AD-55110.2 cAGAGuuGucuuuAuAuGudTsdT AcAuAuAAAGAcAACUCUGdTsdT
76 77 2319-2337 AD-55115.2 GAGuuGucuuuAuAuGuGAdTsdT UcAcAuAuAAAGAcAACUCdTsdT
78 79 2320-2338 AD-55077.2 AGuuGucuuuAuAuGuGAAdTsdT UUcAcAuAuAAAGAcAACUdTsdT
80 81 2344-2362 AD-55083.2 uuAuAuuAAAuuuuAAucudTsdT AGAU u AAAAU U u AAuAu AAdTsdT
82 83 2352-2370 AD-55089.2 AAuuuuAAucuAuAGuAAAdTsdT UUuACuAuAGAUuAAAAUUdTsdT
84 85 2353-2371 AD-55095.2 AuuuuAAucuAuAGuAAAAdTsdT U UU uACuAu AG AU uAAAAU dTsdT
86 87 2376-2394 AD-55101.2 AGuccuGGAAAuAAAuucudTsdT AG AAU U u AU U UCcAGGACU dTsdT
88 89 358-376 AD-53511.1 cuGcccAuucuuAucccGAdTsdT UCGGGAuAAGAAUGGGcAGdTsdT
90 91 789-807 AD-53512.1 ccAGuGuGGuuAGuGuGAAdTsdT UUcAcACuAACcAcACUGGdTsdT
92 93 1076-1094 AD-53513.1 GucuGGuGcAGuAAuGAcudTsdT AG UcAU u ACUGcACcAG ACdTsdT
94 95 1253-1271 AD-53514.1 GcAcucuuGuuuuccucGudTsdT ACGAGGAAAAcAAGAGUGCdTsdT
96 97 1544-1562 AD-53515.1 GAGuuuGGAGcAAucAccudTsdT AGGUGAUUGCUCcAAACUCdTsdT
98 99 2228-2246 AD-53516.1 GGcuuGAGcAAGuuGGuAudTsdT AuACcAACU UGCUcAAGCCdTsdT
100 101 404-422 AD-53517.1 GGcAAAucucuGuuGuucudTsdT AGAAcAAcAGAGAUUUGCCdTsdT
102 103 404-422 AD-53517.1 GGcAAAucucuGuuGuucudTsdT AGAAcAAcAGAGAUUUGCCdTsdT
104 105 866-884 AD-53518.1 cAAAGAccAGAAAGAGuGudTsdT AcACUCUUUCUGGUCUUUGdTsdT
106 107 1080-1098 AD-53519.1 GGuGcAGuAAuGAcuAccudTsdT AGGuAGUcAUuACUGcACCdTsdT
108 109 1258-1276 AD-53520.1 cuuGuuuuccucGuGcuuudTsdT AAAGcACGAGGAAAAcAAGdTsdT
110 111 1616-1634 AD-53521.1 GGGGAucGGGAuGGAGucAdTsdT UGACUCcAUCCCGAUCCCCdTsdT
112 113 2230-2248 AD-53522.1 cuuGAGcAAGuuGGuAucudTsdT AGAuACcAACUUGCUcAAGdTsdT
114 115 436-454 AD-53523.1 ccccAAGAuGAuGGAAGuudTsdT AACUUCcAUcAUCUUGGGGdTsdT
116 117 436-454 AD-53523.1 ccccAAGAuGAuGGAAGuudTsdT AACUUCcAUcAUCUUGGGGdTsdT
118 119 885-903 AD-53524.1 cucAucuucuucAAGAuAAdTsdT UuAUCUUGAAGAAGAUGAGdTsdT
120 121 1127-1145 AD-53525.1 GGGGcAGuuAuGGAcAcuudTsdT AAGUGUCcAuAACUGCCCCdTsdT
122 123 1315-1333 AD-53526.1 GAuGccAGGcuGuGAGAuudTsdT AAUCUcAcAGCCUGGcAUCdTsdT
124 125 1870-1888 AD-53527.1 GAGAcAGAuGcuAAuGGAudTsdT AUCcAUuAGcAUCUGUCUCdTsdT
126 127 2286-2304 AD-53528.1 ccccAGGccAuuAucAuAudTsdT AuAUGAuAAUGGCCUGGGGdTsdT
204
128 129 489-507 AD-53529.1 cAGcAGuAcAcuAccAAcAdTsdT UGUUGGuAGUGuACUGCUGdTsdT
130 131 489-507 AD-53529.1 cAGcAGuAcAcuAccAAcAdTsdT UGUUGGuAGUGuACUGCUGdTsdT
132 133 915-933 AD-53530.1 cuGuuuccAcuuuucAGuAdTsdT uACUGAAAAGUGGAAAcAGdTsdT
134 135 1138-1156 AD-53531.1 GGAcAcuuuGAAAcAAcAudTsdT AUGUUGUUUcAAAGUGUCCdTsdT
136 137 1324-1342 AD-53532.1 cuGuGAGAuuuAcucuGAudTsdT AUcAGAGuAAAUCUcAcAGdTsdT
138 139 1927-1945 AD-53533.1 cccuGuGcGGGuuGcAGAudTsdT AUCUGcAACCCGcAcAGGGdTsdT
140 141 2312-2330 AD-53534.1 GucuucAGAGuuGucuuuAdTsdT uAAAGAcAACUCUGAAGACdTsdT
142 143 646-664 AD-53535.1 cAcuGcAAGcAAAuGcccudTsdT AGGGcAUUUGCUUGcAGUGdTsdT
144 145 922-940 AD-53536.1 cAcuuuucAGuAuGAucGudTsdT ACGAUcAuACUGAAAAGUGdTsdT
146 147 1163-1181 AD-53537.1 GGGGcAGGuGGuAcuAGAAdTsdT UUCuAGuACcACCUGCCCCdTsdT
148 149 1347-1365 AD-53538.1 GGAAccAuGccuccAuGAudTsdT AUcAUGGAGGcAUGGU UCCdTsdT
150 151 1964-1982 AD-53539.1 GucuGuGAuGAAcuAAuGAdTsdT UcAU uAG U UcAUcAcAGACdTsdT
152 153 2321-2339 AD-53540.1 GuuGucuuuAuAuGuGAAudTsdT AU UcAcAu Au AAAGAcAACdTsdT
154 155 671-689 AD-53541.1 GcAGcAcAGAuGAAucAGAdTsdT UCUGAUUcAUCUGUGCUGCdTsdT
156 157 924-942 AD-53542.1 cuuuucAGuAuGAucGuuudTsdT AAACGAUcAuACUGAAAAGdTsdT
158 159 1164-1182 AD-53543.1 GGGcAGGuGGuAcuAGAAAdTsdT UUUCuAGuACcACCUGCCCdTsdT
160 161 1460-1478 AD-53544.1 GuccccAAGAuuGuGGcAudTsdT AUGCcAcAAUCUUGGGGACdTsdT
162 163 1976-1994 AD-53545.1 cuAAuGAGcAGAcAuAAcAdïsdT UGUuAUGUCUGCUcAUuAGdTsdT
164 165 786-804 AD-53546.1 GccccAGuGuGGuuAGuGudTsdT AcACuAACcAcACUGGGGCdTsdT
166 167 935-953 AD-53547.1 GAucGuuucuuuGAGAAAAdTsdT UUUUCUcAAAGAAACGAUCdTsdT
168 169 1165-1183 AD-53548.1 GGcAGGuGGuAcuAGAAAudTsdT AUUUCuAGuACcACCUGCCdTsdT
170 171 1530-1548 AD-53549.1 GuGAuGuGGcccAuGAGuudTsdT AACUcAUGGGCcAcAUcACdTsdT
172 173 2003-2021 AD-53550.1 cAAGcAAucAAuuAcccuAdTsdT uAGGGuAAUUGAUUGCUUGdTsdT
174 175 788-806 AD-53551.1 cccAGuGuGGuuAGuGuGAdTsdT UcAcACuAACcAcACUGGGdTsdT
176 177 974-992 AD-53552.1 GAccAcAccuAucGAGuuudTsdT AAACUCGAuAGGUGUGGUCdTsdT
178 179 1191-1209 AD-53553.1 GAAcuAGuAAAuuccAuGudTsdT AcAUGGAAUUuACuAGUUCdTsdT
180 181 1541-1559 AD-53554.1 cAuGAGuuuGGAGcAAucAdTsdT UGAUUGCUCcAAACUcAUGdTsdT
182 183 2075-2093 AD-53555.1 ccccAGAuGAuGAAcuAcudTsdT AGuAGUUcAUcAUCUGGGGdTsdT
184 185 360-378 AD-53561.1 GcccAuucuuAucccGAGudTsdT ACUCGGGAuAAGAAUGGGCdTsdT
186 187 1356-1374 AD-53567.1 ccuccAuGAuccAAGGGAudTsdT AUCCCUUGGAUcAUGGAGGdTsdT
188 189 1631-1649 AD-53573.1 GucAuGccAAAAAuGGAcAdTsdT UGUCcAUUUUUGGcAUGACdTsdT
190 191 1634-1652 AD-53579.1 AuGccAAAAAuGGAcAucAdTsdT UGAUGUCcAUUUUUGGcAUdTsdT
Table 3: Human ALAS1 Unmodified Single Strands and Duplex Sequences
SEQIDNO: (sense) SEQID NO: (antisense) Position on transcript Duplex Name Sense Sequence (5'-3') Antisense Sequence (5'-3')
205
NM_ 000688.4
192 193 522-540 AD-55078.2 CUCCGGCCAGUGAGAAAGA UCUUUCUCACUGGCCGGAG
194 195 669-687 AD-55084.2 UGGCAGCACAGAUGAAUCA UGAUUCAUCUGUGCUGCCA
196 197 790-808 AD-55090.2 CAGUGUGGUUAGUGUGAAA UUUCACACUAACCACACUG
198 199 853-871 AD-55096.2 CAUCAUGCAAAAGCAAAGA UCUUUGCUUUUGCAUGAUG
200 201 876-894 AD-55102.2 AAAGAGUGUCUCAUCUUCU AGAAGAU GAGACACUCU U U
202 203 877-895 AD-55106.2 AAGAGUGUCUCAUCUUCUU AAGAAGAUGAGACACUCUU
204 205 914-932 AD-55111.2 UCUGUUUCCACUUUUCAGU ACUGAAAAGUGGAAACAGA
206 207 923-941 AD-55073.2 ACUUUUCAGUAUGAUCGUU AACGAUCAUACUGAAAAGU
208 209 926-944 AD-55079.2 UUUCAGUAUGAUCGUUUCU AGAAACGAU CAUACU GAAA
210 211 927-945 AD-55085.2 UUCAGUAUGAUCGUUUCUU AAGAAACGAUCAUACUGAA
212 213 928-946 AD-55091.2 UCAGUAUGAUCGUUUCUUU AAAGAAACGAUCAUACUGA
214 215 932-950 AD-55097.2 UAUGAUCGUUUCUUUGAGA UCUCAAAGAAACGAUCAUA
216 217 973-991 AD-55103.2 UGACCACACCUAUCGAGUU AACUCGAUAGGUGUGGUCA
218 219 975-993 AD-55107.2 ACCACACCUAUCGAGUUUU AAAACUCGAUAGGUGUGGU
220 221 1029-1047 AD-55112.2 UGGCAGAUGACUAUUCAGA UCUGAAUAGUCAUCUGCCA
222 223 1077-1095 AD-55074.2 UCUGGUGCAGUAAUGACUA UAGUCAUUACUGCACCAGA
224 225 1124-1142 AD-55080.2 UGUGGGGCAGUUAUGGACA UGUCCAUAACUGCCCCACA
226 227 1137-1155 AD-55086.2 UGGACACUUUGAAACAACA UGUUGUUUCAAAGUGUCCA
228 229 1182-1200 AD-55098.2 AUAUUUCUGGAACUAGUAA U UACUAG U UCCAGAAAUAU
230 231 1184-1202 AD-55104.2 AUUUCUGGAACUAGUAAAU AU U UACUAG U UCCAGAAAU
232 233 1185-1203 AD-55108.2 U U UCUGGAACUAGUAAAUU AAU U UACUAG U UCCAGAAA
234 235 1188-1206 AD-55113.2 CUGGAACUAGUAAAUUCCA UGGAAUUUACUAGUUCCAG
236 237 1325-1343 AD-55075.2 UGUGAGAUUUACUCUGAUU AAUCAGAGUAAAUCUCACA
238 239 1364-1382 AD-55081.2 AUCCAAGGGAUUCGAAACA UGUUUCGAAUCCCUUGGAU
240 241 1382-1400 AD-55087.2 AGCCGAGUGCCAAAGUACA UGUACUUUGGCACUCGGCU
242 243 1478-1496 AD-55093.2 UUUGAAACUGUCCAUUCAA UUGAAUGGACAGUUUCAAA
244 245 1531-1549 AD-55099.2 UGAUGUGGCCCAUGAGUUU AAACUCAUGGGCCACAUCA
246 247 1631-1649 AD-53573.3 GUCAUGCCAAAAAUGGACA UGUCCAUUUUUGGCAUGAC
248 249 1637-1655 AD-55109.2 CCAAAAAUGGACAUCAUUU AAAUGAUGUCCAUUUUUGG
250 251 1706-1724 AD-55114.2 ACGAGUUCUCUGAUUGACA UGUCAAUCAGAGAACUCGU
252 253 1962-1980 AD-55076.2 AAGUCUGUGAUGAACUAAU AUUAGUUCAUCACAGACUU
254 255 1967-1985 AD-55082.2 UGUGAUGAACUAAUGAGCA UGCUCAUUAGUUCAUCACA
256 257 1977-1995 AD-55088.2 UAAUGAGCAGACAUAACAU AUGUUAUGUCUGCUCAUUA
258 259 2189-2207 AD-55094.2 UUUGAAGUGAUGAGUGAAA UUUCACUCAUCACUUCAAA
260 261 2227-2245 AD-55100.2 AGGCUUGAGCAAGUUGGUA UACCAACUUGCUCAAGCCU
262 263 2313-2331 AD-55105.2 UCUUCAGAGUUGUCUUUAU AUAAAGACAACUCUGAAGA
206
264 265 2317-2335 AD-55110.2 CAGAGUUGUCUUUAUAUGU ACAUAUAAAGACAACUCUG
266 267 2319-2337 AD-55115.2 GAGUUGUCUUUAUAUGUGA UCACAUAUAAAGACAACUC
268 269 2320-2338 AD-55077.2 AGUUGUCUUUAUAUGUGAA UUCACAUAUAAAGACAACU
270 271 2344-2362 AD-55083.2 UUAUAUUAAAUUUUAAUCU AGAU UAAAAU U UAAUAUAA
272 273 2352-2370 AD-55089.2 AAUUUUAAUCUAUAGUAAA U U UACUAUAGAU UAAAAU U
274 275 2353-2371 AD-55095.2 AU U U UAAUCUAUAG UAAAA U U U UACUAUAGAU UAAAAU
276 277 2376-2394 AD-55101.2 AGUCCUGGAAAUAAAUUCU AGAAU U UAU U UCCAGGACU
278 279 358-376 AD-53511.1 CUGCCCAUUCUUAUCCCGA UCGGGAUAAGAAUGGGCAG
280 281 789-807 AD-53512.1 CCAGUGUGGUUAGUGUGAA UUCACACUAACCACACUGG
282 283 1076-1094 AD-53513.1 G UCUGG U GCAG UAAU GACU AGUCAUUACUGCACCAGAC
284 285 1253-1271 AD-53514.1 GCACUCUUGUUUUCCUCGU ACGAGGAAAACAAGAGUGC
286 287 1544-1562 AD-53515.1 GAGUUUGGAGCAAUCACCU AGGUGAUUGCUCCAAACUC
288 289 2228-2246 AD-53516.1 GGCUUGAGCAAGUUGGUAU AUACCAACUUGCUCAAGCC
290 291 404-422 AD-53517.1 GGCAAAUCUCUGUUGUUCU AGAACAACAGAGAUUUGCC
292 293 404-422 AD-53517.1 GGCAAAUCUCUGUUGUUCU AGAACAACAGAGAUUUGCC
294 295 866-884 AD-53518.1 CA A AG ACCAG AAAG AG U G U ACACUCUUUCUGGUCUUUG
296 297 1080-1098 AD-53519.1 GGUGCAGUAAUGACUACCU AGGUAGUCAUUACUGCACC
298 299 1258-1276 AD-53520.1 CUUGUUUUCCUCGUGCUUU AAAGCACGAGGAAAACAAG
300 301 1616-1634 AD-53521.1 GGGGAUCGGGAUGGAGUCA UGACUCCAUCCCGAUCCCC
302 303 2230-2248 AD-53522.1 CUUGAGCAAGUUGGUAUCU AGAUACCAACUUGCUCAAG
304 305 436-454 AD-53523.1 CCCCAAGAUGAUGGAAGUU AACUUCCAUCAUCUUGGGG
306 307 436-454 AD-53523.1 CCCCAAGAUGAUGGAAGUU AACUUCCAUCAUCUUGGGG
308 309 885-903 AD-53524.1 CUCAUCUUCUUCAAGAUAA UUAUCUUGAAGAAGAUGAG
310 311 1127-1145 AD-53525.1 GGGGCAGUUAUGGACACUU AAGUGUCCAUAACUGCCCC
312 313 1315-1333 AD-53526.1 GAUGCCAGGCUGUGAGAUU AAUCUCACAGCCUGGCAUC
314 315 1870-1888 AD-53527.1 GAGACAGAUGCUAAUGGAU AUCCAUUAGCAUCUGUCUC
316 317 2286-2304 AD-53528.1 CCCCAGGCCAUUAUCAUAU AUAUGAUAAUGGCCUGGGG
318 319 489-507 AD-53529.1 CAGCAGUACACUACCAACA UGUUGGUAGUGUACUGCUG
320 321 489-507 AD-53529.1 CAGCAGUACACUACCAACA UGUUGGUAGUGUACUGCUG
322 323 915-933 AD-53530.1 CUGUUUCCACUUUUCAGUA UACUGAAAAGUGGAAACAG
324 325 1138-1156 AD-53531.1 GGACACU U UG AAACAACAU AUGUUGUUUCAAAGUGUCC
326 327 1324-1342 AD-53532.1 CUGUGAGAUUUACUCUGAU AUCAGAGUAAAUCUCACAG
328 329 1927-1945 AD-53533.1 CCCUGUGCGGGUUGCAGAU AUCUGCAACCCGCACAGGG
330 331 2312-2330 AD-53534.1 GUCUUCAGAGUUGUCUUUA UAAAGACAACUCUGAAGAC
332 333 646-664 AD-53535.1 CACUGCAAGCAAAUGCCCU AGGGCAUUUGCUUGCAGUG
334 335 922-940 AD-53536.1 CACUUUUCAGUAUGAUCGU ACGAUCAUACUGAAAAGUG
336 337 1163-1181 AD-53537.1 GGGGCAGGUGGUACUAGAA UUCUAGUACCACCUGCCCC
338 339 1347-1365 AD-53538.1 GGAACCAUGCCUCCAUGAU AUCAUGGAGGCAUGGUUCC
207
340 341 1964-1982 AD-53539.1 GUCUGUGAUGAACUAAUGA UCAUUAGUUCAUCACAGAC
342 343 2321-2339 AD-53540.1 GUUGUCUUUAUAUGUGAAU AUUCACAUAUAAAGACAAC
344 345 671-689 AD-53541.1 GCAGCACAGAUGAAUCAGA UCUGAUUCAUCUGUGCUGC
346 347 924-942 AD-53542.1 CUUUUCAGUAUGAUCGUUU AAACGAUCAUACUGAAAAG
348 349 1164-1182 AD-53543.1 GGGCAGGUGGUACUAGAAA UUUCUAGUACCACCUGCCC
350 351 1460-1478 AD-53544.1 GUCCCCAAGAUUGUGGCAU AUGCCACAAUCUUGGGGAC
352 353 1976-1994 AD-53545.1 CUAAUGAGCAGACAUAACA UGUUAUGUCUGCUCAUUAG
354 355 786-804 AD-53546.1 GCCCCAGUGUGGUUAGUGU ACACUAACCACACUGGGGC
356 357 935-953 AD-53547.1 GAUCGUUUCUUUGAGAAAA UUUUCUCAAAGAAACGAUC
358 359 1165-1183 AD-53548.1 GGCAGGUGGUACUAGAAAU AUUUCUAGUACCACCUGCC
360 361 1530-1548 AD-53549.1 GUGAUGUGGCCCAUGAGUU AACUCAUGGGCCACAUCAC
362 363 2003-2021 AD-53550.1 CAAGCAAUCAAUUACCCUA UAGGGUAAUUGAUUGCUUG
364 365 788-806 AD-53551.1 CCCAGUGUGGUUAGUGUGA UCACACUAACCACACUGGG
366 367 974-992 AD-53552.1 G ACCACACCUAUCG AG U U U AAACUCGAUAGGUGUGGUC
368 369 1191-1209 AD-53553.1 GAACUAGUAAAUUCCAUGU ACAUGGAAUUUACUAGUUC
370 371 1541-1559 AD-53554.1 CAUGAGUUUGGAGCAAUCA UGAUUGCUCCAAACUCAUG
372 373 2075-2093 AD-53555.1 CCCCAGAUGAUGAACUACU AGUAGUUCAUCAUCUGGGG
374 375 360-378 AD-53561.1 GCCCAUUCUUAUCCCGAGU ACUCGGGAUAAGAAUGGGC
376 377 1356-1374 AD-53567.1 CCUCCAUGAUCCAAGGGAU AUCCCUUGGAUCAUGGAGG
378 379 1631-1649 AD-53573.1 GUCAUGCCAAAAAUGGACA UGUCCAUUUUUGGCAUGAC
380 381 1634-1652 AD-53579.1 AUGCCAAAAAUGGACAUCA UGAUGUCCAUUUUUGGCAU
Example 3. In vitro screening of ALAS1 siRNA duplexes for ALAS1 knockdown activity.
ALAS1 siRNA duplexes were screened for the ability to knockdown ALAS1 expression 5 in vitro.
In vitro screening
Cell culture and transfections
Hep3B cells (ATCC, Manassas, VA) were grown to near confluence at 37°C in an atmosphère of 5% CO2 in MEM (ATCC) supplemented with 10% FBS, before being released from the plate by trypsinization. Transfection was carried out by adding 14.8μ1 of Opti-MEM plus 0.2μ1 of Lipofectamine RNAiMax per well (Invitrogen, Carlsbad CA. cat # 13778-150) to 5μ1 of siRNA duplexes per well into a 96-well plate and incubated at room température for 15
208 minutes. 80μ1 of complété growth media containing ~2 xlO4 Hep3B cells were then added to the siRNA mixture. Cells were incubated for either 24 or 120 hours prior to RNA purification. Single dose experiments were performed at lOnM and O.lnM final duplex concentration and dose response experiments were done at 10, 1.67, 0.27, 0.046, 0.0077, 0.0013, 0.00021, 0.00004 nM final duplex concentration.
Total RNA isolation using DYNABEADS mRNA Isolation Kit (Invitrogen, part #: 61012)
Cells were harvested and lysed in 150μ1 of Lysis/Binding Buffer then mixed for 5 minutes at 850rpm using an Eppendorf Thermomixer (the mixing speed was the same throughout the process). Ten microliters of magnetic beads and 80μ1 Lysis/Binding Buffer mixture were added to a round bottom plate and mixed for 1 minute. Magnetic beads were captured using magnetic stand and the supematant was removed without disturbing the beads. After removing supematant, the lysed cells were added to the remaining beads and mixed for 5 minutes. After removing supematant, magnetic beads were washed 2 times with 150μ1 Wash Buffer A and mixed for 1 minute. Beads were captured again and supematant removed. Beads were then washed with 150μ1 Wash Buffer B, captured and supematant was removed. Beads were next washed with 150μ1 Elution Buffer, captured and supematant removed. Beads were allowed to dry for 2 minutes. After drying, 50μ1 of Elution Buffer was added and mixed for 5 minutes at 70°C. Beads were captured on magnet for 5 minutes. 40μ1 of supematant was removed and added to another 96 well plate.
cDNA synthesis using ABI High capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, CA, Cat #4368813)
A master mix of 2μ110X Buffer, 0.8μ1 25X dNTPs, 2μ1 Random primers, 1 μΐ Reverse Transcriptase, 1 μΐ RNase inhibitor and 3.2μ1 of H2O per reaction were added into 10μ1 total
209
RNA. cDNA was generated using a Bio-Rad C-1000 or S-1000 thermal cycler (Hercules, CA) through the following steps: 25°C 10 min, 37°C 120 min, 85°C 5 sec, 4°C hold.
Real time PCR
2μ1 of cDNA were added to a master mix containing 0.5μ1 GAPDH TaqMan Probe (Applied Biosystems Cat #4326317E), 0.5μ1 ALAS1 TaqMan probe (Applied Biosystems cat # Hs00167441_ml) and 5μ1 Lightcycler 480 probe master mix (Roche Cat #04887301001) per well in a 384 well plates (Roche cat # 04887301001). Real time PCR was done in a Roche LC480 Real Time PCR system (Roche) using the AACt(RQ) assay. Each duplex was tested in two independent transfections with two biological replicates each, and each transfection was assayed in duplicate, unless otherwise noted in the summary tables.
To calculate relative fold change, real time data were analyzed using the AACt method and normalized to assays performed with cells transfected with lOnM AD-1955, or mock transfected cells. IC50s were calculated using a 4 parameter fît model using XLFit and normalized to cells transfected with AD-1955 or naïve cells over the same dose range, or to its own lowest dose.
In vitro knockdown of endogenous ALAS1 expression by ALAS1 siRNA duplexes
Table 4 illustrâtes the knockdown of ALAS1 in Hep3B cells by ALAS1 modified siRNA duplexes (See Table 2). Silencing is expressed as the fraction RNA message remaining relative to the négative (luciferase) control siRNA AD-1955. Data were generated as described above following transfection of 10 nM or 0.1 nM of each siRNA. qPCR was run using the ALAS1 TaqMan probe Hs00167441_ml.
210
Table 4: ALAS1 expression in Hep3B cells following transfection with ALAS1 siRNA
Duplex ID 10 nM Avg O.lnM Avg lOnM STDEV O.lnM STDEV
AD-55078.2 0.7 0.87 0.001 0.089
AD-55084.2 0.08 0.3 0 0.04
AD-55090.2 0.06 0.08 0.002 0.003
AD-55096.2 0.61 0.92 0.171 0.34
AD-55102.2 0.63 0.62 0.005 0.069
AD-55106.2 0.07 0.08 0.004 0.027
AD-55111.2 0.06 0.23 0.013 0.062
AD-55073.2 0.21 0.4 0.018 0.061
AD-55079.2 0.17 0.43 0.033 0.089
AD-55085.2 0.13 0.21 0.011 0.019
AD-55091.2 0.27 0.55 0.033 0.009
AD-55097.2 0.31 0.38 0.051 0.059
AD-55103.2 0.05 0.11 0.017 0.006
AD-55107.2 0.12 0.24 0.007 0.008
AD-55112.2 0.15 0.2 0.036 0.025
AD-55074.2 0.16 0.45 0.008 0.002
AD-55080.2 0.79 0.99 0.095 0.304
AD-55086.2 0.09 0.22 0.005 0.035
AD-55098.2 0.25 0.51 0.03 0.07
AD-55104.2 0.06 0.1 0.017 0.001
AD-55108.2 0.47 0.65 0.03 0.015
AD-55113.2 0.38 0.62 0.068 0.039
AD-55075.2 0.12 0.28 0.007 0.051
AD-55081.2 0.21 0.51 0.036 0.066
AD-55087.2 0.1 0.19 0.017 0.02
AD-55093.2 0.24 0.56 0.029 0.053
AD-55099.2 0.05 0.18 0.001 0.038
AD-53573.3 0.67 1.07 0.16 0.153
AD-55109.2 0.07 0.23 0.006 0.052
AD-55114.2 0.08 0.16 0.004 0.017
AD-55076.2 0.05 0.14 0.007 0.035
AD-55082.2 0.08 0.3 0.019 0.016
AD-55088.2 0.06 0.12 0.008 0.02
211
AD-55094.2 0.06 0.18 0.005 0.023
AD-55100.2 0.45 0.83 0.02 0.05
AD-55105.2 0.02 0.05 0.005 0.004
AD-55110.2 0.15 0.19 0.031 0.016
AD-55115.2 0.35 0.58 0.045 0.052
AD-55077.2 0.14 0.14 0.006 0.019
AD-55083.2 0.56 0.98 0.24 0.188
AD-55089.2 0.62 0.79 0.036 0.094
AD-55095.2 0.59 0.92 0.12 0.079
AD-55101.2 0.71 0.97 0.074 0.097
AD-1955 1.00 1.01 0.03 0.04
AD-53511.1 0.84 1.08 0.028 0.0515
AD-53512.1 0.15 0.65 0.062 0.023
AD-53513.1 0.34 0.86 0.055 0.011
AD-53514.1 0.12 0.61 0.003 0.008
AD-53515.1 0.25 0.66 0.005 0.004
AD-53516.1 1.05 1.02 0.032 0.011
AD-53517.1 0.145 0.725 0.025 0.0155
AD-53518.1 0.72 0.85 0.045 0.028
AD-53519.1 0.18 0.66 0.061 0.004
AD-53520.1 0.18 0.9 0.041 0.001
AD-53521.1 0.97 1.07 0.01 0.003
AD-53522.1 0.87 1.1 0.065 0.112
AD-53523.1 0.48 0.96 0.0305 0.0255
AD-53524.1 0.11 0.66 0.02 0.006
AD-53525.1 0.71 1.03 0.016 0.01
AD-53526.1 0.23 0.85 0.075 0.01
AD-53527.1 0.25 0.83 0.015 0.017
AD-53528.1 0.44 0.93 0.037 0.006
AD-53529.1 0.185 0.73 0.015 0.014
AD-53530.1 0.1 0.62 0.02 0.003
AD-53531.1 0.48 0.93 0.019 0.045
AD-53532.1 0.06 0.17 0 0.003
AD-53533.1 0.36 0.93 0.025 0.034
AD-53534.1 0.1 0.36 0.014 0.012
AD-53535.1 0.58 1.05 0.036 0.071
212
AD-53536.1 0.12 0.45 0.009 0.026
AD-53537.1 0.73 0.96 0.101 0.015
AD-53538.1 0.74 1.07 0 0.046
AD-53539.1 0.52 0.97 0.057 0.032
AD-53540.1 0.1 0.47 0.017 0.012
AD-53541.1 0.11 0.29 0.026 0.015
AD-53542.1 0.08 0.23 0.008 0.006
AD-53543.1 0.62 1.01 0.027 0.014
AD-53544.1 0.8 1.04 0.002 0.001
AD-53545.1 0.17 0.73 0.007 0.007
AD-53546.1 0.27 0.93 0.058 0.019
AD-53547.1 0.12 0.28 0.008 0.01
AD-53548.1 0.1 0.34 0.022 0.002
AD-53549.1 0.8 1.04 0.011 0.026
AD-53550.1 0.05 0.54 0.02 0.003
AD-53551.1 0.96 1.16 0.029 0.044
AD-53552.1 0.13 0.5 0.002 0.009
AD-53553.1 0.92 1.1 0.027 0.02
AD-53554.1 0.76 0.67 0.005 0.004
AD-53555.1 0.11 0.53 0.009 0.007
AD-53561.1 0.72 0.94 0.014 0.001
AD-53567.1 0.16 0.66 0.019 0.003
AD-53573.1 1.06 1.10 0.019 0.037
AD-53579.1 0.19 0.76 0.036 0.019
ICgns of select ALAS1 siRNA duplexes in in vitro screen
Table 5 illustrâtes the IC50S of select ALAS1 siRNA duplexes determined from the knockdown of endogenously expressed ALAS1 in the Hep3B cell line, by ALAS1 modified 5 siRNA duplexes (see Table 2). Data were generated as described above, at 24 or 120 hours following transfection of each siRNA duplex. In this example, silencing of ALAS1 is expressed as the fraction mRNA message remaining relative to the siRNA AD-1955, a non-targeting siRNA that was used as a négative control. Data from replicate transfection experiments were used to fit a single line to détermine the IC50. Several ofthe duplexes (e.g., AD-53541.1, AD17746
213
53542.1, and AD-53547.1) had an IC50 as low as about 0.03 nM at 24 hours. Numerous duplexes had an ICsoof less than 0.1 nM (e.g., AD-53534.1, AD-53536.1, AD-53540.1, AD-
53541.1, AD-53542.1, AD-53547.1, AD-53548.1, AD-53550.1, AD-53552.1) at 24 hours, and some ofthese also had an ICsoof less than 0.1 nM (e.g., AD-53534.1, AD-53540.1, AD-53541.1,
AD-53542.1, AD-53547.1, AD-53552.1) at 120 hours.
Table 5: ICgnS of select ALAS1 siRNA duplexes normalized to AD-1955
IC50 (nM)
DUPLEX ID 24hrs 120hrs
AD-53534.1 0.045 0.076
AD-53536.1 0.049 0.105
AD-53540.1 0.054 0.077
AD-53541.1 0.032 0.062
AD-53542.1 0.028 0.093
AD-53547.1 0.03 0.062
AD-53548.1 0.044 0.101
AD-53550.1 0.085 0.152
AD-53552.1 0.077 0.063
AD-53567.1 0.219 0.357
AD-53579.1 0.217 0.566
Example 4. In Vivo Silencing using a mouse/rat ALAS1 siRNA formulated as a LNP
The sequences of the modified duplex AD-53558 are shown in Table 6 below.
Table 6: Sequences of ALAS1 siRNA Duplex AD-53558.4
SEQID NO: (sense) SEQ ID NO: (antisense) Start Position on transcript of NM_ 020559.2 Duplex Name Sense Sequence (5'-3') Antisense Sequence (5'-3')
214
383 384 1184 AD-53558 cuGuGAAAuuuAcucuGAudTsdT AUcAGAGuAAAUUUcAcAGdTsdT
This duplex was formulated as a LNP11 formulation (see Table 10 above). The LNPformulated AD-53558 siRNA was tested in in vivo in mice (N=25 animais; 5 animais per group) and rats (N=20 animais; 4 animais per group) and was confirmed to silence ALAS1 mRNA in vivo. The results are shown in FIG. 5 and FIG. 6.
FIG. 5 shows that the siRNA demonstrated a dose-response effect in mice. The expression of mouse ALAS1 (mALASl) mRNA was reduced by about 78% when the siRNA was administered at 1 mg/kg; mouse ALAS1 mRNA was reduced by about 60% when the siRNA was administered at 0.3 mg/kg; and mouse ALAS1 mRNA was reduced by about 49% when the siRNA was administered at 0.1 mg/kg. These réductions are expressed relative to a PBS control. An AD-1955 LUC control was also employed, as shown in FIG. 5.
Similarly, FIG. 6 shows that the siRNA demonstrated a dose-response effect in rats. The expression of ALAS1 RNA was reduced by about 70% when the when the siRNA was administered at 1 mg/kg; ALAS1 mRNA was reduced by about 62% when the siRNA was administered at 0.3 mg/kg; and ALAS1 mRNA was reduced by about 34% when the siRNA was administered at 0.1 mg/kg.
The durability of silencing was also tested in mice (N=15; 3 animais per timepoint. The results are shown in FIG. 7, which shows that AD-53558 suppressed mALASl mRNA by about 80% for at least 9 days. Suppression of at least about 50% persisted for at least 14 days.
Example 5. Efficacy of ALAS1 siRNA in an Animal Model of AIP
The effects of the AD-53558 LNP11 formulation (a mouse/rat ALAS1 siRNA described in the previous example) were investigated in a mouse model of AIP. The PBGD knockout is not viable (-/-, 0% activity). Heterozygous PBGD knockout mice (+/-, -50% activity) are available but do not hâve the full biochemical phenotype and thus do not recapitulate the human disease phenotype. Thus, a mouse model of AIP has been developed that is a compound hétérozygote with T1/T2 alleles, including Tl (+/-) promoter disruption and T2 (-/-) splice-site
215 alteration. These mice hâve been shown to hâve hepatic residual PBGD activity that is about ~30% of the wild-type level and normal or slightly elevated baseline plasma ALA and PBG levels. The mice hâve been found to appear normal early in life and to become slightly slower and ataxie with âge. By six months of âge, the mice hâve been documented to develop impaired motor coordination and muscular performance and axonal degeneration on pathological examination. Investigation of the pathology of the mouse model has shown axonal degeneration, impaired motor coordination and muscular performance in older mice. Urinary and plasma ALA and PBG hâve been found to markedly increase with serial i.p. administration of phénobarbital (see Lindberg et al., (1996), Nature Genetics, 12:195-219 and Lindberg et al., (1999), Journal of Clinical Investigation, 103:1127-34). The mice were rescued by AAV-mediated expression of PBGD in the liver (Yasuda et al. (2010), Molecular Medicine, 1:17-22 and Unzu et al. (2011), Molecular Medicine, 2:243-50).
On day 1, the mice were administered 1 mg/kg ALAS1 siRNA (n=5) or LUC AD-1955 control (n=3) by i.v. injection. Three phénobarbital injections were given (1 injection per day on days 2, 3, and 4) to induce hepatic ALAS1 and the porphyrin precursors, ALA and PBG. Plasma and ovemight urine specimens were collected on day 5 and métabolite levels were measured by LC-MS. Métabolite levels were measured in plasma by LC-MS and were also measured in urine. Baseline levels of métabolites were measured prior to the first treatment on day 1. The results are shown in FIGs. 8-12 and in Tables 12 and 13.
FIG. 8 and FIG. 9 show the plasma ALA levels in μΜ. Baseline ALA levels were low, (n=4), and phénobarbital treatment induced significant increases in plasma ALA levels in the control LUC siRNA treated animais (n=3). Treatment with ALAS1 siRNA inhibited the induction of plasma ALA (n=5), as shown in FIG. 8. The ALAS1 siRNA was consistently effective in blocking the induction of plasma ALA in each of the individual animais studied (see FIG. 9). These results indicate that ALAS1 siRNA treatment was effective in preventing the increases in plasma ALA associated with the phenobarbital-induced acute attacks in this AIP animal model.
FIG. 10 and FIG. 11 show the plasma PBG levels in μΜ. Baseline PBG levels were low (n=4), and phénobarbital treatment induced significant increases in plasma PBG levels in the
216 control LUC siRNA treated animais (n=3) Treatment with ALAS1 siRNA inhibited the induction of plasma PBG (n=5), as shown in FIG. 10. The ALAS1 siRNA was consistently effective in blocking the induction of plasma PBG in each of the individual animais studied (see
FIG. 11). These results indicate that ALAS1 siRNA treatment was effective in preventing the increases in plasma PBG associated with the phenobarbital-induced acute attacks in this AIP animal model.
Tables 12 and 13 shows urine ALA and PBG levels at baseline and after phénobarbital treatment in LUC siRNA (n=2) control (CTR, which refers to a PBS buffer treated animal, n=l) and ALAS1 siRNA (n=5) treated animais.
Table 12: Urine data from individual animais showing prévention of induced acute attack
Mouse ID ALA (micro M/l) PBG (micro M/L) Creatinin e (mg/dl) ALA (microM/mg créatinine) PBG (microM/mg créatinine) siRNA PB
Ha-17-4-6 29.7 7.9 Baseline -
Ha-19-5-4/2 15.7 5.1 Baseline -
Ha-20-394/3 28.6 6.7 Baseline
Ha-20-38-4 21.4 4.7 Baseline -
Ha-21-33-4 934.92 483.71 0.4205 222.33 115.03 Luc +
Ha-21-36-9 944.08 563.53 0.5055 186.76 111.48 Luc +
Ha-21-18-8 32.88 8.69 0.133 24.72 6.53 ALAS1; 1 mg/kg +
Ha-21-33-7 83.07 23.28 0.426 19.50 5.46 ALAS1; 1 mg/kg +
Ha-21-34-5 59.15 18.41 0.263 22.49 7.00 ALAS1; 1 mg/kg +
PB stands for phénobarbital. A “+” indicates that phénobarbital was administered.
Table 13: Average Urine Data
Condition Mean ALA (microM/mg créatinine) Mean PBG (microM/mg créatinine)
AIP Baseline 23.8 6.1
Luc-siRNA 204.55 113.26
ALAS1-siRNA 22.24 6.33
217
Phénobarbital treatment induced strong increases (-25-30 fold increases) in urine ALA (~9-fold over baseline levels) and PBG (~19-fold over baseline levels) in the LUC siRNA treated mice, control, whereas such increases were not observed in the ALAS1 siRNA treated animais. Thus, ALAS1 siRNA blocked phenobarbital-induced increases in urinary ALA and PBG. These results are consistent with the plasma measurements and show that ALAS1 siRNA treatment was effective in preventing increases in urinary métabolites (ALA and PBG) associated with the phenobarbital-induced acute attacks in this AIP animal model.
In further experiments (FIG. 12), it was found that phénobarbital treatment induced large increases (-25 fold) in ALAS1 mRNA expression in the liver of the mouse model. Administration of ALAS1 siRNA completely blocked this ALAS1 mRNA induction. These results provide further evidence that ALAS1 siRNA is effective in an animal model of AIP.
Collectively, the results provided in this Example show that ALAS1 siRNA was effective in treating acute attacks in an animal model of the acute hepatic porphyria AIP. Multiple outcome measures support this conclusion, including plasma ALA levels, plasma PBG levels, urine ALA levels, urine PBG levels, and liver ALAS1 mRNA expression levels.
Example 6. In Vivo Silencing using GalNAc-Conjugated Mouse ALAS1 siRNA
The experiments described in this example investigated the in vivo effïcacy of three GalNAc-conjugated siRNAs (see Table 7). These siRNAs were designed and produced with methods such as those described in Example 2.
Table 7: Sequences AD-57929
SEQ SEQ Position Dupl Sense Sequence (5'-3') Antisense Sequence (5'-3') Positio
ID ID of sense ex n of
NO: NO: Nam antisen
(sens (anti- seq. on e se seq.
e) sens transcrip on
e) transcri
t pt
NM
NM_ 020559.
020559. 2
218
2
385 386 775-795 AD5621 1 AfaGfuCfuGfuUfllfCfcAfcUfuUfuCfa AfL96 ullfgAfaAfaGfuGfgaaAfcAfgAfcUf usUfsg 773- 795
387 388 2168- 2188 AD5617 3 AfcAfuAfgUfaGfCfCfaGfaAfullfgllfc UfL96 aGfaCfaAfuUfcUfggcUfaCfuAfuGf usGfsg 2166- 2188
389 390 775-795 AD5792 9 AfsasGfuCfuGfuUfUfCfcAfcUfuUfuCf aAfL96 usUfsgAfaAfaGfuGfgaaAfcAfgAfc Ufususg 773- 795
The mice (n=40; n=4 per experimental condition) were divided into groups that received PBS or doses of 3 mg/kg, 10 mg/kg, or 30 mg/kg of siRNA administered subcutaneously. The level of mALASl/mGAPDH mRNA, relative to the PBS control, was determined in liver cells at 5 72 hours post-administration. The results are shown in FIG. 13. There was not a clear doseresponse effect for the siRNAs AD-56211 and AD-56173. In contrast, the ALAS1 siRNA AD57929 showed a dose-response effect in inhibiting mALASl expression. These results demonstrate that an ALAS1 GalNAc conjugate was effective in inhibiting expression of ALAS1 mRNA in vivo and showed a dose-response effect.
Example 7. Human siRNAs
Additional human siRNAs were designed and produced as described in Example 2. The top 45 siRNAs were selected based on their predicted efficacy. The sequences of these 45 siRNAs are provided in Table 8 and the Sequence Listing attached herewith (e.g., a sense sequence corresponding to one of the odd numbered sequences identified as SEQ ID NOs: 391 to 551, and 15 an antisense sequence corresponding to one of the even numbered sequences identified as SEQ
ID NOs: 392 to 552, respectively). Table 8 is disclosed in International Publication No.
WO2013/155204A2.The contents of WO 2013/155204 and the Sequence Listing, includingTable 8, are expressly incorporated by reference.
219
Example 8. Human siRNAs
Additional 19mer human siRNAs were generated. The sequences of these siRNAs are provided in Table 9 and the Sequence Listing attached herewith (e.g., a sense sequence corresponding to one of the odd numbered sequences identified as SEQ ID NOs: 553 to 3365, and an antisense sequence corresponding to one of the even numbered sequences identified as SEQ ID NOs: 554 to 3366, respectively). Table 9 is disclosed in International Publication No. WO2013/155204A2. The contents of WO 2013/155204 and the Sequence Listing, includingTable 9, are expressly incorporated by reference. These siRNAs can be tested for efficacy using methods described herein and/or methods known in the art.
Example 9. Suppression of Porphyrin Precursors Using ALAS1 siRNA in an Acute Treatment Paradigm
The AIP mouse model (see Example 5) was used to investigate whether ALAS1 siRNA would work an an acute treatment paradigm to lower already elevated levels of ALA and PBG, as would be présent, for example, when a human porphyria patient suffers from an acute attack. Administration of the AD-53558 LNP11 formulation siRNA at a lmg/kg dose 12 hours after the last dose of phénobarbital rapidly decreased the levels of both ALA and PBG in mouse plasma, whereas in Luc control treated animais the levels continued to rise (FIG. 14). These results indicate that ALAS siRNA is effective for treating an acute attack. The ALAS1 siRNA was effective to lowei' and prevent further increases in ALA and PBG levels.
As can be observed in FIG. 14, ALAS siRNA had a rapid onset effect in reducing ALA and PBG levels. The onset of the effect occurred within hours after administration of the siRNA. The effect on plasma ALA could be observed within 4 hours of administration of the siRNA (see FIG. 14; the siRNA was administered at 12 hours after the last dose of phénobarbital, and a réduction in plasma ALA relative to control can be observed at 16 hours after the last dose of phénobarbital). The effect on plasma PBG could be observed within 8 hours of administration of the siRNA (see FIG. 14; the siRNA was administered at 12 hours after the last dose of
220 phénobarbital, and a réduction in plasma ALA relative to control can be observed at 20 hours after the last dose of phénobarbital).
Example 10. siRNAs that target ALAS1
Further unmodified and modified siRNA sequences that target ALAS1 siRNA were designed and produced as described in Example 2. The in vitro activity of the modified duplexes was tested as described below.
Methods
Lipid mediated transfection
For Hep3B, PMH, and primary Cynomolgus hépatocytes, transfection was carried out by adding 14.8 μΐ of Opti-MEM plus 0.2 μΐ of Lipofectamine RNAiMax per well (Invitrogen, Carlsbad CA. catalog numberl3778-150) to 5 μΐ of each siRNA duplex to an individual well in a 96-well plate. The mixture was then incubated at room température for 20 minutes. Eighty μΐ of complété growth media without antibiotic containing the appropriate cell number were then added to the siRNA mixture. Cells were incubated for 24 hours prior to RNA purification.
Single dose experiments were performed at 1 uM, 500nM, 20nM, lOnM and 0.2nM final duplex concentration for GalNAc modified.
Free uptake transfection
Cryopreserved Primary Cynomolgus Hépatocytes (Celsis In Vitro Technologies, M003055-P) were thawed at 37°C water bath immediately prior to usage and re-suspended at 0.26xl06 cells/ml in InVitroGRO CP (plating) medium (Celsis In Vitro Technologies, catalog number Z99029). During transfections, cells were plated onto a BD BioCoat 96 well collagen plate (BD, 356407) at 25,000 cells per well and incubated at 37°C in an atmosphère of 5% CO2. Free Uptake experiments were performed by adding 10μ1 of siRNA duplexes in PBS per well into a 96 well (96w) plate. Ninety μΐ of complété growth media containing appropriate cell number for the cell type was then added to the siRNA. Cells were incubated for 24 hours prior to RNA purification. Single dose experiments were performed at 1 uM, 500nM, 20nM and lOnM final duplex.
221
Total RNA isolation using DYNABEADS mRNA Isolation Kit (Invitrogen, part #: 610-12)
Cells were harvested and lysed in 150 μΐ of Lysis/Binding Buffer then mixed for 5 minutes at 850 rpm using an Eppendorf Thermomixer (the mixing speed was the same throughout the process). Ten microliters of magnetic beads and 80 μΐ Lysis/Binding Buffer mixture were added to a round bottom plate and mixed for 1 minute. Magnetic beads were captured using a magnetic stand and the supematant was removed without disturbing the beads. After removing the supematant, the lysed cells were added to the remaining beads and mixed for 5 minutes. After removing the supematant, magnetic beads were washed 2 times with 150 μΐ Wash Buffer A and mixed for 1 minute. The beads were capturedagain and the supematant was removed. The beads were then washed with 150 μΐ Wash Buffer B, captured and the supematant was removed. The beads were next washed with 150 μΐ Elution Buffer, captured and the supematant removed. Finally, the beads were allowed to dry for 2 minutes. After drying, 50 μΐ of Elution Buffer was added and mixed for 5 minutes at 70°C. The beads were captured on magnet for 5 minutes. Forty-five μΐ of supematant was removed and added to another 96 well plate.
cDNA synthesîs using ABI High capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, CA, Cat #4368813)
A master mix of 2 μΐ 10X Buffer, 0.8 μΐ 25X dNTPs, 2 μΐ Random primers, 1 μΐ Reverse Transcriptase, 1 μΐ RNase inhibitor and 3.2 μΐ of H2O per reaction as prepared. Equal volumes master mix and RNA were mixed for a final volume of 12μ1 for in vitro screened or 20μ1 for in vivo screened samples. cDNA was generated using a Bio-Rad C-1000 or S-1000 thermal cycler (Hercules, CA) through the following steps: 25°C for 10 minutes, 37°C for 120 minutes, 85°C for 5 seconds, and 4°C hold.
Real time PCR
Two μΐ of cDNA were added to a master mix containing 2μ1 of H2O, 0.5μ1 GAPDH TaqMan Probe (Life Technologies catalog number 4326317E for Hep3B cells, catalog number 352339E for primary mouse hépatocytes or custom probe for cynomolgus primary hépatocytes), 0.5μ1 C5 TaqMan probe (Life Technologies catalog number Hs00167441_ml for Hep3B cells or
222
Mm00457879_ml for Primary Mouse Hepatoctyes or custom probe for cynomolgus primary hépatocytes) and 5μ1 Lightcycler 480 probe master mix (Roche catalog number 04887301001) per well in a 384 well (384 w) plates (Roche catalog number 04887301001). Real time PCR was performed in an Roche LC480 Real Time PCR system (Roche) using the AACt(RQ) assay. For 5 in vitro screening, each duplex was tested with two biological replicates unless otherwise noted and each Real Time PCR was performed in duplicate technical replicates. For in vivo screening, each duplex was tested in one or more experiments (3 mice per group) and each Real Time PCR was run in duplicate technical replicates.
To calculate relative fold change in ALAS1 mRNA levels, real time data were analyzed using the AACt method and normalized to assays performed with cells transfected with 10 nM AD-1955, or mock transfected cells. IC50S were calculated using a 4 parameter fit model using XLFit and normalized to cells transfected with AD-1955 over the same dose range, or to its own lowest dose.
The sense and antisense sequences of AD-1955 are:
SENSE: cuuAcGcuGAGuAcuucGAdTsdT (SEQ ID NO:3682)
ANTISENSE: UCGAAGuACUcAGCGuAAGdTsdT (SEQ ID NO:3683).
The single strand and duplex sequences of the modified and unmodified siRNAs are provided in Table 14 and Table 15, respectively.
Table 14: Human ALAS1 Modified Single Strands and Duplex Sequences
SEQID NO: (sense) SEQ ID NO: (antisens e) Duplex Name Sense Sequence (5'-3') Antisense Sequence (5'-3') Target sites of antisense sequence on NM_ 000688.4
3371 3372 AD-58848 CfsasUfgCfcAfaAfAfAfuGfgAfcAf uCfaUfL96 asUfsgAfuGfuCfcAfuuuUfuGfgCfaU fgsAfsc 1635-1657
3373 3374 AD-58849 AfsusUfuUfgAfaGfUfGfaUfgAfgU fgAfaAfL96 usUfsuCfaCfuCfaUfcactlfuCfaAfaAf usGfsc 2189-2211
223
3375 3376 AD-58850 AfsgsUfuAfuAfuUfAfAfaUfuUfuA faUfcUfL96 asGfsa UfuAfa Afa Ufuua Af uAf uAfa C fusUfsa 2344-2366
3377 3378 AD-58851 GfscsAf u Uf u UfgAfAfGf uGfa UfgA fgUfgAfL96 usCfsaCfuCfaUfcAfcuuCfaAfaAfuGf csAfsg 2187-2209
3379 3380 AD-58852 GfsasAfcUfaAfuGfAfGfcAfgAfcAf uAfaCfL96 gsUfsuAfuGfuCfuGfcucAfuUfaGfuU fcsAfsu 1975-1997
3381 3382 AD-58853 AfsasUfgAfcCfaCfAfCfcUfaUfcGf aGfuUfL96 asAfscUfcGfaUfaGfgugUfgGfuCfaU fusCfsu 973-995
3383 3384 AD-58854 UfsasAfaUfuUfuAfAfUfcUfaUfaG fuAfaAfL96 usUfsuAfcUfa UfaGf a u u Afa Afa Ufu U fasAfsu 2352-2374
3385 3386 AD-58855 UfsusCfaGfuAfuGfAfUfcGfulIfuC fuUfuGfL96 csAfsaAfgAfaAfcGfaucAfuAfcUfgAf asAfsa 929-951
3387 3388 AD-58856 CfsasCfuUfuUfcAfGfUfaUfgAfuCf gUfuUfL96 asAfsaCfgAfuCfaUfacuGfaAfaAfgUf gsGfsa 924-946
3389 3390 AD-58857 AfsasAfuCfuGfuUfUfCfcAfcUfuUf uCfaGfL96 csUfsgAfaAfaGfuGfgaaAfcAfgAfuUf usUfsg 913-935
3391 3392 AD-58858 CfsasUfu UfgAfa AfCf UfgUfcCfa Uf uCfaAfL96 usUfsgAfaUfgGfaCfaguUfuCfaAfaU fgsCfsc 1478-1500
3393 3394 AD-58859 CfscsUfaUfcGfaGfUfUfuUfuAfaA faCfuGfL96 csAfsgUfuUfuAfaAfaacUfcGfaUfaG fgsUfsg 983-1005
3395 3396 AD-58861 GfsasCfcAfgAfaAfGfAfgUfgUfcUf cAfuCfL96 gsAfsuGfaGfaCfaCfucuUfuCfuGfgU fcsUfsu 872-894
3397 3398 AD-58862 AfscsCfaGfaAfaGfAfGfuGfuCfuCf aUfcUfL96 asGfsaUfgAfgAfcAfcucUfuUfcUfgGf usCfsu 873-895
3399 3400 AD-58863 AfscsUfaAfuGfaGfCfAfgAfcAfuAf aCfaUfL96 asUfsgUfuAfuGfuCfugcUfcAfuUfaG fusUfsc 1977-1999
3401 3402 AD-58864 UfsasGfuAfaAfaAfCfAfuAfgUfcCf uGfgAfL96 usCfscAfgGfaCfuAfuguUfuUfuAfcU fasUfsa 2366-2388
3403 3404 AD-58865 UfsasUfuUfcUfgGfAfAfcUfaGfuA faAfuUfL96 asAfsuUfuAfcUfaGfuucCfaGfaAfaU fasUfsu 1185-1207
3405 3406 AD-58867 UfsusCfuGfcAfaAfGfCfcAfgUfcUf uGfaGfL96 es Ufsc Af a Gf a Cf u Gfgc u Uf u Gf cAfg Af asGfsa 706-728
3407 3408 AD-58868 GfsasGfgAfaAfgAfGfGfuUfgCfuG faAfaCfL96 gsUfsuUfcAfgCfaAfccuCfuUfuCfcUf csAfsc 759-781
3409 3410 AD-58869 GfsgsUfaCfuAfgAfAfAfuAfuUfuCf uGfgAfL96 usCfscAfgAfaAfuAfuuuCfuAfgUfaCf csAfsc 1174-1196
3411 3412 AD-58870 GfsasCfaUfcAfuGfCfAfaAfaGfcAf aAfgAfL96 usCfsuUfuGfcUfuUfugcAfuGfaUfgU fcsCfsu 853-875
3413 3414 AD-58871 AfsasAfuUfuUfaAfUfCfuAfuAfgU faAfaAfL96 usUfsuUfaCfuAfuAfgauUfaAfaAfuU fusAfsa 2353-2375
3415 3416 AD-58873 CfsasUfgAfuCfcAfAfGfgGfaUfuCf gAfaAfL96 usUfsuCfgAfaUfcCfcuuGfgAfuCfaUf gsGfsa 1362-1384
3417 3418 AD-58874 AfsgsAfcCfaGfaAfAfGfaGfuGfuCf uCfaUfL96 asUfsgAfgAfcAfcUfcuuUfcUfgGfuCf usUfsu 871-893
3419 3420 AD-58875 AfsusCfcUfgAfaGfAfGfcGfcUfgAf gGfgAfL96 usCfscCfuCfaGfcGfcucUfuCfaGfgAf usCfsc 1810-1832
3421 3422 AD-58876 GfsusCfuGf uGfa UfGfAfaCf u Af a U fgAfgCfL96 gsCfsuCf a Ufu AfgUfuca UfcAfcAfgAf csUfsu 1966-1988
3423 3424 AD-58877 CfsasGfaAfaGfaGfUfGfuCfuCfa Uf cUfuCfL96 gsAfsaGfaUfgAfgAfcacUfcUfuUfcUf gsGfsu 875-897
3425 3426 AD-58878 AfscsUfuUfuCfaGfUfAfuGfaUfcG fuUfuCfL96 gsAfsaAfcGfaUfcAfuacUfgAfaAfaGf usGfsg 925-947
224
3427 3428 AD-58879 Ufscs Af u Gf cCfa Af Af Af a UfgGf a Cf aUfcAfL96 usGfsaUfgUfcCfaUfuuuUfgGfcAfuG fasCfsu 1634-1656
3429 3430 AD-58880 AfsasUfaUfuUfcUfGfGfaAfcUfaG fuAfaAfL96 usUfsuAfcUfaGfuüfccaGfaAfaUfaU fusUfsc 1183-1205
3431 3432 AD-58881 CfsusUfclIfuCfaAfGfAfuAfaCfuUf gCfcAfL96 usGfsgCfaAfgUfuAfucuUfgAfaGfaA fgsAfsu 892-914
3433 3434 AD-58882 UfsusUfcAfgUfaUfGfAfuCfgUfuU fcUfuUfL96 asAfsaGfaAfaCfgAfucaUfaCfuGfaAf asAfsg 928-950
3435 3436 AD-58883 CfscsCfaGfuGfuGfGfUfuAfgUfgU fgAfaAfL96 usUfsuCfaCfaCfuAfaccAfcAfcUfgGf gsGfsc 790-812
3437 3438 AD-58884 GfscslIfgUfgAfgAfUfUfuAfcUfcUf gAfuUfL96 asAfsuCfaGfaGfuAfaauCfuCfaCfaGf csCfsu 1325-1347
3439 3440 AD-58885 AfsgsGfcUfuGfaGfCfAfaGfuUfgG fuAfuCfL96 gsAfsuAfcCfaAfcUfugclIfcAfaGfcCf usGfsa 2229-2251
3441 3442 AD-58886 GfsasAfaGfaGfuGfUfCfuCfaUfcü fuCfuUfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfullf csUfsg 877-899
3443 3444 AD-58887 AfsusUfuCfuGfgAfAfCfuAfgUfaAf aUfuCfL96 gsAfsa UfuUfa Cf uAfgu uCfcAfgAfa Af usAfsu 1186-1208
3445 3446 AD-58888 UfsgsUfgAfuGfuGfGfCfcCfaUfgAf gUfuUfL96 asAfsaCfuCfallfgGfgccAfcAfuCfaCf asCfsa 1531-1553
3447 3448 AD-58889 AfsasGfaGfaGfaAfGfUfcCfuAfuU fuCfuCfL96 gsAfsgAfaAfuAfgGfacuUfcUfcUfcUf usllfsc 2208-2230
3449 3450 AD-58890 UfsgsGfcAfgCfaCfAf Gf a UfgAfa Uf cAfgAfL96 usCfsuGfaUfuCfaUfcugUfgCfuGfcCf asGfsg 671-693
3451 3452 AD-58891 AfsusGfaUfcGfulIfUfCfuUfuGfaG faAfaAfL96 usUfsuUfcUfcAfaAfgaaAfcGfallfcAf usAfsc 935-957
3453 3454 AD-58892 UfscsUfgGfaAfcUfAfGfuAfaAfuU fcCfaUfL96 asUfsgGfaAfuUfuAfcuaGfuUfcCfaG fasAfsa 1189-1211
3455 3456 AD-59095 GfscsCfcAfuUfcüfUfAfuCfcCfgAf gUfL96 asCfsuCfgGfgAfuAfagaAfuGfgsgsc 360-382
3457 3458 AD-59096 GfsgsAfaCfcAfuGfCfCfuCfcAfuGf aUfL96 asUfscAfuGfgAfgGfcauGfgUfuscsc 1347-1369
3459 3460 AD-59097 UfsgsGfaGfuCfuGfUfGfcGfgAfuC fcUfL96 asGfsgAfuCfcGfcAfcagAfcUfcscsa 1794-1816
3461 3462 AD-59098 CfsasCfcCfa CfgGfGf UfgUfgUfgGf gAfL96 usCfscCfaCfaCfaCfccgUfgGfgsusg 1112-1134
3463 3464 AD-59099 GfsgsAfgUfcUfgUfGfCfgGf a UfcCf uAfL96 usAfsgGfallfcCfgCfacaGfaCfuscsc 1795-1817
3465 3466 AD-59100 CfsasAfaAfcUfgCfCfCfcAfaGfaLlf gAfL96 usCfsaUfcUfuGfgGfgcaGfuUfususg 428-450
3467 3468 AD-59101 GfscsCfuCfcAfuGfAfüfcCfaAfgGf gAfL96 usCfscCfuUfgGfaUfcauGfgAfgsgsc 1355-1377
3469 3470 AD-59102 CfsasUfcAfuCfcCfUfGfuGfcGfgGf uUfL96 a s Af scCf cGf c AfcAf gggAf u Gf a s usg 1921-1943
3471 3472 AD-59103 AfscsCfcAfcGfgGfUfGfuGfuGfgGf gAfL96 usCfscCfcAfcAfcAfcccGfuGfgsgsu 1113-1135
3473 3474 AD-59104 CfsasCfa UfcAfuCfCfCfuGfuGfcGf gAfL96 usCfscGfcAfcAfgGfga uGfa Ufgsusg 1919-1941
3475 3476 AD-59105 CfsasGfaAfaGfaGfUfGfuCfuCfaUf cUfL96 asGfsaUfgAfgAfcAfcucUfuUfcsusg 873-895
3477 3478 AD-59106 CfscsUfcCfaUfgAfUfCfcAfaGfgGf aUfL96 asUfscCfcUfuGfgAfucaUfgGfasgsg 1356-1378
225
3479 3480 AD-59107 UfsgsCfcCfa UfuCf Uf Ufa UfcCfcGf aAfL96 usUfscGfgGfaUfaAfgaaUfgGfgscsa 359-381
3481 3482 AD-59108 CfsusUfcAfcCfclIfGfGfcUfaAfgAf uAfL96 usAfsuCfuUfaGfcCfaggGfuGfasasg 1297-1319
3483 3484 AD-59109 AfsusCfa UfcCfclIfGf UfgCfgGfgUf uAfL96 usAfsaCfcCfgCfaCfaggGfaUfgsasu 1922-1944
3485 3486 AD-59110 AfsgsAfaAfgAfgUfGfUfcUfcAfuCf uUfL96 asAfsgAfuGfaGfaCfacuCfuUfuscsu 874-896
3487 3488 AD-59111 CfsusCfcAfuGfaUfCfCfaAfgGfgAf uUfL96 asAfsuCfcCfuUfgGfaucAfuGfgsasg 1357-1379
3489 3490 AD-59112 CfscsAfu UfcUfuAf UfCfcCfgAfgUf cAfL96 usGfsaCfuCfgGfgAfuaaGfaAfusgsg 362-384
3491 3492 AD-59113 CfsasCfcCfuGfgCfUfAfaGfaUfgAf uAfL96 usAfsuCfaUfcUfuAfgccAfgGfgsusg 1300-1322
3493 3494 AD-59114 UfscsAfuCfcCfuGfUfGfcGfgGfullf gAfL96 usCfsaAfcCfcGfcAfcagGfgAfusgsa 1923-1945
3495 3496 AD-59115 AfsasGfaGfuGfuCfUfCfaUfcUfuCf uUfL96 asAfsgAfaGfaUfgAfgacAfcUfcsusu 877-899
3497 3498 AD-59116 GfsusCfallfgCfcAfAfAfaAfuGfgAf cAfL96 usGfsuCfcAfuUfuUfuggCfaUfgsasc 1631-1653
3499 3500 AD-59117 CfsasUfuCfuUfaUfCfCfcGfaGfuCf cAfL96 usGfsgAfcUfcGfgGfauaAfgAfasusg 363-385
3501 3502 AD-59118 AfscsCfcUfgGfcUfAfAfgAf uGfa Uf gAfL96 usCfsaUfcAfuCfuUfagcCfaGfgsgsu 1301-1323
3503 3504 AD-59119 CfsusCfuUfcAfcCfCfUfgGfcUfaAf gAfL96 usCfsuUfaGfcCfaGfgguGfaAfgsasg 1295-1317
3505 3506 AD-59120 AfsusGfcCfaAfaAfAfUfgGfaCfaUf cAfL96 usGfsaUfgUfcCfaUfuuuUfgGfcsasu 1634-1656
3507 3508 AD-59121 UfsgsCfcCfcAfaGfAfUfgAfuGfgAf aUfL96 asUfsuCfcAfuCfaUfcuuGfgGfgscsa 434-456
3509 3510 AD-59122 GfsasAfcCf a UfgCfCf UfcCfa UfgAf uAfL96 usAfsuCfaUfgGfaGfgcaUfgGfususc 1348-1370
3511 3512 AD-59123 UfscsUfuCfaCfcCfUfGfgCfuAfaGf aUfL96 asUfscUfuAfgCfcAfgggUfgAfasgsa 1296-1318
3513 3514 AD-59124 UfsgsCfcAfaAfaAfUfGfgAfcAfuCf aUfL96 asUfsgAfuGfuCfcAfuuuUfuGfgscsa 1635-1657
3515 3516 AD-59125 CfscsAfgAfaAfgAfGfUfgUfcUfcAf uAfL96 usAfsuGfaGfaCfaCfucuUfuCfusgsg 872-894
3517 3518 AD-59126 GfsasAfaCfuGfuCfCfAfuUfcAfaUf gAfL96 usCfsaUfuGfaAfuGfgacAfgUfususc 1481-1503
3519 3520 AD-59127 UfscsAfcCfcUfgGfCfUfaAfgAfuGf aUfL96 a s U fsc Af uCf u Ufa GfccaGfgGfusgsa 1299-1321
3521 3522 AD-59128 CfscsCfuGfgAfgUfCfUfgUfgCfgGf aUfL96 asUfscCfgCfaCfaGfacuCfcAfgsgsg 1791-1813
3523 3524 AD-59129 GfsasAfaGfaGfuGfUfCfuCfaUfcU fuAfL96 usAfsaGfaUfgAfgAfcacUfcUfususc 875-897
3525 3526 AD-59130 UfsgsGfaGfcCfcUfGfGfaGfuCfuG fuAfL96 usAfscAfgAfcUfcCfaggGfcUfcscsa 1786-1808
226
Table 15: Human ALAS1 Unmodifïed Single Strands and Duplex Sequences
SEQID NO: (sense) SEQ ID NO: (antisens θ) Duplex Name Sense Sequence (5'-3') Antisense Sequence (5'-3') Target sites of antisense sequence on NM_ 000688.4
3684 3527 AD-58848 CAUGCCAAAAAUGGACAUCAU AUGAUGUCCAUUUUUGGCAUGAC 1635-1657
3528 3529 AD-58849 AUUUUGAAGUGAUGAGUGAAA UUUCACUCAUCACUUCAAAAUGC 2189-2211
3530 3531 AD-58850 AG U U AU AU UAAAU U U UAAUCU AGAU UAAAAU U UAAUAUAACU UA 2344-2366
3532 3533 AD-58851 GCAUUUUGAAGUGAUGAGUGA UCACUCAUCACUUCAAAAUGCAG 2187-2209
3534 3535 AD-58852 GAACUAAUGAGCAGACAUAAC GUUAUGUCUGCUCAUUAGUUCAU 1975-1997
3536 3537 AD-58853 AAUG ACCACACCUAUCG AG U U AACUCGAUAGGUGUGGUCAUUCU 973-995
3538 3539 AD-58854 UAAAUUUUAAUCUAUAGUAAA U U UACUAUAGAU UAAAAU UUAAU 2352-2374
3540 3541 AD-58855 UUCAGUAUGAUCGUUUCUUUG CAAAGAAACGAUCAUACUGAAAA 929-951
3542 3543 AD-58856 CACUUUUCAGUAUGAUCGUUU AAACGAUCAUACUGAAAAGUGGA 924-946
3544 3545 AD-58857 AAAUCUGUUUCCACUUUUCAG CUGAAAAGUGGAAACAGAUUUUG 913-935
3546 3547 AD-58858 CAUUUGAAACUGUCCAUUCAA UUGAAUGGACAGUUUCAAAUGCC 1478-1500
3548 3549 AD-58859 CCUAUCGAG U U U U UAAAACUG CAGUUUUAAAAACUCGAUAGGUG 983-1005
3550 3551 AD-58861 GACCAGAAAGAGUGUCUCAUC GAUGAGACACUCUUUCUGGUCUU 872-894
3552 3553 AD-58862 ACCAGAAAGAGUGUCUCAUCU AGAUGAGACACUCUUUCUGGUCU 873-895
3554 3555 AD-58863 ACUAAUGAGCAGACAUAACAU AUGUUAUGUCUGCUCAUUAGUUC 1977-1999
3556 3557 AD-58864 UAGUAAAAACAUAGUCCUGGA UCCAGGACUAUGUUUUUACUAUA 2366-2388
3558 3559 AD-58865 UAUUUCUGGAACUAGUAAAUU AAU U UACUAG U UCCAGAAAUAU U 1185-1207
3560 3561 AD-58867 UUCUGCAAAGCCAGUCUUGAG CUCAAGACUGGCUUUGCAGAAGA 706-728
3562 3563 AD-58868 GAGGAAAGAGGU UGCUGAAAC GUUUCAGCAACCUCUUUCCUCAC 759-781
3564 3565 AD-58869 GGUACUAGAAAUAUUUCUGGA UCCAGAAAUAUUUCUAGUACCAC 1174-1196
3566 3567 AD-58870 GACAUCAUGCAAAAGCAAAGA UCUUUGCUUUUGCAUGAUGUCCU 853-875
3568 3569 AD-58871 AAAU U U UAAUCUAUAG UAAAA UU U UACUAUAGAU UAAAAU U UAA 2353-2375
3570 3571 AD-58873 CAUGAUCCAAGGGAUUCGAAA UUUCGAAUCCCUUGGAUCAUGGA 1362-1384
3572 3573 AD-58874 AGACCAGAAAGAGUGUCUCAU AUGAGACACUCUUUCUGGUCUUU 871-893
3574 3575 AD-58875 AUCCUGAAGAGCGCUGAGGGA UCCCUCAGCGCUCUUCAGGAUCC 1810-1832
3576 3577 AD-58876 GUCUGUGAUGAACUAAUGAGC GCUCAUUAGUUCAUCACAGACUU 1966-1988
3578 3579 AD-58877 CAGAAAGAGUGUCUCAUCUUC GAAGAUGAGACACU CUUUCUGGU 875-897
3580 3581 AD-58878 ACUUUUCAGUAUGAUCGUUUC GAAACGAUCAUACUGAAAAGUGG 925-947
3582 3583 AD-58879 UCAUGCCAAAAAUGGACAUCA UGAUGUCCAUUUUUGGCAUGACU 1634-1656
3584 3585 AD-58880 AAUAUUUCUGGAACUAGUAAA U U UACUAG U UCCAGAAAUAUU U C 1183-1205
3586 3587 AD-58881 CUUCUUCAAGAUAACUUGCCA UGGCAAG U UAUCU UGAAGAAGAU 892-914
3588 3589 AD-58882 UUUCAGUAUGAUCGUUUCUUU AAAGAAACGAUCAUACUGAAAAG 928-950
3590 3591 AD-58883 CCCAGUGUGGUUAGUGUGAAA UUUCACACUAACCACACUGGGGC 790-812
3592 3593 AD-58884 GCUGUGAGAUUUACUCUGAUU AAUCAGAGUAAAUCUCACAGCCU 1325-1347
3594 3595 AD-58885 AGGCUUGAGCAAGUUGGUAUC GAUACCAACUUGCUCAAGCCUGA 2229-2251
3596 3597 AD-58886 GAAAGAGUGUCUCAUCUUCUU AAGAAGAUGAGACACUCUUUCUG 877-899
3598 3599 AD-58887 AUUUCUGGAACUAGUAAAUUC GAAU U UACUAGU UCCAGAAAUAU 1186-1208
3600 3601 AD-58888 UGUGAUGUGGCCCAUGAGUUU AAACUCAUGGGCCACAUCACACA 1531-1553
3602 3603 AD-58889 AAGAGAGAAGUCCUAUUUCUC GAGAAAUAGGACUUCUCUCUUUC 2208-2230
3604 3605 AD-58890 UGGCAGCACAGAUGAAUCAGA UCUGAUUCAUCUGUGCUGCCAGG 671-693
3606 3607 AD-58891 AUGAUCGUUUCUUUGAGAAAA UUUUCUCAAAGAAACGAUCAUAC 935-957
227
3608 3609 AD-58892 UCUGGAACUAGUAAAUUCCAU AUGGAAUUUACUAGUUCCAGAAA 1189-1211
3610 3611 AD-59095 GCCCAUUCUUAUCCCGAGU ACUCGGGAUAAGAAUGGGC 360-382
3612 3613 AD-59096 GGAACCAUGCCUCCAUGAU AUCAUGGAGGCAUGGUUCC 1347-1369
3614 3615 AD-59097 UGGAGUCUGUGCGGAUCCU AGGAUCCGCACAGACUCCA 1794-1816
3616 3617 AD-59098 CACCCACGGGUGUGUGGGA UCCCACACACCCGUGGGUG 1112-1134
3618 3619 AD-59099 GGAGUCUGUGCGGAUCCUA UAGGAUCCGCACAGACUCC 1795-1817
3620 3621 AD-59100 CAAAACUGCCCCAAGAUGA UCAUCUUGGGGCAGUUUUG 428-450
3622 3623 AD-59101 GCCUCCAUGAUCCAAGGGA UCCCUUGGAUCAUGGAGGC 1355-1377
3624 3625 AD-59102 CAUCAUCCCUGUGCGGGUU AACCCGCACAGGGAUGAUG 1921-1943
3626 3627 AD-59103 ACCCACGGGUGUGUGGGGA UCCCCACACACCCGUGGGU 1113-1135
3628 3629 AD-59104 CACAUCAUCCCUGUGCGGA UCCGCACAGGGAUGAUGUG 1919-1941
3630 3631 AD-59105 CAGAAAGAGUGUCUCAUCU AGAUGAGACACUCUUUCUG 873-895
3632 3633 AD-59106 CCUCCAUGAUCCAAGGGAU AUCCCUUGGAUCAUGGAGG 1356-1378
3634 3635 AD-59107 UGCCCAUUCUUAUCCCGAA UUCGGGAUAAGAAUGGGCA 359-381
3636 3637 AD-59108 CUUCACCCUGGCUAAGAUA UAUCU UAGCCAGGGUGAAG 1297-1319
3638 3639 AD-59109 AUCAUCCCUGUGCGGGUUA UAACCCGCACAGGGAUGAU 1922-1944
3640 3641 AD-59110 AGAAAGAGUGUCUCAUCUU AAGAUGAGACACUCUUUCU 874-896
3642 3643 AD-59111 CUCCAUGAUCCAAGGGAUU AAUCCCUUGGAUCAUGGAG 1357-1379
3644 3645 AD-59112 CCAUUCUUAUCCCGAGUCA UGACUCGGGAUAAGAAUGG 362-384
3646 3647 AD-59113 CACCCUGGCUAAGAUGAUA UAUCAUCUUAGCCAGGGUG 1300-1322
3648 3649 AD-59114 UCAUCCCUGUGCGGGUUGA UCAACCCGCACAGGGAUGA 1923-1945
3650 3651 AD-59115 AAGAGUGUCUCAUCUUCUU AAGAAGAUGAGACACUCUU 877-899
3652 3653 AD-59116 G U CAUGCCAAAAAUGGACA UGUCCAUUUUUGGCAUGAC 1631-1653
3654 3655 AD-59117 CAUUCUUAUCCCGAGUCCA UGGACUCGGGAUAAGAAUG 363-385
3656 3657 AD-59118 ACCCUGGCUAAGAUGAUGA UCAUCAUCUUAGCCAGGGU 1301-1323
3658 3659 AD-59119 CUCUUCACCCUGGCUAAGA UCU UAGCCAGGG UG AAGAG 1295-1317
3660 3661 AD-59120 AUGCCAAAAAUGGACAUCA UGAUGUCCAUUUUUGGCAU 1634-1656
3662 3663 AD-59121 UGCCCCAAGAUGAUGGAAU AUUCCAUCAUCUUGGGGCA 434-456
3664 3665 AD-59122 GAACCAUGCCUCCAUGAUA UAUCAUGGAGGCAUGGUUC 1348-1370
3666 3667 AD-59123 UCUUCACCCUGGCUAAGAU AUCUUAGCCAGGGUGAAGA 1296-1318
3668 3669 AD-59124 UGCCAAAAAUGGACAUCAU AUGAUGUCCAUUUUUGGCA 1635-1657
3670 3671 AD-59125 CCAGAAAGAGUGUCUCAUA UAUGAGACACUCUUUCUGG 872-894
3672 3673 AD-59126 GAAACUGUCCAUUCAAUGA UCAUUGAAUGGACAGUUUC 1481-1503
3674 3675 AD-59127 UCACCCUGGCUAAGAUGAU AUCAUCUUAGCCAGGGUGA 1299-1321
3676 3677 AD-59128 CCCUGGAGUCUGUGCGGAU AUCCGCACAGACUCCAGGG 1791-1813
3678 3679 AD-59129 GAAAGAGUGUCUCAUCUUA UAAGAUGAGACACUCUUUC 875-897
3680 3681 AD-59130 UGGAGCCCUGGAGUCUGUA UACAGACUCCAGGGCUCCA 1786-1808
The results of the in vitro assays are provided in Table 16. Table 16 also notes the target species of each of the siRNAs.
Table 16: Results of Functional Assays
Cyno Free Uptake Cyno Transfection Hep3b Transfection
Duplex ID Target Type luM | 500nM 1 20nM | lOnM 20nM | 0.2nM lOnM | O.lnM
228
Species Avg Avg Avg Avg Avg Avg
AD-58848 M/R/Rh/H 21/23 131.6 176.0 104.4 128.0 43.5 44.8 25.3 76.8
AD-58849 H/Rh 21/23 91.9 88.1 92.2 105.0 29.4 35.4 11.5 47.1
AD-58850 H/Rh 21/23 79.4 103.4 80.0 111.2 NA 62.2 31.3 72.0
AD-58851 H/Rh 21/23 99.7 74.7 94.8 104.7 NA 40.7 8.6 81.3
AD-58852 H/Rh 21/23 108.1 91.8 103.3 111.9 101.1 128.8 43.4 129.0
AD-58853 H/Rh 21/23 74.8 67.7 84.2 93.5 24.7 52.9 14.1 61.2
AD-58854 H/Rh 21/23 145.9 124.1 106.6 115.3 119.0 83.9 85.0 84.0
AD-58855 H/Rh 21/23 81.5 97.9 92.7 101.8 39.5 40.3 15.3 67.6
AD-58856 H/Rh 21/23 74.1 90.6 84.6 82.6 22.4 30.7 8.7 33.3
AD-58857 H/Rh 21/23 64.7 91.4 62.3 87.1 22.0 31.6 9.8 106.3
AD-58858 H/Rh 21/23 67.4 91.7 68.6 98.3 27.9 40.3 17.4 44.8
AD-58859 H/Rh 21/23 71.2 77.2 92.4 90.1 19.1 34.3 13.1 39.7
AD-58861 H/Rh 21/23 104.6 107.2 102.0 100.6 25.9 35.1 18.0 69.8
AD-58862 H/Rh 21/23 66.8 77.0 68.7 88.5 20.3 31.1 24.2 49.9
AD-58863 H/Rh 21/23 70.8 66.8 76.8 98.5 21.5 29.7 8.7 54.9
AD-58864 H/Rh 21/23 76.2 85.6 83.7 100.8 60.4 61.0 56.4 87.3
AD-58865 H/Rh 21/23 67.9 77.9 95.9 98.4 21.3 38.6 15.5 81.4
AD-58867 H/Rh 21/23 95.9 93.3 107.0 97.5 32.3 42.7 16.6 79.8
AD-58868 H/Rh 21/23 95.2 92.1 116.2 94.7 54.6 69.2 61.5 105.9
AD-58869 H/Rh 21/23 65.0 78.2 75.8 88.2 17.4 25.0 13.0 63.9
AD-58870 H/Rh 21/23 69.4 92.3 81.0 88.1 29.2 43.8 33.7 79.1
AD-58871 H/Rh 21/23 61.2 77.3 88.2 77.0 71.2 73.2 36.7 110.3
AD-58873 H/Rh 21/23 95.2 100.9 83.3 94.6 54.2 52.8 36.6 73.3
AD-58874 H/Rh 21/23 75.8 76.8 63.8 85.3 22.3 31.2 15.0 38.2
AD-58875 H/Rh 21/23 80.7 88.7 78.6 97.9 48.6 73.6 61.2 90.6
AD-58876 H/Rh 21/23 90.8 93.1 82.5 100.2 41.1 56.9 21.2 58.7
AD-58877 H/Rh 21/23 68.3 85.1 51.2 78.7 18.5 46.6 11.9 27.4
AD-58878 H/Rh 21/23 78.3 68.3 81.2 91.2 24.1 23.4 6.2 37.1
AD-58879 H/Rh 21/23 87.9 94.1 79.7 95.4 32.0 47.8 15.7 82.5
AD-58880 H/Rh 21/23 74.9 72.2 88.9 88.1 20.1 27.5 14.0 60.7
AD-58881 H/Rh 21/23 85.9 76.8 78.8 118.0 22.2 36.7 27.6 71.6
AD-58882 H/Rh 21/23 54.1 53.4 60.3 85.8 14.6 27.2 8.2 23.8
AD-58883 H/Rh 21/23 80.4 69.9 75.7 80.3 31.8 25.8 12.3 63.0
AD-58884 H/Rh 21/23 57.7 55.3 64.8 78.2 20.0 30.0 11.8 68.9
AD-58885 H/Rh 21/23 101.8 91.8 104.1 101.5 85.9 71.9 61.8 71.2
AD-58886 M/R/Rh/H 21/23 47.1 58.0 36.3 93.3 16.0 26.6 9.2 32.0
AD-58887 H/Rh 21/23 73.6 98.7 82.6 95.2 28.5 33.5 12.8 65.2
AD-58888 H/Rh 21/23 90.2 69.9 69.4 85.6 46.9 45.0 16.6 72.0
AD-58889 H/Rh 21/23 83.6 98.6 82.4 92.2 36.5 40.3 31.6 99.4
AD-58890 H/Rh 21/23 69.5 95.4 84.2 88.2 50.8 45.6 21.7 92.9
AD-58891 H/Rh 21/23 62.8 75.7 75.4 109.2 23.6 34.3 15.6 55.8
AD-58892 H/Rh 21/23 60.2 92.9 89.8 92.9 22.8 43.3 20.2 75.6
AD-59095 M/R/Rh/H 19mer 88.9 NA 132.8 NA 48.3 97.4 54.3 99.0
AD-59096 M/R/Rh/H 19mer 95.5 NA 90.5 NA 105.7 138.6 131.4 120.7
AD-59097 M/R/Rh/H 19mer 92.5 NA 84.2 NA 75.0 NA 94.7 108.5
AD-59098 M/R/Rh/H 19mer 84.0 NA 87.7 NA 109.3 NA 130.0 87.3
AD-59099 M/R/Rh/H 19mer 89.7 NA 90.0 NA 77.8 85.4 46.8 74.9
AD-59100 M/R/Rh/H 19mer 84.8 NA 144.3 NA 70.6 108.1 91.5 117.6
AD-59101 M/R/Rh/H 19mer 79.0 NA 103.8 NA 89.8 102.9 124.2 107.0
AD-59102 M/R/Rh/H 19mer 85.9 NA 100.6 NA 72.2 68.5 87.9 95.1
AD-59103 M/R/Rh/H 19mer 86.0 NA 91.1 NA 93.0 81.3 130.0 96.0
229
AD-59104 M/R/Rh/H 19mer 92.6 NA 96.9 NA 94.9 91.4 124.4 83.1
AD-59105 M/R/Rh/H 19mer 48.9 NA 101.7 NA 18.4 48.9 17.0 34.7
AD-59106 M/R/Rh/H 19mer 63.2 NA 76.7 NA 28.5 40.7 28.6 46.4
AD-59107 M/R/Rh/H 19mer 71.4 NA 68.7 NA 37.1 45.3 26.8 63.6
AD-59108 M/R/Rh/H 19mer 70.7 NA 85.1 NA 89.9 84.8 139.2 101.7
AD-59109 M/R/Rh/H 19mer 86.1 NA 83.4 NA 84.9 96.2 131.7 86.7
AD-59110 M/R/Rh/H 19mer 70.8 NA 119.7 NA 38.5 60.4 67.4 80.3
AD-59111 M/R/Rh/H 19mer 66.1 NA 76.5 NA 52.2 61.0 69.7 87.6
AD-59112 M/R/Rh/H 19mer 71.2 NA 80.2 NA 91.2 83.4 127.4 89.0
AD-59113 M/R/Rh/H 19mer 67.0 NA 77.8 NA 49.1 59.0 66.8 91.4
AD-59114 M/R/Rh/H 19mer 81.7 NA 79.3 NA 96.3 88.0 129.6 72.4
AD-59115 M/R/Rh/H 19mer 40.4 NA 69.6 NA 19.6 35.7 9.3 16.9
AD-59116 M/R/Rh/H 19mer 72.2 NA 78.3 NA 53.5 77.8 70.1 107.8
AD-59117 M/R/Rh/H 19mer 70.7 NA 75.6 NA 75.8 74.9 129.0 103.5
AD-59118 M/R/Rh/H 19mer 68.8 NA 75.9 NA 81.4 82.1 114.1 89.7
AD-59119 M/R/Rh/H 19mer 64.9 NA 86.5 NA 85.1 125.1 122.8 124.8
AD-59120 M/R/Rh/H 19mer 63.5 NA 75.1 NA 29.9 52.0 16.1 54.1
AD-59121 M/R/Rh/H 19mer 67.6 NA 72.0 NA 88.8 77.4 108.0 103.1
AD-59122 M/R/Rh/H 19mer 60.2 NA 62.3 NA 25.1 45.3 16.2 54.8
AD-59123 M/R/Rh/H 19mer 68.6 NA 108.2 NA 59.2 84.6 80.0 97.7
AD-59124 M/R/Rh/H 19mer 47.5 NA 56.5 NA 23.9 40.0 9.8 18.9
AD-59125 M/R/Rh/H 19mer 45.4 NA 47.2 NA 15.2 40.7 14.7 15.1
AD-59126 M/R/Rh/H 19mer 64.3 NA 74.6 NA 51.6 57.1 35.5 54.4
AD-59127 M/R/Rh/H 19mer 103.4 NA 105.8 NA 94.0 156.4 135.9 113.7
AD-59128 M/R/Rh/H 19mer 102.4 NA 81.4 NA 66.3 89.3 60.2 74.9
AD-59129 M/R/Rh/H 19mer 41.3 NA 38.8 NA 17.9 41.4 8.6 12.6
AD-59130 M/R/Rh/H 19mer 58.3 NA 80.8 NA 94.9 78.3 106.7 88.0
Table 17 illustrâtes the IC5os of select ALAS1 siRNA duplexes. The IC5os were determined from the knockdown of endogenously expressed ALAS1 in the Hep3B cell line, at 24 hours following transfection of each ALAS1 modified siRNA duplex (see Table 14). At least 5 seven duplexes, including AD-58882, AD-58878, AD-58886, AD-58877, AD-59115, AD58856, and AD-59129, consistently demonstrated IC50S of less than 0.1 nm, indicating that these duplexes were particularly effective in suppressing ALAS1 expression.
Table 17: ICgnS of select ALAS1 siRNA duplexes
Duplex ID 384wIC50(nM) 96w IC50 (nM)
AD-58882 0.008 0.014
AD-58878 0.040 0.031
AD-58886 0.037 0.033
230
AD-58877 0.031 0.034
AD-59115 0.093 0.052
AD-58856 0.061 0.066
AD-59129 0.085 0.071
AD-59124 0.572 0.078
AD-58874 0.140 0.102
AD-59125 0.118 0.115
AD-59105 0.511 0.144
AD-59120 180.592 0.498
AD-59122 36.646 0.646
AD-59106 7.906 0.847
AD-59126 n/a 1.014
AD-59107 n/a 1.971
Example 11. ALASl-GalNAc activity in AIP Phénobarbital induction mouse model
The AIP mouse model was used to investigate the effect of an siRNA that was an ALASlGalNAc conjugate. The siRNA had the sequence of duplex AD-58632 (see Table 20)
Table 20: Sequences of ALAS1 siRNA Duplex AD-58632
SEQ1D NO: (sense) SEQ ID NO: (antisense) Target sites of antisense sequence Duplex Name Sense Sequence (5'-3') Antisense Sequence (5'-3')
4149 4150 873-895 AD- 58632 GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfuUfL96 asAfsgAfaGfatlfgAfgacAfcUfcUfuUfcsusg
AIP mice were untreated (baseline), or injected subcutaneously on day 1 with saline or the ALASl-GalNAc conjugate at a dose of 20mg/kg. On Days 2, 3, and 4 they were left untreated (baseline) or they were treated with IP injections of Phénobarbital. On Day 5 plasma
231 was taken and levels of ALA and PBG were measured using an LC-MS assay. As shown in FIG.
15, the ALASl-GalNAc conjugate blunted the production of plasma ALA and PBG by about 84 and 80% respectively. These results indicate that treatment with an ALASl-GalNAc conjugate was effective in preventing increases in both plasma ALA and PBG associated with phenobarbital-induced acute attacks in this AIP animal model.
Example 12. Further siRNAs that Target ALAS1 and Inhibit ALAS1 Expression
Modified siRNA sequences that target ALAS1 siRNA were designed and produced as described in Example 2. The sequences are provided in Table 18. The in vitro activity of the 10 modified duplexes was tested as described below.
Table 18: Human ALAS1 Modified Single Strands and Duplex Sequences
SEQ.ID NO: (sense) SEQ.ID NO: (antisense) Duplex Name Sense Sequence (5'-3') Antisense Sequence (5'-3') Target sites of antisense sequence on NM 000688.4
3685 3686 AD-59453 CAGGCAAAUCUCUGUUGUUdTdT AACAACAGAGAUUUGCCUGdTdT 402-420
3687 3688 AD-59395 GAAAAAAAU U G AUG AG AAAdTdT UUUCUCAUCAAUUUUUUUCdTdT 949-967
3689 3690 AD-59477 GGAAAGAUGCCGCACUCUUdTdT AAGAGUGCGGCAUCUUUCCdTdT 1242-1260
3691 3692 AD-59492 UGUCUCAUCUUCUUCAAGAdTdT UCUUGAAGAAGAUGAGACAdTdT 882-900
3693 3694 AD-59361 ACAUCUACGUGCAAGCAAUdTdT AUUGCUUGCACGUAGAUGUdTdT 1992-2010
3695 3696 AD-59462 UUCUCUGAUUGACACCGUAdTdT UACGGUGUCAAUCAGAGAAdTdT 1711-1729
3697 3698 AD-59433 GCUGCUGGCUUCAUCUUCAdTdT UGAAGAUGAAGCCAGCAGCdTdT 1739-1757
3699 3700 AD-59424 AGCGCAACGUCAAACUCAUdTdT AUGAGUUUGACGUUGCGCUdTdT 1851-1869
3701 3702 AD-59414 UAUUUCUGGAACUAGUAAAdTdT UU UACUAGU UCCAGAAAUAdTdT 1183-1201
3703 3704 AD-59539 GGUUGUGUUGGAGGGUACAdTdT UGUACCCUCCAACACAACCdTdT 1679-1697
3705 3706 AD-59400 GUGUCAGUCUGGUGCAGUAdTdT UACUGCACCAGACUGACACdTdT 1070-1088
3707 3708 AD-59551 CUUUGUGGCCAAUGACUCAdTdT UGAGUCAUUGGCCACAAAGdTdT 1273-1291
3709 3710 AD-59482 AGAUGCUGCUAAAAACACAdTdT UGUGUUUUUAGCAGCAUCUdTdT 1942-1960
3711 3712 AD-59448 GAGUCAUGCCAAAAAUGGAdTdT UCCAUUUUUGGCAUGACUCdTdT 1629-1647
3713 3714 AD-59392 CUGUGCGGAUCCUGAAGAGdTdT CUCUUCAGGAUCCGCACAGdTdT 1800-1818
3715 3716 AD-59469 CACUUUGAAACAACAUGGUdTdT ACCAUGUUGUUUCAAAGUGdTdT 1141-1159
3717 3718 AD-59431 AAGUGAUGAGUGAAAGAGAdTdT UCUCUUUCACUCAUCACUUdTdT 2193-2211
3719 3720 AD-59423 AUCUGCUAGUCACAUGGAAdTdT UUCCAUGUGACUAGCAGAUdTdT 2103-2121
3721 3722 AD-59517 UGGGGCAGGUGGUACUAGAdTdT UCUAGUACCACCUGCCCCAdTdT 1162-1180
3723 3724 AD-59578 GCAGAUGACUAUUCAGACUdTdT AGUCUGAAUAGUCAUCUGCdTdT 1031-1049
3725 3726 AD-59495 GCCUCAUUCCUCAGCUGAGdTdT CUCAGCUGAGGAAUGAGGCdTdT 2143-2161
3727 3728 AD-59432 GUAUGAUCGUUUCUUUGAGdTdT CUCAAAGAAACGAUCAUACdTdT 931-949
3729 3730 AD-59382 UAUCCAGAUGGUCUUCAGAdTdT UCUGAAGACCAUCUGGAUAdTdT 2302-2320
3731 3732 AD-59472 UAGUGUGAAAACCGAUGGAdTdT UCCAUCGGUUUUCACACUAdTdT 799-817
3733 3734 AD-59459 UCCCCAUGGCAGAUGACUAdTdT UAGUCAUCUGCCAUGGGGAdTdT 1023-1041
3735 3736 AD-59413 CCACUGCAGCAGUACACUAdTdT UAGUGUACUGCUGCAGUGGdTdT 483-501
232
3737 3738 AD-59478 CUGUGAACCGGCGAGCACAdTdT UGUGCUCGCCGGUUCACAGdTdT 999-1017
3739 3740 AD-59376 GGUCCUAUGCUGCUGGCUUdTdT AAGCCAGCAGCAUAGGACCdTdT 1731-1749
3741 3742 AD-59556 AGCCUUUGGUUGUGUUGGAdTdT UCCAACACAACCAAAGGCUdTdT 1672-1690
3743 3744 AD-59399 AAUUCCAUGUGGACUUAGAdTdT UCUAAGUCCACAUGGAAUUdTdT 1200-1218
3745 3746 AD-59474 CCAGGGCACUGCAAGCAAAdTdT UUUGCUUGCAGUGCCCUGGdTdT 640-658
3747 3748 AD-53542 cuuuucAGuAuGAucGuuudTsdT AAACGAUcAuACUGAAAAGdTsdT 924-942
3749 3750 AD-59480 GAAUCAGAGAGGCAGCAGUdTdT ACUGCUGCCUCUCUGAUUCdTdT 682-700
3751 3752 AD-59549 GCAAAGAUCUGACCCCUCAdTdT UGAGGGGUCAGAUCUUUGCdTdT 1441-1459
3753 3754 AD-59515 GGAGAAGAGCUCCUACGGAdTdT UCCGUAGGAGCUCUUCUCCdTdT 2033-2051
3755 3756 AD-59427 CCAUGAGUUUGGAGCAAUCdTdT GAUUGCUCCAAACUCAUGGdTdT 1540-1558
3757 3758 AD-59390 CUUUGAGAAAAAAAUUGAUdTdT AUCAAUUUUUUUCUCAAAGdTdT 943-961
3759 3760 AD-59511 UGAGCAGACAUAACAUCUAdTdT UAGAUGUUAUGUCUGCUCAdTdT 1980-1998
3761 3762 AD-59532 CGUGCAAGCAAUCAAUUACdTdT GUAAUUGAUUGCUUGCACGdTdT 1999-2017
3763 3764 AD-59562 AAAGCAAAGACCAGAAAGAdTdT UCUUUCUGGUCUUUGCUUUdTdT 862-880
3765 3766 AD-59513 GGAUGUGCAGGAAAUGAAUdTdT AUUCAUUUCCUGCACAUCCdTdT 733-751
3767 3768 AD-59362 CAGCAUACUUCCUGAACAUdTdT AUGUUCAGGAAGUAUGCUGdTdT 321-339
3769 3770 AD-53541 GcAGcAcAGAuGAAucAGAdTsdT UCUGAUUcAUCUGUGCUGCdTsdT 671-689
3771 3772 AD-59490 UCUGUUGUUCUAUGCCCAAdTdT UUGGGCAUAGAACAACAGAdTdT 412-430
3773 3774 AD-59422 UGAGACAGAUGCUAAUGGAdTdT UCCAU UAGCAU CUG UCUCAdTdT 1869-1887
3775 3776 AD-59467 GCCAAUGACUCAACCCUCUdTdT AGAGGGUUGAGUCAUUGGCdTdT 1280-1298
3777 3778 AD-59579 GAGUGCAACUUCUGCAGGAdTdT UCCUGCAGAAGUUGCACUCdTdT 2159-2177
3779 3780 AD-59426 GUGAAAGAGAGAAGUCCUAdTdT UAGGACUUCUCUCUUUCACdTdT 2202-2220
3781 3782 AD-59363 UAACUUGCCAAAAUCUGUUdTdT AACAGAU U U UGGCAAGU U AdTdT 901-919
3783 3784 AD-59436 AAGCCAG UCU U GAGCU UCAdTdT UGAAGCUCAAGACUGGCUUdTdT 711-729
3785 3786 AD-53536 cAcuuuucAGuAuGAucGudTsdT ACG AUcAu ACU GAAAAG UGdTsdT 922-940
3787 3788 AD-59491 GCAGCAGUGUCUUCUGCAAdTdT UUGCAGAAGACACUGCUGCdTdT 693-711
3789 3790 AD-59500 UCCUGAACAUGGAGAGUGUdTdT ACACUCUCCAUGUUCAGGAdTdT 330-348
3791 3792 AD-59394 AUUUCUGGAACACUUGGCAdTdT UGCCAAGUGUUCCAGAAAUdTdT 1652-1670
3793 3794 AD-59441 CAGUACACUACCAACAGAUdTdT AUCUGUUGGUAGUGUACUGdTdT 492-510
3795 3796 AD-59365 GCAUGACCUCAAUUAUUUCdTdT GAAAUAAUUGAGGUCAUGCdTdT 2261-2279
3797 3798 AD-59411 AGAACUGCUGCAAAGAUCUdTdT AGAUCUUUGCAGCAGUUCUdTdT 1432-1450
3799 3800 AD-59544 CACCCCAGAUGAUGAACUAdTdT UAGUUCAUCAUCUGGGGUGdTdT 2073-2091
3801 3802 AD-59428 GAUCCAAGGGAUUCGAAACdTdT GUUUCGAAUCCCUUGGAUCdTdT 1363-1381
3803 3804 AD-59471 CUCAUCACCAAAAAGCAAGdTdT CUUGCUUUUUGGUGAUGAGdTdT 1052-1070
3805 3806 AD-59518 ACAACAUGGUGCUGGGGCAdTdT UGCCCCAGCACCAUGUUGUdTdT 1150-1168
3807 3808 AD-53547 GAucGuuucuuuGAGAAAAdTsdT UUUUCUcAAAGAAACGAUCdTsdT 935-953
3809 3810 AD-59573 CAGCACGAGUUCUCUGAUUdTdT AAUCAGAGAACUCGUGCUGdTdT 1702-1720
3811 3812 AD-59473 AAUGAUGUCAGCCACCUCAdTdT UGAGGUGGCUGACAUCAUUdTdT 1412-1430
3813 3814 AD-59412 AGUUAUGGACACUUUGAAAdTdT UUUCAAAGUGUCCAUAACUdTdT 1132-1150
3815 3816 AD-59522 GAUGAUGAACUACUUCCUUdTdT AAGGAAGUAGUUCAUCAUCdTdT 2080-2098
3817 3818 AD-59502 GCAGGAAAUGAAUGCCGUGdTdT CACGGCAUUCAUUUCCUGCdTdT 739-757
3819 3820 AD-59499 UCUUCAAGAUAACUUGCCAdTdT UGGCAAGUUAUCUUGAAGAdTdT 892-910
3821 3822 AD-59520 CGAUGGAGGGGAUCCCAGUdTdT ACUGGGAUCCCCUCCAUCGdTdT 811-829
3823 3824 AD-59581 CCAAAAAGCAAGUGUCAGUdTdT ACUGACACUUGCUUUUUGGdTdT 1059-1077
3825 3826 AD-59461 GAUUGGGGAUCGGGAUGGAdTdT UCCAUCCCGAUCCCCAAUCdTdT 1612-1630
3827 3828 AD-59370 CCCUGGAGUCUGUGCGGAUdTdT AUCCGCACAGACUCCAGGGdTdT 1791-1809
3829 3830 AD-53540 GuuGucuuuAuAuGuGAAudTsdT AU UcAcAu AuAAAG AcAACdTsdT 2321-2339
3831 3832 AD-59574 CGGGCAUUGUCCACUGCAGdTdT CUGCAGUGGACAAUGCCCGdTdT 473-491
3833 3834 AD-59375 UAUUCAGACUCCCUCAUCAdTdT UGAUGAGGGAGUCUGAAUAdTdT 1040-1058
3835 3836 AD-59387 CACUGCAUUUUGAAGUGAUdTdT AUCACUUCAAAAUGCAGUGdTdT 2181-2199
3837 3838 AD-59397 CCAGAAAGAGUGUCUCAUCdTdT GAUGAGACACUCUUUCUGGdTdT 872-890
3839 3840 AD-59396 AGGCGGAGGGAUUGGGGAUdTdT AUCCCCAAUCCCUCCGCCUdTdT 1603-1621
233
3841 3842 AD-59393 AGACCUCCAUGGGAAAGAUdTdT AUCUUUCCCAUGGAGGUCUdTdT 1231-1249
3843 3844 AD-59483 GCAGGAGGCCACUGCAUUUdTdT AAAUGCAGUGGCCUCCUGCdTdT 2172-2190
3845 3846 AD-59430 AUCUGUUUCCACUUUUCAGdTdT CUG AAAAG U G GAAACAGAUdTdT 913-931
3847 3848 AD-59463 AGAGAAGUCCUAUUUCUCAdTdT UGAGAAAUAG GACU UCU CUdTdT 2209-2227
3849 3850 AD-53534 GucuucAGAGuuGucuuuAdTsdT UAAAGAcAACUCUGAAGACdTsdT 2312-2330
3851 3852 AD-59514 GGCUGGAACUGAAGCCUCAdTdT UGAGGCUUCAGUUCCAGCCdTdT 2130-2148
3853 3854 AD-59575 GCCAUUAUCAUAUCCAGAUdTdT AUCUGGAUAUGAUAAUGGCdTdT 2292-2310
3855 3856 AD-59364 AGCAGGCCCCAGUGUGGUUdTdT AACCACACUGGGGCCUGCUdTdT 781-799
3857 3858 AD-59402 UCAGCUGAGUGCAACUUCUdTdT AGAAGUUGCACUCAGCUGAdTdT 2153-2171
3859 3860 AD-59479 GAGCACACAUCUUCCCCAUdTdT AUGGGGAAGAUGUGUGCUCdTdT 1011-1029
3861 3862 AD-59481 ACUUCCAGGACAUCAUGCAdTdT UGCAUGAUGUCCUGGAAGUdTdT 843-861
3863 3864 AD-59530 CCU AUCG AG U U U U U AAAACdTdT GUUUUAAAAACUCGAUAGGdTdT 981-999
3865 3866 AD-59582 CUUCCU UGAGAAUCUGCUAdTdT UAGCAGAUUCUCAAGGAAGdTdT 2092-2110
3867 3868 AD-59506 ACCAACAGAUCAAAGAAACdTdT GUUUCUUUGAUCUGUUGGUdTdT 501-519
3869 3870 AD-59567 UAACCCCAGGCCAUUAUCAdTdT UGAUAAUGGCCUGGGGUUAdTdT 2283-2301
3871 3872 AD-59485 CCAUGCCUCCAUGAUCCAAdTdT UUGGAUCAUGGAGGCAUGGdTdT 1351-1369
3873 3874 AD-59525 UGAUGAACUAAUGAGCAGAdTdT UCUGCUCAUUAGUUCAUCAdTdT 1969-1987
3875 3876 AD-59566 CCUGAAGAGCGCUGAGGGAdTdT UCCCUCAGCGCUCUUCAGGdTdT 1810-1828
3877 3878 AD-59580 AACACU UGGCAAAGCCUU UdTdT AAAGGCUUUGCCAAGUGUUdTdT 1660-1678
3879 3880 AD-59512 UCUGCAGAAAGCAGGCAAAdTdT UUUGCCUGCUUUCUGCAGAdTdT 391-409
3881 3882 AD-59475 CCGGCCUCCCUGUUGUCCAdTdT UGGACAACAGGGAGGCCGGdTdT 1890-1908
3883 3884 AD-59438 CAUCAUCCCUGUGCGGGUUdTdT AACCCGCACAGGGAUGAUGdTdT 1921-1939
3885 3886 AD-59442 UGUGCGGGUUGCAGAUGCUdTdT AGCAUCUGCAACCCGCACAdTdT 1930-1948
3887 3888 AD-59516 GGAAAGAGGUUGCUGAAACdTdT GUUUCAGCAACCUCUUUCCdTdT 759-777
3889 3890 AD-59429 AGGUCCACGCAGUGGGGCUdTdT AGCCCCACUGCGUGGACCUdTdT 1572-1590
3891 3892 AD-59510 UGCCGUGAGGAAAGAGGUUdTdT AACCUCUUUCCUCACGGCAdTdT 751-769
3893 3894 AD-59457 GCUAAUGGAUGCCGGCCUCdTdT GAGGCCGGCAUCCAUUAGCdTdT 1879-1897
3895 3896 AD-59434 GAAGCAAGUGGGGCUGGAAdTdT UUCCAGCCCCACUUGCUUCdTdT 2119-2137
3897 3898 AD-59454 CAUCUUCCGCCACAAUGAUdTdT AUCAUUGUGGCGGAAGAUGdTdT 1399-1417
3899 3900 AD-59468 AUUUCUCAGGCUUGAGCAAdTdT UUGCUCAAGCCUGAGAAAUdTdT 2220-2238
3901 3902 AD-59565 CCCGAGUCCCCCAGGCCUUdTdT AAGGCCUGGGGGACUCGGGdTdT 372-390
3903 3904 AD-59416 CAAGCAAAUGCCCU U UCCU dTdT AGGAAAGGGCAUUUGCUUGdTdT 651-669
3905 3906 AD-59420 CCCCU CAG UCCCCAAGAU UdTdT AAUCUUGGGGACUGAGGGGdTdT 1453-1471
3907 3908 AD-59552 CUACGGUGCCCCGGGGAGAdTdT UCUCCCCGGGGCACCGUAGdTdT 2019-2037
3909 3910 AD-59558 AAAACUGCCCCAAGAUGAUdTdT AUCAUCUUGGGGCAGUUUUdTdT 429-447
3911 3912 AD-59404 ACAAAACUGCUAAGGCCAAdTdT UUGGCCUUAGCAGUUUUGUdTdT 540-558
3913 3914 AD-59455 GAUUCUGGGAACCAUGCCUdTdT AGGCAUGGUUCCCAGAAUCdTdT 1340-1358
3915 3916 AD-59496 CCAGAU GGCACACAGCU UCdTdT GAAGCUGUGUGCCAUCUGGdTdT 593-611
3917 3918 AD-59446 AGGGAUUCGAAACAGCCGAdTdT UCGGCUGUUUCGAAUCCCUdTdT 1369-1387
3919 3920 AD-59435 CUCUGCAGUCCUCAGCGCAdTdT UGCGCUGAGGACUGCAGAGdTdT 109-127
3921 3922 AD-59419 CCGCCGCCUCUGCAGUCCUdTdT AGGACUGCAGAGGCGGCGGdTdT 102-120
3923 3924 AD-59533 CUGGCUGGAGCCCUGGAGUdTdT ACUCCAGGGCUCCAGCCAGdTdT 1781-1799
3925 3926 AD-59366 GACAUCAUGCAAAAGCAAAdTdT UUUGCUUUUGCAUGAUGUCdTdT 851-869
3927 3928 AD-59521 GCUUGAGCAAGUUGGUAUCdTdT GAUACCAACU U GCUCAAGCdTdT 2229-2247
3929 3930 AD-59563 CAGGCUG UGAGAU U UACUCdTdT GAGUAAAUCUCACAGCCUGdTdT 1320-1338
3931 3932 AD-59534 AGAGCUGUGUGAUGUGGCCdTdT GGCCACAUCACACAGCUCUdTdT 1522-1540
3933 3934 AD-59407 GGAGCUGGCAGACCUCCAUdTdT AUGGAGGUCUGCCAGCUCCdTdT 1222-1240
3935 3936 AD-59445 AUCCCAGUGGACUGCUGAAdTdT UUCAGCAGUCCACUGGGAUdTdT 822-840
3937 3938 AD-59546 GUCAAACUCAUGAGACAGAdTdT UCUGUCUCAUGAGUUUGACdTdT 1859-1877
3939 3940 AD-59456 CUUUCCUGGCAGCACAGAUdTdT AUCUGUGCUGCCAGGAAAGdTdT 663-681
3941 3942 AD-59503 CCCUCCGGCCAGUGAGAAAdTdT UUUCUCACUGGCCGGAGGGdTdT 520-538
3943 3944 AD-59536 CUACCUAGGAAUGAGUCGCdTdT GCGACUCAUUCCUAGGUAGdTdT 1093-1111
234
3945 3946 AD-59385 CCCAAGAUUGUGGCAUUUGdTdT CAAAUGCCACAAUCUUGGGdTdT 1463-1481
3947 3948 AD-59367 GAGCAAUCACCUUCGUGGAdTdT UCCACGAAGGUGAUUGCUCdTdT 1551-1569
3949 3950 AD-59458 UGCCCAUUCUUAUCCCGAGdTdT CUCGGGAUAAGAAUGGGCAdTdT 359-377
3951 3952 AD-59381 AAGGCCAAGGUCCAACAGAdTdT UCUGUUGGACCUUGGCCUUdTdT 551-569
3953 3954 AD-59538 CACACAGCUUCCGUCUGGAdTdT UCCAGACGGAAGCUGUGUGdTdT 601-619
3955 3956 AD-59421 UUAUGGGGCUCGAGGCGGAdTdT UCCGCCUCGAGCCCCAUAAdTdT 1591-1609
3957 3958 AD-59388 UGUCUUCUGCAAAGCCAGUdTdT ACUGGCUUUGCAGAAGACAdTdT 700-718
3959 3960 AD-59444 AGGCCUGAGCAUGACCUCAdTdT UGAGGUCAUGCUCAGGCCUdTdT 2253-2271
3961 3962 AD-59528 AUGUGAAUUAAGUUAUAUUdTdT AAUAUAACUUAAUUCACAUdTdT 2332-2350
3963 3964 AD-59498 ACUGCUGAAGAACUUCCAGdTdT CUGGAAGUUCUUCAGCAGUdTdT 832-850
3965 3966 AD-59497 UGAGAAAGACAAAACUGCUdTdT AGCAGUUUUGUCUUUCUCAdTdT 532-550
3967 3968 AD-59384 UCAGCCACCUCAGAGAACUdTdT AGUUCUCUGAGGUGGCUGAdTdT 1419-1437
3969 3970 AD-59452 GGCAACGAGCGUUUCGUUUdTdT AAACGAAACGCUCGUUGCCdTdT 51-69
3971 3972 AD-59379 CCUGAUGGAUCCCAGCAGAdTdT UCUGCUGGGAUCCAUCAGGdTdT 572-590
3973 3974 AD-59529 UGUGCCCACUGGAAGAGCUdTdT AGCUCUUCCAGUGGGCACAdTdT 1509-1527
3975 3976 AD-59389 CCACAGGAGCCAGCAUACUdTdT AGUAUGCUGGCUCCUGUGGdTdT 311-329
3977 3978 AD-59585 GUGGUACUAGAAAUAUUUCdTdT GAAAUAUUUCUAGUACCACdTdT 1170-1188
3979 3980 AD-59570 UUCGCCGCUGCCCAUUCUUdTdT AAGAAUGGGCAGCGGCGAAdTdT 351-369
3981 3982 AD-59415 CCGCCAGCACCAGCGCAACdTdT GUUGCGCUGGUGCUGGCGGdTdT 1840-1858
3983 3984 AD-59505 CGCUGAGGGACGGGUGCUUdTdT AAGCACCCGUCCCUCAGCGdTdT 1819-1837
3985 3986 AD-59557 UGGACUUCUCGACUUGAGUdTdT ACUCAAGUCGAGAAGUCCAdTdT 69-87
3987 3988 AD-59548 AAAGAAACCCCUCCGGCCAdTdT UGGCCGGAGGGGUUUCUUUdTdT 512-530
3989 3990 AD-59487 UUGACACCGUACGGUCCUAdTdT UAGGACCGUACGGUGUCAAdTdT 1719-1737
3991 3992 AD-59550 CCCUCUUCACCCUGGCUAAdTdT UUAGCCAGGGUGAAGAGGGdTdT 1293-1311
3993 3994 AD-59572 CCCCCAGGCCUUUCUGCAGdTdT CUGCAGAAAGGCCUGGGGGdTdT 379-397
3995 3996 AD-59554 AUGCCCAAAACUGCCCCAAdTdT UUGGGGCAGUUUUGGGCAUdTdT 423-441
3997 3998 AD-59437 CUUGAGUGCCCGCCUCCUUdTdT AAGGAGGCGGGCACUCAAGdTdT 81-99
3999 4000 AD-59584 GGGUACAUCGCCAGCACGAdTdT UCGUGCUGGCGAUGUACCCdTdT 1691-1709
4001 4002 AD-59373 GUGUGGGGCAGUUAUGGACdTdT GUCCAUAACUGCCCCACACdTdT 1123-1141
4003 4004 AD-59545 ACAUAGUCCUGGAAAUAAAdTdT UUUAUUUCCAGGACUAUGUdTdT 2372-2390
4005 4006 AD-59547 AUCCCAGCAGAGUCCAGAUdTdT AUCUGGACUCUGCUGGGAUdTdT 580-598
4007 4008 AD-59470 CUAGAUUCUUUCCACAGGAdTdT UCCUGUGGAAAGAAUCUAGdTdT 300-318
4009 4010 AD-59417 UUGUUUUCCUCGUGCUUUGdTdT CAAAGCACGAGGAAAACAAdTdT 1259-1277
4011 4012 AD-59535 CCUCCUUCGCCGCCGCCUCdTdT GAGGCGGCGGCGAAGGAGGdTdT 93-111
4013 4014 AD-59507 UGAGGCUGCUCCCGGACAAdTdT UUGUCCGGGAGCAGCCUCAdTdT 31-49
4015 4016 AD-59519 CCAACAGACUCCUGAUGGAdTdT UCCAUCAGGAGUCUGUUGGdTdT 562-580
4017 4018 AD-59391 UCACAUGGAAGCAAGUGGGdTdT CCCACUUGCUUCCAUGUGAdTdT 2112-2130
4019 4020 AD-59537 CAUUCAAUGGAUGGGGCGGdTdT CCGCCCCAUCCAUUGAAUGdTdT 1490-1508
4021 4022 AD-59450 AGGAAUGAGUCGCCACCCAdTdT UGGGUGGCGACUCAUUCCUdTdT 1099-1117
4023 4024 AD-59449 UGGACUUAGAGCGGGAGCUdTdT AGCUCCCGCUCUAAGUCCAdTdT 1209-1227
4025 4026 AD-59418 CUAAAAACACAGAAGUCUGdTdT CAGACUUCUGUGUUUUUAGdTdT 1950-1968
4027 4028 AD-59561 CCCUCACCACACACCCCAGdTdT CUGGGGUGUGUGGUGAGGGdTdT 2062-2080
4029 4030 AD-59460 AAUCCUUGCUUCAGGGACUdTdT AGUCCCUGAAGCAAGGAUUdTdT 171-189
4031 4032 AD-59409 UUGUGGCAUUUGAAACUGUdTdT ACAG U U UCAAAUGCCACAAdTdT 1470-1488
4033 4034 AD-59476 UCAAUUACCCUACGGUGCCdTdT GGCACCGUAGGGUAAUUGAdTdT 2010-2028
4035 4036 AD-59406 CAAGCCAGCCCCUCGGGCAdTdT UGCCCGAGGGGCUGGCUUGdTdT 460-478
4037 4038 AD-59569 GAGUCUUCCCUGCCUGGAUdTdT AUCCAGGCAGGGAAGACUCdTdT 259-277
4039 4040 AD-59451 UGGAGAGUGUUGUUCGCCGdTdT CGGCGAACAACACUCUCCAdTdT 339-357
4041 4042 AD-59553 ACCCCUUGCCUGCCACAAGdTdT CUUGUGGCAGGCAAGGGGUdTdT 621-639
4043 4044 AD-59372 CUGGAUGGAUGAGUGGCUUdTdT AAGCCACUCAUCCAUCCAGdTdT 272-290
4045 4046 AD-59377 CAAGAUGAUGGAAGUUGGGdTdT CCCAACUUCCAUCAUCUUGdTdT 439-457
4047 4048 AD-59531 UUUCGUUUGGACUUCUCGAdTdT UCGAGAAGUCCAAACGAAAdTdT 62-80
235
4049 4050 AD-59560 UCAUCUUCACCACCUCUCUdTdT AGAGAGG UGG U GAAGAUGAdTdT 1749-1767
4051 4052 AD-59489 UGCCCAGUUCUUCCCGCUGdTdT CAGCGGGAAGAACUGGGCAdTdT 132-150
4053 4054 AD-59540 AAAAAUGGACAUCAUUUCUdTdT AGAAAUGAUGUCCAUUUUUdTdT 1639-1657
4055 4056 AD-59378 CUUGAGCUUCAGGAGGAUGdTdT CAUCCUCCUGAAGCUCAAGdTdT 719-737
4057 4058 AD-59403 CCUCUCUGCCACCCAUGCUdTdT AGCAUGGGUGGCAGAGAGGdTdT 1761-1779
4059 4060 AD-59493 AAAGUCAGGAUCCCUAAGAdTdT UCUUAGGGAUCCUGACUUUdTdT 242-260
4061 4062 AD-59374 CGACCACGGAGGAAUCCUUdTdT AAGGAUUCCUCCGUGGUCGdTdT 159-177
4063 4064 AD-59380 UUCCGUCUGGACACCCCUUdTdT AAGGGGUGUCCAGACGGAAdTdT 609-627
4065 4066 AD-59576 CCACCCAUGCUGCUGGCUGdTdT CAGCCAGCAGCAUGGGUGGdTdT 1769-1787
4067 4068 AD-59425 UGAGAAAAAGAAUGACCACdTdT GUGGUCAUUCUUUUUCUCAdTdT 961-979
4069 4070 AD-59509 UAAGAUGAUGCCAGGCUGUdTdT ACAGCCUGGCAUCAUCUUAdTdT 1309-1327
4071 4072 AD-59488 AGUUAUAUUAAAUUUUAAUdTdT AU U AAAAU U UAAU AUAACUdTdT 2342-2360
4073 4074 AD-59486 UCUUCCCGCUGUGGGGACAdTdT UGUCCCCACAGCGGGAAGAdTdT 140-158
4075 4076 AD-59465 UGCCACAAGCCAGGGCACUdTdT AGUGCCCUGGCUUGUGGCAdTdT 631-649
4077 4078 AD-59484 AGCGCAGUUAUGCCCAGUUdTdT AACUGGGCAUAACUGCGCUdTdT 122-140
4079 4080 AD-59368 GGACCAGGAGAAAGUCAGGdTdT CCUGACUUUCUCCUGGUCCdTdT 232-250
4081 4082 AD-59464 UGUCCACUGCCCCAGCCACdTdT GUGGCUGGGGCAGUGGACAdTdT 1903-1921
4083 4084 AD-59386 AUCGCGGCCUGAGGCUGCUdTdT AGCAGCCUCAGGCCGCGAUdTdT 22-40
4085 4086 AD-59439 GGGGAUGUGGGGACCAGGAdTdT UCCUGGUCCCCACAUCCCCdTdT 222-240
4087 4088 AD-59440 CUGGAAAUAAAUUCUUGCUdTdT AGCAAGAAU U UAU U UCCAGdTdT 2380-2398
4089 4090 AD-59542 UUGAAACUGUCCAUUCAAUdTdT AUUGAAUGGACAGUUUCAAdTdT 1479-1497
4091 4092 AD-59559 GUGGGGACACGACCACGGAdTdT UCCGUGGUCGUGUCCCCACdTdT 150-168
4093 4094 AD-59586 CGCAGUGGGGCUUUAUGGGdTdT CCCAUAAAGCCCCACUGCGdTdT 1579-1597
4095 4096 AD-59408 UUGUCUUUAUAUGUGAAUUdTdT AAUUCACAUAUAAAGACAAdTdT 2322-2340
4097 4098 AD-59568 UCACCCUGGCUAAGAUGAUdTdT AUCAUCUUAGCCAGGGUGAdTdT 1299-1317
4099 4100 AD-59398 GUAUCUGCUCAGGCCUGAGdTdT CUCAGGCCUGAGCAGAUACdTdT 2243-2261
4101 4102 AD-59508 AUGAGUGGCUUCUUCUCCAdTdT UGGAGAAGAAGCCACUCAUdTdT 280-298
4103 4104 AD-59523 GAAGUUGGGGCCAAGCCAGdTdT CUGGCUUGGCCCCAACUUCdTdT 449-467
4105 4106 AD-59410 UCAGGGACUCGGGACCCUGdTdT CAGGGUCCCGAGUCCCUGAdTdT 181-199
4107 4108 AD-59541 UCCUACGGAUUGCCCCCACdTdT GUGGGGGCAAUCCGUAGGAdTdT 2043-2061
4109 4110 AD-59524 UUACUCUGAUUCUGGGAACdTdT G U U CCCAG A AU C AG AG U A AdTdT 1333-1351
4111 4112 AD-59501 AUCCCUAAGAGUCUUCCCUdTdT AGGGAAGACUCUUAGGGAUdTdT 251-269
4113 4114 AD-59383 UGCCAAAGUACAUCUUCCGdTdT CGG AAGAU G U ACU U UGGCAdTdT 1389-1407
4115 4116 AD-59577 UCCUCGGGUUUAGGGGAUGdTdT CAUCCCCUAAACCCGAGGAdTdT 210-228
4117 4118 AD-59447 UGCUGAAACCUCAGCAGGCdTdT GCCUGCUGAGGUUUCAGCAdTdT 769-787
4119 4120 AD-59555 CCACCCACGGGUGUGUGGGdTdT CCCACACACCCGUGGGUGGdTdT 1111-1129
4121 4122 AD-59405 UGGUGCAGUAAUGACUACCdTdT GGUAGUCAUUACUGCACCAdTdT 1079-1097
4123 4124 AD-59371 UUCUCCACCUAGAUUCUUUdTdT AAAGAAUCUAGGUGGAGAAdïdT 292-310
4125 4126 AD-59443 UAAGGCGCCGGCGAUCGCGdTdT CGCGAUCGCCGGCGCCUUAdTdT 9-27
4127 4128 AD-59401 UGGAACUAGUAAAU UCCAU dTdT AUGGAAUUUACUAGUUCCAdTdT 1189-1207
4129 4130 AD-59494 GGACCCUGCUGGACCCCUUdTdT AAGGGGUCCAGCAGGGUCCdTdT 192-210
4131 4132 AD-59504 U CAAU U AU U U CACU U AACCdTdT GGUUAAGUGAAAUAAUUGAdTdT 2269-2287
4133 4134 AD-59369 CCCGGACAAGGGCAACGAGdTdT CUCGUUGCCCUUGUCCGGGdTdT 41-59
4135 4136 AD-59571 UUUUAAAACUGUGAACCGGdTdT CCGG U UCACAG U U U U AAAAdTdT 991-1009
4137 4138 AD-59527 GUGCUUCGCCGCCAGCACCdTdT GGUGCUGGCGGCGAAGCACdTdT 1832-1850
4139 4140 AD-59466 UGGACCCCUUCCUCGGGUUdTdT AACCCGAGGAAGGGGUCCAdTdT 201-219
4141 4142 AD-59526 CUGUAUAUUAAGGCGCCGGdTdT CCGGCGCCUUAAUAUACAGdTdT 1-19
4143 4144 AD-59543 UUGCCCCCACCCCUCACCAdTdT UGGUGAGGGGUGGGGGCAAdTdT 2052-2070
4145 4146 AD-59564 AUGGGGCGGUGUGCCCACUdTdT AGUGGGCACACCGCCCCAUdTdT 1500-1518
4147 4148 AD-59583 CUAUAGUAAAAACAUAGUCdTdT GACUAUGUUUUUACUAUAGdTdT 2361-2379
236
The in vitro activity of the siRNAs in suppressing ALAS1 mRNA was tested in a single dose screen in Hep3B cells that were transfected using Lipofectamine2000 as a transfection reagent. Single dose experiments were performed at lOnM duplex concentration and analyzed by branched DNA (bDNA) assay. The results are shown in Table 19 and are expressed as percent remaining mRNA.
Table 19: Suppression of ALAS1 mRNA as assessed by bDNA assay
Duplex % remaining mRNA SD
AD-59453 11.2 1.5
AD-59395 12.7 1.1
AD-59477 14.5 2.0
AD-59492 14.8 2.1
AD-59361 15.1 4.9
AD-59462 15.4 2.6
AD-59433 15.8 2.7
AD-59424 16.0 1.7
AD-59414 16.1 1.3
AD-59539 16.2 2.6
AD-59400 16.2 1.8
AD-59551 16.3 2.3
AD-59482 16.6 2.1
AD-59448 16.6 3.7
AD-59392 16.9 3.5
AD-59469 16.9 2.2
AD-59431 17.0 2.0
AD-59423 17.1 3.8
AD-59517 17.2 1.5
AD-59578 17.3 3.1
AD-59495 17.7 3.7
AD-59432 17.7 2.8
AD-59382 17.9 3.2
AD-59472 18.6 3.5
AD-59459 18.7 3.8
AD-59413 18.8 2.4
AD-59478 18.9 3.0
AD-59376 18.9 3.2
AD-59556 18.9 2.4
237
AD-59399 19.0 4.1
AD-59474 19.4 1.6
AD-53542 19.4 1.7
AD-59480 19.6 1.6
AD-59549 19.7 2.1
AD-59515 19.8 4.4
AD-59427 19.9 3.2
AD-59390 19.9 3.4
AD-59511 19.9 2.2
AD-59532 20.0 2.4
AD-59562 20.2 2.6
AD-59513 20.3 3.9
AD-59362 20.6 2.5
AD-53541 20.6 2.2
AD-59490 20.7 2.3
AD-59422 20.8 4.5
AD-59467 21.2 2.3
AD-59579 21.2 3.3
AD-59426 21.7 2.3
AD-59363 21.7 2.7
AD-59436 21.7 2.7
AD-53536 21.9 1.5
AD-59491 21.9 2.6
AD-59500 22.2 2.8
AD-59394 22.3 10.1
AD-59441 22.3 2.6
AD-59365 22.4 4.2
AD-59411 22.5 2.9
AD-59544 22.5 2.1
AD-59428 22.7 4.7
AD-59471 22.9 5.0
AD-59518 22.9 2.3
AD-53547 22.9 1.5
AD-59573 23.0 4.2
AD-59473 23.2 1.8
AD-59412 23.4 2.5
AD-59522 23.4 3.3
AD-59502 23.6 2.7
AD-59499 23.6 1.6
238
AD-59520 23.8 3.8
AD-59581 23.9 6.0
AD-59461 24.3 4.2
AD-59370 24.3 5.6
AD-53540 24.4 2.1
AD-59574 24.5 2.0
AD-59375 24.6 2.3
AD-59387 24.8 7.2
AD-59397 24.9 9.6
AD-59396 25.0 10.2
AD-59393 25.3 11.6
AD-59483 25.4 3.8
AD-59430 25.5 1.8
AD-59463 25.6 4.8
AD-53534 25.9 3.1
AD-59514 26.2 5.7
AD-59575 26.2 3.2
AD-59364 26.2 4.5
AD-59402 26.3 3.1
AD-59479 26.3 2.5
AD-59481 26.4 2.2
AD-59530 26.4 4.4
AD-59582 26.6 3.9
AD-59506 27.0 4.1
AD-59567 27.3 1.1
AD-59485 27.7 4.7
AD-59525 28.3 3.1
AD-59566 28.5 0.6
AD-59580 28.7 7.1
AD-59512 29.5 2.5
AD-59475 29.6 4.2
AD-59438 29.6 3.3
AD-59442 29.9 2.8
AD-59516 30.4 3.8
AD-59429 30.8 4.3
AD-59510 31.3 1.9
AD-59457 31.4 1.2
AD-59434 31.6 3.5
AD-59454 32.0 1.9
239
AD-59468 32.2 3.2
AD-59565 32.4 1.5
AD-59416 32.7 1.7
AD-59420 33.2 3.1
AD-59552 33.2 2.2
AD-59558 33.8 3.8
AD-59404 34.0 5.4
AD-59455 34.8 1.3
AD-59496 34.9 5.2
AD-59446 35.5 1.7
AD-59435 35.9 1.2
AD-59419 36.0 1.4
AD-59533 36.7 3.7
AD-59366 36.7 6.0
AD-59521 36.9 4.3
AD-59563 36.9 4.1
AD-59534 36.9 3.3
AD-59407 37.1 4.7
AD-59445 37.2 3.2
AD-59546 37.9 4.9
AD-59456 38.3 4.0
AD-59503 38.8 5.0
AD-59536 39.8 4.2
AD-59385 39.9 13.7
AD-59367 40.0 3.6
AD-59458 40.0 3.4
AD-59381 40.3 9.9
AD-59538 40.8 4.9
AD-59421 40.9 6.4
AD-59388 41.0 9.1
AD-59444 41.1 2.7
AD-59528 41.9 3.3
AD-59498 42.2 3.3
AD-59497 42.4 4.9
AD-59384 42.7 17.6
AD-59452 42.7 3.1
AD-59379 43.6 2.6
AD-59529 43.8 4.8
AD-59389 44.1 6.4
240
AD-59585 44.3 3.2
AD-59570 45.1 4.0
AD-59415 46.6 2.3
AD-59505 47.5 6.2
AD-59557 48.1 4.4
AD-59548 49.9 4.0
AD-59487 50.7 3.2
AD-59550 50.8 5.8
AD-59572 51.1 4.0
AD-59554 51.3 6.0
AD-59437 52.2 4.8
AD-59584 54.9 2.7
AD-59373 55.3 20.1
AD-59545 55.4 3.4
AD-59547 55.9 4.7
AD-59470 56.0 2.7
AD-59417 56.4 7.7
AD-59535 57.6 5.1
AD-59507 58.8 4.7
AD-59519 59.1 5.6
AD-59391 60.1 12.5
AD-59537 60.6 9.1
AD-59450 60.7 7.2
AD-59449 61.6 6.8
AD-59418 61.8 8.4
AD-59561 62.2 7.2
AD-59460 62.8 4.7
AD-59409 64.4 9.0
AD-59476 65.2 5.6
AD-59406 65.6 3.5
AD-59569 66.7 7.6
AD-59451 66.9 2.9
AD-59553 67.2 8.8
AD-59372 67.3 25.6
AD-59377 68.7 5.1
AD-59531 68.7 9.0
AD-59560 68.7 12.7
AD-59489 69.6 8.9
AD-59540 70.1 10.1
241
AD-59378 70.6 14.1
AD-59403 71.4 3.3
AD-59493 72.3 3.5
AD-59374 75.9 5.1
AD-59380 76.4 11.1
AD-59576 77.5 16.2
AD-59425 77.9 10.6
AD-59509 78.0 3.2
AD-59488 78.6 7.1
AD-59486 79.4 5.0
AD-59465 79.5 5.1
AD-59484 79.8 3.2
AD-59368 80.0 11.9
AD-59464 80.2 9.3
AD-59386 80.6 33.2
AD-59439 80.9 4.0
AD-59440 82.2 1.9
AD-59542 83.3 10.6
AD-59559 83.7 9.1
AD-59586 83.8 11.5
AD-59408 86.3 2.8
AD-59568 86.8 4.2
AD-59398 87.4 24.9
AD-59508 87.5 2.5
AD-59523 87.6 11.8
AD-59410 88.8 8.3
AD-59541 88.9 10.8
AD-59524 89.5 12.1
AD-59501 89.9 5.1
AD-59383 90.8 27.4
AD-59577 91.1 2.3
AD-59447 91.3 12.9
AD-59555 91.7 3.4
AD-59405 92.5 5.7
AD-59371 93.5 31.7
AD-59443 93.8 9.0
AD-59401 94.5 7.1
AD-59494 95.1 9.1
AD-59504 96.8 11.7
242
AD-59369 96.8 4.8
AD-59571 97.4 7.0
AD-59527 98.6 7.8
AD-59466 99.7 14.0
AD-59526 102.9 4.6
AD-59543 103.7 3.0
AD-59564 103.7 12.1
AD-59583 112.4 13.2
The two hundred thirty-two duplexes that were tested suppressed ALAS1 mRNA to varying extents in this single dose assay. According to this assay, at least four of the duplexes (AD59453, AD-59395, AD-59477, and AD-59492) suppressed ALAS1 mRNA by 85% or more, 39 of the duplexes suppressed ALAS1 mRNA by 80% or more, 101 of the duplexes suppressed ALAS1 mRNA by 70% or more, and 152 of the duplexes suppressed ALAS1 mRNA by 50% or more. In contrast, some duplexes did not show appréciable suppression in this assay.
Example 13: Dose responsive inhibition of porphyrin precursors ALA and PBG using ALAS1 siRNA
The dose response effects of an ALAS1 siRNA were investigated in a mouse model of AIP (see Example 5). This model shows ~30% residual PBGD activity, ~2 fold increase in basal ALA and PBG levels, ~30-100 fold increase in ALA and PBG levels following induction by injections of Phénobarbital once per day for 3-4 days. Older animais hâve axonal degeneration and impaired motor fonction.
The ALAS1 siRNA used in this example was the AD-53558 duplex in the AF11 formulation. On day 1, the mice were administered 1 mg/kg, 0.5 mg/kg, 0.1 mg/kg, or 0.05 mg/kg of ALAS1 siRNA or LUC AD-1955 control by i.v. injection. Three phénobarbital injections were given (1 injection per day on days 2, 3, and 4) to induce hepatic ALAS1 and the porphyrin precursors, ALA and PBG. Plasma and ovemight urine specimens were collected on day 5 and métabolite levels were measured by LC-MS. Baseline levels of ALA and PBG were measured prior to the first treatment on day 1. The results are shown in FIG. 16. The ALAS1 siRNA inhibited ALA and PBG levels in a dose dépendent manner. The inhibitory effect on
243 plasma ALA levels was observed at ALAS1 siRNA doses as low as 0.05 mg/kg, and the inhibitory effect on plasma PBG levels was seen at siRNA doses as low as 0.1 mg/kg.
Example 14: Durable inhibition of porphyrin precursors ALA and PBG using ALAS1 siRNA
The durability of the effects of an ALAS1 siRNA were investigated in a mouse model of AIP (see Example 5). The ALAS1 siRNA used in this example was the AD-53558 duplex in the AF11 formulation. The experimental design and results of this experiment are shown in FIG. 17. On day 1, mice were administered 1 mg/kg of ALAS1 siRNA or LUC AD-1955 control by i.v. injection. Three phénobarbital injections were given in week 0(1 injection per day on days 2, 3, and 4), week 2 (1 injection per day on days 15, 16, and 17), and week 4 (1 injection per day on days 29, 30, and 31) to induce hepatic ALAS1 and porphyrin precursors ALA and PBG. Plasma and ovemight urine specimens were collected on days 5, 18, and 32 and métabolite levels were measured by LC-MS. Baseline levels of ALA and PBG were measured prior to the first treatment on day 1.
As is shown in FIG. 17, the ALAS1 siRNA had a durable effect in reducing plasma ALA and PBG levels. Administration of the ALAS1 siRNA suppressed plasma ALA and PBG levels for at least 2 weeks. These results indicate that ALAS1 siRNA is an effective treatment for lowering elevated levels of ALA and PBG and thus can be used in prophylaxis, e.g., to lower chronically elevated ALA and PBG levels and to prevent récurrent porphyric attacks.
Example 15: ALAS1 siRNA provides more rapid onset of action compared with hemin treatment
The effects of treatment with an ALAS1 siRNA were compared with the effects of hemin treatment in a mouse model of AIP (see Example 5). The ALAS1 siRNA used in this example was the AD-53558 duplex in the AF11 formulation. The experimental design and results of this
244 experiment are shown in FIG. 18. Phénobarbital (PB) and diethyldithiocarbamate (DDC) were administered on days 1, 2, and 3. DDC is another p450 inducer that, like Phénobarbital, increases the demand for heme and helps extend the induction of ALA/PBG métabolites.
Hemin at a dose of 4 mg/kg, ALAS1 siRNA at a dose of 2 mg/kg, or control treatment was administered intravenously at 8 hours after the last administration of PB and DDC.
As is shown in FIG. 18, the onset of treatment effects was faster with ALAS1 siRNA treatment compared with hemin treatment. The rapid réduction of ALA and PBG with siRNA treatment indicates that siRNA is an effective treatment for acute attacks, because a rapid improvement in clinical symptoms is expected to accompany the réduction in ALA and PBG levels.
Example 16: Effects of ALAS1 siRNA GalNAc conjugate AD-58632
AD-58632 is a 21/23mer disclosed in Example 11. AD-58632 targets the human transcript NM_ 000688.4 and is also cross reactive with mouse, rat, and cynomolgous monkey mRNA transcripts. AD-58632 was the only cross reactive 21/23mer identified from a screen of about 45 compounds. Further experiments with this duplex are described in this example.
Dose dépendent effects of AD-58632 in suppressing ALAS1 mRNA
The dose response effect of AD-58632 in suppressing ALAS1 mRNA, relative to GAPDH mRNA, was investigated in rats. Doses of 30 mg/kg, 10 mg/kg, and 3 mg/kg were tested. The levels of ALAS1 mRNA were measured in liver at 72 hours after the last dose. AD58632, compared with PBS control, suppressed ALAS1 mRNA in a dose dépendent manner (see FIG. 19). AD-58632 had a single dose ED50 of about 10 mg/kg.
Effects of AD-58632 in Rat AIP Model
The dose response effect of the AD-58632 ALAS1 GalNAc conjugate siRNA was further investigated in a rat AIP model. In this model, siRNA in an LNP is used to knock down the level of PBGD specifically in liver prior to inducing heme demaind with phenobarbitol. The rat AIP
245 model shows transient PBGD siRNA knockdown in the liver, has ~15% residual PBGD mRNA, and shows about a 10-50 fold increase in ALA and PBG levels upon induction by daily
Phénobarbital injection for three days.
The experimental design is depicted in FIG. 20. Four groups of rats were studied. One group was treated with phénobarbital (PB) only at the indicated timepoints. A second group was treated with phénobarbital and porphobilinogen deaminase (PBGD) siRNA. A third group received phénobarbital, PBGD siRNA, and a dose of 30 mg/kg of the ALAS1 siRNA. A fourth group received phénobarbital, PBGD siRNA, and a dose of 10 mg/kg of the ALAS1 siRNA. As is shown in FIG. 20, the PBGD siRNA was administered intravenously on day 1. The ALAS1 GalNAc siRNA was administered on day 4. Phénobarbital injections were given on days 4, 5, 6, and 7. Urine was collected for a 24 hour period starting on day 7 and ending on day 8. Levels of liver PBGD mRNA, GAPDH mRNA, and ALAS-1 mRNA were assessed on day 8 using a bDNA assay. PBG and ALA levels in urine were determined using LC-MS.
The mRNA results are shown in FIG. 21. PBGD siRNA decreased PBGD mRNA level but did not decrease ALAS1 mRNA level. The ALAS1 siRNA decreased ALAS1 mRNA levels in a dose-dependent manner (see FIG. 21). The ALA and PBG results are shown in FIG. 22. ALAS1 siRNA decreased ALA and PBG levels in a dose-dependent manner (see FIG. 22).
Example 17: Split dosing with AD-58632
The efficacy of the ALAS1 siRNA GalNAc conjugate AD-58632 was investigated in two separate split dosing paradigms. For each of these studies, female Sprague Dawley rats were used. The rats were housed in SCLR (a light cycle room that is 12 hours light on and 12 hours light off) and were sacrificed at 72 hours following the last injection. ALAS1 and GAPDH mRNA levels in the liver were measured using branched DNA (bDNA) assay.
Five daily doses versus one bolus dose paradigm
Tn the first paradigm, groups of rats were given either five doses of siRNA (one dose each day) or a single bolus dose that had the same total concentration as the sum of the five individual doses. Specifically, rats were assigned to one ofthe following treatment conditions: (1)
246 subcutaneous injection of 6 mg/kg siRNA once per day for five days (2) subcutaneous injection of 2 mg/kg siRNA once per day for five days, (3) subcutaneous injection of 1 mg/kg siRNA once per day for five days, (4) subcutaneous injection of a single bolus dose of 30 mg/kg siRNA (5) subcutaneous injection of a single bolus dose of 10 mg/kg siRNA, (6) subcutaneous injection of a single bolus dose of 5 mg/kg siRNA, or (7) PBS control treatment.
The results are shown in FIG. 23. In this paradigm, a single bolus dose of siRNA provided greater suppression of ALAS1 mRNA than did repeated dosing of the same concentration of siRNA over the course of five days. This was true for ail doses studied.
Once per week dosing for four weeks
In the second paradigm, rats were given subcutaneous injections of siRNA at one of three doses (10 mg/kg, 5 mg/kg, or 2.5 mg/kg) once per week for four weeks. A control group received PBS injections.
The results are shown in FIG. 24. Compared with single dosing, providing four weekly doses at 10 mg/kg improved the maximal knockdown achieved (ED50 is 10 mg/kg at single dose). In contrast, multiple dosing at 5 and 2.5 mg/kg per week did not improve silencing in this paradigm.
Example 18: Identification and testing of ALAS1 siRNAs with shorter sense and antisense strands
Further experiments were conducted to explore the effects of shortening the siRNA duplexes to 19-19mers. Five more new cross-reactive 19-19mer duplexes that bind to human (h) (NM_000688.4), rhésus monkey (rh) (XM_001090440.2), mouse (m) (NM-020559.2), and rat (r) (NM_024484.2) ALAS1 mRNA transcripts were identified. None of these duplexes showed results as good as the 21/23 mer AD-58632 (see FIG. 25).
The effects of modifying the length and overhangs on the best two 19-19mers (AD-59115 and AD-59125) were investigated (FIG. 26 and 27). The modified sequences are shown in Table 21.
247
Table 21: Sequences for length/overhang évaluation of best two 19-19mers
SEQ ID NO: (sense ) SEQ ID NO: (antisense) Target sites of antisense sequen ce on NM_ 000688 .4 Cross reactivity Overhang Duplex Name Sense Sequence (5’-3') Antisense (AS) Sequence (5’-3')
4172 4173 877- 895 h/rh/m/r 19/19 AD59115 AfsasGfaGfuGfuCfUfCfaUfcllfuCfullfL96 asAfsgAfaGfalifgAfgacAfcUfcsusu
4174 4175 875- 895 h/rh/m/r 19/21 AD60090 AfsasGfaGfuGfuCfUfCfaUfcUfuCfuUfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfususc
4176 4177 877- 895 NC OH* 19/21 AD60091 AfsasGfaGfuGfuCfUfCfallfcUfuCfuUfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfusasa
4178 4179 873- 895 h/rh/m/r 21/23 AD58632 GfsasAfaGfaGfuGfUfCfuCfaüfcUfuCfuUf L96 asAfsgAfaGfaUfgAfgacAfcUfclifuUfcs usg
4180 4181 875- 895 NC OH* 21/23 AD60092 GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfuUf L96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcs asa
4182 4183 875- 893 h/rh/m/r 19/19 AD59129 GfsasAfaGfaGfuGfüfCfuCfaUfcUfuAfL96 usAfsaGfaUfgAfgAfcacUfcUfususc
4184 4185 873- 893 h/rh/m/r 19/21 AD60093 GfsasAfaGfaGfuGfUfCfuCfaUfcUfuAfL96 usAfsaGfaUfgAfgAfcacUfclIfuUfcsusg
4186 4187 875- 893 NC OH* 19/21 AD60094 GfsasAfaGfaGfuGfUfCfuCfaUfcUfuAfL96 usAfsaGfalifgAfgAfcacUfcUfuUfcsasa
4188 4189 871- 893 h/rh 21/23 AD60095 Cfsas Gfa Afa GfaGfu GfU fCfuCfa Ufcllfu Af L96 usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgs gsu
4190 4191 871- 893 m/r 21/23 AD60096 CfsasGfaAfaGfaGfuGfUfCfuCfaUfcUfuAf L96 usAfsaGfaUfgAfgAfcacUfcUfulIfclIfgs gsc
*Non-complementary overhang
248
Overhangs improved potency. They also provided a further dérivative sequence (AD-60489, which was based on AD-60095) for further structure activity relationship (SAR) studies (1 mismatch at pos23 to rodent).
Example 19: Effects of ALAS1 siRNA GalNAc conjugates AD-60489 and AD-58632
The effects of a further GalNAc conjugate ALAS1 siRNA duplex AD-60489 were investigated and compared with the effects of AD-58632. The sequences of these duplexes are shown in Table 22A. AD-60489 has a single mismatch to rodent ALAS1 mRNA at the 3’ end of the antisense sequence. Thus, whereas AD-58632 is fully complementary with human, cynomolgous monkey, mouse, and rat sequences, AD-60489 is fully complementary only with human and cynomolgous monkey sequences.
Table 22A: Sequences of ALAS1 siRNA Duplexes AD-58632 and AD-60489
SEQ. IDNO: (sense ) SEQ ID NO: (antisense ) Target sites of antisense sequence on NM_ 000688.4 Duplex Name Sense Sequence (5'-3') Antisense Sequence (5'-3')
4149 4150 873-895 AD58632 GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfuUf L96 asAfsgAfaGfallfgAfgacAfcUfcUfuUfcs usg
4151 4152 871-893 AD60489 CfsasGfaAfaGfaGfUfGfuCfuCfaUfcUfuAf L96 usAfsaGfa UfgAfgAfca cllfcUf uUfclIfgs gsu
The suppression of ALAS1 mRNA is shown in FIG. 28. Compared with AD-58632, AD-60489 provided more effective suppression at 3 mg/kg and 10 mg/kg and exhibited about a two fold improvement in ED50. The single dose ED50 of AD-60489 was about 5 mg/kg.
Example 20: Effects of ALAS1 siRNA GalNAc conjugates AD-60489 and AD-58632 in non-human primate studies
The effectiveness of AD-58632 and AD-60489 in suppressing liver mRNA was investigated in non-human primates. The experimental design is shown in FIG. 29. Doses of
249 siRNA (5 mg/kg, 2.5 mg/kg, or 1.25 mg/kg) or PBS control in a volume of 2 mL/kg were administered subcutaneously every day for 5 days, then every 2 days for 3 weeks. ALAS1 mRNA silencing was evaluated in liver tissue obtained from a liver biopsy taken on day 15. The biopsy was taken after a sérum draw and prior to the administration of dose 10 (see FIG. 29). Sérum samples for the circulating extracellular RNA détection (cERD) method (see Example 21) were collected on days -10, -3, 7, 15, 23, 31, and 43. Sérum was collected for a clinical chemistry panel on days -3, 6, 30, and 43. The clinical chemistry panel included assessment of the levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), and alkaline phosphatase (ALP).
AD-58632 and AD-60489 suppressed ALAS1 mRNA in liver in a dose-dependent manner (see FIG. 30). AD-60489 showed greater efficacy than did AD-58632. For example, at the lowest dose studied (1.25 mg/kg), AD-60489 suppressed the relative ALAS1 message to about 42% of the control level, whereas AD-58632 showed little suppression at this dose. At 2.5 mg/kg, AD-60489 suppressed the relative ALAS1 message to about 26% of the control level, whereas AD-58632 suppressed the relative ALAS1 message to about 64% of the control level. At 5 mg/kg, AD-60489 suppresed the relative ALAS1 message to about 21% of the control level, and AD-58632 suppressed the relative ALAS1 message to about 55% ofthe control level.
Clinical chemistry results indicated that the sustained knockdown of ALAS1 using the ALAS1 siRNAs was safe and well tolerated. No élévations in ALT, AST, or ALP were observed.
Example 21: Effects of ALAS1 siRNA GalNAc conjugates AD-60489 and AD-58632 in non-human primate studies as assessed using the cERD assay
The effects of ALAS1 siRNA GalNAc conjugates AD-60489 and AD-58632 were assessed in non-numan primates using the circulating extracellular RNA détection (cERD) method. This method is described, e.g., in Sehgal, A. et al. Quantitation of tissue-specific target gene modulation using circulating RNA (Poster presented on February 9, 2012 at the Keystone Gene Silencing by small RNAs symposium (Vancouver, February 7-12, 2012) and in Sehgal, A. et al. Tissue-specific gene silencing monitored in circulating RNA, RNA, 20: 1-7, published
250 online December 19, 2013. As is shown in FIG. 29, sérum samples for the circulating extracellular RNA détection (cERD) method were collected on days -10, -3, 7, 15, 23, 31, and
43.
For the cERD assay, sérum samples were thawed on ice. 375-400 pL of 8M LiCl was added to 3-3.5 mL of sérum in ultracentrifuge (UC) tubes, and incubated at a température of 4°C for at least 1 hour. PBS was added to the top of each UC tube, leaving about 1 cm of dry space at the top of the tube to prevent walls of tubes from collapsing during spin. The tubes were dried to remove any condensation from being incubated on ice. Samples were loaded into an MC 55 Rotor under a hood, and the samples were spun at 150,000-200,000g for 100-120 minutes. The supematant was discarded from the pellet. 1 mL Trizol was added to the pellet in the UC tube, the tube was vortexed, and the contents were transferred to a 1.5 mL microcentrifuge tube. To each tube, 200 pL of chloroform was added, and the tube was inverted several times to mix. One sample was prepared at a time. The samples were spun at 13,000 RPM for 10-20 minutes at 4°C. The upper aqueous phase was transferred to a fresh 1.5 mL tube (-500 pL volume). An equal volume of 100% isopropanol, 1 pL of linear acrylamind (4°), and 1/10th volume of 3MNaoAc pH 5.5 or less was added to each sample (typically 500 pL of isopropanol and 50 pL NaoAc). The sample was spun at 13,000 RPM for 10 min at 4°C. Supematants were reserved. The pellet was washed twice with ice cold 70% EtOH (500 pL each wash) and spun at 13,000 RPM for —5 min. at 4°C after each wash. The pellet was allowed to air dry for -5 minutes and then resuspended in 20pL NF H2O. 10 pL was used in cDNA reaction. The resuspended RNA was stored at -80°C.
Results
The sérum mRNA knockdown as assessed using the cERD assay correlated with the results obtained from the liver biopsy. See FIG. 31. This is a surprising resuit, because ALAS1 is not a sérum protein. The cERD assay provided herein allows monitoring of circulating ALAS1 mRNA. This has the advantage, for example, that the levels of ALAS1 mRNA can be measured over time without doing serial liver biopsies, which would be technically difficult and expensive.
251
The kinetics of mRNA knockdown were determined using the cERD assay results. See
FIG. 32. AD-60489 achieved greater than 50% knockdown, even at a dose of only 1.25 mg/kg.
Example 22: Safety studies of ALAS1 siRNAs
The following safety studies indicate that sustained knockdown of ALAS1 is safe and well tolerated.
Non-human primate studies
As described above (see Example 20), in non-human primate studies, no ALT, AST, or ALP élévations were observed after administration of AD-60489 and AD-58632.
Rat studies
In rats, a four week study was carried out with AD-58632. The siRNA was administered every day for 5 days at 10 mg/kg in the first week, then every other day at 10 mg/kg for weeks 24 of the study. The total exposure was 140 mg. No adverse clinical signs or body weight changes were observed. No test article related changes in hematology or coagulation parameters were observed. Furthermore, no adverse histopathology was observed. There was minimal vacuolation in spleen and minimal subcapsular fibrosis in kidney.
Mouse studies
In mice, P450 mRNAs were assessed after ALAS1 knockdown. Minor dose dépendent increases in Cyp2bl0 were observed at 48 hours after administration of an ALAS1 LNP formulation. This resolved by 168 hours.
Example 23: Identification of further effective ALAS1 siRNAs using structure activity relationship studies
Structure activity relationship (SAR) studies, including studies described in other examples herein, were carried out to identify further effective ALAS1 siRNAs derived from those that hâve already been identified, e.g., AD-58632 and AD-60489. Effects of chemical modifications were investigated. Chemical modifications include 1) 2'-O-methyl versus 2’17746
252 fluoro modifications, 2) Decrease in 2’Uf (2’fluoro modifications), 3) Add PS (phosphorothioate), 4) Use internai dTs, and/or 5) glycol nucleic acids (GNAs). Without wishing to be bound by theory, modifications can enhance potency, e.g., through 1) better unwinding or enhanced RISC loading, or 2) better catalytic target engagement. Modifications can also enhance stability so that compounds can accumulate and perform better when multiple doses are administered.
Improved activity relative to other duplexes (e.g., AD-58632 and/or AD-60489) was observed in some instances (see Table 22B), whereas similar activity (see Table 23) or reduced activity (Table 24) was observed in other instances. These instances are merely presented as 10 examples based on the screening of more than 150 siRNAs. Further exemplification of SAR studies is provided herein.
Table 22B: Improved Activity Relative to Parent
Duplex* IC50 Sense (5' to 3’) Antisense (5’ to 3')
AD- 58632.10 (parent) 0.017 GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfuUfL96 (SEQ ID NO: 4192) asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg (SEQ ID NO: 4193)
AD- 80643.1 0.004 GfsasAfaGfAfGfuGfdTcucaucuucuuL96 (SEQ ID NO: 4194) asAfsgAfaGfaugAfgAfcAfcucuuucsusg (SEQ ID NO: 4195)
AD- 60489.3 (parent) 0.010 CfsasGfaAfaGfaGfUfGfuCfuCfallfcUfuAfL96 (SEQ ID NO: 4196) usAfsaGfaUfgAfgAfcaclIfcUfuUfcUfgsgsu (SEQ ID NO: 4197)
AD- 60879.1 0.001 CfsasGfaAfaGfaGfdTGfuCfuCf(Agn)UfscUfsuAfsL96 (SEQID NO: 4198) usAfsaGfaUfgAfgAfcacUfcdTuUfcUfgsgsu (SEQID NO: 4199)
*The number following the décimal point in a duplex name in this and other tables merely refers to a batch production number.
Table 23: Similar Activity Relative to Parent but Increased Stability
Duplex IC50 Sense (5’ to 3') Antisense (5' to 3’)
AD- 58632.10 (parent) 0.017 GfsasAfaGfaGfuGfUfCfuCfaUfcllfuCfuUfL96 (SEQ ID NO: 4200) asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg (SEQ ID NO: 4201)
AD- gsasaagaGfuGfuCfucaucuucuuL96 (SEQ ID asAfsgAfaGfaugAfgacAfcucuuucsusg (SEQ ID
253
60839.1 0.014 NO: 4202) NO: 4203)
Table 24: Reduced Activity Relative to Parent
Duplex IC50 Sense (5’ to 3 j Antisense (5’ to 3 j
AD- 58632.10 (parent) 0.017 GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfuUfL96 (SEQ ID NO: 4204) asAfsgAfaGfaUfgAfgacAfcüfcUfuUfcsusg (SEQ ID NO: 4205)
AD- 60886.1 0.801 GfsasAfaGfAfGfuGfdTcucaucuucuuL96 (SEQ ID NO: 4206) asAfsgAf(Agn)GfaUfgAfgacAfcllfcUfuUfcsusg (SEQ ID NO: 4207)
Example 24: In vitro structure activity relationship studies of AD-58632
AD-58632 and siRNA dérivatives of AD-58632 were generated, and some siRNAs were screened in vitro for activity. Abbreviations for chemical modifications are provided in Table 1. In vitro activity at 10 nM and 0.1 nM siRNA
The in vitro activity of the siRNAs in suppressing ALAS1 mRNA was tested in in Hep3B 10 cells that were transfected using Lipofectamine2000 as a transfection reagent. Experiments were performed at the indicated siRNA concentrations (e.g., 0.1 nM, 10 nM) and analyzed by branched DNA (bDNA) assay at 24 hours post-transfection. The results are expressed as percent remaining mRNA relative to the siRNA AD-1955, a non-targeting siRNA that was used as a négative control.
Sequences of siRNAs and results of in vitro testing are provided in Table 25, Table 26, and Table 27.
Table 25: Sequences and in vitro screen results for AD-58632 and AD-58632 dérivative siRNAs
Q c/) o c 4.21 10.51 10.05 8.21 3.77 7.90 6.64 3.99 8.58 17.01 8.10 21.88 σ> CD ô V“ 1.96 23.09
Avg 0.1 nM 46.65 63.49 62.59 66.10 41.47 55.93 48.68 77.01 99.64 95.83 87.52 108.07 O rtf CO 81.21 95.33
SD 10 nM 2.70 4.49 6.13 5.47 3.03 3.38 CD [-η CN 8.68 5.67 2.08 2.23 7.75 CN CO 13.25 10.02
CD > o < v- C 11.79 15.61 15.04 13.96 12.59 13.79 14.74 28.31 39.90 56.06 43.09 65.84 τ— LO LO rtt 63.96 80.12
Antisense (AS) Sequence (5’-3’) CD cd 3 cd £ ZD a Z) a D £ ω co g) D 42 0 45 < CD 42 < tn co asAfsgAfaGfalifgAfgacAfcUfcUfuUfcsusg CD cd 3 ω a Z) 12 D g Z) î g) Z) 42 0 45 £ 0 42 < U) Cü CD cd 3 cd g Z> g Z) 42 ZD i & Z) 45 0 45 «g 0 42 < CD CÜ CD cd 3 cd g Z) 12 D 12 ZD g < 42 < £ & ZD 45 0 i 0 42 < ω CÜ CD cd 3 cd 42 Z) g Z) 42 ZD £ £ £ o 45 ω 45 ω 45 < ω ra CD en 3 CD 42 ZD g Z) 42 ZD 42 < £ £ Ξ5 45 ω 45 Si CD tf) CÜ asAfsGfAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg CD CD 3 CD 42 Z) a D g Z) % £ £ Σ5 45 CD CD CD CÜ asAfsGfAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg asAfsGfAfaGfallfgAfgAfcAfcUfcUfuUfcsusg cd CD 3 CD a Z) a o Ü 3 % a < g) < gî Z) a 0 i CD £ ω CD CD CD 3 CD a Z) 3 3 CJ 3 a < % £ lg) ZD a 0 £ 0 £ (Λ Cü asAfsGfAfaGfallfgAfgAfcAfcucuuucsusg asAfsGfAfaGfaugAfgAfcAfcucuuucsusg
Sense Sequence (5-3’) | l CD CD q=! Z) a o g Z) a ZD 45 O g O 2 0 a 0 45 0 42 < ω co 42 0 GfsasAfaGfaGfuGfuCfuCfaucuuCfuuL96 GfsasAfaGfaGfuGfuCfuCfaucuucuuL96 GfsasaagaGfuGfuCfuCfaucuucuuL96 CD σ> _j 3 3 O 3 3 O 3 45 O 12 O 12 0 12 0 Cü o CÜ CÜ cd co cd CD gsasaagaGfuGfuCfuCfaucuucuuL96 CD CD —1 3 D O D D CJ D CO Q a O a 0 a 0 Cü O) Cü Cü CD Cü CD CD gsasaagaGfuGfucucaucuucuuL96 __________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________I gsasaagaguGfucucaucuucuuL96 gsasaagagugucucaucuucuuL96 GfsasaagaGfuGfucucaucuucuuL96 gsasaagaGfuGfucucaucuucuuL96 CD CD _l 3 3 O 3 3 O 3 CÜ O 3 ω g 0 g 0 CÜ CD CÜ CÜ CD CÜ (D CD CD CD —I 3 3 O 3 3 O 3 Cü Ü 3 O a 0 a 0 CÜ CD CO CÜ CD CÜ CD CD gsasaagaGfuGfucucaucuucuuL96
Duplex AD-58632.8 AD-60405.1 AD-60411.1 AD-60417.1 AD-60423.1 AD-60423.2 AD-60434.1 AD-60440.1 AD-60400.1 AD-60406.1 AD-60412.1 AD-60418.1 rtf CN rtf O CD Q < AD-60429.1 AD-60435.1
φ ° S g o rt E> g -S ” ra .-e c ω c co l— cd co cd o Z o 873- 895 873- 895 873- 895 873- 895 873- 895 873- 895 873- 895 873- 895 873- 895 873- 895 873- 895 873- 895____ 873- 895____ 873- 895 873- 895
SEQ ID NO: (antisense) 4209 4211 4213 4215 4217 4219 4221 4223 4225 4227 4229 4231 4233 4235 4237
SEQ ID NO: (sense) 4208 4210 4212 4214 4216 4218 4220 4222 4224 4226 4228 4230 4232 4234 4236
255
XF Ο CO 4.23 22.58 5.65 8.31 10.91 11.23 7.41 1.05 6.71 6.12 0.24 3.43 14.49 6.83 3.02 17.93 23.99 3.34 10.72
CD CM O CO
b· O xF CO CD b- CO co CD LO LO CD CO CM CM xF CO
O CD) o co CO xF co LO o cd CD CM O o CD CO LO
r4 O co cm’ b-5 CO T“ T“ cd CM CD xF M* V” cd CD CD O CM* CD
cd v~ CD CD LO b- co co co CO CO CD CD b- CD CD x— b- CD
co CD LO b- O XF x— xF O b-
xf CM CO CD O CO x— b- CD CM LO CM b- v- CD CO O CO CO CZD
0 CO v- LO CO XF T“ CM* X“ LO LO 0 CD χ— LO χ— CD co x—
x~ v~ t- X- T- V“ X“ V“ cd v~ v~ χ- •’d b^ b^
CD b- CD O CM CO xF CM CM CO CD CD b- CD CD o O CO co CO
CM CM CO CD CO LO LO x— co T“ CO LO LO xF CD co x— CM xF CM
CO LO h4 LO ό LO 0 O Ô CM LO cm’ CM CM CD CM LO id O id
CD LO xF LO CM CO xF CD xF CO ^F CO LO LO CM CO CO CM co CM
CD CD O) CD CD CD CD CD CD CD O) CD CD CD CJ) CD CD CD CD CD
ω ω ω ω ω ω ω ω ω CO CO (0 (0 CO CO <0 CO CO CO to
ZD ZD ZD ZD ZD ZD ZD ZD ZD D ZD D D D D D D D
ω ω ω co U) CO tO ω CO CO CO CO (0 (0 CO CO CO ω CO CO
ω o o ω O O CD o O CD CD CD CD CD O CD O o O CD
d d ro ZD ZD ZD ZD ZD ZD ro ZD ZD D D D D D D D
3 ZD ZD ZD ro ro ZD ZD ZD ZD ZD D D D D D D D
ZD D ZD ZD ro ro ZD ZD ZD ZD ZD D D D D D D D D
O ω O CD O O CD O O CD CD Q Q Q O CD CD O O CD
D ZD ZD ZD ZD ZD ZD ro ZD D ZD D D D D D D D
CD o g 4=5 42 42 42 CD 42 U 4^ 42 42 42 42 42 XD ω .CD 42
< <r <r <r < <r <r <r < < < <r <r <r < <r <r < < <
42 42 42 42 o g 42 4a 4a 42 42 42 £ .CD CD 42 £ .CD 42
< < < < < < <· < < < < <r < <r < < < < < <
4^ £) £) £) xp 4?
<r <r <r <r <r <r <r <r <r <r <· <r a <r < <r <r < < <
CD CD CD) CD CD CD CD CD CD CD O) CD CD CD CD CD CD CD CD CD
D D ZD ZD ZD ZD ZD ZD ZD ZD ZD ZD D D D ZD Z5 D D
42 42 4 42 42 42 42 42 42 42 42 42 42 42 42 42 42 42 42
Cl CD CD CD CD CD CD CD CD 0 0 0 0 0 (9 0 0 0 0 0
i2 42 ro 42 42 42 42 42 42 42 42 42 42 42 42 42 42 42 42 42
s£ SS SS s g: SS s i £ SS <ç £ £ g i SS
(9 C) (D 0 CD (D (D 0 0 0 0 0 0 0 (9 0 0 0 0 0
42 42 42 42 42 42 42 42 42 42 .co 42 42 42 42 42 42 42 42 42
<r < <r <r <· <r <r <r <* <r <r <r <r <r < < < < < <
ω co ω to ω CO to ω ω co CO CO CO co co co (Λ co co to
TO <σ ra ro ro ra ra ra ra ro ro ra ra ra ro ro ro ra ro ro
CD CD CD CD co CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD co co CD CD CD CD CD —1 uuL96
CD -J —1 _j _j -j _J —! _l _! _J CD CD CD
CO CD -J ZD ZD O CD CD _1 ZD ZD O ZD CD —1 ZD ZD O ro ro _l ZD ZD O =5 ZD o ZD ZJ O ZD ZJ O ZJ ZJ ZD O ZD ZD O ZD ZD ZD O ZD ZD O ZD ZD Z) Q ZD ZD O ZD ZD ZD O ZD ZD CD ZD o ZD CD ZD ZD CD H ZD ZJ ω ZD ZD O Ό ZD D CD H TD ZD o ZD ZD O TD ZD o l— •CD D CD D D ü _____I D D O D D CD _J D D O D D O —l D D CD D H Ό D CD D H TD O CD D H TJ CD H ITcdTudt
ZD CD ZD ra ra ra ra < Ό ZD D ZD D J— CD
D O O ro Z3 ra ro o o ZD ZD o H O TJ TJ o ro CD ro CD ra CD ro o ro o O Ό ro D ra O ω Q
ro (0 o ZD CD O O ZD ZD ZD ZD D ZD D TD o CD Ό TJ TJ
o 3 O I- td o O CD Q O CD Q CD D D D D D D
ZD Z3 o CD ro a [g a a a ιΞ a a ZD ,ZD Q 0 U O o O
O .P >2 CD a g M— 0 O ZTO ώ ro ω 0 ZD ω ZD ΰ ro O ZD 0 ZD 0 ZD 0 0 D Ό a a a TZ5 a TJ a TJ a
0 .g CD a e < i s SS w— 0 i S CD £ £ e 0 S i W— e s 0 0 0 a 0 0 a 0 0 a 0 o a 0 0 0
45 <c 0 ro 0 0 CD 0 0 0 0 0 0 0 0 a a 42 a a 42
CD CD 45 42 45 a 42 a s a 0 0 0 0 0 0
W ra ro <r < < <r < < < < < < < ro ro ro ro ro ra
ro ra ω C/) ω ω co ω ω co to co co co ro ro ro ro ra ra
ω co ra ra ro ra ra ra ro ro ro ro ro ro co co co co to ω
co ra co 42 (0 co ro ra ra ro ra ra
M— co
CD) CD) 0 0 0 0 0 0 0 O U 0 0 0 CD CD CD CD CD CD
XT“ v~ v~· T- x— X- V“ v~ x~ v~ X” •r- v~ V- x—
co CD LO O co’ CM CM cd •’t O CD X- b^ cd cd CD LO
xt O o CM CO co xF O o x— CM CM CO CO tF o O V“
xF XF xF xF xF xF xF xF xF tF XF ^F xF XF ^F tF XF XF xF xF
O O O O O O O O O O O O O O O O O O O O
CD CD CD CD CO CD CD co CD CD CD CD CO CO CD CD CD CD CD CD
Q Q Q Q Q Q ή ώ ή ή ή Q ή ή Q ή ή Q Q Q
< < < < < < < < < < < < < < < < < < < <
CO LO CO LO CO LO CO LO CO LO CO LO CO LO CO LO CO LO CO LO CO LO CO LO cô LO cô LO cô LO cô LO cô LO J Γ0 LH b> CH 1 m lh b* CH 73- !95
h- CD b- CD b- CD b- CD b- CD b- CD b- CD b- CD b- CD b- CD b- CD b- CD b- CD b- CD b» CD b- CD b- CD
CO CO CO CO 00 CO CO co co CO 00 co CO 00 CO co CO C0 00 00 co co CO CO 00 00 CO CO CO 00 CO 00 CO co 00 00 00 00 OU ou
CD) CO LO b- CD CO LO b· CD CO LO b- CD x— CO LO b-
CO xF xF XF xF xF LO LO LO LO LO CD co CD CD CD b- b» b- b-
CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM
xr M* xF xF xF xF XF xF M- xF •^F xF xF ^F 'ff· xF XF xF XF
co O CM xF CD co O CM xF CD CO O CM ^F CD CO O xF CD
co xF xF xF XF xF LO LO LO LO LO CD CD CD CD CO b· b- b- b-
CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM
XF xF xf xF xF xF xF xF 3· *^F tF ^F xF 'ft- M- xF XF xF xF
Ο un
0.63 11.25 16.72 00 x- O 3.91 2.56 6.06 19.47 12.08 0.26 12.55 13.33 4.05 CJ) ΧΙΟ 0.64
CO LO σ> b* CM CO CO CD CD LO CM CO 00 CO LO
00 CD v~ 00 LO Xfr CD CO O x- CD CD o CD
CD CD σ> b4 CD CO CO* CD* xfr CM b^ b-* CO CO CM
CD b- b- LD CO CD CO b- CO CD CO b- b- CO CD
CO CO xfr CO
CO CO CM CO b- CD CM CO CD T— CM CO o CD
CO v— 'φ xfr ό v~ CO CO ό CM OD b; CM v~
IO* 00 CD σ> CD x— b4 X“ CM LO* CD* CO* CD
CO O CO b- LO CD O CD b· V“ CO χ— LO xF CD
CM 00 b- o LO O xfr LO CO CO b- CO CM b- CM
cd XF CO CM* LO O xfr CO ô CD CD CM* CO* xF
LO CO xfr CO LO LO xfr CM Xfr LO CO CO v~ CO xF
CD CD CD
CD CD to to «
3) CD CD « to ZJ ZD ZD
to 3 to o U) 3 w o w ZJ to ω ZD to O ZJ ZD to CD ZJ to O ZJ ZD CD ZJ ZJ O ZD ZD CD to 3 CD) to 3 CD to 3 CD to 3 CD to 3 CJ) to 3 susg
3 3 23 ZJ 3 3 o CD CD O O O O o
□ ZD ZD I— 3 3 3 3 3 3 3
3 3 H u 42 c h- 3 3 3 3 3 3 3
O Q •o l— o 3 3 3 3 3 3 3
H O TJ ZJ < h- CD CD O O Q O O Q
O TJ ZJ JJ Q ZD 3 3 3 3 3 3 3
< CD g < < <£ 42 42 42 42 £ £ 42 JJ 42
£ < < O m < < < <c < < < < <
< jd 42 < < 42 JD 42 JD 42 42 JJ 42
JD < < TJ) j? < < < < < < < < <
< Æ> < < g JJ) JD)
CD < < CD CD < < < < < < < < <
I— CD CD H I— h** CD CD) CD CD CD CD CD CD CD
c 3 ZD TJ TD ZJ ZD 3 3 3 3 3 3 3
jd JS 45 42 42 42 42 42 42 45 42 .CD 42 42 45
CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD
J2 jd jd 42 42 42 42 42 42 42 42 45 42 42 JD
ί â ί £ g g £ s g ί £ SÊ ί S
CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD
J2 42 42 42 42 42 42 42 42 .to 42 42 42 42 .</)
< < < < < < < < < < < < < < <
ω to to to to to to ω to to to to to to to
CD CD CD CD CD (0 CO CD CD CD CD CD (0 CD CD
CD CD CO CO CD CD CD
CJ) CD CD CD CJ) CD CD
—1 _J _J _J _J -J —1
3 5 3 3 3 3 3
3 3 3 3 3 3
O Q Q
CD CO CD CO CD CO CD CD 3 CD
CD CD CD CD CD CD CD CD 3 C l—
—1 —1 —1 _J _J _1 _1 _J o O O C CD
3 □ 3 ZD 3 ZJ ZJ □ □ 3 3 CD 1—
3 ZJ ZJ ZJ ZJ ZJ o ZJ C h-
Q O O O Q o o cd CD)
3 3 ZD ZD ZD ZD 3 3 CD 1— ο y
3 3 ZD 3 ZJ 3 ZJ 3 O C <
O O O o O o o O CD
3 ro Q 3 3 (D U 3 CD ü ZD ZD CD O ZD 3 C0 o ZJ ZD CD O ZJ ZJ CD O ZJ 3 CD O 3 C CD h— H, V ^3 3 O 3 ü 2 3 O ^3 3 O JD fucuc
O 2 Q a O <2 O a CD 2 ü a o 2 O 2 0 jj 0 3 0 ^3 0 2 0 3 0 2 0 JD
CD S CD CD CD CD a CD CD 42 CD CD CD CD CD CD >2 CD CD £ CD CD <C S S CD £ g se i <2
45 JD 45 42 45 45 45 42 CD CD CD CD CD CD CD
CD CD CD CD CD CD CD CD 45 42 •S •S
CD CD CD DJ CO CD CD CD < <C < < < <
CD CD CO CD CD CD CD CD to w to to to to to
w ω to to to to to to CO CD CD <0 (0 CD CD
CO ot CD CD ω CD CD to CD CD to CD CO to D) (0 to CD CO to CD (D w CD 42 0 42 CD 42 CD 42 0 42 CD 42 0 42 CD
V χ— x— X“ x— X“ X- V- v~ X“ v~
b4 CM 00 xfr xfr 0 CD CM CO cd CD id V- b^
CM CM CO CO O CM CM CO CO XF LO LO
xF xfr xfr xfr xfr xfr xfr Xfr xfr xfr ^F xF XF XF
O O O O O O O O O O o O O O O
CD CD CD CD CD CD CD CD CD CD CD CD CD CO CD
Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q
< < < < < < < < < < < < < < <
t m ld t en lû > en lh 1 m ld 1 en lû > m Lo 1 en m m un t en un m to 1 en LO l en un l en un 1 m un 1 en un
r* en r* en r* en r*· en r* en r* en r* en r^ en r*· en r-. en r- en en rx en r* en r- en
CO 00 00 CO 00 CO 00 CO 00 CO CO 00 00 00 00 00 00 00 00 00 00 CO 00 00 00 00 00 oo 00 00
Q) CO LO b- CD CO LO b- O) X- CO LO b-
b- CO CO CO CO CO CD CJ) CD CD) CDD CD o O o
CM CM CM CM CM CM CM CM CM CM CM CO CO CO CO
xfr xfr Xfr xfr xfr xfr xfr Xfr xfr xF tF xF Xt xF xF
CO O CM CD 00 O CM xfr CD 00 O CM xF CD
b» CO CO CO CO CO CD CD CD CD CD O o O O
CM CM CM CM CM CM CM CM CM CM CM CO CO CO CO
Tl- xfr xfr xfr xfr xfr xfr xfr xfr ^F xF 'T xF xF XF
257
4.64 0.50 11.71 27.32 9.53 ΓΟΟ b4 15.75 11.58 3.01 11.75 25.12 14.34 τ— bb— 0.41
CO CO CO
Γ— O LO LO CD CM 03 03 co to ’Φ· 03 co CD
cd CO eq LQ CD îq O ’Φ ed v CD CO •φ· CM
CD cxi CO CD x- CO ed o ed CO CD o CD
CD N- r— b- b- r— co V“ r- CD CO r— b—
CM
CO O b- LO CO V“ V O r- co r- CM LO O
CD CO CN ’Φ o T~ CM o b- 1O CN b- CD
b- cd ’Φ ’Φ co* LO T“ T“ id ό ’Φ1 ’Φ* Ô
CO to O Τ“ LO CM LO 03 b— ’Φ CO CN
LO CO CD Ο CO CD t— b- LO O LO co ’Φ
CD* CD 00 O CO cd CD* id CM* id T- id
T“ v CN CM CM T~ CM LO co CM v~ CO
CD CD CD CD
CD CD CD CD CD CD
cd D 2 3 CD
O) O O Ο CD CD CD CD D CD JJ Z3 CD CD 3 CD CD Z3
(f) CD cd O
25 CO CO CO D D D 4=- ZD O o 4x
cd cd cd cd cd cd cd ZD D Z) D Z)
a a> 2> a> a> ω a 2 2 a 2
O ZJ < < < < Z) ZD ZD JJ Z) ZD ZD Z) Z)
s 5 a 42 a a a a .CJ Z) a a a
D ZD D ZD Z) < < < Z) JJ Z3 ZD Z)
£ 2 2 a a 2 JJ3 2> ω a 2 p JJ
Z) Z) Z) ZD ZD ZD Z) < < o < •g < o <
o o Q ü O o CJ o Q co CJ o Q
< < < < < < < < CO g co co g’ CO
O o o o o O cj cj 4=iJ < < <
CO CO CO CO CO CO co CO < < < <
£3 2> 2> a1 a> 2* 2 2> JJ) a> 2> CD
< < < < < < < < ZD co ZD Z) ZD ZD ’c'
O CD CD 2> 2> CD CD CD co co C CD
ZD ZD ZD Z) Z) Z) Z) ZD 4H 0 0 0 0 Έ* CD < H
co CO CO CO CO CO CO co £ c CD 42
0 0 0 0 0 0 0 0 c CD < 0 0 0
2 42 42 42 42 42 42 42 CD CD 0 CD 42 42 42
< < < < < < < < a <, < < < <
CD CD CD CD CD CD CD CD < CD CD CD CD CD
jd 42 42 42 42 42 42 42 42 42 42 42 42 42
< < < < < < < < O) < < < < < <
ω cd cd cd cd cd cd cd < CD CD CD ω CD (D
23 CO CO CO CO co co co CO CO CO co CO CO
CO CO CO CD co CD CD CD CD CD CD co CD CO
C3 CD CD 03 CD 03 03 03 03 CD 03 CD CD CD
td td td ed td td <d td td td td td ed
< ZD ZD ZD ZD Z) ZD Z) Z) ZD Z) Z) Z) ZD ZD
£ 5 a a a □ a a a a id a a a a
ο o O O o O o O o 0 o o 0 O O
2 3 23 a 2 a 2 2 a J3 2 a 2 2
Z) ZD ZD Z) Z) Z) ZD ZD ZD ZD Z) Z) ZD ZD ZD
2 2 2 2 .o a 2 2 td jj .o .o a a a
Z) Z) Z) Z) ZD ZD ZJ Z) Z) ZD ZD ZD Z) Z) Z)
45 42 42 42 a 42 42 42 a a 42 a a a 42
Ο O O O O O o Q 0 O o o Q o o
2 a a a a 2 a a tD a Z3 a a a
y o o y ΰ y 2 o Q Q 2 2 Q O 2
P 2 2 2 2 a ZD P P P 2 2 2 2 2
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
a a a a a a a a a a a a a a a
CD 0 0 0 0 0 0 0 0 0 0 0 0 0 0
42 a a a 42 a 42 a a a ,co 42 a 42 42
CD 0 0 0 0 0 o o 0 0 0 0 0 0 0
42 a ,ro a 42 a a a 42 g a g g g g
< < < ZD Z3 ZD Z) < < < < < < < <
cd cd cd co cd U) CD CD CD CD
CO CO □ D D co co co CO CO CO co CO co
42 a a a a a 42 42 a 42 a a 42 42 a
0 o O O O 0 0 0 0 0 0 0 0 0 0
v~ V v~ T— T- V” T- T“ v~ T~ V“
cd CD 03 ’Φ CD CM co’ ’Φ O id O b4 ed
CD CD b- b- CO ’Φ LO LO CD r- b- CO Φ· LO
φ- ’Φ -Φ· ’Φ ’Φ ’Φ •Φ ’Φ φ· φ· ’Φ· Φ* ’Φ
O o O O o Ο O O O o o O o O
CD CD CD CD CD CD CO CD CD CD CD CD CD CO
Q Q Q Q Q Q Q Q Q Q Q Q 2 Q Q
< < < < < < < < < < < < c < <
m ld I m ld t en ld 1 en lq i en m 1 m lo l m m 1 m ld en ld 1 en lo t en lo 1 en ld 1 en ld t en m 1 en la
r- en r- en r- en r- en en en r- en r- en r^· en en r- en en r* en r* en en
00 00 OO 00 00 00 00 00 00 co oo oo 00 00 00 00 00 00 00 co co 00 00 00 co 00 00 00 00 00
CD CO LO b- 03 co LO b- 03 V co LO r-
O CM CM CN CM CM CO co CO co
CO CO CO CO CO CO CO CO CO CO co CO co CO co
’Φ* ’Φ ’Φ ’Φ ’Φ ’Φ Φ· ’Φ ’Φ χφ ’Φ- ’Φ- ’Φ ’Φ φ·
CO o CM CO 00 O CM ’Φ CD 00 O CN ’Φ CD
CM CM CM CM CM co CO CO CO
CO CO CO CO CO co CO CO CO CO CO co co co CO
3· φ· ’Φ ’Φ φ· ’Φ ’Φ ’Φ ’Φ· ’Φ •φ- φ· ’Φ ’Φ ’Φ
258
3.46 5.73 14.62 25.48 6.86 co cd 6.64 1.27 6.01 11.59 11.74 ZZ'Z 1 2.31 o T- CD 0.75
Ο CO CD CO G co CM O r- CO CD CD b- CD CD
CM CM CO b- o CM CD r— CO CO CD CD CO O
cd r< LO CO 00 ^F CD id O CD 'fr id CD CD O
co CO CO co CD LO b- CD LO CD CD CD CO co
T- CM
CD Tf b- co CD t— LO CM xF CO O CD CO CD
ô co 00 LO v— CO CO b- CO LO CD b- TF id
V CD 00 id ’xF o V id id h4 0 *- CD V
Ο CO co 00 T“ CD M* v~ CD LO CM CO CD LO
r- 'fr o x— CO CO CM CD CD CO CD LD CO CO
CO XF V LO id CD ^F cd cm’ id cd CM
CM CM CM CM V“ T~ x~ V V T- CO CM
CD CD CD
(Λ CD CD CD
ZD ω Σ3 D
cd ü D cd CD O cd CD CD CD CD CD CD CD CD CD CD CD
o CD CD CD CD CD CD CD CD CD CD CD
0 ZD Z) ZJ D Z3 Z5 ZD D D D D D
zd ZD ZD CD CD CD CD CD CD CD CD ω CD CD
Q Q o o o o Q Q
23 23
o 0 £ ZD 0 ZD Z) 5 0 0 0 0 0 0
Z) ,ο Z) a a a a a a a a a a a
£ 0 ω o ZD 0 ZD Z) ZD 0 0 0 0 0 0
o O ü o o ü o o Q Q o ü
< <. <r
o < o δ 0 Z) 0 0 0 0 0 0 0 0 0
co o co o o o o o o o O O o o
H- u-
4? CD c CD < < < < < < < < < < <
CD < o o o o o u o o O o o
C 0 co CD co co co co co co co CD co
CD XD CD CD CD X) CD CD CD CD CD CD
0 < < < < < < < < < < < < <
CD ,CD CD o CD CD CD CD CD CD CD
0 0 Z) 0 Z) ZD 0 0 0 0 0 0 0 0 0
co co co CO CO co CD co CO co CD CO CO CO CO
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
co co co co co co co co cO CO co co co co en
Ψ- M-Z M-i ¢=
< < < < < < < < < <£ < < < < <
CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD
ω cd CD cd 42 CD CD CD 42 42 CD CD ω
< < < < < < < < < < < < < < <
cd cd ω cd CD CD CD CD CD ω CD CD CD CD CD
CD CO co CD CD CO CO CO CO co CD CO CO CD CO
CD CD O> CD CD CD CD CD CD CD CD CD CD O CD
CD CD co CD CD _j qz! CD q=J c2 Z) CD 0=! _1 0 CD c2 c2 o CD a -i CD a
CD CD CD CD C ZD 0 *2 0 0 0
q=! 0 q=! Z) 5=i ZD c2 0 H c CD ]— ZD 'c' M— O £ O O ^2 <2 o M— o *2 O δ Cfu
£ O a o a o a o £ O δ CD p. c CD J— D Έ' 0 <2 20 «4= 0 a 0 0 Ufu
D D ZJ D ZD CD 42 4- 42
ZD o 0 Z) ZD 0 ZD Z) Q c 0 0
o o o o ,u Q 42 .CD O CD C CO 42 co
0 0 0 Z) ZD Z) ZD Z) 0 0 C o
CD CD 42 .CD .CD 42 42 42 CO 42 42 CD c ZD
o O o o 0 O u o O O ό O ]— C
D D D D ZD ZD D D D D p CD
M—
o o O O O O o o o o o o o o
p .r! a d a a a a a a a a a a a
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
5 a a a a a a a a a a a a a a
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
42 a a 42 .93 a a 42 42 a 42 a 42 42 42
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
co CD CD co CD CO CO co co CO co CD 42 42 co
< < < < < < < < < < < < < < <
V) cd CD cd CD CD ω CD CD CD CD CD CD CD CD
co co CO co CO CO co CO C0 CO CO CO CO CO CO
CD CD (D CD CD CD CD 42 .CD .CD
M—
0 0 0 0 0 0 0 0 0 0 co 0 0 0 0 0
V V“ v~ T“ v~ V -Ç- -Ç_
CD id τ— CD v- CD CO ^F O CD CM b4 CM r4 CD
LO CD b- b- co CO LO CD CD b- b- CO CO XF
XF •^F ^r ^F XF ^F 'fr ^F ^F ^F ^F XF ’sF
O O O o O O O O O O O o O O O
CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD
Q Q Q Q Q Q Q Q Q Q Q Q Q Q Q
< < < < < < < < < < < < < < <
I m ld I C0 LD 1 en m 1 m ld t en un 1 m un 1 m un 1 m i_n t m ld 1 en ld 1 en ld t en ld 1 en lo 1 en un 1 en un
>· CD r- en en r- en en b> en r* en en r* en r* en r* en en r- en r* en en
00 00 CO 00 00 00 00 00 00 00 00 00 CO 00 00 00 00 00 00 00 oo co 00 00 00 00 00 00 00 00
CD co LO b- CD co LO b- CD V“ co LO b>
co xF -^F ’SF XF LD LO LO LO LO CD CD CD CD
co CO CO co co CO CO CO CO CO CO CO CO CO CO
’i- ^F ^F M· -^F TF tF M- 'ri' •M* ^· ’sF
00 o CM sF CO CO Q CM ’cF CD CO O CM CD
co tF ^F M- ^F W LO LO LO io CD CD CD CD
co CO CO CO CO CO CO CO CO CO co CO CO CO CO
•çf ’fr ^F •’φ ’cF Xt ’cF TF ^F ’CF •'fr ^r ^F sF
259
23.01 22.00 18.92 7.88 16.03 7.90 1.97 11.25 35.17 2.66 22.65 17.72 CN b- CN 1.85
Tf O CD b-
CN CO CD LO CN CD CD LO Tt CD CO CD CO
Tf b; t— O v— CD CN CN Q Τζ CO CD r~
Ο LO CN V t— T— O CN bZ CD ed bZ Tf
V CO CO CD CD CO v- V” X“ CD CD CD CD b-
CN CO CO LO CO CD CD O CD LO CO CD CD CN
CO O CO CN CO LO co CO 00 O CD b- CD CO
CN CN CO Tt CN O CN ό ed ed 0 CO LO* r<
LO O b- Tf 00 Tf CD CN Tf LO b- CO
O CO b- CD r- b- O co CD Tf CO b- b-
V CD r4 Tt CD Tf bZ V co’ CO 0 CD LO CN
CO T“ V v CN CN co Tf CO CN CN T“ CN CN
CD CD CD CD CD CD CD CD
ω CD ω CD cd CD CD
3 ω ω 3 ω Z5 ω 3 ω ω
CD ω 3 Σ5 3 ω 3 cd CD CD 3 3
ω ω £ ω o ω ω
ω o o ¢2 42 U) ω ο
D ZD Z) Z) a ZD ZD Z) 3 3 CD CD
ω ZJ Z) ZD ZD Z) 3 ω ω
,o o o ο ZZ) ZD
ZD ZD 40 ZD Z) 5 Z) a ZD ZD 42 M— ZD Z) .Ü Z) Z) 5 3 42 3 .CD
a Z) 2 ¢2 o £ ZD a Z) a a ZD ZD
ZZD £ ZD ZD ZD 42 ZD a U Z) 0 Q
o O o 42 Q 0 0
< M- <£ <r <c ¢3 <Z <£
D o < < Ü < o < O O ZD Z) ZD ZD
o CD O ω o CD ü CD O 0 0 O
< CD CD co CD cp CD a> CD CD Έ* C CD < < < <
o < < % < < CD < 0 ü 0 0
ro < < < C 0 CD CD CD CD
CD CD 42' CD CD CD CD
< Z) (D ZD Z) ZD zd 'c CD 0 < < < < <
CD 42 CD C CD .CD 1CD CD CD CD
Z) 0 CD 0 0. c CD < H, ZD D D Z) 0 Z) ZD ZZ)
42 ÏF CD c CD 42 42 42 42 .CD 42 42 42 42
G 'c' CD <£ 0 0 0 0 0 0 0 0 0 0 0
42 CD 0 O 42 .CO 42 42 42 42 42 42 42 42 42
< <_ < < < < < < < < < < <
CD CD CD CD CD CD CD CD CD CD CD CD CD CD
42 42 42 42 42 42 42 42 42 42 42 42 42 42 42
< < < < < < < < < < < < < < <
ω ω ω ω ω ω CD w cd V) ω ω ω CD ω
CD CD CD CD CD CD CO CD CD CD CD CD CD CD CD
CO CD CD CO CD CD CO CD CD CO CD CD CD CD
CD ed CD ed a CD q=! _! CD 5=! cd CD a a Z) CD ed CD ed CD CD CD CD CD CD —1 CD
Σ) ZD Z) *2 Z) —J Z) Z) _J _J
^3 O £ z> (Cgn)u »4=o 'c CD H £ O 3 Έ* o a n a o a O a ZD Q a o a Σ2 0 ^3 Z) a o a n ^3 Q Z> a Σ5 a 0 ZD <2 O 3 .ω 42 Z) £ O Z) a 0 3 .CD
£ Z) a Z) fe-' ZD CD H CD o o Έ* o 42 ZD 42 42 Z) 42 ZD Z) Z) 0 a Z) eUf
o £ ,o CD C CD 42 CD £ .CD £ 42
42 o Z) Z) Z) Z) H CD < ’c O 0 42 O ZZ) ZD ZD ZD
5 ,ÇD 45 45 42 a CD CD c CD [— 3 a 42 42 42 42
o 0 O O 0 O O C 0 0 0 0 0
a 3 .3 a CD a ^3
CD 2 o 2 o y £j p σ> 0 y y y
H, 2 2 2 0 2 2 2 2 2 t 2 2 2 2
0 G 0 0 0 0 0 0 0 0 0 0 0 0 0
a •2 a a a a a 42 a a a a a a a
o 0 0 0 0 0 0 0 0 0 0 0 0 0 0
42 .CD 42 42 42 42 42 42 42 42 a a 42 a 42
O 0 0 0 0 0 0 0 0 0 0 0 0 0 0
45 42 45 45 .CD a 42 a s a £ 42 42 £ £
< < < < < < < < < < < < < < <
ω ω <n ω ω CD ω CD ω ω ω ω ω ω ω
CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD
42 42 42 42 42 42 42 42 42 42 42 42 42 42 42
G 0 0 0 0 co 0 0 0 0 0 0 0 0 0 0
T“ V“ T~ x- t— X” V“ T“ v~ X- X“
LO cd CO CO O CD CN CO O* 10’ 0 LO
LO CD CD b- 00 CO LD LO CD CD LO LO CD CD
Tf Tf Tt Tt Tf Tf Tf Tf Tf Tf LO LO LO LO
O O O O O O O O O O O O O O
CD CD CD CD CD CO CD CO CD CD CD CD CD CD
Q Q Q Q CD Q Q ό Q Q Q Q Q Q Q
< < < < C < < < < < < < < < <
1 m LD 1 CO LD t m lo 1 m ld 1 m lh 1 m lh 1 m m 1 m lh m lh 1 m lh t en lh 1 en m l m lh 1 m lh 1 m lh
Px CD r* cd r» cd r- en en >· CD en >· en r* en >. en r* CD >· en en en r* en
00 00 00 00 00 oo 00 00 oo co 00 00 00 oo 00 00 co 00 00 00 00 co 00 00 00 00 00 00 00 00
CD CO LO b- CD co LO b- CD co LO b.
CD c- r- b- b- b- co 00 00 co 00 CD CD CD CD
CO CO CO CO CO CO co co CO co CO CO CO CO CO
Tt Tt Tt Tf Tt Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf
CO o CN Tf CO 00 O CN Tf CD CO O CN Tf CD
CD b- b- b- b- b- CO 00 co CO CO CD CD CD CD
C0 CO CO CO co co CO co co CO co CO CO CO CO
Tf Tt Tt Tt Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf Tf
260
As is shown in the table above, in this in vitro screen, the siRNAs that provided the greatest ALAS1 mRNA suppression (greater than 80% suppression, such that less than 20% mRNA was remaining) at 10 nM concentration included AD-58632, AD-60472, AD-60423, AD-60445, AD-60423, AD-60417, AD-60466, AD-60473, AD-60434, AD-60448, AD-60460, AD-60411, AD-60481, AD-60486, and AD-60453, AD-60480, AD-60405, AD-60477, AD60461, AD-60470, AD-60467, AD-60482, AD-60446, AD-60555, AD-60454, AD-60469 and AD-60463. Furthermore, in this in vitro screen, the siRNAs that provided the greatest ALAS1 mRNA suppression (greater than 30% suppression, such that less than 70% mRNA was remaining) at 0.1 nM concentration included AD-60423, AD-58632, AD-60434, AD-60423, AD-60466, AD-60419, AD-60438, AD-60448, AD-60460, AD-60473, AD-60411, AD-60405, AD-60472, AD-60477, AD-60417, AD-60480, AD-60482, AD-60421, AD-60560, AD-60433, AD-60481, AD-60475, AD-60555, AD-60437, AD-60550, AD-60415, AD-60463, and AD60443.
As is shown in the table below, testing of further siRNAs revealed that the following duplexes provided greater than 80% suppression at 10 nM concentration: AD-58632, AD-60405, AD-60423, AD-60434, AD-60445, AD-60480, AD-60460, and AD-60466, and the following duplexes provided greater than 30% suppression at 0.1 nM concentration: AD-58632, AD60405, AD-60423, AD-60434, AD-60419, AD-60480, AD-60460, and AD-60466.
Table 26: Further sequences and in vitro screen results for AD-58632 and AD-58632 dérivative siRNAs
Q r: s OT O c 4.2 10.5 7.9
J S < O c 46.7 63.5 55.9
Q o S ω t- c 2.7 4.5 3.4
U) — > O ZE < X- C eq 15.6 13.8
Antisense (AS) Sequence (5'-3') asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg asAfsGfAfaGfaugAfgAfcAfcucuuucsusg asAfsgAfaGfaugAfgAfcAfcucuuucsusg asAfsgAfaGfaugAfgacAfcucuuucsusg asAfsGfAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg CD ω 3 ω r) £ Z) 42 Z) 42 < co £ tS5 ZJ 42 0 CD ω ra asAfsGfAfaGfaugAfgAfcAfcucuuucsusg asAfsgAfaGfaugAfgAfcAfcucuuucsusg
Sense Sequence (5’-3’) CD en a 0 5 O Z3 0 £ 0 42 O S2 S ω a 0 42 0 ω ro 0 GfsasAfaGfaGfuGfuCfuCfaucuuCfuuL96 GfsasAfaGfaG1uGfuCfuCfaucuuCfuuL96 CD CD —1 3 ^3 O 3 ü 3 42 O £ O 0 a 0 42 0 ω CO 42 0 GfsasAfaGfaGfuGfuCfuCfaucuuCfuuL96 CD cd _j 3 3 O 2 3 O 3 42 O <2 o <2 0 0 ra CD ra ro ω co ω o gsasaagaGfuGfuCfuCfaucuucuuL96 CD CD _J 3 3 O 3 5 O 3 42 O a o a 0 2 0 ra CD CO ra ω CO CD en gsasaagaGfuGfuCfuCfaucuucuuL96
Duplex Name AD- 58632.8 AD- 60405.1 AD- 60423.2
φ CD O. « ΓΤ) (/) i OT CO £- 0) C CF -s CD H ωοίϋωωοΖο^. 873- 895 873- 895 873- 895 873- 895 873- 895 873- 895 873- 895 873- 895 873- 895
rt i 0 ., .X ω LU A c c « Q z œ. (g 4399 4401 4403 4405 4407 4409 4411 CO V ti* 'ti' 4415
SEQ IDNO: (sense) 4398 4400 4402 4404 4406 4408 4410 CM V“ ti ti- 4414
262
CD CO o
CD cd xF
b- co v—
00 b^ CO
xF LO b-
CO CO
CN LO co
b- 00 co
XF Ô ed
V CN χ~
CD
CD CD CD
ω ω CD CD ω CD CD CD CD
CD 42 cd ω 3 CD ω CD ω 3 ω ω 3 CD cd CD CD 3 CD CD 3 CD CD CD
ω 3 cd ω 3 CD CD 3
3 Σ) U cd 3 ο ZD ο CD 3 ω ZD ω CD 3
(D ω ZD «3 3 3 ο 3 O 3 3 <2 3 3 O 3 ü 3 3 a 3 3 O 3 CD O
ο 42 Σ) 3 3 3 3 D 3 3 3 3 Σ3 3 3 3
3 ο O 3 Ο .ο Ü 3 ω o O 3 3
3 ω 42 Σ) 3 o Ο 3 3 O 3 Ο ZO 3 Q O 3 3 O 3 ω Σ) 3 O ω 3 3 Ü
2 < Ο ¢^ ο 3 Η- υ ιίί 3 Μ- O Mx U 3
ο < Ε O < < E O < υ
< < ο E < Q <É £ b 42 < < E < O E •g <f
ο ro < O < ro < o < ro < ¢=- o
ro CD CD < ro CD CD CD < ro CD CD CD <C ra
§ < < < ^σ) E> < < < E5 E> < < < ig) i?
< 4? ο CD < < CD CD CD < <£ CD CD CD < <
σ) Σ) 3 CD CD 3 3 CD CD 3 3 CD (D
3 ra Σ) ra 3 3 42 ZD ro 3 3 ro ZD E 3 3
S 42 0 45 42 0 45 0 E E 0 E 0 E E
0 ro 0 ro 0 0 ra 0 ra 0 0 ro 0 ra 0 (')
45 < 42 < 45 45 < 42 < E E < E < £ E
< < < < < < < < < <r
CD 0 CD 0 CD CD 0 CD 0 CD CD 0 CD 0 CD ΓΒ
J2 42 42 42 42 42 42 42 42 E E E E E E E
< < < < < < < < < < < < < < < <
ω cd ω ω ω CD ω cd ω ω CD CD CD CD ω CD
ra ro ro ra ro ro ra ro ra ro ra ro ro ra ro ro
CD co co CD CD
CD CD CD CD CD
co CD co CD co _J —] _J _J _J
CD CD CD CD CD 3 3 3 3 3
CD CD _1 _j _j _! 3 3 3 3 3
co CD co cd CD CD co CD CD CD 3 3 3 3 3 3 3 3 3 3 O 3 O 3 O 3 O 3 on(
_j _j _| _j _J C C C C C
3 3 3 3 3 CD CD CD CD CD
ο 3 3 3 3 3 0 O 3 ro ω 3 £ E H 1- 1- 1- H
3 3 Ο 3 Ε Ο ^2 O 3 3 O 3 ro o £ Ο 3 3 Ο 3 ro ω κ2 O 3 3 O 3 ro o £ ü 3 3 ü 3 ro o 12 O 3 3 O 3 ra o 12 3 ra ω 3 Q 1— S 3 ra o 3 Ü 1— 2 3 ra o 3 O l— E 3 ro o 3 Q 1E V 3 ro o 3 O E 3 ro o 3 O E Ή* 3 ra o 3 O E ifucucauc( fucucauc(
Q Q ο Q o O 0 0 0 0 0 0 0 0 0 0
^3 12 ^3 ^3 ^3 ,3 12 ^3 a E 3 E ^3 E
ω 0 0 0 0 0 g y $2 S g ΰ 0 2
a ω a 0 ^3 0 ^3 0 12 0 ^3 0 s 0 g 0 £ 0 S 0 g: 0 <ç 0 s 0 :£ 0 GfA GfA
ro cd ro CD ra CD ra CD ro CD ro CD 45 45 42 45 ,çü 45 42 E E E
ra ro ro ro ro ro < < < < <C < < < < <
ra ro ro ro ra ro CD ω ω CD CD CD CD (D ω CD
ω ω ω (Λ ω CD ro ro ro ro ro ro ra ra ra ro
ra cd Ο) ro ω CD ro ω CD ro ω CD ra cd CD ro ω CD 42 0 42 0 42 0 42 0 E 0 E 0 E 0 E 0 E 0 E 0
T“ T“
xt CD LD
CO V“ . ^F
Q o Q o Q o
< CD < CD < CD
I en ld 1 en un 1 en m 1 m un 1 m un 1 m un m un 1 m un 1 en un 1 m un 1 m un « en un t m un l m un 1 m un 1 m
r* en r- en en Œ) r* en r-. en r- en en en r* en b- en en en b- en Œ)
00 w 00 00 00 00 00 00 00 co 00 00 00 co 00 00 00 co 00 00 00 co 00 00 00 00 00 00 oo 00 00
b- σ> co LO b- CD •c~ co LD b- CD τ— co LD b-
CN CN CN CN CN co co co co CO xt XF XF xF
xt xt xt Xt xF xt xt xF xF XF Xt XF Xt xF xF xF
xt xt xt xt xt xt xt xF xt XF xt xF Xt xt xF xF
CO co O CN xF CD 00 O CN xF co C0 O CN xF CD
CN CN CN CN CN co CO CO co CO xt xt xt xt
Xt xt xF xt xt Xt xF xF XF xF xt XF xt xF
xt Xt xt xF xF xt xt xF xt Xt xF xt xF xF xF
14.3 4.2
St CD CD ri- CD st
CN riCN
LO LO x- eq T~ V“
3 co £ Z) £ ZD £ ZD £ O co σ> < a Z) a 0 c en < < cd ω < ω σ> ro co 3 ω £ Z) a Z) a Z) a < co a5 < a Z) a 0 'c' CD < <ί CD s U> CD eu w 3 co a Z) a Z) £ Z) (J < O co £ a Z) a 0 'c CD < fe* < CD a < ω CD co ω 3 co a Z) a Z) a ZD a < o co a? < a Z> a 0 'c CD < s (Λ CD co ω 3 ω a Z) a Z) a Z) £ o (0 m < a Z) a 0 Έ* CD < <ί CD a < ω en co ω £ Z) a o a Z) £ o co £ a D a 0 *tn c CD < CD .co *+— O) <. ω co 3 co ω CD co D CO o 3 3 3 O 3 % O CO a < o 3 a 0 'c' CD < <ί CD co co CD CO 3 (0 O 3 3 3 O 3 £ Q CO $ CD 3 a 0 c? CD < <ί CD a < co co CD CO 3 CO O 3 3 3 υ 3 a ί co % CD 3 a 0 'c' CD < < CD a < co co CD CD 3 CD O 3 3 3 O 3 ï co £ CD 3 a 0 Έ* CD < % CD CO CD CD 3 CD Q 3 3 3 O 3 ï co a < CD 3 a 0 Έ* σ> < % CD CO CD ω 3 CO o 3 3 3 O 3 a < co a < CD 3 a 0 'co' c CD < a* < CD a < CD CO CD CD 3 CO a z> a Z) a ZD £ o co £ a zd a 0 a $ CD CO CD CD 3 CO a ZD a Z) Z) % ω co a < a ZD a 0 a < CD % tf) co CD co 3 CD a O a ZD o H Ό a < co a < a Z) a 0 CD a < CD CO
GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfuUfL96 CD CD _J 3 3 Ü 3 3 O 3 a Q a o a 0 a 0 CO CD co ce C/3 co ω en CD CD —1 3 3 O 3 3 O 3 C0 ω a o a 0 a 0 C0 CD CO CO ω co ω en CD σ> _l 3 3 O 3 3 O 3 CO O 3 Ü ΙΕ 0 a 0 a 0 a < ω co a 0 CD CD —j 3 3 O 3 c* CD H θ' 3 <0 o 3 O a 0 ^3 0 £ 0 a < CD CO a 0 1 GfsasAfaGfAfGfuGfucucaucs(Tgns)ucuuL96 GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfuUfL96 co CD _! 3 3 O 3 3 Q 3 a o a o a 0 a 0 eu CD CO CO CO CO CO CD co CD _J 3 3 Ü 3 3 O 3 CO O a o a 0 a 0 co CD CO CO (/) CO CD CD CD CD _! 3 3 Ü 3 3 O 3 CO O 3 Q H a 0 a 2 a 0 a < CD C0 a 0 CD CD _! 3 3 O 3 Έ' CD R θ' 3 CO ü 3 O a 0 a e CD CO a 0 CD CD _J 3 3 O 3 CD C CD fc ’ω' o 5 CO o 3 O a 0 1 o 42 < ω ra 42 0 <o d q=! z> o a 42 r> 42 O g 2 0 5 0 42 0 CO co a 0 GfsasAfaGfaGfuGfdTCfuCfaUfcUfuCfuUfL96 CO <3> z> a o 5 Z> 42 0 42 O g 2 0 0 42 0 42 < ω ra 42 0
r~ ό . 00 Qo < co 00 CM CO A to LJ CO < LD
895 I 1 ΓΌ LO en 00 00 t CO LO r* en 00 co 1 C0 LO en 00 00 1 C0 LO r- en CO 00 1 en lo r- en 00 00 l m lo en 00 00 1 m lo en 00 00 l m LO r- en 00 00 1 en lo >- en 00 00 1 en lo >· en CO 00 1 m ld F*- en 00 00 1 en ld en 00 co l en ld en co 00 1 en ld F·- en 00 00 1 en un r* en oo oo
CD St st St LO st st co LO st st LO LO st sf r^· LO St St CD LO st sr CD st st co CD st st LD CD st st riCD st st σ> co St SF v~ rist st co riSt st LO rist st rrist St
CO St st st O LO St St CN LO St st St LO St St CD LO st st co LO st St Q co st st CN CD st St st CO st St CD CD st St CO CD St st O rist st CN rist st st rist st CD rist st
264
6.0 11.6
X— CO
O CD
CO LO
CO LO
LO b^
CD O
2 ’Φ
x— x-
CD CD CD
cd CD CD CD CD 03 CD CD CD CD CD CD CD
ω ω D CD CD CD 25 CD ω CD 23
ο CD Z3 3 25 23 CD Z3 :□ Z5 ω
ω cd £ CD CD CD £ CD CD CD
2 3 £ 42 42 2 2 Z) £ 2 2 2 Z)
Ώ ζτ 23 Z) Z) ZD ZD Z) Z) Z) ZD D 25
Ή 3 2 2 2 E E 2 2 E E 2 Z)
Ζ) z> O Z) ZD ZD o Z) o Z) ZD Z) Z) o
ο O F— Q O o o H o Q ü 1—
l·- 1- T3 4- Έ- 1— h- 1— Ό 4- E 1— 1- 1- TJ
Ό T3 ω ZD Ό D T3 ω ZZD Ό Ό Ό o
£ ω S= £ £ £ ω O E E E 2 ω
< < O < < < < < o < < < < < ü
ο O C0 O o o o o co ü o o o o co
C0 (0 CD CO CO co co co CD co co co co co .CD
E5 ïr E5 o> E E E s= E E E E E
< < CD < < < < < CD < < < < < 03
E5 E E5 E E E E E E E E
ο o CO Z) ZD ZD ZD ZD CD ZD ZD Z) ZD Z) CO
42 E 0 en E E E E E M— 0 E 2 2 E E E 0 CO
0 0 0 0 0 o 0 0 0 0 0 0
45 45 < E E E 45 2 < 2 2 E 2 E <
< < <+h < < < < < < < < < < ù-i
Ο) CD 0 CD CD CD CD CD 0 CD CD CD 03 CD 0
42 E E E E E E E E E E E E 2 E
< < < < < < <c < < < < < < < <
ω U) CD CD CD CD CD ω CD CD CD CD CD CD CD
ω 03 co CO CO CO CO co CD CO CO CO CO CO CO
co E _j u— u- ZD Z) ZD ZD Z) 25
σ> 2 ZD E ZD ZD ^2 ZD E Z) E ZD E E O □ CD CJ E CT Cfu E o Cfu O 23 CD O 23
Ο uCfs ucsu o o CD o Έ' o D n)uC 23 CD 'c' n)sui )Ufui E γ E ZD E ZD^ E O 2 O
fcllfu E ZD E feUfs fc(Tgi CD H fc(Tgi CD H 2 O) H E* CD H 2 f(Cgn CD Q f(Cgn CD O te* 03 O CD O
3 ZD ZD ZD o Z) z> Z) ZD ZD Z) ro Z) Z) Z)
45 E .co E 45 E 45 2 2 2 E 2 2 2 2
Ο O O O 0 CD O O O o o o O 0 0
2 E 2 2 2 2 E 2 2
ω O O Q o Q o O o E 0 o o O o
t- h- H 1- F— H 1— f— h- 1-
Ε 2 2 2 E 2 E p 2 2 2 2 E 2
ω 0 0 0 0 0 0 0 0 0 0 0 0 0 0
<2 <2 5 5 2 2 2 2 2 2 2 2 2 2
ο O 0 0 0 0 0 0 0 0 0 0 0 0 0
Ε E 45 45 E E 2 2 2 E E 2 2 2 2
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
jo E 45 E 45 •s 2 2 2 2 s £ £ E to E
< < < < < < < < CD < < < < < < σ> < co
ω cd CD CD ω CD CD CD 03 te en CD CD CD CD CD -J CD 03
03 CO CO CO co .. C0 _ to _ C0 —1 to S CO .CD CO _J
42 0 .çp CO o3 .CD 0 03 .CD CO S3 CD to S3 (D CD S3 .CD CO S3 2 2 0 Ό 2 3 0 2 2 m 02 2 S 02 2 m 02 2 en 02 Gfs uUf 2 2 0ZD
O co
. to . co
Q 3 ,D- 04
< to C CD
1 en LD 1 Γ0 LT) 1 ΓΟ LD 1 m ld t CO LO 1 en ld t en ld 1 en ld l en lt) 1 en un 1 en un 1 en ld 1 en ld 1 en ld on ld
η*. en en r- en r·» en r* en en en en r> en >· en en en >. en en en
00 00 00 CO 00 00 00 00 00 co oo co 00 co 00 00 00 00 00 00 00 00 00 00 00 00 oo co oo co
Ο) CO LO b- 03 v~ co LO b- 03 co LO b-
b- CO CO CO CO co 03 03 03 03 03 o o o o
'Φ χφ ’Φ ri* to 1X3 LO LO
<φ M* 'fr •çj· ’φ <Φ ^r <· χφ ^r ’tf*
CO O CM CD CO o CM CD co o CM 'Φ CD
b- CO CO CO CO CO 03 O> 03 03 03 o O Q O
’Φ M* LO LO LO LO
'fi ^r ’Φ χφ ’cT 'fi Xf M* ^r
265
Table 27: Further sequences of AD-58632 dérivative siRNAs
SEQID NO: (sense) SEQ ID NO: (antisense) Target sites of antisense sequence on NM_ Duplex Name Sense Sequence (5'-3j Antisense Sequence (5'-3')
4508 4509 873- 895 AD58632 GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfuUfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg
4510 4511 873- 895 AD- 60405.1 GfsasAfaGfaGfijGfuCfuCfaucuuCfuuL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg
4512 4513 873- 895 AD60887 GfsasAfaGfaGfuGfuCfuCfaucuuCfuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg
4514 4515 873- 895 AD60923 GfsasAfaGfaGfuGfuCfuCfaucuuCfuuL96 asAfsGfAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg
4516 4517 873- 895 AD60434.1 gsasaagaGfuGfuCfucaucuucuuL96 asAfsGfAfaGfaUfgAfgAfcAfcUfcllfuUfcsusg
4518 4519 873- 895 AD60892 gsasaagaGfuGfuCfucaucuucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg
4520 4521 873- 895 AD60891 gsasaagaGfuGfuCfucaucuucuuL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg
4522 4523 873- 895 AD60419.1 GfsasAfaGfAfGfuGfdTcucaucuucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg
4524 4525 873- 895 AD60924 GfeasAfeGfAfGfuGfdTcucaucuucuuL96 asAfsGfAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg
4526 4527 873- 895 AD60885 GfsasAfaGfAfGfuGfdTcucaucuucuuL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg
4528 4529 873- 895 AD- 60445.1 GfsasAfaGfAfGfuGfucucauc(Tgn)ucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg
4530 4531 873- 895 AD60925 GfsasAfaGfAfGfuGfucucauc(Tgn)ucuuL96 asAfsGfAfaGfaUfgAfgAfcAfclIfcUfuUfcsusg
4532 4533 873- 895 AD60890 GfsasAfaGfAfGfuGfucucauc(Tgn)ucuuL96 asAfsgAfaGfaUfgAfgacAfcUfclIfuUfcsusg
4534 4535 873- 895 AD60926 GfsasAfaGfaGfuGflJfCfuCfaUfcUfuCfuUfL96 asAfsGfAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg
266
IC50s based on in vitro activity
Similar to the experiments described above, further dose-response experiments were done 5 at 10 nM, 1.66667 nM, 0.277778 nM, 0.046296 nM, 0.007716 nM, 0.001286 nM, 0.000214 nM, and 3.57E-05 nM final duplex concentration, and IC50 values were calculated.
Table 28: Further sequences and IC50s of AD-58632 and AD-58632 dérivative siRNAs
SEQ ID NO: (sens θ) SEQ ID NO: (antisens θ) Target sites of antisense seq on NM_0 00688. 4 Duplex Name Sense Sequence (5’-3 j Antisense (AS) Sequence (5'-3j IC50
4536 4537 873- 895 AD58632.10 GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfu UfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 0.017
4538 4539 873- 895 AD- 60405.2 GfsasAfaGfaGfuGfuCfuCfaucuuCfuuL 96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 0.070
4540 4541 873- 895 AD- 60887.1 GfsasAfaGfaGfuGfuCfuCfaucuuCfuuL 96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 0.120
4542 4543 873- 895 AD- 60819.1 GfsasAfaGfaGfuGfuCfuCfaucuuCfuuL 96 asAfsgAfaGfaugAfgAfcAfcucuuucsusg 0.009
4544 4545 873- 895 AD- 60823.1 GfsasAfaGfaGfuGfuCfuCfaucuuCfuuL 96 asAfsgAfaGfaugAfgacAfcucuuucsusg 0.032
4546 4547 873- 895 AD- 60423.3 gsasaagaGfuGfuCfuCfaucuucuuL96 asAfsGfAfaGfaUfgAfgAfcAfcUfctlfuUfcsusg 0.020
4548 4549 873- 895 AD- 60889.1 gsasaagaGfuGfuCfuCfaucuucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 0.242
4550 4551 873- 895 AD- 60827.1 gsasaagaGfuGfuCfuCfaucuucuuL96 asAfsgAfaGfaugAfgAfcAfcucuuucsusg 0.044
4552 4553 873- 895 AD- 60831.1 gsasaagaGfuGfuCfuCfaucuucuuL96 asAfsgAfaGfaugAfgacAfcucuuucsusg 0.077
4554 4555 873- 895 AD- 60434.2 gsasaagaGfuGfuCfucaucuucuuL96 asAfsGfAfaGfaUfgAfgAfcAfcUfclIfuUfcsusg 0.028
4556 4557 873- 895 AD- 60891.1 gsasaagaGfuGfuCfucaucuucuuL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 0.078
4558 4559 873- 895 AD- 60892.1 gsasaagaGfuGfuCfucaucuucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 0.138
267
4560 4561 873- 895 AD- 60835.1 gsasaagaGfuGfuCfucaucuucuuL96 asAfsgAfaGfaugAfgAfcAfcucuuucsusg 0.015
4562 4563 873- 895 AD- 60839.1 gsasaagaGfuGfuCfucaucuucuuL96 asAfsgAfaGfaugAfgacAfcucuuucsusg 0.014
4564 4565 873- 895 AD- 60419.2 GfsasAfaGfAfGfuGfdTcucaucuucuuL9 6 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 0.014
4566 4567 873- 895 AD- 60885.1 GfsasAfaGfAfGfuGfdTcucaucuucuuL9 6 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 0.091
4568 4569 873- 895 AD- 60419.3 GfsasAfaGfAfGfuGfdT cucaucuucuuL9 6 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 0.026
4570 4571 873- 895 AD- 60843.1 GfsasAfaGfAfGfuGfdTcucaucuucuuL9 6 asAfsgAfaGfaugAfgAfcAfcucuuucsusg 0.004
4572 4573 873- 895 AD- 60847.1 GfsasAfaGfAfGfuGfdTcucaucuucuuL9 6 asAfsgAfaGfaugAfgacAfcucuuucsusg 0.012
4574 4575 873- 895 AD- 60445.2 GfsasAfaGfAfGfuGfucucauc(Tgn)ucuu L96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 0.077
4576 4577 873- 895 AD- 60890.1 GfsasAfaGfAfGfuGfucucauc(Tgn)ucuu L96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 1.201
4578 4579 873- 895 AD- 60445.3 GfsasAfaGfAfGfuGfucucauc(Tgn)ucuu L96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 0.302
4580 4581 873- 895 AD- 60820.1 GfsasAfaGfAfGfuGfucucauc(Tgn)ucuu L96 asAfsgAfaGfaugAfgAfcAfcucuuucsusg 0.006
4582 4583 873- 895 AD- 60824.1 GfsasAfaGfAfGfuGfucucauc(Tgn)ucuu L96 asAfsgAfaGfaugAfgacAfcucuuucsusg 0.032
4584 4585 873- 895 AD- 60480.2 GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfu UÎL96 asAfsgAf(Agn)GfaUfgAfgacAfcUfcUfuUfcsu sg 0.066
4586 4587 873- 895 AD- 60893.1 gsasaagaGfuGfuCfuCfaucuucuuL96 asAfsgAf(Agn)GfaUfgAfgacAfcUfcUfuUfcsu sg 0.034
4588 4589 873- 895 AD- 60884.1 gsasaagaGfuGfuCfucaucuucuuL96 asAfsgAf(Agn)GfaUfgAfgacAfcUfcUfuUfcsu sg 0.157
4590 4591 873- 895 AD- 60886.1 GfsasAfaGfAfGfuGfdTcucaucuucuuL9 6 asAfsgAf(Agn)GfaUfgAfgacAfcUfcUfuUfcsu sg 0.801
4592 4593 873- 895 AD- 60888.1 GfsasAfaGfAfGfuGfucucauc(Tgn)ucuu L96 asAfsgAf(Agn)GfaUfgAfgacAfcllfcUfuUfcsu sg 0.201
4594 4595 873- 895 AD- 60828.1 GfsasAfaGfAfGfuGfucucaucs(Tgns)uc uuL96 asAfsgAfs(Agns)GfaUfgAfgacAfcUfcUful)fc susg 0.145
4596 4597 873- 895 AD- 60832.1 GfsasAfaGfaGfuGfUfCftjCfaUfcUfuCfu UfL96 asAfsgAf(Agn)GfaugAfgacAfcucuuucsusg 0.036
4598 4599 873- 895 AD- 60836.1 gsasaagaGfuGfuCfuCfaucuucuuL96 asAfsgAf(Agn)GfaugAfgacAfcucuuucsusg 0.076
4600 4601 873- 895 AD- 60840.1 gsasaagaGfuGfuCfucaucuucuuL96 asAfsgAf(Agn)GfaugAfgacAfcucuuucsusg 0.033
4602 4603 873- 895 AD- 60844.1 GfsasAfaGfAfGfuGfdTcucaucuucuuL9 6 asAfsgAf(Agn)GfaugAfgacAfcucuuucsusg 0.017
268
4604 4605 873- 895 AD- 60848.1 GfsasAfaGfAfGfuGfucucauc(Tgn)ucuu L96 asAfsgAf(Agn)GfaugAfgacAfcucuuucsusg 0.007
4606 4607 873- 895 AD- 60821.1 GfsasAfaGfAfGfuGfucucaucs(Tgns)uc uuL96 asAfsgAfs(Agns)GfaugAfgacAfcucuuucsus g 0.076
4608 4609 873- 895 AD- 58632.11 GfsasAfaGfaGfuGfüfCfuCfaUfcUfuCftj UfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 0.063
4610 4611 873- 895 AD- 60825.1 GfsasAfaGfaGfijGfdTCfuCfaUfcUfuCf uUfL96 asAfsgAfaGfaUfgAfgacAfcUfclIfijUfcsusg 0.031
4612 4613 873- 895 AD- 60829.1 GfsasAfaGfaGfuGfUfCfuCfaUfcUfuClu UfL96 asAfsgAfaGfallfgAfgacAfcdTcUfuUfcsusg 0.033
4614 4615 873- 895 AD- 60833.1 GfsasAfaGfaGfuGfdTCfuCfaUfcUfuCf uUfL96 asAfsgAfaGfaUfgAfgacAfcdTcUfuUfcsusg 0.100
4616 4617 873- 895 AD- 60837.1 GfsasAfaGfaGfuGfdTCfuCfaUfcUfsuC fsuUfsL96 asAfsgAfaGfallfgAfgacAfcdTcUfuUfcsusg 0.031
4618 4619 873- 895 AD- 60841.1 GfsasAfaGfaGfuGfdTCfuCfaUfcUfsuc sullfsL96 asAfsGfAfaGfaUfgAfgacAfcdTcUfulIfcsusg 0.010
4620 4621 873- 895 AD- 60460.2 GfsasAfaGfaGfuGfUfCfuCfaUfc(Tgn)u CfuUfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfulIfcsusg 0.009
4622 4623 873- 895 AD- 60845.1 GfsasAfaGfaGfuGfdTCfuCfaUfc(Tgn)u CfullfL96 asAfsgAfaGfaUfgAfgacAfctlfcUfuUfcsusg 0.002
4624 4625 873- 895 AD- 60849.1 GfsasAfaGfaGfuGfUfCfuCfallfc(Tgn)u CfuUfL96 asAfsgAfaGfaUfgAfgacAfcdTclIfuUfcsusg 0.005
4626 4627 873- 895 AD- 60822.1 GfsasAfaGfaGfuGfdTCfuCfaUfc(Tgn)u CfuUfL96 asAfsgAfaGfaUfgAfgacAfcdTcUfulIfcsusg 0.007
4628 4629 873- 895 AD- 60826.1 GfsasAfaGfaGftjGfdTCfuCfaUfc(Tgn)s uCfsuUfsL96 asAfsgAfaGfallfgAfgacAfcdTcUfuUfcsusg 0.009
4630 4631 873- 895 AD- 60830.1 GfsasAfaGfaGfuGfdTCfuCfaUfc(Tgn)s ucsullfsL96 asAfsGfAfaGfaUfgAfgacAfcdTcUfuUfcsusg 0.019
4632 4633 873- 895 AD- 60466.2 GfsasAfaGfaGfiiGfUfCfuCfaUf(Cgn)Uf uCfuUfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 0.066
4634 4635 873- 895 AD- 60834.1 GfsasAfaGfaGfuGfdTCfuCfaUf(Cgn)Uf uCfullfL96 asAfsgAfaGfallfgAfgacAfcUfcUfuUfcsusg 0.024
4636 4637 873- 895 AD- 60838.1 GfsasAfaGfaGfuGfUfCfuCfaUf(Cgn)Uf uCfuUfL96 asAfsgAfaGfaUfgAfgacAfcdTcUfuUfcsusg 0.013
4638 4639 873- 895 AD- 60842.1 GfsasAfaGfaGfuGfdTCfuCfaUf(Cgn)Uf uCfuUfL96 asAfsgAfaGfaUfgAfgacAfcdTcUfuUfcsusg 0.010
4640 4641 873- 895 AD- 60846.1 GfsasAfaGfaGfuGfdTCfuCfaUf(Cgn)Uf suCfsuUfsL96 asAfsgAfaGfaUfgAfgacAfcdTcUfuUfcsusg 0.011
4642 4643 873- 895 AD- 60850.1 GfsasAfaGfaGfuGfdTCfuCfaUf(Cgn)Uf sucsullfsL96 asAfsGfAfaGfaUfgAfgacAfcdTcUfuUfcsusg 0.018
269
As is shown in Table 28, the following duplexes had an IC50 of less than O.OlnM: AD60845 , AD-60843, AD-60849, AD-60820, AD-60848, AD-60822, AD-60826, AD-60819, and
AD-60460.
The following duplexes had an IC50 of less than 0.02 nM: AD-60845 , AD-60843, AD5 60849, AD-60820, AD-60848, AD-60822, AD-60826, AD-60819, and AD-60460, AD-60841,
AD-60842, AD-60846, AD-60847, AD-60838, AD-60419, AD-60839, AD-60835, AD586320, AD-60844, AD-60850, and AD-60830.
The following duplexes had an IC50 of less than 0.05 nM: AD-60845 , AD-60843, AD60849, AD-60820, AD-60848, AD-60822, AD-60826, AD-60819, and AD-60460, AD-60841,
AD-60842, AD-60846, AD-60847, AD-60838, AD-60419, AD-60839, AD-60835, AD586320, AD-60844, AD-60850, AD-60830, AD-60423, AD-60834, AD-60419, AD-60434, AD60825, AD-60837, AD-60823, AD-60824, AD-60840, AD-60829, AD-60893, AD-60832, and AD-60827.
Example 25: In vivo structure activity relationship studies of AD-58632
Dérivatives of the AD-58632 parent siRNA were generated and screened in vivo in rats. The sequences of siRNAs that were screened are provided in the table below.
Table 29: Sequences of ALAS1 siRNA Duplexes
SEQ ID NO: (sens e) SEQ ID NO: (antisens e) Target sites of antisense sequence on NM_0006 88.4 Duplex Name Sense Sequence (5'-3') Antisense Sequence (5'-3')
4644 4645 873- 895 AD58632 GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfuUfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg
270
4646 4647 873- 895 AD- 60405 GfsasAfaGfaGfuGfuCfuCfaucuuCfuuL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg
4648 4649 873- 895 AD- 60887 GfsasAfaGfaGfuGfuCfuCfaucuuCfuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg
4650 4651 873- 895 AD- 60923 gsasaagaGfuGfuCfucaucuucuuL96 asAfsGfAfaGfaUfgAfgAfcAfcUfclIfulIfcsusg
4652 4653 873- 895 AD60434 gsasaagaGfuGfuCfucaucuucuuL96 asAfsGfAfaGfaUfgAfgAfcAfcUfcUfulIfcsusg
4654 4655 873- 895 AD- 60892 gsasaagaGfuGfuCfucaucuucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg
4656 4657 873- 895 AD- 60419 GfsasAfaGfAfGfuGfdTcucaucuucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg
4658 4659 873- 895 AD- 60924 GfsasAfaGfAfGfuGfdTcucaucuucuuL96 asAfsGfAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg
4660 4661 873- 895 AD- 60445 GfsasAfaGfAfGfuGfucucauc(Tgn)ucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg
4662 4663 873- 895 AD- 60925 GfsasAfaGfAfGfuGfucucauc(Tgn)ucuuL96 asAfsGfAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg
4664 4665 873- 895 AD- 60926 GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfuUfL96 asAfsGfAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg
A single dose of 5 mg/kg of siRNA was administered. At 5 days following administration of the siRNA, mRNA measurements of rat ALAS1 (rALASl) mRNA and rat GAPDH (rGAPDH) mRNA were made using bDNA assay, and tissue levels of drug were
271 determined using qPCR. The results are provided in FIG. 33 and FIG. 34. As is shown in FIG. 33, at least ten duplexes (AD-60405, AD-60887, AD-60923, AD-60434, AD-60892, AD-60419, AD-60924, AD-60445, AD-60925, and AD-60926) that were screened showed improved suppression of ALAS1 mRNA compared with AD-58632. Furthermore, as is shown FIG. 34, these duplexes (with the exception of AD-60926) achieved higher liver concentrations than did AD-58632.
Example 26: Efficacy of AD-60925 and AD-60926 in a rat AIP model
The therapeutic efficacy of AD-60925 and AD-60926 (described in the previous example) was investigated in a rat AIP model. The experimental design is shown in the top of FIG. 35. Rats were treated with PBS or 3 mg/kg ALASl-GalNAc siRNA t.i.w., Phénobarbital (PB), and a PBGD siRNA in an AF11 LNP formulation (AF11-PBGD) at the times indicated in FIG. 35. Control rats received the PBGD siRNA only, without Phénobarbital induction.
The results are shown in FIG. 35, FIG. 36 and FIG. 37. Administering Phénobarbital induced ALAS1 mRNA expression and increased levels of PBG and ALA in urine, compared with the control. Treatment with a total of eight doses of 3 mg/kg of AD-60925 or AD-60926 three times per week suppressed ALAS1 mRNA (FIG. 35), urine PBG (FIG. 36 and FIG. 37, top), and urine ALA (FIG. 36 and FIG. 37, bottom) Phénobarbital induced increases in ALAS1 mRNA, urine PBG, and ALA. The time course of treatment effects is shown in FIG. 37. The aiTOWs indicate the timepoints when PB was administered. The siRNA treatment prevented phénobarbital induced increases in in ALAS1 mRNA, urine PBG, and ALA.
Both AD-60925 and AD-60926 showed therapeutic efficacy treatment of AIP. AD60925 was even more effective than AD-60926 in suppressing ALAS1 mRNA, urine ALA, and urine PBG.
Example 27: Further in vivo structure activity relationship studies of AD-58632
Dérivatives of the AD-58632 parent siRNA were generated and screened in vivo in rats.
In vivo screen, part I
272
The sequences of siRNAs that were screened are provided in the table below.
Table 30: Sequences of ALAS1 siRNA Duplexes
SEQ ID NO: (sens e) SEQ ID NO: (antisens e) Target sites of antisense sequence on NM_0006 88.4 Duplex Name Sense Sequence (5'-3j Antisense Sequence (5'-3')
4666 4667 873- 895 AD58632 GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfuUfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg
4668 4669 873- 895 AD60820 GfsasAfaGfAfGfuGfucucauc(Tgn)ucuuL96 asAfsgAfaGfaugAfgAfcAfcucuuucsusg
4670 4671 873- 895 AD- 60824 GfsasAfaGfAfGfuGfucucauc(Tgn)ucuuL96 asAfsgAfaGfaugAfgacAfcucuuucsusg
4672 4673 873- 895 AD61137 GfsasAfaGfAfGfuGfucucauc(Tgn)ucuuL96 asAfsgAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg
4674 4675 873- 895 AD- 60843 GfsasAfaGfAfGfuGfdTcucaucuucuuL96 asAfsgAfaGfaugAfgAfcAfcucuuucsusg
4676 4677 873- 895 AD- 60847 GfsasAfaGfAfGfuGfdTcucaucuucuuL96 asAfsgAfaGfaugAfgacAfcucuuucsusg
4678 4679 873- 895 AD61138 GfsasAfaGfAfGfuGfdTcucaucuucuuL96 asAfsgAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg
273
4680 4681 873- 895 AD- 60819 GfsasAfaGfaGfuGfuCfuCfaucuuCfuuL96 asAfsgAfaGfaugAfgAfcAfcucuuucsusg
4682 4683 873- 895 AD- 60823 Gfs as Af a Gfa Gf u Gf u Cf uCfa u cu u Cf u u L9 6 asAfsgAfaGfaugAfgacAfcucuuucsusg
4684 4685 873- 895 AD- 61139 GfsasAfaGfaGfuGfuCfuCfaucuuCfuuL96 asAfsgAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg
4686 4687 873- 895 AD- 61140 GfsasAfaGfaGfuGfdTCfuCfaUfc(Tgn)uCfuUfL 96 asAfsgAfaGfaugAfgAfcAfcucuuucsusg
Rats were administered four doses of 2.5 mg/kg of siRNA biweekly (two times per week) for two weeks. At 72 hours following administration of the last dose of siRNA, the animais were sacrificed and measurements of rat ALAS1 (rALASl) mRNA and rat GAPDH (rGAPDH) mRNA levels were made using bDNA assay.
As is shown in FIG. 38, at least four of the siRNAs (AD-60820, AD-60843, AD-60819, and AD-61140) that were tested showed improved suppression of ALAS1 mRNA compared with AD-58632.
In vivo screen, part II
The sequences of the siRNAs that were screened are provided in the table below.
Table 31 Sequences of ALAS1 siRNA Duplexes
SEQ. SEQ Target Duplex Sense Sequence (5'-3') Antisense Sequence (5'-3')
ID ID sites of Name
NO: NO:
(sens (a ntl- antisense
e) sens e) sequence on NM_0006 88.4
274
4688 4689 873- 895 AD- 58632 GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfuUfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg
4690 4691 873- 895 AD- 61141.2 GfsasAfaGfaGfuGfdTCfuCfaUfc(Tgn)uCfutlfL 96 asAfsgAfaGfaugAfgacAfcucuuucsusg
4692 4693 873- 895 AD- 61142.2 GfsasAfaGfaGfuGfdTCfuCfaUfc(Tgn)uCfullfL 96 asAfsgAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg
4694 4695 873- 895 AD- 60835 gsasaagaGfuGfuCfucaucuucuuL96 asAfsgAfaGfaugAfgAfcAfcucuuucsusg
4696 4697 873- 895 AD- 60839 gsasaagaGfuGfuCfucaucuucuuL96 asAfsgAfaGfaugAfgacAfcucuuucsusg
4698 4699 873- 895 AD- 61143.2 gsasaagaGfuGfuCfucaucuucuuL96 asAfsgAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg
4700 4701 873- 895 AD- 61144.1 gsasaagaGfuGfdTCfucaucuucuuL96 asAfsgAfaGfaugAfgAfcAfcucuuucsusg
4702 4703 873- 895 AD- 61145.1 gsasaagaGfuGfdTCfucaucuuctiuL96 asAfsgAfaGfaugAfgacAfcucuuucsusg
4704 4705 873- 895 AD- 61146.1 gsasaagaGfuGfdTCfucaucuucuuL96 asAfsgAfaGfa UfgAfgAfcAfcUfcUf u Ufcsusg
Rats were administered a single dose of 2.5 mg/kg of siRNA. At 72 hours following administration of the siRNA, mRNA measurements of rat ALAS1 (rALAS 1) mRNA and rat GAPDH (rGAPDH) mRNA were made using bDNA assay.
As is shown in FIG. 39, the siRNAs AD-61141, AD-61142, AD-60835, AD-60839, AD-
143, AD-61144, AD-61145, and AD-61146 showed improved suppression of ALAS1 mRNA
275 compared with AD-58632. The siRNA that provided the greatest suppression in this experiment was AD-60835.
Example 28: In vitro structure activity relationship studies of AD-60489
AD-60489 and siRNA dérivatives of AD-60489 were generated, and some siRNAs were screened in vitro for activity. The in vitro activity of the siRNAs in suppressing ALAS1 mRNA was tested as described in Example 24. Sequences of siRNAs and results of in vitro testing are provided in the tables below.
Table 32: Sequences and in vitro screen results for AD-60489 and AD-60489 dérivative siRNAs
W o c 5.11 18.61 8.93 19.55 7.01 7.72 : 14.17 1.37 I 10.67 5.47 4.25 CO o
Avg 0.1 nM 50.65 63.58 45.19 48.50 51.03 51.70 105.09 CO o 82.70 71.55 81.85 89.23
ω x- c 0.18 5.94 0.66 7.85 2.44 4.88 18.1 6 12.4 7 10.9 2 1.85 12.6 2 21.7 5
CD — > o 2 < x- c 17.02 17.13 11.90 14.63 14.39 14.67 45.24 62.19 39.06 48.90 I 51.83 65.34
Antisense (AS) Sequence (5'-3') usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu 3 cd CD cd £> Z) £ Z) a Z) a Z) £ 42 < < 43 42 < ω 3 3 cd CD cd £> Z) 42 Z) a 42 Z) £ 42 < $ tj) D 45 0 < % cd 3 usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcUfgsgsu usAfsAfGfaüfgAfgAfcAfcUfcUfuUfcUfgsgsu usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcUfgsgsu usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcUfgsgsu 3 CD CD CD Z) 42 Z) ^3 Z) Z) £ £ < 43 ω < 42 < (Λ 3 3 CD CD CD CD 3 a Z) a Z) Z) £ 42 < % S1 n 43 % tn 3 usAfsAfGfaUfgAfgAfcAfcUfclifuucugsgsu usAfsAfGfaUfgAfgAfcAfcUfcuuucugsgsu
Sense Sequence (5-3’) CfsasGfaAfaGfaGfUfGfuCfuCfaUfcUfuAfL96 CfsasGfaAfaGfaGfuGfuCfuCfaucuuAfL96 I CfsasGfaAfaGfaGfuGfuCfuCfaucuuAfL96 CO CD 3 3 O 3 42 O a Q 0 0 42 0 co co CO CD ω (0 42 O CO CD —1 CO 3 3 O 3 42 Q £ 0 a 0 a 0 42 0 CO CO CO CD CD CO 42 Q CO CD -J CO 3 3 O 3 42 O ^3 Q a 0 a 0 42 0 CO CO CO O) CD CO ω o CD O —I CO 3 3 O 3 42 O a o 3 CD £ 0 42 0 CO CO CO CD ω CO CD υ CD CD —J CO 3 3 O 3 42 O 3 O 3 CD a 0 42 0 CO CO CO CD (D CO CD ü csasgaaaGfaGfugucucaucuuaL96 csasgaaaGfaGfugucucaucuuaL96 CD σ> —1 CO 3 3 O 3 CO O 3 O 3 CD a 0 45 0 CO CO CO CD CD CO CD O CO CD _] CO 3 3 O 3 CO O 3 ω 3 CD a 0 a 0 CO CO CO CD CD CO CD O
Duplex Name* I AD- 60489.1 AD- 60495.1 AD- 60501.1 AD- 60507.1 AD- 60513.1 AD- 60519.1 AD- 60525.1 AD- 60531.1 AD- 60490.1 AD- 60496.1 AD- 60502.1 AD- 60508.1
ω ° Φ § o Q) ω t ω ° HS v- Q}’4= C cr^ CO <0 S- C Q) Φ £ CO H cd co cd u) Z o 871- 893 871- 893 871- 893 871- 893 871- 893 871- 893 871- 893 871- 893 871- 893 871- 893 871- 893 871- 893
SEQ IDNO: (antisense) 4707 4709 4711 4713 4715 4717 4719 4721 4723 4725 4727 4729
SEQ ID NO: (sense ) 4706 4708 4710 4712 4714 4716 4718 4720 4722 4724 4726 4728
277
7.36 20.47 7.99 CO 9.77 5.40 6.30 18.62 0.92 7.29 4.81 9.67 0.79 19.60 0.41
102.94 126.75 81.28 94.13 97.85 95.01 i 96.03 104.36 98.80 99.96 I 114.13 O o O ro o 98.41 93.14
3.47 0.93 15.4 4 13.3 6 0.43 10.1 7 cm cd 24.4 1 13.9 5 36.3 9 26.5 6 4.69 1.56 CN rCD V“ 5.13
97.13 104.9 7 61.48 83.47 109.0 5 73.81 75.30 71.37 64.16 73.99 82.69 89.41 83.52 64.64 57.55
usAfsAfGfaUfgAfgAfcAfcucuuucugsgsu usAfsAfGfaugAfgAfcAfcucuuucugsgsu usAfsAfGfaugAfgAfcAfcucuuucugsgsu usAfsAfGfaugAfgAfcAfcdTcuuucugsgsu usAfsAfGfaugAfgAfcAfcdT cuuucugsgsu usAfsAfGfaugAfgAfcAfcdTcuuucugsgsu usAfsAfGfaugAfgAfcAfcdTcuuucugsgsu usAfsAfGfaugAfgAfcAfcdTcuuucugsgsu usAfsAfGfaugAfgAfcAfcdTcuuucugsgsu usAfsAfGfaugAfgAfcAfcdTcuuucugsgsu usAfsAfGfaugAfgAfcAfcdTcuuucugsgsu usAfsAfGfaugAfgAfcAfcdTcuuucugsgsu usAfsAfGfaugAfgAfcAfcdTcuuucugsgsu □ CD CD CD CD O 2D □ 3 O ΙΌ ιθ < £ £ CD 25 42 < CD 25 usAfsAfGfaugAfgAfcAfcdTcuuucugsgsu
CO σ> —1 ra 25 25 ω co o 3 O 25 CD a 0 jü 0 CO co co CD ω CÜ ω o CD O) —1 co 25 25 Q 3 CO Q O 25 CD a 0 42 0 co co co CD ω co cd u CD CD -J CO Z5 3 ω D CO υ 3 O 25 CD 12 i 0 co co co CD cd co cd o CD cd —1 co 25 O 25 CO U 3 ω 3 CD 12 i 0 (0 CO CO CD ω co ω o csasgaAfaGfAfGfugucucaucuuaL96 CfsasgaAfaGfAfGfugucucaucuuaL96 CD CD _J CO 25 25 O 25 CO ω 25 O 25 0 Ό a I 0 co co co CD CD CO cd Ü CD 05 _l CO Q CO o 25 O Ό 25 CD S CD CO co co CD CD CO CD Q CD O) —1 CO 2 ZD O 25 co Q •C 3 o 3 CD 12 i 0 CÜ CÜ CÜ CD CD CO CD O CD CD _J CÜ □ o h“ Ό co o 25 O ZD CD 12 0 i 0 CÜ CO CO CD CD CÜ CD ω csasgaaaGfAfGfugucucaucdT uaL96 CD 05 _J Cü 3 25 O 25 CO O 3 O TD 25 0 12 I 0 co co co CD CD CÜ CD Q CD 05 _J CO ZD ZD O 25 CO 0 Ό 25 Q 25 0 Ό 12 0 £ 0 co co CÜ CD ω Cü ω o CO 05 —1 Cü ZD 25 O FΌ Cü O O 0 T5 12 0 £ 0 CO CÜ CÜ CD ω co CD o CD CD _! CO 25 25 O H Ό CO O 25 O T5 25 0 T5 12 0 <C 0 CÜ Cü cu CD CD CÜ ω o
AD- 60514.1 AD- 60520.1 AD- 60526.1 AD- 60532.1 AD- 60491.1 AD- 60497.1 AD- 60503.1 AD- 60509.1 AD- 60515.1 AD- 60521.1 AD- 60527.1 AD- 60533.1 AD- 60492.1 AD- 60498.1 AD- 60504.1
871- 893 871- 893 871- 893 871- 893 871- 893 871- 893 871- 893 871- 893 871- 893 871- 893 871- 893 871- 893 871- 893 871- 893 871- 893
4731 4733 4735 4737 4739 4741 4743 4745 4747 4749 4751 4753 4755 4757 4759
4730 4732 4734 4736 4738 4740 4742 4744 4746 4748 4750 4752 4754 4756 4758
278
2.06 2.73 5.43 8.60 7.37 2.41 6.68 2.48 14.73 18.41 I 8.40 28.99 26.56 1 1 12.88 i î 4.56
σ> O CM V“ CM co CM CM O b- CD CM CD CO ti·
co ti· CO b- CD CD LO CO LO LO x— O CO •ti*
χ— •ti· V CD CD A A CD* LO* CO b CD* CD V CM*
CD 00 CD CO CD co b- O CD CD CD b- b- co b-
ti- 00 CD CO o -ti- LO LO b- CO ti LO X“ x- CO CD ti- v— LD ti CM b- CO
ιό LO TF b-* O x- co CD O CD CD CM CO*
CM CD* CO* CO CM O X- CM t— ed t—
CO •ti* b- ti* CO x- CO CM b- O CO O LD CO •ti· LD
00 CM •ti* CD bZ CD b- X- CO CD b- r- CO
CO CO* b T“ CM O LO CD CM* O CD 0 CD
LD LO CD CO CD V“ CO CO CO CO CM CM CO CO CM
3 3 3 3
23 3 3 3 3 CD CD CD CD CÜ CO co 3 3
CD CD CD CD CD CD CD CD CD CD CD CD
CD CD CD CD CD CD CD CD CD O O O O) C3
CD CD CD CD CD CD CD CD CD CD
cd CD CD CD CD CD 3 3 3 3 a a Ό)
CD 3 o 3 O 3 3 O 3 3 O 3 3 O 3 3 O I- H TJ U 3 3 CJ 3 3 3 3 D 42 < £ < a> < .P) < a>
3 3 3 3 3 TJ 3 3 3 3 Z) Z) D <
3 3 3 3 H 3 3 O O
n O O Q Z5 CJ
o H H h- o O I- Z) Z> Z) Z) Z)
FO a TJ $ TJ £ TJ £ ΙΌ 42 l— TJ a TJ $ H 42* ιΕ' H % 42 Z) o Z) o 42 ZD o 47 Z) 0 42 Z) 0
< 42 £ 42 < £ g £ < < 42 < < 42 ce 42 CÜ & co 42 CÜ 42 CD 42
< C3 S5 < < .CD < < < < < < < <
a> < < < 43 a> < a> & & ,07 g a> •s
< CD ,CD <3 < < O) < < < < <. < < <
CD H H H CD CD H CD CD CD 42 43 43 43
3 45 tj 42 TJ 42 *o 42 3 42 3 42 TJ 42 3 42 3 42 3 42 Z) ZD Σ) a 0 0 a 0 z a 0
0 52 52 52 g 52 52 g g 52 42 0 42 0
< < < < < < < < <c < co ce CO CD CO
42 42 42 42 42 42 42 42 42 42 42 42 42 42 42
< < < < < < < < < < < < < < <
ω CD CD CD CD CD CD CD CD CD CD CD CD CD CD
3 3 3 3 3 3 3 3 3 3 3 3 3 3 3
CO CO CD CD CO
CD CD CD CD CD
CO <2 c2 a
CD < < < < <
(Ü CO CD _l CD CD _! a a a a
3 3 CO CD CD CD CO CO CD CD CD z> ,Ü ZD 42 ZD £ Z) 42 Z) 42
H Ό _J CD —J CD 23 CD 3 —1 CÜ CD _J CO _J CÜ 07 _J CÜ _J CO 3 CO 3 3 ZD 42 Z) 42 Z) 42 Z) 42 Z) 42
3 3 O 3 3 3 3 3 O O O Q Q 0
U TJ 3 O O 3 3 O 3 ω 3 O 3 Ü O 3 3 a a a a a
3 3 CD ü 3 3 3 3 CO Q O O O Q Q
o CD O ω 3 CO O CO υ CÜ O CÜ O ω 3 a a 12 t3 a
3 Q ZJ 3 3 3 3 CJ 3 0 0 0 0 0
0 TJ 12 0 O 3 CD a 0 3 CD 52 CD i O 3 CD g O 3 CD 12 0 O 3 CD a 0 O 3 CD a 0 3 CD ^3 S CD <2 0 < Ξ 0 42 3 0 a a 0 a Ξ 0 a faGfUi
s 0 <ç 0 S 0 0 42 § 0 <Ç 0 <ç 0 s 0 i 0 co 0 42 0 £ 0 42 < 0 £ 0 £ 0 42 <
co CD < co co CÜ CÜ 4? < 42 42 a
co CD < CD <0 co CÜ CÜ < co
ro CD CD CD co co CO CÜ ce CD 0 0 O O O
CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD
cd CD CD CD CD CD CD CD CD CD CO 3 3 3 3
C0 CD O CO CD O CD CD O 42 0 CO CD O CO CD O CÜ CD O CO ω o CO CD O 42 O a 0 a 0 42 0 42 0 42 O
V v~ T” T“ r~ x— v-
ό CD CM CO CO CD LO v~ A cd CD LD •ti* 0
CM CM . co CD CD O V” . CM . CM . co CD O
A 10 LJ O A 10 LJ O qS A LJ o A LJ o Q o Q o ώο A Q o oS Q_S A 10 Q o A Q 0 ,D- 04 D- 05
< CD < CD < CD < CD < co < co < co < co < CD < co < CD < CO < CD < CO < CD
l rd Cf) 1 rd Cf) rd Cf) l rd C0 rd m C rd m 1 r-1 CO i rd Cf) ( rd Cf) C rd CO ( rd Cf) t rd Cf) 1 rd Cf) 1 rd en e rd en
rb en [b en r-» en rb en [b en îb en rb en r* en rb en en en CT) r* en ib en rb en
CO 00 CO 00 CO 00 00 00 co oo 00 00 00 00 00 00 00 00 CO 00 oo 00 00 oo 00 co 00 00 00 00
co LO b- CD co LO CD CO LD b- CD
CD CD CD CO co b- b- b- b- b. co 00 co co CO
b- b- b- b· b- b- b- b- b- b- b- b- b“ b- b-
•ti· ti· ti ti- ti· •ti* ti· •ti* ti· ti· ti* ti •ti* -ti •ti
O CM •ti CD co o CM •ti· CD CO o C\l ti· CD CO
CO CO CD CD CD b- b- b- b- b- co CO co CO co
b- b- b- b- b- b- b- b- b- b- b. b- b- b- b-
ti- ti* •ti ti* ti ti ti- •ti· •ti* ti· ti· •ti· ti- •ti·
279
11.13 17.69 10.93 17.42 2.20 15.02 11.36 24.99 5.64 27.01 18.28 21.02 9.51 13.34
88.93 86.32 81.03 71.65 91.55 54.36 90.79 76.80 61.90 71.84 67.91 58.75 42.01 49.54
1.98 1.79 2.59 1.39 10.1 9 2.83 1.50 1.11 4.71 6.41 rco 0.04 4.78 4.14
19.06 29.71 27.47 17.02 61.77 25.47 49.32 24.37 21.43 28.25 27.57 24.11 15.32 21.15
usAfsaGfaUfgAfgAfcacUfcUfaAfgUfgsgsu usAfsaGfaUfgAfgAfcacUfcAfaAfcUfgsgsu (Tgns)AfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu 3 ω CD ω £> O £ Z) a Z) jd Z) O co £ < Z) jo 0 Έ* cd < j/f < en 3 3 ω CD ω £> Z) a Z) a z> jj Z) o co jd < < Z) ra 'c' CD 0 'co' % cd cd CD V) Z) jd Z) a Z) a D o (0 £ JD) < a5 z> jo^ Έ? CD < 0 co % ω 3 n 3 ω CD ω JD) Z) 42 Z) a D 42 Z) Q co jd < % CD Έ* CD I— 4? 0 CO ω 3 3 ω 3) ω JD) D a ZJ a Z) JD Z> CD en £ CD < CD 0 5 42 0 en ω 3 3 ω CD ω a5 Z) JD Z) a D JD Z) Ü co £ JD) Έ* CD < a> Z) 42 0 CD £ (Λ 3 3 ω CD ω a* Z) a Z) a Z) a Σ3 CD CO JD < Έ? CD 0 5 a> Z) JO 0 co % CD 3 3 CD CD CD a> Z) a Z) a Z) JD Z) O co CD a CD < £ a Z) a 0 CO £ (Λ 3 3 CD O) CD a D a Z) a Z) a Z) O co a CD O < $ a> ZD a 0 ra £ CD 3 3 CD 3) ω a Z) a Z) a Z) a o a 3) < £ a < a Z) a 0 CO JD < (D 3 CD CD 3 CD JD Z) a ZD £ Zl a < o CO a> z a 0 £ 3) % CD CO asAfsgAfaGfaUfgAfgacAfclIfcUfuUfcsusg
CO CD a ZI a ZD 42 O a O e 2 0 42 0 42 ZD 2 O ω o 42 O to en 2 < a ZD £ ZD 42 O a O a S o S 42 0 a 2 5 0 tn O 42 O CfsasGfaAfaGfaGfUfGfuCfuCfaUfcUfuAfL96 CfsasGfaAfaGfaGfUfGfuCfuCfaUfcUfuAfL96 CfsasGfaAfaGfaGfUfGfuCfuCfaUfcUfuAfL96 CfsasGfaAfaGfaGfUfGfuCfuCfaUfcUfuAfL96 CfsasGfaAfaGfaGfUfGfuCfuCfaUfcUfuAfL96 CfsasGfaAfaGfaGfUfGfuCfuCfaUfcUfuAfL96 CO CD a Z) a Z 42 O a O o g a 0 a 0 £ 42 0 ω <0 42 O CD σ> a ZD JD Z) a Q a O 3 S 2 0 a 0 a < a 0 ω co a O CfsasGfaAfaGfaGfUfGfuCfuCfaUfcllfuAfL96 CD CD a Z a z> a O a o S 2 0 a 0 a 0 CD CO a o CfsasGfaAfaGfaGfUfGfuCfuCfaUfcUfuAfL96 to en —1 en < a ZD a ZD a o a O a g 2 0 a 0 a < a 0 ω ra a o CD CD c en H 5 ZD a O a Q o a Ξ 0 a 0 a < a 0 en ns a o
AD- 60506.1 AD- 60512.1 AD- 60518.1 AD- 60524.1 E/U AD- 60536.1 AD- 60541.1 AD- 60546.1 AD- 60551.1 AD- 60556.1 AD- 60561.1 AD- 60566.1 AD- 60570.1 AD- 60583.1 AD- 60585.1
871- 893 871- 893 871- 893 871- 893 871- 893 871- 893 871- 893 871- 893 871- 893 871- 893 871- 893 871- 893 871- 893 871- 893 871- 893
4791 4793 4795 4797 4799 4801 4803 4805 4807 4809 co ’st 4813 4815 4817 4819
4790 4792 4794 4796 4798 4800 CM O CO 4804 4806 4808 4810 4812 4814 4816 4818
280
13.20 15.63 16.94 11.36 19.39 T- 10.35 6.81 19.62 22.04 19.38 16.44 22.19 2.51
41.47 43.97 36.42 35.43 39.99 51.59 58.79 76.86 99.26 CO 00 00 60.42 110.05 71.24 104.44
1.73 5.12 0.05 0.28 8.17 6.63 2.20 14.2 5 1.66 14.8 5 21.9 3 4.86 14.5 3
14.66 20.77 13.66 13.35 15.13 19.56 23.36 i 27.78 105.2 7 28.74 22.74 86.66 22.37 43.35
asAfsgAfaGfaUfgAfgacAfclIfcUftjUfcsusg asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg asAfsgAfaGfaUfgAfgacAfcUfcUfüUfcsusg I asAfsgAfaGfaUfgAfgacAfcUfcUfijUfcsusg asAfsgAfaGfaUfgAfgacAfcUfcUfiiUfcsusg □) cd Σ3 cd jj ZD £ £ ZD £ en £ JJ) ZD 42 0 42 < cd 42 < ω en asAfsgAfaGfaUfgAfgacAfcUfcUfulIfcsusg CD CD □ ω 42 ZD a ZD jj ZD 42 ? TO < JJ) ZD 42 0 42 < CD 42 < CD TO asAfsgAfaGfaUfgAfgacAfcUfcUftjUfcsusg asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg usAfs(Agn)GfaUfgAfgAfcacUfcUfuUfcUfgsgsu usAfsa(Ggn)aUfgAfgAfcacUfcUfuUfcUfgsgsu CD CD CD Z) JJ ZD a ZD jj ZD O en £ £ a Z) en 'c' CD < 0 en ω ZJ 3 □ CD CD CD a> ZD a ZD a ZD a Z) O en £ a < ai c? O) H a 0 en % CD D usAfsaGfaUf(Ggn)AfgAfcacUfcUfuUfcUfgsgsu
CO O) £ Έ? CD Ia a a O a O jo O 0 jn 0 42 < 42 0 cd TO 42 O CfsasGfaAfaGfaGfUfGfuCfuCfaUf(Cgn)UfuAfL96 CfsasGfaAfaGfaGfUfGfijCfuCfa(Tgn)cUfuAfL96 CO CD 5=! < a D £ z^ O < tpi' o £ O jj 0 2 0 42 0 42 0 ω ro 42 O CfsasGfaAfaGfaGfUfGfuCfu(Cgn)aUfcUfuAfL96 CfsasGfaAfaGfaGfUfGfuCf(Tgn)CfaUfcUfuAfL96 CfsasGfaAfaGfaGfUfGfu(Cgn)uCfaUfcUfuAfL96 <o en 2 < <2 zd 42 zd O 3 O P (S 3 CD 45 CD 45 < 45 CD ω ra 42 O CfsasGfaAfaGfaGfUf(Ggn)uCfuCfaUfcUfuAfL96 CfsasGfaAfaGfaGf(Tgn)GfuCfuCfaUfcUfuAfL96 CfsasGfaAfaGfaGfUfGfuCftjCfaUfc(Tgn)uAfL96 CO σ> ZD CD O 5 45 O >2 O 2 CD a CD 45 CD 42 0 CD TO 42 O CfsasGfaAfaGfaGflJfGfuCfuCfa(Tgn)cUfuAfL96 CD O) 2 Σ3 2 ZD* Έ CD < d 2 O 2 CD a CD 2 CD a 0 CD en a Q CfsasGfaAfaGfaGfUfGfuCfu(Cgn)aUfcUfuAfL96
AD- 60587.1 AD- 60589.1 AD- 60591.1 AD- 60592.1 AD- 60593.1 AD- 60582.1 AD- 60584.1 AD- 60586.1 AD- 60588.1 AD- 60590.1 AD- 60558.1 e/u AD- 60568.1 AD- 60572.1 AD- 60539.1
871- 893 871- 893 871- 893 871- 893 871- 893 871- 893 871- 893 871- 893 871- 893 871- 893 871- 893 871- 893 871- 893 871- 893 871- 893
4821 4823 4825 4827 4829 4831 4833 4835 4837 4839 4841 4843 4845 4847 4849
4820 4822 4824 4826 4828 4830 4832 4834 4836 4838 4840 4842 TF tf CO M- 4846 CO TF CO tF
oo CN
5.86 20.16 19.39 ïô 19.74 14.93 14.97
69.98 72.98 75.36 77.01 59.40 O cq o CD 75.75
1.18 4.62 0.45 10.3 4 5.29 3.83 0.56
25.85 29.40 33.74 27.77 20.34 20.07 24.36
D ω CD ω £p Z) £ D a Z) Z) o CO £ CD Έ* CD < Σ3 4P 0 05 % U) 3 □ ω CD ω D £ <2 ID £ Z) o 05 O < Έ* CD 0 < £3 Z) 4P 0 05 % V) 3 usAfsaGfaUfgAfg(Agn)cacUfcUfuUfcUfgsgsu :□ (Ό CD ω tS5 Z) £ Z) a Z) a Z) o 03 Έ* CD 0 < £ a 0 05 % ω 3 3 ω o> ω a Z) a Z) a Z) ZD o 'c' CD < £ a < a Z) a 0 05 a < CD Σ3 usAfsa Gfa UfgAfgAfcacUfclIfuUfcUfgsgsu usAfsaGfaUfgAfgAfcaclIfcUfuUfcUfgsgsu usAfsaGfaUfsgAfgAfcacUfcUfsuUfsclIfgsgsu usAfsaGfaUfsgAfgAfcacUfcUfsuUfscUfgsgsu
CfsasGfaAfaGfaGfUfGfuCf(Tgn)CfaUfcUfuAfL96 CfsasGfaAfaGfaGfUfGfu(Cgn)uCfaUfcUfuAfL96 CfsasGfaAfaGfaGfUfGf(Tgn)CfuCfaUfcUfuAfL96 CD CD a ZD a Z) a o a o c* CD 0 Ξ 0 a 0 a < a 0 ω 03 a o CfsasGfaAfaGfaGf(Tgn)GfuCfuCfaUfcUfuAfL96 to CB —1 « < 0 £ <2 O >2 O ,2 0 a o 45 0 45 < 45 0 w ra 42 O CfsasGfaAfaGfaGfUfGfuCfuCfaUfscUfsuAfsL96 CfsasGfaAfaGfaGfUfGfuCfuCfaUfcUfuAfsL96 CfsasGfaAfaGfaGfüfGfuCfuCfaUfscUfsuAfsL96
AD- 60544.1 AD- 60549.1 AD- 60554.1 B/U AD- 60564.1 AD- 60569.1 AD- 60573.1 AD- 60540.1 B/U
871- 893 871- 893 871- 893 871- 893 871- 893 871- 893 871- 893 871- 893 871- 893
4851 4853 4855 4857 4859 4861 4863 4865 4867
4850 4852 4854 4856 4858 4860 4862 4864 4866
282
In the in vitro screen for which the results are shown in the table above, the siRNAs that provided the greatest ALAS1 mRNA suppression (greater than 80% suppression, such that less than 20% mRNA was remaining) at 10 nM concentration included AD-60501, AD-60592, AD60591, AD-60513, AD-60507, AD-60587, AD-60519, AD-60593, AD-60583, AD-60524, AD5 60489, AD-60495, AD-60506, and AD-60582.
In the in vitro screen for which the results are shown in the table above, the siRNAs that provided the greatest ALAS1 mRNA suppression (greater than 30% suppression, such that less than 70% mRNA was remaining) at 0.1 nM concentration included AD-60592, AD-60591, AD60593, AD-60587, AD-60583, AD-60589, AD-60501, AD-60507, AD-60585, AD-60489, AD10 60513, AD-60582, AD-60519, AD-60541, AD-60570, AD-60584, AD-60569, AD-60558, AD60573, AD-60556, AD-60495, AD-60523, AD-60566, and AD-60544.
As is shown in the table below, testing of fùrther siRNAs revealed that the following duplexes provided greater than 80% suppression at 10 nM concentration: AD-60489, AD-60495, AD-60501, AD-60507, AD-60513, AD-60519, AD-60583, AD-60591, AD-60592, and AD15 60593, and the following duplexes provided greater than 30% suppression at 0.1 nM concentration: AD-60489, AD-60495, AD-60501, AD-60507, AD-60513, AD-60519, AD60583, AD-60591, AD-60592, and AD-60593.
Table 33: Sequences and in vitro screen results for AD-60489 and AD-60489 dérivative siRNAs
85? LO 18.6 8.9 19.6 7.0 7.7
< O c 50.7 63.6 45.2 48.5 51.0 51.7
QoS ω x- e 0.2 5.9 0.7 7.8 2.4 4.9
CD „ >. ° 2 < T- c 17.0 17.1 CD 14.6 14.4 14.7
Antisense (AS) Sequence (5’-3‘) 3 en CD O £ ZD a Ξ) ZD O CÜ £ £ <5> 42 0 ra £ ω o Z5 c/> CD U) e ZD £ Z) a o ZD O CD O < σ> < jD ZD 42 0 CO £ ω D Σ3 W CD ω £> 42 ZD a ZD 42 £ s <c 0 42 < 42 < « usAfsAfGfaugAfgAfcAfcucuuucugsgsu | usAfsAfGfadTg Afg AfcAfcdTcuudTcugsgsu usAfsaGfadTgAfgAfcAfcdTcuudTcugsgsu usAfsAfGfadTgAfgAfcacdTcuudTcugsgsu usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcUfgsgsu | usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu usAfsAfGfaugAfgAfcAfcucuuucugsgsu 1 usAfsAfGfadTgAfg AfcAfcdTcuudTcugsgsu usAfsaGfadTgAfgAfcAfcdTcuudTcugsgsu | usAfsAfGfadTgAfgAfcacdTcuudTcugsgsu 3 ω CD ω ZD £ ZD £ ZD £ Ξ) 42 g < < ZD 42 0 < £ ω usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu | usAfsAfGfaugAfgAfcAfcucuuucugsgsu | usAfsAfGfadTg Afg AfcAfcdTcuudTcugsgsu usAfsaGfadTgAfgAfcAfcdTcuudTcugsgsu | usAfsAfGfadTgAfgAfcacdTcuudTcugsgsu | usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcUfgsgsu usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu | usAfsAfGfaugAfgAfcAfcucuuucugsgsu
Sense Sequence (5’-3') CfsasGfaAfaGfaGfUfGfuCfuCfaUfcUfuAfL96 CfsasGfaAfaGfaGfuGfuCfuCfaucuuAfL96 CO Oî —1 < 3 3 O O 42 O ,2 O 0 £ 0 42 0 42 < 42 0 ω en 42 O CfsasGfaAfaGfaGfuGfuCfuCfaucuuAfL96 | CfsasGfaAfaGfaGfuGfuCfuCfaucuuAfL96 | CfsasGfaAfaGfaGfuGfuCfuCfaucuuAfL96 | CfsasGfaAfaGfaGfuGfuCfuCfaucuuAfL96 | CfsasgaaaGfaGfuGfuCfuCfaucuuAfL96 CD CD O D 42 O a O <5 0 a 0 42 0 ro co 00 CD ω CD 42 O CfsasgaaaGfaGfuGfuCfuCfaucuuAfL96 CD CD D 3 O Z3 42 O a O £ 0 a 0 42 0 CO CÜ CÜ CD ω CÜ 42 O | CfsasgaaaGfaGfuGfuCfuCfaucuuAfL96 | CfsasgaaaGfaGfuGfuCfuCfaucuuAfL96 CfsasgaaaGfaGfuGfuCfuCfaucuuaL96 CO CD _l CO Σ3 D O Z5 42 O a o a 0 a 0 a 0 CD CÜ CÜ CD ω CO 42 O | CfsasgaaaGfaGfuGfuCfuCfaucuuaL96 | CD σ> _j CÜ Σ3 Σ3 O Z3 a CD a o a 0 a 0 a 0 CD CÜ CÜ CD ω CÜ a O | CfsasgaaaGfaGfuGfuCfuCfaucuuaL96 | | CfsasgaaaGfaGfuGfuCfuCfaucuuaL96 | CD CD —1 CÜ D Z! O D a CD a o 0 0 a 0 CO CO CÜ CD ω CÜ ω o | csasgaaaGfaGfuGfuCfuCfaucuuaL96 | CD CD —1 CO o a o a o 0 a 0 a 0 CÜ CO CÜ CD CD CÜ CD O
Duplex Name AD- 60489.1 AD- 60495.1 AD- 60501.1 AD- 60507.1 AD- 60513.1 AD- 60519.1
Target sites of anti-sense seq on NM_000688.4 871 - 893 871 - 893 ! 871 - 893 871 - 893 I 871 - 893 | 871-893 871 - 893 871 - 893 871 - 893 871 - 893 871 - 893 871 - 893 I 871 - 893 871 - 893 871 - 893 | 871 - 893 I 871 - 893 871 - 893 871 - 893 871 - 893 871 - 893 I 871 - 893
SEQ ID NO: (antisense) 4869 4871 4873 4875 4877 4879 CO 00 4883 LO CO CO 4887 4889 4891 4893 4895 4897 4899 4901 4903 4905 4907 4909 1 4911
SEQ ID NO: (sense) 4868 4870 4872 4874 I 4876 I 4878 o CO CO 3- 4882 xfr CO CO 4886 CO CO CO 4890 4892 4894 4896 4898 4900 4902 4904 4906 4908 4910
284
6.7 9.5 16.9 xF 19.4 LO 16.9
en O xF xF O b- xF
r4 CM CD LO ό CP CD
b- xF CO CO xF LO en
eo CO O CO CN o
co xF Ô xF O CP CP
CD CO xF t- O
ld ID cd cd LO b4 cd
co V” r— T- V •f— V
P n 73 P P 33 ω CD CD «P P 33 “5 P CD 03 CD •P D “J P CD CD CD CD P P P P P P CD OJ m P
CD ω ω CD cd CD CD CD CJJ CD CD CD CD CD CD CD rn CD ω
CD CD CD (J) CJJ (J) (J) O) P P P P CD (J) co P p
CD cd ω CD ω D CD CD CD ^3 CD CD CD (D ω CD CD CD a
=3 Ο CD P CJ U) Σ3 O D ω 4=P Z Z) 42 CD CD U) P O U) P O £5) z Z tp CD CD P CJ UJ P CJ (JJ P CJ 4J Z) £ Z) a z> a Z) a a> -) Z Z Z z C3 a z ^CJ Z a> z
Ό J— H TJ 42 CD 1— 1— .H 5 CD TJ 1- 1- .p .P .P a £ tp a “3 5 a a
□ Ό TJ □ D .r1 O TJ TJ Z .r1 O D TJ TJ ~) n -) ή Z Z Z z P z Z Z
P (J p ZD o a Z P D P a Z P D o 5 P 42 42 £ 42 42 1— 1— 1— 42 a β
Η O O H . ) 33) O ω ) .H H o o Z) O Z) Z) 0 > ΤΊ TJ TJ Z ' ) T>
Ό l— I— TJ C) h- l— o TJ 1— 1— o CJ o o o o O Q Q o o
TJ 4o TJ C) a z (o 33 TJ P TJ o z 42 P £ TJ c> TJ CJ < < < < Z n Z Z Z z <r < z
< en < e> < 4- en c> < <r en o o o o CJ o O CJ O CJ C3 o
ο <£ o £ m u <r <£ TJ m O <r CJ CJ co co CD eu co en en en eu CD m CD
<Γ <r < 42 42 <r jj <· s <r •g <r £3 •g a ^CJ £ £ •g <f •g a
τρ < 4? oj <r <r <C OJ < < Π) rp < < < < <r < < < < < < <
<Γ <r < g <£ a> ,p> a> 4=/ ,03 <r <r £3 £3 42' a’ a> g s aj <£ 42> a5 a>
CD < CD CD < <r < CD <. < CD <c CD ) n Z) Z) < <. Z 3 <
Π TJ CD H TJ 42 0 H TJ 42 Ι- Ό 42 n 42 0 4=/ Z , CD CD P 42 b“ ό 42 (9 H TJ 42 3' Σ3 42 0 Z 42 CD P 42 h“ TJ 42 H TJ 42 0 b S 42 0 42 0 42 0 a 0 a5 z a 0 jjj z a 0 42' Σ) 42 0 42' 3 42 0 42' Σ) 42 0 Z a 42 0 a 0 a> z
g g s g g 0 H- a g g a § <r <r < g f § a 0
<r CD <c <c en < < eu < en <L <. <i en < 03 CD CD CD CD eu CD eu eu < OJ 03 CD
ω 42 a 4 42 42 42 42 4 42 42 42 42 42 42 42 42 42 42 42 42 42 42 42 a a 42 a
<r <r <r <r <r <r <r <r <r <r <r <r <r <r <r <r <r <r <r <r <r <r <r <r <r <· <r <r
ω ω ω cd CD CD (Λ CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD
p p lj 33 P D D U LJ LJ P 33 P P P CD CD CD CD P P P P P P CD CD P
CD CD CD CD CO CD OJ _J (D CD CD CD
-J 03 (H 03 a (D CO CD 03 _J 03 03 a
CD CD CD CD CD CD CD 03 _J CD 03 _1 CD 03 _l CO O> _J CO O> —1 CO 03 _J Ufu(Agn < a Z) o Ή a Z3 a < a D a Z) 03 t ^P Z 03 n 03 a z 03 a < a z < P a z CJ % P CD P CJ < a z o Ή' < ^P Z CJ c < a
_J _J _J CD CD co CD CO CO CD CD CD CD eu eu O CD c co £ a C3 a OJ OJ O)
CD P D CD □ D CD P P CD _I CD CD _J CD CD _1 CD CD _J CD CD _J eu 03 —1 eu P P O 33 P p P P o P P υ P P o P P CJ O Ia CD < Έ* CD 0 Z a z a Z a z a Z a Z a b- a l— a” H a
ω O O p LJ P P P P C C c r: c cz o o o 0 o Q o o o o o r Ί
3 P 33 P 33 35 33 D 35 CD CD CD CD CD CD _j ^p g a a
42 O .2 42 O P 42 O n O P O P O P O P CJ P O P H H H R H u— o a o δ 0 0 c: 0 0 0 o a 0 o a 0
CD O eu c> CD O CD C> CD O CO O CD CJ CO CJ eu C3 CD O CD o eu o *2 a 5 u2 a u2 u2 m2 a u2 a
O O O 33 P P P 33 LJ P P P D P P 0 0 0 0 0 0 0 0 0 0 0 0 g
O O C) C> O O O O ω O C3 CJ M— ]— 1— 1— 1- f-
q=i 0 ^p 0 *2 0 P CD a D CD «P 33 CD <P LJ CD .p 33 CD .p P CD a P CD .p 33 CD P P CD .P D CD •P P CD .P P 03 .p =2 0 2 0 ^2 0 d 0 =2 0 a 0 0 E 0 s 0 E 0 ^2 0 a 0 3 0
M— M— 0 0 0 0 0 0 0 0 0 0 0 0 42 42 42 a a a
0 42 0 0 42 0 0 42 0 § 0 S 0 § 0 § 0 § 0 'iz i 0 <L 0 § 0 g 0 <ç 0 S 0 £ 0 0 § 0 £ 0 0 a < 0 a < u § 0 § 0 § u a <r AfaG AfaG AfaG 0
en eu en CD CD eu eu en en en en en en en en CD CD CD CD
CD CD CD CO C0 CD CD CD CD eu CD CO eu CD CD
CD CD en CD en CD en eu eu eu eu CD en eu en (9 0 0 0 <9 (9 C9 <9 <9 C9 0 0 (9
(D CD CD CD en C JJ <jj c » eu CJ) O> en (jj ( jj OJ CD CD co CD CD CD CD ω CD CD CD CD CD
ω CD ω cd CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD en en en eu IU CD CD eu
CD CD co CD CD en en en en CD CD CD en eu en .CD a a a
ω o en O ω ω cd o CD o CD o CD o CD o CD o CD CJ CD O CD o CD o CD CJ CD CJ 0 o o o 0 o o o o o 0 0 o
v~ T- V“ T“ T“
CD CO V” CN cd 03 X—
CD . CO . 03 . σ> . σ> . co . 03
Q o A «λ LJ o A Q o A 10 Q o A 10 LJ o Q o A 10 A o
< CD < CD < CD < CD < CD < CD < CD
co en m m m m m m m Γ0 en m m m m m en en en rn m m m en en en en m
CD CB CB CB en CB CB CB CB CB CB CB (B en CB CB CB CB CB CB CB CB θ') CB CB CB CB CB
00 00 00 00 00 00 CO 00 00 00 CO 00 00 00 00 00 00 00 00 oo 00 00 00 00 00 00 00 00
vd vd vd vH v-i vd vd vH vH v-1 vd vd vi τ—1 t—1 vd rd t—1 vd vd rH v1 t—1 t—1 vi vd vd vd
r> >· >· r- h* r* r- r* r> r-
00 00 00 00 00 00 CO co 00 00 00 co 00 00 00 00 00 co 00 co 00 00 00 00 00 00 00 co
CO UO r- CD co LD r- CD CO LD 03 CO LO b- 03 en LO b~ CD en LD b·
r\l CN CN CN CN CO CO en co σι xF xF xF xF xF LD U3 LO LO LO co CD CO CD
CD CD CD CD CD 03 03 03 O) 03 03 03 03 03 03 03 03 03 03 03 03 03 OJ OJ O) 03 03 03
XF xF XF xt xF xF xF xF xF xF xF xF xF xF xF xF xF xF xF xF XF xF xF xF XF xF xF xF
CN tF CD CO o CN xF CO en O CN xF CO (TJ O CN xF CD 00 O CN xF CO CO o CN xF CO
CN CN CN CN CN σι σ> σ> G) co XF xF xF XF xF LO LD UJ U3 U) co CD CO CO
CD CD CD CD 03 03 03 O) 03 03 03 03 O) 03 03 03 03 03 03 03 Ü3 03 O) O) O) 03 OJ OJ
xF xF XF xF xF xF xF xF xF xF XF XF xF xF xF xF xF XF xF xF XF xF xF XF xF xF XF xF
285
11.4
St
LO
CO
r—
st
St
en
x~
3 3 3
3 3 C/3 O> 3 3 3 tn 3 ω
CD ω ω 03 C/3 CD
O CD C/3 U) CD 03 C/3 03 C/3
C/3 CD C/3 ω ω CD C/3 03
CD CD 03
D r? X) E E Z) E Z) z> Z) ZD ZD E ZD -J £
42 42 q4 q=> E £ E
D Z) 3 zd ZZ) ZD Z) D 3 Z) 3
3 h- 3 H h“ 42 3 h- 3 3 l- h“ 3 1- ΙΌ
tj TJ , U —} —J VJ TJ TJ T3 o
(O 44 44 44 ,o ,O ,o 44
“) ”) _J < < “) “) ~) —J Q
C) (3 O O e) C) C5 C) en
m m CU CD en en en en Q
CD o o
< <c < £ < < <★= < < < <. 03
Λ? 42* E3 E3 U) E3 E3 4=- E3 4=-'
< < <C CD ZD ZD < < < <C < CD
44’ ,03 ¢= E CO 44’ 42’ 42’ E ,05
o Z) ZD CD ώ ZD ZD Z) ZD Z) Z CU
4“ CD 45 cd g E <r E <r 45 CD 45 CD 45 CD S 45 CD ¢= 0
ffi en < CD CT) en en en < en <r
4ü 42 E E E E E E E E E
<r <r <· <r <r <· <r <r <r <r <r
ω C/3 U) C/3 ω ω C/3 CO ω ω CD
3 3 3 en ω ZD ZD 3 3 3 3
CO CD
03
CO CD _J 03
CO CO 03 _J
03 _J 05 C/3
1 03 CO <O _l <u
CD oj % 3 —1 O) E <r 03 £ 03 05 < 3 ω % 3 3 E “> <. 3 C/3 3
< 42 3 ω a a ,p a n ω 3 o O C/3
3 ZD 23 “) c> C>
(3 C3 C3 u C/3 C/3 ZD ZD
3) ) 73 “) ) “) C/3 C/3
c c C c c
υ> U) U) £_ c C C- CD 03
H H H CD CD CD U) U) u> <r <r
45 45 45 < < <L <. E* 42
O c ) ( > o O f 1 ( ) C ) C) O O
^3 £ 3 ^3 ^3 2 ^3 2 (3 q4
(5 c: o Q C) o C) o C) C) C)
.H .H q4 .5 q4 42 u4 q4 u4 q4
cd cd Cl) 0 CD ΓΠ Cl) CD CD CD CD
1- M— 1- H 1— 1— H
g E E 2 s 2 E E E E [C3
CD (·) <) (D (D (D CD (D (D CD CD
.s 45 E 45 E E 45 45 E E 45
CD CD C) CD CD CD CD CD CD CD CD
45 »ro 45 E 45 .P »<° E 45 45 45
<r < <r <r <r < < < < < <
42 CU E E ,CD E E en E £ E
CD c'd CD CD CD CD CD CD CD CD CD
ω (Λ C/3 ω ω ω ω ω ω C/3 C/3
CU (Π W en en en en en en en eu
.ω 42 E E ,co E E E E E E
ο ο o O o o o O o o o
t-
CN
. 03
A 10 LJ o
< <o
m m m CO en m CO m m m m
CD m CD CD CD CD CD CD CD CD CD
00 00 00 00 00 00 00 00 00 00 00
vH vH t—1 τ—1 rH τ—1 v1 vH r*H t—i vH
r* r* b> r-. r-« r- >·
00 00 CO 00 00 00 00 00 00 CO 00
m CO LO b. O) en ir> b- 03
CO r» b- b- b. b- CO σι o CO CO
03 03 03 03 03 03 03 03 03 03 03
st st st St st sfr sfr st st st St
en O CN st CO CO O ΓΝ St CO CO
CO b· b- b. b- co στ σ) aj CO
03 03 03 03 03 03 03 03 03 03 03
st St st st sfr Sfr St st St st st
286
Table 34: Further sequences of AD-60489 dérivative siRNAs
SEQ ID NO: (sense) SEQ ID NO: (antisense) Target sites of antisense sequence on NM_000688.4 Duplex Name Sense Sequence (5'-3’) Antisense Sequence (5’-3’)
4990 4991 871-893 AD60489 CfsasGfaAfaGfaGfUfGfuCfuCfaUfcUfuAfL96 usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu
4992 4993 871-893 AD60501.1 CfsasGfaAfaGfaGfuGfuCfuCfaucuuAfL96 usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcUfgsgsu
4994 4995 871-893 AD- 60900.1 CfsasGfaAfaGfaGfuGfuCfuCfaucuuAfL96 usAfsAfGfadT gAfg AfcAfcdT cuudTcugsgsu
4996 4997 871 - 893 AD- 60519.1 csasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsAfGfaUfgAfgAfcAfcUfcüfulIfcUfgsgsu
4998 4999 871-893 AD60905.1 csasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsAfGfadTgAfgAfcAfcdT cuudT cugsgsu
5000 5001 871 - 893 AD60901.1 csasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu
5002 5003 871 - 893 AD- 60495.2 csasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu
5004 5005 871-893 AD60935.1 CfsasGfaAfaGfaGfUfGfuCfuCfaUfcUfuAfL96 usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcUfgsgsu
Table 35: Further sequences and IC50s of AD-60489 and AD-60489 dérivative siRNAs
O 'xF CD co to CD M* CD CD CD rtF CD CO
CJ LO O LO co CO CN CN rtfr CD CO rtF CN
LO O O CN O t— o O O O CÜ O CN CO o O CN O O
ô O O c O ό O O O c O 0 v~ ό O c Ô Ô O
3 3 3 3
3 ω 3 CD CD CD 3 CD 3 CD 3 CD CD CD 3 CD CD 3 CD 3 CD CD CD 3 CD 3 CD 3 CD CO CD
CD CD CD CD 4? 3 CD CD CD CD CD 4? CD CD 3 CD CD CD CD CD -P CD CD 3 CD CD CD CD .P
aj Z) g z> Z) a CD CD 3 CJ CD 3 CJ CD 3 CJ Z) a aj Z) CD CD 3 O CD 3 O CD 3 O ZD a g ZD CD CD eug CD 3 CJ D ,p
.H H Z) CD H 1— Z) a CD TJ 1— F- ZD g CD H H ZD
co 1 to Φ o Z) g ZD a g Z) CJ 3 3 3 TJ 3 3 TJ 3 3 a Z) 5 g O 3 3 3 3 3 TJ 3 3 g ZD ZD a CJ 3 TJ 3 3 TJ 3 3 a Z)
Z) a zd Z) a Z) g 3 O 3 1tj a O 1— TJ g CJ 1— •g g Z) a Z) g “) 3 CJ 3 F— TJ a O H TJ a CJ 1— TJ CJ g Z) g ZD a ZD 3 CJ 3 O H TJ .CJ cdfc fcUfc
e ω 3 CF ω ω o CD g < o CO a < s < £ $ < £ £ CD < £ g < CO g < £ CD < 45 < <2> < o co g < £ <c < m < £ £ CD < % g < CÜ % g < CD < a < £ o Cü a < £ 45 < <r jAfgAfcAf gAfgAfca < £ <
co g CD H J— a* CD CD H H .CD CD 1—
< Σ3 45 ω ZD a 0 Z) a 3 a 40 hTJ a 0 TJ a zd a ZD a 0 3 a TJ a h“ TJ a 0 Æ a DD a 0 3 a GfadI TJ a faU
Φ cd g s a g g g g g s 2
Φ ω CO CÜ < <r < CÜ < < CO < <c CD < < CÜ < CO < <
a a 45 45 45 45 a ,CD 45 45 & a 45 a a a 45 45
<r <r <' <r <r <r <r <r <r < < < <r <r <r <r <r <r <
C CD CD CD CD CD CD CD CD CD CD (D CD ω CD CD CD CD CD CD
< 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3
CO CD a CO CO CD CD CO CD
< g CD a CD a CD CD CD a CD a CD CD CO CD CD CD CO CD CO CD CO CD CD CD CD CD CD CD CD
•s < < < < < < a a a a a a —I _J CD _J _!
a <· < < <r <r CÜ Cü CO CÜ CO —J
3 3 3 3 3 3 3 3 3 3 3 CO
a O g 3 a 3 a 3 a 3 a 3 a 3 a 3 O 3 3 O 3 3 ω 3 3 ω 3 3 o 3 3 O 3 3 O 3 3 CJ 3 3 CJ 3 non non 3 3 CJ
0 ci ω o o u 45 a ,C0 45 45 45 a ,C0 45 45 45 3
Q a a a 0 o o O O 0 0 o O O CJ a o
g 0 o 0 o u 0 5 qP .p qP qP 45 .p .p .P .P Æ
co 1 g a a ,3 a a g 0 (i Ci CD CD 0 o 0 O CD (D a o
0 0 0 u 0 0 .P .H •y qP •H .H mP mP 2
LO a qP 4=1 <5 <5 >2 a CD 0 C) w 0 O 0 C1) 0 0 CP S
0) 0 0 O 0 0 0 o >2 g g g a 5 S g <2 -2
o 45 45 a 45 a 45 45 CP w 0 0 l‘J W CP 0 0 CP CP a 0
c 0 0 0 0 s 0 U a a 45 a .R a 45 45 45
3 45 45 a 45 45 a 45 0 CP cü CP CJ 0 0 C'J CJ CJ 0 0
σ < < < < < < < CÜ CÜ co CÜ Cü CO co CÜ CÜ CÜ CO
φ CÜ CÜ CÜ CÜ co co CÜ CÜ Cü CÜ CÜ CÜ co CÜ
ω CÜ CÜ CÜ Cü co Cü CÜ CÜ CÜ Cü co
0 0 0 0 0 0 0 CD CD CD CD CD CD CD CD CD CD CD CÜ
CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD
CO C0 CO C0 CO CÜ Cü CO C0 CÜ CO CÜ CÜ CÜ Cü Cü CO CO CD
φ 45 45 a a 45 a a 45 45 a 45 45 45 45 a 45 45 a CÜ
ω O Q 0 ω U 0 (J 0 0 0 0 O 0 0 O Q 0 O CJ
CO CN CN T“ T- T- CN V“ T— CN T- V V
Q *Φ Q. E CD td CO Ô v~ td rU CN a a ô a co' CO CD CO CN
i 00 1 CD i O i CD i O i to t LO . o ι O t o i CD i CD t CO i v- i CD i CD t CD i Γ·- t
n rtf n rtj- n io n co ΓΊ CD n co Q co Q tO Q CD Q CD Q CO Q CO Q CO Q LO Q » Q « Q CO Q CO n
3 ¢0 Q Z o co CD <r ° **· co <s <s <s <s <s <s <s <s <s <s <s <s <s <s <s <
tes inse □88.4 co co C0 CO co co co CO co co co co co co co co co co co
CD en en en en en en en en en en en en en en en en en OD
oo 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00
S’î°o e—1 vH vH t—i vH 1 t—< vH e—1 t—1 vH vH
5- ra cr^ CÜ μ— Q }— ο ω Z >· h* h* r* r- r* r- r- >· r-
00 00 00 co 00 00 co 00 00 00 00 co 00 00 00 00 00 00 00
ô . Ozj g b- CD co to b- CD CO to b- CD co LO b- CD co
o O CN CN CN CN CN co CO CO co CO xF
mQSS o O o o o o O O o O O O o O O o O o o
to LO LO LO to LO to to LO LO LO to LO LO LO to LO to LO
_o si Qz g co CO O CN CO CO o CN tF co CO o CN rtj- CD 00 o CN
o O CN CN CN CN CN co co CO CO CO rtF
o O O O o O O O O O O O o o o O O O O
cd H Ά LO LO to LO LO LO LO LO LO LO to LO to LO to to 1O LO LO
288
0.080 CO c CO O ô 0.091 0.131 CO C CO C CO C na 4.970 CO c 0.019 0.061 CO C CD O O Ô co 0 0 0 0.025 0.022 0.031 0.010 0.006 0.011
ZJ ZD
3 zj D ZJ ZJ ZJ CD CD CD <R> ZJ ZJ ZJ CD CD CD D D 3 D D D D D
ω CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD
CD CD CD CD CD CD CD CD CD CD CJ CJ σ CJ CD
ω CD CD CD CD CD D CD CD ω CD CD CD CD CD CD CD CD
4? =) CD cd ZJ O CD ZJ Q CD ZJ O D O 42’ “) D £ CD CD CD D O CD D O Z) Z) 42 CD CD D CJ CD D CJ CD Z> CJ 42· Z) Z) 42J ZD 44 Z) 4^ 23
£ CD TJ H H TJ 42 Z) CD H H 42 Z) CD TJ 1— 1— £ 4=! a a
Z) O 3 TJ TJ ZJ “) a CJ TJ TJ Z3 a O D TJ TJ “) “) Z) “) ZD
a Q ZJ ZJ D O D ZJ D D q2 Z) D D 0 ZJ ZJ i2 t2 i2 a i2
) Z3 H O Q 1- o .H O CJ Z) ^J 2 1- 0 CJ ) ) ) ) Z)
£ O ZJ TJ ΙΌ O H TJ O TJ £ 42 “) Z) o O ZJ ΙΌ O ΙΊΟ CJ £ Z) Z) CJ O D TJ g hTJ ω Ι- ΊΟ o “) 42 “) ^CJ 4^ “) 42 ZD
ο 42 < CO < o < CO CJ < 4- < co CJ 0 0 0 0
<0 $ O < 4^ < CD O < 42 < ,p> £ CD co o <r £ < < ω < CJ < % CD co CJ <r 0 < < $ ω < CD £ 42 < CD co 42 <r co $ Afca Afca Afca
en < cp <r <Z CD < < CD < CD CD < < $ .CD < < CD $ £ < CD £ < CD § £ § £
42’ D CD ZJ 42 H TJ 42 ΙΌ 42 m l— TJ 42 lTJ 42 Z) 5· 42 CD ZJ 42 ΙΌ ΙΌ 42 t?) Z) 42 (9 5 42 CD D 42 ΙΌ 42 TJ 42 0 ΙΌ 42 42· 42 f·) 42· 42 O GfaUfg GfaUfg GfaUfg
CD % g <2 42 0 % 2 σ> s g g
co < < CO < < co < < CO < co < < < CO < CO CO CO CO CO
ω 42 42 42 42 42 42 42 .CD 42 42 42 42 42 42 42 42 42 42 42 .CD 42
<r <r < < < < <r < < < < < < < <r <r <· < < < < <
cd CO CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD ω
n ZJ ZJ D ZJ D ZJ ZJ ZJ ZJ ZJ ZJ D ZJ D ZJ 3 ZJ ZJ ZJ D D
CD CD CD CD
CD ;=L CD CD CO
CD CD CD CD CD CD c CD < < a Z) <2 ZD < <2 Z) CD
CD CD CD CD CD CD 23
CD CD CD CD CD —J _J —1 _l _J _J Z) c ZD ZD
_J _J -J _J —1 CD CD CD CD CD CD CO CO CO CO CO CO £ CD c co .0
ro zj 3 CO 3 Z3 CO ZJ ZJ CO ZJ D CO ZJ D CD —1 CO CD —1 CO CD _J CO CD —1 CO CD —J CO CD —1 CO D O D CJ D CJ D D O D D CJ Z5 D O 5 42 H 42 CD < ’c’ CD O faUl
O O O O CJ D ZJ D ZJ ZJ ZJ C c c: C C C O Q Q 0
□ ZJ ZJ ZJ D D D ZJ ZJ CD CD CD CD CD CD
45 O 42 O 42 O 42 O 42 O O D CO O ZJ CO O ZJ CO CJ D CO O ZJ CO CJ D CO H 'co* H' 'co* H 'co’ H 'co* H 's* h 'co* O 0 “o 0 0
zj ,Z5 *2 □ O CJ Q CJ CJ CJ 0 CJ ω CJ 0 CJ
O O O O O ZJ O ZJ Q ZJ Ü ZJ O D CJ ZJ CJ ZJ CJ D CJ D O D ω ZJ 0 ZJ 0 y ω 0 ω
CD CD d CD 25 ¢2 CD a CD D CD <2 D CD • P ZJ CD .P D CD a ZJ CD 42 ZJ CD <2 ZJ CD a D CD a D CD <2 D CD 42 ZJ CD <2 D CD «2 0 0 <2 0 CD d CD
(D M— (D 0 0 0 0 0 0 0 0 0 0 0 0 42 42 42 42 42
0 0 0 M— M— M— M— H— M— M— M— 0 42 0 42 0 0 en
42 42 42 42 42 i i <ç <c s= <£ <ç <r <Ç s= i <ç 42 .co .co
CD CD CD (D CD CD (') cd w tu tu ω U 0 w ω w < < < < <
co CO CO CO CO CO co co co CO co CO co co CO CO co co
en CO CO CO co co co co co co co co co co CO co co
CO CO CO CO co co co co co co co co co co CO co co 0 0 0 0 0
CJ) CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD ω CD
(Λ V) ω CD CD CD CD CD CD CD CD CD CD CD CD CD CD CO CO CO co CO
CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO 42 .ÇD 42 42 42
cd CD CD CD CD CD CD CO CD CD ω CD CD CD CD
O o CJ O O O O O O CJ O O Q CJ O O O O Q O Q O
CM T- χ— x— x- CM V“ CM x- X“ X“ x- X“ CM co CO CM χφ
cd CO LO CD O CD LO CD CM CD V- LO CD CO b4 x- CÔ x- CM CO CD
1 O i O « O t b- i CO t CD i CD > CD t CM 1 LO 1 LO 1 CD 1 CD t CD 1 h* 1 b- . co » co t CD 1 CD t CD 1 co
m η cd Q °> Q CD n co Q 00 Q 'ti· Q CO Q 03 n lo Q CO Q CO Q CO Q CO Q CO Q » Q CO Q CO Q LO Q LO Q LO O LO Q
ο CD <8 eT O **» CD <8 <8 Z< O CD <8 <8 <8 <8 <8 <8 <8 <8 <8 S4 0 CD <8 <8 <8 «tf· 0 *< Cp <8 <8 <8
en en m m en m m m m en en en en en en en en en en en en en
en en en en en en en en en en en en en en en en en en en en en en
00 00 00 co 00 co oo 00 co 00 00 00 00 00 00 00 00 00 00 00 00 00
x-H χ—I x—1 x—1 χ—1 x—1 x—1 x-1 χ—1 x—i x—1 x—1 χ—1 x~1 xH χ—1 χ—1 x-H χ—1 x~1
r* r> h* b* b» b- 1^ h* b* r- hx r* b* b* bs b* b- b- b*
00 CO 00 00 CO co 00 co 00 00 00 00 00 00 00 CO 00 00 00 00 00 00
LD b- CD co LO b- CD co LO CD co 10 b- CD co LO b-
tJ- xt LO LO LO LO LO CD CD CD CD CD r- b- b- b- b- co co CO co
O O O O o O O O O Q O 0 O 0 0 0 0 O 0 0 O 0
LO LO LO io LO LO LO LO LO LO LO LO LO LO 10 LO LD LO LO 10 LO 10
CD CO o CM CD CO O CM CD CO O Çti ’Ç}· CD CO O CM Tt co
’O* Tf LO LO LO LO 1O CD CD CD CD CD b- b- b» b- b- CO CO co co
O O o O O O O O O Q O O O O 0 O O O O 0 0 0
LO LO LO LO LO LO LO LO LO LO LO LO LO LO LO LO LO LO LO LO 10 LO
289
03 CN LO CN CO χφ CO CO r- CO CN CO CO rt- CN CN
V v~ o X“ O o o x- O X“ CO O CD O O O O
Ο O O O o O O o o Q O O O O O O O O O
ό ό ό CD o ό O ô ό ό Ô ό ό ό O O Ô ό ό
3
3 3 3 3 CD 3 3 3 CD 3 3 3 CD 3 CD
CD CD CD CD CD CD CD 33 CD CD 33 33
CD CD CD 33 33 33 33 33 33 CD 33 CD
CD CD CD 33 CD CD CD 33 CD CD 33 CD 33
a Z) a Z) a ZD a Z) Z) Q a a Z) a ZD a ZD a Z) Z) o £ E ZD a Z) a Z) a ZD O Q a ZD O o
a Z) a o a Z) a ZD 5 3 a Z) a ZD a Z) a Z) JD Z) 5 5 a Z) a Z) a ZD a Z) ZD D 3 a Z) Z) 3
a 3 H 3 1- 3 1— H 42 42 3 H 3 1- F· 1- E E 3 1- F* 3 H 1— H l—
Z) TD T3 O Z) TD Ό TD _j —J T3 Ό TD TD
£ a JD a μΧ O E a JD JD E o £ E £ MX JD
o Σ) ZD -> <r < n “) Z) <r <r “) “) “D Z) Z)
ü o o o O O o CD O O O O o o o
ro ro ra ro ra ra ra ro ro ro ro ro ro ro ra
<2 a a a £ a a .3 a O a a a a a a a μχ
<r <r < < < < < < < < < < < < < < < < <
a a a a a a a a a MX a a 33 a a a
< < <r < < Z) ZD < < < < Z) < < < < 33 < < 33
a a a E> a a a a a MX .03 a a a E> MX E MX
Z) Z) Z) ZD ZD 0 0 ZD ZD Z) Z) 0 0 Z) ZD Z) Z3 Z) Z) ra
a (0 45 CD 45 CD 45 CD |5 § a <r a (D 45 CD a 0 <s £ § a 0 a 0 E CD μχ a CD MX
ro ra ra ra < CD σ ro ra ro < 33 33 ro ro ra < ro <
a 42 42 a 42 42 a a 42 42 42 E E E s a E E a
< < <r <r < <r < <r <r <( <r < < < <£ <r <r < <r
CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD W CD
3 3 3 3 3 ra ra 3 3 3 3 ra ra 3 3 3 3 3 3
CD CD
CD CD 03
CD CD 03 —1
CD 03 .LD
CD CD _1 a 03 CD CO —J <
CO CO CD CO 03 CD CD a CD CD CD 03 a CD CD a < 3 —1 a < 03 CD £ 03 a < 03 $ < 3 % 3 3 a Z) <c 3 CD 3
σ> 03 a CD _J < 3 a < < a < a < .2 < a a Z) 3 CD 3 E a z> E ~3 a Z) D o CD 3 O o a O a
< a <. t3 < a a Z) 3 CD 3 Z) o ZD o Z) o ZD o o CD ω CD Z) Z) a a ZD a Z) a ZD ZD^ CD Z) 'cd'
Z) Z) o O c c C c £Z
o O a a 33 g a 33 33 33 c c 03 33
Z) a 5 a ZD a D a Z) a h ?ra” H a* H a F^ a* ha 33 < CD < îjx 33 < 33 < μΧ 33 < 3) < < E < E
o o C) ( ) o o 0 o o 0 0 o (J O 0 (J U U O
a ^3 ,3 E E E ^3 a 42 E a E E E E E
o Q C) () C) o O Q ω 0 0 O o o O O O O O
.2 3 a .2 42 a E a E E 42 a E E E E E E E
CD 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
h- [— H 1- 1- f— H 1- H 1- F- H
E 2 42 E E 2 E 2 E s E Ξ E a E E E E E
0 0 0 0 CD w W CD (D w CD CD CD CD 0 CD CD CD 0
a a a a a a 45 a a a E E a E E a a E E
0 0 0 0 CD CD CD CD CD CD CD CD CD CD 0 CD CD CD CD
a a .ra a a a a a a a a a a a a a a a a
< <r <r <r <r <r < <r <r <r < < < < < < < < <
a a a a a a a a a a a a E E a a E a E
0 0 CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD
CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD
ra ra ra ra ra ra ra ro ro ro ra ra ro ra ro ro ro ra ra
a a a a a a a a a a a a a a a a a a a
o o o o o o o o o o O O o o o o o o O
X- X~ X- CN v- X” CN X- X- X” V χ—
î< CN CD CD ’φ co CN co CO co CN LO 03 CO ^F 03
l LO i CO i CD i b- i CD ! N- i CO i LO i LO CD i 07 i co 1 h- i r*. « b- i C0 t LO i LO
n co Q CO Q 00 n co Q C0 Q £ Q CO Q CO Q CO Q w Q 00 Q LO Q « 0 üi ω ω Q CO 0 !22 Q CO Q 00
o «*. <o <s <s <s <s <s <g <g <s <s <s <s <s <s <§ <s <S CD CD
ro m m ro m m ro ro ro ro co ro ro ro ro ro CO ro ro
CD CD en Ch en en en en Ch œ en en en en en en en en en
00 00 00 00 co 00 00 oo co 00 co 00 00 00 00 00 oo 00 00
x—i x—1 x—1 x—i x—1 χ—i vi χ—1 xH r~4 χ—1 χ—1 χ—1 χ—1 X~i
r-. r- >> r* r* r*. r* r* r* r- r* r*
00 00 00 00 oo 00 00 00 00 00 00 00 00 OO 00 oo 00 00 00
0) CO LO CD X- co LO r- 03 co LO r- 03 v~ co LO
CO 03 CD CD 03 CD O o O o O X- X“ V X- X“ CN CN CN
o o O O O O T” x- x~ X- X“ x— X“ X“ V x-
LO LO LD LO LO LO LO LO LO LO to LO LO LO LO LO LO LO LO
CO O Ol CD CO O CN •κφ CD CO O CN CD CO O CN
CO CD CD 03 03 03 CD O O Q o x~ χ— r— χ— CN CN CN
o <3 O io O O x- V V- r— X“ T“ V“ x-
LO LO LO LO LO LO LO LO LO LO LO LO LO IO LO LO LO LO LO
290
As is shown in the table above, a number of duplexes showed efficacy in suppressing ALAS1 mRNA. The following duplexes had an IC50 of less than 0.01 nM: AD-60879, AD60859, AD-60863, AD-60854, AD-60882, AD-60874, AD-60883, AD-60875, AD-60501, AD60593, AD-60853, AD-60877, AD-60878, AD-60871, and AD-60873. The following duplexes had an IC50 of less than 0.02 nM: AD-60879, AD-60859, AD-60863, AD-60854, AD-60882, AD-60874 , AD-60883, AD-60875, AD-60501, AD-60593, AD-60853, AD-60877, AD-60878, AD-60871, AD-60873, AD-60489, AD-60592, AD-60894, AD-60489, AD-60870, AD-60862, AD-60858, AD-60592, AD-60591, AD-60872, AD-60866, AD-60905, AD-60857, AD-60513, and AD-60861. The following duplexes had an IC50 of less than 0.05 nM: AD-60879, AD60859, AD-60863, AD-60854, AD-60882, AD-60874, AD-60883, AD-60875, AD-60501, AD-60593, AD-60853, AD-60877, AD-60878, AD-60871, AD-60873, AD-60489, AD-60592, AD-60894, AD-60489, AD-60870, AD-60862, AD-60858, AD-60592, AD-60591, AD-60872, AD-60866, AD-60905, AD-60857, AD-60513, AD-60861, AD-60583.2, AD-60902.1, AD60881.1, AD-60519.2, AD-60507.2, AD-60591.3, AD-60851.1, AD-60896.1, and AD-60537.2.
Example 29: In vivo structure activity relationship studies of AD-60489
Dérivatives of the AD-60489 parent siRNA were generated and screened in vivo in rats.
In vivo screen 1 of AD-60489 dérivatives
The sequences of the siRNAs that were screened are provided in the table below.
Table 36: Sequences of ALAS1 siRNA Duplexes
SEQ. ID NO: (sens e) SEQ ID NO: (antisens θ) Target sites of antisense sequence on NM_0006 88.4 Duplex Name Sense Sequence (5'-3') Antisense Sequence (5'-3')
5126 5127 871- 893 AD- 60489 CfsasGfaAfaGfaGfUfGfuCfuCfaUfcUfuAfL96 usAfsa Gf a UfgAfgAfca cUfcUfuUfcUfgsgsu
291
5128 5129 871- 893 AD- 60501.2 CfsasGfaAfaGfaGfuGfuCfuCfaucuuAfL96 usAfsAfGfaUfgAfgAfcAfcUfcüfuUfcUfgsgsu
5130 5131 871- 893 AD- 60519.2 csasgaaaGfaGfuGfuCfuCfaucuuaL96 us AfsAf Gfa UfgAfgAf cAfcUfcUfu UfcUfgsgsu
5132 5133 871- 893 AD- 60901.1 csasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu
5134 5135 871- 893 AD- 60495.2 CfsasGfaAfaGfaGfuGfuCfuCfaucuuAfL96 usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu
5136 5137 871- 893 AD- 60900.1 CfsasGfaAfaGfaGfuGfuCfuCfaucuuAfL96 usAfsAfGfadTgAfgAfcAfcdTcuudTcugsgsu
5138 5139 871- 893 AD- 60935.1 CfsasGfaAfaGfaGf(JfGfuCfuCfaUfcUfuAfL96 usAfsAfGfaUfgAfgAfcAfcUfcUfulIfcUfgsgsu
5140 5141 871- 893 AD- 60905.1 csasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsAfGfadTgAfgAfcAfcdTcuudTcugsgsu
Rats were administered a single dose of 3 mg/kg of siRNA. At 5 days following administration of the siRNA, mRNA measurements of rat ALAS1 (rALASl) mRNA and rat GAPDH (rGAPDH) mRNA were made using bDNA assay, and tissue levels of drug (siRNA) were determined using qPCR.
As is shown in FIG. 40 (top), the siRNAs AD-60501, AD-60519, AD-60901, AD-60495, AD-60900, and AD-60935 showed improved suppression of ALAS1 mRNA compared with AD60489. The siRNAs AD-60519, AD-60901, AD-60495, and AD-60935 achieved higher liver levels than did AD-60489 (see FIG. 40, bottom). Thus, most of the duplexes that provided improved suppression of ALAS1 mRNA also achieved higher liver levels.
292
At least for the duplexes AD-60489, AD-60519, and AD-60901, efficacy correlated with liver levels of the siRNA (see FIG. 41), such that a higher level of siRNA in liver was associated with greater ALAS1 mRNA suppression.
In vivo screen 2 of AD-60489 dérivatives
The sequences of the siRNAs that were screened are provided in the table below.
Table 37: Sequences of ALAS1 siRNA Duplexes
SEQ ID NO: (sens e) SEQ ID NO: (antisens θ) Target sites of antisense sequence on NM_0006 88.4 Duplex Name Sense Sequence (5'-3 j Antisense Sequence (5'-3 j
5142 5143 871- 893 AD- 60489 CfsasGfaAfaGfaGfUfGfuCfuCfaUfcUfuAfL96 usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu
5144 5145 871- 893 AD- 60879 CfsasGfaAfaGfaGfdTGfuCfuCf(Agn)UfscUfsu AfsL96 usAfsaGfaUfgAfgAfcaclIfcdTuUfcUfgsgsu
5146 5147 871- 893 AD- 61190 CfsasGfaAfaGfaGfdTGfuCfuCf(Agn)UfscUfsu AfsL96 usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcUfgsgsu
5148 5149 871- 893 AD61191 CfsasGfaAfaGfaGfdTGfuCfuCf(Agn)UfscUfsu AfsL96 usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcUfgsgsu
5150 5151 871- 893 AD- 60877 csasgaaaGfAfGfugucuca(Tgn)cuuaL96 usAfsaGfadTgAfgAfcAfcdTcuudTcugsgsu
293
5152 5153 871- 893 AD- 61192 csasgaaaGfAfGfugucuca(Tgn)cuuaL96 usAfsaGfadTgAfgAfcAfcdTcuudTcugsgsu
5154 5155 871- 893 AD- 60865 csasgaaaGfaGfuGfuCfuCfaucuuaL96 us Afs a Gfa dT gAfgAfc Af cdT cuudTcugsgsu
5156 5157 871- 893 AD- 60861 csasgaaaGfAfGfugucuca(Tgn)cuuaL96 usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu
5158 5159 871- 893 AD- 60876 csasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsaGfadîgAfgAfcAfcdTcuudTcugsgsu
5160 5161 871- 893 AD- 61193 csasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsaGfallfgAfgAfcaclIfcdTuUfcUfgsgsu
5162 5163 871- 893 AD- 60519 csasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcUfgsgsu
Rats were administered a single dose of 2.5 mg/kg of siRNA. At 5 days following administration of the siRNA, mRNA measurements of rat ALAS1 (rALASl) mRNA and rat GAPDH (rGAPDH) mRNA were made using bDNA assay.
As is shown in FIG. 42, the siRNAs AD-60879, AD-61190, AD-61191, AD-60865, AD60861, AD-60876, AD-61193, and AD-60519 showed improved suppression of ALAS1 mRNA compared with AD-60489.
Example 30: Multidosing improves potency
To investigate the effects of administering multiple doses of siRNA, rats (n=3 per group) were administered PBS or an siRNA (AD-58632, AD-60925, AD-60419, AD-60445, AD-60892, AD-60489, AD-60519, or AD-60901) at a dose of 2.5 mg/kg twice per week for 2 weeks. The levels of rat ALAS1 (rALASl) mRNA and rat GAPDH (rGAPDH) mRNA were assessed using bDNA assay.
294
Table 38: Sequences of ALAS1 siRNA Duplexes
SEQ. ID NO: (sens θ) SEQ ID NO: (antisens e) Target sites of antisense sequence on NM_0006 88.4 Duplex Name Sense Sequence (5'-3') Antisense Sequence (5'-3')
5164 5165 873- 895 AD- 58632 GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfuUfL96 asAfsgAfaGfallfgAfgacAfcUfcUfuUfcsusg
5166 5167 873- 895 AD- 60925 GfsasAfaGfAfGfuGfucucauc(Tgn)ucuuL96 asAfsGfAfaGfallfgAfgAfcAfcUfcUfuUfcsusg
5168 5169 873- 895 AD- 60419 GfsasAfaGfAfGfuGfdTcucaucuucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg
5170 5171 873- 895 AD- 60445 GfsasAfaGfAfGfuGfucucauc(Tgn)ucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg
5172 5173 873- 895 AD- 60892 gsasaagaGfuGfuCfucaucuucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg
5174 5175 871- 893 AD- 60489 CfsasGfaAfaGfaGfUfGfuCfuCfaUfcUfuAfL96 usAfsaGfallfgAfgAfcacUfcUfuUfcUfgsgsu
5176 5177 871- 893 AD- 60519.2 csasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsAfGfaUfgAfgAfcAfcUfclIfuUfcUfgsgsu
5178 5179 871- 893 AD- 60901.1 csasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu
295
As is shown in FIG. 43, the AD-58632 dérivative siRNAs AD-60892, AD-60419, AD60445, and AD-60925 showed improved suppression of ALAS1 mRNA compared with the parent AD-58632. In addition, the AD-60489 dérivative siRNAs AD-60519 and AD-60901 showed improved suppression of ALAS1 mRNA compared with the parent AD-60489.
Example 31: Multidosing studies with AD-60519 and AD-60489
The therapeutic efficacy of AD-60519 was investigated in a rat AIP model. The experimental design is shown in FIG. 44 (top). Rats were treated with PBS or ALASl-GalNAc siRNA at either 2.5 mg/kg or 5 mg/kg two times per week for three weeks. Phénobarbital (Phenobarb) and a PBGD siRNA in an AF11 LNP formulation was administered at the times indicated in FIG. 44. A control group received PBS and the PBGD siRNA only, without Phénobarbital induction. Urine was collected at days 18-19 of the study.
The results are shown in FIG. 44 (bottom). Administering phénobarbital and PBS induced ALAS1 mRNA expression and increased levels of PBG and ALA in urine (see FIG. 44), compared with PBS only. Treatment with a total of six doses of 2.5 or 5 mg/kg of AD-60519 twice per week suppressed the phénobarbital induced increases in urine PBG and urine ALA (FIG. 44). These results demonstrate that AD-60519 is effective in suppressing ALA and PBG when repeated doses as low as 2.5 mg/kg are administered. In particular, AD-60519 was effective in reducing increases in urine levels of PBG and ALA associated with acute attacks in the rat AIP model.
In further studies using the same experimental design but in a mouse model (see schematic at top of FIG. 44), the therapeutic efficacy of AD-60519 and AD-60489 in suppressing phénobarbital induced increases in sérum PBG and ALA was investigated. In the PBS (“Saline”) control group, administration of phénobarbital increased levels of PBG and ALA in sérum (see FIG. 45), compared with PBS only. Treatment with a total of six doses of 2.5 or 5 mg/kg of AD-60519 or AD-60489 twice per week suppressed the phénobarbital induced increases in sérum PBG and sérum ALA (FIG. 44). These results demonstrate that both AD60519 and AD-60489 are effective in suppressing ALA and PBG when repeated doses as low as
2.5 mg/kg are administered. In particular, AD-60519 and AD-60489 were effective in reducing increases in sérum PBG and ALA associated with acute attacks.
Because treatments in this example were administered prior to the phénobarbital induction, these results indicate that AD-60519 and AD-60489 hâve prophylactic effects.
Example 32: Further siRNA sequences
The following AD-58632 dérivative (Table 39) and AD-60489 dérivative (Table 40) siRNA sequences hâve also been generated.
Table 39: AD-58632 dérivative sequences
SEQ ID NO: (sens θ) SEQ ID NO: (antisens θ) Target sites of antisense sequence on NM 0006 88.4 Duplex Name Sense Sequence (5’-3') Antisense Sequence (5'-3')
5180 5181 873- 895 AD60802 GfsasAfaGfAfGfuGfucucauc(Tgn)ucuuL96 asAfsgAfaGfaugAfgAfcAfcucuuucsusg
5182 5183 873- 895 AD60824 GfsasAfaGfAfGfuGfucucauc(Tgn)ucuuL96 asAfsgAfaGfaugAfgacAfcucuuucsusg
5184 5185 873- 895 GfsasAfaGfAfGfuGfucucauc(Tgn)ucuuL96 asAfsgAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg
5186 5187 873- 895 AD60843 GfsasAfaGfAfGftjGfdTcucaucuucuuL96 asAfsgAfaGfaugAfgAfcAfcucuuucsusg
5188 5189 873- 895 AD60847 GfsasAfaGfAfGfuGfdTcucaucuucuuL96 asAfsgAfaGfaugAfgacAfcucuuucsusg
5190 5191 873- 895 GfsasAfaGfAfGfuGfdTcucaucuucuuL96 asAfsgAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg
5192 5193 873- 895 AD60819 GfsasAfaGfaGfuGfuCfuCfaucuuCfuuL96 asAfsgAfaGfaugAfgAfcAfcucuuucsusg
5194 5195 873- 895 AD60823 GfsasAfaGfaGfuGfuCfuCfaucuuCfuuL96 asAfsgAfaGfaugAfgacAfcucuuucsusg
5196 5197 873- 895 GfsasAfaGfaGfuGfuCfuCfaucuuCfuuL96 asAfsgAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg
5198 5199 873- 895 GfsasAfaGfaGfuGfdTCfuCfaUfc(Tgn)uCfuUf L96 asAfsgAfaGfaugAfgAfcAfcucuuucsusg
5200 5201 873- 895 GfsasAfaGfaGfuGfdTCfuCfaUfc(Tgn)uCfuUf L96 asAfsgAfaGfaugAfgacAfcucuuucsusg
5202 5203 873- 895 GfsasAfaGfaGfuGfdTCfuCfaUfc(Tgn)uCfullf L96 asAfsgAfaGfaUfgAfgAfcAfcUfcUfulIfcsusg
5204 5205 873- AD- gsasaagaGfijGfuCfucaucuucuuL96 asAfsgAfaGfaugAfgAfcAfcucuuucsusg
297
895 60853
5206 5207 873- 895 AD60839 gsasaagaGfuGfuCfucaucuucuuL96 asAfsgAfaGfaugAfgacAfcucuuucsusg
5208 5209 873- 895 gsasaagaGfuGfuCfucaucuucuuL96 asAfsgAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg
5210 5211 873- 895 gsasaagaGfuGfdTCfucaucuucuuL96 asAfsgAfaGfaugAfgAfcAfcucuuucsusg
5212 5213 873- 895 gsasaagaGfuGfdTCfucaucuucuuL96 asAfsgAfaGfaugAfgacAfcucuuucsusg
5214 5215 873- 895 gsasaagaGfuGfdTCfucaucuucuuL96 asAfsgAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg
Table 40: AD-60489 dérivative sequences
SEQ ID NO: (sens θ) SEQ ID NO: (antisens e) Target sites of antisense sequence on NM 0006 88.4 Duplex Name Sense Sequence (5’-3’) Antisense Sequence (5’-3’)
5216 5217 871- 893 CfsasGfaAfaGfaGfdTGfuCfijCf(Agn)UfscUfs uAfsL96 usAfsaGfadTgAfgAfcAfcdTcuudTcugsgsu
5218 5219 871- 893 AD60879 CfsasGfaAfaGfaGfdTGfuCfuCf(Agn)UfscUfs uAfsL96 usAfsaGfallfgAfgAfcaclIfcdTuUfcUfgsgsu
5220 5221 871- 893 CfsasGfaAfaGfaGfdTGfuCfuCf(Agn)UfscUfs uAfsL96 usAfsAfGfaUfgAfgAfcAfcUfclIfuUfcUfgsgsu
5222 5223 871- 893 CfsasGfaAfaGfaGfdTGfuCfuCf(Agn)UfscUfs uAfsL96 usAfsaGfaUfgAfgAfcacUfcUfulIfcUfgsgsu
5224 5225 871- 893 AD60877 csasgaaaGfAfGfugucuca(Tgn)cuuaL96 usAfsaGfadT gAfgAfcAfcdT cuudT cugsgsu
5226 5227 871- 893 csasgaaaGfAfGfugucuca(Tgn)cuuaL96 usAfsaGfaUfgAfgAfcacUfcdTuUfclIfgsgsu
5228 5229 871- 893 AD60865 csasgaaaGfAfGfugucuca(Tgn)cuuaL96 usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcUfgsgsu
5230 5231 871- 893 AD60861 csasgaaaGfAfGfugucuca(Tgn)cuuaL96 usAfsaGfaUfgAfgAfcacUfclIfuUfcUfgsgsu
5232 5233 871- 893 AD60876 csasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsaGfadTgAfgAfcAfcdTcuudTcugsgsu
5234 5235 871- 893 csasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsaGfaUfgAfgAfcacUfcdTuUfcUfgsgsu
5236 5237 871- 893 AD60519 csasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsAfGfaUfgAfgAfcAfclIfcUfuUfcUfgsgsu
298
Example 33: Further multidose studies with AD-60519
The therapeutic efficacy of AD-60519 was investigated in a rat AIP model like that used in Example 31. The experimental design is shown in FIG. 46 (top). Rats were treated with PBS or ALASl-GalNAc siRNA at 3 mg/kg, 1 mg/kg, or 0.3 mg/kg once per week for four weeks (treatment on day 0, day 7, day 14, and day 21). Phénobarbital (Phenobarb) and a PBGD siRNA in an AF11 LNP formulation were administered at the times indicated in FIG. 46. A control group received PBS and the PBGD siRNA only, without phénobarbital induction. Urine was collected at day 25 ofthe study.
The results are shown in FIG. 46 (bottom) and in FIG. 47. Administering phénobarbital and PBS induced ALAS1 mRNA expression and increased levels of PBG and ALA in urine, compared with PBS only. Treatment with a total of four doses of 3 mg/kg, 1 mg/kg, or 0.3 mg/kg of AD-60519 once per week suppressed phénobarbital induced increases in levels of rat ALAS1 mRNA in liver in a dose-dependent manner (see FIG. 46). (The levels of rat liver ALAS1 (rALASl) mRNA are expressed relative to the levels of rat GAPDH mRNA.) The levels of urine PBG and urine ALA also showed dose-dependent treatment effects.
Repeated weekly doses of AD-60519 were effective in suppressing ALAS1 mRNA expression and in reducing elevated levels of ALA and PBG associated with induced acute attacks in a rat AIP model. These treatment effects were dose dépendent. These results illustrate that AD-60519 can act prophylactically when dosed prior to an attack.
Example 34: Multidose effects of ALAS1 siRNA GalNAc conjugales in non-human primates
The effects of ALAS1 siRNA GalNAc conjugates in suppressing liver ALAS1 mRNA and circulating ALAS1 mRNA was investigated in a non-human primate (NHP) study. The GalNAc conjugates AD-58632, AD-60519, AD-61193, and AD-60819 were employed. The study design is shown in Table 41 and in FIG. 48.
299
Table 41: NHP study design
Test Article Group # N Dose Level (mg/kg) Dose Cône (mg/mL) Dose Frequency Dose Days Dose Volume (mL/kg) Dose Route
AD-58632 1 3 2.5 1.25 QDx5 WK1, BIW WK2-4 1,2,3,4, 5, 8,11, 15,18, 22, 25 2 SC
AD-60519 2 3 1.25 0.625 QDx5 WK1, BIW WK2-4
3 3 2.5 1.25 QDx5 WK1, BIW WK2-4
4 3 2.5 1.25 QDx5 WK1, QWWK2-4 1,2,3,4, 5,11,18, 25
5 3 5 2.5 QDx5 WK1, QW WK2-4
AD-61193 6 3 2.5 1.25 QDx5 WK1, BIW WK2-4 1,2,3,4, 5, 8,11, 15,18, 22, 25
AD-60819 7 3 2.5 1.25 QDx5 WK1, BIW WK2-4 1,2,3,4, 5, 8,11, 15,18, 22, 25
Each group received multiple subcutaneous doses of an ALAS1 siRNA GalNAc conjugate at a dose volume of 2 mg/ml. Group 1 (n=3) received 2.5 mg/kg of 1.25 mg/ml AD5 58632 on days 1, 2, 3, 4, 5, 8, 11, 15, 18, 22, and 25. Group 2 (n=3) received 1.25 mg/kg of
0.625 mg/ml AD-60519 on 1, 2, 3, 4, 5, 8, 11, 15, 18, 22, and 25. Group 3 (n=3) received 2.5 mg/kg of 1.25 mg/ml AD-60519 on days 1, 2, 3, 4, 5, 8, 11, 15, 18, 22, and 25. Group 4 (n=3) received 2.5 mg/kg of 1.25 mg/ml AD-60519 on days 1, 2, 3, 4, 5, 11, 18, and 25. Group 5 (n=3) received 5 mg/kg of 2.5 mg/ml AD-60519 on days 1, 2, 3, 4, 5, 11, 18, and 25. Group 6 (n=3) received 2.5 mg/kg of 1.25 mg/ml AD-61193 on days 1, 2, 3, 4, 5, 8, 11, 15, 18, 22, and 25. Group 7 (n=3) received 2.5 mg/kg of 1.25 mg/ml of AD-60819 on days 1, 2, 3, 4, 5, 8, 11, 15, 18, 22, and 25.
Sérum samples for the circulating extracellular RNA détection (cERD) assay (see Example 21) were collected on days -3, 7, 13, 21, 27, 39, 46, and 60 (in FIG. 48, “PD Draws” indicates the days on which sérum was collected). Sérum was collected for a clinical chemistry panel on days -3 and 6. The clinical chemistry panel included assessment of the levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), and alkaline phosphatase (ALP).
300
ALAS1 mRNA silencing was evaluated in liver tissue obtained from a liver biopsy taken on day 21 (see FIG. 48). The biopsy was taken after a sérum draw.
Suppression of ALAS1 mRNA levels in liver
The liver ALAS 1 mRNA levels at study day 21 are shown in FIG. 49. The results are shown as a percentage of the average level observed in a control group treated with PB S. Results are shown as the average values for each treatment group.
These results presented in FIG. 49 demonstrate that compared with control animais that received PB S treatment, ail ofthe treatment conditions were effective in suppressing liver levels of ALAS1 mRNA. The treatments achieved mRNA silencing ranging from about 20% to 80% (corresponding to ALAS1 mRNA levels ranging from about 80% to 20% of control levels). Individual animais that received AD-58632 showed silencing of about 20-50%, with the average level of silencing being about 40% (ALAS1 mRNA levels were on average about 60% of control levels). With ail of the dosing schedules employed, AD-60519 was highly effective in suppressing ALAS1 mRNA levels. Individual animais that received AD-60519 showed silencing of between about 60% and 80% (ALAS1 mRNA levels were about 20% to 40% of control levels). On average, AD-60519 treatment regimens achieved silencing of between about 65% and 75%. As is disclosed herein AD-60519 is a dérivative of AD-60489. Similar results for AD-60489 are described in Example 20 and shown in FIG. 30. Furthermore, AD-61193 (a dérivative of AD-60489) and AD-60819 (a dérivative of AD-58632) also achieved silencing of more than 50%. It is noteworthy that the levels of silencing reported in this example and in Example 20 (e.g., about 20% to 80%) were achieved even in a “non-induced” state; it is anticipated that in an induced state, e.g., when levels of ALAS1 are acutely or chronically elevated (e.g., in a patient having or at risk for a poiphyria, e.g., an acute hepatic porphyria, e.g., AIP), lower levels of silencing, e.g., réduction of ALAS1 mRNA levels to normal or pre-attack levels, can suffice to achieve therapeutic efficacy.
Suppression of circulating extracellular ALAS1 mRNA levels
301
FIG. 50 shows circulating extracellular ALAS 1 mRNA levels (means and standard déviations) at each timepoint throughout the study when sérum samples were obtained. The circulating extracellular ALAS1 mRNA results demonstrate efficacy of mRNA silencing following multidose treatment with each of the siRNAs studied (AD60519, AD-61193, AD60819, and AD-58632). In ail groups, the greatest suppression effect on circulating ALAS1 mRNA was obsei-ved on day 27, following the final dose of siRNA on day 25. In ail treatment groups, during the weeks after the treatment ceased, ALAS1 mRNA levels gradually increased and retumed to baseline by the final measurement on day 60.
The most pronounced suppression of circulating ALAS1 mRNA (maximal silencing of nearly 80%) was observed in Group 3 (2.5 mg/kg AD-60519 QDx5, BIWx3) and Group 5 (5 mg/kg AD-60519, QDx5, QWx3). Group 2 (1.25 mg/kg AD-60519, QDx5, BIWx3), Group 4 (2.5 mg/kg AD-60519, QDx5, QWx3), Group 7 (2.5 mg/kg AD-60819, QDx5, BIWx3), and Group 6 (2.5 mg/kg AD-61193, QDx5, BIWx3) also showed excellent suppression, with maximal silencing (day 27) of greater than 50%. In group 1, notable silencing (more than 30% on day 27) was also achieved.
These results are consistent with the liver ALAS1 mRNA results and confirm the potent activity of AD-60519. At dose levels as low as 1.25 mg/kg, AD-60519 provided 65-75% silencing.
Corrélation between circulating and liver ALAS1 mRNA levels
FIG. 27 shows the levels of the ALAS1 mRNA in liver (left bars) and in sérum (right bars). There is a good corrélation between the relative ALAS1 mRNA levels measured in liver and in sérum, indicating that these measurements provide consistent results.
Example 35: Rat single dose study of AD-60519 and AD-60589 using a urine cERD assay to monitor the duration of ALAS1 mRNA suppression
A single dose study was conducted in rats using the ALAS1 siRNA GalNAc conjugates AD-60489 and AD-60519. The efficacy of these GalNAc conjugates in inhibiting expression of ALAS1 mRNA was monitored using assessments of urine with a circulating extracellular RNA
302 détection assay. The assay was similar to the assay used in Examples 21 and 34, except that urine samples were used. The urine samples were lyophilized to concentrate it. Lyophilized urine was resuspended in 4 ml dH2O and vortexed. Then the sample was centrifuged at 4,000xg for 10-20 minutes to pellet any débris. Remaining steps were similar to those described in Example 21.
Groups of rats were administered a single dose of 10 mg/kg of AD-60489 or AD-60519. The normalized levels of ALAS1 mRNA at various timepoints throughout the study are shown in FIG. 51. The timepoint indicated as “0 hours” is for the baseline pre-dose urine sample drawn just prior to administration of the ALAS1 mRNA. Results for subséquent timepoints are expressed as a fraction of the pre-dose level.
As can be seen from the results shown in FIG. 51, AD-60519 provided improved potency compared with AD-60489. At its maximum, the single dose of AD-60519 provided a suppression of up to about 80%, whereas the suppression provided by AD-60489 was about 60%. The effect of a single 10 mg/kg dose of these ALAS1 siRNAs in suppressing ALAS1 mRNA lasted about 21 days. These results demonstrate the validity of the urine cERD assay for monitoring ALAS1 mRNA levels.
Example 36: Pharmacological effects of AD-60519 in non-human primates
A fùrther study of the effects of the ALAS1 siRNA GalNAc conjugate AD-60519 was conducted in a non-human primates. The study investigated the effect of weeky versus biweekly dosing, use of a loading dose versus no loading dose, and the kinetics of ALAS1 mRNA silencing following a single dose. The design of the study is shown in Table 42 and in FIG. 52.
Table 42: Pharmacology Study Design for Study with AD-60519
Group # N Dose Level (mg/kg) Dose Frequency Materi al Needs (mg)* Dose Vol (mL/kg) Dose Days Dose Conc (mg/mL) Dose Route
1 3 2.5 QWx8Wks 210 0.125 1,8,15, 22,29, 36,43, 50
2 3 5 QWx8Wks 420 0.25
Load- LoadDl-D3, 12 3 1, J;
303
3 3 QDx3@5mg/ kg, maint5mg/kg QWx7Wks 525 0.25/25 8,15, 22, 29, 36,43, 50 20 SC
4 3 Load- QDx3@5mg/ kg, maint2.5mg/kg LoadDl-D3, QWx7Wks 270 0.25/0.125
5 3 5 BIWx8Wks 924 0.25 I, 4, 8, II, 15, 18,22 25,29, 32,36, 39,43, 46, 50, 53
6 3 1 Single Dose 12 0.05 1
7 3 10 Single Dose 116 0.5 1
Each group received one or more subcutaneous doses of AD-60519 as provided in Table
42. Group 1 (n=3) received 2.5 mg/kg at a dose volume of 0.125 ml/kg once per week for 8 weeks (doses were administered on dose days 1, 8, 15, 22, 29, 36, 43, and 50). Group 2 (n=3) received 5 mg/kg at a dose volume of 0.25 mg/ml once per week for 8 weeks (doses were administered on dose days 1, 8, 15, 22, 29, 36, 43, and 50). Group 3 (n=3) received a loading dose of 5 mg/kg at a dose volume of 0.25 ml/kg once per day for three days followed by a maintenance dose of 5 mg/kg at a dose volume of 0.25 ml/kg once per week for 7 weeks (doses were administered on days 1, 2, 3, 8, 15, 22, 29, 36, 43, and 50). Group 4 (n=3) received a loading dose of 5 mg/kg at a dose volume of 0.25 ml/kg once per day for three days followed by a maintenance dose of 2.5 mg/kg at a dose volume of 0.125 ml/kg once per week for 7 weeks (doses were administered on days 1, 2, 3, 8, 15, 22, 29, 36, 43, and 50). Group 5 (n=3) received 5 mg/kg at a dose volume of 0.25 ml/kg twice per week for 8 weeks (doses were administered on dose days 1, 4, 8, 11, 15, 18, 22, 25, 29, 32, 36, 39, 43, 46, 50, and 53). Group 6 (n=3) received a single dose of 1 mg/kg at a dose volume of 0.05 ml/kg on day 1. Group 7 (n=3) received a single dose of 10 mg/kg at a dose volume of 0.5 ml/kg on day 1.
Sérum samples (listed as “PD draws” in FIG 52), plasma samples (listed as “PK draws” in FIG 52) and urine samples were collected as indicated in FIG. 52 and in Table 43. The urine
304 and sérum samples were subjected to the cERD assay. Ail blood and urine samples collected on the day of a liver biopsy were collected prior to the liver biopsy.
Table 43: Sample Collection Schedule
Sérum for mRNA Détection Liver Biopsy Urine for exploratory mRNA Détection Plasma for PK
Gps 1-4 Day -3, and Days 5, 10, 17, 24,31,38, 45, 52, 57, 64, 78, 92 Groups 1-5 Day 24* Gps 1-5 Day -3, and Days 24*, 52 Gp7 Day -3, and Day 1 @ 0.25, 0.5, 1,2, 4, 8, 12 hours and Days 2,3,4, 5, 6, 8, 9, 15, 22, 29,36
Gps 5 Day -3, and Days 3, 10, 17, 24,31,38, 45, 52, 60, 67, 81, 95 Groups 6-7 Day 4*
Gps 6-7 Day -3, and Days 2, 4, 6, 9, 15, 22, 29, 36 Gps 6-7 Day-3, and Days 4*, 36
*A11 blood samples and urine were collected prior to the liver biopsy First Moming Urine collection
The liver ALAS1 mRNA results are shown in FIG. 53. Significant ALAS1 mRNA suppression was achieved in ail study conditions. Up to 75-80% ALAS1 silencing was achieved across multi-dose regimens using AD-60519. At three days after a single dose, silencing of about 15% was achieved with a single dose of 1 mg/kg, and silencing of about 70% was achieved with a single dose of 10 mg/kg (see FIG. 53). Comparison of the data from groups 1 and 7 reveals a slight différence in kinetics after a single dose (in group 7) versus multiple doses (group 1) of the same cumulative amount (30 mg administered), as assessed 3 days post-dose in group 7 and at two days after the fourth dose in group 1. In particular, greater silencing was observed after a single dose (silencing of about 70% on average in group 7 versus silencing of about 45% on average in group 1). See FIG. 54. This type of resuit was also observed in rat studies.
305
The sérum ALAS1 mRNA results through day 22 are shown in FIG. 54 (top). The corrélation between liver ALAS1 mRNA, sérum ALAS1 mRNA, and plasma ALAS1 mRNA is shown in FIG. 55. These results demonstrate a good corrélation between liver, sérum, and urine ALAS1 mRNA levels. The results also provide fuither evidence demonstrating potent activity of AD-60519. Silencing of 55-75% was observed at at ail dose levels across ail multi-dose dosing regimens. Administering loading doses (once per day for 3 days, as in groups 3 and 4) resulted in slightly more rapid down-regulation of ALAS1 mRNA. The groups that received weekly (groups 1 and 2) or biweekly doses (group 5) doses ultimately showed comparable levels of ALAS1 mRNA suppression, indicating that accumulation over time provides sustained knockdown.
Results showing the kinetics of ALAS1 mRNA silencing after a single dose are shown in FIG. 54 (bottom). In the 1 mg/kg group, an ALAS1 mRNA suppression of about 20% was obseived by day 6. In the 10 mg/kg group, there was a rapid, about 70% ALAS1 mRNA réduction by day 4, with recovery to within 20% of baseline at day 22 (21 days post-dose). Levels of sérum ALAS1 mRNA retumed to baseline after about 2 weeks or 4 weeks following a lmg/kg or lOmg/kg single dose, respectively.
The full time course of the sérum ALAS mRNA up to 8 weeks after administration of the AD-60519 is shown in FIG. 56. Ail groups reached a maximum of 80% ALAS1 mRNA suppression following 5 to 8 weeks of ALN-AS1 dosing. Groups with three daily doses in week 1 (QDx3) had a faster onset of ALAS1 mRNA suppression than those just dosed once in the first week (QWx8). Ail animais retumed to baseline ALAS1 levels, approximately 30-40 days post the last dose
Example 37: Production of an siRNA Drug Product
ALN-60519 (FIG. 57) is a chemically synthesized double stranded oligonucleotide covalently linked to a ligand containing three N-acetylgalactosamine (GalNAc) residues. Ail nucléotides are 2’-OMe or 2’-F modified and are connected through 3 ’-5’ phosphodiester linkages, thus forming the sugar-phosphate backbone of the oligonucleotide. The sense strand and the antisense strand contain 21 and 23 nucléotides, respectively. The 3’-end ofthe sense
306 strand is conjugated to the triantennary GalNAc moiety (referred to as L96) through a phosphodiester linkage. The antisense strand contains four phosphorothioate linkages - two at the 3’ end and two at the 5’ end. The sense strand contains two phosphorothioate linkages at the 5’ end. The 21 nucléotides ofthe sense strand hybridize with the complementary 21 nucléotides of the antisense strand, thus forming 21 nucléotide base pairs and a two-base overhang at the 3’end of the antisense strand. The two single strands, the sense strand and the antisense strand, were synthesized by conventional solid phase oligonucleotide synthesis, employing standard phosphoramidite chemistry with the 5’-hydroxyl group protected as dimethoxytriphenylmethyl (DMT) ether. Each strand was assembled from the 3’ to the 5’ terminus by sequential addition of protected nucleoside phosphoramidites.
AD-60519, also referred to herein as ALN-60519, was formulated as a solution for Injection for subcutaneous use, referred to herein as ALN-AS1. ALN-60519 was dissolved in water for injection (WFI) and the pH was adjusted (target 7.0). The concentration of ALN60519 was determined and adjusted by adding WFI. The solution with a final concentration of approximately 200 mg/mL was then filter sterilized and filled into 2 mL Type I glass vials. A fill volume of approximately 0.55 mL was chosen to permit complété withdrawal of 0.5 mL of drug product.
Example 38: Measurement of Sérum or Urine ALAS1 mRNA Levels in AIP Patients or Healthy Volunteers Using cERD Method
Non-human primate pharmacology studies with ALN-AS1 indicated that the circulating extracellular RNA détection (cERD) method for measuring the ALAS1 mRNA in sérum or urine was robust and reproducible. The cERD assay was also used to measure ALAS1 mRNA levels in sérum and urine from AIP patients and healthy volunteers. Sérum ALAS1 mRNA levels were generally increased in AIP patients relative to healthy volunteers, consistent with the rôle ALAS1 induction plays in disease pathophysiology (FIG. 58). Importantly, levels of ALAS1 in sérum and mine within the same patient correlated with each other. In two patients that had repeat collections of urine and sérum the ALAS1 mRNA level was consistent over time. Collectively, these data indicate that ALAS1 mRNA can be measured in sérum and urine
307 samples from human subjects including AIP patients, and the cERD method is useful for tracking the pharmacodynamie activity of ALN-AS1.
Example 39: Exemplary Clinical Studies
A human study can be conducted to détermine the safety and tolerability of ALN-AS1 when administered as a single dose and multiple doses to AIP patients that are asymptomatic high excreters (ASHE) (patients who hâve elevated levels of ALA and/or PBG, as described herein) or AIP patients who hâve récurrent attacks.
Secondary objectives include the characterization of plasma and urine PK for ALN-AS1 as well as post-dose assessment of the impact of ALN-AS1 on both plasma and urinary ALA and PBG levels. The cERD assay that measures mRNA in exosomes is used to measure sérum (or plasma) and urinary 5-aminolevulinate synthase (ALAS-1 mRNA).
In the asymptomatic high excreters, ALN-AS1 is administered at single doses, e.g., at 0.1, 0.35 1.0, or 2.5 mg/kg, or in repeated weekly doses, e.g., of 1 and 2.5 mg/kg, for several weeks (e.g., for 4 weeks). As a comparison, a control (e.g., placebo) treatment is administered. The safety, pharmacokinetics and effects of the drug on ALA and PBG levels is assessed. A dose of ALN-AS1 that lowers ALA and PBG to within the normal reference range (e.g., a dose that normalizes ALA and/or PBG to levels below 2x the upper reference value ) can be selected for subséquent studies, e.g., in AIP patients.
In the AIP patients, the attack rate and baseline symptoms are assessed during a predosing run-in period (e.g., of 12 weeks). Patients are administered ALN-AS1, e.g., at a dose of
1-2.5 mg/kg weekly.The safety, pharmacokinetics and effects of the drug on ALA and PBG levels are assessed. In addition, changes in attack number, heme use, pain médication use, and hospitalization are monitored.
Equivalents
Those skilled in the art will recognize, or be able to ascertain using no more than routine expérimentation, many équivalents to the spécifie embodiments ofthe invention described herein. Such équivalents are intended to be encompassed by the following claims.

Claims (58)

1. A double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1, wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a région of complementarity to an ALAS1 RNA transcript (e.g., SEQ ID NO:1), which antisense strand comprises at least 20 contiguous nucléotides from the antisense sequence of UAAGAUGAGACACUCUUUCUGGU (SEQ ID NO: 4153) or UAAGAUGAGACACUCTUUCUGGU (SEQ ID NO: 4154).
2. A double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1, wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a région of complementarity to an ALAS1 RNA transcript (e.g., SEQ ID NO:1), which antisense strand comprises at least 20 contiguous nucléotides from (i) an antisense sequence listed in any one of Tables 21 to 40, or (ii) an unmodifïed version of an antisense sequence listed in any one of Tables 21 to 40 (SEQ ID NOs: 4172 to 5237).
3. The dsRNA of claim 2, wherein said dsRNA comprises at least one modified nucléotide.
4. The dsRNA of any one of the preceding claims, wherein the duplex région is 17-23 nucléotide pairs in length.
5. The dsRNA of any one of the preceding claims, wherein at least one strand comprises a 3’ overhang of at least 2 nucléotides.
6. The dsRNA of any one of the preceding claims, wherein each strand is no more than 26 nucléotides in length.
7. The dsRNA of claim 3, wherein at least one modified nucléotide is chosen from a 2'-O
309 methyl, a 2'-fluoro modified nucléotide, and optionally one or more 5’-phosphorothioate groups, or any combination thereof.
8. The dsRNA of any one of the preceding claims, further comprising a ligand, optionally
5 wherein the ligand is conjugated to the 3 ’ end of the sense strand of the dsRNA.
9. The dsRNA of claim 8, wherein the ligand comprises a carbohydrate, optionally wherein the ligand is a GalNAc ligand.
10 10. The dsRNA of claim 9, wherein the ligand is
11. The dsRNA of any one of claims 8-10, wherein the ligand is attached via a bivalent or
15 trivalent branched linker.
310
12. The dsRNA of claim 11, wherein the ligand and linker are as shown in Formula XXIV:
13. The dsRNA of claim 8, wherein the dsRNA is conjugated to ligand L96 via a linker as
5 shown below
Site of
Conjugation
14. The dsRNA of any one of claims 8 to 13, wherein the ligand targets the dsRNA to hépatocytes.
15. The dsRNA of any one of the preceding claims, wherein the dsRNA comprises a sense strand consisting of a sense sequence selected from the sense sequences listed in Tables 21 to 40, and an antisense strand consisting of an antisense sequence selected from the antisense sequences listed in Tables 21 to 40.
16. The dsRNA of any one of the preceding claims, wherein the dsRNA has an IC50 of less than
1 nM, less than 0.05 nM, less than 0.02 nM, or less than 0.01 nM.
311
17. The dsRNA of any one of the preceding claims, wherein the dsRNA has a single dose ED50 of less than about 10 mg/kg or less than about 5 mg/kg.
18. The dsRNA of any one of the preceding claims, wherein the dsRNA shows improved activity compared with AD-58632 or AD-60489, optionally wherein the dsRNA is selected from the dsRNAs listed in Tables 21 to 40.
19. The dsRNA of any one of the preceding claims, wherein the sense strand comprises or consists ofthe sequence of CAGAAAGAGUGUCUCAUCUUA (SEQ ID NO: 4155).
20. The dsRNA of claim 1 or 2, wherein:
(i) the antisense strand comprises the antisense sequence of AD-60519, wherein the antisense sequence comprises ail of the modified nucléotides of AD-60519;
(ii) the antisense strand consists of the antisense sequence of AD-60519, wherein the antisense sequence comprises ail of the modified nucléotides of AD-60519;
(iii) the sense strand comprises the sense sequence of AD-60519, wherein the sense sequence comprises ail of the modified nucléotides of AD-60519;
(iv) the sense strand consists of the sense sequence of AD-60519, wherein the sense sequence comprises ail of the modified nucléotides of AD-60519;
(v) the sense strand comprises the sense sequence of AD-60519, and the antisense strand comprises the antisense sequence of AD-60519, wherein the sense and antisense sequences comprise ail of the modified nucléotides of AD-60519, or (vi) the sense strand consists of the sense sequence of AD-60519, and the antisense strand consists ofthe antisense sequence of AD-60519, wherein the sense and antisense sequences comprise ail of the modified nucléotides of AD-60519.
312
21. The dsRNA of claim 1 or 2, wherein:
(i) the antisense strand comprises the antisense sequence of AD-60489, and/or the sense strand comprises the sense sequence of AD-60489, wherein the antisense and/or sense sequence comprises ail of the modified nucléotides of AD-60489, or (ii) the antisense strand consists of the antisense sequence of AD-60489, and/or the sense strand consists of the sense sequence of AD-60489, wherein the antisense and/or sense sequence comprises ail of the modified nucléotides of AD-60489.
22. The dsRNA of claim 1 or 2, wherein:
(i) the antisense strand comprises the antisense sequence of AD-61193, and/or the sense strand comprises the sense sequence of AD-61193, wherein the antisense and/or sense sequence comprises ail of the modified nucléotides of AD-61193, or (ii) the antisense strand consists of the antisense sequence of AD-61193, and/or the sense strand consists of the sense sequence of AD-61193, wherein the antisense and/or sense sequence comprises ail of the modified nucléotides of AD-61193.
23. The dsRNA of claim 2, wherein:
(i) the antisense strand comprises the antisense sequence of AD-60819, and/or the sense strand comprises the sense sequence of AD-60819, wherein the antisense and/or sense sequence comprises ail of the modified nucléotides of AD-60819, or (ii) the antisense strand consists of the antisense sequence of AD-60819, and/or the sense strand consists of the sense sequence of AD-60819, wherein the antisense and/or sense sequence comprises ail of the modified nucléotides of AD-60819.
24. A vector encoding at least one strand of a dsRNA of any one of claims 1 to 23.
25. A cell comprising the dsRNA of any one of claims 1 to 23 or the vector of claim 24.
313
26. A pharmaceutical composition for inhibiting expression of an ALAS1 gene, the composition comprising the dsRNA of any one of claims 1 to 23.
27. The pharmaceutical composition of claim 26, wherein dsRNA is administered in an unbuffered saline or water solution.
28. The pharmaceutical composition of claim 26 or 27, wherein said composition is suitable for subcutaneous administration.
29. A method of inhibiting ALAS1 expression in a cell, the method comprising:
(a) introducing into the cell the dsRNA of any one of claims 1 to 23, and (b) maintaining the cell of step (a) for a time sufficient to obtain dégradation of the mRNA transcript of an ALAS1 gene, thereby inhibiting expression of the ALAS1 gene in the cell, optionally wherein the expression of ALAS1 is inhibited by at least 20% or at least 30%.
30. A method for decreasing a level of a porphyrin or a porphyrin precursor (e.g., ALA or PBG) in a cell (e.g., a hépatocyte), comprising contacting the cell with the dsRNA of any one of claims 1 to 23, in an amount effective to decrease the level of the porphyrin or the porphyrin precursor in the cell.
31. A method of treating a porphyria, the method comprising administering to a subject in need of such treatment a therapeutically effective amount of (i) the dsRNA of any one of claims 1 to 23 or (ii) the composition of any one of claims 26 to 28, thereby treating the porphyria.
32. The method of claim 31, wherein the subject is at risk for developing, or is diagnosed with, a porphyria.
314
33. The method of claim 31 or 32, wherein the porphyria is acute inteimittent porphyria or ALA-dehydratase defïciency porphyria.
34. The method of any one of claims 31 to 33, wherein (i) the dsRNA or composition comprising dsRNA is administered after an acute attack of porphyria, (ii) the dsRNA or composition comprising dsRNA is administered during an acute attack of porphyria, or (iii) the dsRNA or composition comprising dsRNA is administered prophylactically to prevent an acute attack of porphyria.
35. The method of any one of claims 31 to 34, wherein the dsRNA is administered at a dose of 0.05 to 50 mg/kg bodyweight of the subject, e.g, at a dose of 0.01 mg/kg to 5 mg/kg bodyweight of the subject.
36. The method of any one of claims 31 to 35, wherein the method (i) decreases a level of a porphyrin or a porphyrin precursor (e.g., δ-aminolevulinic acid (ALA) or porphopilinogen (PBG)) in the subject, optionally wherein the level is decreased by at least 30% and/or (ii) inhibits ALAS1 expression in the subject.
37. The method of any one of claims 31 to 36, wherein said method (i) améliorâtes a symptom associated with an ALAS1 related disorder (e.g., a porphyria), (ii) decreases ffequency of acute attacks of symptoms associated with a porphyria in the subject, and/or (iii) decreases incidence of acute attacks of symptoms associated with a porphyria in the subject when the subject is exposed to a precipitating factor, e.g., the premenstrual phase.
38. The method of claim any one of claims 31 to 37, wherein the dsRNA or composition comprising the dsRNA is administered according to a dosing regimen, e.g., weekly, biweekly, or monthly.
315
39. The method of any one of claims 31 to 38, wherein the dsRNA is administered before an acute attack of porphyria, e.g., during a prodrome.
40. The method of claim any one of claims 31 to 39, wherein the subject has an elevated level (e.g., plasma or urine level) of ALA and/or PBG and optionally wherein the subject suffers from chronic pain.
4L The method of any one of claims 31 to 40, wherein the method decreases the elevated level of ALA and/or PBG.
42. The method of any one of claims 31 to 41, wherein the method decreases or prevents pain, neuropathy, and/or nerve damage.
43. The method of any one of claims 31 to 42, wherein the method prevents acute attacks of porphyria.
44. The method of any one of claims 31 to 43, wherein the dsRNA or composition comprising the dsRNA is administered repeatedly.
45. A method of treating a subject with an elevated level of ALA and/or PBG, the method comprising administering to a subject in need of such treatment a therapeutically effective amount of (i) the dsRNA of any one of claims 1 to 23 or (ii) the composition of any one of claims 26 to 28.
optionally, wherein the method is effective to decrease the level of ALA and/or PBG.
46. A method of treating a subject having an increased level of ALA and/or PBG, the method comprising administering the dsRNA of any one of claims 1 to 23 at 1 mg/kg, 2.5 mg/kg, or 5
316 mg/kg once per week for at least ten weeks, thereby reducing the level of ALA and/or PBG in said subject.
47. A method of treating a human patient with AIP who has suffered from multiple récurrent attacks, the method comprising administering the dsRNA of any one of claims 1 to 23 at a dose of 2.5 mg/kg for at least 6 months, thereby treating said patient, optionally wherein said method (i) reduces the frequency of attacks, (ii) reduces hematin use, (iii) reduces hospitalization, and/or (iv) improves quality of life.
48. A method for assaying the level of circulating extracellular ALAS1 mRNA in a subject, said method comprising:
detecting (e.g., measuring) the level of ALAS1 mRNA in a biological fluid sample (e.g., a blood sample, a plasma sample, a sérum sample, or a urine sample) from the subject, said biological fluid sample comprising the ALAS1 mRNA, thereby assaying the level of circulating extracellular ALAS1 mRNA in the subject.
49. A method for assaying the level of circulating extracellular ALAS1 mRNA in a subject, said method comprising (i) providing RNA (e.g., extracellular RNA) from a biological fluid sample (e.g., a blood sample, a plasma sample, a sérum sample, or urine sample) from the subject, said biological fluid sample comprising the ALAS1 mRNA;
(ii) obtaining an ALAS1 cDNA from the ALAS1 mRNA;
(iii) contacting the ALAS1 cDNA with a nucleic acid complementary (e.g., probe and/or primer) to the ALAS1 cDNA or a portion thereof, thereby producing a reaction mix; and (iv) detecting (e.g., measuring) the level of ALAS1 cDNA in the reaction mix, wherein the ALAS1 cDNA level is indicative of the ALAS1 mRNA level,
317 thereby assaying the level of circulating extracellular ALAS1 mRNA in the subject, optionally wherein (a) the method comprises PCR, qPCR or 5’-RACE, (b) the nucleic acid is a probe or primer, and/or (c) the nucleic acid comprises a détectable moiety and the level of ALAS1 mRNA is determined by détection of the amount of the détectable moiety.
50. The method of claim 49, wherein the efficacy of a porphyria treatment is assessed based on a comparison of the level of circulating extracellular ALAS1 mRNA in the subject with a reference value.
51. The method of claim 49, wherein a decrease in the level of of circulating extracellular ALAS1 mRNA in the subject in response to the porphyria treatment, relative to the reference value, indicates that the poiphyria treatment is efficacious.
52. The method of any one of claims 49 to 51, further comprising acquiring the biological fluid sample from a subject, optionally wherein the biological fluid sample is separate from the tissue, and wherein the biological fluid sample contains exosomes.
53. A composition comprising the dsRNA of claim 20 and water for injection.
54. The composition of claim 53, comprising about 200 mg/mL of the dsRNA of claim 20.
55. The composition of claim 53 or 54, wherein the composition has a pH of 6.0-7.5, e.g., about 7.0.
56. The composition of any one of claims 53 to 55, wherein the composition is formulated for subcutaneous injection.
318
57. A method of treating a subject having a porphyria (e.g., AIP) or an elevated level of ALA and/or PBG, the method comprising subcutaneously administering the composition of any one of claims 53 to 56 to the subject.
5
58. The method of claim 57, wherein the composition is administered at a dose of 0 to 5 mg/kg,
e.g., at a dose of 2.5 mg/kg or less or at a dose of 1 to 2.5 mg/kg.
59 The method of claim 58, wherein the composition is administered weekly.
OA1201600120 2013-10-04 2014-10-03 Compositions and methods for inhibiting expression of the ALAS1 gene. OA17746A (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US61/887,288 2013-10-04
US61/983,720 2014-04-24

Publications (1)

Publication Number Publication Date
OA17746A true OA17746A (en) 2017-11-13

Family

ID=

Similar Documents

Publication Publication Date Title
AU2020202970B2 (en) Compositions and methods for inhibiting expression of the alas1 gene
AU2020286311B2 (en) Compositions and methods for inhibiting expression of the ALAS1 gene
WO2017048843A1 (en) Compositions and methods for inhibiting expression of the alas1 gene
OA17746A (en) Compositions and methods for inhibiting expression of the ALAS1 gene.