WO2017042557A1

WO2017042557A1 - Glycomimetics for use for the treatment of vascular calcification and/or endothelial dysfunction

Info

Publication number: WO2017042557A1
Application number: PCT/GB2016/052764
Authority: WO
Inventors: Marie Yvonne ALEXANDER; Alan Morenc JONES
Original assignee: Manchester Metropolitan University
Priority date: 2015-09-07
Filing date: 2016-09-07
Publication date: 2017-03-16
Also published as: GB2543478A; GB201515850D0

Abstract

The present invention relates to the use of glycomimetic compounds for the treatment of vascular calcification and/or endothelial dysfunction, particularly the use of small molecule mimetics of heparin/heparan sulfate, such as compounds according to formula (A), (B), (C) or (D), or pharmaceutically acceptable derivatives thereof

Description

GLYCOMIMETICS FOR USE FOR THE TREATMENT OF VASCULAR

CALCIFICATION AND/OR ENDOTHELIAL DYSFUNCTION

TECHNICAL FIELD

The present invention relates to medical treatments for vascular calcification and/or endothelial dysfunction, and particularly to the use of glycomimetic compounds or pharmaceutically acceptable derivatives thereof for the treatment of vascular calcification and/or endothelial dysfunction.

BACKGROUND ART

Vascular calcification and endothelial dysfunction

Vascular calcification {e.g. cardiovascular calcification) is a major clinical issue and elucidating an underlying problem is of vital importance to improving its prognosis and the eventual treatment of cardiovascular disease. Vascular calcification is a progressive condition which results in the build-up of calcium mineral deposits and plaques on the inner wall of arteries, which in turn reduces arterial contractility. This deterioration in the condition of the artery walls can lead to the onset of cardiovascular disease and a host of other complications in patients. Vascular calcification has been linked with the occurrence of endothelial dysfunction but the relationship between the two events is not yet fully understood.

Endothelial dysfunction is a systemic pathological state of the endothelium (i.e. the inner lining of blood vessels) and broadly involves an imbalance between vasodilating and vasoconstricting substances produced by the endothelium. Normal functions of endothelial cells include mediation of coagulation, platelet adhesion, immune function and control of volume and electrolyte content of the intravascular and extravascular spaces. Endothelial nitric oxide synthase (eNOS) is expressed in vascular endothelial cells, endomyocardial cells, atrial cells, vascular smooth muscle cells, respiratory endothelial ceils, and the like. The production of eNOS in such ceils serves to adjust vascular tone and maintain homeostasis of vascular endothelial cells by forming nitric oxide (NO). NO reduction is considered to be the hallmark of endothelial dysfunction, where a key feature of this dysfunction is the inability of endothelial cells to release vasodilators such as NO thus leading to a reduction in NO bioavailability. The biochemical mechanisms involved in the development of endothelial dysfunction are complex.

One such endothelial dysfunction related mechanism attracting interest at present is the disruption of the hepatocyte growth factor (HGF)/ receptor tyrosine kinase (c-Met) signaling pathway using NK4 or DAPT as inhibitors. Pathway studies have demonstrated that NK4 inhibits the direct interaction of HGF with c-Met, whereas, DAPT acts to inhibit Notch signaling which is down-stream from the HGF/c-MET interaction. This mechanism has been linked with multiple biological effects on a wide variety of cells (Liu et al. Atherosclerosis 219 (201 1 ) 440- 447).

Giycomimetic compounds

Giycomimetic compounds are molecules that structurally and functionally mimic carbohydrates in the body, such as heparan sulfate, involved in important biological processes. These compounds, generally, have structures similar to carbohydrates but with some variation resulting in a modified biological activity. Therapeutically effective

euccel, glycol* consols «ude Ta_miflu™ in «_he Lmen, o«

Acarbose for the treatment of type 2 diabetes.

Certain glycomimetics have been investigated for use in the treatment of type 1 and type 2 diabetes (WO 201 1/109877A1 , Parish et a!.) as well as cancer progression (Raiber et ai. Bioorganic & Medicinal Chemistry Letters 17 (2007) 8321 -6325). Moreover, Raiber et al. have demonstrated that modulation of the interaction between HGF and c-MET using giycomimetic compounds may be useful in the context of cancer cells and thus cancer treatments, particularly with respect to tumor invasion and metastasis in cancers.

The present inventors have successfully identified small molecule giycomimetic compounds to satisfy an unmet need in the treatment of endothelial dysfunction and the prevention of vascular calcification.

This is surprising not least because, until now, there has been no link between the specific giycomimetic induced modulation of HGF/c-MET signaling and the treatment of endothelial dysfunction or vascular calcification.

DISCLOSURE OF THE INVENTION

In its broadest sense, the inventors propose the use of glycomimetics, particularly small molecule mimetics of heparin/heparan sulfate, for treating endothelial dysfunction and vascular calcification.

The inventors in particular propose giycomimetic compounds of formulae A-D or

pharmaceutically acceptable derivatives thereof, as defined in the claims and further described in aspects and embodiments of the invention below, for the treatment of vascular calcification and/or endothelial dysfunction. As indicated by the examples and figures described herein, the inventors have observed that the compounds of the invention show surprising activity in models of endothelial dysfunction and / or vascular calcification. Compounds of the invention in particular demonstrate a surprising ability to modulate specific biological pathways associated with these medical indications.

The present inventors have in particular observed that compounds of the invention show utility in treating endothelial dysfunction by exploiting a number of biochemical pathways, including (a) upregulation of the eNOS/Akt signalling pathway, (b) potentiation of the antioxidant defence system ; and (c) regulation of NADPH oxidase activity and reactive oxygen species (ROS), thus underpinning a surprising utility of these compounds in the treatment of endothelial dysfunction.

The utility of compounds of the invention in treating vascular calcification is demonstrated by the effective blocking of GP-induced vascular calcification in human pelvic artery smooth muscle cells (HPSMCs), and by desirable effects in a calcium deposition assay (see examples and figures herein). Investigation of the mechanism of action of the compounds in line with Western blotting data indicated that the compounds exert these effects, inter alia, by effective inhibition of c-MET phosphorylation.

The inventors propose that compounds of the invention exhibit their surprising activity by virtue of modulating the interaction of HGF (hepatocyte growth factor) with glycoprotein co-receptor in the glycocalix of endothelial cells, which then has an effect on the downstream biochemical pathways associated with the HGF/c-MET pathway that relate specifically to endothelial dysfunction and / or vascular calcification. Previous treatments proposed for endothelial dysfunction and / or vascular calcification have instead focused on other mechanisms for modulating the HGF-binding properties, such as by providing variants of HGF, such as NK4 (see introduction section), to directly inhibit HGF - c-MET binding. Modulation of the interaction between HGF and glycoprotein co-receptor in the glycocalix has never before been proposed as a way in which to target and treat vascular calcification and / or endothelial dysfunction. The present invention thus represents an important development in the field of treating vascular calcification and / or endothelial dysfunction.

Without wishing to be bound by theory, it is proposed that the activity of the compounds of the invention is at least in part achieved by mimicking the binding mode of native heparan sulfate to HGF. The inventors propose that the spatial orientation of the R¹ carboxyl motif on the ring (or a corresponding bioisostere thereof) relative to the essential sulfate /sulfamide group pendant on the linear right hand side chain at R² and / or R³ plays an important role in providing the desirable activity of the present compounds.

Accordingly, in an aspect, the invention provides a compound (i.e. a glycomimetic) according to formula (A), (B), (C) or (D):

or a pharmaceutically acceptable derivative thereof for use in the treatment of vascular calcification and / or endothelial dysfunction,

wherein:

is a 6-membered carbocyclic or heterocyclic ring;

is a 5-membered carbocyclic or heterocyclic ring; J is H, halo, optionally substituted C_1-10alkyl, optionally substituted C_3-10cycloalkyl, optionally substituted C_2-10alkenyl, optionally substituted C_3-10cycloalkenyl, optionally substituted C_2-10alkynyl, optionally substituted C₂-ioheteroalkyl, optionally substituted C_3-10heterocycloalkyl, optionally substituted C₂-ioheteroalkenyl, optionally substituted C_3-10heterocycloalkenyl, optionally substituted C_2-10heteroalkynyl, optionally substituted

R⁴

C_6-14aryl, optionally substituted C_5-14heteroaryl, or R ;

Z is -O-, -N(R^A)-, -S-, or a Ci_-6alkylene or C_2-6heteroalkylene linker group, wherein the Ci_-6alkylene and C_2-6heteroalkylene linker groups are each independently optionally substituted with 1 to 3 substituents selected from halo, OH, Ci_-6alkyl, Ci_-6haloalkyl; -OSO₃H and -NH(SO₃H), and wherein R^A is H or Ci_-6alkyl;

Q is -O-, -N(R^B)-, -S-, or a Ci_-6alkylene or C_2-6heteroalkylene linker group, wherein the Ci_-6alkylene and C_2-6heteroalkylene linker groups are each independently optionally substituted with 1 to 3 substituents selected from halo, OH, Ci_-6alkyl, Ci_-6haloalkyl; -OSO₃H and -NH(SO₃H), and wherein R^B is H or Ci_-6alkyl;

R¹ is -CO₂W or a bioisostere of a carboxyl group;

R² and R³ are each independently H, -OR⁷ or -NH(R⁷), wherein each R⁷ is independently selected from the group consisting of H, -SO₃Y, optionally substituted C_1-10alkyl, optionally substituted C_3-10cycloalkyl, optionally substituted C_2-10alkenyl, optionally substituted C_3-10cycloalkenyl, optionally substituted C_2-10alkynyl, optionally substituted C_2-10heteroalkyl, optionally substituted C_3-10heterocycloalkyl, optionally substituted C_2-10heteroalkenyl, optionally substituted C_3-10heterocycloalkenyl, optionally substituted C_2-10heteroalkynyl, optionally substituted C_6-14aryl and optionally substituted C_5-14heteroaryl, wherein at least one of R² and R³ is selected from -OSO₃Y and -NH(SO₃Y);

R⁴ and R⁵ are each independently H, -OR⁸ or -NH(R⁸), wherein each R⁸ is independently selected from the group consisting of H, -SO₃Y, optionally substituted Ci-i₀alkyl, optionally substituted C_3-i₀cycloalkyl, optionally substituted C_2-i₀alkenyl, optionally substituted C₃-i₀cycloalkenyl, optionally substituted C_2-i₀alkynyl, optionally substituted C_2-i₀heteroalkyl, optionally substituted C_3-i₀heterocycloalkyl, optionally substituted C_2-i₀heteroalkenyl, optionally substituted C_3-i₀heterocycloalkenyl, optionally substituted C_2-i₀heteroalkynyl, optionally substituted C₆-i₄aryl and optionally substituted C_5-i₄heteroaryl; R⁶ is H, -CH₂OR⁹ or -CH₂NH(R⁹), wherein R⁹ is independently selected from the group consisting of H, -S0₃Y, optionally substituted C_1-10alkyl, optionally substituted C_3-10cycloalkyl, optionally substituted C_2-10alkenyl, optionally substituted C_3-10cycloalkenyl, optionally substituted C_2-10alkynyl, optionally substituted C_2-10heteroalkyl, optionally substituted C_3-10heterocycloalkyl, optionally substituted C_2-10heteroalkenyl, optionally substituted C_3-10heterocycloalkenyl, optionally substituted C_2-10heteroalkynyl, optionally substituted C_6-14aryl and optionally substituted C_5-14heteroaryl;

s is an integer from 0 to 3;

t is an integer from 0 to 2;

each R¹⁰, when present, is independently selected from the group consisting of halo, Ci_-4alkyl, Ci_-4haloalkyl, -OSO₃Y and -NH(S0₃Y);

W is H, optionally substituted C_1-10alkyl, optionally substituted C_3-10cycloalkyl, optionally substituted C_2-10alkenyl, optionally substituted C_3-10cycloalkenyl, optionally substituted C_2-10alkynyl, optionally substituted C_2-10heteroalkyl, optionally substituted C_3-10heterocycloalkyl, optionally substituted C_2-10heteroalkenyl, optionally substituted C_3-10heterocycloalkenyl, optionally substituted C_2-10heteroalkynyl, optionally substituted C_6-14aryl or optionally substituted C_5-14heteroaryl; and

Y is H, optionally substituted C_1-10alkyl, optionally substituted C_3-10cycloalkyl, optionally substituted C_2-10alkenyl, optionally substituted C_3-10cycloalkenyl, optionally substituted C_2-10alkynyl, optionally substituted C_2-10heteroalkyl, optionally substituted C_3-10heterocycloalkyl, optionally substituted C_2-10heteroalkenyl, optionally substituted C_3-10heterocycloalkenyl, optionally substituted C_2-10heteroalkynyl, optionally substituted C_6-14aryl or optionally substituted C_5-14heteroaryl.

Thus, in an aspect, the invention provides the use of a compound (i.e. a glycomimetic) according to formula (A), (B), (C) or (D):

or a pharmaceutically acceptable derivative thereof in the manufacture of a medicament for the treatment of vascular calcification and / or endothelial dysfunction,

wherein:

is a 6-membered carbocyclic or heterocyclic ring;

is a 5-membered carbocyclic or heterocyclic ring;

J is H, halo, optionally substituted Ci-i₀alkyl, optionally substituted

C₃-i₀cycloalkyl, optionally substituted C_2-i₀alkenyl, optionally substituted C_3-i₀cycloalkenyl, optionally substituted C_2-i₀alkynyl, optionally substituted C₂-ioheteroalkyl, optionally substituted C₃-i₀heterocycloalkyl, optionally substituted C₂-ioheteroalkenyl, optionally substituted C₃-i₀heterocycloalkenyl, optionally substituted C -i₀heteroalkynyl, optionally substituted

C₆-i₄aryl, optionally substituted C_5-i₄heteroaryl, or

;

Z is -O-, -N(R^A)-, -S-, or a C_1-6alkylene or C_2-6heteroalkylene linker group, wherein the C_1-6alkylene and C_2-6heteroalkylene linker groups are each independently optionally substituted with 1 to 3 substituents selected from halo, OH, C_1-6alkyl, C_1-6haloalkyl; -OSO₃H and -NH(SOsH), and wherein R^A is H or C_1-6alkyl;

Q is -O-, -N(R )-, -S-, or a C_1-6alkylene or C_2-6heteroalkylene linker group, wherein the C_1-6alkylene and C_2-6heteroalkylene linker groups are each independently optionally substituted with 1 to 3 substituents selected from halo, OH, C_1-6alkyl, C_1-6haloalkyl; -OSO₃H and -NH(SOsH), and wherein R^B is H or C_1-6alkyl;

R is -CO₂W or a bioisostere of a carboxyl group; R² and R³ are each independently H, -OR⁷ or -NH(R⁷), wherein each R⁷ is independently selected from the group consisting of H, -SO₃Y, optionally substituted C_1-10alkyl, optionally substituted C_3-10cycloalkyl, optionally substituted C_2-10alkenyl, optionally substituted C_3-10cycloalkenyl, optionally substituted C_2-10alkynyl, optionally substituted C_2-10heteroalkyl, optionally substituted C_3-10heterocycloalkyl, optionally substituted C_2-10heteroalkenyl, optionally substituted C_3-10heterocycloalkenyl, optionally substituted C_2-10heteroalkynyl, optionally substituted C_6-14aryl and optionally substituted C_5-14heteroaryl, wherein at least one of R² and R³ is selected from -OSO₃Y and -NH(SO₃Y);

R⁴ and R⁵ are each independently H, -OR⁸ or -NH(R⁸), wherein each R⁸ is independently selected from the group consisting of H, -SO₃Y, optionally substituted C_1-10alkyl, optionally substituted C_3-10cycloalkyl, optionally substituted C_2-10alkenyl, optionally substituted C₃-i ₀cycloalkenyl, optionally substituted C_2-i ₀alkynyl, optionally substituted C_2-i₀heteroalkyl, optionally substituted C_3-i ₀heterocycloalkyl, optionally substituted C_2-i₀heteroalkenyl, optionally substituted C_3-i ₀heterocycloalkenyl, optionally substituted C_2-i ₀heteroalkynyl, optionally substituted C₆-i ₄aryl and optionally substituted C_5-i ₄heteroaryl;

R⁶ is H, -CH₂OR⁹ or -CH₂NH(R⁹), wherein R⁹ is independently selected from the group consisting of H, -SO₃Y, optionally substituted Ci-₁₀alkyl, optionally substituted C₃-i ₀cycloalkyl, optionally substituted C₂-i ₀alkenyl, optionally substituted C₃-i₀cycloalkenyl, optionally substituted C₂-i₀alkynyl, optionally substituted C₂-i ₀heteroalkyl, optionally substituted C₃-i ₀heterocycloalkyl, optionally substituted C₂-i₀heteroalkenyl, optionally substituted C₃-i ₀heterocycloalkenyl, optionally substituted C₂-i ₀heteroalkynyl, optionally substituted C₆-i ₄aryl and optionally substituted C_5-i₄heteroaryl;

s is an integer from 0 to 3;

t is an integer from 0 to 2;

each R¹⁰, when present, is independently selected from the group consisting of halo, C_1-4alkyl, C_1-4haloalkyl, -OSO₃Y and -NH(SO₃Y);

W is H, optionally substituted C_1-10alkyl, optionally substituted C_3-10cycloalkyl, optionally substituted C_2-10alkenyl, optionally substituted C_3-10cycloalkenyl, optionally substituted C_2-10alkynyl, optionally substituted C_2-10heteroalkyl, optionally substituted C_3-10heterocycloalkyl, optionally substituted C_2-10heteroalkenyl, optionally substituted C_3-10heterocycloalkenyl, optionally substituted C_2-10heteroalkynyl, optionally substituted C₆-i ₄aryl or optionally substituted C_5-i₄heteroaryl; and Y is H, optionally substituted C_1-10alkyl, optionally substituted C_3-10cycloalkyl, optionally substituted C_2-10alkenyl, optionally substituted C_3-10cycloalkenyl, optionally substituted C_2-10alkynyl, optionally substituted C_2-10heteroalkyl, optionally substituted C_3-10heterocycloalkyl, optionally substituted C_2-10heteroalkenyl, optionally substituted C_3-10heterocycloalkenyl, optionally substituted C_2-10heteroalkynyl, optionally substituted C_6-14aryl or optionally substituted C_5-14heteroaryl.

In a further aspect, the invention provides a method of treating vascular calcification and / or endothelial dysfunction comprising administering a therapeutically effective amount of a compound (i.e. a glycomimetic) according to formula (A), (B), (C) or (D), or a pharmaceutically acceptable derivative thereof, to a patient (e.g. a patient in need thereof):

is a 5-membered carbocyclic or heterocyclic ring;

J is H, halo, optionally substituted C_1-10alkyl, optionally substituted C_3-10cycloalkyl, optionally substituted C_2-10alkenyl, optionally substituted C_3-10cycloalkenyl, optionally substituted C_2-10alkynyl, optionally substituted C_2-10heteroalkyl, optionally substituted C_3-10heterocycloalkyl, optionally substituted C_2-10heteroalkenyl, optionally substituted C_3-10heterocycloalkenyl, optionally substituted C_2-10heteroalkynyl, optionally substituted

R⁴

C_6-14aryl, optionally substituted C_5-14heteroaryl, or R ;

Z is -O-, -N(R^A)-, -S-, or a Ci_-6alkylene or C_2-6heteroalkylene linker group, wherein the Ci_-6alkylene and C_2-6heteroalkylene linker groups are each independently optionally substituted with 1 to 3 substituents selected from halo, OH, Ci_-6alkyl, Ci_-6haloalkyl; -OSO₃H and -NH(SOsH), and wherein R^A is H or Ci_-6alkyl;

Q is -O-, -N(R^B)-, -S-, or a Ci_-6alkylene or C_2-6heteroalkylene linker group, wherein the Ci_-6alkylene and C_2-6heteroalkylene linker groups are each independently optionally substituted with 1 to 3 substituents selected from halo, OH, Ci_-6alkyl, Ci_-6haloalkyl; -OSO₃H and -NH(SOsH), and wherein R^B is H or Ci_-6alkyl;

R¹ is -CO₂W or a bioisostere of a carboxyl group;

R⁴ and R⁵ are each independently H, -OR⁸ or -NH(R⁸), wherein each R⁸ is independently selected from the group consisting of H, -SO₃Y, optionally substituted Ci-i₀alkyl, optionally substituted C_3-i₀cycloalkyl, optionally substituted C_2-i₀alkenyl, optionally substituted C₃-i₀cycloalkenyl, optionally substituted C_2-i₀alkynyl, optionally substituted C_2-i₀heteroalkyl, optionally substituted C_3-i₀heterocycloalkyl, optionally substituted C_2-i₀heteroalkenyl, optionally substituted C_3-i₀heterocycloalkenyl, optionally substituted C_2-i₀heteroalkynyl, optionally substituted C₆-i₄aryl and optionally substituted C_5-i₄heteroaryl;

R⁶ is H, -CH₂OR⁹ or -CH₂NH(R⁹), wherein R⁹ is independently selected from the group consisting of H, -SO₃Y, optionally substituted Ci-i₀alkyl, optionally substituted C₃-i₀cycloalkyl, optionally substituted C_2-i₀alkenyl, optionally substituted C_3-i₀cycloalkenyl, optionally substituted C_2-i₀alkynyl, optionally substituted C_2-i₀heteroalkyl, optionally substituted C₃-i₀heterocycloalkyl, optionally substituted C_2-i₀heteroalkenyl, optionally substituted C_3-10heterocycloalkenyl, optionally substituted C_2-10heteroalkynyl, optionally substituted C_6-14aryl and optionally substituted C_5-14heteroaryl;

s is an integer from 0 to 3;

t is an integer from 0 to 2;

each R¹⁰, when present, is independently selected from the group consisting of halo, Ci_-4alkyl, Ci_-4haloalkyl, -OS0₃Y and -NH(S0₃Y);

W is H, optionally substituted Ci-i₀alkyl, optionally substituted C_3-i₀cycloalkyl, optionally substituted C_2-i₀alkenyl, optionally substituted C_3-i₀cycloalkenyl, optionally substituted C_2-i₀alkynyl, optionally substituted C₂-ioheteroalkyl, optionally substituted C₃-i₀heterocycloalkyl, optionally substituted C_2-i₀heteroalkenyl, optionally substituted C₃-i₀heterocycloalkenyl, optionally substituted C_2-i₀heteroalkynyl, optionally substituted C_6-14aryl or optionally substituted C_5-14heteroaryl; and

a) In embodiments of the above aspects, the compound or pharmaceutically acceptable derivative thereof provided may be according to formula (A) or (B):

b) In embodiments of the above aspects or embodiment, the compound or pharmaceutically acceptable derivative may be according to formula (A):

wherein

J and Z are as defined above.

c) In embodiments of the above aspect and embodiments,

is a 6-membered aryl or heteroaryl ring.

d) In embodiments, formula (A) and (B) are according to formulae (A1 ) and (B1 ), respectively:

wherein C, D and E are each independently selected from the group consisting of CH, CR¹⁰ and N; and

R¹-R³, R¹⁰, J and Z are as defined above.

e) The compound or pharmaceutically acceptable derivative may for instance be a compound or pharmaceutically acceptable derivative according to formula (A1 ):

wherein groups R¹-R³, C-E, J and Z are as defined in embodiment d) above.

f) In alternative embodiments of the above aspects and embodiments,

may be a

6-membered saturated cycloalkyl or heterocycloalkyl ring.

g) The compound or pharmaceutically acceptable derivative according to the above aspects and embodiments may for instance be a compound or pharmaceutically acceptable derivative of any one of formulae (A) and (B), wherein formulae (A) and (B) are according to formulae (A2) and (B2), respectively:

wherein C, D and E are each independently selected from the group consisting of CH₂ °, NH and NR¹⁰; and

R¹-R³, R¹⁰, J and Z are as defined above. h) The compound or pharmaceutically acceptable derivative may in embodiments of the above aspects and embodiments be a compound or pharmaceutically acceptable derivative of formula (A2):

wherein groups R¹-R³, C-E, J and Z are as defined above in embodiment e).

i) In embodiments of the invention, Z is a C^heteroalkylene linker group optionally substituted with 1 to 3 substituents selected from halo, OH, Ci_-6alkyl, Ci_-6haloalkyl, -OS0₃H and

-NH(S0₃H); optionally wherein Z is a C^heteroalkylene linker group. j) In embodiments, the compound or pharmaceutically acceptable derivative of formula (A1 ) a compound or pharmaceutically acceptable derivative of formula (A3):

(A3);

wherein:

groups R¹-R³, C-E, and J are as defined according to embodiment e); A is NR^A, O or S, wherein R^A is H or Ci_-6alkyl; and

m is 1 , 2, 3 or 4.

k) In some embodiments of the aspects of embodiments above, J is H, halo, optionally substituted C_1-10alkyl, optionally substituted C_3-10cycloalkyl, optionally substituted

C₂-ioheteroalkyl, optionally substituted C_3-10heterocycloalkyl, or

wherein Q and

R⁴-R⁶ are as defined above.

R⁴

J may for instance be R wherein Q and R⁴-R⁶ are as defined above. In embodiments Q may be a C^heteroalkylene linker group optionally substituted with 1 to 3 substituents selected from halo, OH, C_1-6alkyl, C_1-6haloalkyl; -OSO₃H and -NH(SO₃H). In embodiments Q is unsubstituted, such as wherein Q is a C^heteroalkylene linker group.

R⁴

J may for instance be ^Rv ^{B i} _ wherein R⁴-R⁶ are as defined in claim 1 ;

B is NR^B, O or S, wherein R^B is H or C_1-6alkyl; and

n is 1 , 2, 3, or 4.

I) In the present invention as described according to the above aspects of the invention, the compound or pharmaceutically acceptable derivative may be a compound or pharmaceutically acceptable derivative of formula (I):

wherein:

A is NR^A, O or S, wherein R^A is H or Ci_-6alkyl;

B is NR^B, O or S, wherein R^B is H or Ci_-6alkyl;

m is 1 , 2, 3 or 4;

n is 1 , 2, 3 or 4;

R¹ is -C0₂W or a bioisostere of a carboxyl group (e.g. -C0₂W);

R⁴ and R⁵ are each independently H, -OR⁸ or -NH(R⁸), wherein each R⁸ is independently selected from the group consisting of H, -SO₃Y, optionally substituted Ci-i₀alkyl, optionally substituted C_3-i₀cycloalkyl, optionally substituted C_2-i₀alkenyl, optionally substituted C₃-i₀cycloalkenyl, optionally substituted C_2-i₀alkynyl, optionally substituted C_2-i₀heteroalkyl, optionally substituted C_3-i₀heterocycloalkyl, optionally substituted C_2-i₀heteroalkenyl, optionally substituted C_3-10heterocycloalkenyl, optionally substituted C_2-10heteroalkynyl, optionally substituted C_6-14aryl and optionally substituted C_5-14heteroaryl;

R⁶ is H, -CH₂OR⁹ or -CH₂NH(R⁹), wherein R⁹ is independently selected from the group consisting of H, -S0₃Y, optionally substituted C_1-10alkyl, optionally substituted C_3-10cycloalkyl, optionally substituted C_2-10alkenyl, optionally substituted C_3-10cycloalkenyl, optionally substituted C_2-10alkynyl, optionally substituted C_2-10heteroalkyl, optionally substituted C_3-10heterocycloalkyl, optionally substituted C_2-10heteroalkenyl, optionally substituted C_3-10heterocycloalkenyl, optionally substituted C_2-10heteroalkynyl, optionally substituted C_6-14aryl and optionally substituted C_5-14heteroaryl;

W is H, optionally substituted Ci-i₀alkyl, optionally substituted C_3-i₀cycloalkyl, optionally substituted C_2-i₀alkenyl, optionally substituted C_3-i₀cycloalkenyl, optionally substituted C_2- i₀alkynyl, optionally substituted C_2-i₀heteroalkyl, optionally substituted C_3-i₀heterocycloalkyl, optionally substituted C_2-i₀heteroalkenyl, optionally substituted C_3-i₀heterocycloalkenyl, optionally substituted C_2-i₀heteroalkynyl, optionally substituted C₆-i₄aryl or optionally substituted C_5-i₄heteroaryl; and

Y is H, optionally substituted Ci-₁₀alkyl, optionally substituted C_3-i₀cycloalkyl, optionally substituted C₂-i₀alkenyl, optionally substituted C₃-i₀cycloalkenyl, optionally substituted C_2- i₀alkynyl, optionally substituted C₂-i₀heteroalkyl, optionally substituted C₃-i₀heterocycloalkyl, optionally substituted C₂-i₀heteroalkenyl, optionally substituted C₃-i₀heterocycloalkenyl, optionally substituted C₂-i₀heteroalkynyl, optionally substituted C₆-i₄aryl or optionally substituted C_5-i₄heteroaryl;

C, D and E are each independently selected from the group consisting of CH, CR¹⁰ and N; and

each R¹⁰ is independently selected from the group consisting of halo, C_1-4alkyl, C_{1 -4}haloalkyl, -OS0₃Y and -NH(S0₃Y). In this embodiment, each optionally substituted group may independently be substituted or unsubstituted. In a particular embodiment, each group is for instance unsubstituted.

m) In the aspects and embodiments above, R¹ may be -C0₂W, wherein W is defined above. W may be H, optionally substituted Ci-i₀alkyl, or optionally substituted C_2-i₀heteroalkyl. For instance W may be H or optionally substituted Ci-i₀alkyl; optionally wherein W is H or Ci_-6alkyl, such as wherein W is H or methyl. n) In the above aspects and embodiments, R² may in embodiments be -OR⁷ or -NH(R⁷), optionally wherein said R⁷ is -SO₃Y, such as wherein R² is -OSO₃Y. o) In the above aspects and embodiments, R³ may in embodiments be -OR⁷ or -NH(R⁷), optionally wherein said R⁷ is -SO₃Y, such as wherein R³ is -OSO₃Y.

R² and R³ may, for instance, be selected independently from -OSO₃Y and -NH(SO₃Y), such as wherein both R² and R³ are -OSO₃Y . p) In embodiments of the invention, R⁴ may be H, -OR⁸ or -NH(R⁸), optionally wherein R⁸ is -SO₃Y, such as wherein R⁴ is -OSO₃Y. For instance, R⁴ may be H. q) R⁵ may, in embodiments of the invention, be -OR⁸ or -NH(R⁸), optionally wherein R⁸ is -SO₃Y, such as wherein R⁵ is -OSO₃Y.

R⁴ and R⁵ may for instance be selected from -OSO₃Y and -NH(SO₃Y). For instance, R⁴ and R⁵ may be each independently selected from -OSO₃Y and -NH(SO₃Y), such as wherein both R⁴ and R⁵ are -OSO₃Y. r) In embodiments, R⁶ may be H. s) In embodiments of the above aspects and embodiments, each R⁷ may be independently selected from the group consisting of H, -SO₃Y and optionally substituted Ci-₁₀alkyl. For instance, each R⁷ may be independently selected from the group consisting of H and -SO₃Y; such as wherein each R⁷ is -SO₃Y. t) In embodiments of the above aspects and embodiments, each R⁸ may be independently selected from the group consisting of H, -SO₃Y and optionally substituted C_1-10alkyl. Each R⁸ may for instance be independently selected from the group consisting of H and -SO₃Y; such as wherein each R⁸ is -SO₃Y. u) In aspects and embodiments described herein, where R⁹ is present, it may be selected from the group consisting of H, -SO₃Y and optionally substituted Ci-₁₀alkyl. R⁹ may for instance be selected from the group consisting of H and -SO₃Y; such as wherein R⁹ is -SO₃Y. v) Each R¹⁰, where present, may be independently selected from the group consisting of halo, C_{1 -4}alkyl, C_1-4haloalkyl and -OSO₃Y. Typically, each R¹⁰, where present, is independently selected from CF, CCH₃, CF₃ and -OSO₃Y. w) Typically, in aspects and embodiments of the invention s is 0. Typically, in aspects and embodiments of the invention t is 0. Both s and t may be 0. x) In particular embodiments of the above aspects and embodiments, at least two, and optionally three, of R², R³, R⁴ and R⁵ are -OS0₃Y. For instance, in embodiments, each of R², R³, R⁴ and R⁵ is -OS0₃Y and R⁶ is H. Alternatively, in embodiments, R², R³ and R⁵ are -OSO₃Y, and R⁴ and R⁶ are each H. y) In the present invention, A may typically be O or S, and in some embodiments O. z) In embodiments, B may be O or S, typically O. In typical embodiments, A and B are each O.

aa) In embodiments wherein

is a 6-membered aryl or heteroaryl ring, C may be selected from the group consisting of CH and C(R¹⁰), wherein R¹⁰ is selected from the group consisting of halo, C_1-4alkyl and C_1-4haloalkyl; optionally wherein R¹⁰ is halo, CF or CCH₃. Additionally or alternatively, in such embodiments, E may be selected from the group consisting of CH and C(R¹⁰), wherein R¹⁰ is selected from the group consisting of halo, C_{1 -4}alkyl and C_1-4haloalkyl, such as wherein R¹⁰ is halo, CF or CCH₃. Additionally or alternatively to the definitions of C and / or E described above, D may be CH or C(R¹⁰), wherein R¹⁰ is selected from the group consisting of halo, C_1-4alkyl and -OSO₃Y; such as wherein R¹⁰ is halo, CF, CCH₃, or -OSO₃Y, e.g. -OSO₃Y. In embodiments, C, D and E may for instance be independently selected from the group consisting of CH and N, typically wherein C, D and E are each CH. bb) Where m is present in the formulae of the present invention, it may for instance be 1 or 2, such as 1 . Similarly, n may be 1 or 2, e.g. 1 . In embodiments, n is 2. cc) In the present invention, Y may be independently selected from H and optionally substituted C_1-10alkyl; optionally wherein each Y is independently selected from H and C_{1 -6}alkyl, such as wherein each Y is H. dd) In a particular embodiment, the compound of formula (I) or a pharmaceutically acceptable derivative thereof as described above may be wherein:

A and B are selected independently from O or S, such as wherein both A and B are O;

C, D and E are each CH;

m is 1 or 2;

n is 1 or 2; R¹ is -C0₂W;

R², R³, R⁴ and R⁵ are each independently selected from H and -OS0₃Y, wherein at least one, and optionally at least 2, of R², R³, R⁴ and R⁵ is -S0₃Y;

W is H or optionally substituted Ci_-6alkyl; and

Y is H. ee) In the present invention as described herein, formula (I) as described above may alternatively be according to formula (II):

wherein:

R¹ - R⁶, A, B, m, n are as defined above for embodiment I) or any further embodiments thereof as described herein.

ff) In the present invention, formula (I) as described herein may be according to formula (I II):

wherein:

R¹ - R⁶ and n are as defined above for embodiment I) or any further embodiments thereof as described herein.

gg) In typical embodiments, formula (I) is according to formula (I II):

wherein:

n is 1 or 2;

R is -C0₂W, wherein W is H or optionally substituted Ci R², R³ and R⁵ are each -OS0₃H; and

R⁴ is H or -OSO₃H.

hh) In embodiments, formula (I) as described herein (e.g. in embodiment I)) above, may be according to formula (IV):

wherein

R¹ , R⁴ and R⁶, m and n are as defined above for embodiment I) or any further embodiments thereof as described herein. Typically R¹ is C0₂W, R⁶ is H and R⁴ is H or -S0₃H

In a further aspect, the invention provides a compound according to any one of the following formulae, or a pharmaceutically acceptable derivative thereof, for use in the treatment of vascular calcification and / or endothelial dysfunction:

The invention also provides the use of a compound of the formulae listed above or pharmaceutically acceptable derivative thereof in a method for manufacturing a medicament for treating vascular calcification and / or endothelial dysfunction is also contemplated.

The invention also provides a method for the treatment of vascular calcification and / or endothelial dysfunction comprising administering a therapeutically effective amount of a compound (i.e. a glycomimetic) according any one of the formulae presented above, or a pharmaceutically acceptable derivative thereof, to a patient (e.g. a patient in need thereof):

The compound or pharmaceutically effective derivative thereof may for instance be selected from the group consisting of:

OSO3H

OSO3H

OSO3H

OSO3H

In a further aspect, the invention provides a pharmaceutical composition comprising a compound or pharmaceutically acceptable derivative thereof according to any aspect or embodiment disclosed herein, and a pharmaceutically acceptable excipient. In an aspect, the invention thus provides a pharmaceutical composition comprising a compound or pharmaceutically acceptable derivative thereof according to any aspect or embodiment disclosed herein, and a pharmaceutically acceptable excipient for use in the treatment of vascular calcification and / or endothelial dysfunction. For avoidance of doubt, any specific embodiment of the compounds and pharmaceutically acceptable derivatives of the formulae of the invention described herein may be provided in the composition of the invention according to this aspect.

In a further aspect is provided the use of a compound or pharmaceutically acceptable derivative thereof as defined according to any aspect or embodiment disclosed herein, or a pharmaceutically acceptable composition as disclosed herein in the manufacture of a medicament for the treatment of vascular calcification and / or endothelial dysfunction. For avoidance of doubt, any specific embodiment of the compounds and pharmaceutically acceptable derivatives of the formulae of the invention described herein may be provided in the use according to this aspect.

In a further aspect is provided a method for the treatment of vascular calcification and / or endothelial dysfunction in a patient, comprising the step of administering a therapeutically effective amount of a compound or pharmaceutically acceptable derivative thereof as defined according to any aspect or embodiment disclosed herein, or a pharmaceutically acceptable composition as defined herein, to a patient, i.e. a patient in need thereof. For avoidance of doubt, any specific embodiment of the compounds and pharmaceutically acceptable derivatives of the formulae of the invention described herein may be provided in the method according to this aspect.

In a further aspect of the invention is provided a method of modulating c-Met activity in an endothelial cell comprising contacting the cell with a compound or pharmaceutical derivative thereof as defined according to any aspect or embodiment thereof disclosed herein. Suitably, said method of modulating c-Met activity is not a method of treatment by therapy. Thus, typically, the method is not an in vivo method. For instance, such a method may be an in vitro or ex-vivo method. The endothelial cell is typically a mammalian endothelial cell, preferably a human endothelial cell. Where the method of modulating c-Met activity described above is a method of treatment by therapy, the method suitably comprises contacting the endothelial cell in a patient (suitably wherein a therapeutically effective amount of the compound or pharmaceutically acceptable derivative thereof has been administered to the patient). Typically, the patient is a patient that has been diagnosed with endothelial dysfunction and / or vascular calcification. In suitable embodiments, the patient may suitably be a patient that has not been diagnosed with cancer (particularly metastatic cancer) and / or diabetes. For instance, in suitable embodiments, the method is a method wherein the compound or pharmaceutically acceptable salt thereof has not been prescribed for treatment of cancer and / or diabetes.

Thus, the present invention also provides a method of treating a disease or condition mediated by c-Met in an endothelial cell.

In an aspect, the invention provides a compound as described herein, such as defined in the claims, or a pharmaceutically acceptable salt thereof, per se. The compound may for instance be provided in the form of a solid dosage form, e.g. a salt form, such as a metal salt form.

In the compounds for use, uses and methods described above, the patient may in embodiments suitably be a patient that has not been diagnosed with cancer (particularly metastatic cancer) and / or diabetes.

Further embodiments of the compounds of the present invention

General

Various embodiments of the compounds of formulae (A)-(D) and (l)-(IV) are described in this application. It should also be understood below that where an embodiment of a compound of any of these formulae is further defined (i.e. by reference to the respective substituent groups), the definition also applies to pharmaceutically acceptable derivatives of the respective compounds. It is intended that features specified in each of these embodiments may be combined with other features specified in other embodiments to provide further embodiments of the invention. The skilled person will also appreciate that any chemically impossible compounds that would result from combining one of more of the embodiments below are not intended to be encompassed within the context of this invention.

Formulae (A)-(D):

In the invention, the compounds may be selected from formulae (A) to (D) and pharmaceutically acceptable derivatives thereof.

wherein the respective substituent groups may be as defined in any of the aspects and embodiments described herein.

The compounds may be selected from formulae (A) and (B). Alternatively they may be selected from (C) and (D). The compounds are typically of formula (A), but may alternatively be selected from formula (B), (C) or (D).

Six-membered rings:

The group represented by

is a 6-membered carbocyclic or heterocyclic ring. In typical

embodiments,

is a 6-membered carbocyclic ring. In alternative embodiments,

is a 6-membered heterocyclic ring. The carbocyclic and / or heterocyclic rings may be saturated or unsaturated. In typical embodiments, the carbocyclic and / or heterocyclic ring is unsaturated. For insta suitable embodiments, the carbocyclic and / or heterocyclic ring

is aromatic, e.g. each

may independently be a 6-membered aryl or heteroaryl ring.

Typically,

is a phenyl ring.

In the invention, the compounds may be selected from formulae (A1 ) and (B1 ):

wherein the respective substituent groups may be as defined in any of the aspects and embodiments described herein, e.g. embodiment d) or its sub-embodiments, above. Typically, compounds of the invention are of formula (A1 ):

wherein the respective substituent groups may be as defined in any of the aspects and embodiments described herein. In the invention, where

saturated, the compounds may be selected from formulae

(A2) and (B2):

wherein

C, D and E are each independently selected from the group consisting of CH₂, CHR¹⁰,

NH and NR¹⁰; and

R¹-R³, R¹⁰, J and Z are as defined elsewhere herein.

The compounds may for instance be according to formula (A2):

wherein groups R¹-R³, C-E, J and Z are as defined above.

Five membered rings:

In formulae (A) to (D), the group represented by

is a 5-membered carbocyclic or

heterocyclic ring. In embodiment

is a 5-membered carbocyclic ring. Alternatively,

may be a 5-membered heterocyclic ring. The ring may be saturated or unsaturated. The ring may be a saturated carbocyclic ring, e.g. cyclopentyl. Where

is a

5-membered heterocyclic ring, it may be heterocycloalkenyl or a heteroaryl ring le

5-membered aromatic rings include thiophene. For instance, in embodiments

is thienyl. For instance, formulae (C) and (D) may be selected from formulae (C1 )-(C2) and (D1 )- (D2), respectively:

wherein the respective substituent groups are as defined according to any aspect or embodiment described herein.

J group

In compounds of the present invention, J may be H, halo, optionally substituted Ci-i₀alkyl, optionally substituted C₃-i₀cycloalkyl, optionally substituted C_2-i₀alkenyl, optionally substituted C₃-i₀cycloalkenyl, optionally substituted C_2-i₀alkynyl, optionally substituted C₂-ioheteroalkyl, optionally substituted C_3-i₀heterocycloalkyl, optionally substituted C₂-ioheteroalkenyl, optionally substituted C -i₀heterocycloalkenyl, optionally substituted C_2-i₀heteroalkynyl, optionally

defined in the aspects or embodiments of the invention described above or below. In embodiments, J may be H, halo, optionally substituted C_1-10alkyl, optionally substituted C_2-10alkenyl, optionally substituted C₂-ioalkynyl, optionally substituted C₂-ioheteroalkyl, optionally substituted C₂-ioheteroalkenyl, optionally substituted C_2-10heteroalkynyl, or

In some embodiments, J is H, halo, optionally substituted Ci-i₀alkyl, optionally substituted C₃-i₀cycloalkyl, optionally substituted C_2-i₀heteroalkyl, optionally substituted

C₃-i₀heterocycloalkyl, or

wherein Q and R⁴-R⁶ are as defined above or further below.

In some embodiments, J is optionally substituted C_1-10alkyl, optionally substituted

C_2-10heteroalkyl, or , wherein Q and R⁴-R⁶ are as defined above or further

below. Typically, J is

, wherein Q and R⁴-R⁶ are as defined above or further below.

R⁴

Preferably, J is ^Rv R ^{B i} , wherein

R⁴-R⁶ are as defined herein above or below according to any aspect or embodiment thereof;

B is NR^B, O or S, wherein R^B is H or C_1-6alkyl; and

n is 1 , 2, 3, or 4, preferably 1 or 2, such as 1. Alternatively n may be 2. Z group

In the present invention, Z may be -0-, -N(R^A)-, -S-, or a Ci_-6alkylene or C_2-6heteroalkylene linker group, wherein the Ci_-6alkylene and C_2-6heteroalkylene linker groups are each independently optionally substituted with 1 to 3 substituents selected from halo, OH, Ci_-6alkyl, Ci_-6haloalkyl; -OSO₃H and -NH(SO₃H), and wherein R^A is H or Ci_-6alkyl.

In embodiments, Z is a C_1-6alkylene linker group optionally substituted with 1 to 3 substituents selected from halo, OH, C_1-6alkyl, Ci_-6haloalkyl, -OSO₃H and -NH(SO₃H). In suitable embodiments, Z is a C_2-6heteroalkylene linker group optionally substituted with 1 to 3 substituents selected from -OSO₃H and -NH(SO₃H). Z may for instance be an unsubstituted C₂-₆alkylene linker group, such as a methylene or ethylene group.

In embodiments, Z is a C_2-6heteroalkylene linker group optionally substituted with 1 to 3 substituents selected from halo, OH, C_1-6alkyl, Ci_-6haloalkyl, -OSO₃H and -NH(SO₃H); optionally wherein Z is a C_2-6heteroalkylene linker group. In suitable embodiments, Z is a C₂-₆heteroalkylene linker group optionally substituted with 1 to 3 substituents selected from -OSO₃H and -NH(SO₃H). Typically, Z is an unsubstituted C_2-6heteroalkylene linker group, such as where the heteroatom is O, e.g. -O-CH₂-.

Q group

In the present invention, Q may be -O-, -N(R^A)-, -S-, or a Ci_-6alkylene or C_2-6heteroalkylene linker group, wherein the Ci_-6alkylene and C_2-6heteroalkylene linker groups are each independently optionally substituted with 1 to 3 substituents selected from halo, OH, Ci_-6alkyl, Ci_-6haloalkyl; -OSO₃H and -NH(SO₃H), and wherein R^A is H or Ci_-6alkyl.

In embodiments, Q is a Ci_-6alkylene linker group optionally substituted with 1 to 3 substituents selected from halo, OH, Ci_-6alkyl, Ci_-6haloalkyl, -OSO₃H and -NH(SO₃H). In suitable embodiments, Q is a C_2-6heteroalkylene linker group optionally substituted with 1 to 3 substituents selected from -OSO₃H and -NH(SO₃H). Q may for instance be an unsubstituted C₂-₆alkylene linker group, such as a methylene or ethylene group.

In embodiments, Q is a C_2-6heteroalkylene linker group optionally substituted with 1 to 3 substituents selected from halo, OH, C_1-6alkyl, Ci_-6haloalkyl, -OSO₃H and -NH(SO₃H). In suitable embodiments, Q is a C_2-6heteroalkylene linker group optionally substituted with 1 to 3 substituents selected from -OS0₃H and -NH(S0₃H). Typically, Q is an unsubstituted C₂-₆heteroalkylene linker group, such as wherein the heteroatom is O, e.g. -0-CH₂-.

A and B groups

In embodiments of the present invention as recited in the respective formulae herein, A and / or B groups may be present. For instance, A and B groups are present in compounds of formula (I) or (II) as defined herein.

In compounds as defined herein, A may be NR^A, O or S, wherein R^A is H or Ci_-6alkyl. A may suitably be O or S. Alternatively, A may be NR^A wherein R^A is H or Ci_-6alkyl. R^A may for instance be H in such embodiments. Typically, A is O.

In compounds as defined herein, B may be NR^B, O or S, wherein R^B is H or Ci_-6alkyl. B may suitably be O or S. Alternatively, B may be NR^B wherein R^B is H or Ci_-6alkyl. R^B may for instance be H in such embodiments. Typically, B is O.

Typically, A may be O and B may be O. In embodiments, A may be O and B may be selected from NH, O and S. In another embodiment B may be O and A may be selected from NH, O and S.

m and n groups

In compounds of the present invention, m may be 1 , 2, 3 or 4, such as 1 or 2.

Typically m may be 1 , however, in some embodiments m may be 2.

In compounds of the present invention, n may be 1 , 2, 3 or 4, such as 1 or 2.

Typically n may be 2, however in some embodiments n may be 1 .

Typically m+n may be 3 or 4, typically 3, such as where m is 2 and n is 1 . In other embodiments, m+n may be 3 where m is 1 and n is 2. In embodiments, m+n may be 4.

In compounds of the present invention, m and n may each independently be 1 or 2.

C, D and E groups

In compounds of the invention, C, D and E may be present.

In embodiments of the invention, where

B1 and embodiments thereof), C, D and E may each may be independently selected from the group consisting of CH, CR¹⁰ and N, such as selected from CH and CR¹⁰, wherein R¹⁰ may be as defined herein above or below. In embodiments, C is CH or CR¹⁰. Alternatively C may be N. Typically C is CH. Where CR¹⁰ is present at C, R¹⁰ may suitably be halo, C_1-4alkyl or C_1-4haloalkyl, such as halo, CF or CCH₃.

In embodiments, D is CH or CR¹⁰. Alternatively D may be N. Typically D is CH. Where CR¹⁰ is present at D, R¹⁰ may suitably be halo, C_1-4alkyl, C_1-4haloalkyl or -OSO₃Y; optionally wherein R¹⁰ is halo, CF, CCH₃, or -OSO₃Y, such as -OSO₃Y, e.g. -OSO₃H.

In embodiments, E is CH or CR¹⁰. Alternatively E may be N. Typically E is CH. Where CR¹⁰ is present at E, R¹⁰ may suitably be halo, Ci_-4alkyl or Ci_-4haloalkyl, such as halo, CF or CCH₃.

C, D and E may each independently be selected from CH and N. In embodiments C, D and E may be N. In other embodiments C and E may be CH and D may be N. In typical embodiments C, D and E are each CH.

In embodiments of the invention, where

A2, B2 and embodiments thereof), e.g. saturated, C, D and E may each may be independently selected from the group consisting of CH₂, CHR¹⁰ , NR¹⁰ and NH, wherein R¹⁰ may be as defined herein above or below, such as selected from CH₂ or CHR¹⁰. In such embodiments, C may be CH₂ or CHR¹⁰. Alternatively C may be NH or NR¹⁰, e.g. NH. Typically, in such embodiments, C is CH₂. Where R¹⁰ is present, e.g. at position C as in the case of CHR¹⁰, R¹⁰ may suitably be halo, Ci_-4alkyl or Ci_-4haloalkyl, such as halo, CF or CCH₃. In embodiments, D is CH₂ or CHR¹⁰. Alternatively D may be NH or NR¹⁰, e.g. NH. Typically, in such embodiments, D is CH₂. Where R¹⁰ is present at D, e.g. as in the case of CHR¹⁰, R¹⁰ may suitably be halo, Ci_-4alkyl, Ci_-4haloalkyl or -OSO₃Y; optionally wherein R¹⁰ is halo, CF, CCH₃, or -OSO₃Y, such as -OSO₃Y, e.g. -OSO₃H. In such embodiments, E may be CH₂ or CHR¹⁰. Alternatively E may be NH or NR¹⁰, e.g. NH. Typically, in such embodiments, E is CH₂. Where R¹⁰ is present, e.g. at position E as in the case of CHR¹⁰, R¹⁰ may suitably be halo, Ci_-4alkyl or Ci_-4haloalkyl, such as halo, CF or CCH₃.

C, D and E may each independently be selected from CH₂ and NH. In embodiments C, D and E may be NH. In other embodiments C and E may be CH₂ and D may be NH. In typical embodiments C, D and E are each CH₂.

Group R

R¹ may be -CO₂W or a bioisostere of a carboxyl group. Typically, R¹ is -CO₂W. Suitable bioisosteres may, for instance be, heterocyclic bioisosteres, e.g. tetrazole. Others may be acyclic bioisosteres, e.g. amides, thioamides, ureas. W may be as defined herein above or below. W may be H, optionally substituted C_1-10alkyl, optionally substituted C_3-10cycloalkyl, optionally substituted C_2-10alkenyl, optionally substituted C_3-10cycloalkenyl, optionally substituted C_2-10alkynyl, optionally substituted C_2-10heteroalkyl, optionally substituted C_3-10heterocycloalkyl, optionally substituted C_2-10heteroalkenyl, optionally substituted C_3-10heterocycloalkenyl, optionally substituted C_2-10heteroalkynyl, optionally substituted C_6-14aryl or optionally substituted C_5-14heteroaryl.

Suitably, W is H, or optionally substituted C_1-10alkyl, C_3-10cycloalkyl, C₂-C₁₀heteroalkyl, C_3-10heterocycloalkyl, C_6-14aryl or C_5-14heteroaryl. In some embodiments, W is H, or optionally substituted C_1-10alkyl or C_3-10cycloalkyl. In other embodiments, W is H, or optionally substituted C_1-6alkyl, e.g. C_1-6alkyl.

In embodiments, W is H, optionally substituted Ci-i₀alkyl, or optionally substituted C₂-i₀heteroalkyl. For instance, W may be H or optionally substituted Ci-i₀alkyl, such as wherein W is H or Ci_-6alkyl. In yet further embodiments, W may preferably be H or methyl_. W may be H. W may be methyl.

Typically, where W is not H, it is not substituted. In embodiments, where the W group is not H and is substituted, the substituent(s) may be selected from the substituent groups described generally below, or may for instance be halo, e.g. fluoro.

Ft², Ft³, Ff and Ff groups

In the compounds of the invention, R² and R³ are each independently H, -OR⁷ or -NH(R⁷), wherein each R⁷ is independently selected from the group consisting of H, -SO₃Y, optionally substituted C_1-10alkyl, optionally substituted C_3-10cycloalkyl, optionally substituted C_2-10alkenyl, optionally substituted C_3-10cycloalkenyl, optionally substituted C_2-10alkynyl, optionally substituted C_2-10heteroalkyl, optionally substituted C_3-10heterocycloalkyl, optionally substituted C_2-10heteroalkenyl, optionally substituted C_3-10heterocycloalkenyl, optionally substituted C_2-10heteroalkynyl, optionally substituted C_6-14aryl and optionally substituted C_5-14heteroaryl, wherein at least one of R² and R³ is selected from -OSO₃Y and -NH(SO₃Y). Y may be as defined herein above or further below. Typically, in such instances, Y is H.

In this regard, it is an essential feature of the invention that at least R² or R³ is selected from -OSO₃Y and -NH(SOsY). Preferably, both R² and R³ are selected from -OSO₃Y and -NH(SOsY), particularly -OSO₃Y, e.g. -SO₃H. Thus, when R² and R³ are described independently below, the skilled person will understand that at least one of R² and R³ must be selected from -OSO₃Y and -NH(SO₃Y). R² may thus, in embodiments, be -NH(R⁷) or -OR⁷, preferably -OR⁷. Alternatively, R² may be H. In embodiments, R² is -OR⁷ or -NH(R⁷) wherein said R⁷ is -SO₃Y, e.g. wherein R² is

R³ may thus, in embodiments, be -NH(R⁷) or -OR⁷, preferably -OR⁷. Alternatively, R³ may be H. In embodiments, R³ is -OR⁷ or -NH(R⁷) wherein said R⁷ is -SO₃Y, e.g. wherein R³ is

For instance, R² and R³ may be selected independently from -OSO₃Y and -NH(SO₃Y), such as wherein both R² and R³ are -OSO₃Y (preferably wherein Y is H).

In the compounds of the invention, R⁴ and R⁵ may each be independently H, -OR⁸ or -NH(R⁸), wherein each R⁸ is independently selected from the group consisting of H, -SO₃Y, optionally substituted Ci-i₀alkyl, optionally substituted C₃-i₀cycloalkyl, optionally substituted C_2-i₀alkenyl, optionally substituted C₃-i₀cycloalkenyl, optionally substituted C_2-i₀alkynyl, optionally substituted C₂-ioheteroalkyl, optionally substituted C₃-i₀heterocycloalkyl, optionally substituted C₂-ioheteroalkenyl, optionally substituted C₃-i₀heterocycloalkenyl, optionally substituted C₂-i₀heteroalkynyl, optionally substituted C₆-i₄aryl and optionally substituted C_5-i₄heteroaryl. Y is as defined herein above or below.

R⁴ may thus, in embodiments, be -OR⁸ or -NH(R⁸), preferably -OR⁸. Alternatively, R⁴ may be H. In embodiments, R⁴ is -OR⁸ or -NH(R⁸) wherein said R⁸ is -SO₃Y, e.g. wherein R⁴ is

R⁵ may thus, in embodiments, be -OR⁸ or -NH(R⁸), preferably -OR⁸. Alternatively, R⁵ may be H. In embodiments, R⁵ is -OR⁸ or -NH(R⁸) wherein said R⁸ is -SO₃Y, e.g. wherein R⁵ is -OSO₃Y. R⁴ and R⁵ may for instance each be independently selected from H, or -SO₃Y.

In embodiments, at least one of R⁴ and R⁵ is selected from -OSO₃Y and -NH(SO₃Y), such as wherein R⁴ and R⁵ are each independently selected from -OSO₃Y and -NH(SO₃Y), e.g. wherein both R⁴ and R⁵ are -OSO₃Y.

In embodiments, at least two, and optionally three, of R², R³, R⁴ and R⁵ are -OSO₃Y. In some embodiments, R², R³ and R⁵ may be -SO₃Y whereas R⁴ may be H, wherein Y may be optionally substituted Ci-i₀alkyl, C₃-i₀cycloalkyl, C₂-Ci₀heteroalkyl or C₃-i₀heterocycloalkyl. In some embodiments, each of R², R³, R⁴ and R⁵ is -OSO₃Y.

In some embodiments, R² ≠ R³. Similarly, in some embodiments, R⁴ ≠ R⁵. In further embodiments, R²≠ R³ and R⁴≠ R⁵. In preferred embodiments, R²=R³. In some embodiments, R4≠ H. R⁶ groups

R⁶ is H, -CH₂OR⁹ or -CH₂NH(R⁹), wherein R⁹ is independently selected from the group consisting of H, -SO₃Y, optionally substituted C_1-10alkyl, optionally substituted C_3-10cycloalkyl, optionally substituted C_2-10alkenyl, optionally substituted C_3-10cycloalkenyl, optionally substituted C_2-10alkynyl, optionally substituted C_2-10heteroalkyl, optionally substituted C_3-10heterocycloalkyl, optionally substituted C_2-10heteroalkenyl, optionally substituted C_3-10heterocycloalkenyl, optionally substituted C_2-10heteroalkynyl, optionally substituted C_6-14aryl and optionally substituted C_5-14heteroaryl.

R⁶ may thus in embodiments be -CH₂OR⁹ or -CH₂NH(R⁹), preferably -CH₂OR⁹. Alternatively, R⁶ is typically H.

In embodiments, each of R², R³, R⁴ and R⁵ is -OSO₃Y and R⁶ is H. Alternatively, R², R³ and R⁵ may be -OSO₃Y, and R⁴ and R⁶ may each be H.

R⁷ groups

R⁷ groups may be present at R² and / or R³. Where present, each R⁷ group is, in embodiments of the invention, independently selected from the group consisting of H, -S0₃Y, optionally substituted C_1-10alkyl, optionally substituted C_3-10cycloalkyl, optionally substituted C_2-10alkenyl, optionally substituted C_3-10cycloalkenyl, optionally substituted C_2-10alkynyl, optionally substituted C_2-10heteroalkyl, optionally substituted C_3-10heterocycloalkyl, optionally substituted C_2-10heteroalkenyl, optionally substituted C_3-10heterocycloalkenyl, optionally substituted C_2-10heteroalkynyl, optionally substituted C_6-14aryl and optionally substituted C_5-14heteroaryl.

In embodiments, each R⁷ is independently selected from the group consisting of H, -S0₃Y, optionally substituted C_1-10alkyl, optionally substituted C_2-10heteroalkyl, optionally substituted C_6-14aryl and optionally substituted C_5-14heteroaryl. Each R⁷ may for instance be independently selected from the group consisting of H, -S0₃Y and optionally substituted C_1-10alkyl, such as wherein each R⁷ is independently selected from the group consisting of H and -S0₃Y, e.g. wherein each R⁷ is -S0₃Y.

The optional substituents of R⁷ groups may be as described in the general substituents section below. In embodiments, optional R⁷ substituents may for instance be selected from OH, NH₂, halo, Ci_-4alkyl, Ci_-4haloalkyl. The optionally substituted Ci-i₀alkyl may be unsubstituted, e.g. Ci_-6alkyl. R⁸ groups

In the compounds of formula (A) to (D), or pharmaceutically acceptable derivatives thereof, each R⁸ may be independently selected from the group consisting of H, -S0₃Y, optionally substituted C_1-10alkyl, optionally substituted C_3-10cycloalkyl, optionally substituted C_2-10alkenyl, optionally substituted C_3-10cycloalkenyl, optionally substituted C_2-10alkynyl, optionally substituted C₂-ioheteroalkyl, optionally substituted C_3-10heterocycloalkyl, optionally substituted C₂-ioheteroalkenyl, optionally substituted C_3-10heterocycloalkenyl, optionally substituted C_2-10heteroalkynyl, optionally substituted C_6-14aryl and optionally substituted C_5-14heteroaryl.

In embodiments, each R⁸ is independently selected from the group consisting of H, -S0₃Y, optionally substituted Ci-i₀alkyl, optionally substituted C_2-i₀heteroalkyl, optionally substituted C₆-i₄aryl and optionally substituted C_5-i₄heteroaryl. Each R⁸ may for instance be independently selected from the group consisting of H, -S0₃Y and optionally substituted Ci-i₀alkyl, such as wherein each R⁸ is independently selected from the group consisting of H and -S0₃Y, e.g. wherein each R⁸ is -S0₃Y. The optionally substituted Ci-i₀alkyl may be unsubstituted, e.g. Ci_-6alkyl.

R⁹ groups

In the compounds of formula (A) to (D), or pharmaceutically acceptable derivatives thereof, each R⁹ may be independently selected from the group consisting of H, -S0₃Y, optionally substituted C_1-10alkyl, optionally substituted C_3-10cycloalkyl, optionally substituted C_2-10alkenyl, optionally substituted C_3-10cycloalkenyl, optionally substituted C_2-10alkynyl, optionally substituted C_2-10heteroalkyl, optionally substituted C_3-10heterocycloalkyl, optionally substituted C_2-10heteroalkenyl, optionally substituted C_3-10heterocycloalkenyl, optionally substituted C_2-10heteroalkynyl, optionally substituted C_6-14aryl and optionally substituted C_5-14heteroaryl.

In embodiments, each R⁹ is independently selected from the group consisting of H, -S0₃Y, optionally substituted C_1-10alkyl, optionally substituted C_2-10heteroalkyl, optionally substituted C_6-14aryl and optionally substituted C_5-14heteroaryl. Each R⁹ may for instance be independently selected from the group consisting of H, -S0₃Y and optionally substituted C_1-10alkyl, such as wherein each R⁹ is independently selected from the group consisting of H and -S0₃Y, e.g. wherein each R⁹ is -S0₃Y. The optionally substituted C_1-10alkyl may be unsubstituted, e.g. C_{1 -6}alkyl.

R¹⁰ groups

In embodiments of the above aspects or embodiments thereof, each R¹⁰, where present, may be independently selected from the group consisting of halo, Ci_-4alkyl, Ci_-4haloalkyl, -OS0₃Y and -NH(S0₃Y). Each R¹⁰, where present, may, for instance, be independently selected from the group consisting of halo, C_1-4alkyl, C_1-4haloalkyl and -OS0₃Y. Each R10 may be halo, e.g. F, CI, Br or I. Each R¹⁰ may be Ci_-4haloalkyl, e.g. CF or CF₃. Suitably, R¹⁰ may be -S0₃Y, wherein Y is as described herein above or below, e.g. -S0₃H. Each R¹⁰, where present, may be independently selected from CF, CCH₃, CF₃ and -OS0₃Y, e.g. -S0₃H. Typically, where an R¹⁰ group is present, only 1 R¹⁰ group is present, e.g. wherein s is 1 or t is 1 . Typically R¹⁰ is not present. Thus, these embodiments for R¹⁰ may apply to any embodiment of C, D and or E recited herein above, or below, e.g. as claimed.

s and t groups

s may be an integer selected from 0-3. Typically s is 0. s may, however be 1 . s may be 2. s may alternatively be 3.

Similarly, t may be an integer selected from 0-2. Typically t is 0. t may, however be 1 . Alternatively, t may be 2.

Y group

Group Y may be H, optionally substituted C_1-10alkyl, optionally substituted C_3-10cycloalkyl, optionally substituted C_2-10alkenyl, optionally substituted C_3-10cycloalkenyl, optionally substituted C_2-10alkynyl, optionally substituted C₂-ioheteroalkyl, optionally substituted C_3-10heterocycloalkyl, optionally substituted C₂-ioheteroalkenyl, optionally substituted C_3-10heterocycloalkenyl, optionally substituted C_2-10heteroalkynyl, optionally substituted C_6-14aryl or optionally substituted C_5-14heteroaryl. In embodiments, Y may be optionally substituted C_1-10alkyl, C_3-10cycloalkyl, C₂-C₁₀heteroalkyl or C_3-10heterocycloalkyl. In some embodiments, Y may be C_1-10alkyl or C_3-10cycloalkyl. In further embodiments, Y may be C₂- C₁₀heteroalkyl or C_3-10heterocycloalkyl. In yet further embodiments, Y may be C_6-14aryl or C_5-14heteroaryl. More particularly, Y may be H or C_1-6alkyl. Even more particularly, Y may be H or C_1-10alkyl, particularly C_1-4alkyl, for example, methyl.

In typical embodiments, Y is independently selected from H and optionally substituted C_{1 -10}alkyl; optionally wherein each Y is independently selected from H and C_1-6alkyl, such as wherein each Y is H.

Stereochemistry

In some embodiments, the stereochemistry of the centre to which R² is bonded is S. In other embodiments, the stereochemistry of the centre to which R² is bonded is R. Similarly, in embodiments, the stereochemistry of the centre to which R⁴ is bonded is S. In other embodiments, the stereochemistry of the centre to which R⁴ is bonded is R. In some embodiments, the stereochemistry of the centres to which R² and R⁴ are bonded are both R. In other embodiments, the stereochemistry of the centres to which R² and R⁴ are bonded are both S. In further embodiments the stereochemistry of the centre to which R² is bonded is R whereas the stereochemistry of the centre to which R⁴ is bonded is S. In yet further embodiments the stereochemistry of the centre to which R² is bonded is S whereas the stereochemistry of the centre to which R⁴ is bonded is R.

Where

is not aromatic, further stereocentres may be present in the ring where the respective J, Z and optionally R¹⁰ groups are bonded to the ring. All enantiomeric and diastereomeric embodiments are intended to encompassed by the present invention. Individual enantiomers / diastereomers are included within the scope of the invention. Mixtures of isomers, e.g. racemic mixtures and / or diastereomeric mixtures may also be provided.

Substituents

Optionally substituted groups of the compounds of the invention (e.g. alkyl, cycloalkyl, alkoxy, alkenyl, cycloalkenyl, alkynyl, alkylene, alkenylene, heteroalkyl, heterocycloalkyl, heteroalkenyl, heterocycloalkenyl, heteroalkynyl, heteroalkylene, heteroalkenylene, aryl, arylalkyi, arylheteroalkyi, heteroaryl, heteroarylalkyi or heteroarylheteroalkyi groups, etc.) may be substituted or unsubstituted, for instance unsubstituted. Typically, substitution involves the notional replacement of a hydrogen atom with a substituent group, or two hydrogen atoms in the case of substitution by =O.

Where substituents are present, there may, for instance, be from 1 to 6 substituents, depending on the available substituent positions of the group. Typically there will be from 1 to 3 substituents, in embodiments 1 or 2 substituents, such as only 1 substituent.

In such embodiments, the optional substituent(s) is/are independently halogen, C_1-6haloalkyl (e.g. trihalomethyl, trihaloethyl), -OH, -NH₂, -NO₂, -CN, -N⁺(Ci_-6alkyl)₂O^", -CO₂H, -CO₂Ci_-6alkyl, -SO₃H, -OSO₃H, -OSO₃Ci_-6alkyl, -NHSO₃H, -NHSO₃Ci_-6alkyl, -N(Ci_-6alkyl)SO₃H, -N(d. ₆alkyl)SO₃Ci_-6alkyl, -SOCi_-6alkyl, -SO₂Ci_-6alkyl, -SO₃Ci_-6alkyl, -OC(=O)OCi_-6alkyl, -C(=O)H,

=O, -N(Ci_-6alkyl)₂, -C(=O)NH₂,

-N(Ci_-6alkyl)C(-O)O(Ci_-6alkyl),

-SO₂N(Ci_-6alkyl)₂, -N(Ci_-6alkyl)SO₂Ci_-6alkyl, -N(Ci_-6alkyl)C(=S)N(Ci_-6alkyl)₂, -N(Ci_-6alkyl)SO₂N(Ci_-6alkyl)₂, -Ci_-6alkyl, -C_2-6heteroalkyl, -C_3-6cycloalkyl, -C_3-6heterocycloalkyl, -C_2-6alkenyl, -C_2-6heteroalkenyl, -C_3-6cycloalkenyl, -C_3-6heterocycloalkenyl, -C_2-6alkynyl, -C_2-6heteroalkynyl, -Z^u-Ci_-6alkyl, -Z^u- C_3-6cycloalkyl, -Z^u-C_2-6alkenyl, -Z^u-C₃-₆cycloalkenyl or -Z^u-C_2-6alkynyl, wherein

Z^u is independently O, S, NH or N(Ci_-6alkyl).

In another embodiment, the optional substituent(s) is/are independently halogen, trihalomethyl, trihaloethyl, -OS0₃H, -OS0₃Ci_-6alkyl, -NHSO₃H, -NHS0₃Ci_-6alkyl, -N(C_1-6alkyl)S0₃H, -N(C_1-6alkyl)S0₃C_1-6alkyl, -OH, -NH₂, -NO₂, -CN, -N⁺(C_1-6alkyl)₂O^", -CO₂H, -SOCi_-6alkyl, -SO₂Ci_-6alkyl,

=O, -N(Ci_-6alkyl)₂, -C(=O)NH₂, -C_1-6alkyl, -C_3-6cycloalkyl, -C_3-6heterocycloalkyl, -Z^uC_1-6alkyl or -Z^u-C_3-6cycloalkyl, wherein Z^u is defined above.

In another embodiment, the optional substituent(s) is/are independently halogen, trihalomethyl, -OH, -CO₂H, -SO₃H, -OSO₃H, -NHSO₃Ci_-6alkyl, -SOCi_-6alkyl, -SO₂Ci_-6alkyl,

=O, -Ci_-6alkyl, -C_3-6cycloalkyl, -C_3-6heterocycloalkyl, -Z^uCi_-6alkyl or - Z^u-C_3-6cycloalkyl, wherein Z^u is defined above.

In another embodiment, the optional substituent(s) is/are independently halogen, -OH, -CO₂H or -OSO₃H.

In another embodiment, the optional substituent(s) is/are independently -CO₂H, -OSO₃H, e.g. -OSO₃H.

Specific compounds

The invention provides the following specific compounds:

Methyl 5-(2,3-bis(sulfooxy)propoxy)-2-(2,3-bis(sulfooxy)propoxy)benzoate;

2-(2,3-Bis(sulfooxy)propoxy)-5-(2,3-bis(sulfooxy)propoxy)benzoic acid; and

Methyl 5-(2,3-bis(sulfooxy)propoxy)-2-(4-(sulfooxy)butoxy)benzoate;

and pharmaceutically acceptable derivatives thereof.

In embodiments, the invention provides the following specific compounds:

Methyl 5-(( ^:?)-2,3-bis(sulfooxy)propoxy)-2-((S)-2,3-bis(sulfooxy)propoxy)benzoate;

Methyl 5-(( ^:?)-2,3-bis(sulfooxy)propoxy)-2-(( ^:?)-2,3-bis(sulfooxy)propoxy)benzoate;

Methyl 5-((S)-2,3-bis(sulfooxy)propoxy)-2-((S)-2,3-bis(sulfooxy)propoxy)benzoate;

Methyl 5-((S)-2,3-bis(sulfooxy)propoxy)-2-(( ^:?)-2,3-bis(sulfooxy)propoxy)benzoate; 2-(( ^:?)-2_!3-Bis(sulfooxy)propoxy)-5-((S)-2_!3-bis(sulfooxy)propoxy)benzoic acid;

2-(( ^:?)-2_!3-Bis(sulfooxy)propoxy)-5-(( ^:? -2_!3-bis(sulfooxy)propoxy)benzoic acid;

2-((S)-2,3-Bis(sulfooxy)propoxy)-5-((S)-2,3-bis(sulfooxy)propoxy)benzoic acid;

2-((S)-2,3-Bis(sulfooxy)propoxy)-5-(( ^:? -2_!3-bis(sulfooxy)propoxy)benzoic acid;

Methyl (fl)-5-(2,3-bis(sulfooxy)propoxy)-2-(4-(sulfooxy)butoxy)benzoate; and

Methyl (S)-5-(2,3-bis(sulfooxy)propoxy)-2-(4-(sulfooxy)butoxy)benzoate;

and pharmaceutically acceptable derivatives thereof.

In embodiments, the invention provides the following specific compounds:

Methyl 5-(( ^:?)-2_!3-bis(sulfooxy)propoxy)-2-((S)-2_!3-bis(sulfooxy)propoxy)benzoate;

2-(( ^:?)-2_!3-Bis(sulfooxy)propoxy)-5-((S)-2_!3-bis(sulfooxy)propoxy)benzoic acid;

Methyl (fl)-5-(2,3-bis(sulfooxy)propoxy)-2-(4-(sulfooxy)butoxy)benzoate; and

Methyl (S)-5-(2,3-bis(sulfooxy)propoxy)-2-(4-(sulfooxy)butoxy)benzoate;

and pharmaceutically acceptable derivatives thereof.

Chemical Groups

Halo

The term "halogen" (or "halo") includes fluorine, chlorine, bromine and iodine.

Alkyl, alkylene, alkenyl, alkynyl, cycloalkyi etc.

The terms "alkyl", "alkylene", "alkenyl" or "alkynyl" are used herein to refer to both straight and branched chain acyclic forms. Cyclic analogues thereof are referred to as cycloalkyi, etc.

The term "alkyl" includes monovalent, straight or branched, saturated, acyclic hydrocarbyl groups. In embodiments, alkyl is Ci-i₀alkyl, in another embodiment Ci_-6alkyl, in another embodiment Ci_-4alkyl, such as methyl, ethyl, n-propyl, i-propyl or t-butyl groups.

The term "cycloalkyi" includes monovalent, saturated, cyclic hydrocarbyl groups. In one embodiment cycloalkyi is C₃-i₀cycloalkyl, in another embodiment C_3-6cycloalkyl such as cyclopentyl and cyclohexyl.

The term "alkoxy" means alkyl-O-.

The term "alkylamino" means alkyl-NH-. The term "alkylthio" means alkyl-S(0)_r, wherein t is defined below.

The term "haloalkyi" refers to an alkyl group wherein at least one H is replaced by a halo group. In embodiments, haloalkyi refers to substitution by from 1 -3 halo groups, e.g. 1 . Examples include trihalomethyl, trihaloethyl, e.g. trifluoromethyl, etc.

The term "alkenyl" includes monovalent, straight or branched, unsaturated, acyclic hydrocarbyl groups having at least one carbon-carbon double bond and, in one embodiment, no carbon- carbon triple bonds. In one embodiment alkenyl is C_2-i ₀alkenyl, in another embodiment C₂-₆alkenyl, in another embodiment C₂-₄alkenyl.

The term "cycloalkenyl" includes monovalent, partially unsaturated, cyclic hydrocarbyl groups having at least one carbon-carbon double bond and, in one embodiment, no carbon-carbon triple bonds. In embodiments, cycloalkenyl is C₃-i₀cycloalkenyl, in another embodiment C_5-10cycloalkenyl, e.g. cyclohexenyl or benzocyclohexyl.

The term "alkynyl" includes monovalent, straight or branched, unsaturated, acyclic hydrocarbyl groups having at least one carbon-carbon triple bond and, in one embodiment, no carbon- carbon double bonds. In one embodiment, alkynyl is C_2-10alkynyl, in another embodiment C_2-6alkynyl, in another embodiment C_2-4alkynyl.

The term "alkylene" includes divalent, straight or branched, saturated, acyclic hydrocarbyl groups. In one embodiment alkylene is C_1-10alkylene, in another embodiment C_1-6alkylene, in another embodiment C_1-4alkylene, such as methylene, ethylene, n-propylene, i-propylene or t- butylene groups.

The term "alkenylene" includes divalent, straight or branched, unsaturated, acyclic hydrocarbyl groups having at least one carbon-carbon double bond and, in one embodiment, no carbon- carbon triple bonds. In one embodiment alkenylene is C_2-10alkenylene, in another embodiment C_2-6alkenylene, in another embodiment C_2-4alkenylene.

Heteroalkyl, etc.

The term "heteroalkyl" includes alkyl groups in which up to three carbon atoms, in one embodiment up to two carbon atoms, in another embodiment one carbon atom, are each replaced independently by O, S(0)_t or N, provided at least one of the alkyl carbon atoms remains. The heteroalkyl group may be C-linked or hetero-linked, i.e. it may be linked to the remainder of the molecule through a carbon atom or through O, S(0)_t or N, wherein t is defined below.

The term "heterocycloalkyi" includes cycloalkyi groups in which up to three carbon atoms, in one embodiment up to two carbon atoms, in another embodiment one carbon atom, are each replaced independently by O, S(0)_t or N, provided at least one of the cycloalkyl carbon atoms remains. Examples of heterocycloalkyl groups include oxiranyl, thiaranyl, aziridinyl, oxetanyl, thiatanyl, azetidinyl, tetrahydrofuranyl, tetrahydrothiophenyl, pyrrolidinyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, 1 ,4-dioxanyl, 1 ,4-oxathianyl, morpholinyl, 1 ,4-dithianyl, piperazinyl, 1 ,4-azathianyl, oxepanyl, thiepanyl, azepanyl, 1 ,4-dioxepanyl, 1 ,4-oxathiepanyl, 1 ,4-oxaazepanyl, 1 ,4-dithiepanyl, 1 ,4-thieazepanyl and 1 ,4-diazepanyl. The heterocycloalkyl group may be C-linked or N-linked, i.e. it may be linked to the remainder of the molecule through a carbon atom or through a nitrogen atom.

The term "heteroalkenyl" includes alkenyl groups in which up to three carbon atoms, in one embodiment up to two carbon atoms, in another embodiment one carbon atom, are each replaced independently by O, S(0)_t or N, provided at least one of the alkenyl carbon atoms remains. The heteroalkenyl group may be C-linked or hetero-linked, i.e. it may be linked to the remainder of the molecule through a carbon atom or through O, S(0)_t or N.

The term "heterocycloalkenyl" includes cycloalkenyl groups in which up to three carbon atoms, in one embodiment up to two carbon atoms, in another embodiment one carbon atom, are each replaced independently by O, S(0)_t or N, provided at least one of the cycloalkenyl carbon atoms remains. Examples of heterocycloalkenyl groups include 3,4-dihydro-2H- pyranyl, 5-6-dihydro-2H-pyranyl, 2H-pyranyl, 1 ,2,3,4-tetrahydropyridinyl and 1 ,2,5,6- tetrahydropyridinyl. The heterocycloalkenyl group may be C-linked or N-linked, i.e. it may be linked to the remainder of the molecule through a carbon atom or through a nitrogen atom.

The term "heteroalkynyl" includes alkynyl groups in which up to three carbon atoms, in one embodiment up to two carbon atoms, in another embodiment one carbon atom, are each replaced independently by O, S(0)_t or N, provided at least one of the alkynyl carbon atoms remains. The heteroalkynyl group may be C-linked or hetero-linked, i.e. it may be linked to the remainder of the molecule through a carbon atom or through O, S(0)_t or N.

The term "heteroalkylene" includes alkylene groups in which up to three carbon atoms, in one embodiment up to two carbon atoms, in another embodiment one carbon atom, are each replaced independently by O, S(0)_t or N, provided at least one of the alkylene carbon atoms remains.

The term "heteroalkenylene" includes alkenylene groups in which up to three carbon atoms, in one embodiment up to two carbon atoms, in another embodiment one carbon atom, are each replaced independently by O, S(0)_t or N, provided at least one of the alkenylene carbon atoms remains. Aryl

The term "aryl" includes monovalent, aromatic, cyclic hydrocarbyl groups, such as phenyl or naphthyl (e.g. 1 -naphthyl or 2-naphthyl). In general, the aryl groups may be monocyclic or polycyclic fused ring aromatic groups. Preferred aryl groups are C₆-C₁₄aryl.

Other examples of aryl groups are monovalent derivatives of aceanthrylene, acenaphthylene, acephenanthrylene, anthracene, azulene, chrysene, coronene, fluoranthene, fluorene, as- indacene, s-indacene, indene, naphthalene, ovalene, perylene, phenalene, phenanthrene, picene, pleiadene, pyrene, pyranthrene and rubicene.

The term "arylalkyl" means alkyl substituted with an aryl group, e.g. benzyl.

Heteroaryl

The term "heteroaryl" includes aryl groups in which one or more carbon atoms are each replaced by heteroatoms independently selected from O, S, N and NR^N, where R^N is defined below (and in one embodiment is H or alkyl (e.g. C_1-6alkyl)).

In general, the heteroaryl groups may be monocyclic or polycyclic (e.g. bicyclic) fused ring heteroaromatic groups. Typically, heteroaryl groups contain 5-14 ring members (preferably 5-10 members) wherein 1 , 2, 3 or 4 ring members are independently selected from O, S, N and NR^N. In one embodiment, a heteroaryl group may be 5, 6, 9 or 10 membered, e.g. 5- membered monocyclic, 6-membered monocyclic, 9-membered fused-ring bicyclic or 10- membered fused-ring bicyclic.

Monocyclic heteroaromatic groups include heteroaromatic groups containing 5-6 ring members wherein 1 , 2, 3 or 4 ring members are independently selected from O, S, N or NR^N.

In one embodiment, 5-membered monocyclic heteroaryl groups contain 1 ring member which is an -NR^N- group, an -O- atom or an -S- atom and, optionally, 1 -3 ring members (e.g. 1 or 2 ring members) which are =N- atoms (where the remainder of the 5 ring members are carbon atoms).

Examples of 5-membered monocyclic heteroaryl groups are pyrrolyl, furanyl, thiophenyl, pyrazolyl, imidazolyl, isoxazolyl, oxazolyl, isothiazolyl, thiazolyl, 1 ,2,3 triazolyl, 1 ,2,4 triazolyl, 1 ,2,3 oxadiazolyl, 1 ,2,4 oxadiazolyl, 1 ,2,5 oxadiazolyl, 1 ,3,4 oxadiazolyl, 1 ,3,4 thiadiazolyl, pyridyl, pyrimidinyl, pyridazinyl, pyrazinyl, 1 ,3,5 triazinyl, 1 ,2,4 triazinyl, 1 ,2,3 triazinyl and tetrazolyl.

Examples of 6-membered monocyclic heteroaryl groups are pyridinyl, pyridazinyl, pyrimidinyl and pyrazinyl. In one embodiment, 6-membered monocyclic heteroaryl groups contain 1 or 2 ring members which are =N- atoms (where the remainder of the 6 ring members are carbon atoms).

Bicyclic heteroaromatic groups include fused-ring heteroaromatic groups containing 9-14 ring members wherein 1 , 2, 3, 4 or more ring members are independently selected from O, S, N or NR^N.

In one embodiment, 9-membered bicyclic heteroaryl groups contain 1 ring member which is an -NR^N- group, an -O- atom or an -S- atom and, optionally, 1 -3 ring members (e.g. 1 or 2 ring members) which are =N- atoms (where the remainder of the 9 ring members are carbon atoms).

Examples of 9-membered fused-ring bicyclic heteroaryl groups are benzofuranyl, benzothiophenyl, indolyl, benzimidazolyl, indazolyl, benzotriazolyl, pyrrolo[2,3-b]pyridinyl, pyrrolo[2,3-c]pyridinyl, pyrrolo[3,2-c]pyridinyl, pyrrolo[3,2-b]pyridinyl, imidazo[4,5-b]pyridinyl, imidazo[4,5-c]pyridinyl, pyrazolo[4,3-d]pyridinyl, pyrazolo[4,3-c]pyridinyl, pyrazolo[3,4- c] pyridinyl, pyrazolo[3,4-b]pyridinyl, isoindolyl, indazolyl, purinyl, indolininyl, imidazo[1 ,2- a] pyridinyl, imidazo[1 ,5-a]pyridinyl, pyrazolo[1 ,2-a]pyridinyl, pyrrolo[1 ,2-b]pyridazinyl and imidazo[1 ,2-c]pyrimidinyl.

In one embodiment, 10-membered bicyclic heteroaryl groups contain 1 -3 ring members which are =N- atoms (where the remainder of the 10 ring members are carbon atoms).

Examples of 10-membered fused-ring bicyclic heteroaryl groups are quinolinyl, isoquinolinyl, cinnolinyl, quinazolinyl, quinoxalinyl, phthalazinyl, 1 ,6-naphthyridinyl, 1 ,7-naphthyridinyl, 1 ,8- naphthyridinyl, 1 ,5-naphthyridinyl, 2,6-naphthyridinyl, 2,7-naphthyridinyl, pyrido[3,2- d] pyrimidinyl, pyrido[4,3-d]pyrimidinyl, py rido [3 ,4-d] pyri m id inyl , pyrido[2,3-d]pyrimidinyl, pyrido[2,3-b]pyrazinyl, pyrido[3,4-b]pyrazinyl, pyrimido[5,4-d]pyrimidinyl, pyrazino[2,3- b] pyrazinyl and pyrimido[4,5-d]pyrimidinyl.

The term "heteroarylalkyl" means alkyl substituted with a heteroaryl group.

General

Unless indicated explicitly otherwise, where combinations of groups are referred to herein as one moiety, e.g. arylalkyi, the last mentioned group contains the atom by which the moiety is attached to the rest of the molecule.

Where reference is made to a carbon atom of an alkyl group or other group being replaced by O, S(0)_t or N, what is intended is that:

— CH— — N—

I is replaced by I -CH= is replaced by -N=;

≡C-H is replaced by≡N; or

-CH₂- is replaced by -0-, -S(0)_t- or -NR^N-.

By way of clarification, in relation to the above mentioned heteroatom containing groups (such as heteroalkyl etc.), where a numerical of carbon atoms is given, for instance C_3-6heteroalkyl, what is intended is a group based on C_3-6alkyl in which one of more of the 3-6 chain carbon atoms is replaced by O, S(0)_t or N. Accordingly, a C₃-₆heteroalkyl group, for example, will contain less than 3-6 chain carbon atoms.

Where mentioned above, R^N is H, alkyl, cycloalkyl, aryl, heteroaryl, -C(0)-alkyl, -C(0)-aryl, -C(0)-heteroaryl, -S(0)_t-alkyl, -S(0)_t-aryl or -S(0)_t-heteroaryl. R^N may, in particular, be H, alkyl (e.g. C_1-6alkyl) or cycloalkyl (e.g. C_3-6cycloalkyl).

Where mentioned above, t is independently 0, 1 or 2, for example 2. Typically, t is 0.

Where a group has at least 2 positions which may be substituted, the group may be substituted by both ends of an alkylene or heteroalkylene chain to form a cyclic moiety.

Compounds of the invention and and derivatives thereof

As used herein, unless it is detailed otherwise, the terms "compounds of the invention" and "compound of formula (A), (B), (C), (D), (I)," etc. include pharmaceutically acceptable derivatives thereof, polymorphs, isomers and isotopically labelled variants thereof. It is thus intended that this applies to all other formulae describing compounds according to the present invention as described herein and their pharmaceutically acceptable derivatives and embodiments thereof disclosed herein.

Pharmaceutically acceptable derivatives

The term "pharmaceutically acceptable derivative" herein includes any pharmaceutically acceptable salt, solvate (e.g. hydrate) or prodrug. In an embodiment, the pharmaceutically acceptable derivative is a pharmaceutically acceptable salt, solvate (e.g. hydrate) of the compound, i.e. compound of formula (I), typically a pharmaceutically acceptable salt thereof. In other words, the term "pharmaceutically acceptable salt" may thus optionally replace the term "pharmaceutically acceptable derivative" as recited anywhere herein.

Pharmaceutically acceptable salts

The term "pharmaceutically acceptable salt" includes a salt prepared from pharmaceutically acceptable non-toxic acids or bases including inorganic or organic acids and bases. Compounds of the invention that contain basic, e.g. amino, groups are capable of forming pharmaceutically acceptable salts with acids. In one embodiment, pharmaceutically acceptable acid addition salts of the compounds of the invention include, but are not limited to, those of inorganic acids such as hydrohalic acids (e.g. hydrochloric, hydrobromic and hydroiodic acid), sulfuric acid, nitric acid and phosphoric acids. In one embodiment, pharmaceutically acceptable acid addition salts of the compounds of the invention include, but are not limited to, those of organic acids such as aliphatic, aromatic, carboxylic and sulfonic classes of organic acids, examples of which include: aliphatic monocarboxylic acids such as formic acid, acetic acid, propionic acid or butyric acid; aliphatic hydroxy acids such as lactic acid, citric acid, tartaric acid or malic acid; dicarboxylic acids such as maleic acid or succinic acid; aromatic carboxylic acids such as benzoic acid, p-chlorobenzoic acid, phenylacetic acid, diphenylacetic acid or triphenylacetic acid; aromatic hydroxyl acids such as o-hydroxybenzoic acid, p-hydroxybenzoic acid, 1 -hydroxynaphthalene-2-carboxylic acid or 3-hydroxynaphthalene-2-carboxylic acid; and sulfonic acids such as methanesulfonic acid, ethanesulfonic acid or benzenesulfonic acid. Other pharmaceutically acceptable acid addition salts of the compounds of the invention include, but are not limited to, those of glycolic acid, glucuronic acid, furoic acid, glutamic acid, anthranilic acid, salicylic acid, mandelic acid, embonic (pamoic) acid, pantothenic acid, stearic acid, sulfanilic acid, algenic acid and galacturonic acid. Wherein the compound of the invention comprises a plurality of basic groups, multiple centres may be protonated to provide multiple salts, e.g. di- or tri-salts of compounds of the invention. For example, a hydrohalic acid salt of a compound of the invention as described herein may be a monohydrohalide, dihydrohalide or trihydrohalide, etc. In one embodiment, the salts include, but are not limited to those resulting from addition of any of the acids disclosed above. In one embodiment of the compound of the invention, two basic groups form acid addition salts. In a further embodiment, the two addition salt counterions are the same species, e.g. dihydrochloride, dihydrosulphide etc. Typically, the pharmaceutically acceptable salt is may be a hydrochloride salt, such as a dihydrochloride salt.

Compounds of the invention which contain acidic, e.g. carboxyl and / or -S0₃H groups are capable of forming pharmaceutically acceptable salts with bases. In embodiments, pharmaceutically acceptable basic salts of the compounds of the invention include, but are not limited to, metal salts such as alkali metal or alkaline earth metal salts (e.g. sodium, potassium, magnesium or calcium salts) and zinc or aluminium salts. In one embodiment, pharmaceutically acceptable basic salts of the compounds of the invention include, but are not limited to, salts formed with ammonia or pharmaceutically acceptable organic amines or heterocyclic bases such as ethanolamines {e.g. diethanolamine), benzylamines, N-methyl- glucamine, amino acids (e.g. lysine) or pyridine.

Hemisalts of acids and bases may also be formed, e.g. hemisulphate salts.

Pharmaceutically acceptable salts of compounds of the invention may be prepared by methods well-known in the art. Thus, in typical embodiments of the aspects and embodiments of the invention, the pharmaceutically acceptable derivative thereof is a base addition salt, such as a metal salt (e.g. a sodium salt), or a salt formed using ammonia, a pharmaceutically acceptable organic amine or a heterocyclic base.

For a review of pharmaceutically acceptable salts, see Stahl and Wermuth, Handbook of Pharmaceutical Salts: Properties, Selection and Use (Wiley-VCH, Weinheim, Germany, 2002).

Prodrugs

The invention includes prodrugs of the compounds of the invention. Prodrugs are derivatives of compounds of the invention (which may have little or no pharmacological activity themselves), which can, when administered in vivo, be converted into compounds of the invention.

Prodrugs can, for example, be produced by replacing functionalities present in the compounds of the invention with appropriate moieties which are metabolized in w o to form a compound of the invention. The design of prodrugs is well-known in the art, as discussed in Bundgaard, Design of Prodrugs 1985 (Elsevier), The Practice of Medicinal Chemistry 2003, 2^nd Ed, 561 - 585 and Leinweber, Drug Metab. Res. 1987, 18: 379.

Examples of prodrugs of compounds of the invention are esters and amides of the compounds of the invention. For example, where the compound of the invention contains a carboxylic acid group (-COOH) and / or sulfonic acid group (-OS0₃H) the hydrogen atom of the acid group may be replaced in order to form an ester (e.g. the hydrogen atom may be replaced by C^. ₆alkyl). Where the compound of the invention contains an alcohol group (-OH), the hydrogen atom of the alcohol group may be replaced in order to form an ester (e.g. the hydrogen atom may be replaced by -C(0)Ci_-6alkyl. Where the compound of the invention contains a primary or secondary amino group, one or more hydrogen atoms of the amino group may be replaced in order to form an amide (e.g. one or more hydrogen atoms may be replaced by -0(0)0_!. ₆alkyl). Amorphous & crystalline forms

The compounds of the invention may exist in solid states from amorphous through to crystalline forms. All such solid forms are included within the invention, including solvated (e.g. hydrated) and non-solvated forms, as described below.

Solvates & hydrates

The compounds of the invention may exist in both unsolvated and solvated solid forms. The term "solvate" includes molecular complexes comprising a compound of the invention and one or more pharmaceutically acceptable solvent molecules such as water or C_1-6 alcohols, e.g. ethanol. The term "hydrate" means a "solvate" where the solvent is water.

Isomeric forms

Compounds of the invention may exist in one or more geometrical, optical, enantiomeric, diastereomeric and tautomeric forms, including, but not limited to, cis- and frans-forms, E- and Z-forms, R-, S- and meso-forms, keto- and enol-forms. All such isomeric forms are included within the invention. The isomeric forms may be in isomerically pure or enriched form, as well as in mixtures of isomers {e.g. racemic or diastereomeric mixtures).

Accordingly, the invention provides, for use in the methods and treatments described herein:

• stereoisomeric mixtures of compounds of the invention;

• a diastereomerically enriched or diastereomerically pure isomer of a compound of the invention; or

• an enantiomerically enriched or enantiomerically pure isomer of a compound of the invention.

Where appropriate, isomers can be separated from their mixtures by the application or adaptation of known methods (e.g. chromatographic techniques - such as chiral chromatography - , resolution techniques and recrystallization techniques). Where appropriate, isomers can be prepared by the application or adaptation of known methods (e.g. asymmetric synthesis).

Isotopic labelling

The invention includes pharmaceutically acceptable isotopically-labelled compounds of the invention wherein one or more atoms are replaced by atoms having the same atomic number, but an atomic mass or mass number different from the atomic mass or mass number usually found in nature. Examples of isotopes suitable for inclusion in the compounds of the invention include isotopes of hydrogen, such as ²H and ³H, carbon, such as ¹¹C, ¹³C and ¹⁴C, chlorine, such as ³⁶CI, fluorine, such as ¹⁸F, iodine, such as ¹²³l and ¹²⁵l, nitrogen, such as ¹³N and ¹⁵N, oxygen, such as ¹⁵0, ¹⁷0 and ¹⁸0, phosphorus, such as ³²P, and sulphur, such as ³⁵S. Certain isotopically- labelled compounds of the invention, for example those incorporating a radioactive isotope, are useful in drug and/or substrate tissue distribution studies. The radioactive isotopes ³H and ¹⁴C are particularly useful for this purpose in view of their ease of incorporation and ready means of detection.

Substitution with positron emitting isotopes, such as ¹¹C, ¹⁸F, ¹⁵0 and ¹³N, can be useful in Positron Emission Topography (PET) studies for examining substrate receptor occupancy.

Isotopically-labelled compounds of the invention can generally be prepared by conventional techniques known to those skilled in the art or by processes analogous to those described herein using an appropriate isotopically-labelled reagent in place of the non-labelled reagent previously employed.

Typically, where the present disclosure refers to a pharmaceutically acceptable derivative of a compound, e.g. a compound of the invention, the derivative may suitably be a pharmaceutically acceptable salt.

Treatment of Diseases and Conditions

The compounds of the present invention have advantageously been found to be useful in the treatment of vascular calcification and endothelial dysfunction. Individual enantiomers / diastereomers are proposed for the uses, methods and treatments disclosed herein. Mixtures of isomers, e.g. racemic mixtures and / or diastereomeric mixtures may also be provided, as discussed above under "stereoisomers".

As described above the inventors propose the use of glycomimetics, particularly mimetics of heparin/heparan sulfate, for treating endothelial dysfunction and vascular calcification (e.g. small molecule mimetics of heparin/heparan sulfate). The inventors in particular propose glycomimetic compounds of formulae A-D (e.g. formulae (I), (II) or (III)) or pharmaceutically acceptable derivatives thereof, as defined in the claims and further described in aspects and embodiments of the invention herein and below, for the treatment of vascular calcification and/or endothelial dysfunction. In a further aspect, the invention provides a pharmaceutical composition comprising a compound or pharmaceutically acceptable derivative thereof according to any aspect or embodiment disclosed herein, and a pharmaceutically acceptable excipient. For instance, the invention provides a pharmaceutical composition comprising a compound or pharmaceutically acceptable derivative thereof according to any aspect or embodiment disclosed herein, and a pharmaceutically acceptable excipient for use in the treatment of vascular calcification and / or endothelial dysfunction. For avoidance of doubt, any specific embodiment of the compounds and pharmaceutically acceptable derivatives of the formulae of the invention described herein (and any combination of these compounds / pharmaceutically acceptable derivatives) may be provided in the composition of the invention according to this aspect.

In a further aspect is provided the use of a compound or pharmaceutically acceptable derivative thereof as defined according to any aspect or embodiment disclosed herein, or a pharmaceutically acceptable composition as disclosed herein (e.g. as described above or in the claims), in the manufacture of a medicament for the treatment of vascular calcification and / or endothelial dysfunction. For avoidance of doubt, any specific embodiment of the compounds and pharmaceutically acceptable derivatives of the formulae of the invention described herein may be provided in the use according to this aspect.

The invention further provides a method of modulating c-Met activity in an endothelial cell comprising contacting the cell with a compound or pharmaceutical derivative thereof as defined according to any aspect or embodiment thereof disclosed herein. Suitably, said method of modulating c-Met activity is not a method of treatment by therapy. Thus, typically, the method is not an in vivo method. For instance, such a method may be an in vitro or ex-vivo method. The endothelial cell is typically a mammalian endothelial cell, preferably a human endothelial cell. Where the method of modulating c-Met activity described above is a method of treatment by therapy, the method suitably comprises contacting the endothelial cell in a patient (suitably wherein a therapeutically effective amount of the compound or pharmaceutically acceptable derivative thereof has been administered to the patient).

Typically, the patient is a patient that has been diagnosed with endothelial dysfunction and / or vascular calcification. In suitable embodiments, the patient (i.e. the patient that is receiving, or whom has been identified to be in need of, the treatment) may suitably be a patient that has not been diagnosed with cancer (e.g. metastatic cancer) and / or diabetes. For instance, in suitable embodiments, the treatment, method or use described above is a treatment, method or use wherein the compound or pharmaceutically acceptable salt thereof has not been prescribed for treatment of cancer and / or diabetes, i.e. wherein the treatment does not comprise prescribing and / or administering a compound of the invention or apharmaceutically acceptable derivative thereof as described herein for treatment of cancer and / or diabetes. Suitably, the patient is a patient that has been diagnosed with vascular disease, such as described further below. Accoridingly, the treatment of endothelial dysfunction and / or vascular calcification may suitably be the treatment of vascular disease, e.g. a vascular condition as described in more detail below.

Thus, the present invention also provides a method of treating a disease or condition mediated by c-Met in an endothelial cell, the method comprising the step of administering a therapeutically effective amount of a compound or pharmaceutically acceptable derivative thereof as defined according to any aspect or embodiment disclosed herein, or a pharmaceutically acceptable composition as defined herein, to a patient, i.e. a patient in need thereof. In this regard, the invention also provides a compound of any one of formulae (A)-(D), (I), (II), (III), etc. as defined according to the above aspects and embodiments thereof, or a pharmaceutically acceptable derivative thereof, for use in the treatment of a disease or condition mediated by c-Met in an endothelial cell. Thus, the use of a compound of any one of formulae (A)-(D), (I), (I I), (I II), etc. as defined according to the above aspects and embodiments thereof, or a pharmaceutically acceptable derivative thereof, in the manufacture of a medicament for the treatment of a disease or condition mediated by c-Met in an endothelial cell, is also provided by the present invention. Suitable diseases mediated by c- Met in an endothelial cell include endothelial dysfunction and / or vascular calcification, such as vascular disease, e.g. as described below.

The invention further provides a method of modulating c-Met activity in an endothelial cell comprising contacting the cell with a compound or pharmaceutical derivative thereof as defined according to any aspect or embodiment thereof disclosed herein. Suitably, said method of modulating c-Met activity is not a method of treatment by therapy. Thus, typically, the method is not an in vivo method. For instance, such a method may be an in vitro or ex-vivo method. The endothelial cell is typically a mammalian endothelial cell, preferably a human endothelial cell. Where the method of modulating c-Met activity described above is a method of treatment by therapy, the method suitably comprises contacting the endothelial cell in a patient (suitably wherein a therapeutically effective amount of the compound or pharmaceutically acceptable derivative thereof has been administered to the patient). Typically, the patient is a patient that has been diagnosed with endothelial dysfunction and / or vascular calcification.

In accordance with the above method, the invention thus further provides a compound of any one of formulae (A)-(D), (I), (II), (II I), etc. as defined according to the above aspects and embodiments thereof, or a pharmaceutically acceptable derivative thereof, for use in a method of modulating c-Met activity in an endothelial cell. Thus, the use of a compound of any one of formulae (A)-(D), (I), (I I), (I II), etc. as defined according to the above aspects and embodiments thereof, or a pharmaceutically acceptable derivative thereof, for the manufacture of a medicament for a method of modulating c-Met activity in an endothelial cell is also provided by the present invention. Suitable diseases mediated by c-Met in an endothelial cell include endothelial dysfunction and / or vascular calcification, e.g. vascular disease, as described below. The endothelial cell is typically a mammalian endothelial cell, preferably a human endothelial cell. The method, use or treatment suitably comprises contacting the endothelial cell in a patient (suitably wherein a therapeutically effective amount of the compound or pharmaceutically acceptable derivative thereof has been administered to the patient). Typically, the patient is a patient that has been diagnosed with endothelial dysfunction and / or vascular calcification.

The invention also provides a crystal of HGF bonded to a compound or pharmaceutically acceptable derivative thereof of any of formulae (A) to (D) or embodiments thereof. Such crystals can be used for X-ray diffraction studies of c-Met receptor binding in endothelial cells, e.g. to provide atomic structural information in order to aid rational design of further c-Met receptor modulators.

The treatments / uses/ methods discussed above involve treatment of endothelial dysfunction and / or vascular calcification. Suitably, the treatment may be treatment of endothelial dysfunction. In embodiments, the treatment may be treatment of vascular calcification. In embodiments the treatment is for endothelial dysfunction and vascular calcification in a patient. Vascular calcification as referred to above may, in embodiments, be vascular calcification caused by endothelial dysfunction. In alternative embodiments, the vascular calcification is not vascular calcification caused by endothelial dysfunction.

In embodiments, in the compounds for use, the uses, or the methods of treatment defined herein, the treatment of endothelial dysfunction and / or vascular calcification may be a treatment of vascular disease. The vascular disease may for instance be selected from, or be incident in a patient diagnosed with, one or more of the following: a) cardiovascular diseases, such as angina pectoris, coronary arteriosclerosis (chronic ischemic heart disease, asymptomatic ischemic heart disease and arteriosclerotic cardiovascular disease); heart failure, congestive heart failure, painless ischemic heart disease, myocardial ischemia, myocardial infarction and diseases that arise from thrombotic states in which the coagulation cascade is activated; b) peripheral vascular diseases, including peripheral arterial disease, such as chronic arterial occlusion including arteriosclerosis, arteriosclerosis obliterans and thromboangiitis obliterans (Buerger's disease), macroangiopathy, microangiopathy, thrombophlebitis, phlebemphraxis, Raynaud's disease, Raynaud's syndrome, CREST syndrome, vascular claudication, disturbance of peripheral circulation function, peripheral circulation disorder, erectile dysfunction, male impotence, female sexual dysfunction, retinopathy, maculopathy, occlusion of the retinal artery, obstruction of central artery of retina, occlusion of retinal vein, neovascular maculopathy, edema, vasculitis, frostbite (cold injury), chilblain, gangrene, hypertension, pulmonary hypertension, portal hypertension, diabetic nephropathy, renal failure, vasospasm, acrocyanosis, ateriovenous fistula, arteriovenous malformations, chronic venous insufficiency, deep vein thrombosis, erythromelalgia, fibromuscular dysplasia, Klippel-Trenauney syndrome, lymphedema, lipedemia, varicose veins and vascular birthmark; and c) cerebrovascular diseases, such as, migraine, cerebral ischemia, cerebral infarction, cerebral vasospasm and thrombotic stroke.

For instance, the disease or condition mediated by c-Met may be a vascular disease selected from pulmonary hypertension and portal hypertension. In particular, the pulmonary hypertension may be pulmonary arterial hypertension. Therapeutic definitions

As used herein, "treatment" includes curative and prophylactic treatment. As used herein, a "patient" means an animal, preferably a mammal, preferably a human, in need of treatment.

The amount of the compound of the invention administered should be a therapeutically effective amount where the compound or derivative is used for the treatment of a disease or condition and a prophylactically effective amount where the compound or derivative is used for the prevention of a disease or condition.

The term "therapeutically effective amount" used herein refers to the amount of compound needed to treat or ameliorate a targeted disease or condition. The term "prophylactically effective amount" used herein refers to the amount of compound needed to prevent a targeted disease or condition. The exact dosage will generally be dependent on the patient's status at the time of administration. Factors that may be taken into consideration when determining dosage include the severity of the disease state in the patient, the general health of the patient, the age, weight, gender, diet, time, frequency and route of administration, drug combinations, reaction sensitivities and the patient's tolerance or response to therapy. The precise amount can be determined by routine experimentation, but may ultimately lie with the judgement of the clinician. An effective dose may in instances be from 0.01 mg/kg/day (mass of drug compared to mass of patient) to 1000 mg/kg/day, e.g. 1 mg/kg/day to 100 mg/kg/day. Compositions may be administered individually to a patient or may be administered in combination with other agents, drugs or hormones.

Administration & Formulation

General

For pharmaceutical use, the compounds of the invention may be administered as a medicament by enteral or parenteral routes, including intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), oral, intranasal, rectal, vaginal, urethral and topical (including buccal and sublingual) administration. The compounds of the invention should be assessed for their biopharmaceutical properties, such as solubility and solution stability (across pH), permeability, etc., in order to select the most appropriate dosage form and route of administration for treatment of the proposed indication.

The compounds of the invention may be administered as crystalline or amorphous products. The compounds of the invention may be administered alone or in combination with one or more other compounds of the invention or in combination with one or more other drugs (or as any combination thereof). Generally, they will be administered as a formulation in association with one or more pharmaceutically acceptable excipients. The term "excipient" includes any ingredient other than the compound(s) of the invention which may impart either a functional (e.g. drug release rate controlling) and/or a non-functional (e.g. processing aid or diluent) characteristic to the formulations. The choice of excipient will to a large extent depend on factors such as the particular mode of administration, the effect of the excipient on solubility and stability and the nature of the dosage form.

Typical pharmaceutically acceptable excipients include:

• diluents, e.g. lactose, dextrose, sucrose, mannitol, sorbitol, cellulose and/or glycine;

• lubricants, e.g. silica, talcum, stearic acid, its magnesium or calcium salt and/or polyethyleneglycol;

• binders, e.g. magnesium aluminium silicate, starch paste, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose and/or polyvinylpyrrolidone;

• disintegrants, e.g. starches, agar, alginic acid or its sodium salt, or effervescent mixtures; and/or

• absorbants, colorants, flavours and/or sweeteners.

A thorough discussion of pharmaceutically acceptable excipients is available in Gennaro, Remington: The Science and Practice of Pharmacy 2000, 20th edition (ISBN: 0683306472).

Accordingly, in an embodiment, the present invention provides a pharmaceutical composition comprising a compound of the present invention, e.g. a compound of formula (I) or a pharmaceutically acceptable derivative thereof, and a pharmaceutically acceptable excipient.

Oral administration

The compounds of the invention may be administered orally. Oral administration may involve swallowing, so that the compound enters the gastrointestinal tract, and/or buccal, lingual, or sublingual administration by which the compound enters the blood stream directly from the mouth.

Formulations suitable for oral administration include solid plugs, solid microparticulates, semisolid and liquid (including multiple phases or dispersed systems) such as tablets; soft or hard capsules containing multi- or nano-particulates, liquids (e.g. aqueous solutions), emulsions or powders; lozenges (including liquid-filled); chews; gels; fast dispersing dosage forms; films; ovules; sprays; and buccal/mucoadhesive patches.

Formulations suitable for oral administration may also be designed to deliver the compounds the invention in an immediate release manner or in a rate-sustaining manner, wherein the release profile can be delayed, pulsed, controlled, sustained, or delayed and sustained or modified in such a manner which optimises the therapeutic efficacy of the said compounds. Means to deliver compounds in a rate-sustaining manner are known in the art and include slow release polymers that can be formulated with the said compounds to control their release.

Examples of rate-sustaining polymers include degradable and non-degradable polymers that can be used to release the said compounds by diffusion or a combination of diffusion and polymer erosion. Examples of rate-sustaining polymers include hydroxypropyl methylcellulose, hydroxypropyl cellulose, methyl cellulose, ethyl cellulose, sodium carboxymethyl cellulose, polyvinyl alcohol, polyvinyl pyrrolidone, xanthum gum, polymethacrylates, polyethylene oxide and polyethylene glycol.

Liquid (including multiple phases and dispersed systems) formulations include emulsions, suspensions, solutions, syrups and elixirs. Such formulations may be presented as fillers in soft or hard capsules (made, for example, from gelatin or hydroxypropylmethylcellulose) and typically comprise a carrier, for example, water, ethanol, polyethylene glycol, propylene glycol, methylcellulose, or a suitable oil and one or more emulsifying agents and/or suspending agents. Liquid formulations may also be prepared by the reconstitution of a solid, for example, from a sachet.

The compounds of the invention may also be used in fast-dissolving, fast-disintegrating dosage forms such as those described in Liang and Chen, Expert Opinion in Therapeutic Patents 2001 , 1 1 (6): 981 -986.

The formulation of tablets is discussed in H. Lieberman and L. Lachman, Pharmaceutical Dosage Forms: Tablets 1980, vol. 1 (Marcel Dekker, New York).

Parenteral administration

The compounds of the invention can be administered parenterally.

The compounds of the invention may be administered directly into the blood stream, into subcutaneous tissue, into muscle, or into an internal organ. Suitable means for administration include intravenous, intraarterial, intrathecal, intraventricular, intraurethral, intrasternal, intracranial, intramuscular, intrasynovial and subcutaneous. Suitable devices for administration include needle (including microneedle) injectors, needle-free injectors and infusion techniques.

Parenteral formulations are typically aqueous or oily solutions. Where the solution is aqueous, excipients such as sugars (including but not restricted to glucose, mannitol, sorbitol, etc.) salts, carbohydrates and buffering agents (preferably to a pH of from 3 to 9), but, for some applications, they may be more suitably formulated as a sterile non-aqueous solution or as a dried form to be used in conjunction with a suitable vehicle such as sterile, pyrogen-free water (WFI).

Parenteral formulations may include implants derived from degradable polymers such as polyesters (i.e. polylactic acid, polylactide, polylactide-co-glycolide, polycapro-lactone, polyhydroxybutyrate), polyorthoesters and polyanhydrides. These formulations may be administered via surgical incision into the subcutaneous tissue, muscular tissue or directly into specific organs.

The preparation of parenteral formulations under sterile conditions, for example, by lyophilization, may readily be accomplished using standard pharmaceutical techniques well known to those skilled in the art.

The solubility of compounds of the invention used in the preparation of parenteral solutions may be increased by the use of appropriate formulation techniques, such as the incorporation of co-solvents and/or solubility-enhancing agents such as surfactants, micelle structures and cyclodextrins.

Inhalation & intranasal administration

The compounds of the invention can be administered intranasally or by inhalation, typically in the form of a dry powder (either alone, as a mixture, for example, in a dry blend with lactose, or as a mixed component particle, for example, mixed with phospholipids, such as phosphatidylcholine) from a dry powder inhaler, as an aerosol spray from a pressurised container, pump, spray, atomiser (preferably an atomiser using electrohydrodynamics to produce a fine mist), or nebuliser, with or without the use of a suitable propellant, such as 1 , 1 , 1 ,2-tetrafluoroethane or 1 , 1 , 1 ,2,3,3,3-heptafluoropropane, or as nasal drops. For intranasal use, the powder may comprise a bioadhesive agent, for example, chitosan or cyclodextrin.

The pressurised container, pump, spray, atomizer, or nebuliser contains a solution or suspension of the compound(s) of the invention comprising, for example, ethanol, aqueous ethanol, or a suitable alternative agent for dispersing, solubilising, or extending release of the active, a propellant(s) as solvent and an optional surfactant, such as sorbitan trioleate, oleic acid or an oligolactic acid.

Prior to use in a dry powder or suspension formulation, the drug product is micronised to a size suitable for delivery by inhalation (typically less than 5 microns). This may be achieved by any appropriate comminuting method, such as spiral jet milling, fluid bed jet milling, supercritical fluid processing to form nanoparticles, high pressure homogenization or spray drying.

Capsules (made, for example, from gelatin or hydroxypropylmethylcellulose), blisters and cartridges for use in an inhaler or insufflator may be formulated to contain a powder mix of the compound of the invention, a suitable powder base such as lactose or starch and a performance modifier such as /-leucine, mannitol or magnesium stearate. The lactose may be anhydrous or in the form of the monohydrate, preferably the latter. Other suitable excipients include dextran, glucose, maltose, sorbitol, xylitol, fructose, sucrose and trehalose.

Formulations for inhaled/intranasal administration may be formulated to be immediate and/or modified release using, for example, poly(lactic-co-glycolic acid) (PGLA). Modified release formulations include delayed-, sustained-, pulsed-, controlled-, targeted and programmed release.

Transdermal administration

Suitable formulations for transdermal application include a therapeutically effective amount of a compound of the invention with carrier. Advantageous carriers include absorbable pharmacologically acceptable solvents to assist passage through the skin of the host. Characteristically, transdermal devices are in the form of a bandage comprising a backing member, a reservoir containing the compound optionally with carriers, optionally a rate controlling barrier to deliver the compound of the skin of the host at a controlled and predetermined rate over a prolonged period of time, and means to secure the device to the skin.

Combination Therapy

The compounds of the invention may be administered alone or may be administered in combination with another compound of the invention or another therapeutic agent (i.e. a different agent to the compound of the invention). Preferably, the compound of the invention and the other therapeutic agent are administered in a therapeutically effective amount.

The compound of the present invention may be administered either simultaneously with, or before or after, the other therapeutic agent. The compound of the present invention may be administered separately, by the same or different route of administration, or together in the same pharmaceutical composition.

In one embodiment, the invention provides a product comprising a compound of the invention and another therapeutic agent as a combined preparation for simultaneous, separate or sequential use in therapy, i.e. in treating endothelial dysfunction and / or vascular calcification. In one embodiment, the therapy is the treatment of a disease or condition mediated by endothelial dysfunction and/or vascular calcification. Products provided as a combined preparation include a composition comprising the compound of the invention and the other therapeutic agent together in the same pharmaceutical composition, or the compound of the invention and the other therapeutic agent in separate form, e.g. in the form of a kit.

In an embodiment, the invention thus provides a pharmaceutical composition comprising a compound of the invention and another therapeutic agent. Optionally, the pharmaceutical composition may comprise a pharmaceutically acceptable excipient, as described above in "Administration and formulation".

In one embodiment, the invention provides a kit comprising two or more separate pharmaceutical compositions, at least one of which contains a compound of the invention. In one embodiment, the kit comprises means for separately retaining said compositions, such as a container, divided bottle or divided foil packet. An example of such a kit is a blister pack, as typically used for the packaging of tablets, capsules and the like.

The kit of the invention may be used for administering different dosage forms, for example, oral and parenteral, for administering the separate compositions at different dosage intervals, or for titrating the separate compositions against one another. To assist compliance, the kit of the invention may typically comprise directions for administration.

In the combination therapies of the invention, the compound of the invention and the other therapeutic agent may be manufactured and/or formulated by the same or different manufacturers. Moreover, the compound of the invention and the other therapeutic may be brought together into a combination therapy: (i) prior to release of the combination product to physicians (e.g. in the case of a kit comprising the compound of the invention and the other therapeutic agent); (ii) by the physician themselves (or under the guidance of the physician) shortly before administration; (iii) in the patient themselves, e.g. during sequential administration of the compound of the invention and the other therapeutic agent.

It will be understood that the compounds, compositions and combinations discussed above may be used in the treatments and uses herein described with respect to treating vascular calcification and / or endothelial dysfunction, such as described in the claims.

General

The term "comprising" encompasses "including" as well as "consisting" e.g. a composition "comprising" X may consist essentially of X or may consist exclusively of X, or may include something additional e.g. X + Y. The word "substantially" does not exclude "completely" e.g. a composition which is "substantially free" from Y may be completely free from Y. Where necessary, the word "substantially" may be omitted from the definition of the invention.

The term "about" in relation to a numerical value x is optional and means, for example, x+10 %.

BRIEF DESCRIPTION OF FIGURES

Figure 1 includes scheme 1 , describing the synthesis of compounds 2 to 5.

Figure 2 includes scheme 2, describing the synthesis of compounds 6 to 8.

Figure 3 includes scheme 3, describing the synthesis of compounds 9 to 11 .

Figure 4 includes scheme 4, describing the synthesis of compounds 12 to 13.

Figure 5 includes scheme 5, describing the synthesis of compound 14.

Figure 6 illustrates representative assay data showing the effect of compounds 8 (C1 ), 11 (C2), 13 (C3) and 14 (C4) on lipid induced NO levels in endothelial cells at 3 h (the left hand line graph shows data corresponding to PAL (bottom line), control (top line), PAL + C2 (line second from top), as well as PAL + C1 , PAL + C3 and PAL + C4 (lines clustered next to bottom)) and at 12 h (the left hand line graph shows data corresponding to PAL (bottom line), control (top line), PAL + C2 (line second from top), PAL + C4 (second from bottom), as well as PAL + C3 and PAL + C4 (lines clustered third from bottom)). ^***P<0.001 vs control (CT), and #P<0.05, ##P<0.01 and ###P<0.001 vs PAL.

Figure 7 illustrates representative assay data showing the effect of compounds 8 (C1 ), 11 (C2), 13 (C3) and 14 (C4) on lipid induced Akt, eNOS and NOX4 mRNA expression in endothelial cells relative to PAL. ^*P<0.05, ^**P<0.01 , ^***P<0.001 vs control (CT), and #P<0.05, ##P<0.01 and ###P<0.001 vs PAL.

Figure 8 illustrates representative assay data showing the effect of compounds 8 (C1 ), 11 (C2), 13 (C3) and 14 (C4) on lipid induced Akt and eNOS phosphorylation in endothelial cells relative to PAL. ^*P<0.05 vs control (CT), and #P<0.05, ##P<0.01 and ###P<0.001 vs PAL.

Figure 9 illustrates representative assay data showing the effect of compounds 8 (C1 ), 11 (C2), 13 (C3) and 14 (C4) on lipid induced oxidative stress in endothelial cells relative to PAL. ^*P<0.05, ^**P<0.01 , ^***P<0.001 vs control (CT), and #P<0.05, ##P<0.01 and ###P<0.001 vs PAL. Figures 10A-D illustrate representative assay data showing the effect of compounds 8 (01 ), 11 (C2), 13 (C3) and 14 (C4) on vascular relaxant responses induced by acetylcholine in mouse-descending aorta samples pre-contracted by U46619. Data corresponding to reference compounds are also provided in Figure 10E. ^*P<0.05, ^**P<0.01 , ^***P<0.001 vs control (CT), and #P<0.05, ##P<0.01 and ###P<0.001 vs PAL.

Figure 1 1 illustrates representative assay data showing the effect of compounds 8 (C1 ), 11 (C2), 13 (C3) and 14 (C4) on pGP-induced vascular calcification in HPSMCs.

Figure 12 illustrates representative assay data showing the effect of compounds 8 (C1 ), 11 (C2), 13 (C3) and 14 (C4) on calcium deposition in GP-induced HPSMCs relative to osteogenic media. ^***P<0.001 .

Figure 13 illustrates representative assay data showing the effect of compounds 8 (C1 ), 11 (C2), 13 (C3) and 14 (C4) on ALP activity in GP-induced HPSMCs. In the line graph, the bottom line at the point of the maximum represents data for Ost + C4, the line second from bottom at the same position represents data for Ost + C1 , the hashed line shows data for Ost + 02, the line above the hashed line shows data for Ost + 03 and the upper line shows data for Ost alone. ^***P<0.001 ; ^**P<0.05; ^*P<0.01 .

METHODS AND EXAMPLES

The following examples are intended to illustrate the invention and are not to be construed as being limitations thereon. If not mentioned otherwise, all evaporations are performed under reduced pressure, between about 50 mmHg and 100 mmHg. The structure of final products, intermediates and starting materials is confirmed by standard analytical methods, e.g., microanalysis, melting point (m.p.) and spectroscopic characteristics, e.g. MS, IR and NMR. Abbreviations used are those conventional in the art.

Preparation of compounds

In general, compounds 2 -14 may be prepared according to reaction schemes 1 to 5 (see Figures 1 to 5). Suitable reaction conditions are described below and can also be found disclosed in Raiber et al (referenced above). The skilled person will appreciate that further compounds of the invention are accessible via these general methods be modification of the starting materials and / or substituent groups included in these general methods. Compound 1 - 2,5-Dihydroxybenzoic acid. This starting material was purchased from Apollo Scientific, Stockport, UK.

Compound 2 - Methyl 2,5-dihydroxybenzoate. Compound 1 (2,5-Dihydroxybenzoic acid) (5.00 g, 32.5 mmol) was dissolved in methanol (33 mL) and concentrated sulphuric acid (5 mL) added drop wise. The reaction mixture was heated at reflux for 16 h. The reaction mixture was cooled to room temperature and the solvent removed in vacuo. The residue was treated with saturated aqueous NaHC0₃ until pH 7 was reached. The product was extracted with ethyl acetate (50 mL x 3) and the combined organic layer was washed with brine (20 mL), dried (MgS0₄), filtered and the filtrate was evaporated to afford the product as a light brown powder (5.13 g, 94%). ¹ H NMR (CDCI₃) δ 10.35 (s, 1 H), 7.29 (d, J - 3.2 Hz, 1 H), 7.02 (dd, J - 8.7, 3.2 Hz, 1 H), 6.89 (d, 8.7 Hz, 1 H), 4.69 (s, 1 H), 3.95 (s, 1 H); ¹³C NMR (CDCI₃) δ 170.1 , 155.8, 147.6, 124.0, 1 18.5, 1 14.7, 1 12.1 , 52.4; HRMS (ESI): [M-H]⁺ calcd. for C₈H₇0₄ 167.0344, found 167.0359.

Compound 3 - Methyl 5-(allyloxy)-2-hydroxybenzoate. Compound 2 (0.50 g, 2.9 mmol) in anhydrous acetone (15 mL) was added at 0 °C to a flask containing potassium carbonate (0.80 g, 5.8 mmol) in anhydrous acetone (2.5 mL). After stirring for 1 h at 0 °C, allyl bromide (0.28 mL, 4.0 mmol) and tetrabutyl ammonium iodide (0.21 g, 0.58 mmol) were added and the reaction mixture was stirred for 15 h at 25 °C. Acetone was evaporated and the mixture was dissolved in ethyl acetate (20 mL) followed by successively washing with water (3 x 10 mL), brine (10 mL), drying over magnesium sulfate and concentration in vacuo. The crude compound was purified by silica gel flash column chromatography (cyclohexane : ethyl acetate; 8 : 2) to give a white powder (0.67 g, 47%). ¹ H NMR (CDCI₃) δ 10.39 (s, 1 H), 7.32 (d, J = 3.2 Hz, 1 H), 7.1 1 (dd, J = 9.2, 3.2 Hz, 1 H), 6.92 (d, J = 9.2 Hz, 1 H), 6.10-6.00 (m, 1 H), 5.45-5.38 (m, 1 H), 5.32-5.27 (m, 1 H), 4.52-4.48 (m, 2H), 3.95 (s, 3H); ¹³C NMR (CDCI₃) δ 170.2, 156.1 , 150.8, 133.1 , 124.6, 1 18.4, 1 17.7, 1 13.1 , 1 1 1 .7, 69.5, 52.3; HRMS (ESI): [M+NH₄]⁺ calcd. for Ci₂Hi₈N0₄ 240.1230, found 240.1229.

Compound 4 - Methyl 2-(4-acetoxybutoxy)-5-(allyloxy)benzoate. To a solution of sodium hydride (60% dispersion in oil) (144 mg, 3.6 mmol) in anhydrous DMF (3 mL) was added at 0 °C, Compound 3 (0.37 g, 1 .8 mmol) in anhydrous DMF (3 mL). After stirring for 1 h at 0 °C, tetrabutyl ammonium iodide (266 mg, 0.72 mmol) and 4-bromobutyl acetate (2.7 mL, 2.0 mmol) were added and the reaction mixture was stirred for a further 12 h at 25 °C. The reaction was stopped with the addition of saturated aqueous ammonium chloride (5 mL). Ethyl acetate (10ml) was added and the organic layer was washed with water (5 x 15 mL), brine (15 mL) and dried over magnesium sulfate. Purification by silica gel flash column chromatography (cyclohexane : ethyl acetate; 8 : 2) afforded 4 as colourless oil (87 mg, 15%). ¹ H NMR (CDCI₃) δ 7.35 (d, J = 3.2 Hz, 1 H), 7.03 (dd, J = 8.7, 3.2 Hz, 1 H), 6.90 (d, J - 8.7 Hz, 1 H), 6.10-5.99 (m, 1 H), 5.45-5.38 (m, 1 H), 5.32-5.27 (m, 1 H), 4.54-4.50 (m, 2H), 4.15 (t, J = 6.0 Hz, 2H), 4.02 (t, J = 6.0 Hz, 2H), 3.89 (s, 3H), 2.06 (s, 3H), 1 .90-1 .85 (m, 4H); HRMS (ESI): [M+H]⁺ calcd. for Ci₇H₂₃0₆ 323.1489, found 323.1486.

Compound 5 - Methyl (fl)-5-(2,3-dihydroxypropoxy)-2-(4-hydroxybutoxy)benzoate. AD mix-β (441 mg) was dissolved in a mixture of M3uOH/ water (2.4 mL / 2.4 mL) and cooled to 0 °C. Compound 4 (51 .0 mg, 0.16 mmol) and methanesulfonamide (16 mg, 0.17 mmol) were added and the reaction mixture was stirred for 12 h at 0 °C. The reaction was quenched with sodium sulfite (0.38 g) and the solvent was removed in vacuo. Ethanol (1 mL) was added to the crude product and the mixture was heated at reflux during 1 h. The salt was filtered off and purification by silica gel flash column chromatography (DCM/ methanol, 9:1 ) afforded 5 as colourless oil (10 mg, 3%). ¹ H NMR (CD₃OD) δ 7.30 (d, J - 3.2 Hz, 1 H), 7.12 (dd, J = 9.0, 3.2 Hz, 1 H), 7.03 (d, J = 9.0 Hz, 1 H), 4.04-4.00 (m, 1 H), 3.96-3.91 (m, 2H), 3.86 (s, 3H), 3.67-3.60 (m, 4H), 1 .88-1 .81 (m, 2H), 1 .77-1 .69 (m, 2H).

Compound 6 - Methyl 2,5-bis(allyloxy)benzoate. Compound 2 (1 .00 g, 5.98 mmol) in anhydrous DMF (30 mL) was added to a flask containing sodium hydride (60% dispersion in oil) (0.57 g, 23.7 mmol) in anhydrous DMF (5 mL) at 0 °C. After 1 h at 0 °C, allyl bromide (1 .5 mL, 17 mmol) and tetrabutyl ammonium iodide (0.44 g, 1 .2 mmol) were added and the reaction mixture was stirred for 16 h at 25 °C. The reaction was quenched with saturated aqueous ammonium chloride (10 mL). Dilution with ethyl acetate (30 mL) was followed by successively washing with water (5 x 60 mL), brine (30 mL), drying over magnesium sulfate and concentration in vacuo. The crude compound was purified by silica gel flash column chromatography (DCM : ethyl acetate; 8:2) to afford 6 as yellow coloured oil (1 .45 g, 98%). ¹ H NMR (CDCI₃) δ 7.39-7.35 (m, 1 H), 7.02 (dd, J - 9.2, 3.2 Hz, 1 H), 6.90 (d, J - 9.2 Hz, 1 H), 6.10-5.98 (m, 2H), 5.51 -5.37 (m, 2H), 5.30-5.25 (m, 2H), 4.58-4.54 (m, 2H), 4.52-4.49 (m, 2H), 3.89 (s, 3H).

Compound 7 - Methyl 2-((/¾-2,3-dihydroxypropoxy)-5-((S)-2,3-dihydroxypropoxy) benzoate. AD mix-a (3.33 g) was dissolved in a mixture of M3uOH/ water (12 mL/ 12 mL) and cooled to 0 °C. Compound 6 (0.30 g, 1 .2 mmol) and methanesulfonamide (1 10 mg, 1 .2 mmol) were added and the reaction mixture was stirred for 12 h at 0 °C. The reaction was quenched with sodium sulfite (3.0 g) and the solvent was removed in vacuo. Methanol (9 mL) was added to the crude product and the mixture was heated at reflux for 1 h. The salt was filtered off and column chromatography (DCM/ methanol, 7:3) of the filtrate gave 7 as colourless oil (40 mg, 1 1 %). ¹ H NMR (CD₃OD) δ 7.35 (d, J - 3.2 Hz, 1 H), 7.15 (dd, J -9.0, 3.2 Hz, 1 H), 7.08 (d, J -9.0 Hz, 1 H), 4.1 1 -3.90 (m, 5H), 3.87 (s, 3H), 3.75-3.48 (m, 5H); HRMS (ESI): [M+H]⁺ calcd. for Ci₄H₂₁0₈ 317.1236, found 317.1218.

Compound 8 - Methyl 5-((/?)-2,3-bis(sulfooxy)propoxy)-2-((S)-2,3- bis(sulfooxy)propoxy)benzoate. Compound 7 (40 mg, 0.13 mmol) was dissolved in DMF (0.5 mL). Sulfur trioxide-trimethylamine complex (70 mg, 0.50 mmol) was added and the reaction mixture was stirred for 16 h at 40 °C. The solvent was removed in vacuo and the crude product was purified by silica gel flash column chromatography (DCM : Methanol; 7:3 to 0:10) to afford 8 as yellow crystals (60 mg, 76%). ¹ H NMR (CD₃OD) δ 7.34-7.32 (m, 1 H), 7.16- 7.12 (m, 1 H), 7.1 1 -7.07 (m, 1 H), 4.20-4.02 (m, 10H), 3.89 (s, 3H); HRMS (ESI): [M-2H]⁺/2 calcd. for Ci₄H₁₈S₄O₂₀/2 316.9715, found 316.9680.

Compound 9 - 2,5-Bis(allyloxy)benzoic acid. To a flask containing potassium hydroxide (334 mg, 6.0 mmol) in water/ethanol (0.8 mL/ 0.8 mL) was added compound 7 (0.74 g, 3.0 mmol) and the mixture stirred for 6 h at 60 °C. The reaction was quenched with a solution of 2 M hydrochloric acid (1 .0 mL). Solvents were removed in vacuo and the crude product was used directly in the next step. ¹ H NMR (CD₃OD) δ 7.22-7.20 (m, 1 H), 6.99-6.96 (m, 2H), 6.12- 5.99 (m, 2H), 5.47-5.36 (m, 2H), 5.26-5.21 (m, 2H), 4.60-4.56 (m, 2H), 4.52-4.48 (m, 2H); HRMS (ESI): [M+Na]⁺ calcd. for Ci₄H₁₆Na0₄ 271 .0946, found 271 .0936.

Compound 10 - 5-((/?)-2,3-Dihydroxypropoxy)-2-((S)-2,3-dihydroxypropoxy)benzoic acid.

AD mix-β (1 .28 g) was dissolved in a mixture of f-BuOH/water (16 mL / 16 mL) and cooled to 0 °C. Compound 9 (106 mg, 0.45 mmol) and methanesulfonamide (44 mg, 0.46 mmol) were added and the reaction mixture was stirred for 12 h at 0 °C. The reaction was quenched with sodium sulfite (1 .2 g) and the solvent was removed in vacuo. Methanol (2 mL) was added to the crude product and the mixture was heated at reflux for 1 h. The salt was filtered off and silica gel flash column chromatography (DCM : Methanol; 10 : 1 to 7 : 3) afforded 10 as colourless oil (120 mg, 88%). ¹ H NMR (CD₃OD) δ 7.30-7.28 (m, 1 H), 7.05-7.03 (m, 2H), 4.17- 4.12 (m, 1 H), 4.07-4.01 (m, 1 H), 3.98-3.92 (m, 4H), 3.71 -3.62 (m, 4H).

Compound 11 - 2-((fl)-2,3-Bis(sulfooxy)propoxy)-5-((S)-2,3-bis(sulfooxy)

propoxy)benzoic acid. Compound 10 (54 mg, 0.18 mmol) was dissolved in DMF (1 .3 ml_). Sulfur-trioxide-trimethylamine complex (149 mg, 1 .08 mmol) was added and the reaction mixture was stirred for 16 h at 40 °C. The solvent was removed in vacuo and the crude product was purified by silica gel flash column chromatography (methanol) to afford 11 as a yellow oil (58 mg, 51 %). ¹ H NMR (CD₃OD) δ 7.43-7.40 (m, 1 H), 7.20-7.12 (m, 2H), 4.38-3.88 (m, 10H); HRMS (ESI): [M-2H]72 calcd. for Ci₃H₁₆S₄O₂₀/2 309.9564, found 309.9566.

Compound 12 - Methyl (S)-5-(2,3-dihydroxypropoxy)-2-(4-hydroxybutoxy)benzoate. AD mix-a (312 mg) was dissolved in a mixture of f-BuOH/ water (1 .7 mL/1 .7 ml_) and cooled to 0 °C. Compound 4 (36.0 mg, 0.1 1 mmol) and methanesulfonamide (13 mg, 0.13 mmol) were added and the reaction mixture was stirred for 12 h at 0 °C. The reaction was quenched with sodium sulfite (0.28 g) and the solvent was removed in vacuo. Ethanol (1 ml_) was added to the crude product and the mixture was heated at reflux during 1 h. The salt was filtered off and purification by silica gel flash column chromatography (DCM/ methanol, 9:1 ) afforded 12 as colourless oil (30 mg, 10%). ¹ H NMR (CD₃OD) δ 7.30 (d, J = 3.2 Hz, 1 H), 7.12 (dd, J = 9.0, 3.2 Hz, 1 H), 7.03 (d, J = 9.0 Hz, 1 H), 4.04-4.00 (m, 1 H), 3.96-3.91 (m, 2H), 3.86 (s, 3H), 3.67- 3.60 (m, 4H), 1 .88-1 .81 (m, 2H), 1 .77-1 .69 (m, 2H).

Compound 13 - Methyl (/?)-5-(2,3-bis(sulfooxy)propoxy)-2-(4-(sulfooxy)butoxy)benzoate.

Compound 12 (15.0 mg, 0.05 mmol) was dissolved in anhydrous DMF (0.5 ml_). Sulfur- trioxide-trimethylamine complex (30.0 mg, 0.22 mmol) was added and the reaction mixture was stirred for 16 h at 40 °C. The solvent was removed in vacuo and the crude mixture was purified by silica gel flash column chromatography (methanol) to afford 13 as a yellow oil (24 mg, 88%). ¹ H NMR (CD₃OD) 5 7.31 -7.29 (m, 1 H), 7.18-7.12 (m, 1 H), 7.08-7.03 (m, 1 H), 4.35- 4.1 1 (m, 4H), 4.10-4.01 (m, 5H), 3.87 (s, 3H), 1 .90-1 .85 (m, 4H). HRMS (ESI): [M-H]⁺ calcd. for Ci₅H₂iOi₆S₃ 552.9992, found 553.0062.

Compound 14 - Methyl (S)-5-(2,3-bis(sulfooxy)propoxy)-2-(4-(sulfooxy)butoxy)benzoate.

Compound 5 (10.0 mg, 0.032 mmol) was dissolved in anhydrous DMF (0.4 ml_). Sulfur- trioxide-trimethylamine complex (20.0 mg, 0.14 mmol) was added and the reaction mixture was stirred for 16 h at 40 °C. The solvent was removed in vacuo and the crude mixture was purified by silica gel flash column chromatography (methanol) to afford 14 as a rose coloured oil (26 mg, 98%). ¹ H NMR (CD₃OD) δ) 7.31 -7.28 (m, 1 H), 7.18-7.13 (m, 1 H), 7.09-7.05 (m, 1 H), 4.33-4.10 (m, 4H), 4.10-4.01 (m, 5H), 3.86 (s, 3H), 1 .90-1 .85 (m, 4H). HRMS (ESI): [M- H]⁺ calcd. for Ci₅H₂₁0i₆S₃ 552.9992, found 553.0065.

The identification of compounds 2-14 was performed using proton nuclear magnetic resonance (¹ H NMR) spectroscopy. In addition, the chemical purities were also assessed by melting point determination, thin layer chromatography, and mass spectrometry.

All analytical data were consistent with the assigned structures with over 95% purity for the four derivatives.

BIOLOGICAL ASSAYS

1. Endothelial Protection

The protective effects of selected glycomimetic compounds were investigated against lipid- induced endothelial dysfunction. Lipid induced endothelial dysfunction is an early event involved in the development of atherosclerosis and ultimately vascular calcification. The effects of compounds 8, 11 , 13 and 14 (referred to as C1 , C2, C3 and C4, respectively in the biological data described herein) on endothelial dysfunction induced by palmitic acid in cultured endothelial cells (in vitro) and isolated vessels (ex vivo) were investigated. Palmitic acid is a major component of dietary saturated fat and forms 20% of the total serum free fatty acids (FFA). Palmitic acid is often used to induce endothelial dysfunction (Maloney E, Sweet IR, Hockenbery DM, Pham M, Rizzo NO, Tateya S, Handa P, Schwartz MW, Kim F. Activation of NF-kappaB by palmitate in endothelial cells: a key role for NADPH oxidase-derived superoxide in response to TLR4 activation. Arterioscler Thromb Vase Biol 2009 Sep 29(9):1370-5).

Cultured endothelial cells (in vitro assay)

Lipid-containing media was prepared by conjugation of sodium palmitate (Sigma-Aldrich No. P9767) with bovine serum albumin solution (BSA) using a method modified from that described previously (see Chavez JA, Summers SA. Characterizing the effects of saturated fatty acids on insulin signaling and ceramide and diacylglycerol accumulation in 3T3-L1 adipocytes and C2C12 myotubes. Arch Biochem Biophys 2003;419(2):101 -109). In particular, sodium palmitate was dissolved in ethanol whilst heating at 60°C in a water bath until completely dissolved. The sodium palmitate solution was then diluted in M1 19 media (Sigma Aldrich: Cat no; M4530) containing 2% (wt/vol) fatty acid-free BSA and left to stir for 1 h in a 37°C incubator to provide a lipid-containing media.

Human umbilical vein endothelial cells (HUVECs) were then:

A. incubated in the lipid-containing media (having a concentration of 100 μΜ sodium palmitate) in the absence of test compounds (illustrated in Figure 6 as PAL);

B. incubated in the lipid-containing media (having a concentration of 100 μΜ sodium palmitate) in the presence of test compounds C1 to C4 (at a concentration of 1 μΜ in dimethylsulfoxide (DMSO)) (illustrated in Figure 6 as PAL + C1 -C4) for 3 h; or

C. pre-incubated with the test compounds C1 to C4 (at a concentration of 1 μΜ in DMSO) in serum free medium for 12 h followed by 3 h incubation in serum free M1 19 containing 2% (wt/vol) fatty acid-free BSA (illustrated in Figure 6 as CT).

As illustrated in Figure 6, the test compounds 8, 11 , 13 and 14 (i.e. C1 -C4, respectively) protected HUVECs against palmitate-induced oxidative stress and reduced A23187-stimulated nitric oxide (NO) production using test conditions B and C defined above. Moreover, palmitate significantly (P<0.001 ) reduced the Ca²⁺ ionophore A23187-stimulated NO production (shown in top-left graph of Figure 6) and quantified using the area under the curve. Co-incubation of HUVECs with glycomimetics and palmitate for 3 h markedly restored the A23187-stimulated NO production.

Pre-incubation of HUVECs with test compounds 8, 11 , 13 and 14 (i.e. C1 -C4, respectively), at a concentration of 1 μΜ, increased mRNA expression of Akt and eNOS, while decreasing the expression of NOX4, as illustrated by Figure 7. It is shown that palmitate treatment for 3 h as well as 24 h produced a marked decrease in both Akt and eNOS mRNA expression and an increase in NOX4 mRNA expression. HUVECs treated with glycomimetics C1 to C4 for 24 h in the presence of palmitate showed a significant increase in gene expression of Akt and eNOS, while treatment of dysfunctional HUVECs (treated with palmitate) with C1 -C4 for 24 h significantly reduced gene expression of NOX4.

In addition, test compounds C1 -C4 increased phosphorylation of Akt and eNOS illustrated by Figure 8, decreased ROS-induced lipid peroxidation and potentiated the activity of superoxide dismutase (SOD), catalase (CAT) and malondialdehyde (MDA) as illustrated by Figure 9. All test compounds C1 -C4 significantly decreased the activity of NADPH oxidase as shown in Figure 9. In particular, in the presence of palmitate, treatment of HUVECs with compounds C1 -C4 diminished palmitate induced ROS production. In addition, treatment of the palmitate- induced HUVECs with compounds C1 -C4 for 24 h markedly diminished MDA content. Furthermore, treatment with palmitate significantly decreased the activity of SOD and CAT. HUVECs treated with C1 -C4 for 24 h in the presence of palmitate noticeably enhanced activity of the antioxidant enzymes SOD and CAT.

The inventors have also demonstrated similar effects of C1 -C4 on the activity of NADPH oxidase activity in whole blood vessel assays. The data illustrated by Figure 8 supports the mRNA expression data shown in Figure 7. That is, palmitate treatment for 3 h as well as 24 h produced a marked decrease in both Akt and eNOS protein expression and an increase in NOX4 protein expression. HUVECs treated with glycomimetics C1 to 04 for 24 h in the presence of palmitate showed a significant increase in protein expression of Akt and eNOS, while treatment of dysfunctional HUVECs (treated with palmitate) with C1 -C4 for 24 h significantly reduced protein expression of NOX4.

Nitric oxide (NO) and reactive oxygen species (ROS) production was measured using DAF-2 and H2DCF-DA, respectively. Colorimetric assays were used to determine lipid peroxidation and activity of the antioxidant enzymes superoxide dismutase (SOD) and catalase (CAT). Expression of Akt, eNOS and NOX4 was assessed using RT-PCR and western blotting. The activity of NADPH oxidase was quantified by using a lucigenin-enhanced chemiluminescence method. Also, the dose-response effect of the test compounds was studied using 1 , 10 and 100 μΜ of each compound.

The biological assays mentioned above and illustrated in Figures 6 to 9 were performed according to the methods and materials provided below. Assay of NO release

NO released by HUVECS was quantified using the NO-sensitive fluorescent probe diaminofluorescein-2 (DAF-2) as described previously (Quintela AM, Jimenez R, Piqueras L, Gomez-Guzman M, Haro J, Zarzuelo MJ, Cogolludo A, Sanz MJ, Toral M, Romero M, Perez- Vizcaino F, Duarte J. PPARbeta activation restores the high glucose-induced impairment of insulin signalling in endothelial cells. Br J Pharmacol. 2014 Jun;171(12):3089-102). After incubation according to conditions A-C described above, HUVEC cells were washed with phosphate buffered saline (PBS) and then pre-incubated with L-arginine (100 μΜ in PBS) for 5 min at 37^eC. In some experiments, L-NAME (100 μΜ in PBS) was added 20 min before the addition of L-arginine. Cells were then incubated with DAF-2 (0.1 μΜ) for 2 min and then the calcium ionophore calimycin (A23187, 1 μΜ in PBS) was added for 30 min. The fluorescence intensity (arbitrary units, AU) was measured using microplate reader (BioTek) and autofluorescence was subtracted from each value.

Assay of intracellular ROS production

Confluent HUVECs in 96-well plates, incubated according to conditions A to C described above, were further incubated with 10 μΜ of the fluorescent probe 2'-7'- dichlorodihydrofluorescein diacetate (CM-H2DCFDA, Sigma-Aldrich) whilst protected from light for 30 min at 37 ^eC. The cells were then washed with PBS and the fluorescent intensity was measured at excitation 490 nm and emission 540 nm using microplate reader (BioTek).

Assay NADPH oxidase activity

NADPH-enhanced superoxide (O₂ ^".) release in homogenates from cultured HUVECs was quantified by lucigenin-enhanced chemiluminescence, as previously described (Sanchez M, Lodi F, Vera R, Villar IC, Cogolludo A, Jimenez R, Moreno L, Romero M, Tamargo J, Perez- Vizcaino F, Duarte J. Quercetin and isorhamnetin prevent endothelial dysfunction, superoxide production, and overexpression of p47phox induced by angiotensin I I in rat aorta. J Nutr. 2007 Apr;137(4):910-5.). Following incubation, according to the conditions A to C described above, HUVECs were homogenized in buffer (of the following composition (mmol/L): HEPES, 10 (pH 8); KCI, 10; EDTA, 1 ; EGTA, 1 ; dithiothreitol, 1 ; aprotinin, 0.006; leupeptin, 0.009; Na-p-tosyl-l- lysine chloromethyl ketone, 0.01 1 ; NaF, 5; Na₂MoO₄, 10; NaVO₄ and phenylmethanesulfonyl fluoride, 0.5 and centrifuged) to provide a HUVEC homogenate suspension. NADPH (100 μΜ) was then added to the buffer containing 50 g protein of the HUVECS homogenate suspension in a total volume of 500 μΙ and lucigenin (5 μΜ in DMSO) was injected automatically. NADPH oxidase activity was calculated by subtracting the basal values from those in the presence of NADPH. The data is expressed as RLU/min/ g protein.

Measurement of lipid peroxidation

Malondialdehyde (MDA), an index for determining the extent of lipid peroxidation, was measured using OxiSelect TBARS assay kit (Cell Biolabs, San Diego, CA, USA) according to the manufacturer's instructions. Following incubation of HUVECs with palmitate and/or EMPs, according to conditions A to C specified above, the cells were washed and homogenized before the addition of sodium dodecyl sulfate (SDS) lysis solution to the HUVECs samples or MDA standards. Samples and standards were then incubated with thiobarbituric acid for 45 min at 95°C. Samples were brought to room temperature and centrifuged at 1000 x g for 15 min. Supernatants were removed to 96-well plate and absorbance was measured spectrophotometrically at 532 nm using microplate reader (BioTek), and the results were expressed as nmol MDA/mg protein.

Determination of Superoxide dismutase (SOD) and catalase (CAT) activity

SOD and CAT activity were determined in HUVECs homogenate using Cayman's assay kits (Ann Arbor, Ml, USA).

The SOD assay utilizes a tetrazolium salt for the detection of superoxide radicals generated by xanthine oxidase and hypoxanthine. In a 96-well plate, samples from the HUVECs incubated according to conditions A to C specified above, and standards were mixed with a tetrazolium salt solution and xanthine oxidase (supplied by the manufacturer in the SOD assay kit (Sigma- Aldrich cat no # 19160), covered and incubated for 30 min at room temperature with continuous shaking. The absorbance of samples and standards was read at 440 nm. One unit of SOD was defined as the amount of enzyme needed to exhibit 50% dismutation of the superoxide radicals.

The CAT assay method is based on the reaction of CAT with methanol in the presence of an optimal concentration of hydrogen peroxide (H₂O₂) to form formaldehyde. The formaldehyde formed reacts with 4-amino-hydrazino-5-mercapto-1 ,2,4-triazole forming a purple colored heterocycle upon oxidation. Samples were prepared and assayed with a catalase assay kit from Sigma Aldrich Cat no # CAT100 in a similar manner to the SOD assay in a 96 well plate containing samples, standards and mixed with 4-amino-hydrazino-5-mercapto-1 ,2,4-triazole (chromogen) and xanthine oxidase. Absorbance of the chromogen was measured at 540 nm using a plate reader. One CAT unit was defined as the amount of enzyme that causes the formation of 1 .0 nmol of formaldehyde per min at 25 ^eC.

RNA isolation and reverse transcriptase-polymerase chain reaction (RT-PCR) analysis

Total RNA was extracted from HUVECs using Trizol reagent (Invitrogen). RNA samples were quantified at 260 nm. RNA samples with A260/A280 ratios > 1 .7 were selected. The first strand cDNAs were synthesized from 2 μg total RNA, using Superscript II reverse transcriptase and oligo deoxythymidine primers (Sigma Aldrich). Reverse transcription was performed with Surecycler 8800 thermocycler (Agilent Technologies), and the reverse transcription products were amplified amplified by SYBR Green master mix (Bioline, UK) in a total volume of 20 μΙ using the primer set described in Table 1 . Real-time PCR reaction involving 10 min at 95°C followed by 40 cycles of 30 sec at 95°C, 60 sec at annealing temperature of respective primer set, and 30 sec at 72°C steps was used to carry out the reaction. To evaluate the specificity and quality of PCR amplifications, melt curve analysis and agarose gel electrophoresis based quality check were performed. The cycle threshold values were analyzed using the 2^_AACt method. The housekeeping gene GAPDH was used for normalizing gene expression.

Table 1: Primer sequences used for qRT-PCR

F: GCATCACCTATGACACCCTC 62.6

eNOS XM_006716002.2

R: CATGTACCAGCCACTGAAGG 63.1

Western blotting analysis:

HUVECs were harvested and lysed in Radio-lmmunoprecipitation Assay (RIPA) buffer supplemented with proteinase inhibitors for total protein extraction. Protein concentration of each sample was determined by the Bicinchoninic Acid (BCA) Protein Assay kit (Pierce Biotechnology). Equal amounts of protein (30 g) were denatured and separated by sodium dodecyl sulphate (SDS)-polyacrilamide gel electrophoresis. Proteins were transferred to polyvinylidene difluoride (PVDF) membranes, blocked for 1 h in Tris-Buffered Saline Tween-20 (TBST) with 5% nonfat milk, and probed with primary rabbit polyclonal anti- phospho-eNOS (Cell Signaling), rabbit anti-eNOS, rabbit anti-phospho-protein kinase B (Akt), rabbit anti-Akt (all three from Santa Cruz Biotechnology) and mouse anti- -actin (Sigma), with gentle agitation overnight at 4°C. The membranes were washed with Tris-buffered saline and tween 20 (TBST) and incubated with the corresponding secondary peroxidase conjugated antibodies for 1 h at room temperature. The membranes were then visualized with an ECL system (Amersham Pharmacia Biotech, Amersham, UK) and densitometric analysis was performed using ImageJ.

Isolated vessels (ex vivo assay)

Vascular reactivity studies were performed using mouse descending aorta samples. Mouse thoracic aortic (MTA) rings were dissected in sterile phosphate buffered saline (PBS) cleared of periadventitial tissue and cut transversely into 2.0 mm rings. The MTA rings were then incubated for 24 h in serum-free dulbecco's modified eagle's medium (DMEM) supplemented with 10% FBS, 100 U/mL penicillin and 100 g/mL streptomycin. The MTA rings were then incubated for 24 h in serum free DMEM containing 2% fatty acid-free BSA (control) or sodium palmitate (100 μΜ) conjugated with BSA using the modified Chavez method described above, in either the presence or absence of the test compounds C1 -C4 (1 and 10 μΜ in DMSO). MTA rings were then handled carefully to avoid damage to the inner surface and transferred to a chamber filled with fresh Krebs solution and mounted in a myograph (model 610M, Danish Myo Technology, Aarhus, Denmark) for isometric tension measurement (Toral M, Gomez- Guzman M, Jimenez R, Romero M, Sanchez M, Utrilla MP, Garrido-Mesa N, Rodriguez- Cabezas ME, Olivares M, Galvez J, Duarte J. The probiotic Lactobacillus coryniformis CECT571 1 reduces the vascular pro-oxidant and pro-inflammatory status in obese mice. Clin Sci (Lond). 2014 Jul;127(1):33-45.). Concentration-relaxation response curves to acetylcholine (10^"9 M-10^"5 M) were performed on intact MTA rings precontracted by U46619 (10^"8 M in DMSO) in control or on L-NAME (100 μΜ in PBS) treated MTA rings. To examine whether ROS are involved in endothelial dysfunction induced by palmitate within mouse descending aorta samples, responses to acetylcholine were studied. These studies were performed after incubation with the mitochondrial antioxidant mitoQ (0.1 μΜ) or the NADPH oxidase inhibitor apocynin (10 μΜ) incubated for 60 min before the addition of U46619 (10^"8 M in DMSO). Relaxant responses to acetylcholine were expressed as a percentage or precontraction.

Incubation of mouse descending aorta samples, with the palmitate, inhibited the endothelium- dependent relaxation to acetylcholine. The tested glycomimetic compounds C1 -C4 restored the aortic relaxation to acetylcholine in a dose-dependent manner. The relaxant response induced by acetylcholine was almost fully inhibited by the eNOS inhibitor L-NAME in all experimental groups. Both, mitoQ and apocynin significantly improved the impaired aortic relaxation to acetylcholine induced by palmitate as illustrated by Figure 10. Aortas treated with palmitate produced a significant decline in endothelium-dependent vasodilatation. In contrast, all of compounds C1 -C4 significantly improved the palmitate-reduced endothelium-dependent vasodilatation. The relaxant response induced by Ach was almost fully inhibited by the eNOS inhibitor L-NAME in all experimental groups. In conclusion, small molecule glycomimetics prevented palmitate impaired endothelium-dependent relaxation to acetylcholine ex vivo and ROS production in situ.

2. Calcification Inhibition

The preventive effect of glycomimetics compounds C1 -C4 on vascular calcification using samples from patients with cardiovascular disease was investigated, β-glycerophosphate (βΘΡ) has been reported to accelerate calcification in cultured bovine vascular smooth muscle cells (Shioi A, Nishizawa Y, Jono S, Koyama H, Hosoi M, Morii H. Beta-glycerophosphate accelerates calcification in cultured bovine vascular smooth muscle cells. Arterioscler Thromb Vase Biol 1995 Nov;15(1 1 ):2003-9). Due to these calcification effects it is commonly utilized in well-established in vitro vascular calcification models which are used for function and mechanistic studies. The in vitro effects of the synthesized compounds on GP-induced vascular calcification in human pelvic artery smooth muscle cells (HPSMCs) were investigated. By taking advantage of hepatocyte growth factor receptor (HGFR/c-Met) inhibitor, the results of this investigation indicated that glycomimetics compounds C1 -C4 exerted their effects through inhibiting c-Met phosphorylation in these vascular smooth muscle cells.

After reaching confluence, the HPSMCs were incubated in DMEM containing 10% fetal bovine serum (FBS), 0.8 mM CaCI₂, 5 mM βΘΡ. Starting from the first day induction, 10 μΜ of each test compound was added and the media changed every 3 days. HPSMCs cultured in 6-well plates for 21 days were used for calcification staining using alizarin red S, calcium deposition quantification and western blotting.

By day 21 , all tested compounds were able to effectively block GP-induced vascular calcification in HPSMCs as demonstrated by alizarin red S staining as illustrated by Figure 1 1 and calcium deposition assay as illustrated by Figure 12. All compounds C1 -C4 significantly attenuated vascular calcification as indicated by the alizarin red S staining. As shown in Figure 1 1 , A1 -A2 represents control HPSMCs, B1 -B2 represents HPSMCs incubated with osteogenic media, C1 -C2 represents HPSMCs treated with C1 , D1 -D2 represents HPSMCs treated with C2, E1 -E2 represents HPSMCs treated with C3, F1 -F2 respresents HPSMCs treated with C4 and G represents absorbance of stain eluted with 10% formic acid. This illustrates that compounds C1 -C4 are effective in attenuating calcium deposition, reducing mineral deposition and prevent GP-induced vascular calcification.

Another set of cells were cultured in 12-well plates and used for assaying alkaline phosphatase (ALP) activity at days 0, 4, 7 and 10. In another experimental set, treated HPSMCs were harvested on day 7 for gene expression analysis using RT-PCR. All compounds C1 -C4 significantly decreased ALP activity at all tested time points as illustrated by Figure 13. By taking into account that vascular calcification is not a simple process due to an elevated calcium phosphate product, but rather involves an active transdifferentiation into osteoblast-like cells (Reynolds JL, Joannides AJ, Skepper JN, McNair R, Schurgers LJ, Proudfoot D, Jahnen-Dechent W, Weissberg PL, Shanahan CM. Human vascular smooth muscle cells undergo vesicle-mediated calcification in response to changes in extracellular calcium and phosphate concentrations: a potential mechanism for accelerated vascular calcification in ESRD. J Am Soc Nephrol 2004 Nov;15(1 1 ):2857-67.), the effect of compounds C1 -C4 on the expression levels of specific genes in osteoblastic and osteogenic cells were investigated. Moreover, since ALP activity is an early marker of vascular calcification and this data demonstrates a reduction in activity thus supporting the conclusion of attenuated mineralisation of the cells.

3. Cell Viability Assessment (MTT Cytotoxicity)

Cell viability assessment studies were performed with compounds 8, 1 1 , 13 and 14 of the present invention using HepG2 cells plated on 96-well tissue culture polystyrene plates.

The cell viability is determined by the conversion of the soluble MTT [yellow; 3-(4,5-dimethyl-2- thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide] to insoluble formazan (purple) by the action of mitochondrial dehydrogenase in living cells. Mitochondrial function and cell loss are determined by the reduced ability to reduce MTT.

HepG2 human hepatocellular carcinoma cells are plated on 96-well tissue culture polystyrene plates for 24 hr prior to dosing of the cells. Test compound is diluted in DMSO or other suitable solvents and serial dilutions are made in 0.5 % DMSO or appropriate solvent in growth media. Test compound at 8 concentrations in triplicate is then incubated for 72 hr. Appropriate controls are simultaneously used as quality controls. One hour prior to the end of the incubation period, the cells are loaded with MTT [yellow; 3-(4,5-dimethyl-2-thiazolyl)-2,5- diphenyl-2H-tetrazolium bromide], the plates are dried and re-solubilised using DMSO. The plates are then scanned at 570 nm. The assay provides simultaneous measurement of mitochondrial function and cell loss.

The vehicle controls are used to determine the definitions of "normal" for each parameter, then the software calculates the percentage of cells that are low or high responders (depending on the biological significance of a particular readout). The vehicle control wells are then used to determine significance limits for wells that have a greater than expected fraction of low or high responders. The minimum effective concentration is determined from the lowest concentration whose mean value exceeds the significance level, provided either a clear dose-response relationship is observed, or at least two consecutive concentration points are above the significance level. AC₅₀ values are also determined provided a clear dose-response relationship is observed.

Cytotoxicity data was obtained for compounds 8, 1 1 , 13 and 14 (also referred to in the figures as compounds C1 -C4, respectively) and is summarised in the "Conclusions" section below.

4. hERG Channel Inhibition (IC₅₀ Determination)

hERG channel inhibition studies were performed using compounds 8, 1 1 , 13 and 14 of the present invention according to the details provided below. Mammalian cells expressing the hERG potassium channel were dispensed into 384-well planar arrays and hERG tail-currents measured by whole-cell voltage-clamping. A range of concentrations of the test compound were then added to the cells and a second recording of the hERG current was made. The percent change in hERG current was calculated and used to calculate an IC₅₀ value (test compound concentration which produces 50 % inhibition).

The experiments are performed on an lonWorks™ automated patch clamp instrument (Molecular Devices LLC), which simultaneously performs electrophysiology measurements for 48 single cells in a specialised 384-well plate (PatchPlate™). All cell suspensions, buffers and test compound solutions were at room temperature during the experiment.

The cells used are Chinese hamster ovary (CHO) cells stably transfected with hERG (cell-line obtained from Cytomyx, UK). A single-cell suspension is prepared in extracellular solution (Dulbecco's phosphate buffered saline with calcium and magnesium pH 7.2) and aliquots added automatically to each well of a PatchPlate™. The cells are then positioned over a small hole at the bottom of each well by applying a vacuum beneath the plate to form an electrical seal. The vacuum is applied through a single compartment common to all wells which is filled with intracellular solution (buffered to pH 7.2 with HEPES). The resistance of each seal is measured via a common ground-electrode in the intracellular compartment and individual electrodes placed into each of the upper wells.

Electrical access to the cell is then achieved by circulating a perforating agent, amphotericin B, underneath the PatchPlate™. The pre-compound hERG current is then measured. An electrode is positioned in the extracellular compartment and a holding potential of -80 mV applied for 15 sec. The hERG channels are then activated by applying a depolarising step to +40 mV for 5 sec and then clamped at -50 mV for 4 sec to elicit the hERG tail current, before returning to -80 mV for 0.3 sec.

Compound dilutions are prepared by diluting a DMSO solution (default 10 mM) of the test compound using a factor 5 dilution scheme into DMSO, followed by dilution into extracellular buffer such that the final concentrations tested are typically 0.008, 0.04, 0.2, 1 , 5, 25 μΜ (final DMSO concentration 0.25 %). The lonWorks™ instrument automatically adds test compound dilutions to the upper wells of the PatchPlate™. The test compound is left in contact with the cells for 300 seconds before recording currents using the same voltage-step protocol as in the pre-compound scan. Quinidine, an established hERG inhibitor, is included as a positive control, and vehicle control (0.25 % DMSO) as negative control.

Each concentration is tested in 4 replicate wells on the PatchPlate™ (maximum of 24 data points). Filters are applied to ensure only acceptable cells are used to assess hERG inhibition. The cell must maintain a seal resistance of greater than 50 MOhm and a pre-compound current of at least 0.1 nA, and ensure cell stability between pre-and post- compound measurements.

For each replicate the hERG response is calculated using the following equation:

% hERG response = (Post-compound current (nA) / Pre-compound current (nA)) x 100

The % hERG response is plotted against concentration for the test compound and, where concentration-dependent inhibition is observed, the data are fitted to the following equation and an IC₅₀ value calculated:

Where:

ERG response

mean vehicle control response

x = concentration IC₅₀ = concentration required to inhibit current by 50 %

s = Hill slope hERG inhibition data was obtained for compounds 8, 1 1 , 13 and 14 (also referred to in the figures as compounds C1 -C4, respectively) and is summarised in the "Conclusions" section below.

4. Microsomal Metabolic Stability

Microsomal metabolic stability data for compounds 8, 1 1 , 13 and 14 of the present invention was obtained according to the details provided below. Test compound (3 μΜ) is incubated with pooled liver microsomes. Test compound is incubated at 5 time points over the course of a 45 min experiment and the test compound is analysed by LC-MS/MS to provide an intrinsic clearance value (CL_int) with standard error and t_½ value.

Pooled liver microsomes are purchased from a reputable commercial supplier. Microsomes are stored at -80 °C prior to use. Microsomes (final protein concentration 0.5 mg/mL), 0.1 M phosphate buffer pH 7.4 and test compound (final substrate concentration 3 μΜ; final DMSO concentration 0.25 %) are pre-incubated at 37 °C prior to the addition of NADPH (final concentration 1 mM) to initiate the reaction. The final incubation volume is 50 μΙ_. A minus cofactor control incubation is included for each compound tested where 0.1 M phosphate buffer pH 7.4 is added instead of NADPH (minus NADPH). Two control compounds are included with each species. All incubations are performed singularly for each test compound.

Each compound is incubated for 0, 5, 15, 30 and 45 min. The control (minus NADPH) is incubated for 45 min only. The reactions are stopped by transferring 20 μΙ_ of incubate to 60 μΙ_ methanol at the appropriate time points. The termination plates are centrifuged at 2,500 rpm for 20 min at 4 °C to precipitate the protein.

Following protein precipitation, the sample supernatants are combined in cassettes of up to 4 compounds, internal standard is added and samples analysed using generic LC-MS/MS conditions. From a plot of In peak area ratio (compound peak area/internal standard peak area) against time, the gradient of the line is determined. Subsequently, half-life and intrinsic clearance are calculated using the equations below:

Elimination rale constant fk) = f- gradient!

0.693

HoJf-tfe |t¾s) fmln! =—

k

V x 0.693

Intrinsic clearance {CLs«*| f pt/ fn mg protein) = where V = Incubation volume ^L)/Microsomal protein (mg)

Relevant control compounds are assessed, ensuring intrinsic clearance values fall within the specified limits (if available). Any failures should be rejected and the experiment repeated.

Stability and intrinsic clearance data was obtained for compounds 8, 1 1 , 13 and 14 (also referred to in the figures as compounds C1 -C4, respectively) and is summarised in the "Conclusions" section below.

Conclusions

In accordance with the data disclosed herein, it has been demonstrated that compounds of the present invention show surprising efficacy in assays of endothelial dysfunction and vascular calcification and thus show surprising utility in treating such conditions.

In addition, based on the MTT Cytotoxity, hERG inhibition and Microsomal Metabolic Stability assays described above, compounds 8, 1 1 , 13 and 14 of the present invention all showed kinetic solubility (>100μΜ), no cytotoxic effect in HepG2 cells (50 μΜ), a long half-life in mouse liver microsomes (MLMs; t½=482-4160 min) and rat liver microsomes (RLMs; t½ =109-2140 min in RLMs). In addition, compounds 8, 1 1 , 13 and 14 of the present invention, due to the compound stability, also demonstrate low levels of intrinsic clearance (< 2.8 μίΛηϊη/ητις protein in RLMs and <2.88 μί/ηιίηΛτ^ protein in MLMs). Furthermore, no inhibition of hERG up to 50 μΜ was observed for the compounds 8, 1 1 , 13 and 14 of the present invention. It will be understood that the invention has been described by way of example only and modifications may be made whilst remaining within the scope and spirit of the invention, such as identified in the claims.

Claims

CLAIMS:

1 . A compound according to formula (A), (B), (C) or (D):

wherein:

is a 6-membered carbocyclic or heterocyclic ring;

is a 5-membered carbocyclic or heterocyclic ring;

J is H, halo, optionally substituted C_1-10alkyl, optionally substituted C_3-10cycloalkyl, optionally substituted C_2-10alkenyl, optionally substituted C_3-10cycloalkenyl, optionally substituted C_2-10alkynyl, optionally substituted C₂-ioheteroalkyl, optionally substituted C_3-10heterocycloalkyl, optionally substituted C₂-ioheteroalkenyl, optionally substituted C_3-10heterocycloalkenyl, optionally substituted C_2-10heteroalkynyl, optionally substituted

R⁴

C_6-14aryl, optionally substituted C_5-14heteroaryl, or R ;

Z is -0-, -N(R^A)-, -S-, or a Ci_-6alkylene or C_2-6heteroalkylene linker group, wherein the Ci_-6alkylene and C_2-6heteroalkylene linker groups are each independently optionally substituted with 1 to 3 substituents selected from halo, OH, C_1-6alkyl, C_1-6haloalkyl; -OSO₃H and -NH(SO₃H), and wherein R^A is H or C_1-6alkyl;

Q is -O-, -N(R^B)-, -S-, or a C_1-6alkylene or C_2-6heteroalkylene linker group, wherein the C_1-6alkylene and C_2-6heteroalkylene linker groups are each independently optionally substituted with 1 to 3 substituents selected from halo, OH, C_1-6alkyl, C_1-6haloalkyl; -OSO₃H and -NH(SO₃H), and wherein R^B is H or C_1-6alkyl;

R¹ is -CO₂W or a bioisostere of a carboxyl group;

R² and R³ are each independently H, -OR⁷ or -NH(R⁷), wherein each R⁷ is independently selected from the group consisting of H, -SO₃Y, optionally substituted Ci-i₀alkyl, optionally substituted C_3-i₀cycloalkyl, optionally substituted C_2-i₀alkenyl, optionally substituted C₃-i₀cycloalkenyl, optionally substituted C_2-i₀alkynyl, optionally substituted C₂-ioheteroalkyl, optionally substituted C_3-i₀heterocycloalkyl, optionally substituted C₂-ioheteroalkenyl, optionally substituted C_3-i₀heterocycloalkenyl, optionally substituted C_2-i₀heteroalkynyl, optionally substituted C₆-i₄aryl and optionally substituted C_5-i₄heteroaryl, wherein at least one of R² and R³ is selected from -OSO₃Y and -NH(SO₃Y);

R⁴ and R⁵ are each independently H, -OR⁸ or -NH(R⁸), wherein each R⁸ is independently selected from the group consisting of H, -SO₃Y, optionally substituted C_1-10alkyl, optionally substituted C_3-10cycloalkyl, optionally substituted C_2-10alkenyl, optionally substituted C_3-10cycloalkenyl, optionally substituted C_2-10alkynyl, optionally substituted C_2-10heteroalkyl, optionally substituted C_3-10heterocycloalkyl, optionally substituted C_2-10heteroalkenyl, optionally substituted C_3-10heterocycloalkenyl, optionally substituted C_2-10heteroalkynyl, optionally substituted C_6-14aryl and optionally substituted C_5-14heteroaryl;

R⁶ is H, -CH₂OR⁹ or -CH₂NH(R⁹), wherein R⁹ is independently selected from the group consisting of H, -SO₃Y, optionally substituted C_1-10alkyl, optionally substituted C_3-10cycloalkyl, optionally substituted C_2-10alkenyl, optionally substituted C_3-10cycloalkenyl, optionally substituted C_2-10alkynyl, optionally substituted C_2-10heteroalkyl, optionally substituted C_3-10heterocycloalkyl, optionally substituted C_2-10heteroalkenyl, optionally substituted C_3-10heterocycloalkenyl, optionally substituted C_2-10heteroalkynyl, optionally substituted C_6-14aryl and optionally substituted C_5-14heteroaryl;

s is an integer from 0 to 3;

t is an integer from 0 to 2;

each R¹⁰, when present, is independently selected from the group consisting of halo, Ci_-4alkyl, Ci_-4haloalkyl, -OSO₃Y and -NH(SO₃Y); W is H, optionally substituted C_1-10alkyl, optionally substituted C_3-10cycloalkyl, optionally substituted C_2-10alkenyl, optionally substituted C_3-10cycloalkenyl, optionally substituted C_2-10alkynyl, optionally substituted C_2-10heteroalkyl, optionally substituted C_3-10heterocycloalkyl, optionally substituted C_2-10heteroalkenyl, optionally substituted C_3-10heterocycloalkenyl, optionally substituted C_2-10heteroalkynyl, optionally substituted C_6-14aryl or optionally substituted C_5-14heteroaryl; and

Y is H, optionally substituted C_1-10alkyl, optionally substituted C_3-10cycloalkyl, optionally substituted C_2-10alkenyl, optionally substituted C_3-10cycloalkenyl, optionally substituted C_2-10alkynyl, optionally substituted C_2-10heteroalkyl, optionally substituted Cs-_!oheterocycloalkyl, optionally substituted C_2-10heteroalkenyl, optionally substituted Cs-_!oheterocycloalkenyl, optionally substituted C_2-10heteroalkynyl, optionally substituted C₆-i₄aryl or optionally substituted C_5-i₄heteroaryl.

2. The compound or a pharmaceutically acceptable derivative for use according to claim 1 wherein the compound is according to formula (A) or (B):

3. The compound or pharmaceutically acceptable derivative for use according to claim 2, wherein the compound is according to formula (A):

wherein

, R¹-R³, R¹⁰, J and Z are as defined according to claim 1 .

The compound or pharmaceutically acceptable derivative for use according to any

previous claim, wherein

a 6-membered aryl or heteroaryl ring.

The compound or pharmaceutically acceptable derivative for use according to claim 1 , 2 or 4, wherein formula (A) and (B) are according to formulae (A1 ) and (B1 ), respectively:

R¹-R³, R¹⁰, J and Z are as defined according to claim 1 .

The compound or pharmaceutically acceptable derivative for use according to any previous claim, wherein the compound is according to formula (A1 ):

wherein groups R¹-R³, C-E, J and Z are as defined according to claim 5. The compound or pharmaceutically acceptable derivative for use according to any one

of claims 1 to 3, wherein

embered saturated cycloalkyl or

heterocycloalkyl ring.

The compound or pharmaceutically acceptable derivative for use according to any one of claims 1 to 3 and 7, wherein formulae (A) and (B) are according to formulae (A2) and (B2), respectively:

wherein C, D and E are each independently selected from the group consisting of CH₂, CHR¹⁰, NH and NR¹⁰; and

R¹-R³, R¹⁰, J and Z are as defined according to claim 1 .

The compound or pharmaceutically acceptable derivative for use according to any one of claims 1 to 3, 7 and 8, wherein the compound is according to formula (A2):

wherein groups R¹-R³, C-E, J and Z are as defined according to claim 8.

The compound or pharmaceutically acceptable derivative for use according to any one of claims 1 to 9, wherein Z is a C^heteroalkylene linker group optionally substituted with 1 to 3 substituents selected from halo, OH, C_1-6alkyl, C_1-6haloalkyl, -OSO₃H and -NH(SO₃H); optionally wherein Z is a C^heteroalkylene linker group, e.g. an

-O-C_1-2alkylene group. The compound or pharmaceutically acceptable derivative for use according to claim 6, wherein formula (A1 ) is according to formula (A3):

wherein:

groups R¹-R³, C-E, and J are as defined according to claim 5;

A is NR^A, O or S, wherein R^A is H or Ci_-6alkyl; and

m is 1 , 2, 3 or 4.

The compound or pharmaceutically acceptable derivative for use according to any previous claim, wherein J is H, halo, optionally substituted C_1-10alkyl, optionally substituted C_3-10cycloalkyl, optionally substituted C₂-ioheteroalkyl, optionally substituted

R⁴

C_3-10heterocycloalkyl, or R wherein Q and R⁴-R⁶ are as defined in claim 1 .

The compound or pharmaceutically acceptable derivative for use according to claim 12,

R⁴

wherein J is R wherein Q and R⁴-R⁶ are as defined in claim 1 ; optionally wherein Q is a C^heteroalkylene linker group optionally substituted with 1 to 3 substituents selected from halo, OH, C_1-6alkyl, C_1-6haloalkyl; -OSO₃H and -NH(SO₃H); optionally wherein Q is a C^heteroalkylene linker group, e.g. -O-C_1-2alkylene. The compound or harmaceutically acceptable derivative for use according to claim 13,

wherein J is

wherein

R⁴-R⁶ are as defined in claim 1 ;

B is NR^B, O or S, wherein R^B is H or C_1-6alkyl; and

n is 1 , 2, 3, or 4.

The compound or pharmaceutically acceptable derivative for use according to claim 14, wherein the compound is according to formula (I):

wherein:

A is NR^A, O or S, wherein R^A is H or C_1-6alkyl;

B is NR^B, O or S, wherein R^B is H or Ci_-6alkyl;

m is 1 , 2, 3 or 4;

n is 1 , 2, 3 or 4;

R¹ is -C0₂W or a bioisostere of a carboxyl group;

R² and R³ are each independently H, -OR⁷ or -NH(R⁷), wherein each R⁷ is independently selected from the group consisting of H, -SO₃Y, optionally substituted C^. ₁₀alkyl, optionally substituted C_3-10cycloalkyl, optionally substituted C_2-10alkenyl, optionally substituted C_3-10cycloalkenyl, optionally substituted C_2-10alkynyl, optionally substituted C₂-ioheteroalkyl, optionally substituted C_3-10heterocycloalkyl, optionally substituted C_2-10heteroalkenyl, optionally substituted C_3-10heterocycloalkenyl, optionally substituted C_2-10heteroalkynyl, optionally substituted C_6-14aryl and optionally substituted C_5-14heteroaryl, wherein at least one of R² and R³ is selected from -OSO₃Y and -NH(SO₃Y); R⁴ and R⁵ are each independently H, -OR⁸ or -NH(R⁸), wherein each R⁸ is independently selected from the group consisting of H, -SO₃Y, optionally substituted C^. 1₀alkyl, optionally substituted C_3-10cycloalkyl, optionally substituted C_2-10alkenyl, optionally substituted C_3-10cycloalkenyl, optionally substituted C_2-10alkynyl, optionally substituted C_2-10heteroalkyl, optionally substituted C_3-10heterocycloalkyl, optionally substituted C_2-10heteroalkenyl, optionally substituted C_3-10heterocycloalkenyl, optionally substituted C_2-10heteroalkynyl, optionally substituted C_6-14aryl and optionally substituted C_5-14heteroaryl;

R⁶ is H, -CH₂OR⁹ or -CH₂NH(R⁹), wherein R⁹ is independently selected from the group consisting of H, -SO₃Y, optionally substituted C_1-10alkyl, optionally substituted C_3-10cycloalkyl, optionally substituted C_2-10alkenyl, optionally substituted C_3-10cycloalkenyl, optionally substituted C_2-10alkynyl, optionally substituted C_2-10heteroalkyl, optionally substituted C_3-i₀heterocycloalkyl, optionally substituted C_2-i₀heteroalkenyl, optionally substituted C_3-i₀heterocycloalkenyl, optionally substituted C_2-i₀heteroalkynyl, optionally substituted C₆-i₄aryl and optionally substituted C_5-i₄heteroaryl;

W is H, optionally substituted Ci-₁₀alkyl, optionally substituted C_3-i₀cycloalkyl, optionally substituted C₂-i₀alkenyl, optionally substituted C₃-i₀cycloalkenyl, optionally substituted C₂-i₀alkynyl, optionally substituted C₂-i₀heteroalkyl, optionally substituted C₃-i₀heterocycloalkyl, optionally substituted C₂-i₀heteroalkenyl, optionally substituted C₃-i₀heterocycloalkenyl, optionally substituted C₂-i₀heteroalkynyl, optionally substituted C₆-i₄aryl or optionally substituted C_5-i₄heteroaryl; and

Y is H, optionally substituted Ci-₁₀alkyl, optionally substituted C₃-i₀cycloalkyl, optionally substituted C₂-i₀alkenyl, optionally substituted C₃-i₀cycloalkenyl, optionally substituted C₂-i₀alkynyl, optionally substituted C₂-i₀heteroalkyl, optionally substituted C₃-i₀heterocycloalkyl, optionally substituted C₂-i₀heteroalkenyl, optionally substituted C₃-i₀heterocycloalkenyl, optionally substituted C₂-i₀heteroalkynyl, optionally substituted C₆-i₄aryl or optionally substituted C_5-i₄heteroaryl;

each R¹⁰ is independently selected from the group consisting of halo, C_1-4alkyl, C_{1 -4}haloalkyl, -OSO₃Y and -NH(SO₃Y).

16. The compound or pharmaceutically acceptable derivative for use according to any one of claims 1 to 15, wherein R¹ is -CO₂W, wherein W is defined according to claim 1 .

17. The compound or pharmaceutically acceptable derivative for use according to any previous claim, wherein W is H, optionally substituted C_1-10alkyl, or optionally substituted C₂-ioheteroalkyl; optionally wherein W is H or optionally substituted C^. 1₀alkyl; optionally wherein W is H or C_1-6alkyl, such as wherein W is H or methyl.

18. The compound or pharmaceutically acceptable derivative for use according to any one of claims 1 to 17, wherein R² is -OR⁷ or -NH(R⁷), optionally wherein said R⁷ is -SO₃Y, such as wherein R² is -OSO₃Y.

19. The compound or pharmaceutically acceptable derivative for use according to any one of claims 1 to 18, wherein R³ is -OR⁷ or -NH(R⁷), optionally wherein said R⁷ is -SO₃Y, such as wherein R³ is -OSO₃Y.

20. The compound or pharmaceutically acceptable derivative for use according to any one of claims 1 to 19, wherein R² and R³ are selected independently from -OSO₃Y and -NH(SO₃Y), such as wherein both R² and R³ are -OSO₃Y .

21 . The compound or pharmaceutically acceptable derivative according to any one of claims 1 to 20, for use according to claim 1 , wherein R⁴ is H, -OR⁸ or -NH(R⁸); optionally wherein R⁴ is -OR⁸ or -NH(R⁸); and optionally wherein R⁸ is -SO₃Y, such as wherein R⁴ is -OSO₃Y.

22. The compound or pharmaceutically acceptable derivative for use according to any one of claims 1 to 20, wherein R⁴ is H.

23. The compound or pharmaceutically acceptable derivative for use according to any one of claims 1 to 22, wherein R⁵ is -OR⁸ or -NH(R⁸), optionally wherein R⁸ is -SO₃Y, such as wherein R⁵ is -OSO₃Y.

24. The compound or pharmaceutically acceptable derivative for use according to any one of claims 1 to 23, wherein at least one of R⁴ and R⁵ is selected from -OSO₃Y and -NH(SO₃Y), optionally wherein R⁴ and R⁵ are each independently selected from -OSO₃Y and -NH(SO₃Y), such as wherein both R⁴ and R⁵ are -OSO₃Y.

25. The compound or pharmaceutically acceptable derivative for use according to any one of claims 1 to 24, wherein R⁶ is H.

26. The compound or pharmaceutically acceptable derivative for use according to any one of claims 1 to 25, wherein each R⁷ is independently selected from the group consisting of H, -SO₃Y and optionally substituted Ci-i₀alkyl; optionally wherein each R⁷ is independently selected from the group consisting of H and -S0₃Y; such as wherein each R⁷ is -S0₃Y.

27. The compound or pharmaceutically acceptable derivative for use according to any one of claims 1 to 26, wherein each R⁸ is independently selected from the group consisting of H, -SO₃Y and optionally substituted Ci-i₀alkyl; optionally wherein each R⁸ is independently selected from the group consisting of H and -S0₃Y; such as wherein each R⁸ is -S0₃Y.

28. The compound or pharmaceutically acceptable derivative for use according to any one of claims 1 to 24, 26 and 27, wherein R⁹ is selected from the group consisting of H, -S0₃Y and optionally substituted C_1-10alkyl; optionally wherein R⁹ is selected from the group consisting of H and -S0₃Y; such as wherein R⁹ is -S0₃Y.

29. The compound or pharmaceutically acceptable derivative for use according to any one of claims 1 to 28, wherein each R¹⁰, where present, is independently selected from the group consisting of halo, Ci_-4alkyl, Ci_-4haloalkyl and -OS0₃Y; optionally wherein each R¹⁰, where present, is independently selected from CF, CCH₃, CF₃ and -OS0₃Y.

30. The compound or pharmaceutically acceptable derivative for use according to any one of claims 1 to 28, wherein s is 0.

31 . The compound or pharmaceutically acceptable derivative thereof according to any one of claims 1 to 30 wherein at least two, and optionally three, of R², R³, R⁴ and R⁵ are -OS0₃Y, optionally wherein each of R², R³, R⁴ and R⁵ is -OS0₃Y and R⁶ is H.

32. The compound or pharmaceutically acceptable derivative thereof for use according to any one of claims 1 to 30, wherein R², R³ and R⁵ are -OS0₃Y, and R⁴ and R⁶ are each H.

33. The compound or pharmaceutically acceptable derivative for use according to any one of claims 1 1 to 32, wherein A is O or S, optionally O.

34. The compound or pharmaceutically acceptable derivative for use according to any one of claims 14 to 33, wherein B is O or S, optionally O, such as wherein A and B are each O.

35. The compound or pharmaceutically acceptable derivative for use according to any one of claims 5, 6 and 10 to 34, wherein C is selected from the group consisting of CH and C(R¹⁰), wherein R¹⁰ is selected from the group consisting of halo, C_1-4alkyl and C_1-4haloalkyl; optionally wherein R¹⁰ is halo, CF or CCH₃.

36. The compound or pharmaceutically acceptable derivative for use according to any one of claims 5, 6 and 10 to 35, wherein E is selected from the group consisting of CH and C(R¹⁰), wherein R¹⁰ is selected from the group consisting of halo, Ci_-4alkyl and Ci_-4haloalkyl; optionally wherein R¹⁰ is halo, CF or CCH₃.

37. The compound or pharmaceutically acceptable derivative for use according to any one of claims 5, 6 and 10 to 36, wherein D is CH or C(R¹⁰), wherein R¹⁰ is selected from the group consisting of halo, C_1-4alkyl and -OS0₃Y; optionally wherein R¹⁰ is halo, CF, CCH₃, or -OS0₃Y, such as -OS0₃Y.

38. The compound or pharmaceutically acceptable derivative for use according to any one of claims 5, 6 and 10 to 34, wherein C, D and E are each independently selected from the group consisting of CH and N, optionally wherein C, D and E are each CH.

39. The compound or pharmaceutically acceptable derivative for use according to any one of claims 1 1 to 38, wherein m is 1 or 2, optionally wherein m is 1 .

40. The compound or pharmaceutically acceptable derivative for use according to any one of claims 14 to 39, wherein n is 1 or 2.

41 . The compound or pharmaceutically acceptable derivative for use according to any one of claims 1 to 40, wherein each Y is independently selected from H and optionally substituted C_1-10alkyl; optionally wherein each Y is independently selected from H and C_1-6alkyl, such as wherein each Y is H.

42. The compound of formula (I) or a pharmaceutically acceptable derivative thereof for use according to claim 15, wherein:

A and B are selected independently from O or S, optionally wherein both A and

B are O;

C, D and E are each CH;

m is 1 or 2;

n is 1 or 2;

R¹ is -C0₂W; R², R³, R⁴ and R⁵ are each independently selected from H and -OS0₃Y, wherein one, and optionally at least 2, of R², R³, R⁴ and R⁵ is -S0₃Y;

W is H or optionally substituted C_1-6alkyl; and

Y is H.

The compound or pharmaceutically acceptable derivative thereof for use according to claim 42 wherein formula (I) is according to formula (III):

wherein:

n is 1 or 2;

R¹ is -C0₂W, wherein W is H or optionally substituted Ci_-6alkyl;

R², R³ and R⁵ are each -OS0₃H or -NHS0₃H; and

R⁴ is H or -OSO₃H or -NHSO₃H.

A compound according to any one of the following formulae, or a pharmaceutically acceptable derivative thereof, for use in the treatment of vascular calcification and / or endothelial dysfunction:

OSO3H

; and

OSO H

A compound selected from any one of the following formulae, or a pharmaceutically acceptable derivative thereof, for use in the treatment of vascular calcification and / or endothelial dysfunction:

OSO3H

OSO3H

47. A compound or pharmaceutically acceptable derivative thereof for use according to any previous claim, wherein the pharmaceutically acceptable derivative thereof is a pharmaceutically acceptable salt; optionally wherein the pharmaceutically acceptable salt is a base addition salt, such as a metal salt (e.g. a sodium salt), or a salt formed using ammonia, a pharmaceutically acceptable organic amine or a heterocyclic base.

48. A pharmaceutical composition comprising a compound or pharmaceutically acceptable derivative thereof defined according to any previous claim and a pharmaceutically acceptable excipient, for use in the treatment of vascular calcification and / or endothelial dysfunction.

49. Use of a compound or pharmaceutically acceptable derivative thereof as defined according to any one of claims 1 to 47, or a pharmaceutically acceptable composition according to claim 48 in the manufacture of a medicament for the treatment of vascular calcification and / or endothelial dysfunction.

50. A method for the treatment of vascular calcification and / or endothelial dysfunction in a patient, comprising the step of administering a therapeutically effective amount of a compound or pharmaceutically acceptable derivative thereof as defined according to any one of claims 1 to 47, or a pharmaceutically acceptable composition according to claim 48 to a patient.

51 . A compound for use according to any one of claims 1 to 47, composition for use according to claim 48, use according to claim 49 or method according to claim 50, wherein the treatment of vascular calcification and / or endothelial dysfunction is the treatment of vascular disease.

52. A method of modulating c-Met activity in an endothelial cell comprising contacting the cell with a compound or pharmaceutical derivative thereof as defined according to any one of claims 1 to 47, optionally wherein the endothelial cell is a human endothelial cell.

53. The method of claim 52, wherein the method is not a method of treatment by therapy, optionally wherein the method is an in vitro or ex-vivo method.