WO2017032869A1

WO2017032869A1 - Induction of the expression of emx2 and use thereof in the treatment of gliomas

Info

Publication number: WO2017032869A1
Application number: PCT/EP2016/070164
Authority: WO
Inventors: Antonio Mallamaci; Carmen FALCONE
Original assignee: S.I.S.S.A. Scuola Internazionale Superiore Di Studi Avanzati
Priority date: 2015-08-26
Filing date: 2016-08-26
Publication date: 2017-03-02
Also published as: ITUB20153238A1

Abstract

The present invention relates to an inducer or activator of the expression and/or function of Emx2 for use in the treatment and/or prevention of a glioma and/or prevention of recurrence of a glioma; preferably, said glioma is a glioblastoma.

Description

Induction of the expression of Emx2 and use thereof in the treatment of gliomas

FIELD OF THE INVENTION

The present invention relates to an inducer or activator of the expression and/or function of Emx2 for use in the treatment and/or prevention of a glioma and in the prevention of recurrence thereof, preferably in the treatment and prevention of the glioblastoma.

BACKGROUND ART

Glioblastoma, also called glioblastoma multiforme (GBM) or grade IV astrocytoma (according to the WHO classification), accounts for about 1/6 of all brain tumours (primary and metastatic), or about 1/2 of astrocytic tumours of the CNS. It has an incidence of about 3 cases per 100,000 people per year. In other words, in Italy alone there are about 2,000 new cases per year. It may arise ex novo, or else originate from the evolution of lower-grade astrocytomas, II or III. It affects men more than women, and adults and the elderly much more than children. The symptoms are complex and variable; they include severe headache, hemiparesis, nausea, vomiting, convulsions, and severe memory and cognitive deficits. The standard attack therapy, when possible, is surgery. It is normally followed by radiotherapy associated with administration of the alkylating radiosensitizing agent temozolamide (TMZ). In any event, the prognosis is very poor. The median life expectancy after the first diagnosis is 14.5 months, and rises to only 24 months in 30% of patients and 60 months in <10% of them. The etiopathogenesis of the tumour is complex and variable. It includes variegated gene lesions impacting different regions of the metabolic track and relevant for the control of proliferation, survival, differentiation and vasculogenic and migratory capacities. A number of advanced diagnostic trials are currently being conducted with the aim of specifically combating the outcome of the most harmful mutation (for example, inhibition of the different membrane RTKs involved, as well as of the cascades operating downstream from them). The approaches include the use of blocking monoclonal antibodies, siR As and tumour suppressor genes to be transduced by means of viral vectors. To date, the effectiveness of such approaches seems to be very low. The functional redundancy of the genic-metabolic lesions underlying glioblastoma and the formidable proliferative advantage imparted by them facilitate the selection of resistant cell subpopulations. What is more, the latter include tumour stem cells, crucial for the development and recurrence thereof. All this makes the disease largely untreatable, irrespective of therapy. Thus there exists a need to provide new therapeutic treatments capable of simultaneously attacking different aspects of GBM that lie at the basis of its aggressiveness. SUMMARY OF THE INVENTION

The present authors have developed an operative approach that simultaneously and successfully addresses the two key factors of the malignancy of GBM, etiopathogenetic redundancy and the resilience of the tumour stem cells to antiblastic treatments.

The present authors have found that the overexpression of the transcription factor Emx2 [GenBank accession numbers NC 000085.6 (59458116...59465357) (mouse gene); NM_010132.2 (mouse transcript); CCDS29937.1 (CDS of mouse Emx2); NP_034262.2 (mouse protein); NG_013009.1 (human gene); NM 004098.3 (human transcript); CCDS7601.1 (CDS of human Emx2); NP 004089.1 (human protein)], however obtained, can be a tool for the treatment of glioblastoma and, alternatively, lower-grade glial tumours, as well as for the prevention of recurrence of the former and degenerations of the latter. The results obtained by the present authors demonstrate that: (1) the overexpression of Emx2 in GBM (or more in particular in the stem cells) causes the collapse of the tumour, both in vitro and in vivo; (2) Emx2 co-alters, in a therapeutically useful manner, the levels of expression of a pool of genes co-responsible for the malignity of GBM. This should prevent the selection of resistant subpopulations, which usually emerge after treatments targeting individual elements of the pool.

A large part of the functional characterisation of the Emx2 gene carried out up to now was originally centred on its role in the regionalization of the front central nervous system and in the early regulation of neuronogenesis (Kimura et al, 2005; Muzio et al, 2002; Mallamaci et al, 2000; Muzio et al., 2005). From the cited study it emerged that Emx2 stimulates the self- renewal of early cerebral cortical neural stem cells, delaying the differentiation thereof into neurons. When, more recently, the present authors investigated the role of this gene in the advanced histogenesis of the cerebral cortex (end of neuronogenesis and start of astrogenesis), it was surprisingly found that the function of Emx2 is inverted, so that it is capable of inhibiting the self-renewal of neural stem cells and pushing the latter toward terminal differentiation (Brancaccio et al, 2010; Falcone et al, 2015). This apparent "functional inversion" allows for a variety of possible population and molecular mechanisms.

Prior to present invention, the knowledge of EMX2 -tumors relationship was poor and not straightforward. Emx2 overexpression was known to suppress human gastrocarcinoma cell lines (Li et al, 2012). However, among CNS tumors, EMX2 was reported to be one of the most overexpressed genes in supratentorial ependimomas. As for glioblastomas, their huge molecular and metabolic and clonal heterogeneity (Brennan et al., 2013) as well as the highly context- dependent activity displayed by Emx2 in healthy murine neural precursors made the presumptive outcome of EMX2 manipulation in these tumors really hard to predict.

The present authors have demonstrated that an increased level of expression of the Emx2 gene in human glioblastoma cultures blocks the expansion thereof and causes it to collapse. The effect - well documented in vitro on at least seven different tumours - is powerful, substantial and rapid. The underlying mechanism seems to consist in a multiple synergetic blocking of metabolic branches that are a key factor for tumour malignity. Not least importantly, this mechanism is effectively expressed in tumour stem cells, crucial for the development and recurrence thereof.

The present authors have found that the overexpression of the Emx2 gene, either generalised or limited to tumour stem cells, can be used as a method for (1) antagonising glioblastoma multiforme as well as other lower-grade gliomas, (2) inducing the regression thereof, and (3) preventing the recurrence thereof.

The invention therefore provides an inducer or activator of the expression and/or function of Emx2 for use in the treatment and/or prevention of a glioma and/or prevention of recurrence of a glioma; preferably, said glioma is a glioblastoma, more preferably it is a resistant glioblastoma.

Said inducer or activator is preferably an agent capable of increasing the expression and/or function of Emx2 or its mRNA.

The inducer or the activator for use according to the invention is preferably selected from the group consisting of:

a) a polypeptide;

b) a polynucleotide coding for said polypeptide;

c) a polynucleotide coding for Emx2 or a functional derivative thereof;

d) the polypeptide Emx2 or a functional fragment thereof;

e) a vector comprising said polynucleotide or expressing said polypeptide;

f) a host cell genetically engineered to express said polypeptide, polynucleotide; and

g) a nucleic acid and/or a small molecule.

Said nucleic acid or small molecule is capable of specifically increasing the expression of the Endogenous EMX2 gene, stimulating its transcription, stabilizing the corresponding mRNA and/or increasing its translation.

The polypeptide Emx2 for use according to the invention is preferably a molecule consisting of a sequence having at least 95% identity with SEQ ID No. 1 or allelic variants thereof. In the vector for use according to the invention, the polypeptide Emx2 is preferably a molecule consisting of a sequence having at least 95% identity with SEQ No. 1 or allelic variants thereof. Preferably the polypeptide Emx2 is a molecule consisting of a sequence having at least 96% identity with SEQ No. 1 or allelic variants thereof, preferably a sequence having at least 97% identity with SEQ No. 1 or allelic variants thereof, preferably a sequence having at least 98% identity with SEQ No. 1 or allelic variants thereof, preferably a sequence having at least 99% identity with SEQ No. 1 or allelic variants thereof.

More preferably, the polypeptide Emx2 consists of SEQ ID No. 1 or SEQ ID No. 4.

Preferably, the polynucleotide coding for Emx2 comprises the sequence nt. 824-1582 of SEQ ID NO:2, SEQ ID NO: 12 or SEQ ID NO: 11.

The vector for use according to the invention is preferably a nanoparticle, a liposome, an exosome, or a viral vector, preferably an adenoviral vector, a herpetoviral vector, a lentiviral vector, a gammaretroviral vector, an adenoassociated vector (AAV), or a vector with a naked DNA plasmid. Preferably said vector is for use in the gene therapy.

In a preferred embodiment, the vector comprises a sequence to overexpress Emx2 mRNA and/or protein in a glioma cell and/or a sequence to destabilize and/or inhibit translation of Emx2-encoding mRNA in a non-glioma cell.

In a preferred embodiment, the vector comprises a set of cis-active elements suitable to achieve Emx2 mRNA and/or protein overexpression, constitutive, or preferentially sustained in glioblastoma cancer cells, and/or confined (specifically limited) to them. These elements include: (1) modules promoting transcription, active in glioblastoma cancer cells and/or glioblastoma cancer stem cells; (2) miRNA-responsive elements (miRNA-REs), driving preferential destabilization and/or translational inhibition of the Emx2-encoding mRNA in non- glioblastoma cells. Preferably, modules referred to in (1) include: the Pgkl-p promoter (Brancaccio et al, 2010)(SEQ ID NO:6), ubiquitously active; the TREt promoter (Brancaccio et al, 2010) (SEQ ID NO:7), responsive to tetracycline-controlled transactivators; the Nes-p module (Brancaccio et al, 2010), comprising the minimal Hspala promoter (SEQ ID NO:9) and the neural enhancer from intron 2 of the nestin gene of Rattus norvegicus (SEQ ID NO: 8). As an example, cis-active modules regulating transcription, referred to in (1), also include (but are not limited to): Hes5-p (Mizutani et al, 2007)(Genbank NC 000070.6: from -800 to +73 with respect to mmu-Hes5 transcription start site); Blbp-p (Anthony et al, 2005)(Genbank NC 000076.6: from -766 to +53 with respect to mmu-Blbp transcription start site); etc.

As an example, miRNA-REs referred to in (2) include (but are not limited to) sequences reverse-complementary to cDNAs of the following mature human miRNAs: hsa-miR-124 (Genbank NR 029668.1), hsa-miR-126 (Genbank NR 029695.1), hsa-miR-128 (Genbank_ NR 029672.1), hsa-miR-135a (Genbank_NR_029677.1), hsa-miR-137 (Genbank_ NR 029679.1), hsa-miR-139-5p (Genbank_LM378892.1), hsa-miR-153 (Genbank_ NR 029688.1), hsa-miR-219-5p (Genbank_ NR 029633.1), hsa-miR-323 (Genbank_ NR 029890.1).

Preferably, the vector as described above comprises SEQ ID NO: 10.

The invention also provides a host cell as described above transformed with a vector as described above.

The invention further provides to a cellular composition comprising at least 50% of the cells as defined above, a viral particle for use in the treatment and/or prevention of a glioma and/or prevention of recurrence of a glioma, comprising the vector as described above.

The invention further provides the inducer or activator, the polypeptide, the vector, the host cell, the cellular composition or the viral particle for use as defined above in combination with at least one therapeutic treatment.

Preferably the therapeutic treatment is selected from the group consisting of radiotherapy or chemotherapy.

Preferably the chemotherapy is selected from the group consisting of: an alkylating agent, a nitrosourea agent, an inhibitor of 06-methylguanine-DNA methyltransferase (MGMT) or cis- platinum.

Preferably the alkylating agent is temozolomide.

The inducer or activator, the polypeptide, the vector, the host cell, the cellular composition or the viral particle for use as defined above may also be used in combination with the anti- angiogenic agent bevacizumab, with irinotecan and with a tyrosine kinase inhibitor such as gefitinib or erlotinib.

The invention further provides a pharmaceutical composition comprising the vector as described above or the host cell as described above or the viral particle as described above or the cellular composition as described above and at least one pharmaceutically acceptable excipient, for use in the treatment and/or prevention of a glioma and/or prevention of recurrence of a glioma.

Preferably the pharmaceutical composition further comprises at least one therapeutic agent. Preferably the therapeutic agent is selected from the group consisting of: an alkylating agent, a nitrosourea agent, an inhibitor of MGMT or cis-platinum.

Preferably the alkylating agent is temozolomide.

The invention further provides the pharmaceutical composition for use as defined above in combination with radiotherapy. The invention also provides a method to decrease or block glioma cell expansion, comprising the administration of an inducer or activator or viral particle as described above.

Preferably, said inducer or activator regulates the levels of expression of genes involved in the transmission / modulation of the mitogenic signal along the cascade of the RTK and/or of the genes involved in the management of the "earlyGl/lateGl-checkpoint" and/or of other genes associated with the etiopathogenesis of glioblastoma.

The invention further provides the inducer or activator, the polypeptide, the vector, the host cell, the cellular composition, the viral particle or the pharmaceutical composition as defined above for use in a method to sensitive a glioma cell to a therapeutic treatment.

Preferably the alkylating agent is temozolomide.

Preferred nitrosourea agent is carmustine or BCNU (carmustine)-polymer wafers.

Preferred inhibitor of 06-methylguanine-DNA methyltransferase is 06-benzylguanine or a

RNA interference that silences MGMT.

The term "glioma" here comprises a tumour selected from among: pilocytic astrocytoma, diffuse astrocytoma (WHO grade II), anaplastic astrocytoma (WHO grade III), and glioblastoma (WHO grade IV).

The term "inducer or activator" means a molecule capable of increasing the expression and/or the function of the Emx2 gene or of the protein coded by it, or by a derivative thereof.

The increase is relative to the normal or basal level of expression and/or function in the absence of an inducer or activator, but under similar conditions.

This increase can be verified with any means known to the person skilled in the art. The increase in the level of expression or presence of Emx2 can be evaluated using classic molecular biology techniques, such as, for example, qPCR, qRT-PCR, microarray, Northern blot, cloning and sequencing, electrophoresis and Western blot. The increase in the function can be evaluated by analysing, for example, the gene expression of genes regulated by Emx2.

In the context of the present invention, a "derivative" comprises a molecule of nucleic acid coding for the polynucleotide as defined above or a nucleic acid comprising the polynucleotide as defined above. The term "derivative" also refers to shorter or longer polynucleotides and/or polynucleotides having, for example, a percentage of identity of at least 41 %, 50 %, 60 %, 65 %, 70 % or 75%, more preferably at least 85%, 90%, and even more preferably at least 95% , 96%, 97 %, 98 % with SEQ ID NO:2 or SEQ ID NO:3 or with the complementary sequence thereof.

The term "derivative" also includes polynucleotides comprising nucleotide analogues, mutations and equivalents. The term "derivative" also includes at least one functional fragment of the polynucleotide.

In the context of the present invention, "functional" means, for example, "maintains at least the same activity", for example that it maintains at least the same activities as Emx2.

As used in the present invention, "fragment" refers to a polynucleotide preferably having a length of at least 45 nucleotides or a polypeptide preferably having a length of at least 15 amino acids. Preferably, the polynucleotide coding for Emx2 comprises sequence nt. 824-1582 of SEQ ID NO:2 or SEQ ID NO: 12.

The term "polynucleotide" also refers to modified polynucleotides.

In the context of the present invention, the term "polypeptide" or "protein" includes:

i. the whole protein, allelic variants and orthologs thereof;

ii. any synthetic, recombinant or proteolytic functional fragment;

iii. any functional equivalent, such as, for example, synthetic or recombinant functional analogues.

Preferably, in the vector as described above, the polynucleotide is under the control of a promoter capable of efficiently expressing said polynucleotide or polypeptide.

The vector according to the invention can comprise, in the 3'UTR of the transgene, miRNA- responsive modules which destabilise the resulting mRNA in undesirable cell types, for example in order to obtain a selective expression in the tumour stem cell compartment.

In the vector, the polynucleotide sequence, preferably a DNA sequence, is operatively tied to an appropriate sequence of control of the expression (promoter) for directing the synthesis of mRNA. As examples of promoters we can mention the immediate promoter of the early genes of cytomegalovirus (CMV), HSV thymidine kinase, early and late SV40 and retroviral LTRs. The vectors can also contain one or more selectable gene markers.

As used here, the term "genetically engineered host cells" refers to a host cell that has been transduced, transformed or transfected with the polynucleotide or with the vector as described above.

As examples of appropriate host cells, we can mention bacterial cells, fungal and yeast cells, insect cells, plant cells and animal cells, preferably glioblastoma cells, for example U87 or T98G, or cells derived from biopsies. The introduction of the previously described polynucleotide or vector into the host cell can be achieved using methods known to the person skilled in the art, such as, for example, calcium phosphate transfection, DEAE-dextran mediated transfection, electroporation, lipofection, microinjection, viral infection, thermal shock, cell fusion... the previously described polynucleotide or vector can be introduced into the glioblastoma cells of the patient using exosomes from engineered autologous cells or artificial nanoparticles or self-complementary adenoassociated viruses.

Suitable routes of administration of the pharmaceutical composition of the invention include, for example, oral, intranasal and parenteral administration... Other methods of administration include injection, viral transfer, the use of liposomes, artificial nanoparticles, exosomes from engineered autologous cells and oral intake.

Pressure-driven infusion of the therapeutic agents of the present invention through an intracranial catheter, also known as convection-enhanced delivery (CED) may also be used. It has the advantage of delivering drugs along a pressure gradient rather than by simple diffusion. The exosomes from engineered autologous cells or artificial nanoparticles or self- complementary adenoassociated viruses can be functionalised if necessary in order to pass through the blood-brain barrier following intravenous administration and preferably configured to selectively translate the CSCs.

The pharmaceutical composition of the present invention can be administered in the form of a dosage unit, for example tablets or capsules, or a solution.

Preferably, it is administered into glioma stem cells.

The inducer or activator as defined above is administered in a pharmaceutically effective dose, which in the case of polynucleotides can be comprised between 0.001 pg/kg of body weight and 1 mg/kg of body weight depending on the route of administration and severity of the tumour. In the present invention the term "effective amount" shall mean an amount which achieves a desired effect or therapeutic effect as such effect is understood by those of ordinary skill in the art. In the present invention, the inducer or activator may be administered simultaneously or sequentially with another therapeutic treatment, that may be a chemotherapy or radiotherapy. Pharmaceutical compositions containing the inducer or activator of the present invention may be manufactured by processes well known in the art, e.g., using a variety of well-known mixing, dissolving, granulating, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes. The compositions may be formulated in conjunction with one or more physiologically acceptable carriers comprising excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen. Parenteral routes are preferred in many aspects of the invention.

For injection, including, without limitation, intravenous, intramusclular and subcutaneous injection, the compounds of the invention may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as physiological saline buffer or polar solvents including, without limitation, a pyrrolidone or dimethylsulfoxide.

The inducer or activator is preferably formulated for parenteral administration, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g. in ampoules or in multi-dose containers. Useful compositions include, without limitation, suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain adjuncts such as suspending, stabilizing and/or dispersing agents. Pharmaceutical compositions for parenteral administration include aqueous solutions of a water soluble form, such as, without limitation, a salt of the active compound. Additionally, suspensions of the active compounds may be prepared in a lipophilic vehicle. Suitable lipophilic vehicles include fatty oils such as sesame oil, synthetic fatty acid esters such as ethyl oleate and triglycerides, or materials such as liposomes. Aqueous injection suspensions may contain substances that increase the viscosity of the suspension, such as sodium carboxym ethyl cellulose, sorbitol, or dextran. Optionally, the suspension may also contain suitable stabilizers and/or agents that increase the solubility of the compounds to allow for the preparation of highly concentrated solutions. Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile, pyrogen-free water, before use.

For oral administration, the compounds can be formulated by combining the active compounds with pharmaceutically acceptable carriers well-known in the art. Such carriers enable the compounds of the invention to be formulated as tablets, pills, lozenges, dragees, capsules, liquids, gels, syrups, pastes, slurries, solutions, suspensions, concentrated solutions and suspensions for diluting in the drinking water of a patient, premixes for dilution in the feed of a patient, and the like, for oral ingestion by a patient. Pharmaceutical preparations for oral use can be made using a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, after adding other suitable auxiliaries if desired, to obtain tablets or dragee cores. Useful excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol, cellulose preparations such as, for example, maize starch, wheat starch, rice starch and potato starch and other materials such as gelatin, gum tragacanth, methyl cellulose, hydroxypropyl- methylcellulose, sodium carboxy- methylcellulose, and/or polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as cross- linked polyvinyl pyrrolidone, agar, or alginic acid. A salt such as sodium alginate may also be used.

For administration by inhalation, the inducer or activator of the present invention can conveniently be delivered in the form of an aerosol spray using a pressurized pack or a nebulizer and a suitable propellant. The inducer or activator may also be formulated in rectal compositions such as suppositories or retention enemas, using, e.g., conventional suppository bases such as cocoa butter or other glycerides.

In addition to the formulations described previously, the inducer or activator may also be formulated as depot preparations. Such long acting formulations may be administered by implantation (for example, subcutaneous ly or intramuscularly) or by intramuscular injection. The compounds of this invention may be formulated for this route of administration with suitable polymeric or hydrophobic materials (for instance, in an emulsion with a pharmacologically acceptable oil), with ion exchange resins, or as a sparingly soluble derivative such as, without limitation, a sparingly soluble salt.

Additionally, the inducer or activator may be delivered using a sustained-release system, such as semi-permeable matrices of solid hydrophobic polymers containing the therapeutic agent. Various sustained-release materials have been established and are well known by those skilled in the art. Sustained-release capsules may, depending on their chemical nature, release the compounds for a few weeks up to over 100 days. Depending on the chemical nature and the biological stability of the particular compound, additional stabilization strategies may be employed.

Other delivery systems such as liposomes and emulsions can also be used.

A therapeutically effective amount refers to an amount of compound effective to prevent, alleviate or ameliorate glioma or glioma recurrence symptoms. Determination of a therapeutically effective amount is well within the capability of those skilled in the art, especially in light of the disclosure herein.

For any inducer or activator used in the methods of the invention, the therapeutically effective amount can be estimated initially from in vitro assays. Then, the dosage can be formulated for use in animal models so as to achieve a circulating concentration range that includes the effective dosage. Such information can then be used to more accurately determine dosages useful in patients.

The amount of the composition that is administered will depend upon the parent molecule included therein. Generally, the amount used in the treatment methods is that amount which effectively achieves the desired therapeutic result in mammals. Naturally, the dosages of the various compounds can vary somewhat depending upon the compound, rate of in vivo hydrolysis, etc. In addition, the dosage, of course, can vary depending upon the dosage form and route of administration.

In particular, alkylating agent, nitrosourea agent, inhibitor of MGMT or cis-platinum administration should follow the current clinical guidelines.

The range set forth above is illustrative and those skilled in the art will determine the optimal dosing of the compound selected based on clinical experience and the treatment indication. Moreover, the exact formulation, route of administration and dosage can be selected by the individual physician in view of the patient's condition and of the most effective route of administration (e.g., intravenous, subcutaneous, intradermal). Additionally, toxicity and therapeutic efficacy of the inducer or activator and other therapeutic agent described herein can be determined by standard pharmaceutical procedures in cell cultures or experimental animals using methods well- known in the art.

It is contemplated that the treatment will be given for one or more cycles until the desired clinical and biological result is obtained. The exact amount, frequency and period of administration of the compound of the present invention will vary, of course, depending upon the sex, age and medical condition of the patient as well as the severity and type of the disease as determined by the attending clinician.

Still further aspects include combining the therapy described herein with other anticancer therapies for synergistic or additive benefit.

Radiotherapy means the use of radiation, usually X-rays, to treat illness. X-rays were discovered in 1895 and since then radiation has been used in medicine for diagnosis and investigation (X-rays) and treatment (radiotherapy). Radiotherapy may be from outside the body as external radiotherapy, using X-rays, cobalt irradiation, electrons, and more rarely other particles such as protons. It may also be from within the body as internal radiotherapy, which uses radioactive metals or liquids (isotopes) to treat glioma, preferably glioblastoma.

In the present invention resistant glioma is a a glioma that is resistant to chemotherapy and/or molecularly targeted therapies. The resistance includes alterations in the drug target, activation of pro-survival pathways and ineffective induction of cell death.

SEQUENCES

Sequence of mouse Emx2 gene [NC_000085.6 (59458116... 59465357)] (SEQ ID NO: 13) Sequence of mouse Emx2 transcript [NM 010132.2] (SEQ ID NO: 3)

Sequence of mouse Emx2 CDS [CCDS29937.1] (SEQ ID NO: 11) Sequence of mouse Emx2 protein [NP 034262.2] (SEQ ID NO:4)

Sequence of human Emx2 gene [NG_013009.1] (SEQ ID NO:5)

Sequence of human Emx2 transcript [NM 004098.3] (SEQ ID NO:2)

Sequence of human Emx2 CDS [CCDS7601.1] (SEQ ID NO: 12)

Sequence of human Emx2 protein [NP 004089.1] (SEQ ID NO: 1)

Sequence of the constitutive promoter Pgkl-p

CGGGGTTGGGGTTGCGCCTTTTCCAAGGCAGCCCTGGGTTTGCGCAGGGACGCGGCTGCTCTGG GCGTGGTTCCGGGAAACGCAGCGGCGCCGACCCTGGGTCTCGCACATTCTTCACGTCCGTTCGC AGCGTCACCCGGATCTTCGCCGCTACCCTTGTGGGCCCCCCGGCGACGCTTCCTGCTCCGCCCC TAAGTCGGGAAGGTTCCTTGCGGTTCGCGGCGTGCCGGACGTGACAAACGGAAGCCGCACGTCT CACTAGTACCCTCGCAGACGGACAGCGCCAGGGAGCAATGGCAGCGCGCCGACCGCGATGGGCT GTGGCCAATAGCGGCTGCTCAGCGGGGCGCGCCGAGAGCAGCGGCCGGGAAGGGGCGGTGCGGG AGGCGGGGTGTGGGGCGGTAGTGTGGGCCCTGTTCCTGCCCGCGCGGTGTTCCGCATTCTGCAA GCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTT

(SEQIDNO:6)

Legend: start of transcription underlined

Sequence of the promoter TREt ("tetracycline responsive element, tight")

GAGTTTACTCCCTATCAGTGATAGAGAACGTATGTCGAGTTTACTCCCTATCAGTGATAGAGAA CGATGTCGAGTTTACTCCCTATCAGTGATAGAGAACGTATGTCGAGTTTACTCCCTATCAGTGA TAGAGAACGTATGTCGAGTTTACTCCCTATCAGTGATAGAGAACGTATGTCGAGTTTATCCCTA TCAGTGATAGAGAACGTATGTCGAGTTTACTCCCTATCAGTGATAGAGAACGTATGTCGAGGTA GGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCC

(SEQ ID NO:7)

Legend: start of transcription underlined

Promoter used to express Emx2 in glioblastoma stem cells.

The promoter includes two modules. In the 5-3' order they are: (a) neural enhancer in the second intron of the nestin gene of Rattus norvegicus

CCCTGAAGAGTTTGTGATCCTGAGATGAGGGCTTTAGCCCCAGTCAGTCCTCTGAGGGGAAGGG TCCAGGCAGCTCTGAGGAATGTAACCACTGGCGTTTGAGGTCTGAAAAGGATTTGGAGAAGGGG AGCTGAATTCATTTGCTTTTGTCTGTTACCAGCTCTGGGGGCAGAGAGAGAGCCATCCCCTGGG AACAGCCTGAGAATTCCCACTTCCCCTGAGGAGCCCTCCCTTCTTAGGCCCTCCAGATGGTAGT GTGGACAAAAGGCAATAATTAGCATGAGAATCGGCCTCCCTCCCAGAGGATGAGGTCATCGGCC TTGGCCTTGGGTGGGGAGGCGGAGACTGATCTGAGGAGTCTGATATAAGTGTTAGCAATTCATT TGGCCCTGCCTCCGACTGTGGGAATCTGCATGTGGGGTCTCCCTGTGTCTCAAATATGGGTTGG CTAAGTATATATCTGTGGGTATATGACTGTGTGGCTTTTATATGACAATGGTCACAATAGAGAT TGATCCTGCAGTGGCAGGACATGCTACCTCAGCTGGAGCTGACCCTATCTCCCCACTCCCCACC AGGACTCTGCTGGAGGCTGAGAACTCTCGGTTGCAGACACCTGGACGAGGTTCCCAGGCTT

(SEQ ID N0:8)

(b) minimum promoter derived from the locus Hspala of Mus musculus (promoter & 5'UTR), plus adaptor

GACTGTAAATCAGTCAAACCTAAGAAAATTCTCAACCCATCAAACGAGGACCAACTGGGACACA GAGGCTTCTGCCCCACTCCAATCAGAGCCTTCCCAGCTCACCTGGGATCTCTACGCCTTCGATC CAGTTTGGAAAATTTGAAGTCGCTGAGCCCCTACGAGCAGGGAGCTCCAGGAACATCCAAACTG AGCAGCCGGGGTCCCCCCCACCCCCCACCCCGCCCCTCCCGGCAACTTTGAGCCTGTGCTGGGA CAGAGCCTCTAGTTCCTAAATTAGTCCATGAGGTCAGAGGCAGCACTGCCATTGTAACGCGATT GGAGAGGATCACGTCACCGGACACGCCCCCAGGCATCTCCCTGGGTCTCCTAAACTTGGCGGGG AGAAGTTTTAGCCCTTAAGTTTTAGCCTTTAACCCCCATATTCAGAACTGTGCGAGTTGGCGAA ACCCCACAAATCACAACAAACTGTACACAACACCGAGCTAGAGGTGATCTTTCTTGTCCATTCC ACACAGGCCTTAGTAATGCGTCGCCATAGCAACAGTGTCACTAGTAGCACCAGCACTTCCCCAC ACCCTCCCCCTCAGGAATCCGTACTCTCCAGTGAACCCCAGAAACCTCTGGAGAGTTCTGGACA AGGGCGGAACCCACAACTCCGATTACTCAAGGGAGGCGGGGAAGCTCCACCAGACGCGAAACTG CTGGAAGATTCCTGGCCCCAAGGCCTCCTCCGGCTCGCTGATTGGCCCAGCGGAGAGTGGGCGG GGCCGGTGAAGACTCCTTAAAGGCGCAGGGCGGCGAGCAGGTCACCAGACGCTGACAGCTACTC AGAACCAAATCTGGTTCCATCCAGAGACAAGCGAAGACAAGAGAAGCAGAGCGAGCGGCGCGTT CCCGATCCTCGGCCAGGACCAGCCTTCCCCAGAGCATCCCTGCCGCGGAGCGCAACCTTCCCAG GAGCATCCCTGCCGCGGAGCGCAACTTTCCCCGGAGCATCCACGCCGCGGAGCGCAGCCTTCCA GAAGCAGAGCGCGGCGCCATGGCTCGCGATATG

(SEQ ID NO:9)

Legend: start of transcription underlined Sequence of the module TREt-Emx2-WPRE

TCTAGACCTTTCGTCTTCATTCGAGTTTACTCCCTATCAGTGATAGAGAACGTATGTCGAGTTT ACTCCCTATCAGTGATAGAGAACGATGTCGAGTTTACTCCCTATCAGTGATAGAGAACGTATGT CGAGTTTACTCCCTATCAGTGATAGAGAACGTATGTCGAGTTTACTCCCTATCAGTGATAGAGA ACGTATGTCGAGTTTATCCCTATCAGTGATAGAGAACGTATGTCGAGTTTACTCCCTATCAGTG ATAGAGAACGTATGTCGAGGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTTTgG TGAACCGTCAGATCGCCTGGACCGGTGTTTGGCCGCTACCATGTTCCAGCCGGCGCCCAAGCGC TGCTTCACCATCGAGTCGCTGGTGGCCAAGGACAGTCCCCTGCCTGCCTCGCGCTCCGAGGATC CCATCCGTCCCGCGGCACTCAGCTACGCCAATTCCAGTCCCATAAATCCGTTCCTCAACGGCTT CCACTCGGCCGCCGCCGCCGCCGCCGCCGGCAGGGGCGTCTACTCCAACCCGGACTTGGTGTTC GCCGAGGCGGTCTCGCACCCGCCCAACCCCGCCGTGCCGGTGCACCCGGTGCCGCCGCCGCACG CCCTGGCCGCCCACCCCCTGCCCTCCTCGCATTCGCCACACCCCCTCTTCGCCTCGCAGCAGCG GGACCCGTCCACCTTCTACCCCTGGCTCATCCACCGCTACCGATATCTGGGTCATCGCTTCCAA GGGAACGACACAAGTCCCGAGAGTTTCCTTTTGCACAACGCTCTGGCCAGAAAGCCAAAGCGGA TTCGAACCGCCTTCTCGCCGTCCCAGCTTTTAAGGCTAGAGCACGCTTTTGAGAAGAACCATTA CGTGGTGGGAGCGGAAAGGAAGCAGCTGGCTCACAGTCTCAGTCTTACGGAAACTCAGGTAAAA GTATGGTTTCAGAACCGGAGAACGAAATTCAAAAGGCAAAAGCTAGAGGAAGAAGGCTCAGATT CTCAACAGAAGAAAAAAGGGACACACCACATTAACCGGTGGAGAATTGCTACCAAGCAGGCGAG TCCGGAGGAAATAGATGTGACCTCAGACGATTAAGTCTTCTCGACAATCAACCTCTGGATTACA AAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGC TGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTAT AAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGT GCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTC CGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGC TGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAGCTGACGT CCTTTCCATGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGT CCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTT CCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCCTG

(SEQ ID NO: 10)

Legend: start of transcription in the frame, Emx2-COS underlined. The underlined portion of sequence ID NO: 10 corresponds to the mouse Emx2 CDS (SEQ ID NO: 11)

The present invention will be illustrated with non-limiting examples in reference to the following figures.

Fig.1. Kinetics of a GBM culture population, Emx2 gain of function. (A) shows is the structure of the lentiviral vectors used, which are capable of guiding the expression of the synthetic transactivator rtTA-M2 under the control of the constitutive promoter Pgkl-p (SEQ ID NO: 6) (a), and that of the control EGFP (bl) or bioactive gene Emx2 (b2) under the control of the rtTA-M2 -responsive TREt promoter (SEQ ID NO: 7). Figures (C-I) show the in vitro expansion curves of the U87, T98G, GbmA, GbmB, GbmC, GbmD and GbmE lines, variously engineered (B) and kept in a floating culture, in DMEM/F12 (Invitrogen) (C-D) and NeuroCult Human-NS (StemCellsTechnologies) (E-I) media, all supplemented with Fgf2 and Egf. n is the number of biological replicates and p was calculated using a t-test (one-tail, unpaired).

Fig. 2. Levels of expression of a selection of genes that are candidate mediators of the tumour-suppressing activity of Emx2, in response to the overexpression of Emx2 in GBM. (A-B) show the levels of expression of the specified genes (± s.e.m.) in samples of GBM rendered Emx2-GOF as per Figure 1A. The measurement was made by qRT-PCR. The values were normalised against GAPDH and - subsequently - against the respective control (EGFP). t is the time elapsing between the lentiviral transduction/administration of doxycycline and collection/extraction of RNA (in days). The values in boldface type represent statistically significant variations. Those with up and down arrows at the sides respectively indicate variations less than and greater than 1, consistent with the tumour suppressing activity of Emx2. ns, not significant, n is the number of biological replicates, and p was calculated using a t-test (one-tail, unpaired).

Fig. 3. Kinetics of GBM culture populations, gain of function for Emx2 and/or EGFR and SOX2. (A) shows the structure of the lentiviral vectors used, which are capable of guiding the expression of the synthetic transactivator rtTA-M2 (a) and the receptor EGFR (c) under the control of the constitutive promoter Pgkl-p, of the control EGFP (bl), of the bioactive factor Emx2 (b2) and of the transcription factor SOX2 (d) under the control of the rtTA-responsive TREt promoter. (C-E) show the in vitro expansion curves of the GbmA and GbmC lines, variously engineered (B) and kept in a floating culture, in NeuroCult Human-NS (StemCellsTechnologies) medium supplemented with Fgf2 and Egf. n is the number of biological replicates and p was calculated using a t-test (one-tail, unpaired).

Fig. 4. Tumour-suppressing activity of Emx2 in vivo. (A,B) show the experimental protocol followed and lentiviral vectors used. The cells of the GbmC line were engineered in vitro 7 days before implantation and the conditional control genes TetOFF were held silent under doxycycline until the day before implantation. On day 0 of the procedure, the red control population (engineered with al, b, cl) and the green one Emx2-GOF (engineered with a2, b, c2) were mixed. In the resulting suspension (E), immediately prior to the injection, the frequency of the two component cell types (C) was verified. 1 microlitre of this suspension, containing a total of 200,000 cells, was injected into the neocortical parenchyma of newborn wild-type CD1 mice, at age P4 [mice supplied by Harlan Laboratories, San Pietro al Natisone, Italy]. The animals, kept under doxy- free conditions, were sacrificed and analysed 7 days after implantation. The transplanted cells and derivatives thereof were assayed with anti-EGFP and anti-mCherry antibodies, immunodetected, respectively, with Alexa-488 and Alexa-594 secondary antibodies. The results with reference to the entire brain are shown in (D). Examples of co -immunodetection of control cells (red) and Emx2-GOF cells (green) are shown in (F-C). The same experimental design was replicated with GbmC cells, purely marked with the lentiviruses al or a2 and a wild type for EMX2. The results are shown in (H) and exemplified in (Ι,Γ).

Figure 5. Differential survival of immunotolerant juvenile mice orthotopically transplanted with U87MG cells overexpressing Emx2 or a mock. (A) Glioblastoma cells were made able to conditionally overexpress Emx2 or an EGFP control, via TetOFF technology and lentiviral gene delivery, by means of the recombinant lentiviruses shown in (B). They were allowed to recover one week in vitro, in the presence of saturating doxycycline, and then stereotactivally transplanted into the striatum of nude juvenile mice, kept under doxycycline- free diet. (C) Kaplan-Meyer analysis of transplanted mice showed an increase of median survival time in the Emx2-GOF-transplanted cohort (32.5 days) compared to controls (27.5 days), z and p were calculated by log-rank test, n is the number of transplanted mice scored in the 7-35 days interval.

Fig. 6. Population kinetics of GBM cultures, conditional Emx2 gain of function in the stem cell compartment. (A) shows the structure of the lentiviral vectors used, capable of guiding the expression of the synthetic transactivator rtTA-M2 under the control of the promoter Nes-p (a), and that of the control EGFP (bl) or the bioactive gene Emx2 (b2) under the control of the rtTA-responsive promoter TREt. (C-D) show the in vitro expansion curves of the GbmA and GbmB lines, variously engineered (B) and kept in a floating culture, in NeuroCult Human-NS (StemCellsTechnologies) medium supplemented with Fgf2 and Egf n is the number of biological replicates and p was calculated using a t-test (one-tail, unpaired).

Figure 7. Restriction of Nes-p promoter activity to embryonic neural stem cells and a subset of glioblastoma cells. E12.5 murine neural stem cells (NSCs) were engineered and cultured as shown in (A-D). Cells were immunoprofiled at different days in vitro as shown in (B-D), for EGFP, driven by Nes-p promoter, and, alternatively, Pax6, Tubp3 and GFAP (E). GbmA and GbmC glioblastoma cells were engineered and cultured as shown in (A,F) and eventually immunoprofiled for EGFP (G,H).« = number of biological replicates, bars = s.e.m.'s.

Figure 8. Emx2 overexpression synergizes with TMZ in suppressing U87MG glioblastoma cells. U87MG glioblastoma cells were cultured and challenged by therapeutic lentiviruses encoding for Emx2 (C) as well by temozolomide (TMZ), according to the protocol summarized in (A). Four days after lentiviral trasduction, sample cells were counted. Results were normalized against day 0 values and statistical significance of differences evaluated by t-test and 2-ways-ANOVA (D). Alternatively, U87MG glioblastoma cells were cultured and challenged by therapeutic lentiviruses encoding for Emx2 (C) as well by temozolomide (TMZ), according to the protocol summarized in (B). Seven days after lentiviral trasduction, [MDR1- mR A] was measured by qRTPCR. Results were double normalized, against GAPDH and LV_a,bl /TMZ- free controls, and statistical significance of differences was evaluated by t-test and 2-ways-ANOVA (E). n = number of biological replicates, bars = s.e.m.'s.

DETAILED DESCRIPTION OF THE INVENTION

Materials and methods

Lentiviral vectors packaging and titration. Lentiviral constructs were as described in Falcone et al. (2016), incorporated by reference. All lentiviruses were generated and titrated as previously described (Brancaccio et al, 2010), incorporated by reference.

GBM cell cultures. They were performed as in Falcone et al. (2016). In particular, temozolomide (TMZ), purchased from SIGMA, was prepared according to manufacturer's instructions.

Murine cell cultures. Reconstruction of cell growth curves. mRNA profiling. Cell transplantation into immunocompetent neonates. Sample preparation for immunofluorescence. Immunofluorescence. They were all performed as previously described (Falcone et al., 2016).

In vivo survival assays. Glioblastoma cells were orthotopically transplanted into 5 weeks-old Foxnlnu/nu recipient female mice, as described in Garcia et al (2014), incorporated by reference, with minor modifications. In particular 300,000 U87MG cells, lentivirally pre- engineered as described in Fig. 5A,B of the present application, were delivered to each animal, according to the following coordinates: AP +0.5, ML -1.8, Z -2.8 (from bregma). Transplanted animals were surveyed over >35 days and scored for survival times. To prevent them from inhumane suffering, particular care was placed to euthanize them whenever appropriate. Survival times were analyzed by non-parametric log-rank test, implemented by free evanmiller software (www.evanmiller.org/ab-testing/survival-curves.html).

Results

The present authors overexpressed the Emx2 transcription factor in 2 lines of glioblastoma (GBM), U87 [Sigma # 89081402-1VL] and T98G [Sigma # 92090213-1VL], and in cell cultures derived from human glioblastomas of 5 different patients, GbmA, GbmB, GbmC, GbmD and GbmE, by means of TetON conditional-control lentiviral vectors. As controls, the present authors used the same cell types, overexpressing Egfp or Emx2, respectively cultured in the presence and absence of doxycycline. In all cases analysed, the switching on of the Emx2 transgene blocked the expansion of the culture, causing it to collapse, in most cases within 7-8 days, at any rate never beyond the 22nd (Fig. 1).

In order to look for the underlying molecular mechanisms, the present authors monitored, in 4 of the samples, the Emx2 gain of function (Emx2-GOF) and the level of expression of a selection of genes whose altered level had been previously associated with a high degree of malignity of the GBM. These genes include: (1) a group involved in the transmission/modulation of the mitogenic signal along the cascade of the RTK, comprising EGFR [Genbank NC 000007.14 (55019032..55207338)], PDGFRa [Genbank NC 000004.12 (54229097..54298245)], PTEN [Genbank NC_000010.11 (87863438..87971930)], NFl [Genbank NC_000017.11 (31007873..31377677)], SOX2 [Genbank NC 000003.12 (181711924..181714436)]; (2) a group involved in the management of the "earlyGl/lateGl- checkpoint", including MYC [Genbank NC_000008.11 (127736069..127741434)], MYCN [Genbank NC 000002.12 (15940438..15947007)], RBI [Genbank NC_000013.11 (48303747..48481890)], CDKN2a/b [Genbank NC_000009.12 (21967752..21995043, complement) & NC 000009.12 (22002903..22009313, complement)], CDK4 [Genbank NC_000012.12 (57747727..57752447, complement)], CDK6 [Genbank NC_000007.14 (92604921..92836627, complement)], CCND2 [Genbank NC 000012.12 (4273733..4305356)]; (3) other noteworthy genes associated with the etiopathogenesis of GBM, including HES1 [Genbank NC 000003.12 (194136142..194138612)] and GUI [Genbank NC 000012.12 (57460135..57472268)]. In the majority of GBMs analysed, Emx2 significantly altered the gene expression of group (1), in a manner consistent with its tumour-suppressing activity. Specifically, the levels of expression of EGFR, PDGFRa and SOX2 decrease and those of PTEN and NFl increase. Moreover, in a large subset of the GBMs analysed, Emx2 disturbed the mRNA levels of the genes in group (2), again in a manner consistent with its tumour- suppressing activity. Finally, HES1, known for inducing the cells of GBM to terminal differentiation, was also stimulated by the overexpression of Emx2, in all of the profiled GBMs (Fig- 2).

With the aim of verifying in principle the functional relevance of what was observed, the present authors sought to restore the original expansion rate of preparations of GbmA and GbmC rendered Emx2-GOF by introducing therein a transgene capable of guiding the constitutive expression of EGFR. This manipulation slowed down the decline of GbmA and GbmC, but only in a partial and temporary manner. An analogous effect was induced in GbmA by the overexpression of SOX2 (implicated in a process of mutual stimulation with EGFR and co-responsible for the resistance of several GBMs to anti-EGFR drugs). It is worth noting that the overexpression of EGFR or SOX2 under control conditions does not modify the kinetics of GBM (Fig. 3). All this confirms the suspicion that Emx2 acts by depressing the expression of EGFR and SOX2, but it likewise suggests that part of its tumour-suppressing activity is mediated by other molecular effectors.

In order to explore the portability of the tumour-suppressing activity of Emx2 in vivo, the present authors transplanted cells of GBM (GbmC) in the neocortical parenchyma of newborn wild-type mice. In particular, the present authors injected a 1 : 1 mixture of cells into each animal, rendered gain of function alternatively for Emx2 or a control, and respectively "stained" with green (Egfp) and red (mCherry) fluoroproteins. A week later they sacrificed the animals and evaluated, in each brain, the ratio between the number of Emx2-GOF cells and control cells. This ratio was equal on average to barely 0.34±0.12 (p<0.025, n=4), suggesting a pronounced tumour-suppressing efficacy in vivo of the treatment administered. (In an analogous pilot test conducted with Egfp+ and mCherry+ cells not engineered with Emx2, the ratio was close to one) (Fig. 4). This result is particularly relevant for at least three reasons. First, the GBM cells were implanted in a histogenetic niche specifically conducive to the proliferation of glial elements, namely, the neonatal cerebral cortical parenchyma. Second, this data emerged despite the fact that the procedure of co-injection of Emx2-GOF and control cells can reduce the apparent efficacy of Emx2, attenuating the non-cell autonomous mediation effects thereof. Third, the tests were performed on non-immunocompromised animals - that is, they were conducted on animals in an immunological situation not too dissimilar from that of the patients. Interestingly, in vivo Emx2 anti-glioblastoma activity was further confirmed in a standard survival assay, upon orthotopic transplantation of engineered tumor cells into immunotolerant rodents. U87MG glioblastoma cells, made EGFP-fluorescent via constitutive lentiviral transgenesis, were engineered to overexpress Emx2 (or a mock) under the control of a tetracycline-responsive TetOFF device and transplanted into the striatum of nude immunodeficient juvenile mice, which were subsequently kept under a doxycyclin-free diet. Remarkably, Emx2 activation increased the median survival time of recipient animals from 27.5 to 32.5 days (pO.001; n=l l,12) (Fig. 5).

The gene manipulations described thus far were all carried out under the guidance of a strong constitutive promoter (Pgkl-p), active in the totality of the cell preparations studied, as well as in the totality of neural types of the human brain. Moreover, the malignity of GBM seems to depend particularly on the presence therein of tumour stem cells (GSCs), capable of generating the complex variety of tumour cell types, as well as of fuelling the processes of recurrence. The present authors thus thought that limiting the overexpression of Emx2 solely to the stem cell compartment could continue to bring about a decisive tumour-suppressing effect while preventing any possible side effects in the other brain cell populations. As proof-of- principle, the present authors repeated the kinetic tests described in Fig. 1, substituting Pgkl-p with a synthetic promoter containing the neural rat nestin enhancer, active in stem cells alone Nes-p). A noteworthy result, the treatment in question replicated - albeit with a few days' delay - the collapse of the cultures of GbmA and GbmB (Fig. 6).

The specific firing of Nes-p in presumptive neural stem cells and GBM-initiating cells as well as its inactivity in differentiated neurons and astrocytes was proved by ad hoc assays (Fig. 7). In this respect, Nes-p is just an example of neural stem cell-restricted promoter, suitable to achieve therapeutic Emx2 overexpression. Other neural stem cell- specific promoters may be envisaged for specific and biosafe overactivation of Emx2 in GBM fouder cells. These include Hes5-p (Mizutani et al, 2007) and Blbp-p (Anthony et al, 2005).

Finally, the authors found that Emx2 -overexpression sensitizes GBM cells to the alkylating agent temozolomide (TMZ), a key ingredient of the standard therapeutic recipe for glioblastoma (Fig. 8A,C,D) Moreover they showed that this is associated to a pronounced downregulation of MultiDrug Resistance 1 gene (MDR1), which is often involved in mediating tumor resistance to TMZ (Fig. 8B,C,E). This suggests that Emx2 overexpression may ameliorate the outcome of TMZ treatment and prevent the emergence of TMZ-resistant subpopulations, namely a highly frequent process leading to recurrencies. This further suggests that Emx2 overexpression may sensitize glioblastoma cells to a variety of other anti-tumor drugs which - similarly to TMZ - are expelled from the cell thanks to the ATP-dependent pump encoded by MDR1.

In conclusion, the overexpression of the Emx2 gene satisfies the need for new therapeutic treatments, capable of simultaneously attacking various aspects of GBM that lie at the basis of its aggressiveness. Emx2 is not a simple effector of an individual histogenetic subroutine (proliferation, differentiation, apoptosis, etc.). Conversely, it functions as a key effector capable of impairing an array of metabolic pathways crucial to GBM malignancy. Moreover, it may sensitize GBM to select drugs employed for its therapy. What is more, its activity is fully expressed, even if specifically limited to the stem cell compartment only, and is thus potentially a solution for the prevention of recurrences.

REFERENCES

Anthony, T., et al, (2005). Genes & Dev. 2005. 19: 1028-1033.

Brancaccio, M., et al, (2010). Stem Cells 28, 1206-1218. Brennan, C, et al, (2013). Cell 155 (2), 462-477.

Falcone, C, et al., (2015). Glia 63(3), 412-422.

Falcone, C, et al, (2016). Oncotarget 27(7),41005-41016. Garcia, C, et al., (2014). BMC Cancer 14: 293.

Kimura, J., et al., (2005). J. Neurosci. 25, 5097-5108. Li, J., et al. (2012). PLoS ONE 7(9): e45970.

Mallamaci, A., et al, (2000). Nat. Neurosci. 3, 679-686. Mizutani, K., et al, (2007). Nature 449, 351-355.

Muzio, L., et al., (2002). Nat. Neurosci. 5, 737-745. Muzio, L., et al., (2005). Cereb. Cortex 15, 2021-2028.

Claims

1. An inducer or activator of the expression and/or function of Emx2 for use in the treatment and/or prevention of a glioma and/or prevention of recurrence of a glioma.

2. The inducer or activator for use according to claim 1, selected from the group consisting of: a) a polypeptide;

b) a polynucleotide coding for said polypeptide;

c) a polynucleotide coding for Emx2 or a functional derivative thereof;

d) the polypeptide Emx2 or a functional fragment thereof;

e) a vector comprising said polynucleotide or expressing said polypeptide;

g) a nucleic acid and/or a small molecule, preferably said nucleic acid and/or said small molecule are capable of specifically increasing the expression of the endogenous Emx2 gene, stimulating its transcription, stabilizing the corresponding mRNA and/or increasing its translation.

3. The polypeptide Emx2 for use according to claim 2 or the vector for use according to claim

2, where the polypeptide Emx2 is a molecule consisting of a sequence having at least 95% identity with SEQ ID No. 1.

4. The vector for use according to any one of claims 2-3, where said vector is a nanoparticle, a liposome, an exosome, or a viral vector, preferably a adenoviral vector, a lentiviral vector, a gammaretroviral vector, a herpetoviral vector, an adenoassociated vector (AAV), or a vector with a naked DNA plasmid, preferably said vector is for use in gene therapy.

5. The vector for use according to any one of claims 2-4, comprising a sequence to overexpress Emx2 mRNA and/or protein in a glioma cell and/or a sequence to destabilize and/or inhibit translation of Emx2-encoding mRNA in a non-glioma cell.

6. The vector for use according to any one of claims 2-5, comprising a promoter and/or regulatory sequences active in cancer cells of glioblastoma, preferably said promoter comprises a neural enhancer active selectively in stem cells.

7. The vector for use according to any one of the preceding claims comprising SEQ ID NO: 10.

8. The host cell for use according to claim 2 transformed with a vector as described in any one of claims 3-7.

9. A cellular composition comprising at least 50% of the cells as defined in claim 2 or 8.

10. A viral particle for use in the treatment and/or prevention of a glioma and/or prevention of recurrence of a glioma, comprising the vector as described in any one of claims 2-7.

11. The inducer or activator, the polypeptide, the vector, the host cell, the cellular composition or the viral particle for use according to any one of previous claim in combination with at least one therapeutic treatment.

12. The inducer or activator, the polypeptide, the vector, the host cell, the cellular composition or the viral particle for use according to claim 11 wherein the therapeutic treatment is selected from the group consisting of radiotherapy or chemotherapy.

13. The inducer or activator, the polypeptide, the vector, the host cell, the cellular composition or the viral particle for use according to claim 12 wherein the chemotherapy is selected from the group consisting of: an alkylating agent, a nitrosourea agent, an inhibitor of 06-methylguanine- DNA methyltransferase (MGMT) or cis-platinum.

14. The inducer or activator, the polypeptide, the vector, the host cell, the cellular composition or the viral particle for use according to claim 13 wherein the alkylating agent is temozolomide.

15. A pharmaceutical composition comprising the polypeptide as defined in claim 2 or 3 or the vector as described in any one of claims 2-7 or the host cell as described in claim 2 or 8 or the cellular composition as defined in claim 9 or the viral particle according to claim 10 and at least one pharmaceutically acceptable excipient, for use in the treatment and/or prevention of a glioma and/or prevention of recurrence of a glioma.

16. The pharmaceutical composition for use according to claim 15 further comprising at least one therapeutic agent.

17. The pharmaceutical composition for use according to claim 16 wherein the therapeutic agent is selected from the group consisting of: an alkylating agent, a nitrosourea agent, an inhibitor of MGMT or cis-platinum.

18. The pharmaceutical composition for use according to claim 17 wherein the alkylating agent is temozolomide.

19. The pharmaceutical composition for use according to claim 15 to 18 in combination with radiotherapy.

20. The inducer or activator, the polypeptide, the vector, the host cell, the cellular composition the viral particle or the pharmaceutical composition for use according to any one of previous claims wherein the glioma is glioblastoma.

21. The inducer or activator, the polypeptide, the vector, the host cell, the cellular composition the viral particle or the pharmaceutical composition for use according to claim 20 wherein the glioblastoma is resistant glioblastoma.

22. A method to decrease or block glioma cell expansion, comprising the administration of an inducer or activator as described in any one of claims 1-9 or the viral particle as defined in claim 10.

23. The method according to claim 22 wherein said inducer or activator regulates the levels of expression of genes involved in the transmission/modulation of the mitogenic signal along the cascade of the RTK and/or of the genes involved in the management of the '"earlyGl / lateGl- checkpoint" and/or of other genes associated with the etiopathogenesis of glioblastoma.

24. The inducer or activator, the polypeptide, the vector, the host cell, the cellular composition, the viral particle or the pharmaceutical composition as defined in claims 1 to 18 for use in a method to sensitive a glioma cell to a therapeutic treatment.

25. The inducer or activator, the polypeptide, the vector, the host cell, the cellular composition, the viral particle or the pharmaceutical composition for use according to claim 24 wherein the therapeutic treatment is selected from the group consisting of radiotherapy or chemotherapy.

26. The inducer or activator, the polypeptide, the vector, the host cell, the cellular composition, the viral particle or the pharmaceutical composition for use according to claim 25 wherein the chemotherapy is selected from the group consisting of: an alkylating agent, a nitrosourea agent, an inhibitor of 06-methylguanine-DNA methyltransferase (MGMT) or cis-platinum.

25. The inducer or activator, the polypeptide, the vector, the host cell, the cellular composition, the viral particle or the pharmaceutical composition for use according to claim 24 wherein the alkylating agent is temozolomide.