WO2017031416A1 - Use of bet inhibitors to treat neurodevelopmental disorders and epilepsy - Google Patents

Abstract

Provided are methods for prophylaxis and/or therapy for a disorder correlated with Brd4 function in brain neurons. The method involves administering to an individual in need thereof a therapeutically effective amount of a Bromodomain and Extra-Terminal motif (BET) targeting compound, such as a BET inhibitor. The disorder can include autism spectrum disorder (ASD), Fragile X Syndrome (FXS), and seizure disorders, such as various forms of epilepsy. Also provided is are methods for selecting an individual for treatment with a BET targeting compound, such as a BET inhibitor that involve testing an individual to determine if the individual has a disorder correlated with Brd4 function in brain neurons and, if the individual is diagnosed with the disorder, designating the individual a candidate for treatment with a BET targeting compound such that one or more symptoms of the disorder are reduced.

Description

USE OF BET INHIBITORS TO TREAT NEURODEVELOPMENTAL DISORDERS

AND EPILEPSY CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional patent application no.

62/207,265, filed August 19, 2015, the disclosure of which is incorporated herein by reference.

STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

[0002] This invention was made with government support under contract no.

F32MH103921 awarded by the National Institutes of Health. The government has certain rights in the invention.

BACKGROUND OF THE DISCLOSURE

[0003] Precise regulation of transcription is crucial for the cellular mechanisms underlying memory formation. However, the link between neuronal stimulation and the proteins that directly interact with histone modifications to activate transcription in neurons remains unclear.

[0004] Brd4 is a member of the Bromodomain and Extra-Terminal motif (BET) proteins family, which binds acetylated histones and has a critical role in numerous cell types in regulating transcription, including in the response to external cues. In particular it functions as a chromatin 'reader' that binds acetylated lysines in histones (Belkina, A. C. & Denis, G. V. Nat. Rev. Cancer 12, 465-477 (2012); Wu, S.-Y., Mol. Cell 49, 843-857 (2013)).

[0005] Small molecule BET inhibitors are in clinical trials, yet almost nothing is currently known about Brd4 function in the brain. In this regard, the nervous system requires tight control of transcription in response to external signals. Rapid activation of immediate early genes (IEGs) in response to stimulation is critical for synaptic plasticity and is observed in vivo during learning and memory. Misregulation of gene expression in the brain results in neuronal deficits and neurodevelopmental disorders, and inhibition of transcription immediately following neuronal stimulation blocks the mechanisms underlying memory formation. This inducible transcription requires that transcription activators bind to promoters of target genes and recruit other proteins such as RNA Polymerase II (PolII). Recent work found that in several non-neuronal cell types, the protein Brd4 is critical in regulating the recruitment of protein complexes such as positive transcription elongation factor b (P-TEFb) to allow for PolII phosphorylation and the subsequent elongation of target genes in response to a signal.

[0006] Knockout of Brd4 in mice is lethal and small molecule inhibitors of BET proteins may represent a promising therapeutic strategy for several types of cancer. Brd4 also regulates stimulus-dependent transcription in postmitotic cells by recruiting P-TEFb to target promoters in response to extracellular signals. While P-TEFb recruitment is necessary for transcriptional elongation in neurons the link between neuronal stimulation and the proteins that directly interact with histone modifications to activate transcription remains unclear. Further, acetyl marks are critical to brain function and are linked to memory formation and multiple neurological disorders. Brd4 activity is regulated by casein kinase 2 (CK2), which is activated in response to neuronal stimulation. However, a role for Brd4 in any particular condition that is associated with neuronal function has not been shown. In addition, a there is a need for analysis of if and how Brd4 functions in the brain, as multiple BET protein inhibitors are currently in clinical trials.

SUMMARY OF THE DISCLOSURE

[0007] In the present disclosure it is demonstrated that Brd4 is critical to normal neuronal function. The loss of Brd4 causes disruptions transcriptional regulation in the brain and prevents memory formation. In several mouse models of epilepsy, inhibition of Brd4 with a BET inhibitor decreases seizure activity. The disclosure also demonstrates links between Brd4 and the neurodevelopmental disorders Fragile X Syndrome and Autism Spectrum Disorder. We demonstrate that Brd4 expression is overexpressed in a mouse model of these disorders. Furthermore, we found that inhibiting Brd4 function with a BET inhibitor reverses both neuronal phenotypes seen in Fragile X Syndrome, and reverses the behavioral deficits observed in these neurodevelopmental disorders.

[0008] In general the present disclosure comprises a method for prophylaxis and/or therapy for a disorder correlated with Brd4 function in brain neurons. The method comprises administering to an individual in need thereof a therapeutically effective amount of a BET targeting compound, i.e., a compound that can modulate BET activity, including but not necessarily limited to an agent that can function as a full or partial BET inhibitor, or an agent that enhances BET activity. In embodiments, the disorder is selected from autism spectrum disorder (ASD), Fragile X Syndrome (FXS), and a seizure disorder. In embodiments, the seizure disorder is epilepsy, including but not limited to drug resistant epilepsy. [0009] In another aspect the disclosure comprises methods for selecting an individual for treatment with a BET targeting compound, such as a BET inhibitor. This approach generally comprises testing an individual to determine if the individual has a disorder correlated with Brd4 function in brain neurons and, if the individual is diagnosed with the disorder, designating the individual a candidate for treatment with a BET targeting compound. In embodiments, the method comprises identifying an individual as having ASD, FXS, a seizure disorder, or a combination thereof, and optionally further comprises administering to the individual a therapeutically effective amount of the BET targeting compound, which in embodiments comprises a BET inhibitor. BRIEF DESCRIPTION OF THE FIGURES

[0010] Figure 1. Brd4 is expressed in neurons throughout the brain, (a) Brd4 staining of a sagittal adult mouse brain section, (b, d) Brd4 and NeuN costaining of cortex (b) or hippocampus (d). (c, e) High magnification image of Brd4 and NeuN costaining of cortex (c) or hippocampus (e). (f, h) Brd4 and GFAP costaining of cortex (f) or hippocampus (h). (g, i) High magnification image of Brd4 and GFAP costaining of cortex (g) or hippocampus (i). (j) Western blot analysis of Brd4 protein from whole cell lysate of cultured cortical neurons or glia. (k) Brd4 mRNA from cultured cortical neurons or glia (n = 3 biological replicates, paired two-tailed t test, P = 0.0057, ί = 4.195.) Full-length blots are presented in Figure 22. Error bars represent standard error. ***, p<0.001. Scale bar is 10 μΜ.

[0011] Figure 2. Brd4 regulates IEG transcription in response to stimulation in neurons, (a) Experimental paradigm for analysis of effects of Jql on activity-dependent transcription, (b, c, d) Jql pretreatment blocks the fold-increase in nascent RNA of Arc (b), Fos (c) and Nr4al (d) in cultured cortical neurons in response to 10 minutes of BDNF stimulation (n = 14 biological replicates, paired two-tailed t test for Arc P = 0.0014, t = 3.133, for Fos P = 1.86E-5, t = 4.064, for Nr4al P = 0.0178, t = 2.53). (e, f, g) Jql pretreatment blocks the fold-increase in nascent RNA of Arc (b), Fos (c) and Nr4al (d) in cultured cortical neurons 10 minutes after TTX withdrawal (paired two-tailed t test, for Arc n = l P = 0.0186, t = 2.475, for Fos P = 0.0264, t = 2.1998, for Nr4al P = 0.0406, t = 2.456). (h, i, j) Infection of neurons with a Brd4 siRNA lentivirus but not a scrambled control virus blocks Arc (h), Fos (i) and Nr4al (j) induction in response to 10 minutes of BDNF stimulation (n = 6 biological replicates, paired two-tailed t test, for Arc P = 0.0337, t = 2.502, for Fos P = 0.0450, t = 2.327, for Nr4al P = 0.0311, t = 2.551). (k, 1) Staining (k) and quantification (1) of Arc in neurons stimulated for 30 minutes with BDNF following pretreatment with Jql or the negative enantiomer (-)Jql (unpaired two-tailed t test, for control n = 232 neurons, for BDNF n = 185 neurons, for Jql n = 245, and for Jql+BDNF n = 200 from 5 biological replicates per group, for control v. BDNF P = 8.52E-26, t = 11.447, Jql v Jql+BDNF P = 0.00084, t = 3.363, for BDNF v. Jql+BDNF P = 0.00013, t = 3.867). (m, n) Quantification (m) and staining (n) for Arc in neurons transfected with GFP and either a nontargeting siRNA pool or Brd4 siRNA (unpaired two-tailed t test, for control n = 105 neurons, for BDNF n = 80, for Brd2 siRNA n = 85, for Brd2+BDNF n = 71, for Brd3 n = 88, for Brd3+BDNF n = 63, for Brd4 n = 80, and for Brd4+BDNF n = l\ from 11 biological replicates, for control vs BDNF P = 0.0012, t = 3.296, for Brd4 siRNA vs Brd4 siRNA + BDNF P = 0.662, t = 0.438, for Brd2 siRNA vs Brd2 siRNA + BDNF P = 8.572E-5, t = 4.035, for Brd3 siRNA vs Brd3 siRNA + BDNF P = 0.167, t = 2.42, for BDNF vs Brd4 siRNA + BDNF P = 0.0157, t = 2.445. *, p<0.05. **, p<0.01 ***, p<0.001. n.s. nonsignificant, a.u. arbitrary units. Min, minutes. Error bars represent standard error. Scale bar is 10 μΜ.

[0012] Figure 3. Genome-wide analysis of effects of Jql. (a) Boxplot of RNA- sequencing data of BDNF-induced gene fold change after (-) or (+) Jql treatment in neurons for the 36 genes significantly upregulated by BDNF (paired two-tailed t test, n = 3 biological replicates, P = 2.98E-5, t = 3.357). (b) Top GO terms of genes clusters enriched in Jql down- regulated genes. Min, minutes, kb, kilobase. ***, p<0.001.

[0013] Figure 4. CK2 regulates Brd4 in neurons, (a, b, c) Brd4 ChlP-qPCR analysis in cultured neurons pretreated with vehicle or CK2 inhibitor TBB and stimulated with BDNF for 10 minutes to measure Brd4 at promoters of Arc (a), Fos (b), and Nr4al (c) (paired two-tailed t test, for Arc dmso treatments n = 10 biological replicates, P = 0.00955, t = 1.693, for TBB treatments n = 6, and for Jql, n = 3, for Fos n = 8 biological replicates, P = 0.0303, t = 2.791, for TBB n = 6 and for Jql treatments, n = 3, for Nr 1A 1, dmso treatments n = 9 biological replicates, P = 0.0411 t = 1.987, for TBB treatments n = 5, and for Jql, n = 3). (d, e, f) TBB pretreatment blocks increased Arc (d), Fos (e), and Nr4al (f) mRNA after 10 minute BDNF stimulation, (paired two-tailed t test, for Arc n = 14 biological replicates, P = 0.0215, t = 2.505, for Fos n = \4 biological replicates, P = 0.0175, t = 2.496, and for Nr 4a 1 n = 13 biological replicates, P = 0.0122, t = 2.926). (g, h, i) TBB pretreatment blocks increased Arc (g), Fos (h), and Nr4al (i) mRNA 10 minute after TTX withdrawal (paired two-tailed t test, for Arc n = 8 biological replicates, P = 0.0451, t = 2.485, for Fos n = 8 biological replicates, P = 0.0179, t = 2.728, and for Nr4al n = 6 biological replicates, P = 0.0437, t = 2.983). (j, k) Arc and Brd4 staining (j) and quantification (k) after TBB or vehicle pretreatment and 30-minute BDNF stimulation, (unpaired two-tailed t test, for control n = 108 neurons, for BD F n = 131, for TBB w = 1 17, for TBB+BD F « = 1 18 from 2 biological replicates, for control vs bdnf P = 7.42E-14, t = 7.962, for TBB vs TBB+BDNF P = 0,001, t = 3.331, for BDNF vs TBB+BDNF P = 7.598E-10, t = 6.408). (1, m) Example of images (1) and recovery curves (m) for FRAP of EGFP-Brd4 expressed in neurons, (n)

Mobile fraction quantification of EGFP-Brd4. (unpaired two-tailed t test, for control n = 120 neurons, for BDNF « = 1 13, for TBB n = 39, for TBB+BDNF n = 50 from 6 biological replicates, P = 9.98E-7, t = 5.02). *, p<0.05. ***, p<0.001. a.u. arbitrary units, s, seconds. Error bars represent standard error. Scale bar is 10 μΜ.

[0014] Figure 5. Phosphorylation of Brd4 is critical for its function, (a) Model of Brd4 and the critical amino acids in the CK2 phosphorylation site, (b) Western blot for phosphorylated Brd4 shows an increase with BDNF but not after TBB pretreatment or phosphatase treatment of lysates. Representative of 3 biological replicates, (c, d) Staining (c) and quantification (d) for Arc and Brd4 in neurons transfected with GFP and Brd4 with deletions or mutations in the CK2 site (unpaired two-tailed t test, for GFP n = 68, for Brd4« = 61, for CK2 deletion n = 46, for deletion 492-494 n = 44, for S492A n = 54, for Brd4-pm n = 51 from 5 biological replicates, for GFP vs Brd4 P = 1.223E-8, t = 6.09, for GFP vs Brd4-pm P = 2.00E-13, t = 2.353, for Brd4 vs CK2 deletion P = 0.001 1, t = 3.36, for Brd4 vs deletion 492-494 P = 0.00037, t = 3.689, for Brd4 vs S492A P = 0.0075, t = 2.724, for Brd4 vs Brd4-pm P = 0.0204, t = 2.353). (e) Quantification of the mobile fraction of FRAP performed on Brd4 with mutations in the CK2 domain (unpaired two-tailed t test, for Brd4 n = 57 neurons, for S492A n = 52 and for Brd4-pm n = 38 from 3 biological replicates, for Brd4 vs S492A P = 0.0001, t = 4.042, for Brd4 vs Brd4-pm P = 0.0085, t = 2.488). (f)

Pearson correlation coefficient for H4K16acetyl colocalization with Brd4 with CK2 site mutations (two-sided two-tailed t test for Brd4 n = 35 neurons, for Brd4 + BDNF n = 21, for S492A n = 29, and for Brd4-pm n = 18 from 3 biological replicates, for Brd4 vs Brd4 + BDNF P = 0.0164, t = 2.477, for Brd4 vs S492A P = 0.00167, t = 3.286, for Brd4 vs SSS492A = 0.035, t = 2.166. *, p<0.05. ***, pO.001. a.u. arbitrary units. Full-length blots are presented in Figure 22. p'ase, phosphatase. Error bars represent standard error. Scale bar is 10 μΜ.

[0015] Figure 6. Brd4 regulates synaptic receptor subunit GluAl. (a) 24-hour Jql treatment decreases Grial but not Gria2 mRNA in the absence of exogenous stimulation in cultured cortical neurons, (one sample t test, for Grial n = 12 biological replicates, P = 6.852E-6, t = 7.959, for Grial n = 6 biological replicates), (b) 24 or 48-hour Jql treatment decreased gluAl protein in neurons. Representative of 3 biological replicates, (c, d) GluAl surface staining (c) and quantification (d) in neurons transfected with GFP and treated with Jql or the negative enantiomer for 24 hours (unpaired two-tailed t test, for control n = 33 neurons and for Jql n = 26 neurons from 4 biological replicates, P = 4.242E-8, t = 6.322). (e, f) Surface GluAl staining (e) and quantification (f) in neurons transfected with GFP and either a nontargeting siRNA pool or Brd4, Brd2, or Brd3 siRNA (unpaired two-tailed t test with Bonferroni correction, n = 33 neurons for control siRNA, for Brd2 siRNA « = 31, for Brd3 siRNA n = 28, and for Brd4 siRNA n = 28 from 5 biological replicates, for control vs Brd4 P = 0.00958, t = 2.667). (g) Brd4 staining in neurons transfected with GFP and a construct expressing Brd4 under a constitutively active promoter, (h, i) GluAl surface staining (h) and quantification (i) 2 days after transfection with GFP and Brd4 (unpaired two- tailed t test, for GFP n = 40 neurons and for GFP-Brd4 n = 35 neurons from 5 biological replicates, P = 0.00167, t = 3.264). ###, p<0.001 with univariate analysis. **, p<0.01, ***, p<0.001. ROI, region of interest, a.u. arbitrary units, h, hours. Full-length blots are presented in Figure 22. Error bars represent standard error. Scale bar is 10 μΜ.

[0016] Figure 7. Jql affects mouse behavior, (a) Time spent in the inner or outer zone of an open field in mice treated with vehicle or with Jql for 1 or 3 weeks (for DMSO n = 10 mice, for 1 week Jql n = 9 mice, and for 3 weeks Jql n = 10 mice, two-way ANOVA (zone) P = 2E16, F = 598.57, two-way ANOVA (treatment) P = 0.986, F = 0.015, df = 54). (b) Novel object recognition paradigm, (c) Discrimination index of time spent with a novel vs familiar object one day after initial exposure to the objects (unpaired two-tailed t test, for

DMSO n = 10 mice, for 1 week Jql n = 9 mice, and for 3 weeks Jql n = 10 mice, for DMSO vs 1 week Jql P = 0.0107, t = 2.88, for DMSO vs 3 weeks Jql P = 0.0094, t = 2.927, one sample t test for DMSO P = 0.00127, t = 4.85)..(d) Discrimination index of time spent with a novel vs familiar object one day after initial exposure after a single dose of Jql (unpaired two-tailed t test, n = 10 mice per group, for DMSO vs post-learning Jql P = 0.0376, t = 2.25, univariate analysis for DMSO P = 0.00262, t = 4.11). (e) Fear conditioning paradigm, (f) Percent of time spent freezing in a new context after fear conditioning (for DMSO n = 10 mice, for 1 week Jql n = 9 mice, and for 3 weeks Jql n = 10 mice, two-way ANOVA

(treatment) P = 0.0135, F = 4.67 and unpaired two-tailed t test for DMSO vs 3 weeks Jql P = 0.0036, t = 3.34, df = 54). Discrimination index on a scale of -1 to 1 : (% time with novel object - % time with familiar object)/(% time with novel object + % time with familiar object). ###, p<0.001 with univariate analysis. *, p<0.05. ***, p<0.001. n.s., nonsignificant, s, seconds. Error bars represent standard error. [0017] Figure 8. Jql decreases seizure susceptibility, (a) Model of seizure induction paradigm, (b) Seizure susceptibility score of mice treated for one week with either DMSO or Jql and given pentylenetetrazol (PTZ) to induce seizures (unpaired two-tailed t test n = l mice for DMSO and 6 mice for Jql, P = 0.002, t = 3.155). (c) Latency to the return of normal movement after PTZ injection (unpaired two-tailed t test n = l mice for DMSO and 6 mice for Jql, P = 0.036, t = 2.388). (d) Model of seizure induction paradigm, (e) Seizure susceptibility score of mice on day 30 of kindling testing (one sample t test, for DMSO n = 4 mice, for Jql n = 4 mice and for non-kindled n = 6 mice, for DMSO P = 0.0473, t = 2.415). (f) Number of mice seizing during each day of testing, (g) Seizure susceptibility of mice seizing during each day of testing (initial n = 8 mice for dmso and Jql and N = 6 mice for non-kindled group, for DMSO vs non-kindled unpaired one-tailed t test, day 13 P = 0.00555, t = 2.494, day 15 P = 0.0486, t = 0.928, unpaired two-tailed t test for day 30 P = 0.0265, t = 2.715). #, p<0.05 with univariate analysis. *, p<0.05. ***, p<0.001. min, minutes. Error bars represent standard error.

[0018] Figure 9. Overlap analysis of FMRP target transcripts and ASD susceptibility genes shows Brd4 is linked to both disorders.

[0019] Figure 10. Brd4 protein, (a) Example western blot of Brd4 protein levels in neurons during development, (b) Quantification of Brd4 protein levels from 3 biological replicates, (c) Brd4 mRNA levels in neurons during development. N=3. (d) Fmrp protein levels in neurons during development, (e) Brd4 protein levels in KO neurons during development, (f) Quantification of Brd4 protein levels in KO neurons from 3 biological replicates, (c) Brd4 mRNA levels in KO neurons during development. N=3. (h) Brd4 protein levels in cortical tissue from WT and KO brains during development, (i) Fmrp protein levels in cortical tissue from WT and KO brains during development. *, p<0.05, ***, p<0.001.

[0020] Figure 11. Fragile X neurons (cultured from the Fmrl knockout mouse) show increased number of spines per section of dendrite. 48 hour treatment with Jql returns the number of spines to WT levels. ***, p<0.001.

[0021] Figure 12. Behavior tests, (a) Social recognition test shows that atypical social interactions seen in knockout mice are returned to normal levels after Jql treatment. (b) Repetitive behavior is measured by compulsive marble burying. Knockout mice show increased levels of marble burying and this is returned to normal levels with Jql treatment, (c) A learning paradigm in which mice are tested 24 hours after exposure to objects. If mice remember the objects they previously saw they show a preference for a novel object measured by a positive discrimination index. Jql blocks this in wild type mice but restores this form of learning in knockout mice. *, p<0.05.

[0022] Figure 13. Brd4 is expressed in the brain, (a) Whole cell lysate of regions of adult mouse brain. Representative blot of 3 biological replicates, (b, c) Cultured cortical neurons stained with Brd4 and CamKII (b) or Gaba (c). (d) Brd4 mRNA from cultured neurons after BDNF treatment (one sample t-test for 0.5 hours n = 14, for 2 hours n = 13, for 4 hours n = 14, for 8 hours n = 12, for 24 hours n = 13, P = 0.0339, t = 2.01). (e, f) Brd4 protein after short (e) or long (f) BDNF treatment. Representative blot of 3 biological replicates. *, p<0.05. Full-length blots are presented in Figure 22. min, minutes, h, hours. Error bars represent standard error. Scale bar is 10 μΜ.

[0023] Figure 14. Brd4 regulates IEG transcription in response neurons, (a, b, c)

Time course of the BDNF-induced increase in Arc (a), Fos (b) and Nr4al (c) after (-) or (+) Jq 1 treatment, (d) Brd4 mRNA 3 days after lentiviral infection of an siRNA targeted against Brd4 compared to a scrambled siRNA (one-sample t test, n = 7 biological replicates P = 6.18E-6, t = 13.07). (e) BDNF-induced MAPK phosphorylation after Brd4 knockdown with lentiviral infection. Representative of 2 biological replicates, (f, g) Staining (f) and quantification (g) of Brd4 in neurons 5 days after transfection with GFP and Brd4 siRNA (unpaired two-sided t test n = 45 neurons for control siRNA and 37 neurons for Brd4 siRNA from 5 biological replicates, P = 6.38E-16, t = 10.093). (h, i) Brd2 (h) and Brd3 (i) mRNA fold decrease 5 days after transfection in N2A cells (one sample t-test n = 3 biological replicates, for Brd2 P = 0.0157, t = 5.51, for Brd3 P = 0.019, t = 4.92). (i) Quantification of Brd4 staining 5 days after transfection with different siRNAs targeted against Brd4. N = 47 neurons for control siRNA (upaired two-tailed t test for control n = 47 for Brd4 siRNAl n = 43 and for Brd4 siRNA2 n = 37 neurons from 2 biological replicates, for siRNA 1 P = 2.24E- 38, t = 22.91, for siRNA2 P = 2.82E-25, t = 15.18). (k, 1) Staining (k) and quantification (1) of Arc with or without 30 minutes BDNF stimulation after transfection with GFP and either a nontargeting siRNA or different Brd4 siRNA constructs (unpaired two-tailed t test for control n = 25 , for control + BDNF n = 23 , for Brd4 siRNA 1 n = 22 , for Brd4 siRNA 1 + BDNF n = 22 , for Brd4 siRNA2 n = 14 , and for Brd4 siRNA2 + BDNF n = 26 from 2 biological replicates, for control vs BDNF P = 9.53E-4, t = 3.432). (m) Quantification of Arc staining in neurons transfected with a long or short form of Brd4 (unpaired two-tailed t test for control n = 42 neurons, for long Brd4 n = 26 neurons and for short Brd4 n = 30 neurons, for control vs long Brd4 P = 0.015, t = 2.48, for long vs short Brd4 P = 0.0016, t = 3.29). (n) Decrease in Arc, Fos and Nr4al RNA after 24 hours of Jql treatment in the absence of exogenous stimulation in cultured cortical neurons (one sample t test, for Arc n = 13 biological replicates P = 3.098E-5, t = 6.58, for Fos n = 13 biological replicates P = 0.013, t = 2.65, and for Nr4al n = 11, P = 0.00104, t = 4.75). (o) Jql does not affect global H3 or H4 acetyl levels, (p) MAPK phosphorylation in response to BD F with or without Jql pretreatment.

Representative blot of 2 biological replicates, a.u., arbitrary units. #, p< 0.05 for univariate analysis. ###, p< 0.001 for univariate analysis. *, p< 0.05. ***, p<0.001. Full-length blots are presented in Figure 22. Error bars represent standard error. Scale bar is 10 μΜ.

[0024] Figure 15. RNA-sequencing analysis of effects of Jql in neurons, (a)

Experimental paradigm for genome-wide analysis of effects of Jql . (b) Heat map of fold induction of all genes significantly induced by BDNF after treatment with (-) or (+) Jql . (c) Top GO terms of genes clusters enriched in Jql up-regulated genes. Data represents averages of 3 biological replicates, (d) Histone acetylation at promoter regions of IEGs in response to BDNF for acetyl marks that recruit Brd4. N = 3 biological replicates, (e) Western blot analysis of acetylated histone H4K16 and H3K14 with (-) or (+) Jql . Representative blot of 3 biological replicates. Full-length blots are presented in Figure 22. min, minutes.

[0025] Figure 16. CK2 regulates Brd4 in neurons, (a, b, c) Brd4 ChlP-qPCR analysis in neurons stimulated with BDNF to measure Brd4 at promoters of Arc (a), Fos (b), and Nr4al (c). (d, e, f) Brd2 ChIP in neurons stimulated with BDNF at promoters of Arc (d), Fos (e), and Nr4al (f). N = 3 biological replicates, (g, h, i) Brd3 ChIP in neurons stimulated with BDNF at promoters of Arc (g), Fos (h), and Nr4al (i). N = 3 biological replicates for a-i. (j) MAPK phosphorylation in response to BDNF in the presence of TBB. Representative of 3 biological replicates, (k, 1, m) CBP ChlP-qPCR analysis in neurons stimulated with BDNF with Jql or TBB pretreatment to measure Brd4 at promoters of Arc (k), Fos (1), and Nr4al (m). N = 2 biological replicates, (n) Quantification of Ck2 expression in neurons transfected with GFP and either nontargeting siRNA, or siRNA targeting CK2 (unpaired two-tailed t test, for control siRNA n = 24 neurons and for CK2 siRNA n = 26 neurons from 3 biological replicates, P = 8.05E-5, t = 3.29). (o, p) Arc and CK2 staining (o) and Arc quantification (p) after a 30 minute BDNF stimulation of neurons transfected with GFP and either a

nontargeting siRNA pool or a siRNA pool targeting CK2 (unpaired two-tailed t test, for control siRNA n = 50 neurons, n = 39 for BDNF, for CK2 siRNA n = 39, and for CK2 siRNA + BDNF n = 37 from 5 biological replicates, control vs BDNF, P = 1.21E-5, t = 5.244, for BDNF vs CK2 siRNA + BDNF P = 7.09E-7, t = 5.42). (q) Mobile fraction quantification of EGFP-Brd4 (unpaired two-tailed t test for control n = 15 for BDNF 18 neurons. P = 5.389E-5, t = 4.73). ***, p<0.001. a.u. arbitrary units, a.u. arbitrary units, min, minutes. Error bars represent standard error. Scale bar is 10 μΜ.

[0026] Figure 17. Phosphorylation of the CK2 site in Brd4. (a) Dot blot for phopho-

Brd4 antisera using target and control peptides shows specific binding to peptides containing phosphorylated S492. (b) Western blot with phospho-Brd4 antisera in lysates treated with phosphatase or control lysates. Blots are representative of 3 replicates, (c) Quantification of Brd4 expression shows elevated and equivalent Brd4 levels in neurons transfected with GFP and Brd4 with deletions or mutations in the CK2 site (unpaired two-sided t test, for GFP n = 68, for Brd4 n = 61, P = 4.596E-17, t = 9.73, for CK2 deletion n = 46, P = 1.26E-27, t = 14.57 for deletion 492-494 n = 44, P = 1.48E-22, t = 12.37, for S492A n = 54, P = 4.14E-34, t = 17.17, for SSS492ESE n = 51 from 5 biological replicates, P = 7.82E-24, t = 12.73, no significant differences between Brd4 constructs), (d) Example images of EGFP-Brd4 with CK2 site mutations costained with H4K16acetyl. (e) Example graphs showing corresponding changes in fluorescent signal of Brd4 and H4K16acetyl in sections of neuronal nuclei. **, p<0.01. ***, p<0.001. Full-length blots are presented in Figure 22. Error bars represent standard error. Scale bar is 5 μΜ.

[0027] Figure 18. Brd4 inhibition decreases surface GluAl . (a) Quantification of mRNA after different times of Jql treatment. N = 3 biological replicates for Arc and Fos, N = 8 for Nr4al, N = 9 for Grial, N = 4 for Bdnf and N = 5 for Brd4. (b) Quantification of hippocampal neurons treated with Jql for 24 hours and stained for surface GluAl (unpaired two-sided t test, for control n = 13 neurons and for Jql n = 12 neurons from 2 biological replicates, P = 0.0015, t = 3.56). (c, d) Images (c) and quantification (d) of surface GluAl staining 5 days after transfection with different siRNAs targeted against Brd4 (unpaired two- sided t test, for control siRNA n = 14 neurons, for Brd4 siRNAl n = 13 neurons, and for Brd4 siRNA2 n = 14 neurons from 2 biological replicates, for control vs siRNAl P = 0.0114, t = 2.61, for control vs siRNA2 P = 0.0078, t = 2.76). (e) Quantification of spine number in neurons treated with Jql for 24 hours (unpaired two-sided t test, n = 68 neurons for control for Jql and n = 66 from 2 biological replicates), (f) Quantification of staining of surface GluAl in neurons with long or short forms of Brd4 (unpaired two-sided t test, for control n = 15 neurons, for long Brd4 n = 17, and for short Brd4 n = 18 from 2 biological replicates, for control vs long Brd4 P = 0.0161, t = 2.55, for long vs short Brd4 P = 0.0308, t = 2.26). (g) ChIP for Brd4 at the grial promoter region. N = 7 biological replicates for control conditions, 3 biological replicates for Jql conditions, (h) ChlPs for histone acetylation at the grial promoter region. N = 2 biological replicates. *, p<0.05. ***, p<0.001. a.u. arbitrary units, n.s., non-significant. Scale bar is 10 μΜ.

[0028] Figure 19. Jql affects mouse behavior, (a) Weight change in mice treated daily with Jql or vehicle, (b) Zone preference ratio in an open field in mice treated with vehicle or with Jql for 1 or 3 weeks, (c) Total distance traveled during 1 hour of an open field in mice treated with vehicle or with Jql for 1 or 3 weeks, (d) Time spent moving during 1 hour of an open field in mice treated with vehicle or with Jql for 1 or 3 weeks, (e) Distance traveled in the novel object box during habituation, (f-i) Time spent exploring objects for memory tests during initial exposure (f) or during testing (g) for memory tests or for learning tests during initial exposure (h) or during testing (i). (j) Discrimination index of time spent with a novel vs familiar object when mice are tested immediately after initial exposure to objects (for learning tests, n = 10 mice for DMSO and 9 mice for 1 week Jql . No significant difference between DMSO and Jql, for one sample t test for DMSO P = 0.00325, t = 4.14, for Jql P = 0.00103, t = 5.017). (k) Percent of time spent freezing in response to a tone before training, during training, or 1 day after training in a new context (2 -way ANO VA with posthoc t test, P = 2E-16, F = 165.7, df = 130) (1) Percent of time spent freezing before, immediately after, or 1 day after fear conditioning training in the training context or in a novel context. (2-way ANOVA with posthoc t test, P = 2E-16, F = 80.72, df = 110). N = 10 mice for control and 3 week Jql and 9 mice for 1 week Jql for testing groups. *, p<0.05. ***, p<0.001. n.s., nonsignificant. Error bars represent standard error.

[0029] Figure 20. Jql affects seizure susceptibility, (a) Quantification of mRNA from cortical tissue from mice after behavioral testing following treatment with DMSO or 1 week of Jql (unpaired two-sided t test for dmso n = 9 brains and for Jql n = 8, for grial P = 0.00517, t value = 3.27, for Nr4al P = 0.018, t value = 2.64). (b) Western of GluAl levels after Jql treatment, (c) Data for each level of Racine scoring of seizure induction for mice treated for one week with either DMSO (left bar for each panel) or Jql (right bar for each panel) and then given pentylenetetrazol (PTZ) to induce seizures, (d) Percent mortality of male mice after seizure injection by PTZ. (e) Seizure susceptibility score of female mice treated for one week with either DMSO or Jql and given pentylenetetrazol (PTZ) to induce seizures, (f) Percent mortality of female mice after seizure injection by PTZ. (g, h) Seizure susceptibility scores during kindling for individual mice treated with DMSO (f) or Jql (g). N = 9 mice per group. *, p<0.05. ***, p<0.001. Error bars represent standard error. Full-length blots are presented in Figure 22. [0030] Figure 21. Model of Brd4 function in neurons. Neuronal activation by signaling molecules such as BDNF trigger activation of CK2 which in turn phosphorylates Brd4. Brd4 binds to acetylated lysines on histone proteins and activates expression of neuronal genes including IEGs which then affect synaptic proteins. Inhibition of Brd4 by Jql affects aspects synaptic function and memory formation.

[0031] Figure 22. Original western blots corresponding to other figures, as designated.

[0032] Figure 23. Graphical representations of data demonstrating that effects on target genes that are indicative of neuronal activity are not limited to the Jql BET inhibitor.

[0033] Figure 24: Graphical representations of data demonstrating that Jql but not other broad-acting transcriptional inhibitors reverses the gene expression changes that occur in FXS neurons. (Fig. 24A-D) qRT-PCR for WT and KO neurons treated with Jql for Nr4al (Fig. 24A), Shank2 (Fig. 24B), dial (Fig. 24C), and Arc (Fig. 24D). N = 4 biological replicates. (Fig. 24E) Significance of the overlap of genes upregulated in KO neurons with genes downregulated by Jql treatment and vice versa. (Fig. 24F-I) qRT-PCR for WT and KO neurons treated with THZ1 for Nr4al (Fig. 24F), Shank2 (Fig. 24G), Grial (Fig. 24H) and Arc (Fig. 241). N = 3 biological replicates. (Fig. 24 J) Overlap of KO up and downregulated genes with THZ down and up regulated genes, n.s. nonsignificant. *p < 0.05, unpaired t test. ***p < 0.001, unpaired t test. Overlap p values, hypergeometric test. DESCRIPTION OF THE DISCLOSURE

[0034] Unless defined otherwise herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains.

[0035] Unless specified to the contrary, it is intended that every maximum numerical limitation given throughout this description includes every lower numerical limitation, as if such lower numerical limitations were expressly written herein. Every minimum numerical limitation given throughout this specification will include every higher numerical limitation, as if such higher numerical limitations were expressly written herein. Every numerical range given throughout this specification will include every narrower numerical range that falls within such broader numerical range, as if such narrower numerical ranges were all expressly written herein.

[0036] The present disclosure relates in part to the discovery that the activity of Brd4 is correlated with disorders that involve neuronal function deficits in brain. Thus, it is disclosed here for the first time that Brd4 is a target for prophylaxis and/or therapy for neurodevelopmental disorders that include but are not necessarily limited to autism spectrum disorders (ASD), seizure disorders including but not limited to epilepsy, Fragile X syndrome (FXS), and combinations thereof. The disclosure includes compositions of matter described herein. The compositions include but are not necessarily limited to antibodies that can discriminate between types of Brd4 proteins, such as by discriminating differences in phosphorylation, and Brd4 protein modifications, such as Brd4 protein fragments and mutations. Recombinant polynucleotides encoding antibodies and protein fragments and mutations, including but not limited to expression vectors, are also included in the invention, as are methods of making and using the recombinant polynucleotides and the compositions.

[0037] In the present disclosure, among other discoveries, it is demonstrated that

Brd4 is expressed throughout the brain and plays a critical role in activity-dependent transcription, and that inhibition of Brd4 and its family members blocks novel object preference, indicating impairments in memory consolidation. This is demonstrated using a representative inhibitor of Bromodomain and Extra-Terminal motif (BET) proteins. The inhibitor known in the art as Jql is used to demonstrate that BET inhibition, and in particular Brd4 inhibition, has potentially significant clinical applications for prophylaxis and/or therapy of a variety of conditions that affect neurological function. In this regard, Brd4, one of many genes that has been postulated as being associated with ASD, is a member of the bromodomain-containing protein family and is a chromatin 'reader' that recruits chromatin- regulating enzymes to target promoters (Belkina AC, et al. BET domain co-regulators in obesity, inflammation and cancer. Nature reviews Cancer. 2012; 12(7):465-77. Epub

2012/06/23; Wu SY, Chiang CM. The double bromodomain-containing chromatin adaptor Brd4 and transcriptional regulation. The Journal of Biological Chemistry.

2007;282(18): 13141-5). It regulates cell cycle control and has been studied extensively in the context of cancer. However, bromodomain proteins are also able to regulate transcription in post-mitotic cells (Belkina, et al.). Bromodomain proteins recognize and bind acetylated lysines in a context-dependent fashion. Acetyl marks are extensively studied epigenetic modifications in the brain and are linked to memory formation and multiple neurological disorders (Fischer A, et al. Targeting the correct HDAC(s) to treat cognitive disorders. Trends in pharmacological sciences. 2010;31(12):605-17). In connection with Jql (also known as JQ1), it is a potent inhibitor of the BET family of bromodomain proteins which include BRD2, BRD3, BRD4, and the testis-specific protein BRDT in mammals. It has CAS Registry Number 1268524-70-4 and PubChem CID 46907787. It has the IUPAC name (S)- tert-butyl 2-(4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][l,2,4]triazolo[4,3- a][l,4]diazepin-6-yl)acetate, and the structure:

[0038] Using JQ1 treatment as a proof of principle it is demonstrated herein that Brd4 inhibition decreases seizure susceptibility in mice. Without intending to be bound by any particular theory, it is considered that this is the first demonstration that Brd4 has a critical function in neurons and that BET protein inhibition affects memory consolidation, and is therefore a potential approach to prophylaxis and/or therapy for epilepsy, among other neurodevelopmental disorders. Moreover, data are provided in the present disclosure that indicate Brd4 inhibition, as tested using Jql, may be effective in treating patients with autism and FXS. In particular, we found that Brd4 is misregulated in the Fmrl knockout mouse model of FXS during critical periods of neurodevelopment. We examined the effect of Brd4 using the Jql on neurons from these mice and found that it results in the complete reversal of neuronal deficits observed in these disorders. We successfully demonstrated that Brd4 inhibition tested using the model BET inhibitor Jql reversed the deficits in social interaction, repetitive behavior, and memory that are typical of the mouse model of FXS. Thus, in various aspects, the present disclosure provides approaches to prophylaxis and/or therapy of a variety of conditions that involve Brd4 function in neurons.

[0039] In certain embodiments the disclosure encompasses use of one or more BET targeting compounds for modulating the activity of a BET protein, such as Brd4. In embodiments, the modulating the activity comprises use of a BET targeting agent that can affect the function of one or more BET proteins, including but not necessarily limited to the function of Brd4. Without intending to be limited by any particular theory, it is generally considered that BET-targeting compounds function by modulating protein-protein interaction between one or more BET proteins and acetylated histones and/or transcription factors. In certain embodiments, modulating a BET protein comprises use of a BET targeting compound to fully, or only partially inhibit one or more functions of the BET protein. In alternative embodiments, modulating a BET protein comprises use of a BET targeting protein for stimulating, enhancing and/or activating one or more functions of the BET protein. A BET inhibitor is used to illustrate non-limiting embodiments of the invention.

[0040] In embodiments the disclosure comprises modulating the activity of Brd4 function in neurons of an individual in need thereof by administering to the individual a BET inhibitor. In certain embodiments, the disclosure comprises administering a composition comprising an effective amount of a BET targeting compound, such as a BET inhibitor, to an individual in need of prophylaxis and/or therapy of a condition that is correlated with Brd4 function in brain neurons. In embodiments the administering of the BET inhibitor is such that one or more symptoms of the condition are improved. In embodiments, the condition that is correlated with Brd4 function is selected from ASD, FXS, and seizure disorders, including but not necessarily limited to epilepsy. In certain embodiments, the individual treated according to this disclosure has not been diagnosed with cancer, and/or is not known to be at risk for developing cancer. In embodiments the individual has not been diagnosed with cardiovascular disease, and/or is not known to be at risk for developing cardiovascular disease. In embodiments, the individual is not in need of male contraception.

[0041] In embodiments, the disclosure comprises selecting an individual as a candidate for treatment with a BET targeting compound, such as a BET inhibitor, for a neuronal condition correlated with Brd4 function, such correlation being established by discoveries and implementations of the present disclosure. The method comprises testing an individual to determine whether the individual has the neuronal condition, and optionally, subsequent to determining the individual has the neuronal condition, administering to the individual a therapeutically effective amount of the BET inhibitor. In embodiments, the individual selected for treatment with a BET inhibitor is selected based on a diagnosis of ASD, FXS, or a seizure disorder. In embodiments, a determination that an individual is a candidate for treatment with a BET targeting compound due to the presence of a neuronal condition correlated with Brd4 function (i.e., the individual is diagnosed with ASD, FXS, or a seizure disorder) can be represented in a written and/or digitized report which can then if desired be communicated to a health care provider.

[0042] The disclosure is illustrated using the model BET inhibitor Jql, but it is contemplated that other inhibitors and/or modulators, provided they have specific or selective BET targeting, and/or specific or selective Brd4 targeting, can also be used in methods of this disclosure, with the proviso that suitable compounds can cross the blood-brain barrier. Thus, compounds that cannot cross the blood brain barrier, or have been modified to preclude or limit blood-brain barrier crossing, are in certain embodiments not encompassed by the present disclosure. In one embodiment, a JQ1 derivative, I-BET 762 is used. In

embodiments, the compound is a BET inhibitor selected from those known in the art by the terms: I-BET 151 (GSK1210151A), I-BET 762 (GSK525762), OTX-015, TEN-010, CPI- 203, CPI-0610, RVX-208, LY294002, and combinations thereof.

[0043] Compositions for performing any method of this disclosure may be prepared by mixing any suitable BET targeting agent with any suitable pharmaceutically acceptable carriers, excipients and/or stabilizers. Some examples of compositions suitable for mixing with the compounds can be found in: Remington: The Science and Practice of Pharmacy (2005) 21 st Edition, Philadelphia, PA. Lippincott Williams & Wilkins.

[0044] In embodiments the disclosure includes administering a composition comprising a therapeutically effective amount of a compound described herein.

"Therapeutically effective amount" as used herein means that amount of the BET targeting compound that elicits the response that is being sought by a medical doctor or other clinician, and includes alleviation of one or more of the symptoms of the disease or disorder being treated, and/or reduction of the severity of one or more of the symptoms of the disease or disorder being treated. Thus, in certain embodiments, by administering a composition comprising a BET targeting compound to an individual in need thereof for a condition associated with neuronal function of Brd4, the severity of at least one symptom in the individual is reduced, and/or there is a slowing of the progression of the symptom(s), or a cessation of the progression of the symptom(s), or elimination of the symptom. In certain embodiments, administration of a BET targeting compound will result in a reduction in one or more symptoms by at least 10%, 20%, 30%, 50% or greater, up to a 75-90%), or 95% or greater, reduction in the one or more symptoms, compared to placebo-treated or other suitable control subjects, or any other suitable reference.

[0045] The compositions of the invention can be administered using any suitable method and route of administration. Some non-limiting examples include oral, parenteral, subcutaneous, intraperitoneal, intrapulmonary, intranasal, intracranial, and can be performed using an implantable device, such as an osmotic pump. Parenteral infusions include intramuscular, intravenous, intraarterial, intraperitoneal, pulmonary instillation as mist or nebulization, and subcutaneous administration.

[0046] In certain embodiments, the disclosure includes an article of manufacture comprising one or more BET targeting compounds, suitable containers, and packaging, wherein the packaging contains printed material which provides an indication that the contents of the package are to be used prophylaxis and/or therapy of any Brd4-associated disorder disclosed herein. The packaging can include one or more sealed containers comprising the BET inhibitor.

[0047] Administration of a BET targeting compound, such as a BET inhibitor, can be performed in conjunction with conventional therapies that are intended to treat the condition associated with neuronal function of Brd4. For example, a composition comprising a BET inhibitor could be administered prior to, concurrently, or subsequent to conventional therapies known to those skilled in the art for prophylaxis or therapy of, for example, autism spectrum disorder, seizure disorders, and Fragile X syndrome. Such therapies include but are not limited to combining treatment with a BET inhibitor with other pharmaceutical agent(s) known to be effective against the particular condition being treated, behavioral and physical therapies, cognitive therapies, and the like.

[0048] Routes and frequency of administration of BET inhibitors, as well as dosage, will vary from individual to individual, and may be readily established using standard techniques given the benefit of the present disclosure. As discussed above, and without intending to be constrained by any particular theory, it is considered that the results presented herein indicate that approaches of this disclosure will be suitable for providing treatment modalities for conditions that include but are not necessarily limited to ASD, FXS, and seizure disorders.

[0049] Autism Spectrum Disorder (ASD)

[0050] In embodiments the disclosure relates to treating patients who are diagnosed with or are suspected of having ASD, and is expected to be pertinent to any subject, such as an adult human, child or infant, who has ASD.

[0051] As is known in the art, ASD comprises a group of disorders generally characterized by varying degrees of impairment in communication skills, social interactions, learning disabilities, and restricted and/or repetitive behaviors which range from mild to severe degrees of impairment. To better understand the role of epigenetics in neuronal function, we sought to identify epigenetic regulators that are associated with ASD.

[0052] ASD is a neurodevelopmental syndrome characterized by impairments in socialization, communication and behavior that affects approximately 1 in 100 children.

Increasing evidence suggests a link between epigenetic regulation and ASD. Transcriptional regulation is required for synaptic homeostasis and the art suggests that ASD may result from problems in maintaining homeostasis (Toro R, et al. Key role for gene dosage and synaptic homeostasis in autism spectrum disorders. Trends Genet. 2010;26(8):363-72; Bourgeron T. A synaptic trek to autism. Current opinion in neurobiology. 2009; 19(2):231-4). The art also demonstrates links between autism and proteins that regulate transcription, such as CHD8 (Roak BJ, et al., Sporadic autism exomes reveal a highly interconnected protein network of de novo mutations. Nature. 2012;485(7397):246-50) and RNF8 (Morrow EM, et al.,

Identifying autism loci and genes by tracing recent shared ancestry. Science.

2008;321(5886):218-23). In addition, a major environmental cause of autism is gestational exposure to valproic acid (VP A) (Chomiak T, Hu B. Alterations of neocortical development and maturation in autism: insight from valproic acid exposure and animal models of autism. Neurotoxicology and teratology. 2013;36:57-66), which is a histone deacetylase (HDAC) inhibitor. Other autism-like disorders, such as Rett Syndrome, also have clear links to epigenetic regulation (Gapp K, et al., Epigenetic regulation in neurodevelopment and neurodegenerative diseases. Neuroscience. 2014;264C:99-111).

[0053] Symptoms of ASD include but are not necessarily limited to social withdrawal, reluctance to make eye contact / averted gaze, obsessions and repetitive behavior, attention deficit, anxiety, hyperactivity, depression, and the inability to comprehend feelings of others. Some ASD patients ignore communication from other, and/or have an aversion to physical contact and/ affection. Communication difficulties range from a complete lack of verbal communication, to monotone speech and/or inappropriate volume. ASD patients may also experience visual difficulties, sound and light sensitivity, and mental retardation. In embodiments, an individual treated according to this disclosure has been diagnosed with or is suspected of having ASD, which can include but is not necessarily limited to autism, Asperger's syndrome, Rhett's disorder, pervasive developmental disorder not otherwise specified (PDD-NOS), childhood disintegrative disorder, semantic

communication disorder, non-verbal learning disabilities, high functioning autism, hyperlexia, and attention deficit hyperactivity disorder.

[0054] In an embodiment of the disclosure, administration of an effective amount of a

BET targeting compound, such as a BET inhibitor, to a subject presenting with ASD symptoms will detectably decrease, eliminate, or prevent the symptom(s). In an

embodiment, administration of an effective amount of a BET inhibitor will result in an improvement of an assessment in an autism diagnostic measurement, such as Autism

Diagnostic Observation Schedule (ADOS), and/or the Autism Diagnostic Interview-Revised (ADI-R). In embodiments, administration of an effective amount of a BET inhibitor to a subject presenting with ASD symptoms will improve one or more scores relative to the specified diagnostic cut-off threshold in at least one of the five domains of the ADOS. In this regard, the scores measure impairment, thus the higher the number, the more severe the impairment. In embodiments, a reduction in impairment can be evidenced by an

improvement in ADOS scores for: communication; reciprocal social interaction;

communication and social; and combinations thereof. In embodiments, administration of a BET inhibitor according to this disclosure results in a change in an ASD assessment score such that the score changes favorably relative to a threshold value.

[0055] In embodiments, treating an ASD patient according to this disclosure results in a reduction in repetitive behavior, and/or an improvement on a cognitive learning test, and/or an improvement in or more oral communication skills and/or improvements in social interaction behavior.

[0056] FXS

[0057] The field of epigenetics examines how environment influences gene expression. This occurs, in part, through the modification of histone proteins, which regulate transcription and package DNA into compact structures called chromatin. Recently, this field has shed light on how the brain is able to take information from the environment and encode it at a molecular level. Epigenetic regulation of transcription plays a crucial role in neuronal development and plasticity (Hsieh J, Gage FH. Chromatin remodeling in neural development and plasticity. Current opinion in cell biology. 2005; 17(6):664-71), and emerging evidence suggests the environmental factors underlying many neurodevelopmental disorders are linked to epigenetic-based regulatory mechanisms (Gapp K, et al. Epigenetic regulation in neurodevelopment and neurodegenerative diseases. Neuroscience. 2014;264C:99-111). In connection with this, and as discussed above, one of myriad genes associated with ASD encodes Brd4. As disclosed herein, there is a potential link between Brd4 and the fragile X mental retardation protein, FMRP. FMRP is an RNA binding protein that regulates the translation of many mRNAs in the brain has been shown to associate with Brd4 mRNA (Darnell JC, et al. FMRP stalls ribosomal translocation on mRNAs linked to synaptic function and autism. Cell. 2011; 146(2):247-61). FXS results from loss of functional FMRP and is characterized by intellectual disability, behavioral and learning issues and physical characteristics. FXS is the leading single gene cause of both ASD and mental retardation.

[0058] Despite links between Brd4 and neuronal function, prior to the present disclosure, the role of Brd4 in the brain has never been investigated. But as described further herein, and particularly in relation to Figures 11 and 12, we examined the effect of Brd4 inhibition in the Fmrl knockout mouse model of FXS during critical periods of

neurodevelopment. Administering the model BET inhibitor Jql results in the complete reversal of neuronal deficits observed in these disorders. We successfully demonstrate that Brd4 inhibition reversed the deficits in social interaction, repetitive behavior, and memory that are typical of the mouse model of FXS. These data indicate that BET inhibition is a feasible approach to treating a variety of conditions that are regulated at least in part by Brd4 activity. Thus, in embodiments, the disclosure relates to administering a BET targeting compound to an individual such that at least one symptom of FXS is reduced and/or eliminated. The disclosure is expected to be pertinent to any subject, such as an adult human, child or infant, who has FXS. In embodiments, administration of a BET targeting compound, such as a BET inhibitor, to an individual with FXS results in reduction in anxiety, and/or a hyperactive behavior, such as fidgeting or impulsive action, and/or a reduction in attention deficit disorder. Approximately one-third of individuals with FXS also exhibit features of ASD that affect communication and social interaction; thus achieving the therapeutic effects for ASD patients described herein is also applicable to this subset of FXS patients. Further, seizures occur in about 15 percent of males and about 5 percent of females with FXS, and the disclosure accordingly includes treating seizures for these individuals, as described further below.

[0059] Seizure disorders

[0060] It is expected that methods of the present disclosure will be suitable for prophylaxis and/or treatment of seizure disorders. The seizure disorders comprise epilepsy (including, but not limited to, localization-related epilepsies, generalized epilepsies, epilepsies with both generalized and local seizures, and the like), seizures associated with Lennox-Gastaut syndrome, seizures as a complication of a disease or condition (such as seizures associated with encephalopathy, phenylketonuria, juvenile Gaucher's disease, Lundborg's progressive myoclonic epilepsy, stroke, head trauma, stress, hormonal changes, drug use or withdrawal, alcohol use or withdrawal, sleep deprivation, fever, infection, and the like), essential tremor, restless limb syndrome, and the like. In embodiments the disorder is selected from epilepsy (regardless of type, underlying cause or origin), essential tremor or restless limb syndrome. In embodiments, the seizure disorder is a disease or condition that is mediated by elevated persistent sodium current.

[0061] In embodiments the subject to whom a composition of this disclosure is administered is undergoing, has experienced, and/or is at risk for experiencing a seizure, and thus may be diagnosed with or be suspected of having any seizure disorder. In embodiments, the seizure disorder is selected from the group consisting of epilepsy and chemically-induced seizure disorders. Epilepsy and related disorders and their attendant seizure symptoms are well characterized in the art. In this regard, the present disclosure is expected to be pertinent to any subject, such as an adult human, child or infant, who experiences one or more seizures. In one embodiment the seizures can comprise tremors. A characteristic that distinguishes categories of seizures is whether the seizure activity is partial (e.g., focal) or generalized. Partial seizures are considered those in which the seizure activity is restricted to discrete areas of the cerebral cortex. If consciousness is fully preserved during the seizure, the seizure is considered to be a simple-partial seizure. If consciousness is impaired, the seizure is considered to be a complex-partial seizure. Within these types of seizures are included those that initiate as partial seizures and subsequently extend through the cortex; these are considered partial seizures with secondary generalization.

[0062] Generalized seizures encompass distant regions of the brain simultaneously in a bilaterally symmetric manner and can include sudden, brief lapses of consciousness, such as in the case of Absence or petit mal seizures, without loss of postural control. Atypical absence seizures usually include a longer period of lapse of consciousness, and more gradual onset and termination. Generalized Tonic-clonic or grand mal seizures, which are considered to be the main type of generalized seizures, are characterized by abrupt onset, without warning. The initial phase of the seizure is usually tonic contraction of muscles, impaired respiration, a marked enhancement of sympathetic tone leading to increased heart rate, blood pressure, and pupillary size. After 10-20 seconds, the tonic phase of the seizure typically evolves into the clonic phase, produced by the superimposition of periods of muscle relaxation on the tonic muscle contraction. The periods of relaxation progressively increase until the end of the ictal phase, which usually lasts no more than one min. The postictal phase is characterized by unresponsiveness, muscular flaccidity, and excessive salivation that can cause stridorous breathing and partial airway obstruction. Atonic seizures are characterized by sudden loss of postural muscle tone lasting 1-2 seconds. Consciousness is briefly impaired, but there is usually no postictal confusion. Myoclonic seizures are characterized by a sudden and brief muscle contraction that may involve one part of the body or the entire body. It is considered that the present disclosure is applicable for prophylaxis and/or therapy of any of the foregoing types of seizures, which are described for illustration but are not meant to be limiting. In embodiments, the disclosure is pertinent to treatment of epilepsy. In embodiments, the epilepsy is selected from idiopathic, cryptogenic, symptomatic, general and focal epilepsy. Idiopathic means there is no apparent cause. Cryptogenic means there is a likely cause, but it has not been identified. Symptomatic means that a cause has been identified. In embodiments, the individual to whom a BET inhibitor is administered as described herein has a seizure disorder that is refractory to at least one other epilepsy drug. In embodiments, the individual to whom a BET inhibitor is administered has been diagnosed with or is suspected of having drug resistant epilepsy, which occurs when a person has failed to become (and stay) seizure free after treatment with two seizure medications.

[0063] In embodiments, the BET targeting compound is administered such that it is adequate to reduce the severity and/or frequency and/or duration of seizures experienced by the individual. In an embodiment, seizures are terminated or prevented by the administration.

[0064] The following examples are meant to illustrate but not limit the disclosure.

EXAMPLE 1

[0065] Brd4 is expressed in neurons

[0066] We examined Brd4 expression in adult mice using an antibody that detects the full-length form of Brd4 and found that it is expressed throughout the brain (Fig. la, Fig. 13a). Brd4 positive cells typically express NeuN but not GFAP in both cortex and

hippocampus (Fig. lb-i) indicating that Brd4 is present in neurons while generally not seen in glial cells. In addition, we separately cultured cortical neurons and glia and found that neurons contain more Brd4 mRNA and protein than glial cells (Fig. lj, k). Both CamKI- positive excitatory neurons and GABA-positive inhibitory neurons express Brd4 (Fig. 13b, c). Finally, we treated cultured neurons with brain-derived neurotrophic factor (BD F) to mimic physiological activation in the brain⁶, which resulted in small increases in Brd4 mRNA and protein (Fig. 13d-f).

[0067] Brd4 regulates IEG transcription in neurons

[0068] Similar to other post-mitotic cells that require Brd4, neurons activate a subset of genes (IEGs) in response to external signals. This rapid response is critical to the consolidation of synaptic modifications underlying synaptic plasticity and memory formation (Frey, U,. J. Physiol. 490 ( Pt 3), 703-711 (1996); Frey, U., et al., Neurosci. Lett. 97, 135- 139 (1989); Nguyen, P. V., et al.. Science 265, 1104-1107 (1994); Messaoudi, E., et al., J. Neurosci. Off. J. Soc. Neurosci. 22, 7453-7461 (2002)). We examined whether Brd4 is involved in transcriptional activation in neurons using the small molecule inhibitor Jql which blocks BET proteins from binding to acetylated histones (Filippakopoulos, P. et al., Nature 468, 1067-1073 (2010)). After pretreatment with Jql or the negative enantiomer (-)Jql, cultured cortical neurons were stimulated with BDNF (Fig. 2a). As expected, BDNF caused a rapid increase in transcripts of IEGs Arc and Fos. However, pre-treatment with Jql blocked the BDNF-induced increase (Fig. 2b, c). Rapidly induced IEGS such as Arc and Fos have PolII poised on their promoters to allow for immediate activation, while other IEGs such as Nr4al must both recruit and phosphorylate PolII to activate transcription (Saha, R. N. et al. Rapid activity-induced transcription of Arc and other IEGs relies on poised RNA polymerase II. Nat. Neurosci. 14, 848-856 (2011)). We found that Jql also prevented the activity-induced increase Nr4al (Fig. 2d) indicating that Jql 's affects are not limited to IEGs with poised PolII.

[0069] We similarly examined the effects of Jql on tetrodotoxin (TTX) withdrawal which rapidly increases neuronal activity. Neurons were treated with TTX for 2 days after which Jql or the negative enantiomer was added before TTX was removed from media. Jql again prevented rapid IEG induction (Fig. 2e-g). Interestingly, Jql cannot prevent IEG activation after long periods of BDNF stimulation, suggesting that Jql only affects the rapid increase in transcription, whereas at later times signaling may be robust enough to overcome BET inhibition (Fig. 14a-c). Because Jql also inhibits other members of the BET protein family, we tested whether loss of Brd4 is sufficient to block IEG induction. Partial knockdown of Brd4 with a lentivirus also blocked BDNF-induced IEG expression but did not block upstream pathways such as MAPK signaling (Fig. 2h-j, Fig. 14d, e). These data fit with a model similar to that observed in other cell types in which Brd4 recruits P-TEFb to promote PolII phosphorylation to allow for rapid transcriptional elongation.

[0070] To confirm that the loss of transcriptional activation results in a corresponding change in protein levels, we examined Arc protein expression at 30 minutes when newly transcribed mRNA has been translated into protein. As expected, Jql -treated neurons exhibited less Arc protein induction than control neurons (Fig. 2k, 1). Similarly, transfection of small interfering RNAs (siRNAs) targeted against Brd4 blocked the BDNF-induced increase in Arc protein whereas transfection with non-targeting siRNA or siRNAs targeted against the other BET family members did not (Fig. 2m, n, Fig. 14f-i). BrdT is testes-specific so was not tested. To ensure that the loss of Arc induction was not due to off-target effects, we tested two distinct Brd4 siRNAs which also blocked BDNF-induced Arc expression (Fig. 14j-l).

[0071] We also sought to determine which of Brd4's known functions is responsible for its effects in neurons. Full-length Brd4 can function by recruiting complexes such as pTEFb and Mediator to trigger elongation whereas both the long and short forms of Brd4 can promote PolII progression through acetylated nucleosomes after elongation begins (Kanno, T. et al. Nat. Struct. Mol. Biol. 21, 1047-1057 (2014)). We found that only the long form of Brd4 affects Arc expression (Fig. 14m) indicating that Brd4 is likely functioning in neurons by recruiting co-activating complexes to target genes.

[0072] These data demonstrate that Brd4 regulates activity -induced IEG expression in neurons. However, inhibition of Brd4 may also disrupt transcriptional output in neurons even without a potent stimulation such as BDNF due to the cumulative loss of the response to endogenous signaling from other neurons over a long period of time. Indeed, we found that by 24 hours Jql decreased Arc, Fos, and Nr4al transcripts (Fig. 14n). We also confirmed that long-term disruption of this BET function did not cause widespread disruption of chromatin acetylation (Fig. 14o) as expected from its function as reader protein. Finally, we showed that Jql did not block upstream signaling pathways by demonstrating that MAP Kinase phosphorylation is intact (Fig. 14p). Together, these data demonstrate that Brd4 is responsible for transcription of IEGs in neurons.

[0073] Genome-wide effects of Jql

[0074] While Brd4 clearly regulates specific IEGs, inhibition of Brd4 likely also affects a wider range of genes. We used RNA-sequencing to examine BDNF induction of IEGs after Jql treatment and long-term effects of Jql and to expand the analysis to all genes significantly induced by BDNF. We found a consistent decrease in induction in the presence of Jql (Fig. 3a, Fig. 15b), supporting a model in which Brd4 mediates the rapid response to neuronal activity. In addition, we also examined the effects of 24 hours of Jql treatment in the absence of exogenous stimulation. At this later time point, the effects of the loss of IEG transcription in response to basal levels of endogenous neuronal signaling will be apparent. We found a highly significant overlap between BDNF -induced genes and those regulated by Jql alone of p < 0.000005. We also separately examined genes up- and down-regulated by Jql as down-regulated genes are more likely to be direct targets of Brd4 due its function as a transcriptional activator. Gene clusters most significantly down-regulated by Jql included genes involved in ion channel regulation and synapse function (Fig. 3b). Jql treatment also increased genes involved in chromatin regulation and nuclear proteins (Fig. 15c) which may be compensatory effects or indirect effects resulting from decreases in Brd4 target genes. To determine which histone modifications are responsible for recruiting Brd4 to target genes, we examined known Brd4 target acetyl marks and found that BDNF increased H3K14 and H4K16 acetylation at IEG promoters (Fig. 15d) suggesting they may be involved in the stimulus dependent recruitment of Brd4. As expected, Jql did not affect these marks (Fig. 15e).

[0075] Brd4 is regulated by casein kinase II in neurons [0076] To better understand how Brd4 is targeted to chromatin in neurons, we next examined the mechanism underlying activation of Brd4 itself. We found that BDNF stimulation increased Brd4 association with promoter regions of IEGs suggesting that neuronal activity targets Brd4 to acetylated histones immediately after stimulation (Fig. 16a- c). This effect was not observed for Brd2 or 3 (Fig. 16d-i). To investigate how Brd4 is targeted to promoters, we explored the role of CK2. In HEK293 cells, CK2 phosphorylates Brd4, which triggers Brd4 binding to acetylated histones at target gene promoters to activate transcription (Wu, S.-Y., et al., Mol. Cell 49, 843-857 (2013)). In neurons, CK2 is important in regulating synaptic strength (Lussier, M. P., et al., Eur. J. Neurosci. 39, 1148-1158 (2014); Sanz-Clemente, A., et al,. Neuron 67, 984-996 (2010)) and is activated by BDNF stimulation Schael, S. et al., J. Biol. Chem. 288, 9303-9312 (2013)). We found that BDNF-induced targeting of Brd4 was blocked by pretreatment with the CK2 inhibitor TBB as well as Jql (Fig. 4a-c) suggesting that Brd4 is activated by CK2 in response to neuronal activity.

Importantly, this short TBB pretreatment did not prevent MAPK phosphorylation

demonstrating upstream signaling is intact (Fig. 16j) and neither TBB nor Jql prevented BDNF-induced CREB Binding Protein (CBP) association with chromatin demonstrating other transcriptional cofactors are still recruited to target genes (Fig. 16k-m). If Brd4 activation by CK2 is necessary for the activity-dependent transcription then CK2 inhibition should also block the activity-induced increase in IEGs. Fitting with this model, pretreatment with TBB blocked the increase in Arc, Fos, and Nr4al mRNA (Fig. 4d-i) as well as Arc protein levels (Fig. 4j-k). To control for off-target effects of TBB, we confirmed that transfection of Ck2 siRNA also blocks Arc induction (Fig. 16n-p).

[0077] To further support our proposed mechanism of Brd4 phosphorylation induced chromatin targeting, we examined the movement of Brd4 after neuronal stimulation using FRAP. Using live neurons, we photobleached a region of the nucleus of expressing EGFP- Brd4, and observed the recovery of the signal in the bleached region over time to measure the mobile fraction of Brd4. As expected, Jql increased the mobile fraction (Fig. 16q). The mobile fraction of Brd4 also increases after BDNF treatment, presumably as it is activated and relocates to acetylated chromatin. However, the enhanced mobility of Brd4 was blocked by TBB (Fig. 41-n) indicating CK2 is responsible for this effect.

[0078] To better understand the mechanism of Brd4 activation in neurons, we examined the specific serine residues in the CK2 site in Brd4, S492 and S494, that are believed to be critical to Brd4 activation (Wu, S.-Y., et al.,. Mol. Cell 49, 843-857 (2013)) (Fig. 5a). We developed a novel, site-selective antibody against a peptide containing the Brd4 CK2 site with phosphorylated S492. Using a dot blot assay, we found that the affinity- purified antibody specifically bound a peptide phosphorylated at S492 as well as a peptide phosphorylated at both S492 and S494, but failed to recognize the unphosphorylated peptide (Fig. 17a). Next we used neuronal lysates to determine the specificity of the antibody in cells and observed a band matching the size of full length Brd4 that was not present in lysates treated with phosphatase, although other small molecular weight bands were also observed at high exposures (Fig. 17b). We observed a robust BDNF-induced increase in the phospho- Brd4 signal that was lost with TBB pretreatment (Fig. 5b).

[0079] Next, to ensure that the effects of CK2 inhibition and knockdown are due to its effects on Brd4 and not an indirect effect of other CK2 targets, we tested the critical target residues in the CK2 phosphorylation site in Brd4. We created a full (delCK2) and partial deletion (del4920494) and a point mutation (S492A) in the CK2 site in Brd4. Transfection of wildtype Brd4 increased Arc expression even in the absence of exogenous stimulation.

However, this effect was greatly reduced when the CK2 site was mutated or deleted.

Conversely, a phosphomimic (Brd4-pm) at the key serines in Brd4 (S492E and S494E) resulted in an even greater increase in Arc expression (Fig. 5c, d). This demonstrates that phosphorylation of the CK2 site within Brd4 is necessary for its ability to activate

transcription of Arc. We also repeated the FRAP assay and found the S492A mutant decreases Brd4 mobility, presumably by preventing activation of Brd4 from endogenous signaling while the phospho-mimic Brd4 behaved similarly to BDNF-stimulated Brd4 showing an increased mobile fraction (Fig. 5e). We also sought to confirm that this increase in the mobile fraction corresponds to a translocation to active chromatin. We focused on acetylated H4K16, which recruits Brd4 and increases in response to BDNF (Fig. 15d). We found moderate colocalization of H4K16acetyl and wildtype Brd4 under basal conditions that was enhanced with BDNF stimulation as expected. We then tested the phospho- mutant and mimic forms of Brd4 and determined that the S492A mutation decreased H4K16acetyl colocalization while Brd4-pm mutations increased colocalization as measured by Pearson's coefficient (Fig. 5f and Fig. 17d-e). Together, these data support a model in which CK2 phosphorylates Brd4 in response to neuronal activity resulting in Brd4 binding to target promoter regions and increased transcription of target IEGs.

[0080] Brd4 affects neuronal receptor proteins

[0081] In neurons, IEGs regulate the response to activity by changing the receptor content of synapses both by directly modifying synaptic proteins and altering gene expression of these proteins. Thus, the prolonged loss of IEG activation resulting from Jql treatment may affect neuronal function by changing critical synaptic proteins. In addition, RNA- sequencing data suggest that Jql treatment affects transcription of synaptic proteins and receptors in neurons (Fig. 2d). We therefore examined the GluAl subunit of the a-amino-3- hydroxy-5-methyl-4-isoxazolepropionic acid receptor (AMPAR), the major excitatory receptor in neurons. Jql treatment decreased transcript levels of Grial (Fig. 6a), the gene encoding GluAl, and decreased total GluAl protein (Fig. 6b). Jql did not affect Gria2, which unlike Grial, lacks activity-responsive promoter regions (Borges, K. & Dingledine, R. J. Biol. Chem. 276, 25929-25938 (2001); Myers, S. J. et al. Off. J. Soc. Neurosci. 18, 6723- 6739 (1998)). These changes, as well as those observed on IEGs, occurred slowly over the course of several hours of Jql treatment (Fig. 18a). To confirm that decreasing the total pool of available GluAl results in decreased surface expression, we used a surface-staining assay that specifically stains receptors expressed on the exterior of dendrites. We found that both Jql and Brd4 siRNA, but not Brd2 or Brd3 siRNA, decreased GluAl surface expression in both cortical and hippocampal neurons without affecting spine number (Fig. 6c-g, Fig. 18b- e). Increasing Brd4 expression resulted in a small, but significant, increase in GluAl surface expression (Fig. 6g-i). We again compared the long and short forms of Brd4 and found that full length Brd4 GluAl increases surface expression while the short isoform does not (Fig. 18f), indicating that Brd4 functions by recruiting co-activating complexes to the promoter of target genes. Grial may be a direct target of Brd4 because Brd4 ChIP assays show a high basal level of Brd4 at Grial regulatory elements in the promoter region and the small BDNF- induced increase in Brd4 binding is not seen with Jql (Fig. 18g). In addition, we observed a non-significant increase in histone acetyl marks at the Grial promoter following BD F treatment (Fig. 18h). These data provide support for RNA-sequencing data showing that Jql affects synaptic proteins and demonstrate that Brd4 affects the expression of a critical subunit of a major excitatory receptor in neurons.

[0082] Jql treatment affects memory formation

[0083] Based on the importance of Brd4 in controlling critical neuronal proteins, we examined whether Jql affects brain function in WT adult mice. We injected adult male mice with Jql (50mg/kg) daily for one week or three weeks before performing behavioral tests. Jql has excellent blood brain permeability (Matzuk, M. M. et al. Cell 150, 673-684 (2012)). and similar to previous reports, we found that Jql is well tolerated in mice at this dose and schedule (Zuber, J. et al. Nature 478, 524-528 (2011); Filippakopoulos, P. et al. Nature 468, 1067-1073 (2010); Schael, S. et al. J. Biol. Chem. 288, 9303-9312 (2013); Delmore, J. E. et al. Cell 146, 904-917 (2011)) (Fig. 19a). In an open field test Jql did not affect distance travelled or zone preference indicating Jql does not cause problems with mobility or anxiety (Fig. 7a, Fig. 19b-d).

[0084] We next used a novel object-recognition task (Fig. 7b) in which mice were briefly exposed to 2 identical objects and later presented with one familiar and one novel object. If mice remember the previous objects they will subsequently spend more time with a novel object (Antunes, M. & Biala, G. Cogn. Process. 13, 93-110 (2012)). All groups behaved similarly during habituation and the initial exposure although mice receiving Jql for 3 weeks explored less during testing (Fig. 19e-g). Strikingly, while control mice preferred the novel object as expected, Jql-treated mice showed no preference (Fig. 7c). However, when mice were tested immediately after the initial exposure, control and Jql treated mice performed equally well (Fig. 19h-j) suggesting that Jql does not disrupt learning or short- term memory but instead affects long-term memory. To control for possible health issues resulting from long-term treatments, we injected mice with a single dose of Jql or DMSO either 6 hours before or within 30 minutes after their initial exposure to objects and tested the following day. We found a complete loss of preference in mice that received a single dose after training compared to control mice (Fig. 7d). This suggests that Jql given during the process of memory consolidation can block long-term memory formation. The smaller effect observed after a dose given before training may be due to a smaller amount of Jql remaining in the brain during the consolidation process several hours later.

[0085] We also tested a fear-conditioning paradigm of 3 tones paired with shocks to determine the extent of the memory deficits (Fig. 7e). All mice learned both cued

conditioning and the context-dependent conditioning (Fig. 19k, 1) demonstrating that Jql did not affect this simple behavior dependent on the amygdala. However, mice given Jql for 3 weeks froze more in a new context suggesting they were less able to distinguish between the training context and a new context. This indicates that the more difficult hippocampal- dependent test of context discrimination may also require BET protein function (Fig. 7f). Without intending to be constrained by any particular theory, it is considered that together, these data provide in vivo support of the cell-based data of this disclosure demonstrating that Jql disrupts the transcriptional responses that are critical to neuronal function.

[0086] Jql treatment decreases seizure susceptibility

[0087] To confirm that Jql has similar effects on neurons in vivo as it does in vitro we examined tissue from mice after behavioral testing. Despite the heterogeneity of cortical tissue we found either trends or significant decreases in IEGs, Grial and GluAl protein (Fig. 20a, b). Long-term decreases in Grial and other synaptic proteins (Fig 3c) may dampen of synaptic strength which also has implications for other aspects of mouse behavior. We hypothesized that if Jql effectively decreases neuronal firing though regulation of synaptic proteins, then Jql treatment might decrease seizure susceptibility because seizures result from excess synaptic excitability. We injected adult male mice with Jql or DMSO for one week and then induced seizures with pentylenetetrazol (PTZ) (50mg/kg) (Fig. 8a), which inhibits GABA-A receptors resulting in increased excitatory activity. Jql treated mice showed decreased seizure susceptibility, as measured by a modified Racine scale which measures both severity of seizure and latency to onset of each seizure stage (Naydenov, A. V. et al. Neuron 83, 361-371 (2014); Ferraro, T. N. et al., J. Neurosci. Off. J. Soc. Neurosci. 19, 6733-6739 (1999)). In addition, while approximately 30% of control mice died after seizure induction, all Jql treated mice survived and recovered faster as measured by a return to normal movement ( Fig. 8c, d, Fig. 20c, d). Similar but more variable effects were observed in female mice (Fig. 20e, f).

[0088] We also tested the kindling method of seizure induction in which DMSO or Jql was given within an hour before mice receive a sub-threshold doses of PTZ (Dhir, A. Curr. Protoc. Neurosci. Editor. Board Jacqueline N Crawley Al Chapter 9, Unit9.37 (2012); Bialer, M. & White, H. S., Nat. Rev. Drug Discov. 9, 68-82 (2010)). This is repeated every two days for two weeks and experimental mice as well as an additional non-kindled group are tested again two weeks later (Fig. 8d). Mice typically show increased seizure induction over time as PTZ-induced increases in neuronal firing enhance the strength of neuronal connections intensifying the response to future doses ((Dhir, A., 2012). Mice are considered kindled if they show enhanced susceptibility that is maintained for several weeks. Jql had little effect during initial treatments, possibly because mice had only received a small number of doses of Jql . However, on day 30, only the DMSO-treated mice showed 'kindling' compared to the non-kindled group (Fig. 8e-f, Fig. 20g, h) These data indicate that Jql treatment has similar effects on neuronal function in vivo as we observed in vitro and raise the intriguing possibility of using BET inhibitors for treatment of epilepsy.

[0089] Materials and Methods

[0090] Cell culture

[0091] Neurons were isolated from E16.5 cortices of C57BL/6 mice (Charles River), dissociated in Optimem media with 20mM glucose and plated at 600,000 cells per mL on coverslips or plates coated with poly-D-lysine. One hour later Optimem media was replaced with Neurobasal media supplemented with Pen/Strep, Glutamax and B27 supplement. 3 days after plating, AraC was added to the media to prevent glial cell growth. Neurons were typically used at 12 days in vitro. Glial cells were isolated from PI cortices, dissociated and grown in DMEM media with 10% fetal bovine serum and Pen/Strep. Media was changed every 3 days and cells were passaged to ensure that no neurons remained in the culture.

[0092] Transfections were performed using lipofectamine 2000 (Life Technologies). Neurons were put in a ImM kynurenic acid solution during transfection to prevent excitotoxicity. Lipofectamine and DNA complexes were left on neurons for 15 minutes. Transfections were performed at 10 DIV for constructs expressing Brd4 and cells were fixed one to two days later. siRNA transfections were performed at 7 DIV and cells were stimulated and fixed 5 to 7 days later. Brd and CK2 siRNAs were from Dharmacon (LG- 041493-00-0002 for Brd4 and L-058653-00-0005 for CK2). Target sequences of Brd4 siRNAs are ACAATCAAGTCTAAACTAG (SEQ ID NO:29),

TTACTGGAATGCTCAGGAA (SEQ ID NO: 30), GAGGATAAGTGTAAGCCCA (SEQ ID NO:31), and GTACAGAGATGCCCAGGAA (SEQ ID NO:32). Target sequences of CK2 siRNAs are CCGAAGAGCCCTTTAAATA (SEQ ID NO:33),

GGTCAGGGTTTACAGAGTA (SEQ ID NO:34), CTGAACGAATCATGTCTTA (SEQ ID NO:35), and TCACCTGGCATCATAGATA (SEQ ID NO:36). For infections, control or Brd4 lentivirus was added to neurons on day 10 and neurons were stimulated and lysed 3 days later. Brd4 lentivirus contained a pool of 4 siRNAs from Applied Biological Materials (ABM) uses a dual convergent promoter system to express sense and antisense siRNA from different promoters. Target sequences of siRNAs are GGGTGAACTCACGTCAGAA (SEQ ID NO:37) for control virus (ABM LVP015-G) and

GTGGATGCCGTCAAGCTGAACCTCCCTGA (SEQ ID NO: 38),

GGACTTCAAGCACTATGTTTACAAATTGTT (SEQ ID NO: 39),

GGAGATGACATCGTCTTAATGGCAGAAGC (SEQ ID NO:40), and

CCCAGGAATTTGGTGCTGATGTCCGATTG (SEQ ID NO:41) for Brd4 (ABM

iV038675). The constitutively expressed Brd4 was from K. Ozato. Stratagene site directed mutagenesis kit was used for creating mutations and deletions. TBB (Tocris 2275) was used at 50μΜ, BDNF (PeproTech 450-02) was used at 50ng/mL. Tetrodotoxin (Abeam ab 120055) was used at . Jql was used at 250 nM.

[0093] N2A cells were grown in DMEM with 10% serum and tested for mycoplasma infection regularly. N2A transfections were performed in DMEM using lipofectamine 2000 (Life Technologies). Lipfectamine and DNA complexes were left on cells overnight. Cells were harvested for analysis 5 days after transfection. [0094] Western blotting

[0095] Cells were lysed in RIPA buffer and lysates were separated by SDS-PAGE and transferred to PVDF paper. Antibodies used were Brd4 (Bethyl A301-985A, 1 : 1000), NeuN (Millipore MAB377, 1 :500), GFAP (Abeam abl0062, 1 : 1000), Gapdh (Abeam ab8245, 1 :500), MAPK (Cell Signaling 4695P, 1 :3000), phosMAPK (Cell Signaling 4370, 1 :3000), H3 (Abeam abl791, 1 :4000), H4 (Abeam abl0158, 1 :4000), H3K14ac (Active motif 39697, 1 :500), H4K16ac (Active motif 39167, 1 :500). Phospho-Brd4 was developed with Millipore. The best bleeds were affinity purified against the phosphorylated target peptide and immuno-depleted against unmodified Brd4. Blots were imaged on an LAS3000 system (FujiFilm).

[0096] Reverse transcription, Quantitative PCR, and ChIP

[0097] RNA was purified using the QIAGEN RNAeasy kit and reverse transcribed using the applied biosystems kit. qPCR was performed with Power SYR green PCR master mix (applied biosystems) on an applied biosystems quantitative PCR system run using StepOne software. ChIP was done as previously described¹. Chromatin shearing was performed with a Bioruptor300 (diagenode) at 4 °C, for 55 cycles of 30 seconds on and off. Immunoprecipitation was performed using 5 μg of antibody bound to 50 μΙ_, of magnetic Dynabeads M280 (life sciences). DNA was purified using the QIAGEN Qiaquick PCR purification kit. Antibodies used were Brd4 (Bethyl A301-985A, 5μg/chip), Brd2 (Bethyl A302-583A, 5μg/chip), Brd3 (Bethyl A302-368A, 5μg/chip), H3K9ac (Millipore 07-352, 5μg/chip), H3K14ac (Active motif 39697, 5μg/chip), H4K12ac (Upstate 05-119, 5μg/chip), H4K16ac (Active motif 39167, 5μg/chip), CBP (Santa Cruz 7300, 5μg/chip).

[0098] Primers used for qPCR were:

Gapdh forward: AACTCCCTCAAGATTGTCAGCAA (SEQ ID NO: l)

Gapdh reverse: GGCATGGACTGTGGTCATGA (SEQ ID NO:2)

Arc forward: TAACCTGGTGTCCCTCCTAGATC (SEQ ID NO:3)

Arc reverse: GGAAAGACTTCTCAGCAGCTTGA (SEQ ID NO:4)

cFos forward: ACAGCCTTTCCTACTACCATTCCC (SEQ ID NO:5)

cFos reverse: CTGCACAAAGCCAAACTCACCTGT (SEQ ID NO:6)

Nr4Al forward: ACCAACTCTTCTGGCTTCCCTTAC (SEQ ID NO:7)

Nr4Al reverse: GGCTGGTTGCTGGTGTTCCATATT (SEQ ID NO:8)

GluAl forward: TCCTGAAGAACTCCTTAGTG (SEQ ID NO:9)

GluAl reverse: ATCATGTCCTCATACACAGC (SEQ ID NO: 10) GluA2 forward: AACGGCGTGTAATCCTTGAC (SEQ ID NO: 11)

GluA2 reverse: CTCCTGCATTTCCTCTCCTG (SEQ ID NO: 12)

Brd4 forward: AAATCAGCTCACCAGGCTGT (SEQ ID NO: 13)

Brd4 reverse: TCTTGGGCTTGTTAGGGTTG (SEQ ID NO: 14)

Brd2 forward: ACAAGGTAGTGATGAAGGCTCTGTGGAA (SEQ ID NO: 15)

Brd2 reverse: CTTGTGGCATTGATGCAACCTTCTGTAGG (SEQ ID NO: 16)

Brd3 forward: GGACATCCTCTGGCAGCTTA (SEQ ID NO: 17)

Brd3 reverse: CCATCTTCCGAAGGGGACT (SEQ ID NO: 18)

Bdnf forward: TGTCTCTGCTTCCTTCCCACAGTT (SEQ ID NO: 19)

Bdnf reverse: TGGACGTTTGCTTCTTTCATGGGC (SEQ ID NO:20)

Primers used for ChIP were:

Arc forward: ATAAATAGCCGCTGGTGGCG (SEQ ID NO:21)

Arc reverse: CGGCTCCGAACAGGCTAAG (SEQ ID NO:22)

cFos forward: CGGGTTTCAACGCCGACTA (SEQ ID NO:23)

cFos reverse: TTGGCACTAGAGACGGACAGA (SEQ ID NO:24)

Nr4Al forward: TGGAATGTCTGCGCGCGTG (SEQ ID NO:25)

Nr4Al reverse: TATAGATCAAACAATCCGCG (SEQ ID NO:26)

GluAl forward: ATCTGGCTGTCAGTCGGTGT (SEQ ID NO:27)

GluAl forward: AAAGAAGCCCTGGTCCAAC (SEQ ID NO:28)

[0099] RNA-sequencing sample preparation and analysis

[0100] RNA was collected and prepared using a Qiagen RNAeasy kit and the TruSeq

RNA Sample Preparation Kit v2 (Illumina). Sequencing was performed with an Illumina HiSeq2500 system. Reads were aligned to the mouse mm9 reference genome using Tophat 2.0.11². Reads with two or fewer mismatches with a maximum of 20 hits for each read were used. Transcript levels were analyzed with Cufflinks 2.2.1³. Expressed genes were defined as those with an fpkm of 1 or above. BDNF-induced genes were defined as those with a significant increase in expression with 10 minutes BDNF treatment using a p value with a Bonforroni correction. David ontology cluster analysis was to determine gene groups enriched in Jql up and down-regulated groups of genes of fpkm of 1 or above. The RNA- sequencing dataset is available at: www.ncbi.nlm. nih.gov/geo/query/acc.cgi?acc=GSE63809.

[0101] Immunohystochemistry [0102] Adult mice were perfused with 4% paraformaldehyde and brains were removed and kept in paraformaldehyde overnight. Tissue was then washed in PBS and processed for paraffin embedding at the Molecular Cytology Core Facility of Memorial Sloan Kettering Cancer Center using Leica ASP6025 tissue processor. Brains were embedded in paraffin, and paraffin sagittal sections of 5 microns were cut on a Leica RM2155 microtome and collected on superfrost plus slides (Fisher scientific). Slides were baked for 1 hour at 60°C before de-paraffinization and staining.

[0103] Staining was performed at the Molecular Cytology Core Facility of Memorial

Sloan Kettering Cancer Center using a Discovery XT processor (Ventana Medical Systems). For GFAP and Brd4 co-staining, slices were first stained for Brd4 (Bethyl A301-985A,

2μg/mL). The tissue sections were blocked for 30 minutes in 10% normal goat serum and 2% BS A in PBS. The incubation with the primary antibody was done for 5 hours, followed by 60 minutes incubation with biotinylated goat anti -rabbit IgG (Vector labs PK6101, 1 :200).

Detection was performed with Streptavidin-URP D (Ventana Medical Systems) followed by incubation with Tyramide-Alexa Fluor (Invirogen T20948, 1 :200). For GFAP, sections were blocked for 30 minutes in 10% normal goat serum and 2% BS A in PBS. Rabbit polyclonal GFAP (Dako Z0334, 1 μg/ml) was incubated for 5 hours at RT, followed by 32 minutes incubation with biotinylated goat anti-rabbit IgG (Vector labs PK6101, 1 :200, 6.5 μg/mL). Detection was performed with Blocker D, Streptavidin-URP and DAB detection. For NeuN, slices were first stained for NeuN and then stained for Brd4 as described above. For NeuN staining, sections were blocked first for 30 min in Mouse IgG Blocking reagent (Vector Labs, MKB-2213) in PBS. Mouse monoclonal NeuN staining (Millipore, MAB377, at 1 μg/mL) was incubated for 3 hours at RT and followed by 60 minutes incubation of biotinylated mouse Secondary (Vector Labs, MOM Kit BMK-2202, 1 :200 dilution, 5.75μg/mL). The detection was performed with Secondary Antibody Blocker, Blocker D, Streptavidin-URP D (Ventana Medical Systems) and DAB Detection Kit (Ventana Medical Systems) according to manufacturer instructions.

[0104] Immunocytochemistry

[0105] Cells were fixed in 4% paraformaldehyde for 10 minutes, washed with PBS and permeabilized in 0.1% triton in PBS for 10 minutes. Cells were then blocked for 1 hour in 2% serum, 3% BSA and 0.1% triton in PBS and then primary antibody was added in the same solution overnight at 4°C. Cells were washed in PBS for 3 10 minute washes and put in secondary antibody for 1 hour at room temperature. After an additional 3 washes, coverslips were mounted with prolong gold antifade solution (Invitrogen). For surface staining assays, GluAl antibody was added for 30 minutes to the media live cells at 37°C before fixation. Cells were then blocked without triton and secondary antibody was added immediately following the blocking step. Antibodies used were Brd4 (BethylA301-985A, 1 : 1000), Arc (Santa Cruz 365736, 1 : 100), GluAl (Millipore 2263, 1 :300), CK2 (Peirce/Thermo PA5-

28686, 1 : 100), H4K16ac (Abeam 109463, 1 :500) and secondary antibodies were AlexaFlour 647 Donkey anti-mouse (Jackson 715-605-150, 1 :500) and Rhodamine Red-X goat anti- rabbit (Invitrogen R6394, 1 :500).

[0106] Microscopy equipment and settings

[0107] Slides were imaged at room temperature on an inverted Lieca DMI 6000, TCS

SP8 laser scanning confocal microscope with a 405 nm laser and a fully tunable white light laser (470-670 nm) with an acousto-optical beam splitter. The microscope uses 3 gated HyD detectors and one PMT detector and both a conventional scanner and a resonant scanner. Objectives used were a 63x HC PL APO CS2 oil objective with a NA of 1.40 and for whole brain images a lOx HCX PL APO DS dry objective with a NA of 0.4. Type F immersion liquid (Leica) was used for oil objectives. For brain images, the Lieca super-z stage and rapid tiling system was used to compile images. For glual surface staining, z-stacks spaced at 0.5 microns were used to image the entire dendrite. For 63x images, images were 184.52 by 184.52 microns, 1052 by 1052 pixels, (5.701 pixels per micron), and 8-bits per pixel. For lOx images, images were 1162.5 by 1162.5 microns, 1052 by 1052 pixels, (0.881 pixels per micron), and 8-bits per pixel.

[0108] Image J was used to crop images and merge channels into composite RGB images. Photoshop was used to adjust individual channels. In all cases, identical adjustments were applied across all images used in an experiment for each channel. No deconvolution software was used. All image analysis as performed in ImageJ. For Arc staining

quantification, a region of interest was selected in the cell body, outside the nucleus, and the average intensity was measured. Regions were selected using dapi and gfp channels and then applied to the Arc channel such that the analysis was performed blind to the Arc staining. For Brd4 staining quantification, the same process was used but inside the nucleus. For surface GluAl quantification, the z-stacks were summed using ImageJ to create one image per channel. GFP images were converted to binary and used to create a mask surrounding the transfected dendrite. The mask was then applied to the GluAl image and the average intensity within the dendrite was measured. This was automated using ImageJ macros to prevent user bias. For all image analysis, an average background intensity value was subtracted from each intensity value. To allow for comparisons across experiments, the average control cell value was set to 100 and all conditions were normalized to this value.

[0109] Behavior

[0110] All experiments were approved by the Institutional Animal Care and Use Committee of the Rockefeller University. C57B/6 male mice (Jackson) were housed up to 5 mice per cage in a 12 hour light-dark cycle. JQl (APExBIO) was administered to 2-3 months old mice via intraperitoneal injections. Each mouse was injected daily for 1 week or 3 weeks before testing began with either JQl at 50mgs/kg dissolved in DMSO or DMSO alone, diluted into cyclo-dextrin (Sigma). Mice were randomly assigned to groups and groups were then checked to ensure that the average weight per mouse of each group was equivalent at the beginning of the experiment. Injections continued during the week of behavioral testing and testing was performed during the light cycle. Open field testing was performed first and activity was measured for 1 hour. Fusion 3.2 was used to track mice and analyze movement. One day after open field testing, mice were habituated to the novel object recognition box for 10 minutes. One day later mice were habituated for an additional 2 minutes and then 2 identical objects (either a faucet or a lego pyramid) were placed in the box and mice were given 10 minutes to explore. On the following day, mice were returned to the box with one object they had previously seen and one new object in place of the original object and allowed to explore for 10 minutes. All sessions were recorded using ethovision software. Time spent interacting with each object was manually analyzed. Discrimination index was calculated as (% time with novel object - % time with familiar object)/(% time with novel object + % time with familiar object). Fear conditioning tests began 1 day after novel object recognition. Mice were placed in a small box and allowed to explore for 2 minutes. A tone was played for 20 seconds followed by a 0.7 mAmp shock. This was repeated once per minute for 3 shocks total. After an additional 2 minutes, mice were removed from the box. One day later mice were returned to the same box for 7 minutes to measure context dependent freezing. Then the flooring, wall covering, and smell of the box was changed and mice were returned to the box. The tone was then played in the same patter as the original training session without a subsequent shock to measure cued learning. Fear conditioning sessions were run and recorded using FreezeFrame 3 software and scored manually in random order. All experiments were carried out and analyzed with the experimenter blind to the treatment group. One mouse was excluded from analysis because the lights went off in the facility during the discrimination test so the data could not be analyzed. [0111] For novel object 'learning' testing, mice were habituated to the novel object recognition box for 10 minutes. One day later mice were given 10 minutes to interact with 2 identical objects. Mice were then removed and one object was replaced with a novel object and mice were returned to the box and again allowed to explore for 10 minutes. For single dose tests, one cohort received a dose of DMSO in the morning approximately 6 hours before testing and a second dose of DMSO within 30 minutes of exposure to objects. One cohort received Jql in the morning and DMOS after testing and the final cohort received DMSO in the morning and Jql following testing. Mice were tested for novel object preference one day after the first exposure to objects. All sessions were recorded using ethovision software. Time spent interacting with each object was manually analyzed. All experiments were carried out and analyzed with the experimenter blind to the treatment group and which object was considered novel.

[0112] Seizure testing

[0113] JQ1 (APExBIO) was administered to 3 to 4 month old C57B/6 male or female mice (Jackson) via intraperitoneal injections. For acute seizure testing, each mouse was injected daily for 1 week before testing began with either JQ1 at 50mgs/kg dissolved in DMSO or DMSO alone, diluted into cyclo-dextrin (Sigma). Pentylenetetrazol (PTZ) (Sigma) dissolved in PBS was injected at 50mgs/kg via intraperitoneal injections. For kindling seizure testing, Jql was administered 1 hour before PTZ injection. Mice were observed up to one hour after injection or until recovery from seizure (defined by a return to normal movement). The modified Racine scale⁴ used to measure seizure induction was as follows:

[0114] Stage 1 : Hypoactivity culminating in behavioral arrest with contact between abdomen and the cage.

[0115] Stage 2: Partial clonus (PC) involving the face head or forelimbs.

[0116] Stage 3 : generalized clonus (GC) including all four limbs and tail, rearing or falling.

[0117] Stage 4: Generalized Tonic-Clonic seizure (GTC)

[0118] Seizure susceptibility score was calculated as: (0.2)(1/PC latency) +

(0.3)(1/GC latency) + (0.5)(1/TC latency).

[0119] Statistics

[0120] An alpha level of 0.05 was used for all statistical analyses. 2-sided t-tests were performed in excel. A bonforonni correction was applied when comparing multiple groups. No statistical methods were used to predetermine sample sizes but our sample sizes are similar to those reported in previous publications. Data distribution was assumed to be normal but this was not formally tested. For fear conditioning, 2-way ANOVA was performed in R with post-hoc Bonforroni corrections for individual comparisons. For novel object testing, context discrimination was calculated by time spent with objects: (novel- familiar)/(novel+familiar). Univariate analysis was used for each individual group to compare to a context discrimination of zero. Degrees of freedom were calculated as the biological replicates minus one. For all other behavioral testing, t-tests with a bonforroni correction were used to compare between multiple groups.

[0121] It will be recognized from the foregoing that the results presented in this disclosure demonstrate that Brd4 is expressed throughout the brain and plays a critical role in activity-dependent transcription. Neuronal activity acts through CK2 to increase Brd4 association with chromatin. Brd4 then promotes transcription of critical IEGs and synaptic proteins (Fig. 21). We found that Jql inhibition of Brd4 and its family members blocked novel object preference, indicating impairments in memory consolidation. In addition, consistent with its effects on synaptic proteins, Jql treatment also decreased seizures susceptibility in mice. This is the first demonstration that Brd4 has an important function in neurons and that BET protein inhibition affects memory consolidation.

[0122] Implications for the clinical use of BET inhibitors

[0123] Our data demonstrate that Brd4 is necessary for rapid activation of genes. As is known in the art, the first few minutes following a burst of neuronal activity are of critical importance for a cell to activate the appropriate transcription response^3"6. Loss of this rapid response may represent the mechanism through which Brd4 inhibition prevents long-term memory formation after.

[0124] BET protein inhibitors have been proposed as a treatment for several types of cancer and are currently in clinical trials. Initial mouse studies reported that Jql was well tolerated, and we did not find obvious deficits in the health or mobility of mice. However, the current disclosure provides new evidence that use of such inhibitors causes memory deficits in mice and thus may also cause neurological problems in patients receiving these drugs. The current results suggest that compounds that do not cross the blood brain barrier may pose less risk of neurological side effects for patients.

[0125] The role of CK2 in neurons

[0126] Casein Kinase 2 has several established functions in neurons in addition to regulating Brd4. CK2 phosphorylates GluAl and GluA2 subunits of the AMPA receptor to promote its expression and regulates composition of the NMDA receptor. These synaptic actions of CK2 promote synaptic strength as does the role we propose for CK2 in regulating Brd4. This dual function would allow CK2 to act immediately on the synapse by directly phosphorylating synaptic proteins while also acting through Brd4 to promote expression of these same genes in order to consolidate synaptic changes. The effects of the CK2 inhibitor TBB have also been tested in vivo in an epilepsy model (Brehme, H., et al.,. Epilepsia 55, 175-183 (2014)). TBB treatment blocked recurrent epileptiform discharges in hippocampal slice preparations after magnesium removal. We demonstrated the Jql results in decreased seizure susceptibility (Fig. 7) suggesting that some of CK2's effects on epileptiform discharges may be the result of its action on Brd4 as well as its effects on the synapse.

[0127] BET inhibitors as epilepsy drugs

[0128] We found that Jql decreased the seizure susceptibility, potentially by decreasing levels of the GluAl subunit of AMPARs which have been linked to epilepsy (Rogawski, M. A. Acta Neurol. Scand. Suppl. 9-18 (2013). doi: 10.1111/ane. l2099; Zhang, J. & Abdullah, J. M. Rev. Neurosci. 24, 499-505 (2013); Kato, A. S., Gill, M. B., Yu, H., Nisenbaum, E. S. & Bredt, D. S., Trends Neurosci. 33, 241-248 (2010); Yamaguchi, S., et al.. Epilepsy Res. 15, 179-184 (1993); Namba, T., et al. Brain Res. 638, 36-44 (1994); Hara, H. et al., Eur. J. Pharmacol. 531, 59-65 (2006); Kodama, M. et al. Eur. J. Pharmacol. 374, 11-19 (1999); Mattes, H., et al. J. Med. Chem. 53, 5367-5382 (2010)). Decreased levels of other gene targets that regulate synaptic function may also contribute to the seizure effect though mechanisms such as phosphorylation of GluAl (Rakhade, S. N. et al. J. Neurosci. Off. J. Soc. Neurosci. 32, 17800-17812 (2012)). Although the dose we tested resulted in memory deficits, it is possible that in an overactive epileptic brain Jql would restore normal levels of synaptic proteins. Most epilepsy treatments directly target synaptic proteins and receptors. Jql treatment represents a novel approach by targeting a protein responsible for the transcriptional regulation of these synaptic receptors instead of modifying proteins already present at the synapse. While many cases of epilepsy respond to available treatments, a significant portion of patients are refractory to current drugs. It is possible that this novel approach of targeting transcriptional regulators of synaptic proteins rather than targeting synaptic proteins directly may provide a more robust method of dampening the heightened synaptic activity leading to seizures and could provide new avenues of treatments for these patients.

[0129] BET inhibitors as FXS and ASD therapeutics

[0130] With respect to ASD, the underlying mechanisms are poorly understood.

Recent advances in sequencing technology helped to uncover a large number of genetic mutations linked to autism. However this extensive and very heterogeneous group of genes has made it difficult to develop a unifying hypothesis of the molecular processes leading to ASD, and to select any particular gene or group of genes for further analysis as potential targets for ASD intervention. Similarly, the autism-related disorder FXS is caused by disruption of the FMRP protein, and is believed to be the leading single gene cause of autism. FMRP regulates numerous mRNA transcripts and typically inhibits their translation into protein. While a large number of FMRP targets are known, this extensive list represents a very large number of transcripts with diverse functions, without guidance as to which target pathways should be tested in order to develop potential treatments for the disorder. In order to narrow potential candidates, a novel approach was used of examining ASD-linked genes that overlap with FRMP bound transcripts in order to identify the subset of genes that appear to be most important to neuronal development and most likely to result in these

developmental disorders (see, Fig. 9). Within the overlapping genes and transcripts, a set of 66 chromatin-modifying enzymes and transcriptional regulators were unexpectedly linked to both disorders. We then explored targets within the set of overlapping proteins in an effort to better understanding the links between ASD and FXS, with an object being to develop potential therapeutic interventions. One of these targets is Brd4 which, as demonstrated in this disclosure, is critical to neuronal function and regulation of transcription in response to extracellular signals in the brain.

[0131] We examined whether Brd4 is overexpressed in a mouse model of these disorders. We used the Fmrl knockout (KO) mouse model which displays phenotypes similar to human patients with FXS such as intellectual disability. Because FXS is the leading single gene cause of ASD, it also can be used as a model of autism in mice and shows deficits in behaviors that are also disrupted in ASD patients such as social interaction phenotypes and repetitive behaviors. We cultured neurons from wild type (WT) and knockout neurons and examined Brd4 levels as neurons mature. We found that while WT neurons showed a rapid decrease in Brd4 during development (Fig. lOa-b) only a small decrease was seen in Brd4 transcript during this same period of development (Fig. 10c) suggesting the decrease in Brd4 protein may be due to regulation of the Brd4 transcript or protein rather then transcriptional regulation. The FMRP protein regulations translation of transcripts into proteins and, as described above, Brd4 was found to be a possible target transcript of the FMRP protein suggesting that the decrease observed in Brd4 protein levels may be due to regulation of Brd4 translation by FMRP. Fitting with this, we found that FMRP protein peaks during the same period of development that Brd4 decreases (Fig. lOd). To confirm that the decrease in Brd4 protein is due to FMRP we examined Brd4 levels in Fmrl knockout neurons. We found that the decrease we observed in WT cells was delayed and less drastic in KO neurons resulting in greater Brd4 levels during this critical periods of neuronal development (Fig. lOe-f). We again only observed a small decrease in Brd4 transcript levels as expected if Brd4 is primarily regulated at the translational level (Fig. lOg). We next confirmed the difference in vivo, by examining cortical tissue from WT and KO mice during early development and again found a more drastic decrease in Brd4 in WT brains then in KO brains (Fig lOh-i).

[0132] If Brd4 is upregulated in FXS mice and this contributes to the deficits observed in the disorder, then blocking Brd4 function may reverse the neuronal deficits observed in FXS neurons. To test this we examined the well-characterized phenotype seen in neurons from FXS patients and mice of increased synapse formation. We found greater numbers of synapses in KO mice. We then examined the effect of Jql on neurons from these mice and found that it results in the complete reversal in this increased synapse formation observed in FXS (Fig. 11). This suggests that by blocking Brd4 function during neuronal development when it is overexpressed in KO mice, synapses formation can return to normal levels.

[0133] We next examined whether the changes observed at the neuronal level in response to Jql also affect the behavioral deficits associated with the disorder. While we have previously shown that Jql can result in deficits in a healthy brain, it is possible that in a brain with too much Brd4, Jql will restore normal function. To test this, we examined behaviors that are typically disrupted in human patients with FXS or ASD and also seen in the FXS mice such as social interaction, repetitive behaviors, and memory formation. Jql or a control vehicle was given for 1 week before testing at 3 weeks of age. Social interaction was measured by examining the mouse preference for another mouse compared to an object. KO mice typically show atypical interactions as measured by a discrimination index in time spent with the object (a Lego) or mouse. KO mice also show repetitive behaviors which we measured by the number of marbles mice buried in a 15 minute interval. While WT mice typically burry a few marbles, KO mice continue this behavior for longer resulting in a greater number of marbles buried. We also measured the ability of mice to learn using a novel object learning test in which mice are exposed to objects on one day and tested the following day to see if they remembered the objects they previously saw. All of these behaviors were disrupted in the KO mice. However, in all cases, these behaviors were returned to WT levels after Jql treatment (Figure 12). In some cases, Jql also disrupted the behaviors in WT which fits with the observation that Brd4 must be at the correct level in neurons for normal neuronal function to occur and loss of Brd4 function in WT mice results in memory deficits. However, in the KO mice in which Brd4 is overexpressed, Jql was able to return behavior to normal levels. We believe this data indicates Jql may be highly effective in treating patients with autism and FXS.

EXAMPLE 2

[0134] This Example demonstrates that the BET inhibitor CP1203 has the same effect on neuronal target genes as Jql, demonstrating that the effects are not limited to a specific BET inhibitor.

[0135] To obtain the data presented in Figure 23, neurons were treated for 24 hours with either Jql or the negative enantiomer, (-) Jql and then transcript expression of target genes Grial, Arc, and Fos were measured by RT-PCR. These target genes are indicative of the level of neuronal activity and thus are likely to be overabundant in epilepsy and Fragile X. Jql decreased expression of all three neuronal genes. Similarly, another BET inhibitor CP 1203 but not the inactive enantiomer also decreased these target genes to the same degree as Jql . This demonstrates that these effects are not specific to Jql but are reproducible with other BET inhibitors. All drugs were used at 0.25uM. *p < 0.05, unpaired t test. ***p < 0.001, unpaired t test.

EXAMPLE 3

[0136] This Example demonstrates that Jql but not other broad-acting transcriptional inhibitors reverses the gene expression changes that occur in FXS neurons. To determine if inhibition of Brd4 is a viable means of alleviating epigenetic misregulation in FXS, we first used qRT-PCR to examine the effects of Jql in Fmrl KO neurons. Jql treatment decreased the expression of Brd4 target genes in Fmrl KO neurons returning them to wildtype levels (Figures 24A-D).

[0137] In addition, we used RNA-sequencing to determine the extent to which Jql restored normal levels of transcription at the genome-wide level. We compared the total overlap of all KO-upregulated genes with Jql-downregulated genes and vice versa. We found that for both of these comparisons, there was a significantly greater overlap then would be expected for a random subset of genes (Figure 5E) indicating that BET inhibition targets genes that are misregulated in Fmrl KO neurons and restores a portion of them to normal levels of expression.

[0138] Next, we examined whether these effects were specific to Jql, or if similar effects could be achieved with any drug that decreases transcription. To answer this question, we turned to THZl, an inhibitor of CDK7 (Kwiatkowski et al., (2014) Targeting transcription regulation in cancer with a covalent CDK7 inhibitor. Nature 511, 616-620), which, like Brd4, is involved in transcription initiation. qRT-PCR analysis revealed that Shank2, Nr4al and other genes showed highly variable responses to THZl with few returning to wildtype levels (Figures 24F-I). Similarly, using RNA-sequencing, we found that unlike Jql, THZ1- upregulated genes did not show a significant overlap with KO-downregulated genes and THZl-downregulated genes had a more modest overlap with KO-upregulated genes then Jql did (Figure 24L). This indicates that while THZ decreases expression of some genes, this effect is not as specific to the KO-upregulated genes as that seen with Jql . Overall this demonstrates that Jql is more successful in returning transcriptional changes occurring in KO neurons to wildtype levels then a broad-acting inhibitor of transcription. While the expression of some genes returned to WT levels, many drastically increased in expression or remained at KO levels. Together, these data indicate that Jql restores a notable subset of KO- misregulated genes to normal levels, particularly those involved in synaptic function and receptor regulation while another transcriptional inhibitor that acts at the same step as Jql but does not specifically inhibit an FMRP target protein is not as effective.

[0139] While the disclosure has been particularly shown and described with reference to specific embodiments (some of which are preferred embodiments), it should be understood by those having skill in the art that various changes in form and detail may be made therein without departing from the spirit and scope of the present disclosure as disclosed herein.

Claims

What is claimed is:

1. A method for therapy for a disorder correlated with Brd4 function in brain neurons comprising administering to the individual a therapeutically effective amount of a Bromodomain and Extra-Terminal motif (BET) inhibitor.

2. The method of claim 1, wherein the disorder is selected from autism spectrum disorder (ASD), Fragile X Syndrome (FXS), and a seizure disorder.

3. The method of claim 2, wherein the individual has been diagnosed with or is suspected of having the ASD.

4. The method of claim 2, wherein the individual has been diagnosed with or is suspected of having the FXS.

5. The method of claim 2, wherein the individual has been diagnosed with or is suspected of having the seizure disorder.

6. The method of claim 5, wherein the seizure disorder is epilepsy.

7. The method of claim 6, wherein the epilepsy is drug resistant epilepsy.

8. The method of any one of claims 1-7 wherein the individual has not been diagnosed with cancer and has not been diagnosed with cardiovascular disease, and is not known to be at risk for developing the cardiovascular disease.

9. A method for selecting an individual for treatment with a Bromodomain and Extra-Terminal motif (BET) inhibitor comprising testing an individual to determine if the individual has a disorder correlated with Brd4 function in brain neurons and, if the individual is diagnosed with the disorder, designating the individual as a candidate for treatment with the BET inhibitor.

10. The method of claim 9, wherein the disorder is selected from autism spectrum disorder (ASD), Fragile X Syndrome (FXS), and a seizure disorder.

11. The method of claim 10, wherein the disorder is ASD.

12. The method of claim 10, wherein the disorder is FXS.

13. The method of claim 10, wherein the disorder is a seizure disorder.

14. The method of claim 13, wherein the seizure disorder is epilepsy.

15. The method of claim 14, wherein the epilepsy is drug resistant epilepsy.

16. The method of any one of claims 9-15 further comprising administering to the individual a therapeutically effective amount of the BET inhibitor subsequent to the designating the individual as a candidate for treatment with the BET inhibitor.

17. The method of claim 16, wherein the individual has not been diagnosed with cancer and has not been diagnosed with cardiovascular disease, and is not known to be at risk for developing the cardiovascular disease.

18. A method for therapy of a disorder selected from autism spectrum disorder (ASD), Fragile X Syndrome (FXS), and a seizure disorder, comprising administering to an individual who has been diagnosed with the disorder an effective amount of a Bromodomain and Extra-Terminal motif (BET) inhibitor, such that at least one symptom of the disorder is reduced subsequent to the administration.

19. The method of claim 18, wherein the individual has been diagnosed with the

ASD, wherein the individual diagnosed with the ASD exhibits a repetitive behavior as the symptom, and wherein the repetition of the repetitive behavior is reduced subsequent to the administration of the BET inhibitor.

20. The method of claim 18, wherein the symptom of the disorder comprises a cognitive impairment, and subsequent to the administration of the BET inhibitor the individual exhibits an improvement on a cognitive learning test.