WO2017026694A1 - Cd9 항체를 유효성분으로 함유하는 안질환 예방 또는 치료용 약학 조성물 - Google Patents
Cd9 항체를 유효성분으로 함유하는 안질환 예방 또는 치료용 약학 조성물 Download PDFInfo
- Publication number
- WO2017026694A1 WO2017026694A1 PCT/KR2016/007996 KR2016007996W WO2017026694A1 WO 2017026694 A1 WO2017026694 A1 WO 2017026694A1 KR 2016007996 W KR2016007996 W KR 2016007996W WO 2017026694 A1 WO2017026694 A1 WO 2017026694A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- pharmaceutical composition
- antibody
- preventing
- cells
- cell
- Prior art date
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
Definitions
- the present invention relates to a pharmaceutical composition for preventing or treating ocular diseases containing a CD9 antibody as an active ingredient, and to a pharmaceutical composition for preventing or treating elderly eye diseases for inhibiting cellular aging by using an antibody that specifically binds to CD9. will be.
- Replication aging is known to occur as cells divide and shorten telomeres, the ends of chromosomes. Cell aging may also be caused by oxidative stress, increased activity of cancer and cancer suppressor genes, and cytotoxic substances such as anticancer agents. It is known to be induced.
- Aging cells not only have morphological features that increase the size and flattening of cells, but also increase cell senescence-associated ⁇ -galactosidase (SA- ⁇ -gal) activity, p16 and p53, known as cancer suppressors. And molecular features such as increased expression of Rb.
- SA- ⁇ -gal cell senescence-associated ⁇ -galactosidase
- p16 and p53 known as cancer suppressors.
- molecular features such as increased expression of Rb.
- the expression of various genes related to inflammatory responses, DNA damage, cell growth, and cycle regulation in senescent cells is known to be altered, and related genes include cancer genes such as Raf and Ras and cancer suppressor genes such as p53 and p16.
- inflammatory factors such as interleukin-6, interleukin-1 ⁇ , interferon, IGFBP5 and cell cycle regulatory genes such as aurora kinase B and polo-like kinase 1 It is known.
- the cellular aging phenomenon contributes to individual and tissue aging, inhibits or promotes cancer and contributes to tissue repair and the pathogenesis of aging-related diseases.
- cellular aging contributes to the pathogenesis of various age-related diseases such as cancer, atherosclerosis, endovascular proliferation, hepatitis, diabetes, retrograde degeneration, skin aging, degenerative neuropathy, myopathy, osteoporosis and prostatic hyperplasia.
- age-related diseases such as cancer, atherosclerosis, endovascular proliferation, hepatitis, diabetes, retrograde degeneration, skin aging, degenerative neuropathy, myopathy, osteoporosis and prostatic hyperplasia.
- Recent studies have shown that selective control of cellular senescence can regulate the aging of tissues, organs, longevity, and age-related diseases.
- the CD9 antigen is a tetraspanin cell membrane glycoprotein with a molecular weight of 24 to 27 kDa. Cell attachment and migration, platelet activity and aggregation, fusion of eggs and sperm in the process of mammalian fertilization, cancer development and metastasis, humorality It is known as an antigen that plays an important role in immune and allergic reactions, human immunodeficiency virus-1 (HIV-1) and influenza virus replication.
- HAV-1 human immunodeficiency virus-1
- cell aging regulation of CD9 antigens or studies on aging regulation have only been reported to increase expression in aged human vascular endothelial cells, but no role of CD9 in cell aging regulation and aging-related eye diseases.
- An object of the present invention is to provide a pharmaceutical composition for preventing or treating eye diseases containing an antibody that specifically binds to CD9 that increases expression in aged cells as an active ingredient.
- the present invention provides a pharmaceutical composition for the prevention or treatment of eye diseases containing an antibody that specifically binds to CD9 as an active ingredient.
- an antibody that specifically binds to CD9 can reduce the expression of CD9 in senescent cells by binding to the extracellular region of the CD9 antigen exposed to the cell surface. Therefore, the composition containing the antibody specifically binding to CD9 as an active ingredient can be utilized as a pharmaceutical composition for preventing or treating senile eye disease.
- FIG. 2 shows Western blot results confirming cellular senescence induced by adriamycin by expression of CD9, p21, p53 and pRB.
- Figure 3 is a result confirmed by beta galactosidase activity staining that cell senescence induced by adriamycin is inhibited by CD9 siRNA.
- CD9 siRNA 4 is a Western blot result confirming the expression of CD9, p21, p53 and pRB that cell senescence induced by adriamycin is inhibited by CD9 siRNA.
- Figure 6 is a result confirmed by Western blot the effect of the CD9 human antibody (10E4) on the cell senescence induced by adriamycin.
- the present inventors confirmed that human retinal pigment epithelial cells (ARPE-19) promotes cellular senescence by adriamycin and increases CD9 expression in the process.
- CD9 small interfering RNA CD9 siRNA
- pretreatment of the CD9 human antibody (10E4) which blocks the function of CD9 it was confirmed that cell aging by adriamycin is suppressed.
- CD9 human antibody (10E4) has been suggested to be effective in senile eye disease by inhibiting cellular senescence of human retinal pigment epithelial cells and completed the present invention.
- prevention refers to any action that inhibits or delays the development of an eye disease by an antibody that specifically binds CD9.
- treatment refers to any action in which symptoms of eye disease improve or benefit altered by antibodies specifically binding to CD9.
- antibody refers to a specific protein molecule directed to the antigenic site.
- Antibodies of the invention can include both polyclonal antibodies, monoclonal antibodies, the preparation of the antibodies can be prepared using techniques well known in the art.
- human retinal pigment epithelial cell is a cell line derived from the human retina and is used as an important cell model for various senile eye diseases such as human retinal disease, particularly age-related macular degeneration.
- eye diseases such as cataracts and glaucoma are typical senile eye diseases in which the prevalence increases with age, and it has been found that cellular aging plays an important role in the occurrence of cataracts, glaucoma, and macular degeneration.
- pretreatment of CD9 human antibody (10E4) it was confirmed that cell aging by adriamycin is suppressed. Accordingly, CD9 human antibody (10E4) has been suggested to be effective in senile eye disease by inhibiting cellular senescence of human retinal pigment epithelial cells and completed the present invention.
- CD9 is a cell surface glycoprotein receptor of about 24 to 27 kDa belonging to the members of the tetraspanin family, a signal that plays an important role in regulating cell development, activity, growth and motility. It is known to regulate signal transduction events. It can also regulate cell adhesion and cell migration and induce platelet activation and aggregation involved in platelet-induced endothelial cell proliferation. In addition, it is involved in various phenomena in cells, such as promoting muscle cell fusion and contributing to myotube maintenance.
- the present invention provides a pharmaceutical composition for preventing or treating eye diseases, which contains an antibody that specifically binds CD9 as an active ingredient.
- the antibody can specifically bind to CD9 and reduce the expression of CD9 to inhibit cell aging.
- the ocular disease may be an senile eye disease, and more specifically, it may be selected from the group consisting of cataracts, glaucoma and macular degeneration, but is not limited thereto.
- the CD9 antibody may be selected from the group consisting of human, mouse, rat and goat, but is not limited thereto. More specifically, it may be, but is not limited to, a CD9 human antibody or a CD9 mouse monoclonal antibody.
- composition for preventing or treating eye diseases of the present invention may further include a pharmaceutically acceptable excipient, carrier, diluent, and the like.
- Carriers usable in the present invention include macromolecules that are slowly metabolized, such as proteins, polypeptides, liposomes, polysaccharides, polylactic acid, polyglycolic acid, polymeric amino acids, amino acid copolymers and inert viral particles.
- Salts of inorganic acids such as, for example, hydrochloride, hydrobromide, phosphate and sulfate; Pharmaceutically acceptable salts such as salts of organic acids such as acetates, propionates, malonates and benzoates; Liquids such as water, saline, glycerol and ethanol; And auxiliary materials such as wetting agents, emulsifiers or pH buffering materials.
- composition may be formulated in a unit dosage form suitable for intrabody administration of a patient, preferably in the form of preparations useful for the administration of protein medicines, according to conventional methods in the pharmaceutical art, for administration commonly used in the art.
- Oral or intravenous, intramuscular, intraarterial, intramedullary, intramedullary, intraventricular, lung, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal tract, topical, sublingual, intravaginal or rectal Administration may be by parenteral administration routes including, but not limited to, routes.
- Formulations suitable for this purpose include various oral preparations, such as tablets, pills, dragees, powders, capsules, syrups, solutions, gels, suspensions, emulsions, microemulsions, and injections such as injectable ampoules, Formulations for parenteral administration, such as injectables, eye drops and nebulizers such as hyposprays, are preferred.
- preparations for injection or infusion they may take the form of suspensions, solutions or emulsions and may include formulations such as suspending agents, preservatives, stabilizers and / or dispersants.
- the antibody molecule may also be formulated in a dried form that can be readjusted and used in an appropriate sterile liquid before use.
- the antibody is divided into one or several times a 0.01 to 50 mg / kg body weight, preferably 0.1 to 20 mg / kg body weight per day for a mammal including a human. May be administered.
- the actual dosage of the active ingredient is dependent on a number of related factors such as the disease to be prevented or treated, the severity of the disease, the route of administration, the patient's weight, age and sex, combination of the drug, the sensitivity of the reaction and the resistance / response to the treatment. It is to be understood that it is to be determined, and therefore, that dosage does not limit the scope of the invention in any aspect.
- CD9 antibody, p53 antibody and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) antibody were obtained from Santa Cruz Biotechnology (USA), phospho-Rb (ser807 / 811) antibody and p21 antibody were detected by Cell Signaling. In Technology (USA), secondary antibodies were purchased from Invitrogen life technologies (USA).
- CD9 human antibody (10E4) was provided by Antibody and Receptor Therapeutics (Korea) and human IgG was purchased from Stratagene (USA).
- Negative control siRNA, p53 siRNA and CD9 siRNA were purchased from Invitrogen's Stealth RNAi, and the sequence information is shown in Table 1 below.
- RNAi negative control Stealth RNAi UUCUCCGAACGUGUCACGU One ACGUGACACGUUCGGAGAA 2 p53Stealth RNAi UCCACACGCAAAUUUCCUUCCACUC 3 GAGUGGAAGGAAAUUUGCGUGUGGA 4 CD9Stealth RNAi AAGGUUUCGAGUACGUCCUUCUUGG 5 CCAAGAAGGACGUACUCGAAACCUU 6
- ARPE-19 cells were cultured using DMEM / F12 medium supplemented with 10% fetal bovine serum and 1% antibiotic. 2 x 10 6 cells were dispensed in a 150 mm diameter dish and cultured in a 37 ° C, 5% carbon dioxide incubator. Subcultured when the cells were 80% full in the culture dish.
- ARPE-19 cells were dispensed into 1 ⁇ 10 6 cells in a 60 mm diameter dish, and then cultured in a 37 ° C., 5% carbon dioxide incubator. After 6 hours, the cells were confirmed to adhere sufficiently, and then cultured for 4 hours by adding 0.5 ⁇ M adriamycin to DMEM medium containing no 10% fetal calf serum. Thereafter, the cells were washed twice with DMEM medium, and then loaded with DMEM / F12 medium containing 10% fetal bovine serum and 1% antibiotics and incubated for 4 days at 37 ° C. and a 5% carbon dioxide incubator.
- the degree of aging of cells was confirmed by Western blot analysis of p53, p21, pRb and CD9 expression in aging-associated ⁇ -galactosidase (SA- ⁇ -gal) activity staining and protein extracted from cells. It was.
- Example 4 aging-related Beta galactosidase (Senescence-associated ⁇ -galactosidase, SA- ⁇ -gal) active staining
- ARPE-19 cells were incubated in 4 x 10 4 plates in a 6-hole culture dish and washed twice with phosphate buffer saline (PBS). After 3.7% (v / v) formaldehyde was fixed at room temperature for 5 minutes, the cells were washed with phosphate buffered saline and then aged-related beta galactosidase solution (40 mM citric acid / sodium phosphate buffer). ) (pH 6.0), 150 mM NaCl, 2 mM MgCl2, 5 mM potassium ferricyanide / potassium ferrocyanide, 1 mg / ml X-gal) were added each 1.5 ml and reacted at 37 ° C. for 17 hours 30 minutes. I was. The cytoplasm was stained for 3 minutes with a 1% eosin solution and photographed with an optical microscope (x100).
- PBS phosphate buffer saline
- the membrane was fixed for 30 minutes with 5% skim milk to reduce nonspecific binding, and then reacted with the primary antibody diluted 1000-fold for one day.
- Membranes reacted with the primary antibody were washed three times with Tris-buffered saline and tween 20 (TBST) at 10 minute intervals.
- the secondary antibody conjugated with horseradish peroxidase (HRP) conjugated was diluted 3000-fold for 1 hour 30 minutes, and washed again with TBST three times at 10 minute intervals.
- the membrane was treated with a detection reagent (Western Blotting Luminol Reagent Solution A and B, Santa Cruz Biotechnology, USA) and confirmed the expression of the protein using the LAS-3000 analyzer (Fuji film, Stanford, CT).
- Example 6 small interfering RNA, siRNA Cell aging inhibition by
- ARPE-19 cells were dispensed into 1 ⁇ 10 6 cells in a 60 mm petri dish and incubated for one day in a 37 ° C., 5% carbon dioxide incubator.
- 20 pmol of siRNA, p53 siRNA, or CD9 siRNA were diluted in 2 ⁇ l of lipofectamine and 50 ⁇ l of Opti-MEM medium and reacted for 5 minutes at room temperature.
- the two tubes were mixed and reacted for 20 minutes at room temperature and treated with cells.
- Cells were incubated for 24 hours at 37 °C, 5% carbon dioxide incubator, the culture was exchanged.
- the degree of cell aging by adriamycin was analyzed.
- the senescence-related beta galactosidase activity increased by the adriamycin treatment resulted in the CD9 siRNA.
- the expression of CD9 and p21 increased by adriamycin treatment decreased after pretreatment of CD9 siRNA it was confirmed that the increased pRb expression by adriamycin treatment increased.
- the cellular senescence inhibitory activity of CD9 siRNA showed similar results to that of p53 siRNA used as a positive control. From the above results, it was confirmed that when the expression of CD9 is reduced, cellular senescence caused by adriamycin is suppressed.
- CD9 siRNA When pretreatment of CD9 siRNA to ARPE-19 cells was confirmed that CD9 expression by adriamycin is reduced and cell senescence is inhibited. Therefore, after pretreatment of CD9 human antibody (10E4), which is known to bind CD9 and block its function, cell aging inhibition experiment by adriamycin was performed.
- ARPE-19 cells were dispensed into 1 ⁇ 10 6 cells in a 60 mm diameter dish, and then cultured in a 37 ° C., 5% carbon dioxide incubator. After 6 hours, it was confirmed that the cells were sufficiently attached, and then treated with human IgG and CD9 human antibody (10E4) 10 ⁇ g / ml and cultured for one day. After washing the cells twice with DMEM medium, 0.5 ⁇ M adriamycin was incubated for 4 hours. Thereafter, the cells were washed twice with DMEM culture and then cultured with DMEM / F12 culture containing 10% fetal bovine serum and 1% antibiotic for 4 days. The degree of cellular aging was confirmed by aging-related beta galactosidase activity staining and Western blot.
Landscapes
- Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Mycology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Engineering & Computer Science (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
본 발명은 CD9에 특이적으로 결합하는 항체를 유효성분으로 함유하는 안질환 예방 또는 치료용 약학 조성물에 관한 것으로, 보다 상세하게는 CD9 특이적 항체는 세포 표면에 노출되어 있는 CD9 항원의 세포 외 영역과 특이적으로 결합함으로써, 노화된 세포에서 CD9의 발현을 감소시켜 세포 노화를 억제하는 효과를 나타내었다. 따라서, 본 발명의 CD9에 특이적으로 결합하는 항체를 유효성분으로 함유하는 조성물은 노인성 안질환 예방 또는 치료용 약학 조성물로 활용될 수 있다.
Description
본 발명은 CD9 항체를 유효성분으로 함유하는 안질환 예방 또는 치료용 약학 조성물에 관한 것으로, CD9에 특이적으로 결합하는 항체를 이용함으로써 세포 노화를 억제하는 노인성 안질환 예방 또는 치료용 약학 조성물에 관한 것이다.
포유류의 정상 체세포를 분리하여 시험관에서 배양하면 일정한 횟수 분열 후, 더 이상 분열하지 않고 성장이 멈추는데 이를 복제노화라고 한다. 복제노화는 세포가 분열하면서 염색체 말단 부분인 텔로미어(telomere)가 짧아지면서 생기는 것으로 알려져 있으며, 그 외 산화 스트레스, 암 유전자 및 암 억제 유전자의 활성 증가, 항암제와 같은 세포 독성 물질 투여에 의해서도 세포 노화가 유도된다고 알려져 있다.
노화 세포는 세포의 크기가 커지고 평평해지는 형태적 특징뿐만 아니라, 세포 노화 관련 베타 갈락토시다아제(senescence-associated β-galactosidase, SA-β-gal) 활성의 증가, 암 억제인자로 알려진 p16, p53 및 Rb의 발현 증가와 같은 분자적 특징을 동반한다. 또한, 노화 세포에서는 염증 반응, DNA 손상, 세포 성장 및 주기 조절과 관련된 다양한 유전자들의 발현이 변하는 것으로 알려져 있는데, 이와 관련된 유전자로는 Raf, Ras와 같은 암 유전자 및 p53, p16과 같은 암 억제 유전자들이 알려져 있으며, 인터루킨-6, 인터루킨-1β, 인터페론, IGFBP5와 같은 염증인자와 오로라 키나아제 B(aurora kinase B), 폴로-유사 키나아제 1(polo-like kinase 1)과 같은 세포주기 조절 유전자들도 관여하는 것으로 알려져 있다.
세포 노화 현상은 개체 및 조직 노화에 기여하며, 암을 억제하거나 촉진하기도 하고 조직복구 및 노화 관련 질환의 병인에 기여한다. 특히, 세포 노화는 암, 죽상경화, 혈관 내막증식, 간염, 당뇨병, 추가판 퇴행증, 피부 노화, 퇴행성 신경질환, 근감소증, 골다공증 및 전립선 비대증과 같은 다양한 노화 관련 질환의 병인에 기여한다. 최근 연구 결과에 따르면, 세포 노화를 선택적으로 조절하면 조직, 장기의 노화, 건강 수명, 노화 관련 질환의 발생을 조절할 수 있다고 보고되었다.
CD9 항원은 분자량이 24 내지 27 kDa의 테트라스파닌(tetraspanin) 세포막 당단백질로 세포 부착 및 이동, 혈소판 활성 및 응집, 포유동물의 수정 과정에서 난자와 정자의 융합, 암의 발생 및 전이, 체액성 면역 반응 및 알러지 반응, 인간 면역 결핍 바이러스-1(HIV-1)과 인플루엔자 바이러스 복제 등에 중요한 역할을 하는 항원으로 알려져 있다. 그러나, CD9 항원의 세포 노화 조절이나, 노화 조절 연구는 단순히 노화된 사람 혈관 내피 세포에서 발현이 증가되는 것이 보고되었을 뿐, CD9의 세포 노화 조절기전 및 노화 관련 안질환에서의 역할은 보고되지 않았다.
본 발명의 목적은 노화된 세포에서 발현이 증가하는 CD9에 특이적으로 결합하는 항체를 유효성분으로 함유하는 안질환을 예방 또는 치료용 약학 조성물을 제공하는 데에 있다.
상기 목적을 달성하기 위하여, 본 발명은 CD9에 특이적으로 결합하는 항체를 유효성분으로 함유하는 안질환 예방 또는 치료용 약학 조성물을 제공한다.
본 발명에 따르면, CD9에 특이적으로 결합하는 항체는 세포 표면에 노출되어 있는 CD9 항원의 세포 외 영역과 결합하여 노화 세포에서 CD9의 발현을 감소시킬 수 있다. 따라서, CD9에 특이적으로 결합하는 항체를 유효성분으로 함유하는 조성물은 노인성 안질환 예방 또는 치료용 약학 조성물로 활용될 수 있다.
도 1은 아드리아마이신에 의해 유도된 세포 노화를 노화 관련 베타 갈락토시다아제 활성 염색으로 확인한 결과이다.
도 2는 아드리아마이신에 의해 유도된 세포 노화를 CD9, p21, p53 및 pRB의 발현으로 확인한 웨스턴 블럿 결과이다.
도 3은 아드리아마이신에 의해 유도된 세포 노화가 CD9 siRNA에 의해 억제되는 것을 베타 갈락토시다아제 활성 염색으로 확인한 결과이다.
도 4는 아드리아마이신에 의해 유도된 세포 노화가 CD9 siRNA에 의해 억제되는 것을 CD9, p21, p53 및 pRB의 발현으로 확인한 웨스턴 블럿 결과이다.
도 5는 아드리아마이신에 의해 유도된 세포 노화가 CD9 인간 항체(10E4)에 의해 억제되는 것을 베타 갈락토시다아제 활성 염색으로 확인한 결과이다.
도 6은 아드리아마이신에 의해 유도된 세포 노화에 CD9 인간 항체(10E4)가 미치는 영향을 웨스턴 블럿으로 확인한 결과이다.
본 발명자들은 사람 망막 색소 상피세포(ARPE-19)가 아드리아마이신에 의해 세포 노화가 촉진되며, 그 과정에서 CD9의 발현이 증가하는 것을 확인하였다. CD9의 발현을 억제하는 CD9 작은 간섭 RNA(CD9 siRNA)를 전처리하였을 때, 아드리아마이신에 의한 세포 노화가 억제되는 것을 확인하였다. 또한, CD9의 기능을 차단하는 CD9 인간 항체(10E4)를 전처리하였을 때, 아드리아마이신에 의한 세포노화가 억제되는 것을 확인하였다. 따라서, CD9 인간항체(10E4)가 사람 망막 색소 상피세포의 세포 노화를 억제함으로써 노인성 안질환에 효과가 있을 것으로 제시하고 본 발명을 완성하였다.
본 발명에서 사용된 용어 “예방”은 CD9에 특이적으로 결합하는 항체에 의해 안 질환을 억제시키거나 발병을 지연시키는 모든 행위를 의미한다.
본 발명에서 사용된 용어 “치료”는 CD9에 특이적으로 결합하는 항체에 의해 안 질환의 증세가 호전되거나 이롭게 변경하는 모든 행위를 의미한다.
본 발명에서‘항체’란 항원성 부위에 대해서 지시되는 특이적인 단백질 분자를 의미한다. 본 발명의 항체는 다클론 항체, 단클론 항체를 모두 포함할 수 있으며, 항체의 제조는 당업계에 널리 공지된 기술을 이용하여 제조할 수 있다.
본 발명에서 사용된 용어 “사람 망막 색소 상피세포(ARPE-19)”는 사람 망막에서 유래된 세포주로서 사람 망막 질환, 특히 노인성 황반변성 등 다양한 노인성 안질환에 중요한 세포모델로 이용되고 있다. 또한, 백내장, 녹내장과 같은 안질환은 연령이 증가하면서 유병율이 증가하는 전형적인 노인성 안질환으로 이와 같은 백내장, 녹내장, 노인성 황반변성 등의 발생에 세포 노화가 중요한 병인으로 작용함이 밝혀지고 있다. CD9 인간 항체(10E4)를 전처리하였을 때, 아드리아마이신에 의한 세포노화가 억제되는 것을 확인하였다. 따라서, CD9 인간항체(10E4)가 사람 망막 색소 상피세포의 세포 노화를 억제함으로써 노인성 안질환에 효과가 있을 것으로 제시하고 본 발명을 완성하였다.
본 발명에서 사용된 용어 “CD9”는 테트라스파닌계(tetraspanin family)의 멤버에 속하는 약 24~27 kDa의 세포표면 당단백질 수용체로서, 세포 발달, 활성, 성장 및 운동성을 조절하는데 중요한 역할을 하는 신호전달 작용(signal transduction events)을 조절한다고 알려져 있다. 또한, 세포 부착 및 세포 이동을 조절할 수 있고, 혈소판-유발 내피세포 증식(platelet-induced endothelial cell proliferation)에 관여하는 혈소판활성화(platelet activation)와 집성(aggregation)을 유도한다. 아울러, 근육세포 융합(muscle cell fusion)을 촉진하고 근관 유지(myotube maintenance)에 기여하는 등 세포 내의 다양한 현상에 관여한다.
본 발명은 CD9에 특이적으로 결합하는 항체를 유효성분으로 함유하는 안질환 예방 또는 치료용 약학 조성물을 제공한다.
바람직하게는, 상기 항체는 CD9에 특이적으로 결합하여 CD9의 발현을 감소시켜 세포 노화를 억제할 수 있다.
바람직하게는, 상기 안질환은 노인성 안질환일 수 있으며, 보다 상세하게는 백내장, 녹내장 및 황반변성으로 이루어지는 군으로부터 선택될 수 있으나, 이에 한정되는 것은 아님을 명시한다.
바람직하게는, CD9 항체는 인간(human), 마우스(mouse), 랫트(rat) 및 고우트(goat)로 이루어지는 군으로부터 선택될 수 있으나 이에 한정되는 것은 아님을 명시한다. 보다 상세하게는 CD9 인간 항체 또는 CD9 생쥐 단클론 항체일 수 있으나, 이에 한정되는 것은 아님을 명시한다.
본 발명의 안질환 예방 또는 치료용 조성물은 약학적으로 허용되는 부형제, 담체, 희석제 등을 추가로 포함할 수 있다. 본 발명에서 사용가능한 담체로는 단백질, 폴리펩타이드, 리포좀, 다당, 폴리락트산, 폴리글리콜산, 중합체성 아미노산, 아미노산 공중합체 및 불활성 바이러스 입자와 같이 천천히 대사되는 거대분자를 들 수 있다. 예를 들면, 하이드로클로라이드, 하이드로브로마이드, 포스페이트 및 설페이트와 같은 무기산의 염; 아세테이트, 프로피오네이트, 말로네이트 및 벤조에이트와 같은 유기산의 염과 같은 약제학적으로 허용 가능한 염; 물, 염수, 글리세롤 및 에탄올과 같은 액체; 및 수화제, 유화제 또는 pH 완충 물질과 같은 보조적 물질을 사용할 수 있다.
또한, 상기 조성물은 약학적 분야에서 통상의 방법에 따라 환자의 신체 내 투여에 적합한 단위투여형의 제제, 바람직하게는 단백질 의약품의 투여에 유용한 제제 형태로 제형화시켜 당 업계에서 통상적으로 사용하는 투여방법을 이용하여 경구, 또는 정맥 내, 근육 내, 동맥 내, 골수 내, 수막강 내, 심실 내, 폐, 경피, 피하, 복강 내, 비강 내, 소화관 내, 국소, 설 하, 질 내 또는 직장 경로를 포함하는 비경구투여 경로에 의하여 투여될 수 있으나, 이들에 한정되는 것은 아니다.
이러한 목적에 적합한 제형으로는 정제, 환제, 당제(dragee), 산제, 캡슐제, 시럽제, 용액제, 겔제, 현탁제, 에멀젼, 마이크로에멀젼 등의 다양한 경구투여용 제제 및 주사용 앰플과 같은 주사제, 주입제, 점안제 및 하이포스프레이(hypospray)와 같은 분무제 등과 같은 비경구투여용 제제가 바람직하다. 주사 또는 주입용 제제의 경우에는, 현탁액, 용액 또는 에멀션 등의 형태를 취할 수 있고, 현탁화제, 보존제, 안정화제 및/또는 분산제와 같은 제제화제를 포함할 수 있다. 또한, 상기 항체 분자는 사용 전에 적절한 무균 액체로 재조정하여 사용할 수 있는 건조된 형태로 제제화될 수도 있다.
본 발명의 조성물 또는 약학적 제제의 유효성분으로서 상기 항체는 사람을 포함하는 포유동물에 대해 하루에 0.01 내지 50 ㎎/kg 체중, 바람직하게는 0.1 내지 20 ㎎/kg 체중을 1회 또는 수회로 나누어 투여할 수 있다. 그러나, 유효성분의 실제 투여량은 예방 또는 치료하고자 하는 질환, 질환의 중증도, 투여경로, 환자의 체중, 연령 및 성별, 약제 조합, 반응 민감성 및 치료에 대한 내성/반응 등의 여러 관련 인자에 비추어 결정되어야 하는 것으로 이해되어야 하며, 따라서, 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다.
이하에서는 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
실시예 1 : 세포 및 시약 준비
사람 망막 색소 상피세포(ARPE-19)는 영남대학교 약학대학 김정애 교수로부터 제공받아 사용하였다. 세포 배지는 DMEM/F-12(Dulbecco's modified eagle's medium/nutrient mixture F-12, 웰진, 한국) 배지에 10% 우태아혈청(fetal bovine serum, FBS)과 1% 항생제(페니실린 100 U/ml, 스트렙토마이신 100 μg/ml)를 첨가하여 사용하였다. 아드리아마이신(adriamycin)은 일동제약에서 구입하였으며 CD9 항체, p53 항체 및 GAPDH(glyceraldehyde 3-phosphate dehydrogenase) 항체는 Santa Cruz Biotechnology(미국)에서, phospho-Rb(ser807/811) 항체 및 p21 항체는 Cell Signaling Technology(미국)에서, 2차 항체는 Invitrogen life technologies(미국)에서 구입하였다. CD9 인간 항체(10E4)는 Antibody and Receptor Therapeutics(한국)로부터 제공받았으며, 사람 IgG는 Stratagene(미국)에서 구입하였다. 음성 대조군 siRNA, p53 siRNA 및 CD9 siRNA는 Invitrogen 사의 Stealth RNAi를 구입하여 사용하였으며, 염기서열 정보는 하기 표 1에 나타내었다.
이름 | 염기서열 | 서열번호 |
음성 대조군(control)Stealth RNAi | UUCUCCGAACGUGUCACGU | 1 |
ACGUGACACGUUCGGAGAA | 2 | |
p53Stealth RNAi | UCCACACGCAAAUUUCCUUCCACUC | 3 |
GAGUGGAAGGAAAUUUGCGUGUGGA | 4 | |
CD9Stealth RNAi | AAGGUUUCGAGUACGUCCUUCUUGG | 5 |
CCAAGAAGGACGUACUCGAAACCUU | 6 |
실시예 2 : 세포 배양 및 유지
ARPE-19 세포는 10% 우태아혈청과 1% 항생제가 첨가된 DMEM/F12 배지를 이용하여 배양하였다. 직경 150 mm 배양접시에 2 x 106개의 세포를 분주하여 37℃, 5% 이산화탄소 배양기에서 배양하였다. 배양접시에 세포가 80% 정도 차면 계대 배양하였다.
실시예 3 : 아드리아마이신에 의한 세포 노화 유도
세포 노화를 유도하기 위하여 ARPE-19 세포를 직경 60mm 배양접시에 1 x 106개로 분주한 후, 37℃, 5% 이산화탄소 배양기에서 배양하였다. 6시간 후, 세포가 충분히 부착된 것을 확인한 다음, 10% 우태아혈청이 포함되지 않은 DMEM 배지에 0.5 μM 아드리아마이신을 첨가하여 4시간 동안 배양하였다. 그 후, 세포를 DMEM 배지로 2회 세척한 후, 10% 우태아혈청과 1% 항생제가 포함된 DMEM/F12 배지를 넣고 37℃, 5% 이산화탄소 배양기에서 4일 동안 배양하였다. 세포의 노화정도는 노화 관련 베타 갈락토시다아제(Senescence-associated β-galactosidase, SA-β-gal) 활성 염색과 세포로부터 추출한 단백질에서 p53, p21, pRb 및 CD9의 발현을 웨스턴 블럿으로 분석함으로써 확인하였다.
실시예
4 : 노화 관련
베타 갈락토시다아제
(Senescence-associated β-galactosidase, SA-β-gal) 활성 염색
ARPE-19 세포를 6홀 배양접시에 4 x 104개로 배양하고, 인산완충식염수(phosphate buffer saline, PBS)로 두 번 세척하였다. 3.7% (v/v) 포름알데히드로 실온에서 세포를 5분 동안 고정 시킨 다음, 인산완충식염수로 씻어내고 노화 관련 베타 갈락토시다아제 용액(40mM 시트르산(citric acid)/인산염 나트륨 버퍼(sodium phosphate buffer) (pH 6.0), 150 mM NaCl, 2 mM MgCl2, 5 mM 페리시안화 칼륨(potassium ferricyanide/potassium ferrocyanide), 1 mg/ml X-gal)을 각 1.5 ml 씩 넣고 37℃에서 17시간 30분 동안 반응시켰다. 1 % 에오신(eosin) 용액으로 3분 동안 세포질을 염색한 다음 광학현미경(x100)으로 촬영하였다.
그 결과, 도 1을 참조하여 보면, 아드리아마이신을 처리하였을 때, 노화 관련 베타 갈락토시다아제 활성이 증가함으로써 세포 노화가 촉진됨을 확인하였다.
실시예 5 : 단백질 분리 및 웨스턴 블럿
1 x 106개의 세포에 RIPA 용액(25 mM Tris-HCl (pH 7.6), 150 mM NaCl, 1% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS, 1 mM sodium vanadate, 5 mM NaF, protease inhibitor) 30 ㎕를 넣고 세포를 용해시켰다. 4℃, 13,000 rpm에서 15분간 원심 분리한 다음 상층액을 새 튜브로 옮기고, 알부민 표준용액(Thermo Scientific 사, 미국)을 이용하여 소 혈청 알부민을 표준으로 단백질 농도를 측정하였다. 단백질 30 ㎍을 12% SDS-PAGE로 분리하고 니트로 셀룰로오스 막으로 옮겼다. 막은 비특이적 결합을 줄이기 위해 5% 탈지유로 30분간 고정한 후, 1000배로 희석한 1차 항체에 하루 동안 반응시켰다. 1차 항체에 반응시킨 막은 10분 간격으로 3회 TBST(Tris-buffered saline and tween 20)로 세척하였다. 그 다음, 1시간 30분 동안 HRP(horseradish peroxidase)가 접합된 2차 항체를 3000배로 희석하여 반응시키고 다시 10분 간격으로 3회 TBST로 세척하였다. 막은 검출시약(Western Blotting Luminol Reagent Solution A와 B, Santa Cruz Biotechnology 사, 미국)을 처리하고 LAS-3000 분석장치(Fuji film, Stanford, CT)을 이용하여 단백질의 발현을 확인하였다.
그 결과, 도 2를 참조하여 보면, 아드리아마이신을 처리하였을 때, CD9, p21 및 p53의 단백질 발현이 증가하였으며, pRb 단백질 발현이 감소하는 것을 확인하였다. 따라서, ARPE-19에 아드리아마이신 처리는 세포 노화를 촉진시키는 것을 확인하였다.
실시예
6 : 작은 간섭 RNA (small interfering RNA,
siRNA
)에 의한 세포 노화 억제
ARPE-19 세포를 60 mm 배양접시에 1 x 106개로 분주하고 37℃, 5% 이산화탄소 배양기에서 하루 동안 배양하였다. 음성 대조군으로 20 pmol의 siRNA, p53 siRNA, 또는 CD9 siRNA를 리포펙타민(lipofectamine) 2 ㎕와 Opti-MEM 배지 50 ㎕에 희석하여 실온에서 5분 동안 반응시켰다. 두 개의 튜브를 혼합하여 실온에서 20분 동안 반응시키고 세포에 처리하였다. 세포를 37℃, 5% 이산화탄소 배양기에서 24시간 배양한 후, 배양액을 교환해 주었다. 세포에 아드리아마이신을 처리하여 세포노화를 유도하면서, p53 siRNA 또는 CD9 siRNA에 의한 세포노화 억제 효능을 노화 관련 베타 갈락토시다아제 활성 염색과 웨스턴 블럿으로 확인하였다.
CD9 발현을 감소시키는 CD9 siRNA를 전처리한 후, 아드리아마이신에 의한 세포노화 정도를 분석한 결과, 도 3을 참조하여 보면, 아드리아마이신 처리에 의해 증가된 노화 관련 베타 갈락토시다아제 활성이 CD9 siRNA를 전처리한 후 통계적으로 유의하게 감소하는 것을 확인하였다. 또한, 도 4를 참조하여 보면, 아드리아마이신 처리에 의해 증가된 CD9 및 p21의 발현이 CD9 siRNA를 전처리한 후 감소하는 것을 확인하였고, 아드리아마이신 처리에 의해 감소된 pRb 발현이 증가하는 것을 확인하였다. 또한, CD9 siRNA의 세포 노화 억제 활성은 양성 대조군으로 사용된 p53 siRNA의 효능과 유사한 결과를 보였다. 이상의 결과로부터 CD9 의 발현이 감소하면 아드리아마이신에 의한 세포 노화가 억제되는 것을 확인하였다.
실시예 7 : CD9 인간 항체(10E4)에 의한 세포 노화 억제
ARPE-19 세포에 CD9 siRNA를 전처리하면 아드리아마이신에 의한 CD9 발현이 감소됨으로써 세포 노화가 억제되는 것을 확인하였다. 따라서, CD9와 결합하여 그 기능을 차단하는 것으로 알려진 CD9 인간항체(10E4)를 전처리한 후, 아드리아마이신에 의한 세포 노화 억제 실험을 수행하였다.
세포 노화를 유도하기 위하여 ARPE-19 세포를 직경 60mm 배양접시에 1 x 106개로 분주한 후, 37℃, 5% 이산화탄소 배양기에서 배양하였다. 6시간 후, 세포가 충분히 부착된 것을 확인한 다음, 사람 IgG와 CD9 인간항체(10E4)를 10 ㎍/ml 처리하고 하루 동안 배양하였다. 세포를 DMEM 배지로 2회 세척한 후, 0.5 μM 아드리아마이신을 4시간 동안 배양하였다. 그 후, DMEM 배양액으로 2회 세척한 후, 10% 우태아혈청과 1% 항생제가 포함된 DMEM/F12 배양액으로 세포를 4일 동안 배양하였다. 세포 노화정도는 노화 관련 베타 갈락토시다아제 활성 염색과 웨스턴 블럿으로 확인하였다.
그 결과, 도 5를 참조하여 보면, 사람 IgG와 비교하여 CD9 인간항체(10E4)을 전처리 하였을 때, 아드리아마이신에 의해 증가된 노화 관련 베타 갈락토시다아제 활성이 통계적으로 유의하게 감소하는 것을 확인하였다. 그러나 도 6을 참조하여 보면, 웨스턴 블럿 결과에서 CD9, p21, p53 및 pRb의 발현에는 영향이 을 보이지 않는 것을 확인하였다. 이상의 결과로부터 CD9 인간항체(10E4)가 아드리아마이신에 의한 ARPE-19의 세포 노화를 부분적으로 억제하는 것을 확인하였다.
실시예 8 : 결과 분석 및 통계처리
통계 처리된 모든 결과들은 3번의 독립적인 실험을 수행한 뒤 평균값과 표준오차로 나타내었다. 통계적 유의성은 two-tailed Students't-test로 검정하였다 (* p < 0.05, ** p < 0.01).
이상으로 본 발명의 특정한 부분을 상세히 기술한 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현 예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.
본 발명의 범위는 후술하는 특허청구범위에 의하여 나타내어지며, 특허청구범위의 의미 및 범위 그리고 그 균등 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.
Claims (5)
- CD9에 특이적으로 결합하는 항체를 유효성분으로 함유하는 안질환 예방 또는 치료용 약학 조성물.
- 제 1항에 있어서, 상기 항체는 CD9에 특이적으로 결합하여 CD9의 발현을 감소시켜 세포 노화를 억제하는 것을 특징으로 하는 안질환 예방 또는 치료용 약학 조성물.
- 제 1항에 있어서, 상기 안질환은 노인성 안질환인 것을 특징으로 하는 안질환 예방 또는 치료용 약학 조성물.
- 제 3항에 있어서, 상기 노인성 안질환은 백내장, 녹내장 및 황반변성으로 이루어지는 군으로부터 선택된 것을 특징으로 하는 안질환 예방 또는 치료용 약학 조성물.
- 제 1항에 있어서, 상기 약학 조성물은 정제, 환제, 당제, 산제, 캡슐제, 시럽제, 용액제, 겔제, 현탁제, 에멀젼, 마이크로에멀전, 주사제, 주입제, 점안제 및 분무제로 이루어진 군으로부터 선택되는 어느 하나의 제형을 가지는 것을 특징으로 하는 안질환 예방 또는 치료용 약학 조성물.
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR20150113261 | 2015-08-11 | ||
KR10-2015-0113261 | 2015-08-11 | ||
KR10-2016-0089797 | 2016-07-15 | ||
KR1020160089797A KR20170019319A (ko) | 2015-08-11 | 2016-07-15 | Cd9 항체를 유효성분으로 함유하는 안질환 예방 또는 치료용 약학 조성물 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2017026694A1 true WO2017026694A1 (ko) | 2017-02-16 |
Family
ID=57984434
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/KR2016/007996 WO2017026694A1 (ko) | 2015-08-11 | 2016-07-22 | Cd9 항체를 유효성분으로 함유하는 안질환 예방 또는 치료용 약학 조성물 |
Country Status (1)
Country | Link |
---|---|
WO (1) | WO2017026694A1 (ko) |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20040136985A1 (en) * | 2002-07-12 | 2004-07-15 | Jennings Lisa K. | Methods of modifying behavior of CD9-expressing cells |
KR20090103163A (ko) * | 2008-03-27 | 2009-10-01 | 성균관대학교산학협력단 | Cd9이 과발현된 고형암의 항암제 개발을 위한표적단백질로서의 cd9의 용도 |
KR20140033431A (ko) * | 2011-05-18 | 2014-03-18 | 더 리젠츠 오브 더 유니버시티 오브 캘리포니아 | 망막 질환을 치료하기 위한 조성물 및 방법 |
JP5594695B2 (ja) * | 2009-04-23 | 2014-09-24 | 国立大学法人 鹿児島大学 | 血管新生抑制剤 |
-
2016
- 2016-07-22 WO PCT/KR2016/007996 patent/WO2017026694A1/ko active Application Filing
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20040136985A1 (en) * | 2002-07-12 | 2004-07-15 | Jennings Lisa K. | Methods of modifying behavior of CD9-expressing cells |
KR20090103163A (ko) * | 2008-03-27 | 2009-10-01 | 성균관대학교산학협력단 | Cd9이 과발현된 고형암의 항암제 개발을 위한표적단백질로서의 cd9의 용도 |
JP5594695B2 (ja) * | 2009-04-23 | 2014-09-24 | 国立大学法人 鹿児島大学 | 血管新生抑制剤 |
KR20140033431A (ko) * | 2011-05-18 | 2014-03-18 | 더 리젠츠 오브 더 유니버시티 오브 캘리포니아 | 망막 질환을 치료하기 위한 조성물 및 방법 |
Non-Patent Citations (1)
Title |
---|
PENAS, P. F. ET AL.: "Inhibition of the Motility of Melanoma Cells Using Interference RNA Against CD 9", ACTAS DERMO-SIFILIOGRAFICAS, vol. 96, no. 1, 2005, pages 30 - 36 * |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US9937224B2 (en) | Modulation of axon degeneration | |
Okumura et al. | Cell surface markers of functional phenotypic corneal endothelial cells | |
Wang et al. | Upregulation of CCR3 by age-related stresses promotes choroidal endothelial cell migration via VEGF-dependent and-independent signaling | |
Lim et al. | Neuronal release of cytokine IL-3 triggered by mechanosensitive autostimulation of the P2X7 receptor is neuroprotective | |
US11919933B2 (en) | Use of MYOG gene as target in preparation of drug for treating cardiomyocyte apoptosis-associated cardiovascular disease | |
Cui et al. | miR-194 suppresses epithelial-mesenchymal transition of retinal pigment epithelial cells by directly targeting ZEB1 | |
Abusalamah et al. | Pyruvate affects inflammatory responses of macrophages during influenza A virus infection | |
Hou et al. | HMGA2 modulates the TGFβ/Smad, TGFβ/ERK and Notch signaling pathways in human lens epithelial-mesenchymal transition | |
Chen et al. | Bevacizumab modulates epithelial‐to‐mesenchymal transition in the retinal pigment epithelial cells via connective tissue growth factor up‐regulation | |
Jiang et al. | Two-pore channels mediated receptor-operated Ca2+ entry in pulmonary artery smooth muscle cells in response to hypoxia | |
Zhang et al. | The expression of CAP1 after traumatic brain injury and its role in astrocyte proliferation | |
US10975126B1 (en) | MERS-CoV inhibitor peptides | |
WO2017026694A1 (ko) | Cd9 항체를 유효성분으로 함유하는 안질환 예방 또는 치료용 약학 조성물 | |
Wang et al. | Shikonin alleviates choroidal neovascularization by inhibiting proangiogenic factor production from infiltrating macrophages | |
CA3171783A1 (en) | Deuterated oxophenylarsine compound and use thereof | |
Liao et al. | Inhibition of enhancer of zeste homolog 2 prevents corneal myofibroblast transformation in vitro | |
CN108610409A (zh) | Etv5在制备预防或治疗肥胖症及相关代谢性疾病药物中的应用 | |
Wang et al. | Role of CTCF in EGF-induced migration of immortalized human corneal epithelial cells | |
Zhang et al. | PDGF-D-induced immunoproteasome activation and cell-cell interactions | |
US20200352954A1 (en) | Methods of treating age-related symptoms in mammals and compositions therefor | |
KR20170019319A (ko) | Cd9 항체를 유효성분으로 함유하는 안질환 예방 또는 치료용 약학 조성물 | |
Cao et al. | Loss of miR-673-5p expression in the cornea promotes rat corneal allograft rejection by promoting Th17 cell differentiation mediated by JAK2/STAT3 | |
Hamuro et al. | Spatiotemporal Coordination of RPE Cell Quality by Extracellular Vesicle miR-494-3p Via Competitive Interplays with SIRT3 or PTEN | |
US20150094288A1 (en) | Antiangiogenic brassinosteroid compounds | |
Tao et al. | Pirfenidone suppresses the abnormal activation of human Müller cells after platelet-derived growth factor-BB stimulation |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 16835335 Country of ref document: EP Kind code of ref document: A1 |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
122 | Ep: pct application non-entry in european phase |
Ref document number: 16835335 Country of ref document: EP Kind code of ref document: A1 |