WO2017018937A1 - Traitement de remplacement génique fonctionnel - Google Patents

Traitement de remplacement génique fonctionnel Download PDF

Info

Publication number
WO2017018937A1
WO2017018937A1 PCT/SG2016/050350 SG2016050350W WO2017018937A1 WO 2017018937 A1 WO2017018937 A1 WO 2017018937A1 SG 2016050350 W SG2016050350 W SG 2016050350W WO 2017018937 A1 WO2017018937 A1 WO 2017018937A1
Authority
WO
WIPO (PCT)
Prior art keywords
frans
splicing
vector
gene
rnai
Prior art date
Application number
PCT/SG2016/050350
Other languages
English (en)
Inventor
Volker Patzel
Original Assignee
National University Of Singapore
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by National University Of Singapore filed Critical National University Of Singapore
Publication of WO2017018937A1 publication Critical patent/WO2017018937A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111—General methods applicable to biologically active non-coding nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C12N2310/141—MicroRNAs, miRNAs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/351—Conjugate
    • C12N2310/3519—Fusion with another nucleic acid
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/33—Alteration of splicing

Definitions

  • the invention concerns a method for effecting functional gene replacement therapy; at least one vector and/or at least one nucleic acid molecule for use in said method; and a therapeutic or pharmaceutical composition also for use in said method including said at least one vector and/or at least one nucleic acid molecule.
  • the invention has use in the medical and veterinary field. Background of the Invention
  • Acquired and/or inherited genetic disorders are often characterized by the presence of defective or aberrant gene transcripts and gene products which can be caused by abnormalities in chromosomes, genes, and gene expression.
  • these disorders include cancers, storage disorders, asthma, diabetes, mental retardation, obesity, heart disease, autoimmune diseases, and infections with viruses such as HIV and HPV which integrate their genome into the host's genome.
  • These disorders currently are treated symptomatically i.e. by administration of drugs which treat the symptoms rather than the genetic causes of the diseases although it is acknowledged that a causal treatment, i.e. one that addresses the cause of the disorder, is the only chance of a cure.
  • a causal treatment implies the usage of genetic tools suitable to resolve the genetic defects.
  • RNAi RNA interference
  • RNA frans-splicing allows one to repair genetic defects at the RNA level by replacing a defect with an intact function ( Figure 1 ).
  • Trans-splicing is a special form of RNA processing in eukaryotes where exons from two different primary RNA transcripts are joined end to end and ligated.
  • frans-splicing results in an RNA transcript that comes from multiple RNA polymerases on the genome.
  • frans-splicing describes splice reactions between two different pre-mRNAs.
  • RNA frans-splicing is undertaken by the spliceosome which is a large and complex molecular machine composed of five small nuclear RNAs (snRNA), and a range of associated protein factors.
  • the spliceosome removes introns from a transcribed pre- mRNA segment. This process is generally referred to as splicing.
  • RNA frans-splicing in the following referred to as RNA frans-splicing or frans-splicing, is a gene therapy approach that uses a cell's spliceosome to combine two distinct pre-mRNAs to produce a chimeric mature mRNA.
  • frans-splicing typically replaces a disease causing gene portion with a wild-type portion.
  • RNA frans-splicing represents a technology that is able to repair defective gene expression at the level of precursor messenger RNA (pre-mRNA); without any need to interfere with genomic DNA [1 -3]. Trans-splicing may occur naturally, however for therapeutic purposes an artificial frans-splicing RNA (tsRNA) is created to target a deleterious cellular pre-mRNA.
  • pre-mRNA precursor messenger RNA
  • tsRNA frans-splicing RNA
  • a frans-splicing RNA is composed of three functional domains: (i) an antisense binding domain that is specific for the respective target message, (ii) a coding domain expressing a recombinant therapeutic gene or exon, and (iii) a splicing domain that includes all functional sequences required for spliceosomal splicing such as splice sites, a branch point, a polypyrimidine tract, splice enhancers etc.
  • RNA frans-splicing can be used for 5' terminal (5'ER), internal (iER), or 3' terminal (3'ER) exon replacement.
  • the frans-splicing technology allows molecular-surgical repair of defective gene functions and, hence, frans-splicing has high therapeutic potential compared with RNAi technology.
  • RNA interference also called post transcriptional gene silencing (PTGS) represents an evolutionary conserved mechanism of post-transcriptional gene silencing in higher eukaryotes including mammals and humans [4-6].
  • RNAi is undertaken by microRNAs (miRNAs), siRNAs, shRNAs, and piRNAs any of which can be endogenously expressed within or exogenously delivered into the target cells. Endogenous expression usually starts with the transcription of nuclear precursor molecules which are then exported into the cytoplasm where they are processed to finally trigger the formation of RNA-induced silencing complexes (RISC).
  • RISC contains the so-called guide RNA sequence and provided that is complementary to a messenger RNA target the RISC can trigger target gene knockdown.
  • a method of gene therapy comprising:
  • RNAi molecule having a sequence of nucleotides that is complementary to a cellular version of said target nuclear transcript
  • RNA interference of said cellular version of said target nuclear transcript takes place to prevent the function of a protein encoded thereby or to support the death of the pre-mRNA transcript or its product.
  • Reference herein to a frans-splicing RNA molecule is a molecule that interacts with a target precursor mRNA molecule and mediates a frans-splicing event to generate a novel chimeric mRNA that can be processed in the cell to yield a protein product.
  • said target nuclear transcript encodes a defective gene product, typically a defective protein and so said target nuclear transcript is a target defective nuclear transcript.
  • Reference herein to a target defective nuclear transcript is reference to a transcript of a defective gene which transcript carries or encodes the said defect whereby a defective gene protein product is ultimately produced following cellular translation.
  • Reference herein to a cellular version of said target nuclear transcript, defective or otherwise, is reference to the same or a modified version of said target (defective) nuclear transcript when outside the cell nucleus.
  • said molecules are delivered to said target cell using conventional delivery technologies well known to those skilled in the art including but not restricted to transfection, lipofection, electroporation, nucleofection, jet-injection, gene gun, and needle injection.
  • said molecules are delivered to said target cell using conventional delivery routes well known to those skilled in the art including but not restricted to topical, intravenous, intramuscular, oral, cutaneous, subcutaneous, intraperitoneal, nasal, intra-tracheal, systemic, and intratumoral.
  • said delivery is undertaken using a viral vector that encodes said frans-splicing RNA molecule or RNAi molecule and that can transfect or transform said cell and in either case said vector is suitably equipped to ensure the frans-splicing RNA molecule or RNAi molecule is manufactured in said cell following transfection or transformation.
  • said delivery is undertaken using a viral vector and/or plasmid that encodes said frans-splicing RNA molecule or RNAi molecule and that can transfect or transform said cell and in either case said vector is suitably equipped to ensure the frans- splicing RNA molecule or RNAi molecule is manufactured in said cell following transfection or transformation.
  • said viral vector includes, but is not restricted to, retroviral vectors, lentiviral vectors, adenoviral vectors, and adeno-associated viral vectors (AAV).
  • said delivery is undertaken using a non-viral vector that encodes said frans-splicing RNA molecule or RNAi molecule and that can transfect or transform said cell and in either case said non-viral vector is suitably equipped to ensure the frans-splicing RNA molecule or RNAi molecule is manufactured in said cell following transfection or transformation.
  • said non-viral vector includes, but is not restricted to, liposomes, nanoparticles, polymer capsules, and conjugates containing peptides including cell penetrating peptides, proteins including antibodies or receptors, sugars, lipids, nucleic acids, and steroids.
  • said delivery is undertaken using a naked nucleic acid vector that encodes said frans-splicing RNA molecule or RNAi molecule and that can transfect or transform said cell and in either case said vector is suitably equipped to ensure the frans- splicing RNA molecule or RNAi molecule is manufactured in said cell following transfection or transformation.
  • Said naked nucleic acid vector includes but is not restricted to plasmids, cosmids, DNA minicircles, dumbbell-shaped DNA vectors, and RNA.
  • a single one of the above referenced vectors is used to deliver both said frans-splicing RNA molecule and said RNAi molecule and so said single vector encodes both said frans-splicing RNA molecule and RNAi molecule.
  • Said single vector comprises either two separate expression cassettes or a single expression cassette to express the frans-splicing RNA and the RNAi molecule.
  • Said single expression cassette includes but is not restricted to a gene expressing a frans-splicing RNA that harbours an intronic miRNA or shRNA or a miRtron.
  • a single vector is used to deliver the frans- splicing RNA, the RNAi molecule, and as a third component the recombinant wild-type therapeutic gene.
  • said frans-splicing RNA molecule comprises a binding domain that is specific for the target pre-mRNA and so comprises a sequence of nucleotides that recognizes or is complementary to a sequence encoding a selected region of a gene, typically having a genetic defect, ideally said region is upstream or downstream of a particular exon to be spliced and so most preferably said region comprises intronic DNA.
  • said frans-splicing RNA molecule comprises two binding domains complementary to regions either side of the exon(s) to be spliced.
  • said frans-splicing RNA molecule comprises a wild-type therapeutic gene or exon which when spliced into a target defective nuclear transcript restores the wild- type function of said transcript and so enables the production of an effective gene protein product.
  • said wild-type therapeutic gene or exon comprises recombinant RNA.
  • said frans-splicing RNA molecule comprises a sequence of nucleotides encoding an apoptotic signal leading to the selective destruction of said protein encoded by said transcript and ultimately the target cell.
  • the synergism of trans- splicing and RNAi can be relevant for suicide gene therapy where, for example, oncogene transcripts can be targeted by frans-splicing with apoptotic/death signals to ultimately selectively destroy/kill for example cancer cells.
  • This effect is boosted when co-targeting the oncogene transcript with RNAi because many cancer cells require oncogene expression and so suppression of oncogene function often triggers cell death.
  • a frans-splicing RNA molecule having at least one apoptotic/death signal that triggers death of the corresponding transcript or its product and the co-use of a RNAi molecule having a sequence of nucleotides that is complementary to a cellular version of the target nuclear transcript to prevent the function of a protein encoded thereby supports the death of the target cell.
  • said frans-splicing RNA molecule comprises functional sequences required for spliceosomal splicing such as splice sites, a branch point, a polypyrimidine tract, and splice enhancers.
  • RNA frans- splicing can be used for 5' terminal (5'ER), internal (iER), or 3' terminal (3'ER) exon replacement. All these variations from part of the invention and are well known to those skilled in the art.
  • said RNAi molecule is a micro RNA (miRNAs) and/or a siRNA either of which can be endogenously expressed within or exogenously delivered into the target cells. Endogenous expression usually starts with the transcription of nuclear precursor molecules (e.g. DNA molecules) which are then exported into the cytoplasm where they are processed to finally trigger the formation of RNA-induced silencing complexes (RISC).
  • nuclear precursor molecules e.g. DNA molecules
  • RISC RNA-induced silencing complexes
  • said RNAi molecule is a endogenously transcribed small hairpin (sh)RNA precursor which is processed by Dicer only after nuclear export within the cytoplasm triggering the formation of RISC.
  • said RNAi molecule comprises a sequence of nucleotides that is complementary to a defective cellular version of said target nuclear transcript.
  • the RNAi used is therefore specifically targeting the defect/mutated exon, not it's functionally intact counterpart.
  • said RNAi molecule comprises a sequence of nucleotides that provides for perfect pairing with said target nuclear transcript or said defective cellular version of said target nuclear transcript.
  • said frans-splicing RNA molecule and said RNAi molecule are co-delivered exogenously into target cells using various delivery technologies.
  • either or both said frans-splicing RNA molecule and said interfering RNAi molecule are transcribed endogenously from a vector or plasmid encoding same and, ideally, a single vector or plasmid.
  • said vector and/or plasmid further encodes a selected recombinant therapeutic gene with a view to treating the disorder that ensues when said target defective nuclear transcript is present.
  • RNAi will not target unspliced transcripts ( Figures 2 and 3) thus both corrective mechanisms can be used at the same time to achieve a dual purpose which is either i) to restore gene function and prevent the effect of any defective genes or ii) to destroy cells expressing aberrant, including oncogenic, gene functions.
  • a vector or plasmid comprising:
  • At least one nucleic acid molecule encoding at least one RNAi molecule having a sequence of nucleotides that is complementary to a cellular version of said target nuclear transcript.
  • said target nuclear transcript is defective.
  • a therapeutic for treating a gene defect disorder comprising said vector or plasmid.
  • a therapeutic for treating a gene defect disorder comprising: a) at least one nucleic acid molecule encoding at least one frans-splicing RNA molecule having i) at least one sequence of nucleotides complementary to a target nuclear transcript comprising pre-mRNA, ii) at least one wild-type therapeutic gene or exon or at least one gene or exon encoding an apoptotic/death signal and iii) at least one functional sequence required for spliceosomal splicing; and
  • a pharmaceutical composition comprising a therapeutic according to the invention and at least one carrier.
  • said therapeutic or pharmaceutical composition is formulated for mammalian and ideally human use.
  • Figure 1 shows a schematic depiction of different gene therapy approaches. Displayed are cross sections through mammalian or human cells. Nuclear genomic DNA is being transcribed to single-stranded messenger RNA (mRNA) which is subsequently being spliced and exported into the cytoplasm where protein synthesis takes place. A defect (red) gene can lead to a defect mRNA and finally code for a defect or gene function/protein.
  • the classical gene therapy approach is based on gene complementation of the defect with an intact (green) gene function. As a result, targeted cell carry both the defect and the recombinant intact function (lower part). Some defect proteins are pathogenic or carcinogenic. In such a case it is more promising to block the aberrant function using antisense or RNAi technologies i.e.
  • RNAi-based inhibition (upper part). In the consequence however targeted cells lose a gene function. RNA frans-splicing based repair, allows repairing the defect function or exon on the pre-mRNA level. In that case the corrected gene function replaces the defect function which is basically the most desirable outcome (middle part).
  • Figure 2 shows enhancement of apparent frans-splicing efficacy by RNAi. Compartmental separation of splicing and RNAi allows for selective cytoplasmic destruction of aberrant c/ ' s- spliced transcripts which escaped therapeutic nuclear frans-splicing.
  • C Cytoplasm
  • N Nucleus
  • e exon
  • i intron
  • Red defect sequence
  • green intact sequence.
  • Trans-splicing RNAs providing the intact sequences and siRNAs are not depicted in this figure.
  • Figure 3 shows examples how an siRNA effector molecule can be co-delivered together with a frans-splicing RNA expression vector.
  • A Co-delivery of a chemically synthesised siRNA.
  • B Co-delivery of a seperate shRNA expression vector.
  • C Co-delivery as independent shRNA expression cassette implemented into the frans-splicing RNA expression vector.
  • D Co-delivery as miRtron implemented into the trans-splicing RNA expression cassette. Splicing of the miRtron will generate the shRNA or miRNA precursor which can then be exported into the cytoplasm in a Drosha- and Exportin-5-independent manner.
  • Figure 4 shows a detailed molecular illustration of synergies between RNA frans-splicing and RNA interference.
  • A for frans-splicing-based 5' exon replacement
  • B for frans-splicing- based 3' exon replacement
  • C for frans-splicing-based internal exon replacement.
  • the siRNA used is specifically targeting the defect/mutated exon, not it's functionally intact counterpart. Due to the subcellular compartmentalization, the siRNA can exert its silencing potential only in the cytoplasm, i.e. target the defect/mutated exon exclusively on the level of the c/ ' s-spliced cytoplasmic target message but not on the level of the nuclear un-spliced pre- mRNA. That is, RNAi cannot negatively interfere with frans-splicing but instead support frans-splicing-based replacement of aberrant gene functions.
  • FIG 5 shows experimental proof of synergies (no negative interference) between RNA frans-splicing-based 3' exon replacement and RNAi.
  • the RNAi effector was co-delivered as exogenously synthesised siRNA (scenario A, Figure 3).
  • the alpha-fetoprotein (AFP) pre-mRNA was targeted with a frans-splicing RNA that replaces the 3' terminal exons 6 to 14 of the endogenous transcript or exon 6 of an exogenously delivered recombinant transcript encompassing only the exons 3 to 6 by a sequence coding for the herpes simplex virus thymidine kinase (HSVtk).
  • HSVtk herpes simplex virus thymidine kinase
  • the HepG2 target cells were co-transfected with a vector expressing AFP exons 3 to 6, a vector expressing the frans-splicing RNA, and the siRNA which was directed against AFP exon 6 using lipofection.
  • Total cellular RNA was isolated 24 hours post transfection and both, the c/ ' s-spliced and the frans-spliced AFP message was quantified using real-time reverse transcriptase (rtRT-)PCR.
  • A knockdown of c/ ' s-spliced AFP mRNA by the exon 6-targeting siRNA.
  • B dose response curve of knockdown in A.
  • C knockdown of the c/ ' s-spliced AFP message illustrated by ACt values.
  • the siRNA has no effect on frans-spliced AFP mRNA levels as depicted by ACt values.
  • ACt C spiicedAFP - Ct P - ac tin- Data represent mean values of three independent experiments. Error bars indicate mean deviations from the averages. P values were calculated using a student's t-test. * : p ⁇ 0.05, ** : p ⁇ 0.01 ; *** : p ⁇ 0.001 .
  • Figure 6 shows experimental proof of synergies (no negative interference) between RNA frans-splicing-based 5' exon replacement and RNAi. The RNAi effector was co-delivered as exogenously synthesised siRNA (scenario A, Figure 3).
  • the AFP pre-mRNA was targeted with a frans-splicing RNA that replaces the 5' terminal exons 1 to 3 of the endogenous transcript or exon 3 of an exogenously delivered recombinant transcript encompassing only the exons 3 to 6 by a sequence coding for the HSVtk.
  • the HepG2 target cells were co-transfected with a vector expressing AFP exons 3 to 6, a vector expressing the frans-splicing RNA, and the siRNA which was directed against AFP exon 3 using lipofection.
  • RNA Total cellular RNA was isolated 24 hours post transfection and both, the c/ ' s-spliced and the frans-spliced AFP message was quantified using rtRT-PCR.
  • A knockdown of c/ ' s-spliced AFP mRNA by the exon 3-targeting siRNA.
  • B dose response curve of knockdown in A.
  • C knockdown of the c/ ' s-spliced AFP message illustrated by ACt values.
  • D the siRNA has no effect on frans-spliced AFP mRNA levels as depicted by ACt values.
  • ACt Ct cis - S pi iC edAFP - Ctp-actin- Data represent mean values of three independent experiments. Error bars indicate mean deviations from the averages. P values were calculated using a student's t-test. * : p ⁇ 0.05, ** : p ⁇ 0.01 ; *** : p ⁇ 0.001
  • Figure 7 shows an exemplary suggested design of gene therapy vectors.
  • a single vector contains two (b and c) or three (a, b, and c) functional elements which support the replacement of a defect by an intact gene function: a, the recombinant therapeutic version of the defect endogenous gene the expression of which complements the defect with the intact gene function; b, a gene expressing a frans-splicing RNA suitable to repair the defect target message on the pre-mRNA level in the nucleus; and c, a gene coding for siRNA precursor, a small hairpin (sh)RNA, specifically targeting the defect/mutated exon of the target message in the cytoplasm.
  • siRNA precursor a small hairpin (sh)RNA
  • shRNAs are exported from the nucleus into the cytoplasm recruiting the exportin-5 dependent pathway and will then be recognised and processed in the cytoplasm by dicer to generate the siRNA, trigger RISC formation, and knockdown of c/ ' s-spliced target messages that escaped nuclear frans-splicing.
  • the combination of functional elements b and c allows partly replacement of the defect by an intact gene function with simultaneous elimination of the defect gene function on the RNA level.
  • the combination of functional elements a to c can in addition either fully restore native expression levels of the intact target gene or trigger its over-expression.
  • FIG 8 shows experimental proof of synergies (no negative interference) between RNA frans-splicing-based 3' exon replacement and RNAi.
  • the frans- splicing RNA and the RNAi effector (shRNA) were encoded on separate plasmid vectors (scenario B, Figure 3).
  • the alpha-fetoprotein (AFP) pre-mRNA was targeted with a trans- splicing RNA that replaces the 3' terminal exons 6 to 14 of the endogenous transcript or exon 6 of an exogenously delivered recombinant transcript encompassing only the exons 3 to 6 by a sequence coding for the herpes simplex virus thymidine kinase (HSVtk).
  • HSVtk herpes simplex virus thymidine kinase
  • the HepG2 target cells were co-transfected with 500ng a vector expressing AFP exons 3 to 6, 500ng of a vector expressing the frans-splicing RNA, and 500ng of a vector expressing an shRNA which was directed against AFP exon 6 using lipofection.
  • Total cellular RNA was isolated 24 hours post transfection and both, the c/ ' s-spliced and the frans-spliced AFP message was quantified using real-time reverse transcriptase (rtRT-)PCR.
  • rtRT- real-time reverse transcriptase
  • FIG 9 shows experimental proof of synergies (no negative interference) between RNA trans-splicing-based 5' exon replacement and RNAi.
  • the trans- splicing RNA and the RNAi effector (shRNA) were encoded on the same plasmid vector (scenario C, Figure 3).
  • the alpha-fetoprotein (AFP) pre-mRNA was targeted with a trans- splicing RNA that replaces the 5' terminal exons 1 to 3 of the endogenous transcript or exon 3 of an exogenously delivered recombinant transcript encompassing only the exons 3 to 6 by a sequence coding for the HSVtk.
  • AFP alpha-fetoprotein
  • the HepG2 target cells were co-transfected with 500ng of a vector expressing AFP exons 3 to 6 and 500ng of a vector expressing both the trans- splicing RNA and the shRNA which was directed against AFP exon 3 using lipofection.
  • Total cellular RNA was isolated 24 hours post transfection and both, the c/ ' s-spliced and the trans- spliced AFP message was quantified using real-time reverse transcriptase (rtRT-)PCR.
  • rtRT- real-time reverse transcriptase
  • FIG 10 shows experimental proof of synergies between RNA frans-splicing-based 3' and 5' exon replacement and RNAi.
  • the frans-splicing RNA and the RNAi effector (shRNA) were encoded by the same transcription cassette with the shRNA implemented as a miRtron into the HSVtk mRNA (scenario D, Figure 3).
  • the miRtron has no negative effect on frans-splicing but instead enhances the frans-splicing activity.
  • HepG2 target cells were co-transfected with 500ng a vector expressing AFP exons 3 to 6 and a vector expressing the trans-splicing RNA together with an AFT-targeting miRtron using lipofection.
  • A Co-transfection of 500ng of the 3'EL construct.
  • B Co-transfection of 150ng of the 5'EL construct.
  • C Co-transfection of 500ng of the 5'EL construct.
  • Total cellular RNA was isolated 24 hours post transfection and both, the c/ ' s-spliced and the frans-spliced AFP message was quantified using real-time reverse transcriptase (rtRT-)PCR.
  • rtRT- real-time reverse transcriptase
  • FIG 11 comparing the efficiency of shRNAs in knocking down the AFP mini-gene target with real time RT-PCR using (a) 3'AFP probe and (b) 5'AFP probe.
  • the shRNAE3a and shRNAE3b targets AFP exon 3 and shRNAE6a and shRNAE6b targets AFP exon 6.
  • the "a” denotes conventional perfect pairing miRNA hairpin precursor and the "b" contains two bulges in the guide sequence.
  • Figure 12 relative mRNA expression checking the levels of escaped c/s-spliced AFP and frans-splicing when specific shRNAs are introduced as separate vector.
  • Figure 13 relative mRNA expression checking the levels of escaped c/s-spliced AFP and frans-splicing when specific shRNAs are cloned into the trans-splicing cassette as a single vector system.
  • shRNAs E6a and E6b fused with frans-splicing vector on (a) 3' c/ ' s-splicing and (b) 3' frans-splicing.
  • Figure 14 relative mRNA expression checking the levels of escaped c/s-spliced AFP and frans-splicing when specific shRNAs (mirtrons) are cloned into the HSV-tk coding region of frans-splicing cassette as a single vector system.
  • shRNAs E6a and E6b mirtron fused with frans-splicing vector on (a) 3' c/ ' s-splicing and (b) 3' frans-splicing.
  • siRNA Design siRNAs targeting exon 3 of AFP and exon 6 of AFP were designed following the protocols proposed previously [8,9]. siRNA targeting luciferases was previously described [8]. The selected siRNA sequence was summarized in Table 1 and ordered from Dharmacron Thermo Scientific.
  • siRNA_E6 sense 5'-AUUAAGAGAAAGCAGCUUGdTdT-3' (SEQ ID NO:1 ); antisense 5'- CAAGCUGCUUUCUCUUAAUUC-3' (SEQ ID NO:2)
  • siRNA_E3 sense 5'-AGUCUUCAGGGUGUUUAGAdTdT-3' (SEQ ID NO:3), antisense 5'- UCUAAACACCCUGAAGACUGU-3' (SEQ ID NO:4)
  • DMEM Dulbecco's Modified Eagle Medium
  • FBS fetal bovine serum
  • siRNA various concentration (0, 0.1 , 1 , 10, 100 pmol/uL) were co-transfected 14 hours after plating using lipofectamine 2000 TM or 3000 TM (Introvigen) in Opti-MEM (Introvigen) following the manufacturer's protocol.
  • frans-splicing constructs pVAX1 -AFP, shRNA, combined frans-splicing-shRNA constructs or mirtron constructs were co-transfected.
  • total DNA was topped up with empty pSuper vector to transfect all cells with the same total amount of DNA.
  • Successfully transfected Hep G2 cells were cultured in DMEM supplemented with 10% fetal bovine serum (FBS) and 1 % of penicillin-streptomycin (P-S) overnight.
  • FBS fetal bovine serum
  • P-S penicillin-streptomycin
  • Target mRNA was previously designed by S. Poddar according to endogeously express part of the alpha fetoprotein (AFP) from a DNA minigene plasmid.
  • AFP alpha fetoprotein
  • the AFP minigene consisted of exon 3, intron 3, linked exons 4 and 5, intron 5 and exon 6. It was introduced into the pVAX1 plasmid which harbors a Kanamycin resistance with a cytomegalovirus (CMV) promoter (pVAX1 -AFP).
  • CMV cytomegalovirus
  • frans-splicing RNA constructs 7rans-splicing RNA constructs 3'PAR and 5'PAR for 3' exon replacement (ER) or 5' ER were designed including a target binding domain, a splicing domain, and a coding domain (which in this case was a gene for HSVtk expression), and synthesized by GeneArt® (Life Technologies).
  • 3'PAR interacts with AFP minigene mRNA (target mRNA) and undergoes 3'exon labeling (3'EL) by excising and replacing exon 6 with the domain which encodes the Herpes simplex virus thymidine kinase (HSV-TK). It was designed with:
  • a binding domain in antisense orientation to intron 5 of the AFP minigene i.
  • a splicing domain with a 3' active splice signal, a branch point consensus and a polypyrimidine tract i.
  • iii A coding domain which encodes the HSV-TK but a deletion of the translational start codon to prevent translation in the absence of frans-splicing, iv. A poly-adenosine tail to confer correct processing of the frans-splice product.
  • 5'PAR was designed for 5'exon labeling (5'EL) in which exon 3 is excised and replaced with coding domain of HSV-TK and it consists of: i. A splicing domain containing a 5' splice site,
  • shRNA Polycistronic shRNA plasmids obtained from the GeneArt® Gene synthesis service (Life Technologies). Two 21 -nucleotides shRNA guide strands, targeting exon 3 and exon 6 of AFP were generated. Selection of guide sequence candidates were done according to the criteria for in silico selection of siRNA (Patzel, 2007). Selected shRNA guide strands were further extended with additional two nucleotides at both 3' and 5' ends, forming 25-nucleotide elongated shRNA guide strands.
  • 25-nucleotide elongated shRNA guide strands in this article were selected to fold an open secondary structure with high Gibbs free energy, AG predicted by Mfold (Zuker, 2003). Both guide strands were used to replace mature miRNA sequences within human precursor miRNA (pre-miRNA) structures selected from the miRBase namely hsa-miR-4699, hsa-miR-3116-1 , hsa-miR-106b and hsa-miR-20a [10-14], forming Dicer substrate shRNAs.
  • pre-miRNA human precursor miRNA
  • Exon 3 targeting guide strand replaced hsa-miR-4699 and hsa-miR-106b, while exon 6 targeting guide strand replaced hsa-miR-3116-1 and hsa-miR-20a.
  • the shRNA constructs derived from the replacement of mature sequences of human miRNAs by guide strands were labeled as shRNA_E3_a (or shRNAI ), shRNA_E3_b (or shRNA3), shRNA_E6_a (or shRNA2) and shRNA_E6_b (or shRNA4) respectively.
  • the passenger strand of shRNAs were modified such that identical secondary structures to original miRNAs were maintained.
  • shRNA_E3_a 5'-AGCAAGAACAGUCUUCAGGGUGUUUAGAAAUGAUUAAGAAAUUUUC GUAAACACCCUGAAGACUGUUCUUGCU-3' (SEQ ID NO:5)
  • shRNA_E6_a 5'-CUUUAUAAGAAUUAAGAGAAAGCAGCUUGUUUGGGUAUCGUAGAAC AAGCUGCUUUCUCUUAAUUCUUAUAAAG-3' (SEQ ID NO:6)
  • shRNA_E3_b 5'-CCUGCCGGGUUUCUAAACACCCUGAAGACUGUUCUGGUCCUCUCC UUGGAAACUCUUCAGGGUGUUUAUCUAAUCCAGCAGG-3' (SEQ ID NO:7)
  • shRNA_E6_b 5'-GUAGCAUAACAAGCUGCUUUCUCUUAAUUCUGUUUAGUCAUGAAUA AGAGAAAGCAGCUUCAUUAUACUGC-3' (SEQ ID NO:8)
  • a combined frans-splicing RNA molecule and shRNA plasmids in a single plasmid was designed.
  • the design of an artificial mirtron considers rules (i) for the design of a spliceable RNA that (ii) generates an RNAi effector molecule [15].
  • the miR- 1224 was chosen from the miRBase due to its existence in mammalian cells as an endogenous mirtron (Sibley et al., 201 1 ).
  • Mmu-miR-1224 was originally designed as introns within the eGFP plasmid in Sibley et al.'s experiment [16]. In this article, miR-1224 served as the model structure for the design of a mirtron.
  • miR-1224 was predicted by Mfold [17] and RNAfold [18]; both predicted structures were identical.
  • Two shRNA guide strands were designed to replace the seed region of miR-1224.
  • the passenger strands of mirtron-RNAs were modified such that the original secondary structures of the miRNAs were maintained.
  • Final constructs were labelled as mirtron_E3 (or mirtron 1 ) and mirtron_E6 (or mirtron2).
  • miR-1224 5'-GUGAGGACUCGGGAGGUGGAGGGUGGUGCCGCCGGGGCCGGGCGCU GUUUCAGCUCGCUUCUCCCCCCACCUCCUCUCUCCUCAG-3' (SEQ ID NO:9)
  • miRtron_E3 5'-GTCTAAACACCCTGAAGACTGTTCAGCATCATTAGAGCCAGAGTTCTGT CTCAGCTAACACTCCCCGTCTTTAGGGACTTTAGAG-3' (SEQ ID NO:10)
  • miRtron_E6 5'-GTAACAAGCTGCTTTCTCTTAATTCGCATCATTAGAGCCAGAGTTCTGT CTCAGCGATTACTCCCCAGAGAAAGTACGTTGTTAG-3' (SEQ ID NO:1 1 )
  • the cloned mirtron constructs were termed as 5'PAR-mirtron_E3 (or 5'mir1 ) and 3'PAR- mitron_E6 (or 3'mir2).
  • General cloning strategies Approximately two ⁇ g of the basis vector constructs were incubated with 1 ⁇ each of two specific restriction enzymes and 10X Fast Digest Buffer (Thermo Scientific) in a 50 ⁇ reaction at 37°C for two hours, then 80°C for 15 minutes to inactivate the restriction enzymes. Following the digestion, the entire 50 ⁇ digestion mixtures were loaded onto 1 % agarose gels for gel electrophoresis at 90V for one hour. Two bands were observed under UV illumination and desired bands were cut and weighed.
  • the DNA was extracted from the gels using GeneJET Gel Extraction Kit (Thermo Scientific).
  • the vector DNA and the insert DNA were then ligated with 1 ⁇ T4 DNA ligase (Thermo Scientific) at a concentration ratio of one to three (vector to insert) in 20 ⁇ reaction mixture which consists of 10X T4 ligase buffer.
  • the ligation step was carried out at 22 e C for four hours and the T4 ligase was inactivated at 70°C for 15 minutes.
  • a total of 10 ⁇ of the ligation mixture was then transformed into chemically-competent E. coli strain DH5a using a standard transformation protocol.
  • the resulting constructs were termed 3'ER-shRNA2 and 5'ER-shRNA1 .
  • 2pg of frans-splicing RNA constructs, 3'ER or 5'ER and 30pg of cloning plasmid, pSUPER- shRNAI or pSUPER-shRNA2 were digested with 1 ⁇ each of restriction enzymes as summarized in the following table ⁇ Table 2).
  • Cloning of pVAX1 -mirtron The parental frans-splicing constructs, 3'PAR and 5'PAR having two SphI (or Pael) restriction endonuclease cleavage sites at the backbone, could't be used for mirtron cloning. Therefore prior to the introduction of mirtron, the two SphI sites must be diminished.
  • Four primers were designed for PCR of the entire frans-splicing constructs using Pfu DNA polymerase (Thermo Scientific) by introducing a mismatch in one SphI sequence or a total replacement of the SphI restriction site with a BamHI restriction site.
  • FP_pVAX_large and RP_pVAX_large were designed for the PCR of the bigger fragment between two SphI sites while FP pVAX small and RP_pVAX_small were used to PCR amplify the smaller fragment between two SphI sites.
  • Primers were phosphorylated prior to the PCR. Blunt end ligation was carried out after PCR with the addition of PEG4000.
  • Successful clones, 3'PAR_mod and 5'PAR_mod were picked for the cloning of mirtron.
  • Mirtron_E3 and mirtron_E6 were first isolated from the synthesized mirtron_E3_E6 plasmid by GeneArt® with following restriction enzymes: Table 3.
  • RNA isolation and first-strand cDNA synthesis Total RNA from transfected HepG2 cells was isolated using RNeasy Plus Mini Kit (Qiagen) according to the manufacturer's protocol 24 hours or 48 hours post-transfection depending on conditions to be tested. First strand cDNA was synthesized using the Superscript III First-Strand Synthesis Kit (Invitrogen). Approximately 500 ng of total cellular RNA was incubated with 1 ⁇ each of random hexamer and dNTPs at 65°C for five minutes in a 14 ⁇ reaction.
  • First-strand cDNA synthesis with specific primers for detection of shRNA and mirtron processing efficiency First strand sequence specific cDNA was synthesized using the Superscript III First-Strand Synthesis Kit (Invitrogen). Approximately 500 ng of total cellular RNA was incubated with 1 .5 ⁇ of specific stem loop primer and 1 ⁇ of dNTPs at 65 e C for five minutes in a 14 ⁇ reaction. After one minute chill snap, 6 ⁇ of master mix consisting 4 ⁇ of buffer, 0.1 M DTT (1 ⁇ ), RNase OUT (0.5 ⁇ ) and Superscript III reverse transcriptase (0.5 ⁇ ) were added and incubated at 50 e C for two hours, followed by inactivation of the enzyme at 70 e C for 15 minutes.
  • qPCR Real-time Polymerase Chain Reaction
  • Forward and reverse primers (3'FP and 3'RP_c/ ' s for the 3'AFP probe and 5'FP_c/ ' s and 5'RP for the 5'AFP probe) were designed to detect escaped c/ ' s-spliced AFP mRNA while 3'FP and 3'RP_trans for the 3'AFP probe and 5'FP_trans and 5'RP for the 5'AFP probe were designed to detect successful frans-spliced AFP/HSV-tk chimeric mRNA.
  • Primers were designed using Primer Express (Applied Biosystems) with preference for open secondary structures and melting temperatures at around 60 e C.
  • RT primers stem loop primers
  • FP Forward primers recognizing remaining nucleotides that were 2 nucleotides away from the 6 nucleotides mentioned above on miRNA were designed with additional nucleotides at 5' ends for stability and to achieve melting point of 58 to 60 e C qPCR cycle condition were retained for the determination of C, value.
  • AC t values were calculated by subtracting the C t value of ⁇ - actin (endogenous control) from the C t value obtained from real-time qPCR. AAC t was then obtained by subtracting AC X (construct) by AC X (control). A fold change was calculated with the equation of 2 ⁇ AACt . This fold change value was then represented as relative RNA expression in all charts shown in this report. Data shown as 3 experiments made in triplicates. Error bar represents SEM. All statistical analysis were done in GraphPad Prism 5 (Graph Pad Software) using two-tailed unpaired t test for comparison between two constructs and two way ANOVA (multiple comparison) for comparison among multiple constructs against control construct.
  • Trans-splicing RNA vectors and exogenously synthesised siRNAs were co-delivered into target cells using various transfection technologies including lipofectamine 2000 or 3000.
  • the frans-splicing RNA and interfering RNA were transcribed endogenously from a single plasmid or DNA-vector ( Figure 3).
  • RNA frans-splicing and RNAi using alpha- fetoprotein (AFP) a protein whose elevated levels are a known marker for Hodgkin's disease and various types of liver disease such as chronic liver disease and liver cancer.
  • AFP alpha- fetoprotein
  • RNA frans-splicing and RNAi using frans-splicing RNA triggering either 5'ER or 3'ER.
  • AFP alpha-fetoprotein
  • a frans-splicing RNA that either replaces the 3' terminal exons 6 to 14 of the endogenous transcript or exon 6 of an exogenously delivered recombinant transcript encompassing only the exons 3 to 6 by a sequence coding for the herpes simplex virus thymidine kinase (HSVtk).
  • HSVtk herpes simplex virus thymidine kinase
  • the AFP pre-mRNA was targeted with a frans- splicing RNA that replaces the 5' terminal exons 1 to 3 of the endogenous transcript or exon 3 of an exogenously delivered recombinant transcript encompassing only the exons 3 to 6 by a sequence coding for the HSVtk.
  • HepG2 target cells were co-transfected with a vector expressing AFP exons 3 to 6, a vector expressing the frans-splicing RNA, and the siRNA which was directed against AFP exon 6 or exon 3 using lipofection.
  • RNAi-based knockdown of a target gene does not negatively interfere with frans-splicing-based reprogramming (the fusion with the HSVtk) in the same cell ( Figures 5-6 and 12-14).
  • the use of a miRtron even enhances frans-splicing which might be due to the fact that the miRtron functions like an intron and recruits the spliceosome for its own c/ ' s-splicing which subsequently facilitates the frans-splice reaction as well.
  • both, the frans-splicing molecule and the RNAi effector can be encoded by a single DNA vector facilitates the use of any state-of-the-art delivery system including the use of viral delivery vectors which can carry only a single recombinant viral genome. That is important for therapeutic applications in vivo since it would be very unlikely that a single cell can be successfully targeted with two different genetic vectors.
  • frans-splicing RNA and RNAi act synergistically to replace a defect and so restore normal gene function and prevent any defective products being translated into protein products, respectively.
  • This combined strategy is essential to compensate for incomplete frans-splicing activities and so to successfully target deleterious transcripts thus preventing any related diseases.
  • This invention describes a significant improvement of spliceosome-mediated RNA frans-splicing by combining it with RNAi technology.
  • the amalgamation of RNA frans-splicing with the RNAi technology triggers clinically relevant efficiencies of functional genetic repair enabling the treatment of previously incurable genetic disorders.
  • RNA frans-splicing The amalgamation of two technologies which are commonly used separately, namely spliceosomal RNA frans-splicing and RNA interference, to achieve a significant improvement and broaden/expand applications of RNA frans-splicing towards previously incurable inherited and acquired genetic disorders.
  • the technology can be applied but is not restricted to (i) genetic disorders that are associated with point mutations of cellular genes. Examples are color blindness, cystic fibrosis, hemochromatosis, hemophilia, phenylketonuria, polycystic kidney disease, sickle cell disease, Tay-Sachs disease, and various cancers. A complete list can be found under http://www.qenome.qov/10001204 and includes:
  • diseases associated with the expression of specific disease markers including oncogenes, cancer genes, and viral transcripts (e.g. HIV, HPV).
  • RNA frans- splicing and RNA interference Figure 7
  • These vectors can be any state of the art gene delivery system that contains or allows synthesis of therapeutic frans-splicing RNA and RNAi effector molecules.
  • frans-splicing RNA and RNAi act synergistically, we suggest because they are compartmentally separated in cells, to replace a genetic defect with an intact gene function.
  • Trans-splicing patents see (a) Aescu Life GmbH, Eul J. (2002). (WO/2003/016537) Method for repairing a mutant RNA from a DNA with genetic defects and for the programmed death of tumour cells by RNA frans-splicing as well as a method for identifying naturally frans-spliced cellular RNA. (b) Mitchell Lloyd G. and Garcia- Bianco, Mariano A. (1998) Methods and compositions for use in spliceosome- mediated RNA trans-spWcmg. United States Patent 6083702.
  • RNAi a potential new class of therapeutic for human genetic disease.

Abstract

L'invention concerne un procédé permettant de réaliser un traitement de remplacement génique fonctionnel à l'aide d'une combinaison d'un trans-épissage d'ARN et d'un ARNi ; au moins un vecteur et/ou au moins une molécule d'acide nucléique destiné à être utilisé dans ledit procédé ; et une composition thérapeutique ou pharmaceutique également destinée à être utilisée dans ledit procédé comportant le ou les vecteurs et/ou la ou les molécules d'acide nucléique.
PCT/SG2016/050350 2015-07-27 2016-07-26 Traitement de remplacement génique fonctionnel WO2017018937A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB1513151.9 2015-07-27
GBGB1513151.9A GB201513151D0 (en) 2015-07-27 2015-07-27 Functional gene replacement therapy

Publications (1)

Publication Number Publication Date
WO2017018937A1 true WO2017018937A1 (fr) 2017-02-02

Family

ID=54106628

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/SG2016/050350 WO2017018937A1 (fr) 2015-07-27 2016-07-26 Traitement de remplacement génique fonctionnel

Country Status (2)

Country Link
GB (1) GB201513151D0 (fr)
WO (1) WO2017018937A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019060779A1 (fr) * 2017-09-22 2019-03-28 City Of Hope Oligonucléotides inhibiteurs d'épissage

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005070948A1 (fr) * 2004-01-23 2005-08-04 Intronn, Inc. Correction de defauts genetiques lies a l'alpha-1-antitrypsine par transepissage d'arn a mediation par spliceosome
WO2010012472A1 (fr) * 2008-07-30 2010-02-04 Johann Bauer Molécules de trans-épissage de pré-arnm (rtm) perfectionnées et leurs utilisations

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005070948A1 (fr) * 2004-01-23 2005-08-04 Intronn, Inc. Correction de defauts genetiques lies a l'alpha-1-antitrypsine par transepissage d'arn a mediation par spliceosome
WO2010012472A1 (fr) * 2008-07-30 2010-02-04 Johann Bauer Molécules de trans-épissage de pré-arnm (rtm) perfectionnées et leurs utilisations

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
BERGER A ET AL.: "mRNA trans-splicing in gene therapy for genetic diseases", WIRES RNA, vol. 7, 2016, pages 487 - 498, XP055351384 *
KOLLER U ET AL.: "Trans-Splicing Improvement by the Combined Application of Antisense Strategies", INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES, vol. 16, 6 January 2015 (2015-01-06), pages 1179 - 1191, XP055333419 *
SHABABI M ET AL.: "Combination of SMN Trans-Splicing and a Neurotrophic Factor Increases the Life Span and Body Mass in a Severe Model of Spinal Muscular Atrophy", HUMAN GENE THERAPY, vol. 22, 2011, pages 135 - 144, XP055056236 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019060779A1 (fr) * 2017-09-22 2019-03-28 City Of Hope Oligonucléotides inhibiteurs d'épissage
US11104902B2 (en) 2017-09-22 2021-08-31 City Of Hope Splice inhibiting oligonucleotides
US11767530B2 (en) 2017-09-22 2023-09-26 City Of Hope Splice inhibiting oligonucleotides

Also Published As

Publication number Publication date
GB201513151D0 (en) 2015-09-09

Similar Documents

Publication Publication Date Title
EP2925866B1 (fr) Arn circulaire destiné à l'inhibition de micro-arn
CN110352244B (zh) 化学修饰的编辑rna的单链寡核苷酸
Izquierdo et al. Regulation of Fas alternative splicing by antagonistic effects of TIA-1 and PTB on exon definition
Dal Mas et al. Improvement of SMN2 pre-mRNA processing mediated by exon-specific U1 small nuclear RNA
TW202043249A (zh) 編輯rna的方法和組合物
WO2005070948A1 (fr) Correction de defauts genetiques lies a l'alpha-1-antitrypsine par transepissage d'arn a mediation par spliceosome
US9074207B2 (en) Modified human U1snRNA molecule, a gene encoding for the modified human U1snRNA molecule, an expression vector including the gene, and the use thereof in gene therapy
US20240075051A1 (en) TRANS-SPLICING RNA (tsRNA)
EP3219803A1 (fr) Transposons « sleeping beauty » améliorés, kits et procédés de transposition
WO2018053632A1 (fr) Procédés de modification du gène de la dystrophine et de restauration de l'expression de la dystrophine et leurs utilisations
Dooley et al. Spliceosome-mediated pre-mRNA trans-splicing can repair CEP290 mRNA
US7972816B2 (en) Efficient process for producing dumbbell DNA
EP3302522B1 (fr) Moyens et procédés pour le traitement de la dystrophie facio-scapulo-humérale
Poddar et al. RNA structure design improves activity and specificity of trans-splicing-triggered cell death in a suicide gene therapy approach
TWI382849B (zh) 產生藉由基因靜默效應以用於皮膚維護之化妝品的方法以及編碼基因靜默效應物之基因重組核苷酸
WO2022159402A1 (fr) Composition et procédé d'ingénierie génomique à multiplexage élevé à l'aide de réseaux crispr synthétiques
Economos et al. Antispacer peptide nucleic acids for sequence-specific CRISPR-Cas9 modulation
WO2017018937A1 (fr) Traitement de remplacement génique fonctionnel
Yoshimoto et al. 4.5 SH RNA counteracts deleterious exonization of SINE B1 in mice
WO2020065062A1 (fr) Inhibiteurs d'activité hors cible pour des endonucléases guidées
IL295284A (en) Preparations and methods for the treatment of neurodegenerative diseases
WO2020148400A1 (fr) Oligonucléotides antisens destinés à être utilisés dans le traitement d'un crpc
WO2023130959A1 (fr) Arnsn ciblant un pré-arnm de ush2a et son application
JP2018007589A (ja) インビボクローニング可能な細胞株をスクリーニングするための方法、インビボクローニング可能な細胞株の製造方法、細胞株、インビボクローニング方法、及びインビボクローニングを行うためのキット
Pandey et al. Post-transcriptional gene regulation: an overview

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16830931

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16830931

Country of ref document: EP

Kind code of ref document: A1