WO2017018937A1 - Functional gene replacement therapy - Google Patents

Functional gene replacement therapy Download PDF

Info

Publication number
WO2017018937A1
WO2017018937A1 PCT/SG2016/050350 SG2016050350W WO2017018937A1 WO 2017018937 A1 WO2017018937 A1 WO 2017018937A1 SG 2016050350 W SG2016050350 W SG 2016050350W WO 2017018937 A1 WO2017018937 A1 WO 2017018937A1
Authority
WO
WIPO (PCT)
Prior art keywords
frans
splicing
vector
gene
rnai
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/SG2016/050350
Other languages
French (fr)
Inventor
Volker Patzel
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
National University of Singapore
Original Assignee
National University of Singapore
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by National University of Singapore filed Critical National University of Singapore
Publication of WO2017018937A1 publication Critical patent/WO2017018937A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111General methods applicable to biologically active non-coding nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • C12N2310/141MicroRNAs, miRNAs
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/351Conjugate
    • C12N2310/3519Fusion with another nucleic acid
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/33Alteration of splicing

Definitions

  • the invention concerns a method for effecting functional gene replacement therapy; at least one vector and/or at least one nucleic acid molecule for use in said method; and a therapeutic or pharmaceutical composition also for use in said method including said at least one vector and/or at least one nucleic acid molecule.
  • the invention has use in the medical and veterinary field. Background of the Invention
  • Acquired and/or inherited genetic disorders are often characterized by the presence of defective or aberrant gene transcripts and gene products which can be caused by abnormalities in chromosomes, genes, and gene expression.
  • these disorders include cancers, storage disorders, asthma, diabetes, mental retardation, obesity, heart disease, autoimmune diseases, and infections with viruses such as HIV and HPV which integrate their genome into the host's genome.
  • These disorders currently are treated symptomatically i.e. by administration of drugs which treat the symptoms rather than the genetic causes of the diseases although it is acknowledged that a causal treatment, i.e. one that addresses the cause of the disorder, is the only chance of a cure.
  • a causal treatment implies the usage of genetic tools suitable to resolve the genetic defects.
  • RNAi RNA interference
  • RNA frans-splicing allows one to repair genetic defects at the RNA level by replacing a defect with an intact function ( Figure 1 ).
  • Trans-splicing is a special form of RNA processing in eukaryotes where exons from two different primary RNA transcripts are joined end to end and ligated.
  • frans-splicing results in an RNA transcript that comes from multiple RNA polymerases on the genome.
  • frans-splicing describes splice reactions between two different pre-mRNAs.
  • RNA frans-splicing is undertaken by the spliceosome which is a large and complex molecular machine composed of five small nuclear RNAs (snRNA), and a range of associated protein factors.
  • the spliceosome removes introns from a transcribed pre- mRNA segment. This process is generally referred to as splicing.
  • RNA frans-splicing in the following referred to as RNA frans-splicing or frans-splicing, is a gene therapy approach that uses a cell's spliceosome to combine two distinct pre-mRNAs to produce a chimeric mature mRNA.
  • frans-splicing typically replaces a disease causing gene portion with a wild-type portion.
  • RNA frans-splicing represents a technology that is able to repair defective gene expression at the level of precursor messenger RNA (pre-mRNA); without any need to interfere with genomic DNA [1 -3]. Trans-splicing may occur naturally, however for therapeutic purposes an artificial frans-splicing RNA (tsRNA) is created to target a deleterious cellular pre-mRNA.
  • pre-mRNA precursor messenger RNA
  • tsRNA frans-splicing RNA
  • a frans-splicing RNA is composed of three functional domains: (i) an antisense binding domain that is specific for the respective target message, (ii) a coding domain expressing a recombinant therapeutic gene or exon, and (iii) a splicing domain that includes all functional sequences required for spliceosomal splicing such as splice sites, a branch point, a polypyrimidine tract, splice enhancers etc.
  • RNA frans-splicing can be used for 5' terminal (5'ER), internal (iER), or 3' terminal (3'ER) exon replacement.
  • the frans-splicing technology allows molecular-surgical repair of defective gene functions and, hence, frans-splicing has high therapeutic potential compared with RNAi technology.
  • RNA interference also called post transcriptional gene silencing (PTGS) represents an evolutionary conserved mechanism of post-transcriptional gene silencing in higher eukaryotes including mammals and humans [4-6].
  • RNAi is undertaken by microRNAs (miRNAs), siRNAs, shRNAs, and piRNAs any of which can be endogenously expressed within or exogenously delivered into the target cells. Endogenous expression usually starts with the transcription of nuclear precursor molecules which are then exported into the cytoplasm where they are processed to finally trigger the formation of RNA-induced silencing complexes (RISC).
  • RISC contains the so-called guide RNA sequence and provided that is complementary to a messenger RNA target the RISC can trigger target gene knockdown.
  • a method of gene therapy comprising:
  • RNAi molecule having a sequence of nucleotides that is complementary to a cellular version of said target nuclear transcript
  • RNA interference of said cellular version of said target nuclear transcript takes place to prevent the function of a protein encoded thereby or to support the death of the pre-mRNA transcript or its product.
  • Reference herein to a frans-splicing RNA molecule is a molecule that interacts with a target precursor mRNA molecule and mediates a frans-splicing event to generate a novel chimeric mRNA that can be processed in the cell to yield a protein product.
  • said target nuclear transcript encodes a defective gene product, typically a defective protein and so said target nuclear transcript is a target defective nuclear transcript.
  • Reference herein to a target defective nuclear transcript is reference to a transcript of a defective gene which transcript carries or encodes the said defect whereby a defective gene protein product is ultimately produced following cellular translation.
  • Reference herein to a cellular version of said target nuclear transcript, defective or otherwise, is reference to the same or a modified version of said target (defective) nuclear transcript when outside the cell nucleus.
  • said molecules are delivered to said target cell using conventional delivery technologies well known to those skilled in the art including but not restricted to transfection, lipofection, electroporation, nucleofection, jet-injection, gene gun, and needle injection.
  • said molecules are delivered to said target cell using conventional delivery routes well known to those skilled in the art including but not restricted to topical, intravenous, intramuscular, oral, cutaneous, subcutaneous, intraperitoneal, nasal, intra-tracheal, systemic, and intratumoral.
  • said delivery is undertaken using a viral vector that encodes said frans-splicing RNA molecule or RNAi molecule and that can transfect or transform said cell and in either case said vector is suitably equipped to ensure the frans-splicing RNA molecule or RNAi molecule is manufactured in said cell following transfection or transformation.
  • said delivery is undertaken using a viral vector and/or plasmid that encodes said frans-splicing RNA molecule or RNAi molecule and that can transfect or transform said cell and in either case said vector is suitably equipped to ensure the frans- splicing RNA molecule or RNAi molecule is manufactured in said cell following transfection or transformation.
  • said viral vector includes, but is not restricted to, retroviral vectors, lentiviral vectors, adenoviral vectors, and adeno-associated viral vectors (AAV).
  • said delivery is undertaken using a non-viral vector that encodes said frans-splicing RNA molecule or RNAi molecule and that can transfect or transform said cell and in either case said non-viral vector is suitably equipped to ensure the frans-splicing RNA molecule or RNAi molecule is manufactured in said cell following transfection or transformation.
  • said non-viral vector includes, but is not restricted to, liposomes, nanoparticles, polymer capsules, and conjugates containing peptides including cell penetrating peptides, proteins including antibodies or receptors, sugars, lipids, nucleic acids, and steroids.
  • said delivery is undertaken using a naked nucleic acid vector that encodes said frans-splicing RNA molecule or RNAi molecule and that can transfect or transform said cell and in either case said vector is suitably equipped to ensure the frans- splicing RNA molecule or RNAi molecule is manufactured in said cell following transfection or transformation.
  • Said naked nucleic acid vector includes but is not restricted to plasmids, cosmids, DNA minicircles, dumbbell-shaped DNA vectors, and RNA.
  • a single one of the above referenced vectors is used to deliver both said frans-splicing RNA molecule and said RNAi molecule and so said single vector encodes both said frans-splicing RNA molecule and RNAi molecule.
  • Said single vector comprises either two separate expression cassettes or a single expression cassette to express the frans-splicing RNA and the RNAi molecule.
  • Said single expression cassette includes but is not restricted to a gene expressing a frans-splicing RNA that harbours an intronic miRNA or shRNA or a miRtron.
  • a single vector is used to deliver the frans- splicing RNA, the RNAi molecule, and as a third component the recombinant wild-type therapeutic gene.
  • said frans-splicing RNA molecule comprises a binding domain that is specific for the target pre-mRNA and so comprises a sequence of nucleotides that recognizes or is complementary to a sequence encoding a selected region of a gene, typically having a genetic defect, ideally said region is upstream or downstream of a particular exon to be spliced and so most preferably said region comprises intronic DNA.
  • said frans-splicing RNA molecule comprises two binding domains complementary to regions either side of the exon(s) to be spliced.
  • said frans-splicing RNA molecule comprises a wild-type therapeutic gene or exon which when spliced into a target defective nuclear transcript restores the wild- type function of said transcript and so enables the production of an effective gene protein product.
  • said wild-type therapeutic gene or exon comprises recombinant RNA.
  • said frans-splicing RNA molecule comprises a sequence of nucleotides encoding an apoptotic signal leading to the selective destruction of said protein encoded by said transcript and ultimately the target cell.
  • the synergism of trans- splicing and RNAi can be relevant for suicide gene therapy where, for example, oncogene transcripts can be targeted by frans-splicing with apoptotic/death signals to ultimately selectively destroy/kill for example cancer cells.
  • This effect is boosted when co-targeting the oncogene transcript with RNAi because many cancer cells require oncogene expression and so suppression of oncogene function often triggers cell death.
  • a frans-splicing RNA molecule having at least one apoptotic/death signal that triggers death of the corresponding transcript or its product and the co-use of a RNAi molecule having a sequence of nucleotides that is complementary to a cellular version of the target nuclear transcript to prevent the function of a protein encoded thereby supports the death of the target cell.
  • said frans-splicing RNA molecule comprises functional sequences required for spliceosomal splicing such as splice sites, a branch point, a polypyrimidine tract, and splice enhancers.
  • RNA frans- splicing can be used for 5' terminal (5'ER), internal (iER), or 3' terminal (3'ER) exon replacement. All these variations from part of the invention and are well known to those skilled in the art.
  • said RNAi molecule is a micro RNA (miRNAs) and/or a siRNA either of which can be endogenously expressed within or exogenously delivered into the target cells. Endogenous expression usually starts with the transcription of nuclear precursor molecules (e.g. DNA molecules) which are then exported into the cytoplasm where they are processed to finally trigger the formation of RNA-induced silencing complexes (RISC).
  • nuclear precursor molecules e.g. DNA molecules
  • RISC RNA-induced silencing complexes
  • said RNAi molecule is a endogenously transcribed small hairpin (sh)RNA precursor which is processed by Dicer only after nuclear export within the cytoplasm triggering the formation of RISC.
  • said RNAi molecule comprises a sequence of nucleotides that is complementary to a defective cellular version of said target nuclear transcript.
  • the RNAi used is therefore specifically targeting the defect/mutated exon, not it's functionally intact counterpart.
  • said RNAi molecule comprises a sequence of nucleotides that provides for perfect pairing with said target nuclear transcript or said defective cellular version of said target nuclear transcript.
  • said frans-splicing RNA molecule and said RNAi molecule are co-delivered exogenously into target cells using various delivery technologies.
  • either or both said frans-splicing RNA molecule and said interfering RNAi molecule are transcribed endogenously from a vector or plasmid encoding same and, ideally, a single vector or plasmid.
  • said vector and/or plasmid further encodes a selected recombinant therapeutic gene with a view to treating the disorder that ensues when said target defective nuclear transcript is present.
  • RNAi will not target unspliced transcripts ( Figures 2 and 3) thus both corrective mechanisms can be used at the same time to achieve a dual purpose which is either i) to restore gene function and prevent the effect of any defective genes or ii) to destroy cells expressing aberrant, including oncogenic, gene functions.
  • a vector or plasmid comprising:
  • At least one nucleic acid molecule encoding at least one RNAi molecule having a sequence of nucleotides that is complementary to a cellular version of said target nuclear transcript.
  • said target nuclear transcript is defective.
  • a therapeutic for treating a gene defect disorder comprising said vector or plasmid.
  • a therapeutic for treating a gene defect disorder comprising: a) at least one nucleic acid molecule encoding at least one frans-splicing RNA molecule having i) at least one sequence of nucleotides complementary to a target nuclear transcript comprising pre-mRNA, ii) at least one wild-type therapeutic gene or exon or at least one gene or exon encoding an apoptotic/death signal and iii) at least one functional sequence required for spliceosomal splicing; and
  • a pharmaceutical composition comprising a therapeutic according to the invention and at least one carrier.
  • said therapeutic or pharmaceutical composition is formulated for mammalian and ideally human use.
  • Figure 1 shows a schematic depiction of different gene therapy approaches. Displayed are cross sections through mammalian or human cells. Nuclear genomic DNA is being transcribed to single-stranded messenger RNA (mRNA) which is subsequently being spliced and exported into the cytoplasm where protein synthesis takes place. A defect (red) gene can lead to a defect mRNA and finally code for a defect or gene function/protein.
  • the classical gene therapy approach is based on gene complementation of the defect with an intact (green) gene function. As a result, targeted cell carry both the defect and the recombinant intact function (lower part). Some defect proteins are pathogenic or carcinogenic. In such a case it is more promising to block the aberrant function using antisense or RNAi technologies i.e.
  • RNAi-based inhibition (upper part). In the consequence however targeted cells lose a gene function. RNA frans-splicing based repair, allows repairing the defect function or exon on the pre-mRNA level. In that case the corrected gene function replaces the defect function which is basically the most desirable outcome (middle part).
  • Figure 2 shows enhancement of apparent frans-splicing efficacy by RNAi. Compartmental separation of splicing and RNAi allows for selective cytoplasmic destruction of aberrant c/ ' s- spliced transcripts which escaped therapeutic nuclear frans-splicing.
  • C Cytoplasm
  • N Nucleus
  • e exon
  • i intron
  • Red defect sequence
  • green intact sequence.
  • Trans-splicing RNAs providing the intact sequences and siRNAs are not depicted in this figure.
  • Figure 3 shows examples how an siRNA effector molecule can be co-delivered together with a frans-splicing RNA expression vector.
  • A Co-delivery of a chemically synthesised siRNA.
  • B Co-delivery of a seperate shRNA expression vector.
  • C Co-delivery as independent shRNA expression cassette implemented into the frans-splicing RNA expression vector.
  • D Co-delivery as miRtron implemented into the trans-splicing RNA expression cassette. Splicing of the miRtron will generate the shRNA or miRNA precursor which can then be exported into the cytoplasm in a Drosha- and Exportin-5-independent manner.
  • Figure 4 shows a detailed molecular illustration of synergies between RNA frans-splicing and RNA interference.
  • A for frans-splicing-based 5' exon replacement
  • B for frans-splicing- based 3' exon replacement
  • C for frans-splicing-based internal exon replacement.
  • the siRNA used is specifically targeting the defect/mutated exon, not it's functionally intact counterpart. Due to the subcellular compartmentalization, the siRNA can exert its silencing potential only in the cytoplasm, i.e. target the defect/mutated exon exclusively on the level of the c/ ' s-spliced cytoplasmic target message but not on the level of the nuclear un-spliced pre- mRNA. That is, RNAi cannot negatively interfere with frans-splicing but instead support frans-splicing-based replacement of aberrant gene functions.
  • FIG 5 shows experimental proof of synergies (no negative interference) between RNA frans-splicing-based 3' exon replacement and RNAi.
  • the RNAi effector was co-delivered as exogenously synthesised siRNA (scenario A, Figure 3).
  • the alpha-fetoprotein (AFP) pre-mRNA was targeted with a frans-splicing RNA that replaces the 3' terminal exons 6 to 14 of the endogenous transcript or exon 6 of an exogenously delivered recombinant transcript encompassing only the exons 3 to 6 by a sequence coding for the herpes simplex virus thymidine kinase (HSVtk).
  • HSVtk herpes simplex virus thymidine kinase
  • the HepG2 target cells were co-transfected with a vector expressing AFP exons 3 to 6, a vector expressing the frans-splicing RNA, and the siRNA which was directed against AFP exon 6 using lipofection.
  • Total cellular RNA was isolated 24 hours post transfection and both, the c/ ' s-spliced and the frans-spliced AFP message was quantified using real-time reverse transcriptase (rtRT-)PCR.
  • A knockdown of c/ ' s-spliced AFP mRNA by the exon 6-targeting siRNA.
  • B dose response curve of knockdown in A.
  • C knockdown of the c/ ' s-spliced AFP message illustrated by ACt values.
  • the siRNA has no effect on frans-spliced AFP mRNA levels as depicted by ACt values.
  • ACt C spiicedAFP - Ct P - ac tin- Data represent mean values of three independent experiments. Error bars indicate mean deviations from the averages. P values were calculated using a student's t-test. * : p ⁇ 0.05, ** : p ⁇ 0.01 ; *** : p ⁇ 0.001 .
  • Figure 6 shows experimental proof of synergies (no negative interference) between RNA frans-splicing-based 5' exon replacement and RNAi. The RNAi effector was co-delivered as exogenously synthesised siRNA (scenario A, Figure 3).
  • the AFP pre-mRNA was targeted with a frans-splicing RNA that replaces the 5' terminal exons 1 to 3 of the endogenous transcript or exon 3 of an exogenously delivered recombinant transcript encompassing only the exons 3 to 6 by a sequence coding for the HSVtk.
  • the HepG2 target cells were co-transfected with a vector expressing AFP exons 3 to 6, a vector expressing the frans-splicing RNA, and the siRNA which was directed against AFP exon 3 using lipofection.
  • RNA Total cellular RNA was isolated 24 hours post transfection and both, the c/ ' s-spliced and the frans-spliced AFP message was quantified using rtRT-PCR.
  • A knockdown of c/ ' s-spliced AFP mRNA by the exon 3-targeting siRNA.
  • B dose response curve of knockdown in A.
  • C knockdown of the c/ ' s-spliced AFP message illustrated by ACt values.
  • D the siRNA has no effect on frans-spliced AFP mRNA levels as depicted by ACt values.
  • ACt Ct cis - S pi iC edAFP - Ctp-actin- Data represent mean values of three independent experiments. Error bars indicate mean deviations from the averages. P values were calculated using a student's t-test. * : p ⁇ 0.05, ** : p ⁇ 0.01 ; *** : p ⁇ 0.001
  • Figure 7 shows an exemplary suggested design of gene therapy vectors.
  • a single vector contains two (b and c) or three (a, b, and c) functional elements which support the replacement of a defect by an intact gene function: a, the recombinant therapeutic version of the defect endogenous gene the expression of which complements the defect with the intact gene function; b, a gene expressing a frans-splicing RNA suitable to repair the defect target message on the pre-mRNA level in the nucleus; and c, a gene coding for siRNA precursor, a small hairpin (sh)RNA, specifically targeting the defect/mutated exon of the target message in the cytoplasm.
  • siRNA precursor a small hairpin (sh)RNA
  • shRNAs are exported from the nucleus into the cytoplasm recruiting the exportin-5 dependent pathway and will then be recognised and processed in the cytoplasm by dicer to generate the siRNA, trigger RISC formation, and knockdown of c/ ' s-spliced target messages that escaped nuclear frans-splicing.
  • the combination of functional elements b and c allows partly replacement of the defect by an intact gene function with simultaneous elimination of the defect gene function on the RNA level.
  • the combination of functional elements a to c can in addition either fully restore native expression levels of the intact target gene or trigger its over-expression.
  • FIG 8 shows experimental proof of synergies (no negative interference) between RNA frans-splicing-based 3' exon replacement and RNAi.
  • the frans- splicing RNA and the RNAi effector (shRNA) were encoded on separate plasmid vectors (scenario B, Figure 3).
  • the alpha-fetoprotein (AFP) pre-mRNA was targeted with a trans- splicing RNA that replaces the 3' terminal exons 6 to 14 of the endogenous transcript or exon 6 of an exogenously delivered recombinant transcript encompassing only the exons 3 to 6 by a sequence coding for the herpes simplex virus thymidine kinase (HSVtk).
  • HSVtk herpes simplex virus thymidine kinase
  • the HepG2 target cells were co-transfected with 500ng a vector expressing AFP exons 3 to 6, 500ng of a vector expressing the frans-splicing RNA, and 500ng of a vector expressing an shRNA which was directed against AFP exon 6 using lipofection.
  • Total cellular RNA was isolated 24 hours post transfection and both, the c/ ' s-spliced and the frans-spliced AFP message was quantified using real-time reverse transcriptase (rtRT-)PCR.
  • rtRT- real-time reverse transcriptase
  • FIG 9 shows experimental proof of synergies (no negative interference) between RNA trans-splicing-based 5' exon replacement and RNAi.
  • the trans- splicing RNA and the RNAi effector (shRNA) were encoded on the same plasmid vector (scenario C, Figure 3).
  • the alpha-fetoprotein (AFP) pre-mRNA was targeted with a trans- splicing RNA that replaces the 5' terminal exons 1 to 3 of the endogenous transcript or exon 3 of an exogenously delivered recombinant transcript encompassing only the exons 3 to 6 by a sequence coding for the HSVtk.
  • AFP alpha-fetoprotein
  • the HepG2 target cells were co-transfected with 500ng of a vector expressing AFP exons 3 to 6 and 500ng of a vector expressing both the trans- splicing RNA and the shRNA which was directed against AFP exon 3 using lipofection.
  • Total cellular RNA was isolated 24 hours post transfection and both, the c/ ' s-spliced and the trans- spliced AFP message was quantified using real-time reverse transcriptase (rtRT-)PCR.
  • rtRT- real-time reverse transcriptase
  • FIG 10 shows experimental proof of synergies between RNA frans-splicing-based 3' and 5' exon replacement and RNAi.
  • the frans-splicing RNA and the RNAi effector (shRNA) were encoded by the same transcription cassette with the shRNA implemented as a miRtron into the HSVtk mRNA (scenario D, Figure 3).
  • the miRtron has no negative effect on frans-splicing but instead enhances the frans-splicing activity.
  • HepG2 target cells were co-transfected with 500ng a vector expressing AFP exons 3 to 6 and a vector expressing the trans-splicing RNA together with an AFT-targeting miRtron using lipofection.
  • A Co-transfection of 500ng of the 3'EL construct.
  • B Co-transfection of 150ng of the 5'EL construct.
  • C Co-transfection of 500ng of the 5'EL construct.
  • Total cellular RNA was isolated 24 hours post transfection and both, the c/ ' s-spliced and the frans-spliced AFP message was quantified using real-time reverse transcriptase (rtRT-)PCR.
  • rtRT- real-time reverse transcriptase
  • FIG 11 comparing the efficiency of shRNAs in knocking down the AFP mini-gene target with real time RT-PCR using (a) 3'AFP probe and (b) 5'AFP probe.
  • the shRNAE3a and shRNAE3b targets AFP exon 3 and shRNAE6a and shRNAE6b targets AFP exon 6.
  • the "a” denotes conventional perfect pairing miRNA hairpin precursor and the "b" contains two bulges in the guide sequence.
  • Figure 12 relative mRNA expression checking the levels of escaped c/s-spliced AFP and frans-splicing when specific shRNAs are introduced as separate vector.
  • Figure 13 relative mRNA expression checking the levels of escaped c/s-spliced AFP and frans-splicing when specific shRNAs are cloned into the trans-splicing cassette as a single vector system.
  • shRNAs E6a and E6b fused with frans-splicing vector on (a) 3' c/ ' s-splicing and (b) 3' frans-splicing.
  • Figure 14 relative mRNA expression checking the levels of escaped c/s-spliced AFP and frans-splicing when specific shRNAs (mirtrons) are cloned into the HSV-tk coding region of frans-splicing cassette as a single vector system.
  • shRNAs E6a and E6b mirtron fused with frans-splicing vector on (a) 3' c/ ' s-splicing and (b) 3' frans-splicing.
  • siRNA Design siRNAs targeting exon 3 of AFP and exon 6 of AFP were designed following the protocols proposed previously [8,9]. siRNA targeting luciferases was previously described [8]. The selected siRNA sequence was summarized in Table 1 and ordered from Dharmacron Thermo Scientific.
  • siRNA_E6 sense 5'-AUUAAGAGAAAGCAGCUUGdTdT-3' (SEQ ID NO:1 ); antisense 5'- CAAGCUGCUUUCUCUUAAUUC-3' (SEQ ID NO:2)
  • siRNA_E3 sense 5'-AGUCUUCAGGGUGUUUAGAdTdT-3' (SEQ ID NO:3), antisense 5'- UCUAAACACCCUGAAGACUGU-3' (SEQ ID NO:4)
  • DMEM Dulbecco's Modified Eagle Medium
  • FBS fetal bovine serum
  • siRNA various concentration (0, 0.1 , 1 , 10, 100 pmol/uL) were co-transfected 14 hours after plating using lipofectamine 2000 TM or 3000 TM (Introvigen) in Opti-MEM (Introvigen) following the manufacturer's protocol.
  • frans-splicing constructs pVAX1 -AFP, shRNA, combined frans-splicing-shRNA constructs or mirtron constructs were co-transfected.
  • total DNA was topped up with empty pSuper vector to transfect all cells with the same total amount of DNA.
  • Successfully transfected Hep G2 cells were cultured in DMEM supplemented with 10% fetal bovine serum (FBS) and 1 % of penicillin-streptomycin (P-S) overnight.
  • FBS fetal bovine serum
  • P-S penicillin-streptomycin
  • Target mRNA was previously designed by S. Poddar according to endogeously express part of the alpha fetoprotein (AFP) from a DNA minigene plasmid.
  • AFP alpha fetoprotein
  • the AFP minigene consisted of exon 3, intron 3, linked exons 4 and 5, intron 5 and exon 6. It was introduced into the pVAX1 plasmid which harbors a Kanamycin resistance with a cytomegalovirus (CMV) promoter (pVAX1 -AFP).
  • CMV cytomegalovirus
  • frans-splicing RNA constructs 7rans-splicing RNA constructs 3'PAR and 5'PAR for 3' exon replacement (ER) or 5' ER were designed including a target binding domain, a splicing domain, and a coding domain (which in this case was a gene for HSVtk expression), and synthesized by GeneArt® (Life Technologies).
  • 3'PAR interacts with AFP minigene mRNA (target mRNA) and undergoes 3'exon labeling (3'EL) by excising and replacing exon 6 with the domain which encodes the Herpes simplex virus thymidine kinase (HSV-TK). It was designed with:
  • a binding domain in antisense orientation to intron 5 of the AFP minigene i.
  • a splicing domain with a 3' active splice signal, a branch point consensus and a polypyrimidine tract i.
  • iii A coding domain which encodes the HSV-TK but a deletion of the translational start codon to prevent translation in the absence of frans-splicing, iv. A poly-adenosine tail to confer correct processing of the frans-splice product.
  • 5'PAR was designed for 5'exon labeling (5'EL) in which exon 3 is excised and replaced with coding domain of HSV-TK and it consists of: i. A splicing domain containing a 5' splice site,
  • shRNA Polycistronic shRNA plasmids obtained from the GeneArt® Gene synthesis service (Life Technologies). Two 21 -nucleotides shRNA guide strands, targeting exon 3 and exon 6 of AFP were generated. Selection of guide sequence candidates were done according to the criteria for in silico selection of siRNA (Patzel, 2007). Selected shRNA guide strands were further extended with additional two nucleotides at both 3' and 5' ends, forming 25-nucleotide elongated shRNA guide strands.
  • 25-nucleotide elongated shRNA guide strands in this article were selected to fold an open secondary structure with high Gibbs free energy, AG predicted by Mfold (Zuker, 2003). Both guide strands were used to replace mature miRNA sequences within human precursor miRNA (pre-miRNA) structures selected from the miRBase namely hsa-miR-4699, hsa-miR-3116-1 , hsa-miR-106b and hsa-miR-20a [10-14], forming Dicer substrate shRNAs.
  • pre-miRNA human precursor miRNA
  • Exon 3 targeting guide strand replaced hsa-miR-4699 and hsa-miR-106b, while exon 6 targeting guide strand replaced hsa-miR-3116-1 and hsa-miR-20a.
  • the shRNA constructs derived from the replacement of mature sequences of human miRNAs by guide strands were labeled as shRNA_E3_a (or shRNAI ), shRNA_E3_b (or shRNA3), shRNA_E6_a (or shRNA2) and shRNA_E6_b (or shRNA4) respectively.
  • the passenger strand of shRNAs were modified such that identical secondary structures to original miRNAs were maintained.
  • shRNA_E3_a 5'-AGCAAGAACAGUCUUCAGGGUGUUUAGAAAUGAUUAAGAAAUUUUC GUAAACACCCUGAAGACUGUUCUUGCU-3' (SEQ ID NO:5)
  • shRNA_E6_a 5'-CUUUAUAAGAAUUAAGAGAAAGCAGCUUGUUUGGGUAUCGUAGAAC AAGCUGCUUUCUCUUAAUUCUUAUAAAG-3' (SEQ ID NO:6)
  • shRNA_E3_b 5'-CCUGCCGGGUUUCUAAACACCCUGAAGACUGUUCUGGUCCUCUCC UUGGAAACUCUUCAGGGUGUUUAUCUAAUCCAGCAGG-3' (SEQ ID NO:7)
  • shRNA_E6_b 5'-GUAGCAUAACAAGCUGCUUUCUCUUAAUUCUGUUUAGUCAUGAAUA AGAGAAAGCAGCUUCAUUAUACUGC-3' (SEQ ID NO:8)
  • a combined frans-splicing RNA molecule and shRNA plasmids in a single plasmid was designed.
  • the design of an artificial mirtron considers rules (i) for the design of a spliceable RNA that (ii) generates an RNAi effector molecule [15].
  • the miR- 1224 was chosen from the miRBase due to its existence in mammalian cells as an endogenous mirtron (Sibley et al., 201 1 ).
  • Mmu-miR-1224 was originally designed as introns within the eGFP plasmid in Sibley et al.'s experiment [16]. In this article, miR-1224 served as the model structure for the design of a mirtron.
  • miR-1224 was predicted by Mfold [17] and RNAfold [18]; both predicted structures were identical.
  • Two shRNA guide strands were designed to replace the seed region of miR-1224.
  • the passenger strands of mirtron-RNAs were modified such that the original secondary structures of the miRNAs were maintained.
  • Final constructs were labelled as mirtron_E3 (or mirtron 1 ) and mirtron_E6 (or mirtron2).
  • miR-1224 5'-GUGAGGACUCGGGAGGUGGAGGGUGGUGCCGCCGGGGCCGGGCGCU GUUUCAGCUCGCUUCUCCCCCCACCUCCUCUCUCCUCAG-3' (SEQ ID NO:9)
  • miRtron_E3 5'-GTCTAAACACCCTGAAGACTGTTCAGCATCATTAGAGCCAGAGTTCTGT CTCAGCTAACACTCCCCGTCTTTAGGGACTTTAGAG-3' (SEQ ID NO:10)
  • miRtron_E6 5'-GTAACAAGCTGCTTTCTCTTAATTCGCATCATTAGAGCCAGAGTTCTGT CTCAGCGATTACTCCCCAGAGAAAGTACGTTGTTAG-3' (SEQ ID NO:1 1 )
  • the cloned mirtron constructs were termed as 5'PAR-mirtron_E3 (or 5'mir1 ) and 3'PAR- mitron_E6 (or 3'mir2).
  • General cloning strategies Approximately two ⁇ g of the basis vector constructs were incubated with 1 ⁇ each of two specific restriction enzymes and 10X Fast Digest Buffer (Thermo Scientific) in a 50 ⁇ reaction at 37°C for two hours, then 80°C for 15 minutes to inactivate the restriction enzymes. Following the digestion, the entire 50 ⁇ digestion mixtures were loaded onto 1 % agarose gels for gel electrophoresis at 90V for one hour. Two bands were observed under UV illumination and desired bands were cut and weighed.
  • the DNA was extracted from the gels using GeneJET Gel Extraction Kit (Thermo Scientific).
  • the vector DNA and the insert DNA were then ligated with 1 ⁇ T4 DNA ligase (Thermo Scientific) at a concentration ratio of one to three (vector to insert) in 20 ⁇ reaction mixture which consists of 10X T4 ligase buffer.
  • the ligation step was carried out at 22 e C for four hours and the T4 ligase was inactivated at 70°C for 15 minutes.
  • a total of 10 ⁇ of the ligation mixture was then transformed into chemically-competent E. coli strain DH5a using a standard transformation protocol.
  • the resulting constructs were termed 3'ER-shRNA2 and 5'ER-shRNA1 .
  • 2pg of frans-splicing RNA constructs, 3'ER or 5'ER and 30pg of cloning plasmid, pSUPER- shRNAI or pSUPER-shRNA2 were digested with 1 ⁇ each of restriction enzymes as summarized in the following table ⁇ Table 2).
  • Cloning of pVAX1 -mirtron The parental frans-splicing constructs, 3'PAR and 5'PAR having two SphI (or Pael) restriction endonuclease cleavage sites at the backbone, could't be used for mirtron cloning. Therefore prior to the introduction of mirtron, the two SphI sites must be diminished.
  • Four primers were designed for PCR of the entire frans-splicing constructs using Pfu DNA polymerase (Thermo Scientific) by introducing a mismatch in one SphI sequence or a total replacement of the SphI restriction site with a BamHI restriction site.
  • FP_pVAX_large and RP_pVAX_large were designed for the PCR of the bigger fragment between two SphI sites while FP pVAX small and RP_pVAX_small were used to PCR amplify the smaller fragment between two SphI sites.
  • Primers were phosphorylated prior to the PCR. Blunt end ligation was carried out after PCR with the addition of PEG4000.
  • Successful clones, 3'PAR_mod and 5'PAR_mod were picked for the cloning of mirtron.
  • Mirtron_E3 and mirtron_E6 were first isolated from the synthesized mirtron_E3_E6 plasmid by GeneArt® with following restriction enzymes: Table 3.
  • RNA isolation and first-strand cDNA synthesis Total RNA from transfected HepG2 cells was isolated using RNeasy Plus Mini Kit (Qiagen) according to the manufacturer's protocol 24 hours or 48 hours post-transfection depending on conditions to be tested. First strand cDNA was synthesized using the Superscript III First-Strand Synthesis Kit (Invitrogen). Approximately 500 ng of total cellular RNA was incubated with 1 ⁇ each of random hexamer and dNTPs at 65°C for five minutes in a 14 ⁇ reaction.
  • First-strand cDNA synthesis with specific primers for detection of shRNA and mirtron processing efficiency First strand sequence specific cDNA was synthesized using the Superscript III First-Strand Synthesis Kit (Invitrogen). Approximately 500 ng of total cellular RNA was incubated with 1 .5 ⁇ of specific stem loop primer and 1 ⁇ of dNTPs at 65 e C for five minutes in a 14 ⁇ reaction. After one minute chill snap, 6 ⁇ of master mix consisting 4 ⁇ of buffer, 0.1 M DTT (1 ⁇ ), RNase OUT (0.5 ⁇ ) and Superscript III reverse transcriptase (0.5 ⁇ ) were added and incubated at 50 e C for two hours, followed by inactivation of the enzyme at 70 e C for 15 minutes.
  • qPCR Real-time Polymerase Chain Reaction
  • Forward and reverse primers (3'FP and 3'RP_c/ ' s for the 3'AFP probe and 5'FP_c/ ' s and 5'RP for the 5'AFP probe) were designed to detect escaped c/ ' s-spliced AFP mRNA while 3'FP and 3'RP_trans for the 3'AFP probe and 5'FP_trans and 5'RP for the 5'AFP probe were designed to detect successful frans-spliced AFP/HSV-tk chimeric mRNA.
  • Primers were designed using Primer Express (Applied Biosystems) with preference for open secondary structures and melting temperatures at around 60 e C.
  • RT primers stem loop primers
  • FP Forward primers recognizing remaining nucleotides that were 2 nucleotides away from the 6 nucleotides mentioned above on miRNA were designed with additional nucleotides at 5' ends for stability and to achieve melting point of 58 to 60 e C qPCR cycle condition were retained for the determination of C, value.
  • AC t values were calculated by subtracting the C t value of ⁇ - actin (endogenous control) from the C t value obtained from real-time qPCR. AAC t was then obtained by subtracting AC X (construct) by AC X (control). A fold change was calculated with the equation of 2 ⁇ AACt . This fold change value was then represented as relative RNA expression in all charts shown in this report. Data shown as 3 experiments made in triplicates. Error bar represents SEM. All statistical analysis were done in GraphPad Prism 5 (Graph Pad Software) using two-tailed unpaired t test for comparison between two constructs and two way ANOVA (multiple comparison) for comparison among multiple constructs against control construct.
  • Trans-splicing RNA vectors and exogenously synthesised siRNAs were co-delivered into target cells using various transfection technologies including lipofectamine 2000 or 3000.
  • the frans-splicing RNA and interfering RNA were transcribed endogenously from a single plasmid or DNA-vector ( Figure 3).
  • RNA frans-splicing and RNAi using alpha- fetoprotein (AFP) a protein whose elevated levels are a known marker for Hodgkin's disease and various types of liver disease such as chronic liver disease and liver cancer.
  • AFP alpha- fetoprotein
  • RNA frans-splicing and RNAi using frans-splicing RNA triggering either 5'ER or 3'ER.
  • AFP alpha-fetoprotein
  • a frans-splicing RNA that either replaces the 3' terminal exons 6 to 14 of the endogenous transcript or exon 6 of an exogenously delivered recombinant transcript encompassing only the exons 3 to 6 by a sequence coding for the herpes simplex virus thymidine kinase (HSVtk).
  • HSVtk herpes simplex virus thymidine kinase
  • the AFP pre-mRNA was targeted with a frans- splicing RNA that replaces the 5' terminal exons 1 to 3 of the endogenous transcript or exon 3 of an exogenously delivered recombinant transcript encompassing only the exons 3 to 6 by a sequence coding for the HSVtk.
  • HepG2 target cells were co-transfected with a vector expressing AFP exons 3 to 6, a vector expressing the frans-splicing RNA, and the siRNA which was directed against AFP exon 6 or exon 3 using lipofection.
  • RNAi-based knockdown of a target gene does not negatively interfere with frans-splicing-based reprogramming (the fusion with the HSVtk) in the same cell ( Figures 5-6 and 12-14).
  • the use of a miRtron even enhances frans-splicing which might be due to the fact that the miRtron functions like an intron and recruits the spliceosome for its own c/ ' s-splicing which subsequently facilitates the frans-splice reaction as well.
  • both, the frans-splicing molecule and the RNAi effector can be encoded by a single DNA vector facilitates the use of any state-of-the-art delivery system including the use of viral delivery vectors which can carry only a single recombinant viral genome. That is important for therapeutic applications in vivo since it would be very unlikely that a single cell can be successfully targeted with two different genetic vectors.
  • frans-splicing RNA and RNAi act synergistically to replace a defect and so restore normal gene function and prevent any defective products being translated into protein products, respectively.
  • This combined strategy is essential to compensate for incomplete frans-splicing activities and so to successfully target deleterious transcripts thus preventing any related diseases.
  • This invention describes a significant improvement of spliceosome-mediated RNA frans-splicing by combining it with RNAi technology.
  • the amalgamation of RNA frans-splicing with the RNAi technology triggers clinically relevant efficiencies of functional genetic repair enabling the treatment of previously incurable genetic disorders.
  • RNA frans-splicing The amalgamation of two technologies which are commonly used separately, namely spliceosomal RNA frans-splicing and RNA interference, to achieve a significant improvement and broaden/expand applications of RNA frans-splicing towards previously incurable inherited and acquired genetic disorders.
  • the technology can be applied but is not restricted to (i) genetic disorders that are associated with point mutations of cellular genes. Examples are color blindness, cystic fibrosis, hemochromatosis, hemophilia, phenylketonuria, polycystic kidney disease, sickle cell disease, Tay-Sachs disease, and various cancers. A complete list can be found under http://www.qenome.qov/10001204 and includes:
  • diseases associated with the expression of specific disease markers including oncogenes, cancer genes, and viral transcripts (e.g. HIV, HPV).
  • RNA frans- splicing and RNA interference Figure 7
  • These vectors can be any state of the art gene delivery system that contains or allows synthesis of therapeutic frans-splicing RNA and RNAi effector molecules.
  • frans-splicing RNA and RNAi act synergistically, we suggest because they are compartmentally separated in cells, to replace a genetic defect with an intact gene function.
  • Trans-splicing patents see (a) Aescu Life GmbH, Eul J. (2002). (WO/2003/016537) Method for repairing a mutant RNA from a DNA with genetic defects and for the programmed death of tumour cells by RNA frans-splicing as well as a method for identifying naturally frans-spliced cellular RNA. (b) Mitchell Lloyd G. and Garcia- Bianco, Mariano A. (1998) Methods and compositions for use in spliceosome- mediated RNA trans-spWcmg. United States Patent 6083702.
  • RNAi a potential new class of therapeutic for human genetic disease.

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The invention concerns a method for effecting functional gene replacement therapy using a combination of RNA trans-splicing and RNAi; at least one vector and/or at least one nucleic acid molecule for use in said method; and a therapeutic or pharmaceutical composition alsofor use in said method including said at least one vector and/or at least one nucleic acid molecule.

Description

Functional Gene Replacement Therapy
Field of the Invention
The invention concerns a method for effecting functional gene replacement therapy; at least one vector and/or at least one nucleic acid molecule for use in said method; and a therapeutic or pharmaceutical composition also for use in said method including said at least one vector and/or at least one nucleic acid molecule. The invention has use in the medical and veterinary field. Background of the Invention
Acquired and/or inherited genetic disorders are often characterized by the presence of defective or aberrant gene transcripts and gene products which can be caused by abnormalities in chromosomes, genes, and gene expression. Among others these disorders include cancers, storage disorders, asthma, diabetes, mental retardation, obesity, heart disease, autoimmune diseases, and infections with viruses such as HIV and HPV which integrate their genome into the host's genome. These disorders currently are treated symptomatically i.e. by administration of drugs which treat the symptoms rather than the genetic causes of the diseases although it is acknowledged that a causal treatment, i.e. one that addresses the cause of the disorder, is the only chance of a cure. A causal treatment implies the usage of genetic tools suitable to resolve the genetic defects.
One conventional gene therapy approach is based on complementing a defect gene function with an intact gene function. Alternatively, toxic or carcinogenic gene functions are preferably targeted with antagonistic drugs or RNA interference (RNAi). Whereas the former functional complementation implies the coexistence of the correct and the defective gene function in the same cell, the blocking of a defective function using RNAi results in functional loss. Thus, both of these approaches yield suboptimal results.
RNA frans-splicing, on the other hand, allows one to repair genetic defects at the RNA level by replacing a defect with an intact function (Figure 1 ). Trans-splicing is a special form of RNA processing in eukaryotes where exons from two different primary RNA transcripts are joined end to end and ligated. In other words, frans-splicing results in an RNA transcript that comes from multiple RNA polymerases on the genome. Thus, as opposed to cellular c/s-splicing which occurs within one pre-mRNA transcript, frans-splicing describes splice reactions between two different pre-mRNAs. In eukaryotes RNA frans-splicing is undertaken by the spliceosome which is a large and complex molecular machine composed of five small nuclear RNAs (snRNA), and a range of associated protein factors. The spliceosome removes introns from a transcribed pre- mRNA segment. This process is generally referred to as splicing. Spliceosome-mediated RNA trans
-splicing, in the following referred to as RNA frans-splicing or frans-splicing, is a gene therapy approach that uses a cell's spliceosome to combine two distinct pre-mRNAs to produce a chimeric mature mRNA. Thus frans-splicing typically replaces a disease causing gene portion with a wild-type portion.
RNA frans-splicing represents a technology that is able to repair defective gene expression at the level of precursor messenger RNA (pre-mRNA); without any need to interfere with genomic DNA [1 -3]. Trans-splicing may occur naturally, however for therapeutic purposes an artificial frans-splicing RNA (tsRNA) is created to target a deleterious cellular pre-mRNA. A frans-splicing RNA is composed of three functional domains: (i) an antisense binding domain that is specific for the respective target message, (ii) a coding domain expressing a recombinant therapeutic gene or exon, and (iii) a splicing domain that includes all functional sequences required for spliceosomal splicing such as splice sites, a branch point, a polypyrimidine tract, splice enhancers etc. Depending on the design of the frans-splicing RNA, RNA frans-splicing can be used for 5' terminal (5'ER), internal (iER), or 3' terminal (3'ER) exon replacement. The frans-splicing technology allows molecular-surgical repair of defective gene functions and, hence, frans-splicing has high therapeutic potential compared with RNAi technology.
RNA interference (RNAi) also called post transcriptional gene silencing (PTGS) represents an evolutionary conserved mechanism of post-transcriptional gene silencing in higher eukaryotes including mammals and humans [4-6]. RNAi is undertaken by microRNAs (miRNAs), siRNAs, shRNAs, and piRNAs any of which can be endogenously expressed within or exogenously delivered into the target cells. Endogenous expression usually starts with the transcription of nuclear precursor molecules which are then exported into the cytoplasm where they are processed to finally trigger the formation of RNA-induced silencing complexes (RISC). RISC contains the so-called guide RNA sequence and provided that is complementary to a messenger RNA target the RISC can trigger target gene knockdown. Despite the appeal of frans-splicing technology, so far, studies in mice indicate few trans- splicing activities are suitable for only a few disease phenotypes. One reason for low observed frans-splicing rates is based on the fact that intermolecular frans-splicing has to compete with intramolecular c/'s-splicing reactions. As a corollary, a substantial fraction of the target message is still spliced in c/'s, exported to the cytoplasm and translated into the aberrant gene function. Many aberrant gene products have carcinogenic or toxic activities. In these cases, we have considered a successful therapy requires both restoration of the defective gene function and quantitative elimination of the deleterious phenotype.
Statements of the Invention
According to a first aspect of the invention there is provided a method of gene therapy comprising:
a) delivering into a target cell, at least one frans-splicing RNA molecule having
i) at least one sequence of nucleotides complementary to a target nuclear transcript comprising pre-mRNA;
ii) at least one wild-type therapeutic gene or exon or at least one gene or exon encoding an apoptotic/death signal; and
iii) at least one functional sequence required for spliceosomal splicing; and b) delivering into said same target cell, at least one RNAi molecule having a sequence of nucleotides that is complementary to a cellular version of said target nuclear transcript; whereby
c) frans-splicing of said pre-mRNA by said frans-spl icing RNA molecule takes place to restore the function of a protein encoded thereby or to trigger death of the transcript or its product; and
d) RNA interference of said cellular version of said target nuclear transcript takes place to prevent the function of a protein encoded thereby or to support the death of the pre-mRNA transcript or its product.
Reference herein to a frans-splicing RNA molecule is a molecule that interacts with a target precursor mRNA molecule and mediates a frans-splicing event to generate a novel chimeric mRNA that can be processed in the cell to yield a protein product.
In a preferred method said target nuclear transcript encodes a defective gene product, typically a defective protein and so said target nuclear transcript is a target defective nuclear transcript. Reference herein to a target defective nuclear transcript is reference to a transcript of a defective gene which transcript carries or encodes the said defect whereby a defective gene protein product is ultimately produced following cellular translation. Reference herein to a cellular version of said target nuclear transcript, defective or otherwise, is reference to the same or a modified version of said target (defective) nuclear transcript when outside the cell nucleus.
In a preferred method of the invention said molecules are delivered to said target cell using conventional delivery technologies well known to those skilled in the art including but not restricted to transfection, lipofection, electroporation, nucleofection, jet-injection, gene gun, and needle injection.
In another preferred method of the invention said molecules are delivered to said target cell using conventional delivery routes well known to those skilled in the art including but not restricted to topical, intravenous, intramuscular, oral, cutaneous, subcutaneous, intraperitoneal, nasal, intra-tracheal, systemic, and intratumoral.
Additionally or alternatively, said delivery is undertaken using a viral vector that encodes said frans-splicing RNA molecule or RNAi molecule and that can transfect or transform said cell and in either case said vector is suitably equipped to ensure the frans-splicing RNA molecule or RNAi molecule is manufactured in said cell following transfection or transformation.
Additionally or alternatively, said delivery is undertaken using a viral vector and/or plasmid that encodes said frans-splicing RNA molecule or RNAi molecule and that can transfect or transform said cell and in either case said vector is suitably equipped to ensure the frans- splicing RNA molecule or RNAi molecule is manufactured in said cell following transfection or transformation. In the instance where said viral vector is used it includes, but is not restricted to, retroviral vectors, lentiviral vectors, adenoviral vectors, and adeno-associated viral vectors (AAV).
Additionally or alternatively, said delivery is undertaken using a non-viral vector that encodes said frans-splicing RNA molecule or RNAi molecule and that can transfect or transform said cell and in either case said non-viral vector is suitably equipped to ensure the frans-splicing RNA molecule or RNAi molecule is manufactured in said cell following transfection or transformation. In the instance where said non-viral vector is used it includes, but is not restricted to, liposomes, nanoparticles, polymer capsules, and conjugates containing peptides including cell penetrating peptides, proteins including antibodies or receptors, sugars, lipids, nucleic acids, and steroids. Additionally or alternatively, said delivery is undertaken using a naked nucleic acid vector that encodes said frans-splicing RNA molecule or RNAi molecule and that can transfect or transform said cell and in either case said vector is suitably equipped to ensure the frans- splicing RNA molecule or RNAi molecule is manufactured in said cell following transfection or transformation. Said naked nucleic acid vector includes but is not restricted to plasmids, cosmids, DNA minicircles, dumbbell-shaped DNA vectors, and RNA.
In yet a further method of the invention a single one of the above referenced vectors is used to deliver both said frans-splicing RNA molecule and said RNAi molecule and so said single vector encodes both said frans-splicing RNA molecule and RNAi molecule. Said single vector comprises either two separate expression cassettes or a single expression cassette to express the frans-splicing RNA and the RNAi molecule. Said single expression cassette includes but is not restricted to a gene expressing a frans-splicing RNA that harbours an intronic miRNA or shRNA or a miRtron. In yet a further preferred method of the invention a single vector is used to deliver the frans- splicing RNA, the RNAi molecule, and as a third component the recombinant wild-type therapeutic gene.
Most preferably said frans-splicing RNA molecule comprises a binding domain that is specific for the target pre-mRNA and so comprises a sequence of nucleotides that recognizes or is complementary to a sequence encoding a selected region of a gene, typically having a genetic defect, ideally said region is upstream or downstream of a particular exon to be spliced and so most preferably said region comprises intronic DNA. Those skilled in the art will appreciate that where one or more exons are to be inserted between upstream and downstream exons, said frans-splicing RNA molecule comprises two binding domains complementary to regions either side of the exon(s) to be spliced.
Most preferably also said frans-splicing RNA molecule comprises a wild-type therapeutic gene or exon which when spliced into a target defective nuclear transcript restores the wild- type function of said transcript and so enables the production of an effective gene protein product. Preferably said wild-type therapeutic gene or exon comprises recombinant RNA. Alternatively, said frans-splicing RNA molecule comprises a sequence of nucleotides encoding an apoptotic signal leading to the selective destruction of said protein encoded by said transcript and ultimately the target cell. In this latter context the synergism of trans- splicing and RNAi can be relevant for suicide gene therapy where, for example, oncogene transcripts can be targeted by frans-splicing with apoptotic/death signals to ultimately selectively destroy/kill for example cancer cells. This effect is boosted when co-targeting the oncogene transcript with RNAi because many cancer cells require oncogene expression and so suppression of oncogene function often triggers cell death. Thus use of a frans-splicing RNA molecule having at least one apoptotic/death signal that triggers death of the corresponding transcript or its product and the co-use of a RNAi molecule having a sequence of nucleotides that is complementary to a cellular version of the target nuclear transcript to prevent the function of a protein encoded thereby supports the death of the target cell. More preferably still, said frans-splicing RNA molecule comprises functional sequences required for spliceosomal splicing such as splice sites, a branch point, a polypyrimidine tract, and splice enhancers. Depending on the design of the frans-splicing RNA, RNA frans- splicing can be used for 5' terminal (5'ER), internal (iER), or 3' terminal (3'ER) exon replacement. All these variations from part of the invention and are well known to those skilled in the art.
Most preferably still, said RNAi molecule is a micro RNA (miRNAs) and/or a siRNA either of which can be endogenously expressed within or exogenously delivered into the target cells. Endogenous expression usually starts with the transcription of nuclear precursor molecules (e.g. DNA molecules) which are then exported into the cytoplasm where they are processed to finally trigger the formation of RNA-induced silencing complexes (RISC). Alternatively, said RNAi molecule is a endogenously transcribed small hairpin (sh)RNA precursor which is processed by Dicer only after nuclear export within the cytoplasm triggering the formation of RISC.
In yet a further preferred method of the invention said RNAi molecule comprises a sequence of nucleotides that is complementary to a defective cellular version of said target nuclear transcript. The RNAi used is therefore specifically targeting the defect/mutated exon, not it's functionally intact counterpart. More desirably still, said RNAi molecule comprises a sequence of nucleotides that provides for perfect pairing with said target nuclear transcript or said defective cellular version of said target nuclear transcript. In yet a further preferred method of the invention said frans-splicing RNA molecule and said RNAi molecule are co-delivered exogenously into target cells using various delivery technologies. Additionally or alternatively, either or both said frans-splicing RNA molecule and said interfering RNAi molecule are transcribed endogenously from a vector or plasmid encoding same and, ideally, a single vector or plasmid.
In a yet further preferred embodiment of the invention said vector and/or plasmid further encodes a selected recombinant therapeutic gene with a view to treating the disorder that ensues when said target defective nuclear transcript is present.
Notably, since frans-splicing occurs in the nucleus and RNAi is effective in the cytoplasm of cells, we believe it is appealing to combine both technologies because this inherent spatial separation means RNAi will not target unspliced transcripts (Figures 2 and 3) thus both corrective mechanisms can be used at the same time to achieve a dual purpose which is either i) to restore gene function and prevent the effect of any defective genes or ii) to destroy cells expressing aberrant, including oncogenic, gene functions.
According to a second aspect of the invention there is provided a vector or plasmid comprising:
a) at least one nucleic acid molecule encoding at least one frans-splicing RNA molecule having i) at least one sequence of nucleotides complementary to a target nuclear transcript comprising pre-mRNA, ii) at least one wild-type therapeutic gene or exon or at least one gene or exon encoding an apoptotic/death signal and iii) at least one functional sequence required for spliceosomal splicing; and
b) at least one nucleic acid molecule encoding at least one RNAi molecule having a sequence of nucleotides that is complementary to a cellular version of said target nuclear transcript. In a preferred vector or plasmid said target nuclear transcript is defective.
According to a third aspect of the invention there is provided a therapeutic for treating a gene defect disorder comprising said vector or plasmid.
According to a further aspect of the invention there is provided a therapeutic for treating a gene defect disorder comprising: a) at least one nucleic acid molecule encoding at least one frans-splicing RNA molecule having i) at least one sequence of nucleotides complementary to a target nuclear transcript comprising pre-mRNA, ii) at least one wild-type therapeutic gene or exon or at least one gene or exon encoding an apoptotic/death signal and iii) at least one functional sequence required for spliceosomal splicing; and
b) at least one nucleic acid molecule encoding at least one RNAi molecule having a sequence of nucleotides that is complementary to a cellular version of said target nuclear transcript. According to a yet further aspect of the invention there is provided a pharmaceutical composition comprising a therapeutic according to the invention and at least one carrier.
In a preferred embodiment of the invention said therapeutic or pharmaceutical composition is formulated for mammalian and ideally human use.
In the claims which follow and in the preceding description of the invention, except where the context requires otherwise due to express language or necessary implication, the word "comprises", or variations such as "comprises" or "comprising" is used in an inclusive sense i.e. to specify the presence of the stated features but not to preclude the presence or addition of further features in various embodiments of the invention.
All references, including any patent or patent application, cited in this specification are hereby incorporated by reference. No admission is made that any reference constitutes prior art. Further, no admission is made that any of the prior art constitutes part of the common general knowledge in the art.
Preferred features of each aspect of the invention may be as described in connection with any of the other aspects. Other features of the present invention will become apparent from the following examples. Generally speaking, the invention extends to any novel one, or any novel combination, of the features disclosed in this specification (including the accompanying claims and drawings). Thus, features, integers, characteristics, compounds or chemical moieties described in conjunction with a particular aspect, embodiment or example of the invention are to be understood to be applicable to any other aspect, embodiment or example described herein, unless incompatible therewith. Moreover, unless stated otherwise, any feature disclosed herein may be replaced by an alternative feature serving the same or a similar purpose. Throughout the description and claims of this specification, the singular encompasses the plural unless the context otherwise requires. In particular, where the indefinite article is used, the specification is to be understood as contemplating plurality as well as singularity, unless the context requires otherwise. An embodiment of the present invention will now be described by way of example only with reference to the following wherein:
Figure 1 shows a schematic depiction of different gene therapy approaches. Displayed are cross sections through mammalian or human cells. Nuclear genomic DNA is being transcribed to single-stranded messenger RNA (mRNA) which is subsequently being spliced and exported into the cytoplasm where protein synthesis takes place. A defect (red) gene can lead to a defect mRNA and finally code for a defect or gene function/protein. The classical gene therapy approach is based on gene complementation of the defect with an intact (green) gene function. As a result, targeted cell carry both the defect and the recombinant intact function (lower part). Some defect proteins are pathogenic or carcinogenic. In such a case it is more promising to block the aberrant function using antisense or RNAi technologies i.e. RNAi-based inhibition (upper part). In the consequence however targeted cells lose a gene function. RNA frans-splicing based repair, allows repairing the defect function or exon on the pre-mRNA level. In that case the corrected gene function replaces the defect function which is basically the most desirable outcome (middle part). Abbr.: e1 -3: exons; i1 ,2: introns; e2: defect exon 2; e2*: corrected exon 2. Figure modified according to [7].
Figure 2 shows enhancement of apparent frans-splicing efficacy by RNAi. Compartmental separation of splicing and RNAi allows for selective cytoplasmic destruction of aberrant c/'s- spliced transcripts which escaped therapeutic nuclear frans-splicing. C: Cytoplasm; N: Nucleus; e: exon; i: intron. Red: defect sequence; green: intact sequence. Trans-splicing RNAs providing the intact sequences and siRNAs are not depicted in this figure. Figure 3 shows examples how an siRNA effector molecule can be co-delivered together with a frans-splicing RNA expression vector. A, Co-delivery of a chemically synthesised siRNA. B, Co-delivery of a seperate shRNA expression vector. C, Co-delivery as independent shRNA expression cassette implemented into the frans-splicing RNA expression vector. D, Co-delivery as miRtron implemented into the trans-splicing RNA expression cassette. Splicing of the miRtron will generate the shRNA or miRNA precursor which can then be exported into the cytoplasm in a Drosha- and Exportin-5-independent manner.
Figure 4 shows a detailed molecular illustration of synergies between RNA frans-splicing and RNA interference. A, for frans-splicing-based 5' exon replacement; B, for frans-splicing- based 3' exon replacement; C, for frans-splicing-based internal exon replacement. The siRNA used is specifically targeting the defect/mutated exon, not it's functionally intact counterpart. Due to the subcellular compartmentalization, the siRNA can exert its silencing potential only in the cytoplasm, i.e. target the defect/mutated exon exclusively on the level of the c/'s-spliced cytoplasmic target message but not on the level of the nuclear un-spliced pre- mRNA. That is, RNAi cannot negatively interfere with frans-splicing but instead support frans-splicing-based replacement of aberrant gene functions.
Figure 5 shows experimental proof of synergies (no negative interference) between RNA frans-splicing-based 3' exon replacement and RNAi. The RNAi effector was co-delivered as exogenously synthesised siRNA (scenario A, Figure 3). In this experimental setup, the alpha-fetoprotein (AFP) pre-mRNA was targeted with a frans-splicing RNA that replaces the 3' terminal exons 6 to 14 of the endogenous transcript or exon 6 of an exogenously delivered recombinant transcript encompassing only the exons 3 to 6 by a sequence coding for the herpes simplex virus thymidine kinase (HSVtk). The HepG2 target cells were co-transfected with a vector expressing AFP exons 3 to 6, a vector expressing the frans-splicing RNA, and the siRNA which was directed against AFP exon 6 using lipofection. Total cellular RNA was isolated 24 hours post transfection and both, the c/'s-spliced and the frans-spliced AFP message was quantified using real-time reverse transcriptase (rtRT-)PCR. A, knockdown of c/'s-spliced AFP mRNA by the exon 6-targeting siRNA. B, dose response curve of knockdown in A. C, knockdown of the c/'s-spliced AFP message illustrated by ACt values. D, the siRNA has no effect on frans-spliced AFP mRNA levels as depicted by ACt values. ACt = C spiicedAFP - CtP-actin- Data represent mean values of three independent experiments. Error bars indicate mean deviations from the averages. P values were calculated using a student's t-test. *: p<0.05, **: p<0.01 ; ***: p<0.001 . Figure 6 shows experimental proof of synergies (no negative interference) between RNA frans-splicing-based 5' exon replacement and RNAi. The RNAi effector was co-delivered as exogenously synthesised siRNA (scenario A, Figure 3). In this experimental setup, the AFP pre-mRNA was targeted with a frans-splicing RNA that replaces the 5' terminal exons 1 to 3 of the endogenous transcript or exon 3 of an exogenously delivered recombinant transcript encompassing only the exons 3 to 6 by a sequence coding for the HSVtk. The HepG2 target cells were co-transfected with a vector expressing AFP exons 3 to 6, a vector expressing the frans-splicing RNA, and the siRNA which was directed against AFP exon 3 using lipofection. Total cellular RNA was isolated 24 hours post transfection and both, the c/'s-spliced and the frans-spliced AFP message was quantified using rtRT-PCR. A, knockdown of c/'s-spliced AFP mRNA by the exon 3-targeting siRNA. B, dose response curve of knockdown in A. C, knockdown of the c/'s-spliced AFP message illustrated by ACt values. D, the siRNA has no effect on frans-spliced AFP mRNA levels as depicted by ACt values. ACt = Ctcis-SpiiCedAFP - Ctp-actin- Data represent mean values of three independent experiments. Error bars indicate mean deviations from the averages. P values were calculated using a student's t-test. *: p<0.05, **: p<0.01 ; ***: p<0.001 .
Figure 7 shows an exemplary suggested design of gene therapy vectors. A single vector contains two (b and c) or three (a, b, and c) functional elements which support the replacement of a defect by an intact gene function: a, the recombinant therapeutic version of the defect endogenous gene the expression of which complements the defect with the intact gene function; b, a gene expressing a frans-splicing RNA suitable to repair the defect target message on the pre-mRNA level in the nucleus; and c, a gene coding for siRNA precursor, a small hairpin (sh)RNA, specifically targeting the defect/mutated exon of the target message in the cytoplasm. After transcription, shRNAs are exported from the nucleus into the cytoplasm recruiting the exportin-5 dependent pathway and will then be recognised and processed in the cytoplasm by dicer to generate the siRNA, trigger RISC formation, and knockdown of c/'s-spliced target messages that escaped nuclear frans-splicing. The combination of functional elements b and c allows partly replacement of the defect by an intact gene function with simultaneous elimination of the defect gene function on the RNA level. The combination of functional elements a to c can in addition either fully restore native expression levels of the intact target gene or trigger its over-expression.
Figure 8 shows experimental proof of synergies (no negative interference) between RNA frans-splicing-based 3' exon replacement and RNAi. In this experimental setup, the frans- splicing RNA and the RNAi effector (shRNA) were encoded on separate plasmid vectors (scenario B, Figure 3). The alpha-fetoprotein (AFP) pre-mRNA was targeted with a trans- splicing RNA that replaces the 3' terminal exons 6 to 14 of the endogenous transcript or exon 6 of an exogenously delivered recombinant transcript encompassing only the exons 3 to 6 by a sequence coding for the herpes simplex virus thymidine kinase (HSVtk). The HepG2 target cells were co-transfected with 500ng a vector expressing AFP exons 3 to 6, 500ng of a vector expressing the frans-splicing RNA, and 500ng of a vector expressing an shRNA which was directed against AFP exon 6 using lipofection. Total cellular RNA was isolated 24 hours post transfection and both, the c/'s-spliced and the frans-spliced AFP message was quantified using real-time reverse transcriptase (rtRT-)PCR. Left panel, knockdown of c/'s-spliced AFP mRNA by the exon 6-targeting shRNA. Right panel, the endogenously expressed shRNA has no negative effect on frans-spliced AFP mRNA levels and even seems to support RNA- frans-splicing. Data represent mean values of three independent experiments. Error bars indicate mean deviations from the averages. P values were calculated using a student's t-test. *: p<0.05, **: p<0.01 ; ***: p<0.001 .
Figure 9 shows experimental proof of synergies (no negative interference) between RNA trans-splicing-based 5' exon replacement and RNAi. In this experimental setup, the trans- splicing RNA and the RNAi effector (shRNA) were encoded on the same plasmid vector (scenario C, Figure 3). The alpha-fetoprotein (AFP) pre-mRNA was targeted with a trans- splicing RNA that replaces the 5' terminal exons 1 to 3 of the endogenous transcript or exon 3 of an exogenously delivered recombinant transcript encompassing only the exons 3 to 6 by a sequence coding for the HSVtk. The HepG2 target cells were co-transfected with 500ng of a vector expressing AFP exons 3 to 6 and 500ng of a vector expressing both the trans- splicing RNA and the shRNA which was directed against AFP exon 3 using lipofection. Total cellular RNA was isolated 24 hours post transfection and both, the c/'s-spliced and the trans- spliced AFP message was quantified using real-time reverse transcriptase (rtRT-)PCR. Left panel, knockdown of c/'s-spliced AFP mRNA by the exon 3-targeting shRNA. Right panel, the endogenously expressed shRNA has no significant negative effect on frans-spliced AFP mRNA levels. Data represent mean values of three independent experiments. Error bars indicate mean deviations from the averages. P values were calculated using a student's t- test. *: p<0.05, **: p<0.01 ; ***: p<0.001 .
Figure 10 shows experimental proof of synergies between RNA frans-splicing-based 3' and 5' exon replacement and RNAi. In this experimental setup, the frans-splicing RNA and the RNAi effector (shRNA) were encoded by the same transcription cassette with the shRNA implemented as a miRtron into the HSVtk mRNA (scenario D, Figure 3). The miRtron has no negative effect on frans-splicing but instead enhances the frans-splicing activity. HepG2 target cells were co-transfected with 500ng a vector expressing AFP exons 3 to 6 and a vector expressing the trans-splicing RNA together with an AFT-targeting miRtron using lipofection. A, Co-transfection of 500ng of the 3'EL construct. B, Co-transfection of 150ng of the 5'EL construct. C, Co-transfection of 500ng of the 5'EL construct. Total cellular RNA was isolated 24 hours post transfection and both, the c/'s-spliced and the frans-spliced AFP message was quantified using real-time reverse transcriptase (rtRT-)PCR. Left panel, no significant effect of the miRtron on c/'s-spliced AFP mRNA levels. Right panel, co- expression of the miRtron enhances RNA frans-splicing. Data represent mean values of three independent experiments. Error bars indicate mean deviations from the averages. P values were calculated using a student's t-test. *: p<0.05, **: p<0.01 ; ***: p<0.001 .
Figure 11 comparing the efficiency of shRNAs in knocking down the AFP mini-gene target with real time RT-PCR using (a) 3'AFP probe and (b) 5'AFP probe. The shRNAE3a and shRNAE3b targets AFP exon 3 and shRNAE6a and shRNAE6b targets AFP exon 6. The "a" denotes conventional perfect pairing miRNA hairpin precursor and the "b" contains two bulges in the guide sequence. n=3, mean ± SEM, test for significance used was one-way ANOVA with Dunnett post-hoc. Relative mRNA expression was calculated in terms of fold change (2-AACt) where ACt = Ct c/'s-spliced AFP - Ct β-Actin. * p<0.05.
Figure 12 relative mRNA expression checking the levels of escaped c/s-spliced AFP and frans-splicing when specific shRNAs are introduced as separate vector. The effect of co- transfection of 250 ng AFP mini-gene vector plus 250 ng shRNA vectors E6a and E6b along with 250 ng frans-splicing vector using Lipofectamin 3000 on (a) 3' c/'s-splicing and (b) 3' frans-splicing. The effect of co-transfection of 250 ng AFP mini-gene vector plus 250 ng shRNA vectors E3a and E3b along with 250 ng frans-splicing vector using Lipofectamin 3000 on (c) 5' c/'s-splicing and (d) 5' frans-splicing. In the negative controls total DNA was topped up with 250 ng empty pSuper vector. n=3, mean ± SEM, test for significance used was one-way ANOVA with Dunnett post-hoc. Relative mRNA expression was calculated in terms of fold change (2-AACt) where ACt = Ct c/'s/frans-spliced AFP - Ct β-Actin. * *p<0.01.
Figure 13 relative mRNA expression checking the levels of escaped c/s-spliced AFP and frans-splicing when specific shRNAs are cloned into the trans-splicing cassette as a single vector system. The effect of shRNAs E6a and E6b fused with frans-splicing vector on (a) 3' c/'s-splicing and (b) 3' frans-splicing. The effect of shRNAs E3a and E3b fused along with frans-splicing vector on (c) 5' c/'s-splicing and (d) 5' frans-splicing. Cells were co-transfected with 250 ng of each plasmid using Lipofectamin 3000. In the negative controls total DNA was topped up with 250 ng empty pSuper vector. n=3, mean ± SEM, test for significance used was one-way ANOVA with Dunnett post-hoc. Relative mRNA expression was calculated in terms of fold change (2-AACt) where ACt = Ct c/'s/frans-spliced AFP - Ct β-Actin. * p<0.05.
Figure 14 relative mRNA expression checking the levels of escaped c/s-spliced AFP and frans-splicing when specific shRNAs (mirtrons) are cloned into the HSV-tk coding region of frans-splicing cassette as a single vector system. The effect of shRNAs E6a and E6b mirtron fused with frans-splicing vector on (a) 3' c/'s-splicing and (b) 3' frans-splicing. The effect of shRNAs E3a and E3b mirtron fused along with frans-splicing vector on (c) 5' c/'s-splicing and (d) 5' frans-splicing. Cells were co-transfected with 250 ng of each plasmid using Lipofectamin 3000. In the negative controls total DNA was topped up with 250 ng empty pSuper vector. n=3, mean ± SEM, test for significance used was one-way ANOVA with Dunnett post-hoc. Relative mRNA expression was calculated in terms of fold change (2- AACt) where ACt = Ct c/'s/frans-spliced AFP - Ct β-Actin. * p<0.05.
Materials & Methods
siRNA Design: siRNAs targeting exon 3 of AFP and exon 6 of AFP were designed following the protocols proposed previously [8,9]. siRNA targeting luciferases was previously described [8]. The selected siRNA sequence was summarized in Table 1 and ordered from Dharmacron Thermo Scientific.
siRNA_E6: sense 5'-AUUAAGAGAAAGCAGCUUGdTdT-3' (SEQ ID NO:1 ); antisense 5'- CAAGCUGCUUUCUCUUAAUUC-3' (SEQ ID NO:2)
siRNA_E3: sense 5'-AGUCUUCAGGGUGUUUAGAdTdT-3' (SEQ ID NO:3), antisense 5'- UCUAAACACCCUGAAGACUGU-3' (SEQ ID NO:4)
Cell Culture: HepG2 cells were cultivated in Dulbecco's Modified Eagle Medium (DMEM) media supplemented with 10% fetal bovine serum (FBS) and 1 % penicillin- streptomycin. Cell Transfection: HepG2 cells in log growth phase were plated in 24 well plate at 10 5 cells / well. 500 ng of pVaxl - AFP, 500 ng of pVaxl - PTM, and siRNA of various concentration (0, 0.1 , 1 , 10, 100 pmol/uL) were co-transfected 14 hours after plating using lipofectamine 2000 ™ or 3000 ™ (Introvigen) in Opti-MEM (Introvigen) following the manufacturer's protocol. Alternatively, various amounts of frans-splicing constructs, pVAX1 -AFP, shRNA, combined frans-splicing-shRNA constructs or mirtron constructs were co-transfected. In the negative controls total DNA was topped up with empty pSuper vector to transfect all cells with the same total amount of DNA. Successfully transfected Hep G2 cells were cultured in DMEM supplemented with 10% fetal bovine serum (FBS) and 1 % of penicillin-streptomycin (P-S) overnight.
Design of Target mRNA constructs: Target mRNA was previously designed by S. Poddar according to endogeously express part of the alpha fetoprotein (AFP) from a DNA minigene plasmid. The AFP minigene consisted of exon 3, intron 3, linked exons 4 and 5, intron 5 and exon 6. It was introduced into the pVAX1 plasmid which harbors a Kanamycin resistance with a cytomegalovirus (CMV) promoter (pVAX1 -AFP).
Design of frans-splicing RNA constructs: 7rans-splicing RNA constructs 3'PAR and 5'PAR for 3' exon replacement (ER) or 5' ER were designed including a target binding domain, a splicing domain, and a coding domain (which in this case was a gene for HSVtk expression), and synthesized by GeneArt® (Life Technologies). 3'PAR interacts with AFP minigene mRNA (target mRNA) and undergoes 3'exon labeling (3'EL) by excising and replacing exon 6 with the domain which encodes the Herpes simplex virus thymidine kinase (HSV-TK). It was designed with:
i. A binding domain in antisense orientation to intron 5 of the AFP minigene, ii. A splicing domain with a 3' active splice signal, a branch point consensus and a polypyrimidine tract,
iii. A coding domain which encodes the HSV-TK but a deletion of the translational start codon to prevent translation in the absence of frans-splicing, iv. A poly-adenosine tail to confer correct processing of the frans-splice product.
5'PAR was designed for 5'exon labeling (5'EL) in which exon 3 is excised and replaced with coding domain of HSV-TK and it consists of: i. A splicing domain containing a 5' splice site,
ii. A coding domain which encodes the HSV-TK,
iii. A binding domain consisting of 42 complementary bases pairing to intron 3 iv. A polyA tail Design and cloning of shRNA: Polycistronic shRNA plasmids obtained from the GeneArt® Gene synthesis service (Life Technologies). Two 21 -nucleotides shRNA guide strands, targeting exon 3 and exon 6 of AFP were generated. Selection of guide sequence candidates were done according to the criteria for in silico selection of siRNA (Patzel, 2007). Selected shRNA guide strands were further extended with additional two nucleotides at both 3' and 5' ends, forming 25-nucleotide elongated shRNA guide strands. 25-nucleotide elongated shRNA guide strands in this article were selected to fold an open secondary structure with high Gibbs free energy, AG predicted by Mfold (Zuker, 2003). Both guide strands were used to replace mature miRNA sequences within human precursor miRNA (pre-miRNA) structures selected from the miRBase namely hsa-miR-4699, hsa-miR-3116-1 , hsa-miR-106b and hsa-miR-20a [10-14], forming Dicer substrate shRNAs. Exon 3 targeting guide strand replaced hsa-miR-4699 and hsa-miR-106b, while exon 6 targeting guide strand replaced hsa-miR-3116-1 and hsa-miR-20a. The shRNA constructs derived from the replacement of mature sequences of human miRNAs by guide strands were labeled as shRNA_E3_a (or shRNAI ), shRNA_E3_b (or shRNA3), shRNA_E6_a (or shRNA2) and shRNA_E6_b (or shRNA4) respectively. The passenger strand of shRNAs were modified such that identical secondary structures to original miRNAs were maintained.
shRNA_E3_a: 5'-AGCAAGAACAGUCUUCAGGGUGUUUAGAAAUGAUUAAGAAAUUUUC GUAAACACCCUGAAGACUGUUCUUGCU-3' (SEQ ID NO:5)
shRNA_E6_a: 5'-CUUUAUAAGAAUUAAGAGAAAGCAGCUUGUUUGGGUAUCGUAGAAC AAGCUGCUUUCUCUUAAUUCUUAUAAAG-3' (SEQ ID NO:6)
shRNA_E3_b: 5'-CCUGCCGGGUUUCUAAACACCCUGAAGACUGUUCUGGUCCUCUCC UUGGAAACUCUUCAGGGUGUUUAUCUAAUCCAGCAGG-3' (SEQ ID NO:7)
shRNA_E6_b: 5'-GUAGCAUAACAAGCUGCUUUCUCUUAAUUCUGUUUAGUCAUGAAUA AGAGAAAGCAGCUUCAUUAUACUGC-3' (SEQ ID NO:8)
Design and cloning of combined frans-splicing RNA molecules and shRNA plasmid:
To increase ease of delivery of the combined frans-splicing RNA constructs and RNA interference therapy for future applications, a combined frans-splicing RNA molecule and shRNA plasmids in a single plasmid was designed.
Design and cloning of the mirtron: The design of an artificial mirtron considers rules (i) for the design of a spliceable RNA that (ii) generates an RNAi effector molecule [15]. The miR- 1224 was chosen from the miRBase due to its existence in mammalian cells as an endogenous mirtron (Sibley et al., 201 1 ). Mmu-miR-1224 was originally designed as introns within the eGFP plasmid in Sibley et al.'s experiment [16]. In this article, miR-1224 served as the model structure for the design of a mirtron. The structure of miR-1224 was predicted by Mfold [17] and RNAfold [18]; both predicted structures were identical. Two shRNA guide strands were designed to replace the seed region of miR-1224. The passenger strands of mirtron-RNAs were modified such that the original secondary structures of the miRNAs were maintained. Final constructs were labelled as mirtron_E3 (or mirtron 1 ) and mirtron_E6 (or mirtron2).
miR-1224: 5'-GUGAGGACUCGGGAGGUGGAGGGUGGUGCCGCCGGGGCCGGGCGCU GUUUCAGCUCGCUUCUCCCCCCACCUCCUCUCUCCUCAG-3' (SEQ ID NO:9) miRtron_E3: 5'-GTCTAAACACCCTGAAGACTGTTCAGCATCATTAGAGCCAGAGTTCTGT CTCAGCTAACACTCCCCGTCTTTAGGGACTTTAGAG-3' (SEQ ID NO:10) miRtron_E6: 5'-GTAACAAGCTGCTTTCTCTTAATTCGCATCATTAGAGCCAGAGTTCTGT CTCAGCGATTACTCCCCAGAGAAAGTACGTTGTTAG-3' (SEQ ID NO:1 1 )
The cloned mirtron constructs were termed as 5'PAR-mirtron_E3 (or 5'mir1 ) and 3'PAR- mitron_E6 (or 3'mir2). General cloning strategies: Approximately two μg of the basis vector constructs were incubated with 1 μΙ each of two specific restriction enzymes and 10X Fast Digest Buffer (Thermo Scientific) in a 50μΙ reaction at 37°C for two hours, then 80°C for 15 minutes to inactivate the restriction enzymes. Following the digestion, the entire 50 μΙ digestion mixtures were loaded onto 1 % agarose gels for gel electrophoresis at 90V for one hour. Two bands were observed under UV illumination and desired bands were cut and weighed. The DNA was extracted from the gels using GeneJET Gel Extraction Kit (Thermo Scientific). The vector DNA and the insert DNA were then ligated with 1 μΙ T4 DNA ligase (Thermo Scientific) at a concentration ratio of one to three (vector to insert) in 20μΙ reaction mixture which consists of 10X T4 ligase buffer. The ligation step was carried out at 22eC for four hours and the T4 ligase was inactivated at 70°C for 15 minutes. A total of 10 μΙ of the ligation mixture was then transformed into chemically-competent E. coli strain DH5a using a standard transformation protocol. Successful clones (three to five from each transformation set) were selected for colony PCR using forward and reverse primers designed and were verified for the correct amplification band size before they were sent for sequencing (AITBiotech) to confirm for successful cloning. Cloning of pVAX1 -shRNA and pSUPER-shRNA
30pg of shRNA and 2pg cloning plasmid, pVAX1 or pSUPER was digested with 1 μΙ each of restriction enzymes as summarized in the following table { Table 1). After digestion, ligation and transformation steps were done as mentioned above in Section 2.6. Cloning of 3'PAR-shRNA_E6a and 5'PAR-shRNA_E3a: Cloning of the combined hybrid plasmid was done by insertion of frans-splicing RNA expression cassettes of constructs 3'ER and 5'ER into previously cloned pSUPER-shRNA constructs using Spel and BamHI restriction sites. The resulting constructs were termed 3'ER-shRNA2 and 5'ER-shRNA1 . 2pg of frans-splicing RNA constructs, 3'ER or 5'ER and 30pg of cloning plasmid, pSUPER- shRNAI or pSUPER-shRNA2 were digested with 1 μΙ each of restriction enzymes as summarized in the following table { Table 2).
Cloning of pVAX1 -mirtron: The parental frans-splicing constructs, 3'PAR and 5'PAR having two SphI (or Pael) restriction endonuclease cleavage sites at the backbone, couldn't be used for mirtron cloning. Therefore prior to the introduction of mirtron, the two SphI sites must be diminished. Four primers were designed for PCR of the entire frans-splicing constructs using Pfu DNA polymerase (Thermo Scientific) by introducing a mismatch in one SphI sequence or a total replacement of the SphI restriction site with a BamHI restriction site. FP_pVAX_large and RP_pVAX_large were designed for the PCR of the bigger fragment between two SphI sites while FP pVAX small and RP_pVAX_small were used to PCR amplify the smaller fragment between two SphI sites. Primers were phosphorylated prior to the PCR. Blunt end ligation was carried out after PCR with the addition of PEG4000. Successful clones, 3'PAR_mod and 5'PAR_mod were picked for the cloning of mirtron. Mirtron_E3 and mirtron_E6 were first isolated from the synthesized mirtron_E3_E6 plasmid by GeneArt® with following restriction enzymes: Table 3.
Digested mirtron constructs, mirtronl or mirtron2 and 2pg of cloning plasmid, frans-splicing RNA constructs, 5'PAR_mod or 3'PAR_mod respectively was digested with 1 μΙ each of restriction enzymes of SphI and Sacl. Positive clones were selected via colony PCR and then verified by sequencing. Cloned plasmids were labelled as 3'mir2 and 5'mir1 .
RNA isolation and first-strand cDNA synthesis: Total RNA from transfected HepG2 cells was isolated using RNeasy Plus Mini Kit (Qiagen) according to the manufacturer's protocol 24 hours or 48 hours post-transfection depending on conditions to be tested. First strand cDNA was synthesized using the Superscript III First-Strand Synthesis Kit (Invitrogen). Approximately 500 ng of total cellular RNA was incubated with 1 μΙ each of random hexamer and dNTPs at 65°C for five minutes in a 14μΙ reaction. After one minute chill snap, 6μΙ of master mix consisting 4μΙ of buffer, 0.1 M DTT (1 μΙ), RNase OUT (0.5μΙ) and Superscript III reverse transcriptase (0.5μΙ) were added and incubated at 25°C for five minutes then 50°C for two hours, followed by inactivation of the enzyme at 70eC for 15 minutes.
First-strand cDNA synthesis with specific primers for detection of shRNA and mirtron processing efficiency: First strand sequence specific cDNA was synthesized using the Superscript III First-Strand Synthesis Kit (Invitrogen). Approximately 500 ng of total cellular RNA was incubated with 1 .5 μΙ of specific stem loop primer and 1 μΙ of dNTPs at 65eC for five minutes in a 14μΙ reaction. After one minute chill snap, 6μΙ of master mix consisting 4μΙ of buffer, 0.1 M DTT (1 μΙ), RNase OUT (0.5μΙ) and Superscript III reverse transcriptase (0.5μΙ) were added and incubated at 50eC for two hours, followed by inactivation of the enzyme at 70eC for 15 minutes.
Real-time Polymerase Chain Reaction (qPCR): Quantitative real-time PCR was done using TaqMan probe as fluorescence reporter. Quencher probes were designed for each set of constructs (probes 3'AFP and 5'AFP) both targeting on exon 5 and exon 4 of the AFP mini gene respectively. Forward and reverse primers (3'FP and 3'RP_c/'s for the 3'AFP probe and 5'FP_c/'s and 5'RP for the 5'AFP probe) were designed to detect escaped c/'s-spliced AFP mRNA while 3'FP and 3'RP_trans for the 3'AFP probe and 5'FP_trans and 5'RP for the 5'AFP probe were designed to detect successful frans-spliced AFP/HSV-tk chimeric mRNA. Approximately 20ng of first-strand cDNA incubated with 5μΙ of TaqMan Universal PCR Master Mix buffer (Applied Biosystem), 0.5μΙ probe, 0.5μΙ forward primer and 0.5μΙ reverse primer in a 10μΙ reaction in 96-well PCR plate (Applied Biosystem). The PCR cycling conditions were as below: an initial 10 minutes denaturation step at 95eC was followed by 40 cycles of denaturation and annealing (95eC for 15 seconds and 60eC for 1 minute). For the quantification of processing efficiency, real time qPCR was carried out according to the universal TaqMan-based RT-PCR protocol for cost-efficient detection of small noncoding RNA developed [19]. Primers were designed using Primer Express (Applied Biosystems) with preference for open secondary structures and melting temperatures at around 60 eC. RT primers (stem loop primers) were designed with 6 nucleotides complementary with 3' ends of miRNAs. Forward primers (FP) recognizing remaining nucleotides that were 2 nucleotides away from the 6 nucleotides mentioned above on miRNA were designed with additional nucleotides at 5' ends for stability and to achieve melting point of 58 to 60 eC qPCR cycle condition were retained for the determination of C, value.
Data and statistical analysis: ACt values were calculated by subtracting the Ct value of β- actin (endogenous control) from the Ct value obtained from real-time qPCR. AACt was then obtained by subtracting ACX (construct) by ACX (control). A fold change was calculated with the equation of 2~AACt . This fold change value was then represented as relative RNA expression in all charts shown in this report. Data shown as 3 experiments made in triplicates. Error bar represents SEM. All statistical analysis were done in GraphPad Prism 5 (Graph Pad Software) using two-tailed unpaired t test for comparison between two constructs and two way ANOVA (multiple comparison) for comparison among multiple constructs against control construct.
Trans-splicing RNA vectors and exogenously synthesised siRNAs were co-delivered into target cells using various transfection technologies including lipofectamine 2000 or 3000. Alternatively, the frans-splicing RNA and interfering RNA, were transcribed endogenously from a single plasmid or DNA-vector (Figure 3).
Results and discussion
In the following study we investigated of RNA frans-splicing and RNAi using alpha- fetoprotein (AFP) a protein whose elevated levels are a known marker for Hodgkin's disease and various types of liver disease such as chronic liver disease and liver cancer.
More specifically, we investigated a combination of RNA frans-splicing and RNAi using frans-splicing RNA triggering either 5'ER or 3'ER. For 3'ER, the alpha-fetoprotein (AFP) pre- mRNA was targeted with a frans-splicing RNA that either replaces the 3' terminal exons 6 to 14 of the endogenous transcript or exon 6 of an exogenously delivered recombinant transcript encompassing only the exons 3 to 6 by a sequence coding for the herpes simplex virus thymidine kinase (HSVtk). For 5'ER the AFP pre-mRNA was targeted with a frans- splicing RNA that replaces the 5' terminal exons 1 to 3 of the endogenous transcript or exon 3 of an exogenously delivered recombinant transcript encompassing only the exons 3 to 6 by a sequence coding for the HSVtk. In both cases, HepG2 target cells were co-transfected with a vector expressing AFP exons 3 to 6, a vector expressing the frans-splicing RNA, and the siRNA which was directed against AFP exon 6 or exon 3 using lipofection. Total cellular RNA was isolated and both, the c/'s-spliced and the frans-spliced AFP message was quantified using real-time reverse transcriptase (rtRT-)PCR. The results demonstrated for 5'ER and 3'ER that RNAi-based knockdown of a target gene (AFP) does not negatively interfere with frans-splicing-based reprogramming (the fusion with the HSVtk) in the same cell (Figures 5-6 and 12-14).
The data in Figure 1 1 prove that all investigated shRNAs trigger knockdown of the c/'s- spliced target message, regardless of their precursor structures.
Further the mode of delivery of the frans-splicing RNA and RNAi does not appear to be crucial to success (Figures 12-14) thus suggesting some flexibility in the nature of the delivery used e.g. a single vector; a single vector wherein said frans-splicing RNA and said RNAi are remotely located/separated; a single vector wherein said frans-splicing RNA and said RNAi are next to each other/joined; or a vector for each type of RNA i.e. one for the frans-splicing RNA and one for the RNAi. However, clearest results were obtained when siRNAs were used as RNAi effector molecules. In addition, the use of a miRtron even enhances frans-splicing which might be due to the fact that the miRtron functions like an intron and recruits the spliceosome for its own c/'s-splicing which subsequently facilitates the frans-splice reaction as well.
Notably, it will also be possible to combine the investigated modes of delivery, i.e. generating a vector that expresses a miRtron-containing frans-splicing RNA and a shRNA, in order to maximize knockdown of the c/s-spliced defective RNA on the one hand and to boost frans- splicing on the other hand.
The fact that both, the frans-splicing molecule and the RNAi effector can be encoded by a single DNA vector facilitates the use of any state-of-the-art delivery system including the use of viral delivery vectors which can carry only a single recombinant viral genome. That is important for therapeutic applications in vivo since it would be very unlikely that a single cell can be successfully targeted with two different genetic vectors.
We have demonstrated herein that frans-splicing RNA and RNAi act synergistically to replace a defect and so restore normal gene function and prevent any defective products being translated into protein products, respectively. This combined strategy is essential to compensate for incomplete frans-splicing activities and so to successfully target deleterious transcripts thus preventing any related diseases. This invention describes a significant improvement of spliceosome-mediated RNA frans-splicing by combining it with RNAi technology. The amalgamation of RNA frans-splicing with the RNAi technology triggers clinically relevant efficiencies of functional genetic repair enabling the treatment of previously incurable genetic disorders.
Major embodiments of this invention are:
1 . The amalgamation of two technologies which are commonly used separately, namely spliceosomal RNA frans-splicing and RNA interference, to achieve a significant improvement and broaden/expand applications of RNA frans-splicing towards previously incurable inherited and acquired genetic disorders. The technology can be applied but is not restricted to (i) genetic disorders that are associated with point mutations of cellular genes. Examples are color blindness, cystic fibrosis, hemochromatosis, hemophilia, phenylketonuria, polycystic kidney disease, sickle cell disease, Tay-Sachs disease, and various cancers. A complete list can be found under http://www.qenome.qov/10001204 and includes:
Achondroplasia
Alpha-1 Antitrypsin Deficiency
Antiphospholipid Syndrome
Autism
Autosomal Dominant Polycystic Kidney Disease
Breast cancer
Charcot-Marie-Tooth
Colon cancer
Cri du chat
Crohn's Disease
Cystic fibrosis
Dercum Disease
Down Syndrome
Duane Syndrome
Duchenne Muscular Dystrophy
Factor V Leiden Thrombophilia
Familial Hypercholesterolemia
Familial Mediterranean Fever
Fragile X Syndrome
Gaucher Disease
Hemochromatosis
Hemophilia
Holoprosencephaly
Huntington's disease
Klinefelter syndrome
Marfan syndrome
Myotonic Dystrophy
Neurofibromatosis
Noonan Syndrome Osteogenesis imperfecta
Parkinson's disease
Phenylketonuria
Poland Anomaly
Porphyria
Progeria
Prostate Cancer
Retinitis Pigmentosa
Severe Combined Immunodeficiency (SCID)
Sickle cell disease
Skin Cancer
Spinal Muscular Atrophy
Tay-Sachs
Thalassemia
Trimethylaminuria
Turner Syndrome
Velocardiofacial Syndrome
WAGR Syndrome
Wilson Disease
It can further be applied to (ii) diseases associated with the expression of specific disease markers including oncogenes, cancer genes, and viral transcripts (e.g. HIV, HPV).
2. Physical structures or molecules, i.e. improved vectors for genetic therapy which compartmentally or molecularly unify the features of the two technologies, RNA frans- splicing and RNA interference (Figure 7). These vectors can be any state of the art gene delivery system that contains or allows synthesis of therapeutic frans-splicing RNA and RNAi effector molecules.
3. Applications of the embodiments under 1 and 2 in a therapeutic context.
Conclusion
We have demonstrated that frans-splicing RNA and RNAi act synergistically, we suggest because they are compartmentally separated in cells, to replace a genetic defect with an intact gene function.
References
1. Garcia-Blanco M.A. (2003) Messenger RNA reprogramming by spliceosome- mediated RNA trans- splicing. J Clin Invest 1 12, 474-80. Mansfield S.G. et al. (2004.) RNA repair using spliceosome-mediated RNA trans- splicing. Trends Mol Med 10, 263-8.
Trans-splicing patents see (a) Aescu Life GmbH, Eul J. (2002). (WO/2003/016537) Method for repairing a mutant RNA from a DNA with genetic defects and for the programmed death of tumour cells by RNA frans-splicing as well as a method for identifying naturally frans-spliced cellular RNA. (b) Mitchell Lloyd G. and Garcia- Bianco, Mariano A. (1998) Methods and compositions for use in spliceosome- mediated RNA trans-spWcmg. United States Patent 6083702.
Seyhan AA (201 1 ) RNAi: a potential new class of therapeutic for human genetic disease. Hum Genet 130:583-605.
Patzel, V. (2007) In silico selection of active siRNA. Drug Discov Today 12, 139-48. RNAi patents see US2013177631 , US2012322858, US201 1065777 (b)
US2013130322 US2013245090.
Patzel V. (2008) GenomXPress 3.08, 18-21 .
Patzel V, Rutz S, Dietrich I, Koeberle S, Scheffold A & Kaufmann SHE (2005). Design of siRNAs producing unstructured guide-RNAs results in improved RNA interference efficiency. Nat Biotechnol 23(1 1 ), 1440-1444.
Koberle C, Kaufmann SH, Patzel V. (2006). Selecting effective siRNAs based on guide RNA structure. Nat Protoc 1 (4), 1832-1839.
Kozomara A, Griffith-Jones S. (2014). miRBase: annotating high confidence microRNAs using deep sequencing data. Nucleic Acids Res. Jan;42(Database issue):D68-73. doi: 10.1093/nar/gkt1 181 . Epub 2013 Nov 25.
Lagos-Quintana M, Rauhut R, Lendeckel W, TuschI T. (2001 ). Identification of novel gene coding for small expressed RNAs. Scinece 294(5543):853-8.
Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C. (201 1 ). Identificartion of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. Cancer Res. 71 (1 ): 105-16.
Stark, M. S., Tyagi, S., Nancarrow, D. J., Boyle, G. M., Cook, A. L., Whiteman, D. C, Hayward, N. K. (2010). Characterization of the melanoma miRNAome by deep sequencing. PloS one, 5(3), e9685.
Weber, M. J. (2005). New human and mouse microRNA genes found by homology search. FEBs Journal, 272(λ ), 59-73.
Seow, Y, Sibley, C. R., & Wood, M. J. (2012). Artificial mirtron-mediated gene knockdown: Functional DMPK silencing in mammalian cells. RNA, 18(7), 1328-1337. Sibley, C. R., Seow, Y, Saayman, S., Dijkstra, K. K., El Andaloussi, S., Weinberg, M. S., & Wood, M. J. (2011 ). The biogenesis and characterization of mammalian microRNAs of mirtron origin. Nucleic acids research, gkr722.
Zuker M (2003). Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res 31 (13), 3406-3415.
Hofacker IL, Fontana W, Stadler PF, Bonhoeffer S, Tacker M, Schuster P (1994), "Fast Folding and Comparison of RNA Secondary Structures", Monatshefte f. Chemie: 125, 167-188
Jung U, Jiang X, Kaufmann SHE, Patzel V A universal stem-loop primer-based TaqMan RT-PCR protocol for cost efficient detection of small non-coding RNA. RNA 19:12, 1864-73, 2013. Epub 2013 Oct 22.
Table 1. Summary of the cloning strategies for shRNA constructs.
Figure imgf000026_0001
Table 2. Summary of cloning strategies for 3'ER-shRNA_E6_a and 5'ER-shRNA_E3_a.
Figure imgf000027_0001
Table 3. Summary of cloning strategies for 3'PAR-shRNA_E6_a and 5'PAR-shRNA_E3_a.
Figure imgf000027_0002

Claims

Claims
1 . A method of gene therapy comprising:
a) delivering into a target cell, at least one frans-splicing RNA molecule having:
i) at least one sequence of nucleotides complementary to a target nuclear transcript comprising pre-mRNA,
ii) at least one wild-type therapeutic gene or exon or at least one gene or exon encoding an apoptotic/death signal and
iii) at least one functional sequence required for spliceosomal splicing; and b) delivering into said same target cell, at least one RNAi molecule having a sequence of nucleotides that is complementary to a cellular version of said target nuclear transcript; whereby
c) frans-splicing of said pre-mRNA takes place to restore the function of a protein encoded thereby or to trigger death of the transcript or its product; and
d) RNA interference of said cellular version of said target nuclear transcript takes place to prevent the function of a protein encoded thereby or to support the death of the pre-mRNA transcript or its product.
2. The method according to claim 1 wherein said target nuclear transcript is defective.
3. The method according to claim 1 or claim 2 wherein said molecules are delivered to said target cell using conventional transfection technologies.
4. The method according to any one of claims 1 - 3 wherein said delivering is undertaken using a vector and/or plasmid that encodes said frans-splicing RNA molecule or RNAi molecule and that can transfect or transform said target cell whereby said frans-splicing RNA molecule or RNAi molecule is manufactured in said cell following transfection or transformation.
5. The method according to any one of claims 1 - 4 wherein a single vector is used to deliver both said frans-splicing RNA molecule and said RNAi molecule and so said single vector encodes both said frans-splicing RNA molecule and RNAi molecule.
6. The method according to claim 5 wherein said RNAi is contained as a miRtron in said vector.
7. The method according to any one of the preceding claims wherein said frans-splicing RNA molecule comprises at least one binding domain that is specific for the target pre-mRNA and so comprises at least one sequence of nucleotides that recognizes or is complementary to said pre-mRNA.
8. The method according to any one of the preceding claims wherein said frans-splicing RNA molecule comprises at least one wild-type therapeutic gene or exon which when spliced into said target nuclear transcript provides a gene capable of producing an effective or wild type protein product or restores the wild-type function of a defective gene product and so enables the production of an effective or wild type protein product.
9. The method according to any one of the preceding claims wherein said apoptotic/death signal comprises at least one cell death gene or exon(s) which when spliced into said target nuclear transcript encodes a cell death signal that results in destruction of the transcript or its product or the cell expressing said target nuclear transcript.
10. The method according to any one of claims 1 - 8 wherein said frans-splicing RNA molecule comprises at least one wild-type therapeutic gene or exon.
1 1 . The method according to any one of the preceding claims wherein said frans-splicing RNA molecule comprises recombinant RNA.
12. The method according to any one of the preceding claims wherein said frans-splicing RNA molecule comprises functional sequences required for spliceosomal splicing.
13. The method according to any one of the preceding claims wherein said frans-splicing RNA molecule comprises functional sequences required for 5' terminal (5'ER), or internal (iER), or 3' terminal (3'ER) exon replacement.
14. The method according to any one of the preceding claims wherein said RNAi molecule is a micro RNA (miRNA) and/or a siRNA and/or shRNA.
15. The method according to claim 14 wherein said RNAi is delivered as a precursor molecule and the RNAi is endogenously expressed within the target cell.
16. The method according to any one of claims 4 -15 wherein said vector and/or plasmid further encodes a selected recombinant therapeutic gene.
17. The method according to any one of the preceding claims wherein said RNAi molecule comprises a sequence of nucleotides that is complementary to a defective cellular version of said target nuclear transcript.
18. The method according to any one of the preceding claims wherein said RNAi molecule comprises a sequence of nucleotides that provides for perfect pairing with said target nuclear transcript.
19. A vector or plasmid comprising:
a) at least one nucleic acid molecule encoding at least one frans-splicing RNA molecule having:
i) at least one sequence of nucleotides complementary to a target nuclear transcript comprising pre-mRNA, ii) at least one wild-type therapeutic gene or exon or at least one gene or exon encoding an apoptotic/death signal and
iii) at least one functional sequence required for spliceosomal splicing; and b) at least one nucleic acid molecule encoding at least one RNAi molecule having a sequence of nucleotides that is complementary to a cellular version of said target nuclear transcript.
20. A vector or plasmid according to claim 19 wherein said target nuclear transcript is defective.
21 . A vector or plasmid according to claim 19 or claim 120 wherein said RNAi is contained as a miRtron in said vector.
22. The vector or plasmid according to any one of claims 19-21 wherein said RNAi molecule comprises a sequence of nucleotides that is complementary to a defective cellular version of said target nuclear transcript.
23. The vector or plasmid according to any one of claims 19-22 wherein said RNAi molecule comprises a sequence of nucleotides that provides for perfect pairing with said target nuclear transcript.
24. A therapeutic for treating a gene defect disorder comprising the vector or plasmid according to any one of claims 19 - 23.
25. A pharmaceutical composition comprising a therapeutic according to claim 24 and at least one carrier.
26. The pharmaceutical composition according to claim 25 wherein said pharmaceutical composition is formulated for mammalian use.
27. The therapeutic according to claim 24 wherein said therapeutic composition is formulated for mammalian use.
28. The pharmaceutical composition according to claim 26 or the therapeutic according to claim 27 wherein the pharmaceutical composition or therapeutic is formulated for human use.
29. A method according to any one of claims 1 -18, a vector or plasmid according to any one of claims 19-23, a therapeutic according to any one of claims 24, 27 and 28, or a pharmaceutical composition according to any one of claims 25-26 and 28 as substantially herein described and with reference to the accompanying figures.
PCT/SG2016/050350 2015-07-27 2016-07-26 Functional gene replacement therapy Ceased WO2017018937A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB1513151.9 2015-07-27
GBGB1513151.9A GB201513151D0 (en) 2015-07-27 2015-07-27 Functional gene replacement therapy

Publications (1)

Publication Number Publication Date
WO2017018937A1 true WO2017018937A1 (en) 2017-02-02

Family

ID=54106628

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/SG2016/050350 Ceased WO2017018937A1 (en) 2015-07-27 2016-07-26 Functional gene replacement therapy

Country Status (2)

Country Link
GB (1) GB201513151D0 (en)
WO (1) WO2017018937A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019060779A1 (en) * 2017-09-22 2019-03-28 City Of Hope Splice inhibiting oligonucleotides
US20220249702A1 (en) * 2018-10-26 2022-08-11 Oxford University Innovation Limited Gene therapy for retinal disease

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005070948A1 (en) * 2004-01-23 2005-08-04 Intronn, Inc. Correction of alpha-1-antitrypsin genetic defects using spliceosome mediated rna trans splicing
WO2010012472A1 (en) * 2008-07-30 2010-02-04 Johann Bauer Improved pre-mrna trans-splicing molecule (rtm) molecules and their uses

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005070948A1 (en) * 2004-01-23 2005-08-04 Intronn, Inc. Correction of alpha-1-antitrypsin genetic defects using spliceosome mediated rna trans splicing
WO2010012472A1 (en) * 2008-07-30 2010-02-04 Johann Bauer Improved pre-mrna trans-splicing molecule (rtm) molecules and their uses

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
BERGER A ET AL.: "mRNA trans-splicing in gene therapy for genetic diseases", WIRES RNA, vol. 7, 2016, pages 487 - 498, XP055351384 *
KOLLER U ET AL.: "Trans-Splicing Improvement by the Combined Application of Antisense Strategies", INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES, vol. 16, 6 January 2015 (2015-01-06), pages 1179 - 1191, XP055333419 *
SHABABI M ET AL.: "Combination of SMN Trans-Splicing and a Neurotrophic Factor Increases the Life Span and Body Mass in a Severe Model of Spinal Muscular Atrophy", HUMAN GENE THERAPY, vol. 22, 2011, pages 135 - 144, XP055056236 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019060779A1 (en) * 2017-09-22 2019-03-28 City Of Hope Splice inhibiting oligonucleotides
US11104902B2 (en) 2017-09-22 2021-08-31 City Of Hope Splice inhibiting oligonucleotides
US11767530B2 (en) 2017-09-22 2023-09-26 City Of Hope Splice inhibiting oligonucleotides
US20220249702A1 (en) * 2018-10-26 2022-08-11 Oxford University Innovation Limited Gene therapy for retinal disease

Also Published As

Publication number Publication date
GB201513151D0 (en) 2015-09-09

Similar Documents

Publication Publication Date Title
EP2925866B1 (en) Circular rna for inhibition of microrna
Tay et al. Using artificial microRNA sponges to achieve microRNA loss-of-function in cancer cells
TW202043249A (en) Methods and compositions for editing rnas
CN109642241B (en) Trans-splicing RNA (tsRNA)
EP3219803A1 (en) Enhanced sleeping beauty transposons, kits and methods of transposition
US7972816B2 (en) Efficient process for producing dumbbell DNA
WO2012049665A1 (en) A modified human u1snrna molecule, a gene encoding for the modified human u1snrna molecule, an expression vector including the gene, and the use thereof in gene therapy
JP2023002469A (en) Novel mRNA composition used for antiviral and anticancer vaccines and method for producing the same
WO2022159402A1 (en) Composition and method for high-multiplexed genome engineering using synthetic crispr arrays
IL295284A (en) Compositions and methods for treating neurodegenerative diseases
Poddar et al. RNA structure design improves activity and specificity of trans-splicing-triggered cell death in a suicide gene therapy approach
CN101569597B (en) Using intron-based ribonucleic acid technology in the design and production of cosmetics
WO2017018937A1 (en) Functional gene replacement therapy
Krooss et al. Pathological mechanism and antisense oligonucleotide-mediated rescue of a non-coding variant suppressing factor 9 RNA biogenesis leading to hemophilia B
Sharma et al. Engineering circular RNA for molecular and metabolic reprogramming
WO2020148400A1 (en) Antisense oligonucleotides for use in the treatment of crpc
EP4577651A1 (en) Programmable rna writing using crispr effectors and trans-splicing templates
CA3246987A1 (en) Antisense nucleic acids for use in the treatment for lmna mutation carriers
JP7812584B2 (en) snRNA targeting USH2A pre-mRNA and uses thereof
US20240392291A1 (en) Nucleotide and use thereof
WO2025007937A1 (en) Snrna targeting ush2a pre-mrna pseudo-exon pe40 and use thereof
Ursu et al. Extending the Degradation Toolkit–mRNA Targeting as an Alternative Means to Affect Protein Levels
CN119265189A (en) snRNA targeting USH2A gene pre-mRNA and its application
JP2025135809A (en) MicroRNA expression cassettes, expression vectors, and their uses
WO2026061453A1 (en) Targeting system and use thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16830931

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16830931

Country of ref document: EP

Kind code of ref document: A1