WO2017009418A1

WO2017009418A1 - Modifying bacteriophage

Info

Publication number: WO2017009418A1
Application number: PCT/EP2016/066750
Authority: WO
Inventors: Adam Wilkinson; Heather Marie Fairhead; Emmanuele SEVERI; Anne Mary Louise BARNARD; Neil Anderson
Original assignee: Phico Therapeutics Ltd
Priority date: 2015-07-15
Filing date: 2016-07-14
Publication date: 2017-01-19
Also published as: GB2544957A; GB2544957B; GB201512377D0

Abstract

The present invention relates to a method for modifying the genome of a lytic target phage, uses of the method and products thereof.

Description

MODIFYING BACTERIOPHAGE

Background to the Invention

Bacteriophage are the most abundant organisms in the world with an estimated 10³⁰ present at any one time. Bacteriophage reportedly can inhabit every imaginable environment (Brabban et al, 2005), thus providing a huge reservoir of biological diversity for use in biotechnology. Phage have been used in a variety of applications, such as phage display to characterise protein-protein interactions (Smith and Petrenko, 1997), diagnostic tests for the rapid identification of bacterial pathogens (Dobozi-King et al., 2005), and in the treatment of bacterial infections by "phage therapy" (Harper et al., 2011).

Phage can be broadly split into temperate and non-temperate phage (Abedon, 2008). Temperate phage are able to exist in two distinct lifestyles. In one lifestyle, temperate phage replicate "lytically" - they infect the host cell, replicate and make new phage progeny, a process which ends in the lysis of the cell and the release of mature phage particles. In the other lifestyle, temperate phage infect the cell and integrate into the host cell genome, usually at specific attachment sites, to become "prophage". In so doing, they become a transient part of the host cell's genome, and are replicated together with the host cell's DNA. Integrated prophage are generally harmless to their host cell whilst in this integrated state, and can often provide selective advantage to the cell, by providing extra genes to the cell, e.g. CTX toxin genes are provided by CTX prophage to Vibrio cholerae, increasing the virulence of such strains compared to non-toxin gene carrying strains (Waldor and Mekalanos, 1996). In contrast, non-temperate phage, otherwise known as "lytic" phage, are only able to replicate in the lytic lifestyle described above - they cannot integrate into host cell DNA and therefore never become part of the host cell genome: Henceforth such phages will be described as "obligately lytic" to distinguish them from temperate phage which are capable of both lytic and prophage replication.

Broadly speaking, temperate bacteriophage are easily genetically modified, providing that the bacterial host species can be manipulated by standard molecular genetic techniques involving recombination and resistance marker selection, or a recombineering system (Tho mason et al., 2014).

Temperate phage, in the form of lysogens which carry integrated phage DNA as a prophage, can be engineered to carry exogenous DNA linked to any of a wide array of selectable markers, such as antibiotic or heavy metal resistance markers. Such markers may be linked to exogenous DNA and flanked by regions of prophage DNA, and cloned into suitable vectors which are not replicative (suicide vectors) in the bacterial host (lysogen). Upon introduction of such plasmids into the bacterial lysogen, by common methods such as conjugation or chemical or electro-transformation, recombinants which have integrated via the homologous sequences present on the plasmid, may be selected via the resistance marker linked to the exogenous DNA. Counter-selectable markers can also be used in engineering temperate phage. Recombinant phage which have retained the resistance marker can be screened by common methods such as PCR. Alternatively a counter-selectable marker, such as sacB, can be engineered into the backbone of the plasmid used for engineering such phage, and by selecting for the resistance marker linked to the exogenous DNA but against the counter- selectable marker, recombinant prophage can be isolated carrying only the exogenous DNA. The genotype can be confirmed by PCR. Such vectors are commonly available. Such engineered phage can be induced from the lysogenised strain, for example by the addition of Mitomycin C (Williamson et al., 2002), at which point the phage excise from the host chromosome and enter their lytic phase, such that the retained marker can no longer be selected, but the marker and exogenous DNA nevertheless remain in the phage genome.

Isolation of genetically manipulated lytic phage, however, cannot be achieved using the same methods described above. For example it is impossible to use conventional positive selection in order to isolate engineered obligately lytic phage, such as antibiotic and heavy metal resistance markers, which confer resistance to bacteria. These bacterial markers cannot be selected due to the obligately lytic lifestyle of the phage. The DNA of the phage never becomes part of the host cell genome and therefore selectable resistance markers which convey resistance to the host are not selectable when located on obligately lytic phage.

Some techniques have been developed for the engineering of lytic phage. One such example is the BRED technique (Bacteriophage Recombineering of Electroporated DNA) (Marinelli et al., 2008), which uses a "recombineering" approach, and has been described for the engineering of Mycobacterium phage. Recombineering methods for the manipulation of bacterial genomes were first described in the λ Red system (Yu et al., 2000). In this technique the recombination proteins Exo and Beta catalyse the efficient recombination of linear DNA sequence introduced into host cell via transformation. The BRED approach similarly utilises recombination promoting proteins - the RecE/RecT-like proteins gp60 and gp61 from a Mycobacterium bacteriophage - to promote high levels of recombination when phage genomes are co-transformed with linear "targeting" DNA fragments into M. smegmatis cells. Recombinant phage are then screened and identified with relative ease due to the high efficiency of recombination. However, such an approach relies upon the development of an efficient recombineering system in the chosen bacterial species. Furthermore, phage genomes are large (Hendrix, 2009) and transformation of large DNA molecules is inefficient even in readily transformable bacteria such as E. coli (Sheng et al., 1995), and efficient transformation techniques have not been developed for many bacterial species.

Specific techniques have been developed for the engineering of certain bacteriophage. For instance a technique known as RIPh (Rho* -mediated inhibition of phage replication) has been developed for phage T4 (Pouillot et al., 2010). Early genes essential to phage replication are transcribed as concatenated run-through RNAs requiring the host transcription terminator factor Rho for the production of the early proteins. It was found that engineering E. coli to contain an inducer-controlled overexpressed mutated copy of Rho, called Rho*, inhibits production of the early T4 proteins and thus reversibly inhibits T4 phage replication, but has a minimal effect on host cell viability. In this state the T4 genome does not replicate and the phage lifecycle through to mature phage synthesis and lysis does not continue, but the T4 genome is not lost from the cell, and is a substrate for recombination. In the RIPh technique, the λ Red system is used to target recombination into the T4 genome whilst it is in this stable suspended state. Removal of the inducer controlling Rho* expression lifts the repression of T4 phage replication and allows the phage to continue its lifecycle, forming mature, engineered, phage.

Another example of specific obligately lytic phage engineering systems is found in T7 phage. The E. coli genes trxA and cmk are required for the propogation of phage T7, but are not required for the growth of the host cell (Qimron et al., 2006; Mark & Richardson, 1976). Therefore T7 could be engineered to carry either of these "marker" genes, by selecting recombinant phage on engineered host cells that lack the marker genes. However, in both the T4 and T7 examples, quite specific and detailed knowledge of the phage's replication machinery, or the host cell genes specifically required for phage replication, is required.

It would be desirable to have a technique for modifying the genome of lytic phage which does not rely upon specific detailed knowledge of the genes involved in the replication pathway of the phage or the genes of the host cell required for phage propagation in the cell. It would further be desirable for such a technique to be broadly applicable to phage from any bacterial species.

Summary of the invention

The present invention provides a method for modifying the genome of a lytic target phage, which is endolysin-deficient, which method comprises:

(a) providing a vector which contains a phage-targeting region comprising an endolysin gene which is flanked by first and second flanking sequences capable of targeting the target phage genome;

(b) introducing the vector into a first host cell, which carries an endolysin gene in trans and which host cell is a host for the target phage;

(c) infecting the first host cell with the target phage;

(d) allowing replication of phage to take place in the presence of the vector whereby the genome of the target phage is modified by insertion of the endolysin gene;

(e) propagating resultant phage on a second host cell which is endolysin-deficient, which host cell is a host for the target phage; and

(f) harvesting the resultant phage.

It has surprisingly been found that an endolysin gene of a phage can be used as a selectable marker to modify the genome of a phage which is endolysin-deficient, for example in which the native endolysin gene has been deleted or mutated. The invention is particularly useful for the genetic modification of obligately lytic phage which cannot form lysogens and which have already been rendered non-lytic by deletion or mutation of their endolysin gene. In this way, there is provided a means for genetic selection that is not reliant upon selecting characteristics of the host cell and instead selects for a characteristic inherited by the phage in its lytic state. Insertion of the endolysin gene into the genome of the target phage may be effected by homologous recombination or transposition. Such recombination or transposition of the endolysin gene may be made into the original (native) location of the endolysin gene or into an ectopic position which is different from the original location.

It has further been surprisingly found that by providing the first host cell with an endolysin gene in trans as a host for the target phage, recombination or transposition of the endolysin gene occurs at a higher than expected rate.

Where homologous recombination is desired, the target phage genome includes a first target sequence and a second target sequence wherein the first and second flanking sequences of the phage-targeting region are homologous to the first and second target sequences of the target phage genome so that recombination occurs upon replication of phage in the presence of the vector.

Because the first and second flanking sequences of the phage targeting region are homologous to the first and second target sequences of the target phage genome, once the first host cell contains both the vector and the target phage, the phage can replicate and recombination can take place at the pairs of sequences homologous with one another. Following recombination, only those resultant phage carrying the endolysin gene may propagate in host cells lacking the endolysin gene. This enables direct selection of desired resultant phage containing the marker endolysin gene.

According to this arrangement, the genome of the endolysin deficient lytic target phage may be modified by incorporation of an exogenous DNA sequence therein, by incorporation of a mutation such as a point mutation, or by creating a deletion. Combinations of these modifications may also be made.

The first and second target sequences of the target phage genome may be contiguous or noncontiguous. In one arrangement, the first and second target sequences of the target phage are non-contiguous. According to this arrangement, where a recombination event occurs between the first and second flanking sequences and the first and second target sequences the region of DNA between the first and second target sequences is excised from the target phage genome resulting in a deletion. This region of DNA is preferably inessential to phage function. Advantageously, where the first and second target sequences of the target phage genome flank a phage gene or part thereof, such deletion results in inactivation of the gene following recombination.

Alternatively, genes essential to phage function could be deleted or inactivated. Here, the essential gene may be provided in trans in the first host cell, for example on a vector or in the genome of a host strain which can be used to propagate the phage.

Where modification of the genome of the lytic target phage involves incorporation of an exogenous DNA sequence, the phage-targeting region of the vector further comprises an exogenous DNA sequence for incorporation into the genome of the target phage. Because the exogenous DNA sequence and endolysin gene both fall within the first and second flanking sequences of the phage-targeting region, recombination of the phage to select for the endolysin gene will result in incorporation of the exogenous DNA sequence in the resultant phage. According to this arrangement, the first and second target sequences of the target phage genome may be contiguous or non-contiguous. Where they are non-contiguous, incorporation of the exogenous DNA sequence will simultaneously result in deletion of a region of the genome. Where the first and second target sequences are positioned in a phage gene or where they flank a phage gene or part thereof, incorporation of the exogenous DNA sequence will simultaneously result in inactivation of the gene following recombination.

Where a mutation, such as a point mutation is needed to be incorporated into the endolysin deficient lytic target phage, at least one of the first and second flanking sequences in the phage-targeting region would contain the mutation as compared with the first and second target sequences of the target phage genome. Upon replication and recombination of the phage the genome of the target phage would be modified so as to incorporate the mutation. In this way, phage would be isolated carrying the endolysin gene, and could be screened for the presence of the mutation.

As described above, introduction of such mutations could be combined with the incorporation of exogenous DNA sequence optionally together with a deletion in the target phage.

In a further arrangement, the phage-targeting region comprises a transposable element (TE) comprising the endolysin gene and, optionally, an exogenous DNA sequence, wherein the first and second flanking regions are inverted repeats recognisable by a transposase. In this way, transposition occurs upon replication of phage in the presence of the vector and a transposase. The transposase may be provided on the vector, in the genome of the first host cell, in a second vector or even in the phage. Preferably, the transposase is expressed from a transposase gene present on the vector or in the genome of the host cell.

Advantageously, the exogenous DNA sequence is flanked by protein translation stop codons in each frame of translation, so that translation from the transcripts of any gene into which the transposon may insert is halted at the point of insertion. Each translation stop sequence (known henceforth as a "3 frame stop codon sequence") carries stop codons in all 3 frames of translation. Relative to the orientation of the endolysin gene, the flanking 3 frame stop codon sequences are arranged such that the translation of proteins encoded on the sense or anti- sense DNA strand is halted at the point of insertion.

Where modification of an endolysin^" phage genome by transposon mutagenesis is needed, the endolysin gene may be flanked by 3 frame translation stop sequences and the inverted repeats of a transposon and cloned into a plasmid, together with a transposase gene from the same transposon, and introduced into a host cell for the phage which carries the endolysin gene in trans. When the phage is replicated in such a strain, transposition can occur. Transposon- carrying phage can be isolated on a strain which lacks the endolysin gene. Such phage contain transposon insertions which are not deleterious to the phage, such as insertions within non-coding sequences or non-essential genes.

Where random insertion of an exogenous sequence into the phage genome is required, the exogenous sequence, together with the endolysin gene, may be flanked by 3 frame translation stop sequences and the inverted repeats of a transposon and cloned into a plasmid, together with a transposase gene from the same transposon, and introduced into a host cell for the phage which carries the endolysin gene in trans. Transposon carrying phage can be isolated as described above.

Typically the vector which contains the phage-targeting region is a plasmid. Such vectors are capable of replication in the first host cell. The plasmid may be a broad host range plasmid (Jain and Srivastava, 2013) or a shuttle plasmid, for example capable of replicating in both E. coli and the first host cell. The second host cell is preferably isogenic with the first host cell except that it is endolysin deficient, for example lacking in the in trans endolysin gene. Detailed description of the technique

Generally, bacteriophage encode two enzymes which allow the release of progeny phage from the host cell following lytic replication. In all dsDNA bacteriophage the endolysin protein catalyses the degradation of the peptidoglycan layer of the bacterial cell wall, thus compromising the structural integrity of the peptidoglyan layer of the cell leading to bursting of the cell and release of the cytoplasmic proteins, including newly generated phage. However, in the majority of dsDNA phages, the endolysin cannot access the peptidoglycan layer without the production of the phage-encoded holin protein, which inserts into the cytoplasmic membrane, thus allowing the endolysin to access the peptidoglycan layer. The timing of holin expression determines the timing of host cell lysis, as the endolysin can accumulate without affecting host cell viability (Young, 1992).

In the present invention, it has been found that the endolysin gene can be inserted into the genome of an endolysin deficient phage, either in the original position of the endolysin gene or in an ectopic position, restoring the ability of the phage to lyse a host cell without the endolysin gene being provided in trans. According to the present invention the genetic marker used is a gene encoding an endolysin. The endolysin enzymes identified in bacteriophage are classified according to their site of catalytic activity, as lysozymes, transglycosidases, endopeptidases and amidases. Endolysin genes in bacteriophage can be found by bio informatics analysis of sequenced bacteriophage genome, as demonstrated by Oliveira et al. (2013). Putative endolysins are identified by searching for genes encoding proteins which carry putative catalytic domains but which lack domains with extraneous function (which would be characteristic of exolysins - also known as structural lysins). Such an approach lead to the identification of putative endolysins in bacteriophage infecting 63 different Gram positive and negative genera, including Pseudomonas spp, Escherichia spp., Klebsiella spp., Bacillus spp., Staphylococcus spp. and Streptococcus spp. (Oliveira et al., 2013). Alternatively, phage endolysins may be identified by BLAST search and identification of genes homologous to putative phage endolysin genes in sequence databases.

Furthermore, phenotypic testing can be carried out in order to confirm the murein hydrolase activity of proteins encoded by putative endolysin genes (Briers et al., 2007; Briers et al., 2011). Putative endolysin genes can be cloned into a plasmid and introduced into bacterial cells. Expression of the putative endolysin is not deleterious to the cell because the endolysin cannot access its peptidoglycan substrate due to the inner membrane, therefore allowing the stable acquisition of the cloned endolysin gene by the bacterial cell. In the absence of the holin protein, the inner membrane of bacterial cells can be permeablised by the addition of chloroform. Thus chloroform can be added to cultures of bacteria carrying putative endolysins, as well as to control cultures carrying empty plasmid vector, and the optical density of such cultures assessed over time. Bacteria carrying cloned endolysin genes can be identified by a reduction in optical density upon addition of chloroform, with no such reduction in the control culture carrying empty plasmid. The reduction in optical density is caused by cell lysis as the endolysin proteins are able to degrade the peptidoglycan upon permealisation of the inner membrane upon chloroform addition.

Bacteriophage Phi33 was isolated as a broad host range phage infecting Pseudomonas aeruginosa. The genome of Phi33 was sequenced and a putative endolysin gene - οτβθ, encoding a predicted 222 amino acid protein - was identified by BLAST search, showing homology to putative endolysin proteins from phage infecting P. aeruginosa, Burkholderia ambifaria, and E. coli (47-99% amino acid identity over 97-100% of the protein.) Residues 22-217 were identified as a conserved domain from the lysozyme-like superfamily of proteins. Residues 121-219 were identified as part of the conserved domain from the glycoside hydrolase family 19, members of which catalyse the hydrolysis of the β(1 - 4) glycosidic bond. No domains with extraneous functions could be identified. Therefore, ονβθ would appear to encode an endolysin with glycoside hydrolase activity.

The endolysin activity of οτβθ was phenotypically confirmed by transferring a plasmid carrying οτβθ into P. aeruginosa and assessing the chloroform sensitivity of the strain, as described earlier (e.g. Briers et ah, 2011). Strains carrying οτβθ displayed chloroform sensitivity, as seen by a reduction in optical density measured at 600 nm (OD600) upon chloroform addition, whilst strains which did not carry οτβθ were insensitive to chloroform, indicating that οτβθ is an endolysin.

A preferred embodiment of this invention is to use the οτβθ endolysin gene from Phi33 as a selectable marker for modification of P. aeruginosa phage genomes by recombination or transposon mutagenesis. The endolysin gene may incorporate its native promoter, isolated from the phage from which it was derived. Alternatively, the endolysin gene may be used without a promoter, with its transcription being driven by a phage promoter, provided upon insertion into the phage genome by transposition or recombination. In such a way, regions of the phage carrying promoter sequences could be identified, as only insertion or recombination into such regions would allow the formation of functional bacteriophage restored to a lytic phenotype. A further alternative is to use a promoter-regulator system, such as the lacI-lac\JV5 system, controlling the expression of the endolysin gene using exogenously added chemicals, or in response to environmental cues. Another alternative is to use a constitutive promoter. Both regulated and constitutive promoters may be isolated from a phage, bacterium, or designed in silico and synthesised.

In one arrangement, the endolysin gene is flanked by the inverted repeats from a transposon (henceforth, referred to as IR-endolysin-IR) and cloned into a plasmid, together with the gene for the transposase which is specific to the chosen IR sequences, and the transposase gene can be under the control of an inducible promoter. In one arrangement the plasmid can be a broad-host range plasmid or a shuttle plasmid, capable of replicating in both E. coli and the chosen bacterial host, and such a plasmid can be transferred into a suitable recipient strain of a species other than E. coli, that is a host for the bacteriophage to be modified, and transposon mutagenesis of the targeted phage can be performed.

In another arrangement the plasmid can be a "suicide" plasmid which replicates in E. coli but does not replicate in the target species, in which case the plasmid would contain a "targeting" sequence for integration into the bacterial genome of a suitable strain by homologous recombination. Transposon mutagenesis of the targeted phage can then be performed.

In one arrangement the insertion sequences may flank a transposase gene in addition to the endolysin gene, allowing catalysis of transposition in the chosen bacterial species. In a preferred arrangement, the transposase would be provided in trans to the IR-endolysin-IR sequence.

In one arrangement the transposase gene could be provided in trans on another plasmid, such a plasmid being a shuttle vector, broad host range vector, or a suicide vector for chromosomal integration as described above. In a preferred arrangement, the transposase gene could be provided on the same plasmid as the IR-endolysin-IR sequence, outside the IR sequences.

In another arrangement of the invention, the transposase gene could be engineered into the genome of the bacteriophage chosen to undergo transposon mutagenesis.

There are many transposons that would be suitable for use in such a technique, which have characterised inverted repeat sequences and transposase genes. Well characterised transposons, used for mutagenesis in bacteria, include Tn5, Tn7 TnlO and Mariner-type transposons (Berg and Berg, 1995; Rubin et ah, 1999).

A preferred transposon is the Himarl mariner transposon from Haematobia irritans, or derivatives of this transposon.

In one embodiment, this invention may be used to identify transposon mutants of obligately lytic bacteriophage. In another embodiment, the invention may be used to identify transposon mutants of temperate phage, during lytic growth.

In one arrangement, this invention may be used to create transposon mutants of obligately lytic bacteriophage. In another arrangement, the invention may be used to create transposon mutants of temperate phage, during lytic growth.

This approach can be used as a technique for the manipulation of a lytic phage genome which has been modified to inactivate its native endolysin gene, if the endolysin sequence is introduced alongside adjustments to the phage genome.

In one arrangement of this invention, endolysin selection can be used to identify or produce phages carrying exogenous DNA sequence(s): sequences of homology flanking the site of insertion in the phage can be cloned into a plasmid capable of replicating in the chosen bacterial host carrying the endolysin gene in trans (endolysin-complementing strain); endolysin can be cloned between the homology arms together with exogenous DNA sequence(s). The plasmid would be transformed into the endolysin-complementing strain, and bacteria carrying the engineered plasmid would be infected by phage, and a phage lysate isolated. The phage lysate would be used to identify endolysin expressing plaques on a strain which is a host for the wild-type phage, but does not carry the endolysin in trans. Plaques can be picked and tested by PCR for the presence of the expected recombinant sequence.

In another arrangement of this invention endolysin selection can be used to identify or produce phages with sequences which have been deleted: Non-contiguous sequences of homology flanking the proposed deletion site in the phage can be cloned into a plasmid capable of replicating in the endolysin-complementing strain; endolysin can be cloned between the homology arms. The plasmid would be transformed into the endolysin- complementing strain, and bacteria carrying the engineered plasmid would be infected by phage, and a phage lysate isolated. The phage lysate would be used to identify endolysin expressing plaques on a strain which is a host for the wild-type phage, but does not carry the endolysin in trans. Plaques can be picked and tested by PCR for the presence of the expected deletion in the phage DNA sequence.

In another arrangement of this invention endolysin selection can be used to identify or produce phages with sequences which carry point mutations: sequences of homology carrying one or more point mutations in the DNA sequence compared to the targeted phage, and flanking a suitable marker insertion site in the phage, can be cloned into a plasmid capable of replicating in the endolysin-complementing strain; endolysin can be cloned between the homology arms. The plasmid would be transformed into the endolysin- complementing strain, and bacteria carrying the engineered plasmid would be infected by phage, and a phage lysate isolated. The phage lysate would be used to identify endolysin expressing plaques on a strain which is a host for the wild-type phage, but does not carry the endolysin in trans. Plaques can be picked and tested by PCR and sequencing, to check for the insertion of the desired point mutations.

In another arrangement, an exogenous DNA sequence can be added to a phage, together with a deletion in the targeted phage, by a combination of the approaches described above.

In another arrangement, an exogenous DNA sequence can be added to a phage, together with a point mutation in the targeted phage, by a combination of the approaches described above. In another arrangement, an exogenous DNA sequence can be added to a phage, together with a deletion in the targeted phage and a point mutation(s) introduced by a combination of the approaches described above.

In another arrangement, a deletion could be made in the targeted phage and a point mutation(s) introduced by a combination of the approaches described above.

In one embodiment, this invention may be used to identify or produce modified obligately lytic bacteriophage. In another embodiment, the invention may be used to identify or produce modified temperate phage, either as lysogens or during lytic growth.

In one arrangement, this invention may be used to modify obligately lytic bacteriophage. In another arrangement, the invention may be used to modify a temperate phage, during lytic growth.

In one embodiment, this invention can be used to identify or produce transposon mutated phages, and hence the identification of non-essential regions and genes in the phage.

Detailed description of the invention

This invention will now be described in more detail, by way of example only, and with reference to the accompanying drawings, in which:

Figure 1 is a schematic diagram showing construction of plasmids containing lacZ M\5 and Phi33 endolysin for genetic modification of P. aeruginosa to carry these genes in trans;

Figure 2 is a schematic diagram showing construction of plasmids to genetically modify Phi33 to replace the endolysin gene with lacZa;

Figure 3 is a schematic diagram showing construction of a plasmid carrying IR-endolysin-IR transposable element for genetic modification of phage via transposon mutagenesis; and

Figure 4 is a schematic diagram showing the location of transposon insertion sites in orf84 of phage Phi33. Figure 5 is a schematic diagram showing construction of a plasmid to genetically modify an endolysin minus derivative of Phi33 to delete orf84, while simultaneously re-introducing the endolysin gene.

This is a summary of the genetic modification of a lytic bacteriophage by transposon mutagenesis to identify putative non-essential sequences or genes in the genome of Pseudomonas aeruginosa phage Phi33, and subsequent deletion of an identified non-essential gene.

For the creation and identification of phage Phi33 mutants, carrying transposon insertions in non-essential genes or DNA regions, it is shown how, using an E. colilP. aeruginosa broad host range vector carrying a transposase gene and a transposable element (TE), phage mutants carrying a transposable element (TE) can be selected, using an endolysin gene as a selectable marker.

It is further shown how, using recombinant plasmids carrying non-contiguous DNA from the Phi33 genome, phage can be selected which have deletions in a targeted gene, by using an endolysin gene as a selectable marker.

A pre-requisite for these procedures is that the endolysin gene of the phage to be modified is deleted. There are a number of methods described in the literature for the modification of temperate and lytic bacteriophage (Marinelli et al., 2008; Thomason et al., 2014). As an example only, the deletion of the endolysin gene, orflO, of phage Phi33 is described using the lacZa gene as a marker to identify recombinant phage on media carrying a chromogenic substrate. This is described in co-pending UK Patent Application No. 1417811.5 of the present applicant.

Since the bacteriophage to be modified is lytic (rather than temperate), a requirement for these described steps of bacteriophage construction is the construction of a suitable host P. aeruginosa strain that carries the Phi33 endolysin gene at a suitable location in the bacterial genome, to complement the Aendolysin phenotype of the desired recombinant bacteriophage, and also addition of the lacZ ΔΜ15 allele which complements the lacZa fragment so that lacZa carrying phage can be identified on suitable chromogenic media. As an example, the construction of these P. aeruginosa strains may be achieved via homologous recombination using an E. coli vector that is unable to replicate in P. aeruginosa. Furthermore, the genomic location for insertion of the endolysin and lacZAM\5 transgenes should be chosen such that no essential genes are affected and no unwanted phenotypes are generated through polar effects on the expression of adjacent genes. As an example, one such location may be immediately downstream of the P. aeruginosa strain PAOl phoA homologue.

The Phi33 endolysin gene and the E. coli lacZ ΔΜ15 allele may be cloned into an E. coli vector that is unable to replicate in P. aeruginosa, between two regions of P. aeruginosa strain PAOl genomic DNA that flank the 3' end of phoA. This plasmid may be introduced into P. aeruginosa and isolates having undergone a single homologous recombination to integrate the whole plasmid into the genome selected according to the acquisition of tetracycline (50 μg/ml) resistance. Isolates (endolysin⁺, /acZAM15⁺) which have undergone a second homologous recombination event may then be isolated on medium containing 10% sucrose (utilising the sacB counter-selectable marker present on the plasmid backbone).

Homologous recombination may be used to replace the orflO endolysin gene of Phi33, to render it non-lytic (Aendolysin Phi33). A region consisting of the E. coli lacZa sequence may be cloned in broad host range E. coli/P. aeruginosa vector, between two regions of Phi33 genomic DNA which flank the native orflO endolysin gene. This plasmid may be transferred to a suitable P. aeruginosa (endolysin⁺ /acZAM15⁺) strain, and the resulting strain infected by Phi33. Progeny phage may be harvested and double recombinants identified by plaquing on P. aeruginosa (endolysin⁺ /acZAM15⁺), looking for acquisition of the lacZa reporter on medium containing a chromogenic substrate that detects the action of β-galactosidase.

Transposon mutants can be identified in Phi33 by mutagenesis using an orflO endolysin- containing TE. A 3-frame translation stop sequence, together with the or/30 endolysin gene, may be cloned between the inverted repeat sequences of the Himarl mariner transposon from Haematobia irritans in a broad host range E. coli/P. aeruginosa vector, together with the Himarl transposase gene. This plasmid may be introduced into a suitable P. aeruginosa host carrying orflO in trans (endolysin⁺ strain), and the resulting strain infected with Phi33. Phage progeny may be isolated and transposon mutants identified by plaquing on a strain which does not carry orflO in trans, such as PAOl . Only phage carrying the described transposon are able to plaque. Homologous recombination may be used to replace the or/84 gene of Phi33, using the orflO endolysin gene as a selectable marker. A region consisting of the orflO gene, may be cloned between two regions of Phi33 that are non-contiguous and flank the orf84 gene, in a broad host range E. coli/P. aeruginosa vector. This plasmid may be transferred to a suitable endolysin⁺ P. aeruginosa strain, and the resulting strain infected by Aendolysin Phi33. Progeny phage may be harvested and double recombinants identified by plaquing on a strain which does not carry orftO in trans, such as PAOl . Only phage carrying the described recombinant sequence are able to plaque.

Experimental procedures

PCR reactions to generate DNA for cloning purposes may be carried out using Herculase II Fusion DNA polymerase (Agilent Technologies), depending upon the melting temperatures (Tm) of the primers, according to manufacturer's instructions. PCR reactions for screening purposes may be carried out using Taq DNA polymerase (NEB), depending upon the T_m of the primers, according to manufacturer's instructions. Unless otherwise stated, general molecular biology techniques, such as restriction enzyme digestion, agarose gel electrophoresis, T4 DNA ligase-dependent ligations, competent cell preparation and transformation may be based upon methods described in Sambrook et al., (1989). Enzymes may be purchased from New England Biolabs or Thermo Scientific. DNA may be purified from enzyme reactions and prepared from cells using Qiagen DNA purification kits. Plasmids may be transferred from E. coli strains to P. aeruginosa strains by conjugation, mediated by the conjugation helper strain E. coli HB101 (pRK2013). A chromogenic substrate for β- galactosidase, S-Gal, that upon digestion by β-galactosidase forms a black precipitate when chelated with ferric iron, may be purchased from Sigma (S9811).

Primers may be obtained from Sigma Life Science. Where primers include recognition sequences for restriction enzymes, additional 2-6 nucleotides may be added at the 5' end to ensure digestion of the PCR-amplified DNA.

All clonings, unless otherwise stated, may be achieved by ligating DNAs overnight with T4 DNA ligase and then transforming them into E. coli cloning strains, such as DH5a or TOP 10, with isolation on selective medium, as described elsewhere (Sambrook et al., 1989). An E. coli/P. aeruginosa broad host range vector, such as pSM1080, may be used to transfer genes between E. coli and P. aeruginosa. pSM1080 was previously produced by combining a broad host-range origin of replication, from a Pseudomonas plasmid, oriT from pRK2, the tetAR selectable marker for use in both E. coli and P. aeruginosa, from plasmid pR 415, and the high-copy-number, E. coli origin of replication, oriV, from plasmid pUC19.

An E. coli vector that is unable to replicate in P. aeruginosa, pSM1104, may be used to generate P. aeruginosa mutants by allelic exchange. pSM1104 was previously produced by combining oriT from pRK2, the tetAR selectable marker for use in both E. coli and P. aeruginosa, from plasmid pRK415, the high-copy-number, E. coli origin of replication, oriV, from plasmid pUC19, and the sacB gene from Bacillus subtilis strain 168, under the control of a strong promoter, for use as a counter-selectable marker.

An E. coli/P. aeruginosa broad host range vector carrying the Himarl transposase gene under control of the lac promoter, such as pSMX80, may be used to clone and transfer transposable elements into P. aeruginosa. pSMX80 was previously produced by combining oriT from pRK2, the tetAR selectable marker and oriV, for use in both E. coli and P. aeruginosa, from plasmid pRK415, and the lacI-lacUV5 promoter and the Himarl transposase gene from published sequences.

Phi33 sequences, which form templates for PCR amplification, are given in appendix 1.

Construction of plasmids to generate a Pseudomonas aerusinosa strain that carries both the Phi33 endolysin gene and the Escherichia coli lacZ AMIS gene, immediately downstream of the phoA locus of the bacterial genome

1. Plasmid pSMX700 (Figure 1), comprising pSMl 104 carrying DNA flanking the 3' end of the P. aeruginosa PAOl phoA homologue, may be constructed as follows.

A region comprising the terminal approximately 1 kb of the phoA gene from P. aeruginosa may be amplified by PCR using primers B4700 and B4701 (Figure 1). The PCR product may then be cleaned and digested with Spel and Bglll. A second region comprising approximately 1 kb downstream of the phoA gene from P. aeruginosa, including the 3' end of the PA3297 open reading frame, may be amplified by PCR using primers B4702 and B4703 (Figure l).This second PCR product may then be cleaned and digested with Bglll and Xhol. The two digests may be cleaned again and ligated to pSM1104 that has been digested with Spel and Xhol, in a 3-way ligation, to yield plasmid pSMX700 (Figure 1).

Primer B4700 consists of a 5' Spel restriction site (underlined), followed by sequence located approximately 1 kb upstream of the stop codon of phoA from P. aeruginosa strain PAOl (Figure 1). Primer B4701 consists of 5 ' Bglll and Aflll restriction sites (underlined), followed by sequence complementary to the end of the phoA gene from P. aeruginosa strain PAOl (the stop codon is in lower case; Figure 1). Primer B4702 consists of 5' Bglll and Nhel restriction sites (underlined), followed by sequence immediately downstream of the stop codon of the phoA gene from P. aeruginosa strain PAOl (Figure 1). Primer B4703 consists of a 5' Xhol restriction site (underlined), followed by sequence within the PA3297 open reading frame, approximately 1 kb downstream of the phoA gene from P. aeruginosa strain PAOl (Figure 1).

Primer B4700 (SEQ ID NO: 1)

5 '-GATAACTAGTCCTGGTCCACCGGGGTCAAG-3 '

Primer B4701 (SEQ ID NO: 2)

5'-GCTCAGATCTTCCTTAAGtcaGTCGCGCAGGTTCAG-3 '

Primer B4702 (SEQ ID NO: 3)

5'-AGGAAGATCTGAGCTAGCTCGGACCAGAACGAAAAAG-3 '

Primer B4703 (SEQ ID NO: 4)

5'-GATA.CTCGAGGCGGATGAACATTGAGGTG-3 '

2. Plasmid pSMX701 (Figure 1), comprising pSMX700 carrying the Phi33 endolysin gene under the control of an endolysin promoter, may be constructed as follows.

The endolysin promoter may be amplified by PCR from Phi33 using primers B4704 and B4705 (Figure 1). The endolysin gene itself may be amplified by PCR from Phi33 using primers B4706 and B4707 (Figure 1). The two PCR products may then be joined together by Splicing by Overlap Extension (SOEing) PCR, using the two outer primers, B4704 and B4707. The resulting PCR product may then be digested with Afill and Bglll, and ligated to pSMX700 that has also been digested with Afill and Bglll, to yield plasmid pSMX701 (Figure 1).

Primer B4704 consists of a 5 ' Afill restriction site (underlined), followed by a bi-directional transcriptional terminator (soxR terminator, 60-96 bases of Genbank accession number DQ058714), and sequence of the beginning of the Phi33 endolysin promoter region (underlined, in bold) (Figure 1). Primer B4705 consists of a 5' region of sequence that is complementary to the region overlapping the start codon of the endolysin gene from Phi33, followed by sequence that is complementary to the end of the endolysin promoter region (underlined, in bold; Figure 1). Primer B4706 is the reverse complement of primer B4705 (see also Figure 1). Primer B4707 consists of a 5' Bglll restriction site (underlined), followed by sequence complementary to the end of the Phi33 endolysin gene (Figure 1).

Primer B4704 (SEQ ID NO: 5)

5'-GATACT AAGAAAACAAACTAAAGCGCCCTTGTGGCGCTTTAGTTTTA

TACTACTGAGAAAAATCTGGATTC-3 '

Primer B4705 (SEQ ID NO: 6)

5'-GATTTTCATCAATACTCCTGGATCCCGTTAATTCGAAGAGTCG-3 ' Primer B4706 (SEQ ID NO: 7)

5'-CGACTCTTCGAATTAACGGGATCCAGGAGTATTGATGAAAATC-3 '

Primer B4707 (SEQ ID NO: 8)

5 '-GATAAGATCTTCAGGAGCCTTGATTGATC-3 '

3. Plasmid pSMX702 (Figure 1), comprising pSMX701 carrying lacZ AM 15 under the control of a lac promoter, may be constructed as follows.

The lacZ AM 15 gene under the control of a lac promoter may be amplified by PCR from Escherichia coli strain DH10B using primers B4708 and B4709 (Figure 1). The resulting PCR product may then be digested with Bglll and Nhel, and ligated to pSMX701 that has also been digested with Bglll and Nhel, to yield plasmid pSMX702 (Figure 1).

Primer B4708 consists of a 5' Bglll restriction site (underlined), followed by sequence of the lac promoter (Figure 1). Primer B4709 consists of a 5' Nhel restriction site (underlined), followed by a bi-directional transcriptional terminator and sequence complementary to the 3' end of lacZ AMI 5 (underlined, in bold; Figure 1).

Primer B4708 (SEQ ID NO: 9)

5 '-GATAAGATCTGCGCAACGCAATTAATGTG-3 '

Primer B4709 (SEQ ID NO: 10)

5'-GATAGCTAGCAGTCAAAAGCCTCCGGTCGGAGGCTTTTGACTTTATT

TTTGACACCAGACC AAC-3 '

Genetic modification of Pseudomonas aeruginosa to introduce the Phi33 endolysin gene and Escherichia coli lacZ AMIS immediately downstream of the phoA locus of the bacterial genome

1. Plasmid pSMX702 (Figure 1) may be transferred to P. aeruginosa by conjugation, selecting for primary recombinants by acquisition of resistance to tetracycline (50 μg/ml).

2. Double recombinants may then be selected via saci?-mediated counter-selection, by plating onto medium containing 10% sucrose.

3. Isolates growing on 10% sucrose may then be screened by PCR to confirm that the endolysin gene and lacZ AMI 5 have been introduced downstream of the P. aeruginosa phoA gene.

4. Following verification of an isolate (PAX7), this strain may then be used as a host for further modification of Phi33, or similar bacteriophage, where complementation of one of both of an endolysin mutation and a lacZ reporter are required. Construction of a plasm id for the introduction in to Phi33 of a complete deletion of the endolysin (ονβθ) gene containing a lacZa marker

1. Plasmid pSMX703, comprising pSM1080 containing a region of Phi33 spanning the orf29- οτβ2 region with a complete deletion of the CDS of οτβθ, may be constructed as follows.

The region of Phi33 sequence immediately downstream of the CDS of the endolysin gene (orfiO) may be amplified by PCR using primers B4710 and B4711 (Figure 2). This PCR product may then be cleaned and digested with Ndel and Nhel. The region of Phi33 sequence immediately upstream of or 30's CDS may be amplified by PCR using primers B4712 and B4713 (Figure 2). This second PCR product may then be cleaned and digested with Ndel and Nhel. The two PCR product digests may then be cleaned again and ligated to pSM1080 that has been digested with Nhel and dephosphorylated, to yield plasmid pSMX703.

Primer B4710 consists of a 5' Nhel restriction site (underlined), followed by sequence that is complementary to Phi33 sequence located approximately 750bp downstream of the Phi33 οτβθ gene (Figure 2). Primer B4711 consists of 5' Ndel and Kpnl restriction sites (underlined), followed by sequence of Phi33 that is located immediately downstream of the οτβθ gene (Figure 2). Primer B4712 consists of a 5' Ndel restriction site (underlined), followed by sequence that is complementary to sequence located immediately upstream of the Phi33 οτβθ gene (Figure 2). Primer B4713 consists of a 5 ' Nhel site (underlined), followed by Phi33 sequence that is located approximately 750 bp upstream of the οτβθ gene (Figure 2).

B4710 (SEQ ID NO: 11)

5 '-GATAGCTAGCGTGGCCTGGCGTCACCTTC-3 '

B4711 (SEQ ID NO: 12)

5'-GATACATATGTCGGTACCTATTCGCCCAAAAGAAAAG-3 '

B4712 (SEQ ID NO: 13)

5 '-GATACATATGTCAATACTCCTGATTTTTG-3 ' B4713 (SEQ ID NO: 14)

5 '-GATAGCTAGCCGTTCTCAAAGTGGGTGGTG-3 '

2. Plasmid pSMX704, comprising pSMX703 containing the lacZa gene, may be constructed as follows. lacZa may be PCR amplified using primers B4714 and B4715 (Figure 2). The resulting PCR product may then be digested with Kpnl and ligated to pSMX703 that has also been digested with Kpnl and treated with alkaline phosphatase, to yield pSMX704 (Figure 2).

Primer B4714 consists of a 5 ' Kpnl restriction site (underlined), followed by sequence complementary to the 3' end of lacZa (Figure 2). Primer B4715 consists of a 5 ' Kpnl restriction site (underlined), followed by sequence of the lac promoter driving expression of lacZa (Figure 2).

Primer B4714 (SEQ ID NO: 15)

5 '-GATAGGTACCTTAGCGCCATTCGCCATTC-3 '

Primer B4715 (SEQ ID NO: 16)

5 '-GATAGGTACCGCGCAACGCAATTAATGTG-3 '

Genetic modification of Phi33 to replace orfiO with lacZa

1. Plasmid pSMX704 may be introduced into P. aeruginosa strain PAX7 by conjugation, selecting transconjugants on the basis of tetracycline resistance (50 μg/ml), yielding strain PTA700.

2. Strain PTA700 may be infected with phage Phi33, and the progeny phage harvested.

3. Recombinant phage in which οτβθ has been replaced with lacZa may identified by plaquing the lysate from step (2) on P. aeruginosa strain PAX7, onto medium containing S- gal (500 μg/ml) and IPTG (1 mM final concentration), looking for black plaques, which are indicative of β-galactosidase activity. 4. PCR may be carried out to check that orflO has been removed, and that lacZa is present in its place.

5. Following identification of a verified isolate (PTPX700; Figure 2), this isolate may be plaque purified twice more on P. aeruginosa strain PAX7, prior to further use.

Construction of a plasmid for the transposon mutagenesis of a non-lytic derivative of phage Phi33 using the Himarl mariner transposon

Plasmid pSMX710, carrying a transposable element (TE) consisting of the inverted repeat sequences from the Himarl transposon flanking the Phi33 οτβθ endolysin gene, which is flanked by 3 frame translational stop sequences, cloned into plasmid pSMX80 may be constructed as follows:

The coding sequence of οτβθ, inclusive of the native ribosome binding site, may be amplified from Phi33 genomic DNA with primers B4750 and B4751. This PCR product may be cleaned, digested with Xbal, cleaned again then finally ligated in to pSMX80, a broad host range plasmid carrying a tetracycline resistance gene and the Himarl transposase gene under the control of the lacI-lacUV5 regulated promoter system, that has been digested with Nhel and dephosphorylated. This yields plasmid pSMX710 (Figure 3). The orientation of the insert may be determined by PCR.

Primer B4750 comprises a 5' Xbal sequence (underlined) followed by the Himarl inverted repeat sequence (bold), followed by a 3 frame translation stop sequence (italics), followed by the οτβθ 5' sequence. Primer B4751 comprises an Xbal site (underlined) followed by the Himarl inverted repeat sequence (bold), followed by a 3 frame translation stop sequence (italics), followed by sequence complementary to the οτβθ 3' sequence.

Primer B4750 (SEQ ID NO: 17)

5'-

CGCGTCTAGAGTAACAGGTTGGCTGATAAGTCCCCGGTCTCTAGm4 CTGATT GA AGGAGTATTGATGAAAATCACGAAGGATG-3 ' Primer B4751 (SEQ ID NO: 18)

5'-

CGCGTCTAGAGTAACAGGTTGGCTGATAAGTCCCCGGTCTCTAGrG^ CTGATT G^TCAGGAGCCTTGATTGATCG-3 '

Creation and selection of transposon mutants of an endolysin^" derivative of Phi33 (ΦΡΤΡΧ700) using endolysin selection

1. Plasmid pSMX710 may be conjugated into P. aeruginosa strain PAX7, selecting for transconjugants which are tetracycline resistant (50 μg/ml), creating strain PTA710 (Figure 3)

2. Strain PTA710 may be infected with phage ΦΡΤΡΧ700 and a cell- free phage lysate obtained, following growth in media supplemented with IPTG (1 mM final concentration) (Figure 3).

3. The phage lysate may be plaqued on P. aeruginosa strain PAOl and individual plaques isolated. Each plaque is clonal for a phage containing a transposon insertion (Figure 3).

4. The position of transposon insertions in phage mutants, from individual plaques isolated above, can be assessed by PCR using semi-random primers followed by sequencing. The PCR procedure is essentially as described by Malone et al. (2010). The location of the transposon insertion may be ascertained by locating the position of the sequence that adjoins the end of the transposon sequence in the Phi33 (the progenitor of ΦΡΤΡΧ700) reference genome. Sequence alignment tools such as BLAST may be used.

5. By such methods, transposon insertions were found in the Phi33 or 84 gene (figure 4).

Construction of plasmids for the deletion of phage Phi33 gene orf84

1. Plasmid pSMX720 (Figure 5), comprising pSM1080 containing regions of Phi33 immediately flanking the orf84 gene, together with the or/30 endolysin gene, may be constructed as follows.

A region encompassing the 992 bp upstream of the or/84 gene from Phi33, together with the first 4 bp of the or/84 gene, may be amplified from Phi33 genomic DNA, using primers B4720 and B4721. A region encompassing the orflO gene, including the RBS, may be amplified using primers B4722 and B4723. A third region corresponding to 977 bp downstream of the orf84 coding sequence may be amplified using primers B4724 and B4725. The three PCR fragments can be joined together using Splicing by Overlap Extension (SOEing) PCR, using the two outer primers B4720 and B4725. The resulting PCR fragment may be purified and then digested with Spel and Mlul (provided at the 5' end of B4720 and B4725), purified again and ligated into plasmid pSM1080, which has been digested with Spel and Mlul, dephosphorylated and purified, to yield plasmid pSMX720.

Primer B4720 comprises a 5' Spel site (underlined) and sequence starting 992bp upstream of the GTG start codon of orf84. Primer B4721 is complementary to the first 9 bp of the οτβθ sequence and the 14 bp preceding the gene, followed by sequence complementary to the first 4 bp of ονβ4 and the 18bp preceding ονβ4 (underlined). Primer B4722 is the reverse complement of primer B4121. Primer B4723 comprises sequence complementary to the 2 bp immediately following the ονβ4 stop codon, followed by sequenced complementary to the terminal 18 bp of the οτβ4 open reading frame, followed by sequence complementary to the terminal 20 bp of the οτβθ gene (underlined). Primer B4724 is the reverse complement of primer B4723. Primer B4125 comprises a 5' Mlul site (underlined) and sequence complementary to a region 997bp downstream of the stop codon of οτβ4.

B4720 5'-GATAACTAGTGCCGACCAGGCAGTGCTC-3 ' (SEQ ID NO: 19)

B4721 5'-GATTTTCATCAATACTCCTGATTTCACTTGACATACTTCCCGAA

G-3' (SEQ ID NO: 20)

B4722 5'-CTTCGGGAAGTATGTCAAGTGAAATCAGGAGTATTGATGAAA

ATC-3' (SEQ ID NO: 21)

B4723 5'-GATCATGCTTTACGCTCCTGCTAGGAGCCTTGATTGATCG-3 '

(SEQ ID NO: 22)

CGATCAATCAAGGCTCCTAGCAGGAGCGTAAAGCATGATC-3 ' B4725 5 '-GATAACGCGTTGCGTCCAGGGCAGACTG-3 ' (SEQ ID NO: 24)

Construction of a phage carrying a deletion in orf84

1. Plasmid pSMX720 may be introduced into P. aeruginosa strain PAX7 by conjugation, selecting transconjugants on the basis of tetracycline resistance (50 μg/ml), yielding strain PTA720 (Figure 5).

2. Strain PTA720 may be infected with phage ΦΡΤΡΧ700 (Figure 2; Figure 5), and the progeny phage harvested.

3. Recombinant phage in which orf84 has been replaced with orflO may identified by plaquing the lysate from step (2) on wild type P. aeruginosa strain PAOl , lacking an in trans orflO gene.

4. PCR may be carried out on isolated plaques to check that or/84 has been removed, and that orflO is present in its place.

5. Following identification of a verified isolate (ΦΡΤΡΧ701 ; Figure 5), this isolate may be plaque purified twice more on P. aeruginosa strain PAOl , prior to further use.

References

Abedon, S.T. (2008). Bacteriophage Ecology: Population Growth, Evolution, an Impact of Bacterial Viruses. Cambridge. Cambridge University Press. Chapter 1.

Berg, C. M., & D. E. Berg. (1995). Transposabie elements as tools for molecular analysis in bacteria, p. 38-68. In D. J. Sherratt (ed.), Mobile genet ic elements. Oxford University Press, Oxford, England.

Brabban, A.D., Hite, E. & Callaway, T.R. (2005 ). Evolution of Foodborne Pathogens via

Temperate Bacteriophage-Mediated Gene Transfer. Foodborne Pathogens and Disease. 2: 287-303.

Briers, Y., Volckaert, G„ Comeiissen, A., Lagaert, S., Michiels, C. W., Hertveidt, K., & Lavigne, R. (2007). Muraiytic activity and modular structure of the endolysins of

Pseudomonas aeruginosa bacteriophages φΚΖ and EL. Molecular Microbiology, 65(5): 1334- 1344.

Briers, Y., Pcctcrs, L. M.. Volckaert, G., & Lavigne, R. (2011). The lysis cassette of bacteriophage cbKMV encodes a signal-arrest-release endolysin and a pinholin. Bacteriophage, 1( 1): 25-30.

Dobozi-King, M., Seo, S., Kim, J.U., Young, R., Cheng, M. & Kish, L.B. (2005). Rapid detection and identification of bacteria: SEnsing of Phage-T ^'riggered Ion Cascade (SEPTIC). Journal of Biological Physics and Chemistry 5: 3-7.

Harper, D.R., Anderson, J. & Enwright, M.C. (2011). Phage therapy: delivering on the promise. Therapeutics Delivery . 2:935-47.

Hendrix, R.W. (2009). Jumbo Bacteriophages. Current Topics in Microbiology and Immunology. 328:229-40.

Jain, A., & Srivastava, P. (2013). Broad host range plasmids. FEMS microbiology letters, 348(2), 87-96. Malone, J. G., Jaeger, T., Spangler, C, Ritz, D., Spang, A., Arrieumerlou, C, ... & Jenal, U. (2010). YfiBNR mediates cyclic di-GMP dependent small colony variant formation and persistence in Pseudomonas aeruginosa. PLoS Pathog, 6(3), el000804-el000804.

Mark, D.F. & Richardson, C.C. (1976). Escherichia coli thioredoxin: a subunit of bacteriophage T7 DNA polymerase. Proc. Natl. Acad. Sci. 73:780-4.

Marinelli, L.J., Piuri, M., Swigonova, Z., Balachandran, A., Oldfield, L.M., van Kessel, J.C. & Hatfull, G.F. (2008). BRED: a simple and powerful tool for constructing mutant and recombinant bacteriophage genomes. PLoS One. 3:e3957.

Oliveira, FL, Melo, L.D.R.. Santos, S.B., Nobrega, F.L., Ferreira, E.C., Cerca. N., Azeredo. J. & Kluskens, L.D. (2013). Molecular aspects and comparative genomics of bacteriophage endolysins. Journal of Virology 87 (8): 4558-4570.

Pouillot, F., Blois, H. & Iris, F. (2010). Biosecurity and Bioterrorism: Biodefense Strategy, Practice, and Science. Biosecurity and Bioterrorism. 8: 155-169

Qimron, U., Marintcheva, B., Tabor, S. & Richardson, C.C. (2006). Genomewide screens for Escherichia coli genes affecting growth of T7 bacteriophage. Proc. Natl. Acad. Sci. U S A. 103: 19039-44.

Rubin, E. J., Akerley, B.J., Novik, V.N., Lampe, D.J., Husson, R.N., Mekalanos, J.J. ( 1 99).

In vivo transposition of mariner-based elements in enteric bacteria and mycobacteria. Proceedings of the National Academy of Sciences, 96(4), 1645-1650.

Sam brook, J., Fritsch, E. & Maniatis, T. (1989). Molecular cloning (Vol. 1, No. 7.58). New York: Cold Spring Harbor Laboratory Press.

Sheng, Y., Mancino, V. & Birren, B. (1995). Transformation of Escherichia coli with large DNA molecules by electroporation. Nucl. Acids Res. 23: 1990-6.

Smith, G.P., Petrenko, V.A. (2005). Phage Display. Chem. Rev. 97:391-410. Thomason, L.C., Sawitzke, J.A., Li, X., Costantino, N. & Court, D.L. (2014). Recombineering: genetic engineering in bacteria using homologous recombination. Curr. Protoc. Mol. Biol. 106: 1-16.

Waldor, M. & Mekalanos, J. (1996). Lysogenic conversion by a filamentous phage encoding cholera toxin. Science. 272: 1910-1914.

Williamson, S.J., Houchin, L.A., McDaniel, L. & Paul, J.H. (2002). Seasonal variation in lysogeny as depicted by prophage induction in Tampa Bay, Florida. Appl. Environ. Microbiol. 68:4307-14.

Young, R. Y. (1992) Bacteriophage lysis: mechanism and regulation. Microbiological Reviews 56(3): 430.

Yu, D., Ellis, H.M., Lee, E.C., Jenkins, N.A., Copeland, N.G., et al. (2000). An efficient recombination system for chromosome engineering in Escherichia coli. Proc. Natl. Acad. Sci. USA. 97:5978-5983.

Appendix 1

Phi33 partial DNA sequence. ORF30 coding sequence shaded. (SEQ ID NO: 25)

cgttctcaaagtgggtggtggaaacctgggggcaaacgcctacccagtcatccacgccgggaactaca acaactacatcaatcaagcgctggttcaggtcggtctggaaggcgtcggttcctatggaattttcgcg gttctggataatgccgctccaaccgcaaccgttcaacccggagtggtcgtggacggttccattctcat ctactcgtcttgcgccgcaaactacaatagcggtaaaagacctgccggaacttggcgctgcatgggat atgtagtcaaccgggatgccaacacccctgactccgcgacccttttccagcgagtgacgtaaaatgaa atggacgcggatcagaaacccacgttggctggacgcagtaaacatccacgccatggtgactttcgagg gaatcggtgaagtgccgttcaccgccaatccgcaagacgtggaggcccacggaagggccatctacgct gcgattctatctggggagcacggacctatcgccccggtcgattcgaagcgggagaaggccttgcagga cgctatacgagccagggaaaagcgggctatccttcgggatacccgctggcccatagatcgccacgaag agcaaagacggctgggtatcgaaaccacggacggccctgggctgatcgcagcccttgttcactggagg cagcagattcgcgattggaatagcggggatcggccgcgacttcccatggctctgaaaacaatgttcaa aaatcaggagtattgatgaaaatcacgaaggatgttctgatcaccggaaccgggtgcaccacggatcg ggcgatcaagtggctggatgatgtacaggcggccatggacaagttccacatcgagtcaccgcgagcca tcgcggcctacctcgccaacatcggcgtcgagtccggcggactggtaagtctggtggagaatctcaac tacagcgcccaagggttggccaacacctggcctcgccggtacgcagtagacccgcgagtccgcccgta tgtcccgaacgctctggcgaaccgcctggcccgtaacccggtcgccatcgccaacaacgtgtacgcgg ctgaccgggaagtcgaactattccctgttcgccgaagactccggcatggacgttctggagaaaccgga gcttctggaaactccggccggcgcgtcgatgtcttctgcctggttcttctggcgcaatcgctgcatcc aaccatggccagctccggatcaaccgttatatgaagaccatcgccgcgatcaatcaaggctcctgata ttcgcccaaaagaaaaggccgcttattcagcggcctttttgctttccggctttgcctcttcaatcttc ctgacttcaaccggcgcggcggactcttcctgagtgaccgaatccacatagttccctagtgaactcag aacgccgattaacagcgctcttaccaccttgtccttgactgtctcgcctatgatcttggtcagaacgg atattaactcttcccggagtctggggctgattcttggccgaaagcgcttgcgatgctctttgcgtttc atgtttagtcctctgtctgcggtcttctcctcaccccgataatggcttggggatgcgctgtgttggtc ggaagggtcgggcgttattataactcgacgaaaatgctcgcgcttaactgtttaacgatacgcaccgc gatattaaatcgccttctttctggccaaggaactctggcggccgggtccggtctaaggcttaatttgt cgacattaaaacgagaaaacccggatcgcctgtaggataaggcgtccgggtttatctcgatctagtgt acgctagaatcagtggcttccgccccatccgtccagccagcaatcgaagacggcgtgtcgcggcttgt ccttggcgccatgagagaaatgcttgaatcggatgacctggcccttgatggactcccggtcgttccag aaacgacgtttctcgtcgtgggtcaggctggaggccgacacgttgaaggtgacgccaggccac

ORF30 promoter region. (SEQ ID NO: 26)

tactgagaaaaatctggattctgactaaaaattctagtccggatagccgcaaattaccgtttacggaa aatagcagtaatttggaaatcctactgccgcgaggctttaacagagccagttcctaatttccgattta gccgcatgcttcaaaagtatatagcctgggaaattagaagtaacgttccaatagaattcatctataag taacgttataatataacgtcaatctatatgctctagacgtattgaaattcaatttttaatcggtaaat tggtaatttgaattagtttaggagttgaaagcctcgcggcagtaggcttagacaaatcccgtcaagtt tccgagaccaaattaccggattttcgcggctgaggaaactggtaattagatcataatacaaattataa tgtaagttaacagtcacggctacatctaattattgttccgcttatttacccttagatgtactgcgtat ataatacagccatagtccacgactcttcgaattaacgggatccaggagtattg

Claims

Claims:

1. A method for modifying the genome of a lytic target phage, which is endolysin- deficient, which method comprises:

(c) infecting the first host cell with the target phage;

(f) harvesting the resultant phage.

2. A method according to claim 1, wherein the target phage genome includes a first target sequence and a second target sequence, and wherein the first and second flanking sequences of the phage-targeting region are homologous to the first and second target sequences of the target phage genome so that recombination occurs upon replication of phage in the presence of the vector.

3. A method according to claim 2, wherein the first and second target sequences of the target phage genome are non-contiguous.

4. A method according to claim 3, wherein the first and second target sequences of the target phage genome flank a phage gene or part thereof for inactivation of the gene following recombination.

5. A method according to claim 4, wherein the gene is essential to phage function and wherein the gene is provided in trans in the first host cell.

6. A method according to claim 3, wherein the first and second target sequences of the target phage genome flank a region of the target phage genome which is inessential to phage function.

7. A method according to any one of claims 2 to 6, wherein at least one of the first and second flanking sequences contains a mutation as compared with the first and second target sequences of the target phage genome.

8. A method according to claim 7, wherein the mutation is a point mutation.

9. A method according to any one of claims 2 to 8, wherein the phage-targeting region of the vector further comprises an exogenous DNA sequence for incorporation into the genome of the target phage.

10. A method according to claim 1, wherein the phage-targeting region comprises a transposable element (TE) comprising the endolysin gene, wherein the first and second flanking sequences are inverted repeats recognisable by a transposase so that transposition occurs upon replication of phage in the presence of the vector and a transposase.

11. A method according to clam 10, wherein the phage-targeting region of the vector further comprises an exogenous DNA sequence for incorporation into the genome of the target phage.

12. A method according to claim 11, wherein the exogenous DNA is flanked by 3 frame stop sequences.

13. A method according to any one of claims 10 to 12, wherein the transposase is expressed from a transposase gene present on the vector or in the genome of the host cell.

14. A method according to any one of claims 10 to 13, wherein the transposable element comprises transposon Tn5, Tn7, TnlO or a Mariner-type transposon.

15. A method according to claim 14, wherein the transposable element comprises a Himarl Mariner transposon.

16. A method according to any preceding claim, wherein the vector comprises a plasmid.

17. A method according to claim 16, wherein the plasmid is a broad host range plasmid or a shuttle plasmid.

18. A method according to any preceding claim, wherein each host cell is a Pseudomonas host cell.

19. A method according to claim 18, wherein the Pseudomonas is Pseudomonas aeruginosa.