WO2017000904A1 - Use of interaction between influenza virus proteins and host protein cpsf30 in inhibition of tumor cells proliferation - Google Patents

Abstract

Disclosed is the use of the interaction between the influenza virus proteins and the host protein CPSF30 in the inhibition of the tumor cells proliferation. The two viral proteins NS1 and NP of influenza virus inhibit the normal activity of the host protein CPSF30 by binding to CPSF30, thereby blocking the cell cycle of the host cell at the G0/G1 phase, and further inhibiting the division of the host cell. By expressing exogenous NS1 and NP proteins in cancer cell lines or by inhibiting of the expression of endogenous CPSF30 with siRNA, the cell cycle can be arrested at G0/G1 phase and the proliferation of cancer cells can be slowed.

Description

Application of interaction between influenza virus protein and host protein CPSF30 in inhibiting cancer cell proliferation Technical field

The invention relates to the field of biotechnology and immunology. More specifically, the invention relates to the use of an interaction of an influenza virus protein with a host protein CPSF30 for inhibiting proliferation of cancer cells.

Background technique

Cancer is an important disease that threatens human health. The number of people dying from cancer every year is more than the total number of people dying from AIDS, malaria, and tuberculosis. About 13% of human deaths are caused by cancer, and this proportion is increasing year by year. . The importance of developing new and effective anticancer drugs is undoubted in the case of cancer types and increased disease population.

All somatic cells, including cancer cells, want to achieve cell proliferation, and they need to undergo cell cycle to reach mitosis, and turn one cell into two to increase the number of cells. There are many causes of cancer, and the sites are different, but all cancers have a common feature. Cancer cells are mostly in an active period of cell division compared with normal cells, showing unrestricted and disordered cells. Cell growth. Therefore, whether it is traditional radiotherapy and chemotherapy or other immunotherapy methods, it is to inhibit cell division and proliferation, and even kill cancer cells.

Viral infection is not conducive to health in normal organisms, but virological studies have found that the interaction of the virus with the host can affect many host signaling pathways and physiological responses, which makes the virus possible to use. The characteristics of the virus are used to treat diseased cells. In cancer treatment, the idea of killing cancer cells using the principle of viral infection leading to cell death occurred as early as around 1940, but it was not until 1991 that the first oncolytic virus herpesvirus could cleave glia. Tumor cells, the first viral therapy (Virotherapy) was born. Subsequently, many different viruses were used to study their carcinogenic properties. However, this kind of viral therapy mainly uses the principle that viral infection eventually leads to cell lysis. Although it can realize the specificity of cancer cell infection, it requires a live virus with replication ability, and its safety leads to great application restrictions.

In addition, the side effects of some commonly used cancer treatment methods are still very large, leading to patients even having to stop treatment.

In summary, there has not been developed a satisfactory drug for inhibiting cancer cells in the art, and therefore there is an urgent need to develop a safer method and drug for inhibiting cancer cells.

Summary of the invention

It is an object of the present invention to provide a novel and safe method and medicament for inhibiting cancer cells.

In a first aspect of the invention, there is provided a use of a viral protein, or an expression vector thereof, or an agonist thereof, for the preparation of (a) a composition for arresting a cell cycle of a cell in a G0/G1 phase; And/or (b) a composition for inhibiting the growth of cancer cells.

In another preferred embodiment, the viral protein is from a virus selected from the group consisting of an influenza virus, a parainfluenza virus.

In another preferred embodiment, the virus is an influenza virus, more preferably an influenza A virus.

In another preferred embodiment, the viral protein is selected from the group consisting of NP protein, NS1 protein, or a combination thereof.

In another preferred embodiment, the cells comprise cells of a mammal.

In another preferred embodiment, the composition comprises a pharmaceutical composition, a dietary supplement, a nutraceutical composition, a food composition.

In another preferred embodiment, the composition includes an injection, an oral preparation, and a transdermal preparation.

In another preferred embodiment, the cancer cells are selected from the group consisting of kidney cancer cells, lung cancer cells, liver cancer cells, breast cancer cells, colon cancer cells, gastric cancer cells, esophageal cancer cells, and ovarian cancer.

In another preferred embodiment, the vector comprises a viral vector, a plasmid.

In a second aspect of the invention, there is provided a use of a vector for expressing an exogenous influenza virus protein for the preparation of (a) a composition for arresting a cell cycle of a cell in a G0/G1 phase; and/or (b) A composition for inhibiting the growth of cancer cells.

In another preferred embodiment, the vector comprises a viral vector, a plasmid.

In another preferred embodiment, the viral vector comprises a lentiviral vector, a yellow fever virus vector, an adenoviral vector.

In another preferred embodiment, the exogenous influenza virus protein is selected from the group consisting of NP protein, NS1 protein, or a combination thereof.

In a third aspect of the invention, there is provided a use of a CPSF30 inhibitor for the preparation of a composition for arresting the cell cycle of a cell in the G0/G1 phase.

In another preferred embodiment, the CPSF30 inhibitor is a viral protein.

In another preferred embodiment, the CPSF30 inhibitor is selected from the group consisting of an NP protein of an influenza virus, an NS1 protein, or a combination thereof.

In another preferred embodiment, the CPSF30 inhibitor comprises a small molecule compound, an antisense nucleic acid, or an siRNA.

In another preferred embodiment, the CPSF30 inhibitor comprises an antibody, a ligand, or a short peptide.

In another preferred embodiment, the composition is also useful for inhibiting cancer cells or for treating tumors.

In a fourth aspect of the invention, there is provided a pharmaceutical composition or pharmaceutical combination, characterized in that the pharmaceutical composition or pharmaceutical combination contains (i) a pharmaceutically acceptable carrier; (ii) a viral protein or An agonist; and (iii) optionally other anti-tumor active ingredients than component (ii).

In another preferred embodiment, the components (ii) and (iii) may be in the same formulation or in separate formulations.

In another preferred embodiment, the component (iii) is a drug that inhibits mitosis of cancer cells.

In another preferred embodiment, the component (iii) is selected from the group consisting of a raf enzyme inhibitor (such as SORAFENIB (sorafenib) or the like), a mitotic enzyme inhibitor (such as gefitinib or It is similar to a drug).

In another preferred embodiment, component (iii) is a CPSF30 inhibitor.

In another preferred embodiment, the CPSF30 inhibitor is selected from the group consisting of a small molecule compound, an antisense nucleic acid, an siRNA, an antibody, a ligand, a short peptide, or a combination thereof.

In a fifth aspect of the invention, there is provided a method for non-therapeutic in vitro arrest of a cell cycle of a cell in the G0/G1 phase, comprising the steps of:

The cells are cultured in the presence of (a) a viral protein or an agonist thereof, and/or (b) a CPSF30 inhibitor, such that the cell cycle of the cell is arrested in the G0/G1 phase, wherein the virus The protein is selected from the group consisting of the influenza virus proteins: NP protein, NS1 protein, or a combination thereof.

In another preferred embodiment, the cell is a cell that expresses CPSF30.

In another preferred embodiment, the cells are from a mammal (e.g., a primate), more preferably a human.

In another preferred embodiment, the cells comprise normal cells, or cancer cells.

In another preferred embodiment, the cancer cells are selected from the group consisting of kidney cancer cells, lung cancer cells, liver cancer cells, breast cancer cells, colon cancer cells, gastric cancer cells, esophageal cancer cells, and ovarian cancer.

In another preferred embodiment, the CPSF30 inhibitor is an antisense nucleic acid (such as siRNA).

In a sixth aspect of the invention, a method of screening for an anti-tumor drug candidate is provided, comprising the steps of:

(i) in the experimental group, in the presence of the test substance, and in the presence of viral proteins, culture the mammalian cells in vitro, and test the cell cycle of the cells in the experimental group; and in the control group, The mammalian cells were cultured in vitro in the same test conditions but without the presence of the test substance, and the cell cycle of the cells in the control group was tested.

Wherein the viral protein is selected from the group consisting of NP protein, NS1 protein, or a combination thereof;

(ii) Comparing the cell ratio value Rs of the cell cycle in the G0/G1 phase of the experimental group with the cell ratio value Rc of the cell cycle in the G0/G1 phase in the control group, if the Rs is significantly higher than Rc, the test substance is indicated. a potential anti-tumor drug candidate (ie, a potential anti-tumor drug candidate that interacts with the viral protein); if Rs is not significantly higher than Rc, the test substance is not considered to be present with the viral protein a potential anti-tumor drug candidate for the relationship;

(iii) Optionally, for the potential anti-tumor drug candidate selected in the previous step, its ability to inhibit or kill tumor cells in the absence of the viral protein is tested.

In another preferred embodiment, said "significantly higher" means that the ratio of Rs/Rc is ≥ 1.20, preferably ≥ 1.50, more preferably ≥ 2.0.

Another screening method of the present invention includes the steps of:

(i) in the experimental group, in the presence of the test substance, and in the presence of viral protein and CPSF30, and testing the case where the viral protein in the experimental group binds to CPSF30 to form a complex; and in the control group, The test conditions were the same but without the presence of the test substance, the viral protein in the test experimental group was combined with CPSF30 to form a complex.

Wherein the viral protein is selected from the group consisting of NP protein, NS1 protein, or a combination thereof;

(ii) comparing the amount Vs of the combination of the viral protein and the CPSF30 in the experimental group to form a complex with the number Vc of the combination of the viral protein and the CPSF30 in the control group, and if the Vs is significantly higher than Vc, it indicates that The test substance is a potential anti-tumor drug candidate (ie, a potential anti-tumor drug candidate that interacts with the viral protein) and can be subjected to step (iii); if Vs is not significantly higher than Vc, the test is not performed As a potential anti-tumor drug candidate;

(iii) Optionally, for the potential anti-tumor drug candidate selected in the previous step, its ability to inhibit or kill tumor cells in the absence of the viral protein is tested.

In another preferred embodiment, the test substance comprises a small molecule compound, an antisense nucleic acid, an antibody, or a combination thereof.

In a seventh aspect of the invention, a complex is provided, characterized in that the complex is a complex formed by CPSF30 and a viral protein, and the complex is selected from the group consisting of CPSF30/NP binary complex , or CPSF30/NP/NS1 ternary complex.

In another preferred embodiment, the complex is a CPSF30/NP/NS1 ternary complex.

In an eighth aspect of the invention, there is provided the use of the complex of the seventh aspect of the invention for screening for a drug affecting the cell cycle.

In another preferred embodiment, the "affecting the cell cycle" refers to arresting the cell cycle of the cell in the G0/G1 phase.

In a ninth aspect of the invention, there is provided a method of treatment for arresting a cell cycle of a cell in a G0/G1 phase, the method comprising the steps of: administering to a subject in need thereof (a) a viral protein or An agonist, and/or (b) a CPSF30 inhibitor.

In another preferred embodiment, the viral protein is selected from the group consisting of NP protein, NS1 protein, or a combination thereof.

In another preferred embodiment, the subject comprises a mammal (e.g., a primate), preferably a human.

In another preferred embodiment, the administration of the viral protein comprises direct administration of the protein and indirect administration of the protein (eg, administration of a vector expressing the protein).

It is to be understood that within the scope of the present invention, the various technical features of the present invention and the technical features specifically described hereinafter (as in the embodiments) may be combined with each other to constitute a new or preferred technical solution. Due to space limitations, we will not repeat them here.

DRAWINGS

Figure 1 shows that influenza A virus infects human lung cancer cells A549 causing cell cycle arrest in the G0/G1 phase. A549 cells were infected with MOI=2 for 1 h, cells were harvested 24 h after infection, and cell cycle was analyzed by flow cytometry. In the figure, (A) uninfected cells (control group, mock) and infected cells (infected) were stained with antibodies of NP, respectively, and positive cells showed infection efficiency. (B) Uninfected cells (control group) and infected cells (infected group) were stained with PI, respectively, and the cell cycle was analyzed. (C) Use the ModFit LT software to count the proportion of cells in B at different cell cycles.

Figure 2 shows that expression of the NS1 and NP genes of influenza A virus causes cell cycle arrest in the G0/G1 phase. HEK293 cells were not transfected or transfected with plasmids expressing GFP or NP-GFP and NS1-GFP fusion proteins. Cells were treated with nocodazole (Noc) for 24 h after transfection, and cells were arrested in G2/M phase. , receiving cells, flow cytometry analysis. In the figure, (A) each group of cells were stained with PI, and the cell cycle was analyzed. (B) Use the ModFit LT software to count the proportion of cells in B at different cell cycles.

Figure 3 shows that the ability of the NS1 protein to inhibit the cell cycle is positively correlated with its ability to bind CPSF30. GST-CPSF30 protein pull down H5N1NS1 and its F103S/M106I mutation and pH1N1NS and its triple mutation (TripleMut) 108K/125D/189D, wherein H5N1NS1, pH1N1NS1 and their mutant proteins were synthesized by the external translation kit (Promega) . The H5N1 strain and the pH1N1 strain NS1 gene and the corresponding mutant gene were transfected in the same manner as in Fig. 2, and the cells were harvested and the cell cycle results were examined.

Figure 4 shows that the ability of NP protein to inhibit the cell cycle is positively correlated with its ability to bind CPSF30. The top panel shows the results of the GST-CPSF30 protein pull down H5N1NP and its 17G del/K400R/A451T mutation and pH1N1NP and its triple mutant 17G del/K400R/A451T, in which H5N1NP, pH1N1NP and their mutant proteins are passed through an external translation reagent. Box (Promega) synthesized. The following figure shows that the NP gene of H5N1 strain and pH1N1 strain and the corresponding mutant gene were transfected in the same manner as in Fig. 2, and the cells were collected and then the cell cycle results were detected.

Figure 5 shows that inhibition of CPSF30 expression levels results in cell cycle arrest in the G0/G1 phase. In the figure, (AB) HEK293 cells were transfected with siRNA1, s iRNA2 and Negative control siRNA (NC) of CPSF30, respectively, and cells were collected 48 hours later. (A) RT-PCR was used to detect the transcription of CPSF30 gene; (B) Immunological protein was used. The expression of CPSFF30 protein was detected by blotting assay. (C) Validated s iRNA1, siRNA2 and NC were transfected into HEK293 cells, Nocodazole was added 24 hours later, and cells were collected 24 hours later to detect cell cycle status. (D) Analysis of the cell cycle map for ModFitLT software to obtain the percentage of cells in each cycle of the cell cycle. The results are shown in a histogram showing the mean and standard deviation of three independent experiments.

Figure 6 shows that expression of the NS1 and NP genes can inhibit the proliferation of cancer cells. Human lung cancer cell A549 cells (A and B) and human cervical cancer cell Hela cells (C and D) were infected with a lentivirus expressing the NS1 gene and the NP gene or a control virus not expressing any gene, respectively, at infection with MOI=20. The MTT reaction solution was added to each group of cells at 24, 48, 72, 96, and 120 hours to detect the OD value.

Figure 7 shows that inhibition of the expression of the CPSF4 gene can inhibit the proliferation of cancer cells. Human cervical cancer Hela cells were infected with MOI=20 with lentivirus expressing siRNA1 or control virus not expressing any gene, respectively, and MTT reaction was added to each group at 24, 48, 72, 96 and 120 hours after infection. Liquid, detecting OD value.

detailed description

The inventors have conducted extensive and intensive research and found that influenza virus infection can cause the cell cycle to stagnate in the G0/G1 phase. Surprisingly, the two influenza virus proteins NS1 and NP are effective in inhibiting the cell cycle, and both inhibit the activity of a common host protein, mRNA cleavage and polyadenylation factor CPSF30. Achieve inhibition of the cell cycle. The present invention has been completed on this basis.

Specifically, the present inventors used the principle of influenza virus protein (NS1 and/or NP) to inhibit cell cycle arrest in the G0/G1 phase, by exogenously expressing NS1 and NP proteins of influenza virus in cancer cells, or inhibiting by siRNA. The expression of endogenous CPSF30 in cancer cells inhibits the proliferation of cancer cells.

the term

As used herein, the term "stagnation in the G0/G1 phase" refers to a significant increase in the proportion of cells in the G0/G1 phase for a population of cells. For example, the proportion of cells in the G0/G1 phase of the experimental group was significantly increased compared to the cell population of the control group. Generally, this relative increase is ≥ 20%, more preferably ≥ 50% or higher.

Protein of the invention and preparation thereof

The term "protein of the invention" as used herein refers to an NS1 protein, an NP protein, or a combination thereof.

The term "polynucleotide of the invention" as used herein refers to a nucleotide sequence that is used to encode an NS1 protein, an NP protein, or a combination thereof.

The polynucleotide of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA or synthetic DNA. DNA can be single-stranded or double-stranded. The DNA can be a coding strand or a non-coding strand. The coding region sequences encoding the mature polypeptides include degenerate sequences.

The polypeptides and polynucleotides of the invention are preferably provided in isolated form, more preferably purified to homogeneity.

The full-length nucleotide sequence of NS1 or NP of the present invention or a fragment thereof can be usually obtained by a PCR amplification method, a recombinant method or a synthetic method. For PCR amplification, primers can be designed in accordance with the disclosed nucleotide sequences, particularly open reading frame sequences, and related sequences can be obtained by amplification. When the sequence is long, it is often necessary to perform two or more PCR amplifications, and then the amplified fragments are spliced together in the correct order.

Once the relevant sequences are obtained, the recombinant sequence can be used to obtain the relevant sequences in large quantities. This is usually done by cloning it into a vector, transferring it to a cell, and then isolating the relevant sequence from the proliferated host cell by conventional methods.

In addition, synthetic sequences can be used to synthesize related sequences, especially when the fragment length is short. Usually, a long sequence of fragments can be obtained by first synthesizing a plurality of small fragments and then performing the ligation.

At present, it has been possible to obtain a DNA sequence encoding the protein of the present invention (or a fragment thereof, or a derivative thereof) completely by chemical synthesis. The DNA sequence can then be introduced into various existing DNA molecules (or vectors) and cells known in the art. In addition, mutations can also be introduced into the protein sequences of the invention by chemical synthesis.

The invention also relates to vectors comprising the polynucleotides of the invention, as well as host cells genetically engineered with the vectors of the invention or the protein coding sequences of the invention, and methods of producing the polypeptides of the invention by recombinant techniques.

The polynucleotide sequences of the present invention can be used to express or produce recombinant proteins of the present invention by conventional recombinant DNA techniques (Science, 1984; 224: 1431). Generally there are the following steps:

(1) using a polynucleotide (or variant) of the present invention encoding a protein of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;

(2) a host cell cultured in a suitable medium;

(3). Separating and purifying the protein from the culture medium or the cells.

mRNA cleavage and polyadenylation factor CPSF30

As used herein, the terms "CPSF30" and "CPSF-30" and "CPSF4" are used interchangeably and refer to cleavage and polyadenylation specificity factor 30 (cleavage and polyadenylation specificity factor 30). It should be understood that the term CPSF30 includes not only wild-type CPSF30 but also mutant CPSF30. Furthermore, the CPSF30 gene or nucleic acid sequence includes the genomic, cDNA or RNA form, while the CPSF30 protein or polypeptide comprises full length CPSF30 or an active fragment thereof.

In another preferred embodiment, the CPSF 30 is a CPSF30 derived from a mammal, especially a human.

The nucleotide sequence and amino acid sequence of human CPSF30 are registered as GenBank NM_006693.2, which is a member of the cleavage and polyadenylation specific factor family proteins. The protein size is about 30KD, so it is called CPSF30. Because it is the smallest of the four family proteins; CPSF30 and other proteins of this family, CPSF73, CPSF100 and CPSF160, are responsible for cleavage of the 3' end of the precursor mRNA and the addition of a poly(A) tail to promote mRNA maturation. .

Influenza virus protein NP

As used herein, the terms "influenza virus protein NP" and "protein NP" are used interchangeably and refer to a nuclear protein from an influenza virus. It should be understood that the term NP includes not only wild-type NP but also mutant NP. Furthermore, the NP gene or nucleic acid sequence includes the DNA or RNA form, and the NP protein or polypeptide includes the full length NP or an active fragment thereof.

Further, the influenza virus protein NP includes not only an NP protein derived from each type or each subtype of influenza virus or an active fragment thereof, but also an NP protein derived from a similar virus (such as a parainfluenza virus) or an active fragment thereof, as long as the NP protein or The active fragment also has the function of binding to the CPSF30 protein (especially the human CPSF30 protein) and inhibiting the activity of CPSF30.

Representative influenza viruses include, but are not limited to, influenza A, influenza B, influenza C, and the like.

It should be understood that there are certain variations in the genes of different influenza viruses. Thus, based on the present invention, the term NP includes these variant or mutant NP genes and NP proteins.

As a representative NP protein, the nucleotide sequence and amino acid sequence of the NP of influenza A virus A/WSN/33 (H1N1) are as follows:

Nucleotide sequence of NP of influenza A virus A/WSN/33 (H1N1) (SEQ ID NO.: 1)

Protein sequence of NP of influenza A virus A/WSN/33 (H1N1) (SEQ ID NO.: 2)

In the present invention, the term "NP protein" refers to a polypeptide having NP protein activity and represented by the sequence of SEQ ID NO: 2. The term also encompasses variant forms of the sequence of SEQ ID NO: 2 that have the same function as the NP protein. These variants include, but are not limited to, one or more (usually 1-50, preferably 1-30, more preferably 1-20, optimally 1-10) amino acid deletions , Insertion and/or Substitution, and the addition of one or several (usually within 20, preferably within 10, more preferably within 5) amino acids at the C-terminus and/or N-terminus. For example, in the art, when substituted with amino acids of similar or similar properties, the function of the protein is generally not altered. As another example, the addition of one or several amino acids at the C-terminus and/or N-terminus will generally not alter the function of the protein. The term also includes active fragments and active derivatives of NP proteins.

Variants of the polypeptide include: homologous sequences, conservative variants, allelic variants, natural mutants, induced mutants, proteins encoded by DNA that hybridize to NP DNA under high or low stringency conditions, And a polypeptide or protein obtained using an antiserum against the NP polypeptide. The invention also provides other polypeptides, such as fusion proteins comprising an NP polypeptide or a fragment thereof (e.g., a fusion protein formed with GFP). In addition to nearly full length polypeptides, the invention also includes soluble fragments of NP polypeptides. Typically, the fragment has at least about 10 consecutive NP polypeptide sequences. Amino acids, typically at least about 30 contiguous amino acids, preferably at least about 50 contiguous amino acids, more preferably at least about 80 contiguous amino acids, optimally at least about 100 contiguous amino acids.

In the present invention, "NP conservative variant polypeptide" means up to 10, preferably up to 8, more preferably up to 5, optimally up to 3 compared to the amino acid sequence of SEQ ID NO: 2. Amino acids are replaced by amino acids of similar or similar nature to form a polypeptide. These conservative variant polypeptides are preferably produced by amino acid substitution according to Table 1.

Table 1

Initial residue	Representative substitution	Preferred substitution
Ala(A)	Val; Leu; Ile	Val
Arg(R)	Lys; Gln; Asn	Lys
Asn(N)	Gln;His;Lys;Arg	Gln
Asp(D)	Glu	Glu
Cys(C)	Ser	Ser
Gln(Q)	Asn	Asn
Glu(E)	Asp	Asp
Gly(G)	Pro; Ala	Ala
His(H)	Asn; Gln; Lys; Arg	Arg
Ile(I)	Leu;Val;Met;Ala;Phe	Leu
Leu(L)	Ile;Val;Met;Ala;Phe	Ile
Lys(K)	Arg; Gln; Asn	Arg
Met(M)	Leu;Phe;Ile	Leu
Phe(F)	Leu;Val;Ile;Ala;Tyr	Leu
Pro(P)	Ala	Ala
Ser(S)	Thr	Thr
Thr(T)	Ser	Ser
Trp(W)	Tyr;Phe	Tyr
Tyr(Y)	Trp;Phe;Thr;Ser	Phe
Val(V)	Ile; Leu; Met; Phe; Ala	Leu

Influenza virus protein NS1

As used herein, the terms "influenza virus protein NS1" and "protein NS1" are used interchangeably and refer to non-structural protein 1 from influenza A virus. It should be understood that the term NS1 includes not only wild-type NS1 but also mutant NS1. Furthermore, the NS1 gene or nucleic acid sequence includes the DNA or RNA form, and the NS1 protein or polypeptide includes full length NS1 or an active fragment thereof.

Further, the influenza virus protein NS1 includes not only the NS1 protein or an active fragment thereof derived from various types or subtypes of influenza viruses, but also an NS1 protein derived from a similar virus (such as a parainfluenza virus) or an active fragment thereof, as long as the NS1 protein or The active fragment also has the function of binding to the CPSF30 protein (especially the human CPSF30 protein) and inhibiting the activity of CPSF30.

Representative influenza viruses include, but are not limited to, influenza A, influenza B, and C. Influenza virus, etc.

It should be understood that there are certain variations in the genes of different influenza viruses. Thus, based on the present invention, the term NS1 includes these variant or mutated NS1 genes and NS1 proteins.

As a representative NS1 protein, the nucleotide sequence and amino acid sequence of NS1 of influenza A virus A/WSN/33 (H1N1) are as follows:

Nucleotide sequence of NS1 of influenza A virus A/WSN/33 (H1N1) (SEQ ID NO.: 3)

Protein sequence of NS1 of influenza A virus A/WSN/33 (H1N1) (SEQ ID NO.: 4)

In the present invention, the term "NS1 protein" refers to a polypeptide having NS1 protein activity and represented by the sequence of SEQ ID NO: 4. The term also encompasses variant forms of the sequence of SEQ ID NO: 4 that have the same function as the NS1 protein. These variants include, but are not limited to, one or more (usually 1-50, preferably 1-30, more preferably 1-20, optimally 1-10) amino acid deletions , Insertion and/or Substitution, and the addition of one or several (usually within 20, preferably within 10, more preferably within 5) amino acids at the C-terminus and/or N-terminus. For example, in the art, when substituted with amino acids of similar or similar properties, the function of the protein is generally not altered. As another example, the addition of one or several amino acids at the C-terminus and/or N-terminus will generally not alter the function of the protein. The term also includes active fragments and active derivatives of the NS1 protein.

Variants of the polypeptide include: homologous sequences, conservative variants, allelic variants, natural mutants, induced mutants, proteins encoded by DNA that hybridize to NS1 DNA under high or low stringency conditions, and A polypeptide or protein obtained using an antiserum against an NS1 polypeptide. The invention also provides other polypeptides, such as fusion proteins comprising an NS1 polypeptide or a fragment thereof (e.g., a fusion protein formed with GFP). In addition to nearly full length polypeptides, the invention also includes soluble fragments of the NS1 polypeptide. Typically, the fragment has at least about 10 contiguous amino acids of the NS1 polypeptide sequence, typically at least about 30 contiguous amino acids, preferably at least about 50 contiguous amino acids, More preferably, it is at least about 80 contiguous amino acids, optimally at least about 100 contiguous amino acids.

In the present invention, "NS1 conservative variant polypeptide" means having up to 10, preferably up to 8, more preferably up to 5, and most preferably up to 3, compared to the amino acid sequence of SEQ ID NO:4. Amino acids are replaced by amino acids of similar or similar nature to form a polypeptide. These conservative variant polypeptides are preferably produced by amino acid substitution according to Table 1.

Pharmaceutical composition and treatment

The invention also provides a pharmaceutical composition or a pharmaceutical composition comprising (i) a pharmaceutically acceptable carrier; (ii) a viral protein of the invention or an agonist thereof; and (iii) optionally Different from the other anti-tumor active ingredients of component (ii).

Such pharmaceutically acceptable carriers include, but are not limited to, saline, buffer, dextrose, water, glycerol, ethanol, and combinations thereof. The pharmaceutical preparation should be matched to the mode of administration. The pharmaceutical composition of the present invention can be prepared in the form of an injection, for example, by a conventional method using physiological saline or an aqueous solution containing glucose and other adjuvants. Pharmaceutical compositions such as tablets and capsules can be prepared by conventional methods. Pharmaceutical compositions such as injections, solutions, tablets and capsules are preferably manufactured under sterile conditions.

Further, the pharmaceutically active ingredient of the present invention can also be used together with other anti-tumor therapeutic agents.

When a pharmaceutical composition is used, a safe and effective amount of (a) a viral protein of the invention or an agonist thereof, and/or (b) a CPSF30 inhibitor is administered to a mammal, wherein the safe and effective amount is usually at least about 10 micrograms per kilogram. The body weight, and in most cases does not exceed about 8 mg/kg body weight, preferably the dose is from about 10 micrograms per kilogram of body weight to about 1 milligram per kilogram of body weight. Of course, specific doses should also consider factors such as the route of administration, the health of the patient, etc., which are within the skill of the skilled physician.

The present invention also provides a method of treatment for arresting a cell cycle of a cell in a G0/G1 phase, the method comprising the steps of: administering to a subject in need thereof (a) a viral protein or an agonist thereof, and/or Or (b) a CPSF30 inhibitor.

In another preferred embodiment, the viral protein is selected from the group consisting of NP protein, NS1 protein, or a combination thereof.

In another preferred embodiment, the subject comprises a mammal (e.g., a primate), preferably a human.

In another preferred embodiment, the administration of the viral protein comprises direct administration of the protein and indirect administration of the protein (eg, administration of a vector expressing the protein).

The method of treatment of the present invention can be used to effectively inhibit and treat a variety of different tumors by arresting tumor cells in the G0/G1 phase.

Drug screening

The present invention also provides a screening method for an antitumor drug, which can more efficiently screen potential antitumor drugs having an interaction relationship with the NP protein or NS1 protein of the present invention.

Typically, a screening method includes the following steps:

(i) in the experimental group, in the presence of the test substance, and in the presence of viral proteins, cultured in vitro Animal cells, and testing the cell cycle condition of the cells in the experimental group; and in the control group, the mammalian cells were cultured in vitro under the same test conditions but without the test substance, and tested in the control group. The cell cycle of the cell,

Wherein the viral protein is selected from the group consisting of NP protein, NS1 protein, or a combination thereof;

(ii) Comparing the cell ratio value Rs of the cell cycle in the G0/G1 phase of the experimental group with the cell ratio value Rc of the cell cycle in the G0/G1 phase in the control group, if the Rs is significantly higher than Rc, the test substance is indicated. As a potential anti-tumor drug candidate (ie, a potential anti-tumor drug candidate that interacts with the viral protein), and can perform step (iii); if Rs is not significantly higher than Rc, the test object is not considered As a potential anti-tumor drug candidate;

(iii) Optionally, for the potential anti-tumor drug candidate selected in the previous step, its ability to inhibit or kill tumor cells in the absence of the viral protein is tested.

In another preferred embodiment, the test in step (iii) comprises an in vitro cell test, an animal test, and the like.

In another preferred embodiment, the method is non-diagnostic and non-therapeutic.

In another preferred embodiment, the screening method comprises:

(i) in the experimental group, in the presence of the test substance, and in the presence of viral protein and CPSF30, and testing the case where the viral protein in the experimental group binds to CPSF30 to form a complex; and in the control group, The test conditions were the same but without the presence of the test substance, the viral protein in the test experimental group was combined with CPSF30 to form a complex.

Wherein the viral protein is selected from the group consisting of NP protein, NS1 protein, or a combination thereof;

(ii) comparing the amount Vs of the combination of the viral protein and the CPSF30 in the experimental group to form a complex with the number Vc of the combination of the viral protein and the CPSF30 in the control group, and if the Vs is significantly higher than Vc, it indicates that The test substance is a potential anti-tumor drug candidate (ie, a potential anti-tumor drug candidate that interacts with the viral protein) and can be subjected to step (iii); if Vs is not significantly higher than Vc, the test is not performed As a potential anti-tumor drug candidate;

(iii) Optionally, for the potential anti-tumor drug candidate selected in the previous step, its ability to inhibit or kill tumor cells in the absence of the viral protein is tested.

In another preferred embodiment, said "significantly higher" means that the ratio of Vs/Vc is ≥ 1.20, preferably ≥ 1.50, more preferably ≥ 2.0.

In another preferred embodiment, the complex is a CPSF30/NP binary complex, a CPSF30/NS1 binary complex, or a CPSF30/NP/NS1 ternary complex.

The main advantages of the invention include:

(a) It was first revealed that the proteins NP and NS1 of influenza viruses can arrest human cells (especially cancer cells) in the G0/G1 phase, and thus can be used to inhibit the growth of cancer cells.

(b) It was revealed for the first time that the proteins NS1 and NP of influenza virus can effectively inhibit the activity of CPSF30 by binding to human CPSF30, thereby inhibiting the growth of cancer cells.

(c) Based on the unexpected findings of the present invention, a drug which utilizes the binding of NS1 to CPSF30 and /NP to CPSF30 to inhibit the growth of cancer cells can be developed.

The invention is further illustrated below in conjunction with specific embodiments. It is to be understood that the examples are not intended to limit the scope of the invention. Experimental methods in which the specific conditions are not indicated in the following examples are generally carried out according to the conditions described in conventional conditions, for example, Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturing conditions. The conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are by weight and parts by weight.

General methods and materials

Cell culture:

Human lung adenocarcinoma cell line (A549), human cervical cancer cell (Hela) and human embryonic kidney cell HEK293 were purchased from ATCC in DMEM medium (Hyclone) containing 10% fetal bovine serum, 5% concentration of CO ₂ The cells were cultured in a 37 ° C cell culture incubator, and 50 unit/ml penicillin (Invitrogen), 50 ug/ml streptomycin (Invitrogen), and 0.1 mg/ml kanamycin (Invitrogen) were simultaneously added to the medium.

Viral genes:

The influenza virus A/Sichuan/1/2009 (H1N1) (2009pH1N1) viral gene was provided by the Chinese Center for Disease Control and Prevention. The influenza virus A/Duck/Hubei/L-1/2004 (H5N1) viral gene was provided by the Wuhan virus. The influenza A/WSN/33 (H1N1) viral gene was obtained from a public database or the University of Marburg.

Plasmid construction:

Clones of all viral genes were PCR amplified using the corresponding primers and cloned into the pTM1 vector (purchased from Promega) for in vitro translation of viral proteins. The viral gene was further cloned into the lentiviral expression vector pLenti-CMV-NS1-HA-3Flag-P2A-LUC-T2A-Puro (purchased from Heyuan) for packaging of lentiviruses expressing viral proteins. Alternatively, the NP and NS1 genes were cloned into the pEGFP-C1 plasmid (purchased from Clontech).

The construction of the mutant plasmid was carried out according to the PCR-based site-directed mutagenesis specification, and a new mutant plasmid was synthesized by KOD+DNA polymerase (Toyobo), and then the original plasmid was chopped by DpnI restriction enzyme (NEB), and then Transfection of E. coli is done. The sequences of the mutant plasmids were all confirmed by sequencing.

The full-length CPSF-30 cDNA of human was obtained by RT-PCR. The primers were designed by the cDNA sequence of CPSF30, and the full-length sequence was cloned into pGEX-4T1 vector (purchased from GE) to obtain pGEX. -4T1-CPSF-30.

The purified GST-CPSF-30 protein was obtained by transferring pGEX-4T1-CPSF-30 into E. coli BL21 by a conventional purification method.

The siRNA1 sequence of CPSF30 was cloned into a lentiviral vector. GV115 (purchased from Jikai Bio Company) for use in packages A lentivirus expressing the siRNA is loaded.

Transfection:

The pEGFP-C1 plasmid carrying the NP and NS1 genes was transferred to a 50-60% confluent human embryonic kidney cell HEK293 cell in a 6-well plate by lipofectamine 2000 (Invitrogen), and 400 ng/ml of commercially available Nocodazole (Sigma) was added 24 hours later. Company) (a drug that allows the cell cycle to stay in the G2/M phase by depolymerizing the microtubules), one day after digestion with the trypsin, collecting it in a flow tube and fixing it with 1 ml of cold 70% ethanol. Store at 4 degrees for flow cytometry analysis of the cell cycle.

siRNA interference:

The two siRNA sequences were: siRNA 1: ACGCCAACAGAUGCACCAAA (SEQ ID NO.: 5), siRNA2: AGAGUCAUCUGUGUGAAUUACCUCG (SEQ ID NO.: 6).

These siRNAs were transfected into HEK293 cells and A549 cells using X-tremeGENE siRNA Transfection Reagent (Roche). After 48 hours, cells were harvested for immunoblotting and real-time quantitative PCR (RT-PCR) to analyze the expression of CPSF30. HEK293 cells with reduced CPSF30 expression levels were collected for treatment of cell cycle after addition of 400 ng/ml Nocodazole treatment.

Real-time quantitative PCR:

10 ⁶ cells were collected from 6-well plates, 1 ml of TRIZOL was added, and the solution was clarified by pipetting. The mixture was allowed to stand at room temperature for 5 minutes, then 0.2 ml of chloroform was added, mixed by inversion, and centrifuged at 12,000 g for 15 minutes at 4 ° C to transfer the upper aqueous phase to another. In a clean EP tube, add an equal volume of isopropanol, mix and let stand for 10 minutes at room temperature. 12000 g was centrifuged at 4 ° C for 10 minutes. The supernatant was discarded, 1 ml of 75% cold ethanol was added, and 7500 g was centrifuged at 4 ° C for 5 minutes, the supernatant was discarded, air-dried, and dissolved in 20 μl of DEPC water. Extracted RNA (2μg) using ReverTra

The qPCR RT Kit (Toyobo) was reverse transcribed into cDNA, and Realtime PCR Master Mix (Toyobo) was used for specific PCR product amplification assays.

CPSF-30 quantitative PCR primer sequence:

Forward: 5'-TTGACTTGGAGATCGCGG-3' (SEQ ID NO.: 7)

Revers: 5'-GCAGGCAGCTTTCAAAAAGA-3' (SEQ ID NO.: 8).

GAPDH quantitative PCR primer sequence:

Forward: 5'-GAAATCCCATCACCATCTTCCAC-3' (SEQ ID NO.: 9)

Reverse: 5'-GAGCCCCAGCCTTCTCCATG-3' (SEQ ID NO.: 10).

Cell cycle analysis:

Intranuclear DNA content was stained with PI and analyzed by flow cytometry. Cells adherently grown were trypsinized and washed with PBS. The cells were fixed in 1 ml of 70% cold ethanol and resuspended in staining solution (50 ug/ml PI [Sigma], 20 ug/ml RNAase). After standing at room temperature for 20 minutes, analysis was carried out by flow cytometry (FACScan; BD LSRII). At least 30,000 cells per sample were analyzed. Data analysis software is ModfitLT2.0 (Verity Software House).

Prokaryotic expression and purification of fusion proteins:

In order to purify the fusion protein GST-CPSF-30, the prokaryotic expression plasmid pGEX4T1-CPSF-30 was transformed into E. coli expression strain BL21, and a single colony was picked and cultured in 15 ml of LB medium containing the corresponding antibiotic at 37 ° C overnight. The overnight culture was inoculated at a ratio of 1:100 to 1 L of LB medium containing the corresponding antibiotic in a shaker at 37 ° C for about 2 h to OD600 = 0.4-0.6, and 1 ml of the uninduced culture was taken out in a 1.5 ml centrifuge tube. As a negative control. The remaining ITG was added to the final concentration of 1 mM IPTG (Isopropyl-1-thio-β-D-galactopyranoside), and cultured on a shaker at 18 °C for about 4 hours. The bacterial solution was collected, centrifuged at 7000 rpm for 15 min, and the supernatant was removed. Pre-cooled PBS was used. After resuspending the buffer, the cells were lysed at 12000 rpm, 4 ° C, and centrifuged for 10 min. 40 μl of the supernatant was added to 6×SDS loading buffer, resuspended, boiled at 100 ° C for 5 min, and 20 μl was applied to SDS-PAGE for electrophoresis. . The supernatant was stored in a refrigerator at -20 ° C for purification. Purification of the fusion protein was carried out using an affinity purification resin, and the purified fusion protein GST-CPSF-30 was used for GST pull-down.

GST Co-precipitation analysis (Pull Down analysis):

The NS1 and NP genes constructed on the pTM1 vector were directly used for PCR of the target gene using a primer pair with a T7 and a transcription termination signal, and then HA-tagged NS1 and NP were synthesized in vitro using a TNT transcription/translation kit (Promega). Add equal amounts of GST and GST-CPSF-30 protein to Glutathione Sepharose Beads (GE), spin mix at 4 °C for 1 h, wash beads three times with pre-cooled PBS to remove unbound GST and GST-CPSF-30, then The in vitro transcribed target protein was added, rotated at 4 ° C overnight, and the beads were washed three times with pre-cooled PBS, added with 2×SDS loading buffer, and boiled at 100 ° C for 5 min, and applied to SDS-PAGE and Western blot.

Western blotting: Cells were washed once with PBS and then directly lysed with SDS buffer (60 mM Tris-HCl [pH 6.8], 2% SDS, 10% glycerol, 5% 2-mercaptoethanol, 0.01% bromophenol blue), then boiled. 10 minutes. Whole cell lysates were run on SDS-PAGE. The protein was transferred to a nitrocellulose membrane (BioRad), dissolved in TBST (20 mM Tris-HCL, 150 mM NaCL, 0.02 Tween) with 5% skim milk powder, blocked for 1 hour at room temperature, and then the corresponding primary and secondary antibodies were used. Detection. Development using an enhanced chemiluminescence kit (PIERCE).

The following antibodies were used in immunoblot experiments: murine monoclonal antibody: CPSF-30 antibody (purchased from Abgent); horseradish peroxidase-labeled anti-mouse IgG was purchased from Sigma; anti-NP and anti-NS1 polyclonal antibody were purchased. From the Shanghai Research Institute of Life Sciences Research Center.

Example 1. Influenza virus proteins NS1 and NP inhibit cell cycle in G0/G1 phase

In this example, the effects of influenza virus and various proteins of influenza virus on the cell cycle were observed by an infection test or a transfection test.

result

As shown in Figure 1, influenza A virus (specifically A/WSN/33 (H1N1)) infected human lung cancer cells A549 caused cell cycle arrest in the G0/G1 phase. In Figure 1A, the viral infection efficiency is over 90%. At this time, compared with the control group, the cells in the infected group were significantly more concentrated in the G0/G1 phase (Fig. 1B), and the data showed that only about 30% of the cells were in the G0/G1 phase, while the infected cells had About 60% are in the G0/G1 phase (Fig. 1C).

In addition, by extensive screening, it was unexpectedly discovered that by transfecting the viral protein gene expressing influenza A virus A/WSN/33 (H1N1) in HEK293 cells, the two proteins of the influenza virus (ie, NS1 protein and NP protein) The expression of the cell cycle can be suppressed to the G0/G1 phase, respectively (Fig. 2). As shown in Figure 2A, the expression of GFP itself has little effect on the cell cycle. When Noc was added to stop the cell cycle in the G2/M phase, the distribution of cells in the previous G0/G1 and S phases was more clearly seen. After adding noc, most cells passed smoothly because the expression of GFP had no effect on the cell cycle. G0/G1 and S phase enter G2/M phase and stop in G2/M phase; while cells expressing NS1-GFP and NP-GFP fusion protein are arrested in G0/G1 phase, followed by S and G2/ The M phase is carried out (Fig. 2A). Statistics show that in the NP group, about 50% of the cells are inhibited in the G0/G1 phase; in the NS1 group, nearly 60% of the cells are inhibited in the G0/G1 phase, while in the GFP control group, less than 20% of the cells are The G0/G1 phase was inhibited (Fig. 2B).

The ability of Example 2, NS1 and NP proteins to inhibit the cell cycle depends on their binding to the host factor CPSF30.

In order to find out the molecular mechanism by which the NS1 protein and NP protein inhibit the cell cycle, in this example, the functions of NS1 protein and NP protein of many influenza A virus strains were analyzed, and various NS1 proteins and NP proteins were also constructed. Mutant proteins and observe the effects of these mutant proteins on the cell cycle

Experimental results show that,

(1) NS1 can combine with CPSF30 to form a complex. The NS1 protein of the H5N1 virus capable of interacting with the host factor CPSF30 has a cell cycle inhibitory effect, and the binding of the F103S, M106I mutant and CPSF30 of the NS1 of the H5N1 virus is greatly attenuated, and its ability to inhibit the cell cycle is also lost ( image 3).

(2) The NS1 protein from the 2009 pH1N1 virus has poor binding ability to itself and CPSF30. Therefore, only the mutation introduced into three sites (108K/125D/189D) enhances its binding to CPSF30. Stronger ability to inhibit the cell cycle (Figure 3).

(3) NP can combine with CPSF30 to form a complex. The NP proteins from H5N1 and 2009pH1N1 both interacted with CSPF4 and had the ability to inhibit the cell cycle (Fig. 4). However, when a mutation at three sites (17G del/400R/451T) was introduced on the NP protein (TripleMut), the binding of the NP protein to CPSF30 was greatly attenuated, and its ability to inhibit the cell cycle was also lost.

These experimental results suggest that the ability of NS1 and NP proteins to inhibit the cell cycle is related to its binding to the host factor CPSF30. In addition, since NP and NS1 bind to CPSP30, the three can form a CPSF30/NP/NS1 ternary complex.

Example 3, CPSF30 is a key molecule for maintaining normal cell cycle

Studies in Examples 1-2 indicate that CPSF30 is an important molecule in the cell cycle, and viral proteins bind and hijack CPSF30 (reducing the activity of CPSF30), leading to cell cycle arrest. In order to verify the regulation of the cell cycle by CPSF30, the expression of endogenous CPSF30 in cells was inhibited by the method using siRNA in this example.

The results showed that both siRNA sequences (siRNA 1 and siRNA 2) were effective in inhibiting mRNA and protein expression of CPSF30 (Figs. 5A and 5B). Cells transfected with these two siRNAs significantly arrested the cell cycle in the G0/G1 phase (Figures 5C and 5D).

This indicates that inhibition of the expression or activity of CPSF30 can inhibit the normal progression of the cell cycle. In addition, by inhibiting CPSF30, the cell cycle can be effectively arrested in the G0/G1 phase.

Example 4, NS1 and NP genes overexpressing influenza A virus in cancer cells can inhibit proliferation of cancer cell lines

In order to efficiently express the NS1 and NP genes in cancer cells, in the present example, two viral genes NP and NS1 were separately constructed in a lentiviral expression vector. The cancer cell lines A549 and Hela were infected with lentivirus expressing NS1 or NP gene, and the proliferation ability of NS1, NP infected cell group and negative control lentivirus infected cell group was detected by MTT method, and the proliferation ability of NS1 and NP genes on cancer cells was studied. Impact.

The results showed that the cell proliferation of the experimental group expressing NS1 protein was significantly lower than that of the A549 negative control infection group (**p<0.01, ***p<0.001) at 96 and 120 hours after infection, while NP protein was expressed. The cell proliferation of the experimental group was also slightly lower than that of the A549 negative control infection group (Fig. 6A and B); similarly, at 96 and 120 hours after infection, the cell proliferation of the experimental group expressing NS1 protein was significantly lower than that of the Hela negative control infection group. (**p<0.01, ***p<0.001), the experimental group expressing NP protein was also significantly lower than the Hela negative control infection group (*p<0.05, ***p<0.001) (Fig. 6C and D) .

These results suggest that both NS1 and NP gene expression can inhibit the proliferation of A539 cells and Hela cells.

Example 5, inhibiting the expression of CPSF30 can inhibit cancer cell proliferation

In this example, the siRNA series (siRNA 1) which inhibits the expression of CPSF30 was cloned into a lentiviral expression vector, and the cancer cell lines A549 and Hela were infected with the lentivirus, and the expression of CPSF30 was inhibited by MTT assay for A549 and Hela. The effect of cell proliferation ability.

The results showed that in the A549 cells, although the negative control infection group had an inhibitory effect on cell proliferation compared with the blank group, the cell proliferation of the experimental group expressing CPSF30 was lower than that of A549 from 72 hours after infection. In the control infection group, data analysis showed that the cell proliferation of the experimental group expressing CPSF30 siRNA was significantly lower than that of the A549 negative control infection group (*P<0.05) at 96 hours after infection (Fig. 7A and B). In Hela cells, the negative control infection group had almost no effect on cell proliferation compared with the blank group. Therefore, from 24 hours after infection, the cell proliferation of the experimental group expressing CPSF30 was significantly lower than that of the negative control infection. Group (*P<0.05, ***P<0.001) (Fig. 7C and D).

This indicates that inhibition of CPSF30 gene expression by RNA interference can inhibit the proliferation of A549 and Hela cancer cells.

discuss

Viral infection is not conducive to health in normal organisms, but virological studies have found that the interaction of the virus with the host can affect many host signaling pathways and physiological responses, which makes the virus possible to use. The characteristics of the virus are used to treat diseased cells. In cancer treatment, the idea of killing cancer cells using the principle of viral infection leading to cell death occurred as early as around 1940, but it was not until 1991 that the first oncolytic virus herpesvirus could cleave glia. Tumor cells, the first viral therapy (Virotherapy) was born. Subsequently, many different viruses were used to study their carcinogenic properties. However, this kind of viral therapy mainly uses the principle that viral infection eventually leads to cell lysis. Although it can realize the specificity of cancer cell infection, it requires a live virus with replication ability, and its safety leads to great application restrictions.

A complete cell cycle, ie, continuous division of cells from the end of the last mitosis to the completion of the next mitosis, including G0 (resting phase), G1 phase (pre-phase), S phase (intermediate), G2 phase (late), M Period (mitosis) four stages.

At present, many anticancer drugs inhibit mitosis of cancer cells. For example, SORAFENIB (sorafenib), developed by Bayer AG, contains RAF inhibitors that inhibit the activity of mitotic enzymes. Iressa (gefitinib), a new anticancer drug developed by AstraZeneca in the United Kingdom, also inhibits the proliferation and proliferation of cancer cells by inhibiting mitotic enzymes. However, mitosis occurs at the end of the entire cell cycle. If the cancer cells can be inhibited in the early stage of the cell cycle, such as the G0/G1 phase, inhibition of the cell cycle from the source will have a better inhibitory effect.

The present invention completely jumps out of the limitations of the principle of viral cancer, and develops viral proteins that directly interfere with the cell cycle, thereby inhibiting the cell cycle more safely and more specifically. By expressing the NS1 and NP genes of influenza A virus in cancer cell lines, or inhibiting the expression of CPSF30 gene in cancer cell weeks, inhibition of cancer cell proliferation is important for developing new anticancer methods.

In addition, the NP and NS1 proteins of the present invention or agonists thereof can effectively arrest cells (especially tumor cells) in the G0/G1 phase, and therefore, in combination with the existing mitotic drugs, a more complete inhibition of cancer cells will be achieved. The effect of division.

All documents mentioned in the present application are hereby incorporated by reference in their entirety in their entireties in the the the the the the the the In addition, it should be understood that various modifications and changes may be made by those skilled in the art in the form of the appended claims.

Claims (10)

1. Use of a viral protein, or an expression vector thereof, or an agonist thereof, for the preparation of (a) a composition for arresting a cell cycle of a cell in a G0/G1 phase; and/or (b) A composition for inhibiting the growth of cancer cells.
2. The use according to claim 1, wherein the viral protein is derived from a virus selected from the group consisting of an influenza virus and a parainfluenza virus.
3. The use according to claim 2, wherein the viral protein is selected from the group consisting of NP protein, NS1 protein, or a combination thereof.
4. Use of a vector for expressing an exogenous influenza virus protein, characterized in that it is used for preparing (a) a composition for arresting a cell cycle of a cell in a G0/G1 phase; and/or (b) for inhibiting A composition for the growth of cancer cells.
5. The use according to claim 4, wherein the exogenous influenza virus protein is selected from the group consisting of NP protein, NS1 protein, or a combination thereof.
6. Use of a CPSF30 inhibitor for the preparation of a composition for arresting the cell cycle of a cell in the G0/G1 phase;

   Preferably, the CPSF30 inhibitor is selected from the group consisting of an NP protein of influenza virus, an NS1 protein, or a combination thereof.
7. A pharmaceutical composition or combination of pharmaceuticals, comprising: (i) a pharmaceutically acceptable carrier; (ii) a viral protein or an agonist thereof; and (iii) optionally different from the group Sub-(ii) other anti-tumor active ingredients.
8. An in vitro non-therapeutic method for arresting a cell cycle of a cell in the G0/G1 phase, comprising the steps of:

   The cells are cultured in the presence of (a) a viral protein or an agonist thereof, and/or (b) a CPSF30 inhibitor, such that the cell cycle of the cell is arrested in the G0/G1 phase, wherein the virus The protein is selected from the group consisting of the influenza virus proteins: NP protein, NS1 protein, or a combination thereof.
9. A method for screening anti-tumor drug candidates, characterized in that

   The method includes the steps of:

   (i) in the experimental group, in the presence of the test substance, and in the presence of viral proteins, culture the mammalian cells in vitro, and test the cell cycle of the cells in the experimental group; and in the control group, The mammalian cells were cultured in vitro in the same test conditions but without the presence of the test substance, and the cell cycle of the cells in the control group was tested.

   Wherein the viral protein is selected from the group consisting of NP protein, NS1 protein, or a combination thereof;

   (ii) Comparing the cell ratio value Rs of the cell cycle in the G0/G1 phase of the experimental group with the cell ratio value Rc of the cell cycle in the G0/G1 phase in the control group, if the Rs is significantly higher than Rc, the test substance is indicated. a potential anti-tumor candidate (ie, a potential anti-tumor candidate that interacts with the viral protein) a drug; if Rs is not significantly higher than Rc, the test is not considered to be a potential anti-tumor drug candidate in an interaction with the viral protein;

   (iii) optionally, for the potential anti-tumor drug candidate selected in the previous step, tested for its ability to inhibit or kill tumor cells in the absence of the viral protein;

   or,

   The method includes the steps of:

   (i) in the experimental group, in the presence of the test substance, and in the presence of viral protein and CPSF30, and testing the case where the viral protein in the experimental group binds to CPSF30 to form a complex; and in the control group, The test conditions were the same but without the presence of the test substance, the viral protein in the test experimental group was combined with CPSF30 to form a complex.

   Wherein the viral protein is selected from the group consisting of NP protein, NS1 protein, or a combination thereof;

   (ii) comparing the amount Vs of the combination of the viral protein and the CPSF30 in the experimental group to form a complex with the number Vc of the combination of the viral protein and the CPSF30 in the control group, and if the Vs is significantly higher than Vc, it indicates that The test substance is a potential anti-tumor drug candidate (ie, a potential anti-tumor drug candidate that interacts with the viral protein) and can be subjected to step (iii); if Vs is not significantly higher than Vc, the test is not performed As a potential anti-tumor drug candidate;

   (iii) Optionally, for the potential anti-tumor drug candidate selected in the previous step, its ability to inhibit or kill tumor cells in the absence of the viral protein is tested.
10. A complex characterized in that the complex is a complex formed by CPSF30 and a viral protein, and the complex is selected from the group consisting of a CPSF30/NP binary complex or a CPSF30/NP/NS1 ternary Complex.

Images