WO2016209907A1 - Stable support films for electron microscopy - Google Patents
Stable support films for electron microscopy Download PDFInfo
- Publication number
- WO2016209907A1 WO2016209907A1 PCT/US2016/038683 US2016038683W WO2016209907A1 WO 2016209907 A1 WO2016209907 A1 WO 2016209907A1 US 2016038683 W US2016038683 W US 2016038683W WO 2016209907 A1 WO2016209907 A1 WO 2016209907A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- lipid
- biotin
- binding protein
- molecules
- carbon film
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- H—ELECTRICITY
- H01—ELECTRIC ELEMENTS
- H01J—ELECTRIC DISCHARGE TUBES OR DISCHARGE LAMPS
- H01J37/00—Discharge tubes with provision for introducing objects or material to be exposed to the discharge, e.g. for the purpose of examination or processing thereof
- H01J37/02—Details
- H01J37/20—Means for supporting or positioning the object or the material; Means for adjusting diaphragms or lenses associated with the support
-
- H—ELECTRICITY
- H01—ELECTRIC ELEMENTS
- H01J—ELECTRIC DISCHARGE TUBES OR DISCHARGE LAMPS
- H01J37/00—Discharge tubes with provision for introducing objects or material to be exposed to the discharge, e.g. for the purpose of examination or processing thereof
- H01J37/26—Electron or ion microscopes; Electron or ion diffraction tubes
-
- H—ELECTRICITY
- H01—ELECTRIC ELEMENTS
- H01J—ELECTRIC DISCHARGE TUBES OR DISCHARGE LAMPS
- H01J37/00—Discharge tubes with provision for introducing objects or material to be exposed to the discharge, e.g. for the purpose of examination or processing thereof
- H01J37/26—Electron or ion microscopes; Electron or ion diffraction tubes
- H01J37/261—Details
-
- H—ELECTRICITY
- H01—ELECTRIC ELEMENTS
- H01J—ELECTRIC DISCHARGE TUBES OR DISCHARGE LAMPS
- H01J2237/00—Discharge tubes exposing object to beam, e.g. for analysis treatment, etching, imaging
- H01J2237/20—Positioning, supporting, modifying or maintaining the physical state of objects being observed or treated
- H01J2237/2007—Holding mechanisms
-
- H—ELECTRICITY
- H01—ELECTRIC ELEMENTS
- H01J—ELECTRIC DISCHARGE TUBES OR DISCHARGE LAMPS
- H01J2237/00—Discharge tubes exposing object to beam, e.g. for analysis treatment, etching, imaging
- H01J2237/26—Electron or ion microscopes
- H01J2237/28—Scanning microscopes
- H01J2237/2802—Transmission microscopes
Definitions
- This disclosure relates generally to electron microscopy grids and more particularly to electron microscopy grids with stable support films disposed thereon.
- Described herein is a simplified, on-grid crystallization protocol that yields large SA crystals in times as short as 10 minutes.
- trehalose-embedding makes it possible to prepare these grids in advance, with their useful shelf life expected to be months or longer.
- a thin layer of evaporated carbon also can be deposited on the back side (lipid-tail side) of the trehalose-embedded SA crystals in order to add mechanical stability.
- E. coli 70S ribosomes were used to obtain a 3-D reconstruction at a global resolution estimated to be -4.0 A, which improved to -3.9 A when focused refinement was used for the large subunit.
- the electron microscopy grid comprises a first surface and a second surface, with the first surface having a holey carbon film disposed thereon.
- a plurality of lipid molecules are disposed in a hole in the holey carbon film.
- Each lipid molecule of the plurality of lipid molecules has a hydrophilic head and a hydrophobic tail.
- a biotin-binding protein is attached to the hydrophilic heads of the plurality of lipid molecules.
- the biotin-binding protein is crystalline.
- the electron microscopy grid comprises a first surface and a second surface, with the first surface having a holey carbon film disposed thereon.
- a plurality of lipid molecules are provided. Each lipid molecule of the plurality of lipid molecules has a hydrophilic head and a hydrophobic tail.
- the holey carbon film is contacted with hydrophobic tails of the plurality of lipid molecules to form a lipid monolayer disposed in a hole in the holey carbon film.
- the lipid monolayer comprises a portion of the plurality of lipid molecules.
- a biotin-binding protein is attached to hydrophilic heads of the lipid monolayer. A period of time is allowed to elapse to allow the biotin-binding protein to crystalize.
- Figure 1A shows an example of a flow diagram illustrating a method of fabricating an arrangement including an electron microscopy grid.
- Figures IB and 1C show examples of schematic illustrations of a holey carbon film disposed on an electron microscopy grid.
- Figure ID shows an example of a cross- sectional schematic illustration of an arrangement including an electron microscopy grid.
- Figure IE shows an example of a flow diagram illustrating a method of using an arrangement including an electron microscopy grid.
- Figures 2A and 2B illustrate two operations in the on-grid crystallization technique.
- Figure 3A shows an example of an image of a SA monolayer crystal after trehalose embedding, backing with evaporated carbon, and subsequent removal of trehalose just before use.
- Figure 3B shows an example of the raw Fourier transform of the image shown in Figure 3 A.
- Figure 3C shows an example of the Fourier transform of the "unbent" image, in which the Bragg spots are displayed as a so-called IQ plot.
- Figures 4 A and 4B show examples of images demonstrating the effectiveness of binding randomly biotinylated 70S ribosomes to the SA monolayer-crystal support film.
- Figure 4A shows an example of an image in which only a sparse density of ribosomes was obtained in the control experiment, for which the ribosomes were not biotinylated.
- Figure 4B shows an example of an image in which a uniform, high density of ribosomes was obtained when the ribosomes were biotinylated.
- the terms "about” or “approximate” and the like are synonymous and are used to indicate that the value modified by the term has an understood range associated with it, where the range can be +20%, + 15%, + 10%, + 5%, or + 1 %.
- the term “substantially” is used to indicate that a value is close to a targeted value, where close can mean, for example, the value is within 80% of the targeted value, within 90% of the targeted value, within 95% of the targeted value, or within 99% of the targeted value.
- Figure 1A shows an example of a flow diagram illustrating a method of fabricating an arrangement including an electron microscopy grid.
- the arrangement may be used, for example, as a sample support or holder in cryo-electron microscopy of macromolecules.
- an electron microscopy grid is provided.
- the electron microscopy grid comprises a first surface and a second surface.
- the first surface has a holey carbon film disposed thereon.
- An electron microscopy grid is a grid upon which a sample to be observed in an electron microscope can be placed.
- the electron microscopy grid can be placed in an electron microscopy specimen holder that can be inserted into the electron microscope.
- Electron microscopy grids are generally used in transmission electron microscopy (TEM).
- An electron microscopy grid can be made of a number of materials or a combination or alloy of such materials.
- the electron microscopy grid comprises gold, molybdenum, titanium, or copper. It is believed that molybdenum has a thermal expansion that is matched with carbon, which may desirable in some cases.
- An electron microscopy grid is generally an about 3.05 millimeter (mm) diameter disc that has a thickness and mesh size ranging from about 3 microns to 100 microns. In some embodiments, an electron microscopy grid has a thickness of about 30 microns and a mesh size of about 100 microns.
- a holey carbon film is disposed on one side of the electron microscopy grid that is used in the method 100. Holey carbon films are often used for high resolution studies in conjunction with cryo-electron microscopy. A holey carbon film differs from a continuous carbon film in that a holey carbon film has holes defined in the carbon film. In some
- the holes in the holey carbon film have a specified size.
- One purpose of the holes in the holey carbon film is to eliminate any absorption and scattering of the electron beam in an electron microscope by the carbon film. Absorption and scattering of the electron beam will generate noise and obstruct the signal.
- the holes in the holey carbon film have a cross-sectional dimension of about 1 micron, about 2 microns, or about 1 micron to 2 microns.
- the holes in the holey carbon film are circular, the holes have a diameter of about 1 micron, about 2 microns, or about 1 micron to 2 microns.
- the holey carbon film has a thickness of about 10 nanometers (nm) to 25 nm, or about 12 nm.
- Figures IB and 1C show examples of schematic illustrations of a holey carbon film disposed on an electron microscopy grid.
- an electron microscopy grid 150 has a holey carbon film disposed on one side of the electron microscopy grid 150.
- Figure 1C shows the holey carbon film 155disposed over one opening in the mesh 157 of the electron microscopy grid 150.
- the holey carbon film has holes 159 defined in the carbon film.
- a plurality of lipid molecules is provided.
- Each lipid molecule of the plurality of lipid molecules has a hydrophilic head and a hydrophobic tail.
- the plurality of lipid molecules comprises a homogenous mixture of lipid molecules with biotinylated head groups.
- the plurality of lipid molecules comprises a heterogeneous mixture of lipid molecules, with at least a part of the heterogeneous mixture comprising lipid molecules with biotinylated head groups.
- the holey carbon film is contacted with hydrophobic tails of the plurality of lipid molecules.
- the plurality of lipid molecules form a lipid monolayer before the holey carbon film is contacted with hydrophobic tails of the plurality of lipid molecules.
- the electron microscopy grid is subsequently lifted from contact with the plurality of lipid molecules, a portion of plurality of lipid molecules adheres to the holey carbon film and is transferred thereto.
- Some of the plurality of lipid molecules forms a lipid monolayer disposed in a hole in the holey carbon film.
- the operation in block 115 may be referred to as a direct transfer method or a Langmuir-Schaefer transfer method (Langmuir and Schaefer, 1938).
- a loop transfer method is used to form the lipid monolayer.
- the loop transfer method is described in Asturias and Kornberg (1995), "A novel method for transfer of two-dimensional crystals from the air/water interface to specimen grids. EM sample preparation/lipid-layer crystallization," Journal of Structural Biology, 114(l):60-66, which is hereby incorporated by reference.
- a biotin-binding protein is attached to hydrophilic heads of the lipid monolayer.
- the biotin-binding protein used is typically able to form well-ordered crystals.
- the biotin-binding protein is selected from a group consisting of streptavidin, avidin, NeutrAvidin (i.e., a deglycosylated version of avidin), CaptAvidin (i.e., a biotin-binding protein derived from avidin, in which the tyrosine in the biotin-binding site has been nitrated), and tamavidins.
- mutant versions of such biotin-binding proteins are used.
- the mutations include truncation at the C-terminus, the N-terminus, or both, or mutations changing charged residues to non-charges residues.
- the operation at block 120 allows for crystallization of the biotin-binding protein on the electron microscopy grid.
- On-grid crystallization of the biotin-binding protein addresses the issue described above in which the transfer of a biotin-binding protein crystal onto an electron microscopy grid is itself plagued by inconsistency because touching a lipid monolayer with a carbon film imparts mechanical force that tends to distort the attached crystals (Brisson et al., 1999).
- the biotin-binding protein is added to a small droplet of buffer that remains adhered on the hydrophilic face of the electron microscopy grid.
- affinity-binding systems such as the FITC-anti-FITC (FITC - fluorescein isothiocyanate) system (Harmer and Samuel, 1989) or the use of other capture molecules, such as antibodies may, also be used in place of the biotin-binding protein.
- FITC-anti-FITC FITC - fluorescein isothiocyanate
- capture molecules such as antibodies
- a period of time is allowed to elapse.
- the period of time allows the biotin-binding protein to crystallize.
- the standard protocol known and used in the art for growing monolayer crystals typically involves an additional incubation step of 2 hours or more (See Wang and Sigworth, 2010).
- the period of time is less than about 10 minutes. In some embodiments, the period of time is about 1 minute to 20 minutes.
- small molecules are deposited on the biotin-binding protein.
- the small molecules are soluble in water.
- the small molecules are hydrophilic.
- the small molecules are operable to preserve lipid and protein structure when water is removed.
- the water is removed by evaporation.
- the small molecules are selected from a group consisting of trehalose, glucose, betaine, proline, and glycine.
- the small molecules are deposited on the biotin-binding protein in the form of a solution. The solvent of the solution (e.g., water) is then allowed to evaporate.
- the small molecules form a layer on the biotin- binding protein that is about 50 nm to 150 nm thick, or about 100 nm thick.
- the small molecules form a layer on the biotin-binding protein that is thicker than about 100 nm.
- a layer of carbon is deposited on the hydrophobic tails of the lipid monolayer.
- the layer of carbon is deposited with an evaporation process.
- the layer of carbon may increase the consistency with which a well-ordered single crystal of the biotin-binding protein is obtained, spanning an entire hole in the holely carbon film.
- a single crystal of the biotin-binding protein may span an about 1 micron to 2 micron hole in the holey carbon film.
- the layer of carbon is about 5 nm or less in thickness.
- the layer of carbon is deposited on the hydrophobic tails of the lipid monolayer after block 125 or after small molecules are deposited on the biotin- binding protein.
- the electron microscopy grid before beginning the method 100, is pretreated.
- a pretreatment of the electron microscopy grid comprises immersing the electron microscopy grid in a solvent, depositing carbon on the first surface of the grid, and allowing a period of about 3 or more days to elapse.
- immersing the electron microscopy grid in a solvent includes immersing the electron microscopy grid in chloroform and then immersing the electron microscopy grid in ethanol.
- an evaporation method is used to deposit the carbon on the first surface of the grid.
- block 115 is described with reference to one hole in the holey carbon film, in some embodiments, a plurality of the holes in the holey carbon film undergo the operations described in blocks 115, 120 and 125.
- Figure ID shows an example of a cross- sectional schematic illustration of an arrangement including an electron microscopy grid.
- the schematic illustration shown in Figure ID shows an area that is close to, and includes one edge of, a hole in the holey carbon film.
- the schematic illustration shown in Figure ID also shows an area that is close to, and includes one edge of, an opening in the mesh of the electron microscopy grid.
- the arrangement 300 shown in Figure ID includes a portion of an electron microscopy grid 330.
- the electron microscopy grid 330 includes a first surface and a second surface, with the first surface having a holey carbon film 325 disposed thereon.
- a plurality of lipid molecules 315 that form a lipid monolayer are disposed in a hole in the holey carbon film 325.
- a biotin-binding protein 310 is attached to the hydrophilic heads of the plurality of lipid molecules 315.
- the biotin- binding protein 310 is crystalline.
- biotin-binding protein 310 comprises a single crystal of the biotin-binding protein 310 and spans a hole in the holey carbon film 325.
- the biotin-binding protein 310 consists of a single crystal of the biotin- binding protein 310 and spans a hole in the holey carbon film 325.
- the arrangement includes small molecules 305 disposed on the biotin-binding protein 310.
- a layer of carbon 320 is disposed on the hydrophobic tails of the plurality of lipid molecules 315.
- Each lipid molecule of the plurality of lipid molecules 315 has a hydrophilic head and a hydrophobic tail. While the location of the plurality of lipid molecules 315 relative to the surface of the holey carbon film 325 is not known in molecular detail, the hydrophobic lipid tails are expected to be in contact with the edge of the carbon, which is hydrophobic, defining a hole in the holey carbon film 325, as shown in Figure ID.
- the plurality of lipid molecules comprises a homogenous mixture of lipid molecules with biotinylated head groups. In some embodiments, the plurality of lipid molecules comprises a heterogeneous mixture of lipid molecules, with at least a part of the heterogeneous mixture comprising lipid molecules with biotinylated head groups.
- the biotin-binding protein used is typically able to form well-ordered crystals.
- the biotin-binding protein 310 is selected from a group consisting of streptavidin, avidin, NeutrAvidin, CaptAvidin, and tamavidins.
- mutant versions of such biotin-binding proteins are used.
- the mutations include truncation at the C-terminus, the N-terminus, or both, or mutations changing charged residues to non-charges residues.
- the small molecules 305 disposed on the biotin-binding protein 310 are soluble in water.
- the small molecules 305 are hydrophilic.
- the small molecules 305 are operable to preserve lipid and the protein structure when water is removed.
- the small molecules 305 are selected from a group consisting of trehalose, glucose, betaine, proline, and glycine.
- Figure IE shows an example of a flow diagram illustrating a method of using an arrangement including an electron microscopy grid. At block 205 of the method 200, an arrangement including an electron microscopy grid is provided.
- the arrangement is an arrangement 300 as described with respect to Figure ID.
- the arrangement includes small molecules disposed on the biotin-binding protein.
- the small molecules are removed from the biotin-binding protein.
- the biotin-binding protein remains bonded to the hydrophilic heads of the plurality of lipid molecules that form the lipid monolayer.
- the arrangement includes a layer of carbon disposed on the hydrophobic tails of the plurality of lipid molecules. The layer of carbon may serve to stabilize the biotin-binding protein during block 210.
- block 210 is performed immediately prior to using the arrangement in an electron microscopy experiment. For example, blocks 210 and 215 may be performed and no more than about 30 minutes to 45 minutes may elapse before inserting the arrangement in an electron microscope.
- removal of the small molecules is performed by depositing a biotin-binding crystallization buffer on the small molecules followed by depositing a buffer on the arrangement, the buffer being specific to the macromolecule that is to be bound to the biotin- binding protein.
- the depositing is performed by washing the arrangement with the buffers.
- the buffer specific to the macromolecule that is to be bound to the biotin- binding protein may aid in ensuring that the arrangement will not have any residual biotin- binding crystallization buffer disposed thereon and will be macromolecule-friendly; the biotin- binding crystallization buffer is generally biotin-binding protein-friendly but not macromolecule- friendly.
- a macromolecule is bound to the biotin-binding protein of arrangement.
- the macromolecule is a macromolecule that is to be examined in an electron microscope.
- the macromolecule is bound to the arrangement through affinity binding of the macromolecule to the biotin-binding protein.
- a macromolecule is bound to the arrangement using techniques described in Han, Bong-Gyoon, et al. (2012). "Electron microscopy of biotinylated protein complexes bound to streptavidin monolayer crystals," Journal of Structural Biology 180: 249-253, which is hereby incorporated by reference.
- macromolecules of interest can be tagged with biotin or a streptavidin-binding peptide and then bound to the bio tin-binding protein with high affinity and specificity.
- the biotinylated lipid used here is l,2-dipalmitoyl-sn-glycero-3- phosphoethanolamine-N-(cap biotinyl), supplied as a 10 mg/mL solution in
- Streptavidin Streptavidin (SA) as purchased was provided at a concentration of ⁇ 1 mg/mL, dissolved in 10 mM sodium phosphate pH 7.2 with 0.15 M NaCl. This was aliquoted in quantities intended for single use, frozen in liquid nitrogen, and stored at -80°C. Similar to what we do for the lipid, as a precaution, we prepare new aliquots of streptavidin after a period of about 6 months.
- Protocol for growing monolayer crystals directly on holey-carbon EM grids A lipid monolayer, cast on an air-water interface, is first picked up by touching the lipid from above with a hydrophobic, holey-carbon EM grid. This results in Langmuir-Schaefer transfer of patches of the monolayer that span the holes of the carbon film, as was discovered by (Kubalek et al., 1991). We presume that an additional, unwanted lipid monolayer is also transferred to the air- water surface of the small volume of buffer that adheres to the (now hydrophilic) face of the EM grid. Thus, to remove as much lipid as possible from the surface of the adhering drop, we touch the grid to three successive, 50 drops of subphase buffer sitting on parafilm. Next, SA is added to the small droplet of buffer that adheres to the face of the EM grid. The grid is then incubated long enough to allow binding and subsequent crystallization of SA. We refer to this technique as the "on-grid" crystallization method.
- the advancing front of oil sweeps away contaminants at the air-water interface and compresses them to the perimeter of the trough.
- a Hamilton syringe is then used to deliver -0.5 ⁇ ⁇ of previously aliquoted lipid to the center of the trough.
- the thin film of castor oil also serves as a "piston" to control the surface pressure of the lipid monolayer (Langmuir, 1917) .
- the castor-oil piston is a desirable but not necessary element of our protocol. Using a trough, rather than smaller, individual wells, facilitates use of the castor- oil piston, and allows one to prepare multiple grids from a single lipid monolayer.
- Quantifoil grids Quantifoil Micro Tools GmbH, Germany
- We wash Quantifoil grids by first dipping them into chloroform and then into 95% ethanol.
- Streptavidin crystals are then embedded in trehalose and backed with evaporated carbon. After washing the grids to remove unbound SA, excess trehalose solution is gently "wicked off by touching the edge of the grid to a piece of filter paper. The grid then is left on a filter paper with the wet side facing the air, and any remaining liquid on the grid is allowed to dry.
- a thin layer ( ⁇ 5 nm or less) of evaporated carbon is deposited on the back side (lipid-tail side) of the EM grid.
- Grids are placed -20 cm below a carbon-arc source, and evaporation is done at a vacuum of 10 ⁇ 5 torr or lower.
- the carbon rod is heated very rapidly, resulting in breakage of the thin tip and a concomitant flash of evaporated carbon.
- the grid is rehydrated by touching to two successive, 50 ⁇ ⁇ drops of a solution of 10 mM HEPES (pH 7.5) with 150 mM KC1 without trehalose and then left on a 100 ⁇ L ⁇ drop of the same solution for 10 minutes. This same process is repeated a second time, with the intent being to rinse away all remaining trehalose. After that, the grid is further washed with whatever buffer is optimal for the macromolecular sample under investigation.
- Ribosomes were purified from E. coli strain MRE600 using sucrose gradient centrifugation, as previously described (Blaha et al., 2000). Ribosome complexes were formed by incubating 1.5 ⁇ deacylated tRNA phe and 3 ⁇ mRNA of sequence 5'-
- GGCAAGGAGGUAAAAUUCUAC AAA-3 with 0.5 ⁇ ribosomes at 37 °C for 15 minutes in the buffer A: 20 mM HEPES, pH 7.5/ 70 mM KC1/ 6 mM MgOAc/ 1 mM TCEP.
- the antibiotic spectinomycin at a concentration of 20 ⁇ was added to the pre-formed complex and incubated an additional 10 minutes at 37°C.
- Ribosomes were biotinylated by adding 5-fold excess of biotin-labeling reagent and incubated 20 minutes at room temperature. Excess unreacted biotin was removed by using 1 mL S300 Sephacryl (GE Healthcare, Little Chalfont, Buckinghamshire, United Kingdom) gel- filtration spin column. The column was equilibrated with Buffer A, and usually 50 of ribosome complex was loaded on the column and spun on a table centrifuge at 3200 rpm for 1 minute.
- S300 Sephacryl GE Healthcare, Little Chalfont, Buckinghamshire, United Kingdom
- Grids were first washed 3 times with 50 drops of cold ribosome buffer, and then a 4 ⁇ L ⁇ aliquot of ribosomes was applied at a concentration in the range of 20-40 nM. After incubating for 20 minutes, chilled and in a humidity box to minimize evaporation, as described above for growth of monolayer crystals, unbound ribosomes were washed away by touching to three successive, 50 ⁇ ⁇ drops of buffer.
- the grid is transferred to the Vitrobot (FEI, Hillsboro, Oregon) tweezers after washing away unbound ribosomes with ribosome buffer.
- the tweezers and grid were then loaded into the Vitrobot Mark IV chamber (FEI, Hillsboro, Oregon), which was previously equilibrated at a temperature of 15°C and a relative humidity setting of 100%.
- FEI FEI, Hillsboro, Oregon
- excess liquid was first wicked off by touching the bottom edge of the grid with filter paper, which was brought in through a side port of the Vitrobot chamber.
- 1.2 ⁇ L ⁇ of sample buffer was then added to the wet face of the grid.
- the blotting time used was 5 s, with a force setting of 8, a blotting time of 3 seconds, and zero wait/drain time.
- Candidate ribosome particles were automatically boxed with a software tool provided in RELION (Scheres, 2012). Images, with candidate particles outlined, were edited manually, using the BOXER tool provided in EMAN (Tang et al., 2007) to remove initial candidates that were obviously aggregates or other undesired material. Three-dimensional classification of particles and subsequent refinement again used tools provided in RELION.
- the Bragg spots in the FFT of the unbent image are represented by squares of various sizes, the largest corresponding to an IQ (Henderson et al., 1986) of 1 (estimated phase error of -4 degrees) and the smallest corresponding to an IQ of 7 (estimated phase error of -45 degrees). As in this example, Bragg spots with an IQ of 3
- a set of 1497 movies were recorded in order to test the use of SA support films for single-particle data collection. After removing the SA background from these images, candidate ribosome particles were boxed automatically. This raw set was edited manually to produce a working data set of 101,213 particles. 3-D classification was then used to obtain structurally more homogeneous subsets of the working set.
- Streptavidin affinity-grids can be used to obtain high-resolution structures.
- the resolution of the 3-D density map that we obtained for E. coli 70 S ribosomes, using SA monolayer crystals as a support film, is in line with that of maps obtained previously by others, using continuous carbon as a support film.
- a map at a somewhat lower resolution of -5.1 A was obtained by (Bai et al., 2013) for T. thermophilus 70 S ribosomes, but from a much smaller data set consisting of 15,202 particles.
- significantly higher-resolution maps have been obtained, this time for E. coli 70 S ribosomes, when using much larger data sets.
- a 3.0 A map was obtained from 164,353 particles by (Brown et al., 2016), and an even higher-resolution structure was obtained by (Fischer et al., 2015) from 417,201 particles.
- Random biotinylation can result in particles adopting many orientations.
- One of the major concerns about using affinity grids is that particles might be bound in a preferred orientation with respect to the support film.
- Affinity support films in general provide a number of features that are expected to be helpful for preparing cryo-EM grids. These include the fact that particles are bound at a single plane (single Z-height, for untilted specimens), which is important for CTF correction at high resolution. In addition, tethered particles are prevented from interacting with the air-water interface, provided that the aqueous sample is not too thin.
- Affinity binding is, in general, expected to leave structures in a close-to-native state.
- Streptavidin affinity grids have the special feature that binding of the biotin ligand is essentially as strong as a covalent bond.
- the background image of the SA lattice might serve as a fiducial to aid alignment of movie frames, and even sub-regions of frames.
- the background image of the SA lattice might also serve to track changes in tilt orientation that occur during the course of recording dose-fractionated images.
- Trehalose is known to have superior properties for room-temperature preservation of freeze-dried phospholipid vesicles and proteins (Zhou, 2008). It has also been used extensively to preserve the high-resolution structure of thin protein crystals adsorbed to a carbon support film, a few examples of which are (Hebert et al., 1997; Leong et al., 2010; Tang et al., 2007). We note that other hydrophilic solutes might also work as well as does trehalose - see, for example, section 6.4 of (Glaeser et al., 2007).
Landscapes
- Chemical & Material Sciences (AREA)
- Analytical Chemistry (AREA)
- Analysing Materials By The Use Of Radiation (AREA)
- Peptides Or Proteins (AREA)
Abstract
This disclosure provides systems, methods, and apparatus related to arrangements including electron microscopy grids. In one aspect an arrangement includes an electron microscopy grid. The electron microscopy grid comprises a first surface and a second surface, with the first surface having a holey carbon film disposed thereon. A plurality of lipid molecules are disposed in a hole in the holey carbon film. Each lipid molecule of the plurality of lipid molecules has a hydrophilic head and a hydrophobic tail. A biotin-binding protein is attached to the hydrophilic heads of the plurality of lipid molecules. The biotin-binding protein is crystalline.
Description
STABLE SUPPORT FILMS FOR ELECTRON MICROSCOPY
Inventors: Robert M. Glaeser, Bong-Gyoon Han
RELATED APPLICATIONS
[0001] This application claims priority to U.S. Provisional Patent Application Serial No. 62/184,532, filed June 25, 2015, which is herein incorporated by reference.
STATEMENT OF GOVERNMENT SUPPORT
[0002] This invention was made with government support under Contract No. DE-AC02- 05CH11231 awarded by the U.S. Department of Energy and under Grant No. GM083039 from the National Institute of General Medical Sciences. The government has certain rights in this invention.
TECHNICAL FIELD
[0003] This disclosure relates generally to electron microscopy grids and more particularly to electron microscopy grids with stable support films disposed thereon.
BACKGROUND
[0004] There are a number of reasons to consider using streptavidin monolayer crystals as "affinity" support films for cryo-electron microscopy (cryo-EM). Macromolecules of interest can be easily tagged with biotin or a streptavidin-binding peptide and then bound to streptavidin (SA) with high affinity and specificity. Furthermore, tagging followed by affinity binding is expected to pose less risk to the native structure of the macromolecule than does (1) adsorption of particles to the surface of carbon film, even when rendered hydrophilic by exposure to a glow discharge, or (2) repeated collision with the air-water interface that occurs when freely diffusing
macromolecules are confined to a thin aqueous film (Taylor and Glaeser, 2008).
[0005] Monolayer crystals of SA have been considered previously by several authors for use as an affinity- support film. One early study viewed SA as being a "general adaptor" for linking any kind of biotinylated molecule to a lipid monolayer (Darst et al., 1991). Chemically biotinylated ferritin was used in that work to show that a high density of randomly distributed particles could be bound to 2-D crystals of SA. In an extension of the adaptor-molecule idea,
Crucifix et al. first randomly decorated SA monolayer crystals with biotinylated dsDNA molecules, and then used the immobilized DNA as bait to bind yeast RNA Pol I particles (Crucifix et al., 2004). Wang et al. showed that biotinylated proteoliposomes could be bound at high density (Wang and Sigworth, 2009; Wang et al., 2008), and they introduced the further innovation of eliminating the periodic background due to SA by masking out the Bragg reflections in the computed Fourier transforms of images. Han et al. then went on to demonstrate the generality with which chemical biotinylation of soluble-protein complexes could be used (Han et al., 2012).
[0006] In spite of these promising demonstrations, SA monolayer crystals have not been adopted as support films for routine data collection. Two major problems remained with the use of SA monolayer crystals. First, the standard protocol for growing monolayer crystals involves an additional incubation step of 2 hours or more (Wang and Sigworth, 2010), which both slows and complicates the process of preparing cryo-EM specimens. Second, while the results can be excellent, the growth of large, well-ordered crystals on micro-wells, together with their transfer onto EM grids, is quite inconsistent.
SUMMARY
[0007] Described herein is a simplified, on-grid crystallization protocol that yields large SA crystals in times as short as 10 minutes. In addition, trehalose-embedding makes it possible to prepare these grids in advance, with their useful shelf life expected to be months or longer. A thin layer of evaporated carbon also can be deposited on the back side (lipid-tail side) of the trehalose-embedded SA crystals in order to add mechanical stability. In a practical test of these grids, E. coli 70S ribosomes were used to obtain a 3-D reconstruction at a global resolution estimated to be -4.0 A, which improved to -3.9 A when focused refinement was used for the large subunit.
[0008] One innovative aspect of the subject matter described in this disclosure can be implemented in an arrangement including an electron microscopy grid. The electron microscopy grid comprises a first surface and a second surface, with the first surface having a holey carbon film disposed thereon. A plurality of lipid molecules are disposed in a hole in the holey carbon film. Each lipid molecule of the plurality of lipid molecules has a hydrophilic head and a
hydrophobic tail. A biotin-binding protein is attached to the hydrophilic heads of the plurality of lipid molecules. The biotin-binding protein is crystalline.
[0009] Another innovative aspect of the subject matter described in this disclosure can be implemented in a method including providing an electron microscopy grid. The electron microscopy grid comprises a first surface and a second surface, with the first surface having a holey carbon film disposed thereon. A plurality of lipid molecules are provided. Each lipid molecule of the plurality of lipid molecules has a hydrophilic head and a hydrophobic tail. The holey carbon film is contacted with hydrophobic tails of the plurality of lipid molecules to form a lipid monolayer disposed in a hole in the holey carbon film. The lipid monolayer comprises a portion of the plurality of lipid molecules. A biotin-binding protein is attached to hydrophilic heads of the lipid monolayer. A period of time is allowed to elapse to allow the biotin-binding protein to crystalize.
[0010] Details of one or more embodiments of the subject matter described in this specification are set forth in the accompanying drawings and the description below. Other features, aspects, and advantages will become apparent from the description, the drawings, and the claims. Note that the relative dimensions of the following figures may not be drawn to scale.
BRIEF DESCRIPTION OF THE DRAWINGS
[0011] Figure 1A shows an example of a flow diagram illustrating a method of fabricating an arrangement including an electron microscopy grid.
[0012] Figures IB and 1C show examples of schematic illustrations of a holey carbon film disposed on an electron microscopy grid.
[0013] Figure ID shows an example of a cross- sectional schematic illustration of an arrangement including an electron microscopy grid.
[0014] Figure IE shows an example of a flow diagram illustrating a method of using an arrangement including an electron microscopy grid.
[0015] Figures 2A and 2B illustrate two operations in the on-grid crystallization technique.
[0016] Figure 3A shows an example of an image of a SA monolayer crystal after trehalose embedding, backing with evaporated carbon, and subsequent removal of trehalose just before use.
[0017] Figure 3B shows an example of the raw Fourier transform of the image shown in
Figure 3 A.
[0018] Figure 3C shows an example of the Fourier transform of the "unbent" image, in which the Bragg spots are displayed as a so-called IQ plot.
[0019] Figures 4 A and 4B show examples of images demonstrating the effectiveness of binding randomly biotinylated 70S ribosomes to the SA monolayer-crystal support film. Figure 4A shows an example of an image in which only a sparse density of ribosomes was obtained in the control experiment, for which the ribosomes were not biotinylated. Figure 4B shows an example of an image in which a uniform, high density of ribosomes was obtained when the ribosomes were biotinylated.
DETAILED DESCRIPTION
[0020] Reference will now be made in detail to some specific examples of the invention including the best modes contemplated by the inventors for carrying out the invention. Examples of these specific embodiments are illustrated in the accompanying drawings. While the invention is described in conjunction with these specific embodiments, it will be understood that it is not intended to limit the invention to the described embodiments. On the contrary, it is intended to cover alternatives, modifications, and equivalents as may be included within the spirit and scope of the invention as defined by the appended claims.
[0021] In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention. Particular example embodiments of the present invention may be implemented without some or all of these specific details. In other instances, well known process operations have not been described in detail in order not to unnecessarily obscure the present invention. Various techniques and mechanisms of the present invention will sometimes be described in singular form for clarity. However, it should be noted that some embodiments include multiple iterations of a technique or multiple instantiations of a mechanism unless noted otherwise.
[0022] The terms "about" or "approximate" and the like are synonymous and are used to indicate that the value modified by the term has an understood range associated with it, where the range can be +20%, + 15%, + 10%, + 5%, or + 1 %. The term "substantially" is used to indicate that a value is close to a targeted value, where close can mean, for example, the value is
within 80% of the targeted value, within 90% of the targeted value, within 95% of the targeted value, or within 99% of the targeted value.
[0023] Figure 1A shows an example of a flow diagram illustrating a method of fabricating an arrangement including an electron microscopy grid. The arrangement may be used, for example, as a sample support or holder in cryo-electron microscopy of macromolecules. Starting at block 105 of the method 100, an electron microscopy grid is provided. The electron microscopy grid comprises a first surface and a second surface. The first surface has a holey carbon film disposed thereon.
[0024] An electron microscopy grid is a grid upon which a sample to be observed in an electron microscope can be placed. The electron microscopy grid can be placed in an electron microscopy specimen holder that can be inserted into the electron microscope. Electron microscopy grids are generally used in transmission electron microscopy (TEM).
[0025] An electron microscopy grid can be made of a number of materials or a combination or alloy of such materials. In some embodiments, the electron microscopy grid comprises gold, molybdenum, titanium, or copper. It is believed that molybdenum has a thermal expansion that is matched with carbon, which may desirable in some cases. An electron microscopy grid is generally an about 3.05 millimeter (mm) diameter disc that has a thickness and mesh size ranging from about 3 microns to 100 microns. In some embodiments, an electron microscopy grid has a thickness of about 30 microns and a mesh size of about 100 microns.
[0026] A holey carbon film is disposed on one side of the electron microscopy grid that is used in the method 100. Holey carbon films are often used for high resolution studies in conjunction with cryo-electron microscopy. A holey carbon film differs from a continuous carbon film in that a holey carbon film has holes defined in the carbon film. In some
embodiments, the holes in the holey carbon film have a specified size. One purpose of the holes in the holey carbon film is to eliminate any absorption and scattering of the electron beam in an electron microscope by the carbon film. Absorption and scattering of the electron beam will generate noise and obstruct the signal. In some embodiments, the holes in the holey carbon film have a cross-sectional dimension of about 1 micron, about 2 microns, or about 1 micron to 2 microns. For example, when the holes in the holey carbon film are circular, the holes have a diameter of about 1 micron, about 2 microns, or about 1 micron to 2 microns. In some embodiments, the holey carbon film has a thickness of about 10 nanometers (nm) to 25 nm, or
about 12 nm.
[0027] Figures IB and 1C show examples of schematic illustrations of a holey carbon film disposed on an electron microscopy grid. As shown in Figure IB, in some embodiments, an electron microscopy grid 150 has a holey carbon film disposed on one side of the electron microscopy grid 150. Figure 1C shows the holey carbon film 155disposed over one opening in the mesh 157 of the electron microscopy grid 150. The holey carbon film has holes 159 defined in the carbon film.
[0028] At block 110 of the method 100, a plurality of lipid molecules is provided. Each lipid molecule of the plurality of lipid molecules has a hydrophilic head and a hydrophobic tail. In some embodiments, the plurality of lipid molecules comprises a homogenous mixture of lipid molecules with biotinylated head groups. In some embodiments, the plurality of lipid molecules comprises a heterogeneous mixture of lipid molecules, with at least a part of the heterogeneous mixture comprising lipid molecules with biotinylated head groups.
[0029] At block 115 of the method 100, the holey carbon film is contacted with hydrophobic tails of the plurality of lipid molecules. In some embodiments, the plurality of lipid molecules form a lipid monolayer before the holey carbon film is contacted with hydrophobic tails of the plurality of lipid molecules. When the electron microscopy grid is subsequently lifted from contact with the plurality of lipid molecules, a portion of plurality of lipid molecules adheres to the holey carbon film and is transferred thereto. Some of the plurality of lipid molecules forms a lipid monolayer disposed in a hole in the holey carbon film. The operation in block 115 may be referred to as a direct transfer method or a Langmuir-Schaefer transfer method (Langmuir and Schaefer, 1938).
[0030] In some embodiments, instead of contacting the holey carbon film with hydrophobic tails of the plurality of lipid molecules to form a lipid monolayer in a hole of the holey carbon film, a loop transfer method is used to form the lipid monolayer. The loop transfer method is described in Asturias and Kornberg (1995), "A novel method for transfer of two-dimensional crystals from the air/water interface to specimen grids. EM sample preparation/lipid-layer crystallization," Journal of Structural Biology, 114(l):60-66, which is hereby incorporated by reference.
[0031] At block 120, a biotin-binding protein is attached to hydrophilic heads of the lipid monolayer. The biotin-binding protein used is typically able to form well-ordered crystals. In
some embodiments, the biotin-binding protein is selected from a group consisting of streptavidin, avidin, NeutrAvidin (i.e., a deglycosylated version of avidin), CaptAvidin (i.e., a biotin-binding protein derived from avidin, in which the tyrosine in the biotin-binding site has been nitrated), and tamavidins. In some embodiments, mutant versions of such biotin-binding proteins are used. In some embodiments, the mutations include truncation at the C-terminus, the N-terminus, or both, or mutations changing charged residues to non-charges residues.
[0032] The operation at block 120 allows for crystallization of the biotin-binding protein on the electron microscopy grid. On-grid crystallization of the biotin-binding protein addresses the issue described above in which the transfer of a biotin-binding protein crystal onto an electron microscopy grid is itself plagued by inconsistency because touching a lipid monolayer with a carbon film imparts mechanical force that tends to distort the attached crystals (Brisson et al., 1999). In some embodiments, the biotin-binding protein is added to a small droplet of buffer that remains adhered on the hydrophilic face of the electron microscopy grid. Other affinity-binding systems, such as the FITC-anti-FITC (FITC - fluorescein isothiocyanate) system (Harmer and Samuel, 1989) or the use of other capture molecules, such as antibodies may, also be used in place of the biotin-binding protein.
[0033] At block 125, a period of time is allowed to elapse. The period of time allows the biotin-binding protein to crystallize. The standard protocol known and used in the art for growing monolayer crystals typically involves an additional incubation step of 2 hours or more (See Wang and Sigworth, 2010). However, in the method 100, in some embodiments the period of time is less than about 10 minutes. In some embodiments, the period of time is about 1 minute to 20 minutes.
[0034] When the electron microscopy grid is not going to be used immediately in an electron microscopy experiment after the period of time has elapsed at block 125, in some embodiments, small molecules are deposited on the biotin-binding protein. In some embodiments, the small molecules are soluble in water. In some embodiments, the small molecules are hydrophilic. In some embodiments, the small molecules are operable to preserve lipid and protein structure when water is removed. In some embodiments, the water is removed by evaporation. In some embodiments, the small molecules are selected from a group consisting of trehalose, glucose, betaine, proline, and glycine. In some embodiments, the small molecules are deposited on the biotin-binding protein in the form of a solution. The solvent of the solution (e.g., water) is then
allowed to evaporate. In some embodiments, the small molecules form a layer on the biotin- binding protein that is about 50 nm to 150 nm thick, or about 100 nm thick. In some
embodiments, the small molecules form a layer on the biotin-binding protein that is thicker than about 100 nm.
[0035] In some embodiments, a layer of carbon is deposited on the hydrophobic tails of the lipid monolayer. In some embodiments, the layer of carbon is deposited with an evaporation process. The layer of carbon may increase the consistency with which a well-ordered single crystal of the biotin-binding protein is obtained, spanning an entire hole in the holely carbon film. For example, a single crystal of the biotin-binding protein may span an about 1 micron to 2 micron hole in the holey carbon film. In some embodiments, the layer of carbon is about 5 nm or less in thickness. In some embodiments, the layer of carbon is deposited on the hydrophobic tails of the lipid monolayer after block 125 or after small molecules are deposited on the biotin- binding protein.
[0036] In some embodiments, before beginning the method 100, the electron microscopy grid is pretreated. In some embodiments, a pretreatment of the electron microscopy grid comprises immersing the electron microscopy grid in a solvent, depositing carbon on the first surface of the grid, and allowing a period of about 3 or more days to elapse. In some
embodiments, immersing the electron microscopy grid in a solvent includes immersing the electron microscopy grid in chloroform and then immersing the electron microscopy grid in ethanol. In some embodiments, an evaporation method is used to deposit the carbon on the first surface of the grid.
[0037] While block 115 is described with reference to one hole in the holey carbon film, in some embodiments, a plurality of the holes in the holey carbon film undergo the operations described in blocks 115, 120 and 125.
[0038] Figure ID shows an example of a cross- sectional schematic illustration of an arrangement including an electron microscopy grid. The schematic illustration shown in Figure ID shows an area that is close to, and includes one edge of, a hole in the holey carbon film. The schematic illustration shown in Figure ID also shows an area that is close to, and includes one edge of, an opening in the mesh of the electron microscopy grid. The arrangement 300 shown in Figure ID includes a portion of an electron microscopy grid 330. The electron microscopy grid 330 includes a first surface and a second surface, with the first surface having a holey carbon
film 325 disposed thereon. A plurality of lipid molecules 315 that form a lipid monolayer are disposed in a hole in the holey carbon film 325. A biotin-binding protein 310 is attached to the hydrophilic heads of the plurality of lipid molecules 315. In some embodiments, the biotin- binding protein 310 is crystalline. In some embodiments, biotin-binding protein 310 comprises a single crystal of the biotin-binding protein 310 and spans a hole in the holey carbon film 325. In some embodiments, the biotin-binding protein 310 consists of a single crystal of the biotin- binding protein 310 and spans a hole in the holey carbon film 325. In some embodiments, the arrangement includes small molecules 305 disposed on the biotin-binding protein 310. In some embodiments, a layer of carbon 320 is disposed on the hydrophobic tails of the plurality of lipid molecules 315.
[0039] Each lipid molecule of the plurality of lipid molecules 315 has a hydrophilic head and a hydrophobic tail. While the location of the plurality of lipid molecules 315 relative to the surface of the holey carbon film 325 is not known in molecular detail, the hydrophobic lipid tails are expected to be in contact with the edge of the carbon, which is hydrophobic, defining a hole in the holey carbon film 325, as shown in Figure ID. In some embodiments, the plurality of lipid molecules comprises a homogenous mixture of lipid molecules with biotinylated head groups. In some embodiments, the plurality of lipid molecules comprises a heterogeneous mixture of lipid molecules, with at least a part of the heterogeneous mixture comprising lipid molecules with biotinylated head groups.
[0040] The biotin-binding protein used is typically able to form well-ordered crystals. In some embodiments, the biotin-binding protein 310 is selected from a group consisting of streptavidin, avidin, NeutrAvidin, CaptAvidin, and tamavidins. In some embodiments, mutant versions of such biotin-binding proteins are used. In some embodiments, the mutations include truncation at the C-terminus, the N-terminus, or both, or mutations changing charged residues to non-charges residues.
[0041] In some embodiments, the small molecules 305 disposed on the biotin-binding protein 310 are soluble in water. In some embodiments, the small molecules 305 are hydrophilic. In some embodiments, the small molecules 305 are operable to preserve lipid and the protein structure when water is removed. In some embodiments, the small molecules 305 are selected from a group consisting of trehalose, glucose, betaine, proline, and glycine.
[0042] Figure IE shows an example of a flow diagram illustrating a method of using an arrangement including an electron microscopy grid. At block 205 of the method 200, an arrangement including an electron microscopy grid is provided. In some embodiments, the arrangement is an arrangement 300 as described with respect to Figure ID. In the method 200 shown in Figure IE, the arrangement includes small molecules disposed on the biotin-binding protein.
[0043] At block 210, the small molecules are removed from the biotin-binding protein. The biotin-binding protein remains bonded to the hydrophilic heads of the plurality of lipid molecules that form the lipid monolayer. In some embodiments, the arrangement includes a layer of carbon disposed on the hydrophobic tails of the plurality of lipid molecules. The layer of carbon may serve to stabilize the biotin-binding protein during block 210. In some embodiments, block 210 is performed immediately prior to using the arrangement in an electron microscopy experiment. For example, blocks 210 and 215 may be performed and no more than about 30 minutes to 45 minutes may elapse before inserting the arrangement in an electron microscope.
[0044] In some embodiments, removal of the small molecules is performed by depositing a biotin-binding crystallization buffer on the small molecules followed by depositing a buffer on the arrangement, the buffer being specific to the macromolecule that is to be bound to the biotin- binding protein. In some embodiments, the depositing is performed by washing the arrangement with the buffers. The buffer specific to the macromolecule that is to be bound to the biotin- binding protein may aid in ensuring that the arrangement will not have any residual biotin- binding crystallization buffer disposed thereon and will be macromolecule-friendly; the biotin- binding crystallization buffer is generally biotin-binding protein-friendly but not macromolecule- friendly.
[0045] At block 215, a macromolecule is bound to the biotin-binding protein of arrangement. The macromolecule is a macromolecule that is to be examined in an electron microscope. The macromolecule is bound to the arrangement through affinity binding of the macromolecule to the biotin-binding protein. In some embodiments, a macromolecule is bound to the arrangement using techniques described in Han, Bong-Gyoon, et al. (2012). "Electron microscopy of biotinylated protein complexes bound to streptavidin monolayer crystals," Journal of Structural Biology 180: 249-253, which is hereby incorporated by reference. For example, macromolecules
of interest can be tagged with biotin or a streptavidin-binding peptide and then bound to the bio tin-binding protein with high affinity and specificity.
EXAMPLE
[0046] The following examples are intended to be examples of the embodiments disclosed herein, and are not intended to be limiting.
[0047] Lipids. The biotinylated lipid used here is l,2-dipalmitoyl-sn-glycero-3- phosphoethanolamine-N-(cap biotinyl), supplied as a 10 mg/mL solution in
chloroform/methanol/water. This was diluted to 1.0 mg/mL with a solution of
chloroform/methanol/water and aliquoted into small volumes intended for a single usage. The aliquots were sealed under nirogen gas and stored at -80°C. No deterioration as a function of time was observed in the ability of such aliquots to produce high-quality streptavidin monolayer crystals. Nevertheless, as a precaution, we prepare new aliquots after a period of about 6 months.
[0048] Streptavidin. Streptavidin (SA) as purchased was provided at a concentration of ~1 mg/mL, dissolved in 10 mM sodium phosphate pH 7.2 with 0.15 M NaCl. This was aliquoted in quantities intended for single use, frozen in liquid nitrogen, and stored at -80°C. Similar to what we do for the lipid, as a precaution, we prepare new aliquots of streptavidin after a period of about 6 months.
[0049] Protocol for growing monolayer crystals directly on holey-carbon EM grids. A lipid monolayer, cast on an air-water interface, is first picked up by touching the lipid from above with a hydrophobic, holey-carbon EM grid. This results in Langmuir-Schaefer transfer of patches of the monolayer that span the holes of the carbon film, as was discovered by (Kubalek et al., 1991). We presume that an additional, unwanted lipid monolayer is also transferred to the air- water surface of the small volume of buffer that adheres to the (now hydrophilic) face of the EM grid. Thus, to remove as much lipid as possible from the surface of the adhering drop, we touch the grid to three successive, 50
drops of subphase buffer sitting on parafilm. Next, SA is added to the small droplet of buffer that adheres to the face of the EM grid. The grid is then incubated long enough to allow binding and subsequent crystallization of SA. We refer to this technique as the "on-grid" crystallization method.
[0050] As shown in Figure 2A, we cast the above-mentioned lipid monolayer on a small trough holding ~5 mL of subphase buffer consisting of 50 mM HEPES (pH 7.5), 0.15 M KC1, and 10 % trehalose. Including trehalose in the subphase buffer serves only to eliminate the need
for a buffer-exchange "wash" before air-drying. This simplification became possible after we observed that adding 10% trehalose has no effect on the quality of monolayer crystals of streptavidin. Before applying lipid, however, we first "dust" the air-water interface lightly with unscented talcum powder, and then we apply a small droplet (-10 μί) of castor oil at the center. As the castor oil spreads, the advancing front of oil sweeps away contaminants at the air-water interface and compresses them to the perimeter of the trough. A Hamilton syringe is then used to deliver -0.5 μΐ^ of previously aliquoted lipid to the center of the trough. At this point the thin film of castor oil also serves as a "piston" to control the surface pressure of the lipid monolayer (Langmuir, 1917) . We believe that the castor-oil piston is a desirable but not necessary element of our protocol. Using a trough, rather than smaller, individual wells, facilitates use of the castor- oil piston, and allows one to prepare multiple grids from a single lipid monolayer.
[0051] We wash Quantifoil grids (Quantifoil Micro Tools GmbH, Germany) by first dipping them into chloroform and then into 95% ethanol. We also apply an additional -5 nm of evaporated carbon to the top side of Quantifoil grids and then allow these to "age" for at least three days to make the freshly evaporated carbon more hydrophobic. Just before use, we again wash these grids by dipping them into 95% ethanol. We have less experience with C-flat grids (Electron Microscopy Sciences, Hatfield, Pennsylvania), but we have successfully used them as received, i.e. without depositing additional carbon. We prefer to use gold or molybdenum grids to copper grids.
[0052] In our current crystallization protocol, we dilute an aliquot of SA to a concentration of 0.2 mg/mL with subphase buffer, and we use 4 μL· of diluted SA for each grid (shown in Figure 2B). After applying SA to the EM grid, the crystals are grown within a humidity chamber. Care is taken to minimize evaporation by placing crushed ice on the tweezers, with the intent to cool the grid slightly below the ambient dew point. Whereas an incubation time of 1-2 minutes appears to be too short to ensure full crystal formation in which streptavidin tetramers bind to the biotinylated lipid and form monolayer crystals, we observed crystallization to be completed within 10 minutes.
[0053] Following an incubation time that, for convenience, is often about half an hour when doing many grids at a time, most of the unbound SA is washed away by placing the grid on top of a 200 μΐ^ drop of wash buffer. The composition of the wash buffer is 10% trehalose in 10 mM HEPES (pH 7.5), as before, but with the KC1 concentration now reduced to 50 mM. After
waiting several seconds, the floating grid is caught with a tweezers and lifted vertically until it separates from the wash drop. We believe that this step in the protocol may be the one in which the monolayer crystals of S A are at greatest risk of becoming fragmented or even lost completely. Even when crystals have been severely damaged (at this stage, as we believe), most, if not all, holes in the holey carbon film still remain covered by a monolayer of SA bound to biotinylated lipid.
[0054] Streptavidin crystals are then embedded in trehalose and backed with evaporated carbon. After washing the grids to remove unbound SA, excess trehalose solution is gently "wicked off by touching the edge of the grid to a piece of filter paper. The grid then is left on a filter paper with the wet side facing the air, and any remaining liquid on the grid is allowed to dry.
[0055] After the trehalose solution has dried, a thin layer (~5 nm or less) of evaporated carbon is deposited on the back side (lipid-tail side) of the EM grid. Grids are placed -20 cm below a carbon-arc source, and evaporation is done at a vacuum of 10~5 torr or lower. We use carbon rods with a tip width of 1 mm, which require less power to evaporate, in order to minimize heating of the trehalose-embedded SA "target". To further minimize the risk of radiant heating, the carbon rod is heated very rapidly, resulting in breakage of the thin tip and a concomitant flash of evaporated carbon.
[0056] We believe that the integrity of the SA monolayer crystals may be especially at risk at any stage before a carbon backing is deposited onto the lipid tails. The reason for our concern is that pressure fluctuations must occur every time a grid is either touched to, or is separated from, a drop of buffer, due to the high surface tension. Our hypothesis is that these transient changes in pressure can cause the thin, membrane-like monolayers to bulge above or below the plane of the holes in the holey carbon film. Although the lipid monolayer is fluid and extensible, the SA crystals are not. Thus, if pressure-induced bulging causes the area of the lipid monolayer to increase by only a few per cent, the SA crystals are likely to crack and not anneal properly as the bulging relaxes.
[0057] We take care to minimize the mechanical stresses that we believe to be associated both with fusion between, and rupture of, the air-water interfaces as the grid is moved from one drop to the next. We believe that, prior to backing the SA crystals with evaporated carbon, this
step in the protocol may be the one in which the monolayer crystals of SA are at greatest risk of becoming fragmented or even lost completely.
[0058] We store the carbon-backed, trehalose embedded SA crystals at room temperature in a sealed container. We prefer to store grids over silica gel that is pink (but not white) to maintain a relatively constant value of humidity.
[0059] Just before use, the grid is rehydrated by touching to two successive, 50 μΐ^ drops of a solution of 10 mM HEPES (pH 7.5) with 150 mM KC1 without trehalose and then left on a 100 μL· drop of the same solution for 10 minutes. This same process is repeated a second time, with the intent being to rinse away all remaining trehalose. After that, the grid is further washed with whatever buffer is optimal for the macromolecular sample under investigation.
[0060] Preparation of grids and electron microscopy of 70S ribosomal particles. Ribosomes were purified from E. coli strain MRE600 using sucrose gradient centrifugation, as previously described (Blaha et al., 2000). Ribosome complexes were formed by incubating 1.5 μΜ deacylated tRNAphe and 3 μΜ mRNA of sequence 5'-
GGCAAGGAGGUAAAAUUCUAC AAA-3 ' with 0.5 μΜ ribosomes at 37 °C for 15 minutes in the buffer A: 20 mM HEPES, pH 7.5/ 70 mM KC1/ 6 mM MgOAc/ 1 mM TCEP. The antibiotic spectinomycin at a concentration of 20 μΜ was added to the pre-formed complex and incubated an additional 10 minutes at 37°C.
[0061] Ribosomes were biotinylated by adding 5-fold excess of biotin-labeling reagent and incubated 20 minutes at room temperature. Excess unreacted biotin was removed by using 1 mL S300 Sephacryl (GE Healthcare, Little Chalfont, Buckinghamshire, United Kingdom) gel- filtration spin column. The column was equilibrated with Buffer A, and usually 50
of ribosome complex was loaded on the column and spun on a table centrifuge at 3200 rpm for 1 minute.
[0062] Grids were first washed 3 times with 50
drops of cold ribosome buffer, and then a 4 μL· aliquot of ribosomes was applied at a concentration in the range of 20-40 nM. After incubating for 20 minutes, chilled and in a humidity box to minimize evaporation, as described above for growth of monolayer crystals, unbound ribosomes were washed away by touching to three successive, 50 μΐ^ drops of buffer.
[0063] To prepare negatively stained specimens, we added 4 μL· of 2% uranyl acetate to the lens of buffer adhering to the rinsed grid, which then was mixed by repeated, gentle pipetting
while on the grid. This was followed by two cycles in which 3 μΐ^ was removed from the grid and 4 μL· of 2% uranyl acetate was again added. After the second cycle, the excess uranyl acetate solution that remained was removed by blotting with filter paper. Images were recorded with a Gatan CCD camera (Gatan, Inc., Pleasanton, CA) on a JEOL 1200 electron microscope (JEOL USA, Inc., Peabody, MA).
[0064] To prepare cryo-EM samples, the grid is transferred to the Vitrobot (FEI, Hillsboro, Oregon) tweezers after washing away unbound ribosomes with ribosome buffer. The tweezers and grid were then loaded into the Vitrobot Mark IV chamber (FEI, Hillsboro, Oregon), which was previously equilibrated at a temperature of 15°C and a relative humidity setting of 100%. In order to standardize the volume of liquid on the grid before blotting, excess liquid was first wicked off by touching the bottom edge of the grid with filter paper, which was brought in through a side port of the Vitrobot chamber. Following this, 1.2 μL· of sample buffer was then added to the wet face of the grid. The blotting time used was 5 s, with a force setting of 8, a blotting time of 3 seconds, and zero wait/drain time.
[0065] For routine evaluation of cryo-grids, images were recorded with a Gatan CCD camera (Gatan, Inc., Pleasanton, CA) on a Philips CM 200 (FEI, Hillsboro, Oregon). High-resolution images were obtained with a Gatan K2 camera (Gatan, Inc., Pleasanton, CA) on an FEI low-base Titan (FEI, Hillsboro, Oregon), using a Gatan cryo-holder (Gatan, Inc., Pleasanton, CA). In this latter case, images were recorded as dose-fractionated movies consisting of twenty 300 ms frames, each with an exposure of 1.2 electrons/A ° 2 at the specimen. The pixel size in these images was 1.3 A, referred to the specimen. The movie frames were aligned and summed with the motion-correction software developed by (Li et al., 2013).
[0066] Data processing. The "2dx" software package (Gipson et al., 2007) was used to unbend the SA lattice in a few of the images. This was done to sharpen the Bragg spots in the Fourier transforms, thereby increasing the resolution at which spots could be detected with a good signal-to-noise ratio.
[0067] In all other cases, Fourier filtration of Bragg peaks was used to remove the image of the SA crystal, without unbending, before particles were boxed for further analysis. To do this, a script was written in MATLAB (The Math Works, Inc., Natick, Massachusetts) to identify all pixels where the magnitude of the Fourier transform of an image was higher than a user-defined value. The Fourier-transform magnitudes in such pixels, plus those in several adjacent pixels,
were replaced by the average value of the surrounding background, and the phases were replaced by random values. The threshold value was adjusted manually, while looking at a display of the Fourier transform of an image, until all visible diffraction spots were removed.
[0068] Candidate ribosome particles were automatically boxed with a software tool provided in RELION (Scheres, 2012). Images, with candidate particles outlined, were edited manually, using the BOXER tool provided in EMAN (Tang et al., 2007) to remove initial candidates that were obviously aggregates or other undesired material. Three-dimensional classification of particles and subsequent refinement again used tools provided in RELION.
[0069] Characterization of the carbon-backed SA monolayer crystals. Obtaining monolayer crystals by the on-grid technique is quite reliable and reproducible. On the basis of our current work using LEGINON for automated data collection (Suloway et al., 2005), we estimate the success rate to be well over 90 percent for getting images in which single SA crystals cover the full field of view. The estimated ice thickness was the only criterion used when selecting areas to be added to the data-collection queue, and no attempt was made to decide, in advance, whether the holes contained SA crystals. Nevertheless, until the monolayers have been backed with evaporated carbon, our experience indicates that their crystallinity may still be at considerable risk.
[0070] The fact that these SA crystals remain well ordered after carbon coating, removal of trehalose, and application of a sample has been established by recording high-resolution images. One such image is shown in Figure 3A, and the FFT of this raw, unprocessed image is shown in Figure 3B. In addition to showing clear Thon rings from the evaporated carbon, the FFT also shows many Bragg peaks from the streptavidin monolayer crystal. The Fourier transform of the unbent image is shown in Figure 3C. The Bragg spots in the FFT of the unbent image are represented by squares of various sizes, the largest corresponding to an IQ (Henderson et al., 1986) of 1 (estimated phase error of -4 degrees) and the smallest corresponding to an IQ of 7 (estimated phase error of -45 degrees). As in this example, Bragg spots with an IQ of 3
(estimated phase error of -14 degrees) commonly extend to a resolution of 4 A.
[0071] Finally, these grids are easy to prepare and use. The incubation time required to grow streptavidin-monolayer crystals by the on-grid technique is much shorter than the -2 hours or more that has been recommended for crystallization by the micro-well technique (Wang and Sigworth, 2010). While we often use the SA support films within a week after first making them,
we have confirmed that the SA lattice shows no signs of deterioration when stored for a month. We thus expect that the room-temperature shelf life will prove to be much longer than that.
[0072] Use of randomly biotinylated 70S ribosome particles as a test specimen. Figure 4B shows that a high density of ribosome particles is obtained for the conditions of sample concentration and subsequent grid-washing as described above under Streptavidin crystals are then embedded in trehalose and backed with evaporated carbon. In a corresponding control experiment, using ribosomes that had not been biotinylated, few ribosomes remain on the support film, as is shown in Figure 4A. We thus conclude that the biotin-binding functionality of streptavidin is retained throughout the process of trehalose embedding, carbon evaporation, and storage.
[0073] A set of 1497 movies were recorded in order to test the use of SA support films for single-particle data collection. After removing the SA background from these images, candidate ribosome particles were boxed automatically. This raw set was edited manually to produce a working data set of 101,213 particles. 3-D classification was then used to obtain structurally more homogeneous subsets of the working set.
[0074] Refinement of the largest such subset, consisting of 52,433 particles, produced the density map. The overall resolution of this map is estimated to be 4.0 A, based on the point at which the "gold standard" FSC curve, falls to a value of 0.143. Focused refinement, based on the 50 S subunit, improved this only slightly, to just under 3.9 A.
[0075] Streptavidin affinity-grids can be used to obtain high-resolution structures. The resolution of the 3-D density map that we obtained for E. coli 70 S ribosomes, using SA monolayer crystals as a support film, is in line with that of maps obtained previously by others, using continuous carbon as a support film. A map at a somewhat lower resolution of -5.1 A was obtained by (Bai et al., 2013) for T. thermophilus 70 S ribosomes, but from a much smaller data set consisting of 15,202 particles. On the other hand, significantly higher-resolution maps have been obtained, this time for E. coli 70 S ribosomes, when using much larger data sets. A 3.0 A map was obtained from 164,353 particles by (Brown et al., 2016), and an even higher-resolution structure was obtained by (Fischer et al., 2015) from 417,201 particles.
[0076] It is natural to be concerned that the periodic motif of the SA crystal might interfere with alignment and assignment of Euler angles for boxed particles. In principle, this should not be a problem because this background is easily removed by Fourier filtration when it is no longer
of value to have it there (Han et al., 2012; Wang et al., 2008). Our success in obtaining a high- resolution density map of the 70 S ribosome particle confirms that removal of the periodic SA motif by Fourier filtering was as effective as it was expected to be.
[0077] Another concern is that nearly irreversible affinity binding could, in principle, trap the structure of a large complex in one or more off -pathway states. This could happen if some biotin residues are normally inaccessible for binding, for example those that are coupled to lysine residues within deep indentations of the surface. Transient fluctuations of the structure might nevertheless bring such biotin residues sufficiently far out that they would have access to a streptavidin binding site. We can again say that our success in obtaining a high-resolution density map rules out the hypothesis that the trapping of non-native structural variants contributes significantly to the structural heterogeneity of the data set.
[0078] Random biotinylation can result in particles adopting many orientations. One of the major concerns about using affinity grids is that particles might be bound in a preferred orientation with respect to the support film. Chemical biotinylation of one or a few lysine residues per particle, used here, addresses this concern by placing affinity ligands as uniformly as possible over the surface of the particle.
[0079] Although the distribution of particle orientations in our case is clearly not uniform, there is sufficient coverage to adequately sample the 3-D Fourier transform of the ribosome particle. Fortunately, not all particle orientations need to be presented for the resulting 3-D structure factors to still be sampled completely. In fact, a complete sampling of Fourier space already occurs for rotation of an object about a single axis. In that case, the location of all projection directions is restricted to a great circle on the unit sphere. The Euler-angle distribution is actually far more complete than that.
[0080] As was indicated in Use of randomly biotinylated 70S ribosome particles as a test specimen, the distribution of surface locations where there are potential biotinylation sites agrees only partially, but not completely, with the pattern of densely populated Euler angles. The reasons for there being discrepancies can be complex, and the explanations, once determined, may not be generalizable. Variations in reactivity with the biotinylation reagent (which could be determined by mass spectroscopy of peptide fragments) could, for example, be one factor.
Flexibility of protein subunits that are biotinylated is very likely to be another factor. In the latter case, flexible tethering of particles to the SA lattice might allow them to search locally for
nonspecific, but preferred binding interactions that would, otherwise, be too weak to produce significant binding.
[0081] In addition, large portions of the Euler angle plot have only one or two particles that were assigned to each point. We are investigating whether an almost uniform background distribution, in which there are only one or two particles at a given angle, may reflect errors that are occasionally made in the process of projection matching, rather than binding that was not mediated by biotinylation - i.e. non-specific binding.
[0082] Significant benefits are expected from using streptavidin affinity -grids. Affinity support films in general provide a number of features that are expected to be helpful for preparing cryo-EM grids. These include the fact that particles are bound at a single plane (single Z-height, for untilted specimens), which is important for CTF correction at high resolution. In addition, tethered particles are prevented from interacting with the air-water interface, provided that the aqueous sample is not too thin.
[0083] Affinity binding is, in general, expected to leave structures in a close-to-native state. Streptavidin affinity grids have the special feature that binding of the biotin ligand is essentially as strong as a covalent bond.
[0084] In addition, the background image of the SA lattice might serve as a fiducial to aid alignment of movie frames, and even sub-regions of frames. The background image of the SA lattice might also serve to track changes in tilt orientation that occur during the course of recording dose-fractionated images.
[0085] Value is added by the long shelf-life feature of these affinity grids. The step of preserving SA monolayer crystals over open holes required some optimization of the trehalose concentration, in combination with the blotting technique (i.e. wicking from the edge of the grid), used to leave a residual volume of solution to dry. The requirement for optimization is not too surprising in light of the fact that millimeter-scale droplets of aqueous trehalose can leave complex patterns of convection (e.g., colloidal-particle deposition), thickness, and stress (e.g., cracking) after drying by evaporation (Grant and Grigorieff, 2015). Spin-coating may be especially well-suited as a way to spread a thin film of trehalose (Abazari et al., 2014).
[0086] Trehalose is known to have superior properties for room-temperature preservation of freeze-dried phospholipid vesicles and proteins (Zhou, 2008). It has also been used extensively to preserve the high-resolution structure of thin protein crystals adsorbed to a carbon support
film, a few examples of which are (Hebert et al., 1997; Leong et al., 2010; Tang et al., 2007). We note that other hydrophilic solutes might also work as well as does trehalose - see, for example, section 6.4 of (Glaeser et al., 2007).
CONCLUSION
[0087] Further details regarding the embodiments described herein can be found in the publication Bong-Gyoon Han, et al. "Long shelf-life streptavidin support-films suitable for electron microscopy of biological macromolecules," posted May 20, 2016 on biorxiv, which is herein incorporated by reference.
[0088] In the foregoing specification, the invention has been described with reference to specific embodiments. However, one of ordinary skill in the art appreciates that various modifications and changes can be made without departing from the scope of the invention as set forth in the claims below. Accordingly, the specification and figures are to be regarded in an illustrative rather than a restrictive sense, and all such modifications are intended to be included within the scope of invention.
REFERENCES
Abazari, A., N. Chakraborty, S. Hand, A. Aksan, M. Toner, 2014. A Raman Microspectroscopy Study of Water and Trehalose in Spin-Dried Cells. Biophysical Journal 107, 2253-2262.
Bai, X.-c, I.S. Fernandez, G. McMullan, S.H. Scheres, 2013. Ribosome structures to near- atomic resolution from thirty thousand cryo-EM particles. eLife Sciences 2.
Blaha, G., U. Stelzl, C.M.T. Spahn, R.K. Agrawal, J. Frank, K.H. Nierhaus, 2000. Preparation of functional ribosomal complexes and effect of buffer conditions on tRNA positions observed by cryoelectron microscopy. Rna-Ligand Interactions Pt A 317, 292-309.
Brown, A., I.S. Fernandez, Y. Gordiyenko, V. Ramakrishnan, 2016. Ribosome-dependent activation of stringent control. Nature advance online publication.
Crucifix, C, M. Uhring, P. Schultz, 2004. Immobilization of biotinylated DNA on 2-D streptavidin crystals. Journal of Structural Biology 146, 441-451.
Darst, S.A., M. Ahlers, P.H. Meller, E.W. Kubalek, R. Blankenburg, H.O. Ribi, H. Ringsdorf, R.D. Kornberg, 1991. 2-Dimensional Crystals of Streptavidin on Biotinylated Lipid Layers and Their Interactions with Biotinylated Macromolecules. Biophysical Journal 59, 387-396.
Fischer, N., P. Neumann, A.L. Konevega, L.V. Bock, R. Ficner, M.V. Rodnina, H. Stark, 2015. Structure of the E. coli ribosome-EF-Tu complex at <3 A resolution by Cs-corrected cryo-EM. Nature 520, 567-570.
Gipson, B., X. Zeng, Z.Y. Zhang, H. Stahlberg, 2007. 2dx - User-friendly image processing for 2D crystals. Journal of Structural Biology 157, 64-72.
Glaeser, R.M., K. Downing, D. DeRosier, W. Chiu, J. Frank, 2007. Electron crystallography of biological macromolecules. Oxford University Press.
Grant, T., N. Grigorieff, 2015. Measuring the optimal exposure for single particle cryo-EM using a 2.6 A reconstruction of rotavirus VP6. Elife 4, e06980.
Han, B.G., R.W. Walton, A. Song, P. Hwu, M.T. Stubbs, S.M. Yannone, P. Arbelaez, M. Dong, R.M. Glaeser, 2012. Electron microscopy of biotinylated protein complexes bound to streptavidin monolayer crystals. Journal of Structural Biology 180, 249-253.
Hebert, H., I. SchmidtKrey, R. Morgenstern, K. Murata, T. Hirai, K. Mitsuoka, Y. Fujiyoshi, 1997. The 3.0 angstrom projection structure of microsomal glutathione transferase as determined by electron crystallography of p2(l)2(l)2 two-dimensional crystals. Journal of Molecular Biology 271, 751-758.
Henderson, R., J.M. Baldwin, K.H. Downing, J. Lepault, F. Zemlin, 1986. Structure of Purple Membrane from Halobacterium-Halobium - Recording, Measurement and Evaluation of Electron-Micrographs at 3.5 a Resolution. Ultramicroscopy 19, 147-178.
Kubalek, E.W., R.D. Kornberg, S.A. Darst, 1991. Improved Transfer of 2-Dimensional Crystals from the Air- Water- Interface to Specimen Support Grids for High-Resolution Analysis by Electron-Microscopy. Ultramicroscopy 35, 295-304.
Langmuir, I., 1917. The constitution and fundamental properties of solids and liquids. II.
Liquids. Journal of the American Chemical Society 39, 1848-1906.
Leong, P.A., X.K. Yu, Z.H. Zhou, G.J. Jensen, 2010. Correcting for the Ewald sphere in high- resoluiton single-particle reconstructions, p. 369-380, in: Jensen, G J, (Ed.), Methods in
Enzymology, Vol 482: Cryo-Em, Part B: 3-D Reconstruction, Vol. 482, pp. 369-380.
Li, X.M., P. Mooney, S. Zheng, C.R. Booth, M.B. Braunfeld, S. Gubbens, D.A. Agard, Y.F. Cheng, 2013. Electron counting and beam- induced motion correction enable near-atomic- resolution single-particle cryo-EM. Nature Methods 10, 584-+.
Scheres, S.H.W., 2012. RELION: Implementation of a Bayesian approach to cryo-EM structure determination. Journal of Structural Biology 180, 519-530.
Suloway, C, J. Pulokas, D. Fellmann, A. Cheng, F. Guerra, J. Quispe, S. Stagg, C.S. Potter, B. Carragher, 2005. Automated molecular microscopy: The new Leginon system. Journal of Structural Biology 151, 41-60.
Tang, G., L. Peng, P.R. Baldwin, D.S. Mann, W. Jiang, I. Rees, S.J. Ludtke, 2007. EMAN2: An extensible image processing suite for electron microscopy. Journal of Structural Biology 157, 38- 46.
Taylor, K.A., R.M. Glaeser, 2008. Retrospective on the early development of cryoelectron microscopy of macromolecules and a prospective on opportunities for the future. Journal of Structural Biology 163, 214-223.
Wang, L.G., F.J. Sigworth, 2009. Structure of the BK potassium channel in a lipid membrane from electron cryomicroscopy. Nature 461, 292-295.
Wang, L.G., F.J. Sigworth, 2010. Liposomes on a streptavidin crystal: a system to study membrane proteins by cryo-EM p. 147-164, in: Jensen, G J, (Ed.), Methods in Enzymology, Vol 481: Cryo-Em, Part a - Sample Preparation and Data Collection, Vol. 481, pp. 147-164.
Wang, L.G., P. Ounjai, F.J. Sigworth, 2008. Streptavidin crystals as nanostructured supports and image-calibration references for cryo-EM data collection. Journal of Structural Biology 164, 190-198.
Zhou, Z.H., 2008. Towards atomic resolution structural determination by single-particle cryoelectron microscopy. Current Opinion in Structural Biology 18, 218-228.
Claims
1. An arrangement comprising:
an electron microscopy grid, the electron microscopy grid comprising a first surface and a second surface, the first surface having a holey carbon film disposed thereon;
a plurality of lipid molecules disposed in a hole in the holey carbon film, each lipid molecule of the plurality of lipid molecules having a hydrophilic head and a hydrophobic tail; and
a biotin-binding protein attached to the hydrophilic heads of the plurality of lipid molecules, the biotin-binding protein being crystalline.
2. The arrangement of claim 1, further comprising:
small molecules disposed on the biotin-binding protein.
3. The arrangement of claim 2, wherein the small molecules form a layer, and wherein the layer is about 50 nanometers to 150 nanometers thick.
4. The arrangement of claim 1, further comprising:
a layer of carbon disposed on the hydrophobic tails of the plurality of lipid molecules.
5. The arrangement of claim 4, wherein the layer of carbon has a thickness of 5 nanometers or less.
6. The arrangement of claim 1, wherein the plurality of lipid molecules comprises a homogenous mixture of lipid molecules with biotinylated head groups.
7. The arrangement of claim 1, wherein the plurality of lipid molecules comprises a
heterogeneous mixture of lipid molecules, and wherein at least a part of the heterogeneous mixture comprises lipid molecules with biotinylated head groups.
8. The arrangement of claim 1, wherein the biotin-binding protein comprises streptavidin.
9. The arrangement of claim 1, wherein the small molecules are selected from a group consisting of trehalose, glucose, betaine, proline, and glycine.
10. The arrangement of claim 1, wherein the holey carbon film is about 10 nanometers to 25 nanometers thick, and wherein the hole in the holey carbon film has a diameter of about 1 nanometer to 2 nanometers.
11. A method comprising:
(a) providing an electron microscopy grid, the electron microscopy grid comprising a first surface and a second surface, the first surface having a holey carbon film disposed thereon;
(b) providing a plurality of lipid molecules, each lipid molecule of the plurality of lipid molecules having a hydrophilic head and a hydrophobic tail;
(c) contacting the holey carbon film with hydrophobic tails of the plurality of lipid molecules to form a lipid monolayer disposed in a hole in the holey carbon film, the lipid monolayer comprising a portion of the plurality of lipid molecules;
(d) attaching a biotin-binding protein to hydrophilic heads of the lipid monolayer; and
(e) allowing a period of time to elapse to allow the biotin-binding protein to crystalize.
12. The method of claim 11, further comprising:
depositing small molecules on the biotin-binding protein after operation (e).
13. The method of claim 11, further comprising:
depositing a layer of carbon on the hydrophobic tails of the lipid monolayer.
14. The method of claim 11, further comprising:
removing biotin-binding protein that is not attached to the hydrophilic heads of the lipid monolayer after operation (d).
15. The method of claim 11, wherein the period of time in operation (e) is about 1 minute to 20
minutes.
16. The method of claim 11, wherein the plurality of lipid molecules comprises a homogenous mixture of lipid molecules with biotinylated head groups.
17. The method of claim 11, wherein the plurality of lipid molecules comprises a heterogeneous mixture of lipid molecules, and wherein at least part of the heterogeneous mixture comprises lipid molecules with biotinylated head groups.
18. The method of claim 11, wherein the biotin-binding protein comprises streptavidin.
19. The method of claim 11, wherein the small molecules are selected a group consisting of trehalose, glucose, betaine, proline, and glycine.
20. The method of claim 11, wherein the holey carbon film is about 10 nanometers to 25 nanometers thick, and wherein the hole in the holey carbon film has a diameter of about 1 nanometer to 2 nanometers.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US15/844,854 US10559449B2 (en) | 2015-06-25 | 2017-12-18 | Stable support films for electron microscopy |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201562184532P | 2015-06-25 | 2015-06-25 | |
| US62/184,532 | 2015-06-25 |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US15/844,854 Continuation US10559449B2 (en) | 2015-06-25 | 2017-12-18 | Stable support films for electron microscopy |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2016209907A1 true WO2016209907A1 (en) | 2016-12-29 |
Family
ID=57586192
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2016/038683 Ceased WO2016209907A1 (en) | 2015-06-25 | 2016-06-22 | Stable support films for electron microscopy |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US10559449B2 (en) |
| WO (1) | WO2016209907A1 (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107014652A (en) * | 2017-04-14 | 2017-08-04 | 广西大学 | A kind of annular contained network for transmission electron microscope is with cross-sectional sample to viscous device |
| WO2019156964A1 (en) * | 2018-02-06 | 2019-08-15 | Protochips, Inc. | Sample support structure for cryo-electron microscopy |
| WO2021237116A1 (en) * | 2020-05-22 | 2021-11-25 | The Regents Of The University Of California | Methods for analyzing intermolecular interactions in microcrystals |
| CN113891854A (en) * | 2019-03-26 | 2022-01-04 | 英国研究与创新基金会 | Graphene functionalization method, apparatus and functionalized graphene product |
| CN116626305A (en) * | 2022-04-28 | 2023-08-22 | 中国科学院深圳先进技术研究院 | Method for elucidating protein structure using cryo-electron microscopy |
| US12259343B2 (en) | 2019-09-20 | 2025-03-25 | The Regents Of The University Of California | Systems and methods for structurally characterizing compounds |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020208433A1 (en) * | 2019-04-09 | 2020-10-15 | King Abdullah University Of Science And Technology | A transferrable sample platform containing an exfoliated graphene membrane for the analysis and processing of nanomaterials |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009154688A1 (en) * | 2008-05-28 | 2009-12-23 | President And Fellows Of Harvard College | A pre-fabricated electron microscopy grid for monolayer purification and methods and kits therefor |
| US20100202672A1 (en) * | 2002-10-08 | 2010-08-12 | John Charles Sinclair | Protein Layers And Their Use In Electron Microscopy |
| US8581205B2 (en) * | 2011-04-14 | 2013-11-12 | Tsinghua University | Transmission electron microscope micro-grid |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB8604983D0 (en) | 1986-02-28 | 1986-04-09 | Biocompatibles Ltd | Protein preservation |
| CA2829833C (en) * | 2011-03-15 | 2019-04-09 | President And Fellows Of Harvard College | Controlled fabrication of nanopores in nanometric solid state materials |
| US20130164379A1 (en) * | 2011-11-03 | 2013-06-27 | Andrei L. Gartel | Nanoparticle micelle coated compositions |
-
2016
- 2016-06-22 WO PCT/US2016/038683 patent/WO2016209907A1/en not_active Ceased
-
2017
- 2017-12-18 US US15/844,854 patent/US10559449B2/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100202672A1 (en) * | 2002-10-08 | 2010-08-12 | John Charles Sinclair | Protein Layers And Their Use In Electron Microscopy |
| WO2009154688A1 (en) * | 2008-05-28 | 2009-12-23 | President And Fellows Of Harvard College | A pre-fabricated electron microscopy grid for monolayer purification and methods and kits therefor |
| US8581205B2 (en) * | 2011-04-14 | 2013-11-12 | Tsinghua University | Transmission electron microscope micro-grid |
Non-Patent Citations (6)
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107014652A (en) * | 2017-04-14 | 2017-08-04 | 广西大学 | A kind of annular contained network for transmission electron microscope is with cross-sectional sample to viscous device |
| CN107014652B (en) * | 2017-04-14 | 2023-03-24 | 广西大学 | Device for oppositely adhering annular grid and cross-section sample for transmission electron microscope |
| WO2019156964A1 (en) * | 2018-02-06 | 2019-08-15 | Protochips, Inc. | Sample support structure for cryo-electron microscopy |
| CN113891854A (en) * | 2019-03-26 | 2022-01-04 | 英国研究与创新基金会 | Graphene functionalization method, apparatus and functionalized graphene product |
| CN113891854B (en) * | 2019-03-26 | 2024-06-07 | 英国研究与创新基金会 | Graphene functionalization methods, apparatus, and functionalized graphene products |
| US12259343B2 (en) | 2019-09-20 | 2025-03-25 | The Regents Of The University Of California | Systems and methods for structurally characterizing compounds |
| WO2021237116A1 (en) * | 2020-05-22 | 2021-11-25 | The Regents Of The University Of California | Methods for analyzing intermolecular interactions in microcrystals |
| US12535437B2 (en) | 2020-05-22 | 2026-01-27 | The Regents Of The University Of California | Methods for analyzing intermolecular interactions in microcrystals |
| CN116626305A (en) * | 2022-04-28 | 2023-08-22 | 中国科学院深圳先进技术研究院 | Method for elucidating protein structure using cryo-electron microscopy |
Also Published As
| Publication number | Publication date |
|---|---|
| US20180108510A1 (en) | 2018-04-19 |
| US10559449B2 (en) | 2020-02-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10559449B2 (en) | Stable support films for electron microscopy | |
| Han et al. | Long shelf-life streptavidin support-films suitable for electron microscopy of biological macromolecules | |
| JP5253148B2 (en) | Delivery of molecules to the lipid bilayer | |
| US7151167B2 (en) | Open channel solid phase extraction systems and methods | |
| Booth et al. | Visualizing proteins and macromolecular complexes by negative stain EM: from grid preparation to image acquisition | |
| US7122640B2 (en) | Open channel solid phase extraction systems and methods | |
| US12360021B2 (en) | Graphene oxide affinity sample grids for Cyro-EM | |
| Harris | Negative staining of thinly spread biological samples | |
| US8362219B2 (en) | Open channel solid phase extraction systems and methods | |
| Lahiri et al. | 3.1 Å structure of yeast RNA polymerase II elongation complex stalled at a cyclobutane pyrimidine dimer lesion solved using streptavidin affinity grids | |
| US7667010B2 (en) | Open channel solid phase extraction systems and methods | |
| US20040241721A1 (en) | Open channel solid phase extraction systems and methods | |
| WO2023025318A1 (en) | Methods and formulations for expansion proteomic analysis of biological samples | |
| JP2011513762A (en) | Sensitive detection and quantification of biomolecules using secondary ion mass spectrometry (SIMS) and related techniques | |
| Cookis et al. | Streptavidin-affinity grid fabrication for cryo-electron microscopy sample preparation | |
| JP5138937B2 (en) | Analysis of chemically crosslinked cell samples | |
| JP3656159B2 (en) | Screening method of protein having intermolecular interaction with ligand | |
| Liu et al. | Graphene in cryo-EM specimen optimization | |
| Belnap | Electron microscopy and image processing: essential tools for structural analysis of macromolecules | |
| De Carlo et al. | Cryonegative staining of macromolecular assemblies | |
| Truong et al. | Sample preparation using a lipid monolayer method for electron crystallographic studies | |
| Zhao et al. | A simple pressure-assisted method for cryo-EM specimen preparation | |
| US7850915B2 (en) | Apparatus for detecting and recognizing analytes based on their crystallization patterns | |
| Skrajna et al. | Nickel-NTA lipid-monolayer affinity grids allow for high-resolution structure determination by cryo-EM | |
| US20060160077A1 (en) | Method for analyzing the spatial distribution of a chemical substance retained by a biological matter |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 16815184 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 16815184 Country of ref document: EP Kind code of ref document: A1 |