WO2016207730A1

WO2016207730A1 - Targeting of vaccine antigen to an intracellular compartment

Info

Publication number: WO2016207730A1
Application number: PCT/IB2016/001017
Authority: WO
Inventors: Aram Nikolai ANDERSEN; Bjarne Bogen; Inger OYNEBRATEN
Original assignee: The University Of Oslo
Priority date: 2015-06-22
Filing date: 2016-06-22
Publication date: 2016-12-29

Abstract

The present invention relates to compositions and methods for targeting proteins to intracellular compartments. In particular, the present invention provides vaccine compositions comprising fusion proteins that target the vaccines to the autophagy pathway.

Description

TARGETING OF VACCINE ANTIGEN TO AN INTRACELLULAR

COMPARTMENT

FIELD OF THE INVENTION

The present invention relates to compositions and methods for targeting proteins to intracellular compartments. In particular, the present invention provides vaccine

compositions comprising fusion proteins that target the vaccines to the autophagy pathway.

BACKGROUND OF THE INVENTION CD8⁺ T cells have the potential to eradicate infectious diseases and cancer. Also following HIV-1 infection, CD8⁺ T cells are important to keep the viral load low and to delay the onset of AIDS. Such "protective" CD8 T cell responses in HIV-1 are reactive towards epitopes of Gag, Pol, Nef, and Vif Recently, these epitopes were identified to be subdominant whereas other epitopes appear to be dominant and elicit irrelevant responses that even undermine effective targeting of the more vulnerable regions. However, vaccines consisting of full-length HIV-1 protein rarely elicit responses to subdominant, vulnerable epitopes. Thus, in order to improve vaccine responses, one suggestion has been to carefully design immunogens.

The pathways for antigen processing and loading onto MHC class I, is still not fully identified and development of technologies that can improve CD8⁺ T cell responses is a major goal in vaccine design and immunotherapy. The conventional pathway for antigen processing and peptide presentation on MHC class I molecules, includes proteasomal degradation.

Additional vaccines for communicable disease, in particular HIV, are needed.

SUMMARY OF THE INVENTION

For example, embodiments of the present invention provide a fusion protein comprising a) sequestosome l(SQSTMl)/p62 (e.g., described by NCBI Reference Sequence for p62/SQSTMl : NM_003900.4); and b) a conjugate. In some embodiments, the conjugate is fused to the C-terminus of SQSTMl/p62. In some embodiments, the SQSTMl/p62 targets the fusion protein to the autophagy pathway of a subject. In some embodiments, the conjugate is an antigen (e.g., immunogen). In some embodiments, the antigen is a viral antigen (e.g., HIV). In some embodiments, the HIV antigen is Gagp24. In some embodiments the antigen is a cancer antigen (e.g., MART-1). In some embodiments, the antigen induces an immune response in a subject.

Further embodiments provide a nucleic acid encoding the polypeptide or fusion proteins described herein.

Additional embodiments provide a host cell comprising the nucleic acids or polypeptides described herein.

Yet other embodiments provide a vaccine composition comprising the fusion proteins or nucleic acids described herein and a pharmaceutically acceptable carrier.

Still other embodiments provide a method of inducing an immune response in a subject, comprising administering to the subject the vaccine compositions described herein under conditions such that the subj ect generates an immune response. In some embodiments, the vaccine is delivered to the autophagy pathway of the subject. In some embodiments, the fusion protein is protected from degradation by the proteasome. In some embodiments, the vaccine induces a T-cell immune response in the subject.

In some embodiments, the present invention provides the use of the vaccine compositions described herein to elicit an immune response in a subject.

In other embodiments, the present invention provides the use the fusion proteins described herein in a vaccine composition.

Additional embodiments are described herein.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1. Schematic drawing of the SQSTMl/p62-containing vaccine construct. A) The 3-prime end of DNA encoding p62 is connected via a linker region (L) to the antigenic unit HIV-1 Gagp24. (B) Overview of all the constructs that were included in the study: i) p62- Gagp24 (Gagp24, isolate BH10), ii) Gagp24, Hi) Gagp24 fused to mCherry, and iv) p62 fused to mCherry.

FIG. 2. p62 -mCherry and p62-Gagp24, but not mCherry nor Gagp24, localize in LC3⁺ autophagic vesicles. (A-C) Cells were transfected and after 20 hrs, 10 mM NH₄C1 was added to half of the wells before incubation for additional 24 hrs before fixation. DNA plasmids encoding Gagp24-mCherry or p62-mCherry were (A) transfected into EGFP-LC3⁺ HEK293 cells or (B) co-transfected with DNA encoding Rab7-EGFP into HEK293T cells. (C) DNA encoding Gagp24 alone or p62-Gagp24 was transfected into EGFP-LC3⁺ HEK293 cells. Scale bars indicate (A), 5 μηι and (B), 10 μηι. The corner insets show high magnification of framed areas.

FIG. 3. Modulators of autophagy affected p62-Gagp24 but not Gagp24. (A) Cell lysates were analyzed for changes in Gagp24 levels by SDS-PAGE, western blotting and a monoclonal anti-Gagp24 antibody. (B) Results of the experiment outlined above, presented in a histogram, showing band density of Gagp24 normalized to that of β-tubulin. Each column shows mean values ± SEM of pooled data from two independent experiments.

FIG. 4. p62 protected Gagp24 from degradation by the proteasome. (A) The lysates were analyzed by SDS-PAGE, western blotting, and staining with anti-Gagp24. (B) Results of the experiment described above, presented in a histogram, with band density of Gagp24 normalized to that of β-tubulin. Each column shows mean values ± SEM of pooled data from three independent experiments. * p = 0.01, ** p = 0.002, *** p = 0.001, calculated by two- tailed t-test.

FIG. 5. Fusion to p62 increased the number of Gagp24-reactive T cells in mice. Mean values ± SEM are shown, n=3-6 mice/group at week 5 and n=4 mice/group at week 7 -p- values are calculated by two-tailed t-test.

FIG. 6. Fusion to p62 increased the number of Gagp24-reactive CD8⁺ T cells in mice. Mean values ± SEM are shown, n=3-+ mice/group at week 5, and n=4 mice/group at week 7. p-values are calculated by two-tailed t-test.

FIG. 7. IFNy-ELISpot of splenocytes re-stimulated with a mixture of Gagp24 15-mer peptides of pool 2, 3, and 5 three weeks after immunization. Mean values and SEM are presented, and the p-value is calculated by two-tailed t-test.

FIG. 8. MART-1 fused to p62 enters the MHC class I presentation pathway and that p62-MART-l in a specific manner induced substantial activation of cytotoxic CD8⁺ T cells.

DEFINITIONS

The term "wildtype" when used in reference to a protein refers to proteins encoded by the genome of a cell, tissue, or organism, other than one manipulated to produce synthetic proteins.

The term "variant" and "mutant" when used in reference to a polypeptide refer to an amino acid sequence that differs by one or more amino acids from another, usually related polypeptide. The variant may have "conservative" changes, wherein a substituted amino acid has similar structural or chemical properties. One type of conservative amino acid substitutions refers to the interchangeability of residues having similar side chains. For example, a group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of amino acids having aliphatic-hydroxyl side chains is serine and threonine; a group of amino acids having amide-containing side chains is asparagine and glutamine; a group of amino acids having aromatic side chains is

phenylalanine, tyrosine, and tryptophan; unnatural amino acids like p-aminophenylalanine, a group of amino acids having basic side chains is lysine, arginine, and histidine; and a group of amino acids having sulfur-containing side chains is cysteine and methionine. Preferred conservative amino acids substitution groups are: valine-leucine-isoleucine, phenylalanine- tyrosine, lysine-arginine, alanine-valine, and asparagine-glutamine. More rarely, a variant may have "non-conservative" changes (e.g., replacement of a glycine with a tryptophan).

Similar minor variations may also include amino acid deletions or insertions (i.e., additions), or both. Guidance in determining which and how many amino acid residues may be substituted, inserted or deleted without abolishing biological activity may be found using computer programs well known in the art, for example, DNAStar software. Variants can be tested in functional assays. Preferred variants have less than 10%, and preferably less than 5%, and still more preferably less than 2% changes (whether substitutions, deletions, and so on). For an amino acid substitution, the following nomenclature is used: Original amino acid, position, substituted amino acid. Accordingly, the substitution of lysine with alanine at position 573 is designated as "K573A" and the substitution of lysine with proline at position 573 is designated as K573P. Multiple mutations are separated by addition marks ("+") or "/", e.g., "Gly205Arg + Ser411Phe" or "G205R/S411F", representing mutations at positions 205 and 411 substituting glycine (G) with arginine (R), and serine (S) with phenylalanine (F), respectively.

The relatedness between two amino acid sequences or between two nucleotide sequences is described by the parameter "identity". For purposes of the present invention, the degree of identity between two amino acid sequences is determined using the Needleman- Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as

implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends in Genetics 16: 276-277), preferably version 3.0.0 or later. The optional parameters 11644.000-EP7 used are gap open penalty of 10, gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix. The output of Needle labeled "longest identity" (obtained using the -nobrief option) is used as the percent identity and is calculated as follows:

(Identical Residues x 100)/(Length of Alignment - Total Number of Gaps in Alignment). The expression Xnnn is intended to mean an amino acid residue X located in a position corresponding to position nnn in HSA and the expression XnnnY is intended to mean a substitution of any amino acid X located in a position corresponding to position nnn in HSA with the amino acid residue Y.

As used herein, the term "conjugate" as in "a fusion protein comprising an

SQSTMl/p62 protein and a conjugate" refers to any molecule attached (e.g., covalently as in a fusion protein or non-covalently (e.g., via hydrophobic interactions)) to a SQSTMl/p62 protein. Examples include, but are not limited to, peptides, polypeptides, antigens, immunogens, antigens, drugs, proteins, lipids, small molecules, nucelotides, radioactive tracers etc.

As used herein, the term "under conditions such that said subject generates an immune response" refers to any qualitative or quantitative induction, generation, and/or stimulation of an immune response (e.g., innate or acquired).

As used herein, the term "immune response" refers to a response by the immune system of a subject. For example, immune responses include, but are not limited to, a detectable alteration (e.g., increase) in Toll receptor activation, lymphokine (e.g., cytokine (e.g., Thl or Th2 type cytokines) or chemokine) expression and/or secretion, macrophage activation, dendritic cell activation, T cell activation (e.g., CD4+ or CD8+ T cells), NK cell activation, and/or B cell activation (e.g., antibody generation and/or secretion). Additional examples of immune responses include binding of an antigen (e.g., immunogen (e.g., immunogenic polypeptide)) to an MHC molecule and inducing a cytotoxic T lymphocyte ("CTL") response, inducing a B cell response (e.g., antibody production), and/or T-helper lymphocyte response, and/or a delayed type hypersensitivity (DTH) response against the antigen from which the immunogenic polypeptide is derived, expansion (e.g., growth of a population of cells) of cells of the immune system (e.g., T cells, B cells (e.g., of any stage of development (e.g., plasma cells), and increased processing and presentation of antigen by antigen presenting cells. An immune response may be to antigens that the subject's immune system recognizes as foreign (e.g., non-self antigens from microorganisms (e.g., pathogens), or self-antigens recognized as foreign). Thus, it is to be understood that, as used herein, "immune response" refers to any type of immune response, including, but not limited to, innate immune responses (e.g., activation of Toll receptor signaling cascade) cell-mediated immune responses (e.g., responses mediated by T cells (e.g., antigen-specific T cells) and non-specific cells of the immune system) and humoral immune responses (e.g., responses mediated by B cells (e.g., via generation and secretion of antibodies into the plasma, lymph, and/or tissue fluids). The term "immune response" is meant to encompass all aspects of the capability of a subject's immune system to respond to antigens and/or immunogens (e.g., both the initial response to an antigen (e.g., a pathogen) as well as acquired (e.g., memory) responses that are a result of an adaptive immune response).

As used herein, the term "immunity" refers to protection from disease (e.g., preventing or attenuating (e.g., suppression) of a sign, symptom or condition of the disease) upon exposure to a microorganism (e.g., pathogen) capable of causing the disease. Immunity can be innate (e.g., non-adaptive (e.g., non-acquired) immune responses that exist in the absence of a previous exposure to an antigen) and/or acquired (e.g., immune responses that are mediated by B and T cells following a previous exposure to antigen (e.g., that exhibit increased specificity and reactivity to the antigen)).

As used herein, the term "immunogen" refers to an agent (e.g., a microorganism (e.g., bacterium, virus or fungus) and/or portion or component thereof (e.g., a protein antigen)) that is capable of eliciting an immune response in a subject. In some embodiments, immunogens elicit immunity against the immunogen (e.g. , microorganism (e.g., pathogen or a pathogen product)).

The term "test compound" refers to any chemical entity, pharmaceutical, drug, and the like that can be used to treat or prevent a disease, illness, sickness, or disorder of bodily function, or otherwise alter the physiological or cellular status of a sample. Test compounds comprise both known and potential therapeutic compounds. A test compound can be determined to be therapeutic by screening using the screening methods of the present invention. A "known therapeutic compound" refers to a therapeutic compound that has been shown (e.g. , through animal trials or prior experience with administration to humans) to be effective in such treatment or prevention.

The term "sample" as used herein is used in its broadest sense. In one sense it can refer to a tissue sample. In another sense, it is meant to include a specimen or culture obtained from any source, as well as biological. Biological samples may be obtained from animals (including humans) and encompass fluids, solids, tissues, and gases. Biological samples include, but are not limited to blood products, such as plasma, serum and the like. These examples are not to be construed as limiting the sample types applicable to the present invention. A sample suspected of containing a human chromosome or sequences associated with a human chromosome may comprise a cell, chromosomes isolated from a cell (e.g., a spread of metaphase chromosomes), genomic DNA (in solution or bound to a solid support such as for Southern blot analysis), RNA (in solution or bound to a solid support such as for Northern blot analysis), cDNA (in solution or bound to a solid support) and the like. A sample suspected of containing a protein may comprise a cell, a portion of a tissue, an extract containing one or more proteins and the like. DETAILED DESCRIPTION OF THE INVENTION

Autophagy is an evolutionary conserved process which engulfes cytosolic content and can target damaged organelles, protein aggregates, and cytoplasmic microorganisms for degradation upon fusion with endocytic vesicles. There is an increasing amount of data supporting that autophagy has a role in innate and adaptive immunity, and it is well established that autophagy delivers peptides for presentation on MHC class II molecules (Dengjel, J., et al. Autophagy promotes MHC class II presentation of peptides from intracellular source proteins. Proc Natl Acad Sci USA 102, 7922-7927 (2005); Paludan, C, et al. Endogenous MHC class II processing of a viral nuclear antigen after autophagy.

Science 307, 593-596 (2005); Schmid, D., Pypaert, M. & Munz, C. Antigen-loading compartments for major histocompatibility complex class II molecules continuously receive input from autophagosomes. Immunity 26, 79-92 (2007)). A recent study showed that autophagy in APCs enhanced antigen presentation to CD8⁺ T cells (English, L., et al.

Autophagy enhances the presentation of endogenous viral antigens on MHC class I molecules during HSV-1 infection. Nat Immunol 10, 480-487 (2009); Ravindran, R, et al. Vaccine activation of the nutrient sensor GCN2 in dendritic cells enhances antigen presentation. Science 343, 313-317 (2014)) and CD4⁺ T cells (Ravindran et al, supra). Moreover, cross- presentation of antigen to CD8⁺ T cells was shown to be mutually dependent on autophagy in the APC and the antigen donor cell ((Ravindran et al., supra)). Several other studies support these findings. Li et al. and Uhl et al. observed that autophagy in antigen donor cells such as melanoma, HEK293T cells expressing ovalbumin, and mouse embryonic fibroblasts expressing influenza antigen, significantly increased re-stimulation of CD8⁺ T cell clones or priming of naive CD8⁺ T cells (Li, Y., et al. Efficient cross-presentation depends on autophagy in tumor cells. Cancer Res 68, 6889-6895 (2008); Uhl, M., et al. Autophagy within the antigen donor cell facilitates efficient antigen cross-priming of virus-specific CD8+ T cells. Cell Death Differ 16, 991-1005 (2009)). Antigen has also been found in vesicles together with markers of autophagy, indicating that autophagic vesicles can be carriers of antigen for MHC class I presentation (Li et al, supra; Uhl et al, supra. Finally, treatment of antigen donor cells with a proteasomal inhibitor increased the CD8⁺ T cell responses, indicating that autophagy acted as a back up mechanism that promoted enrichment of antigens in autophagosomes.

Taking these data into consideration and aiming to mimic how APCs naturally may encounter an infection, it was contemplated that delivery of vaccine antigen into the autophagic pathway could be a viable strategy to promote induction of T cell responses, in particular priming of CD8⁺ T cells. For this purpose, the protein sequestosome 1

(SQSTMl)/p62 was used. p62 is targeted to the autophagic pathway via binding of its LC3 interacting region (LIR) to LC3, a marker of the autophagic pathway (Pankiv, S., et al.

p62/SQSTMl binds directly to Atg8/LC3 to facilitate degradation of ubiquitinated protein aggregates by autophagy. J Biol Chem 282, 24131-24145 (2007); Ichimura, Y., et al.

Structural basis for sorting mechanism of p62 in selective autophagy. J Biol Chem 283, 22847-22857 (2008)). Because p62 is a receptor that can transport a broad range of cargo such as ubiquitinated proteins, bacteria and damaged organelles, as well as virus and virus- derived protein, it was utilized for fusion with various types of antigen. In addition, the ability of p62 to act as a signaling hub that can activate NF-ιςΒ important in inflammation and immunity, could be beneficial for vaccine responses (Puis, A., Schmidt, S., Grawe, F. & Stabel, S. Interaction of protein kinase C zeta with ZIP, a novel protein kinase C-binding protein. Proc Natl Acad Sci U S A 94, 6191-6196 (1997); Sanchez, P., De Career, G., Sandoval, I.V., Moscat, J. & Diaz-Meco, M.T. Localization of atypical protein kinase C isoforms into lysosome-targeted endosomes through interaction with p62. Mol Cell Biol 18, 3069-3080 (1998); Moscat, J., Diaz-Meco, M.T. & Wooten, M.W. Signal integration and diversification through the p62 scaffold protein. Trends Biochem Sci 32, 95-100 (2007)). Finally, it has been shown that following proteasome inhibition, which may occur during a viral infection, p62 was important for delivery of ubiquitinated proteins to autophagosomes and for cross-presentation of antigens to CD8⁺ T cells when (Twitty, C.G, Jensen, S.M., Hu, H.M. & Fox, B.A. Tumor-derived autophagosome vaccine: induction of cross-protective immune responses against short-lived proteins through a p62-dependent mechanism. Clin Cancer Res 17, 6467-6481 (2011)). Therefore, by fusion of p62 to vaccine antigen, it was contemplated that p62 would rescue antigen from rapid proteasomal degradation and potentiate T cell responses towards the antigen.

Experiments described herein resulted in the development of a vaccine strategy that utilized the alternative intracellular degradative pathway, i.e. the autophagic pathway (See e.g., Jin et al, PL0S1, March 2014 Volume 9: page 1). Autophagy is an evolutionary conserved process which engulfes cytosolic content such as damaged organelles and protein aggregates which can be degraded upon fusion with endocytic compartments. In addition, autophagy protects cells against cytoplasmic microorganisms and it is well established that the pathway delivers peptides for presentation on MHC class II molecules. Autophagy was shown to be crucial for generation of CD8 T cell responses in mice. Moreover, delivery of autophagosomes to dendritic cells induced potent/protective CD8 T cell responses, indicating that the compartment harbour peptides that can be loaded on MHC class I molecules.

To ensure that the vaccine antigen would be sorted into autophagic pathway, the adapter protein Sequestosome l(SQSTMl)/p62, was used; antigen was fused to its C- terminal end. P62 selectively sort to the pathway of autophagy by binding to LC3, a marker protein of the pathway. Moreover, p62 naturally sorts cargo into the pathway and is a signalling hub that mediates NF-KB-signalling. By this technology the vaccine antigen was rescued from rapid proteasomal degradation, and instead the vaccine antigen could be exposed to proteolytic enzymes of the autophagic pathway. By this strategy, T cell responses toward Gagp24 were enhanced. Use of an MHC class I restricted epitope revealed that this strategy also increased the magnitude of the CD8⁺ T cell response.

Several studies support a role for autophagy in antigen presentation and T cell activation. It is well established that the autophagic pathway can deliver peptides for presentation on MHC class II molecules (Dengjel, J., et al. Autophagy promotes MHC class II presentation of peptides from intracellular source proteins. Proc Natl Acad Sci U S A 102, 7922-7927 (2005); Paludan, C, et al. Endogenous MHC class II processing of a viral nuclear antigen after autophagy. Science 307, 593-596 (2005); Schmid, D., Pypaert, M. & Munz, C. Antigen-loading compartments for major histocompatibility complex class II molecules continuously receive input from autophagosomes. Immunity 26, 79-92 (2007). Whether the autophagic pathway also can contribute with peptides for presentation on MHC class I molecules is more controversial. Aiming to promote T cell responses towards HIV-1 Gagp24, Gagp24 was fused to p62. It was contemplated that targeting of the antigen to the autophagic pathway by use of p62, would rescue the antigen from rapid proteasomal degradation, stabilize the antigen, and thereby promote T cell responses.

Whereas there are numerous reports on p62 with fusion of proteins to its N-terminal end, mCherry and Gagp24 were fused to the C-terminal end of p62. mCherry and Gagp24 are both between 20 and 30 kDa in size but show different biochemical properties such as conformation and isoelectric points. Moreover, mCherry is designed to exist as a monomer whereas Gagp24 can interact with itself and form dimers and polymers. Experiments described herein revealed that p62 also tolerates fusions in its C-terminus as p62 retained the ability to sort into the autophagic pathway (Ciuffa, R., et al. The Selective Autophagy Receptor p62 Forms a Flexible Filamentous Helical Scaffold. Cell Rep 11, 748-758). Because a function of p62 is to sort cargo into the autophagic pathway, it is contemplated that the protein is suitable as a targeting molecule for a variety of antigens.

The levels of Gagp24 in Gagp24-transfected cells were insensitive to modulators of autophagy, whereas the level increased in the presence of MG132, an inhibitor of enzymatic activity of the 20S proteasome core (Goldberg, A.L. Development of proteasome inhibitors as research tools and cancer drugs. J Cell Biol 199, 583-588 (2012)). Opposite results were observed for the levels of Gagp24 in p62-Gagp24-transfected cells exposed to the same treatment as indicated above. In particular, the increased levels following blockade of the initiation of autophagy by use of 3-MA, indicated that p62-Gagp24 entered the autophagic pathway and was degraded there. Moreover, increased levels following treatment with NH₄C1 indicate that p62-Gagp24 was degraded by pH-dependent enzymes delivered into the autophagic pathway via endosomes or lysosomes. These data are consistent with the results obtained by immunostaining and fluorescence microscopy, showing that p62 directed Gagp24 but also mCherry from the cytosol to the autophagic pathway.

In comparison to delivery of Gagp24 alone into mice, targeting of Gagp24 by p62 gave either a tendency or a significant increase in antigen-reactive IFNy⁺ T cells towards all peptide pools that were tested. Several studies have shown that there is an association between HIV-1 control and T cell recognition of Gag epitopes (Janes, H., et al. Vaccine- induced gag-specific T cells are associated with reduced viremia after HIV-1 infection. J Infect Dis 208, 1231-1239 (2013); Kiepiela, P., et al. CD8+ T-cell responses to different HIV proteins have discordant associations with viral load. Nat Med 13, 46-53 (2007); Zuniga, R., et al. Relative dominance of Gag p24-specific cytotoxic T lymphocytes is associated with human immunodeficiency virus control. J Virol 80, 3122-3125 (2006)) or Gag epitopes in combination with epitopes in Pol, Nef, and Vif³². Various properties of such protective T cell response have been suggested, but there is good evidence that the magnitude of CD8⁺ T cells as well as the breadth of the response is crucial. Recently, it was reported that the strongest association of viral inhibition was found for CD8⁺ T cells targeting so-called beneficial regions. But there was only a weak association between viral inhibition and CD8⁺ T cell responses towards conserved element peptides (Hancock, G, et al. Identification of Effective Subdominant Anti -HIV-1 CD8+ T Cells Within Entire Post-infection and Post-vaccination Immune Responses. PLoS Pathog 11, el004658 (2015)). When analyzing responses in vaccinees of the STEP/HVTN 502 trial in which HIV-1 antigens (Gag, Pol, and Nef) were delivered by adenovirus 5, there was a preferential targeting of T cells towards non-beneficial regions. A similar skewing of responses was observed following a therapeutic MVA-based vaccine, and newer candidate vaccines such as Ad35-GRIN and Ad-35 Env induced responses to a median of one Gag-epitope in HIV-1 uninfected individuals (Kopycinski, J., et al. Broad HIV epitope specificity and viral inhibition induced by multigenic HIV-1 adenovirus subtype 35 vector vaccine in healthy uninfected adults. PLoS One 9, e90378 (2014)). Because of such findings, it has been stated that immunogens for HIV-1 vaccines should be designed to consist of beneficial regions whereas irrelevant regions that may induce immunodominant decoy regions are excluded.

Most vaccine strategies involve cytosolic localization of vaccine proteins. The conventional pathway for degradation of cytosolic vaccine antigens into peptides presented on MHC class I molecules includes proteasomes. Despite being considered the conventional pathway, it may include some limitations when aiming to induce vaccine responses. For example, HIV-1 Gagp24 and a number of other viral derived units have been shown to inhibit the immunoproteasome. Moreover, only a small fraction of peptides generated by the proteasome escape further hydrolyze and is presented on MHC molecules. Finally, the state of proteasome depends on the cell type and the inflammatory status.

Accordingly, embodiments of the present disclosure provide fusion protein vaccines of an antigen fused to SQSTMl/p62. Such vaccines find use in prevention and treatment of infection (e.g., by microorganisms), as well as in the prevention of virus induced cancers. The present disclosure is not limited to particular antigens. While the present disclosure is exemplified with the HIV antigen Gagp24, the compositions and methods described herein find use with a variety of viral and other antigens.

The SQSTMl/p62 proteins may be conjugated to an antigen (e.g., immunogen) using techniques known within the art.

The fusion proteins of the present invention may also be connected to a signal sequence in order to have the polypeptide secreted into the growth medium during culturing of the transformed host organism. It is generally advantageous to have the variant polypeptide secreted into the growth medium in order to ease recovery and purification.

The fusion proteins may be recovered and purified from the growth medium using a combination of known separation techniques such as filtrations, centrifugations,

chromatography, affinity separation techniques etc. It is within the skills of the average practitioner to purify the variant albumins, fragments thereof, and fusions of the invention using a particular combination of such known separation steps. As an example of purification techniques that may be applied to the variants of the present invention can be mentioned the teaching of WO0044772.

In some embodiments, fusion proteins are expressed from fusion nucleic acids using molecular biology techniques known in the art. The one or more antigen polypeptides may be fused to the N-terminus, the C-terminus of the SQSTMl/p62, inserted into a loop in the SQSTMl/p62 protein or any combination thereof. It may or it may not comprise linker sequences separating the various components of the fusion polypeptide.

In some embodiments, the present invention provides vaccine compositions comprising an SQSTMl/p62 protein described herein and an antigen or immunogen. The present invention is not limited by the particular formulation of a composition comprising a fusion. Indeed, a vaccine composition of the present invention may comprise one or more different agents in addition to the fusion protein. These agents or cofactors include, but are not limited to, adjuvants, surfactants, additives, buffers, solubilizers, chelators, oils, salts, therapeutic agents, drugs, bioactive agents, antibacterials, and antimicrobial agents (e.g., antibiotics, antivirals, etc.). In some embodiments, a vaccine composition comprising a fusion protein comprises an agent and/or co-factor that enhance the ability of the antigen to induce an immune response (e.g., an adjuvant). In some preferred embodiments, the presence of one or more co-factors or agents reduces the amount of antigen required for induction of an immune response (e.g., a protective immune response (e.g., protective immunization)). In some embodiments, the presence of one or more co-factors or agents can be used to skew the immune response towards a cellular (e.g., T cell mediated) or humoral (e.g., antibody mediated) immune response. The present invention is not limited by the type of co-factor or agent used in a therapeutic agent of the present invention.

Adjuvants are described in general in Vaccine Design—the Subunit and Adjuvant Approach, edited by Powell and Newman, Plenum Press, New York, 1995. The present invention is not limited by the type of adjuvant utilized (e.g., for use in a composition (e.g., pharmaceutical composition). For example, in some embodiments, suitable adjuvants include an aluminium salt such as aluminium hydroxide gel (alum) or aluminium phosphate. In some embodiments, an adjuvant may be a salt of calcium, iron or zinc, or may be an insoluble suspension of acylated tyrosine, or acylated sugars, cationically or anionically derivatised polysaccharides, or polyphosphazenes. In general, an immune response is generated to an antigen through the interaction of the antigen with the cells of the immune system. Immune responses may be broadly categorized into two categories: humoral and cell mediated immune responses (e.g., traditionally characterized by antibody and cellular effector mechanisms of protection, respectively). These categories of response have been termed Th-type responses (cell- mediated response), and B cell responses (humoral response).

Stimulation of an immune response can result from a direct or indirect response of a cell or component of the immune system to an intervention (e.g., exposure to an antigen or immunogen). Immune responses can be measured in many ways including activation, proliferation or differentiation of cells of the immune system (e.g., B cells; T cells; APCs such as for example dendritic cells and macrophages, NK cells, NKT cells etc.); up-regulated or down-regulated expression of markers and cytokines; stimulation of IgA, IgM, or IgG titer; splenomegaly (including increased spleen cellularity); hyperplasia and mixed cellular infiltrates in various organs. Other responses, cells, and components of the immune system that can be assessed with respect to immune stimulation are known in the art.

Although an understanding of the mechanism is not necessary to practice the present invention and the present invention is not limited to any particular mechanism of action, in some embodiments, compositions and methods of the present invention induce expression and secretion of cytokines (e.g., by macrophages, dendritic cells and CD4+ and CD8+ T cells). Modulation of expression of a particular cytokine can occur locally or systemically. It is known that cytokine profiles can determine T cell regulatory and effector functions in immune responses. In some embodiments, Thl-type cytokines can be induced, and thus, the immunostimulatory compositions of the present invention can promote a Thl type antigen- specific immune response including cytotoxic T-cells (e.g., thereby avoiding unwanted Th2 type immune responses (e.g., generation of Th2 type cytokines (e.g., IL-13) involved in enhancing the severity of disease (e.g., IL-13 induction of mucus formation))).

Cytokines play a role in directing the T cell response. Helper (CD4+) T cells orchestrate the immune response of mammals through production of soluble factors that act on other immune system cells, including B and other T cells. Most mature CD4+T helper cells express one of two cytokine profiles: Thl or Th2. Thl-type CD4+ T cells secrete IL-2, IL-3, IFN-γ, GM-CSF and high levels of TNF-a. Th2 cells express IL-3, IL-4, IL-5, IL-6, IL- 9, IL-10, IL-13, GM-CSF and low levels of TNF-a. Thl type cytokines promote both cell- mediated immunity, and humoral immunity that is characterized by immunoglobulin class switching to IgG2a in mice and IgGl in humans. Thl responses may also be associated with delayed-type hypersensitivity and autoimmune disease. Th2 type cytokines induce primarily humoral immunity and induce class switching to IgGl and IgE. The antibody isotypes associated with Thl responses generally have neutralizing and opsonizing capabilities whereas those associated with Th2 responses are associated more with allergic responses.

Several factors have been shown to influence skewing of an immune response towards either a Thl or Th2 type response. The best characterized regulators are cytokines. IL-12 and IFN-γ are positive Thl and negative Th2 regulators. IL-12 promotes IFN- γ production, and IFN-γ provides positive feedback for IL-12. IL-4 and IL-10 appear important for the establishment of the Th2 cytokine profile and to down-regulate Thl cytokine production.

Thus, in preferred embodiments, the present invention provides a method of stimulating a Thl -type immune response in a subject comprising administering to a subject a composition comprising an antigen or immunogen. However, in other embodiments, the present invention provides a method of stimulating a Th2-type immune response in a subject (e.g., if balancing of a T cell mediated response is desired) comprising administering to a subject a composition comprising an antigen or immunogen. In further preferred

embodiments, adjuvants can be used (e.g., can be co-administered with a composition of the present invention) to skew an immune response toward either a Thl or Th2 type immune response. For example, adjuvants that induce Th2 or weak Thl responses include, but are not limited to, alum, saponins, and SB-As4. Adjuvants that induce Thl responses include but are not limited to MPL, MDP, ISCOMS, IL-12, IFN- γ, and SB-AS2.

Several other types of Thl -type immunogens can be used (e.g., as an adjuvant) in compositions and methods of the present invention. These include, but are not limited to, the following. In some embodiments, monophosphoryl lipid A (e.g., in particular 3-de-O- acylated monophosphoryl lipid A (3D-MPL)), is used. 3D-MPL is a well known adjuvant manufactured by Ribi Immunochem, Montana. Chemically it is often supplied as a mixture of 3-de-O-acylated monophosphoryl lipid A with either 4, 5, or 6 acylated chains. In some embodiments, diphosphoryl lipid A, and 3-O-deacylated variants thereof are used. Each of these immunogens can be purified and prepared by methods described in GB 2122204B, hereby incorporated by reference in its entirety. Other purified and synthetic

lipopolysaccharides have been described (See, e.g., U.S. Pat. No. 6,005,099 and EP 0 729 473; Hilgers et al, 1986, Int. Arch. Allergy. Immunol, 79(4):392-6; Hilgers et al, 1987, Immunology, 60(1): 141-6; and EP 0 549 074, each of which is hereby incorporated by reference in its entirety). In some embodiments, 3D-MPL is used in the form of a particulate formulation (e.g., having a small particle size less than 0.2 μηι in diameter, described in EP 0 689 454, hereby incorporated by reference in its entirety).

In some embodiments, saponins are used as an adjuvant (e.g.,Thl-type adjuvant) in a composition of the present invention. Saponins are well known adjuvants (See, e.g., Lacaille- Dubois and Wagner (1996) Phytomedicine vol 2 pp 363-386). Examples of saponins include Quil A (derived from the bark of the South American tree Quillaja Saponaria Molina), and fractions thereof (See, e.g., U.S. Pat. No. 5,057,540; Kensil, Crit Rev Ther Drug Carrier Syst, 1996, 12 (1-2): 1-55; and EP 0 362 279, each of which is hereby incorporated by reference in its entirety). Also contemplated to be useful in the present invention are the haemolytic saponins QS7, QS17, and QS21 (HPLC purified fractions of Quil A; See, e.g., Kensil et al. (1991). J. Immunology 146,431-437, U.S. Pat. No. 5,057,540; WO 96/33739; WO 96/11711 and EP 0 362 279, each of which is hereby incorporated by reference in its entirety). Also contemplated to be useful are combinations of QS21 and polysorbate or cyclodextrin (See, e.g., WO 99/10008, hereby incorporated by reference in its entirety.

In some embodiments, an immunogenic oligonucleotide containing unmethylated

CpG dinucleotides ("CpG") is used as an adjuvant. CpG is an abbreviation for cytosine- guanosine dinucleotide motifs present in DNA. CpG is known in the art as being an adjuvant when administered by both systemic and mucosal routes (See, e.g., WO 96/02555, EP 468520, Davis et al, J.Immunol, 1998, 160(2):870-876; McCluskie and Davis, J.Immunol, 1998, 161(9):4463-6; and U.S. Pat. App. No. 20050238660, each of which is hereby incorporated by reference in its entirety). For example, in some embodiments, the immunostimulatory sequence is Purine-Purine-C-G-pyrimidine-pyrirnidine; wherein the CG motif is not methylated.

Although an understanding of the mechanism is not necessary to practice the present invention and the present invention is not limited to any particular mechanism of action, in some embodiments, the presence of one or more CpG oligonucleotides activate various immune subsets including natural killer cells (which produce IFN-γ) and macrophages. In some embodiments, CpG oligonucleotides are formulated into a composition of the present invention for inducing an immune response. In some embodiments, a free solution of CpG is co-administered together with an antigen (e.g., present within a solution (See, e.g., WO

96/02555; hereby incorporated by reference). In some embodiments, a CpG oligonucleotide is covalently conjugated to an antigen (See, e.g., WO 98/16247, hereby incorporated by reference), or formulated with a carrier such as aluminium hydroxide (See, e.g., Brazolot- Millan et al, Proc.Natl.AcadSci., USA, 1998, 95(26), 15553-8). In some embodiments, adjuvants such as Complete Freunds Adjuvant and Incomplete Freunds Adjuvant, cytokines (e.g., interleukins (e.g., IL-2, IFN-γ, IL-4, etc.), macrophage colony stimulating factor, tumor necrosis factor, etc.), detoxified mutants of a bacterial ADP- ribosylating toxin such as a cholera toxin (CT), a pertussis toxin (PT), or an E. Coli heat- labile toxin (LT), particularly LT-K63 (where lysine is substituted for the wild-type amino acid at position 63) LT-R72 (where arginine is substituted for the wild-type amino acid at position 72), CT-S109 (where serine is substituted for the wild-type amino acid at position 109), and PT-K9/G129 (where lysine is substituted for the wild-type amino acid at position 9 and glycine substituted at position 129) (See, e.g., WO93/13202 and W092/19265, each of which is hereby incorporated by reference), and other immunogenic substances (e.g., that enhance the effectiveness of a composition of the present invention) are used with a composition comprising an antigen or immunogen of the present invention.

Additional examples of adjuvants that find use in the present invention include poly(di(carboxylatophenoxy)phosphazene (PCPP polymer; Virus Research Institute, USA); derivatives of lipopolysaccharides such as monophosphoryl lipid A (MPL; Ribi

ImmunoChem Research, Inc., Hamilton, Mont.), muramyl dipeptide (MDP; Ribi) and threonyl-muramyl dipeptide (t-MDP; Ribi); OM-174 (a glucosamine disaccharide related to lipid A; OM Pharma SA, Meyrin, Switzerland); and Leishmania elongation factor (a purified Leishmania protein; Corixa Corporation, Seattle, Wash.).

Adjuvants may be added to a composition comprising an antigen or immunogen, or, the adjuvant may be formulated with carriers, for example liposomes, or metallic salts (e.g., aluminium salts (e.g., aluminium hydroxide)) prior to combining with or co-administration with a composition.

In some embodiments, a composition comprising an antigen or immunogen comprises a single adjuvant. In other embodiments, a composition comprises two or more adjuvants (See, e.g., WO 94/00153; WO 95/17210; WO 96/33739; WO 98/56414; WO 99/12565; WO 99/11241 ; and WO 94/00153, each of which is hereby incorporated by reference in its entirety).

In some embodiments, a composition comprising an antigen or immunogen comprises one or more mucoadhesives (See, e.g., U.S. Pat. App. No. 20050281843, hereby incorporated by reference in its entirety). The present invention is not limited by the type of mucoadhesive utilized. Indeed, a variety of mucoadhesives are contemplated to be useful in the present invention including, but not limited to, cross-linked derivatives of poly(acrylic acid) (e.g., carbopol and polycarbophil), polyvinyl alcohol, polyvinyl pyrollidone, polysaccharides (e.g., alginate and chitosan), hydroxypropyl methylcellulose, lectins, fimbrial proteins, and carboxymethylcellulose. Although an understanding of the mechanism is not necessary to practice the present invention and the present invention is not limited to any particular mechanism of action, in some embodiments, use of a mucoadhesive (e.g., in a composition comprising an antigen or immunogen) enhances induction of an immune response in a subject (e.g., administered a composition of the present invention) due to an increase in duration and/or amount of exposure to an antigen or immunogen that a subject experiences when a mucoadhesive is used compared to the duration and/or amount of exposure to an antigen or immunogen in the absence of using the mucoadhesive.

In some embodiments, a composition of the present invention may comprise sterile aqueous preparations. Acceptable vehicles and solvents include, but are not limited to, water, Ringer's solution, phosphate buffered saline and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose any bland fixed mineral or non-mineral oil may be employed including synthetic mono-ordi-glycerides. In addition, fatty acids such as oleic acid find use in the preparation of injectables. Carrier formulations suitable for mucosal, subcutaneous, intramuscular, intraperitoneal, intravenous, or administration via other routes may be found in Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, Pa.

A composition comprising an antigen or immunogen of the present invention can be used therapeutically (e.g., to enhance an immune response) or as a prophylactic (e.g., for immunization (e.g., to prevent signs or symptoms of disease)). A composition comprising an antigen or immunogen of the present invention can be administered to a subject via a number of different delivery routes and methods.

In some embodiments, compositions of the present invention are administered mucosally (e.g., using standard techniques; See, e.g., Remington: The Science and Practice of Pharmacy, Mack Publishing Company, Easton, Pa., 19th edition, 1995 (e.g., for mucosal delivery techniques, including intranasal, pulmonary, vaginal and rectal techniques), as well as European Publication No. 517,565 and Ilium et al, J. Controlled Rel., 1994, 29: 133-141 (e.g., for techniques of intranasal administration), including via cell, vesicles, and liposomes, each of which is hereby incorporated by reference in its entirety). Alternatively, the compositions of the present invention may be administered dermally or transdermally, using standard techniques (See, e.g., Remington: The Science arid Practice of Pharmacy, Mack Publishing Company, Easton, Pa., 19th edition, 1995). The present invention is not limited by the route of administration. Although an understanding of the mechanism is not necessary to practice the present invention and the present invention is not limited to any particular mechanism of action, in some embodiments, mucosal vaccination is the preferred route of administration as it has been shown that mucosal administration of antigens has a greater efficacy of inducing protective immune responses at mucosal surfaces (e.g., mucosal immunity), the route of entry of many pathogens. In addition, mucosal vaccination, such as intranasal vaccination, may induce mucosal immunity not only in the nasal mucosa, but also in distant mucosal sites such as the genital mucosa (See, e.g., Mestecky, Journal of Clinical Immunology, 7:265-276, 1987). More advantageously, in further preferred embodiments, in addition to inducing mucosal immune responses, mucosal vaccination also induces systemic immunity. In some embodiments, non-parenteral administration (e.g., muscosal administration of vaccines) provides an efficient and convenient way to boost systemic immunity (e.g., induced by parenteral or mucosal vaccination (e.g., in cases where multiple boosts are used to sustain a vigorous systemic immunity)).

In some embodiments, a composition comprising an antigen or immunogen of the present invention may be used to protect or treat a subject susceptible to, or suffering from, disease by means of administering a composition of the present invention via a mucosal route (e.g., an oral/alimentary or nasal route). Alternative mucosal routes include intravaginal and intra-rectal routes. In preferred embodiments of the present invention, a nasal route of administration is used, termed "intranasal administration" or "intranasal vaccination" herein. Methods of intranasal vaccination are well known in the art, including the administration of a droplet or spray form of the vaccine into the nasopharynx of a sujbect to be immunized. In some embodiments, a nebulized or aerosolized composition is provided. Enteric

formulations such as gastro resistant capsules for oral administration, suppositories for rectal or vaginal administration also form part of this invention. Compositions of the present invention may also be administered via the oral route. Under these circumstances, a composition comprising an antigen or immunogen may comprise a pharmaceutically acceptable excipient and/or include alkaline buffers, or enteric capsules. Formulations for nasal delivery may include those with dextran or cyclodextran and saponin as an adjuvant.

Compositions of the present invention may also be administered via a vaginal route.

In such cases, a composition comprising an antigen or immunogen may comprise pharmaceutically acceptable excipients and/or emulsifiers, polymers (e.g., CARBOPOL), and other known stabilizers of vaginal creams and suppositories. In some embodiments, compositions of the present invention are administered via a rectal route. In such cases, compositions may comprise excipients and/or waxes and polymers known in the art for forming rectal suppositories.

In some embodiments, the same route of administration (e.g., mucosal administration) is chosen for both a priming and boosting vaccination. In some embodiments, multiple routes of administration are utilized (e.g., at the same time, or, alternatively, sequentially) in order to stimulate an immune response.

For example, in some embodiments, a composition comprising an antigen or immunogen is administered to a mucosal surface of a subject in either a priming or boosting vaccination regime. Alternatively, in some embodiments, the composition is administered systemically in either a priming or boosting vaccination regime. In some embodiments, a composition is administered to a subject in a priming vaccination regimen via mucosal administration and a boosting regimen via systemic administration. In some embodiments, a composition is administered to a subject in a priming vaccination regimen via systemic administration and a boosting regimen via mucosal administration. Examples of systemic routes of administration include, but are not limited to, a parenteral, intramuscular, intradermal, transdermal, subcutaneous, intraperitoneal or intravenous administration. A composition comprising an antigen or immunogen may be used for both prophylactic and therapeutic purposes.

In some embodiments, compositions of the present invention are administered by pulmonary delivery. For example, a composition of the present invention can be delivered to the lungs of a subject (e.g., a human) via inhalation (e.g., thereby traversing across the lung epithelial lining to the blood stream (See, e.g., Adjei, et al. Pharmaceutical Research 1990; 7:565-569; Adjei, et al. Int. J. Pharmaceutics 1990; 63: 135-144; Braquet, et al. J.

Cardiovascular Pharmacology 1989 143-146; Hubbard, et al. (1989) Annals of Internal Medicine, Vol. Ill, pp. 206-212; Smith, et al. J. Clin. Invest. 1989;84: 1145-1146; Oswein, et al. "Aerosolization of Proteins", 1990; Proceedings of Symposium on Respiratory Drug Delivery II Keystone, Colorado; Debs, et al. J. Immunol. 1988; 140:3482-3488; and U.S. Pat. No. 5,284,656 to Platz, et al, each of which are hereby incorporated by reference in its entirety). A method and composition for pulmonary delivery of drugs for systemic effect is described in U.S. Pat. No. 5,451,569 to Wong, et al, hereby incorporated by reference; See also U.S. Pat. No. 6,651,655 to Licalsi et al, hereby incorporated by reference in its entirety)).

Further contemplated for use in the practice of this invention are a wide range of mechanical devices designed for pulmonary and/or nasal mucosal delivery of pharmaceutical agents including, but not limited to, nebulizers, metered dose inhalers, and powder inhalers, all of which are familiar to those skilled in the art. Some specific examples of commercially available devices suitable for the practice of this invention are the Ultravent nebulizer (Mallinckrodt Inc., St. Louis, Mo.); the Acorn II nebulizer (Marquest Medical Products, Englewood, Colo.); the Ventolin metered dose inhaler (Glaxo Inc., Research Triangle Park, N.C.); and the Spinhaler powder inhaler (Fisons Corp., Bedford, Mass.). All such devices require the use of formulations suitable for dispensing of the therapeutic agent. Typically, each formulation is specific to the type of device employed and may involve the use of an appropriate propellant material, in addition to the usual diluents, adjuvants, surfactants, carriers and/or other agents useful in therapy. Also, the use of liposomes, microcapsules or microspheres, inclusion complexes, or other types of carriers is contemplated.

Thus, in some embodiments, a composition comprising an antigen or immunogen of the present invention may be used to protect and/or treat a subject susceptible to, or suffering from, a disease by means of administering the composition by mucosal, intramuscular, intraperitoneal, intradermal, transdermal, pulmonary, intravenous, subcutaneous or other route of administration described herein. Methods of systemic administration of the vaccine preparations may include conventional syringes and needles, or devices designed for ballistic delivery of solid vaccines (See, e.g., WO 99/27961, hereby incorporated by reference), or needleless pressure liquid jet device (See, e.g., U.S. Pat. No. 4,596,556; U.S. Pat. No.

5,993,412, each of which are hereby incorporated by reference), or transdermal patches (See, e.g., WO 97/48440; WO 98/28037, each of which are hereby incorporated by reference). The present invention may also be used to enhance the immunogenicity of antigens applied to the skin (transdermal or transcutaneous delivery, See, e.g., WO 98/20734 ; WO 98/28037, each of which are hereby incorporated by reference).

The present invention is not limited by the type of subject administered (e.g., in order to stimulate an immune response (e.g., in order to generate protective immunity (e.g., mucosal and/or systemic immunity))) a composition of the present invention. Indeed, a wide variety of subjects are contemplated to be benefited from administration of a composition of the present invention. In preferred embodiments, the subject is a human. In some embodiments, human subjects are of any age (e.g., adults, children, infants, etc.) that have been or are likely to become exposed to a microorganism (e.g., HIV). In some embodiments, the human subjects are subjects that are more likely to receive a direct exposure to pathogenic microorganisms or that are more likely to display signs and symptoms of disease after exposure to a pathogen (e.g., immune suppressed subjects). In some embodiments, the general public is administered (e.g., vaccinated with) a composition of the present invention (e.g., to prevent the occurrence or spread of disease). For example, in some embodiments, compositions and methods of the present invention are utilized to vaccinate a group of people (e.g., a population of a region, city, state and/or country) for their own health (e.g., to prevent or treat disease). In some embodiments, the subjects are non-human mammals (e.g., pigs, cattle, goats, horses, sheep, or other livestock; or mice, rats, rabbits or other animal). In some embodiments, compositions and methods of the present invention are utilized in research settings (e.g., with research animals).

A composition of the present invention may be formulated for administration by any route, such as mucosal, oral, transdermal, intranasal, intramuscular, parenteral or other route described herein. The compositions may be in any one or more different forms including, but not limited to, tablets, capsules, powders, granules, lozenges, foams, creams or liquid preparations.

Topical formulations of the present invention may be presented as, for instance, ointments, creams or lotions, foams, and aerosols, and may contain appropriate conventional additives such as preservatives, solvents (e.g., to assist penetration), and emollients in ointments and creams.

Topical formulations may also include agents that enhance penetration of the active ingredients through the skin. Exemplary agents include a binary combination of N- (hydroxyethyl) pyrrolidone and a cell-envelope disordering compound, a sugar ester in combination with a sulfoxide or phosphine oxide, and sucrose monooleate, decyl methyl sulfoxide, and alcohol.

Other exemplary materials that increase skin penetration include surfactants or wetting agents including, but not limited to, polyoxy ethylene sorbitan mono-oleoate

(Polysorbate 80); sorbitan mono-oleate (Span 80); p-isooctyl polyoxyethylene-phenol polymer (Triton WR-1330); polyoxy ethylene sorbitan tri-oleate (Tween 85); dioctyl sodium sulfosuccinate; and sodium sarcosinate (Sarcosyl NL-97); and other pharmaceutically acceptable surfactants.

In certain embodiments of the invention, compositions may further comprise one or more alcohols, zinc-containing compounds, emollients, humectants, thickening and/or gelling agents, neutralizing agents, and surfactants. Water used in the formulations is preferably deionized water having a neutral pH. Additional additives in the topical formulations include, but are not limited to, silicone fluids, dyes, fragrances, pH adjusters, and vitamins. Topical formulations may also contain compatible conventional carriers, such as cream or ointment bases and ethanol or oleyl alcohol for lotions. Such carriers may be present as from about 1% up to about 98% of the formulation. The ointment base can comprise one or more of petrolatum, mineral oil, ceresin, lanolin alcohol, panthenol, glycerin, bisabolol, cocoa butter and the like.

In some embodiments, pharmaceutical compositions of the present invention may be formulated and used as foams. Pharmaceutical foams include formulations such as, but not limited to, emulsions, microemulsions, creams, jellies and liposomes. While basically similar in nature these formulations vary in the components and the consistency of the final product. The compositions of the present invention may additionally contain other adjunct components conventionally found in pharmaceutical compositions. Thus, for example, the compositions may contain additional, compatible, pharmaceutically-active materials such as, for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents, or may contain additional materials useful in physically formulating various dosage forms of the compositions of the present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers. However, such materials, when added, preferably do not unduly interfere with the biological activities of the components of the compositions of the present invention. The formulations can be sterilized and, if desired, mixed with auxiliary agents (e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings and/or aromatic substances and the like) that do not deleteriously interact with the antigen or immunogen or other components of the formulation. In some embodiments,

immunostimulatory compositions of the present invention are administered in the form of a pharmaceutically acceptable salt. When used the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically acceptable salts thereof. Such salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulphuric, nitric, phosphoric, maleic, acetic, salicylic, p-toluene sulphonic, tartaric, citric, methane sulphonic, formic, malonic, succinic, naphthalene-2-sulphonic, and benzene sulphonic. Also, such salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts of the carboxylic acid group.

Suitable buffering agents include, but are not limited to, acetic acid and a salt (1-2% w/v); citric acid and a salt (1-3% w/v); boric acid and a salt (0.5-2.5% w/v); and phosphoric acid and a salt (0.8-2% w/v). Suitable preservatives may include benzalkonium chloride (0.003-0.03% w/v); chlorobutanol (0.3-0.9% w/v); parabens (0.01-0.25% w/v) and thimerosal (0.004-0.02% w/v).

In some embodiments, vaccine compositions are co-administered with one or more antibiotics or antiviral agents. For example, one or more antibiotics may be administered with, before and/or after administration of the composition. The present invention is not limited by the type of antibiotic co-administered. Indeed, a variety of antibiotics may be coadministered including, but not limited to, β-lactam antibiotics, penicillins (such as natural penicillins, aminopenicillins, penicillinase-resistant penicillins, carboxy penicillins, ureido penicillins), cephalosporins (first generation, second generation, and third generation cephalosporins), and other β-lactams (such as imipenem, monobactams,), β -lactamase inhibitors, vancomycin, aminoglycosides and spectinomycin, tetracyclines, chloramphenicol, erythromycin, lincomycin, clindamycin, rifampin, metronidazole, polymyxins, doxycycline, quinolones (e.g., ciprofloxacin), sulfonamides, trimethoprim, and quinolines.

There are an enormous amount of antimicrobial agents currently available for use in treating bacterial, fungal and viral infections. For a comprehensive treatise on the general classes of such drugs and their mechanisms of action, the skilled artisan is referred to Goodman & Gilman's "The Pharmacological Basis of Therapeutics" Eds. Hardman et al , 9th Edition, Pub. McGraw Hill, chapters 43 through 50, 1996, (herein incorporated by reference in its entirety). Generally, these agents include agents that inhibit cell wall synthesis (e.g., penicillins, cephalosporins, cycloserine, vancomycin, bacitracin); and the imidazole antifungal agents (e.g., miconazole, ketoconazole and clotrimazole); agents that act directly to disrupt the cell membrane of the microorganism (e.g., detergents such as polmyxin and colistimethate and the antifungals nystatin and amphotericin B); agents that affect the ribosomal subunits to inhibit protein synthesis (e.g., chloramphenicol, the tetracyclines, erthromycin and clindamycin); agents that alter protein synthesis and lead to cell death (e.g., aminoglycosides); agents that affect nucleic acid metabolism (e.g., the rifamycins and the quinolones); the antimetabolites (e.g., trimethoprim and sulfonamides); and the nucleic acid analogues such as zidovudine, gangcyclovir, vidarabine, and acyclovir which act to inhibit viral enzymes essential for DNA synthesis. Various combinations of antimicrobials may be employed.

The present invention also includes methods involving co-administration of a vaccine composition comprising an antigen or immunogen with one or more additional active and/or immunostimulatory agents (e.g., a composition comprising a different antigen, an antibiotic, anti-oxidant, etc.). Indeed, it is a further aspect of this invention to provide methods for enhancing prior art immunostimulatory methods (e.g., immunization methods) and/or pharmaceutical compositions by co-administering a composition of the present invention. In co-administration procedures, the agents may be administered concurrently or sequentially. In one embodiment, the compositions described herein are administered prior to the other active agent(s). The pharmaceutical formulations and modes of administration may be any of those described herein. In addition, the two or more co-administered agents may each be administered using different modes (e.g., routes) or different formulations. The additional agents to be co-administered (e.g., antibiotics, adjuvants, etc.) can be any of the well-known agents in the art, including, but not limited to, those that are currently in clinical use.

In some embodiments, a composition comprising an antigen or immunogen is administered to a subject via more than one route. For example, a subject that would benefit from having a protective immune response (e.g., immunity) towards a pathogenic

microorganism may benefit from receiving mucosal administration (e.g., nasal administration or other mucosal routes described herein) and, additionally, receiving one or more other routes of administration (e.g., parenteral or pulmonary administration (e.g., via a nebulizer, inhaler, or other methods described herein). In some preferred embodiments, administration via mucosal route is sufficient to induce both mucosal as well as systemic immunity towards an antigen or immunogen or organism from which the antigen or immunogen is derived. In other embodiments, administration via multiple routes serves to provide both mucosal and systemic immunity. Thus, although an understanding of the mechanism is not necessary to practice the present invention and the present invention is not limited to any particular mechanism of action, in some embodiments, it is contemplated that a subject administered a composition of the present invention via multiple routes of administration (e.g., immunization (e.g., mucosal as well as airway or parenteral administration of the composition) may have a stronger immune response to an antigen or immunogen than a subj ect administered a composition via just one route.

Other delivery systems can include time-release, delayed release or sustained release delivery systems. Such systems can avoid repeated administrations of the compositions, increasing convenience to the subject and a physician. Many types of release delivery systems are available and known to those of ordinary skill in the art. They include polymer based systems such as poly(lactide-glycolide), copolyoxalates, polycaprolactones, polyesteramides, polyorthoesters, polyhydroxybutyric acid, and polyanhydrides.

Microcapsules of the foregoing polymers containing drugs are described in, for example, U. S. Pat. No. 5,075, 109, hereby incorporated by reference. Delivery systems also include non- polymer systems that are: lipids including sterols such as cholesterol, cholesterol esters and fatty acids or neutral fats such as mono-di-and tri-glycerides; hydrogel release systems;

sylastic systems; peptide based systems; wax coatings; compressed tablets using conventional binders and excipients; partially fused implants; and the like. Specific examples include, but are not limited to: (a) erosional systems in which an agent of the invention is contained in a form within a matrix such as those described in U.S. Pat. Nos. 4,452,775, 4,675,189, and 5,736,152, each of which is hereby incorporated by reference and (b) diffusional systems in which an active component permeates at a controlled rate from a polymer such as described in U.S. Pat. Nos. 3,854,480, 5,133,974 and 5,407,686, each of which is hereby incorporated by reference. In addition, pump-based hardware delivery systems can be used, some of which are adapted for implantation.

In some embodiments, a vaccine composition of the present invention is formulated in a concentrated dose that can be diluted prior to administration to a subject. For example, dilutions of a concentrated composition may be administered to a subject such that the subject receives any one or more of the specific dosages provided herein. In some embodiments, dilution of a concentrated composition may be made such that a subject is administered (e.g., in a single dose) a composition comprising 0.5-50% of a nanemulsion and antigen or immunogen present in the concentrated composition. Concentrated compositions are contemplated to be useful in a setting in which large numbers of subjects may be

administered a composition of the present invention (e.g., an immunization clinic, hospital, school, etc.). In some embodiments, a composition comprising an antigen or immunogen of the present invention (e.g., a concentrated composition) is stable at room temperature for more than 1 week, in some embodiments for more than 2 weeks, in some embodiments for more than 3 weeks, in some embodiments for more than 4 weeks, in some embodiments for more than 5 weeks, and in some embodiments for more than 6 weeks.

In some embodiments, following an initial administration of a composition of the present invention (e.g., an initial vaccination), a subject may receive one or more boost administrations (e.g., around 2 weeks, around 3 weeks, around 4 weeks, around 5 weeks, around 6 weeks, around 7 weeks, around 8 weeks, around 10 weeks, around 3 months, around 4 months, around 6 months, around 9 months, around 1 year, around 2 years, around 3 years, around 5 years, around 10 years) subsequent to a first, second, third, fourth, fifth, sixth, seventh, eights, ninth, tenth, and/or more than tenth administration. Although an

understanding of the mechanism is not necessary to practice the present invention and the present invention is not limited to any particular mechanism of action, in some embodiments, reintroduction of an antigen or immunogen in a boost dose enables vigorous systemic immunity in a subject. The boost can be with the same formulation given for the primary immune response, or can be with a different formulation that contains the antigen or immunogen. The dosage regimen will also, at least in part, be determined by the need of the subject and be dependent on the judgment of a practitioner.

Dosage units may be proportionately increased or decreased based on several factors including, but not limited to, the weight, age, and health status of the subject. In addition, dosage units may be increased or decreased for subsequent administrations (e.g., boost administrations).

It is contemplated that the compositions and methods of the present invention will find use in various settings, including research settings. For example, compositions and methods of the present invention also find use in studies of the immune system (e.g., characterization of adaptive immune responses (e.g., antigen processing and presentation pathways, protective immune responses (e.g., T cell specificity, phenotype of T cells, mucosal or systemic immunity))). Uses of the compositions and methods provided by the present invention encompass human and non-human subjects and samples from those subjects, and also encompass research applications using these subjects. Compositions and methods of the present invention are also useful in studying and optimizing vaccines, antigems, immunogens, and other components and for screening for new components. Thus, it is not intended that the present invention be limited to any particular subject and/or application setting.

The present invention further provides kits comprising the vaccine compositions comprised herein. In some embodiments, the kit includes all of the components necessary, sufficient or useful for administering the vaccine. For example, in some embodiments, the kits comprise devices for administering the vaccine (e.g., needles or other injection devices), temperature control components (e.g., refrigeration or other cooling components), sanitation components (e.g., alcohol swabs for sanitizing the site of injection) and instructions for administering the vaccine. Example 1

Materials and methods

Plasmids and design of constructs pBudCE4.1 (Life Technologies) was used as expression vector to retain the possibility of dual expression of genes in the future. For simple and versatile subcloning of all constructs in this study, pBudCE4.1 was modified to insert a fragment containing the restriction sites 5'- HindIII-SalI-SfiIi-Sfil₂-XbaI in the multiple cloning site downstream of the CMV promoter. The cDNA sequence of HIV-1 Gagp24, isolate BH10 (GenBank accession number

M15654.1, nucleotide 508-1200) was ordered from GenScript (Piscataway, NJ, USA) with Sfil restriction sites in the 5- and 3-prime end (Sfili: 5' GGCCTCAGCGGCC TG (SEQ ID NO: l)- and Sfil₂: -GGCCTGCAGGGCC-3'(SEQ ID NO:2)). Human p62/SQSTMl cDNA was retrieved by PCR from a pDEST-EGFP vector kindly given by Prof. Anne Simonsen (University of Oslo, Oslo, Norway) by PCR and primers including overhangs for Hindlll

(P_fwd: 5 ' - AAATTT AAGCTTGATGGC GTC GCTC AC CGTGAAG G-3 ' (SEQ ID NO:3)) and Sail (P_rev: 5'-AAATTTGTCGACCTCAACGGCGGGGGATGCTTTGAATA-3' (SEQ ID NO:4)). cDNA encoding mCherry was amplified by PCR with primers including overhangs for Sfili (Pfw_d: 5 ' - AAATTTGGC CTC AGCGGC CTGGTGAGC AAGGGC GAGGAGGAT- 3'(SEQ ID NO:5)) and Sfil₂ (P_rev: 5'-

AAATTTGGCCCTGCAGGCCTTACTTGTACAGCTCGTCCATGCCG-3' (SEQ ID NO:6)). To conjugate Gagp24 with mCherry, Gagp24 cDNA was amplified by PCR with primers including overhangs for Hindlll (P_fwd: 5'-

AAATTTAAGCTTGATGCCCATCGTGCAGAACATCCAG -3' (SEQ ID NO: 7)) and Sail (P_rev: 5'-AAATTTGTCGACCCCAGCACTCTAGCCTTATGGCC-3' (SEQ ID NO: 8)). Plasmid encoding mCherry only, was generated by PCR and primers that contained overhangs for Hindlll (P_fwd: 5 ' -AAATTTAAGCTTGATGGTGAGC AAGGGC GAGGAG- 3'(SEQ ID NO: 9)) and Xbal (P_rev: 5'-

AAATTTTCTAGACTTGTAC AGCTCGTCC ATGCCG-3 ' (SEQ ID NO: 10)).

DNA preparation

All plasmid were prepared and amplified using TOPI OF' E. coli cells (Life

Technologies, Grand Island, NY, USA). For the cloning procedures, small-scale DNA preparations were performed using Wizard™ Plus SV Minipreps DNA Purification System (Promega, Madison, WI, USA). For all cell culture experiments, medium-scale DNA preparations were performed using Wizard™ Plus SV Minipreps DNA Purification System (Promega). For all in vivo mice experiments, large-scale endotoxin free DNA preparations were performed using EndoFree Plasmid Mega Kit (Qiagen, Strasse, Hilden, Germany). Sequence analysis

All cloned DNA constructs were sequenced at GATC Biotech AG (Konstanz, Germany) to confirm the gene sequence fidelity. For sequencing of pBud-vectors the following primers were used: CMV forward priming site: 5'-

CGC AAATGGGCGGTAGGCGTG-3 ' (SEQ ID NO: 11); BGH reverse primer: 5'- TAGAAGGCAC AGTCGAGGC-3 ' (SEQ ID NO: 12). For sequencing of pLNOH2 vectors the following primers were used: Forward 5'pLNOH2: 5 ' -TC AC AGTAGC AGGCTTG-3 ' (SEQ ID NO: 13); Reverse 3'pLNOH2: ATGGCTGGCAACTAGAAG (SEQ ID NO: 14).

Mice and cell lines

Female C57BL/6 mice and female BALB/c mice were purchased from Taconic Farms (Ry, Denmark). All mice were acclimatized to the animal research facility over 2 weeks, and used for experimentation at 5-10 weeks of age. The Norwegian Animal Research Authority authorized all animal experiments.

HEK293T (293T) cells were kindly provided by Prof. Erik Dissen. HEK293 cells stably transfected with EGFP-LC3 (EGFP-LC3⁺ 293 cells) were kindly by Prof. Anne Simonsen. HEK293E (293E) cells were purchased from ATCC (Manassas, VA, USA). Primary human peripheral blood mononuclear cells (PBMC) were kindly provided by Prof. Frode Jahnsen. All cells were cultured in RPMI 1640 (Life Technologies) supplemented with 10 % heat-inactivated FCS (Biochrom AG, Berlin, Germany), 0.1 μΜ non-essential amino acids (Lonza, Switzerland), 1 mM sodium pyruvate (Lonza), 50 μΜ monothioglycerol (Sigma-Aldrich) and 40 mg ml^"1 Genumyzin (Sanofi-Aventis Norge AS, Lysaker, Norway) (herein referred to as complete RPMI). For confocal microscopy, RPMI 1640, No Phenol Red (Life Technologies) was used. All mammalian cells were grown at 37 °C and 5 % CO2.

DNA transfection for transient protein expression

All DNA plasmids were transfected into cells using Lipfectamine LTX with PLUS- reagent (Life Technologies). Cells were seeded at a density of 1000 cells per mm³ in 24-well plates or 8-well Nunc® Lab-Tek® II Chambered Coverglass (Sigma-Aldrich). 24 h after seeding, the cells were transfected with 0.5 μg plasmid per well in 24-well plates according to the manufactures instructions (Life Technologies). Co-transfections of two plasmids were performed by using 0.25 μg DNA of each plasmid. In vitro manipulation of autophagy

293T or EGFP-LC3⁺ 293 cells were transfected at 80 % confluency in 6-well cell culture plates or 8-well Nunc® Lab-Tek® II Chambered Coverglass (Sigma- Aldrich) slides. For initial detection of p24-constructs, the cells were incubated for 3 days. For manipulation of autophagy, the growth media was changed to complete RPMI, or complete RPMI supplemented with 10 mM NH₄C1, 5 μΜ MG132 (EMD Millipore), Earl's Balanced Salt Solution (EBSS) (Life Technologies) or 5 mM 3-MA (Sigma-Aldrich), and incubated for 4 hrs before proceeding with protein extraction. For co-localization studies by confocal microscopy, the cells were kept in 10 mM NH₄CI for 12-16 hrs.

Cell culture protein extraction

For assessment of intracellular protein levels, cell cultures were washed in Phosphate Buffer Saline (PBS) (Lonza) IX, and directly lysed with 0.3 ml CytoBuster™ Protein Extraction Reagent (EMD Millipore, Billerica, MA, USA) for 15 min on ice. The ly sates were then purified by 2000 x g centrifugation for 15 min at 4 °C. The supernatants were transferred to new tubes, and proceeded for western blotting or enzyme-linked

immunosorbent assay (ELISA), or stored at 4 °C for 5 days or -20 °C for longer periods. Western Blotting

Proteins were denatured by mixing of 20 μΐ lysate with 4 μΐ of 12 % sodium dodecyl sulphate (SDS), 3 mM Tris pH 6.8, 0.05 % bromophenolblue sample loading solution, followed by incubation at 95 °C for 5 min. Samples were run on a 4-12 % Novex Tris- Glycine Gel (Life Technologies), and blotted onto a Immun-Blot™ PVDF membrane (Bio- Rad, Hercules, CA, USA) in 1 % Tween-PBS. The membranes were blocked with 4 % ECL Advance™ Blocking Reagent (GE Healthcare, Pittsburg, PA, USA) at RT for 1.5 hrs. For detection of p24-constructs, the membranes were stained with a mouse monoclonal anti-HIV- l-p24 antibody (Abeam, Cambridge, UK) (0.5 μg ml^"1) at 4 °C for 12 hrs, and an HRP- conjugated rabbit anti-mouse IgGIA antibody (Life Technologies) (1 μg ml^"1) at RT for 1.5 hrs. Membranes were developed using ECL Advance™ Western Blotting Detection Kit (GE Healthcare) and Kodak Image Station 2000R (Eastman Kodag, New Haven, CT, USA). For loading control detection, the membranes were stripped using Restore Plus Western Blot Stripping Buffer (Life Technologies) at RT for 20 min, and re-stained with a mouse monoclonal anti-a-tubulin antibody (Abeam) (0.5 μg ml^"1) at RT for 1.5 hrs, and an HRP- conjugated rabbit anti-mouse IgGIA antibody (1 μg ml^"1) at RT for 1.5 hrs. Band intensities were measured in Adobe Photoshop CS5.

3.10 EUSA

Coming^® 96 well EIA/RIA plates (Sigma- Aldrich) were coated with antibodies or ligands at 4 °C for 12 hrs, and blocked with 10 % BSA in PBS at RT for 1 hr. Samples were applied as duplicates in 3-fold serial dilutions, and incubated at RT for 2 hrs. Detection antibodies were incubated at RT for 1 hr. Streptavi din- Alkaline Phosphatase Conjugate (GE Healthcare) (1/3000) was incubated for 1 hr, followed by catalysed chemifluorescence reaction with a Phosphatase Substrate (Sigma- Aldrich) solution (3 mM p-nitrophenol phosphate in 0.1 M diethanolamine/HCl pH 9.5, 5 M magnesium chloride). The optical density (absorbance) at a wavelength of 405 nm (OD405nm) was measured with a Tecan Sunrise Microplate Reader (Tecan Austria, Gesellschaft, Salzburg, Austria). To estimate the total absorbance of each sample, a deming regression was used to calculate the best fit with the linear correlation of the dilution curve.

For detection of cell-extracted mCh-constructs, mouse monoclonal anti-mCh antibody (clone 1) (1 μg ml^"1) was used as coat, and biotinylated mouse monoclonal anti-mCh antibody (clone 2) (1 μg ml^"1) was used for detection.

For detection of secreted vaccibody molecules, mouse polyclonal anti-human IgG (C_H3-domain) (AbD Serotec, Kidlington, Oxford, UK) (2 μg ml^"1) or NIP-BSA (1 μg ml^"1) were used for coating, and biotinylated mouse monoclonal anti -human IgG Fc (Abeam) (0.5 μg ml^"1), biotinylated goat polyclonal anti-human CCL3/MIP-la antibody (R&D Systems) (0.1 μg ml^"1), biotinylated goat polyclonal anti-mouse CCL3/MIP-la antibody (R&D

Systems) (0.1 μg ml^"1), mouse monoclonal anti-HIV-l-p24 antibody (Abeam) (0.5 μg ml^"1) or goat polyclonal anti-mouse XCLl/lymphotactin antibody (R&D Systems) (1 μg ml^"1) were used for detection. For detection of p24 and XCL1, biotinylated goat polyclonal anti-mouse IgG (Sigma- Aldrich) (1/10,000) and biotinylated rabbit polyclonal anti-goat IgG (Sigma- Aldrich) (1/10,000) were used as secondary detection antibodies, respectively. Microscopy, sampling and quantitation

Fluorescence light mircographs were taken with a Nikon Eclipse Inverted Microscope (Nikon Instruments, Melville, NY, USA). Confocal micrographs were taken with an

Olympus FluoView™ FV1000 Confocal Microscope (Olympus America, Center Valley, PA, USA). All images were acquired by systematic uniform random (SUR) sampling to avoid feature bias during quantitation and selection of the data. All quantitation was performed in Image J. Image editing was performed in Image J and Adobe Photoshop CS5.

DNA vaccination

Female C67BL/6 mice or BALB/c mice were anesthetized by subcutaneous injection of Hypnorm Dormicum, and their legs were shaved. Intradermal vaccination: 25 μΐ of 0.5 μg μΓ¹ plasmid DNA in sterile 0.9 % NaCl solution (B. Braun) was injected in the dermis of both hind legs. Immediately after injection, electroporation was performed with the

DermaVax™ PA-4000S-Advanced PulseAgile, Rectangular Wave Electroporation System and Software (Glen Burnie, MD, USA) applying a temporary electric field of ten trains of electric pulses (2x (450 V cm^' V50 us) + 8x (110 Vcm^'VlO ms)) via a needle array electrode. Intramuscular vaccination: Conductive gel was applied to the area of injection, and 50 μΐ of 0.5 μg μΓ¹ plasmid DNA in sterile 0.9 % NaCl solution was injected into each quadriceps femoris of the hind leg. Immediately after injection, electroporation was performed with the Elgen electroporator device equipped with a caliper electrode (Elgen; Inovio Biomedical Co., Blue Bell, PA, USA) applying a temporary electric field of eight trains of electric pulses (200 V cm-1 /400 us).

IFN-y EUSpot

Gagp24-reactive cellular immune responses in vaccinated mice were assessed by pre- coated IFNy-ELISpot plates according to the manufacturer's protocol (Mabtech, Nacka Strand, Sweden). Splenocytes in RPMI 1640 with 10 % fetal bovine serum and Gensumycin were seeded at cell density l x lO⁶, 5 * 10⁵, and 2.5 * 10⁵ per well in duplicates, and re- stimulated with peptides in concentration 4 μg/μl for 26-28 h at 37°C. The peptides comprised the entire Gagp24, and were 15-mers with 11 -amino acid overlaps between sequential peptides. The peptides were divided in pool 1 to 5 as described by Trumpfheller et al, and each pool consisted of 9-12 peptides²³. In addition, the MHC class I restricted, H-2 Kd-binding peptide AMQMLKETI (amino acid 197-205) (GenScript) was used for re- stimulation of CD8⁺ T cells. Splenocytes cultivated in medium only, and splenocytes from mice that had received NaCl before electroporation were used as negative controls. The number of IFNy⁺ spots was determined by CTL ELISPOT reader (CTL Europe GmbH, Bonn, Germany).

Bioinformatics and statistics Sequence management and alignments were performed in CLC Sequence Viewer 6. Statistical analysis was performed in GraphPad Prism v5. Significance was accepted at p< 0.05. Results

Design of SQSTMl/p62-containing vaccine

CD8⁺ T cells play a key role in initial containment of an HIV-1 infection as well as in subsequent control of the virus (Janes H et al. Vaccine-induced gag-specific T cells are associated with reduced viremia after HIV-1 infection. J Infect Dis 2013,208: 1231-1239; Goepfert P, and Bansal A. Human immunodeficiency virus vaccines. Infect Dis Clin North Am 2014,28:615-631 ; Ndhlovu ZM et al. The Breadth of Expandable Memory CD8+ T Cells Inversely Correlates with Residual Viral Loads in HIV Elite Controllers. J Virol

2015;89(21): 10735-47). CD4⁺ T cells may be important effector cells per se, or for generation of memory CD8⁺ T cells ( Janssen EM et al. CD4+ T cells are required for secondary expansion and memory in CD8+ T lymphocytes. Nature 2003,421 :852-856;

Shedlock DJ and Shen H. Requirement for CD4 T cell help in generating functional CD8 T cell memory. Science 2003,300:337-339; Sun JC and Bevan MJ. Defective CD8 T cell memory following acute infection without CD4 T cell help. Science 2003,300:339-342). Aiming to elicit CD4⁺ and CD8⁺ T cell responses towards a broad range of of epitopes from HIV-1, Gagp24 was fused to the C-terminus of sequestosome 1 (SQSTMl)/p62 (Fig. 1A,B). To be able to track p62, it was also fused to the fluorescent molecule mCherry. Gagp24 and mCherry alone were used as controls (Fig. IB). p62 delivers vaccine antigen into the pathway of autophagy

Because HIV-1 Gag has been found in complexes with LC3 (Kyei, G.B., et al.

Autophagy pathway intersects with HIV-1 biosynthesis and regulates viral yields in macrophages. J Cell Biol 186, 255-268 (2009)), a marker protein of the autophagic pathway, the possibility that Gagp24 itself sorts to the pathway was excluded. For this purpose, HEK293 cells stably expressing EGFP-LC3, which upon induction of autophagy are observed as punctuated or vesicular structures of EGFP, serving as makers for autophagic vesicles (Mizushima, N. Methods for monitoring autophagy. Int J Biochem Cell Biol 36, 2491-2502 (2004); Kabeya, Y., et al. LC3, a mammalian homologue of yeast Apg8p, is localized in autophagosome membranes after processing. EMBO J 19, 5720-5728 (2000); Kuma, A., Matsui, M. & Mizushima, N. LC3, an autophagosome marker, can be incorporated into protein aggregates independent of autophagy: caution in the interpretation of LC3 localization. Autophagy 3, 323-328 (2007)) were used. Moreover, to make certain that LC3 as well as the transfected constructs could be visualized throughout the autophagic pathway, half of the samples were treated with NH₄C1, which prevents acidification of intracellular vesicles, and thereby protect proteins from being degraded by pH-regulated enzymes.

Transfection of DNA encoding Gagp24-mCherry into EGFP-LC3⁺ HEK293 cells followed by live cell confocal laser scanning microscopy gave a weak, uniform mCherry signal throughout the cell, indicating that Gagp24 did not sort into any particular compartment (Fig. 2A, upper panel). The same observation was made after NH₄C1 treatment of the transfected cells (Fig. 2A, second top panel). In contrast, transfection of DNA encoding p62-mCherry resulted in highly fluorescent mCherry positive foci in the cytoplasm (Fig. 2A, two lower panels), consistent with previous reports (Pankiv, S., et al. p62/SQSTMl binds directly to Atg8/LC3 to facilitate degradation of ubiquitinated protein aggregates by autophagy. J Biol Chem 282, 24131-24145 (2007). Following NH₄C1 treatment, more than 90 % of the p62- mCherry foci co-localized with EGFP-LC3⁺ puncta (Fig. 2A, lower panel, and Fig. 2D). These findings together with the observation that mCherry alone distributed evenly in the cell (data not shown), indicated that p62 altered the distribution of mCherry and efficiently targeted mCherry into the autophagic pathway.

Because both LC3 and p62 can be present as aggregates in the cytosol, it was confirmed that p62-mCherry indeed was sequestered in autophagic vesicles. For this purpose, Rab7-EGFP, a marker of late endosomes, lysosomes, amphisomes, and autolysosomes, was used. HEK293 cells were transfected with DNA encoding Gagp24-mCherry or p62-mCherry and Rab7-EGFP, and were left untreated or incubated with NH₄C1. Scanning confocal microscopy revealed that p62-mCherry co-localized with Rab7-EGFP and there was a prominent increase in the number of p62-mCherry and Rab7-EGFP double positive vesicles following NH C1 treatment (Fig. 2B). Thus, the major part of p62-mCherry was sequestered into the autophagic vesicles.

Finally, it was examined whether p62 also could target HIV-1 Gagp24 into autophagosomes. EGFP-LC3⁺ HEK293 cells were transfected with DNA plasmids encoding Gagp24 or p62-Gagp24. Half of the samples were treated with NH C1 before fixation and immunostaining of Gagp24. In Gagp24-transfected cells, Gagp24 mainly distributed evenly throughout the cell and was largely excluded from EGFP-LC3⁺ puncta (Fig. 2C, two upper panels). In contrast, but similar to what was observed for p62-mCherry, p62-Gagp24 accumulated in puncta which showed overt co-localization with EGFP-LC3 (Fig. 2C, two lower panels). Collectively these data indicate that p62 can be utilized to carry vaccine antigen into the autophagy pathway. p62 altered the level of vaccine antigen

To examine whether p62 altered the turnover and level of Gagp24, HEK293 cells were transfected with DNA encoding Gagp24 or p62-Gagp24 and treated with reagents that afflict autophagy in different ways. Rapamycin as well as starvation was utilized to induce autophagy. NH₄C1 was used to hinder acidification and thereby degradation by enzymes derived from endosomes and lysosomes, and 3-methyladenine (3-MA) was added to inhibit initiation of autophagy. After treatment with the reagents, cell lysates were subjected to SDS- PAGE and western blotting before the proteins were detected with an anti-Gagp24 antibody. Comparison of the band intensities revealed no effect of the various treatments on the level of Gagp24 in Gagp24-transfected cells (Fig. 3A,B). However, the levels of Gagp24 in p62- Gagp24-transfected cells differed significantly following the various treatments (Fig. 3A,B): When autophagy was induced by use of rapamycin or starvation, the level of Gagp24 was reduced, showing that p62-Gagp24 was degraded in mature autophagsomes, i.e.

autophagosomes that had fused with late endosomes or lysosomes. In contrast, hampering of acidification and degradation by use of NH₄C1, or blockade of initiation of autophagy by use of 3-MA, resulted in increased levels of Gagp24 (Fig. 3A,B). Moreover, the level of antigen was higher in p62-Gagp24-transfected cells than Gagp24-transfeced cells (Fig. 3A,B). Taken together, these data were consistent with the observations made by microscopy, i.e. that p62 altered the localization of Gagp24 and sorted the antigen to the pathway of autophagy.

Moreover, these experiments showed that transfection of p62-Gagp24 resulted in higher levels of Gagp24 than transfection of Gagp24 alone. Higher levels of vaccine antigen would likely be beneficial for the vaccine response. p62 protected HIV-1 Gagp24 from rapid degradation by the proteasome

Formation of aggregates and sorting into the pathway of autophagy should protect the antigen from extensive degradation by the proteasome. In order to test this, half of the transfected HEK293 cells were treated for 1, 3, and 6 hrs with MG132, an inhibitor of the proteasome (Goldberg, A.L. Development of proteasome inhibitors as research tools and cancer drugs. J Cell Biol 199, 583-588 (2012)). SDS-PAGE and western blotting of cell lysates, followed by staining with an anti-Gagp24 antibody and analysis of the intensity of the bands, revealed that inhibition of the proteasome, led to a significant increase of Gagp24 in the Gagp24-transfected cells (Fig. 4A,B). In contrast, the level of Gagp24 was similar in untreated and MG132-treated, p62-Gagp24 expressing cells (Fig. 4A,B). These data support the hypothesis that Gagp24 and p62-Gagp24 are exposed to different degradation pathways and that p62 protects Gagp24 from rapid degradation by the proteasome.

Fusion to p62 increased the number of Gagp24-reactive T cells

Given the data obtained in vitro, it was examined whether fusion of the antigen to p62 could increase the T cell responses in vivo in mice. DNA plasmids encoding Gagp24 or p62- Gagp24 were injected into the dermis of mice before electroporation, which was used to enhance uptake of the DNA. Splenocytes were harvested after 3, 5, and 7 weeks (Fig. 5 and 6), and to detect T cell immunity, a library of peptides covering the Gagp24 sequence was used. The peptides were mainly 15 amino acids in length, with 11 amino acid overlaps between sequential peptides, and were divided into 5 pools each containing 9-12 peptides. Each peptide pool was added to splenocytes, and responding T cells were detected by IFNy- ELISpot. Immunization with Gagp24 resulted in only low numbers of IFNy⁺ T cells reactive towards peptide pool 1, 3, 4, and 5, and there was a tendency of more IFNy⁺ T cells towards all peptide pools following immunization with p62-Gagp24 (Fig. 5). The mean values of the IFNy⁺ T cell responses were 2 to 14-fold higher in the p62-Gagp24-immunized mice, compared to the Gagp24-immunized mice. Furthermore, there was a significant increase in T cell responses towards pool 3 peptides both at week 5 and 7. The highest number of IFNy⁺ T cells was observed towards peptide pool 2 which included a previously defined MHC class I peptide (Gagl97-205). Fusion to p62 increased the number of Gagp24-reactive CD8⁺ T cells

Splenocytes examined for their responses towards 15-mer peptides spanning Gagp24 (described in the previous section), were also tested for their recall response towards the MHC class I restricted peptide Gagl97-205 (Mata M et al. J Immunol, 161:2985-2993 (1998)). Enumeration of IFNy⁺ ELISpot showed that p62-Gagp24 induced a significantly higher number of IFNy⁺ CD8⁺ T cells compared to Gagp24 alone (Fig. 6). Example 2

To examine whether MART-1 peptides can enter the MHC class I presentation pathway when expressed in fusion with p62, a CD8⁺ T cell line specific for MART-1 was used. Epstein Barr Virus-transformed lymphoblastoid cell lines (EBV-LCL) were used as antigen presenting cells. They were transduced with p62-MART-l or p62-Gagp24 or no construct, the latter two being negative controls. Co-incubation of the p62 -MART-1 expressing EBV-LCL and a MART-1 reactive CD8⁺ T cell line stimulated 82 % of CD8⁺ T cells to express CD 107a, a marker of activated cytotoxic CD8⁺ T cells (Fig. 8). In contrast, in cultures with EBV-LCL expressing no construct or p62-Gagp24, only 5.5 and 6.3 % of the CD8⁺ T cells were activated. The data show that MART-1 fused to p62 enters the MHC class I presentation pathway and that p62-MART-l in a specific manner induced substantial activation of cytotoxic CD8⁺ T cells.

Results are shown in Figure 8. p62MART-l activates CD8⁺ cytotoxic T cells in a specific manner. HLA-A2 positive B cells were transduced with Epstein Barr Virus (EBV) to express p62 -MART-1, p62Gagp24 or no vaccine construct. The EBV -transformed lymphoblastoid cell lines (EBV-LCL) were co-incubated with a T cell line specific for MART-1 in the presence of monensin and anti-CD 107a antibody for 5 h. The CD8⁺ T cells were gated in flow cytometry by an anti-CD8 antibody, and 82.2 % of the CD8⁺ T cells were activated by EBV-LCL expressing p62-MART-l .

All publications and patents mentioned in the above specification are herein incorporated by reference. Various modifications and variations of the described method and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in the relevant fields are intended to be within the scope of the following claims.

Claims

1. A fusion protein comprising a) sequestosome l(SQSTMl)/p62; and b) a conjugate.

2. The fusion protein of claim 1, wherein said conjugate is fused to the C-terminus of said SQSTMl/p62.

3. The fusion protein of claims 1 or 2, wherein said SQSTMl/p62 targets said fusion protein to the autophagic pathway of a subject.

4. The fusion protein of any one of claims 1 to 3, wherein said conjugate is an antigen.

5. The fusion protein of claim 4, wherein said antigen is derived from virus.

6. The fusion protein of claim 5, wherein said viral antigen is HIV Gagp24.

7. The fusion protein of claim 4, wherein said antigen is a cancer antigen.

8. The fusion protein of claim 4, wherein said fusion protein induces an immune response in a subject towards the antigen.

9. A nucleic acid encoding the polypeptide or fusion protein of any one of claims 1 to 8.

10. A host cell comprising the nucleic acid of claim 9.

11. A vaccine composition comprising the fusion protein of any one of claims 1 to 8 and a pharmaceutically acceptable carrier.

12. A method of inducing an immune response in a subject, comprising administering to the subject the vaccine composition of Claim 11 under conditions such that said subject generates an immune response.

13. The method of claim 12, wherein said vaccine is delivered to the autophagic pathway of said subject.

14. The method of claim 13, wherein said fusion protein is protected from degradation by the proteasome.

15. The method of claim 13, wherein said vaccine induces a T-cell immune response in said subject.

16. Use of the vaccine composition of Claim 11 to elicit an immune response in a subject.

17. Use of the fusion protein of any one of claims 1 to 8 in a vaccine composition.