WO2016204403A1 - Collagen-based sustained-release bmp delivery carrier comprising bisphosphonate, and production method for same - Google Patents
Collagen-based sustained-release bmp delivery carrier comprising bisphosphonate, and production method for same Download PDFInfo
- Publication number
- WO2016204403A1 WO2016204403A1 PCT/KR2016/004643 KR2016004643W WO2016204403A1 WO 2016204403 A1 WO2016204403 A1 WO 2016204403A1 KR 2016004643 W KR2016004643 W KR 2016004643W WO 2016204403 A1 WO2016204403 A1 WO 2016204403A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- collagen
- bmp
- bisphosphonate
- bone
- heparin
- Prior art date
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/66—Phosphorus compounds
- A61K31/662—Phosphorus acids or esters thereof having P—C bonds, e.g. foscarnet, trichlorfon
- A61K31/663—Compounds having two or more phosphorus acid groups or esters thereof, e.g. clodronic acid, pamidronic acid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/18—Growth factors; Growth regulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/30—Macromolecular organic or inorganic compounds, e.g. inorganic polyphosphates
- A61K47/36—Polysaccharides; Derivatives thereof, e.g. gums, starch, alginate, dextrin, hyaluronic acid, chitosan, inulin, agar or pectin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/30—Macromolecular organic or inorganic compounds, e.g. inorganic polyphosphates
- A61K47/42—Proteins; Polypeptides; Degradation products thereof; Derivatives thereof, e.g. albumin, gelatin or zein
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
- A61L27/14—Macromolecular materials
- A61L27/22—Polypeptides or derivatives thereof, e.g. degradation products
- A61L27/24—Collagen
Definitions
- the present invention relates to a collagen-based sustained release BMP (Bone Morphogenetic Protein (BMP) carrier) including a bisphosphonate and a method for preparing the same, and more specifically, to a collagen-based BMP carrier by containing bisphosphonates and optionally heparin. It relates to a collagen-based sustained release BMP transporter and a method for preparing the same that can control the release persistence, release rate and degree of release.
- BMP Bosphinetic Protein
- the present invention can increase the affinity of collagen and BMP in the collagen-based BMP transporter by containing bisphosphonates in the collagen-based BMP transporter and selectively immobilizing heparin, thereby continually releasing an appropriate concentration of BMP and It relates to a collagen-based sustained release BMP transporter and a method for preparing the same that can control the release rate and the degree of release.
- the present invention also relates to a process for inducing and promoting bone differentiation of bone marrow-derived mesenchymal stem cells by continuously releasing an appropriate concentration of BMP using a collagen-based sustained-release BMP transporter containing bisphosphonates and optionally heparin. .
- the present invention relates to a process for promoting bone formation or bone regeneration by implanting a collagen-based sustained release BMP transporter containing bisphosphonate and optionally heparin into a bone defect so that an appropriate concentration of BMP is continuously released. .
- BMP Bone Morphogenetic Protein
- BMP-1 Bone Morphogenetic Protein 1
- BMP-2 is reported to have the best osteoinductive ability.
- BMP is used to induce bone differentiation of an applied site by applying it alone or in combination with bone graft material to a site of bone injury or bone regeneration, and ultimately to promote bone formation or bone regeneration.
- BMP such as BMP-2
- BMP-2 is rapidly diffused and lost in vivo due to its water-soluble property, it is difficult to continuously apply to a desired bone injury site. Therefore, for effective bone regeneration in the field of bone regeneration medicine, a carrier capable of slowly releasing at an appropriate concentration while supporting BMP is essential.
- Biomaterials such as ⁇ -Tricalcium Phosphate ( ⁇ -TCP), fibrin-fibronectin sealing system (FFSS), Macroporous biphasic calcium phosphate (MBCP), and collagen, which have been studied, perform basic functions as BMP carriers, There is a limitation that does not meet the requirements of the ideal BMP carrier for the purpose of bone graft material used in.
- ⁇ -TCP is widely used in clinical practice as an osteoconductive bone substitute and has the property of maintaining BMP in the micropores and slowly releasing it, but has a weak sustained release.
- space maintenance ability of the defect is excellent, the moldability is poor and the rate of dissolution and absorption in the living body does not match the rate of bone regeneration, thereby preventing the formation of new bone.
- FFSS FFSS is known to have disadvantages such as new bone formation, defect closure, bone density, etc.
- the coagulated FFSS dissolves in a week and is unsuitable for sustained release BMP carriers.
- MBCP is a combination of hydroxyapatite and ⁇ -TCP in various ratios of 6: 4, 7: 3, and 8: 2, providing a framework for the slow absorption of hydroxyapatite and rapidly absorbing ⁇ -TCP. To form a space in which bone can be produced.
- MBCP has a relatively weak physical property and a slow release effect as a carrier capable of continuously releasing BMP-2.
- Collagen is a biocompatible material approved by the US FDA and the Korean Food and Drug Administration. When used as a BMP carrier, collagen generally has excellent cell adhesiveness and easy molding. However, since the affinity with BMP is relatively low, when the collagen BMP carrier is applied to a bone defect, high concentrations of BMP release may cause swelling or other problems.
- bisphosphonate is a bone resorption inhibitor that plays a role in reducing the activity of osteoclasts
- its type is for oral administration and injection
- a variety of medicinal strengths have been developed, and are typically alendronate, zoleronate, and ivan Dronate and the like are widely used for the treatment of osteoporosis and Pajese disease, suppression of bone metastasis of malignant tumors and suppressing hypercalcemia.
- bisphosphonates have been reported to have an effect of inducing bone differentiation of osteoblasts and mesenchymal stem cells.
- US Patent Publication No. US 2007/0191851 A1 discloses the use of collagen as a carrier supporting an active ingredient, and BMP, bisphosphonate, and the like as the active ingredient supported on such collagen.
- the prior art only mentions the use of bisphosphonates as osteoclast inhibitors and the use of BMPs as osteoinducers, and does not disclose anything about the effects of bisphosphonates on collagen-based transporters when combined with collagen. Or does not imply. That is, the prior art only discloses the loading of each active ingredient on the collagen carrier based on the individual efficacy of each active ingredient, and the effect of bisphosphonates on the BMP release carried on the collagen-based carrier when combined with collagen. It is not disclosed or implied at all.
- WO 2002/098307 A1 discloses a mixture of bisphosphonates and collagen, and discloses that a collagen and bisphosphonate mixture composition is coated on a bone fixation device to help treat fractures.
- the prior art also does not disclose or imply any effect on the collagen-based transporter when bisphosphonate is combined with collagen. That is, the prior art only discloses the use of bisphosphonate as an effective drug component at the fracture site, paying attention to the osteoclast suppression and osteoinduction efficacy of the bisphosphonate, and the BMP loaded on the collagen-based transporter when the bisphosphonate is combined with collagen. Unexpected effects on release, etc., are not disclosed or implied at all.
- the present inventors have continued to develop technologies for compensating the low affinity of collagen with BMP and increasing the osteoinductive capacity of BMP.
- the present invention was completed by confirming that the release persistence, the release rate, and the degree of release can be controlled and that bone formation or bone regeneration can be promoted in the bone defect.
- heparin covalently binds the free amine group of collagen and plays an important role in the binding of collagen and BMP through ionic bonds with BMP, thereby efficiently controlling BMP persistence and release rate of the collagen transporter.
- the present invention can increase the affinity of collagen and BMP in the collagen-based BMP transporter by containing bisphosphonates in the collagen-based BMP transporter and selectively immobilizing heparin, thereby continually releasing an appropriate concentration of BMP and It is an object of the present invention to provide a collagen-based sustained release BMP carrier and a method for preparing the same that can control the release rate and the degree of release thereof.
- the present invention provides a process for inducing and promoting bone differentiation of bone marrow-derived mesenchymal stem cells by continuously releasing an appropriate concentration of BMP using a collagen-based sustained release BMP transporter containing bisphosphonates and optionally heparin.
- the purpose is.
- the present invention provides a process for promoting bone formation or bone regeneration by implanting a collagen-based sustained release BMP transporter containing bisphosphonate and optionally heparin into the bone defect to continuously release an appropriate concentration of BMP.
- the purpose is.
- the inventors of the present invention provide a bisphosphonate-based drug in order to compensate the low affinity of collagen with BMP and increase the osteoinductive capacity of BMP. It has led to the design of a collagen-based sustained release BMP transporter, which optionally contains heparin.
- a collagen support obtained by mixing the collagen solution and the bisphosphonate solution and then lyophilizing, and a bisphosphonate contained in the collagen support;
- the collagen-based sustained release BMP carrier of one embodiment of the present invention can efficiently control the release sustainability, release rate and degree of release of BMP by containing bisphosphonates.
- the collagen-based sustained release BMP carrier of one embodiment of the present invention preferably further contains heparin immobilized on the collagen support containing the bisphosphonate. At this time, heparin covalently bonds with the free amine group of the collagen support and ionic bonds with the BMP, thereby playing a necessary role for binding of the collagen support to the BMP. Therefore, the collagen-based sustained release BMP transporter of one embodiment of the present invention can further control the release persistence, release rate, and degree of release of BMP by further containing heparin.
- the collagen support is preferably ionized atelo collagen from which telopeptide is removed from collagen, and more preferably, cationic collagen support.
- the cationized collagen support (or anionized collagen support) has a cation (or anion) on its surface, thereby facilitating the binding of negatively charged (or positively charged) materials to the BMP carrier. It enhances and improves cell adhesion compared to normal collagen support.
- ionized collagen encompasses cationized collagen or anionized collagen, and may be prepared by ionizing collagen prepared through pretreatment and extraction of animal tissues well known in the art.
- Ionized collagen constituting the ionized collagen based sustained release BMP transporter of one embodiment of the present invention can be obtained according to methods well known in the art.
- cationized collagen can be obtained by adding collagen to ethanol or methanol and then esterifying
- anionized collagen can be obtained by reacting collagen with succinic anhydride (US 2013/0071645 A1). And US 2014/0377737 A1).
- the present invention is not limited thereto, and any of a variety of known methods for producing cationized collagen and anionized collagen may be used.
- the bisphosphonate-containing collagen support is preferably crosslinked, and crosslinked with EDC (N- (3-Dimethylaminopropyl) -N'-ethylcarbodiimide hydrochloride) solution. More preferably.
- EDC N- (3-Dimethylaminopropyl) -N'-ethylcarbodiimide hydrochloride
- the present invention is not limited thereto, and various crosslinking materials known in the art may be used.
- the bisphosphonate-containing collagen is a solution in which heparin is dissolved in MES (4-Morpholine ethane sulfonic acid) buffer containing EDC and NHS (N-hydroxysuccinimide).
- MES 4-Morpholine ethane sulfonic acid
- NHS N-hydroxysuccinimide
- Collagen-based sustained-release BMP carriers in one embodiment of the present invention are hydroxy apatite, a mixture of hydroxy apatite and tri-calcium phosphate (TCP), tri-calcium phosphate (TCP) or animal bones, eg bovine bones, horse bones. Or may further comprise porcine bone. At this time, the bone of the animal is preferably removed from the protein and fat.
- TCP tri-calcium phosphate
- TCP tri-calcium phosphate
- animal bones eg bovine bones, horse bones. Or may further comprise porcine bone.
- the bone of the animal is preferably removed from the protein and fat.
- the present invention is not limited thereto, and any bone of an animal applicable to the human body without side effects may be used.
- a method for preparing a collagen-based sustained-release BMP carrier comprises mixing a collagen solution and a bisphosphonate solution, lyophilizing a mixed solution of a collagen solution and a bisphosphonate solution, and a bisphosphonate obtained by lyophilization. Supporting the BMP on the contained collagen support.
- the method for preparing a collagen-based sustained-release BMP carrier of an embodiment of the present invention preferably further comprises fixing heparin to the collagen support containing the bisphosphonate. At this time, heparin is covalently bonded to the free amine group of the collagen support and ionic bond with the BMP plays a necessary role for the binding of collagen and BMP.
- the collagen support is preferably ionized atelo collagen from which telopeptide is removed from collagen, and more preferably, cationic collagen support.
- the bisphosphonate-containing collagen support is preferably crosslinked, more preferably crosslinked with an EDC solution.
- the present invention is not limited thereto, and various crosslinking materials known in the art may be used.
- the bisphosphonate is a solution in which heparin is dissolved in MES (4-Morpholine ethane sulfonic acid) buffer containing EDC and NHS (N-hydroxysuccinimide).
- MES 4-Morpholine ethane sulfonic acid
- NHS N-hydroxysuccinimide
- Collagen-based sustained-release BMP delivery method of one embodiment of the present invention is a hydroxy apatite, a mixture of hydroxy apatite and TCP (tri-calcium phosphate), TCP (tri-calcium phosphate) or animal bone, for example
- the method may further include adding a bovine bone, a horse bone, or a pork bone. At this time, the bone of the animal is preferably removed from the protein and fat.
- collagen-based sustained-release BMP transporter of an embodiment of the present invention may be prepared by, for example, a method of preparing a collagen-based sustained release BMP transporter.
- the bone graft material of the present invention is characterized in that it comprises a collagen-based sustained release BMP transporter as described above.
- the bisphosphonate is alendronate (alendronate), zoleronate (zoledronate), ibandronate (ibandronate), pamidronate (pamidronate), etidronate (clodronate) , Risedronate, tiludronate, restroomonate, olpadronate and neridronate, and the like.
- the present invention is not limited thereto and various bisphosphonates known in the art may be used.
- the present invention by containing bisphosphonates and optionally heparin in the collagen-based BMP transporter, it is possible to efficiently control the release sustainability, release rate and degree of release of BMP.
- the present invention can increase the affinity of collagen and BMP in the collagen-based BMP transporter by containing bisphosphonates in the collagen-based BMP transporter and selectively immobilizing heparin, thereby continually releasing an appropriate concentration of BMP and The release rate and release rate of can be controlled efficiently.
- the BMP concentration can be continuously released to induce and promote bone differentiation of bone marrow-derived mesenchymal stem cells.
- a collagen-based sustained-release BMP transporter containing bisphosphonate and optionally heparin may be implanted into a bone defect to promote bone formation or bone regeneration by continuously releasing an appropriate concentration of BMP.
- FIG. 3 shows ionized collagen alone carrier (EC), bisphosphonate containing ionized collagen carrier (EC / A), heparin containing ionized collagen carrier (EC / H), bisphosphonate and heparin containing ionized collagen carrier (EC / A / H), culture dish (C) Alizarin Red S staining picture of bone marrow-derived mesenchymal stem cells induced on (C).
- the lower photo of FIG. 3 is a micrograph at 100 times magnification of the upper photo.
- FIG. 5 shows ionized collagen alone carrier (EC) coating, bisphosphonate containing ionized collagen carrier (EC / A) coating, heparin containing ionized collagen carrier (EC / H) coating, bisphosphonate and heparin containing ionized collagen carrier (EC / A / H)
- ALP, OCN and OPN bone formation factor
- ALP bone formation factor
- FIG. 7 is a comparative photograph taken at 4 and 8 weeks after transplanting the control group containing BMP to the ionized collagen transporter and the transporter containing BMP to the bisphosphonate and heparin containing ionized collagen, respectively, in a white skull cranial defect model.
- FIG. 8 shows a control model containing BMP in an ionized collagen transporter and a BMP-containing transporter in bisphosphonate and heparin containing ionized collagen in a white skull cranial bone defect model, respectively.
- MT Masson's trichrome
- FIG. 9 is an indicator of new bone formation in cranial defects measured at 4 and 8 weeks after implantation of ionized collagen carrier controls and bisphosphonate and heparin-containing ionized collagen carriers in a white skull cranial defect model, respectively. (tissue volume), bone volume (BV) and BV / TV.
- FIG. 10 shows Tb, an index related to new bone formation in skull defects measured at 4 and 8 weeks after implantation of ionized collagen transporters and bisphosphonate and heparin-containing ionized collagen transporters, respectively, in a rat skull bone defect model. It is a bar graph which compares and shows the trabecular thickness (Th), the trabecular number (Tb.N), and the trabecular space (Tb.Sp).
- FIG. 11 shows BMDs related to new bone formation in cranial defects measured at 4 and 8 weeks after implantation of ionized collagen transporters and bisphosphonate and heparin-containing ionized collagen transporters, respectively, in a rat skull bone defect model.
- bar graph showing bone mineral density comparisons.
- the BMP-2 release data of FIG. 12 were obtained from ionized collagen / synthetic bone carriers with mass ratios of ionized collagen and synthetic bone 100: 0, 50:50, 10:90 and 5:95, respectively, and 95: 5 (A / H) shows data obtained from ionized collagen / synthetic bone carriers containing bisphosphonates and heparin with a mass ratio of ionized collagen to synthetic bone being 95: 5.
- ionized collagen is prepared through pretreatment, extraction and ionization of animal tissues well known in the art (see, eg, US Patent Publications US 2013/0071645 A1 and US 2014/0377737 A1). Ionized collagen prepared through this known procedure is used for the preparation of ionized collagen carriers comprising bisphosphonates and optionally heparin as described below. It is preferable to use ionized atelo collagen from which telopeptide is removed as ionized collagen. Method for producing an ionized collagen carrier comprising a bisphosphonate of one embodiment of the present invention and optionally heparin is as follows.
- step (3) The ionized collagen / bisphosphonate solution obtained in step (2) was dispensed and lyophilized at ⁇ 40 ° C. for 24 hours to prepare a sponge-type bisphosphonate-containing ionized collagen carrier.
- step (8) The ionized collagen carrier obtained in step (8) is sterilized with ethylene oxide (EO) gas.
- EO ethylene oxide
- bisphosphonate / heparin containing ionized collagen ionized collagen
- step (4) Take the supernatant for each time zone in step (4) and discard the remaining PBS buffer, and then immerse the ionized collagen carrier in 2 ml of PBS buffer and store it in shaker culture again.
- step (4) The supernatant taken in step (4) was analyzed with a BMP-2 ELISA kit (Antigenix America Inc., USA) to determine the amount of BMP-2 released from the ionized collagen transporter.
- BMP-2 ELISA kit Antigenix America Inc., USA
- the bisphosphonate / heparin-containing ionized collagen carrier of the present invention delays the release of BMP, and the rate and degree of release thereof are constantly adjusted over time, compared to the ionized collagen carrier containing no bisphosphonate. . That is, the bisphosphonate / heparin-containing ionized collagen-based sustained-release BMP transporter of the present invention contains a bisphosphonate-based drug in the ionized collagen transporter, thereby maintaining sustained release of BMP in addition to promoting bone formation along with BMP and releasing BMP. Efficacy in controlling the speed constantly.
- the surface of the modified collagen has a negative charge and The binding is facilitated, and the adhesion to BMP is increased in the preparation of the BMP transporter, and the adhesion of cells is improved compared to the normal collagen.
- heparin is covalently bonded to the free amine group of collagen and the collagen and BMP are efficiently mediated by the binding of collagen and BMP through ionic bonding with BMP.
- the carrier's BMP persistence and release rate can be controlled.
- the bisphosphonate / heparin-containing sustained release collagen-based sustained release BMP carrier enhances the affinity of ionized collagen and BMP, thereby maintaining the sustained release of BMP, It can be seen that the degree of release can be controlled efficiently.
- Example 2 the release rate of BMP-2 was measured for a carrier using ionized collagen, whereas in the present example, the release rate of BMP-2 was measured using a carrier using natural collagen (unionized collagen) instead of ionizing collagen. Measured.
- the bisphosphonate / heparin-containing natural collagen transporter of the present invention delays the release of BMP compared to the natural collagen transporter containing no bisphosphonate, and its release rate and degree are constantly controlled over time.
- the bisphosphonate / heparin-containing sustained-release BMP carrier of the present invention contains bisphosphonate-based drugs in the natural collagen carrier, thereby maintaining the sustained release of BMP and releasing BMP in addition to the effect of promoting bone formation with BMP. Efficacy in controlling the speed constantly.
- heparin is covalently bonded to the free amine group of collagen and the collagen is effectively mediated by the binding of collagen and BMP through ionic bonding with BMP.
- the carrier's BMP persistence and release rate can be controlled.
- the bisphosphonate / heparin-containing sustained-release BMP transporter also enhances the affinity of natural collagen and BMP, thereby maintaining sustained release of BMP, and It can be seen that the degree of release can be controlled efficiently.
- Example 4-1 Two-dimensional Culture of Bone Marrow-derived Mesenchymal Stem Cells
- step (3) The collagen / bisphosphonate solution obtained in step (2) was dispensed into a culture dish, completely dried, crosslinked with 2 mM EDC solution dissolved in 70% ethanol for 4 hours, and washed with purified water.
- step (3) In order to fix the heparin in the culture dish prepared in step (3), incubated with a solution of 1% (w / v) heparin dissolved in 5 mM MES buffer containing 2 mM EDC and 1 mM NHS The dish is allowed to react for 4 hours. On the other hand, if heparin fixation is not required, the culture dish is reacted with 5 mM MES buffer containing 2 mM EDC and 1 mM NHS without heparin lysis.
- Example 4-2 Alizarin Red S Staining of Bone Marrow-derived Mesenchymal Stem Cells in Bone Differentiation Induction Culture (2D Culture)
- Alizarin Red S staining was performed on bone marrow-derived mesenchymal stem cells cultured on bone differentiation in sustained-release BMP carriers based on bisphosphonates / heparin containing ionized collagen to colorimetric calcification of bone differentiated cells. Also, for comparison, bone marrow derived from bone marrow induction cultured for 2 weeks in an ionized collagen alone carrier (EC), a heparin-containing ionized collagen carrier (EC / H), a culture dish (C), etc., in the same manner as in Example 4-1. Alizarin Red S staining was also performed on mesenchymal stem cells according to the following method.
- Example 4-1 The bone marrow-derived mesenchymal stem cells cultured for 2 weeks by the method of Example 4-1 were fixed with 10% formalin for 15 minutes, and then washed three times with PBS buffer.
- step (1) The cells fixed in step (1) were soaked in 2% (w / v) alizarin red S solution for 20 minutes, and then washed 5 times with PBS buffer.
- FIG. 3 ionizing collagen alone transporter (EC), bisphosphonate containing ionized collagen transporter (EC / A), heparin containing ionized collagen transporter (EC / H), and bisphosphonate and heparin containing ionization via alizarin red S staining
- EC collagen alone transporter
- EC / A bisphosphonate containing ionized collagen transporter
- EC / H heparin containing ionized collagen transporter
- C bisphosphonate and heparin containing ionization via alizarin red S staining
- the bone marrow-derived mesenchymal stem cells on the collagen transporter (EC / A / H) stained red to observe calcification due to bone differentiation.
- the bisphosphonate / heparin-containing ionized collagen-based sustained release BMP transporter can continuously release BMP, thereby inducing and promoting bone differentiation of bone marrow-derived mesenchymal stem cells.
- EC ionized collagen alone carrier
- EC / H heparin-containing ionized collagen carrier
- C culture dish
- 0.5 N HCl was also added to mesenchymal stem cells, respectively, and the amount of calcium deposition in the supernatant was measured by QuantiChrom TM calcium assay kit (BioAssay Systems, USA).
- the amount of calcium deposition in the bisphosphonate-containing ionized collagen carrier (EC / A) and the bisphosphonate- and heparin-containing ionized collagen carrier (EC / A / H) showed a significantly higher value than the ionized collagen alone carrier (EC).
- the amount of calcium deposition in the heparin-containing ionized collagen transporter (EC / H) was lower than that of the bisphosphonate-containing ionized collagen transporter (EC / A) but was generally higher than the ionized collagen alone transporter (EC).
- the bisphosphonate / heparin-containing sustained release BMP transporter can continuously release BMP, thereby inducing and promoting bone differentiation of bone marrow-derived mesenchymal stem cells, and furthermore, It can be confirmed that the bone defect may promote bone formation to bone regeneration.
- Example 4-4 Confirmation of bone formation factor expression level of bone marrow-derived mesenchymal stem cells in bone differentiation-induced culture (two-dimensional culture)
- bone formation factor expression levels of bone marrow-derived mesenchymal stem cells in bone differentiation-induced culture (two-dimensional culture) in bisphosphonate / heparin-containing sustained-release BMP carriers.
- bone differentiation-induced culture two-dimensional
- an ionized collagen alone carrier EC
- a heparin-containing ionized collagen carrier EC / H
- a culture dish C
- bone marrow-derived mesenchymal stem cells were also confirmed the amount of bone formation factor expression according to the following method.
- cDNA was obtained by reverse transcription of the total mRNA of bone marrow-derived mesenchymal stem cells extracted in step (1) using an Omniscript RT kit (Qiagen, USA).
- Primer base sequence (5 ' ⁇ 3') Target genes SEQ ID NO: 1 Forward: AGGCAGGATTGACCACGG Alkaline phosphatase (ALP) SEQ ID NO: 2 Reverse: TGTAGTTCTGCTCATGGA SEQ ID NO: 3 Forward: AAAGCCCAGCGACTCTC OCN (Osteocalcin) SEQ ID NO: 4 Reverse: CTAAACGGTGGTGCCATAGAT SEQ ID NO: 5 Forward: CGACGGCCGAGGTGATAGCTT OPN (Osteopontin) SEQ ID NO: 6 Reverse: CATGGCTGGTCTTCCCGTTGCC SEQ ID NO: 7 Forward: AACCCATCACCATCTTCCAGG Housekeeping gene (GAPDH) SEQ ID NO: 8 Reverse: GCCTTCTCCATGGTGGTGAA
- results for the bone formation gene (ALP, OCN and OPN) expression amount is shown in FIG.
- FIG. 5 generally ionized collagen alone carrier (EC) coating, bisphosphonate containing ionized collagen carrier (EC / A) coating, heparin containing ionized collagen carrier (EC / H) coating, and bisphosphonate and heparin containing ionized collagen
- the expression level of bone differentiation factor (ie, expression levels of ALP, OCN and OPN) on the carrier (EC / A / H) coating was higher than the expression level of bone differentiation factor on the culture dish (C).
- the expression level of bone differentiation factor on the bisphosphonate-containing ionized collagen transporter (EC / A) coating and the bisphosphonate- and heparin-containing ionized collagen transporter (EC / A / H) coating was statistically compared to the ionized collagen transporter alone (EC) coating. It was high with statistical significance.
- bisphosphonate containing ionized collagen transporter (EC / A) coatings showed higher expression levels of bone differentiation factor than heparin containing ionized collagen transporter (EC / H) coatings and ionized collagen alone transporter (EC) coatings.
- For the OPN gene bisphosphonate and heparin containing ionized collagen transporter (EC / A / H) coatings showed significantly higher expression levels than heparin containing ionized collagen transporter (EC / H) coatings.
- Example 4-5 Confirmation of bone formation factor expression level of bone marrow-derived mesenchymal stem cells in bone differentiation-induced culture (three-dimensional culture)
- the following process was performed to determine the bone formation factor expression level of bone marrow-derived mesenchymal stem cells in bone differentiation-induced culture (3-dimensional culture) in bisphosphonate / heparin-containing sustained-release BMP carrier. That is, ionized collagen alone carrier (EC) sponge, bisphosphonate containing ionized collagen carrier (EC / A) sponge, heparin containing ionized collagen carrier (EC / H) sponge, and bisphosphonate and heparin containing ionized collagen carrier according to the method of Example 1 A (EC / A / H) sponge was prepared.
- Each of these sponges was loaded with 10 ng of BMP-2 in the same manner as in Example 2, followed by three-dimensional culture of bone marrow-derived mesenchymal stem cells in each sponge loaded with BMP-2. Bone marrow-derived mesenchymal stem cells subjected to bone differentiation induction culture (three-dimensional culture) for 2 weeks in each sponge were confirmed in accordance with the same method as in Example 4-4.
- FIG. 6 As shown in FIG. 6, a bisphosphonate containing ionized collagen transporter (EC / A) sponge, a heparin containing ionized collagen transporter (EC / H) sponge, and a bisphosphonate and heparin containing ionized collagen transporter (EC / A / H) sponge
- the expression level of bone differentiation factor in the stomach ie, the expression levels of ALP, OCN and OPN
- the expression levels of the bisphosphonate-containing ionized collagen transporter (EC / A) sponge and the bisphosphonate and heparin-containing ionized collagen transporter (EC / A / H) sponges were compared to the ionized collagen alone transporter (EC) sponge. It was high with statistical significance.
- bisphosphonate containing ionized collagen transporter (EC / A) sponges showed higher expression levels of bone differentiation factors than heparin containing ionized collagen transporter (EC / H) sponges and ionized collagen alone transporter (EC) sponges.
- For the OCN gene bisphosphonates and heparin-containing ionized collagen transporter (EC / A / H) sponges showed significantly higher expression levels than heparin-containing ionized collagen transporter (EC / H) sponges.
- the skull model of the white paper was used to confirm the in vivo efficacy (in vivo bone formation to bone regeneration efficacy) of the bisphosphonate / heparin containing ionized collagen-based sustained release BMP transporter. Then, bone formation to bone regeneration efficacy test was performed according to the following procedure. In addition, the bone formation to bone regeneration efficacy test was performed for the ionized collagen transporter control group (without BMP and / or without bisphosphonate) for the preparation according to the following procedure.
- the surgical site of the skull is dissected and a bone defect is formed using a drill having an outer diameter of 8 mm.
- ionized collagen transporter containing bisphosphonate and heparin prepared by the method of Example 1 and an ionized collagen transporter control group are respectively filled in the white skull cranial defect formed in step (1).
- the charged collagen carrier was divided into a native collagen group consisting of ionized collagen alone, an ionized collagen transporter group containing bisphosphonates and heparin, and then each of these groups was further loaded with 40 ⁇ g of BMP-2; The test is further divided into groups not supported.
- micro-CT micro-CT photographs of the skull defects of white paper filled with collagen transporters were taken, and the tissues surrounding the graft were recovered for MT's trichrome (MT) staining. Conduct.
- the micro CT photographed as described above measures and calculates the indexes related to new bone formation of the cranial defects in which the collagen carriers are filled.
- the bisphosphonate and heparin-containing ionized collagen transporter carrying BMP was compared to the bone volume (BV) and bone volume (BV) / tissue volume (TV) (%) compared to the ionized collagen transporter carrying only BMP. It can be seen that the values of are high.
- the TV (tissue volume) value represents the amount of newly generated tissue (eg, bone and granulation tissue, soft tissue, etc.)
- the BV value represents the amount of newly generated bone tissue
- the BV / TV (%) value is It represents the proportion of bone tissue to the amount of newly created tissue. Higher BV and% TV / TV values indicate that the absolute and relative amounts of newly generated bone tissue are large.
- BMP-supported bisphosphonates and heparin-containing ionized collagen transporters are effective for bone tissue regeneration, and bone graft due to swelling phenomenon and edema in the bone graft itself, which is caused by growth promotion of peripheral tissues that are not related to bone, which is one of the problems of BMP Can reduce the spread of
- the bisphosphonate and heparin-containing ionized collagen transporter carrying BMP has a trabecular thickness (trabecular) in comparison with the ionized collagen transporter carrying only BMP.
- Tb.Th the thickness
- Tb.N the trabecular number
- Tb.Sp the trabecular space
- bisphosphonates and heparin-containing ionized collagen carriers carrying BMP can reproduce bones tightly and tightly at the skull site where bone defects occur.
- the bisphosphonate and heparin-containing ionized collagen transporter carrying BMP may have a higher BMD (bone mineral density), that is, bone density, than the ionized collagen transporter carrying only BMP.
- BMD bone mineral density
- BMD bone mineral density
- 1 standard deviation means a difference of approximately 10-15% bone density (g / cm 2 ). Therefore, bisphosphonates and heparin-containing ionized collagen carriers carrying BMPs can effectively increase bone density at the skull site where bone defects occur.
- Bisphosphonate and heparin-containing ionized collagen / synthetic bone delivery method of an embodiment of the present invention is as follows.
- synthetic bone is used as a mixture of hydroxyapatite and TCP (tri-calcium phosphate) at 6: 4 (mass ratio) (trade name: MBCP (manufactured by Keystone Dental, Inc., USA)).
- the synthetic bone is mixed with the ionized collagen solution obtained in step (1).
- the ratio of the ionized collagen and synthetic bone is 100: 0, 50:50, 10:90, 5:95 based on the mass.
- synthetic bone is mixed at a mass ratio of 5:95.
- step (3) The lyophilized mixture in step (3) was crosslinked with 5 mM EDC (N- (3-Dimethylaminopropyl) -N'-ethylcarbodiimide hydrochloride) solution dissolved in 70% ethanol for 4 hours.
- EDC N- (3-Dimethylaminopropyl) -N'-ethylcarbodiimide hydrochloride
- step (4) The carrier crosslinked in step (4) was washed 10 times with purified water for 10 minutes.
- bisphosphonate-containing ionized collagen / synthetic bone carriers contained 1% (w / w) in 5 mM MES (4-Morpholine ethane sulfonic acid) buffer containing 5 mM EDC and 1 mM NHS (N-hydroxysuccinimide) to fix heparin. Reaction with v) heparin dissolved solution for 4 hours.
- step (5) the carrier to which heparin was fixed in step (5) was washed 10 times with purified water for 10 minutes, and then frozen at -80 ° C and dried for 24 hours.
- the aspect of BMP-2 released from the ionized collagen / synthetic bone carrier of one embodiment of the present invention was measured by the following method.
- step (4) Take the supernatant for each time zone in step (4) and discard the remaining PBS buffer, and then immerse the ionized collagen / synthetic bone carrier in 2 ml of PBS buffer and store in shaker again.
- step (4) The supernatant taken in step (4) was analyzed with a BMP-2 ELISA kit (Antigenix America Inc., USA) to determine the amount of BMP-2 released from the ionized collagen / synthetic bone transporter.
- BMP-2 ELISA kit Antigenix America Inc., USA
- BMP-2 emission data were obtained from ionized collagen / synthetic bone carriers in which the mass ratios of ionized collagen and synthetic bone were 100: 0, 50:50, 10:90 and 5:95, respectively.
- the BMP-2 release data was obtained from ionized collagen / synthetic bone carrier (95: 5 (A / H)) containing a bisphosphonate and heparin with a mass ratio of 95: 5.
- the BMP-2 release pattern of the ionized collagen / synthetic bone carrier with different ratios of ionized collagen and synthetic bone was measured and found to be 773 ⁇ 60 ng (100: 0), 559 for 48 hours.
- BMP-2 was released at ⁇ 40 ng (50:50), 494 ⁇ 29 ng (10:90), and 395 ⁇ 31 ng (5:95), from which the higher the percentage of synthetic bone, the higher the release of BMP-2. You can see that the speed is delayed.
- the bisphosphonate / heparin-containing collagen-based sustained release BMP carrier of the present invention can continuously release an appropriate concentration of BMP when applied to a bone defect, thereby deriving from bone marrow.
- By inducing and promoting bone differentiation of mesenchymal stem cells can be said to have the advantage of promoting bone formation or bone regeneration in bone defects.
Abstract
The present invention provides: a collagen-based sustained-release BMP delivery carrier wherein a collagen-based BMP delivery carrier has incorporated therein a bisphosphonate, and heparin is selectively secured thereto so as to increase the affinity between the collagen and the BMP in the collagen-based BMP delivery carrier, such that an appropriate concentration of BMP can be released on a sustained basis and the BMP release rate and release extent can be adjusted; and a production method for the collagen-based sustained-release BMP delivery carrier. According to the present invention, by releasing an appropriate concentration of BMP on a sustained basis, it is possible to induce and promote bone differentiation of marrow-derived mesenchymal stem cells, and it is possible to promote bone formation or bone regeneration in a bone defect.
Description
본 발명은 비스포스포네이트를 포함하는 콜라겐 기반의 서방형 BMP(Bone Morphogenetic Protein; 골형성 단백질) 전달체 및 이의 제조방법에 관한 것으로서, 보다 상세하게는 콜라겐 기반의 BMP 전달체에 비스포스포네이트와 선택적으로 헤파린을 함유시킴으로써 BMP의 방출지속성, 방출속도 및 방출정도를 조절할 수 있는 콜라겐 기반의 서방형 BMP 전달체 및 이의 제조방법에 관한 것이다.The present invention relates to a collagen-based sustained release BMP (Bone Morphogenetic Protein (BMP) carrier) including a bisphosphonate and a method for preparing the same, and more specifically, to a collagen-based BMP carrier by containing bisphosphonates and optionally heparin. It relates to a collagen-based sustained release BMP transporter and a method for preparing the same that can control the release persistence, release rate and degree of release.
구체적으로, 본 발명은 콜라겐 기반의 BMP 전달체에 비스포스포네이트를 함유시키고 선택적으로 헤파린을 고정하여 콜라겐 기반의 BMP 전달체에서 콜라겐과 BMP의 친화성을 높임으로써, 적정 농도의 BMP를 지속적으로 방출할 수 있고 BMP의 방출속도 및 방출정도를 조절할 수 있는 콜라겐 기반의 서방형 BMP 전달체 및 이의 제조방법에 관한 것이다.Specifically, the present invention can increase the affinity of collagen and BMP in the collagen-based BMP transporter by containing bisphosphonates in the collagen-based BMP transporter and selectively immobilizing heparin, thereby continually releasing an appropriate concentration of BMP and It relates to a collagen-based sustained release BMP transporter and a method for preparing the same that can control the release rate and the degree of release.
또한, 본 발명은 비스포스포네이트와 선택적으로 헤파린을 함유한 콜라겐 기반의 서방형 BMP 전달체를 이용하여 적정 농도의 BMP를 지속적으로 방출함으로써 골수 유래 중간엽 줄기세포의 골분화를 유도 및 촉진하는 과정에 관한 것이다.The present invention also relates to a process for inducing and promoting bone differentiation of bone marrow-derived mesenchymal stem cells by continuously releasing an appropriate concentration of BMP using a collagen-based sustained-release BMP transporter containing bisphosphonates and optionally heparin. .
추가로, 본 발명은 비스포스포네이트와 선택적으로 헤파린을 함유한 콜라겐 기반의 서방형 BMP 전달체를 골결손부에 이식하여 적정 농도의 BMP가 지속적으로 방출되도록 함으로써 골형성 내지 골재생을 촉진하는 과정에 관한 것이다.In addition, the present invention relates to a process for promoting bone formation or bone regeneration by implanting a collagen-based sustained release BMP transporter containing bisphosphonate and optionally heparin into a bone defect so that an appropriate concentration of BMP is continuously released. .
골형성단백질(Bone Morphogenetic Protein)(이하, BMP로 약칭됨)은 골재생을 촉진시키는데 있어서 중요한 성장인자이며, 그 예로서는 BMP-1, BMP-2, BMP-4, BMP 7 등을 들 수 있다. 이러한 다양한 BMP들 중 BMP-2는 골유도능이 가장 우수하다고 보고되어 있다. BMP를 근육 내에 이식하면 5일 내지 7일째에 먼저 연골이 형성되고, 연골조직에 모세혈관이 침입하게 되면 연골이 흡수된 후 근육 내에 이소성(異所性) 골조직이 형성되는 것으로 알려져 있다. 따라서, BMP는 골손상 부위나 골재생이 필요한 부위에 단독으로 또는 골이식재 등과 함께 적용함으로써 적용 부위의 골분화를 유도하고, 궁극적으로는 골형성 내지는 골재생을 촉진하는데 사용된다.Bone Morphogenetic Protein (hereinafter abbreviated as BMP) is an important growth factor in promoting bone regeneration, and examples thereof include BMP-1, BMP-2, BMP-4, and BMP 7. Of these various BMPs, BMP-2 is reported to have the best osteoinductive ability. When BMP is implanted into the muscle, cartilage is first formed on the 5th to 7th day, and when capillaries invade the cartilage tissue, it is known that the cartilage is absorbed and then the heterotopic bone tissue is formed in the muscle. Therefore, BMP is used to induce bone differentiation of an applied site by applying it alone or in combination with bone graft material to a site of bone injury or bone regeneration, and ultimately to promote bone formation or bone regeneration.
그러나, BMP-2 등의 BMP는 수용성 성질로 인하여 생체 내에서 빠르게 확산되어 소실되기 때문에 원하는 골 손상 부위에 지속적인 적용에 어려움이 있다. 그러므로, 골재생 의료분야에서 효과적인 골재생을 위해서는 BMP를 담지하면서 적정 농도로 서서히 방출시킬 수 있는 전달체가 필수적이다. However, since BMP, such as BMP-2, is rapidly diffused and lost in vivo due to its water-soluble property, it is difficult to continuously apply to a desired bone injury site. Therefore, for effective bone regeneration in the field of bone regeneration medicine, a carrier capable of slowly releasing at an appropriate concentration while supporting BMP is essential.
현재 BMP의 효과적인 적용을 위한 전달체에 관한 다양한 연구들이 진행되고 있다. 기존에 연구된 β-TCP (β-Tricalcium Phosphate), FFSS (fibrin-fibronectin sealing system), MBCP (Macroporous biphasic calcium phosphate), 콜라겐 등과 같은 생체 재료는 BMP 전달체로서 기본적인 기능을 수행하지만, 골재생 의료분야에서 사용되는 골이식재의 목적에 부합하는 이상적인 BMP 전달체의 요건을 만족시키지 못하는 한계가 있다.Currently, various studies on the carrier for the effective application of BMP are in progress. Biomaterials such as β-Tricalcium Phosphate (β-TCP), fibrin-fibronectin sealing system (FFSS), Macroporous biphasic calcium phosphate (MBCP), and collagen, which have been studied, perform basic functions as BMP carriers, There is a limitation that does not meet the requirements of the ideal BMP carrier for the purpose of bone graft material used in.
예를 들어, β-TCP는 다공성을 가진 골전도성(osteoconductive)의 골대체재로 임상에서 폭 넓게 이용되고 있으며 미세공극 안에 BMP를 유지하고 천천히 유리시킬 수 있는 성질이 있으나 서방성이 약한 단점이 있다. 또, 결손부의 공간유지능이 뛰어난 반면에, 성형성이 떨어지며 생체 내에서 용해되어 흡수되는 속도가 골재생 속도와 맞지 않아 신생골 형성이 방해되는 것이 단점으로 지적되고 있다. For example, β-TCP is widely used in clinical practice as an osteoconductive bone substitute and has the property of maintaining BMP in the micropores and slowly releasing it, but has a weak sustained release. In addition, it is pointed out that while the space maintenance ability of the defect is excellent, the moldability is poor and the rate of dissolution and absorption in the living body does not match the rate of bone regeneration, thereby preventing the formation of new bone.
FFSS는 다른 전달체와 비교 시 신생골 형성량, 결손부 폐쇄량, 골밀도 등의 결과가 떨어지는 단점이 있다고 알려져 있으며 응고된 FFSS는 채내에서 일주일 후에 용해되어 서방형 BMP 전달체로서는 부적합하다.Compared with other carriers, FFSS is known to have disadvantages such as new bone formation, defect closure, bone density, etc. The coagulated FFSS dissolves in a week and is unsuitable for sustained release BMP carriers.
MBCP는 하이드록시 아파타이트(Hydroxyapatite)와 β-TCP를 6:4, 7:3, 8:2의 다양한 비율로 혼합한 전달체로서, 하이드록시 아파타이트가 천천히 흡수되면서 뼈대를 제공하고 β-TCP가 빠르게 흡수되어 골이 생성될 수 있는 공간을 형성할 수 있다. 하지만, MBCP는 비교적 약한 물성과 BMP-2를 지속적으로 방출할 수 있는 전달체로서의 서방형 효과가 작다는 단점이 있다.MBCP is a combination of hydroxyapatite and β-TCP in various ratios of 6: 4, 7: 3, and 8: 2, providing a framework for the slow absorption of hydroxyapatite and rapidly absorbing β-TCP. To form a space in which bone can be produced. However, MBCP has a relatively weak physical property and a slow release effect as a carrier capable of continuously releasing BMP-2.
콜라겐은 미국 FDA 및 우리나라 식약처의 허가를 받은 생체적합성 재료로서, BMP 전달체로 사용시 일반적으로 세포접착성이 우수하고 성형이 용이한 장점이 있다. 하지만 BMP와의 친화성이 비교적 낮으므로 콜라겐 BMP 전달체를 골결손부에 적용할 때, 고농도의 BMP 방출로 인하여 종창(swelling)이나 다른 문제점이 생길 수 있다는 단점이 있다.Collagen is a biocompatible material approved by the US FDA and the Korean Food and Drug Administration. When used as a BMP carrier, collagen generally has excellent cell adhesiveness and easy molding. However, since the affinity with BMP is relatively low, when the collagen BMP carrier is applied to a bone defect, high concentrations of BMP release may cause swelling or other problems.
따라서, 본 발명이 속하는 기술분야에서는 적정 농도의 BMP를 지속적으로 방출할 수 있고 골이식재의 목적에 부합하는 이상적인 콜라겐 기반의 BMP 전달체 개발에 대한 요구가 여전히 존재한다.Therefore, there is still a need in the art to develop an ideal collagen-based BMP transporter capable of continuously releasing an appropriate concentration of BMP and meeting the purpose of bone graft material.
한편, 비스포스포네이트는 파골세포의 활성을 떨어뜨리는 역할을 하는 골흡수 억제제로서, 그 종류에는 경구투여용과 주사용이 있고, 다양한 효능세기의 약제가 개발되어 있으며, 대표적으로 알렌드로네이트, 졸레드로네이트, 이반드로네이트 등이 있으며 골다공증 및 파제씨 병의 치료와 악성종양의 골전이 억제 및 고칼슘증억제 등의 목적으로 많이 사용되고 있다. 또한, 최근 연구에서 비스포스포네이트는 골아세포와 중간엽줄기세포 등의 골분화를 유도하는 효과를 나타내는 것이 보고되고 있다. 그러나, 종래의 연구들은 비스포스포네이트가 파골세포 억제 효능 내지는 골분화 유도 효능을 갖는다는 것에 대해 주목하고 있을 뿐, 비스포스포네이트가 콜라겐과 조합될 때 콜라겐 기반의 전달체에 대해 미치는 영향, 특히 콜라겐 기반의 전달체에 담지된 BMP 방출에 대한 영향 등에 대해서는 전혀 주목하고 있지 않고 있다.On the other hand, bisphosphonate is a bone resorption inhibitor that plays a role in reducing the activity of osteoclasts, its type is for oral administration and injection, and a variety of medicinal strengths have been developed, and are typically alendronate, zoleronate, and ivan Dronate and the like are widely used for the treatment of osteoporosis and Pajese disease, suppression of bone metastasis of malignant tumors and suppressing hypercalcemia. In recent studies, bisphosphonates have been reported to have an effect of inducing bone differentiation of osteoblasts and mesenchymal stem cells. However, previous studies have noted that bisphosphonates have osteoclast suppression or osteoblast differentiation efficacy, and the effects of bisphosphonates on collagen-based transporters, in particular collagen-based transporters, when combined with collagen. Attention has not been paid to the effects on the released BMP.
이와 관련하여 S. Panzavolta 등의 논문에서는 콜라겐과 유사한 물질인 젤라틴을 α-TCP(tricalcium phosphate) 시멘트에 포함시켜 기계적 특성을 향상시키고, 젤라틴 함유에 의해 α-TCP 시멘트에 로딩되는 비스포스포네이트의 도입량을 높이는 것에 대해 개시하고 있다[S. Panzavolta et al. Functionalization of biomimetic calcium phosphate bone cements with alendronate, Journal of Inorganic Biochemistry 104 (2010) 1099-1106]. 그러나, 상기 선행기술은 인공 골이식재인 α-TCP 시멘트에 활성 성분인 비스포스포네이트를 다량 함유시키기 위해 젤라틴을 사용하고 있고 비스포스포네이트 자체를 유효성분으로서 이용하여 파골을 억제하는 것을 개시하고 있을 뿐, 비스포스포네이트가 콜라겐과 조합될 때 콜라겐 기반의 전달체에 대해 미치는 영향, 특히 콜라겐 기반의 전달체에 담지된 BMP 방출에 대한 영향 등에 대해서는 전혀 개시하거나 암시하고 있는 바가 없다. In this paper, S. Panzavolta et al. Have suggested that gelatin, a collagen-like substance, is included in α-TCP (tricalcium phosphate) cement to improve mechanical properties and increase the amount of bisphosphonates loaded on α-TCP cement by gelatin. It is disclosed about [S. Panzavolta et al. Functionalization of biomimetic calcium phosphate bone cements with alendronate, Journal of Inorganic Biochemistry 104 (2010) 1099-1106]. However, the prior art discloses that gelatin is used to contain a large amount of bisphosphonate as an active ingredient in α-TCP cement, an artificial bone graft material, and bisphosphonate itself is used as an active ingredient to inhibit the osteoclast. When combined with the effect on the collagen-based transporter, in particular the effect on the release of BMP loaded on the collagen-based transporter, etc. is not disclosed or implied at all.
또한, 미국공개특허공보 제US 2007/0191851 A1호는 유효 성분을 담지하는 담체로서 콜라겐과, 이러한 콜라겐에 담지되는 유효 성분으로서 BMP, 비스포스포네이트 등을 사용하는 것을 개시하고 있다. 그러나, 상기 선행기술은 비스포스포네이트가 파골 억제제로서 사용되는 것과, BMP가 골유도물질로서 사용되는 것을 개별적으로 언급하고 있을 뿐, 비스포스포네이트가 콜라겐과 조합될 때 콜라겐 기반의 전달체에 대해 미치는 영향 등에 대해서는 전혀 개시하거나 암시하고 있지 않다. 즉, 상기 선행기술은 각 유효 성분의 개별적 효능에 입각하여 각 유효성분을 콜라겐 담체에 담지시키는 것을 개시하고 있을 뿐이며, 비스포스포네이트가 콜라겐과 조합될 때 콜라겐 기반의 전달체에 담지된 BMP 방출에 대해 미치는 영향 등에 대해서는 전혀 개시하거나 암시하고 있지 않다. Further, US Patent Publication No. US 2007/0191851 A1 discloses the use of collagen as a carrier supporting an active ingredient, and BMP, bisphosphonate, and the like as the active ingredient supported on such collagen. However, the prior art only mentions the use of bisphosphonates as osteoclast inhibitors and the use of BMPs as osteoinducers, and does not disclose anything about the effects of bisphosphonates on collagen-based transporters when combined with collagen. Or does not imply. That is, the prior art only discloses the loading of each active ingredient on the collagen carrier based on the individual efficacy of each active ingredient, and the effect of bisphosphonates on the BMP release carried on the collagen-based carrier when combined with collagen. It is not disclosed or implied at all.
또한, 국제공개특허공보 제WO 2002/098307 A1호는 비스포스포네이트가 콜라겐과 혼합된 것에 대해 개시하고 있고, 콜라겐과 비스포스포네이트 혼합조성을 뼈 고정기구에 코팅하여 골절부위의 치료를 도와 주는 것에 대해 개시하고 있다, 그러나, 상기 선행기술 역시 비스포스포네이트가 콜라겐과 조합될 때 콜라겐 기반의 전달체에 대해 미치는 영향 등에 대해서는 전혀 개시하거나 암시하고 있지 않다. 즉, 상기 선행기술은 비스포스포네이트의 파골 억제 효능 및 골유도 효능에 주목하여 비스포스포네이트를 골절 부위에 유효 약물 성분으로서 사용하는 것을 개시하고 있을 뿐이며, 비스포스포네이트가 콜라겐과 조합될 때 콜라겐 기반의 전달체에 담지된 BMP 방출에 대해 미치는 예기치 못한 영향 등에 대해서는 전혀 개시하거나 암시하고 있는 바가 없다.In addition, WO 2002/098307 A1 discloses a mixture of bisphosphonates and collagen, and discloses that a collagen and bisphosphonate mixture composition is coated on a bone fixation device to help treat fractures. However, the prior art also does not disclose or imply any effect on the collagen-based transporter when bisphosphonate is combined with collagen. That is, the prior art only discloses the use of bisphosphonate as an effective drug component at the fracture site, paying attention to the osteoclast suppression and osteoinduction efficacy of the bisphosphonate, and the BMP loaded on the collagen-based transporter when the bisphosphonate is combined with collagen. Unexpected effects on release, etc., are not disclosed or implied at all.
전술한 바와 같은 선행기술들의 문제점을 감안하여 본 발명자들은 콜라겐의 BMP와의 낮은 친화성을 보완하고 BMP의 골유도능을 증대하기 위한 기술 개발을 계속 거듭한 결과, 콜라겐 전달체에 비스포스포네이트를 함유시킴으로써 BMP의 방출지속성, 방출속도 및 방출정도를 조절할 수 있고, 골결손부에서 골형성 내지는 골재생을 촉진할 수 있는 것을 확인함으로써 본 발명을 완성하기에 이르렀다.In view of the problems of the prior arts described above, the present inventors have continued to develop technologies for compensating the low affinity of collagen with BMP and increasing the osteoinductive capacity of BMP. The present invention was completed by confirming that the release persistence, the release rate, and the degree of release can be controlled and that bone formation or bone regeneration can be promoted in the bone defect.
또한, 본 발명자들은 헤파린을 콜라겐의 자유아민기와 공유 결합시키고 BMP와의 이온결합을 통해 콜라겐과 BMP의 결합에 필요한 매개 역할을 하게 함으로써 효율적으로 콜라겐 전달체의 BMP 지속성과 방출 속도를 조절하는 것도 확인하였다.In addition, the present inventors have also confirmed that heparin covalently binds the free amine group of collagen and plays an important role in the binding of collagen and BMP through ionic bonds with BMP, thereby efficiently controlling BMP persistence and release rate of the collagen transporter.
본 발명은 콜라겐 기반의 BMP 전달체에 비스포스포네이트와 선택적으로 헤파린을 함유시킴으로써 BMP의 방출지속성, 방출속도 및 방출정도를 조절할 수 있는 콜라겐 기반의 서방형 BMP 전달체 및 이의 제조방법을 제공하는데 그 목적이 있다. It is an object of the present invention to provide a collagen-based sustained release BMP carrier and a method for preparing the same, which can control the release sustainability, release rate, and degree of release of BMP by containing bisphosphonates and optionally heparin in the collagen-based BMP carrier.
구체적으로, 본 발명은 콜라겐 기반의 BMP 전달체에 비스포스포네이트를 함유시키고 선택적으로 헤파린을 고정하여 콜라겐 기반의 BMP 전달체에서 콜라겐과 BMP의 친화성을 높임으로써, 적정 농도의 BMP를 지속적으로 방출할 수 있고 BMP의 방출속도 및 방출정도를 조절할 수 있는 콜라겐 기반의 서방형 BMP 전달체 및 이의 제조방법을 제공하는데 그 목적이 있다. Specifically, the present invention can increase the affinity of collagen and BMP in the collagen-based BMP transporter by containing bisphosphonates in the collagen-based BMP transporter and selectively immobilizing heparin, thereby continually releasing an appropriate concentration of BMP and It is an object of the present invention to provide a collagen-based sustained release BMP carrier and a method for preparing the same that can control the release rate and the degree of release thereof.
또한, 본 발명은 비스포스포네이트와 선택적으로 헤파린을 함유한 콜라겐 기반의 서방형 BMP 전달체를 이용하여 적정 농도의 BMP를 지속적으로 방출함으로써 골수 유래 중간엽 줄기세포의 골분화를 유도 및 촉진하는 과정을 제공하는데 그 목적이 있다. In addition, the present invention provides a process for inducing and promoting bone differentiation of bone marrow-derived mesenchymal stem cells by continuously releasing an appropriate concentration of BMP using a collagen-based sustained release BMP transporter containing bisphosphonates and optionally heparin. The purpose is.
추가로, 본 발명은 비스포스포네이트와 선택적으로 헤파린을 함유한 콜라겐 기반의 서방형 BMP 전달체를 골결손부에 이식하여 적정 농도의 BMP가 지속적으로 방출되도록 함으로써 골형성 내지 골재생을 촉진하는 과정을 제공하는데 그 목적이 있다.In addition, the present invention provides a process for promoting bone formation or bone regeneration by implanting a collagen-based sustained release BMP transporter containing bisphosphonate and optionally heparin into the bone defect to continuously release an appropriate concentration of BMP. The purpose is.
상기한 발명의 기술적 과제를 해결하고 상기한 발명의 목적에 부합되도록 예의 연구를 거듭한 결과, 본 발명자들은 콜라겐의 BMP와의 낮은 친화성을 보완하고 BMP의 골유도능을 증대하기 위해 비스포스포네이트 계열의 약물과 선택적으로 헤파린을 포함하는 콜라겐 기반의 서방형 BMP 전달체를 고안하기에 이르렀다. As a result of intensive studies to solve the technical problem of the present invention and meet the object of the invention, the inventors of the present invention provide a bisphosphonate-based drug in order to compensate the low affinity of collagen with BMP and increase the osteoinductive capacity of BMP. It has led to the design of a collagen-based sustained release BMP transporter, which optionally contains heparin.
본 발명의 일실시예의 콜라겐 기반의 서방형 BMP 전달체는,Collagen-based sustained release BMP carrier of one embodiment of the present invention,
콜라겐 용액과 비스포스포네이트 용액을 혼합한 후 동결건조하여 얻은 콜라겐 지지체와, 이러한 콜라겐 지지체에 함유된 비스포스포네이트; 및A collagen support obtained by mixing the collagen solution and the bisphosphonate solution and then lyophilizing, and a bisphosphonate contained in the collagen support; And
상기 비스포스포네이트가 함유된 콜라겐 지지체에 담지되어 미리 결정된 시간 동안 지속적으로 방출되는 BMP를 포함한다. 본 발명의 일실시예의 콜라겐 기반의 서방형 BMP 전달체는 비스포스포네이트를 함유함으로써 BMP의 방출지속성, 방출속도 및 방출정도를 효율적으로 조절할 수 있다.It contains BMP supported on the collagen support containing the bisphosphonate is released continuously for a predetermined time. The collagen-based sustained release BMP carrier of one embodiment of the present invention can efficiently control the release sustainability, release rate and degree of release of BMP by containing bisphosphonates.
본 발명의 일실시예의 콜라겐 기반의 서방형 BMP 전달체는 상기 비스포스포네이트가 함유된 콜라겐 지지체에 고정된 헤파린을 추가로 함유하는 것이 바람직하다. 이때, 헤파린은 콜라겐 지지체의 자유아민기와는 공유 결합을 하고 BMP와는 이온 결합을 함으로써 콜라겐 지지체와 BMP와의 결합에 필요한 매개 역할을 하게 된다. 따라서, 본 발명의 일실시예의 콜라겐 기반의 서방형 BMP 전달체는 헤파린을 추가로 함유함으로써 BMP의 방출지속성, 방출속도 및 방출정도를 더욱 효율적으로 조절할 수 있다.The collagen-based sustained release BMP carrier of one embodiment of the present invention preferably further contains heparin immobilized on the collagen support containing the bisphosphonate. At this time, heparin covalently bonds with the free amine group of the collagen support and ionic bonds with the BMP, thereby playing a necessary role for binding of the collagen support to the BMP. Therefore, the collagen-based sustained release BMP transporter of one embodiment of the present invention can further control the release persistence, release rate, and degree of release of BMP by further containing heparin.
본 발명의 일실시예의 콜라겐 기반의 서방형 BMP 전달체에 있어서, 상기 콜라겐 지지체는 콜라겐에서 텔로펩타이드를 제거한 아텔로 콜라겐을 이온화한 것이 바람직하며, 더욱 바람직하기로는 양이온화 콜라겐 지지체이다. 예를 들어, 양이온화 콜라겐 지지체(또는 음이온화 콜라겐 지지체)는 표면에 양이온(또는 음이온)을 띠기 때문에 음전하(또는 양전하)를 띠는 물질과의 결합이 용이하게 되며 BMP 전달체 제조시 BMP와의 결합력을 증대시키고 일반 콜라겐 지지체에 비해 세포의 부착이 향상된다.In the collagen-based sustained-release BMP carrier of an embodiment of the present invention, the collagen support is preferably ionized atelo collagen from which telopeptide is removed from collagen, and more preferably, cationic collagen support. For example, the cationized collagen support (or anionized collagen support) has a cation (or anion) on its surface, thereby facilitating the binding of negatively charged (or positively charged) materials to the BMP carrier. It enhances and improves cell adhesion compared to normal collagen support.
이와 관련하여 본 명세서에서 사용되는 용어인 "이온화 콜라겐"이란 양이온화 콜라겐 또는 음이온화 콜라겐을 포괄하는 것으로서, 당업계에 널리 알려진 동물조직의 전처리 과정 및 추출 과정을 통해 준비된 콜라겐을 이온화함으로써 제조될 수 있다. 본 발명의 일실시예의 이온화 콜라겐 기반의 서방형 BMP 전달체를 구성하는 이온화 콜라겐은 당업계에 널리 알려진 방법에 따라 수득될 수 있다. 예를 들어 양이온화 콜라겐은 에탄올 또는 메탄올에 콜라겐을 넣은 후 에스테르화 과정을 거쳐 수득될 수 있고, 음이온화 콜라겐은 콜라겐과 숙신산 무수물을 반응시켜 수득될 수 있다(미국공개특허공보 US 2013/0071645 A1 및 US 2014/0377737 A1 참조). 그러나, 본 발명은 이에 제한되는 것이 아니고, 양이온화 콜라겐 및 음이온화 콜라겐을 제조할 수 있는 다양한 공지의 방법들 중 어느 것이라도 사용가능함은 물론이다.As used herein, the term "ionized collagen" encompasses cationized collagen or anionized collagen, and may be prepared by ionizing collagen prepared through pretreatment and extraction of animal tissues well known in the art. have. Ionized collagen constituting the ionized collagen based sustained release BMP transporter of one embodiment of the present invention can be obtained according to methods well known in the art. For example, cationized collagen can be obtained by adding collagen to ethanol or methanol and then esterifying, and anionized collagen can be obtained by reacting collagen with succinic anhydride (US 2013/0071645 A1). And US 2014/0377737 A1). However, the present invention is not limited thereto, and any of a variety of known methods for producing cationized collagen and anionized collagen may be used.
본 발명의 일실시예의 콜라겐 기반의 서방형 BMP 전달체에 있어서, 상기 비스포스포네이트가 함유된 콜라겐 지지체는 가교화되는 것이 바람직하며, EDC(N-(3-Dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride) 용액으로 가교화되는 것이 더욱 바람직하다. 그러나, 본 발명은 이에 제한되는 것이 아니고 당업계에 알려진 다양한 가교물질이 사용가능될 수 있음은 물론이다.In the collagen-based sustained-release BMP carrier of one embodiment of the present invention, the bisphosphonate-containing collagen support is preferably crosslinked, and crosslinked with EDC (N- (3-Dimethylaminopropyl) -N'-ethylcarbodiimide hydrochloride) solution. More preferably. However, the present invention is not limited thereto, and various crosslinking materials known in the art may be used.
본 발명의 일실시예의 콜라겐 기반의 서방형 BMP 전달체에 있어서, EDC와 NHS(N-hydroxysuccinimide)를 포함하는 MES(4-Morpholine ethane sulfonic acid) 버퍼에 헤파린을 용해시킨 용액으로 상기 비스포스포네이트가 함유된 콜라겐 지지체를 처리함으로써, 상기 헤파린은 상기 비스포스포네이트가 함유된 콜라겐 지지체에 고정될 수 있다. In the collagen-based sustained-release BMP carrier of one embodiment of the present invention, the bisphosphonate-containing collagen is a solution in which heparin is dissolved in MES (4-Morpholine ethane sulfonic acid) buffer containing EDC and NHS (N-hydroxysuccinimide). By treating the support, the heparin can be fixed to the collagen support containing the bisphosphonate.
본 발명의 일실시예의 콜라겐 기반의 서방형 BMP 전달체는 하이드록시 아파타이트, 하이드록시 아파타이트와 TCP(tri-calcium phosphate)의 혼합물, TCP(tri-calcium phosphate) 또는 동물의 뼈, 예를 들어 소뼈, 말뼈, 또는 돼지뼈를 추가로 포함할 수 있다. 이때 동물의 뼈는 단백질과 지방을 제거한 것이 바람직하다. 그러나, 본 발명은 이에 제한되는 것이 아니고 인체에 부작용 없이 적용가능한 동물의 뼈라면 어느 것이라도 사용될 수 있음은 물론이다. Collagen-based sustained-release BMP carriers in one embodiment of the present invention are hydroxy apatite, a mixture of hydroxy apatite and tri-calcium phosphate (TCP), tri-calcium phosphate (TCP) or animal bones, eg bovine bones, horse bones. Or may further comprise porcine bone. At this time, the bone of the animal is preferably removed from the protein and fat. However, the present invention is not limited thereto, and any bone of an animal applicable to the human body without side effects may be used.
본 발명의 일실시예의 콜라겐 기반의 서방형 BMP 전달체의 제조방법은, 콜라겐 용액과 비스포스포네이트 용액을 혼합하는 단계와, 콜라겐 용액과 비스포스포네이트 용액의 혼합 용액을 동결건조하는 단계와, 동결건조하여 얻은 비스포스포네이트가 함유된 콜라겐 지지체에 BMP를 담지하는 단계를 포함한다. In one embodiment of the present invention, a method for preparing a collagen-based sustained-release BMP carrier comprises mixing a collagen solution and a bisphosphonate solution, lyophilizing a mixed solution of a collagen solution and a bisphosphonate solution, and a bisphosphonate obtained by lyophilization. Supporting the BMP on the contained collagen support.
본 발명의 일실시예의 콜라겐 기반의 서방형 BMP 전달체의 제조방법은, 상기 비스포스포네이트가 함유된 콜라겐 지지체에 헤파린을 고정하는 단계를 더 포함하는 것이 바람직하다. 이때, 헤파린은 콜라겐 지지체의 자유아민기와는 공유 결합을 하고 BMP와는 이온 결합을 함으로써 콜라겐과 BMP의 결합에 필요한 매개 역할을 하게 된다.The method for preparing a collagen-based sustained-release BMP carrier of an embodiment of the present invention preferably further comprises fixing heparin to the collagen support containing the bisphosphonate. At this time, heparin is covalently bonded to the free amine group of the collagen support and ionic bond with the BMP plays a necessary role for the binding of collagen and BMP.
본 발명의 일실시예의 콜라겐 기반의 서방형 BMP 전달체의 제조방법에 있어서, 상기 콜라겐 지지체는 콜라겐에서 텔로펩타이드를 제거한 아텔로 콜라겐을 이온화한 것이 바람직하며, 더욱 바람직하기로는 양이온화 콜라겐 지지체이다.In the method for preparing a collagen-based sustained-release BMP carrier of an embodiment of the present invention, the collagen support is preferably ionized atelo collagen from which telopeptide is removed from collagen, and more preferably, cationic collagen support.
본 발명의 일실시예의 콜라겐 기반의 서방형 BMP 전달체의 제조방법에 있어서, 상기 비스포스포네이트가 함유된 콜라겐 지지체는 가교화되는 것이 바람직하며, EDC 용액으로 가교화되는 것이 더욱 바람직하다. 그러나, 본 발명은 이에 제한되는 것이 아니고 당업계에 알려진 다양한 가교물질이 사용가능될 수 있음은 물론이다.In the method for producing a collagen-based sustained-release BMP carrier of an embodiment of the present invention, the bisphosphonate-containing collagen support is preferably crosslinked, more preferably crosslinked with an EDC solution. However, the present invention is not limited thereto, and various crosslinking materials known in the art may be used.
본 발명의 일실시예의 콜라겐 기반의 서방형 BMP 전달체의 제조방법에 있어서, EDC와 NHS(N-hydroxysuccinimide)를 포함하는 MES(4-Morpholine ethane sulfonic acid) 버퍼에 헤파린을 용해시킨 용액으로 상기 비스포스포네이트가 함유된 콜라겐 지지체를 처리함으로써, 상기 헤파린을 고정하는 단계가 수행될 수 있다.In the method for preparing a collagen-based sustained-release BMP carrier of an embodiment of the present invention, the bisphosphonate is a solution in which heparin is dissolved in MES (4-Morpholine ethane sulfonic acid) buffer containing EDC and NHS (N-hydroxysuccinimide). By treating the contained collagen support, the step of immobilizing the heparin can be performed.
본 발명의 일실시예의 콜라겐 기반의 서방형 BMP 전달체의 제조방법은 하이드록시 아파타이트, 하이드록시 아파타이트와 TCP(tri-calcium phosphate)의 혼합물, TCP(tri-calcium phosphate) 또는 동물의 뼈, 예를 들어 소뼈, 말뼈, 또는 돼지뼈를 추가하는 단계를 더 포함할 수 있다. 이때 동물의 뼈는 단백질과 지방을 제거한 것이 바람직하다. Collagen-based sustained-release BMP delivery method of one embodiment of the present invention is a hydroxy apatite, a mixture of hydroxy apatite and TCP (tri-calcium phosphate), TCP (tri-calcium phosphate) or animal bone, for example The method may further include adding a bovine bone, a horse bone, or a pork bone. At this time, the bone of the animal is preferably removed from the protein and fat.
또한, 본 발명의 일실시예의 콜라겐 기반의 서방형 BMP 전달체는 예를 들어, 전술한 바와 같은 콜라겐 기반의 서방형 BMP 전달체의 제조방법에 의해 제조된 것일 수 있다.In addition, the collagen-based sustained-release BMP transporter of an embodiment of the present invention may be prepared by, for example, a method of preparing a collagen-based sustained release BMP transporter.
추가로, 본 발명의 골이식재는 전술한 바와 같은 콜라겐 기반의 서방형 BMP 전달체를 포함하는 것을 특징으로 한다.In addition, the bone graft material of the present invention is characterized in that it comprises a collagen-based sustained release BMP transporter as described above.
한편, 본 발명에 있어서, 비스포스포네이트는 알렌드로네이트(alendronate), 졸레드로네이트(zoledronate), 이반드로네이트(ibandronate), 팔미드로네이트(pamidronate), 에티드로네이트(etidronate), 클로드로네이트(clodronate), 리세드로네이트(risedronate), 틸루드로네이트(tiludronate), 인카드로네이트(incadronate), 올파드로네이트(olpadronate) 및 네리드로네이트(neridronate) 등일 수 있다. 그러나, 본 발명은 이에 제한되는 것이 아니고 당업계에 알려진 다양한 비스포스포네이트가 사용될 수 있음은 물론이다. On the other hand, in the present invention, the bisphosphonate is alendronate (alendronate), zoleronate (zoledronate), ibandronate (ibandronate), pamidronate (pamidronate), etidronate (clodronate) , Risedronate, tiludronate, incadronate, olpadronate and neridronate, and the like. However, the present invention is not limited thereto and various bisphosphonates known in the art may be used.
본 발명에 따르면, 콜라겐 기반의 BMP 전달체에 비스포스포네이트와 선택적으로 헤파린을 함유시킴으로써 BMP의 방출지속성, 방출속도 및 방출정도를 효율적으로 조절할 수 있다. According to the present invention, by containing bisphosphonates and optionally heparin in the collagen-based BMP transporter, it is possible to efficiently control the release sustainability, release rate and degree of release of BMP.
구체적으로, 본 발명은 콜라겐 기반의 BMP 전달체에 비스포스포네이트를 함유시키고 선택적으로 헤파린을 고정하여 콜라겐 기반의 BMP 전달체에서 콜라겐과 BMP의 친화성을 높임으로써, 적정 농도의 BMP를 지속적으로 방출할 수 있고 BMP의 방출속도 및 방출정도를 효율적으로 조절할 수 있다. Specifically, the present invention can increase the affinity of collagen and BMP in the collagen-based BMP transporter by containing bisphosphonates in the collagen-based BMP transporter and selectively immobilizing heparin, thereby continually releasing an appropriate concentration of BMP and The release rate and release rate of can be controlled efficiently.
또한, 본 발명에 따르면, 비스포스포네이트와 선택적으로 헤파린을 함유한 콜라겐 기반의 서방형 BMP 전달체를 이용하여 적정 농도의 BMP를 지속적으로 방출함으로써 골수 유래 중간엽 줄기세포의 골분화를 유도 및 촉진할 수 있다.In addition, according to the present invention, by using a collagen-based sustained-release BMP transporter containing bisphosphonates and optionally heparin, the BMP concentration can be continuously released to induce and promote bone differentiation of bone marrow-derived mesenchymal stem cells. .
추가로, 본 발명에 따르면, 비스포스포네이트와 선택적으로 헤파린을 함유한 콜라겐 기반의 서방형 BMP 전달체를 골결손부에 이식하여 적정 농도의 BMP가 지속적으로 방출되도록 함으로써 골형성 내지 골재생을 촉진할 수 있다.In addition, according to the present invention, a collagen-based sustained-release BMP transporter containing bisphosphonate and optionally heparin may be implanted into a bone defect to promote bone formation or bone regeneration by continuously releasing an appropriate concentration of BMP. .
도 1은 이온화 콜라겐 단독 전달체(EC), 비스포스포네이트 함유 이온화 콜라겐 전달체(EC/A), 헤파린 함유 이온화 콜라겐 전달체(EC/H), 비스포스포네이트 및 헤파린 함유 이온화 콜라겐 전달체(EC/A/H)의 시간 경과에 따른 BMP-2 방출량을 비교하여 도시하는 그래프이다 (n=4, mean ± SE).1 is a time course of ionized collagen alone carrier (EC), bisphosphonate containing ionized collagen carrier (EC / A), heparin containing ionized collagen carrier (EC / H), bisphosphonate and heparin containing ionized collagen carrier (EC / A / H) Is a graph comparing the amount of BMP-2 released according to (n = 4, mean ± SE).
도 2는 천연 콜라겐(이온화되지 않은 콜라겐) 단독 전달체(NC), 비스포스포네이트 함유 천연 콜라겐 전달체(NC/A), 헤파린 함유 천연 콜라겐 전달체(NC/H), 비스포스포네이트 및 헤파린 함유 천연 콜라겐 전달체(NC/A/H)의 시간 경과에 따른 BMP-2 방출량을 비교하여 도시하는 그래프이다 (n=4, mean ± SE).Figure 2 shows natural collagen (unionized collagen) carrier alone (NC), bisphosphonate containing natural collagen transporter (NC / A), heparin containing natural collagen transporter (NC / H), bisphosphonate and heparin containing natural collagen transporter (NC / A) / H) is a graph comparing the amount of BMP-2 release over time (n = 4, mean ± SE).
도 3은 이온화 콜라겐 단독 전달체(EC), 비스포스포네이트 함유 이온화 콜라겐 전달체(EC/A), 헤파린 함유 이온화 콜라겐 전달체(EC/H), 비스포스포네이트 및 헤파린 함유 이온화 콜라겐 전달체(EC/A/H), 배양 접시(C) 상에서 골분화 유도된 골수 유래 중간엽 줄기세포의 알리자린 레드 에스 염색 사진이다. 도 3의 아래쪽 사진은 위쪽 사진을 100배 확대한 현미경 사진이다.3 shows ionized collagen alone carrier (EC), bisphosphonate containing ionized collagen carrier (EC / A), heparin containing ionized collagen carrier (EC / H), bisphosphonate and heparin containing ionized collagen carrier (EC / A / H), culture dish (C) Alizarin Red S staining picture of bone marrow-derived mesenchymal stem cells induced on (C). The lower photo of FIG. 3 is a micrograph at 100 times magnification of the upper photo.
도 4는 이온화 콜라겐 단독 전달체(EC), 비스포스포네이트 함유 이온화 콜라겐 전달체(EC/A), 헤파린 함유 이온화 콜라겐 전달체(EC/H), 비스포스포네이트 및 헤파린 함유 이온화 콜라겐 전달체(EC/A/H), 배양 접시(C) 상에서 골분화 유도 배양된 골수 유래 중간엽 줄기세포의 칼슘 침착량을 비교하여 도시하는 막대그래프이다 [n=3, mean ± SE; * p<0.05, ** p<0.01 (이온화 콜라겐 단독 전달체에 대한 통계학적 유의수준); # p<0.05 (모든 전달체에 대한 통계학적 유의수준)].4 shows ionized collagen alone carrier (EC), bisphosphonate containing ionized collagen carrier (EC / A), heparin containing ionized collagen carrier (EC / H), bisphosphonate and heparin containing ionized collagen carrier (EC / A / H), culture dish (C) is a histogram showing the comparison of calcium deposition of bone marrow-derived mesenchymal stem cells cultured on bone differentiation [n = 3, mean ± SE; * p <0.05, ** p <0.01 (statistic significance level for ionized collagen alone transporter); # p <0.05 (statistic significance level for all carriers)].
도 5는 이온화 콜라겐 단독 전달체(EC) 코팅, 비스포스포네이트 함유 이온화 콜라겐 전달체(EC/A) 코팅, 헤파린 함유 이온화 콜라겐 전달체(EC/H) 코팅, 비스포스포네이트 및 헤파린 함유 이온화 콜라겐 전달체(EC/A/H) 코팅, 배양 접시(C) 상에서 골분화 유도 배양(2차원 배양)된 골수 유래 중간엽 줄기세포의 골형성 인자(ALP, OCN 및 OPN) 발현량을 비교하여 도시하는 막대그래프이다 [n=3, mean ± SE; * p<0.05, ** p<0.01 (배양 접시에 대한 통계학적 유의수준); ## p<0.01 (이온화 콜라겐 단독 전달체에 대한 통계학적 유의수준)].FIG. 5 shows ionized collagen alone carrier (EC) coating, bisphosphonate containing ionized collagen carrier (EC / A) coating, heparin containing ionized collagen carrier (EC / H) coating, bisphosphonate and heparin containing ionized collagen carrier (EC / A / H) It is a histogram showing the comparison of bone formation factor (ALP, OCN and OPN) expression levels of bone marrow-derived mesenchymal stem cells in bone differentiation-induced culture (two-dimensional culture) on a coating and culture dish (C) [n = 3, mean ± SE; * p <0.05, ** p <0.01 (statistic significance level for culture dishes); ## p <0.01 (statistic significance level for ionized collagen alone transporter)].
도 6은 이온화 콜라겐 단독 전달체(EC) 스펀지, 비스포스포네이트 함유 이온화 콜라겐 전달체(EC/A) 스펀지, 헤파린 함유 이온화 콜라겐 전달체(EC/H) 스펀지, 비스포스포네이트 및 헤파린 함유 이온화 콜라겐 전달체(EC/A/H) 스펀지 상에서 골분화 유도 배양(3차원 배양)된 골수 유래 중간엽 줄기세포의 골형성 인자(ALP, OCN 및 OPN) 발현량을 비교하여 도시하는 막대그래프이다 [n=6, mean ± SE; * p<0.05, ** p<0.01 (이온화 콜라겐 단독 전달체에 대한 통계학적 유의수준)].Figure 6 shows ionized collagen alone carrier (EC) sponge, bisphosphonate containing ionized collagen carrier (EC / A) sponge, heparin containing ionized collagen carrier (EC / H) sponge, bisphosphonate and heparin containing ionized collagen carrier (EC / A / H) It is a histogram showing the comparison of bone formation factor (ALP, OCN, and OPN) expression levels of bone marrow-derived mesenchymal stem cells in bone differentiation-induced culture (three-dimensional culture) on a sponge [n = 6, mean ± SE; * p <0.05, ** p <0.01 (statistic significance level for ionized collagen alone transporter)].
도 7은 백서 두개골 골결손부 모델에 이온화 콜라겐 전달체에 BMP를 함유하는 대조군과, 비스포스포네이트 및 헤파린 함유 이온화 콜라겐에 BMP를 함유하는 전달체를 각각 이식한 후, 4주 및 8주가 경과한 시점에서 비교 촬영한 마이크로 CT(micro-CT) 사진이다.FIG. 7 is a comparative photograph taken at 4 and 8 weeks after transplanting the control group containing BMP to the ionized collagen transporter and the transporter containing BMP to the bisphosphonate and heparin containing ionized collagen, respectively, in a white skull cranial defect model. One micro-CT picture.
도 8은 백서 두개골 골결손부 모델에 이온화 콜라겐 전달체에 BMP를 함유하는 대조군과, 비스포스포네이트 및 헤파린 함유 이온화 콜라겐에 BMP를 함유하는 전달체를 각각 이식한 후, 4주 및 8주가 경과한 시점에서 시행한 MT (Masson's trichrome) 염색 사진이다.FIG. 8 shows a control model containing BMP in an ionized collagen transporter and a BMP-containing transporter in bisphosphonate and heparin containing ionized collagen in a white skull cranial bone defect model, respectively. MT (Masson's trichrome) stained picture.
도 9는 백서 두개골 골결손부 모델에 이온화 콜라겐 전달체 대조군들과, 비스포스포네이트 및 헤파린 함유 이온화 콜라겐 전달체를 각각 이식한 후, 4주 및 8주가 경과한 시점에서 측정한 두개골 결손부의 신생골 형성 관련 지표인 TV(tissue volume), BV(bone volume) 및 BV/TV를 비교하여 도시하는 막대그래프이다.FIG. 9 is an indicator of new bone formation in cranial defects measured at 4 and 8 weeks after implantation of ionized collagen carrier controls and bisphosphonate and heparin-containing ionized collagen carriers in a white skull cranial defect model, respectively. (tissue volume), bone volume (BV) and BV / TV.
도 10은 백서 두개골 골결손부 모델에 이온화 콜라겐 전달체 대조군들과, 비스포스포네이트 및 헤파린 함유 이온화 콜라겐 전달체를 각각 이식한 후, 4주 및 8주가 경과한 시점에서 측정한 두개골 결손부의 신생골 형성 관련 지표인 Tb.Th (trabecular thickness), Tb.N (trabecular number) 및 Tb.Sp (trabecular space)를 비교하여 도시하는 막대그래프이다.FIG. 10 shows Tb, an index related to new bone formation in skull defects measured at 4 and 8 weeks after implantation of ionized collagen transporters and bisphosphonate and heparin-containing ionized collagen transporters, respectively, in a rat skull bone defect model. It is a bar graph which compares and shows the trabecular thickness (Th), the trabecular number (Tb.N), and the trabecular space (Tb.Sp).
도 11은 백서 두개골 골결손부 모델에 이온화 콜라겐 전달체 대조군들과, 비스포스포네이트 및 헤파린 함유 이온화 콜라겐 전달체를 각각 이식한 후, 4주 및 8주가 경과한 시점에서 측정한 두개골 결손부의 신생골 형성 관련 지표인 BMD (bone mineral density)를 비교하여 도시하는 막대그래프이다.FIG. 11 shows BMDs related to new bone formation in cranial defects measured at 4 and 8 weeks after implantation of ionized collagen transporters and bisphosphonate and heparin-containing ionized collagen transporters, respectively, in a rat skull bone defect model. bar graph showing bone mineral density comparisons.
도 12는 이온화 콜라겐과 합성골의 비율, 그리고 비스포스포네이트 및 헤파린 함유 여부에 따른 이온화 콜라겐/합성골 전달체의 BMP-2 방출량을 비교하여 도시하는 그래프이다 (n=4, mean ± SE). 도 12의 BMP-2 방출량 데이터는 이온화 콜라겐과 합성골의 질량비가 각각 100:0, 50:50, 10:90 및 5:95인 이온화 콜라겐/합성골 전달체로부터 얻었으며, 95:5(A/H)는 이온화 콜라겐과 합성골의 질량비가 95:5이면서 비스포스포네이트 및 헤파린이 함유된 이온화 콜라겐/합성골 전달체로부터 얻은 데이터를 나타낸다.FIG. 12 is a graph comparing the ratio of ionized collagen to synthetic bone and the amount of BMP-2 release of ionized collagen / synthetic bone carrier depending on the presence of bisphosphonates and heparin (n = 4, mean ± SE). The BMP-2 release data of FIG. 12 were obtained from ionized collagen / synthetic bone carriers with mass ratios of ionized collagen and synthetic bone 100: 0, 50:50, 10:90 and 5:95, respectively, and 95: 5 (A / H) shows data obtained from ionized collagen / synthetic bone carriers containing bisphosphonates and heparin with a mass ratio of ionized collagen to synthetic bone being 95: 5.
이하에서는, 본 발명을 한정하지 않는 실시예에 따라 본 발명을 상세히 설명한다. 본 발명의 하기 실시예는 본 발명을 구체화하기 위한 것일 뿐 본 발명의 권리범위를 제한하거나 한정하는 것이 아님은 물론이다. 따라서, 본 발명의 상세한 설명 및 실시예로부터 본 발명이 속하는 기술분야의 전문가가 용이하게 유추할 수 있는 것은 본 발명의 권리범위에 속하는 것으로 해석된다. 본 발명에 인용된 참고문헌은 본 발명에 참고로서 통합된다.Hereinafter, the present invention will be described in detail according to embodiments which do not limit the present invention. The following examples of the present invention are not intended to limit or limit the scope of the present invention only to embody the present invention. Therefore, what can be easily inferred by the expert in the technical field to which this invention belongs from the detailed description and the Example of this invention is interpreted as belonging to the scope of the present invention. References cited in the present invention are incorporated herein by reference.
실시예 1: 비스포스포네이트와 선택적으로 헤파린을 포함하는 이온화 콜라겐 전달체의 제조Example 1 Preparation of Ionized Collagen Transporters Containing Bisphosphonates and Optional Heparin
우선, 이온화 콜라겐은 당업계에 널리 알려진 동물조직의 전처리 과정, 추출 과정 및 이온화 과정을 통해 제조한다(예를 들어 미국공개특허공보 US 2013/0071645 A1 및 US 2014/0377737 A1 참조). 이러한 공지의 과정을 통해 준비된 이온화 콜라겐을 아래에서 기술하는 바와 같은 비스포스포네이트와 선택적으로 헤파린을 포함하는 이온화 콜라겐 전달체의 제조에 사용한다. 이온화 콜라겐으로는 텔로펩타이드가 제거된 이온화 아텔로 콜라겐을 사용하는 것이 바람직하다. 본 발명의 일실시예의 비스포스포네이트와 선택적으로 헤파린을 포함하는 이온화 콜라겐 전달체의 제조방법은 다음과 같다.First, ionized collagen is prepared through pretreatment, extraction and ionization of animal tissues well known in the art (see, eg, US Patent Publications US 2013/0071645 A1 and US 2014/0377737 A1). Ionized collagen prepared through this known procedure is used for the preparation of ionized collagen carriers comprising bisphosphonates and optionally heparin as described below. It is preferable to use ionized atelo collagen from which telopeptide is removed as ionized collagen. Method for producing an ionized collagen carrier comprising a bisphosphonate of one embodiment of the present invention and optionally heparin is as follows.
(1) 정제수에 0~1% (w/v) 비스포스포네이트를 용해시킨다.(1) Dissolve 0-1% (w / v) bisphosphonate in purified water.
(2) 상기 (1)번 과정에서 얻은 비스포스포네이트 용액에 1% (w/v) 이온화 콜라겐을 용해시킨다.(2) 1% (w / v) ionized collagen is dissolved in the bisphosphonate solution obtained in step (1).
(3) 상기 (2)번 과정에서 얻은 이온화 콜라겐/비스포스포네이트 용액을 분주하고 -40℃로 24시간 동안 동결건조하여 스펀지 형태의 비스포스포네이트 함유 이온화 콜라겐 전달체를 제조한다.(3) The ionized collagen / bisphosphonate solution obtained in step (2) was dispensed and lyophilized at −40 ° C. for 24 hours to prepare a sponge-type bisphosphonate-containing ionized collagen carrier.
(4) 상기 (3)번 과정에서 얻은 이온화 콜라겐 전달체를 70% 에탄올에 용해시킨 2 mM EDC(N-(3-Dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride) 용액으로 4시간 동안 가교화한다.(4) The ionized collagen carrier obtained in step (3) was crosslinked for 4 hours with 2 mM EDC (N- (3-Dimethylaminopropyl) -N'-ethylcarbodiimide hydrochloride) solution dissolved in 70% ethanol.
(5) 상기 (4)번 과정에서 얻은 가교화된 이온화 콜라겐 전달체를 정제수로 10분씩 10회 세척한다.(5) The crosslinked ionized collagen carrier obtained in step (4) was washed 10 times with purified water for 10 minutes.
(6) 상기 (5)번 과정에서 얻은 이온화 콜라겐 전달체 내에 헤파린을 고정하기 위해, 2 mM EDC와 1 mM NHS(N-hydroxysuccinimide)를 포함하는 5 mM MES(4-Morpholine ethane sulfonic acid) 버퍼에 1% (w/v)의 헤파린을 용해시킨 용액으로 4시간 동안 반응시킨다. 반면에, 헤파린 고정을 필요로 하지 않는 이온화 콜라겐 전달체는 헤파린을 용해시키지 않은 2 mM EDC와 1 mM NHS를 포함하는 5 mM MES 버퍼에 반응시킨다.(6) In order to fix the heparin in the ionized collagen carrier obtained in step (5), 1 to 5 mM MES (4-Morpholine ethane sulfonic acid) buffer containing 2 mM EDC and 1 mM NHS (N-hydroxysuccinimide) 1 The solution is reacted with a solution of heparin in% (w / v) for 4 hours. On the other hand, ionized collagen transporters that do not require heparin fixation are reacted with 5 mM MES buffer containing 2 mM EDC and 1 mM NHS that did not dissolve heparin.
(7) 상기 (6)번 과정에서 MES 버퍼에 반응시킨 이온화 콜라겐 전달체를 정제수로 10분씩 10회 세척한다.(7) The ionized collagen carrier reacted with the MES buffer in step (6) was washed 10 times with purified water for 10 minutes.
(8) 상기 (7)번 과정에서 세척한 이온화 콜라겐 전달체를 -80℃로 동결한 후, 24시간 동안 건조한다.(8) After freezing the ionized collagen carrier washed in step (7) to -80 ℃, it is dried for 24 hours.
(9) 상기 (8)번 과정에서 얻은 이온화 콜라겐 전달체를 EO(Ethylene Oxide) 가스로 멸균처리한다.(9) The ionized collagen carrier obtained in step (8) is sterilized with ethylene oxide (EO) gas.
실시예 2: 이온화 콜라겐 전달체에서의 BMP-2 방출속도 비교Example 2: Comparison of BMP-2 Release Rate in Ionized Collagen Transporters
실시예 1에서 준비된 본 발명의 일실시예의 비스포스포네이트와 선택적으로 헤파린을 포함하는 이온화 콜라겐(이하, "비스포스포네이트/헤파린 함유 이온화 콜라겐"으로 표기함)에서 방출되는 BMP-2의 양상을 측정하기 위하여 아래와 같은 과정을 수행하였다.In order to measure the aspect of BMP-2 released from ionized collagen (hereinafter referred to as "bisphosphonate / heparin containing ionized collagen") containing bisphosphonate and optionally heparin of one embodiment of the present invention prepared in Example 1, The procedure was performed.
(1) PBS 완충액에 BMP-2를 50μg/ml 용해시킨다.(1) 50 μg / ml of BMP-2 is dissolved in PBS buffer.
(2) 상기 (1)번 과정에서 얻은 BMP-2 용액 100μL를 상기 실시예 1의 방법으로 제조한 이온화 콜라겐 전달체에 적신 후, 1시간 동안 상온보관한다.(2) 100 μL of the BMP-2 solution obtained in step (1) was soaked in the ionized collagen carrier prepared by the method of Example 1, and then stored at room temperature for 1 hour.
(3) 상기 (2)번 과정에서 BMP-2 용액에 적신 이온화 콜라겐 전달체를 PBS 완충액 2ml에 침지하여 37℃에서 15rpm의 조건으로 진탕배양기에서 보관한다.(3) The ionized collagen transporter soaked in BMP-2 solution in step (2) was immersed in 2 ml of PBS buffer and stored at 37 ° C. in a shaker at 15 rpm.
(4) 상기 (3)번 과정에서 이온화 콜라겐 전달체가 침지된 PBS 완충용액의 상층액을 정해진 시간대 별로 취하여 동결보존한다.(4) The supernatant of the PBS buffer in which the ionized collagen transporter was immersed in step (3) was taken at predetermined time points and cryopreserved.
(5) 상기 (4)번 과정에서 시간대 별로 상층액을 취한 후 남은 PBS 완충액을 버리고, 이온화 콜라겐 전달체를 새로이 PBS 완충액 2ml에 침지한 후 다시 진탕배양기에 보관한다.(5) Take the supernatant for each time zone in step (4) and discard the remaining PBS buffer, and then immerse the ionized collagen carrier in 2 ml of PBS buffer and store it in shaker culture again.
(6) 상기 (4)번 과정에서 취한 상층액을 BMP-2 ELISA 키트 (Antigenix America Inc., 미국)로 분석하여 이온화 콜라겐 전달체에서 방출된 BMP-2의 양을 측정한다.(6) The supernatant taken in step (4) was analyzed with a BMP-2 ELISA kit (Antigenix America Inc., USA) to determine the amount of BMP-2 released from the ionized collagen transporter.
그 결과는 도 1에 도시된 바와 같다(n=4, mean ± SE). 도 1에 도시된 바와 같이, 통상적인 이온화 콜라겐 단독 전달체(EC)에 비해 비스포스포네이트 함유 이온화 콜라겐 전달체(EC/A)와, 비스포스포네이트 및 헤파린 함유 이온화 콜라겐 전달체(EC/A/H)에서 BMP-2 방출 속도가 지연되면서 제어되는 것을 확인할 수 있다.The result is as shown in Figure 1 (n = 4, mean ± SE). As shown in FIG. 1, BMP-2 release from bisphosphonate containing ionized collagen carrier (EC / A) and bisphosphonate and heparin containing ionized collagen carrier (EC / A / H) compared to conventional ionized collagen alone carrier (EC) You can see that the speed is controlled by the delay.
이러한 결과로부터 본 발명의 비스포스포네이트/헤파린 함유 이온화 콜라겐 전달체는 비스포스포네이트를 함유하지 않는 이온화 콜라겐 전달체에 비해 BMP의 방출을 지연시키고, 그 방출 속도 및 정도가 시간의 경과에 따라 일정하게 조절되는 것을 알 수 있다. 즉, 본 발명의 비스포스포네이트/헤파린 함유 이온화 콜라겐 기반의 서방형 BMP 전달체는 이온화 콜라겐 전달체 내에 비스포스포네이트 계열의 약물을 함유시킴으로써, BMP와 함께 골형성을 촉진하는 효능 외에 BMP의 지속적인 방출을 유지하며 BMP의 방출 속도를 일정하게 제어하는 효능을 나타낸다.From these results, it can be seen that the bisphosphonate / heparin-containing ionized collagen carrier of the present invention delays the release of BMP, and the rate and degree of release thereof are constantly adjusted over time, compared to the ionized collagen carrier containing no bisphosphonate. . That is, the bisphosphonate / heparin-containing ionized collagen-based sustained-release BMP transporter of the present invention contains a bisphosphonate-based drug in the ionized collagen transporter, thereby maintaining sustained release of BMP in addition to promoting bone formation along with BMP and releasing BMP. Efficacy in controlling the speed constantly.
또한, 본 발명의 비스포스포네이트/헤파린 함유 이온화 콜라겐 기반의 서방형 BMP 전달체에서는 콜라겐을 메탄올 또는 에탄올 등으로 화학적 처리를 함으로써 양이온화한 경우에 변형된 콜라겐의 표면이 양이온을 띠기 때문에 음전하를 띠는 물질과의 결합이 용이하게 되며, BMP 전달체 제조시 BMP와의 결합력을 증대시키고 일반 콜라겐에 비해 세포의 부착이 향상된다.In addition, in the bisphosphonate / heparin-containing ionized collagen-based sustained-release BMP carrier of the present invention, when the collagen is cationicly treated by chemical treatment with methanol or ethanol, the surface of the modified collagen has a negative charge and The binding is facilitated, and the adhesion to BMP is increased in the preparation of the BMP transporter, and the adhesion of cells is improved compared to the normal collagen.
뿐만아니라, 본 발명의 비스포스포네이트/헤파린 함유 이온화 콜라겐 기반의 서방형 BMP 전달체에서는 헤파린을 콜라겐의 자유아민기와 공유 결합시키고 BMP와의 이온결합을 통해 콜라겐과 BMP의 결합에 필요한 매개 역할을 하게 함으로써 효율적으로 콜라겐 전달체의 BMP 지속성과 방출 속도를 조절할 수 있다.In addition, in the bisphosphonate / heparin-containing ionized collagen-based sustained-release BMP transporter of the present invention, heparin is covalently bonded to the free amine group of collagen and the collagen and BMP are efficiently mediated by the binding of collagen and BMP through ionic bonding with BMP. The carrier's BMP persistence and release rate can be controlled.
이러한 결과들을 종합할 때, 본 실시예에서는 비스포스포네이트/헤파린 함유 이온화 콜라겐 기반의 서방형 BMP 전달체가 이온화 콜라겐과 BMP의 친화성을 높임으로써, BMP의 방출 지속성을 유지할 수 있고, 또한 BMP의 방출 속도 및 방출 정도를 효율적으로 조절할 수 있음을 확인할 수 있다.Putting these results together, in this example, the bisphosphonate / heparin-containing sustained release collagen-based sustained release BMP carrier enhances the affinity of ionized collagen and BMP, thereby maintaining the sustained release of BMP, It can be seen that the degree of release can be controlled efficiently.
실시예 3: 천연 콜라겐 전달체에서의 rhBMP-2 방출속도 비교Example 3: Comparison of rhBMP-2 Release Rate in Natural Collagen Transporters
실시예 2에서는 이온화 콜라겐을 이용한 전달체에 대해 BMP-2 방출속도를 측정한 반면에, 본 실시예에서는 이온화 콜라겐 대신에 천연 콜라겐(이온화되지 않은 콜라겐)을 이용한 전달체를 이용하여 BMP-2 방출 속도를 측정하였다. In Example 2, the release rate of BMP-2 was measured for a carrier using ionized collagen, whereas in the present example, the release rate of BMP-2 was measured using a carrier using natural collagen (unionized collagen) instead of ionizing collagen. Measured.
이온화 콜라겐을 이용하는 대신에 천연 콜라겐을 사용하는 것을 제외하고는 실시예 1의 방법에 따라 천연 콜라겐 단독 전달체(NC) 스펀지, 비스포스포네이트 함유 천연 콜라겐 전달체(NC/A) 스펀지, 헤파린 함유 천연 콜라겐 전달체(NC/H) 스펀지, 그리고 비스포스포네이트 및 헤파린 함유 천연 콜라겐 전달체(NC/A/H) 스펀지를 준비한다. Natural collagen alone carrier (NC) sponge, bisphosphonate containing natural collagen carrier (NC / A) sponge, heparin containing natural collagen carrier according to the method of Example 1, except using natural collagen instead of using ionized collagen. / H) sponges and bisphosphonates and heparin-containing natural collagen carrier (NC / A / H) sponges are prepared.
준비된 전달체 스펀지 각각에 5μg의 rhBMP-2를 담지시킨 후 PBS/CaCl2 완충액 2ml(2.5mM Ca2+)에 침지하여 37℃에서 15rpm의 조건으로 진탕배양기에서 보관한다. 그리고 나서, 실시예 2와 같은 방법으로 각 시간대 별(0.5, 1, 2, 4, 8, 12, 24, 48 시간)로 상층액을 취하여 보관한 후 BMP-2의 양을 측정한다.5 μg of rhBMP-2 was loaded on each of the prepared carrier sponges, and then immersed in 2 ml (2.5 mM Ca 2+ ) PBS / CaCl 2 buffer and stored at 37 ° C. in a shaker at 15 rpm. Then, the supernatant was taken for each time slot (0.5, 1, 2, 4, 8, 12, 24, 48 hours) in the same manner as in Example 2, and the amount of BMP-2 was measured.
그 결과는 도 2에 도시된 바와 같다(n=4, mean ± SE). 도 2에 도시된 바와 같이, 천연 콜라겐 단독 전달체(NC)에 비해 비스포스포네이트 함유 천연 콜라겐 전달체(NC/A)와, 비스포스포네이트 및 헤파린 함유 천연 콜라겐 전달체(NC/A/H)에서 BMP-2 방출 속도가 지연되면서 제어되는 것을 확인할 수 있다. 즉, 천연 콜라겐을 기초로 한 비스포스포네이트/헤파린 함유 전달체 역시 이온화 콜라겐을 기초로 한 비스포스포네이트/헤파린 함유 전달체에 대등한 BMP-2 방출 지연 효과를 나타내는 것을 알 수 있다. The results are as shown in Figure 2 (n = 4, mean ± SE). As shown in FIG. 2, the rate of BMP-2 release in bisphosphonate containing natural collagen transporter (NC / A) and bisphosphonate and heparin containing natural collagen transporter (NC / A / H) compared to natural collagen alone transporter (NC) You can see that it is controlled with delay. In other words, it can be seen that the bisphosphonate / heparin-containing transporter based on natural collagen also exhibits a comparable delayed BMP-2 release effect to the bisphosphonate / heparin-containing transporter based on ionized collagen.
이러한 결과로부터 본 발명의 비스포스포네이트/헤파린 함유 천연 콜라겐 전달체는 비스포스포네이트를 함유하지 않는 천연 콜라겐 전달체에 비해 BMP의 방출을 지연시키고, 그 방출 속도 및 정도가 시간의 경과에 따라 일정하게 조절되는 것을 알 수 있다. 즉, 본 발명의 비스포스포네이트/헤파린 함유 천연 콜라겐 기반의 서방형 BMP 전달체는 천연 콜라겐 전달체 내에 비스포스포네이트 계열의 약물을 함유시킴으로써, BMP와 함께 골형성을 촉진하는 효능 외에 BMP의 지속적인 방출을 유지하며 BMP의 방출 속도를 일정하게 제어하는 효능을 나타낸다.From these results, it can be seen that the bisphosphonate / heparin-containing natural collagen transporter of the present invention delays the release of BMP compared to the natural collagen transporter containing no bisphosphonate, and its release rate and degree are constantly controlled over time. . That is, the bisphosphonate / heparin-containing sustained-release BMP carrier of the present invention contains bisphosphonate-based drugs in the natural collagen carrier, thereby maintaining the sustained release of BMP and releasing BMP in addition to the effect of promoting bone formation with BMP. Efficacy in controlling the speed constantly.
뿐만아니라, 본 발명의 비스포스포네이트/헤파린 함유 천연 콜라겐 기반의 서방형 BMP 전달체에서는 헤파린을 콜라겐의 자유아민기와 공유 결합시키고 BMP와의 이온결합을 통해 콜라겐과 BMP의 결합에 필요한 매개 역할을 하게 함으로써 효율적으로 콜라겐 전달체의 BMP 지속성과 방출 속도를 조절할 수 있다.In addition, in the bisphosphonate / heparin-containing natural collagen-based sustained-release BMP transporter of the present invention, heparin is covalently bonded to the free amine group of collagen and the collagen is effectively mediated by the binding of collagen and BMP through ionic bonding with BMP. The carrier's BMP persistence and release rate can be controlled.
이러한 결과들을 종합할 때, 본 실시예에서는 비스포스포네이트/헤파린 함유 천연 콜라겐 기반의 서방형 BMP 전달체 역시 천연 콜라겐과 BMP의 친화성을 높임으로써, BMP의 방출 지속성을 유지할 수 있고, 또한 BMP의 방출 속도 및 방출 정도를 효율적으로 조절할 수 있음을 확인할 수 있다.Putting these results together, in this embodiment, the bisphosphonate / heparin-containing sustained-release BMP transporter also enhances the affinity of natural collagen and BMP, thereby maintaining sustained release of BMP, and It can be seen that the degree of release can be controlled efficiently.
실시예 4: 비스포스포네이트/헤파린을 포함하는 이온화 콜라겐 기반의 서방형 BMP 전달체에서 골수 유래 중간엽 줄기세포의 골분화 확인 시험Example 4 Bone Differentiation Identification Test of Bone Marrow-derived Mesenchymal Stem Cells in Ionized Collagen-Based Sustained Release BMP Transporter Containing Bisphosphonate / Heparin
본 실시예에서는 비스포스포네이트/헤파린 함유 이온화 콜라겐 기반의 서방형 BMP 전달체 상에서의 골수 유래 중간엽 줄기세포의 골분화 효능을 확인하기 위하여 아래와 같은 시험관내 시험을 실시하였다.In this example, the following in vitro tests were performed to confirm the bone differentiation efficacy of bone marrow-derived mesenchymal stem cells on bisphosphonate / heparin-containing ionized collagen-based sustained release BMP transporters.
실시예 4-1: 골수 유래 중간엽 줄기세포의 2차원 배양Example 4-1: Two-dimensional Culture of Bone Marrow-derived Mesenchymal Stem Cells
(1) 정제수에 0~1% (w/v) 비스포스포네이트를 용해시킨다.(1) Dissolve 0-1% (w / v) bisphosphonate in purified water.
(2) 상기 (1)번 과정에서 얻은 비스포스포네이트 용액에 1% (w/v) 이온화 콜라겐을 용해시킨다.(2) 1% (w / v) ionized collagen is dissolved in the bisphosphonate solution obtained in step (1).
(3) 상기 (2)번 과정에서 얻은 콜라겐/비스포스포네이트 용액을 배양접시에 분주하여 완전히 건조한 후, 70% 에탄올에 용해시킨 2 mM EDC용액으로 4시간 동안 가교화하고 정제수로 세척한다.(3) The collagen / bisphosphonate solution obtained in step (2) was dispensed into a culture dish, completely dried, crosslinked with 2 mM EDC solution dissolved in 70% ethanol for 4 hours, and washed with purified water.
(4) 상기 (3)번 과정에서 준비된 배양접시에 헤파린을 고정하기 위해, 2 mM EDC와 1 mM NHS를 포함하는 5 mM MES 버퍼에 1% (w/v)의 헤파린을 용해시킨 용액으로 배양접시를 4시간 반응시킨다. 반면에, 헤파린 고정을 필요로 하지 않는 경우, 헤파린을 용해시키지 않은 2 mM EDC와 1 mM NHS를 포함하는 5 mM MES 버퍼에 배양접시를 반응시킨다.(4) In order to fix the heparin in the culture dish prepared in step (3), incubated with a solution of 1% (w / v) heparin dissolved in 5 mM MES buffer containing 2 mM EDC and 1 mM NHS The dish is allowed to react for 4 hours. On the other hand, if heparin fixation is not required, the culture dish is reacted with 5 mM MES buffer containing 2 mM EDC and 1 mM NHS without heparin lysis.
(5) 상기 (4)번 과정에서 준비된 배양접시를 PBS 완충액으로 세척한다.(5) wash the culture plate prepared in step (4) with PBS buffer.
(6) 상기 (5)번 과정에서 세척된 배양접시에 SD 래트(Sprague Dawley rat)에서 분리한 골수 유래 중간엽 줄기세포 1×104 개를 접종하여 37℃의 CO2 배양기에서 골분화를 유도하면서 배양한다. 여기서, 골분화 유도 배양을 위한 배양액으로 10% FBS(Fetal Bovine Serum)와 1% 항생제를 포함하는 DMEM(Dulbecco's Modified Eagle's Medium; 고농도 글루코오스)에 골분화 유도제 (10-8 M 덱사메타손, 50 μg/ml 아스코르브산, 10 mM β-글리세로포스페이트)를 추가하여 사용한다. 배양하는 동안 2-3일마다 배양액을 교체한다.(6) Inoculate 1 × 10 4 bone marrow-derived mesenchymal stem cells isolated from SD rats (Sprague Dawley rat) in the culture dish washed in step (5) to induce bone differentiation in a CO 2 incubator at 37 ° C. Incubate while Here, bone differentiation inducing agent (10 -8 M dexamethasone, 50 μg / ml in DMEM (Dulbecco's Modified Eagle's Medium; high glucose) containing 10% FBS (Fetal Bovine Serum) and 1% antibiotic as a culture medium for bone differentiation induction culture Ascorbic acid, 10 mM β-glycerophosphate) is added and used. Change the culture every 2-3 days during the incubation.
실시예 4-2: 골분화 유도 배양(2차원 배양)된 골수 유래 중간엽 줄기세포의 알리자린 레드 에스 염색Example 4-2: Alizarin Red S Staining of Bone Marrow-derived Mesenchymal Stem Cells in Bone Differentiation Induction Culture (2D Culture)
골분화된 세포의 석회화를 비색정량하기 위하여 비스포스포네이트/헤파린 함유 이온화 콜라겐 기반의 서방형 BMP 전달체에서 골분화 유도 배양된 골수 유래 중간엽 줄기세포에 대한 알리자린 레드 에스 염색을 하기와 같이 실시하였다. 또한, 대비를 위해 실시예 4-1과 동일한 방법으로 이온화 콜라겐 단독 전달체(EC), 헤파린 함유 이온화 콜라겐 전달체(EC/H), 및 배양 접시(C) 등에서 2주 동안 골분화 유도 배양된 골수 유래 중간엽 줄기세포에 대해서도 하기와 같은 방법에 따라 알리자린 레드 에스 염색을 실시하였다. Alizarin Red S staining was performed on bone marrow-derived mesenchymal stem cells cultured on bone differentiation in sustained-release BMP carriers based on bisphosphonates / heparin containing ionized collagen to colorimetric calcification of bone differentiated cells. Also, for comparison, bone marrow derived from bone marrow induction cultured for 2 weeks in an ionized collagen alone carrier (EC), a heparin-containing ionized collagen carrier (EC / H), a culture dish (C), etc., in the same manner as in Example 4-1. Alizarin Red S staining was also performed on mesenchymal stem cells according to the following method.
(1) 실시예 4-1의 방법으로 2주 동안 배양한 골수 유래 중간엽 줄기세포를 10% 포르말린으로 15분간 고정한 후, PBS 완충액으로 3회 세척한다.(1) The bone marrow-derived mesenchymal stem cells cultured for 2 weeks by the method of Example 4-1 were fixed with 10% formalin for 15 minutes, and then washed three times with PBS buffer.
(2) 상기 (1)번 과정에서 고정된 세포를 2% (w/v) 알리자린 레드 에스 용액에 20분간 침지한 후, PBS 완충액으로 5회 세척한다.(2) The cells fixed in step (1) were soaked in 2% (w / v) alizarin red S solution for 20 minutes, and then washed 5 times with PBS buffer.
그 결과가 도 3에 도시되어 있다. 도 3에 도시된 바와 같이, 알리자린 레드 에스 염색을 통하여 이온화 콜라겐 단독 전달체(EC), 비스포스포네이트 함유 이온화 콜라겐 전달체(EC/A), 헤파린 함유 이온화 콜라겐 전달체(EC/H), 그리고 비스포스포네이트 및 헤파린 함유 이온화 콜라겐 전달체(EC/A/H) 상에서의 골수 유래 중간엽 줄기세포가 붉게 염색됨으로써 골분화로 인한 석회화를 관찰하였다. 이들 결과는 배양접시(C)에서 배양한 줄기세포에 대한 염색 결과에 비해 확연한 차이를 나타내었다. 또한, 알리자린 레드 에스 염색 결과, 비스포스포네이트 함유 이온화 콜라겐 전달체(EC/A)와 비스포스포네이트 및 헤파린 함유 이온화 콜라겐 전달체(EC/A/H)가 이온화 콜라겐 단독 전달체(EC) 및 헤파린 함유 이온화 콜라겐 전달체(EC/H) 보다 더 붉은 색을 나타내는 것을 확인할 수 있다.The result is shown in FIG. As shown in FIG. 3, ionizing collagen alone transporter (EC), bisphosphonate containing ionized collagen transporter (EC / A), heparin containing ionized collagen transporter (EC / H), and bisphosphonate and heparin containing ionization via alizarin red S staining The bone marrow-derived mesenchymal stem cells on the collagen transporter (EC / A / H) stained red to observe calcification due to bone differentiation. These results showed a marked difference compared to the staining results for stem cells cultured in the culture dish (C). In addition, Alizarin Red S staining showed that the bisphosphonate-containing ionized collagen transporter (EC / A) and the bisphosphonate- and heparin-containing ionized collagen transporter (EC / A / H) were the ionized collagen alone transporter (EC) and the heparin-containing ionized collagen transporter (EC / A). It can be seen that the color is more red than H).
이러한 결과들로부터 본 실시예에서는 비스포스포네이트/헤파린 함유 이온화 콜라겐 기반의 서방형 BMP 전달체가 BMP를 지속적으로 방출할 수 있고, 이로써 골수 유래 중간엽 줄기세포의 골분화를 유도 및 촉진할 수 있다는 것을 알 수 있다.From these results, it can be seen that in this Example, the bisphosphonate / heparin-containing ionized collagen-based sustained release BMP transporter can continuously release BMP, thereby inducing and promoting bone differentiation of bone marrow-derived mesenchymal stem cells. have.
실시예 4-3: 골분화 유도 배양(2차원 배양)된 골수 유래 중간엽 줄기세포의 칼슘 침착 정량Example 4-3 Quantification of Calcium Deposition of Bone Marrow-derived Mesenchymal Stem Cells in Bone Differentiation Induction Culture (2D Culture)
비스포스포네이트/헤파린 함유 이온화 콜라겐 기반의 서방형 BMP 전달체에서 골분화 유도 배양된 골수 유래 중간엽 줄기세포의 칼슘 침착량을 확인하기 위하여 실시예 4-1의 방법으로 2주 동안 배양한 골수 유래 중간엽 줄기세포에 0.5 N HCl을 가하고 그 상층액의 칼슘 침착량을 QuantiChromTM 칼슘 어세이 키트(QuantiChromTM Calcium Assay Kit)(BioAssay Systems, 미국)로 측정하였다. 또한, 대비를 위해 실시예 4-1과 동일한 방법으로 이온화 콜라겐 단독 전달체(EC), 헤파린 함유 이온화 콜라겐 전달체(EC/H), 및 배양 접시(C) 등에서 2주 동안 골분화 유도 배양된 골수 유래 중간엽 줄기세포에 대해서도 각각 0.5 N HCl을 가하고 그 상층액의 칼슘 침착량을 QuantiChromTM 칼슘 어세이 키트(BioAssay Systems, 미국)로 측정하였다. Bone marrow-derived mesenchymal stem cells cultured for 2 weeks by the method of Example 4-1 to determine the calcium deposition amount of bone marrow-derived mesenchymal stem cells cultured in bone differentiation in bisphosphonate / heparin-containing sustained-release BMP carriers was measured in the 0.5 N HCl was added to the calcium deposition in the supernatant QuantiChrom TM calcium assay kit (QuantiChrom TM calcium assay kit) (BioAssay Systems, USA). Also, for comparison, bone marrow derived from bone marrow induction cultured for 2 weeks in an ionized collagen alone carrier (EC), a heparin-containing ionized collagen carrier (EC / H), a culture dish (C), etc., in the same manner as in Example 4-1. 0.5 N HCl was also added to mesenchymal stem cells, respectively, and the amount of calcium deposition in the supernatant was measured by QuantiChrom ™ calcium assay kit (BioAssay Systems, USA).
그 결과는 도 4에 도시된 바와 같다. 도 4에 도시된 바와 같이, 이온화 콜라겐 단독 전달체(EC), 비스포스포네이트 함유 이온화 콜라겐 전달체(EC/A), 헤파린 함유 이온화 콜라겐 전달체(EC/H), 그리고 비스포스포네이트 및 헤파린 함유 이온화 콜라겐 전달체(EC/A/H) 상에서 골분화 유도 배양한 골수 유래 중간엽 줄기세포의 칼슘 침착량은 배양접시(C)와 대비하여 유의적으로 높게 나타났다. 또한, 비스포스포네이트 함유 이온화 콜라겐 전달체(EC/A)와, 비스포스포네이트 및 헤파린 함유 이온화 콜라겐 전달체(EC/A/H)에서의 칼슘 침착량은 이온화 콜라겐 단독 전달체(EC)에 비해 유의적으로 높은 값을 나타냈다. 추가로, 헤파린 함유 이온화 콜라겐 전달체(EC/H)에서의 칼슘 침착량은 비스포스포네이트 함유 이온화 콜라겐 전달체(EC/A)에 비해 낮은 값을 보였으나 이온화 콜라겐 단독 전달체(EC) 보다는 대체적으로 높은 값을 나타냈다.The result is as shown in FIG. As shown in FIG. 4, ionized collagen alone carrier (EC), bisphosphonate containing ionized collagen transporter (EC / A), heparin containing ionized collagen transporter (EC / H), and bisphosphonate and heparin containing ionized collagen transporter (EC / A) / H), calcium deposits of bone marrow-derived mesenchymal stem cells cultured on bone differentiation were significantly higher than that of culture dish (C). In addition, the amount of calcium deposition in the bisphosphonate-containing ionized collagen carrier (EC / A) and the bisphosphonate- and heparin-containing ionized collagen carrier (EC / A / H) showed a significantly higher value than the ionized collagen alone carrier (EC). In addition, the amount of calcium deposition in the heparin-containing ionized collagen transporter (EC / H) was lower than that of the bisphosphonate-containing ionized collagen transporter (EC / A) but was generally higher than the ionized collagen alone transporter (EC).
이러한 결과들로부터 본 실시예에서는 비스포스포네이트/헤파린 함유 이온화 콜라겐 기반의 서방형 BMP 전달체가 BMP를 지속적으로 방출할 수 있고, 이로써 골수 유래 중간엽 줄기세포의 골분화를 유도 및 촉진할 수 있을 뿐만 아니라 나아가서는 골결손부에서 골형성 내지 골재생을 촉진할 수 있음을 확인할 수 있다. From these results, in this example, the bisphosphonate / heparin-containing sustained release BMP transporter can continuously release BMP, thereby inducing and promoting bone differentiation of bone marrow-derived mesenchymal stem cells, and furthermore, It can be confirmed that the bone defect may promote bone formation to bone regeneration.
실시예 4-4: 골분화 유도 배양(2차원 배양)된 골수 유래 중간엽 줄기세포의 골형성 인자 발현량 확인Example 4-4: Confirmation of bone formation factor expression level of bone marrow-derived mesenchymal stem cells in bone differentiation-induced culture (two-dimensional culture)
비스포스포네이트/헤파린 함유 이온화 콜라겐 기반의 서방형 BMP 전달체에서 골분화 유도 배양(2차원 배양)된 골수 유래 중간엽 줄기세포의 골형성 인자 발현량을 확인하기 위하여 하기와 같은 과정을 수행하였다. 또한, 대비를 위해 실시예 4-1과 동일한 방법으로 이온화 콜라겐 단독 전달체(EC), 헤파린 함유 이온화 콜라겐 전달체(EC/H), 및 배양 접시(C) 등에서 2주 동안 골분화 유도 배양(2차원 배양)된 골수 유래 중간엽 줄기세포에 대해서도 하기와 같은 방법에 따라 골형성 인자 발현량을 확인하였다.The following procedure was performed to confirm the bone formation factor expression levels of bone marrow-derived mesenchymal stem cells in bone differentiation-induced culture (two-dimensional culture) in bisphosphonate / heparin-containing sustained-release BMP carriers. Also, for contrast, bone differentiation-induced culture (two-dimensional) in an ionized collagen alone carrier (EC), a heparin-containing ionized collagen carrier (EC / H), a culture dish (C), etc. in the same manner as in Example 4-1. Cultured) bone marrow-derived mesenchymal stem cells were also confirmed the amount of bone formation factor expression according to the following method.
(1) 실시예 4-1의 방법으로 2주 동안 배양한 골수 유래 중간엽 줄기세포에서 전체 mRNA를 RNeasy 미니 키트(RNeasy Mini kit)(Qiagen, 미국)를 사용하여 추출하였다.(1) Total mRNA was extracted from bone marrow-derived mesenchymal stem cells cultured for 2 weeks by the method of Example 4-1 using RNeasy Mini kit (Qiagen, USA).
(2) 상기 (1)번 과정에서 추출한 골수 유래 중간엽 줄기세포의 전체 mRNA를 옴니스크립트 RT 키트(Omniscript RT kit)(Qiagen, 미국)를 사용하여 역전사반응시켜 cDNA를 얻었다.(2) cDNA was obtained by reverse transcription of the total mRNA of bone marrow-derived mesenchymal stem cells extracted in step (1) using an Omniscript RT kit (Qiagen, USA).
(3) 상기 (2)번 과정에서 얻은 cDNA를 이용하여 리얼타임 PCR (Polymerase chain recation)을 수행하였다. 골분화 유도 배양된 골수 유래 중간엽 줄기세포의 골형성 유전자(ALP, OCN 및 OPN) 증폭용 프라이머 쌍의 염기 서열은 하기 표 1과 같다.(3) Real-time PCR (Polymerase chain recation) was performed using the cDNA obtained in step (2). The base sequence of the primer pairs for amplification of bone formation genes (ALP, OCN and OPN) of bone marrow-derived mesenchymal stem cells cultured in bone differentiation is shown in Table 1 below.
서열번호SEQ ID NO: | 프라이머 염기서열 (5'→3')Primer base sequence (5 '→ 3') | 타겟 유전자Target genes |
서열번호 1SEQ ID NO: 1 | 정방향: AGGCAGGATTGACCACGGForward: AGGCAGGATTGACCACGG | ALP (Alkaline phosphatase)Alkaline phosphatase (ALP) |
서열번호 2SEQ ID NO: 2 | 역방향: TGTAGTTCTGCTCATGGAReverse: TGTAGTTCTGCTCATGGA | |
서열번호 3SEQ ID NO: 3 | 정방향: AAAGCCCAGCGACTCTCForward: AAAGCCCAGCGACTCTC | OCN (Osteocalcin)OCN (Osteocalcin) |
서열번호 4SEQ ID NO: 4 | 역방향: CTAAACGGTGGTGCCATAGATReverse: CTAAACGGTGGTGCCATAGAT | |
서열번호 5SEQ ID NO: 5 | 정방향: CGACGGCCGAGGTGATAGCTTForward: CGACGGCCGAGGTGATAGCTT | OPN (Osteopontin)OPN (Osteopontin) |
서열번호 6SEQ ID NO: 6 | 역방향: CATGGCTGGTCTTCCCGTTGCCReverse: CATGGCTGGTCTTCCCGTTGCC | |
서열번호 7SEQ ID NO: 7 | 정방향: AACCCATCACCATCTTCCAGGForward: AACCCATCACCATCTTCCAGG | GAPDH(housekeeping gene)Housekeeping gene (GAPDH) |
서열번호 8SEQ ID NO: 8 | 역방향: GCCTTCTCCATGGTGGTGAAReverse: GCCTTCTCCATGGTGGTGAA |
골형성 유전자(ALP, OCN 및 OPN) 발현량에 대한 결과는 도 5에 도시된 바와 같다. 도 5에 도시된 바와 같이, 대체적으로 이온화 콜라겐 단독 전달체(EC) 코팅, 비스포스포네이트 함유 이온화 콜라겐 전달체(EC/A) 코팅, 헤파린 함유 이온화 콜라겐 전달체(EC/H) 코팅, 그리고 비스포스포네이트 및 헤파린 함유 이온화 콜라겐 전달체(EC/A/H) 코팅 상에서의 골분화 인자의 발현량(즉 ALP, OCN 및 OPN의 발현량)은 배양접시(C) 상에서의 골분화 인자의 발현량에 비해 높은 값을 나타냈다. Results for the bone formation gene (ALP, OCN and OPN) expression amount is shown in FIG. As shown in FIG. 5, generally ionized collagen alone carrier (EC) coating, bisphosphonate containing ionized collagen carrier (EC / A) coating, heparin containing ionized collagen carrier (EC / H) coating, and bisphosphonate and heparin containing ionized collagen The expression level of bone differentiation factor (ie, expression levels of ALP, OCN and OPN) on the carrier (EC / A / H) coating was higher than the expression level of bone differentiation factor on the culture dish (C).
또한, 비스포스포네이트 함유 이온화 콜라겐 전달체(EC/A) 코팅과, 비스포스포네이트 및 헤파린 함유 이온화 콜라겐 전달체(EC/A/H) 코팅 상에서의 골분화 인자의 발현량은 이온화 콜라겐 단독 전달체(EC) 코팅에 비해 통계학적 유의성을 갖고 높게 나타났다. 추가로, 비스포스포네이트 함유 이온화 콜라겐 전달체(EC/A) 코팅은 헤파린 함유 이온화 콜라겐 전달체(EC/H) 코팅 및 이온화 콜라겐 단독 전달체(EC) 코팅 보다 높은 골분화 인자의 발현량을 보였다. OPN 유전자의 경우, 비스포스포네이트 및 헤파린 함유 이온화 콜라겐 전달체(EC/A/H) 코팅이 헤파린 함유 이온화 콜라겐 전달체(EC/H) 코팅에 비해 유의적으로 높은 발현량을 보였다.In addition, the expression level of bone differentiation factor on the bisphosphonate-containing ionized collagen transporter (EC / A) coating and the bisphosphonate- and heparin-containing ionized collagen transporter (EC / A / H) coating was statistically compared to the ionized collagen transporter alone (EC) coating. It was high with statistical significance. In addition, bisphosphonate containing ionized collagen transporter (EC / A) coatings showed higher expression levels of bone differentiation factor than heparin containing ionized collagen transporter (EC / H) coatings and ionized collagen alone transporter (EC) coatings. For the OPN gene, bisphosphonate and heparin containing ionized collagen transporter (EC / A / H) coatings showed significantly higher expression levels than heparin containing ionized collagen transporter (EC / H) coatings.
이러한 결과들로부터도 비스포스포네이트/헤파린 함유 이온화 콜라겐 기반의 서방형 BMP 전달체는 골수 유래 중간엽 줄기세포의 골분화를 유도 및 촉진할 수 있을 뿐만 아니라 나아가서는 골결손부에서 골형성 내지 골재생을 촉진할 수 있음을 확인할 수 있다. These results suggest that bisphosphonate / heparin-containing ionized collagen-based sustained release BMP carriers can not only induce and promote bone differentiation of bone marrow-derived mesenchymal stem cells, but also promote bone formation or bone regeneration in bone defects. It can be confirmed that.
실시예 4-5: 골분화 유도 배양(3차원 배양)된 골수 유래 중간엽 줄기세포의 골형성 인자 발현량 확인Example 4-5: Confirmation of bone formation factor expression level of bone marrow-derived mesenchymal stem cells in bone differentiation-induced culture (three-dimensional culture)
비스포스포네이트/헤파린 함유 이온화 콜라겐 기반의 서방형 BMP 전달체에서 골분화 유도 배양(3차원 배양)된 골수 유래 중간엽 줄기세포의 골형성 인자 발현량을 확인하기 위하여 하기와 같은 과정을 수행하였다. 즉, 실시예 1의 방법에 따라 이온화 콜라겐 단독 전달체(EC) 스펀지, 비스포스포네이트 함유 이온화 콜라겐 전달체(EC/A) 스펀지, 헤파린 함유 이온화 콜라겐 전달체(EC/H) 스펀지, 그리고 비스포스포네이트 및 헤파린 함유 이온화 콜라겐 전달체(EC/A/H) 스펀지를 준비하였다. 이들 스펀지 각각에 실시예 2와 같은 방식으로 10 ng의 BMP-2를 담지시킨 후 BMP-2가 담지된 각각의 스펀지에서 골수 유래 중간엽 줄기세포를 2주 동안 3차원 배양하였다. 각각의 스펀지에서 2주 동안 골분화 유도 배양(3차원 배양)된 골수 유래 중간엽 줄기세포에 대해 실시예 4-4와 같은 방법에 따라 골형성 인자 발현량을 확인하였다.The following process was performed to determine the bone formation factor expression level of bone marrow-derived mesenchymal stem cells in bone differentiation-induced culture (3-dimensional culture) in bisphosphonate / heparin-containing sustained-release BMP carrier. That is, ionized collagen alone carrier (EC) sponge, bisphosphonate containing ionized collagen carrier (EC / A) sponge, heparin containing ionized collagen carrier (EC / H) sponge, and bisphosphonate and heparin containing ionized collagen carrier according to the method of Example 1 A (EC / A / H) sponge was prepared. Each of these sponges was loaded with 10 ng of BMP-2 in the same manner as in Example 2, followed by three-dimensional culture of bone marrow-derived mesenchymal stem cells in each sponge loaded with BMP-2. Bone marrow-derived mesenchymal stem cells subjected to bone differentiation induction culture (three-dimensional culture) for 2 weeks in each sponge were confirmed in accordance with the same method as in Example 4-4.
그 결과는 도 6에 도시된 바와 같다. 도 6에 도시된 바와 같이, 대체적으로 비스포스포네이트 함유 이온화 콜라겐 전달체(EC/A) 스펀지, 헤파린 함유 이온화 콜라겐 전달체(EC/H) 스펀지, 그리고 비스포스포네이트 및 헤파린 함유 이온화 콜라겐 전달체(EC/A/H) 스펀지 상에서의 골분화 인자의 발현량(즉 ALP, OCN 및 OPN의 발현량)은 이온화 콜라겐 단독 전달체(EC) 스펀지 상에서의 골분화 인자의 발현량에 비해 높은 값을 나타냈다. 또한, 비스포스포네이트 함유 이온화 콜라겐 전달체(EC/A) 스펀지와, 비스포스포네이트 및 헤파린 함유 이온화 콜라겐 전달체(EC/A/H) 스펀지 상에서의 골분화 인자의 발현량은 이온화 콜라겐 단독 전달체(EC) 스펀지에 비해 통계학적 유의성을 갖고 높게 나타났다. 추가로, 비스포스포네이트 함유 이온화 콜라겐 전달체(EC/A) 스펀지는 헤파린 함유 이온화 콜라겐 전달체(EC/H) 스펀지 및 이온화 콜라겐 단독 전달체(EC) 스펀지 보다 높은 골분화 인자의 발현량을 보였다. OCN 유전자의 경우, 비스포스포네이트 및 헤파린 함유 이온화 콜라겐 전달체(EC/A/H) 스펀지가 헤파린 함유 이온화 콜라겐 전달체(EC/H) 스펀지에 비해 유의적으로 높은 발현량을 보였다.The result is as shown in FIG. As shown in FIG. 6, a bisphosphonate containing ionized collagen transporter (EC / A) sponge, a heparin containing ionized collagen transporter (EC / H) sponge, and a bisphosphonate and heparin containing ionized collagen transporter (EC / A / H) sponge The expression level of bone differentiation factor in the stomach (ie, the expression levels of ALP, OCN and OPN) showed a higher value than the expression level of bone differentiation factor on the ionized collagen alone carrier (EC) sponge. In addition, the expression levels of the bisphosphonate-containing ionized collagen transporter (EC / A) sponge and the bisphosphonate and heparin-containing ionized collagen transporter (EC / A / H) sponges were compared to the ionized collagen alone transporter (EC) sponge. It was high with statistical significance. In addition, bisphosphonate containing ionized collagen transporter (EC / A) sponges showed higher expression levels of bone differentiation factors than heparin containing ionized collagen transporter (EC / H) sponges and ionized collagen alone transporter (EC) sponges. For the OCN gene, bisphosphonates and heparin-containing ionized collagen transporter (EC / A / H) sponges showed significantly higher expression levels than heparin-containing ionized collagen transporter (EC / H) sponges.
이러한 결과들로부터도 비스포스포네이트/헤파린 함유 이온화 콜라겐 기반의 서방형 BMP 전달체는 골수 유래 중간엽 줄기세포의 골분화를 유도 및 촉진할 수 있을 뿐만 아니라 나아가서는 골결손부에서 골형성 내지 골재생을 촉진할 수 있음을 확인할 수 있다. These results suggest that bisphosphonate / heparin-containing ionized collagen-based sustained release BMP carriers can not only induce and promote bone differentiation of bone marrow-derived mesenchymal stem cells, but also promote bone formation or bone regeneration in bone defects. It can be confirmed that.
실시예 5: 동물실험 모델을 통한 골재생 효능 시험Example 5 Bone Regeneration Efficacy Test Using Animal Experimental Model
본 실시예에서는 비스포스포네이트/헤파린 함유 이온화 콜라겐 기반의 서방형 BMP 전달체의 생체내 효능(생체내 골형성 내지 골재생 효능)을 확인하기 위하여 백서의 두개골 모델을 이용하였다. 그리고, 아래의 과정에 따라 골형성 내지 골재생 효능 시험을 수행하였다. 또한, 대비를 위해 이온화 콜라겐 전달체 대조군(BMP 없는 것 및/또는 비스포스포네이트 없는 것)에 대해서도 아래의 과정에 따라 골형성 내지 골재생 효능 시험을 수행하였다.In this example, the skull model of the white paper was used to confirm the in vivo efficacy (in vivo bone formation to bone regeneration efficacy) of the bisphosphonate / heparin containing ionized collagen-based sustained release BMP transporter. Then, bone formation to bone regeneration efficacy test was performed according to the following procedure. In addition, the bone formation to bone regeneration efficacy test was performed for the ionized collagen transporter control group (without BMP and / or without bisphosphonate) for the preparation according to the following procedure.
(1) 백서를 전신마취을 시행한 후, 두개골의 수술부위를 절개하고 외경 8mm의 드릴을 이용하여 골결손부를 형성한다.(1) After performing general anesthesia on the white paper, the surgical site of the skull is dissected and a bone defect is formed using a drill having an outer diameter of 8 mm.
(2) 실시예 1의 방법으로 제조한 비스포스포네이트 및 헤파린을 함유하는 이온화 콜라겐 전달체와, 이온화 콜라겐 전달체 대조군을 각각 상기 (1)번 과정에서 형성한 백서 두개골 결손부에 충전한다. 이때, 충전되는 콜라겐 전달체는 이온화 콜라겐 단독으로 이루어진 전달체 그룹(Native collagen group)과, 비스포스포네이트 및 헤파린을 함유하는 이온화 콜라겐 전달체 그룹으로 나눈 후, 이들 각각의 그룹을 다시 BMP-2를 40μg 담지한 그룹과 담지하지 않는 그룹으로 추가로 나누어 시험을 진행한다. (2) An ionized collagen transporter containing bisphosphonate and heparin prepared by the method of Example 1 and an ionized collagen transporter control group are respectively filled in the white skull cranial defect formed in step (1). At this time, the charged collagen carrier was divided into a native collagen group consisting of ionized collagen alone, an ionized collagen transporter group containing bisphosphonates and heparin, and then each of these groups was further loaded with 40 μg of BMP-2; The test is further divided into groups not supported.
(3) 수술 후 4주 및 8주가 경과한 시점에서, 콜라겐 전달체 각각을 충전한 백서의 두개골 결손부의 마이크로 CT(micro-CT) 사진을 촬영하고 이식 주변 조직을 회수하여 MT(Masson's trichrome) 염색을 실시한다. 또한, 이와 같이 촬영된 마이크로 CT를 통해, 콜라겐 전달체 각각을 충전한 두개골 결손부의 신생골 형성에 관련된 지표들을 측정 및 계산한다.(3) At 4 and 8 weeks after surgery, micro-CT (micro-CT) photographs of the skull defects of white paper filled with collagen transporters were taken, and the tissues surrounding the graft were recovered for MT's trichrome (MT) staining. Conduct. In addition, the micro CT photographed as described above measures and calculates the indexes related to new bone formation of the cranial defects in which the collagen carriers are filled.
그 결과가 도 7의 마이크로 CT 사진과 도 8의 MT(Masson's trichrome) 염색 사진에 도시되어 있다. 도 7 및 도 8에 도시된 바와 같이, 콜라겐 전달체 각각을 백서 두개골 골결손부에 이식한 후 4주 및 8주가 경과 한 시점에서 이식 부위를 관찰한 결과, BMP를 담지한 비스포스포네이트 및 헤파린을 함유하는 이온화 콜라겐 전달체가 BMP 만을 담지한 이온화 콜라겐 단독 전달체 보다 신생골의 형성을 더 촉진하였음을 확인할 수 있다.The results are shown in the micro CT picture of FIG. 7 and the Masson's trichrome (MT) staining picture of FIG. 8. As shown in FIGS. 7 and 8, when the collagen transporters were implanted into the skull cranial defects of the white rats, the transplantation sites were observed at 4 and 8 weeks, and the bisphosphonates and heparin containing BMP were observed. It can be seen that the ionized collagen transporter further promoted the formation of new bone than the ionized collagen transporter carrying only BMP.
또한, 두개골 결손부의 신생골 형성에 관련된 지표들을 측정 및 계산한 결과는 도 9 내지 도 11에 비교 도시되어 있다. In addition, the results of measuring and calculating the indicators related to the formation of new bone in the cranial defect are shown in FIGS. 9 to 11.
도 9에 도시된 바와 같이, BMP를 담지한 비스포스포네이트 및 헤파린 함유 이온화 콜라겐 전달체는 BMP 만을 담지한 이온화 콜라겐 단독 전달체에 비해 BV(bone volume) 및 BV(bone volume)/TV(tissue volume)(%)의 값들이 높은 것을 알 수 있다. TV(tissue volume)값은 새로 생성된 조직(예를 들어, 골 및 육아 조직, 연조직 등)의 양을 나타내고, BV값은 새로 생성된 골 조직의 양을 나타내며, BV/TV(%) 값은 새로 생성된 조직의 양에서 골조직이 차지하는 비율을 나타낸다. BV값과 BV/TV(%)값이 높다는 것은 새로 생성된 골 조직의 절대적 양과 상대적 양이 많다는 것을 의미한다. 따라서, BMP를 담지한 비스포스포네이트 및 헤파린 함유 이온화 콜라겐 전달체는 골조직 재생에 효과적이고, BMP의 문제점 중 하나인 골과 관계없는 주변 조직도 함께 성장 촉진되어 나타나는 종창 현상 및 골이식부 자체 내의 부종으로 인한 골이식재의 퍼짐 현상을 줄일 수 있다.As shown in FIG. 9, the bisphosphonate and heparin-containing ionized collagen transporter carrying BMP was compared to the bone volume (BV) and bone volume (BV) / tissue volume (TV) (%) compared to the ionized collagen transporter carrying only BMP. It can be seen that the values of are high. The TV (tissue volume) value represents the amount of newly generated tissue (eg, bone and granulation tissue, soft tissue, etc.), the BV value represents the amount of newly generated bone tissue, and the BV / TV (%) value is It represents the proportion of bone tissue to the amount of newly created tissue. Higher BV and% TV / TV values indicate that the absolute and relative amounts of newly generated bone tissue are large. Thus, BMP-supported bisphosphonates and heparin-containing ionized collagen transporters are effective for bone tissue regeneration, and bone graft due to swelling phenomenon and edema in the bone graft itself, which is caused by growth promotion of peripheral tissues that are not related to bone, which is one of the problems of BMP Can reduce the spread of
다음으로, 도 10을 참조하면, BMP를 담지한 비스포스포네이트 및 헤파린 함유 이온화 콜라겐 전달체는 BMP 만을 담지한 이온화 콜라겐 단독 전달체에 비해 소주(trabecular)(골에서 기둥 모양의 골 조직을 지칭함)의 두께(trabecular thickness; Tb.Th로 약칭)가 두껍고, 소주의 개수(trabecular number; Tb.N으로 약칭)가 많으며, 소주의 간격(trabecular space; Tb.Sp로 약칭)이 좁은 것을 확인할 수 있다. 소주의 개수가 많고 소주의 간격이 좁을 수록 형성된 골이 치밀하고, 소주의 개수와 소주 간의 거리가 같다면 소주의 두께가 두꺼울 수록 형성된 골이 단단하다. 따라서, BMP를 담지한 비스포스포네이트 및 헤파린 함유 이온화 콜라겐 전달체는 골결손이 일어난 두개골 부위에서 골을 치밀하면서도 단단하게 재생할 수 있다. Next, referring to FIG. 10, the bisphosphonate and heparin-containing ionized collagen transporter carrying BMP has a trabecular thickness (trabecular) in comparison with the ionized collagen transporter carrying only BMP. It can be seen that the thickness (abbreviated as Tb.Th) is thick, the trabecular number (abbreviated as Tb.N) is large, and the trabecular space (abbreviated as Tb.Sp) is narrow. The larger the number of shochu and the narrower the distance of the shochu, the denser the bones are formed, and if the distance between the number of shochu is the same as the thickness of the shochu, the thicker the shochu, the harder the bone. Thus, bisphosphonates and heparin-containing ionized collagen carriers carrying BMP can reproduce bones tightly and tightly at the skull site where bone defects occur.
또한, 도 11을 참조하면, BMP를 담지한 비스포스포네이트 및 헤파린 함유 이온화 콜라겐 전달체는 BMP 만을 담지한 이온화 콜라겐 단독 전달체에 비해 BMD(bone mineral density), 즉 골밀도가 높은 것을 확인할 수 있다. BMD(bone mineral density)는 아주 작은 차이라도 임상적 효과는 대단히 큰 차이를 나타내는 대표적 골 지표로서, 1 표준편차는 대략 10-15% 골밀도 수치(g/cm2)의 차이를 의미한다. 따라서, BMP를 담지한 비스포스포네이트 및 헤파린 함유 이온화 콜라겐 전달체는 골결손이 일어난 두개골 부위에서 골밀도를 효과적으로 높일 수 있다.In addition, referring to FIG. 11, the bisphosphonate and heparin-containing ionized collagen transporter carrying BMP may have a higher BMD (bone mineral density), that is, bone density, than the ionized collagen transporter carrying only BMP. BMD (bone mineral density) is a representative bone index that shows a very large difference in clinical effect even with a very small difference, and 1 standard deviation means a difference of approximately 10-15% bone density (g / cm 2 ). Therefore, bisphosphonates and heparin-containing ionized collagen carriers carrying BMPs can effectively increase bone density at the skull site where bone defects occur.
이러한 결과들로부터, 이온화 콜라겐 단독으로 이루어진 전달체 보다 비스포스포네이트 및 헤파린 함유 이온화 콜라겐 전달체에서 두개골 결손부의 신생골 형성과 관련된 지표가 더 우수하다고 할 수 있다. From these results, it can be said that the indicators related to new bone formation of cranial defects in bisphosphonates and heparin-containing ionized collagen carriers are superior to those of ionized collagen alone.
실시예 6: 비스포스포네이트 및 헤파린 함유 이온화 콜라겐/합성골 전달체 제조Example 6 Preparation of Bisphosphonates and Heparin-Ionized Collagen / Synthetic Bone Carriers
본 발명의 일실시예의 비스포스포네이트 및 헤파린 함유 이온화 콜라겐/합성골 전달체의 제조방법은 다음과 같다. 본 실시예에서는 예시로서 합성골을 하이드록시 아파타이트와 TCP(tri-calcium phosphate)가 6:4 (질량비)로 혼합된 것[상품명: MBCP (미국 Keystone Dental, Inc. 제품)]을 사용한다.Bisphosphonate and heparin-containing ionized collagen / synthetic bone delivery method of an embodiment of the present invention is as follows. In this embodiment, synthetic bone is used as a mixture of hydroxyapatite and TCP (tri-calcium phosphate) at 6: 4 (mass ratio) (trade name: MBCP (manufactured by Keystone Dental, Inc., USA)).
(1) 정제수에 2.5% (w/v) 이온화 콜라겐을 용해시킨다. 또한, 비스포스포네이트 및 헤파린 함유 이온화 콜라겐/합성골 전달체를 제조하기 위해 0.1% (w/v) 비스포스포네이트 용액에 2.5% (w/v) 이온화 콜라겐을 용해시킨다.(1) Dissolve 2.5% (w / v) ionized collagen in purified water. In addition, 2.5% (w / v) ionized collagen is dissolved in 0.1% (w / v) bisphosphonate solution to prepare bisphosphonates and heparin containing ionized collagen / synthetic bone carriers.
(2) 상기 (1)번 과정에서 얻은 이온화 콜라겐 용액에 합성골을 혼합한다. 이때, 이온화 콜라겐과 합성골의 비율은 질량을 기준으로 100:0, 50:50, 10:90, 5:95로 한다. 한편, 비스포스포네이트와 이온화 콜라겐의 혼합 용액에는 5:95의 질량비로 합성골을 혼합한다. (2) The synthetic bone is mixed with the ionized collagen solution obtained in step (1). At this time, the ratio of the ionized collagen and synthetic bone is 100: 0, 50:50, 10:90, 5:95 based on the mass. On the other hand, in the mixed solution of bisphosphonate and ionized collagen, synthetic bone is mixed at a mass ratio of 5:95.
(3) 상기 (2)번 과정에서 얻은 혼합물을 40℃에서 24시간 동안 동결건조한다.(3) The mixture obtained in the step (2) is lyophilized at 40 ℃ for 24 hours.
(4) 상기 (3)번 과정에서 동결건조한 혼합물을 70% 에탄올에 용해시킨 5 mM EDC(N-(3-Dimethylaminopropyl)-N′-ethylcarbodiimide hydrochloride) 용액으로 4시간 동안 가교화한다.(4) The lyophilized mixture in step (3) was crosslinked with 5 mM EDC (N- (3-Dimethylaminopropyl) -N'-ethylcarbodiimide hydrochloride) solution dissolved in 70% ethanol for 4 hours.
(5) 상기 (4)번 과정에서 가교화한 전달체를 정제수로 10분씩 10회 세척한다. 한편, 비스포스포네이트 함유 이온화 콜라겐/합성골 전달체는 헤파린을 고정하기 위해, 5 mM EDC와 1 mM NHS (N-hydroxysuccinimide)를 포함하는 5 mM MES (4-Morpholine ethane sulfonic acid) 버퍼에 1% (w/v)의 헤파린을 용해시킨 용액으로 4시간 동안 반응시킨다.(5) The carrier crosslinked in step (4) was washed 10 times with purified water for 10 minutes. On the other hand, bisphosphonate-containing ionized collagen / synthetic bone carriers contained 1% (w / w) in 5 mM MES (4-Morpholine ethane sulfonic acid) buffer containing 5 mM EDC and 1 mM NHS (N-hydroxysuccinimide) to fix heparin. Reaction with v) heparin dissolved solution for 4 hours.
(6) 상기 (5)번 과정에서 헤파린을 고정시킨 전달체를 정제수로 10분씩 10회 세척한 후, -80℃에서 동결하여 24시간 동간 건조한다.(6) the carrier to which heparin was fixed in step (5) was washed 10 times with purified water for 10 minutes, and then frozen at -80 ° C and dried for 24 hours.
실시예 7: 이온화 콜라겐/합성골 전달체에서의 BMP-2 방출속도 비교Example 7: Comparison of BMP-2 Release Rate in Ionized Collagen / Synthetic Bone Carriers
본 발명의 일실시예의 이온화 콜라겐/합성골 전달체에서 방출되는 BMP-2의 양상을 다음과 같은 방법으로 측정하였다. The aspect of BMP-2 released from the ionized collagen / synthetic bone carrier of one embodiment of the present invention was measured by the following method.
(1) PBS 완충액에 BMP-2를 50μg/ml 용해시킨다.(1) 50 μg / ml of BMP-2 is dissolved in PBS buffer.
(2) 상기 (1)번 과정에서 얻은 BMP-2 용액 100μL를 실시예 6의 방법으로 제조한 이온화 콜라겐/합성골 전달체에 적신 후, 1시간 동안 상온보관한다.(2) 100 μL of the BMP-2 solution obtained in step (1) was soaked in the ionized collagen / synthetic bone carrier prepared in Example 6, and then stored at room temperature for 1 hour.
(3) BMP-2 용액에 적신 이온화 콜라겐/합성골 전달체를 PBS 완충액 2ml에 침지하여 37℃에서 15rpm의 조건으로 진탕배양기에서 보관한다.(3) Ionized collagen / synthetic bone carrier soaked in BMP-2 solution was immersed in 2 ml of PBS buffer and stored at 37 ° C. in a shaker at 15 rpm.
(4) 상기 (3)번 과정에서 이온화 콜라겐/합성골 전달체가 침지된 PBS 완충용액의 상층액을 정해진 시간대 별로 취하여 동결보존한다.(4) The supernatant of PBS buffer solution in which the ionized collagen / synthetic bone carrier was immersed in step (3) was taken at predetermined time points and cryopreserved.
(5) 상기 (4)번 과정에서 시간대 별로 상층액을 취한 후 남은 PBS 완충액을 버리고, 이온화 콜라겐/합성골 전달체를 새로이 PBS 완충액 2ml에 침지한 후 다시 진탕배양기에 보관한다.(5) Take the supernatant for each time zone in step (4) and discard the remaining PBS buffer, and then immerse the ionized collagen / synthetic bone carrier in 2 ml of PBS buffer and store in shaker again.
(6) 상기 (4)번 과정에서 취한 상층액을 BMP-2 ELISA 키트 (Antigenix America Inc., 미국)로 분석하여 이온화 콜라겐/합성골 전달체에서 방출된 BMP-2의 양을 측정한다.(6) The supernatant taken in step (4) was analyzed with a BMP-2 ELISA kit (Antigenix America Inc., USA) to determine the amount of BMP-2 released from the ionized collagen / synthetic bone transporter.
그 결과, 이온화 콜라겐과 합성골의 질량비가 각각 100:0, 50:50, 10:90 및 5:95인 이온화 콜라겐/합성골 전달체로부터 BMP-2 방출량 데이터를 얻었으며, 또한 이온화 콜라겐과 합성골의 질량비가 95:5이면서 비스포스포네이트 및 헤파린이 함유된 이온화 콜라겐/합성골 전달체(95:5(A/H))로부터 BMP-2 방출량 데이터를 얻었다.As a result, BMP-2 emission data were obtained from ionized collagen / synthetic bone carriers in which the mass ratios of ionized collagen and synthetic bone were 100: 0, 50:50, 10:90 and 5:95, respectively. The BMP-2 release data was obtained from ionized collagen / synthetic bone carrier (95: 5 (A / H)) containing a bisphosphonate and heparin with a mass ratio of 95: 5.
도 12에 도시된 바와 같이, 이온화 콜라겐과 합성골의 비율을 달리한 이온화 콜라겐/합성골 전달체에서의 BMP-2 방출 양상을 측정한 결과, 48시간 동안 773±60 ng (100:0), 559±40 ng (50:50), 494±29 ng (10:90), 395±31 ng (5:95)의 BMP-2가 방출되었으며, 이로부터 합성골의 비율이 높을수록 BMP-2의 방출 속도가 지연되는 것을 확인할 수 있다. As shown in FIG. 12, the BMP-2 release pattern of the ionized collagen / synthetic bone carrier with different ratios of ionized collagen and synthetic bone was measured and found to be 773 ± 60 ng (100: 0), 559 for 48 hours. BMP-2 was released at ± 40 ng (50:50), 494 ± 29 ng (10:90), and 395 ± 31 ng (5:95), from which the higher the percentage of synthetic bone, the higher the release of BMP-2. You can see that the speed is delayed.
또한, 비스포스포네이트 및 헤파린의 포함 유무에 따른 전달체의 BMP-2 방출량을 비교했을 경우, 비스포스포네이트 함유 및 헤파린 고정 이온화 콜라겐/합성골 전달체에서는 48시간 동안 168±17 ng의 BMP-2가 방출되어 이온화 콜라겐/합성골로만 이루어진 전달체 보다 방출량이 적은 것으로 확인되었다. 따라서, 이온화 콜라겐/합성골 전달의 경우에도 비스포스포네이트 및 헤파린의 방출 지연 효과를 확인할 수 있다.In addition, when comparing the amount of BMP-2 release of the carrier with or without bisphosphonate and heparin, 168 ± 17 ng of BMP-2 was released for 48 hours in the bisphosphonate-containing and heparin-fixed ionized collagen / synthetic bone carriers. It was confirmed that the amount of release less than the carrier consisting only of synthetic bone. Therefore, the effect of delaying the release of bisphosphonates and heparin can also be confirmed in the case of ionized collagen / synthetic bone delivery.
전술한 바와 같은 실시예들의 결과들을 종합할 때, 본 발명의 비스포스포네이트/헤파린 함유 콜라겐 기반의 서방형 BMP 전달체는 골결손부에 적용 시 적정 농도의 BMP를 지속적으로 방출할 수 있고, 이로 인해 골수 유래 중간엽 줄기세포의 골분화를 유도 및 촉진함으로써 골결손부에서 골형성 내지는 골재생을 촉진할 수 있는 장점이 있다고 할 수 있다.Combining the results of the embodiments as described above, the bisphosphonate / heparin-containing collagen-based sustained release BMP carrier of the present invention can continuously release an appropriate concentration of BMP when applied to a bone defect, thereby deriving from bone marrow. By inducing and promoting bone differentiation of mesenchymal stem cells can be said to have the advantage of promoting bone formation or bone regeneration in bone defects.
이상 본 발명을 상기 실시예를 들어 설명하였으나, 본 발명은 이에 제한되는 것이 아니다. 당업자라면 본 발명의 취지 및 범위를 벗어나지 않고 수정, 변경을 할 수 있으며 이러한 수정과 변경 또한 본 발명에 속하는 것임을 알 수 있을 것이다.Although the present invention has been described with reference to the above embodiments, the present invention is not limited thereto. Those skilled in the art can make modifications and changes without departing from the spirit and scope of the present invention, and it will be appreciated that such modifications and changes also belong to the present invention.
Claims (15)
- 콜라겐 용액과 비스포스포네이트 용액을 혼합한 후 동결건조하여 얻은 콜라겐 지지체와, 이러한 콜라겐 지지체에 함유된 비스포스포네이트; 및A collagen support obtained by mixing the collagen solution and the bisphosphonate solution and then lyophilizing, and a bisphosphonate contained in the collagen support; And상기 비스포스포네이트가 함유된 콜라겐 지지체에 담지되어 미리 결정된 시간 동안 지속적으로 방출되는 BMP를 포함하는 콜라겐 기반의 서방형 BMP 전달체.Collagen-based sustained release BMP transporter comprising BMP supported on the bisphosphonate-containing collagen support and continuously released for a predetermined time.
- 제1항에 있어서,The method of claim 1,상기 비스포스포네이트가 함유된 콜라겐 지지체에 고정된 헤파린을 추가로 함유하는 콜라겐 기반의 서방형 BMP 전달체.A collagen-based sustained release BMP transporter further comprising heparin immobilized on the bisphosphonate-containing collagen support.
- 제2항에 있어서,The method of claim 2,상기 고정된 헤파린은 상기 콜라겐 지지체의 자유아민기와는 공유 결합을 하고 상기 BMP와는 이온 결합을 함으로써 상기 콜라겐 지지체와 상기 BMP와의 결합에 필요한 매개 역할을 하는 것을 특징으로 하는 콜라겐 기반의 서방형 BMP 전달체.The fixed heparin is a collagen-based sustained-release BMP carrier, characterized in that the covalent bond with the free amine group of the collagen support and the ionic bond with the BMP plays a necessary role for binding of the collagen support and the BMP.
- 제1항 내지 제3항 중 어느 한 항에 있어서,The method according to any one of claims 1 to 3,상기 비스포스포네이트가 함유된 콜라겐 지지체는 이온화 콜라겐 지지체인 것을 특징으로 하는 콜라겐 기반의 서방형 BMP 전달체.The collagen-based sustained release BMP carrier, characterized in that the bisphosphonate-containing collagen support is an ionized collagen support.
- 제1항 내지 제3항 중 어느 한 항에 있어서,The method according to any one of claims 1 to 3,상기 비스포스포네이트가 함유된 콜라겐 지지체는 EDC(N-(3-Dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride) 용액으로 가교화되는 것을 특징으로 하는 콜라겐 기반의 서방형 BMP 전달체.The collagen-based sustained release BMP carrier, characterized in that the bisphosphonate-containing collagen support is crosslinked with an N- (3-dimethylaminopropyl) -N'-ethylcarbodiimide hydrochloride (EDC) solution.
- 제2항 또는 제3항에 있어서,The method according to claim 2 or 3,EDC와 NHS(N-hydroxysuccinimide)를 포함하는 MES(4-Morpholine ethane sulfonic acid) 버퍼에 헤파린을 용해시킨 용액으로 상기 비스포스포네이트가 함유된 콜라겐 지지체를 처리함으로써, 상기 헤파린이 상기 비스포스포네이트가 함유된 콜라겐 지지체에 고정되는 것을 특징으로 하는 콜라겐 기반의 서방형 BMP 전달체. By treating the bisphosphonate-containing collagen support with a solution of heparin in MES (4-Morpholine ethane sulfonic acid) buffer containing EDC and NHS (N-hydroxysuccinimide), the heparin was added to the bisphosphonate-containing collagen support. Collagen-based sustained release BMP transporter, characterized in that it is fixed.
- 제1항 내지 제3항 중 어느 한 항에 있어서,The method according to any one of claims 1 to 3,하이드록시 아파타이트, 하이드록시 아파타이트와 TCP(tri-calcium phosphate)의 혼합물, TCP(tri-calcium phosphate), 소뼈, 말뼈 및 돼지뼈로 구성된 군으로부터 선택된 적어도 하나를 추가로 포함하는 것을 특징으로 하는 콜라겐 기반의 서방형 BMP 전달체.Collagen based, characterized in that it further comprises at least one selected from the group consisting of hydroxyapatite, a mixture of hydroxyapatite and tri-calcium phosphate (TCP), tri-calcium phosphate (TCP), bovine bone, horse bone and pork bone Sustained release BMP transporter.
- 콜라겐 기반의 서방형 BMP 전달체의 제조방법에 있어서, In the method for producing a collagen-based sustained release BMP carrier,콜라겐 용액과 비스포스포네이트 용액을 혼합하는 단계와, Mixing the collagen solution and the bisphosphonate solution,콜라겐 용액과 비스포스포네이트 용액의 혼합 용액을 동결건조하는 단계와, Lyophilizing the mixed solution of the collagen solution and the bisphosphonate solution,동결건조하여 얻은 비스포스포네이트가 함유된 콜라겐 지지체에 BMP를 담지하는 단계를 포함하는 콜라겐 기반의 서방형 BMP 전달체의 제조방법. A method for preparing a collagen-based sustained release BMP carrier comprising the step of supporting BMP on a collagen support containing bisphosphonates obtained by lyophilization.
- 제8항에 있어서,The method of claim 8,상기 비스포스포네이트가 함유된 콜라겐 지지체에 헤파린을 고정하는 단계를 더 포함하는 콜라겐 기반의 서방형 BMP 전달체의 제조방법.The method of producing a collagen-based sustained release BMP carrier further comprising the step of fixing the heparin to the collagen support containing the bisphosphonate.
- 제9항에 있어서,The method of claim 9,상기 고정된 헤파린은 상기 콜라겐 지지체의 자유아민기와는 공유 결합을 하고 상기 BMP와는 이온 결합을 함으로써 상기 콜라겐 지지체와 상기 BMP와의 결합에 필요한 매개 역할을 하는 것을 특징으로 하는 콜라겐 기반의 서방형 BMP 전달체의 제조방법.The immobilized heparin covalently bonds with the free amine group of the collagen support and ionic bonds with the BMP to play a necessary role for binding of the collagen support to the BMP. Manufacturing method.
- 제8항 내지 제10항 중 어느 한 항에 있어서,The method according to any one of claims 8 to 10,상기 비스포스포네이트가 함유된 콜라겐 지지체는 이온화 콜라겐 지지체인 것을 특징으로 하는 콜라겐 기반의 서방형 BMP 전달체의 제조방법.The method of producing a collagen-based sustained-release BMP carrier, characterized in that the bisphosphonate-containing collagen support is an ionized collagen support.
- 제8항 내지 제10항 중 어느 한 항에 있어서,The method according to any one of claims 8 to 10,상기 비스포스포네이트가 함유된 콜라겐 지지체를 EDC(N-(3-Dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride) 용액으로 가교화하는 단계를 더 포함하는 콜라겐 기반의 서방형 BMP 전달체의 제조방법.The method of producing a collagen-based sustained-release BMP carrier further comprises the step of crosslinking the bisphosphonate-containing collagen support with an N- (3-dimethylaminopropyl) -N'-ethylcarbodiimide hydrochloride (EDC) solution.
- 제9항 또는 제10항에 있어서,The method of claim 9 or 10,EDC와 NHS(N-hydroxysuccinimide)를 포함하는 MES(4-Morpholine ethane sulfonic acid) 버퍼에 헤파린을 용해시킨 용액으로 상기 비스포스포네이트가 함유된 콜라겐 지지체를 처리함으로써, 상기 헤파린을 상기 비스포스포네이트가 함유된 콜라겐 지지체에 고정하는 것을 특징으로 하는 콜라겐 기반의 서방형 BMP 전달체의 제조방법.By treating the bisphosphonate-containing collagen support with a solution in which heparin was dissolved in MES (4-Morpholine ethane sulfonic acid) buffer containing EDC and NHS (N-hydroxysuccinimide), the heparin was added to the bisphosphonate-containing collagen support. Method for producing a collagen-based sustained release BMP carrier, characterized in that fixed.
- 제8항 내지 제10항 중 어느 한 항에 있어서,The method according to any one of claims 8 to 10,하이드록시 아파타이트, 하이드록시 아파타이트와 TCP(tri-calcium phosphate)의 혼합물, TCP(tri-calcium phosphate), 소뼈, 말뼈 및 돼지뼈로 구성된 군으로부터 선택된 적어도 하나를 추가하는 단계를 더 포함하는 콜라겐 기반의 서방형 BMP 전달체의 제조방법.Further comprising adding at least one selected from the group consisting of hydroxyapatite, a mixture of hydroxyapatite and tri-calcium phosphate (TCP), tri-calcium phosphate (TCP), bovine bone, horse bone and porcine bone Method for producing a sustained release BMP carrier.
- 제7항에 기재된 콜라겐 기반의 서방형 BMP 전달체를 포함하는 골이식재.A bone graft material comprising the collagen-based sustained release BMP transporter according to claim 7.
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR10-2015-0086395 | 2015-06-18 | ||
KR1020150086395A KR101790782B1 (en) | 2015-06-18 | 2015-06-18 | A bisphosphonates containing collagen based sustained delivery system for BMP and a method for manufacturing the same |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2016204403A1 true WO2016204403A1 (en) | 2016-12-22 |
Family
ID=57545780
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/KR2016/004643 WO2016204403A1 (en) | 2015-06-18 | 2016-05-03 | Collagen-based sustained-release bmp delivery carrier comprising bisphosphonate, and production method for same |
Country Status (2)
Country | Link |
---|---|
KR (1) | KR101790782B1 (en) |
WO (1) | WO2016204403A1 (en) |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20080065606A (en) * | 2005-09-02 | 2008-07-14 | 인터페이스 바이오텍 에이/에스 | A method for cell implantation |
KR20130092511A (en) * | 2012-02-09 | 2013-08-20 | 고려대학교 산학협력단 | Antibiotics and osteoinductive molecules-eluting implant or scaffold with enhanced osteointegration and antibacterial activity and the manufacturing method thereof |
KR20140094305A (en) * | 2013-01-22 | 2014-07-30 | 서울대학교산학협력단 | Method for preparing apatite-coated collagen scaffold |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
AUPR553701A0 (en) | 2001-06-07 | 2001-07-12 | Royal Alexandra Hospital For Children, The | A device for the delivery of a drug to a fractured bone |
FI20031120A0 (en) | 2003-07-31 | 2003-07-31 | Bci Bioabsorbable Concepts Ltd | Multifunctional implant device |
-
2015
- 2015-06-18 KR KR1020150086395A patent/KR101790782B1/en active IP Right Grant
-
2016
- 2016-05-03 WO PCT/KR2016/004643 patent/WO2016204403A1/en active Application Filing
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20080065606A (en) * | 2005-09-02 | 2008-07-14 | 인터페이스 바이오텍 에이/에스 | A method for cell implantation |
KR20130092511A (en) * | 2012-02-09 | 2013-08-20 | 고려대학교 산학협력단 | Antibiotics and osteoinductive molecules-eluting implant or scaffold with enhanced osteointegration and antibacterial activity and the manufacturing method thereof |
KR20140094305A (en) * | 2013-01-22 | 2014-07-30 | 서울대학교산학협력단 | Method for preparing apatite-coated collagen scaffold |
Non-Patent Citations (2)
Title |
---|
MURPHY, C. M. ET AL.: "A Collagen-hydroxyapatite Scaffold allows for Binding and Co-delivery of Recombinant Bone Morphogenetic Proteins and Bisphosphonates.", ACTA BIOMATERIALIA, vol. 10, no. 5, 2014, pages 2250 - 2258, XP055338184 * |
WISSINK, M. J. B. ET AL.: "Immobilization of Heparin to EDC/NHS-crosslinked Collagen. Characterization and in Vitro Evaluation.", BIOMATERIALS, vol. 22, no. 2, 2001, pages 151 - 163, XP004236388 * |
Also Published As
Publication number | Publication date |
---|---|
KR101790782B1 (en) | 2017-10-26 |
KR20160149441A (en) | 2016-12-28 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US7163920B2 (en) | Peptide with osteogenic activity | |
Samee et al. | Bone morphogenetic protein-2 (BMP-2) and vascular endothelial growth factor (VEGF) transfection to human periosteal cells enhances osteoblast differentiation and bone formation | |
KR101728675B1 (en) | Scaffold for hard tissue regeneration containing active ingredient for treating osteoporosis and preparing method thereof | |
WO2011002249A2 (en) | In situ forming hydrogel and biomedical use thereof | |
Luong et al. | Effects of osteogenic growth factors on bone marrow stromal cell differentiation in a mineral-based delivery system | |
WO2010024549A2 (en) | Bone filler containing a sustained-release therapeutic agent for osteoporosis | |
JP2002520334A (en) | How to promote bone and cartilage growth and repair | |
EP3274003B1 (en) | Biphasic ceramic bone substitute | |
Maeda et al. | Bone healing by sterilizable calcium phosphate tetrapods eluting osteogenic molecules | |
Song et al. | Synergistic effects of fibroblast growth factor-2 and bone morphogenetic protein-2 on bone induction | |
WO2019066140A1 (en) | Pharmaceutical composition and biomaterial comprising fusion peptide having parathyroid hormone (pth) conjugated with peptide selective for bone tissue | |
WO2011090255A2 (en) | Highly injectable calcium-based bone cement composition | |
Toledano‐Osorio et al. | Doxycycline‐doped collagen membranes accelerate in vitro osteoblast proliferation and differentiation | |
WO2021040249A1 (en) | Foraminifera-derived bone graft material | |
WO2016204403A1 (en) | Collagen-based sustained-release bmp delivery carrier comprising bisphosphonate, and production method for same | |
Huang et al. | Melatonin having therapeutic bone regenerating capacity in biomaterials | |
Wang et al. | A Recombinant Parathyroid Hormone‐Related Peptide Locally Applied in Osteoporotic Bone Defect | |
WO2022050694A1 (en) | Biomimetic tissue-adhesive hydrogel patch for preventing or treating cartilage or bone diseases | |
KR101811391B1 (en) | A bisphosphonates containing collagen based sustained delivery system for BMP and a method for manufacturing the same | |
WO2022050695A1 (en) | Extracellular matrix-supported biomimetic tissue adhesive hydrogel patch | |
WO2014208824A1 (en) | Method for producing implant having bioactive material immobilized on surface thereof and implant produced thereby | |
WO2023013964A1 (en) | Composition for preparing organic-inorganic complex hydrogel and kit for preparing organic-inorganic complex hydrogel comprising same | |
WO2018139869A1 (en) | Cell therapy product for bone regeneration and preparation method therefor | |
Preidl et al. | Lineage-associated connexin 43 expression in bisphosphonate-exposed rat bones | |
KR20160126766A (en) | Composition for sustained release of bioactive subastances comprising a decellularized extracellular matrix and use thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 16811816 Country of ref document: EP Kind code of ref document: A1 |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
122 | Ep: pct application non-entry in european phase |
Ref document number: 16811816 Country of ref document: EP Kind code of ref document: A1 |