WO2016204403A1 - Collagen-based sustained-release bmp delivery carrier comprising bisphosphonate, and production method for same - Google Patents

Abstract

The present invention provides: a collagen-based sustained-release BMP delivery carrier wherein a collagen-based BMP delivery carrier has incorporated therein a bisphosphonate, and heparin is selectively secured thereto so as to increase the affinity between the collagen and the BMP in the collagen-based BMP delivery carrier, such that an appropriate concentration of BMP can be released on a sustained basis and the BMP release rate and release extent can be adjusted; and a production method for the collagen-based sustained-release BMP delivery carrier. According to the present invention, by releasing an appropriate concentration of BMP on a sustained basis, it is possible to induce and promote bone differentiation of marrow-derived mesenchymal stem cells, and it is possible to promote bone formation or bone regeneration in a bone defect.

Description

Collagen-Based Sustained Release JPMP Carrier Containing Bisphosphonate and Method for Making the Same

The present invention relates to a collagen-based sustained release BMP (Bone Morphogenetic Protein (BMP) carrier) including a bisphosphonate and a method for preparing the same, and more specifically, to a collagen-based BMP carrier by containing bisphosphonates and optionally heparin. It relates to a collagen-based sustained release BMP transporter and a method for preparing the same that can control the release persistence, release rate and degree of release.

Specifically, the present invention can increase the affinity of collagen and BMP in the collagen-based BMP transporter by containing bisphosphonates in the collagen-based BMP transporter and selectively immobilizing heparin, thereby continually releasing an appropriate concentration of BMP and It relates to a collagen-based sustained release BMP transporter and a method for preparing the same that can control the release rate and the degree of release.

The present invention also relates to a process for inducing and promoting bone differentiation of bone marrow-derived mesenchymal stem cells by continuously releasing an appropriate concentration of BMP using a collagen-based sustained-release BMP transporter containing bisphosphonates and optionally heparin. .

In addition, the present invention relates to a process for promoting bone formation or bone regeneration by implanting a collagen-based sustained release BMP transporter containing bisphosphonate and optionally heparin into a bone defect so that an appropriate concentration of BMP is continuously released. .

Bone Morphogenetic Protein (hereinafter abbreviated as BMP) is an important growth factor in promoting bone regeneration, and examples thereof include BMP-1, BMP-2, BMP-4, and BMP 7. Of these various BMPs, BMP-2 is reported to have the best osteoinductive ability. When BMP is implanted into the muscle, cartilage is first formed on the 5th to 7th day, and when capillaries invade the cartilage tissue, it is known that the cartilage is absorbed and then the heterotopic bone tissue is formed in the muscle. Therefore, BMP is used to induce bone differentiation of an applied site by applying it alone or in combination with bone graft material to a site of bone injury or bone regeneration, and ultimately to promote bone formation or bone regeneration.

However, since BMP, such as BMP-2, is rapidly diffused and lost in vivo due to its water-soluble property, it is difficult to continuously apply to a desired bone injury site. Therefore, for effective bone regeneration in the field of bone regeneration medicine, a carrier capable of slowly releasing at an appropriate concentration while supporting BMP is essential.

Currently, various studies on the carrier for the effective application of BMP are in progress. Biomaterials such as β-Tricalcium Phosphate (β-TCP), fibrin-fibronectin sealing system (FFSS), Macroporous biphasic calcium phosphate (MBCP), and collagen, which have been studied, perform basic functions as BMP carriers, There is a limitation that does not meet the requirements of the ideal BMP carrier for the purpose of bone graft material used in.

For example, β-TCP is widely used in clinical practice as an osteoconductive bone substitute and has the property of maintaining BMP in the micropores and slowly releasing it, but has a weak sustained release. In addition, it is pointed out that while the space maintenance ability of the defect is excellent, the moldability is poor and the rate of dissolution and absorption in the living body does not match the rate of bone regeneration, thereby preventing the formation of new bone.

Compared with other carriers, FFSS is known to have disadvantages such as new bone formation, defect closure, bone density, etc. The coagulated FFSS dissolves in a week and is unsuitable for sustained release BMP carriers.

MBCP is a combination of hydroxyapatite and β-TCP in various ratios of 6: 4, 7: 3, and 8: 2, providing a framework for the slow absorption of hydroxyapatite and rapidly absorbing β-TCP. To form a space in which bone can be produced. However, MBCP has a relatively weak physical property and a slow release effect as a carrier capable of continuously releasing BMP-2.

Collagen is a biocompatible material approved by the US FDA and the Korean Food and Drug Administration. When used as a BMP carrier, collagen generally has excellent cell adhesiveness and easy molding. However, since the affinity with BMP is relatively low, when the collagen BMP carrier is applied to a bone defect, high concentrations of BMP release may cause swelling or other problems.

Therefore, there is still a need in the art to develop an ideal collagen-based BMP transporter capable of continuously releasing an appropriate concentration of BMP and meeting the purpose of bone graft material.

On the other hand, bisphosphonate is a bone resorption inhibitor that plays a role in reducing the activity of osteoclasts, its type is for oral administration and injection, and a variety of medicinal strengths have been developed, and are typically alendronate, zoleronate, and ivan Dronate and the like are widely used for the treatment of osteoporosis and Pajese disease, suppression of bone metastasis of malignant tumors and suppressing hypercalcemia. In recent studies, bisphosphonates have been reported to have an effect of inducing bone differentiation of osteoblasts and mesenchymal stem cells. However, previous studies have noted that bisphosphonates have osteoclast suppression or osteoblast differentiation efficacy, and the effects of bisphosphonates on collagen-based transporters, in particular collagen-based transporters, when combined with collagen. Attention has not been paid to the effects on the released BMP.

In this paper, S. Panzavolta et al. Have suggested that gelatin, a collagen-like substance, is included in α-TCP (tricalcium phosphate) cement to improve mechanical properties and increase the amount of bisphosphonates loaded on α-TCP cement by gelatin. It is disclosed about [S. Panzavolta et al. Functionalization of biomimetic calcium phosphate bone cements with alendronate, Journal of Inorganic Biochemistry 104 (2010) 1099-1106]. However, the prior art discloses that gelatin is used to contain a large amount of bisphosphonate as an active ingredient in α-TCP cement, an artificial bone graft material, and bisphosphonate itself is used as an active ingredient to inhibit the osteoclast. When combined with the effect on the collagen-based transporter, in particular the effect on the release of BMP loaded on the collagen-based transporter, etc. is not disclosed or implied at all.

Further, US Patent Publication No. US 2007/0191851 A1 discloses the use of collagen as a carrier supporting an active ingredient, and BMP, bisphosphonate, and the like as the active ingredient supported on such collagen. However, the prior art only mentions the use of bisphosphonates as osteoclast inhibitors and the use of BMPs as osteoinducers, and does not disclose anything about the effects of bisphosphonates on collagen-based transporters when combined with collagen. Or does not imply. That is, the prior art only discloses the loading of each active ingredient on the collagen carrier based on the individual efficacy of each active ingredient, and the effect of bisphosphonates on the BMP release carried on the collagen-based carrier when combined with collagen. It is not disclosed or implied at all.

In addition, WO 2002/098307 A1 discloses a mixture of bisphosphonates and collagen, and discloses that a collagen and bisphosphonate mixture composition is coated on a bone fixation device to help treat fractures. However, the prior art also does not disclose or imply any effect on the collagen-based transporter when bisphosphonate is combined with collagen. That is, the prior art only discloses the use of bisphosphonate as an effective drug component at the fracture site, paying attention to the osteoclast suppression and osteoinduction efficacy of the bisphosphonate, and the BMP loaded on the collagen-based transporter when the bisphosphonate is combined with collagen. Unexpected effects on release, etc., are not disclosed or implied at all.

In view of the problems of the prior arts described above, the present inventors have continued to develop technologies for compensating the low affinity of collagen with BMP and increasing the osteoinductive capacity of BMP. The present invention was completed by confirming that the release persistence, the release rate, and the degree of release can be controlled and that bone formation or bone regeneration can be promoted in the bone defect.

In addition, the present inventors have also confirmed that heparin covalently binds the free amine group of collagen and plays an important role in the binding of collagen and BMP through ionic bonds with BMP, thereby efficiently controlling BMP persistence and release rate of the collagen transporter.

It is an object of the present invention to provide a collagen-based sustained release BMP carrier and a method for preparing the same, which can control the release sustainability, release rate, and degree of release of BMP by containing bisphosphonates and optionally heparin in the collagen-based BMP carrier.

Specifically, the present invention can increase the affinity of collagen and BMP in the collagen-based BMP transporter by containing bisphosphonates in the collagen-based BMP transporter and selectively immobilizing heparin, thereby continually releasing an appropriate concentration of BMP and It is an object of the present invention to provide a collagen-based sustained release BMP carrier and a method for preparing the same that can control the release rate and the degree of release thereof.

In addition, the present invention provides a process for inducing and promoting bone differentiation of bone marrow-derived mesenchymal stem cells by continuously releasing an appropriate concentration of BMP using a collagen-based sustained release BMP transporter containing bisphosphonates and optionally heparin. The purpose is.

In addition, the present invention provides a process for promoting bone formation or bone regeneration by implanting a collagen-based sustained release BMP transporter containing bisphosphonate and optionally heparin into the bone defect to continuously release an appropriate concentration of BMP. The purpose is.

As a result of intensive studies to solve the technical problem of the present invention and meet the object of the invention, the inventors of the present invention provide a bisphosphonate-based drug in order to compensate the low affinity of collagen with BMP and increase the osteoinductive capacity of BMP. It has led to the design of a collagen-based sustained release BMP transporter, which optionally contains heparin.

Collagen-based sustained release BMP carrier of one embodiment of the present invention,

A collagen support obtained by mixing the collagen solution and the bisphosphonate solution and then lyophilizing, and a bisphosphonate contained in the collagen support; And

It contains BMP supported on the collagen support containing the bisphosphonate is released continuously for a predetermined time. The collagen-based sustained release BMP carrier of one embodiment of the present invention can efficiently control the release sustainability, release rate and degree of release of BMP by containing bisphosphonates.

The collagen-based sustained release BMP carrier of one embodiment of the present invention preferably further contains heparin immobilized on the collagen support containing the bisphosphonate. At this time, heparin covalently bonds with the free amine group of the collagen support and ionic bonds with the BMP, thereby playing a necessary role for binding of the collagen support to the BMP. Therefore, the collagen-based sustained release BMP transporter of one embodiment of the present invention can further control the release persistence, release rate, and degree of release of BMP by further containing heparin.

In the collagen-based sustained-release BMP carrier of an embodiment of the present invention, the collagen support is preferably ionized atelo collagen from which telopeptide is removed from collagen, and more preferably, cationic collagen support. For example, the cationized collagen support (or anionized collagen support) has a cation (or anion) on its surface, thereby facilitating the binding of negatively charged (or positively charged) materials to the BMP carrier. It enhances and improves cell adhesion compared to normal collagen support.

As used herein, the term "ionized collagen" encompasses cationized collagen or anionized collagen, and may be prepared by ionizing collagen prepared through pretreatment and extraction of animal tissues well known in the art. have. Ionized collagen constituting the ionized collagen based sustained release BMP transporter of one embodiment of the present invention can be obtained according to methods well known in the art. For example, cationized collagen can be obtained by adding collagen to ethanol or methanol and then esterifying, and anionized collagen can be obtained by reacting collagen with succinic anhydride (US 2013/0071645 A1). And US 2014/0377737 A1). However, the present invention is not limited thereto, and any of a variety of known methods for producing cationized collagen and anionized collagen may be used.

In the collagen-based sustained-release BMP carrier of one embodiment of the present invention, the bisphosphonate-containing collagen support is preferably crosslinked, and crosslinked with EDC (N- (3-Dimethylaminopropyl) -N'-ethylcarbodiimide hydrochloride) solution. More preferably. However, the present invention is not limited thereto, and various crosslinking materials known in the art may be used.

In the collagen-based sustained-release BMP carrier of one embodiment of the present invention, the bisphosphonate-containing collagen is a solution in which heparin is dissolved in MES (4-Morpholine ethane sulfonic acid) buffer containing EDC and NHS (N-hydroxysuccinimide). By treating the support, the heparin can be fixed to the collagen support containing the bisphosphonate.

Collagen-based sustained-release BMP carriers in one embodiment of the present invention are hydroxy apatite, a mixture of hydroxy apatite and tri-calcium phosphate (TCP), tri-calcium phosphate (TCP) or animal bones, eg bovine bones, horse bones. Or may further comprise porcine bone. At this time, the bone of the animal is preferably removed from the protein and fat. However, the present invention is not limited thereto, and any bone of an animal applicable to the human body without side effects may be used.

In one embodiment of the present invention, a method for preparing a collagen-based sustained-release BMP carrier comprises mixing a collagen solution and a bisphosphonate solution, lyophilizing a mixed solution of a collagen solution and a bisphosphonate solution, and a bisphosphonate obtained by lyophilization. Supporting the BMP on the contained collagen support.

The method for preparing a collagen-based sustained-release BMP carrier of an embodiment of the present invention preferably further comprises fixing heparin to the collagen support containing the bisphosphonate. At this time, heparin is covalently bonded to the free amine group of the collagen support and ionic bond with the BMP plays a necessary role for the binding of collagen and BMP.

In the method for preparing a collagen-based sustained-release BMP carrier of an embodiment of the present invention, the collagen support is preferably ionized atelo collagen from which telopeptide is removed from collagen, and more preferably, cationic collagen support.

In the method for producing a collagen-based sustained-release BMP carrier of an embodiment of the present invention, the bisphosphonate-containing collagen support is preferably crosslinked, more preferably crosslinked with an EDC solution. However, the present invention is not limited thereto, and various crosslinking materials known in the art may be used.

In the method for preparing a collagen-based sustained-release BMP carrier of an embodiment of the present invention, the bisphosphonate is a solution in which heparin is dissolved in MES (4-Morpholine ethane sulfonic acid) buffer containing EDC and NHS (N-hydroxysuccinimide). By treating the contained collagen support, the step of immobilizing the heparin can be performed.

Collagen-based sustained-release BMP delivery method of one embodiment of the present invention is a hydroxy apatite, a mixture of hydroxy apatite and TCP (tri-calcium phosphate), TCP (tri-calcium phosphate) or animal bone, for example The method may further include adding a bovine bone, a horse bone, or a pork bone. At this time, the bone of the animal is preferably removed from the protein and fat.

In addition, the collagen-based sustained-release BMP transporter of an embodiment of the present invention may be prepared by, for example, a method of preparing a collagen-based sustained release BMP transporter.

In addition, the bone graft material of the present invention is characterized in that it comprises a collagen-based sustained release BMP transporter as described above.

On the other hand, in the present invention, the bisphosphonate is alendronate (alendronate), zoleronate (zoledronate), ibandronate (ibandronate), pamidronate (pamidronate), etidronate (clodronate) , Risedronate, tiludronate, incadronate, olpadronate and neridronate, and the like. However, the present invention is not limited thereto and various bisphosphonates known in the art may be used.

According to the present invention, by containing bisphosphonates and optionally heparin in the collagen-based BMP transporter, it is possible to efficiently control the release sustainability, release rate and degree of release of BMP.

Specifically, the present invention can increase the affinity of collagen and BMP in the collagen-based BMP transporter by containing bisphosphonates in the collagen-based BMP transporter and selectively immobilizing heparin, thereby continually releasing an appropriate concentration of BMP and The release rate and release rate of can be controlled efficiently.

In addition, according to the present invention, by using a collagen-based sustained-release BMP transporter containing bisphosphonates and optionally heparin, the BMP concentration can be continuously released to induce and promote bone differentiation of bone marrow-derived mesenchymal stem cells. .

In addition, according to the present invention, a collagen-based sustained-release BMP transporter containing bisphosphonate and optionally heparin may be implanted into a bone defect to promote bone formation or bone regeneration by continuously releasing an appropriate concentration of BMP. .

1 is a time course of ionized collagen alone carrier (EC), bisphosphonate containing ionized collagen carrier (EC / A), heparin containing ionized collagen carrier (EC / H), bisphosphonate and heparin containing ionized collagen carrier (EC / A / H) Is a graph comparing the amount of BMP-2 released according to (n = 4, mean ± SE).

Figure 2 shows natural collagen (unionized collagen) carrier alone (NC), bisphosphonate containing natural collagen transporter (NC / A), heparin containing natural collagen transporter (NC / H), bisphosphonate and heparin containing natural collagen transporter (NC / A) / H) is a graph comparing the amount of BMP-2 release over time (n = 4, mean ± SE).

3 shows ionized collagen alone carrier (EC), bisphosphonate containing ionized collagen carrier (EC / A), heparin containing ionized collagen carrier (EC / H), bisphosphonate and heparin containing ionized collagen carrier (EC / A / H), culture dish (C) Alizarin Red S staining picture of bone marrow-derived mesenchymal stem cells induced on (C). The lower photo of FIG. 3 is a micrograph at 100 times magnification of the upper photo.

4 shows ionized collagen alone carrier (EC), bisphosphonate containing ionized collagen carrier (EC / A), heparin containing ionized collagen carrier (EC / H), bisphosphonate and heparin containing ionized collagen carrier (EC / A / H), culture dish (C) is a histogram showing the comparison of calcium deposition of bone marrow-derived mesenchymal stem cells cultured on bone differentiation [n = 3, mean ± SE; * p <0.05, ** p <0.01 (statistic significance level for ionized collagen alone transporter); # p <0.05 (statistic significance level for all carriers)].

FIG. 5 shows ionized collagen alone carrier (EC) coating, bisphosphonate containing ionized collagen carrier (EC / A) coating, heparin containing ionized collagen carrier (EC / H) coating, bisphosphonate and heparin containing ionized collagen carrier (EC / A / H) It is a histogram showing the comparison of bone formation factor (ALP, OCN and OPN) expression levels of bone marrow-derived mesenchymal stem cells in bone differentiation-induced culture (two-dimensional culture) on a coating and culture dish (C) [n = 3, mean ± SE; * p <0.05, ** p <0.01 (statistic significance level for culture dishes); ## p <0.01 (statistic significance level for ionized collagen alone transporter)].

Figure 6 shows ionized collagen alone carrier (EC) sponge, bisphosphonate containing ionized collagen carrier (EC / A) sponge, heparin containing ionized collagen carrier (EC / H) sponge, bisphosphonate and heparin containing ionized collagen carrier (EC / A / H) It is a histogram showing the comparison of bone formation factor (ALP, OCN, and OPN) expression levels of bone marrow-derived mesenchymal stem cells in bone differentiation-induced culture (three-dimensional culture) on a sponge [n = 6, mean ± SE; * p <0.05, ** p <0.01 (statistic significance level for ionized collagen alone transporter)].

FIG. 7 is a comparative photograph taken at 4 and 8 weeks after transplanting the control group containing BMP to the ionized collagen transporter and the transporter containing BMP to the bisphosphonate and heparin containing ionized collagen, respectively, in a white skull cranial defect model. One micro-CT picture.

FIG. 8 shows a control model containing BMP in an ionized collagen transporter and a BMP-containing transporter in bisphosphonate and heparin containing ionized collagen in a white skull cranial bone defect model, respectively. MT (Masson's trichrome) stained picture.

FIG. 9 is an indicator of new bone formation in cranial defects measured at 4 and 8 weeks after implantation of ionized collagen carrier controls and bisphosphonate and heparin-containing ionized collagen carriers in a white skull cranial defect model, respectively. (tissue volume), bone volume (BV) and BV / TV.

FIG. 10 shows Tb, an index related to new bone formation in skull defects measured at 4 and 8 weeks after implantation of ionized collagen transporters and bisphosphonate and heparin-containing ionized collagen transporters, respectively, in a rat skull bone defect model. It is a bar graph which compares and shows the trabecular thickness (Th), the trabecular number (Tb.N), and the trabecular space (Tb.Sp).

FIG. 11 shows BMDs related to new bone formation in cranial defects measured at 4 and 8 weeks after implantation of ionized collagen transporters and bisphosphonate and heparin-containing ionized collagen transporters, respectively, in a rat skull bone defect model. bar graph showing bone mineral density comparisons.

FIG. 12 is a graph comparing the ratio of ionized collagen to synthetic bone and the amount of BMP-2 release of ionized collagen / synthetic bone carrier depending on the presence of bisphosphonates and heparin (n = 4, mean ± SE). The BMP-2 release data of FIG. 12 were obtained from ionized collagen / synthetic bone carriers with mass ratios of ionized collagen and synthetic bone 100: 0, 50:50, 10:90 and 5:95, respectively, and 95: 5 (A / H) shows data obtained from ionized collagen / synthetic bone carriers containing bisphosphonates and heparin with a mass ratio of ionized collagen to synthetic bone being 95: 5.

Hereinafter, the present invention will be described in detail according to embodiments which do not limit the present invention. The following examples of the present invention are not intended to limit or limit the scope of the present invention only to embody the present invention. Therefore, what can be easily inferred by the expert in the technical field to which this invention belongs from the detailed description and the Example of this invention is interpreted as belonging to the scope of the present invention. References cited in the present invention are incorporated herein by reference.

Example 1 Preparation of Ionized Collagen Transporters Containing Bisphosphonates and Optional Heparin

First, ionized collagen is prepared through pretreatment, extraction and ionization of animal tissues well known in the art (see, eg, US Patent Publications US 2013/0071645 A1 and US 2014/0377737 A1). Ionized collagen prepared through this known procedure is used for the preparation of ionized collagen carriers comprising bisphosphonates and optionally heparin as described below. It is preferable to use ionized atelo collagen from which telopeptide is removed as ionized collagen. Method for producing an ionized collagen carrier comprising a bisphosphonate of one embodiment of the present invention and optionally heparin is as follows.

(1) Dissolve 0-1% (w / v) bisphosphonate in purified water.

(2) 1% (w / v) ionized collagen is dissolved in the bisphosphonate solution obtained in step (1).

(3) The ionized collagen / bisphosphonate solution obtained in step (2) was dispensed and lyophilized at −40 ° C. for 24 hours to prepare a sponge-type bisphosphonate-containing ionized collagen carrier.

(4) The ionized collagen carrier obtained in step (3) was crosslinked for 4 hours with 2 mM EDC (N- (3-Dimethylaminopropyl) -N'-ethylcarbodiimide hydrochloride) solution dissolved in 70% ethanol.

(5) The crosslinked ionized collagen carrier obtained in step (4) was washed 10 times with purified water for 10 minutes.

(6) In order to fix the heparin in the ionized collagen carrier obtained in step (5), 1 to 5 mM MES (4-Morpholine ethane sulfonic acid) buffer containing 2 mM EDC and 1 mM NHS (N-hydroxysuccinimide) 1 The solution is reacted with a solution of heparin in% (w / v) for 4 hours. On the other hand, ionized collagen transporters that do not require heparin fixation are reacted with 5 mM MES buffer containing 2 mM EDC and 1 mM NHS that did not dissolve heparin.

(7) The ionized collagen carrier reacted with the MES buffer in step (6) was washed 10 times with purified water for 10 minutes.

(8) After freezing the ionized collagen carrier washed in step (7) to -80 ℃, it is dried for 24 hours.

(9) The ionized collagen carrier obtained in step (8) is sterilized with ethylene oxide (EO) gas.

Example 2: Comparison of BMP-2 Release Rate in Ionized Collagen Transporters

In order to measure the aspect of BMP-2 released from ionized collagen (hereinafter referred to as "bisphosphonate / heparin containing ionized collagen") containing bisphosphonate and optionally heparin of one embodiment of the present invention prepared in Example 1, The procedure was performed.

(1) 50 μg / ml of BMP-2 is dissolved in PBS buffer.

(2) 100 μL of the BMP-2 solution obtained in step (1) was soaked in the ionized collagen carrier prepared by the method of Example 1, and then stored at room temperature for 1 hour.

(3) The ionized collagen transporter soaked in BMP-2 solution in step (2) was immersed in 2 ml of PBS buffer and stored at 37 ° C. in a shaker at 15 rpm.

(4) The supernatant of the PBS buffer in which the ionized collagen transporter was immersed in step (3) was taken at predetermined time points and cryopreserved.

(5) Take the supernatant for each time zone in step (4) and discard the remaining PBS buffer, and then immerse the ionized collagen carrier in 2 ml of PBS buffer and store it in shaker culture again.

(6) The supernatant taken in step (4) was analyzed with a BMP-2 ELISA kit (Antigenix America Inc., USA) to determine the amount of BMP-2 released from the ionized collagen transporter.

The result is as shown in Figure 1 (n = 4, mean ± SE). As shown in FIG. 1, BMP-2 release from bisphosphonate containing ionized collagen carrier (EC / A) and bisphosphonate and heparin containing ionized collagen carrier (EC / A / H) compared to conventional ionized collagen alone carrier (EC) You can see that the speed is controlled by the delay.

From these results, it can be seen that the bisphosphonate / heparin-containing ionized collagen carrier of the present invention delays the release of BMP, and the rate and degree of release thereof are constantly adjusted over time, compared to the ionized collagen carrier containing no bisphosphonate. . That is, the bisphosphonate / heparin-containing ionized collagen-based sustained-release BMP transporter of the present invention contains a bisphosphonate-based drug in the ionized collagen transporter, thereby maintaining sustained release of BMP in addition to promoting bone formation along with BMP and releasing BMP. Efficacy in controlling the speed constantly.

In addition, in the bisphosphonate / heparin-containing ionized collagen-based sustained-release BMP carrier of the present invention, when the collagen is cationicly treated by chemical treatment with methanol or ethanol, the surface of the modified collagen has a negative charge and The binding is facilitated, and the adhesion to BMP is increased in the preparation of the BMP transporter, and the adhesion of cells is improved compared to the normal collagen.

In addition, in the bisphosphonate / heparin-containing ionized collagen-based sustained-release BMP transporter of the present invention, heparin is covalently bonded to the free amine group of collagen and the collagen and BMP are efficiently mediated by the binding of collagen and BMP through ionic bonding with BMP. The carrier's BMP persistence and release rate can be controlled.

Putting these results together, in this example, the bisphosphonate / heparin-containing sustained release collagen-based sustained release BMP carrier enhances the affinity of ionized collagen and BMP, thereby maintaining the sustained release of BMP, It can be seen that the degree of release can be controlled efficiently.

Example 3: Comparison of rhBMP-2 Release Rate in Natural Collagen Transporters

In Example 2, the release rate of BMP-2 was measured for a carrier using ionized collagen, whereas in the present example, the release rate of BMP-2 was measured using a carrier using natural collagen (unionized collagen) instead of ionizing collagen. Measured.

Natural collagen alone carrier (NC) sponge, bisphosphonate containing natural collagen carrier (NC / A) sponge, heparin containing natural collagen carrier according to the method of Example 1, except using natural collagen instead of using ionized collagen. / H) sponges and bisphosphonates and heparin-containing natural collagen carrier (NC / A / H) sponges are prepared.

5 μg of rhBMP-2 was loaded on each of the prepared carrier sponges, and then immersed in ₂ ml (2.5 mM Ca ²⁺ ) PBS / CaCl ₂ buffer and stored at 37 ° C. in a shaker at 15 rpm. Then, the supernatant was taken for each time slot (0.5, 1, 2, 4, 8, 12, 24, 48 hours) in the same manner as in Example 2, and the amount of BMP-2 was measured.

The results are as shown in Figure 2 (n = 4, mean ± SE). As shown in FIG. 2, the rate of BMP-2 release in bisphosphonate containing natural collagen transporter (NC / A) and bisphosphonate and heparin containing natural collagen transporter (NC / A / H) compared to natural collagen alone transporter (NC) You can see that it is controlled with delay. In other words, it can be seen that the bisphosphonate / heparin-containing transporter based on natural collagen also exhibits a comparable delayed BMP-2 release effect to the bisphosphonate / heparin-containing transporter based on ionized collagen.

From these results, it can be seen that the bisphosphonate / heparin-containing natural collagen transporter of the present invention delays the release of BMP compared to the natural collagen transporter containing no bisphosphonate, and its release rate and degree are constantly controlled over time. . That is, the bisphosphonate / heparin-containing sustained-release BMP carrier of the present invention contains bisphosphonate-based drugs in the natural collagen carrier, thereby maintaining the sustained release of BMP and releasing BMP in addition to the effect of promoting bone formation with BMP. Efficacy in controlling the speed constantly.

In addition, in the bisphosphonate / heparin-containing natural collagen-based sustained-release BMP transporter of the present invention, heparin is covalently bonded to the free amine group of collagen and the collagen is effectively mediated by the binding of collagen and BMP through ionic bonding with BMP. The carrier's BMP persistence and release rate can be controlled.

Putting these results together, in this embodiment, the bisphosphonate / heparin-containing sustained-release BMP transporter also enhances the affinity of natural collagen and BMP, thereby maintaining sustained release of BMP, and It can be seen that the degree of release can be controlled efficiently.

Example 4 Bone Differentiation Identification Test of Bone Marrow-derived Mesenchymal Stem Cells in Ionized Collagen-Based Sustained Release BMP Transporter Containing Bisphosphonate / Heparin

In this example, the following in vitro tests were performed to confirm the bone differentiation efficacy of bone marrow-derived mesenchymal stem cells on bisphosphonate / heparin-containing ionized collagen-based sustained release BMP transporters.

Example 4-1: Two-dimensional Culture of Bone Marrow-derived Mesenchymal Stem Cells

(1) Dissolve 0-1% (w / v) bisphosphonate in purified water.

(2) 1% (w / v) ionized collagen is dissolved in the bisphosphonate solution obtained in step (1).

(3) The collagen / bisphosphonate solution obtained in step (2) was dispensed into a culture dish, completely dried, crosslinked with 2 mM EDC solution dissolved in 70% ethanol for 4 hours, and washed with purified water.

(4) In order to fix the heparin in the culture dish prepared in step (3), incubated with a solution of 1% (w / v) heparin dissolved in 5 mM MES buffer containing 2 mM EDC and 1 mM NHS The dish is allowed to react for 4 hours. On the other hand, if heparin fixation is not required, the culture dish is reacted with 5 mM MES buffer containing 2 mM EDC and 1 mM NHS without heparin lysis.

(5) wash the culture plate prepared in step (4) with PBS buffer.

(6) Inoculate 1 × 10 ⁴ bone marrow-derived mesenchymal stem cells isolated from SD rats (Sprague Dawley rat) in the culture dish washed in step (5) to induce bone differentiation in a CO ₂ incubator at 37 ° C. Incubate while Here, bone differentiation inducing agent (10 ^-8 M dexamethasone, 50 μg / ml in DMEM (Dulbecco's Modified Eagle's Medium; high glucose) containing 10% FBS (Fetal Bovine Serum) and 1% antibiotic as a culture medium for bone differentiation induction culture Ascorbic acid, 10 mM β-glycerophosphate) is added and used. Change the culture every 2-3 days during the incubation.

Example 4-2: Alizarin Red S Staining of Bone Marrow-derived Mesenchymal Stem Cells in Bone Differentiation Induction Culture (2D Culture)

Alizarin Red S staining was performed on bone marrow-derived mesenchymal stem cells cultured on bone differentiation in sustained-release BMP carriers based on bisphosphonates / heparin containing ionized collagen to colorimetric calcification of bone differentiated cells. Also, for comparison, bone marrow derived from bone marrow induction cultured for 2 weeks in an ionized collagen alone carrier (EC), a heparin-containing ionized collagen carrier (EC / H), a culture dish (C), etc., in the same manner as in Example 4-1. Alizarin Red S staining was also performed on mesenchymal stem cells according to the following method.

(1) The bone marrow-derived mesenchymal stem cells cultured for 2 weeks by the method of Example 4-1 were fixed with 10% formalin for 15 minutes, and then washed three times with PBS buffer.

(2) The cells fixed in step (1) were soaked in 2% (w / v) alizarin red S solution for 20 minutes, and then washed 5 times with PBS buffer.

The result is shown in FIG. As shown in FIG. 3, ionizing collagen alone transporter (EC), bisphosphonate containing ionized collagen transporter (EC / A), heparin containing ionized collagen transporter (EC / H), and bisphosphonate and heparin containing ionization via alizarin red S staining The bone marrow-derived mesenchymal stem cells on the collagen transporter (EC / A / H) stained red to observe calcification due to bone differentiation. These results showed a marked difference compared to the staining results for stem cells cultured in the culture dish (C). In addition, Alizarin Red S staining showed that the bisphosphonate-containing ionized collagen transporter (EC / A) and the bisphosphonate- and heparin-containing ionized collagen transporter (EC / A / H) were the ionized collagen alone transporter (EC) and the heparin-containing ionized collagen transporter (EC / A). It can be seen that the color is more red than H).

From these results, it can be seen that in this Example, the bisphosphonate / heparin-containing ionized collagen-based sustained release BMP transporter can continuously release BMP, thereby inducing and promoting bone differentiation of bone marrow-derived mesenchymal stem cells. have.

Example 4-3 Quantification of Calcium Deposition of Bone Marrow-derived Mesenchymal Stem Cells in Bone Differentiation Induction Culture (2D Culture)

Bone marrow-derived mesenchymal stem cells cultured for 2 weeks by the method of Example 4-1 to determine the calcium deposition amount of bone marrow-derived mesenchymal stem cells cultured in bone differentiation in bisphosphonate / heparin-containing sustained-release BMP carriers was measured in the 0.5 N HCl was added to the calcium deposition in the supernatant QuantiChrom ^TM calcium assay kit (QuantiChrom ^TM calcium assay kit) (BioAssay Systems, USA). Also, for comparison, bone marrow derived from bone marrow induction cultured for 2 weeks in an ionized collagen alone carrier (EC), a heparin-containing ionized collagen carrier (EC / H), a culture dish (C), etc., in the same manner as in Example 4-1. 0.5 N HCl was also added to mesenchymal stem cells, respectively, and the amount of calcium deposition in the supernatant was measured by QuantiChrom ^™ calcium assay kit (BioAssay Systems, USA).

The result is as shown in FIG. As shown in FIG. 4, ionized collagen alone carrier (EC), bisphosphonate containing ionized collagen transporter (EC / A), heparin containing ionized collagen transporter (EC / H), and bisphosphonate and heparin containing ionized collagen transporter (EC / A) / H), calcium deposits of bone marrow-derived mesenchymal stem cells cultured on bone differentiation were significantly higher than that of culture dish (C). In addition, the amount of calcium deposition in the bisphosphonate-containing ionized collagen carrier (EC / A) and the bisphosphonate- and heparin-containing ionized collagen carrier (EC / A / H) showed a significantly higher value than the ionized collagen alone carrier (EC). In addition, the amount of calcium deposition in the heparin-containing ionized collagen transporter (EC / H) was lower than that of the bisphosphonate-containing ionized collagen transporter (EC / A) but was generally higher than the ionized collagen alone transporter (EC).

From these results, in this example, the bisphosphonate / heparin-containing sustained release BMP transporter can continuously release BMP, thereby inducing and promoting bone differentiation of bone marrow-derived mesenchymal stem cells, and furthermore, It can be confirmed that the bone defect may promote bone formation to bone regeneration.

Example 4-4: Confirmation of bone formation factor expression level of bone marrow-derived mesenchymal stem cells in bone differentiation-induced culture (two-dimensional culture)

The following procedure was performed to confirm the bone formation factor expression levels of bone marrow-derived mesenchymal stem cells in bone differentiation-induced culture (two-dimensional culture) in bisphosphonate / heparin-containing sustained-release BMP carriers. Also, for contrast, bone differentiation-induced culture (two-dimensional) in an ionized collagen alone carrier (EC), a heparin-containing ionized collagen carrier (EC / H), a culture dish (C), etc. in the same manner as in Example 4-1. Cultured) bone marrow-derived mesenchymal stem cells were also confirmed the amount of bone formation factor expression according to the following method.

(1) Total mRNA was extracted from bone marrow-derived mesenchymal stem cells cultured for 2 weeks by the method of Example 4-1 using RNeasy Mini kit (Qiagen, USA).

(2) cDNA was obtained by reverse transcription of the total mRNA of bone marrow-derived mesenchymal stem cells extracted in step (1) using an Omniscript RT kit (Qiagen, USA).

(3) Real-time PCR (Polymerase chain recation) was performed using the cDNA obtained in step (2). The base sequence of the primer pairs for amplification of bone formation genes (ALP, OCN and OPN) of bone marrow-derived mesenchymal stem cells cultured in bone differentiation is shown in Table 1 below.

Base sequence of primer pair for amplification of bone formation gene (ALP, OCN and OPN)

SEQ ID NO:	Primer base sequence (5 '→ 3')	Target genes
SEQ ID NO: 1	Forward: AGGCAGGATTGACCACGG	Alkaline phosphatase (ALP)
SEQ ID NO: 2	Reverse: TGTAGTTCTGCTCATGGA
SEQ ID NO: 3	Forward: AAAGCCCAGCGACTCTC	OCN (Osteocalcin)
SEQ ID NO: 4	Reverse: CTAAACGGTGGTGCCATAGAT
SEQ ID NO: 5	Forward: CGACGGCCGAGGTGATAGCTT	OPN (Osteopontin)
SEQ ID NO: 6	Reverse: CATGGCTGGTCTTCCCGTTGCC
SEQ ID NO: 7	Forward: AACCCATCACCATCTTCCAGG	Housekeeping gene (GAPDH)
SEQ ID NO: 8	Reverse: GCCTTCTCCATGGTGGTGAA

Results for the bone formation gene (ALP, OCN and OPN) expression amount is shown in FIG. As shown in FIG. 5, generally ionized collagen alone carrier (EC) coating, bisphosphonate containing ionized collagen carrier (EC / A) coating, heparin containing ionized collagen carrier (EC / H) coating, and bisphosphonate and heparin containing ionized collagen The expression level of bone differentiation factor (ie, expression levels of ALP, OCN and OPN) on the carrier (EC / A / H) coating was higher than the expression level of bone differentiation factor on the culture dish (C).

In addition, the expression level of bone differentiation factor on the bisphosphonate-containing ionized collagen transporter (EC / A) coating and the bisphosphonate- and heparin-containing ionized collagen transporter (EC / A / H) coating was statistically compared to the ionized collagen transporter alone (EC) coating. It was high with statistical significance. In addition, bisphosphonate containing ionized collagen transporter (EC / A) coatings showed higher expression levels of bone differentiation factor than heparin containing ionized collagen transporter (EC / H) coatings and ionized collagen alone transporter (EC) coatings. For the OPN gene, bisphosphonate and heparin containing ionized collagen transporter (EC / A / H) coatings showed significantly higher expression levels than heparin containing ionized collagen transporter (EC / H) coatings.

These results suggest that bisphosphonate / heparin-containing ionized collagen-based sustained release BMP carriers can not only induce and promote bone differentiation of bone marrow-derived mesenchymal stem cells, but also promote bone formation or bone regeneration in bone defects. It can be confirmed that.

Example 4-5: Confirmation of bone formation factor expression level of bone marrow-derived mesenchymal stem cells in bone differentiation-induced culture (three-dimensional culture)

The following process was performed to determine the bone formation factor expression level of bone marrow-derived mesenchymal stem cells in bone differentiation-induced culture (3-dimensional culture) in bisphosphonate / heparin-containing sustained-release BMP carrier. That is, ionized collagen alone carrier (EC) sponge, bisphosphonate containing ionized collagen carrier (EC / A) sponge, heparin containing ionized collagen carrier (EC / H) sponge, and bisphosphonate and heparin containing ionized collagen carrier according to the method of Example 1 A (EC / A / H) sponge was prepared. Each of these sponges was loaded with 10 ng of BMP-2 in the same manner as in Example 2, followed by three-dimensional culture of bone marrow-derived mesenchymal stem cells in each sponge loaded with BMP-2. Bone marrow-derived mesenchymal stem cells subjected to bone differentiation induction culture (three-dimensional culture) for 2 weeks in each sponge were confirmed in accordance with the same method as in Example 4-4.

The result is as shown in FIG. As shown in FIG. 6, a bisphosphonate containing ionized collagen transporter (EC / A) sponge, a heparin containing ionized collagen transporter (EC / H) sponge, and a bisphosphonate and heparin containing ionized collagen transporter (EC / A / H) sponge The expression level of bone differentiation factor in the stomach (ie, the expression levels of ALP, OCN and OPN) showed a higher value than the expression level of bone differentiation factor on the ionized collagen alone carrier (EC) sponge. In addition, the expression levels of the bisphosphonate-containing ionized collagen transporter (EC / A) sponge and the bisphosphonate and heparin-containing ionized collagen transporter (EC / A / H) sponges were compared to the ionized collagen alone transporter (EC) sponge. It was high with statistical significance. In addition, bisphosphonate containing ionized collagen transporter (EC / A) sponges showed higher expression levels of bone differentiation factors than heparin containing ionized collagen transporter (EC / H) sponges and ionized collagen alone transporter (EC) sponges. For the OCN gene, bisphosphonates and heparin-containing ionized collagen transporter (EC / A / H) sponges showed significantly higher expression levels than heparin-containing ionized collagen transporter (EC / H) sponges.

These results suggest that bisphosphonate / heparin-containing ionized collagen-based sustained release BMP carriers can not only induce and promote bone differentiation of bone marrow-derived mesenchymal stem cells, but also promote bone formation or bone regeneration in bone defects. It can be confirmed that.

Example 5 Bone Regeneration Efficacy Test Using Animal Experimental Model

In this example, the skull model of the white paper was used to confirm the in vivo efficacy (in vivo bone formation to bone regeneration efficacy) of the bisphosphonate / heparin containing ionized collagen-based sustained release BMP transporter. Then, bone formation to bone regeneration efficacy test was performed according to the following procedure. In addition, the bone formation to bone regeneration efficacy test was performed for the ionized collagen transporter control group (without BMP and / or without bisphosphonate) for the preparation according to the following procedure.

(1) After performing general anesthesia on the white paper, the surgical site of the skull is dissected and a bone defect is formed using a drill having an outer diameter of 8 mm.

(2) An ionized collagen transporter containing bisphosphonate and heparin prepared by the method of Example 1 and an ionized collagen transporter control group are respectively filled in the white skull cranial defect formed in step (1). At this time, the charged collagen carrier was divided into a native collagen group consisting of ionized collagen alone, an ionized collagen transporter group containing bisphosphonates and heparin, and then each of these groups was further loaded with 40 μg of BMP-2; The test is further divided into groups not supported.

(3) At 4 and 8 weeks after surgery, micro-CT (micro-CT) photographs of the skull defects of white paper filled with collagen transporters were taken, and the tissues surrounding the graft were recovered for MT's trichrome (MT) staining. Conduct. In addition, the micro CT photographed as described above measures and calculates the indexes related to new bone formation of the cranial defects in which the collagen carriers are filled.

The results are shown in the micro CT picture of FIG. 7 and the Masson's trichrome (MT) staining picture of FIG. 8. As shown in FIGS. 7 and 8, when the collagen transporters were implanted into the skull cranial defects of the white rats, the transplantation sites were observed at 4 and 8 weeks, and the bisphosphonates and heparin containing BMP were observed. It can be seen that the ionized collagen transporter further promoted the formation of new bone than the ionized collagen transporter carrying only BMP.

In addition, the results of measuring and calculating the indicators related to the formation of new bone in the cranial defect are shown in FIGS. 9 to 11.

As shown in FIG. 9, the bisphosphonate and heparin-containing ionized collagen transporter carrying BMP was compared to the bone volume (BV) and bone volume (BV) / tissue volume (TV) (%) compared to the ionized collagen transporter carrying only BMP. It can be seen that the values of are high. The TV (tissue volume) value represents the amount of newly generated tissue (eg, bone and granulation tissue, soft tissue, etc.), the BV value represents the amount of newly generated bone tissue, and the BV / TV (%) value is It represents the proportion of bone tissue to the amount of newly created tissue. Higher BV and% TV / TV values indicate that the absolute and relative amounts of newly generated bone tissue are large. Thus, BMP-supported bisphosphonates and heparin-containing ionized collagen transporters are effective for bone tissue regeneration, and bone graft due to swelling phenomenon and edema in the bone graft itself, which is caused by growth promotion of peripheral tissues that are not related to bone, which is one of the problems of BMP Can reduce the spread of

Next, referring to FIG. 10, the bisphosphonate and heparin-containing ionized collagen transporter carrying BMP has a trabecular thickness (trabecular) in comparison with the ionized collagen transporter carrying only BMP. It can be seen that the thickness (abbreviated as Tb.Th) is thick, the trabecular number (abbreviated as Tb.N) is large, and the trabecular space (abbreviated as Tb.Sp) is narrow. The larger the number of shochu and the narrower the distance of the shochu, the denser the bones are formed, and if the distance between the number of shochu is the same as the thickness of the shochu, the thicker the shochu, the harder the bone. Thus, bisphosphonates and heparin-containing ionized collagen carriers carrying BMP can reproduce bones tightly and tightly at the skull site where bone defects occur.

In addition, referring to FIG. 11, the bisphosphonate and heparin-containing ionized collagen transporter carrying BMP may have a higher BMD (bone mineral density), that is, bone density, than the ionized collagen transporter carrying only BMP. BMD (bone mineral density) is a representative bone index that shows a very large difference in clinical effect even with a very small difference, and 1 standard deviation means a difference of approximately 10-15% bone density (g / cm ² ). Therefore, bisphosphonates and heparin-containing ionized collagen carriers carrying BMPs can effectively increase bone density at the skull site where bone defects occur.

From these results, it can be said that the indicators related to new bone formation of cranial defects in bisphosphonates and heparin-containing ionized collagen carriers are superior to those of ionized collagen alone.

Example 6 Preparation of Bisphosphonates and Heparin-Ionized Collagen / Synthetic Bone Carriers

Bisphosphonate and heparin-containing ionized collagen / synthetic bone delivery method of an embodiment of the present invention is as follows. In this embodiment, synthetic bone is used as a mixture of hydroxyapatite and TCP (tri-calcium phosphate) at 6: 4 (mass ratio) (trade name: MBCP (manufactured by Keystone Dental, Inc., USA)).

(1) Dissolve 2.5% (w / v) ionized collagen in purified water. In addition, 2.5% (w / v) ionized collagen is dissolved in 0.1% (w / v) bisphosphonate solution to prepare bisphosphonates and heparin containing ionized collagen / synthetic bone carriers.

(2) The synthetic bone is mixed with the ionized collagen solution obtained in step (1). At this time, the ratio of the ionized collagen and synthetic bone is 100: 0, 50:50, 10:90, 5:95 based on the mass. On the other hand, in the mixed solution of bisphosphonate and ionized collagen, synthetic bone is mixed at a mass ratio of 5:95.

(3) The mixture obtained in the step (2) is lyophilized at 40 ℃ for 24 hours.

(4) The lyophilized mixture in step (3) was crosslinked with 5 mM EDC (N- (3-Dimethylaminopropyl) -N'-ethylcarbodiimide hydrochloride) solution dissolved in 70% ethanol for 4 hours.

(5) The carrier crosslinked in step (4) was washed 10 times with purified water for 10 minutes. On the other hand, bisphosphonate-containing ionized collagen / synthetic bone carriers contained 1% (w / w) in 5 mM MES (4-Morpholine ethane sulfonic acid) buffer containing 5 mM EDC and 1 mM NHS (N-hydroxysuccinimide) to fix heparin. Reaction with v) heparin dissolved solution for 4 hours.

(6) the carrier to which heparin was fixed in step (5) was washed 10 times with purified water for 10 minutes, and then frozen at -80 ° C and dried for 24 hours.

Example 7: Comparison of BMP-2 Release Rate in Ionized Collagen / Synthetic Bone Carriers

The aspect of BMP-2 released from the ionized collagen / synthetic bone carrier of one embodiment of the present invention was measured by the following method.

(1) 50 μg / ml of BMP-2 is dissolved in PBS buffer.

(2) 100 μL of the BMP-2 solution obtained in step (1) was soaked in the ionized collagen / synthetic bone carrier prepared in Example 6, and then stored at room temperature for 1 hour.

(3) Ionized collagen / synthetic bone carrier soaked in BMP-2 solution was immersed in 2 ml of PBS buffer and stored at 37 ° C. in a shaker at 15 rpm.

(4) The supernatant of PBS buffer solution in which the ionized collagen / synthetic bone carrier was immersed in step (3) was taken at predetermined time points and cryopreserved.

(5) Take the supernatant for each time zone in step (4) and discard the remaining PBS buffer, and then immerse the ionized collagen / synthetic bone carrier in 2 ml of PBS buffer and store in shaker again.

(6) The supernatant taken in step (4) was analyzed with a BMP-2 ELISA kit (Antigenix America Inc., USA) to determine the amount of BMP-2 released from the ionized collagen / synthetic bone transporter.

As a result, BMP-2 emission data were obtained from ionized collagen / synthetic bone carriers in which the mass ratios of ionized collagen and synthetic bone were 100: 0, 50:50, 10:90 and 5:95, respectively. The BMP-2 release data was obtained from ionized collagen / synthetic bone carrier (95: 5 (A / H)) containing a bisphosphonate and heparin with a mass ratio of 95: 5.

As shown in FIG. 12, the BMP-2 release pattern of the ionized collagen / synthetic bone carrier with different ratios of ionized collagen and synthetic bone was measured and found to be 773 ± 60 ng (100: 0), 559 for 48 hours. BMP-2 was released at ± 40 ng (50:50), 494 ± 29 ng (10:90), and 395 ± 31 ng (5:95), from which the higher the percentage of synthetic bone, the higher the release of BMP-2. You can see that the speed is delayed.

In addition, when comparing the amount of BMP-2 release of the carrier with or without bisphosphonate and heparin, 168 ± 17 ng of BMP-2 was released for 48 hours in the bisphosphonate-containing and heparin-fixed ionized collagen / synthetic bone carriers. It was confirmed that the amount of release less than the carrier consisting only of synthetic bone. Therefore, the effect of delaying the release of bisphosphonates and heparin can also be confirmed in the case of ionized collagen / synthetic bone delivery.

Combining the results of the embodiments as described above, the bisphosphonate / heparin-containing collagen-based sustained release BMP carrier of the present invention can continuously release an appropriate concentration of BMP when applied to a bone defect, thereby deriving from bone marrow. By inducing and promoting bone differentiation of mesenchymal stem cells can be said to have the advantage of promoting bone formation or bone regeneration in bone defects.

Although the present invention has been described with reference to the above embodiments, the present invention is not limited thereto. Those skilled in the art can make modifications and changes without departing from the spirit and scope of the present invention, and it will be appreciated that such modifications and changes also belong to the present invention.

Claims (15)

1. A collagen support obtained by mixing the collagen solution and the bisphosphonate solution and then lyophilizing, and a bisphosphonate contained in the collagen support; And

   Collagen-based sustained release BMP transporter comprising BMP supported on the bisphosphonate-containing collagen support and continuously released for a predetermined time.
2. The method of claim 1,

   A collagen-based sustained release BMP transporter further comprising heparin immobilized on the bisphosphonate-containing collagen support.
3. The method of claim 2,

   The fixed heparin is a collagen-based sustained-release BMP carrier, characterized in that the covalent bond with the free amine group of the collagen support and the ionic bond with the BMP plays a necessary role for binding of the collagen support and the BMP.
4. The method according to any one of claims 1 to 3,

   The collagen-based sustained release BMP carrier, characterized in that the bisphosphonate-containing collagen support is an ionized collagen support.
5. The method according to any one of claims 1 to 3,

   The collagen-based sustained release BMP carrier, characterized in that the bisphosphonate-containing collagen support is crosslinked with an N- (3-dimethylaminopropyl) -N'-ethylcarbodiimide hydrochloride (EDC) solution.
6. The method according to claim 2 or 3,

   By treating the bisphosphonate-containing collagen support with a solution of heparin in MES (4-Morpholine ethane sulfonic acid) buffer containing EDC and NHS (N-hydroxysuccinimide), the heparin was added to the bisphosphonate-containing collagen support. Collagen-based sustained release BMP transporter, characterized in that it is fixed.
7. The method according to any one of claims 1 to 3,

   Collagen based, characterized in that it further comprises at least one selected from the group consisting of hydroxyapatite, a mixture of hydroxyapatite and tri-calcium phosphate (TCP), tri-calcium phosphate (TCP), bovine bone, horse bone and pork bone Sustained release BMP transporter.
8. In the method for producing a collagen-based sustained release BMP carrier,

   Mixing the collagen solution and the bisphosphonate solution,

   Lyophilizing the mixed solution of the collagen solution and the bisphosphonate solution,

   A method for preparing a collagen-based sustained release BMP carrier comprising the step of supporting BMP on a collagen support containing bisphosphonates obtained by lyophilization.
9. The method of claim 8,

   The method of producing a collagen-based sustained release BMP carrier further comprising the step of fixing the heparin to the collagen support containing the bisphosphonate.
10. The method of claim 9,

    The immobilized heparin covalently bonds with the free amine group of the collagen support and ionic bonds with the BMP to play a necessary role for binding of the collagen support to the BMP. Manufacturing method.
11. The method according to any one of claims 8 to 10,

    The method of producing a collagen-based sustained-release BMP carrier, characterized in that the bisphosphonate-containing collagen support is an ionized collagen support.
12. The method according to any one of claims 8 to 10,

    The method of producing a collagen-based sustained-release BMP carrier further comprises the step of crosslinking the bisphosphonate-containing collagen support with an N- (3-dimethylaminopropyl) -N'-ethylcarbodiimide hydrochloride (EDC) solution.
13. The method of claim 9 or 10,

    By treating the bisphosphonate-containing collagen support with a solution in which heparin was dissolved in MES (4-Morpholine ethane sulfonic acid) buffer containing EDC and NHS (N-hydroxysuccinimide), the heparin was added to the bisphosphonate-containing collagen support. Method for producing a collagen-based sustained release BMP carrier, characterized in that fixed.
14. The method according to any one of claims 8 to 10,

    Further comprising adding at least one selected from the group consisting of hydroxyapatite, a mixture of hydroxyapatite and tri-calcium phosphate (TCP), tri-calcium phosphate (TCP), bovine bone, horse bone and porcine bone Method for producing a sustained release BMP carrier.
15. A bone graft material comprising the collagen-based sustained release BMP transporter according to claim 7.

Images