WO2016203577A1

WO2016203577A1 - Cytotoxic t-cell epitope peptide and use thereof

Info

Publication number: WO2016203577A1
Application number: PCT/JP2015/067469
Authority: WO
Inventors: 棟梁李; 弘紀大鷹; 一絵中野; 真悟田路
Original assignee: 株式会社医学生物学研究所
Priority date: 2015-06-17
Filing date: 2015-06-17
Publication date: 2016-12-22
Also published as: TW201708248A; CN107709351A; JPWO2016203577A1

Abstract

The present invention provides a cytotoxic T-cell (cytotoxic T lymphocyte, abbreviated hereinafter as CTL) epitope peptide specific to the Epstein-Barr virus (described hereinafter as EBV), a vaccine for treating or preventing EBV infection or EBV-positive cancer using this peptide, a passive immunotherapeutic agent for EBV, and a method for assaying CTL specific to EBV. The present invention also provides an HLA-A*24:02-restricted epitope peptide comprising an IYTEVRELV sequence (SEQ ID NO: 43) from a cytoskeleton-associated protein (cytoskeleton-associated protein 4: CKAP4 hereinafter, also known as: CLIMP-63, ERGIC-63, P63). The peptide-specific cytotoxic T-cells (CTL hereinafter) can attack malignant tumor cells that express a high level of CKAP4.

Description

Cytotoxic T cell epitope peptide and use thereof

The present invention relates to a cytotoxic T cell (cytotoxic T T lymphocyte, hereinafter referred to as CTL) epitope peptide specific to Epstein-Barr virus (hereinafter referred to as EBV), and EBV using the peptide. The present invention relates to a vaccine for treating or preventing infection and virus-positive cancer, a passive immunotherapeutic agent for EBV, and a method for quantifying EBV-specific CTL. Furthermore, the present invention relates to a peptide capable of inducing CTL targeting cancer cells. Moreover, this invention relates to the cancer vaccine and anticancer agent containing the said peptide. The present invention further relates to the use of the peptide for inducing CTL targeting cancer cells, the obtained CTL and an anticancer agent comprising the CTL.

In 1964, Epstein and Barr discovered a new herpes virus from cultured cells derived from Burkitt lymphoma tissue and named it Epstein-Barr virus (EBV) (Non-patent Document 1). EBV is classified into HHV-4, which is one of eight types of human herpesviruses (HHV), and is a virus that is widely latently infected worldwide (Non-patent Document 2). Usually, infection occurs in the oral and pharyngeal mucosa via saliva in childhood, and the virus produced in the oral and pharyngeal mucosal epithelial cells further infects B cells that pass between the epithelia and spreads throughout the body. Infected B cells are injured and killed mainly by the immune surveillance mechanism with cytotoxic T cells (CTL), but some become latent infections that do not produce viruses.

Since EBV virus-derived DNA fragments were found in nasopharyngeal carcinoma tissues in 1970, EBV has been called the first tumor virus among viruses that infect humans (Non-Patent Documents 3 and 4). . In addition to EBV, typical examples of tumor viruses include hepatitis C virus (HCV) that causes liver cancer, human papilloma virus (HPV) that causes cervical cancer, and humans that cause adult T-cell leukemia. Examples include T cell leukemia virus (HTLV-1).

EBV mainly infects B cells, one of the human lymphocyte components, but it also infects epithelial cells, T cells, NK cells, etc. in addition to B cells, and its diverse cell tropism causes various tumor development Is thought to be involved. For example, cancers that are thought to be caused by EBV infection include malignant tumors such as Burkitt lymphoma (BL), Hodgkin lymphoma (HL), NK / T cell lymphoma, nasopharyngeal cancer (NPC), and gastric cancer (MK). It is done. EBV is also deeply involved in multiple immunodeficiency diseases, such as lymphoproliferative disease (LPD), infectious mononucleosis (IM), and post-transplant lymphoproliferative disease (PTLD). (Non-Patent Document 4).

Recent research is revealing that EBV is also involved in autoimmune diseases. Increased viral load of EBV has been reported in patients with multiple sclerosis (MS), systemic lupus erythematosus (SLE), rheumatoid arthritis (RA), and Sjogren's syndrome (SS). In addition, EBV-derived small RNA (EBV encoded small RNA, EBER) and some proteins are thought to be deeply related to the onset and progression of autoimmune diseases, and the mechanism is being elucidated. (Non-Patent

Documents

5, 6, and 7).

Thus, since EBV is considered to be closely related to cancer and immunodeficiency diseases, clinical research on immune cell therapy targeting EBV has made great progress in the last decades and has achieved brilliant results. It is stored. For example, for EBV-related lymphoproliferative disease (LPD) and post-transplant lymphoproliferative disease (PTLD), so-called immune cells that transfuse immunocompetent cells that can eliminate the causative virus-infected cells into the patient's body Therapy was performed and the therapeutic effect was proved (Non-patent

Documents

8, 9, and 10). The effectiveness of immune cell therapy has also been reported for EBV-related malignant tumors such as Hodgkin lymphoma and nasopharyngeal cancer (Non-Patent

Documents

11, 12, 13, 14, 15).

Due to their effective clinical research, immune cell therapy is gaining great interest as a new cancer treatment strategy. Immune cell therapy is considered to be a powerful treatment for malignant tumors and immunodeficiency diseases that are refractory to conventional surgical procedures, radiation therapy, and chemotherapy.

Immune cell therapy is a treatment method that activates the immune power of patients and specifically attacks and eliminates target cancer cells or virus-infected cells. is there. Cytotoxic T cells (CTL) play a central role in specifically attacking these target cells. When CTL recognizes target cells such as cancer cells or virus-infected cells, the T cell receptor (TCR) expressed on the surface of the CTL cell membrane plays an important role. TCR does not directly recognize cancer antigen molecules or virus particles themselves, but HLA (human leukocyte type antigen) expressed on the membrane surface of target cells and, in the case of tumor cells, cancer antigen-derived or viral infection In the case of cells, CTL recognizes a target cell and exerts a killing effect by binding to a complex with a peptide (epitope peptide) consisting of 8 to 10 amino acids derived from a virus. HLA is broadly classified into class I and class II. Complexes of HLA class I and peptides are recognized by TCR expressed on CD8 + T cells, and complexes of HLA class II and peptides are TCR expressed on CD4 + T cells. And an immune response is elicited. HLA class I is further divided into a classical classification called HLA-A, B, C and a non-classical classification called HLA-E, F, G. HLA compatibility between donors and recipients in transplantation therapy is important for HLA-A, B and HLA-DRB class 6 HLA-DRB classification, especially for transplants between unrelated individuals. It is considered as a risk factor. According to the IMGT HLA database (http://www.imgt.org/), 2,041 types of HLA-A, 2,688 types of HLA-B, and 1,677 types of proteins are registered for HLA-C. However, it is known that there is a bias among races, for example, about 60% of Japanese people have HLA-A24, HLA-A2 is over 50% of white people, and about 20 Japanese people % Holds. The EBV-derived LMP2 and EBNA1-specific CTL epitope peptides identified by the inventors specifically bind to HLA-A11, and EBV-infected cells are killed and eliminated by CTLs that recognize them. The ownership rate of HLA-A11 is about 10% in the Japanese, but in Southeast Asia, it has a wide population distribution as the third largest allele. The allele frequencies of HLA-A24, HLA-A2 and HLA-A11 in Southeast Asia are 32.1%, 24.5% and 23.7%, respectively (http://www.ncbi.nlm.nih.gov/projects/gv/mhc/ ihwg.cgi).

«Many of the immuno-cell therapies that have been reported so far are the most clinical trials targeting HLA-A2 in the world, and in many cases the target is HLA-A24 in Japan. In Asia, the number of cancer patients is expected to increase due to the extension of life expectancy, and immune cell therapy is required to increase the number of HLA types to be treated more than ever. The number of HLA-A11-restricted CTL epitopes reported so far is extremely small compared to HLA-A2 and HLA-A24, and there are almost no reports of clinical trials targeting patients with HLA-A11. From the fact that it does not exist, the identification of EBV LMP2 and EBV EBNA1-specific CTL epitopes exhibiting the HLA-A11 restriction of the present invention seems to be significant.

Among EBV-related malignant tumors, noteworthy is nasopharyngeal cancer (Nasopharyngeal Carcinoma, hereinafter referred to as NPC). NPC has a high incidence in Southeast Asia including South China, Hong Kong, Singapore, Vietnam, Malaysia, and the Philippines. In addition, the incidence is relatively high in areas such as North Africa. In 2012, 86,691 people were newly diagnosed with NPCs worldwide and the death toll has reached 50,828 (GLOBOCAN2012). In addition, it has been reported that the survival rates for 1, 3, 5, and 10 years after radiation therapy were 89.86%, 60.60%, 47%, and 33.03%, respectively (Non-patent Document 18). Interestingly, HLA type has been reported as one of the onset risks of NPC (Non-patent Document 17). For example, the frequency of HLA-A, which is the highest in the results of statistical analysis of HLA-A frequency in NPC patients, is 50% for A11 holders, 50% for A2 holders, and A24 holders. 30% and B40 holders were reported to be 32% (Non-patent Document 15). Or, according to the survey results of different research groups, it was reported that A11 holders were 58%, A2 holders were 53%, A24 holders were 30%, and B40 holders were 43% (Non-patent Document 16). . Recently, as a result of exhaustive examination of HLA amino acid sequence variants and SNPs using next-generation sequencer technology, HLA-A11 has been reported to be closely related to the onset of NPC (Non-patent literature). 19). In this way, NPC has a high incidence of HLA-A11 carriers, and it is probable that it is profound to provide a treatment method using EBV LMP2 and EBV EBNA1-specific CTL epitopes exhibiting HLA-A11 restriction according to the present invention.

Because NPC is a refractory malignant tumor, there is a great interest in immune cell therapy using EBV-specific CTL activated in vitro as the fourth treatment following surgical treatment, chemotherapy, and radiation therapy It is growing and has been reported in several clinical trials. However, CTL epitope peptides used in these clinical trials are mainly HLA-A2 and HLA-A24 restricted peptides, and there are almost no clinical trial reports of HLA-A11 restricted CTL epitope peptides. The reason for this is that almost no attempt has been made worldwide to identify HLA-A11-restricted CTL epitope peptides and it is very difficult to identify EBNA1-derived CTL epitopes expressed in NPCs. Can be mentioned.

In the present invention, the identification method described later was used to intensively investigate the identification of CTL epitope peptides that are restricted to EBV-related malignant tumors, particularly HLA-A11, which has the highest prevalence in NPC patients.

EBV has about 170kbp double-stranded DNA encoding about 85 gene products, but the expression of LMP1, LMP2, and EBNA1, which are EBV-derived proteins, has been reported in NPC cancer affected areas. While LMP1 can be detected only in some patients, LMP2 and EBNA1 are constitutively expressed in NPC (Non-patent Documents 20 and 21), and these two proteins are used to identify cytotoxic T cell epitope peptides. Is an attractive target for. However, in previous reports, it has been believed that the immune response of CTL is preferentially directed to LMP2, and that EBNA1 is not recognized by CTL (Non-patent Documents 22, 23, 24, 25). The reason is that EBNA1 is composed of 641 amino acids in total length, but there is a glycine-alanine repetitive sequence (GAr) consisting of about 200 amino acids in the central region (101st to 324th amino acids). Thus, it has been found that the treatment by the proteasome, which is the main catalytic mechanism for producing the MHC class 妨げる I epitope, is prevented (Non-patent Documents 26, 27 and 28). Furthermore, it is clear that the same central region prevents translation of EBNA1 mRNA, and it is reported that the expression of EBNA1 protein itself is low (Non-patent Documents 29 and 30).

On the other hand, the CTL epitope of LMP2 has been reported by several research groups. An overlapping peptide library was created for the LMP2 protein consisting of 497 amino acids in total length (derived from B95.8 strain), and CTL epitope search targeting HLA-A2, HLA-A24, HLA-A11, etc. was performed. While many HLA-A2 and HLA-A24-restricted peptides were identified, only one HLA-A11-restricted peptide was identified to date (Non-patent Document 15). Despite the fact that EBV is a virus that infects over 90% of adults worldwide, there is a strong regionality in the prevalence of NPCs. For example, in areas such as Southeast Asia, North Africa, and Alaska, epidemiological studies have shown that the incidence of NPC is about 100 times higher than in other areas (Rickinson, A. B., and E. Kieff. 1996). . Epstein-Barr virus, p. 2397-2446. In B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Fields virology, 3rd ed., Vol. 2. Lippincott-Raven , Philadelphia, Pa). The causes of this strong locality have been factors such as environment, heredity and lifestyle habits, but due to differences in EBV strains, differences in the expression level of oncogenic proteins and differences in immune responses due to amino acid mutations It is also considered that the difference of the infected strain may be another important factor involved in the development of NPC. It should be noted that one of the regions where the prevalence of NPC is very high is Guangdong Province in China, and one of the widely transmitted EBV strains here is GD1 (Zeng MS, Li DJ, Liu QL, Song LB, Li MZ, Zhang RH, Yu XJ, Wang HM, Ernberg I, Zeng YX. Genomic sequence analysis of Epstein-Barr virus strain GD1 from a nasopharyngeal carcinoma patient. : 15323-30). Here, sequences corresponding to specific CTL epitope peptides may differ between EBV strains, for example, B95.8 strain and GD1 strain, which may affect CTL induction ability and detection ability with MHC-tetramer reagent. There is a possibility of receiving. This means that a CTL for treatment independent of the strain type of an infected person can be prepared by using CTL derived by mixing two or more peptides for treatment.

On the other hand, it has long been known that CTLs responsible for cell-mediated immunity specifically recognize cells infected with various viruses and pathogens, and attack and eliminate them. This is because the infected cell presents the antigen peptide derived from the virus or pathogen through the major histocompatibility complex (hereinafter referred to as MHC, HLA in humans), which is recognized by the T cell and the immune response This is because Specifically, MHC has class I and class II. MHC class I (hereinafter referred to as MHC-I) is expressed on the cell membrane surface of all nucleated cells, and CTLs mainly express non-self peptides derived from viral proteins. Present and activate. On the other hand, MHC class II (hereinafter referred to as MHC-II) is expressed on the cell membrane surface of antigen-presenting cells such as dendritic cells, and presents non-self peptides to CD4 ⁺ T cells to induce cytokine secretion and antibody production To do. In other words, there are two pathways, MHC-I-CTL and MHC-II-CD4 ⁺ T cells, as a mechanism for protecting the living body from infection.

In 1991, it was reported that a peptide derived from MAGE antigen specifically expressed in malignant melanoma was recognized by CTL (Non-patent Document 31). This is the first example that shows that MHC-I specifically induces cytotoxic activity by presenting its own antigenic peptide derived from cancer cells to CTL. In other words, CTL can also react with self-antigens, and it has been shown that cancer can be treated by using its function. Since then, identification of proteins specifically expressed in cancer (hereinafter referred to as cancer antigens) and peptide fragments derived from the proteins has been actively promoted. In parallel with these discoveries, development of cancer immunotherapy has been actively promoted. Cancer immunotherapy is a method for treating cancer by proliferating immunocytes such as CTLs that kill and eliminate cancer cells in vivo and in vivo. There are several possible methods for cancer immunotherapy.

1. 1. Auto-cancer immunotherapy in which a patient's cancer tissue is pulverized with liquid nitrogen or the like and inoculated to the patient together with an immunostimulant. 2. Autologous cancer dendritic cell therapy in which a patient's cancer tissue is crushed with liquid nitrogen or the like, co-cultured with a dendritic cell separated and cultured from the peripheral blood of the patient, and then inoculated to the patient. Patient cancer tissue is pulverized with liquid nitrogen, etc., mixed and cultured with lymphocytes separated from the patient's peripheral blood, and returned to the patient's body.

1 to 3 are non-specific cancer immunotherapy, which is not necessarily an immune response specific to cancer antigens. In addition, there is a drawback that a surgical procedure such as excision of a cancer affected part from a cancer patient becomes necessary.

4). 4. Cancer peptide vaccine therapy in which a patient is inoculated with a cancer antigen-specific CTL epitope peptide and an immunostimulant. 5. Peptide pulse dendritic cell therapy in which a cancer antigen-specific CTL epitope peptide is pulsed to a dendritic cell isolated and cultured from peripheral blood of a patient and then inoculated to the patient. Combination therapy of CTL transfer therapy 7.4 and 6 that induces specific CTL by stimulating culture of lymphocytes isolated from patient's peripheral blood using cancer antigen-specific CTL epitope peptide and returns this to the patient's body. The patient is inoculated with a cancer antigen-specific CTL epitope peptide and an immunostimulant. This method induces specific CTLs by stimulating the lymphocytes isolated from the patient's peripheral blood with a cancer antigen-specific CTL epitope peptide and returns it to the patient's body.
8). Artificial CTL transfer therapy by extracting T cell receptor (TCR) gene from cancer antigen-specific CTL and introducing it into lymphocytes isolated and cultured from the patient's peripheral blood to produce artificial CTL and return it to the patient's body .

4-8 are all specific cancer immunotherapy that elicits and uses cancer antigen-specific immune responses. However, in order to implement these, the first requirement is to identify a cancer antigen-specific CTL epitope and prove the presence of CTLs that recognize it.

As described above, various cancer immunotherapy that elicits and uses a cancer antigen-specific immune response has been developed, but their therapeutic effect is not necessarily high, and many clinical trials have been conducted in Phase II and Phase II. Failed in Phase III. Due to these failures, the following points should be considered when implementing cancer immunotherapy.

(1) Appropriate CTL monitoring Cancer immunotherapy is a treatment method that recognizes cancer in vivo and expects amplification of CTL that attacks, and monitoring of CTL, which is an effective component, is important . Methods for monitoring CTL include intracellular cytokine staining and measurement of cytotoxic activity. These are methods for indirectly detecting CTL. For example, intracellular cytokine staining is a method that measures the production of IFNγ (interferon gamma) and TNFα (tumor necrosis factor-alpha) in response to peptide stimulation, and may detect reactions other than antigen peptide-specific immune responses. is there. On the other hand, as a more appropriate method, there is a method using an MHC-tetramer reagent. The MHC-tetramer reagent is a reagent in which a ternary complex (MHC-monomer) of MHC, β2-microglobulin (hereinafter β2m) and a peptide fragment is produced in a test tube, and the MHC-monomer is tetramerized.

The reason why this reagent is suitable for CTL monitoring is described below. MHC-MHC that constitutes a monomer is a diverse molecule. According to the IMGT HLA database (http://hla.alleles.org/nomenclature/stats.html), there are 2077 types of HLA-A and HLA-B. There are 2741 types of proteins registered for HLA-C and 1739 types for HLA-C (as of October 2014). In addition, the characteristics of peptide fragments (8 to 12 amino acid residues in length) to be bound differ depending on the allyl type of MHC. In other words, there are an enormous number of combinations of MHC / peptide complexes, which include only the allyl form of MHC and the types of peptide fragments. On the other hand, CTL recognizes the peptide presented by MHC-I by TCR. Individual TCRs are created by rearrangement of the TCR gene, and the number of TCR repertoires in one individual is said to be as high as 10 ¹⁸ . That is, both the MHC / peptide complex of the target cell and the TCR on the CTL side have a great variety. Each CTL generally expresses one type of TCR on the cell membrane surface and recognizes and activates only a specific MHC / peptide complex. MHC-tetramer reagent is a reagent using this mechanism. That is, the MHC-tetramer reagent is a reagent that mimics the structure of the MHC / peptide complex on the target cell membrane, whereby only CTL having a specific TCR can be selectively detected. In this respect, the MHC-tetramer reagent is considered to be an ideal reagent for CTL monitoring. The reason that tetramerization of MHC-monomer is to enhance the binding force with TCR expressed by CTLs so that they can be detected by a device such as a flow cytometer.
(2) Mutations in antigen-presenting molecules (HLA and β2m) in cancer cells Mutations in HLA and β2m in cancer cells are known as the immune escape mechanism of cancer cells. When these occur, the cancer cells no longer present the antigenic peptide, so the CTL cannot recognize and attack the cancer cells. As an HLA mutation, an LOH type mutation (loss of heterozygosity) in which one side of the same locus is deleted is known. Further, β2m mutation is known as frameshift mutation. For β2m mutations, attempts have been made to compensate for β2m expression by introducing the β2m gene with an adenoviral vector and to present antigenic peptides to cancer cells.
(3) Expression of cancer cell target antigens There are various types of cancer antigens, and which cancer antigen is expressed varies depending on the type of cancer and the individual. For this reason, it is very important to confirm the expression of a cancer antigen in a patient when performing cancer immunotherapy. For example, when the cancer antigen derived from the peptide vaccine is not expressed at all in the cancerous part of the patient, the cancer cells cannot be targeted, so the therapeutic effect of the cancer peptide vaccine therapy cannot be expected. In recent years, several cancer peptide vaccine therapy clinical trials have confirmed whether cancer cells of patients express peptide vaccine-derived antigens by tissue staining using cancer antigen-specific antibodies. . On the other hand, in the case of malignant glioblastoma, it is difficult to confirm the expression of a cancer antigen in a cancer affected part because it is difficult to obtain a cancer cell sample.
(4) Action of immunosuppressive molecule CTL activates when it specifically recognizes an antigenic peptide presented by a target cell, and exhibits cytotoxic activity. On the other hand, the existence of molecules that inhibit CTL activation is known, such as TGFβ, PD-1, and CTLA-4. TGFβ is a suppressive cytokine secreted by cancer cells and inhibits the proliferation and differentiation of CTL and CD4 ⁺ T cells. Both PD-1 and CTLA-4 are molecules on the cell membrane of T cells. When each binds to a ligand expressed by cancer cells, an inhibitory signal is transmitted and CTL is inactivated. In recent years, it has been reported that the action of CTL is promoted by inhibiting the action of these immunosuppressive molecules by anti-PD-1 antibody and anti-CTLA-4 antibody.
(5) HLA type of patient Epitope peptide is basically presented to only one type of HLA. This is called HLA restraint. For this reason, even if cancer immunotherapy is performed on a patient who does not have an HLA type capable of presenting an epitope peptide, no therapeutic effect can be expected because cancer cells do not present the epitope peptide in that patient. That is, the target patient of cancer immunotherapy is limited to the HLA restriction | limiting of the epitope peptide to be used. In fact, in clinical trials of cancer immunotherapy, patients' HLA types are determined in advance by serotyping or genotyping using anti-HLA antibodies, and patients who meet the HLA restriction of the epitope used are included in the study. be registered.

Based on the above, in order to obtain therapeutic effects by cancer immunotherapy, appropriate CTL monitoring, confirmation of antigen-presenting molecule expression, confirmation of cancer antigen expression in the affected cancer area, immunity It is important to inhibit the function of the suppressor molecule and select a cancer antigen epitope peptide that matches the HLA type of the patient. Above all, in order to select a cancer antigen epitope peptide that matches the patient's HLA type, it is premised that various HLA-restricted epitope peptides have been identified. Therefore, in order to deal with a wide variety of cancer patients, it is desirable to identify as many HLA-restricted epitope peptides as possible in a plurality of cancer antigens. For this reason, identification of epitope peptides has great significance. HLA-A * 24: 02 is the most common HLA-A allylate in Japanese, with about 60%. Therefore, in the present invention, HLA-A * 24: 02-restricted novel cancer antigen epitope peptide that can be used for specific cancer immunotherapy, cancer vaccine and anticancer agent using the same, and epitope peptide specific An object of the present invention is to provide a reagent that detects CTL.

CKAP4 is a type II transmembrane protein composed of a molecular weight of 63 kDa and a total length of 602 amino acids. From the N-terminal side, there are three regions: a cytoplasmic region composed of 106 amino acids, a transmembrane region composed of 21 amino acids, and an extracellular region composed of 475 amino acids (non-patented) Reference 32). CKAP4 has a function of binding to the endoplasmic reticulum and microtubules in the intercytoplasmic region in the interphase of the cell cycle and fixing the endoplasmic reticulum to the microtubules (Non-patent Document 33). Before the cell enters mitosis, the cysteine residue, which is the 100th amino acid from the N-terminal side of CKAP4, is reversibly palmitoylated (Non-patent Document 34). By this palmitoylation, localization of CKAP4 Turns into a cell membrane (Non-patent Document 35), and the interaction with microtubules is inhibited. It has also been reported that CKAP4 is phosphorylated during mitosis and loses its ability to bind to microtubules (Non-patent Document 36). On the other hand, it is known that microtubules constitute a spindle that plays a role in correctly dividing a cell by distributing chromosomes during mitosis. Thus, CKAP4 is thought to be involved in the control of normal mitosis by dissociating appropriately from microtubules during mitosis. CKAP4 is also known to act as a receptor for surfactant-protein-A (hereinafter referred to as SP-A), which is responsible for the removal of surfactant (pulmonary surfactant) on the surface of alveolar cells (non-patented). Reference 32). On the surface of alveolar cells, a surfactant composed of lipids contributes to alveolar extension by reducing the surface tension of water covering the surface. SP-A has the function of removing a surfactant and is responsible for maintaining alveolar cell homeostasis by functioning with the receptor CKAP4.

Although CKAP4 is expressed in normal cells, it is highly expressed in cell lines derived from various cancers such as breast cancer, central nervous system tumor, lung cancer, kidney cancer, and malignant melanoma (http://129.187.44.58 : 7070 / NCI60 / protein / show / 10796). CKAP4 is highly expressed in osteosarcoma patients (http://www.ebi.ac.uk/gxa/experiments/E-MEXP-3628?geneQuery=ENSG00000136026&queryFactorValues=g2_g1&_specific=on) It has been reported that it is highly expressed in patients (Non-patent Document 37). From these, it is possible that CKAP4 is an overexpressed cancer antigen that is highly expressed in cancer cells (Non-patent Document 38). As an overexpressed cancer antigen, for example, Her-2 is known, and clinical trials of cancer peptide vaccines using Her-2 derived peptides have been conducted (Non-patent Documents 39 and 40).

As described above, CKAP4 is considered to be highly expressed in various cancers, but the antigenicity of CKAP4 in cancer cells has not been clarified. That is, whether CKAP4 is a target of the immune system as a cancer antigen, that is, CKAP4-derived peptides are presented on the HLA on the surface of cancer cells, and cancer cells attack by CTLs that specifically recognize this It is unclear as to whether or not it has been done.

The present invention has been made in view of such a situation, and the target is limited to LMP2 and EBNA1 of EBV, and the purpose thereof is LMP2-specific cytotoxic T cell epitope peptide, and EBNA1-specific cytotoxicity. A vaccine for identifying a T cell epitope peptide and treating or preventing EBV-related malignant tumors and immunodeficiencies including NPC using the peptide, a passive immunotherapeutic agent for EBV, and cytotoxic T cells specific to EBV It is to provide a quantitative method. In addition, the present inventors have conducted extensive studies on cancer antigenicity, that is, CTL inducing ability of various CKAP4-derived peptides. As a result, a specific peptide in the extracellular region of CKAP4 shown in SEQ ID NO: 43 induces HLA-A * 24: 02-restricted CKAP4-specific CTL, and the specific CTL exhibits cytotoxic activity. I found. The present invention has been made based on these findings.

The present invention has been made based on such findings, and in a specific aspect, for example, relates to the following invention.
[1] An epitope peptide having cytotoxic T cell-inducing activity specific to Epstein-Barr virus (EBV), wherein the epitope peptide is SEQ ID NO: 1, SEQ ID NO: 2, sequence An epitope peptide consisting of an amino acid sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 26, SEQ ID NO: 27 and SEQ ID NO: 28;
[2] An epitope peptide having cytotoxic T cell-inducing activity specific to Epstein-Barr virus (EBV), wherein the epitope peptide is SEQ ID NO: 1, SEQ ID NO: 2, sequence In the amino acid sequence set forth in SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 26, SEQ ID NO: 27 or SEQ ID NO: 28, one or more amino acids are substituted or deleted An epitope peptide inserted and / or added,
[3] a nucleic acid encoding the epitope peptide according to any one of [1] to [2],
[4] An expression vector comprising a nucleic acid encoding the epitope peptide according to any one of [1] to [2],
[5] A vaccine for treating or preventing EBV infection or EBV-positive cancer comprising the epitope peptide according to any one of [1] to [2] as an active ingredient,
[6] The vaccine according to [5], wherein EBV is selected from AKata strain, GD1 strain, GD2 strain, HKNPC1 strain, AG876 strain, Mutu strain and B95.8 strain,
[7] A vaccine for treating or preventing EBV infection or EBV positive cancer comprising the nucleic acid or expression vector according to any one of [3] to [4] as an active ingredient,
[8] The vaccine according to [7], wherein EBV is selected from AKata strain, GD1 strain, GD2 strain, HKNPC1 strain, AG876 strain, Mutu strain and B95.8 strain,
[9] A vaccine for treating or preventing EBV infection or EBV virus-positive cancer, comprising as an active ingredient antigen-presenting cells presenting the epitope peptide of any one of [1] to [2] on HLA ,
[10] The vaccine according to [9], wherein EBV is selected from AKata strain, GD1 strain, GD2 strain, HKNPC1 strain, AG876 strain, Mutu strain and B95.8 strain,
[11] EBV-specific cytotoxic T cells obtained by stimulating peripheral blood lymphocytes with the epitope peptide according to any one of [1] to [2] or antigen-presenting cells presenting the epitope peptide on HLA A passive immunotherapy for EBV, including
[12] A major histocompatibility antigen complex and / or a major histocompatibility antigen complex-tetramer prepared from the epitope peptide according to any one of [1] to [2] is contacted with peripheral blood lymphocytes, A cytotoxic T cell obtained by forming a conjugate in which cytotoxic T cells are bound to the major histocompatibility antigen complex and / or major histocompatibility antigen complex-tetramer and isolating from the conjugate is obtained. Including passive immunotherapy for EBV,
[13] A step of stimulating peripheral blood derived from a subject with the epitope peptide according to any one of [1] to [2],
EBV comprising the steps of obtaining EBV-specific cytotoxic T cells generated by the above steps, and measuring cytokines and / or chemokines and / or cell surface molecules produced by the obtained cytotoxic T cells. A method for quantifying specific cytotoxic T cells;
[14] A step of mixing the epitope peptide according to any one of [1] to [2], a major histocompatibility antigen complex and β2-microglobulin, and the prepared major histocompatibility antigen complex-tetramer and subject-derived A method of quantifying cytotoxic T cells specific for EBV in the peripheral blood, comprising a step of contacting the peripheral blood with
[15] A method for inducing cytotoxic T cells specific to EBV, comprising the step of contacting the epitope peptide according to any one of [1] to [2] with an antigen-presenting cell,
[16] A kit for inducing cytotoxic T cells comprising the epitope peptide according to any one of [1] to [2] as a constituent element,
[17] A method for producing EBV-specific CTL comprising the step of contacting the peptide according to any one of [1] to [2] with peripheral blood mononuclear cells in a medium containing plasma,
[18] CTL epitope peptide specific for CKAP4 consisting of the amino acid sequence set forth in SEQ ID NO: 43,
[19] A CTL epitope peptide specific for CKAP4, wherein one or more amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of SEQ ID NO: 43,
[20] An HLA-A * 24: 02 molecule-restricted antigen peptide that specifically recognizes a cell that presents a complex with the HLA-A * 24: 02 molecule on the cell surface. An epitope peptide according to any one of [18] or [19], characterized by inducing CTL
[21] a nucleic acid encoding the epitope peptide according to any one of [18] to [19], an expression vector comprising a nucleic acid encoding the epitope peptide according to any of [22] [18] to [19],
[23] A vaccine for cancer treatment and prevention comprising the epitope peptide of any one of [18] to [19] as an active ingredient,
[24] A vaccine for treating or preventing cancer comprising the nucleic acid according to any one of [21] to [22] as an active ingredient,
[25] A vaccine for treating or preventing cancer, comprising, as an active ingredient, an antigen-presenting cell presenting the epitope peptide of any one of [18] to [19] on HLA,
[26] The epitope peptide according to any one of [18] to [19] or a CKAP4-specific CTL obtained by stimulating peripheral blood lymphocytes with antigen-presenting cells presenting the epitope peptide on HLA as an active ingredient Passive immunotherapy agents for cancer treatment, including
[27] A major histocompatibility antigen complex and / or a major histocompatibility antigen complex-tetramer prepared from the epitope peptide according to any one of [18] to [19] is contacted with peripheral blood lymphocytes, Cancer treatment comprising, as an active ingredient, CTL obtained by forming a conjugate of CTL bound to the major histocompatibility antigen complex and / or major histocompatibility antigen complex-tetramer, and isolating from the conjugate Passive immunotherapy agent for,
[28] A step of stimulating peripheral blood derived from a subject with the epitope peptide according to any one of [18] to [19],
Obtaining CTL specific for CKAP4 produced by the step, and measuring cytokine and / or chemokine and / or cell surface molecule produced by the obtained CTL,
A method for quantifying CTL specific for CKAP4,
[29] a step of preparing a major histocompatibility antigen complex-tetramer from the epitope peptide according to any one of [18] to [19], and a major histocompatibility antigen complex-tetramer and peripheral blood from a subject; A method for quantifying CTL specific for CKAP4 in the peripheral blood, comprising the step of contacting
[30] A method for inducing CKAP4-specific CTL comprising the step of contacting the epitope peptide according to any one of [18] to [19] with peripheral blood mononuclear cells derived from a subject,
[31] including a step of obtaining CKAP4-specific CTL by stimulating peripheral blood lymphocytes with the epitope peptide according to any one of [18] to [19] or an antigen-presenting cell presenting the epitope peptide on HLA , A method for producing a passive immunotherapeutic agent for cancer treatment,
[32] A step of bringing a major histocompatibility antigen complex and / or a major histocompatibility antigen complex-tetramer prepared from the epitope peptide of any one of [18] to [19] into contact with peripheral blood lymphocytes ,
Forming a major histocompatibility antigen complex and / or a major histocompatibility antigen complex-tetramer with a CTL-bound conjugate, and obtaining a CTL obtained by isolation from the conjugate. A method for producing a passive immunotherapeutic agent for cancer treatment,
[33] an antibody specific for a major histocompatibility antigen complex prepared from the epitope peptide of any one of [18] to [19],
[A1] Use of the epitope peptide according to any one of [1] to [2] in the manufacture of a medicament for treating or preventing EBV infection or EBV positive cancer,
[A2] Use according to [A1], wherein EBV is selected from AKata strain, GD1 strain, GD2 strain, HKNPC1 strain, AG876 strain, Mutu strain and B95.8 strain,
[A3] Use of the nucleic acid or expression vector according to any one of [3] to [4] in the manufacture of a medicament for treating or preventing EBV infection or EBV positive cancer,
[A4] Use according to [A3], wherein EBV is selected from AKata strain, GD1 strain, GD2 strain, HKNPC1 strain, AG876 strain, Mutu strain and B95.8 strain,
[A5] Use of an antigen-presenting cell in which the epitope peptide according to any one of [1] to [2] is presented to HLA in the manufacture of a medicament for treating or preventing EBV infection or EBV virus-positive cancer ,
[A6] Use according to [A5], wherein EBV is selected from AKata strain, GD1 strain, GD2 strain, HKNPC1 strain, AG876 strain, Mutu strain and B95.8 strain,
[A7] For the production of a passive immunotherapeutic agent for EBV, peripheral blood lymphocytes are stimulated with the epitope peptide according to any one of [1] to [2] or antigen-presenting cells presenting the epitope peptide on HLA. Use of EBV-specific cytotoxic T cells obtained by
[A8] Major histocompatibility antigen complex and / or major histocompatibility antigen complex-tetramer prepared from the epitope peptide according to any one of [1] to [2] in the production of a passive immunotherapeutic agent for EBV And peripheral blood lymphocytes are contacted to form a conjugate in which cytotoxic T cells are bound to the major histocompatibility antigen complex and / or major histocompatibility complex-tetramer. Use of cytotoxic T cells obtained separately,
[A9] Use of the epitope peptide according to any one of [18] to [19] in the manufacture of a medicament for treating or preventing cancer,
[A10] Use of the nucleic acid or expression vector according to any one of [21] to [22] in the manufacture of a medicament for treating or preventing cancer,
[A11] Use of an antigen-presenting cell in which the epitope peptide according to any one of [18] to [19] is presented to HLA in the manufacture of a medicament for treating or preventing cancer,
[A12] In the production of a passive immunotherapeutic agent for cancer treatment, peripheral blood lymphocytes are produced by the epitope peptide according to any one of [18] to [19] or antigen-presenting cells presenting the epitope peptide on HLA. Use of CKAP4-specific CTL obtained by stimulation,
[A13] Major histocompatibility complex and / or major histocompatibility antigen prepared from the epitope peptide of any one of [18] to [19] in the production of a passive immunotherapeutic agent for cancer treatment The complex-tetramer is contacted with peripheral blood lymphocytes to form the major histocompatibility antigen complex and / or the conjugate with CTL bound to the major histocompatibility antigen complex-tetramer. Use of CTL obtained separately,
[B1] A vaccine composition comprising the epitope peptide according to any one of [1] to [2] as an active ingredient for treating or preventing EBV infection or EBV positive cancer,
[B2] The vaccine composition according to [B1], wherein EBV is selected from AKata strain, GD1 strain, GD2 strain, HKNPC1 strain, AG876 strain, Mutu strain and B95.8 strain,
[B3] A vaccine composition comprising the nucleic acid or expression vector according to any one of [3] to [4] as an active ingredient for treating or preventing EBV infection or EBV-positive cancer,
[B4] The vaccine composition according to [B3], wherein EBV is selected from AKata strain, GD1 strain, GD2 strain, HKNPC1 strain, AG876 strain, Mutu strain, and B95.8 strain,
[B5] containing, as an active ingredient, an antigen-presenting cell presenting the epitope peptide according to any one of [1] to [2] for HLA for treating or preventing EBV infection or EBV virus-positive cancer, Vaccine composition,
[B6] The vaccine composition according to [B5], wherein EBV is selected from AKata strain, GD1 strain, GD2 strain, HKNPC1 strain, AG876 strain, Mutu strain and B95.8 strain,
[B7] Obtained by stimulating peripheral blood lymphocytes with the epitope peptide according to any one of [1] to [2] or antigen-presenting cells presenting the epitope peptide on HLA for passive immunotherapy against EBV A composition comprising EBV-specific cytotoxic T cells;
[B8] Major histocompatibility antigen complex and / or major histocompatibility antigen complex-tetramer prepared from the epitope peptide according to any one of [1] to [2] for passive immunotherapy against EBV Contact with peripheral blood lymphocytes to form a conjugate of cytotoxic T cells bound to the major histocompatibility complex and / or major histocompatibility complex-tetramer and isolated from the conjugate. A composition comprising cytotoxic T cells obtained by
[B9] A vaccine composition comprising the epitope peptide according to any one of [18] to [19] as an active ingredient for cancer treatment or prevention,
[B10] A vaccine composition comprising the nucleic acid or expression vector according to any one of [21] to [22] as an active ingredient for cancer treatment or prevention,
[B11] A vaccine composition comprising, as an active ingredient, an antigen-presenting cell presenting the epitope peptide according to any one of [18] to [19] on HLA for cancer treatment or prevention,
[B12] For treating cancer by passive immunotherapy, the peripheral blood lymphocytes are stimulated by the epitope peptide according to any one of [18] to [19] or antigen-presenting cells presenting the epitope peptide on HLA. A composition comprising CKAP4-specific CTL obtained as an active ingredient,
[B13] Major histocompatibility complex and / or major histocompatibility complex prepared from the epitope peptide of any one of [18] to [19] for treating cancer by passive immunotherapy Contacting the tetramer with peripheral blood lymphocytes to form a major histocompatibility antigen complex and / or a major histocompatibility antigen complex-a conjugate in which CTL is bound to the tetramer, and isolated from the conjugate A composition comprising the obtained CTL as an active ingredient,
[C1] A method for treating or preventing EBV infection or EBV-positive cancer, comprising a step of administering the epitope peptide according to any one of [1] to [2] to an individual in need thereof ,
[C2] EBV is selected from AKata strain, GD1 strain, GD2 strain, HKNPC1 strain, AG876 strain, Mutu strain and B95.8 strain,
[C3] To treat or prevent EBV infection or EBV-positive cancer, comprising the step of administering the nucleic acid or expression vector according to any one of [3] to [4] to an individual in need thereof. The method of [C4] EBV is selected from AKata strain, GD1 strain, GD2 strain, HKNPC1 strain, AG876 strain, Mutu strain and B95.8 strain,
[C5] EBV-infected or EBV virus-positive cancer, comprising a step of administering an antigen-presenting cell presenting the epitope peptide of any one of [1] to [2] to HLA to an individual in need thereof A method for treating or preventing
[C6] The method according to [C5], wherein EBV is selected from AKata strain, GD1 strain, GD2 strain, HKNPC1 strain, AG876 strain, Mutu strain and B95.8 strain,
[C7] EBV-specific cytotoxic T cells obtained by stimulating peripheral blood lymphocytes with the epitope peptide according to any one of [1] to [2] or antigen-presenting cells presenting the epitope peptide on HLA Passive immunotherapy against EBV, comprising the step of administering to an individual in need thereof,
[C8] A step of bringing a major histocompatibility antigen complex and / or a major histocompatibility antigen complex-tetramer prepared from the epitope peptide according to any one of [1] to [2] into contact with peripheral blood lymphocytes ,
Forming a conjugate of cytotoxic T cells bound to the major histocompatibility complex and / or major histocompatibility complex-tetramer;
Passive immunotherapy against EBV comprising the step of administering cytotoxic T cells obtained by isolation from said conjugate to an individual in need thereof,
[C9] a method for treating or preventing cancer comprising the step of administering the epitope peptide according to any one of [18] to [19] to an individual in need thereof;
[C10] a method for treating or preventing cancer, comprising the step of administering the nucleic acid or expression vector according to any one of [21] to [22] to an individual in need thereof;
[C11] A method for treating or preventing cancer, comprising a step of administering an antigen-presenting cell presenting the epitope peptide of any one of [18] to [19] to HLA to an individual in need thereof ,
[C12] The epitope peptide according to any one of [18] to [19] or a CKAP4-specific CTL obtained by stimulating peripheral blood lymphocytes with antigen-presenting cells presenting the epitope peptide on HLA, Passive immunotherapy for cancer treatment, including the step of administering to an individual in need thereof,
[C13] A step of bringing a major histocompatibility antigen complex and / or a major histocompatibility antigen complex-tetramer prepared from the epitope peptide of any one of [18] to [19] into contact with peripheral blood lymphocytes ,
Forming a conjugate of CTL bound to the major histocompatibility antigen complex and / or major histocompatibility antigen complex-tetramer;
A passive immunotherapy for cancer treatment, comprising a step of administering CTL obtained by isolation from the conjugate to an individual in need thereof.

It is a figure which shows the typical example of a gel filtration column analysis in case MHC-monomer formation is recognized. It is a figure which shows the folding test result of EBV LMP2-specific CTL epitope candidate peptide. It is a figure which shows the folding test result of EBV EBNA1-specific CTL epitope candidate peptide. It is a figure which shows the examination result of the intracellular IFNγ production cell quantification method using a control peptide. FIG. 4 is a diagram showing the quantification of the proportion of live IFNγ-producing cells present in CD8-positive cells after confirming EBVEBLMP2-specific CTL induction by the intracellular IFNγ-producing cell quantification method. LMP2-specific CTL induction was confirmed by quantification of intracellular IFNγ-producing cells (donor ID * 11-11). This is a dot plot development showing the fluorescence intensity for CD8 on the X-axis and IFNγ on the Y-axis in log scale, and shows the result of quantification of intracellular IFNγ-producing cells by restimulation with the same peptide used for induction. It is a figure. FIG. 11 is a view showing the detection result of LMP2-specific CTL by the prepared MHC-tetramer reagent (donor ID * 11-11). FIG. 6 is a diagram showing the detection result (1) of EBNA1-specific CTL by the prepared MHC-tetramer reagent. FIG. 6 is a diagram showing the detection result (2) of EBNA1-specific CTL by the prepared MHC-tetramer reagent. It is a figure which shows the confirmation result of EBNA1 specific CTL induction | guidance | derivation by the intracellular IFNγ production cell quantification method (donor ID * 11-8). It is a figure which shows the change of MHC affinity by having deleted the N terminal and C terminal amino acid of ASS (10mer). It is a figure which shows the change of CTL induction ability by deleting the amino acid of the N terminal and C terminal of ASS (10mer) (donor ID * 11-11). It is a figure which shows the change of TCR binding property by having deleted the amino acid of the N terminal and C terminal of ASS (10mer) (donor ID * 11-11). It is a figure which shows the variation | mutation comparison of the amino acid between the EBV strain | stump | stock of ASS (10mer) and HRG. It is a figure which shows the result of a sequence of an ASS (10mer) CTL epitope. It is a figure which shows the difference in the induction ability by the amino acid variation | mutation of ASS (10mer) (donor ID: * 11-11). It is a figure which shows the change of TCR binding property by amino acid substitution of ASS (10mer) (donor ID: * 11-11). It is a figure which shows the result of mass culture (1) of CTL using a culture bag. It is a figure which shows the result of mass culture (2) of CTL using a culture bag. It is a figure which shows the result of mass culture (3) of CTL using a culture bag. It is a figure which shows the typical example of a gel filtration column analysis in case MHC-monomer formation is recognized. It is a figure which shows the folding test result of a CKAP4-specific CTL epitope candidate peptide. It is a figure which shows the induction | guidance | derivation result of CKAP4-specific CTL (specimen number; A24-37, 1st stage). It is a figure which shows the induction | guidance | derivation result of CKAP4-specific CTL (specimen number; A24-37, 2nd stage, lane 7). It is a figure which shows the induction | guidance | derivation result of CKAP4-specific CTL (specimen number; A24-39, 1st stage). It is a figure which shows the induction | guidance | derivation result of CKAP4-specific CTL (specimen number; A24-39, 2nd stage, lane 10/11). It is a figure which shows the fixed_quantity | quantitative_assay result of the IFNγ production cell in CKAP4-specific CTL.

The present invention will be described in further detail.

[Epitope peptide]
The peptide referred to in the present invention means a molecular chain of linear amino acids having physiological activity and bound to each other by a peptide bond between an α-amino group and a carboxyl group of adjacent amino acid residues. Peptides are not meant to be of a specific length and can be of various lengths. Further, it may be in an uncharged or salt form, and may be modified by glycosylation, amidation, phosphorylation, carboxylation, phosphorylation or the like in some cases. Further, the epitope peptide of the present invention may be one or several (for example, 1 to 10) unless the physiological peptide and the immune activity are substantially modified and has no harmful activity when administered. Peptides in which insertion, addition, substitution, deletion or the like of amino acids or amino acid analogs have occurred are also included in the present invention. The purpose of changing such amino acids is, for example,
1． Changes to increase affinity with HLA (Rosenberg SA, Yang JC, Schwartzentruber DJ, Hwu P, Marincola FM, Topalian SL, Restifo NP, Dudley ME, Schwarz SL, Spiess PJ, Wunderlich JR, Parkhurst MR, Kawakami Y, Seipp CA, Einhorn JH, White DE.Immunologic and therapeutic evaluation of a synthetic peptide vaccine for the treatment of patients with metastatic melanoma. Nat Med. 1998; 4: 321-327, Berzofsky JA, Ahlers JD, Belyakov IM. Strategies for designing and optimizing new generation vaccines. Nat Rev Immunol. 2001; 1: 209-219),
2． Changes to improve TCR recognition (Fong L, Hou Y, Rivas A, Benike C, Yuen A, Fisher GA, Davis MM, Engleman EG. Altered peptide ligand vaccination with Flt3 ligand expanded dendritic cells for tumor immunotherapy. Proc Natl Acad Sci US A. 2001; 98: 8809-8814, Rivoltini L, Squarcina P, Loftus DJ, Castelli C, Tarsini P, Mazzocchi A, Rini F, Viggiano V, Belli F, Parmiani G. A superagonist variant of peptide MART1 / Melan A27-35 elicits anti-melanoma CD8 + T cells with enhanced functional characteristics: implication for more effective immunotherapy. Cancer Res. 1999; 59: 301-306),
3． Changes to avoid metabolism by peptide degrading enzymes in serum (Berzofsky JA, Ahlers JD, Belyakov IM. Strategies for designing and optimizing new generation vaccines. Nat Rev Immunol. 2001; 1: 209-219, Parmiani G, Castelli C, Dalerba P, Mortarini R, Rivoltini L, Marincola FM, Anichini A. Cancer immunotherapy with peptide-based vaccines: what have we achieved? Where are we going? J Natl Cancer Inst. 2002; 94: 805-818, Brinckerhoff LH , Kalashnikov VV, Thompson LW, Yamshchikov GV, Pierce RA, Galavotti HS, Engelhard VH, Slingluff CL Jr.Terminal modifications inhibit proteolytic degradation of an immunogenic MART-1 (27-35) peptide: implications for peptide vaccines. Int J Cancer. 1999; 83: 326-334).

Included are those in which an additional amino acid sequence is interposed at the N-terminus or C-terminus of the peptide for such purposes. In addition, the peptide of the present invention can be used in the form of a complex to which saccharides, polyethylene glycol, lipids and the like are added, a derivative with a radioisotope, or a polymer. Examples of the amino acid analogs include N-acylated products, O-acylated products, esterified products, acid amidated products, and alkylated products of various amino acids.

In addition, if the cells presenting the ternary complex of HLA molecule, β2-microglobulin, and epitope peptide on the cell surface are within the range that CTL can specifically recognize, the N-terminus of the antigen peptide or free amino group May be bound with a formyl group, an acetyl group, a t-butoxycarbonyl (t-Boc) group, and the C-terminus of the antigen peptide and a free carboxyl group include a methyl group, an ethyl group, and a t-butyl group. Group, benzyl group and the like may be bonded.

Further, the epitope peptide of the present invention may be subjected to various modifications that can facilitate introduction into the living body. The PT (Protein Transduction) domain is famous as an example of various modifications that can facilitate introduction into the living body. The PT domain of HIV is a peptide composed of the 49th to 57th amino acids (Arg Lys Lys Arg Arg Gln Arg Arg Arg) of the Tat protein. It has been reported that this PT domain can be easily introduced into cells by adding it to the N-terminal and / or C-terminal of the target protein or peptide (Ryu J, Han K, Park J, Choi SY. Enhanced uptake of a heterologous protein with an HIV-1 Tat protein transduction domains (PTD) at both termini. Mol Cells. 2003; 16: 385-391, Kim DT, Mitchell DJ, Brockstedt DG, Fong L , Fathman CG, Engleman EG, Rothbard JB. Introduction of soluble proteins into the MHC class I pathway by conjugation to an HIV tat peptide. J Immunol. 1997; 159: 1666-1668).

Most antigens presented via HLA class I molecules are broken down by cytoplasmic proteasomes, then transferred to TAP (transporter ingengen processing), and associated with TAP in the rough endoplasmic reticulum. It binds to a complex of class I molecule and β2-microglobulin and is transported to the cell surface by exocytosis via the Golgi apparatus. By fusing HSP (heat shock prtein) 70, HSP90, or gp96, which are chaperones acting in a series of these antigen presentation pathways, with the desired peptide or protein, it is possible to efficiently present the antigen ( Basu S, Binder RJ, Ramalingam T, Srivastava PK. CD91 is a common receptor for heat shock proteins gp96, hsp70, and calreticulin. Immunity. 2001; 14: 303-313).

[Nucleic acid encoding epitope peptide]
The nucleic acid encoding the epitope peptide is important for producing the epitope peptide in the host using genetic recombination techniques. In this case, since the usage frequency (codon usage) of the amino acid codon differs between hosts, it is desirable to change the codon of the amino acid so as to match the codon usage of the host to be produced. Nucleic acids encoding epitope peptides are also important as vaccines and can be transported as bare nucleic acids or using appropriate viral or bacterial vectors (Berzofsky JA, Ahlers JD, Janik J, Morris J, Oh S, Terabe M, Belyakov IM Progress on new vaccine strategies against chronic viral infections.J Clin Invest. 2004; 114: 450-462, Berzofsky JA, Terabe M, Oh S, Belyakov IM, Ahlers JD, Janik JE, Morris JC Progress on new vaccine strategies for the immunotherapy and prevention of cancer. J Clin Invest. 2004; 113: 1515-1525). Suitable bacterial vectors are Salmonella subspecies bacteria. Suitable viral vectors are, for example, retroviral vectors, EBV vectors, vaccinia vectors, Sendai virus vectors, lentiviral vectors. One example of a suitable vaccinia vector is a modified vaccinia ankara vector.

[Selection of CTL epitope candidate peptide]
1. Analysis using Computer Prediction Algorithm The CTL epitope candidate peptide specific for EBV of the present invention consists of 8 to 10 amino acids having a binding motif for the target HLA class I molecule with respect to the amino acid sequences of LMP2 and EBNA1. MHC binding Nucleic Acids Multiple epitope prediction software published on the Internet (Pingping Guan, Irini A. Doytchinova, Christianna Zygouri, and Darren R. Flower MHCPred: a server for quantitative prediction of peptide? Res., 2003; 31: 3621-3624, Karosiene E, Lundegaard C, Lund O, Nielsen M. NetMHCcons: a consensus method for the major histocompatibility complex class I predictions. Immunogenetics. 2012 Mar; 64 (3): 177-86 , Jorgensen KW, Rasmussen M, Buus S, Nielsen M. NetMHCstab-predicting stability of peptide-MHC-I complexes; impacts for cytotoxic T lymphocyte epitope discovery. Immunology. 2014 Jan; 141 (1): 18-26. ) Can be selected.

2. Examination using anchor motifs HLA class I molecules mainly include HLA-A, HLA-B, and HLA-C, and the epitope peptides that are displayed by binding to these consist of 8 to 10 amino acids. The second, ninth or tenth amino acid from the N-terminal side of the epitope peptide is the most important amino acid for binding to the HLA class I molecule, and is called an anchor motif. It has been reported that this anchor motif varies depending on the type of each HLA class I molecule. For example, as the peptide that binds to HLA-A2 that is the most studied worldwide, Leu is located at the second position from the N-terminus, and Leu or Val is located at the 9th or 10th position. Peptides of 9 to 10 amino acids are best known (T Sudo, N Kamikawaji, A Kimura, Y Date, CJ Savoie, H Nakashima, E Furuichi, S Kuhara, and T Sasazuki Differences in MHC class I self peptide repertoires among HLA-A2 subtypes J. Immunol., 1995; 155: 4749-4756). HLA-A11 (Chang CX, Tan AT, Or MY, Toh KY, Lim PY, Chia AS, Froesig TM, Nadua KD, Oh HL, Leong HN, Hadrup SR, Gehring AJ, Tan YJ, Bertoletti A, Grotenbreg GM. Conditional ligands for Asian HLA variants facilitate the definition of CD8 + T-cell responses in acute and chronic viral diseases. Eur J Immunol. 2013 Apr; 43 (4): 1109-20. As a peptide that binds to the peptide, either Ile, Met, Ser, Thr, or Val is placed at the second position from the N-terminus, and either Lys or Arg is placed at the 9th or 10th position A peptide consisting of 9 to 10 amino acids is best known (Rapin N, Hoof I, Lund O, Nielsen M. The MHC motif viewer: a visualization tool for MHC binding motifs. Curr Protoc Immunol. 2010 Feb; Chapter 18: Unit 18.17. A candidate CTL epitope peptide can be selected by searching 8 to 10 amino acid sequences having this anchor motif in the amino acid sequence of the protein.

3. Preparation of peptide library A peptide library consisting of about 20 amino acid sequences covering the entire target protein among the proteins constituting EBV is synthesized. A library is prepared so that about 10 amino acid sequences out of about 20 amino acids overlap with preceding and subsequent peptides. As a result, the entire protein can be searched comprehensively, and once the library is prepared, the HLA restriction can be comprehensively examined.

(Peptide synthesis)
The CTL epitope candidate peptides represented by SEQ ID NOs: 1 to 35 of the present invention can be prepared by various conventional peptide synthesis methods. For example, organic chemical synthesis methods such as solid phase peptide synthesis methods, or nucleic acids encoding peptides can be prepared and prepared using recombinant DNA technology. Moreover, the synthesis | combination by a commercially available chemical synthesizer (For example, the peptide synthesizer of Applied Biosystems) is also possible.

[Examination of CTL epitope candidate peptides]
The CTL epitope candidate peptide selected by the above-mentioned method does not necessarily become a CTL epitope peptide, and can only become an EBV LMP2-specific CTL epitope peptide and an EBV EBNA1-specific CTL epitope peptide after the following examination.

(1) Examination using cultured cell lines Peptide fragments generated by proteasomal proteolysis are introduced into the endoplasmic reticulum lumen by TAP (transporter associated with antigen processing) molecules, and HLA class I molecules and β2-microglobulin It binds to the complex and is transported to the cell membrane surface. A TAP gene-deficient cell line deficient in this TAP molecule cannot express peptide fragments, which are degradation products of endogenous proteins, on the cell membrane surface. In addition, human lymphoblastoid cell line T2, which is a typical TAP gene-deficient cell line, or a cell line (T2-A11) in which HLA-A11 molecule is introduced into T2 is expressed on the cell membrane surface. Very unstable. However, when bound to an externally supplied peptide, the HLA molecule is stabilized on the cell membrane surface. Utilizing this property, the TAP gene-deficient cell line can be used in experiments for verifying the binding properties of HLA molecules and externally supplied peptides. Specifically, mixed culture of TAP gene-deficient cell line and CTL epitope candidate peptide, staining with anti-HLA antibody, and calculating change in expression intensity of HLA molecule by flow cytometry The binding of CTL epitope candidate peptides can be examined. When the CTL epitope candidate peptide added to the HLA molecule expressed by the TAP gene-deficient cell line binds, the HLA molecule-peptide complex is stabilized on the cell membrane surface, and when stained with an anti-HLA antibody, the expression of the HLA molecule is enhanced. Is observed. On the other hand, if the added CTL epitope candidate peptide does not bind to the HLA molecule, the HLA molecule on the cell membrane surface is unstable, and even when stained with an anti-HLA antibody, enhanced expression of the HLA molecule is not confirmed. Using such a method, it is possible to verify the binding between the HLA molecule and the CTL epitope candidate peptide.

(2) Folding test The MHC-tetramer reagent is a three-component complex (MHC-monomer) of MHC (HLA in the case of humans), β2-microglobulin and peptide fragments in vitro. It is an incorporated reagent. The MHC-tetramer reagent is the only reagent that can selectively detect antigen-specific cytotoxic T cells (CTLs) that are MHC restricted. In addition, MHC-tetramer reagent can not only quantify the number of CTLs by co-staining with anti-CD (cluster of differentiation) antibody, anti-cytokine antibody, etc., but also by analyzing with flow cytometry. It is possible to evaluate every single cell. The first step in MHC-tetramer reagent production begins with folding where the raw materials MHC, β2-microglobulin and peptide are mixed in a suitable solution in a test tube. In the folding solution, a three-component complex (MHC-monomer) is formed by the association reaction of these three raw materials. At this time, if the binding force between the MHC and the peptide is high, this association reaction proceeds smoothly, and analysis with a gel filtration column makes it possible to detect a complex of three kinds of raw materials (MHC-monomer). On the other hand, when there is no binding force between MHC and peptide, MHC-monomer is hardly detected. Therefore, it is possible to verify the binding properties and stability of MHC and peptide by analyzing the folding solution over time or by performing heat treatment or the like.

(3) Epitope peptide-specific CTL detection (3-1) Epitope peptide determination method Peripheral blood mononuclear cells (PBMC) isolated from a person with a history of EBV infection, or T cells isolated from PBMC Suspend in a suitable medium at a cell concentration of 0.1-2 x 10 ⁶ / mL. To this, 1 × 10 ⁵ / mL of EBV-infected cells previously separated and cultured from the same person is added, and cultured at 37 ° C. for 7 days in a 5% carbon dioxide (CO ₂ ) thermostat. After culturing for 7 days, EBV-infected cells and interleukin 2 (IL-2) are added, and then CTL are induced by repeated stimulation with EBV-infected cells and IL-2 every week. Whether or not the CTL thus induced is specific for the epitope candidate peptide is determined by MHC-tetramer method, elicitor assay, chromium release assay, intracellular cytokine staining method, etc. (Current Protocols in Immunology Edited by: John E. Coligan, Ada M. Kruisbeek, David H. Margulies, Ethan M. Shevach, Warren Strober 6.19 ELISPOT Assay to Detect Cytokine-Secreting Murine and Human Cells 6.24 Detection of Intracellular Cytokines by Flow Cytometry published by John Wiley & Sons, Inc.).

(3-2) Epitope peptide determination method 2
PBMCs isolated from a person with a history of EBV infection are suspended in an appropriate medium at a cell concentration of 0.1-2 × 10 ⁶ / mL, and any one of the epitope candidate peptides at a concentration of 0.01-100 μg / mL Add. Incubate at 37 ° C in a 5% CO ₂ constant temperature bath, and add IL-2 after 2 days. Thereafter, CTL is induced by repeating stimulation with the peptide and IL-2 once a week or once every two weeks. Whether the CTL thus induced is specific for the epitope candidate peptide is determined by MHC-tetramer method, elyspot assay, chromium release assay, intracellular cytokine staining method and the like.

(3-3) Epitope peptide determination method 3
PBMCs isolated from a person with a history of EBV infection were suspended in an appropriate medium at a cell concentration of 0.1 to 2 × 10 ⁶ / mL, and the peptide libraries synthesized in this were pooled to an appropriate number (for example, 10 types each). Add things. Incubate at 37 ° C in a 5% CO ₂ constant temperature bath, and add IL-2 after 2 days. Thereafter, CTL is induced by repeating stimulation with the pool peptide and IL-2 once a week or once every two weeks. Whether or not the CTL thus induced is specific for the epitope candidate peptide is determined by an Elispot assay, a chromium release assay, an intracellular cytokine staining method, or the like. For pooled peptides that showed good results, it is possible to select peptides having CTL inducing ability by repeating the above experiment with one peptide added at a time. The reacted peptides are shortened in order, and finally an epitope peptide consisting of 8 to 10 amino acids is obtained as the epitope peptide of the present invention.

[Production of EBV LMP2 and EBNA1-specific MHC-monomers and MHC-tetramer reagents]
MHC-monomer and MHC-tetramer reagent using EBV LMP2-specific CTL epitope candidate peptide and EBV EBNA1-specific CTL epitope candidate peptide can be prepared by known methods (US Patent Number 5,635,363, French Application Number FR9911133) . MHC-, which is a triple complex of an HLA class I molecule, β2-microglobulin and LMP2-specific CTL epitope candidate peptide of the present invention, or EBNA1-specific CTL epitope candidate peptide purified from a recombinant host for protein expression Monomers are formed in the folding solution. A biotin binding site is added to the C-terminus of the recombinant HLA class I molecule in advance, and biotin is added to this site after MHC-monomer formation. A MHC-tetramer reagent can be prepared by mixing commercially available dye-labeled streptavidin and biotinylated MHC-monomer at a molar ratio of 1: 4. The combination of MHC-tetramer reagent and antibodies against cell surface proteins (CD62L, CCR7, CD45RA, etc.) can be used to examine the differentiation stage of CTL (Seder RA, Ahmed R. Similarities and differences in CD4 + and CD8 + effector and memory T cell generation. Nat Immunol. 2003; 4: 835-842.). Alternatively, it can be used for functional evaluation of CTL by combining with intracellular cytokine staining method. For example, in hepatitis C, CTL against HCV (Hepatitis C virus) exists as one of the causes for maintaining persistent infection, but CTL does not produce cytokines, or the proportion of CTL produced is extremely low. It has been reported that there is a possibility of anomaly (Gruener NH, Lechner F, Jung MC, Diepolder H, Gerlach T, Lauer G, Walker B, Sullivan J, Phillips R, Pape GR , Klenerman P. Sustained dysfunction of antiviral CD8 + T lymphocytes after infection with hepatitis C virus. J Virol. 2001; 75: 5550-5558.). In addition, regarding CMV-specific CTL after bone marrow transplantation, it is considered effective not only to examine the presence or absence of CTL but also to examine the level of cytokine production ability in order to measure the timing of administration of antiviral drugs, etc. Cytomegalovirus reactivation following allogeneic stem cell transplantation is associated with the presence of dysfunctional antigen-specific CD8 + T cells.Blood. 2002; 100: 3690-3697.). Thus, if a specific CTL epitope peptide is identified and an MHC-tetramer reagent is produced, it becomes possible to quantify and qualify specific CTLs, and to make a great contribution to obtaining diagnostic information.

[Active immune vaccine]
Peptide vaccine The CTL epitope peptide of the present invention can be used as a peptide vaccine in active immunotherapy. That is, a vaccine comprising the CTL epitope peptide of the present invention is administered to a patient, and EBV LMP2-specific CTL or EBV EBNA1-specific CTL is proliferated in the body to prevent infection and treat infection and EBV positive tumor. Can be useful. Only one type of epitope peptide may be used, or two or more types of peptides may be combined and mixed according to the intended use of the vaccine.

Vaccine using antigen-presenting cell The antigen-presenting cell on which the CTL epitope peptide of the present invention is presented can be used as a vaccine in active immunotherapy. Antigen-presenting cells with CTL epitope peptides presented
1. 1. CTL epitope peptide pulse antigen-presenting cells in which antigen-presenting cells and CTL epitope peptides are mixed for 30 minutes to 1 hour in an appropriate culture medium. 2. A cell in which a CTL epitope peptide is presented to an antigen-presenting cell by gene transfer or the like using a nucleic acid encoding a CTL epitope peptide. It means an artificial antigen-presenting cell having an antigen-presenting ability prepared artificially. An antigen-presenting cell means, for example, a dendritic cell, a B cell, a macrophage, a certain type of T cell, etc., and is a cell that expresses on its cell surface an HLA molecule to which the peptide can bind, It means something that has stimulating ability. Artificial antigen-presenting cells with antigen-presenting ability are artificially prepared by immobilizing a ternary complex of HLA molecule, CTL epitope peptide and β2-microglobulin on beads such as lipid bilayer membrane, plastic or latex. Immobilize costimulatory molecules such as CD80, CD83, and CD86 that can stimulate CTLs, or fix antibodies that act agonistically on CD28, a T cell ligand that binds to costimulatory molecules. (Oelke M, Maus MV, Didiano D, June CH, Mackensen A, Schneck JP. Ex vivo induction and expansion of antigen-specific cytotoxic T cells by HLA-Ig-coated artificial antigen-presenting cells. Nat Med. 2003; 9: 619-624, Walter S, Herrgen L, Schoor O, Jung G, Wernet D, Buhring HJ, Rammensee HG, Stevanovic S. Cutting edge: predetermined avidity of human CD8 T cells expanded on calibrated MHC / anti -CD28-coated microspheres. J Immunol. 2003; 171: 4974- 4978, Oosten LE, Blokland E, van Halteren AG, Curtsinger J, Mescher MF, Falkenburg JH, Mutis T, Goulmy E. Artificial antigen-presenting constructs efficiently stimulate minor histocompatibility antigen-specific cytotoxic T lymphocytes.Blood. 2004; 104: 224 -226).

Gene Vaccine The nucleic acid of the CTL epitope peptide of the present invention can be used for DNA vaccines, recombinant virus vector vaccines and the like in active immunotherapy. In this case, it is desirable to change the nucleic acid sequence of the CTL epitope peptide to codon usage suitable for the host producing the recombinant vaccine or the recombinant virus vaccine (Casimiro, DR et al. Comparative Immunogenicity in Rhesus Monkeys of DNA Plasmid , Recombinant Vaccinia Virus, and Replication-Defective Adenovirus Vectors Expressing a Human Immunodeficiency Virus Type 1 gag Gene J. Virol., 2003; 77: 6305-6313, Berzofsky JA, Ahlers JD, Janik J, Morris J, Oh S, Terabe M , Belyakov IM. Progress on new vaccine strategies against chronic viral infections. J Clin Invest. 2004; 114: 450-462).

A vaccine comprising a CTL epitope peptide of the present invention or an antigen-presenting cell on which a CTL epitope peptide is presented can be prepared using methods known in the art. For example, such a vaccine includes an injection or a solid preparation containing the CTL epitope peptide of the present invention as an active ingredient. The CTL epitope peptide can be formulated in a neutral or salt form. Examples of pharmaceutically acceptable salts include inorganic salts such as hydrochloric acid and phosphoric acid, and organic acids such as acetic acid and tartaric acid. . Further, the antigen-presenting cell on which the CTL epitope peptide of the present invention is presented is a pharmaceutically acceptable excipient compatible with the peptide or the activity of the cell, such as water, saline, dextrose, ethanol, It can be used by mixing with glycerol, DMSO (dimethyl sulphoxide), other adjuvants, or a combination thereof. Furthermore, you may add adjuvants, such as albumin, a wetting agent, and an emulsifier, as needed.

The vaccine of the present invention can be administered by parenteral administration or oral administration, but parenteral administration is generally preferred. Parenteral administration includes nasal administration, subcutaneous injection, intramuscular injection, injection such as intravenous injection, suppository and the like. For oral administration, it can be prepared as a mixture with excipients such as starch, mannitol, lactose, magnesium stearate, and cellulose.

The vaccine of the present invention is administered in a therapeutically effective amount. The dose to be administered depends on the subject to be treated and the immune system, and the required dose is determined by the judgment of the clinician. In general, the appropriate dose is 1 to 100 mg of CTL epitope peptide and 10 ⁶ to 10 ⁹ CTL epitope peptide pulsed cells per patient. In addition, the administration interval can be set according to the subject and purpose.

[Passive immunization vaccine]
The CTL epitope peptide of the present invention can be used for the preparation of a passive immunotherapeutic agent. The CTL specific for EBV LMP2 or the CTL specific for EBV EBNA1 obtained as described below can be suspended in human albumin-containing PBS or the like and used as a passive immunotherapy for EBV. The CTL specific for EBV contained in the passive immunotherapeutic agent can be obtained by the following preparation method, and can be purified and used to increase the purity of CTL.

CTL preparation method 1
PBMC is reacted with an appropriate concentration of EBV-specific MHC-tetramer reagent. Since the EBV-specific CTL bound to the MHC-tetramer reagent is stained with a labeling dye, only the stained CTL is isolated using a cell sorter, a microscope or the like. EBV-specific CTL isolated in this way are T cell stimulating drugs such as anti-CD3 antibodies, PHA, IL-2, and antigen-presenting cells whose proliferation ability has been lost by X-ray irradiation or mitomycin treatment. Stimulate growth to ensure the number of cells required for passive immunotherapy.

CTL preparation method 2
EBV-specific MHC-monomer and / or MHC-tetramer reagent is immobilized on a sterile plate and PBMC is cultured on the immobilized plate. In order to isolate EBV-specific CTL bound to MHC-monomer and / or MHC-tetramer reagent immobilized on the plate, other cells floating without being bound are washed off on the plate. Suspend only the specific CTL remaining in the fresh medium. EBV-specific CTLs isolated in this way are stimulated with anti-CD3 antibodies, PHA, IL-2 and other T cell stimulating agents, and antigen-presenting cells whose proliferation ability has been lost by X-ray irradiation or mitomycin treatment. Proliferate to ensure the number of cells required for passive immunotherapy.

CTL preparation method 3
Acts agonistically on EBV-specific MHC-monomers and / or MHC-tetramer reagents and costimulatory molecules such as CD80, CD83, CD86, or CD28, a T cell ligand that binds to costimulatory molecules The antibody to be immobilized is immobilized on a sterile plate, and PBMC is cultured on the immobilized plate. Two days later, IL-2 is added to the medium and cultured in a 5% CO ₂ constant temperature bath at 37 ° C. for 7 to 14 days. The cultured cells are collected and cultured on a new solid phase plate. By repeating this operation, CTLs with the number of cells necessary for passive immunotherapy are secured.

CTL preparation method 4
Stimulate PBMC or T cells directly with the CTL epitope peptide of the present invention, or with antigen-presenting cells pulsed with the peptide, gene-introduced antigen-presenting cells, or artificially prepared antigen-presenting cells with antigen-presenting ability To do. Stimulation can be in vitro, but may also be in vivo. When stimulated in vitro, CTL induced by stimulation is cultured at 37 ° C for 7 to 14 days in a 5% CO ₂ thermostat. In culture, CTL epitope peptide and IL-2, or antigen-presenting cells and IL-2 stimulation are repeated once a week to secure the number of CTLs necessary for passive immunotherapy.

Purification method of CTL In the CTL preparation method, when the ratio of specific CTL is low, the specific CTL can be recovered with high purity by using the following method as needed.

Purification with MHC-tetramer reagent Reacting EBV-specific MHC-tetramer reagent with CTL induced by the CTL preparation method, a secondary antibody magnetically labeled with an antibody against a labeled dye labeled with MHC-tetramer reagent And can be separated. Such a magnetically labeled secondary antibody and a magnetically labeled cell separation device are available from, for example, Dynal and Miltenyi Biotec GmbH. The EBV-specific CTL isolated in this way is stimulated and proliferated with a T cell stimulating agent such as anti-CD3 antibody, PHA, IL-2, and the number of cells required for passive immunotherapy is ensured.

Purification by secreted cytokines EBV-specific CTLs can be purified by utilizing cytokines released by EBV-specific CTLs. For example, by using a kit available from Miltenyi Biotec GmbH, the cytokine released from the CTL is captured on the cell surface with a specific antibody, stained with an anti-cytokine-labeled antibody, and then magnetically labeled for the labeling substance-specific After reacting with the antibody, it can be purified using a magnetically labeled cell separator. The EBV-specific CTL isolated in this way is stimulated and proliferated with a T cell stimulating agent such as anti-CD3 antibody, PHA, IL-2, and the number of cells required for passive immunotherapy is ensured.

Purification using cell surface protein-specific antibodies Cell surface proteins (eg CD137, CD107a, CD107b, CD63, CD69, etc.) whose expression is enhanced by specific stimulation have been reported on the cell surface of specific CTLs (Betts MR , Brenchley JM, Price DA, De Rosa SC, Douek DC, Roederer M, Koup RA.Sensitive and viable identification of antigen-specific CD8 + T cells by a flow cytometric assay for degranulation.J Immunol Methods.2003; 281: 65-78 , Trimble LA, Shankar P, Patterson M, Daily JP, Lieberman J. Human immunodeficiency virus-specific circulating CD8 T lymphocytes have down-modulated CD3zeta and CD28, key signaling molecules for T-cell activation. J Virol. 2000; 74: 7320 -7330). By magnetically labeling such a protein-specific antibody, it is possible to purify CTL using a magnetic separation apparatus or the like. In addition, CTL can be similarly purified by magnetically labeling such an anti-IgG antibody against the specific antibody. Alternatively, specific CTLs can be purified by coating these specific antibodies onto a plastic plate for culturing, culturing stimulated PBMC using this plate, and washing away the cell population that did not bind to the plate. It is. The EBV-specific CTL isolated in this way is stimulated and proliferated with a T cell stimulating agent such as anti-CD3 antibody, PHA, IL-2, and the number of cells required for passive immunotherapy is ensured.

[Quantification of EBV-specific CTL]
Knowing whether EBV-specific CTLs are present in the peripheral blood of cancer patients or the variation in their amounts is important information for predicting EBV-specific CTL epitope peptides. Quantification of EBV-specific CTL can be performed by the following three methods using the CTL epitope peptide of the present invention.

Quantitation method 1 (MHC-tetramer method)
CTL specific for EBV in peripheral blood can be quantified using the MHC-tetramer reagent produced using the CTL epitope peptide of the present invention. The quantification can be performed, for example, as follows. Peripheral blood or PBMC are reacted with an appropriate concentration of MHC-tetramer reagent. Since the CTL bound to the MHC-tetramer reagent is stained with a labeling dye, it is counted using a flow cytometer, a microscope or the like. When reacting with MHC-tetramer reagent, anti-CD3 antibody, anti-CD4 antibody, anti-CD8 antibody, etc. labeled with a different dye from MHC-tetramer reagent can be reacted to simultaneously determine T cell subsets of EBV-specific CTLs. it can.

Quantitation method 2
This is a method for quantifying cytokines and / or chemokines such as IFNγ (interferon gamma), TNFα (tumor necrosis factor alpha), and interleukin produced by CTL by stimulating PBMC with the CTL epitope peptide of the present invention. A specific method will be described below using IFNγ as an example.

2-1 Method 1 based on cytokine quantification (intracellular IFNγ producing cell quantification method)
PBMCs are suspended in a suitable medium at a cell concentration of approximately 2 × 10 ⁶ / mL, and the CTL epitope peptide of the present invention is added. Further, an intracellular protein transport inhibitor (eg, Brefeldin A, Monensin, etc.) is added, and the cells are cultured at 37 ° C. for 5 to 16 hours in a 5% CO ₂ constant temperature bath. After culturing, the cells are reacted with a T cell marker antibody (anti-CD3 antibody, anti-CD4 antibody, anti-CD8 antibody) or MHC-tetramer reagent, and after fixing the cells, membrane permeation treatment is performed, and a dye-labeled anti-IFNγ antibody is reacted. Analysis is performed using a flow cytometer or the like, and the IFNγ positive cell rate in total cells, T cells, or MHC-tetramer reagent positive cells is quantified.

2-2 Method 2 by cytokine quantification (Elispot assay)
PBMC are plated on a 96-well MultiScreen-HA plate (Millipore) on which an anti-IFNγ antibody is immobilized. Thereafter, the CTL epitope peptide is placed in each well and cultured in a 5% CO ₂ thermostat incubator at 37 ° C. for 20 hours. On the next day, the plate is washed and reacted with anti-IFNγ antibody and peroxidase-labeled anti-IgG antibody in this order. Further, a substrate of peroxidase is added, the IFNγ spot is visualized by color development, and quantified by counting using a stereomicroscope or ELISPOT analyzer (CTL).

2-3 Method 3 by cytokine quantification (method of quantifying IFNγ secreted into the culture supernatant)
PBMCs are suspended in a suitable medium at a cell concentration of approximately 2 × 10 ⁶ / mL, and the CTL epitope peptide of the present invention is added. Incubate for 24-48 hours at 37 ° C in a 5% CO ₂ oven. After the culture, the supernatant is collected, and the IFNγ concentration contained therein is quantified using a commercially available ELISA kit (for example, Quantikine ELISA Human IFNγ Immunoassay from R & D Systems).

Quantitation method 3
Quantification is performed using cell surface protein specific antibodies. CTLs specific for CTL epitope peptides have been reported to enhance the expression of cell surface proteins (eg, CD137, CD107a, CD107b, CD63, CD69, etc.) by specific stimulation. Therefore, by mixing PBMC stimulated with a CTL epitope peptide and a labeled antibody that specifically recognizes a cell surface protein, CTL binds to the labeled antibody and is stained with a labeled dye. Stained CTL can be counted and quantified using a flow cytometer, a microscope or the like. Furthermore, by adding an anti-CD3 antibody, an anti-CD4 antibody, an anti-CD8 antibody or the like labeled with a dye different from the labeled antibody, the T cell subset of specific CTL can be determined simultaneously.

[Large CTL culture using culture bag]
This culture process does not use dendritic cells for the induction of antigen-specific cytotoxic T cells (CTLs), which is a conventional method, and can produce large quantities of CTLs at low cost and with simple operations because it uses autologous plasma. It is characterized by things. Details of the technology are described in detail in the patent application filed by the inventors (Patent Application No. 2009-166630).

Collect 20-200 mL of HLA-A11 positive healthy adult peripheral blood in a heparin blood collection tube and centrifuge at 3,000 rpm for 10 minutes at room temperature. The supernatant plasma is collected and inactivated (56 ° C., 20 minutes). Centrifuge again at 3,000 rpm for 10 minutes at room temperature, collect the supernatant, aliquot, store at -30 ° C, dissolve at any time and use as culture plasma. For the remainder of the supernatant plasma fractionated, an equal amount of RPMI1640 medium is added, and PBMC is isolated by Ficoll specific gravity centrifugation. The number of cells is counted, 10/11 amount of cells are suspended in RPMI1640 medium, and culture plasma is added to a final concentration of 10%. By adding CTL epitope peptide followed, injected 37 ° C. in the culture bag using a luer lock syringe (CultiLife215 TAKARA BIO Inc.), to stand at CO ₂ thermostat at 5% CO ₂ (CTL induction Bag) . 1/11 amount of cells were suspended in RPMI1640 medium, culture plasma was added to a final concentration of 10%, anti-CD3 antibody was added to a final concentration of 1 μg / mL, and then a luer lock syringe was used. It is poured into a culture bag and allowed to stand in a CO ₂ constant temperature bath at 37 ° C. and 5% CO ₂ (antigen-presenting cell induction bag). Two days later, an equal volume of IL-2 containing medium (RPMI1640 IL-2 100 IU / mL) is injected into the culture bag. After culturing in a CO ₂ thermostat for 5 days, an equal volume of IL-2 containing medium (AlyS505N IL-2 100 IU / mL) is injected into the culture bag. Then, every 3 days, an equal volume of IL-2 containing medium (AlyS505N IL-2 100 IU / mL) is injected (the interval here is not necessarily uniform). By the above operation, both antigen-specific CTL and antigen-presenting cells can be induced in about 14 days from the start of culture. Approximately 14 days later, cells in the antigen-presenting cell induction bag are collected, the number of cells is counted, centrifuged, suspended in RPMI1640 medium, CTL epitope peptide is added, and cultured at room temperature for 1 hour. After centrifugation, the supernatant is removed by suction and suspended in a medium containing IL-2 (AlyS505N IL-2 100 IU / mL 10% plasma) (peptide pulse antigen-presenting cells). Similarly, the cells in the CTL induction bag are collected, counted and centrifuged, and the supernatant is removed by aspiration. The cells are suspended in an IL-2 containing medium (AlyS505N IL-2 100 IU / mL 10% plasma). Peptide pulse antigen-presenting cells in an amount equal to the number of cells in the CTL induction bag are mixed and injected into a culture bag using a luer lock syringe. Thereafter, the culture bag is transferred to a CO ₂ thermostatic bath at 37 ° C. and 5% CO ₂ to start the culture. One day later, the growth medium (AlyS505N IL-2 1000 IU / mL) is added to the culture bag. After culturing for 3 days in a CO ₂ thermostatic bath, the growth medium is added to the culture bag. Thereafter, a growth medium is added every two days. By the above operation, antigen-specific CTL can be obtained in a short time of about 20 to 24 days from the start of culture.

[Selection of CTL epitope candidate peptide]
1. Analysis using computer The CTL epitope candidate peptide specific for CKAP4 of the present invention is a peptide comprising 8 to 12 amino acids having a binding motif for the target HLA class I molecule with respect to the amino acid sequence of the CKAP4 protein. Multiple software published on the Internet that can be searched (Lundegaard C, Lund O, Buus S, Nielsen M, Major histocompatibility complex class I binding predictions as a tool in epitope discovery. Immunology., 2010; 130: 309- 318) can be selected.

2. Examination using anchor motifs HLA class I molecules mainly include HLA-A, HLA-B, and HLA-C, and the epitope peptides that are displayed by binding to these consist of 8 to 10 amino acids. The second, ninth or tenth amino acid from the N-terminal side of the epitope peptide is the most important amino acid for binding to the HLA class I molecule, and is called an anchor motif. It has been reported that this anchor motif varies depending on the type of each HLA class I molecule. For example, as a peptide that binds to the HLA-A2 molecule, the most studied in the world, Leu is placed at the second position from the N-terminus, and Leu or Val is placed at the 9th or 10th position. Peptides consisting of 9-10 amino acids are best known (T Sudo, N Kamikawaji, A Kimura, Y Date, CJ Savoie, H Nakashima, E Furuichi, S Kuhara, and T Sasazuki Differences in MHC class I self peptide repertoires among HLA-A2 subtypes. J. Immunol., 1995; 155: 4749-4756). In addition, as a peptide that binds to the HLA-A24 molecule, which is common in Asian races including Japanese, either Tyr, Phe, Met or Trp is placed at the second position from the N-terminus, and the 9th or 10th peptide Peptides with any of Leu, Ile, Trp or Phe at the position and consisting of 9 to 10 amino acids are best known (A Kondo, J Sidney, S Southwood, MF del Guercio , E Appella, H Sakamoto, E Celis, HM Gray, RW Chesnut, and RT Kubo, Prominent roles of secondary anchor residues in peptide binding to HLA-A24 human class I molecules., J. Immunol., 1995; 155: 4307- 4312). By searching a sequence consisting of 8 to 12 amino acids having this anchor motif from the amino acid sequence of the protein, a CTL epitope candidate peptide can be selected.

(Peptide synthesis)
The CTL epitope candidate peptides shown in SEQ ID NOs: 36 to 47 of the present invention can be prepared by various conventional peptide synthesis methods. For example, organic chemical synthesis methods such as solid phase peptide synthesis methods, or nucleic acids encoding peptides can be prepared and prepared using recombinant DNA technology. Moreover, the synthesis | combination by a commercially available chemical synthesizer (For example, the peptide synthesizer of Applied Biosystems) is also possible.

[Examination of CTL epitope candidate peptides]
As described above, by using the prediction software, it is possible to analyze the amino acid sequence constituting the protein in a short time, and predict the binding force and the half-life of dissociation between the CTL epitope candidate peptide and HLA. However, candidate peptides obtained using such prediction software do not necessarily function in vivo as CTL epitopes.

The first reason is that these analysis softwares hardly take into account the efficiency of peptide fragment production by protein degradation. The CTL epitope is composed of peptide fragments having a length of 8 to 12 amino acid residues, and these are produced by various degradation of antigen proteins in cells. Specifically, the antigen protein is first degraded by the proteasome in the cytoplasm to form the C-terminus of the peptide. Thereafter, the peptide fragment is transported to the endoplasmic reticulum lumen by a TAP (transporter-associated-with-antigen-processing) molecule, where it becomes a peptide fragment of 8 to 12 amino acid residues only after the N-terminus is formed by the protease ERAP1. The prediction of CTL epitope candidate peptides must take into account the production process and efficiency of peptide fragments in these cells, but this cannot be accurately predicted at present. For this reason, candidate peptides obtained using the prediction software include those that cannot actually constitute peptide fragments having a length of 8 to 12 amino acid residues in the cell.

The second reason is the selective differentiation process of T cells. Cancer antigens are self-antigens, and T cells that react strongly with self-antigen-derived peptide fragments induce apoptosis in the thymus by negative selection and are eliminated. On the other hand, T cells that react with foreign antigens are selected by positive selection. From such a T cell differentiation process, T cells that react with a self-antigen-derived peptide fragment are usually removed by the thymus, and it is thought that only a small part is present in peripheral blood. In addition, peptide fragments derived from autoantigens are presented on HLA molecules expressed on the membrane surface of all nucleated cells and platelets, and there are innumerable peptide fragments that bind to HLA. In other words, CTL recognizes only a part of the peptide fragments derived from HLA on the cell membrane surface that are recognized by HLA, and most of the CTL epitope candidate peptides by the prediction software are not recognized by CTL. It is believed that. That is, it is considered that there is no antigenicity.

For these reasons, it can be said that obtaining a CTL epitope candidate peptide by simply using prediction software is greatly different from identifying a CTL epitope peptide responsible for an immune response. The inventors have identified a CTL epitope peptide by a method of directly detecting in vivo CTL specific for a candidate peptide using an MHC-tetramer reagent. In other words, the detection of specific CTLs from a sample such as peripheral blood by the MHC-tetramer reagent means that a candidate peptide-specific immune response has been induced in vivo, and the candidate peptide is a CTL epitope. Indicates that it is a peptide.

From the above, the CTL epitope candidate peptide selected by the above-described method can be a CKAP4-specific CTL epitope peptide only after the following studies (1) to (3).
(1) Examination using cultured cell lines Peptide fragments generated by proteasomal proteolysis are guided to the endoplasmic reticulum lumen by TAP molecules, bound to the complex of HLA class I molecules and β2-microglobulin, and the cell membrane Transported to the surface. A TAP gene-deficient cell line deficient in this TAP molecule cannot express peptide fragments, which are degradation products of endogenous proteins, on the cell membrane surface. In addition, human lymphoblastoid cell line T2, which is a typical TAP gene-deficient cell line, or a cell line in which HLA-A24 molecule is introduced into T2 (T2-A24) is expressed on the cell membrane surface. Very unstable. However, when bound to an externally supplied peptide, the HLA molecule is stabilized on the cell membrane surface. Using this property, the TAP gene-deficient cell line can be used in experiments for verifying the binding property between HLA molecules and externally supplied peptides. Specifically, after mixing culture of TAP gene-deficient cell line and CTL epitope candidate peptide, staining with anti-HLA antibody, and calculating the change in expression intensity of HLA molecule by flow cytometry, the target HLA molecule and The binding of CTL epitope candidate peptides can be examined. When the CTL epitope candidate peptide added to the HLA molecule expressed by the TAP gene-deficient cell line binds, the HLA molecule-peptide complex is stabilized on the cell membrane surface, and when stained with an anti-HLA antibody, the expression of the HLA molecule is enhanced. Is observed. On the other hand, if the added CTL epitope candidate peptide does not bind to the HLA molecule, the HLA molecule on the cell membrane surface is unstable, and even when stained with an anti-HLA antibody, enhanced expression of the HLA molecule is not confirmed. Using such a method, it is possible to verify the binding between the HLA molecule and the CTL epitope candidate peptide.
(2) Folding test MHC-tetramer reagent is a ternary complex (MHC-monomer) consisting of MHC (HLA for humans), β2-microglobulin and peptide fragments in vitro. It is an incorporated reagent. The MHC-tetramer reagent is the only reagent that can selectively detect antigen-specific CTLs that are MHC restricted. In addition, MHC-tetramer reagent can not only quantify the amount of CTL by analyzing with flow cytometry after co-staining with anti-CD (cluster of differentiation) antibody, anti-cytokine antibody, etc., but also its activation state and differentiation stage It is possible to evaluate each cell individually. The first step in MHC-tetramer reagent production begins with folding where the raw materials MHC, β2-microglobulin and peptide are mixed in a suitable solution in a test tube. In the folding solution, a three-component complex (MHC-monomer) is formed by the association reaction of these three raw materials. At this time, if the binding force between the MHC and the peptide is high, this association reaction proceeds smoothly, and analysis with a gel filtration column makes it possible to detect a complex of three kinds of raw materials (MHC-monomer). On the other hand, when there is no binding force between MHC and peptide, MHC-monomer is hardly detected. Therefore, it is possible to verify the binding properties and stability of MHC and peptide by analyzing the folding solution over time or by performing heat treatment or the like.
(3) Detection of epitope peptide-specific CTL Peripheral blood mononuclear cells (PBMC) isolated from healthy individuals are suspended in an appropriate medium at a cell concentration of 1 to 3 × 10 ⁶ / mL. Add any one or several of the synthesized CTL epitope candidate peptides (SEQ ID NO: 36 to 47) to a concentration of 1 to 100 μg / mL, and dispense into a 96-well culture plate at 100 μL / well. . Incubate at 37 ° C in a 5% CO ₂ constant temperature bath, and add IL-2 after 2 days. Thereafter, CTL is induced by stimulation with peptide and IL-2 once every 7 to 14 days. Whether the CTL thus induced is specific for the CTL epitope candidate peptide is determined by the MHC-tetramer method. When CTL that can be stained with the MHC-tetramer reagent is detected, the used CTL epitope candidate peptide can be identified as an antigenic peptide (epitope peptide) having CTL inducing ability. In general, T cells (naive T cells) transferred from the thymus are activated and differentiated into effector T cells only upon antigen stimulation by dendritic cells, macrophages and other antigen-presenting cells. In this method of simply culturing PBMC and peptide in a mixed manner, it was unlikely that naive T cells in peripheral blood were differentiated because they did not use artificially prepared antigen-presenting cells. It is thought that effector / memory T cells are proliferating by peptide stimulation. Therefore, when CTL that can be stained with MHC-tetramer reagent is detected, it means that effector / memory type CTL is originally present in the donor's peripheral blood PBMC. This suggests that the mediated immune response is elicited in vivo.

[Production of CKAP4-specific MHC-monomer and MHC-tetramer reagent]
MHC-monomer and MHC-tetramer reagent using a CKAP4-specific CTL epitope candidate peptide can be prepared by a known method (US Patent Number 5,635,363, French Application Number FR9911133). An MHC-monomer that is a complex of three of a HLA class I molecule purified from a recombinant host for protein expression, β2-microglobulin, and a CKAP4-specific CTL epitope candidate peptide of the present invention is formed in a folding solution. A biotin binding site is added to the C-terminus of the recombinant HLA class I molecule in advance, and biotin is added to this site after MHC-monomer formation. A MHC-tetramer reagent can be prepared by mixing commercially available dye-labeled streptavidin and biotinylated MHC-monomer at a molar ratio of 1: 4. It can also be used in combination with antibodies against cell surface proteins (CD62L, CCR7, CD45RA, etc.) to examine the differentiation stage of CTL (Seder RA, Ahmed R. Similarities and differences in CD4 + and CD8 + effector and memory T cell generation) Nat Immunol. 2003; 4: 835-842). Alternatively, it can be used for functional evaluation of CTL by combining with intracellular cytokine staining method. For example, in hepatitis C, CTL against HCV (Hepatitis C virus) exists as one of the causes for maintaining persistent infection, but CTL does not produce cytokines, or the proportion of CTL produced is extremely low. It has been reported that there is a possibility of anomaly (Gruener NH, Lechner F, Jung MC, Diepolder H, Gerlach T, Lauer G, Walker B, Sullivan J, Phillips R, Pape GR , Klenerman P. Sustained dysfunction of antiviral CD8 + T lymphocytes after infection with hepatitis C virus. J Virol. 2001; 75: 5550-5558). In addition, for HCMV-specific CTL after bone marrow transplantation, it is considered effective not only to examine the presence or absence of CTL but also to examine the strength of cytokine production in order to measure the timing of administration of antiviral drugs, etc. Cytomegalovirus reactivation following allogeneic stem cell transplantation is associated with the presence of dysfunctional antigen-specific CD8 + T cells.Blood. 2002; 100: 3690-3697). Thus, if a specific CTL epitope peptide is identified and an MHC-tetramer reagent is produced, it becomes possible to quantify and qualify specific CTLs, and to make a great contribution to obtaining diagnostic information.

[Active immune vaccine]
Peptide vaccine The CTL epitope peptide of the present invention can be used as a peptide vaccine in active immunotherapy. That is, a vaccine comprising the CTL epitope peptide of the present invention is administered to a patient, and CKAP4-specific CTL is proliferated in the body, so that treatment for malignant tumor can be expected.

Vaccine using antigen-presenting cell The antigen-presenting cell on which the CTL epitope peptide of the present invention is presented can be used as a vaccine in active immunotherapy. Antigen-presenting cells with CTL epitope peptides presented
1. 1. CTL epitope peptide pulse antigen-presenting cells in which antigen-presenting cells and CTL epitope peptides are mixed for 30 minutes to 1 hour in an appropriate culture medium. 2. A cell in which a CTL epitope peptide is presented to an antigen-presenting cell by gene transfer or the like using a nucleic acid encoding a CTL epitope peptide. It means an artificial antigen-presenting cell having an antigen-presenting ability prepared artificially. The antigen-presenting cell means, for example, a dendritic cell, a B cell, a macrophage, a certain type of T cell, etc., and is a cell that expresses an HLA molecule to which the peptide can bind on its cell membrane surface, It means something that has stimulating ability. Artificial antigen-presenting cells with antigen-presenting ability are artificially prepared by immobilizing a ternary complex of HLA molecule, CTL epitope peptide and β2-microglobulin on beads such as lipid bilayer membrane, plastic or latex. Immobilize costimulatory molecules such as CD80, CD83, and CD86 that can stimulate CTLs, or fix antibodies that act agonistically on CD28, a T cell ligand that binds to costimulatory molecules. (Oelke M, Maus MV, Didiano D, June CH, Mackensen A, Schneck JP. Ex vivo induction and expansion of antigen-specific cytotoxic T cells by HLA-Ig-coated artificial antigen-presenting cells. Nat Med. 2003; 9: 619-624, Walter S, Herrgen L, Schoor O, Jung G, Wernet D, Buhring HJ, Rammensee HG, Stevanovic S. Cutting edge: predetermined avidity of human CD8 T cells expanded on calibrated MHC / anti -CD28-coated microspheres. J Immunol. 2003; 171: 4974-49 78, Oosten LE, Blokland E, van Halteren AG, Curtsinger J, Mescher MF, Falkenburg JH, Mutis T, Goulmy E. Artificial antigen-presenting constructs efficiently stimulate minor histocompatibility antigen-specific cytotoxic T lymphocytes.Blood. 2004; 104: 224 -226).

Gene Vaccine The nucleic acid of the CTL epitope peptide of the present invention can be used for DNA vaccines, recombinant virus vector vaccines and the like in active immunotherapy. In this case, it is desirable to change the nucleic acid sequence of the CTL epitope peptide to codon usage suitable for the host producing the recombinant vaccine or the recombinant virus vaccine (Casimiro, DR et al. Comparative Immunogenicity in Rhesus Monkeys of DNA Plasmid , Recombinant Vaccinia Virus, and Replication-Defective Adenovirus Vectors Expressing a Human Immunodeficiency Virus Type 1 gag Gene. J. Virol., 2003; 77: 6305-6313, Berzofsky JA, Ahlers JD, Janik J, Morris J, Oh S, Terabe M, Belyakov IM. Progress on new vaccine strategies against chronic viral infections. J Clin Invest. 2004; 114: 450-462).

The vaccine of the present invention can be administered by parenteral administration or oral administration, but parenteral administration is generally preferred. Examples of parenteral administration include nasal administration, subcutaneous / intradermal injection, intramuscular injection, intravenous injection and other suppositories, and suppositories. For oral administration, it can be prepared as a mixture with excipients such as starch, mannitol, lactose, magnesium stearate, and cellulose.

[Passive immunization vaccine]
The CTL epitope peptide of the present invention can be used for the preparation of a passive immunotherapeutic agent. The CTL specific for CKAP4 obtained as described below can be suspended in human albumin-containing PBS or the like and used as a passive immunotherapeutic agent for malignant tumors expressing CKAP4. CTL specific for CKAP4 contained in the passive immunotherapeutic agent can be obtained by the following preparation method, and can be purified and used to increase the purity of CTL.

CTL preparation method 1
PBMC is reacted with an appropriate concentration of CKAP4-specific MHC-tetramer reagent. Since the CKAP4-specific CTL bound to the MHC-tetramer reagent is stained with the labeling dye, only the stained CTL is isolated using a cell sorter, a microscope or the like. CTLs specific for CKAP4 isolated in this way are anti-CD3 antibodies, PHA, IL-2 and other T cell stimulating agents, and antigen-presenting cells whose proliferation ability has been lost by X-ray irradiation or mitomycin treatment. Stimulate growth to ensure the number of cells required for passive immunotherapy.

CTL preparation method 2
CKAP4-specific MHC-monomer and / or MHC-tetramer reagent is immobilized on a sterile plate and PBMC is cultured on the immobilized plate. In order to isolate the CKAP4-specific CTL bound to the MHC-monomer and / or MHC-tetramer reagent immobilized on the plate, after washing off other cells that are not bound, Only the remaining CKAP4-specific CTL is suspended in fresh medium. CKAP4-specific CTL isolated in this way is stimulated to proliferate on T-cell stimulating drugs such as anti-CD3 antibodies, PHA, IL-2, and antigen-presenting cells whose proliferation ability has been lost by treatment with X irradiation or mitomycin. And secure the number of cells required for passive immunotherapy.

CTL preparation method 3
Acts agonistically on CKAP4-specific MHC-monomers and / or MHC-tetramer reagents and costimulatory molecules such as CD80, CD83, CD86, or CD28, a T cell ligand that binds to costimulatory molecules The antibody to be immobilized is immobilized on a sterile plate, and PBMC is cultured on the immobilized plate. Two days later, IL-2 is added to the medium and cultured in a 5% CO ₂ constant temperature bath at 37 ° C for 7 to 10 days. The cultured cells are collected and cultured on a new solid phase plate. By repeating this operation, CTLs with the number of cells necessary for passive immunotherapy are secured.

CTL preparation method 4
Stimulate PBMC or T cells directly with the CTL epitope peptide of the present invention, or with antigen-presenting cells pulsed with the peptide, gene-introduced antigen-presenting cells, or artificially prepared antigen-presenting cells with antigen-presenting ability To do. Stimulation can be in vitro, but may also be in vivo. When stimulated in vitro, CTL induced by stimulation is cultured at 37 ° C for 7 to 14 days in a 5% CO ₂ thermostat. In culture, CTL of the number of cells necessary for passive immunotherapy is ensured by repeating stimulation with CTL epitope peptide and IL-2 or antigen-presenting cells and IL-2 once a week.

Purification method of CTL In the CTL preparation method, when the ratio of specific CTL is low, it is possible to recover the specific CTL with high purity by using the following method as needed.

Purification with MHC-tetramer reagent CKAP4-specific MHC-tetramer reagent reacts with CTL induced by the CTL preparation method, and a secondary antibody magnetically labeled with an antibody against a labeled dye labeled with MHC-tetramer reagent And can be separated. Such a magnetically labeled secondary antibody and a magnetically labeled cell separation device are available from, for example, Dynal and Miltenyi Biotec GmbH. The CKAP4-specific CTL isolated in this manner is stimulated and proliferated with a T cell stimulating agent such as anti-CD3 antibody, PHA, IL-2, etc., and the number of cells necessary for passive immunotherapy is ensured.

Purification by secreted cytokine CKAP4-specific CTLs can be purified by using cytokines released by CKAP4-specific CTLs. For example, by using a kit available from Miltenyi Biotec GmbH, the cytokine released from CTL is supplemented with a specific antibody on the cell surface, stained with a cytokine-specific labeled antibody, and then magnetically labeled labeling substance specific It is also possible to purify using a magnetically labeled cell separation apparatus after reacting with a typical antibody. The CKAP4-specific CTL isolated in this manner is stimulated and proliferated with a T cell stimulating agent such as anti-CD3 antibody, PHA, IL-2, etc., and the number of cells necessary for passive immunotherapy is ensured.

Purification using cell surface protein specific antibodies Cell surface proteins (eg CD137, CD107a, CD107b, CD63, CD69, etc.) whose expression is enhanced by specific stimulation have been reported on the cell surface of specific CTLs (Betts MR , Brenchley JM, Price DA, De Rosa SC, Douek DC, Roederer M, Koup RA.Sensitive and viable identification of antigen-specific CD8 + T cells by a flow cytometric assay for degranulation.J Immunol Methods.2003; 281: 65-78 , Trimble LA, Shankar P, Patterson M, Daily JP, Lieberman J. Human immunodeficiency virus-specific circulating CD8 T lymphocytes have down-modulated CD3zeta and CD28, key signaling molecules for T-cell activation. J Virol. 2000; 74: 7320 -7330, Watanabe K, Suzuki S, Kamei M, Toji S, Kawase T, Takahashi T, Kuzushima K, and Akatsuka Y.CD137-guided isolation and expansion of antigen-specific CD8 cells for potential use in adoptive immunotherapy.Int J Hematol , 2008; 88; 311-320). By magnetically labeling a specific antibody against such a protein, it is possible to purify CKAP4-specific CTL using a magnetic separator or the like. In addition, CKAP4-specific CTL can be similarly purified by magnetically labeling such an anti-IgG antibody against the specific antibody. Alternatively, these specific antibodies can be coated on a plastic plate for culture, and PBMCs can be cultured using this plate, and the CKAP4-specific CTL can be purified by washing away the cell population that did not bind to the plate. Is possible. The CKAP4-specific CTL isolated in this manner is stimulated and proliferated with a T cell stimulating agent such as anti-CD3 antibody, PHA, IL-2, etc., and the number of cells necessary for passive immunotherapy is ensured.

[Quantification of CKAP4-specific CTL]
Knowing whether CKAP4-specific CTLs are present in the peripheral blood of cancer patients or the variation in their amounts predicts the effectiveness of active and passive immunity vaccines using CKAP4-specific CTL epitope peptides Because it is important information. In passive immunization vaccines, the content of CKAP4-specific CTL in the preparation must be measured in advance. Quantification of CKAP4-specific CTL can be performed by the following three methods using the CTL epitope peptide of the present invention.

Quantitation method 1 (MHC-tetramer method)
CTL specific for CKAP4 in peripheral blood can be quantified using the MHC-tetramer reagent produced using the CTL epitope peptide of the present invention. The quantification can be performed, for example, as follows. Peripheral blood or PBMC are reacted with an appropriate concentration of MHC-tetramer reagent. Since the CTL bound to the MHC-tetramer reagent is stained with a labeling dye, it is counted using a flow cytometer, a microscope or the like. When reacting with MHC-tetramer reagent, anti-CD3 antibody, anti-CD4 antibody, anti-CD8 antibody, etc. labeled with a different dye from MHC-tetramer reagent can be reacted to simultaneously determine T cell subsets of CKAP4-specific CTL it can.

2-1 Method 1 based on cytokine quantification (intracellular IFNγ producing cell quantification method)
PBMCs are suspended in a suitable medium at a cell concentration of approximately 2 × 10 ⁶ / mL, and the CTL epitope peptide of the present invention is added. Furthermore, an intracellular protein transport inhibitor (for example, Brefeldin A, Monensin, etc.) is added, and cultured at 37 ° C. for 5 to 16 hours in a 5% CO ₂ thermostat. After culturing, the cells are reacted with a T cell marker antibody (anti-CD3 antibody, anti-CD4 antibody, anti-CD8 antibody) or MHC-tetramer reagent, and after fixing the cells, membrane permeation treatment is performed, and a dye-labeled anti-IFNγ antibody is reacted. Analysis is performed using a flow cytometer or the like, and the IFNγ positive cell rate in total cells, T cells, or MHC-tetramer reagent positive cells is quantified.

Quantitation method 3
Quantification is performed using cell surface protein specific antibodies. CTL specific for CTL epitope peptide has been reported to increase the expression of cell surface proteins (eg CD137, CD107a, CD107b, CD63, CD69, etc.) by specific stimulation (Watanabe K, Suzuki S, Kamei M , Toji S, Kawase T, Takahashi T, Kuzushima K, and Akatsuka Y. CD137-guided isolation and expansion of antigen-specific CD8 cells for potential use in adoptive immunotherapy. Int J Hematol, 2008; 88; 311-320). Therefore, by mixing PBMC stimulated with a CTL epitope peptide and a labeled antibody that specifically recognizes a cell surface protein, CTL binds to the labeled antibody and is stained with a labeled dye. Stained CTL can be counted and quantified using a flow cytometer, a microscope or the like. Furthermore, by adding an anti-CD3 antibody, an anti-CD4 antibody, an anti-CD8 antibody or the like labeled with a dye different from the labeled antibody, the T cell subset of specific CTL can be determined simultaneously.

[Antibodies specific to peptide-MHC complexes]
The identified monoclonal antibody specific for the complex of cancer antigen epitope peptide and MHC (hereinafter referred to as pMHC antibody) can specifically detect cancer cells presenting the epitope peptide on the surface of the cell membrane. For this reason, pMHC antibodies can be used as diagnostic agents for cancer immunotherapy, and can also be used as highly specific therapeutic antibodies by binding antibody-dependent cytotoxicity (ADCC activity) or anticancer drugs. There is utility. In general, pMHC antibodies are obtained by the phage display method. The phage display method is a system for expressing a foreign gene as a fusion protein so as not to lose the infectivity of the phage. It is known that specific monoclonal antibodies can be isolated by expressing and screening antibody variable regions on phages (Tsukahara T, Emori M, Murata K, Hirano T, Muroi N, Kyono M, Toji S, Watanabe K, Torigoe T, Kochin V, Asanuma H, Matsumiya H, Yamashita K, Himi T, Ichimiya S, Wada T, Yamashita T, Hasegawa T, Sato N. Specific targeting of a naturally presented osteosarcoma antigen, papillomavirus binding factor peptide, using an artificial monoclonal antibody. J Biol Chem. 2014; 289 (32): 22035-22047). Acquisition of a pMHC antibody is performed in the flow of preparation of an antibody library, panning, antibody isolation, and evaluation. For panning, a cancer antigen epitope peptide and MHC complex (MHC-monomer) is immobilized on an ELISA plate or immobilized with a biotin-avidin bond, and this is reacted with a phage library. By repeating washing and elution, it is possible to isolate an antibody having a high binding force that is specific for the complex of epitope peptide and MHC. The obtained antibody can be evaluated by adding an epitope peptide to the aforementioned TAP gene-deficient strain T2, reacting the antibody, and measuring the average fluorescence intensity with FCM.

Note that all prior art documents cited in this specification are incorporated herein by reference.

EXAMPLES The present invention will be specifically described below with reference to examples, but the present invention is not limited to these examples. Unless otherwise noted, the experimental methods were conducted with reference to the book (Immune Experiment Method, Shunsuke Ueda, Susumu Hamada, Honjo, Toshiyuki Sasaoka, Nanedo 1995).
[Example 1]
[Selection of EBV-specific CTL epitope candidate peptides]
EBV is classified into type 1 and type 2 depending on the difference in the expressed protein. Type 1 infections, including AG876, are rare in Asia, most of which are infected / hidden in humans (Dambaugh T, Hennessy K, Chamnankit L, Kieff E. U2 region of Epstein- Barr virus DNA may encode Epstein-Barr nuclear antigen 2. Proc Natl Acad Sci US A. 1984 Dec; 81 (23): 7632-6). However, cases of co-infection of EBV in the same individual have been reported, and race- and region-dependent diversity of EBV-infected strains have been reported (Apolloni A, Sculley TB. Detection of A-type and B- type Epstein-Barr virus in throat washings and lymphocytes.Virology. 1994 Aug 1; 202 (2): 978-81, Correa RM, Fellner MD, Alonio LV, Durand K, Teyssie AR, Picconi MA.Epstein-barr virus (EBV ) in healthy carriers: Distribution of genotypes and 30 bp deletion in latent membrane protein-1 (LMP-1) oncogene.J Med Virol. 2004 Aug; 73 (4): 583-8, Klemenc P, Marin J, Soba E, Gale N, Koren S, Strojan P. Distribution of Epstein-Barr virus genotypes in throat washings, sera, peripheral blood lymphocytes and in EBV positive tumor biopsies from Slovenian patients with nasopharyngeal carcinoma.J Med Virol. 2006 Aug; 78 (8): 1083-90, Trimeche M, Bonnet C, Korbi S, Boniver J, de Leval L. Association between Epstein-Barr virus and Hodgkin's lymphoma in Belgium: a pathological and virological study.Leuk Ly 2007 Jul; 48 (7): 1323-31, Tiwawech D, Srivatanakul P, Karalak A, Ishida T. Association between EBNA2 and LMP1 subtypes of Epstein-Barr virus and nasopharyngeal carcinoma in Thais.
J Clin Virol. 2008 May; 42 (1): 1-6. Several EBV strains have been isolated so far, but due to co-infection and strain diversity problems, it has become difficult to analyze the base sequence, and the total base sequence was determined to be B95.8, AG876 , MUTU, GD1, GD2, HKNPC1 and AKATA, only 7 strains in total (Baer R, Bankier AT, Biggin MD, Deininger PL, Farrell PJ, Gibson TJ, Hatfull G, Hudson GS, Satchwell SC, Seguin C, et al. DNA sequence and expression of the B95-8 Epstein-Barr virus genome.Nature. 1984 Jul 19-25; 310 (5974): 207-11, Zeng MS, Li DJ, Liu QL, Song LB, Li MZ, Zhang RH, Yu XJ, Wang HM, Ernberg I, Zeng YX.Genomic sequence analysis of Epstein-Barr virus strain GD1 from a nasopharyngeal carcinoma patient.J Virol. 2005 Dec; 79 (24): 15323-30, Dolan A, Addison C, Gatherer D, Davison AJ, McGeoch DJ.The genome of Epstein-Barr virus type 2 strain AG876.
Virology. 2006 Jun 20; 350 (1): 164-70, Liu P, Fang X, Feng Z, Guo YM, Peng RJ, Liu T, Huang Z, Feng Y, Sun X, Xiong Z, Guo X, Pang SS , Wang B, Lv X, Feng FT, Li DJ, Chen LZ, Feng QS, Huang WL, Zeng MS, Bei JX, Zhang Y, Zeng YX.Direct sequencing and characterization of a clinical isolate of Epstein-Barr virus from nasopharyngeal carcinoma tissue by using next-generation sequencing technology.J Virol. 2011 Nov; 85 (21): 11291-9., Kwok H, Tong AH, Lin CH, Lok S, Farrell PJ, Kwong DL, Chiang AK.Genomic sequencing and comparative analysis of Epstein-Barr virus genome isolated from primary nasopharyngeal carcinoma biopsy.PLoS One. 2012; 7 (5): e36939., Lin Z, Wang X, Strong MJ, Concha M, Baddoo M, Xu G, Baribault C, Fewell C , Hulme W, Hedges D, Taylor CM, Flemington EK. Whole-genome sequencing of the Akata and Mutu Epstein-Barr virus strains. J Virol. 2013 Jan; 87 (2): 1172-82.

Differences in the expression of major proteins and amino acid sequences among these strains have been partially analyzed, and several reports have been made on LMP2 and EBNA1 (Midgley RS, Bell AI, Yao QY, Croom- Carter D, Hislop AD, Whitney BM, Chan AT, Johnson PJ, Rickinson AB. HLA-A11-restricted epitope polymorphism among Epstein-Barr virus strains in the HLA-A11-positive Chinesegenic J Virol. 2003 Nov; 77 (21): 11507-16, Wang X, Liu X, Jia Y, Chao Y, Xing X, Wang Y, Luo B. Widespread sequence variation in the Epstein-Barr virus latent membrane protein 2A gene among northern Chinese isolates. J Gen Virol. 2010 Oct; 91 (Pt 10): 2564-73., Han J, Chen JN, Zhang ZG, Li HG, Ding YG, Du H, Shao CK. Sequence variations membrane protein 2A in Epstein-Barr virus-associated gastri c carcinomas from Guangzhou, southern China. PLoS One. 2012; 7 (3): e34276.).

Selection of LMP2 and EBNA1-specific CTL epitope candidate peptides of the present invention is based on the amino acid sequence of B95.8 (GenBank: V01555.2), the most representative strain belonging to EBV type 1, and other strains. This was carried out with reference to amino acid mutations in. Specifically, it was carried out by collating with a plurality of software published on the Internet, which can search for a CTL epitope candidate peptide consisting of 8 to 10 amino acids having a binding motif for the HLA-A11 molecule. As a result, CTL epitope candidate peptides consisting of 9 or 10 amino acids having a binding motif of HLA-A11 molecule from the amino acid sequences of EBVEBLMP2 and EBNA1 were selected, a total of 33 types including 22 types for LMP2 and 11 types for EBNA1. These peptides were synthesized and shown below as CTL epitope candidate peptides. Amino acid mutation sites in different EBV strains are underlined. In the present invention, the B95.8 strain is a wild strain, and amino acid substitutions in other strains are called mutations. As a positive control peptide, HLA-A * 11: 01 restricted epitope peptide (ATVQGQNLK, SEQ ID NO: 34) derived from pp65 protein of human cytomegalovirus (CMV) was synthesized. As a peptide for negative control, survivin-2B HLA-A * 24: 02 restricted epitope peptide (AYACNTSTL, SEQ ID NO: 35) was synthesized.

(1) Synthesized EBV LMP2-derived HLA-A * 11: 01 restricted CTL epitope peptide candidate
Ala Ser Ser Tyr Ala Ala Ala Gln Arg Lys (SEQ ID NO: 1)
Ala Asn Ser Tyr Ala Ala Ala Gln Arg Lys (SEQ ID NO: 2)
Ala Ser Ser Ser Ala Ala Ala Gln Arg Lys (SEQ ID NO: 3)
Ala Asn Ser Ser Ala Ala Ala Gln Arg Lys (SEQ ID NO: 4)
Ala Ser Ser Tyr Ala Ala Ala Gln Arg (SEQ ID NO: 5)
Ser Ser Tyr Ala Ala Ala Gln Arg Lys (SEQ ID NO: 6)
Val Met Leu Val Leu Leu Ile Leu Ala Tyr (SEQ ID NO: 7)
Leu Val Leu Leu Ile Leu Ala Tyr Arg (SEQ ID NO: 8)
Leu Val Leu Leu Ile Leu Ala Tyr Arg Arg (SEQ ID NO: 9)
Leu Ala Tyr Arg Arg Arg Trp Arg Arg (SEQ ID NO: 10)
Thr Thr Met Phe Leu Leu Met Leu Leu (SEQ ID NO: 11)
Lys Ile Leu Leu Ala Arg Leu Phe Leu Tyr (SEQ ID NO: 12)
Lys Val Leu Leu Ala Arg Leu Phe Leu Tyr (SEQ ID NO: 13)
Ile Leu Leu Ala Arg Leu Phe Leu Tyr (SEQ ID NO: 14)
Val Leu Leu Ala Arg Leu Phe Leu Tyr (SEQ ID NO: 15)
Gly Ser Ile Leu Gln Thr Asn Phe Lys (SEQ ID NO: 16)
Leu Thr Glu Trp Gly Ser Gly Asn Arg (SEQ ID NO: 17)
Arg Thr Tyr Gly Pro Val Phe Met Cys Leu (SEQ ID NO: 18)
Arg Thr Tyr Gly Pro Val Phe Met Ser Leu (SEQ ID NO: 19)
Thr Val Met Ser Asn Thr Leu Leu Ser (SEQ ID NO: 20)
Thr Val Met Thr Asn Thr Leu Leu Ser (SEQ ID NO: 21)
Ala Leu Phe Gly Val Ile Arg Cys Cys Arg (SEQ ID NO: 22)

(2) HLA-A * 11: 01 restricted CTL epitope peptide candidate derived from synthesized EBV EBNA1 Gly Pro Gly Asn Gly Leu Gly Glu Lys (SEQ ID NO: 23)
Ser Ser Ser Ser Gly Ser Pro Pro Arg Arg (SEQ ID NO: 24)
Gly Gln Gly Asp Gly Gly Arg Arg Lys (SEQ ID NO: 25)
His Arg Gly Gln Gly Gly Ser Asn Pro Lys (SEQ ID NO: 26)
His Arg Gly Glu Gly Gly Ser Ser Gln Lys (SEQ ID NO: 27)
His Arg Gly Gln Gly Gly Ser Asn Gln Lys (SEQ ID NO: 28)
Gly Val Phe Val Tyr Gly Gly Ser Lys (SEQ ID NO: 29)
Lys Thr Ser Leu Tyr Asn Leu Arg Arg (SEQ ID NO: 30)
Gln Thr His Ile Phe Ala Glu Val Leu Lys (SEQ ID NO: 31)
Gly Arg Gly Arg Gly Arg Gly Glu Lys (SEQ ID NO: 32)
Ala Ile Lys Asp Leu Val Met Thr Lys (SEQ ID NO: 33)

(3) Peptide synthesized for control Ala Thr Val Gln Gly Gln Asn Leu Lys (SEQ ID NO: 34)
Ala Tyr Ala Cys Asn Thr Ser Thr Leu (SEQ ID NO: 35)

Tables 1, 2, and 3 show the characteristics of the synthesized LMP2 and EBNA1 HLA-A11: 01 restricted CTL epitope peptides and the peptides synthesized for control. The peptide name is indicated by three amino acid sequences from the N-terminal side of the synthesized peptide. From left, peptide name (a in the table), amino acid sequence (b in the table), position on the amino acid sequence of the derived protein, number of amino acids, NetMHC3.4 used for analysis (http://www.cbs.dtu.dk / Services / NetMHC /) HLA Peptide Binding Predictions (Nielsen M, Lundegaard C, Worning P, Lauemoller SL, Lamberth K, Buus S, Brunak S, Lund O. Reliable prediction vel ations-no . Protein Sci. 2003 May; 12 (5): 1007-17, Lundegaard C, Lamberth K, Harndahl M, Buus S, Lund O, Nielsen M. NetMHC-3.0: accurate web accessible predictions of human, mouse HC I affinities for peptides of length 8-11. Nucleic Acids Res. 2008 Jul 1; 36 (Web Server issue): W509-12., Lundegaard C, Lund O, Nielsen M. Accurate approximation method for predictionforHC peptides of

length

8, 10 and 11 using prediction tools tra Ined (on 9mers. Bioinformatics. 2008 Jun 1; 24 (11): 1397-8.), the scores (c in the table) are shown in descending order. This score is a numerical value that predicts the affinity between HLA-A11 and the peptide. The higher the score, the more likely the HLA and peptide may form a stable complex. The scores of NetMHC 3.4 shown in Table 1, Table 2 and Table 3 are shown as representative examples obtained with 11 types of analysis software used in the analysis.

[Folding test of EBV-specific CTL epitope candidate peptide]
The inventors conducted a folding test using 35 types of peptides described in Tables 1, 2 and 3. Specifically, HLA-A * 11: 01, β2-microglobulin expressed using E. coli expression system and β2-microglobulin, and synthetic peptide were added to the folding solution, mixed, and the folding solution was collected over time. The analysis was performed with a gel filtration column. When gel filtration column analysis shows the formation of a ternary complex (MHC-monomer) of HLA-A * 11: 01, β2-microglobulin, and EBV-specific CTL epitope candidate peptide, MHC-monomer Since the molecular weight is large, the elution time in the gel filtration column analysis is shortened. Further, the amount of MHC-monomer formation can be calculated from the peak area obtained by the absorption wavelength of 280 nm. On the other hand, MHC-monomer formation is not confirmed with candidate peptides that do not bind to HLA molecules. A typical gel filtration column analysis example in which MHC-monomer formation is observed is shown in FIG.

As a result of gel filtration column analysis, HLA molecules and β2-microglobulin were solubilized in 8M urea after purification of the insoluble fraction as inclusion bodies when purified using the E. coli expression system. Soluble HLA molecules that do not lead to MHC-monomer formation are detected as aggregates in 7-8 minutes. However, most of the aggregates are removed by filter filtration, which is a pretreatment step of gel filtration column analysis. β2-microglobulin is a soluble protein, solubilized in a folding solution, and is detected in the vicinity of 14 minutes when using Superdex 75GL10 / 300GL (GE Healthcare). After 15 minutes, the folding solution composition and peptide are detected. The peak of MHC-monomer is not confirmed immediately after the start of the folding test (day 0), but the peak increases after 1 day (day 1) and 3 days (day （3), and MHC-monomer formation is progressing smoothly. Shows things.

2 and 3 show the analysis results after 1, 3 and 7 days of the folding test performed on 35 types of peptides. As a positive control peptide, HLA-A * 11: 01 restricted epitope peptide derived from CMV pp65 protein (ATVQGQNLK, SEQ ID NO: 34), and as a negative control, survivin-2B derived HLA-A * 24: 02 restricted epitope peptide ( AYACNTSTL, SEQ ID NO: 35) was used for comparison. The area of the peak indicating MHC-monomer formation is shown as a bar graph. Tables 4 and 5 show the results of comparing SEQ ID NOs: 1 to 22 (LMP2) and SEQ ID NOs: 23 to 33 (EBNA1) with SEQ ID NOs: 34 to 35, which are positive control peptides and negative controls, respectively.

Tables 4 and 5 show HLA-A * 11: 01 binding properties of peptide candidates. In the folding test, the presence / absence of binding is indicated by ○ when the value exceeding the highest binding value of the negative control (135,674 μV * sec) is considered as having a binding property, and by × when the lower value is not binding. Thus, the HLA-A * 11: 01 binding determined by the experimental values does not necessarily match the predicted value obtained by the computer algorithm, and the experimental values of the folding test are the candidate peptides and HLA-A in in vitro. * Represents the binding with 11:01. The results of the folding test showed HLA-A * 11: 01 binding for all of the lower eight peptide candidates predicted by the computer algorithm (predicted value <0.400). On the other hand, the predicted values of the four peptides that do not show the HLA-A * 11: 01 binding property as a result of the folding test are as follows. VML: 0.417; LVL (9mer): 0.439; TTM: 0.477; KIL: 0.602. It can be seen that although neither predicted value is higher than 0.400, it does not bind to HLA-A * 11: 01. Thus, the binding between the epitope candidate peptide and the HLA molecule cannot be judged only by the computer algorithm.

[Production of EBV LMP2-specific MHC-tetramer reagent]
Based on the results of the folding test, a PE-labeled MHC-tetramer reagent was prepared using HLA-A * 11: 01-binding EBV LMP2-specific or EBV EBNA1-specific CTL epitope candidate peptides. The MHC-tetramer reagent produced in the present invention is abbreviated as, for example, ASS (10mer) -Tet, which is HLA-A * 11: 01, ASS (10mer) peptide (ASSYAAAQRK, SEQ ID NO: 1) and β2 -Indicates one produced using a microglobulin ternary complex. MHC-monomer, which is a complex of HLA class I molecule purified from a recombinant host for protein expression, β2-microglobulin and EBV LMP2 or EBV EBNA1-specific CTL epitope candidate peptide of the present invention in an appropriate folding solution To form. A biotin binding site is added to the C-terminus of the recombinant HLA class I molecule in advance, and biotin is added to this site after MHC-monomer formation. A MHC-tetramer reagent can be prepared by mixing commercially available dye-labeled streptavidin and biotinylated MHC-monomer at a molar ratio of 1: 4.

[Identification of EBV-specific CTL epitope peptide]
(Selection of specimen HLA type)
As candidate peptides for EBV-specific CTL epitopes, 33 types of candidate peptides having a binding motif for HLA-A * 11: 01 were selected. Furthermore, a folding test revealed that HLA-A * 11: 01, β2-microglobulin and 29 EBV-specific CTL epitope candidate peptides bind to each other to form MHC-monomers in vitro. In order to confirm whether these 29 kinds of EBV LMP2-specific or EBNA1-specific CTL epitope candidate peptides actually bind to HLA-A * 11: 01 and CTLs that recognize them exist in vivo, It is necessary to examine whether it is possible to amplify EBV-specific CTLs present in peripheral blood using the peripheral blood of donors carrying HLA-A * 11: 01. First, whether or not a blood donor holds HLA-A * 11: 01 was confirmed by genotyping of HLA-A using Genosearch (trademark) HLA-A Ver.2 (MBL). Subsequent examinations were conducted using PBMCs of 5 healthy adults with HLA-A * 11: 01.

(Preparation of antigen-presenting cells)
(1) Preparation of EBV-infected B cell line (Kuzushima K, Yamamoto M, Kimura H, Ando Y, Kudo T, Tsuge I, Morishima T. Establishment of anti-Epstein-Barr virus (EBV) cellular immunity by adoptive transfer of In accordance with virus-specific cytotoxic T lymphocytes from an HLA-matched sibling to a patient with severe chronic active EBV infection. Clin Exp Immunol. 1996; 103: 192-198), the B95.8 cell line (JCRB Cell) The culture supernatant (including live EBV virus) and PBMC were mixed and cultured to establish an EBV-infected B cell line (hereinafter referred to as EBV-infected LCL). About 2 weeks later, the expression of HLA molecules and the expression of CD80, CD83, CD86 and CD20 were confirmed.

(2) Preparation of CD40-B cells NIH3T3 cells (NIH-CD40L) into which human CD40L was introduced and stably expressed were co-cultured in the presence of IL-4. NIH-CD40L inhibited growth by 96 Gy X-ray irradiation and repeated co-culture every 3-4 days (Kondo E, Topp MS, Kiem HP, Obata Y, Morishima Y, Kuzushima K, Tanimoto M, Harada M, Takahashi T, Akatsuka Y. Efficient generation of antigen-specific cytotoxic T cells using retrovirally transduced CD40-activated B cells. J Immunol. 2002; 169: 2164-2171). About 2 weeks later, HLA molecule expression and CD80, CD83 and CD86 expression were confirmed.

(3) Preparation of dendritic cells PBMC were cultured in a plastic culture dish at 37 ° C. in a 5% CO ₂ constant temperature bath for 2 hours, and the cells that did not adhere to the culture dish were gently washed away. GM-CSF and IL-4 were added thereto, and cultured for 24 hours. Subsequently, TNFα, IL-1β and PGE2 (Prostaglandin E2) were added, and cultured for 24 to 48 hours. The cells recovered by washing gently with an appropriate medium were used as dendritic cells (Kondo E, Topp MS, Kiem HP, Obata Y, Morishima Y, Kuzushima K, Tanimoto M, Harada M, Takahashi T, Akatsuka Y. Efficient generation of antigen-specific cytotoxic T cells using retrovirally transduced CD40-activated B cells. J Immunol. 2002; 169: 2164-2171). After 48 hours, HLA molecule expression and CD80, CD83 and CD86 expression were confirmed.

[Induction of EBV-specific CTL]
1) Induction using antigen-presenting cells The above-described antigen-presenting cells (EBV-infected LCL, CD40-B cells, dendritic cells) were prepared in advance from PBMC holding HLA-A * 11: 01. Antigen-presenting cells are suspended in pulse medium (0.1% human serum albumin / 55 μM 2-mercaptoethanol / RPMI 1640) or AIM-V medium (Invitrogen), and CTL epitope candidate peptides are added at a concentration of 10 μg / mL. In addition, leave it for 30 to 60 minutes at room temperature with gentle mixing at approximately 15 minute intervals, then wash 3 times with an excess amount of washing solution (2% fetal calf serum (FCS) / PBS) and do not bind to HLA molecules. The peptide was washed away. By performing this operation, it is considered that the CTL epitope candidate peptide binds to the HLA molecule on the antigen-presenting cell. The antigen-presenting cell subjected to this operation is called a peptide pulse antigen-presenting cell. Peptide pulse antigen-presenting cells were treated with a lethal dose of X-ray irradiation or mitomycin C treatment to lose their ability to grow. This was mixed with PBMC isolated from the same person, or CD8 positive or CD4 positive T cells and cultured in a 37 ° C., 5% CO ₂ constant temperature bath. As the medium to be used, RPMI1640 medium containing 10% FCS, RPMI1640 medium containing 10% human serum, or RPMI1640 medium containing 1 to 10% human plasma was examined. In this method, 10% human serum is contained. Good results were obtained with RPMI1640 medium. IL-2 (Shionogi Pharmaceutical Co., Ltd.) was added for the purpose of maintaining the survival of T cells and assisting proliferation. However, there are many reports that the timing is usually 7 to 14 days after the start of mixed culture. -2 was examined at the start of culture, 2 days after the start of culture, 6 days after the start of the culture, but good results were obtained when administered 2 days after the start of the culture. Added in. Stimulation was again applied using peptide pulse antigen-presenting cells 10-14 days after the start of culture. Stimulation was performed every 10 to 14 days using peptide pulse antigen-presenting cells, and evaluation of CTL induction was performed approximately 2 weeks and 4 weeks later. When induction of EBV-specific CTL was confirmed, stimulation was further performed using peptide pulse antigen-presenting cells to establish a CTL line.

2) Induction method without using antigen-presenting cells This induction method is a method for inducing CTL by introducing a peptide into a PBMC culture solution. It is considered that the peptide is presented to antigen-presenting cells present in PBMC, such as dendritic cells, B cells, macrophages, and certain T cells, and CTL precursor cells contained in PBMC are stimulated to proliferate. Unlike the above-described induction method using antigen-presenting cells, the method is distinguished in that it is not necessary to prepare antigen-presenting cells in advance and can be easily carried out. It is a system that stimulates and proliferates memory / effector type CTL circulating in peripheral blood without using antigen presenting cells.

Peripheral blood collected from healthy adults holding HLA-A * 11: 01 was centrifuged at 3,000 rpm for 5-10 minutes, and the plasma portion of the supernatant was collected. PBMCs were separated according to the conventional method except for the plasma portion. It is characterized by adding several percent of plasma to the medium used for induction. In the present invention, good results were obtained when 5% plasma was added. The medium is generally supplemented with appropriate additives and antibiotics for the medium used for cell culture. As the CTL induction medium used in the present invention, RPMI1640 Hepes modify (Sigma) was added with 2-mercaptoethanol, L-glutamine, and antibiotics streptomycin and penicillin. In addition, insulin, transferrin, selenious acid, pyruvic acid, human serum albumin, a non-essential amino acid solution, and the like can be added. 1 to 3 × 10 ⁶ PBMCs were suspended in 1 to 2.5 mL of medium. To this was added the candidate peptide at a concentration of 1-20 μg / mL. The concentration of the peptide can be varied depending on the solubility of the peptide. In the present invention, it was carried out at 10 μg / mL. Two days later, IL-2 was added at a final concentration of 20-100 U / mL. In the mixed culture of PBMC and peptide, it is desirable to use a round-bottom culture dish capable of carbon dioxide exchange. In the present invention, a polypropylene 14 mL round-bottom tube (BD Biosciences) or 96-well U-bottom cell culture is used. A micro test plate (BD Biosciences) was used. Confirmation of EBV-specific CTL was performed after 2 weeks and 4 weeks of culture. After 2 weeks of culture, stimulation with 10 μg / mL peptide was performed again. When induction of EBV-specific CTL was confirmed, stimulation was performed using peptide pulse antigen-presenting cells to establish a CTL line.

[Confirmation of EBV-specific CTL]
Whether EBV-specific CTL is present in the cell population cultured by the above-described method was examined by an intracellular IFNγ-producing cell quantification method and MHC-tetramer method.

Confirmation of specific CTL induction by intracellular IFNγ-producing cell quantification method Transfer about 1/10 to the total amount of the cell population induced by the above method to a 96-well U-bottom cell culture microtest plate, and finally use the peptide used for induction. It was added at a concentration of 0.01-0.05 μg / mL. Further, an intracellular protein transport inhibitor (eg, Brefeldin A, Monensin, etc.) was added, and the cells were cultured at 37 ° C. for 5 to 16 hours in a 5% CO ₂ thermostat. After culturing, the cells were washed, PE (phycoerythrin) -labeled MHC-tetramer reagent and PC5 (phycoerythrin-Cy5) -labeled anti-CD8 antibody (Beckman Coulter) were added, and left at room temperature for 15 to 30 minutes. After washing, it was fixed with 4% formaldehyde at 4 ° C. for 15 minutes, and then washed with an excessive amount of washing solution. After membrane permeabilization with 0.1% saponin, FITC-labeled anti-IFNγ antibody (Beckman Coulter) was added and allowed to react at room temperature for 15-30 minutes. After washing, the IFNγ positive cell rate in T cells or the IFNγ positive cell rate in MHC-tetramer reagent positive cells was quantified using a flow cytometer.

FIG. 4 shows the results of examining specific CTLs using a positive control peptide by an induction method that does not use antigen-presenting cells and examined by an intracellular IFNγ-producing cell quantification method. PBMC isolated from healthy adult peripheral blood that retains HLA-A * 11: 01 but does not retain HLA-A * 24: 02 is an epitope peptide derived from HLA-A * 11: 01-restricted CMV pp65 (ATVQGQNLK, SEQ ID NO: 34) Or as a negative control peptide, stimulation with HLA-A * 24: 02-restricted survivin-2B-derived epitope peptide (AYACNTSTL, SEQ ID NO: 35) for 13 days, followed by each peptide used for stimulation in the presence of Brefeldin 14 Restimulated for hours. The result of triple staining with PE-labeled MHC-tetramer reagent (MBL), PC5-labeled anti-CD8 antibody and FITC-labeled anti-IFNγ antibody, and analysis using a flow cytometer are shown. The numbers in the dot plot development view indicate the ratio (%) of the cells present in the four divided regions to the whole living cells. The four-divided area will be referred to as UL (upper left), UR (upper right), LL (lower left), and LR (lower right). In the dot plot development diagram showing the fluorescence intensity for CD8 on the X-axis and INFγ on the Y-axis in log scale, IFNγ-positive CD8-positive cells appeared in the UR when re-stimulated with the positive control peptide, and regenerated with the negative control peptide. It hardly appears even when stimulated. The presence of CMV 培養 pp65-specific CTL in the cell population stimulated with the positive control peptide for 13 days indicates that the X-axis shows CD8 on the X-axis and the fluorescence intensity for the MHC-tetramer reagent on the Y-axis on a log scale. In the figure, it is clear from the presence of CD8 positive MHC-tetramer reagent positive cell population in UR. On the other hand, it is also clear that survivin-2B-specific CTLs do not appear in the cell population to which a restrictive negative control peptide different from the donor allele is added. That is, 29.37% of specific CTLs were induced in the cell population to which HLA-A * 11: 01-restricted CMV pp65-derived epitope peptide was added, and survivin-2B-derived HLA-A * 24: 02-restricted epitope peptide Specific CTLs are not induced in the added cell population. This result is consistent with the above-mentioned measurement result of IFNγ. Furthermore, in the dot plot development diagram showing the fluorescence intensity for IFNγ on the X-axis and the MHC-tetramer reagent on the Y-axis in log scale, when a negative control peptide is added, there are almost MHC-tetramer reagent-positive and IFNγ-positive cells. However, specific CTLs induced by stimulation with HLA-A * 11: 01-restricted CMV pp65-derived positive control peptides accounted for 29.39% of the total cell population, 73% of which produced IFNγ ( UR), in other words, has cytotoxic activity.

As a result, IFNγ-producing cells were induced by restimulation in PBMC cultured with the HLA-restricted CTL epitope peptide retained by the donor, and these cells were stained with MHC-tetramer reagent. It is clear that the CTL is specific to the added CTL epitope peptide. Whether or not specific CTLs are induced in this way can also be determined by an intracellular IFNγ-producing cell quantification method. Similarly, an investigation was performed on five healthy adults to determine whether IFNγ-producing cells were induced using EBV LMP2-specific CTL epitope candidate peptides. The ratio of live IFNγ-producing cells present in CD8-positive cells is quantified and shown in FIG. FIG. 6 shows representative results of quantifying intracellular IFNγ-producing cells.

In Fig. 5, peripheral blood of five healthy adults (donor ID numbers: * 11-13, * 11-16, * 11-8, * 11-11, * 11-2) was used, and 21 types of peptides were used. Intracellular IFNγ producing cells were quantified. The percentage (%) of the number of CD8 positive IFNγ positive cells in PBMC is shown on the X axis. Peptide candidates that showed a positive result compared with the negative control are ASS (10mer) (SEQ ID NO: 1) and the positive control peptide CMV pp65. The detailed result of the peptide which showed positive is demonstrated in FIG.

Fig. 6 is a dot plot development showing the fluorescence intensity for CD8 on the X-axis and IFNγ on the Y-axis on a log scale, and quantifies intracellular IFNγ-producing cells by restimulation with the same peptide used for induction. The results were shown. The ratio (%) of the number of CD8-positive IFNγ-positive cells to PBMC in UR is shown as a numerical value.

In the positive control CMV pp65, 28.0% of CD8-positive IFNγ-positive (producing) cells were detected in UR. A significant difference was observed compared to the positive rate (8.67%) of the negative control survivin-2B. Based on these results, we synthesized MHC-tetramer reagents and examined their usefulness.

[Examination using EBV-specific MHC-tetramer reagent]
(Synthesis of MHC-tetramer reagent)
The inventors made a PE-labeled MHC-tetramer reagent using EBV-specific CTL epitope peptide and HLA-A * 11: 01 molecule. The MHC-tetramer reagent prepared in the present invention is indicated by an abbreviation, for example, ASS (10mer) -Tet, which is an HLA-A * 11: 01 molecule and a peptide ASS (10mer) (ASSYAAAQRK, SEQ ID NO: 1). A compound synthesized using a ternary complex of β2-microglobulin is shown.

[Quantitative method using MHC-tetramer reagent]
Using the MHC-tetramer reagent prepared using the CTL epitope peptide of the present invention as a sample, the CTL line obtained by adding and inducing CTL epitope peptide to peripheral blood or PBMC separated from peripheral blood is used as a sample. CTL was quantified. Examples are shown below using PE labeled MHC-tetramer reagent as an example. The labeling dyes may be used in an appropriate combination according to the type of flow cytometer used, and are not limited to the following.

In the case of peripheral blood To 200 μL of collected peripheral blood, 10 μL of PE-labeled MHC-tetramer reagent, 20 μL of FITC-labeled anti-T cell surface antibody (eg, CD8, CD4, CD3) and the like were added. Furthermore, an anti-CD45 antibody labeled with PC5 or the like may be added in order to exclude non-specific fluorescence due to mixed red blood cells. Gently mixed and left at room temperature for 30 minutes. OptiLyse B (Beckam coulter) was added, and hemolysis fixation was performed according to the instructions. After adding 2 mL of PBS and stirring, it was centrifuged at 400 × g for 5 minutes. After discarding the supernatant by aspiration, the cells were resuspended in 500 μL of PBS and analyzed with a flow cytometer within 24 hours.

For CTL lines derived using PBMC or CTL epitope peptide 10 μL of PE-labeled MHC for an appropriate amount of PBMC (10 ⁵ to 10 ⁶ cells) or an appropriate amount of CTL line derived using CTL epitope peptide -Tetramer reagent and 20 μL of FITC-labeled anti-T cell surface antibody (eg CD8, CD4, CD3) etc. were added. Furthermore, an anti-CD45 antibody labeled with PC5 or the like may be added in order to exclude non-specific fluorescence due to mixed red blood cells. Gently mixed and left at room temperature for 30 minutes. After adding 3 mL of PBS and stirring, it was centrifuged at 400 × g for 5 minutes. The supernatant was aspirated and discarded, and the cells were resuspended in 500 μL of PBS. In the case of the CTL line, 7-AAD viability Dye (dead cell detection reagent, MBL) may be added to exclude non-specific fluorescence due to dead cells. The analysis was performed with a flow cytometer within 24 hours.

[Detection of EBV LMP2-specific CTL in healthy adult peripheral blood using MHC-tetramer reagent]
Persons whose immune system is reduced for some reason, patients with congenital immunodeficiency, or patients who have received bone marrow transplantation, hematopoietic stem cell transplantation, umbilical cord blood transplantation, solid organ transplantation and are receiving immunosuppressants to prevent rejection To know whether EBV-specific CTLs are present in the peripheral blood of high-risk patients such as chronic viral infection patients, AIDS patients, elderly people, infants and pregnant women, or transplant donors It is important in the management of infectious diseases including proper use of immunosuppressants. However, since the immunocompetence of these patients has declined, the presence of EBV-specific CTL has been difficult with existing methods because the presence of EBV-specific CTL has decreased. If an EBV-specific MHC-tetramer reagent is used, there is a possibility that the presence of EBV-specific CTL can be determined in about 1 hour after blood collection. Therefore, we examined whether EBV-specific CTL could be detected using healthy adult peripheral blood. The result is shown in FIG. Using peripheral blood of donor ID * 11-11, three types of EBV-specific MHC-tetramer reagent and positive control CMV pp65 MHC-tetramer reagent (MBL) and negative control survivin-2B HLA-A * 24: 02 Stained with MHC-tetramer reagent (MBL). The X-axis is CD8, and the Y-axis is a dot plot development drawing analyzing the fluorescence intensity for the MHC-tetramer reagent on a log scale. The numerical value in the dot plot development diagram represents the ratio of CD8 positive MHC-tetramer reagent positive cells in CD8 positive cells as a positive rate (%). As a result, immediately after blood collection (day 0), the CD8 positive MHC-tetramer reagent positive cell population was not significantly different from the negative control. This is because the peripheral blood used is a healthy adult and is less likely to develop an opportunistic infection caused by EBV or CMV. Subsequently, PBMC were stimulated with each peptide for 14 days (day 14) and then stained with MHC-tetramer reagent in the same manner. As a result, the positive rate of 44.47% for ASS (10mer) and 40.52% for CMV pp65 was detected after 14 days of culture. The positive cell population obtained from the negative control HLA-A * 24: 02-restricted survivin-2B MHC-tetramer reagent was 0.17%. It can be said that. From these results, it became clear that EBV LMP2-specific CTLs are present in healthy adult peripheral blood and can grow to such an extent that the presence or absence of CTLs can be determined after 2 weeks of culture. This means that the induction method that does not use antigen-presenting cells, which is carried out in the present invention, is effective for the detection of EBV-specific CTL. In addition, ASS (10mer) derived from EBV LMP2 (SEQ ID NO: 1) identified in the present invention has a function of proliferating EBV LMP2-specific CTL in peripheral blood, and these cell populations are ASS (10mer) -Tet. Thus, it was found to be an HLA-A * 11: 01-restricted EBV LMP2-specific CTL epitope peptide.

[Detection of EBV EBNA1-specific CTL in healthy adult peripheral blood using MHC-tetramer reagent]
Subsequently, the inventors identified CTL epitopes restricted to EBV EBNA1-derived HLA-A * 11: 01. From the verification results obtained with the previous LMP2, 8.67% non-specific reaction was detected even in the negative control survivin-2B as shown in FIG. On the other hand, as shown in FIG. 7, it was revealed that there was almost no non-specific reaction in the detection of CTL using the MHC-tetramer reagent.

Since there has been no report of CTL epitopes derived from HLA-A * 11: 01-restricted EBV EBNA1 in the past, we decided to verify with the MHC-tetramer staining method with less nonspecific staining.

As shown in Table 5, as a result of the folding test, all 11 EBV EBNA1-specific CTL epitope candidate peptides showed HLA * 11: 01 binding properties. Therefore, the inventors prepared an MHC-tetramer reagent using 11 EBV EBNA1 CTL epitope candidate peptides in order to identify EBV EBNA1-specific CTL epitope peptides. We next examined whether EBNA1-specific CTL could be detected using healthy adult peripheral blood. The results are shown in FIGS. First, peripheral blood of five healthy adults (donor ID numbers: * 11-13, * 11-16, * 11-8, * 11-11, * 11-2) using three types of mixed peptides Was used to induce CTL. Two weeks later, detection was performed using three types of mixed MHC-tetramer reagents corresponding to the induction peptide. In FIG. 8, the X-axis is CD8, and the Y-axis is a dot plot developed by analyzing the fluorescence intensity for Tetramer on a log scale. The numerical value in the dot plot development diagram represents the ratio of the MHC-tetramer reagent positive cells in the CD8 positive cells in the living cells as a positive rate (%). As a result, in the donor * 11-8, the cell population derived from the three mixed peptides (HRG + GVF + KTS) was synthesized using each of the same three peptides and the three mixed MHC-tetramer reagents (HRG) -Tet + GVF-Tet + KTS-Tet), 0.38% positive cells were detected. In order to verify which peptide has specificity among the three types of peptides, in FIG. 9, detection was performed separately using each of the three types of MHC-tetramer reagents. As a result, when stained with HRG-Tet alone, HRG-Tet positive cells were detected with a positive rate of 0.42%. Since no positive cells were detected in Tet-GVF-Tet and KTS-Tet, HRG (SEQ ID NO: 26) is an EBV EBNA1-specific CTL epitope peptide showing HLA-A * 11: 01 restriction It has been shown.

[Confirmation of EBV EBNA1-specific CTL induction by quantification of intracellular IFNγ producing cells]
Intracellular IFNγ production is used as an indicator of the cytotoxic activity of CTL. In order to evaluate the functionality of CTL induced by the EBV EBNA1-specific CTL epitope peptide identified by the above MHC-tetramer reagent, the inventors performed intracellular IFNγ-producing cell quantification. The result is shown in FIG.

The upper part of FIG. 10 is a dot plot development view showing the fluorescence intensity for CD8 on the X-axis and IFNγ on the Y-axis on a log scale. Restimulation with the same peptide as that used for induction was performed to increase the IFNγ production ability. The verified result is shown. The ratio (%) of the number of IFNγ-positive cells in CD8-positive cells to PBMC in UR is shown as a numerical value. The lower part of FIG. 10 shows the result of staining with tetramer when the IFNγ production ability was verified. The X-axis is a dot plot development showing the fluorescence intensity for CD8 on the X-axis and the tetramer on the Y-axis on a log scale.

The HRG-induced CTLs were restimulated with HRG peptide or negative control survivin-2B peptide for 14 hours. As a result, CD8 positive IFNγ positive (producing) cells (re-stimulated: 0.08%; unstimulated: 0.06%) did not appear when restimulated with the negative control survivin-2B and when unstimulated. In restimulation with HRG (SEQ ID NO: 26) peptide, 0.68% of CD8 positive IFNγ positive (producing) cells appeared in UR (0.98% CD8 positive tetramer positive cells).

As described above, the HRG derived from EBV EBNA1 (SEQ ID NO: 26) identified in the present invention has a function of proliferating EBV EBNA1-specific CTL in peripheral blood, and these cell populations have cytotoxic activity and Since it was detectable with HRG-Tet, it was revealed that it is an HLA-A * 11: 01-restricted EBV EBNA1-specific CTL epitope peptide.

[Study on the importance of amino acids at N-terminal and C-terminal of ASS (10mer) sequence]
The CTL epitope peptide presented on the HLA class I molecule consists of 8 to 10 amino acids, and the 2nd, 9th and 10th amino acids from the N-terminal side are the most important for binding to the HLA class I molecule. It is an amino acid and is called an anchor motif. As a peptide that binds to the HLA-A11 molecule, either Ile, Met, Ser, Thr, or Val is arranged at the second position from the N-terminus, and either Lys or Arg is located at the ninth or tenth position. Peptides consisting of 9 to 10 amino acids are best known (Chang CX, Tan AT, Or MY, Toh KY, Lim PY, Chia AS, Froesig TM, Nadua KD, Oh HL, Leong HN, Hadrup SR, Gehring AJ, Tan YJ, Bertoletti A, Grotenbreg GM.Conditional ligands for Asian HLA variants facilitate the definition of CD8 + T-cell responses in acute and chronic viral diseases.Eur J Immunol. 2013 Apr; 43 (4): 1109-20. The HLA-A * 11: 01-restricted EBV LMP2-specific CTL epitope peptide ASS (10mer) provided by the present invention consists of 10 amino acids, Ala Ser Ser Tyr Ala Ala Ala Gln Arg Lys (SEQ ID NO: 1). It has Ser as the anchor motif, 2nd and 3rd from the N-terminal side, 9th Arg, and 10th Lys. Therefore, for the purpose of clarifying the embodiment of the present invention, a peptide in which one amino acid residue was deleted from the N-terminal side or the C-terminal was synthesized and verified. The amino acid sequence of SEQ ID NO: 6 from which N-terminal Ala has been deleted is Ser Ser Tyr Ala Ala Ala Gln Arg Lys, and the amino acid sequence of SEQ ID NO: 5 from which C-terminal Lys has been deleted is Ala Ser Ser Tyr Ala Ala Ala Gln Arg. The results of comparative experiments using these are shown in FIGS.

Ala Ser Ser Tyr Ala Ala Ala Gln Arg Lys ASS (10mer) SEQ ID NO: 1
Ala Ser Ser Tyr Ala Ala Ala Gln Arg ASS (9mer) SEQ ID NO: 5
Ser Ser Tyr Ala Ala Ala Gln Arg Lys SSY SEQ ID NO: 6

In FIG. 11, a folding test was conducted to examine the ability to form a complex with HLA-A * 11: 01. As a result, according to the results of the 7-day folding test, the MHC-monomer formation rate is ASS (9mer) (337,803 μV * second), SSY (294,932 μV * second), ASS (10mer) (238,655 μV * second) in descending order. However, in any of the sequences, the ability to form MHC-monomer was confirmed by comparison with the peptide of the negative control (83,587 μV * sec).

In the experiment of FIG. 12, a CTL induction experiment was performed using three types of peptides by the above-described induction method without using antigen-presenting cells. 14 days after induction, specific CTLs were detected using three types of MHC-tetramer reagents. In the upper part of FIG. 12, CTL was induced using ASS (10mer), and this was stained using ASS (10mer) -Tet, ASS (9mer) -Tet, and SSY-Tet. As a result, 53.31% ASS (10mer) -Tet positive CD8 positive specific CTL was detected when stained with ASS (10mer) -Tet, but ASS (9mer) -Tet or SSY-Tet positive CD8 positive was detected. Specific CTLs were not detected (upper middle and upper left). In the upper cell population, although 53.31% of ASS (10mer) -Tet positive CD8 positive cell population exists, these cell populations cannot be detected by ASS (9mer) -Tet or SSY-Tet. The ASS (10mer) -Tet positive CD8 positive cell population was found to be unable to recognize ASS (9mer) and SSY presented in the HLA-A * 11: 01 molecule. A similar experiment was performed on cell populations in which CTL was induced with ASS (9mer) and SSY peptides, but all cell populations were reactive to ASS (10mer) -Tet, ASS (9mer) -Tet, and SSY-Tet. No cell population showing was detected (middle and lower). As shown in FIG. 11, although both ASS (9mer) and SSY peptides have the ability to bind to HLA-A * 11: 01 molecules, they are EBV LMP2-specific CTL precursors ( ASS (10mer) means that there is no ability to stimulate proliferation of effector / memory cells) and CTL induction even if either Ala residue on the N-terminal side or Lys residue on the C-terminal side is deleted And CTL detectability disappeared.

In FIG. 13, IFNγ production ability is detected when restimulated with the same peptide as the peptide used for induction in the cell population induced by CTL using each peptide of ASS (10mer), ASS (9mer), and SSY. The results were shown. 40.52% of ATV-Tet positive cells are present in the cell population induced using HLA-A * 11: 01 restricted epitope peptide (ATVQGQNLK, SEQ ID NO: 34) derived from CMV pp65 protein, which is a peptide for positive control, 28% of cells produced IFNγ upon restimulation with ATV peptide.

On the other hand, in the case of survivin-2B HLA-A * 24: 02 restricted epitope peptide (AYACNTSTL, SEQ ID NO: 35) used as a negative control peptide, 0.17% of AYA-Tet positive cells were detected. The cell population is not detected as a clear spot and is considered to be a non-specific reaction. In addition, 8.67% of IFNγ-positive cells were detected by restimulation with AYA peptide, which is a level of non-specific staining that is common in intracellular IFNγ staining. The cell population induced by using the EBV LMP2-derived HLA-A * 11: 01-restricted ASS (10mer) identified in the present invention has 53.31% ASS (10mer) -Tet-specific CTL, and the ASS (10mer) 68% of the cell population produced IFNγ by restimulation. In contrast, in the case of SSY lacking the N-terminal Ala residue, no SSY-Tet positive cells were detected, and IFNγ production was also lower than that of the negative control. From this, even if it is a peptide having an amino acid corresponding to an anchor motif and also forms an MHC-monomer, it cannot always specifically induce CTL as an epitope peptide. It has been shown that an epitope peptide capable of inducing CTL cannot be easily conceived.

[From amino acid mutation of CTL epitope due to EBV strain diversity to peptide cocktail therapy]
(Amino acid mutation of CTL epitope of ASS (10mer) between EBV strains)
Amino acid mutations in the CTL epitope resulting from the diversity of EBV strains cause a decrease in immune response and immune escape, which is a potential problem for immunotherapy using CTL epitopes. In order to solve this problem, peptide cocktail therapy in which a plurality of CTL epitopes are mixed has been proposed. This can be said to be a solution that expects that if one type of epitope is used and if it is immune unresponsive due to mutation or the like, it can be supplemented with another epitope. This solution includes a method using a plurality of CTL epitopes for one type of HLA and a method using each CTL epitope for a plurality of HLA types. is there. For example, when the subject patient holds HLA-A2 and HLA-A11, it is desirable that a plurality of HLA-restricted CTL epitopes are selected for treatment. This is one of the problems to be solved by the present invention.

As mentioned above, it has been clarified by surveys of several research groups so far that NPC patients have the largest number of HLA-A11 holders. However, only one SSC has been reported so far for the HLA-A11 restricted CTL epitopes of LMP2 and EBNA1.

The inventors investigated amino acid mutations between strains of HLA-A * 11: 01-restricted LMP2-derived CTL epitope ASS (10mer) and HLA-A * 11: 01-restricted EBNA1-derived CTL epitope HRG The results are shown in FIG. The new epitope ASS (10mer) is GD2 (from Guangdong, China) and HKNPC1 (from a Hong Kong NPC patient), with the second and fourth Tyr residues mutated to Asn and Ser residues, respectively. (S2N Y4S) was found. Furthermore, the novel epitope HRG was found to be mutated in two strains. In AG876 (from West Africa type 2), the 4th Gln residue is mutated to Glu residue, the 8th Asn residue is mutated to Ser residue, and the 9th Pro residue is mutated to Gln residue. In Mutu (from Asia), the 9th Pro residue is mutated to a Gln residue.

[Sequence of ASS (10mer) CTL epitope in each sample]
In order to examine in detail the mutations of the CTL epitope of ASS (10mer) newly identified in the present invention, the inventors used 5 donors (* 11-2, * 11-8, * 11-11) used in the present invention. , * 11-13, * 11-16), EBV LMP2-derived DNA sequences including ASS (10mer) were analyzed. Primers for DNA sequence analysis are designed within LMP2 Exon 2 and the amplified gene product is 292 bp.
5'primer: TTGCTCTATTCACCCTTACT (SEQ ID NO: 50)
3'primer: ATGCATTGTAAATGGTGCGT (SEQ ID NO: 51)

EBV genomic DNA was extracted from PBMC of 5 donors or B95.8 cell line (ATCC) using GeneJET Viral DNA and RNA Purification Kit (Thermo scientific). Using this as a template and the above primers, the Exon 2 fragment was amplified by PCR reaction and cloned using TOPO (registered trademark) TA cloning Kit (Life technologies). Three clones were selected from each specimen and sequence analysis was performed. The results of the sequence are shown in FIG. In FIG. 15, the mutation positions of ASSYAAAQRK (SEQ ID NO: 1) (base sequence: GCCAGCTCATATGCCGCTGCACAAAGGAAA (SEQ ID NO: 48), GCCAGCTCATATGCCGCTGCACAGAGGAAA (SEQ ID NO: 49)) observed between EBV strains are shown in close-up. Table 6 shows the ASS (10mer) sequence results. Compared to B95.8, donor * 11-11 in the DNA sequence, but was seen (CA G from CAA) single base substitution was not an amino acid substitution. The other 4 individuals had the same sequence as B95.8. From these results, five Japanese donors used in the present invention were infected with the most widely distributed B95.8 strain, and mutations in the ASS (10mer) CTL epitope could not be detected. Based on the results of the above sequence, the inventors examined the influence of ASS (10mer) CTL epitope mutations on CTL inducibility, which is observed among EBV strains. Synthesized peptides ASS (10mer) (SEQ ID NO: 1), ANS (S2N) (SEQ ID NO: 2), ASS (Y4S) (SEQ ID NO: 3), ANS (S2N; Y4S) (SEQ ID NO: 4) and negative CTL induction was performed using survivin-2B as a control peptide and PBMC of donor * 11-11. The result is shown in FIG. In the induction using ASS (10mer), 27.63% of ASS (10mer) -Tet positive cells were detected, but CTL induction was not observed in each mutant peptide. This is probably because donor * 11-11 was infected with B95.8 strain from EBV LMP2 sequence analysis and ASS (10mer) showed no amino acid mutation. Even if ANS (S2N) (SEQ ID NO: 2), ASS (Y4S) (SEQ ID NO: 3) and ANS (S2N; Y4S) of GD2 and HKNPC1 strains were used for B95.8 strain infected individuals Since CTL could not be induced, it became clear that S2N and Y4S mutations are important mutations for TCR recognition. Therefore, when inducing EBV-specific CTL, it is important to examine whether there is a mutation in the ASS (10mer) region beforehand. If there is a mutation, ANS (S2N), ASS (Y4S), ANS It is considered preferable to use (S2N; Y4S).

[Difference in CTL inducibility and TCR binding by mutation of ASS (10mer) CTL epitope]
In order to investigate in detail the effects of S2N and Y4S mutations on TCR binding ability, the inventors used three mutant peptide sequences, ANS (S2N) -Tet, ASS (Y4S) -Tet, ANS (S2N , Y4S) -Tet MHC tetramer reagents were prepared. Tetramer staining for HLA-A * 11: 01-restricted EBV LMP2-specific CTL derived from PBMC was performed using the ASS (10mer) epitope peptide provided in the present invention (SEQ ID NO: 1). The results are shown in FIG.

Since HLA-A * 11: 01-restricted EBV LMP2 ASS (10mer) -specific CTL was detected by ANS (S2N) -Tet as shown in FIG. 17, ANS (S2N) -Tet was detected by ASS (10mer ) -Tet cross-reactivity was maintained (26.87% vs. 27.63%), but ASS (Y4S) -Tet could hardly detect positive cells and lost its binding to TCR ( 0.49%). ASN (S2N, Y4S) -Tet retained some ability to bind to TCR (5.93%). This is thought to be due to the degree of change in hydrophobicity / hydrophilicity of amino acids and the difference in the side chain configuration due to both substitution of S2N and Y4S and substitution of Y4S alone. For these two amino acid mutations, there was no single substitution between EBV strains, and only co-substitution was observed (GD2, HKNPC1). However, it should be noted that the ASS (10mer) mutation provided in the present invention is found only in the GD2 and HKNPC1 strains. From this fact, it is considered that this epitope is functionally complementary, that is, it is possible to avoid a decrease in immune response due to amino acid mutation caused by the difference between GD2 strain and HKNPC1 strain and other infected EBV strains when both are used in combination.

In addition, the novel epitope HRG derived from HLA-A * 11: 01-restricted EBV EBNA1 (SEQ ID NO: 26) includes HRG derived from AG876 strain (Q4E, N8S, P9Q) and HRG derived from Mutu strain (P9Q). Thus, as shown in FIG. 3, it has binding ability to HLA-A * 11: 01, and each MHC-tetramer reagent was successfully synthesized. By conducting the same verification as ASS (10mer), the difference in induction efficiency will be clarified for each infected strain.

[Large-scale culture of CTL using culture bags]
The present invention has succeeded in identifying a novel CTL epitope specific to EBV LMP2 or EBV EBNA1, and can realize antigen-specific cytotoxic T cell therapy (CTL therapy) targeting HLA-A11 carriers. It was. CTL therapy is expected as a next generation immunotherapy. However, in order to prepare antigen-specific CTLs in vitro, complicated and complicated operations are involved, so it has been necessary to rely on an open culture system. For this reason, facilities that maintain a clean environment of class 100 level within a medical grade cultured cell processing center (CPC) had to be maintained and managed, which required a great deal of money.

In addition, since various cytokines are used in the conventional method, the cost required for preparation becomes considerable. In addition, culture in an open system carries a safety risk, although it is prepared in a facility maintained at class 100 level. As described above, in the conventional antigen-specific CTL preparation method, operability, economy, and safety greatly hinder practical application, and can be performed only in a limited facility. In order to solve the above problems, the inventors studied a method for mass-culturing CTL, and examined an EBV-specific CTL culture system that has both simplicity and safety and can be carried out at low cost. Using a commercially available gas-permeable culture bag, we succeeded in culturing EBV LMP2-specific CTL in a large amount in just 3 weeks.

FIG. 18 shows the result of observing cells during the culture period with a microscope. PBMCs stimulated with anti-CD3 antibody were observed to activate T cell masses on day 7 and PBMCs stimulated with peptide on day 14; one week after starting mixed culture (day 21), activated T cell masses Further growth was shown.

As mentioned above, the use of mixed peptides is one of the solutions for enhancing the effectiveness of cancer immunotherapy. In this example, four types of peptides, the newly identified CTL epitope ASS (10mer) (SEQ ID NO: 1) and its mutant sequence ASN (S2N) (SEQ ID NO: 2) were confused and CTL mass culture was performed. The results are shown in FIGS.

FIG. 19 shows the total number of cells during the culture period and the number of CTLs proliferated by induction of four types of peptides. The CTL number was calculated from the tetramer staining result of FIG. FIG. 19 is a dot plot development view showing the fluorescence intensity for CD8 on the X axis and the tetramer on the Y axis on a log scale, and was stained with a tetramer of the same peptide as that used for induction. The numerical value in the dot plot development diagram represents the ratio of the MHC-tetramer reagent positive cells in the CD8 positive cells in the living cells as a positive rate (%).

For ASS (10mer) and ANS (S2N), the number of MHC-tetramer reagent positive cells in the separated PBMCs before mass culture was only 0.04% or less, but from day 7 to day 24 when positive cells were detected. In the meantime, ASS (10mer) increased from about 1.3 × 10 ³ to 2.3 × 10 ⁵ , and ANS increased from about 3.2 × 10 ³ to 3.1 × 10 ⁵ about 100 times. Thereby, the effectiveness of the peptide cocktail therapy using the novel CTL epitope peptide was shown. Furthermore, the success in mass proliferation of CTLs using novel CTL epitope peptides is indicated by clinical utility.

The above culture system examined by the inventors is characterized in that it is performed in a closed system instead of a conventional open system. Therefore, it is considered that operability, economy and safety in preparation of antigen-specific CTL can be realized, and the practical use of CTL therapy can be promoted.

In previous clinical trials of cancer immunotherapy, there were many cases in which one epitope was used for one type of HLA type, but although effectiveness was confirmed, individual differences cannot be denied. As mentioned above, cocktail peptide therapy is one solution. However, only one EBV LMP2 antigen-specific and EBNA1 antigen-specific HLA-A11 restricted epitope peptide has been identified so far. It should be pointed out that the reduced immune response that can be caused by amino acid mutations between EBV strains is a potential clinical problem. As this problem cannot be overlooked, and as a result of intensive studies in the present invention, new epitopes ASS (10mer) (SEQ ID NO: 1) and HRG (SEQ ID NO: 26) were identified. This novel CTL epitope is expected to greatly contribute to the treatment of EBV-related cancers and immunodeficiencies, especially NPCs with many HLA-A11 patients.

[Vaccine injection]
Each peptide of SEQ ID NO: 1 was dissolved in DMSO to a final concentration of 20 mg / ml, and sterilized by filtration. The obtained peptide-containing solution was dispensed and sealed in 1 mL sterilized vials to obtain a vaccine injection.

[Example 2]
(Prediction of CKAP4-specific HLA-A * 24: 02 restricted epitope peptide)
CKAP4 is a type II membrane protein composed of 602 amino acids in total length, and no isoform has been reported. Selection of CKAP4-specific CTL epitope candidate peptides of the present invention was performed against HLA-A * 24: 02 possessed by about 60% of Japanese. Specifically, we collated with multiple software published on the Internet that can search for CTL epitope candidate peptides consisting of 8 to 12 amino acids having a binding motif for HLA-A * 24: 02. Carried out. As a result, ten types of CTL epitope candidate peptides consisting of 9 to 10 amino acids having a binding motif of HLA-A * 24: 02 were selected from the amino acid sequence of CKAP4 and synthesized. The synthesized CTL epitope candidate peptides are shown below.

Synthesized HLA-A * 24: 02-binding CKAP4-specific CTL epitope candidate peptide
Arg Leu Gly Arg Ala Leu Asn Phe Leu Phe (SEQ ID NO: 36)
Phe Tyr Leu Ala Leu Val Ala Ala Ala Ala (SEQ ID NO: 37)
Tyr Leu Ala Leu Val Ala Ala Ala Ala Phe (SEQ ID NO: 38)
Asp Phe Ser Arg Gln Arg Glu Glu Leu (SEQ ID NO: 39)
Lys Val Gln Ser Leu Gln Ala Thr Phe (SEQ ID NO: 40)
Ser Leu Gln Ala Thr Phe Gly Thr Phe (SEQ ID NO: 41)
Thr Phe Gly Thr Phe Glu Ser Ile Leu (SEQ ID NO: 42)
Ile Tyr Thr Glu Val Arg Glu Leu Val (SEQ ID NO: 43)
Lys Val Gln Glu Gln Val His Thr Leu Leu (SEQ ID NO: 44)
Asp Phe Leu Asp Arg Leu Ser Ser Leu (SEQ ID NO: 45)

Table 7 shows the characteristics of the synthesized HLA-A * 24: 02-binding CKAP4-specific CTL epitope candidate peptides. Three or four amino acid sequences from the N-terminal side of the synthesized CKAP4-specific CTL epitope candidate peptide are abbreviated as peptide names. From left, peptide name, amino acid sequence, position on CKAP4 amino acid sequence, number of amino acids, HLASPeptide of BIMAS (BioInformatics & Molecular Analysis Section / http://thr.cit.nih.gov/index.shtml) used for analysis The score calculated by Binding Predictions (http://thr.cit.nih.gov/molbio/hla_bind/) is shown. This score is a numerical value that predicts the affinity between HLA-A * 24: 02 and the peptide. The higher the score, the more likely the HLA molecule and peptide may form a stable complex. In addition to the analysis software BIMAS described in Table 7, the inventors selected 10 types (SEQ ID NOs: 36 to 45) of CTL epitope candidate peptides using analysis software such as SYFPEITHI, Rankpep, IEDB Bind prediction, and NetCTL.

[Folding test of CKAP4-specific CTL epitope candidate peptide]
The inventor conducted a folding test using ten types of artificially synthesized CKAP4-specific CTL epitope candidate peptides. Specifically, HLA-A * 24: 02 expressed and purified using an E. coli expression system, β2-microglobulin, and CKAP4-specific CTL epitope candidate peptide are added to the folding solution, mixed, and then folded over time. The solution was collected and analyzed with a gel filtration column. When gel filtration column analysis shows formation of a ternary complex (MHC-monomer) of HLA-A * 24: 02, β2-microglobulin, and CKAP4-specific CTL epitope candidate peptide, MHC-monomer Since the molecular weight is large, the elution time in the gel filtration column analysis is shortened. Further, the amount of MHC-monomer formation can be calculated from the peak area obtained by the absorption wavelength of 280 nm. On the other hand, MHC-monomer formation is not confirmed with candidate peptides that do not bind to HLA molecules. A typical gel filtration column analysis example in which MHC-monomer formation is observed is shown in FIG.

HLA molecules and β2-microglobulin are purified as inclusion bodies, which are insoluble fractions, and are solubilized with 8M urea when purified using the E. coli expression system. As for HLA molecules that are hardly soluble, those that do not lead to MHC-monomer formation are detected as aggregates in 7 to 8 minutes. However, most of the aggregates are removed by filter filtration before gel filtration column analysis. β2-microglobulin is a soluble protein that is solubilized in the folding solution and detected around 14 minutes. After 15 minutes, the folding solution composition and peptide are detected. The peak of MHC-monomer is not confirmed immediately after the start of the folding test (day 0), but the peak increases after 1 day (day 1) and 3 days (day （3), and MHC-monomer formation is progressing smoothly. Shows things.

FIG. 22 shows the analysis results after 4 days of the folding test performed on 10 kinds of CKAP4-specific CTL epitope candidate peptides. At the same time, a positive control peptide consisting of 9 amino acids (SEQ ID NO: 46) and a negative control (SEQ ID NO: 47) were used for comparison.

Control peptide used for folding test Ala Tyr Ala Cys Asn Thr Ser Thr Leu (SEQ ID NO: 46)
Ser Ser Tyr Arg Arg Pro Val Gly Ile (SEQ ID NO: 47)

The graph shows the peak area indicating MHC-monomer formation as a bar graph. As a result of comparing SEQ ID NOS: 36 to 45 with a positive control peptide and a negative control (79,031 μV * sec), SEQ ID NOS: 36, 40, 42 and 43 showed good MHC-monomer formation, and the subsequent analysis was advanced. .

[Production of CKAP4-specific MHC-tetramer reagent]
Based on the results of the folding test, PE (phycoerythrin) -labeled MHC-tetramer using CKAP4-specific CTL epitope candidate peptides of SEQ ID NOs: 36, 40, 42 and 43, HLA-A * 24: 02, and β2-microglobulin Reagents were manufactured. The MHC-tetramer reagent produced in the present invention is abbreviated as, for example, KVQE-Tet. It shows what was manufactured using the person complex. MHC-monomer, a complex of HLA class I molecule purified from a recombinant host for protein expression, β2-microglobulin, and a CKAP4-specific CTL epitope candidate peptide of the present invention is formed in an appropriate folding solution. A biotin binding site is added to the C-terminus of the recombinant HLA class I molecule in advance, and biotin is added to this site after MHC-monomer formation. A MHC-tetramer reagent can be prepared by mixing commercially available dye-labeled streptavidin and biotinylated MHC-monomer at a molar ratio of 1: 4.

[Identification of CKAP4-specific CTL epitope peptide]
(Selection of HLA type of specimen)
Ten candidate peptides having a binding motif for HLA-A * 24: 02 were selected as CKAP4-specific CTL epitope candidate peptides. Furthermore, by a folding test, HLA-A * 24: 02, β2-microglobulin and 4 types of CKAP4-specific CTL epitope candidate peptides (SEQ ID NOs: 36, 40, 42, 43) were bound in vitro to bind MHC-monomer. It was found to form well. In order to confirm whether these four types of CKAP4-specific CTL epitope candidate peptides actually bind to HLA-A * 24: 02 and CTLs that recognize them are present in vivo, HLA-A * 24 It is desirable to verify using the peripheral blood of the donor who holds: 02. First, whether or not a donor has HLA-A * 24: 02 was confirmed by genotyping of HLA-A using Genosearch (trademark) HLA-A Ver.2 (MBL). Subsequent examinations were performed using PBMCs of 7 healthy adults with HLA-A * 24: 02.

[Induction of CKAP4-specific CTL]
[Induction of CKAP4-specific CTL using MLPC (Mixed Lymphocyte-Peptide Cultures) method]
The MLPC method is a method of inducing CTL by adding a peptide to a PBMC culture solution (Karanikas V, Lurquin C, Colau D, van Baren N, De Smet C, Lethe B, Connerotte T, Corbiere V, Demoitie MA , Lienard D, Dreno B, Velu T, Boon T, Coulie PG.Monoclonal anti-MAGE-3 CTL responses in melanoma patients displaying tumor regression after vaccination with a recombinant canarypox virus.J Immunol. 2003; 171 (9): 4898- 904, Tsukahara T, Kawaguchi S, Torigoe T, Takahashi A, Murase M, Kano M, Wada T, Kaya M, Nagoya S, Yamashita T, Sato N. HLA-A * 0201-restricted CTL epitope of a novel osteosarcoma antigen, papillomavirus binding factor. J Transl Med. 2009; 7: 44). Peptides are presented to antigen-presenting cells present in PBMC, such as dendritic cells, B cells, macrophages, and certain T cells, and memory-type CTLs contained in PBMC are thought to proliferate upon stimulation. Peripheral blood collected from healthy adults carrying HLA-A * 24: 02 was centrifuged at 3,000 rpm for 5-10 minutes, and the plasma portion of the supernatant was collected. Except for the plasma portion, PBMCs were separated by the conventional density gradient centrifugation method. In the present invention, good results were obtained using a medium supplemented with 5% plasma. The medium is generally supplemented with appropriate additives and antibiotics for the medium used for cell culture. As the CTL induction medium used in the present invention, a medium in which RPMI1640 Hepes modify (Sigam) was added with 2-mercaptoethanol, L-glutamine, and streptomycin and penicillin as antibiotics was used. In addition, insulin, transferrin, selenious acid, pyruvic acid, human serum albumin, a non-essential amino acid solution, and the like can be added. About 3 × 10 ⁷ PBMCs were suspended in 10 mL of medium. One or two of the four types of CKAP4-specific CTL epitope candidate peptides (SEQ ID NOs: 36, 40, 42, and 43) were added at a concentration of 10 μg / mL. The concentration of the peptide can be varied depending on the solubility of the peptide. In the present invention, it was carried out at 10 μg / mL. For the mixed culture of PBMC and peptide, a 96-well U-bottom cell culture microtest plate (BECTON DICKINSON) was used. The cells were cultured in a 37 ° C., 5% CO ₂ constant temperature bath. Two days later, IL-2 was added at a final concentration of 20-100 U / mL. Thereafter, the IL-2 added CTL induction medium was appropriately replaced. Confirmation of CKAP4-specific CTL was carried out within 2 weeks of culture. When induction of CKAP4-specific CTL was confirmed, stimulation with peptide pulse antigen-presenting cells or direct stimulation with a peptide was attempted to establish a CTL line.

[Confirmation of CKAP4-specific CTL]
Whether or not CKAP4-specific CTL is present in the cell population cultured by the above-described method was examined by the MHC-tetramer method. After culturing, 10 μL of PE-labeled MHC-tetramer reagent, 20 μL of FITC (fluorescein isothiocyanate) -labeled T cell surface antibody (eg, CD8, CD4, CD3) and the like were added to an appropriate amount of cells. Furthermore, a CD45 antibody labeled with PC5 (phycoerythrin-Cy5) or the like may be added in order to exclude non-specific fluorescence due to contaminated erythrocytes. Thereafter, the mixture was gently mixed and allowed to stand at 2-8 ° C. for 60 minutes or at room temperature for 30 minutes. After adding 1.5 mL of PBS and stirring, the mixture was centrifuged at 3,000 rpm for 5 minutes. After discarding the supernatant, the cells were resuspended in 400 μL of PBS. At this time, 7-AAD viability dye (dead cell detection reagent, MBL) may be added in order to exclude non-specific fluorescence due to dead cells. The analysis was performed with a flow cytometer within 24 hours.

Confirmation of CKAP4-specific CTL was performed in two stages. The first step is to collect some of the cells from each of the 8 wells in a 96-well U-bottom cell culture microtest plate and pool them as one sample (lane pool) to check for the induction of CKAP4-specific CTL. This was confirmed by the MHC-tetramer method. In the second stage, cells in each well were individually collected in the lane pool in which the induction of CKAP4-specific CTL was confirmed in the first stage, and the presence or absence of induction of CKAP4-specific CTL was confirmed by the MHC-tetramer method. By using such a method, it was confirmed in which well of the 96-well U-bottom cell culture microtest plate that CKAP4-specific CTL was induced.

FIG. 23 and FIG. 25 show typical results of confirmation at the first stage after induction of CKAP4-specific CTL by MLPC method. PBMCs of specimen numbers A24-37 (FIG. 23) and A24-39 (FIG. 25) were cultured with SEQ ID NO: 43 of a CKAP4-specific CTL epitope candidate peptide for 14 days. The numbers in the dot plot development diagram are (UR + LR) for the area obtained by dividing the development quadrant into UL (upper left), UR (upper right), LL (lower left), and LR (lower right). Shows the percentage of UR. The X-axis is CD8, and the Y-axis is a dot plot development view showing the fluorescence intensity for the MHC-tetramer reagent on a log scale. IYT-Tet confirmed the induction of the specific CTL of SEQ ID NO: 43. Species number A24-37 was lane 7, A24-39 was lane 11 UR, CD8 positive IYT-Tet positive cells A population was detected. This indicates that SEQ ID NO: 43 is a CKAP4-specific CTL epitope peptide and memory type CKAP4-specific CTL was present in the peripheral blood of specimens A24-37 and A24-39. FIG. 24 and FIG. 26 show the results of the second step in which the CTL specific for SEQ ID NO: 43 was induced by MLPC method and detected by MHC-tetramer method. FIG. 23 and FIG. 25 show the results of confirming the presence or absence of induction of CKAP4-specific CTL in each well by MHC-tetramer method in each lane where the induction of CKAP4-specific CTL was confirmed. As a result, the sample number A24-37 lane 7 G well (7-G) shown in FIG. 24 and the sample number A24-39 lane 11 B well (11-B) shown in FIG. CTL was detected. These facts prove that SEQ ID NO: 43 is a CKAP4-specific CTL epitope peptide exhibiting HLA-A * 24: 02 restriction. In specimen numbers A24-37 and A24-39, SEQ ID NO: 43-specific CTL was detected in 1 of 96 wells, respectively. Therefore, the abundance ratio of SEQ ID NO: 43-specific CTL in peripheral blood PBMC was It is calculated by the following formula.

Sample No. A24-37 SEQ ID NO: 43 Frequency of specific CTL
= (Number of MHC-tetramer reagent positive wells) / (number of PBMCs used in experiment x CD8 positive rate before induction)
= 1 / (3 × 10 ⁷ × 0.311)
= 1.07 × 10 ^-7

SEQ ID NO: 43 of specimen No. A24-39 Frequency of specific CTL
= 1 / (3 × 10 ⁷ × 0.155)
= 2.15 × 10 ^-7

The limit of detection of specific CTLs by the 96-well MLPC method is usually 1.6 to 3.3 × 10 ⁻⁷ assuming that the CD8 positive cell rate before induction is 10 to 20%. In other words, in the 96-well MLPC method in this case, the standard ratio of specific CTL detected is 1 per 3-6 × 10 ⁶ CD8 positive cells.

Furthermore, the present invention was carried out in the same manner for 7 blood donors using SEQ ID NOs: 36, 40, 42, and 43 as shown in Table 8, but specific CTLs were detected except for SEQ ID NO: 43. I couldn't. Even with SEQ ID NO: 43, only 2 out of 7 were detected. This indicates that it is difficult to predict a CKAP4-specific HLA-A * 24: 02-restricted epitope peptide, and it is more difficult to predict whether the epitope peptide has the ability to induce specific CTLs. ing.

(Preparation of antigen-presenting cells)
Preparation of EBV-infected B cell lines (Kuzushima K, Yamamoto M, Kimura H, Ando Y, Kudo T, Tsuge I, Morishima T. Establishment of anti-Epstein-Barr virus (EBV) cellular immunity by adoptive transfer of virus-specific cytotoxic T lymphocytes from an HLA-matched sibling to a patient with severe chronic active EBV infection. Clin Exp Immunol. 1996; 103: 192-198), B95-8 cells (obtained from JCRB Cell Bank) The culture supernatant (including live EBV virus) and PBMC were mixed and cultured to establish an EBV-infected B cell line (hereinafter referred to as EBV-infected LCL).

[Amplification of specific CTL using antigen-presenting cells]
Suspend the antigen-presenting cells (EBV-infected LCL) in pulse medium (0.5% human serum albumin / RPMI1640) or AIM-V medium (Invitrogen), and add CTL epitope candidate peptide at a concentration of 10 μg / mL The mixture was allowed to stand at room temperature for 30 to 60 minutes with gentle mixing at intervals of approximately 15 minutes, and then washed three times with an excessive amount of pulse medium to wash away unbound peptides to HLA molecules. By performing this operation, it is considered that the CTL epitope candidate peptide binds to the HLA molecule on the antigen-presenting cell. The antigen-presenting cell subjected to this operation is called a peptide pulse antigen-presenting cell. Peptide pulse antigen-presenting cells were treated with a lethal dose of X-rays or mitomycin to lose their ability to grow. This was mixed with a cell population containing CKAP4-specific CTL derived from the same person and cultured in a 37 ° C., 5% CO ₂ constant temperature bath. As the medium to be used, RPMI1640 medium containing 10% fetal calf serum (FCS), RPMI1640 medium containing 10% human serum, or RPMI1640 medium containing 1-10% human plasma was examined. In this method, Good results were obtained with RPMI1640 medium containing 5% human plasma. IL-2 (Shionogi Pharmaceutical Co., Ltd.) was added at 50 U / mL for the purpose of maintaining the survival of T cells and assisting proliferation. Evaluation of CKAP4-specific CTL induction was performed 10 to 16 days after the start of the culture. When induction of CKAP4-specific CTL was confirmed, stimulation was further performed using peptide pulse antigen-presenting cells to establish a CTL line.

[Functional analysis of specific CTLs by quantification of intracellular IFNγ-producing cells]
About 1/10 to the total amount of the cell population containing CKAP4-specific CTL induced by the above method is transferred to a 96-well U-bottom cell culture microtest plate. Added in. Further, an intracellular protein transport inhibitor (for example, Brefeldin A, Monensin, etc.) was added, and the cells were cultured at 37 ° C. for 5 to 16 hours in a 5% CO ₂ constant temperature bath. After culturing, the cells were washed, PE-labeled MHC-tetramer reagent and PC5-labeled CD8 antibody (Beckman Coulter) were added, and left at room temperature for 15-30 minutes. After washing, it was fixed with 4% formaldehyde at 4 ° C. for 15 minutes, and then washed with an excessive amount of washing solution. After membrane permeabilization with 0.1% saponin, FITC-labeled anti-IFNγ antibody (manufactured by MBL) was added and allowed to react at room temperature for 15-30 minutes. After washing, the IFNγ positive cell rate in T cells or the IFNγ positive cell rate in MHC-tetramer reagent positive cells was quantified using a flow cytometer.

FIG. 27 shows the results of examination by an intracellular IFNγ producing cell quantification method of CKAP4-specific CTL induced. PBMC of specimen number A24-39 was stimulated with SEQ ID NO: 43, which is an HLA-A * 24: 02-restricted CKAP4-specific CTL epitope peptide. This shows the results of triple staining with PE-labeled MHC-tetramer reagent (MBL), PC5-labeled CD8 antibody, and FITC-labeled IFNγ antibody, and analysis using a flow cytometer. The numbers in the dot plot development diagram indicate the percentage of the living cells occupied by cells present in the quadrant. FIG. 27 shows that IFNγ-positive MHC-tetramer reagent-positive cells appear in UR only when stimulated with a specific peptide, and hardly appear when no peptide is added. However, the presence of IYT-Tet-specific CTLs in both the cell population with and without the peptide indicates that the fluorescence intensity for CD8 on the X axis and the MHC-tetramer reagent on the Y axis is log. It is clear from the dot plot development shown on the scale that the CD8 positive MHC-tetramer reagent positive cell population is seen in the UR.

From this result, CKAP4-specific CTL having cytotoxic activity to produce IFNγ was induced by restimulation in PBMC cultured with CKAP4-specific CTL epitope peptide, and these cells were stained with MHC-tetramer reagent. From this, it was revealed that the CTL was specific to the HLA-A * 24: 02-restricted CKAP4-derived peptide IYTEVRELV (SEQ ID NO: 43).

The present invention makes it possible to treat or prevent EBV infection and a virus-positive cancer using a cytotoxic T cell epitope peptide specific to Epstein-Barr virus. In addition, CTL specific for EBV can be quantified. Further, by using the HLA-A * 24: 02-restricted epitope peptide comprising the sequence of IYTEVRELV (SEQ ID NO: 43) of the present invention, it becomes possible to treat diseases dependent on malignant tumor cells that highly express CKAP4. .

Claims

Epitope peptide having cytotoxic T cell-inducing activity specific to Epstein-Barr virus (EBV), wherein the epitope peptide is SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 An epitope peptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 26, SEQ ID NO: 27, and SEQ ID NO: 28.
Epitope peptide having cytotoxic T cell-inducing activity specific to Epstein-Barr virus (EBV), wherein the epitope peptide is SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 In the amino acid sequence described in SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 26, SEQ ID NO: 27, or SEQ ID NO: 28, one or more amino acids are substituted, deleted, inserted, and Epitope peptide added / or added.
A nucleic acid encoding the epitope peptide according to any one of claims 1 to 2.
An expression vector comprising a nucleic acid encoding the epitope peptide according to any one of claims 1 to 2.
A vaccine for treating or preventing EBV infection or EBV-positive cancer comprising the epitope peptide according to any one of claims 1 and 2 as an active ingredient.
The vaccine according to claim 5, wherein the EBV is selected from AKata strain, GD1 strain, GD2 strain, HKNPC1 strain, AG876 strain, Mutu strain and B95.8 strain.
A vaccine for treating or preventing EBV infection or EBV positive cancer comprising the nucleic acid or expression vector according to any one of claims 3 to 4 as an active ingredient.
The vaccine according to claim 7, wherein the EBV is selected from AKata strain, GD1 strain, GD2 strain, HKNPC1 strain, AG876 strain, Mutu strain and B95.8 strain.
A vaccine for treating or preventing EBV infection or EBV virus-positive cancer comprising, as an active ingredient, an antigen-presenting cell presenting the epitope peptide according to any one of claims 1 and 2 on HLA.
The vaccine according to claim 9, wherein the EBV is selected from AKata strain, GD1 strain, GD2 strain, HKNPC1 strain, AG876 strain, Mutu strain and B95.8 strain.
3. An EBV-specific cytotoxic T cell obtained by stimulating peripheral blood lymphocytes with the epitope peptide according to claim 1 or the antigen-presenting cell presenting the epitope peptide on HLA. Passive immunotherapy agent.
A major histocompatibility is prepared by bringing a major histocompatibility antigen complex and / or a major histocompatibility antigen complex-tetramer prepared from the epitope peptide according to any one of claims 1 and 2 into contact with peripheral blood lymphocytes. Antigen complex and / or major histocompatibility antigen complex-passive against EBV, comprising cytotoxic T cells obtained by forming a conjugate in which a cytotoxic T cell is bound to a tetramer and isolated from the conjugate. Immunotherapy agent.
Stimulating peripheral blood from a subject with the epitope peptide according to claim 1 or 2,
EBV comprising the steps of obtaining EBV-specific cytotoxic T cells generated by the above steps, and measuring cytokines and / or chemokines and / or cell surface molecules produced by the obtained cytotoxic T cells. Specific cytotoxic T cell quantification method.
A step of mixing the epitope peptide according to any one of claims 1 to 2, a major histocompatibility antigen complex, and β2-microglobulin, and the prepared major histocompatibility antigen complex-tetramer and peripheral blood derived from a subject. A method for quantifying cytotoxic T cells specific to EBV in the peripheral blood, comprising a step of contacting.
A method of inducing cytotoxic T cells specific for EBV, comprising the step of bringing the epitope peptide according to any one of claims 1 and 2 into contact with an antigen-presenting cell.
A kit for inducing cytotoxic T cells comprising the epitope peptide according to any one of claims 1 and 2 as a constituent element.
A method for producing EBV-specific CTL comprising the step of contacting the peptide according to any one of claims 1 and 2 with peripheral blood mononuclear cells in a medium containing plasma.
CTL epitope peptide specific for CKAP4 consisting of the amino acid sequence set forth in SEQ ID NO: 43.
CTL epitope peptide specific to CKAP4, wherein one or more amino acids are substituted, deleted, inserted and / or added in the amino acid sequence set forth in SEQ ID NO: 43.
HLA-A * 24: 02 molecule-restricted antigen peptide that has a T cell receptor that specifically recognizes cells that present a complex with the HLA-A * 24: 02 molecule on the cell surface The epitope peptide according to claim 18 or 19, wherein the epitope peptide is induced.
A nucleic acid encoding the epitope peptide according to any one of claims 18 to 19.
An expression vector comprising a nucleic acid encoding the epitope peptide according to any one of claims 18 to 19.
A vaccine for treating or preventing cancer, comprising the epitope peptide according to any one of claims 18 to 19 as an active ingredient.
A vaccine for treating or preventing cancer comprising the nucleic acid or expression vector according to any one of claims 21 to 22 as an active ingredient.
A vaccine for treating or preventing cancer, comprising, as an active ingredient, antigen-presenting cells presenting the epitope peptide according to any one of claims 18 to 19 on HLA.
A cancer treatment comprising, as an active ingredient, the epitope peptide according to any one of claims 18 to 19 or a CKAP4-specific CTL obtained by stimulating peripheral blood lymphocytes with an antigen-presenting cell presenting the epitope peptide on HLA Passive immunotherapy agent for.
A major histocompatibility is prepared by bringing a major histocompatibility antigen complex and / or a major histocompatibility antigen complex-tetramer prepared from the epitope peptide according to any one of claims 18 to 19 into contact with peripheral blood lymphocytes. Antigen complex and / or major histocompatibility antigen complex-passive immunization for cancer treatment comprising as an active ingredient CTL obtained by forming a conjugate in which CTL is bound to a tetramer Therapeutic agent.
Stimulating peripheral blood from a subject with the epitope peptide according to any of claims 18 to 19,
Obtaining CTL specific for CKAP4 produced by the step, and measuring cytokine and / or chemokine and / or cell surface molecule produced by the obtained CTL,
A method for quantifying CTL specific for CKAP4.
A step of preparing a major histocompatibility antigen complex-tetramer from the epitope peptide according to any one of claims 18 to 19, and a step of bringing the major histocompatibility antigen complex-tetramer into contact with peripheral blood from a subject. A method for quantifying CTL specific for CKAP4 in the peripheral blood.
A method for inducing CKAP4-specific CTL, comprising a step of contacting the epitope peptide according to any one of claims 18 to 19 with a peripheral blood mononuclear cell derived from a subject.
A method for treating cancer, comprising a step of stimulating peripheral blood lymphocytes with the epitope peptide according to any one of claims 18 to 19 or an antigen-presenting cell presenting the epitope peptide on HLA to obtain CKAP4-specific CTL. For producing a passive immunotherapeutic agent.
A step of bringing a major histocompatibility antigen complex prepared from the epitope peptide according to any one of claims 18 to 19 and / or a major histocompatibility antigen complex-tetramer with peripheral blood lymphocytes;
Forming a major histocompatibility antigen complex and / or a major histocompatibility antigen complex-tetramer with a CTL-bound conjugate, and obtaining a CTL obtained by isolation from the conjugate. A method for producing a passive immunotherapeutic agent for cancer treatment.
An antibody specific for a major histocompatibility antigen complex prepared from the epitope peptide according to any one of claims 18 to 19.