WO2016202980A1 - Microparticules de polyphosphate de calcium amorphe, implants dentaires et compositions dentaires comprenant lesdites particules - Google Patents

Microparticules de polyphosphate de calcium amorphe, implants dentaires et compositions dentaires comprenant lesdites particules Download PDF

Info

Publication number
WO2016202980A1
WO2016202980A1 PCT/EP2016/064008 EP2016064008W WO2016202980A1 WO 2016202980 A1 WO2016202980 A1 WO 2016202980A1 EP 2016064008 W EP2016064008 W EP 2016064008W WO 2016202980 A1 WO2016202980 A1 WO 2016202980A1
Authority
WO
WIPO (PCT)
Prior art keywords
polyp
microparticles
polyphosphate
dental
enamel
Prior art date
Application number
PCT/EP2016/064008
Other languages
English (en)
Inventor
Werner Ernst Ludwig Georg MÜLLER
Original Assignee
Müller Werner Ernst Ludwig Georg
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Müller Werner Ernst Ludwig Georg filed Critical Müller Werner Ernst Ludwig Georg
Publication of WO2016202980A1 publication Critical patent/WO2016202980A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K6/00—Preparations for dentistry
    • A61K6/80—Preparations for artificial teeth, for filling teeth or for capping teeth
    • A61K6/831—Preparations for artificial teeth, for filling teeth or for capping teeth comprising non-metallic elements or compounds thereof, e.g. carbon
    • A61K6/838—Phosphorus compounds, e.g. apatite
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
    • A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
    • A61L27/02—Inorganic materials
    • A61L27/12—Phosphorus-containing materials, e.g. apatite
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K33/00—Medicinal preparations containing inorganic active ingredients
    • A61K33/06—Aluminium, calcium or magnesium; Compounds thereof, e.g. clay
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K33/00—Medicinal preparations containing inorganic active ingredients
    • A61K33/42—Phosphorus; Compounds thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K6/00—Preparations for dentistry
    • A61K6/20—Protective coatings for natural or artificial teeth, e.g. sealings, dye coatings or varnish
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K6/00—Preparations for dentistry
    • A61K6/80—Preparations for artificial teeth, for filling teeth or for capping teeth
    • A61K6/849—Preparations for artificial teeth, for filling teeth or for capping teeth comprising inorganic cements
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/19—Cosmetics or similar toiletry preparations characterised by the composition containing inorganic ingredients
    • A61K8/24—Phosphorous; Compounds thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
    • A61L24/00—Surgical adhesives or cements; Adhesives for colostomy devices
    • A61L24/02—Surgical adhesives or cements; Adhesives for colostomy devices containing inorganic materials
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
    • A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
    • A61L27/28—Materials for coating prostheses
    • A61L27/30—Inorganic materials
    • A61L27/32—Phosphorus-containing materials, e.g. apatite
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
    • A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
    • A61L27/36—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix
    • A61L27/38—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix containing added animal cells
    • A61L27/3839—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix containing added animal cells characterised by the site of application in the body
    • A61L27/3843—Connective tissue
    • A61L27/3865—Dental/periodontal tissues
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
    • A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
    • A61L27/40—Composite materials, i.e. containing one material dispersed in a matrix of the same or different material
    • A61L27/42—Composite materials, i.e. containing one material dispersed in a matrix of the same or different material having an inorganic matrix
    • A61L27/425—Composite materials, i.e. containing one material dispersed in a matrix of the same or different material having an inorganic matrix of phosphorus containing material, e.g. apatite
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
    • A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
    • A61L27/50—Materials characterised by their function or physical properties, e.g. injectable or lubricating compositions, shape-memory materials, surface modified materials
    • A61L27/54—Biologically active materials, e.g. therapeutic substances
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q11/00—Preparations for care of the teeth, of the oral cavity or of dentures; Dentifrices, e.g. toothpastes; Mouth rinses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2800/00—Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
    • A61K2800/40—Chemical, physico-chemical or functional or structural properties of particular ingredients
    • A61K2800/41—Particular ingredients further characterized by their size
    • A61K2800/412—Microsized, i.e. having sizes between 0.1 and 100 microns
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2800/00—Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
    • A61K2800/40—Chemical, physico-chemical or functional or structural properties of particular ingredients
    • A61K2800/60—Particulates further characterized by their structure or composition
    • A61K2800/65—Characterized by the composition of the particulate/core
    • A61K2800/651—The particulate/core comprising inorganic material
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
    • A61L2430/00—Materials or treatment for tissue regeneration
    • A61L2430/12—Materials or treatment for tissue regeneration for dental implants or prostheses

Definitions

  • This invention concerns a method for sealing dentinal tubules exposed at the tooth surface as a consequence of enamel defects, based on amorphous calcium polyphosphate microparticles that, in contrast to polyphosphate-calcium salts/complexes, strongly bind both to tooth enamel, cementum and dentin surfaces.
  • the inventive method uses microsized particles, consisting a biocompatible and biodegradable polymer (calcium polyphosphate), can be applied not only for protective teeth coatings but also in the fabrication of morphogenetically- active tooth implants that stimulate differentiation of precursor odontoblasts to mature, alkaline phosphatase-expressing cells, with a hardness and elastic modulus close to natural enamel.
  • the invention furthermore relates to an improved biomimetic dental composition, in particular a toothpaste, containing the morphogenetically active amorphous polyphosphate (polyP) microparticles enriched with retinyl acetate.
  • the inventive composition efficiently repairs both cracks/fissures and carious lesions in the tooth enamel, and reseals dentinal tubules, already after a short-time treatment of teeth.
  • this composition significantly increases the growth of human mesenchymal stem cells and the expression of marker genes for osteoblast differentiation.
  • a further aspect of this invention then concerns the finding that the polyP ingredient, supplied as zinc-polyP microparticles strongly inhibits the growth of the cariogenic bacterium Streptococcus mutans.
  • the inventive composition is particularly suitable for a prevention/repair of (cariogenic) damages of tooth enamel/dentin and for the treatment and/or prevention of dental hypersensitivity.
  • Teeth are composed of two specialized hard tissues, dentin and enamel. Both tissues are primarily composed of hydroxyapatite (HA) crystals. Enamel almost exclusively consists of this inorganic matrix with only very little organic constituents, while dentin contains about 70% mineral, 20% organic matrix, and 10% water.
  • HA hydroxyapatite
  • teeth enamel and dentin undergo a permanent remodeling by demineralization and remineralization processes.
  • demineralization and remineralization processes are slow.
  • Calcium and phosphate ions, as well as by fluoride can be administered in order to partially reconstitute the crystal remnants on the subsurface lesions remaining after demineralization.
  • the remineralized crystals are more resistant to acid, but less soluble and more brittle than the original mineral.
  • the biomineral of tooth enamel, dentin and cementum mainly consists of hydroxyapatite (HA).
  • HA hydroxyapatite
  • growth factors e.g., amelogenin and ameloblastin
  • enzymes e.g., ALP and carbonic anhydrase
  • Dentin is traversed by a network of tubular structures, termed dentinal tubules. These tubules are shielded by the enamel (crown) and the cementum (root), which form a protective layer of the pulp against external physical and chemical influences, like temperature changes and acids, and prevent affection of the nerve protrusions and dentin hypersensitivity.
  • the diameter of the dentinal tubules which protrude into the dentin layer and are open to the dental surface varies between 1 and 2.5 ⁇ . Patients suffering from tooth hypersensitivity have larger number of open dentinal tubules and/or tubules with a larger in diameter than normal.
  • polyP inorganic polyphosphate
  • Schroder HC Miiller WEG, eds (1999) Inorganic Polyphosphates - Biochemistry, Biology, Biotechnology. Prog Mol Subcell Biol 23:45-81; Kulaev IS, Vagabov V, Kulakovskaya T (2004) The Biochemistry of Inorganic Polyphosphates. New York: John Wiley & Sons Inc.; and Miiller, W.E.G., et al. (2015), Polyphosphate: A Morphogenetically Active Implant Material Serving as Metabolic Fuel for Bone Regeneration. Macromol. Biosci., 15: 1182-1197.
  • the inventor also found that mineralization leading to crystalline HA deposition starts from enzymatically formed amorphous calcium carbonate (ACC; Miiller WEG, et al. (2016) Mineralization of bone-related SaOS-2 cells under physiological hypoxic conditions. FEBS J 283:74-87) that is transferred non-enzymatically to amorphous calcium phosphate (ACP) (Miiller WEG, et al. (2015) Non-enzymatic transformation of amorphous CaC0 3 into calcium phosphate mineral after exposure to sodium phosphate in vitro: Implications for in vivo hydroxyapatite bone formation.
  • ACP amorphous calcium phosphate
  • PolyP a nontoxic polymer, exists in a wide range of organisms, from bacteria to human. This linear polymer consists of tens to hundreds of phosphate units which are linked together by energy-rich phosphoanhydride bonds. In previous studies, the inventor showed that polyP a) is accumulated especially in bone cells (Leyhausen G, Lorenz B, Zhu H, Geurtsen W, Bohnensack R, Miiller WEG, Schroder HC (1998) Inorganic polyphosphate in human osteoblast-like cells. J Bone Mineral Res 13:803-812; Schroder HC, et al. (2000) Polyphosphate in bone.
  • polyP displays antibacterial activity (Kulakovskaya TV, Vagabov VM, Kulaev IS (2012) Inorganic polyphosphate in industry, agriculture and medicine: Modern state and outlook. Proc Biochem 47: 1-10; Miiller WEG, et al. (2012) Potentiation of the cytotoxic activity of copper by polyphosphate on bio film-producing bacteria: A bioinspired approach. Marine Drugs 10:2369-2387).
  • Pi released from the natural polymer polyphosphate (polyP) through enzymatic cleavage via alkaline phosphatase (ALP) acts as a supply of Pi during bone formation (Wang XH, Schroder HC, Miiller WEG (2016) Polyphosphate as a metabolic fuel in Metazoa: A foundational breakthrough invention for biomedical applications. Biotechnol. J. 11 : 11-30).
  • This polymer is present in considerable amounts in the circulating blood serum, as well as within cells, especially within blood platelets.
  • GB1420363.2 the inventor described a new biocompatible, biodegradable and biologically active material that is based on polyP.
  • polyP has been used as potential scaffold for bone implants after calcination. This treatment causes in degradation of the polyP chain.
  • the size of the microparticles described in GB1420363.2 can be adjusted by a defined Pi : Ca 2+ molar ratio of 1 : 1 or 1 :2 (Miiller WEG, et al. (2015) A new polyphosphate calcium material with morphogenetic activity. Materials Lett 148: 163-166). The particles formed are amorphous and hence are prone to enzymatic hydrolysis by ALP.
  • polyphosphate a hard amorphous polyphosphate (polyP)-based material that is produced at ambient conditions in the presence of a defined concentration of CaCl 2 .
  • This material consists of spherical, amorphous particles that are biocompatible and biodegradable. Now the inventor surprisingly found that this material, prepared with a size in the microparticulate range, strongly binds to the HA of tooth enamel, cementum and dentin, exposed at the tooth surfaces or damaged tooth surfaces. This finding was unexpected because it was shown that the calcium salt or complex of polyP does not bind to these surfaces, as demonstrated by electron microscopically and element analytical (EDX) methods.
  • EDX element analytical
  • the calcium polyP microparticles trigger differentiation of precursor osteoblasts to the functionally active, alkaline phosphatase expressing cells, if the diameter of these particles is in a range (300 nm) that is not suitable for receptor-mediated endocytosis (around 50 nm).
  • the method according to this invention can be used for resealing dentinal tubules exposed to the tooth surface and coating of teeth to ameliorate tooth hypersensitivity and to prevent tooth decay (caries formation).
  • a further aspect of this invention is the application of the inventive method for preparation of tooth implants that are able to stimulate the formation of body's own new tooth material (HA) by triggering differentiation of osteoblast precursor cells and activating osteoblasts.
  • HA body's own new tooth material
  • a-polyP amorphous polyP
  • CaCl 2 amorphous polyP
  • poly(ethylene glycol) amorphous polyP
  • Na-polyP in general and a-polyP in particular have been found to be morphogenetically active due to the property of the polymer to elicit the expression of those genes that are involved in cell growth activation and cell differentiation, e.g.
  • BMP-2 bone morphogenetic protein-2
  • polyP entrapped in PLGA [poly(D,L-lactide-co-glycolide)]- based microspheres, accelerates bone regeneration in calvarial critical-sized defects faster compared to ⁇ -tri-calcium phosphate ( ⁇ -TCP) containing spheres
  • ⁇ -TCP ⁇ -tri-calcium phosphate
  • polyP Another potentially beneficial property of polyP resides in the potential of this polymer to act as an antimicrobial agent. PolyP was found to interfere with growth of Gram-positive bacteria, while Gram-negative bacteria are generally more resistant (Obritsch JA, et al. (2008) Antibacterial effects of long-chain polyphosphates on selected spoilage and pathogenic bacteria. J Food Prot 71 : 1401-1405). The following patent applications also describe polyP: GB1406840.7; GB1403899.6; WO 2012/010520; GB1420363.2; and GB1502116.5.
  • the present inventor determined the effect of amorphous polyP microparticles, enriched with retinyl acetate, on repair of cracks in enamel, resealing of dentinal tubules in dentin and finally the effect of polyP on growth of Streptococcus mutans, a facultatively anaerobic, gram-positive coccus with pronounced cariogenic properties.
  • the amorphous polyP microparticles were incorporated into a basis dental composition, here as a dentifrice/toothpaste, composed of: carboxymethylcellulose, Na-methyl-/?-hydroxybenzoate, Na-saccharin, glycerol, Na-lauryl sulfate and water.
  • a dentifrice/toothpaste composed of: carboxymethylcellulose, Na-methyl-/?-hydroxybenzoate, Na-saccharin, glycerol, Na-lauryl sulfate and water.
  • triclosan which is a component of the commercially sold toothpaste Colgate® (http://www.colgateprofessional.com/products/colgate-total-advanced- toothpaste/faqs), indeed strongly inhibits the growth of widespread bacteria, e.g. Staphylococcus aureus. Nevertheless, these bacteria can subsequently develop a certain degree of resistance against triclosan. Furthermore, triclosan-containing toothpastes do not display any growth inhibitory activity against S. mutans. In contrast to this, the inventor demonstrates that polyP in the salt form of Ca-polyP distinctly impairs multiplication of bacteria.
  • the inventor furthermore supplemented the polyP -based microparticles used for the preparation of the inventive dental composition with retinyl acetate.
  • the inventor demonstrates that this retinoid causes an induction of collagen type I ⁇ COL I) gene expression, which together with the ALP gene is a marker for differentiation of the mesenchymal stem cells (MSC) into odontoblasts (Andujar MB, et al. (1991) Differential expression of type I and type III collagen genes during tooth development. Development 111 :691-698).
  • the inventive dental composition in particular toothpaste/dentifrice, which contains amorphous polyP and retinyl acetate, exhibits three main effects: i) Resealing of cracks/fissures within enamel/dentin; ii) Filling carious cavities; and iii) Remineralization), beneficial for the repair and prevention of carious damages in teeth dentin as well as enamel.
  • the damages caused by dental caries and enamel defects can be efficiently and sustainably resealed by the polyP component, as shown in schematic Fig. 9.
  • the deposits formed from those microparticles are firmly attached to the HA surface and presumably - at least transitionally - ameliorate dental pain etiologically originating from those damages.
  • this mineral deposition property of polyP its inducing property of bone gene expression, especially on ALP, should be mentioned that is required for the mineralization activity onto the odontoblastic processes and the enzymatic hydrolysis of polyP. The latter reaction might trigger the transformation of the existing crystalline HA as well as the amorphous Ca-polyP deposits to mutual and fused mineralic crystalline patches.
  • a polyP material that is characterized by the following properties was described.
  • the material a) is amorphous, b) has an unusual hardness, c) consists of nanoparticles (diameter of about 200-300 nm), and d) can be prepared under mild conditions, in particular at room temperature.
  • this material was found to be superior compared to conventional polyP preparations used, for example, for bone regeneration and as a bone replacement material (see, e.g., GB1406840.7 and GB1403899.6).
  • the inventive method described here in one aspect relates to innovative uses of this material, in the form of microparticles with a size range of around 300 nm (diameter), for the (re)sealing of dentinal tubules exposed at the tooth surface and the filling of tooth defects (defects in tooth enamel, cementum and dentin).
  • This invention is based on the unexpected finding by the inventor that these Ca-polyP microparticles are able to form a tightly bound polyP layer onto the HA surface. This finding was surprising because the calcium salt or calcium complex of polyP do not bind to these surfaces.
  • a possible explanation might be the existence of free ionic valencies at the surface of the microparticles that are not saturated by calcium ions and can interact with surface-exposed calcium of the HA material, if a phosphate to calcium ratio of 1 : 1 has been used during preparation of the particles.
  • a further aspect of this invention thus concerns the finding that these calcium polyP microparticles are able to stimulate the differentiation of osteoblast precursor cells to mature osteoblasts (expressing the enzyme alkaline phosphatase which is involved in HA formation).
  • the inventive method can be used for resealing dentinal tubules exposed to the tooth surface and coating of teeth to ameliorate tooth hypersensitivity and to prevent tooth decay (application for caries prophylaxis).
  • the inventive method can also be used for the preparation of tooth implants that trigger the body's own tooth material (HA) formation via induction of differentiation of osteoblast precursor cells and activation of mature osteoblasts.
  • HA body's own tooth material
  • the polyP layer formed on the tooth surface was demonstrated to have a hardness and elastic modulus similar like natural enamel.
  • the preferred average size (diameter) of the Ca-polyP microparticles used in the inventive method is in the range of about 50 to about 500 nm, preferably 300 nm.
  • the preferred composition of the Ca-polyP microparticles used in the inventive method is a weight ratio of 0.1 to 10 (phosphate to calcium), preferably of 0.5 to 1, and most preferred 1 to 1.
  • the chain lengths of the polyP component of the Ca-polyP microparticles can be in the range 3 to up to 1000 phosphate units. Optimal results are achieved with polyP molecules with an average chain length of approximately 200 to 20, and optimally about 40 phosphate units.
  • the polyP material is biodegradable and displays superior morphogenetic activity, compared to the Ca-polyP salts prepared by conventional techniques.
  • a further aspect of the inventive method is the use of this method to ameliorate dental hypersensitivity or for caries prophylaxis.
  • Another aspect of the inventive method is the application of this method for preparation of tooth implants that stimulate differentiation and activation of odontoblast precursor cells and odontoblasts.
  • a method for the preparation of a dental hygiene composition containing amorphous polyphosphate (polyP) nanoparticles or microparticles enriched with retinyl acetate comprising the steps of: a) Preparing amorphous calcium polyphosphate nanoparticles or microparticles (termed "a-polyP-MP") by mixing of an aqueous solution of sodium polyphosphate with an aqueous solution of calcium chloride for several hours at elevated temperature, preferably 3h at 90°C, under formation of a colloidal suspension; b) adding a solution of a retinol compound in an organic solvent to said calcium polyphosphate nanoparticles or microparticles; c) stirring of the suspension preferably at room temperature under avoidance of light for 3h, collecting the nanoparticles or microparticles by centrifugation, drying of the sediment, preferably at 60°C overnight, grinding of the
  • said dental composition basis is a basis for a toothpaste, a mouthwash, a dental whitening composition, or a dental coating material (e.g. for an artificial tooth or dental implant).
  • a dental coating material e.g. for an artificial tooth or dental implant.
  • this invention relates to the preparation of a biomimetic toothpaste containing morphogenetically active amorphous polyP microparticles enriched with retinyl acetate (herein designated as "a-polyP/RA-MP").
  • the Ca-polyP microparticles prepared by the inventor are thus preferably enriched with the more stable retinyl acetate instead of retinol, since it also contains DL-a-tocopherol as stabilizer.
  • the retinyl acetate oil is preferably dissolved in ethanol.
  • inventive toothpaste "dRs"-l% as disclosed herein efficiently reseals cracks and carious damages of the human teeth. It is surprising that even a 5 d application/brushing, twice daily, causes an (almost) complete filling and occlusion of the cracks. Even more important and surprising, the inventive "dRs"-l% paste has the unique property to be resistant even against a short sonication by a high power (320 W) sonicator, in contrast to dentifrices containing crystalline HA particles that cannot form such an intimate bonding at physiological pH-neutral conditions.
  • the deposits formed onto the carious tooth holes after the 5d treatment with "dRs"-l% consist of amorphous Ca-polyP and not crystalline HA, as supported by EDX analysis.
  • FIG. 10 A schematic outline of the resealing activity on exposed dentinal tubules of the inventive "dRs"-l% toothpaste is given in Fig. 10.
  • the Ca-polyP ingredient of the toothpaste is layered on top of the HA surface and protrude to some extent into the tubules.
  • a fusion stage follows during which the Ca-polyP polymers undergo degradation by the ALP under lowering the pH of the environment of the polymer.
  • an acceleration of the physiological mineralization of the Ca-phosphate deposits will proceed during which first the amorphous Ca-carbonate bio-seeds and subsequently the Ca-phosphate minerals are synthesized.
  • the toothpaste according to this invention offers two more additional and beneficial properties.
  • the inventive toothpaste does not include any additional antibacterial component, e.g. triclosan.
  • the inventive microparticles formed from polyP and ZnCl 2 (herein designated "Zn-a-polyP-MP") have an antibacterial effect towards the main bacterium causing cariogenic damages, S. mutans. Such a potency has not been described for triclosan, very often used in commercial dentifrices, e.g. Colgate®-Original.
  • the dental composition/toothpaste formula according to this invention is preferably supplemented with "Zn-a-polyP-MP".
  • the inventive dentifrice does not inhibit MSC cell growth and induces the steady-state-expression of collagen type I, which is essential for the reconstitution of the periodontium, especially after caries damages (Chibinski AC, et al. (2014) Bone sialoprotein, matrix metalloproteinases and type I collagen expression after sealing infected caries dentin in primary teeth. Caries Res 48:312-319).
  • concentration of the a- polyP/RA-MP is between 1% [w/w] and 10% [w/w].
  • the preferred composition of the Ca-polyP microparticles used in the inventive method is a stoichiometric ratio of between 0.1 to 3 (phosphate to calcium), preferably between 0.3 and 1, and most preferred 0.6.
  • the chain length of the polyP can be in the range of 3 to 1000 phosphate units, preferably in the range of 10 to 100 phosphate units, and most preferred about 40 phosphate units.
  • the Ca-polyP microparticles are biologically active although their diameter (0.3 and 1 ⁇ ) is outside the range allowing receptor-mediated endocytosis (about 50 nm).
  • the preferred average size (diameter) of the Ca-polyP microparticles used is in the range of about 50 to about 500 nm, preferably 300 nm.
  • the stoichiometric ratio between the retinol compound and polyP (based on phosphate) can be in the range between 10 to 10000, preferably between 100 to 2000. Optimal results are achieved at a stoichiometric ratio of about 750.
  • a further aspect of the inventive method concerns the application of the polyP ingredient as Zn-polyP microparticles ("Zn-a-polyP-MP"). These particles surprisingly turned out to strongly inhibit the growth of the cariogenic bacterium S. mutans.
  • the aqueous solution of sodium polyphosphate is admixed with an aqueous solution of zinc chloride.
  • the atomic ratio of zinc to phosphate is in the range of about 10: 1 to about 1 :2, preferably in the range of about 5 : 1 to about 1 : 1, and most preferred 2: 1.
  • the inventive method can be applied for the fabrication of a biomimetic toothpaste.
  • the inventive "a-polyP/RA-MP" containing toothpaste turned out to significantly increase the growth of MSC, compared to a commercial toothpaste which acts rather inhibitory and the paste without polyP and retinyl acetate.
  • qRT-PCR experiments revealed that the retinoid causes an induction of the expression of the MSC marker genes for osteoblast differentiation encoding collagen type I and alkaline phosphatase.
  • inventive toothpaste containing amorphous polyP enriched with retinyl acetate, efficiently repairs both cracks/fissures and carious lesions in the tooth enamel, and reseals dentinal tubules, already after a 5d treatment (brushing) of teeth twice daily for 5 min as examined by SEM and quantitative EDX analysis.
  • Another aspect of the inventive method is the combined application of biologically active "a- polyP/RA-MP" with "Zn-a-polyP-MP", exploiting its enhancing, inhibitory effect on the growth of cariogenic bacteria, such as Streptococcus mutans or Streptococcus sobrinus.
  • the dental composition preferably is a biomimetic toothpaste, a mouthwash, a dental whitening composition, or a dental coating material.
  • Another aspect of the invention relates to the dental composition according to the invention for use in repairing cracks/fissures and carious lesions in the tooth enamel, resealing dentinal tubules (prevention or treatment of dental hypersensitivity), increasing growth of human mesenchymal stem cells, inducing osteoblast differentiation, and/or inhibiting the growth of cariogenic bacteria, such as Streptococcus mutans or Streptococcus sobrinus.
  • Another aspect of the invention relates to a method for repairing cracks/fissures and carious lesions in the tooth enamel, resealing dentinal tubules (prevention or treatment of dental hypersensitivity), increasing growth of human mesenchymal stem cells, inducing osteoblast differentiation, and/or inhibiting the growth of Streptococcus mutans in a subject (such as a human or other mammal) comprising applying to said subject a dental composition, produced by the method according to the invention as described herein.
  • the dental composition preferably is a biomimetic toothpaste, a mouthwash, a dental whitening composition, or a dental coating material.
  • Figure 1 shows the amorphous Ca-polyP microparticles (aCa-polyP-MP) and their proposed interaction with the Ca-phosphate surface of the teeth.
  • a and B The aCa-polyP-MP; SEM analysis.
  • C Proposed interaction of the microparticles with the hydroxyapatite (HA) enamel of a tooth. Enamel (en) forms the crown around the dentin (de) region and surrounds the dental pulp (pu).
  • the minerals enamel and dentin are composed of HA plates, built mainly of ⁇ 0 4 3" and Ca 2+ ions.
  • the aCa-polyP-MP are filled. It is proposed that the Ca 2+ ions within the microparticles form a bridging to the HA of the enamel.
  • Figure 2 shows the coating of teeth specimens from the root region with polyP. Teeth samples were incubated in 10 mg/mL of either Na-polyP [Ca 2+ ] (A and C) or aCa-polyP-MP (B and D) for 2 d. Then the samples were taken, subjected to slicing and inspected by light microscopy. Images were taken either from the cut areas (A and B) or the corresponding surfaces (C and D). The different layers, cement (ce) and dentin (de) as well as the polyP layer are marked.
  • a and C Na-polyP [Ca 2+ ]
  • B and D aCa-polyP-MP
  • Figure 3 shows the formation of a polyP layer onto the teeth specimens after incubation with aCa-polyP-MP; SEM.
  • teeth samples were submersed in Na-polyP [Ca 2+ ] or aCa- polyP-MP (10 mg/mL each) for 2 d. Then the samples were, after washing, cut and then analyzed by SEM.
  • the images A, C and E were taken from samples that had been exposed to Na-polyP [Ca 2+ ], while those of B, D and F came from teeth samples incubated in aCa-polyP- MP.
  • the cement (ce) and dentin (de) layers are seen in all samples, while only in those treated with aCa-polyP-MP the additional polyP layer (polyP) is seen.
  • the dentinal tubules are exposed in the Na-polyP [Ca 2+ ] sample (E; ..::dt::..), while no opening from the tubules are seen on the surface of the aCa-polyP-MP sample (F).
  • Figure 4 shows the kinetics of coating with polyP; SEM.
  • A Surface of the dentin with the opening of the dentinal tubules (dt).
  • B and C Incubation of the root samples for 30 min with aCa-polyP-MP; the microparticles (Ca-polyP-MP) are accumulating in the openings of the tubules.
  • D and E A longer incubation period with aCa-polyP-MP results in an expansion of the polyP deposits under formation of a layer; at higher magnification the individual microparticles can be resolved.
  • Figure 5 shows the time course of polyP deposition onto the surface of the teeth; EDX analysis.
  • A Untreated enamel. The enamel samples were treated for 30 min (B) or 2 d (C) with the aCa-polyP-MP; a strong increase of the signals for P and Ca is seen in the sample after 2 d incubation.
  • Figure 6 shows the mechanical characteristics of the polyP coating onto enamel.
  • Slices from human teeth were prepared and either measured directly or incubated in a saline solution supplemented with 10 mg/mL of aCa-polyP-MP. Incubation at 25 °C was performed for 3 h or 2 d. After the incubation the specimens were dried for 10 min and then measured.
  • a typical load-penetration depth curve for a control sample (solid line) or a polyP treated sample after 2 d (broken line) or 3 h (dotted line) is shown.
  • the indentation loads of 82 mN are given.
  • the following load-penetration stages are marked within the curves: loading stage, dwell period at maximum load and unloading part.
  • Figure 7 shows the increase of the levels of ALP transcripts in hMSCs after exposure to polyP.
  • the cells remained either untreated or were exposed to 30 ⁇ g/mL of Na-polyP [Ca 2 ] or aCa-polyP-MP. Samples were collected at day 1, day 3 and day 7. The cells were harvested, RNA was extracted and subjected to qRT-PCR analysis; the expression levels, correlated to the expression of the reference gene GAPDH, were determined for the untreated cells (control; open bars), as well as for the Na-polyP [Ca 2+ ] (Na-polyP; cross-hatched) and the aCa-polyP-MP -treated cultures (Ca-polyP-MP; filled bars). Data are expressed as mean values ⁇ SD for four independent experiments. Differences between the groups were evaluated using the unpaired t-test. *p ⁇ 0.05.
  • Figure 8 represents a summary of the mode of action of the aCa-polyP-MP, which is twofold.
  • the microparticles attach strongly to the surface of the tooth, especially in the exposed openings of the dentinal tubules (dt). Those tubules are located in the dentin (de), which is usually covered by the enamel (en) layer.
  • the ALP and the hydrolysis product of Ca-polyP, the ortho-phosphate form hydroxyapatite (HA) and by that repair the dentinal tubules.
  • Figure 9 shows the polyP-containing formula "dRs"-l% comprising trifunctional activity: First, resealing of cracks within the enamel and dentin regions of the teeth: ameliorate hypersensitivity by acting anti-sensitively; second, filling out of carious damages: anti- cariously and via remineralization processes.
  • the new formula is proposed to repair periodontitis lesions of the periodontal apparatus.
  • the first and second mode of action is caused by polyP, while the third property is due to the concerted morphogenetic activity elicited by the inorganic polymer (induction of the ALP gene) and the retinyl acetate (upregulation of the steady-state-expression of collagen type I).
  • Figure 10 shows the occlusion of the dentinal tubules by the polyP-based and microparticle- formulated "dRs"-l% paste.
  • the microparticles adsorb to the HA surface where in the second step an ALP-driven hydrolysis of the polyP within the microparticles takes place, resulting in a lowering of the pH.
  • the dentinal tubules are occluded by a genuine repair process.
  • the different phases are illustrated (A) by the respective SEM images and (B) by the corresponding sketches.
  • Figure 11 shows the morphology of the microparticles prepared of amorphous Na-polyP and CaCl 2 . SEM analysis.
  • Figure 12 shows the effect of the different paste samples on viability/growth of MSC.
  • the cells were exposed to the control paste "BP" (basis paste without a-polyP/RA-MP; open bars), the "CO” (Colgate-Original ) sample (cross-hatched) or to paste supplemented with 10% "a-polyP/RA-MP” microparticles, "dRs"-10% (filled bars).
  • the absorbance level at time zero is given as a grey bar.
  • a concentration of 10 ⁇ g/mL was chosen.
  • Figure 13 shows the density of MSC in assays exposed for (A) the short incubation period of 3 h (set to time 0) to the basis paste "BP", or for 3 d to "BP" (B), to the paste with 10% “a- polyP/RA-MP” microparticles, "dRs"-10% (C) as well as to the "CO” formula (D). Light microscopy.
  • Figure 14 shows the steady-state expression of the (A) ALP or of the (B) COL-I gene in MSC, cultured in the presence of the mineralization activation cocktail, MAC, after an incubation period for 21 d.
  • the expression ratio for the ALP gene or of the COL-I gene versus the YWHAZ house-keeping gene was determined (time zero); grey bars.
  • the MSC were incubated with 10 ⁇ g/mL of "BP" (open bars), "CO” (cross- hatched) or "dRs"-10% (filled bars). After incubation the cells were harvested and the RNA was extracted and subsequently subjected to RT-qPCR analysis.
  • the expression values are given as ratios to the reference house-keeping gene YWHAZ. The results are means from 5 parallel experiments (*P ⁇ 0.01).
  • Figure 15 shows the antibacterial activity testing. Applying the conventional filter paper disc assay the effect of the basis paste "BP", the commercially available paste “CO” as well as of "Zn-a-polyP-MP". The quantities of the respective compounds/materials added to the discs are indicated. The culture dishes were incubated with S. aureus and S. mutans.
  • Figure 16 shows the treatment of the cut teeth either with (A and D) the control paste "BP” or (B and E) the "dRs"-l% polyP-containing paste.
  • C Human teeth were cut and immobilized with the cut surfaces onto a glass slide. The enamel (en) and dentin (de) regions are marked. SEM (A, B, D, E) or light microscope (C) inspections.
  • Figure 17 shows the treatment of the carious tooth lesion damages in the enamel region; SEM. The tooth sections were treated either (A and C) with the control paste "BP” or (B and D) with "dRs"-l% twice a day for 5 d.
  • Figure 18 shows the energy-dispersive X-ray analysis plot obtained for the deposits in a caries cavity, that was brushed for (A) 5 d with "dRs"-l%.
  • the spectra for (B) the "a-polyP/RA-MP" (Ca-polyP [reference]) material added to the "dRs"-l% paste and for (C) enamel is given as well.
  • Figure 19 shows the closure of the cracks within the enamel region by polyP; SEM.
  • a to C Treatment of the tooth samples with "BP”. The crack damages (cr) are constantly seen.
  • D to F Brushing of the teeth with "dRs"-l% results in a repairing of the cracks (> ⁇ re-cr) within the enamel region (en).
  • G to I At a higher magnification the globular, spherical microparticles, originating from the polyP microparticles in the "a-polyP/RA-MP" sample that were fabricated into the "dRs"-l% paste become visible.
  • Figure 20 shows the sealing of the cracks within the dentin region; light microscopic images.
  • the samples were treated with (A) “BP", (B) “dRs”-l% or (C) “dRs”-10% for 5 d.
  • BP BP
  • C dentin
  • re-cr re-cr
  • Figure 21 shows the surface morphology of the tooth dentin specimens after a 5 d treatment with (A) the "BP” paste, or (B) the “dRs"-l% dentifrice.
  • Figure 22 shows the resistance of the "dRs"-l%-mediated sealant against sonication.
  • the teeth samples were brushed either with "BP" (A to D), or with "dRs"-l% (E to H). Subsequently the samples were either sonicated for 1 min (A, B and E, F) of for 5 min (C, D and G, H).
  • Figure 23 shows the occlusion of the dentinal tubules by "dRs"-l%; SEM.
  • a to C Untreated dentin zone with openings of dentinal tubules (dt). Frequently the odontoblastic processes (op) are seen.
  • D to I Sealing of the dentinal tubules (dt) after a 5 d brushing treatment, twice daily, with "dRs"-l%.
  • FIG. 4B At a higher magnification the microparticles within the openings of those tubules can be visualized (Fig. 4C). If the incubation time is prolonged to 2 d an (almost) homogenous polyP coating can be resolved by SEM at low magnification (Fig. 4D); at a higher resolution the microparticles are visible (Fig. 4E).
  • EDX spectroscopy was employed to characterize the polyP deposition onto the enamel surface of the root part of the teeth. Analyzing the element distribution of the surface of the untreated enamel shows the characteristic signals for O, P and Ca, especially representing the mineral part of the teeth, while the significant C signal reflects the organic constituents of the teeth. In addition, low amounts of Na and Mg are seen (Fig. 5 A). During the short incubation period with 10 mg/mL of aCa-polyP-MP for 30 min only low signals for P and Ca are measured (Fig. 5B); however, after the 2 d incubation period the P and Ca signals substantially increased, reflecting the deposition of polyP from the microparticles (Fig. 5C).
  • Hardness measurements were performed with a triangular Berkovich diamond indenter. Per given value, 30 single measurements were performed onto the (polyP) enamel. A maximum load of 82 mN was applied resulting in a displacement of 1000 nm in maximum. On average the maximum penetration depth of the indents was 250 ⁇ 21 nm. Within one group all load- displacement curves showed a similar shape as the one given in Fig. 6. The typical loading, hold and unloading periods in a typical test cycle of a single indent are shown for each of the three series of experiments. The contact stiffness at maximum load was calculated by fitting a power-law function under the unloading segment. In turn, the slope of the obtained function at maximum load was used to calculate the contact depth of an indent.
  • the stromal cells, hMSC, differentiating towards odontoblasts in the presence of conditioned medium were cultivated either in the absence or presence of polyP.
  • polyP samples both Na-polyP [Ca 2+ ] and aCa-polyP-MP were used at a concentration of 30 ⁇ g/mL.
  • cells were harvested after 1, 3 or 7 d of incubation for determination of the expression level of the ALP gene. The results show that in the absence of polyP the steady-state- expression level of ALP remains almost unchanged during the 7-d incubation period with a ratio to the expression of the reference gene GAPDH of approximately 0.02 (Fig. 7).
  • amorphous Ca-polyP microparticles (aCa-polyP-MP) strongly attach to the surface of the teeth and - undergo in the dentinal tubules hydrolysis to ortho-phosphate via the enzyme alkaline phosphatase (ALP).
  • ALP alkaline phosphatase
  • the products elicit morphogenetic activity during which the gene encoding for the ALP becomes induced; this process contributes to the repair of the hydroxyapatite in the decayed dentinal tubules.
  • the dentinal tubules are resealed by a layer of Ca-polyP (Fig. 8).
  • the sodium polyphosphate (Na-polyP of an average chain of 40 phosphate units) used in the Examples has been obtained from Chemische Fabrik Budenheim (Budenheim; Germany). Preparation of amorphous Ca-polyP microparticles
  • microparticles composed of Ca-polyP (termed aCa-polyP-MP), are prepared as described (Miiller WEG, et al. (2015) A new polyphosphate calcium material with morphogenetic activity. Materials Lett 148: 163-16) with some modifications.
  • 10 g of Na-polyP are dissolved in distilled water and added to 14.2 g of CaCl 2 *2H 2 0 at room temperature. During the preparation the pH is adjusted to 10.0. After stirring (4 h), the particles are collected, washed with ethanol and dried at 60°C.
  • the polymer characteristics of polyP within the microparticles can be verified, for example, by application of Fourier transform infrared spectroscopy; X-ray diffraction analysis can be used prove that the material is amorphous.
  • the average size of the particles is 300 nm and they vary between the size range of 100 to 600 nm (Fig. 1A and B).
  • human teeth are used. Prior to use the teeth are mechanically cleaned from soft tissue, treated for 5h in 3% Na- hypochlorite to remove tissue remains and then stored at 4°C in a 100% relative humidity chamber.
  • Teeth specimens are submersed in saline (0.90% [w/v] NaCl) which contained, as mentioned in the text, either 10 mg/mL of aCa-polyP-MP or Na-polyP, stoichiometrically complexed with Ca 2+ (molar ratio of 2: l/phosphate monomer: Ca 2+ [Miiller WEG, et al. (2011) Inorganic polymeric phosphate/polyphosphate as an inducer of alkaline phosphatase and a modulator of intracellular Ca 2+ level in osteoblasts (SaOS-2 cells) in vitro. Acta Biomater 7:2661-2671]). Incubation is performed at 25°C.
  • Scanning electron microscopy can be performed, for example, with a HITACHI SU 8000 (Hitachi High-Technologies Europe GmbH), equipped with a low voltage ( ⁇ 1 kV; analysis of near-surface organic surfaces) detector. Tooth samples, after the respective incubation, are washed 3-times in PBS (phosphate-buffered saline). After a short traversing through distilled water the specimens are dried and inspected. Where mentioned the samples have been cut.
  • Digital light microscopy can be performed, for example, with a VHX-600 Digital Microscope (Keyence) equipped with a VH-Z100 zoom lens.
  • Energy dispersive X-ray (EDX) spectroscopy can be performed, for example, with an ED AX Genesis EDX System attached to a scanning electron microscope (Nova 600 Nanolab) operating at 10 kV with a collection time of 30-45s. Areas of approximately 10 ⁇ 2 are analyzed.
  • EDX Energy dispersive X-ray
  • the surfaces of either the untreated or the polyP-coated teeth specimens are evaluated at 25°C by depth-sensing indentation, using, for example, a NanoTest Vantage system (Micro Materials Ltd).
  • a three-sided Berkovich diamond indenter is used to produce triangular- shaped indentation marks on the coating surface; the tip radius measures approximately 50- 100 nm.
  • a total of 30 single measurements is performed.
  • the loading rate as well as the unloading rate is fixed to 0.5 mN s "1 .
  • To determine the "creep-effect" a 30s dwell period is introduced at a maximum load. In the unloading curve a second dwell period (60 s) at 10% of the maximum load is used to determine the thermal drift of the system.
  • qRT-PCR reverse transcription-quantitative real-time polymerase chain reaction
  • nti 05 9 to ntiovs; 215 bp can be used.
  • the amplification can be performed, for example, in an iCycler (Bio-Rad) with the respective iCycler software. After determination of the C t values the expression of the respective transcripts can be calculated (Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucl Acids Res 29:2002-2007).
  • the human multipotent stromal cells differentiate into odontoblasts in the presence of conditioned medium from developing tooth germ cells; the conditioned medium is prepared as described (Huo N, Tang L, Yang Z, Qian H, Wang Y, Han C, Gu Z, Duan Y, Jin Y (2010) Differentiation of dermal multipotent cells into odontogenic lineage induced by embryonic and neonatal tooth germ cell-conditioned medium. Stem Cells Dev 19:93-104).
  • the sixth passage is used for the studies.
  • the cells are incubated in a-MEM (Biochrom), supplemented with 20% fetal calf serum (FCS; Gibco Invitrogen) as well as with 100 units/mL penicillin and lOOmg/mL streptomycin.
  • FCS fetal calf serum
  • 5% of conditioned medium is added to the assays.
  • the cells are continued to culture in 48-well plates (Cat. no. 677102; Greiner) either in the absence of polyP or the presence of 30 ⁇ / ⁇ . either of Na-polyP [Ca 2+ ] or of aCa-polyP-MP. Then, the cells are harvested for qRT-PCR analysis.
  • a-polyP/RA-MP The sample of microparticles, fabricated from polyP and containing retinyl acetate, is termed "a-polyP/RA-MP".
  • X-ray diffraction analysis and Fourier transform infrared spectroscopic analysis can be applied to verify the amorphous state of polyP.
  • the sizes of the particles range between 100 to 200 nm.
  • the retinyl acetate content can be determined using the colorimetric assay (Subramanyam GB, Parrish DB (1976) Colorimetric reagents for determining vitamin A in feeds and foods. J. Assoc. Off. Anal. Chem. 59: 1 125-1130). In the experiments, described under Examples, it was 5.4 ⁇ 0.3 mg per 1 g of polyP. Toothpaste test samples
  • microparticles "a-polyP/RA-MP" have been blended into the basis toothpaste, composed of carboxymethylcellulose, Na-methyl-/?- hydroxybenzoate, Na-saccharin, glycerol, Na-lauryl sulfate, 20% [w/w] Ca 2+ Carbonate (El 70, CaC0 3 ; Diaclean) and water (Brighenti FL, Takeshita EM, Sant'ana CO, Buzalaf MA, Delbem AC (2013) Effect of low fluoride acidic dentifrices on dental remineralization.
  • Human mesenchymal stem cells can be isolated from normal (non-diabetic) adult human bone marrow of normal volunteers and purchased, for example, from Lonza Cologne (Cologne; Germany). Incubation is performed as described (Wang XH, et al. (2014) The marine sponge-derived inorganic polymers, biosilica and polyphosphate, as morphogenetically active matrices/scaffolds for differentiation of human multipotent stromal cells: Potential application in 3D printing and distraction osteogenesis. Mar Drugs 12: 1131- 1147).
  • the cells are maintained in 75 cm 2 flasks and cultivated in a-MEM (Biochrom), supplemented with 20% FCS (fetal calf serum; Biochrom) and 0.5 mg mL "1 of gentamycin, 100 units mL "1 penicillin, 100 mg mL "1 of streptomycin and 1 mM pyruvate. Incubation is performed in a humidified incubator at 37°C.
  • the MSC cultures are inoculated with 1 ⁇ 10 4 cells per well (48 well plates) in a total volume of 0.5 mL. The cultures are first incubated for a period of 3d in the absence of the mineralization-activating cocktail (MAC). Subsequently, the cultures are used for the cell viability studies. For the gene expression studies the cells are incubated for a total period 21d in the presence of MAC, comprising 50 mM ascorbic acid and 10 nM dexamethasone to induce biomineralization.
  • the third component usually used in the MAC, ⁇ -glycerophosphate, is omitted since polyP has been shown to be sufficient as a phosphate supply.
  • Quantifying cell growth/metabolic activity can be performed, for example, by a colorimetric method based on the tetrazolium salt XTT (Cell Proliferation Kit II; Roche), as described in (Mori K, et al. (2007) Receptor activator of nuclear factor-kappaB ligand (RANKL) directly modulates the gene expression profile of RANK-positive Saos-2 human osteosarcoma cells. Oncol Rep 18: 1365-1371). The absorbance is determined at 450 nm and subtracted by the background values (500 nm). Routinely the viable cells are determined after 72h.
  • qRT-PCR quantitative real-time reverse transcription polymerase chain reaction
  • the ALP alkaline phosphatase; NM_000478.4
  • Fwd 5'- TGCAGTACGAGCTGAACAGGAAC A-3 ' (SEQ ID NO: 1) (nt habit 4 i to nt soil 64 ) and Rev: 5'- TCCACCAAATGTGAAGACGTGGGA-3 ' (SEQ ID NO: 2) (ntnis to nti 395 ; 278 bp) and second the COL I (collagen type I; NM 000088)
  • Fwd 5'-TATGG- GACCCCAAGGACCAAAAGG-3 ' (SEQ ID NO: 5) (ntgrass 2 2 to nt perennial 45 ) and Rev: 5'- TTTTCC ATCTGACCCAGGGGAACC-3 ' (SEQ ID NO: 6) (nti 257 to nti 234 ; 136 bp).
  • the expression levels of the respective transcripts have been correlated to the reference housekeeping gene YWHAZ (tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein; NM 003406]
  • Fwd 5 '-GCTTGCATCCCACAGACTATTTCC-3 ' (SEQ ID NO: 7) (nt 2473 to nt 2496 ) and Rev: 5 '-GGCAGACAATGACAGACCATTCAG-3 ' (SEQ ID NO: 8) (nt 2 596 to nt 2 5 73 ; 124 bp).
  • the cells are extracted for RNA using the TRIzol reagent and subjected to qRT-PCR.
  • the reactions are run at an initial denaturation of 95°C for 3 min, followed by 40 cycles, each with 95°C for 20 s, 58°C for 20 s, 72°C for 20 s, and 80°C for 20 s. Finally, the fluorescence data are computed at the 80°C step.
  • the quantitative real-time PCR experiments can be performed, for example, in an iCycler (Bio-Rad); the mean C t values and efficiencies are calculated with the iCycler software (Bio-Rad); the estimated PCR efficiencies range between 93% and 103%.
  • Staphylococcus aureus subsp. aureus; DSM No. 2569
  • Streptococcus mutans DSM No. 20523
  • Both strains can be obtained from the DSMZ-German Resource Centre for Biological Material (Braunschweig, Germany).
  • S. aureus is cultivated on Columbia agar supplemented with 5% horse blood (Becton-Dickinson).
  • the S. mutans is cultivated as described (Miiller WEG, et al. (2012) Potentiation of the cytotoxic activity of copper by polyphosphate on bio film-producing bacteria: A bioinspired approach. Mar Drugs 10:2369-2387) on 5% defibrinated sheep blood agar. Cultivation is performed in an incubator (5% C0 2 ).
  • the paper disc assay can be applied.
  • Sterile paper discs (Whatman 3MM; Fisher Scientific) with a diameter of 5 mm are placed onto the Petri dishes (94 x 16 mm), containing the culture agar. Overnight cultures are made which gave for S. aureus an OD 6 oonm density of ⁇ 3.0 and for S. mutans of -1.2.
  • S. aureus samples are taken and diluted 1 :3 with LB medium (Luria/Miller; Roth) giving an OD 6 oonm of ⁇ 1.0; then 350 ⁇ are plated out the plates with a Drigalski spatula and allow the surface to "dry" agar.
  • LB medium Lia/Miller; Roth
  • Escherichia coli TOP 10 (a MCI 061 E. coli derivative; Invitrogen) has been used for a parallel series of experiments. As test compounds the "BP", "CO” as well as "Zn-a-polyP-MP".
  • Molar and premolar human teeth have been used as sample material for treatment with experimental dentifrices. Prior to use the specimens are cleaned from organic material by incubation in 4% sodium hypochlorite solution for 4h. Subsequently, the samples are thoroughly rinsed with distilled water then air dried.
  • Brushing can be performed, for example, with an electric toothbrush (Braun Oral-B PRO 6000; Procter & Gamble) at 8,000 rpm and 100 g force for 3 min at room temperature.
  • the cut teeth are immobilized with their cut surfaces onto a glass slide and kept wet with distilled water. Then ⁇ 0.2 g dentifrice is spread evenly onto the respective entire enamel and dentin surfaces of both the control group and the experimental group and subsequently brushed.
  • Routinely the samples are brushed twice a day for 5 d and then inspected. Where indicated under Examples, the samples are ultra-sonicated with a RK 100/H ultrasonic cleaning unit (Bandelin, Berlin; Germany) with 320 W for 1 min or 5 min.
  • scanning electron microscopic (SEM) visualization is performed, for example, either with a Philips XL30 ESEM-FEG/EDAX system (Philips) or a HITACHI SU 8000 electron microscope (Hitachi High-Technologies).
  • Philips XL30 ESEM-FEG/EDAX system Philips
  • HITACHI SU 8000 electron microscope Hitachi High-Technologies
  • EDAX Genesis EDX System attached to the scanning electron microscope (Nova 600 Nanolab; FEI) operating at 10 kV with a collection time of 30-45 s can be used.
  • the light microscopic images can be taken, for example, with a VHX-600 Digital Microscope from KEYENCE.
  • the surface roughness of the tooth samples can be measured with the software provided by the manufacturer.
  • Energy dispersive X-ray (EDX) spectroscopy can be performed, for example, with an EDAX Genesis EDX System attached to a scanning electron microscope (Nova 600 Nanolab; FEI) operating at 10 kV with a collection time of 30-45 s. Areas of approximately 10 ⁇ 2 are analyzed by EDX.
  • EDAX Genesis EDX System attached to a scanning electron microscope (Nova 600 Nanolab; FEI) operating at 10 kV with a collection time of 30-45 s. Areas of approximately 10 ⁇ 2 are analyzed by EDX.
  • the results are statistically evaluated using the independent two-sample Student's t-test.
  • the amorphous polyP microparticles were prepared by controlled precipitation of Na-polyP with CaCl 2 in a weight ratio of Ca 2+ to phosphate of 1 :2. PEG was added during the procedure to suppress phase separation. Retinyl acetate was added to the particles as described under "Methods". In the final sample the concentration of retinyl acetate in the examples described below was 5.4 ⁇ 0.3 mg per 1 g of polyP. The morphology of the particles was close to be spherical with an average size of 550 ⁇ 120 nm (Fig. 11). A quantitative EDX analysis revealed a Ca to P atomic ratio of 1 to 2. X-ray diffraction and Fourier transform infrared spectroscopy were used to prove that the deposits are amorphous and composed of polyP polymer chains.
  • Fig. 13 In order to substantiate the results from the XTT colorimetric assay images were taken with an optical microscope (Fig. 13). At time 0, a low density of cells can be imaged (Fig. 13 A). After the 3 d incubation with the "BP" control basis paste or the inventive "a-polyP/RA-MP" paste ("dRs"-10%), the cell layer is close to dense (Fig. 13B and C), while only scarcely cells are seen on the bottom of the assays exposed to "CO” (Fig. 13D).
  • Teeth sections, containing carious lesions in the enamel were brushed twice daily for 5 days with "BP” or with “dRs"-l% and then inspected by SEM.
  • the existing cracks, and especially the carious lesions remained (Fig. 17A and C) as in the untreated controls.
  • the cracks are visible, while in the extensive carious lesions the rows of the separated enamel prisms became overt.
  • the "dRs"-l% treated samples all crack damages are filled with paste material; the carious lesions became filled with the "a-polyP/RA-MP" component of the "dRs"-l% paste (Fig. 17B and D).
  • the stability of the occlusion of the cracks within the dentin was determined by sonication of the samples.
  • the teeth were brushed for 5 d with the "BP", in the absence of polyP, or the paste supplemented with "a-polyP/RA-MP", the "dRs"-l% (Fig. 22).
  • the distinct cracks in the dentin regions remained in those samples which were treated with "BP” after a sonication for both 1 min and 5 min (Fig. 22 A to D). Very much in contrast are the images after sonication of the teeth treated with "dRs"-l%. After a sonication period of 1 min and even 5 min the dental sealant remained unchanged (Fig. 22E to H).
  • the occlusion effect polyP-containing dentifrice, "dRs"-l%, towards dentinal tubules was studied by SEM analysis (Fig. 23).
  • the dentinal tubules have a size of ⁇ 1.5 to 4 ⁇ (Fig. 23A and B) and show inside of them the odontoblastic processes (Fig. 23C). If the teeth specimens were treated with "dRs"-l% for 5 d those openings of the dentinal tubules were sealed/re-sealed (Fig. 23D to I). It is amazing that even after the short treatment time of 5 d most of the openings are covered, e.g. as in Fig. 23G to I.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Epidemiology (AREA)
  • Oral & Maxillofacial Surgery (AREA)
  • Inorganic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Dermatology (AREA)
  • Transplantation (AREA)
  • Biomedical Technology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Plastic & Reconstructive Surgery (AREA)
  • Zoology (AREA)
  • Vascular Medicine (AREA)
  • Cell Biology (AREA)
  • Materials Engineering (AREA)
  • Botany (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Surgery (AREA)
  • Molecular Biology (AREA)
  • Composite Materials (AREA)
  • Birds (AREA)
  • Dental Preparations (AREA)
  • Cosmetics (AREA)
  • Materials For Medical Uses (AREA)

Abstract

La présente invention concerne un procédé permettant de sceller des tubules dentinaires exposés au niveau de la surface des dents en conséquence de défauts de l'émail, sur la base de microparticules de polyphosphate de calcium amorphe qui se lient solidement à la fois à l'émail, au cément et aux surfaces dentinaires des dents. Le procédé selon l'invention utilise des particules microdimensionnées, constituées d'un polymère biocompatible et biodégradable (polyphosphate de calcium), et peut être utilisé non seulement pour des revêtements de protection des dents, mais également pour la fabrication d'implants dentaires à effet morphogénétique qui stimulent la différentiation des précurseurs odontoblastiques en cellules matures exprimant la phosphatase alcaline, présentant un module de dureté et d'élasticité proche de celui de l'émail naturel. L'invention concerne également une composition dentaire biomimétique améliorée, en particulier un dentifrice, contenant les microparticules de polyphosphate amorphe (polyP) à effet morphogénétique, enrichies en acétate de rétinyle. La composition selon l'invention permet de réparer efficacement des fissures/craquelures et des lésions carieuses de l'émail dentaire, et referme hermétiquement les tubules dentinaires, dès un traitement dentaire de courte durée. De plus, cette composition augmente de manière significative la croissance de cellules souches mésenchymateuses humaines et l'expression de gènes marqueurs pour la différenciation des ostéoblastes. Selon un autre aspect, l'invention a permis de découvrir que l'ingrédient polyP, présent sous la forme de microparticules de polyP de zinc, inhibe fortement la croissance de la bactérie cariogène Streptococcus mutans. La composition selon l'invention est particulièrement appropriée pour la prévention/la réparation de dommages (cariogènes) de l'émail dentaire/de la dentine et pour le traitement et/ou la prévention de l'hypersensibilité dentaire.
PCT/EP2016/064008 2015-06-19 2016-06-17 Microparticules de polyphosphate de calcium amorphe, implants dentaires et compositions dentaires comprenant lesdites particules WO2016202980A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
GB1510772.5 2015-06-19
GB1510772.5A GB2539490A (en) 2015-06-19 2015-06-19 Method for the preparation of teeth coatings having morphogenetic activity
GB1604816.7 2016-03-22
GBGB1604816.7A GB201604816D0 (en) 2015-06-19 2016-03-22 Biomimetic dental composition for repairing enamel cracks/carious damages and resealing dentinal tubules

Publications (1)

Publication Number Publication Date
WO2016202980A1 true WO2016202980A1 (fr) 2016-12-22

Family

ID=53784168

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2016/064008 WO2016202980A1 (fr) 2015-06-19 2016-06-17 Microparticules de polyphosphate de calcium amorphe, implants dentaires et compositions dentaires comprenant lesdites particules

Country Status (2)

Country Link
GB (2) GB2539490A (fr)
WO (1) WO2016202980A1 (fr)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB2600768A (en) * 2020-11-10 2022-05-11 Werner ernst ludwig georg mueller Method for preventing infections by respiratory viruses including SARS-CoV-2 through strengthening airway mucus function
CN114615966A (zh) * 2019-10-30 2022-06-10 皮斯洛克斯有限公司 稳定的非晶态钙镁磷酸盐颗粒组合物
CN114642603A (zh) * 2022-03-30 2022-06-21 浙江大学 一种酶促磷酸钙仿生矿化试剂套装及其制备方法和矿化应用
US11617711B2 (en) 2018-08-30 2023-04-04 University Of Washington Compositions and methods for dental care
WO2023109376A1 (fr) * 2021-12-17 2023-06-22 上海纳米技术及应用国家工程研究中心有限公司 Procédé de préparation d'un échafaudage de réparation osseuse chargé de médicament capable de favoriser une vascularisation ordonnée au moyen d'une impression 3d, et produit associé et utilisation du produit

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008005509A2 (fr) * 2006-07-06 2008-01-10 Massachusetts Institute Of Technology Procédés et compositions destinés à modifier des surfaces biologiques
WO2008006204A2 (fr) * 2006-07-12 2008-01-17 Mcgill University Particules fibreuses de pyrophosphage de calcium, procédés de fabrication et méthodes d'utilisation

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5037639A (en) * 1989-05-24 1991-08-06 American Dental Association Health Foundation Methods and compositions for mineralizing calcified tissues
JPH09295942A (ja) * 1996-04-26 1997-11-18 Koshi Ishino 虫歯予防剤
US7494614B2 (en) * 2002-07-12 2009-02-24 Pilliar Robert M Method of manufacture of porous inorganic structures
US10052406B2 (en) * 2013-07-03 2018-08-21 Wayne State University Method of making water soluble injectable calcium polyphosphate gels
WO2015023773A2 (fr) * 2013-08-14 2015-02-19 University Of Tennessee Research Foundation Compositions et procédés de reminéralisation dentaire

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008005509A2 (fr) * 2006-07-06 2008-01-10 Massachusetts Institute Of Technology Procédés et compositions destinés à modifier des surfaces biologiques
WO2008006204A2 (fr) * 2006-07-12 2008-01-17 Mcgill University Particules fibreuses de pyrophosphage de calcium, procédés de fabrication et méthodes d'utilisation

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
MÜLLER WERNER E G ET AL: "A new polyphosphate calcium material with morphogenetic activity", MATERIALS LETTERS, vol. 148, 18 April 2015 (2015-04-18), pages 163 - 166, XP029154041, ISSN: 0167-577X, DOI: 10.1016/J.MATLET.2015.02.070 *
WERNER E.G. MÜLLER ET AL: "Retinol encapsulated into amorphous Ca2+ polyphosphate nanospheres acts synergistically in MC3T3-E1 cells", EUROPEAN JOURNAL OF PHARMACEUTICS AND BIOPHARMACEUTICS., vol. 93, 1 June 2015 (2015-06-01), NL, pages 214 - 223, XP055301810, ISSN: 0939-6411, DOI: 10.1016/j.ejpb.2015.04.005 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11617711B2 (en) 2018-08-30 2023-04-04 University Of Washington Compositions and methods for dental care
CN114615966A (zh) * 2019-10-30 2022-06-10 皮斯洛克斯有限公司 稳定的非晶态钙镁磷酸盐颗粒组合物
GB2600768A (en) * 2020-11-10 2022-05-11 Werner ernst ludwig georg mueller Method for preventing infections by respiratory viruses including SARS-CoV-2 through strengthening airway mucus function
WO2023109376A1 (fr) * 2021-12-17 2023-06-22 上海纳米技术及应用国家工程研究中心有限公司 Procédé de préparation d'un échafaudage de réparation osseuse chargé de médicament capable de favoriser une vascularisation ordonnée au moyen d'une impression 3d, et produit associé et utilisation du produit
CN114642603A (zh) * 2022-03-30 2022-06-21 浙江大学 一种酶促磷酸钙仿生矿化试剂套装及其制备方法和矿化应用

Also Published As

Publication number Publication date
GB201604816D0 (en) 2016-05-04
GB201510772D0 (en) 2015-08-05
GB2539490A (en) 2016-12-21

Similar Documents

Publication Publication Date Title
Bordea et al. Nano-hydroxyapatite use in dentistry: A systematic review
WO2016202980A1 (fr) Microparticules de polyphosphate de calcium amorphe, implants dentaires et compositions dentaires comprenant lesdites particules
Zhang et al. Development of a multifunctional adhesive system for prevention of root caries and secondary caries
Ma et al. Effects of a coating resin containing S-PRG filler to prevent demineralization of root surfaces
Yu et al. Development of epigallocatechin-3-gallate-encapsulated nanohydroxyapatite/mesoporous silica for therapeutic management of dentin surface
Fan et al. Remineralization effectiveness of the PAMAM dendrimer with different terminal groups on artificial initial enamel caries in vitro
Eva et al. Surface changes of enamel and dentin after two different bleaching procedures
He et al. Nanocomplexes of carboxymethyl chitosan/amorphous calcium phosphate reduce oral bacteria adherence and biofilm formation on human enamel surface
Chen et al. Biomimetic remineralization of artificial caries dentin lesion using Ca/P-PILP
Liu et al. Bioinspired heptapeptides as functionalized mineralization inducers with enhanced hydroxyapatite affinity
Zhong et al. Contemporary research findings on dentine remineralization
Toledano-Osorio et al. Polymeric nanoparticles protect the resin-dentin bonded interface from cariogenic biofilm degradation
Renné et al. Antibacterial properties of copper iodide-doped glass ionomer-based materials and effect of copper iodide nanoparticles on collagen degradation
Hasegawa et al. Effect of a novel glass ionomer cement containing fluoro-zinc-silicate fillers on biofilm formation and dentin ion incorporation
Hotta et al. Adherence of Streptococcus sanguinis and Streptococcus mutans to salivacoated S-PRG resin blocks
Yu et al. Epigallocatechin-3-gallate/nanohydroxyapatite platform delivery approach to adhesive-dentin interface stability
Fang et al. Biocompatibility and antibacterial properties of zinc-ion implantation on titanium
Pushpalatha et al. Nanohydroxyapatite in dentistry: A comprehensive review
Müller et al. A biomimetic approach to ameliorate dental hypersensitivity by amorphous polyphosphate microparticles
CN107108751A (zh) 唾液富酪蛋白肽
Tang et al. Crosslinking improve demineralized dentin performance and synergistically promote biomimetic mineralization by CaP_PILP
Ren et al. Synergistic remineralization of enamel white spot lesions using mesoporous bioactive glasses loaded with amorphous calcium phosphate
Soares et al. Raman spectroscopy-multivariate analysis related to morphological surface features on nanomaterials applied for dentin coverage
Rani et al. Evaluation of remineralizing potential of Calcium Sucrose Phosphate and CPP-ACP: An in vitro study
IL302155A (en) Acceleration of tooth remineralization and bone regeneration by self-assembling peptides and amorphous calcium phosphate

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16736005

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16736005

Country of ref document: EP

Kind code of ref document: A1