WO2016196925A1 - Composition pour les os et ses procédés de fabrication et d'utilisation - Google Patents

Composition pour les os et ses procédés de fabrication et d'utilisation Download PDF

Info

Publication number
WO2016196925A1
WO2016196925A1 PCT/US2016/035705 US2016035705W WO2016196925A1 WO 2016196925 A1 WO2016196925 A1 WO 2016196925A1 US 2016035705 W US2016035705 W US 2016035705W WO 2016196925 A1 WO2016196925 A1 WO 2016196925A1
Authority
WO
WIPO (PCT)
Prior art keywords
nell
bone
composition
mice
component
Prior art date
Application number
PCT/US2016/035705
Other languages
English (en)
Other versions
WO2016196925A9 (fr
Inventor
Kang Ting
Chia Soo
Benjamin M. Wu
Aaron W. JAMES
Original Assignee
The Regents Of The University Of California
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Regents Of The University Of California filed Critical The Regents Of The University Of California
Publication of WO2016196925A1 publication Critical patent/WO2016196925A1/fr
Publication of WO2016196925A9 publication Critical patent/WO2016196925A9/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/66—Phosphorus compounds
    • A61K31/662—Phosphorus acids or esters thereof having P—C bonds, e.g. foscarnet, trichlorfon
    • A61K31/663—Compounds having two or more phosphorus acid groups or esters thereof, e.g. clodronic acid, pamidronic acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/18—Growth factors; Growth regulators
    • A61K38/1875—Bone morphogenic factor; Osteogenins; Osteogenic factor; Bone-inducing factor
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca

Definitions

  • Bone disorders such as osteoporosis is a disease of severe bone loss affecting an estimated 10 million Americans and causing two million pathological fractures per year (1). Osteoporosis results from an imbalance between bone formation and resorption. This balance depends on both the number of osteoblastic (OB) and osteoclastic (OC) cells as well as their cellular activity within the bone metabolic unit (2-4).
  • OB osteoblastic
  • OC osteoclastic
  • bone anabolic agents produce a secondary osteoclastogenic response, as is the case for PTH, BMP2, and retinoic acid (5-9), and as such, increasing the level of osteoblasts or the activities thereof would also increase the osteoclasts or their activities.
  • An alternative approach is to increase levels of Wnt signaling via inactivation of endogenous Wnt inhibitors (Sclerostin (SOST) and DKK-1).
  • Sclerostin (SOST) and DKK-1 antibodies results in increased OB number and activity, reduced OC number and activity, and a consequent increase in bone mineral density (BMD) (13,14), observed in rat (15, 16), non-human primate (17), and human studies (18).
  • BMD bone mineral density
  • positive regulation of the Wnt/p-catenin signaling pathway has emerged as a promising new field for anabolic, anti-osteoclastic therapies in osteoporosis.
  • antibody therapies have inherent limitations such as, among others, high production cost and low tissue penetration.
  • compositions for a bone condition comprising an effective amount of a first component that is effective to increase the cell number and activity of osteoblast (OB) and an effective amount of a second component that is effective to decrease the cell number and activity of osteoclast (OC) such that the composition is effective to cause the increased cell number of OB
  • OB cell number and activity of osteoblast
  • OC osteoclast
  • the decreased cell number of OC (“increased OB”) and the decreased cell number of OC (“decreased OC”) to have a ratio that decreased OC / increased OB is from about 100: 1 to about 1 :100, wherien the first component and/or the second component are not one of anti-SOST and anti-DKK-1 antibodies.
  • the first component and the second component comprise an osteoinductive agent.
  • the first component or the second component comprise a bisphosphonate.
  • the composition comprises a scaffold impregnated with the bisphosphonate.
  • the osteoinductive agent comprises NELL-1. In some embodiments of the invention composition, optionally in combination with any or all the various embodiments disclosed herein, the osteoinductive agent is effective for activation of the Wnt/p-catenin signaling pathway.
  • the increased OB and the decreased OC have a ratio that decreased OC / increased OB is from about 10: 1 to about 26: 1.
  • the bone condition is osteopenia.
  • the bone condition is osteoporosis.
  • a method of treating or preventing a bone condition comprising administering to a subject:
  • OB osteoblast
  • the first component and the second component comprise an osteoinductive agent.
  • the first component or the second component comprise a bisphosphonate.
  • the composition comprises a scaffold impregnated with the bisphosphonate.
  • the osteoinductive agent comprises NELL-1.
  • the osteoinductive agent is effective for activation of the Wnt/p-catenin signaling pathway.
  • the increased OB and the decreased OC have a ratio that decreased OC / increased OB is from about 10: 1 to about 26: 1.
  • the bone condition is osteopenia.
  • the bone condition is osteoporosis.
  • the subject is a human being.
  • OB osteoblast
  • composition is effective to cause the increased cell number of OB ("increased OB”) and the decreased cell number of OC (“decreased OC”) to have a ratio that decreased OC / increased OB is from about 100: 1 to about 1 : 100, and
  • the first component and the second component comprise an osteoinductive agent.
  • the first component or the second component comprise a bisphosphonate.
  • the composition comprises a scaffold impregnated with the bisphosphonate.
  • the osteoinductive agent comprises NELL-1.
  • the osteoinductive agent is effective for activation of the Wnt/p-catenin signaling pathway.
  • the increased OB and the decreased OC have a ratio that decreased OC / increased OB is from about 10: 1 to about 26: 1.
  • the bone condition is osteopenia.
  • the bone condition is osteoporosis.
  • Figures 2a-j show Nell-1 haploinsufficient mice exhibit impaired osteoblastic and excessive osteoclastic activity.
  • OB or OC precursors were derived from the bone marrow of aged (18 mo. old) wildtype (Nell-1 +/+ ) and Nell-1 haploinsufficient (Nell-1 +/6R ) mice,
  • Red arrowheads indicate resorption pits
  • (g) Photographic quantification of bone resorption, as determined by Toluidine blue staining (N 3 mice per genotype and 9 and 1 1 resorption discs, respectively).
  • Figures 3a-3e show Nell-1 signaling activates Wnt/ -catenin signaling activity in vivo through evaluation of Wnt/p-catenin signaling in Nell-1 +/6R animals (a-e).
  • (b) Semi- quantification of Axin2 immunohistochemical staining among trabecular bone-lining cells (N 32 and 22 images),
  • M2-10B4 cells were treated with PBS or rhNELL-1 with or without DKK-1 for 3 days. Runx2 expression measured by qRT-PCR.
  • M2-10B4 cells were transduced with Runx2 -EGFP reporter lentivirus and treated with PBS or rhNELL-1 with or without XAV939.
  • G Gene expression after 2 days with or without rhNELL-1.
  • Rh Active ⁇ -catenin immunocytochemistry in RAW264.7 cells, treated with rhNELL-1 , WNT3A or control (PBS).
  • i,j Western blot and quantification with or without rhNELL-1.
  • Figures 5a- 5j show rhNELL-1 protein intravertebral injection increases bone formation in an osteoporotic sheep model.
  • Recombinant human (rh)NELL-l protein or vehicle control was injected into the lumbar vertebral bodies of osteoporotic sheep.
  • RhNELL-1 was lyophilized onto ⁇ -TCP particles, which has been previously shown to increase the stability of rhNELL-1 in v/vo(25).
  • Composition of the injected materials can be found in Table 3.
  • BMD Bone Volume / Tissue Volume
  • BV/TV Percent change in Bone Volume / Tissue Volume
  • Figures 6a-6n show intravenous injection of rhNELL-1 increases bone formation in an osteoporotic mouse model
  • Figures 8a-8x show skeletal phenotype and body habitus of aged Nell-1
  • BMD Bone Mineral Density
  • BMC Bone Mineral Content
  • N 12 Nell-1 +/+ and 19 Nell-1 +/6R individual vertebrae per genotype
  • e MicroCT reconstructions of the distal femur of aged Nell-1 +/+ and Nell-1 +/6R mice
  • f-j Trabecular microCT quantifications of the distal femur, including (f) BMD, (g) BV/TV, (h) Tb.Th, (i) Tb.N, and ⁇ Tb.Sp.
  • N 10 individual vertebrae per genotype.
  • N 6 Nell-1 +/+ and 8 Nell-1 +/6R mice.
  • RANKL and OPG immunohistochemistry in aged Nell-1 +/+ and Ne/ - 1 +/6R mouse spines. Semi-quantification is expressed as relative RANKL + to OPG + bone lining cells. Black scale bar: 25 um. Data points indicate means, while error bars represent one SEM. * P ⁇ 0.05, ** P ⁇ 0.01 in comparison to Nell-1 +/+ values.
  • Figures 9a-9g show rhNELL-1 In Vitro Effects in OB precursors and OC precursors.
  • Cells were derived from the marrow of wildtype mice for either OB precursor or OC precursor assays, (a-c) OB precursor differentiation assays, (a) Alkaline Phosphatase (ALP) staining among wildtype OB precursors with or without rhNELL-1 (100 & 300 ng/mL) at 7 days of osteogenic differentiation, (b) Alizarin Red (AR) staining of bone nodule formation at 14 days of osteogenic differentiation with or without rhNELL-1 (100 & 300 ng/mL).
  • ALP Alkaline Phosphatase
  • AR Alizarin Red
  • Figures l Oa-lOd show evidence of NELL- 1 - Integrinpl binding. Please note that evidence for NELL-1 binding to Integral by co-immunoprecipitation assays has been previously published' 11 , (a) Thermal shift assays of NELL-1 and integrin ⁇ 3 ⁇ 1 , shown as the first derivative. The integrin ⁇ 3 ⁇ 1 heterodimer was used so as to maintain protein bioactivity (R&D Systems, 2840-A3-050). Two Tm from integrin ⁇ 3 ⁇ 1 were shifted upon addition of NELL-1. Assays were performed in triplicate with a representative assay shown, with means and standard deviations of Tm shown in the chart below, (b-d) Docking stimulation of NELL- 1 interaction.
  • the three top-scoring models of NELL-1 - integrin ⁇ interaction predicted by docking simulation by using RosettaDock are shown.
  • the structure of integrin ⁇ was taken from the crystal structure of ⁇ 5 ⁇ 1 integrin headpiece (PDB entry 3VI3).
  • the I-like domain and hybrid domain of integrin ⁇ (in a green color) are highlighted.
  • the model of the EGF- like domain of NELL-1 was built by using Robetta protein structure prediction server (amino acid 549-582 of NELL-1 protein), (b)
  • the model predicts that the EGF-like domain of NELL- 1 binds to the I-like domain of the integrin ⁇ , the same binding pocket as previously reported [2] . Its predicted total energy is -230kcal/mol.
  • the model predicts that the EGF-like domain of NELL-1 binds to the I-like domain of the integrin ⁇ at an alternative binding pocket. Its predicted total energy is -235kcal/mol.
  • the model predicts that the EGF-like domain of NELL-1 binds to the hybrid domain of the integrin ⁇ . Its predicted total energy is -231kcal/mol.
  • Figures 1 la-1 le show Nell-1 signaling increases Wnt ⁇ -catenin activity in human BMSCs derived from osteoporotic and non-osteoporotic patients. See Table 2 for details of patient samples, (a) Alizarin red staining among osteoporotic and non-osteoporotic hBMSCs, assessed at 1 1 days, (b) Photographic quantification of Alizarin red staining. (c) Axin2 and CyclinD mRNA expression 3 days after viral infection in non-osteoporotic hBMSCs. (d,e) Western blot of ⁇ -catenin of both cytoplasmic and nuclear fractions of hBMSCs
  • Ad-GFP GFP encoding adenovirus
  • ad-GFP Western blot and quantification from non-osteoporotic hBMSCs.
  • e Western blot and quantification from osteoporotic hBMSCs.
  • Black scale bar 100 ⁇ . All experiments using human BMSC were performed in triplicate wells. Data points indicate means, while error bars represent one SEM. **P ⁇ 0.0 ⁇ , Confirming efficacy of transection, Ad-Nell- 1 resulted in a 17.5 fold increase in Nell-1 mRNA transcripts (data not shown).
  • Figures 12a- 12m show sheep study design, induction of osteoporosis and additional data, (a) Study design. Osteoporosis was induced over four months time by a combination of ovariectomy, steroid administration, and dietary deficiency in Vitamin D and Calcium. After successful induction of osteoporosis, rhNELL-1 was applied by intravertebral body injection. Postoperative analysis included monthly CT scans.
  • N 9 random images per treatment group, (d-j) Histomorphometric quantification of cortical and trabecular measurements, including (d) Cortical Width (Ct.Wi), (e) Trabecular bone Area (Tb.Ar), (f) Percentage Trabecular bone Area (% Tb.Ar), (g) Trabecular bone Perimeter (Tb.Pm), (h) Trabecular bone Width (Tb.Wi), (i) Trabecular bone Number (Tb.N) and (j) Trabecular bone Spacing (Tb.Sp). (k) Representative images of Von Kossa MacNeal's Tetrachrome (VKMT) staining of the area contralateral to the injection site.
  • VKMT Von Kossa MacNeal's Tetrachrome
  • Figures 13a-13g show systemic NELL-1 treatment and additional data,
  • (a) Serum concentration of rhNELL-1 after a single intravenous injection. N 3 samples per timepoint.
  • (b,c) Induction of osteoporosis was performed by ovariectomy (OVX) and ensuing bone loss over a five week period. OVX was confirmed by post-mortem examination of uterine atrophy and mean weight (N 13 and 15 mice, respectively),
  • RhNELL-1 was next administered by tail vein injection (1.25 mg/kg q48hr), sacrificed after four weeks,
  • OPN Osteopontin
  • RANKL immunohistochemical staining and quantification of RANKL + bone lining cells per B.Pm.
  • Figure 14 shows raw images for data presented in Figures 4b, 4i, 4k, 4m, and Figures l id and l i e.
  • Figure 15 Effects on expression of Opg and Rankl by an embodiment of invention composition comprising rhNELL-1 as a component of the composition in primary mouse BMSC.
  • the term “agent” refers to osteoinductive agent effective for promoting bone formation.
  • the term “agent” explicitly excludes anti-SOST and anti-DKK-1 antibodies.
  • the term “agent” is also referred to from time to time as "bioactive agent”, “compound”, “chemical”, “chemical compound”, peptide, polypeptide, or protein.
  • the term “effective” is also referred to as “therapeutically effective” refers to inducing statistically significant result of bone formation under clinical conditions in that it has the effect (1) to increase the cell number and activity of osteoblast (OB) and (2) to decrease the cell number and activity of osteoclast (OC). As such, the term “effective” as used herein is different from / does not encompass an agent that shows only of (1) and (2) effects.
  • the term “therapeutically effective amount”, as used herein, is an amount of an osteoinductive agent effective for inducing statistically significant result of bone formation under clinical conditions in that it includes a sufficient amount of the osteoinductive agent (1) to increase the cell number and activity of osteoblast (OB) and (2) to decrease the cell number and activity of osteoclast (OC). As such, the term “effective amount” as used herein is different from / does not encompass an amount that shows only of (1 ) and (2) effects.
  • safe and effective amount refers to the quantity of a component which is sufficient to yield a desired therapeutic response without undue adverse side effects (such as toxicity, irritation, or allergic response) commensurate with a reasonable benefit/risk ratio when used in the manner of this invention.
  • the specific safe and effective amount or therapeutically effective amount will vary with such factors as the particular condition being treated, the physical condition of the patient, the type of mammal or animal being treated, the duration of the treatment, the nature of concurrent therapy (if any), and the specific formulations employed and the structure of the compounds or its derivatives.
  • the term bisphosphonate refers to a compound that has two phosphonate groupings. In some embodiments, the bisphosphonate is one of
  • the term “impregnated” or “embedded” refers to a state of physical mixture or blend where the parts of the mixture or blend have no or minial interaction among/between components thereof so as not to involve conjugation or covalent chemical bonding. As such, the term “impregnated” or “embedded” explicitly exclude the state of conjugation or covalent chemical bonding.
  • the term “functional” when used in conjunction with “derivative” or “variant” refers to a compound or agent which possesses a biological activity that is substantially similar to a biological activity of the osteoinductive compound or agent of which it is a derivative or variant.
  • substantially similar in this context is meant that at least 50% of the relevant or desired biological activity of a corresponding osteoinductive compound or agent is retained, e.g., preferably the variant retains at least 60%, at least 70%, at least 80%, at least 90%, at least 95%), at least 100%» or even higher (i.e., the variant or derivative has greater activity than the original osteoinductive compound or agent), e.g., at least 1 10%), at least 120%, or more compared to a measurable activity of the osteoinductive compound or agent.
  • compositions, methods, and respective component(s) thereof are used in reference to compositions, methods, and respective component(s) thereof, that are essential to the invention, yet open to the inclusion of unspecified elements, whether essential or not.
  • the term "consisting essentially of” refers to those elements required for a given embodiment. The term permits the presence of elements that do not materially affect the basic and novel or functional characteristic(s) of that embodiment of the invention.
  • the term “about” or “approximately” means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, “about” can mean within 1 or more than 1 standard deviation, per the practice in the art. Alternatively, “about” can mean a range of up to 20%, preferably up to 10%, more preferably up to 5%, and more preferably still up to 1 % of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, preferably within 5-fold, and more preferably within 2-fold, of a value. Where particular values are described in the application and claims, unless otherwise stated the term "about” meaning within an acceptable error range for the particular value should be assumed.
  • active fragment or variant is meant a fragment that is 100% identical to a contiguous portion of the peptide, polypeptide or protein, or a variant that is at least 90%, preferably 95%) identical to a fragment up to and including the full length peptide, polypeptide or protein.
  • a variant may include conservative amino acid substitutions, as defined in the art, or nonconservative substitutions, providing that at least e.g. 10%, 25%, 50%, 75%o or 90% of the activity of the original peptide, polypeptide or protein is retained.
  • expression vector refers to a vector containing a nucleic acid sequence coding for at least part of a gene product capable of being transcribed. In some cases, RNA molecules are then translated into a protein, polypeptide, or peptide. In other cases, these sequences are not translated, for example, in the production of antisense molecules, siRNA, ribozymes, and the like.
  • Expression vectors can contain a variety of control sequences, which refer to nucleic acid sequences necessary for the transcription and possibly translation of an operatively linked coding sequence in a particular host organism. In addition to control sequences that govern transcription and translation, vectors and expression vectors may contain nucleic acid sequences that serve other functions as well.
  • nucleic acid encoding a protein may comprise non-translated sequences (e.g., introns) within translated regions of the nucleic acid, or may lack such intervening non-translated sequences (e.g., as in cDNA).
  • non-translated sequences e.g., introns
  • cDNA e.g., as in cDNA
  • the information by which a protein is encoded is specified by the use of codons.
  • amino acid sequence is encoded by the nucleic acid using the "universal" genetic code.
  • heterologous in reference to a nucleic acid is a nucleic acid that originates from a foreign species, or, if from the same species, is substantially modified from its native form in composition and/or genomic locus by deliberate human intervention.
  • a promoter operably linked to a heterologous structural gene is from a species different from that from which the structural gene was derived, or, if from the same species, one or both are substantially modified from their original form.
  • a heterologous protein may originate from a foreign species or, if from the same species, is substantially modified from its original form by deliberate human intervention.
  • sample is used herein in its broadest sense.
  • a sample comprising polynucleotides, polypeptides, peptides, antibodies and the like may comprise a bodily fluid; a soluble fraction of a cell preparation, or media in which cells were grown; a chromosome, an organelle, or membrane isolated or extracted from a cell; genomic DNA, RNA, or cDNA, polypeptides, or peptides in solution or bound to a substrate; a cell; a tissue; a tissue print; a fingerprint, skin or hair; and the like.
  • patient “subject” or “individual” are used interchangeably herein, and refers to a mammalian subject to be treated, with human patients being preferred. In some cases, the methods of the invention find use in experimental animals, in veterinary
  • rodents including mice, rats, and hamsters; and primates.
  • Treatment is an intervention performed with the intention of preventing the development or altering the pathology or symptoms of a disorder. Accordingly, “treatment” refers to both therapeutic treatment and prophylactic or preventative measures. Those in need of treatment include those already with the disorder as well as those in which the disorder is to be prevented.
  • ameliorated or “treatment” refers to a symptom which is approaches a normalized value (for example a value obtained in a healthy patient or individual), e.g., is less than 50% different from a normalized value, preferably is less than about 25% different from a normalized value, more preferably, is less than 10% different from a normalized value, and still more preferably, is not significantly different from a normalized value as determined using routine statistical tests.
  • a normalized value for example a value obtained in a healthy patient or individual
  • a normalized value for example a value obtained in a healthy patient or individual
  • compositions for a bone condition comprising an effective amount of a first component that is effective to increase the cell number and activity of osteoblast (OB) and an effective amount of a second component that is effective to decrease the cell number and activity of osteoclast (OC) such that the composition is effective to cause the increased cell number of OB
  • OB cell number and activity of osteoblast
  • OC osteoclast
  • the first component and the second component comprise an osteoinductive agent.
  • the first component or the second component comprise a bisphosphonate.
  • the composition comprises a scaffold impregnated with the bisphosphonate.
  • the osteoinductive agent comprises NELL-1.
  • the osteoinductive agent is effective for activation of the Wnt/p-catenin signaling pathway.
  • the increased OB and the decreased OC have a ratio that decreased OC / increased OB is from about 10: 1 to about 26: 1.
  • the bone condition is osteopenia.
  • the bone condition is osteoporosis.
  • the pharmaceutical composition described herein may be administered to a subject in need of treatment by a variety of routes of administration, including orally and parenterally, (e.g., intravenously, subcutaneously or intramedullary), intranasally, as a suppository or using a "flash" formulation, i.e., allowing the medication to dissolve in the mouth without the need to use water, topically, intradermally, subcutaneously and/or administration via mucosal routes in liquid or solid form.
  • the pharmaceutical composition can be formulated into a variety of dosage forms, e.g., extract, pills, tablets, microparticles, capsules, oral liquid.
  • the active materials can also be mixed with other active materials including antibiotics, antifungals, other virucidals and immunostimulants which do not impair the desired action and/or supplement the desired action.
  • the mode of administration of the pharmaceutical composition described herein is oral.
  • Oral compositions generally include an inert diluent or an edible carrier. They may be enclosed in gelatin capsules or compressed into tablets.
  • the aforesaid compounds may be incorporated with excipients and used in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, chewing gums and the like. Some variation in dosage will necessarily occur, however, depending on the condition of the subject being treated.
  • These preparations should produce a serum concentration of active ingredient of from about 0.01 nM to 1 ,000,000 nM, e.g., from about 0.2 to 40 ⁇ .
  • a preferred concentration range is from 0.2 to 20 ⁇ and most preferably about 1 to 10 ⁇ .
  • the concentration of active ingredient in the drug composition itself depends on bioavailability of the drug and other factors known to those of skill in the art.
  • the mode of administration of the pharmaceutical compositions described herein is topical or mucosal administration.
  • a specifically preferred mode of mucosal administration is administration via female genital tract.
  • Another preferred mode of mucosal administration is rectal administration.
  • polymeric and/or non-polymeric materials can be used as adjuvants for enhancing mucoadhesiveness of the pharmaceutical composition disclosed herein.
  • the polymeric material suitable as adjuvants can be natural or synthetic polymers.
  • Representative natural polymers include, for example, starch, chitosan, collagen, sugar, gelatin, pectin, alginate, karya gum, methylcellulose, carboxymethylcellulose, methylethylcellulose, and hydroxypropylcellulose.
  • Representative synthetic polymers include, for example, poly(acrylic acid), tragacanth, poly(methyl vinylether-co-maleic anhydride), poly(ethylene oxide), carbopol, poly(vinyl pyrrolidine), poly(ethylene glycol), polyvinyl alcohol), poly(hydroxyethylmethylacrylate), and polycarbophil.
  • Other bioadhesive materials available in the art of drug formulation can also be used (see, for example, Bioadhesion— Possibilities and Future Trends, Gurny and Junginger, eds., 1990).
  • dosage values also varies with the specific severity of the disease condition to be alleviated. It is to be further understood that for any particular subject, specific dosage regimens should be adjusted to the individual need and the professional judgment of the person administering or supervising the administration of the aforesaid compositions. It is to be further understood that the concentration ranges set forth herein are exemplary only and they do not limit the scope or practice of the invention.
  • the active ingredient may be administered at once, or may be divided into a number of smaller doses to be administered at varying intervals of time.
  • the formulation may contain the following ingredients: a binder such as
  • the dosage unit form is a capsule, it may contain, in addition to material of the above type, a liquid carrier such as a fatty oil.
  • a liquid carrier such as a fatty oil.
  • Other dosage unit forms may contain other various materials which modify the physical form of the dosage unit, for example, as coatings. Thus tablets or pills may be coated with sugar, shellac, or other enteric coating agents. Materials used in preparing these various compositions should be pharmaceutically pure and non-toxic in the amounts used.
  • the solutions or suspensions may also include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methylparabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose.
  • a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents
  • antibacterial agents such as benzyl alcohol or methylparabens
  • antioxidants such as ascorbic acid or sodium bisulfite
  • chelating agents such as ethylenediaminetetraacetic acid
  • compositions of the present invention are prepared as formulations with pharmaceutically acceptable carriers.
  • pharmaceutically acceptable carriers Preferred are those carriers that will protect the active compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems.
  • Biodegradable, biocompatible polymers can be used, such as polyanhydrides, polyglycolic acid, collagen, and polylactic acid. Methods for preparation of such formulations can be readily performed by one skilled in the art.
  • Liposomal suspensions are also preferred as pharmaceutically acceptable carriers.
  • Methods for encapsulation or incorporation of compounds into liposomes are described by Cozzani, I.; Jori, G.; Bertoloni, G.; Milanesi, C; Sicuro, T. Chem. Biol. Interact. 53, 131-143 (1985) and by Jori, G.; Tomio, L.; Reddi, E.; Rossi, E. Br. J. Cancer 48, 307-309 (1983), for example.
  • These may also be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No.
  • liposome formulations may be prepared by dissolving appropriate lipid(s) (such as stearoyl phosphatidyl ethanolamine, stearoyl phosphatidyl choline, arachadoyl phosphatidyl choline, and cholesterol) in an inorganic solvent that is then evaporated, leaving behind a thin film of dried lipid on the surface of the container. An aqueous solution of the active compound is then introduced into the container. The container is then swirled by hand to free lipid material from the sides of the container and to disperse lipid aggregates, thereby forming the liposomal suspension.
  • appropriate lipid(s) such as stearoyl phosphatidyl ethanolamine, stearoyl phosphatidyl choline, arachadoyl phosphatidyl choline, and cholesterol
  • the pharmaceutical composition described herein may be administered in single (e.g., once daily) or multiple doses or via constant infusion.
  • the compounds of this invention may also be administered alone or in combination with pharmaceutically acceptable carriers, vehicles or diluents, in either single or multiple doses.
  • Suitable pharmaceutical carriers, vehicles and diluents include inert solid diluents or fillers, sterile aqueous solutions and various organic solvents.
  • the pharmaceutical compositions formed by combining the compounds of this invention and the pharmaceutically acceptable carriers, vehicles or diluents are then readily administered in a variety of dosage forms such as tablets, powders, lozenges, syrups, injectable solutions and the like.
  • These pharmaceutical compositions can, if desired, contain additional ingredients such as flavorings, binders, excipients and the like according to a specific dosage form.
  • tablets containing various excipients such as sodium citrate, calcium carbonate and/or calcium phosphate may be employed along with various disintegrants such as starch, alginic acid and/or certain complex silicates, together with binding agents such as polyvinylpyrrolidone, sucrose, gelatin and/or acacia.
  • various lubricating agents such as magnesium stearate, sodium lauryl sulfate and talc are often useful for tabletting purposes.
  • Solid compositions of a similar type may also be employed as fillers in soft and hard filled gelatin capsules. Preferred materials for this include lactose or milk sugar and high molecular weight polyethylene glycols.
  • the active pharmaceutical agent therein may be combined with various sweetening or flavoring agents, coloring matter or dyes and, if desired, emulsifying or suspending agents, together with diluents such as water, ethanol, propylene glycol, glycerin and/or combinations thereof.
  • solutions of the compounds of this invention in sesame or peanut oil, aqueous propylene glycol, or in sterile aqueous solutions may be employed.
  • aqueous solutions should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose.
  • aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration.
  • the sterile aqueous media employed are all readily available by standard techniques known to those skilled in the art.
  • the compounds of the invention are conveniently delivered in the form of a solution or suspension from a pump spray container that is squeezed or pumped by the patient or as an aerosol spray presentation from a pressurized container or a nebulizer, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • the dosage unit may be determined by providing a valve to deliver a metered amount.
  • the pressurized container or nebulizer may contain a solution or suspension of a compound of this invention.
  • Capsules and cartridges for use in an inhaler or insufflator may be formulated containing a powder mix of a compound or compounds of the invention and a suitable powder base such as lactose or starch.
  • the pharmaceutical composition provided herein can also be used with another pharmaceutically active agent effective for a disease such as neurodisorders, cardiovascular disorders, tumors, AIDS, depression, and/or type-1 and type-2 diabetes.
  • additional agents can be, for example, antiviral agent, antibiotics, anti-depression agent, anti-cancer agents, immunosuppressant, anti-fungal, and a combination thereof.
  • composition described herein can be formulated alone or together with the other agent in a single dosage form or in a separate dosage form.
  • Methods of preparing various pharmaceutical formulations with a certain amount of active ingredient are known, or will be apparent in light of this disclosure, to those skilled in this art.
  • For examples of methods of preparing pharmaceutical formulations see Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, Pa., 19th Edition (1995).
  • the composition of invention can be formulated into a scaffold.
  • a scaffold can include a carrier, which can be biodegradable, such as degradable by enzymatic or hydrolytic mechanisms.
  • carriers include, but are not limited to synthetic absorbable polymers such as such as but not limited to poly(.alpha.- hydroxy acids) such as poly (L-lactide) (PLLA), poly (D, L-lactide) (PDLLA), polyglycolide (PGA), poly (lactide-co-glycolide (PLGA), poly (-caprolactone), poly (trimethylene carbonate), poly (p-dioxanone), poly (-caprolactone-co-glycolide), poly (glycolide-co- trimethylene carbonate) poly (D, L-lactide-co-trimethylene carbonate), polyarylates, polyhydroxybutyrate (PHB), polyanhydrides, poly (anhydride-co-imide), propylene-co- fumarates
  • PHA poly(
  • glaxanone polysaccharides, and poly(orthoesters), polyglactin, polyglactic acid, polyaldonic acid, polyacrylic acids, polyalkanoates; copolymers and admixtures thereof, and any derivatives and modifications.
  • carriers include cellulosic polymers such as, but not limited to alkylcellulose, hydroxyalkylcellulose, methylcellulose, ethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropyl-methylcellulose, carboxymethylcellulose, and their cationic salts.
  • Other examples of carriers include synthetic and natural bioceramics such as, but not limited to calcium carbonates, calcium phosphates, apatites, bioactive glass materials, and coral-derived apatites.
  • the carrier may further be coated by compositions, including bioglass and or apatites derived from sol-gel techniques, or from immersion techniques such as, but not limited to simulated body fluids with calcium and phosphate concentrations ranging from about 1.5 to 7-fold the natural serum concentration and adjusted by various means to solutions with pH range of about 2.8-7.8 at temperature from about 15-65 degrees C.
  • compositions including bioglass and or apatites derived from sol-gel techniques, or from immersion techniques such as, but not limited to simulated body fluids with calcium and phosphate concentrations ranging from about 1.5 to 7-fold the natural serum concentration and adjusted by various means to solutions with pH range of about 2.8-7.8 at temperature from about 15-65 degrees C.
  • Other examples of carriers include collagen (e.g. Collastat, Helistat collagen sponges), hyaluronan, fibrin, chitosan, alginate, and gelatin, or a mixture thereof.
  • the carrier may include heparin-binding agents; including but not limited to heparin-like polymers e.g. dextran sulfate, chondroitin sulfate, heparin sulfate, fucan, alginate, or their derivatives; and peptide fragments with amino acid modifications to increase heparin affinity.
  • heparin-binding agents including but not limited to heparin-like polymers e.g. dextran sulfate, chondroitin sulfate, heparin sulfate, fucan, alginate, or their derivatives; and peptide fragments with amino acid modifications to increase heparin affinity.
  • the scaffold may be in the form of a liquid, solid or gel.
  • the scaffold can be a carrier that is in the form of a flowable gel.
  • the gel may be selected so as to be injectable, such as via a syringe at the site where bone formation is desired.
  • the gel may be a chemical gel which may be a chemical gel formed by primary bonds, and controlled by pH, ionic groups, and/or solvent concentration.
  • the gel may also be a physical gel which may be formed by secondary bonds and controlled by temperature and viscosity.
  • gels include, but are not limited to, pluronics, gelatin, hyaluronan, collagen, polylactide-polyethylene glycol solutions and conjugates, chitosan, chitosan & b-glycerophosphate (BST-gel), alginates, agarose, hydroxypropyl cellulose, methyl cellulose, polyethylene oxide, polylactides/glycolides in N-methyl-2-pyrrolidone. See for example, Anatomical Record (2001), 263(4), 342-349, the teachings of which are incorporated herein by reference.
  • the carrier may be photopolymerizable, such as by electromagnetic radiation with wavelength of at least about 250 nm, Example of
  • photopolymerizable polymers include polyethylene (PEG) acrylate derivatives, PEG methacrylate derivatives, propylene fumarate-co-ethylene glycol, polyvinyl alcohol derivatives, PEG-co-poly(-hydroxy acid) diacrylate macromers, and modified polysaccharides such as hyaluronic acid derivatives and dextran methacrylate.
  • PEG polyethylene
  • PEG methacrylate derivatives propylene fumarate-co-ethylene glycol
  • polyvinyl alcohol derivatives polyvinyl alcohol derivatives
  • PEG-co-poly(-hydroxy acid) diacrylate macromers PEG-co-poly(-hydroxy acid) diacrylate macromers
  • modified polysaccharides such as hyaluronic acid derivatives and dextran methacrylate.
  • the scaffold may include a carrier that is temperature sensitive.
  • a carrier that is temperature sensitive. Examples include carriers made from N-isopropylacrylamide (NiPAM), or modified NiPAM with lowered lower critical solution temperature (LCST) and enhanced peptide (e.g. NELLI) binding by incorporation of ethyl methacrylate and N-acryloxysuccinimide; or alkyl methacrylates such as butylmethacrylate, hexylmethacrylate and dodecylmethacrylate (PCT Int. Appl. WO/2001070288; U.S. Pat. No. 5,124,151 , the teachings of which are incorporated herein by reference).
  • NiPAM N-isopropylacrylamide
  • LCST lower critical solution temperature
  • enhanced peptide e.g. NELLI
  • alkyl methacrylates such as butylmethacrylate, hexylmethacrylate and dodecylmethacrylate
  • the carrier may have a surface that is decorated and/or immobilized with cell adhesion molecules, adhesion peptides, and adhesion peptide analogs which may promote cell-matrix attachment via receptor mediated
  • polycationic polyamino-acid- peptides e.g. poly-lysine
  • polyanionic polyamino-acid-peptides Mefp-class adhesive molecules and other DOPA-rich peptides (e.g. poly-lysine-DOPA), polysaccharides, and proteoglycans.
  • DOPA-rich peptides e.g. poly-lysine-DOPA
  • polysaccharides e.g. poly-lysine-DOPA
  • the carrier may be comprised of sequestering agents such as, but not limited to, collagen, gelatin, hyaluronic acid, alginate, poly(ethylene glycol), alkylcellulose (including hydroxyalkylcellulose), including methylcellulose, ethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropyl- methylcellulose, and carboxymethylcellulose, blood, fibrin, polyoxyethylene oxide, calcium sulfate hemihydrate, apatites, carboxyvinyl polymer, and poly(vinyl alcohol). See for example, U.S. Pat. No. 6,620,406, herein incorporated by reference.
  • sequestering agents such as, but not limited to, collagen, gelatin, hyaluronic acid, alginate, poly(ethylene glycol), alkylcellulose (including hydroxyalkylcellulose), including methylcellulose, ethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropyl- methylcellulose, and
  • the carrier may include buffering agents such as, but not limited to glycine, glutamic acid hydrochloride, sodium chloride, guanidine, heparin, glutamic acid hydrochloride, acetic acid, succinic acid, polysorbate, dextran sulfate, sucrose, and amino acids. See for example, U.S. Pat. No. 5,385,887, herein incorporated by reference.
  • the carrier may include a combination of materials such as those listed above.
  • the carrier may be a PLGA/collagen carrier membrane.
  • the scaffold can be an implant of the various embodiments described herein.
  • the composition according to this invention may be contained within a time release tablet.
  • a bioactive agent described herein can be formulated with an acceptable carrier to form a pharmacological composition.
  • Acceptable carriers can contain a physiologically acceptable compound that acts, for example, to stabilize the composition or to increase or decrease the absorption of the agent.
  • Physiologically acceptable compounds can include, for example, carbohydrates, such as glucose, sucrose, or dextrans, antioxidants, such as ascorbic acid or glutathione, chelating agents, low molecular weight proteins, compositions that reduce the clearance or hydrolysis of the anti-mitotic agents, or excipients or other stabilizers and/or buffers.
  • physiologically acceptable compounds include wetting agents, emulsifying agents, dispersing agents or preservatives which are particularly useful for preventing the growth or action of microorganisms.
  • Various preservatives are well known and include, for example, phenol and ascorbic acid.
  • phenol and ascorbic acid include, for example, phenol and ascorbic acid.
  • Embodiments of the composition of invention can be administered in a variety of unit dosage forms depending upon the method of administration.
  • unit dosage forms suitable may include powder, tablets, pills, capsules.
  • OB osteoblast
  • composition wherein the composition is effective to cause the increased cell number of OB
  • the first component and the second component comprise an osteoinductive agent.
  • the first component or the second component comprise a bisphosphonate.
  • the composition comprises a scaffold impregnated with the bisphosphonate.
  • the osteoinductive agent comprises NELL-1.
  • the osteoinductive agent is effective for activation of the Wnt/p-catenin signaling pathway.
  • the increased OB and the decreased OC have a ratio that decreased OC / increased OB is from about 10:1 to about 26: 1.
  • the bone condition is osteopenia.
  • the bone condition is osteoporosis.
  • the first component and the second component comprise an osteoinductive agent.
  • the first component or the second component comprise a bisphosphonate.
  • the composition comprises a scaffold impregnated with the bisphosphonate.
  • the osteoinductive agent comprises NELL-1.
  • the osteoinductive agent is effective for activation of the Wnt/ -catenin signaling pathway.
  • the increased OB and the decreased OC have a ratio that decreased OC / increased OB is from about 10: 1 to about 26: 1.
  • the bone condition is osteopenia.
  • the bone condition is osteoporosis.
  • the subject is a human being.
  • Example 1 Osteoinductive studies on invention composition embodiments comprising NELL-1 as a component.
  • NELL-1 is a secreted, osteoinductive protein whose expression rheostatically controls skeletal ossification. Overexpression of NELL-1 results in craniosynostosis in humans and mice whereas lack of Nell-1 expression is associated with skeletal under-mineralization.
  • Nell-1 haploinsufficient mice showed normal skeletal development but exhibited an osteoporotic phenotype with age characterized by a reduction in osteoblast:osteoclast (OB:OC) ratio and increased bone fragility.
  • OB:OC osteoblast:osteoclast
  • NELL-1 deficiency plays a role in manifestation of an osteoporotic phenotype, and demonstrate the potential utility of NELL-1 as a combination anabolic/anti-osteoclastic therapeutic for osteoporosis.
  • NELL-1 is a unique secreted protein of 810-amino acids first studied in the context of human craniofacial skeletal development, where NELL-1 was noted to be osteoinductive and its overexpression associated with human craniosynostosis (CS)(19). Since that time, transgenic Nell-1 overexpressing mice have been observed to recapitulate a CS-like phenotype(20). Conversely, Nell-1 deficient mice (as developed by ENU-induced mutagenesis) exhibit cranial and vertebral bone defects with under-mineralization(21).
  • NELL-1 binds to the cell surface receptor integrin Bl (22), and regulates activity of the master osteogenic transcription factor, Runt-related transcription factor-2 (Runx2)(23).
  • Runt-related transcription factor-2 Runt-related transcription factor-2
  • Nell-1 protein showed a significant reduction with age, as shown by immunohistochemistry of trabecular bone-lining osteoblasts in the rat lumbar spine (Fig. la).
  • Semi-quantitative analysis demonstrated a significant decrease in Nell-1 + bone-lining cells with age (Fig. lb).
  • Fig. lc The consequences of Nell-1 deficiency on skeletal aging were next assessed.
  • Nell-1 6RJ6R Nell-1 6RJ6R
  • Nell-1 6 J6R Complete deficiency
  • Nell-1 +/6R heterozygote mice
  • Total bone formation activity (serum ⁇ ) was reduced among Nell-1 +/6R mice; while total bone resorption activity was increased in Nell-1 +/6R mice, (serum TRAP5b and CTX). Histological analysis confirmed a significant reduction in vertebral body trabecular bone among Nell-1 +/6R specimens (Fig. ln-q, Figures 8s-y). Next, OB and OC prevalence was analyzed histologically (Fig. lr-t). OB Number (Ob.N / B.Pm) was significantly reduced in Nell-1 +/6R lumbar vertebrae.
  • Nell-1 haploinsufficiency results in normal skeletogenesis and development, but results in an osteoporotic defect with age.
  • This osteoporotic defect manifested in both sexes, is characterized by increased cortical bone fragility, altered trabecular bone morphology, decreased OB and increased OC number.
  • NELL-1 has Inverse Effects on Bone Formation and Resorption
  • Nell-1 haploinsufficiency were determined by the culture of either OB or OC precursors.
  • marrow- derived Nell-1 +/6R OB precursors were examined (Fig. 2a-e). Consistent with in vivo findings, Nell-1 +I6R OB precursors showed a significant reduction in expression across all markers of in vitro osteogenic differentiation, including alkaline phosphatase (ALP) positive cells, as well as alizarin red positive bone nodules. Specific gene expression showed a global reduction across both 'early' and 'later' markers of OB differentiation.
  • ALP alkaline phosphatase
  • OB precursor proliferation was reduced among Nell-1 +/6R cells.
  • OC precursors Fig. 2f-j
  • OC precursors from Nell-1 +/+ and Nell-1 +/6R aged littermates were seeded on bone discs for resorption assays.
  • SEM scanning electron microscopy
  • greater bone resorption was detected among Nell-1 +/6R OC precursors.
  • Nell-1 OB precursors showed a reduction in proliferation, differentiation, and bone nodule formation.
  • Nell-1 +I6R OC precursors showed increased OC activity and bone resorption when compared to Nell-1 +/+ cells.
  • NELL-1 Increases ⁇ / ⁇ - ⁇ Signaling via Integral
  • BMSC M2-10B4 mouse bone marrow stromal cell
  • rhNELL-1 induced a significant increase in Wnt/p-catenin (Fig. 4a-c).
  • immunocytochemistry for active ⁇ -catenin showed increased staining (Fig. 4a).
  • Western blotting for cytoplasmic and nuclear fractions demonstrated increased nuclear ⁇ -catenin (Fig. 4b, c).
  • M2-10B4 cells expressing the TOPFLASH reporter system exhibited an increase in TCF/LEF1 activity (Fig. 4d).
  • Wnt/ ⁇ - catenin signaling would impede rhNELL-1 -induced OB differentiation.
  • two antagonists of Wnt signaling were used: DKK-1 (Fig. 4e) or XAV939 (Fig. 4f). Results showed that both Wnt antagonists inhibited rhNELL-1 's induction of Runx2.
  • rhNELL- 1 induced Wnt ⁇ -catenin signaling in OC precursor cells using the mouse OC line RAW264.7 (Fig. 4g-j).
  • rhNELL-1 As assessed by immunocytochemistry, nuclear ⁇ - catenin accumulation, and gene markers of Wnt ⁇ -catenin signaling, rhNELL-1 showed a similar induction of Wnt signaling activity in RAW264.7 cells. In summary, rhNELL-1 protein activates signaling in both OB and OC cell types in vitro. Moreover, NELL-l 's induction of OB differentiation is dependent on intact Wnt ⁇ -catenin signaling.
  • integrin receptor complexes containing integrin ⁇ activate Wnt ⁇ -catenin signaling via integrin-linked kinase signaling and modulation of GSK3P phosphorylation(34). Therefore, we assayed whether integrin ⁇ was required for NELL-1 activation of Wnt ⁇ -catenin signaling (Fig. 4k-p). SiRNA mediated knockdown of integrin ⁇ inhibited rhNELL-1 's activation of Wnt ⁇ -catenin signaling, both in OB and OC precursor cell lines. Thus, integrin ⁇ is required for NELL-1 activation of Wnt ⁇ -catenin signaling in both OB and OC cell types.
  • human (h)BMSC were harvested from patients with or without a clinical history of osteoporosis (Table 2, Figures 1 1). NELL-1 signaling was manipulated by adenoviral Nell-1 (Ad-Nell- 1) or control (Ad-GFP). Ad-Nell- 1 increased OB differentiation in hBMSC derived from either osteoporotic or non-osteoporotic samples. Further, Ad-Nell- 1 treatment resulted in increased Wnt/p-catenin signaling activity in non-osteoporotic and osteoporotic hBMSC, as shown by gene markers and nuclear accumulation of ⁇ -catenin.
  • NELL-1 activates Wnt/p-catenin signaling in OB and OC precursor cells, in a process requiring integrin ⁇ .
  • NELL-1 signaling activates Wnt/p-catenin signaling in human cells, from either non-osteoporotic or osteoporotic patients.
  • Thickness Ct.Th
  • Fig. 5c-g Thickness
  • Fig. 5c-g Histological examination confirmed a significant anabolic response to rhNELL-1 injection (Fig. 5h), quantified by histomorphometric analysis of cortical and trabecular bone measurements in the peri-injection area (Table 4). Bone distant from the injection site was analyzed, showing a similar anabolic response ( Figures 12d-g).
  • osteoinductive protein that activates Wnt/p-catenin signaling via integrin ⁇ , can be a safe, systemic therapy to improve osteoporotic bone quality, tipping the balance in favor of bone anabolism over bone resorption.
  • Nell-1 deficiency in aged mice results in an osteoporotic phenotype, characterized by increased bone fragility, reduced Wnt/p-catenin signaling, and reduced OB:OC ratio in terms of cell number and activity.
  • NELL-1 exerts its effects through interaction with integrin ⁇ , and subsequent positive regulation of Wnt/p-catenin signaling.
  • rhNELL-1 increases endocortical and cancellous bone in osteoporotic animal models, via either local or systemic administration.
  • NELL-1 activates Wnt/p-catenin signaling via integrin ⁇ , uncouples OB:OC activity, may play a protective role against bone loss, and represents a new anabolic and anti-osteoclastic pharmacotherapeutic agent.
  • NELL-1 differs from most other osteoinductive molecules in its negative effects on osteoclastic bone resorption. Typically, anabolic agents also produce a secondary osteoclastogenic response. In contrast, we observed NELL-1 to have inhibitory effects on OCs, with decreased OC number and activity - much like anti-Wnt inhibitor therapies. Our studies suggest that NELL-l 's OC inhibition may be direct and/or indirect. NELL-1 directly activates Wnt/p-catenin signaling in both OB and OC cell types.
  • Wnt/ ⁇ - catenin signaling in OBs is well described to induce OB-derived expression of the major osteoclast inhibitor Osteoprotegerin (OPG), and alteration of the balance between OPG and RANKL, thereby indirectly inhibiting OC activity(39-42).
  • OPG major osteoclast inhibitor
  • Wnt ⁇ -catenin signaling activation in OC precursors has anti-osteoclastogenic effects, independent of OB elaborated OPG(43). Therefore, NELL-l 's positive effects on bone formation and negative effects on bone resorption may be explained both by activation of Wnt ⁇ -catenin signaling in OB and OC precursors, respectively.
  • the extent to which the anti-OC effects of NELL-1 are similar or different to anti-Wnt inhibitor therapies, such as anti-SOST antibodies, has yet to be determined.
  • integrin ⁇ 3 is highly expressed in OC and mediates bone extracellular matrix attachment(46). Although the specific effects of integrin ⁇ agonists have not been examined, integrin ⁇ ablation led to reduced OC resorptive capacity(47).
  • Our findings of NELL-1 activation of Wnt/ -catenin signaling in OCs via integrin ⁇ may represent a new and unexplored function of integrins in OCs(34). In summary, our observations of NELL-1 interacting with integrin ⁇ to exert its cellular and tissue level effects are overall in agreement with the known roles of integrin ⁇ in bone biology.
  • NELL-1 has potential dual uses as both a local bone- forming growth factor as well as a systemic osteogenic factor for osteoporosis.
  • the present study advances our knowledge of the local bone-forming effects of NELL-1 to a sheep osteoporotic model.
  • Therapeutic options for bone graft in the osteoporotic patient are limited. For example, autograft bone is less effective(48) and donor site fracture is more common(49).
  • BMP2 based substitutes induce direct stimulation of bone resorption(50, 51), leading to vertebral subsidence or collapse(52).
  • NELL-1 may be a future bone graft substitute well suited for the osteoporotic patient.
  • NELL-1 has several practical and theoretical benefits over other systemic therapies for osteoporosis.
  • NELL-1 has dual anabolic and anti-osteoclastic properties. Second, NELL-1 has documented tumor suppressive properties and its expression is lost in several carcinomas(53, 54). This lies in contrast to PTH, whose clinical use is limited by the risk of osteosarcoma as suggested by rat studies(55). Finally, NELL-1 has an excellent safety profile. Mice with constitutive Nell-1 overexpression have a normal lifespan, and are without abnormalities excepting the skeleton(20). Similarly, formal intravenous NELL-1 toxicity testing found no pathologic or biochemical abnormalities. Although the kinetics of unmodified NELL-1 protein involve rapid elimination, structural modification of NELL-1 may allow for sustained therapeutic serum levels. However, NELL-1 has known functions in neurogenesis(56), chondrogenesis(57), and vasculogenesis(58) - and a thorough study of these off-bone effects must be instituted before consideration of NELL-1 as an osteoporotic therapy.
  • NELL-1 deficiency induces age related osteoporosis in a rodent model.
  • our data suggest that NELL-1 modulates OB and OC activities through Integrinpi binding and subsequent Wnt/p-catenin signaling activation.
  • the therapeutic impact of our large and small osteoporotic animal studies demonstrates how NELL-1 may be used as a new anabolic, anti- osteoclastic treatment for osteoporosis in both local and systemic intervention.
  • demonstration of the ability of systemic NELL-1 to activate Wnt/p-catenin signaling will provide fundamental insights relevant to the development of NELL-1 based therapies for the treatment of multiple bone pathologies.
  • the Nell-1 6R/6R mouse genotypes were identified from DNA extracted from clipped tails of mutant and wildtype mice.
  • the extracted DNA was amplified using micro satellite primers D7Mit 315-L; TGATA AC AAA ACAGT CAGTA TGAAGC (SEQ ID NO: 1 ), D7Mit 315;
  • mice were housed in the light and temperature controlled UCLA vivarium, and provided water and feed ad libitum. Sheep were cared for at Colorado State University according to Veterinary Teaching Hospital (VTH) institutional guidelines. All sheep were fed a grass/alfalfa mix hay, and provided water and feed ad libitum. Whenever possible, animals were randomized with even distribution across treatment groups (including data presented in Figures 5 and 6).
  • Murine samples were analyzed by DXA, live microCT / 18 F PET, and high-resolution microCT.
  • DXA was performed as previously described on live Nell-1 +/+ and Nell-1 + 6R littermates as follows. Scans were performed under isoflurane sedation using a Lunar
  • F-Fluoride ion was produced at specific activities of ⁇ 37 TBq/mmol.
  • Using an ARC-approved isolated imaging chamber all animals underwent PET/CT scanning. Mice were injected with 18 F-Fluoride ion via tail vein using a 27-gauge needle. Animals were positioned in a multimodality, portable isolated bed system. Whole-body scans were performed with a 10-min acquisition time using a microPET FOCUS 200 system (Siemens Preclinical Solutions). Immediately afterward, a noncontrast-enhanced microCT study using a microCAT II (Siemens Preclinical Solutions) imaging system was used to scan animals with a 20-min acquisition time.
  • PET scan images were reconstructed using filtered backprojection and an iterative 3D reconstruction algorithm (maximum a posteriori [MAP]).
  • MicroCT images were created using Fledkamp reconstruction at 200 ⁇ ⁇ resolution.
  • 18 F-Fluoride and CT data were analyzed and quantified by AMIDE (A Medical Image Data Examiner).
  • AMIDE A Medical Image Data Examiner
  • a cylindrical region of interest (ROI) was drawn encompassing a single lumbar vertebrae of set dimensions.
  • Data for CT/PET images were compiled and analyzed by 3 independent, blinded reviewers.
  • N 6 mice per genotype for were analyzed at 18 mo. of age.
  • ROI region of interest
  • BV/TV Bone Volume / Tissue Volume
  • Trabecular analysis was performed on aged mouse spine specimens, for which ROIs were drawn to include each individual lumbar vertebral body excluding cortical bone. Reconstructions were performed using Osirix software, using coronal cross sectional images with a 0.25 ⁇ width. All quantitative and structural morphometric data use nomenclature described by the American Society for Bone and Mineral Research (ASBMR) Nomenclature Committee (62). MicroCT indices were compared to published norms to ensure accuracy of analysis and reporting(59-61). Whenever possible, all radiographic studies were performed and quantified in a blinded fashion.
  • ASBMR American Society for Bone and Mineral Research
  • Nell-1 +/+ d Nell-l +/6R littermates look nearly identical, with the exception of a variably lighter coat color among Nell-1 +/6R mice.
  • unblinding of radiographic technicians would have minimal potential for the introduction of bias, as all radiographic studies were highly routinized.
  • ROI construction was performed in a completely blinded fashion.
  • a visually osteopenic skeleton among Nell-1 +/6R mice in theory presented a potential for unblinding.
  • NMR nuclear magnetic resonance
  • immunohistochemical staining are either reported as the number of immunoreactive cells per B.Pm, or semi-quantitative measurement of relative total immunoreactivity.
  • ELISA based serum studies were performed using serum samples per manufacturer's instructions. Briefly, Nell-1 +/+ and Nell-1 +/6R littermates were bled via the retro-orbital sinus at 9am on the same day after overnight fasting. Serum was collected via centrifugation and stored prior to examination of serum ⁇ (Procollagen I N-terminal Propeptide), serum TRAP (Tartrate-Resistant Acid Phosphatase)-5b, and serum CTX (C-Terminal Telopeptide). All assays were obtained from ImmunoDiagnostic Systems, Inc. and performed according to manufacturer instructions.
  • BioDentTM Reference Point Indenter For biomechanical testing, two methods were independently used: the BioDentTM Reference Point Indenter and computerized simulation (finite element analysis, FEA).
  • Finite Element (biomechanical) Analysis was performed using micro-CT images converted to DICOM files using SKyScan Dicom Converter software (DicomCT application, Skyscan 1 172F, Skyscan). Tetrahedral three-dimensional mesh models were created using an VOI of either the lumbar spine (level 4) using ScanIP software (Simpleware Limited). A constant thickness of 0.54 mm was used for both VOIs.
  • mice were injected intraperitoneally with calcein
  • Lumbar vertebrae were dissected, fixed in 70% ethanol, dehydrated, and embedded undecalcified in methyl methacrylate. Coronal sections at 5 ⁇ ⁇ thickness were analyzed using the OsteoMeasure morphometry system (Osteometries, Atlanta, GA, USA).
  • the mineral apposition rate (MAR, ⁇ /d), the distance between the midpoints of the two labels divided by the time between the midpoints of the interval, were measured in unstained sections under UV light and used to calculate bone formation rate with a bone surface referent (BFR/BS, Bone formation rate per bone surface (BFR/BS) is the volume of mineralized bone formed per unit time and per unit bone surface.
  • BFR/BS Bone formation rate per bone surface
  • OB precursors were harvested by flushing the femoral marrow cavities and harvesting adherent cells on standard culture-treated plates.
  • Osteogenic differentiation medium was constituted with 10 mM ⁇ -glycerophosphate and 50 ⁇ ascorbic acid (Fisher Scientific, Pittsburgh, PA) in high-glucose DMEM, 10% fetal bovine serum (FBS), 1% penicillin / streptomycin (GIBCO, Invitrogen, Carlsbad, CA). To assess early to intermediate OB differentiation, alkaline phosphatase staining and
  • Calvarial discs were obtained using a 2 mm punch biopsy from the mid-parietal bone of postnatal day 7, CD-I , wildtype mice. Discs were processed by gentle removal of periosteal and dural tissues and stored in 100% ethanol to decellularize the tissues at 4°C.
  • the product of total bone marrow flush was cultured in 25 ng/mL recombinant mouse M-CSF (R&D Systems, Minneapolis, MN) overnight.
  • the non-adherent cells were then cultured on calvarial discs for resorption assays in phenol red- free MEM media, 10% FBS, 25 ng/mL rmM-CSF and 100 ng/mL recombinant soluble
  • RANKL (R&D Systems), with or without rhNELL-1 (0-1200 ng/mL).
  • SEM scanning electron microscopy
  • Accelerating voltage was used at 10 kV with a working difference varying between 4.8 and 5.7 mm. Samples were analyzed at a magnification of 200x.
  • the M2-10B4 cell line a clone derived from BMSCs from a (C57BL/6J X C3H/HeJ) Fl mouse, was purchased from American Type Culture Collection (ATCC # CRL-1972, Lot # 58696031 , Manassas, VA) and used for experiments within 6 months of mycoplasma contamination testing.
  • RAW264.7 cells were a kind gift from the laboratory of Dr. Tintut. Cells were maintained in growth medium (RPMI 1640 supplemented with 10% FBS, 1 mM sodium pyruvate, and 100 U/ml penicillin/streptomycin). RAW264.7 cells were cultured in aMEM + 10%) FBS. Wnt/p-catenin signaling was assayed by four methods:
  • the transduction plasmid for preparing lentiviral vector carrying the Runx2 Pl -EGFP expression cassette was prepared by substituting the CMV promoter in the pRRL-cPPT-CMV-X-PRE-SIN plasmid with the mouse Runx2 PI promoter.
  • the mouse Runx2 PI promoter was obtained by PCR of mouse genomic DNA (forward primer: GCGAATTACTCGAGAGCAGCACTGTTGCTCAGAA (SEQ ID NO: 3); reverse primer: GCGAATGCCCGGGTCACACAATCCAAAAAAGC (SEQ ID NO: 4)).
  • 293T cells were cotransfected with the transduction plasmids, the package plasmid pCMV-dR8.2-vprX and the envelope plasmid pCMV-VSVG.
  • the viral vectors were collected at 2 to 4 days post- transfection, filtered and concentrated, and the concentrations of viral vector were quantified by counting the core protein p24 by ELISA assay.
  • M2-10B4 cells were seeded in 24-well cell culture plates at 2* 10 4 cells/well 16 hours prior to infection. Viral vectors with p24 counts of 0.4 ⁇ g were added to each well in 24-well plates. 3 hours postinfection, the viral vectors were washed away and fresh medium was added to the cultures.
  • siRNA small interfering RNA
  • hBMSCs were obtained by marrow flush and harvesting adherent cells on standard culture-treated plates. Cells were expanded in MEM + 20% FBS on 10 mm cell culture plates. All experiments were performed in triplicate for each patient sample.
  • hBMSCs were transduced with Ad-Nell- 1 or Ad-GFP at MOI 50 pfu/cells. First, cells were either seeded for osteogenic differentiation assays (2x10 4 cells/well) in 24 well plates.
  • Osteogenic differentiation medium consisted of 50 ⁇ g/ml ascorbic acid and 10 mM ⁇ -glycerophosphate. Staining for AR was performed at 1 1 days of differentiation. Next, Wnt/p-catenin signaling activity was assayed on the gene and protein level. mRNA analysis was performed 3 days after transduction. For Western blot analysis, cell lysate was collected 3 days after transduction. Nuclear and cytoplasmic fractions were extracted using NE-PER Nuclear and Cytoplasmic Extraction Kit (Thermo Scientific, Rockford, IL). Western blot was performed with anti-P-catenin (610153, BD Biosciences) and anti ⁇ -actin (sc-1616, Santa Cruz). Quantification was performed using Image Pro. Taqman primers were used for human NELL-1 (Hs00196243_ml) and human GAPDH (Hs99999905_ml). All experiments using human BMSC were performed in triplicate wells.
  • thermal shift assay was performed using the 7300 Real Time PCR System (Applied Biosy stems, CA). Prior to use, the environmentally sensitive fluorescent dye SYPRO Orange stock solution in DMSO (5,000 x, Sigma) was diluted 1 : 125 in PBS.
  • Ovariectomy was performed on B6 mice with age-matched Sham controls at 12 weeks of age, using a 5mm dorsal incision. Anesthesia was performed with Isoflurane (3-5% for induction, 1.5-2% for maintenance). Pre-operative analgesia (Buprenorphine) was given once before surgery and twice daily for two days postoperative. Five weeks post ovariectomy (OVX), rhNELL-1 delivery by intravenous injection was instituted, by lateral tail vein injection using a 25 gauge needle. Animals were assigned to treatment groups by simple randomization. Drug administrators were completely blinded as to treatment groups. The dosage of rhNELL-1 (1.25 mg/kg) was obtained from pilot studies examining a wide range of doses. PBS served as vehicle control.
  • MicroCT indices were compared to published norms to ensure accuracy of analysis and reporting (59-61). Additionally, postmortem analysis of uteri weight was obtained to confirm OVX. In select experiments, FITC conjugation was employed to determine the pharmacokinetics of rhNELL-1 systemic delivery.
  • Osteoporosis was induced through ovariectomy (OVX), controlled diet, and steroid induction in eight adult ewes.
  • Post-ovariectomy three intramuscular injections of 500 mg methylprednisolone acetate (Depomedrol) were administered at three-week intervals starting two weeks post-operation.
  • Special low calcium and low vitamin D osteoporosis diets were formulated in cooperation with Purina LabDiet and were fed to the sheep for eight months post-ovariectomy. Based on pre-established inclusion criteria, of eight sheep in total, the six sheep with highest response to osteoporotic induction were used for further study. Successful induction of osteoporosis was confirmed using DXA imaging and quantification.
  • P-TCP ⁇ -tricalcium phosphate
  • DXA, CT and microCT, Finite Element Analysis (FEA), histology, and histomorphometry were performed by DXA, CT and microCT, Finite Element Analysis (FEA), histology, and histomorphometry.
  • DXA scans were performed pre- and post-induction (Konica Minolta mc5430DL).
  • a Philip's GEMINI TF Big Bore CT machine (0.8 mm thickness) was used to analyze bone formation post-operative, monthly until sacrifice at 3 months. Although serial live animal imaging was performed, data evaluation was performed at the study endpoint (no interim evaluation of the results performed).
  • Post-mortem, high- resolution microCT scanning of individual vertebrae was performed as per mouse studies. Cortical and trabecular analysis were performed on post-mortem individual sheep vertebrae.
  • Cortical measurements were obtained per vertebral body either assessing the surface of injection or the opposing cortical surface.
  • Trabecular measurements were made using an OI excluding cortical bone.
  • Finite Element (biomechanical) Analysis (FEA) was performed using micro-CT images converted to DICOM files using SKyScan Dicom Converter software (DicomCT application, Skyscan 1172F, Skyscan). Tetrahedral three-dimensional mesh models were created by drawing a rectangular VOI directly underneath injection tract, using ScanIP software (Simpleware Limited).
  • Finite element analyses were performed using the ABAQUS software (Dassault Systemes) with boundary conditions set as encastre, constrained in all directions. Next, we applied a uniform compressive pressure of 0.5 MPa on the superior surface of the spine, to reproduce human intradiscal pressure experienced in relaxed standing. The von Mises stress experienced and total strain energy of the samples were analyzed. All radiographic analyses, including ROI construction, were performed in a blinded fashion. The significant and visually observed anabolic effect of rhNELL-1 in theory presented a potential for unblinding.
  • tissues were formalin-fixed, resin-embedded and stained with Hematoxylin and Eosin (H&E), Goldner's Modified Trichrome (GMT), and Von Kossa-MacNeaPs Tetrachrome. Histological specimens were analyzed using the Olympus BX51 microscopes and images acquired using MicroFire digital camera with Picture Frame software (Optronics, Goleta, CA). Histomorphometry was performed as per mouse studies.
  • H&E Hematoxylin and Eosin
  • GTT Goldner's Modified Trichrome
  • Von Kossa-MacNeaPs Tetrachrome Von Kossa-MacNeaPs Tetrachrome. Histological specimens were analyzed using the Olympus BX51 microscopes and images acquired using MicroFire digital camera with Picture Frame software (Optronics, Goleta, CA). Histomorphometry was performed as per mouse studies.
  • Quantitative data are expressed at mean ⁇ SEM unless otherwise described, with *P ⁇ 0.05 and **P ⁇ 0.01 considered significant.
  • a Shapiro-Wilk test for normality was performed on all datasets. Homogeneity was confirmed by a comparison of variances test.
  • Parametric data was analyzed using an appropriate Student's t-test when two groups were being compared, or a one-way ANOVA was used when more than two groups were compared, followed by a post-hoc Tukey's test to compare two groups.
  • Nonparametric data was analyzed with a Mann- Whitney U test when two groups were being compared or a Kruskal-Wallis one-way analysis when more than two groups were compared.
  • Wnt proteins are lipid-modified and can act as stem cell growth factors. Nature. 2003 May 22;423(6938):448-52.
  • mice have reduced expression of extracellular matrix proteins causing cranial and vertebral defects.
  • Human molecular genetics 2006 Apr 15; 15(8): 1329-41.
  • Bikle DD Integrins, insulin like growth factors, and the skeletal response to load. Osteoporos Int. 2008 Sep;19(9): 1237-46.
  • Table 6 Table 7. List of EL1SA assays used.
  • Ad-Nell- 1 Adenoviral Nell-1

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Veterinary Medicine (AREA)
  • Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Marine Sciences & Fisheries (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne une composition pour affection osseuse et leurs procédés de fabrication et d'utilisation. La composition comprend un agent ostéoinducteur, et l'agent ostéo-inducteur est efficace pour augmenter le nombre de cellules et l'activité de l'ostéoblaste (OB) et pour diminuer le nombre de cellules et l'activité de l'ostéoclaste (OC).
PCT/US2016/035705 2015-06-04 2016-06-03 Composition pour les os et ses procédés de fabrication et d'utilisation WO2016196925A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201562171167P 2015-06-04 2015-06-04
US62/171,167 2015-06-04
US201562175026P 2015-06-12 2015-06-12
US62/175,026 2015-06-12

Publications (2)

Publication Number Publication Date
WO2016196925A1 true WO2016196925A1 (fr) 2016-12-08
WO2016196925A9 WO2016196925A9 (fr) 2017-01-05

Family

ID=57441765

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/035705 WO2016196925A1 (fr) 2015-06-04 2016-06-03 Composition pour les os et ses procédés de fabrication et d'utilisation

Country Status (1)

Country Link
WO (1) WO2016196925A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017160855A1 (fr) 2016-03-15 2017-09-21 The Regents Of The University Of California Conjugué thérapeutique de ciblage osseux et méthodes de fabrication et d'utilisation de celui-ci

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080193515A1 (en) * 2006-12-06 2008-08-14 Shaughnessy John D Overexpression of Wnt ligands and treatment of lytic bone diseases
US20120244128A1 (en) * 2009-08-20 2012-09-27 The Regents Of The University Of California Perivascular Stem Cell Composition For Bone
WO2015009991A2 (fr) * 2013-07-19 2015-01-22 Cayman Chemical Company, Inc. Procédés, systèmes et compositions pour activer la croissance osseuse

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080193515A1 (en) * 2006-12-06 2008-08-14 Shaughnessy John D Overexpression of Wnt ligands and treatment of lytic bone diseases
US20120244128A1 (en) * 2009-08-20 2012-09-27 The Regents Of The University Of California Perivascular Stem Cell Composition For Bone
WO2015009991A2 (fr) * 2013-07-19 2015-01-22 Cayman Chemical Company, Inc. Procédés, systèmes et compositions pour activer la croissance osseuse

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
JAMES, A, W ET AL.: "NELL-1 in the treatment of osteoporotic bone loss", NATURE COMMUNICATIONS, vol. 6, no. 7362, 17 June 2015 (2015-06-17), pages 1 - 14, XP055335319 *
JAMES, A. W.: "Review of Signaling Pathways Governing MSC Osteogenic and Adipogenic Differentiation", SCIENTIFICA, vol. 2013, 2013, pages 1 - 17, XP055335316 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017160855A1 (fr) 2016-03-15 2017-09-21 The Regents Of The University Of California Conjugué thérapeutique de ciblage osseux et méthodes de fabrication et d'utilisation de celui-ci
EP3454913A4 (fr) * 2016-03-15 2019-11-27 The Regents of the University of California Conjugué thérapeutique de ciblage osseux et méthodes de fabrication et d'utilisation de celui-ci

Also Published As

Publication number Publication date
WO2016196925A9 (fr) 2017-01-05

Similar Documents

Publication Publication Date Title
James et al. NELL-1 in the treatment of osteoporotic bone loss
JP7209382B2 (ja) 心不全の治療用組成物
Liu et al. Postmenopausal osteoporosis is associated with the regulation of SP, CGRP, VIP, and NPY
Pallafacchina et al. Role of satellite cells in muscle growth and maintenance of muscle mass
Xue et al. Myokine Irisin promotes osteogenesis by activating BMP/SMAD signaling via αV integrin and regulates bone mass in mice
US20150352131A1 (en) Compositions and Methods for the Prevention and Treatment of Osteolysis and Osteoporosis
Feng et al. Systemic administration of sclerostin monoclonal antibody accelerates fracture healing in the femoral osteotomy model of young rats
Siddiqui et al. Catabolic effects of human PTH (1–34) on bone: requirement of monocyte chemoattractant protein-1 in murine model of hyperparathyroidism
Zhen et al. An antibody against Siglec-15 promotes bone formation and fracture healing by increasing TRAP+ mononuclear cells and PDGF-BB secretion
US20030109537A1 (en) Methods and materials for treating bone conditions
Lau et al. Conditional deletion of IGF-I in osteocytes unexpectedly accelerates bony union of the fracture gap in mice
Wu et al. Specific inhibition of FAK signaling attenuates subchondral bone deterioration and articular cartilage degeneration during osteoarthritis pathogenesis
CN113347990A (zh) 膜联蛋白在预防和治疗肌膜损伤中的用途
Yang et al. Collagen type V a2 (COL5A2) is decreased in steroid-induced necrosis of the femoral head
Ding et al. Lack of endogenous parathyroid hormone delays fracture healing by inhibiting vascular endothelial growth factor‑mediated angiogenesis
Xu et al. Myeloid‐derived growth factor (MYDGF) protects bone mass through inhibiting osteoclastogenesis and promoting osteoblast differentiation
WO2016196925A1 (fr) Composition pour les os et ses procédés de fabrication et d'utilisation
Liu et al. Osteoprotegerin deficiency leads to deformation of the articular cartilage in femoral head
Sun et al. High bone microarchitecture, strength, and resistance to bone loss in MRL/MpJ mice correlates with activation of different signaling pathways and systemic factors
Ali et al. The bone-protective benefits of amino-conjugated calcium in an ovariectomized (OVX) rat model
Gao et al. Impaired bone defect and fracture healing in dystrophin/utrophin double-knockout mice and the mechanism
Piao et al. The Bcr-Abl inhibitor DCC-2036 inhibits necroptosis and ameliorates osteoarthritis by targeting RIPK1 and RIPK3 kinases
Li et al. Progranulin deficiency associates with postmenopausal osteoporosis via increasing ubiquitination of estrogen receptor α
Yao et al. Glucocorticoid-induced bone loss can be reversed by the actions of PTH and Risedronate on different pathways for bone formation and mineralization
Noreldin et al. Emerging Therapeutic Potential of Short Mitochondrial-produced Peptides for Anabolic Osteogenesis

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16804521

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16804521

Country of ref document: EP

Kind code of ref document: A1