WO2016195224A1

WO2016195224A1 - Transgenic animal model with knock-out zc4h2 gene, and use thereof

Info

Publication number: WO2016195224A1
Application number: PCT/KR2016/003348
Authority: WO
Inventors: 김철희; 유경원; 이. 슈와르츠찰스; 박두상
Original assignee: 충남대학교산학협력단
Priority date: 2015-06-04
Filing date: 2016-03-31
Publication date: 2016-12-08
Also published as: KR20160143913A; KR101750893B1

Abstract

The present invention relates to a transgenic animal model with a knock-out ZC4H2 gene, and a use thereof. Following preparation of a zebrafish with a knock-out ZC4H2 gene, it was observed that the zebrafish with a knock-out ZC4H2 gene has movement disorder symptoms, and the expression of V2a interneurons, GABAneric neurons and V2b inhibitory neurons was reduced. When the ZC4H2 gene in the zebrafish with a knock-out ZC4H2 gene was restored, it was confirmed that the expression of GABAnergic neurons was restored, and thus the zebrafish with a knock-out ZC4H2 gene of the present invention can be usefully used in a method for screening drugs associated with movement disorders including epilepsy.

Description

Transformed animal model knocked out ZC4H2 gene and use thereof

The present invention relates to a transgenic animal model knocking out the ZC4H2 gene and its use.

Representative diseases causing movement disorder due to neuronal abnormalities include parkinson's disease and epilepsy.

Parkinson's disease is a neurodegenerative disease, and neurodegenerative disease refers to a disease in which nerve cells die due to some cause and cause abnormal brain function. Parkinson's disease, Parkinson's syndrome, etc. are difficult to distinguish the meaning, but the typical symptom is stable tremor, hand tremor, muscle stiffness, postural instability. In Korea, a large-scale study on Parkinson's disease itself is insufficient. The prevalence rate is 374 in 100,000 people over 18 years old and 1.47% in 60 years old.

Meanwhile, another disease, epilepsy or epilepsy, is one of chronic neurological disorders, and the rapid development of modern medicine has changed the concept of epilepsy (epilepsy) from past incurable chronic disease to a curable disease.

Epilepsy (epilepsy) is at the heart of the epileptic seizure (epileptic seizure), epileptic seizure seizures are localized brain lesions, systemic metabolic disorders, drug addiction, hypoxia, head trauma or severe overwork and sleep deprivation It is a central symptom that occurs. Interstitial seizures are defined as neurophysiologically abrupt and disordered cerebral cortical cells, which can be easily understood by clinical seizure EEG findings. It is not yet clear why neuronal cells in normal function abruptly enter into an abnormal state of excitement, but it is understood that the regulation of excitation and suppression for normal brain function is caused by a variety of causes, which are experimental. This is supported by the phenomenon that interstitial seizures occur when the function of excitatory neurotransmitters is increased or the function of inhibitory neurotransmitters is suppressed.

The ZC4H2 gene, which has been identified as the causative gene of Miles-Carpenter Syndrome (MCS), one of the X-linked intellectual disability (XLID), has been reported to exhibit dyskinesia such as epilepsy during deficits. However, no clear mechanism has been identified.

Epilepsy has a high incidence in childhood and old age, and epilepsy patients occur at a rate of about 1% to 1.5% of the world's population. In particular, the incidence rate reported in developing countries and developing countries is more than 100 per 100,000 people. While it is relatively high, it is reported to be relatively low in developed countries such as 40 to 70 people. In particular, it is estimated that there are about 400,000 patients in Korea.

Transgenic animals are animals that express their intended genotype by artificially inserting or removing external genes, and can be useful for basic research to identify the role of specific genes in living organisms. . In other words, by inserting or deleting a gene whose function is suspected, and observing how the effect appears, the physiological function mediated by the gene can be inferred. In addition, transgenic animals can be used as a model of human disease, and are very useful for identifying the cause of disease, the progress of disease, and the effects or side effects of potential therapeutic drugs. Currently, transgenic mice, zebrafish, and the like have been developed for diseases such as dementia, cancer, heart disease, and genetic diseases.

A zebrafish is transparent in embryonic embryos, in vitro fertilized, can easily acquire large numbers of fertilized eggs, and develops so rapidly that most tissues and organs are formed in one day. In addition, the genetic information of the entire genome has been revealed and can be easily retrieved through the zebrafish database, and because it has the advantage that the composition of the genome is similar to that of humans, it is possible to analyze the function of human genes and target natural products or compounds. It has been usefully used for screening biomodulators. Due to the above advantages, research on transgenic zebrafish has been very active, and the zebrafish transformation technology is easily applied to mammalian technology. Zebrafish embryos are readily available in large numbers, transparent and easy to handle, and have the advantage that various vectors such as retroviral vectors or transposons can be applied.

Therefore, the present inventors are trying to develop a human disease model that can be easily and quickly accessed, and the ZC4H2 gene knockout zebrafish has symptoms of motor disorders very similar to those of Miles-Carpenter Syndrome patients. The expression of neurons and V2b inhibitory neurons was observed to be reduced, and the present invention was completed by confirming that the expression of GABA neurons was restored when ZC4H2 gene was restored to ZC4H2 gene knockout zebrafish.

It is an object of the present invention to provide a transgenic animal model knocking out the ZC4H2 gene and its use.

In order to achieve the above object, the present invention provides a transgenic animal in which the ZC4H2 gene is knocked out.

In addition, the present invention provides a transgenic fertilized egg knocked out ZC4H2 gene.

The present invention also provides a transgenic sperm in which the ZC4H2 gene is knocked out.

In addition, the present invention,

1) treating the test compound to the transgenic animal of the present invention; And

2) provides a method for screening a disease drug related to a movement disorder comprising comparing the transgenic animal treated with the test compound of step 1) with the untreated control to determine whether symptoms are recovered.

In addition, the present invention,

1) preparing a ZC4H2 gene knock-out construct;

2) introducing the construct of step 1) into the fertilized egg; And

3) It provides a method for producing a transgenic animal comprising the step of selecting a ZC4H2 gene knockout embryo in the fertilized egg of step 2).

Hereinafter, the present invention will be described in detail.

The present invention provides a transgenic animal in which the ZC4H2 gene is knocked out.

The ZC4H2 gene is preferably composed of SEQ ID NO: 9, but is not limited thereto.

In addition, the transgenic animal is characterized by having a disorder related to movement disorder.

In addition, the movement-related disorders include epilepsy including posttraumatic epilepsy, Parkinson's disease, pediatric epilepsy, Miles-Carpenter Syndrome, psychosis, migraine, cerebral anemia, Alzheimer's disease, Huntington's chorea, obsessive dementia, obsessive compulsive reaction Abnormalities (OCD), neuropathic defects associated with AIDS, sleep disorders (including insomnia and sleep attacks), convulsions such as Gilles de la Tourette's syndrome, traumatic cerebral damage, tinnitus, neuralgia, neuropathic pain Neurological activity, multiple sclerosis (MS), motor neuron disease, ataxia, myopathy (convulsiveness), temporomandibular joint dysfunction and muscular dystrophy, which cause neurological health defects in diseases such as toothache, cancer pain and diabetes It may be any one selected from the group consisting of (ALS), according to a specific embodiment of the present invention epilepsy, convulsions, seizures, Parkinson's syndrome and children Witness the EEG is characterized.

In addition, the transgenic animal of the manufacturing method is preferably zebrafish, but is not limited thereto, and all animals including monkeys, pigs, horses, cows, sheep, dogs, cats, mice, mice, rabbits, etc. Can be.

In a specific embodiment of the present invention, the inventors found that patients with Miles-Carpenter Syndrome (MCS) disease have a common ZC4H2 mutant gene based on a clinical report, and based on this, polymorphism analysis and expression. Tissue analysis confirmed the variation and expression of the ZC4H2 gene. Subsequently, the gene was isolated from zebrafish, and the homology between amino acid sequences with humans and mice was analyzed (see FIG. 1), and the ZC4H2 gene was mainly expressed near the developing CNS (see FIG. 2). ZC4H2 Gene knockout zebrafish were fabricated (see FIG. 3) and observed. ZC4H2 knockout zebrafish showed excessive jaw muscle stiffness compared to normal zebrafish, with abnormally active pectoral fin movement, and human exotropia Similar to the symptoms, the eye was found to be abnormally positioned (see FIG. 4). However, ZC4H2 gene knockout zebrafish confirmed the formation of normal motor neurons and axons as well as normal zebrafish (see FIG. 5). It was observed that the expression of V2a interneurons, GABA neurons, and V2b inhibitory neurons was reduced due to ZC4H2 gene knockout (see FIG. 6). When the ZC4H2 gene was restored to ZC4H2 gene knockout zebrafish, the expression of GABA neurons was decreased. Confirmed recovery (see FIG. 7). In addition, ZC4H2 gene knockout zebrafish was treated with retigabine approved as an epilepsy treatment, it was confirmed that abnormally active movement of the jaw and pectoral fin is inhibited (see FIGS. 8 and 9). Therefore, the present invention has prepared a ZC4H2 gene knockout transformed zebrafish showing symptoms similar to epilepsy, convulsions and seizures, and can be usefully used for screening related disease drugs using the same.

The present invention provides a transgenic fertilized egg knocked out ZC4H2 gene.

The present invention provides a transgenic sperm in which the ZC4H2 gene is knocked out.

The present invention,

The transgenic animal of step 1) is preferably zebrafish, but is not limited thereto, and may include all animals including monkeys, pigs, horses, cattle, sheep, dogs, cats, mice, mice, rabbits, and the like. have.

In addition, the test compound may be selected from the group consisting of natural compounds, synthetic compounds, RNA, DNA, polypeptides, enzymes, proteins, ligands, antibodies, antigens, metabolites of bacteria or fungi, and bioactive molecules. It is not limited.

In addition, the method of determining whether symptoms are recovered by comparing the transgenic animal treated with the test compound of step 2) with the untreated control, for example, PCR method based on tail genomic DNA or abnormal symptoms of knockout embryos The method of discriminating with the naked eye is mentioned, and it is easy to distinguish abnormal symptoms visually.

In a specific embodiment of the present invention, the ZC4H2 gene knockout zebrafish produced by the method of the present invention has movement disorder symptoms similar to those in human patients, and the knockout zebrafish is treated with epilepsy treatment retigabine 5 It was confirmed that seizure symptoms were suppressed in the group treated with the concentration of μM (see FIGS. 8 and 9). Therefore, the knockout zebrafish of the present invention can be usefully used for drug screening of dyskinesia-related diseases such as epilepsy and Parkinson's disease.

The present invention,

1) preparing a ZC4H2 gene knock-out construct;

2) introducing the construct of step 1) into the fertilized egg; And

ZC4H2 gene of step 1) is preferably composed of SEQ ID NO: 9, but is not limited thereto.

In addition, the knockout construct of step 1) preferably comprises a gene shear, the gene shear is ZFN (zinc-finger nuclease), TALEN (transcription activator-like effector nuclease) and CRISPR / Cas9 (clustered regulary interspaced short palindromic repeats / CRISPR-associated protein-9), but preferably any one selected from the group consisting of, according to the embodiment of the present invention was used to select TALEN. In addition, the mutagenic transporter including the TALEN preferably knocks out ZC4H2, but includes all cases in which only a part of the sequence is knocked out as well as the entire ZC4H2 sequence.

In addition, the fertilized egg of step 2) is preferably a zebrafish (zebrafish) fertilized egg, but is not limited to this, all animals including monkeys, pigs, horses, cattle, sheep, dogs, cats, mice, mice, rabbits, etc. Any derived fertilized egg can be used.

In addition, the method of introducing the construct of step 2) into the fertilized egg is a method of using the microinjection (microinjection), electroporation (electroporation), particle bombardment (sperm bombardment), sperm after preparing the gene construct (sperm-mediated gene transfer), viral infection (viral infection), direct muscle injection (direct muscle injection), insulators (insulator) and transposons (transnas) can be selected and appropriately selected. In the present invention, the expression vector was transformed into the zebrafish embryo by microinjection.

In addition, the step of selecting the ZC4H2 gene knockout embryo of step 3) may be selected according to various methods well known in the art. Examples of such a screening method include a PCR method using a tail genomic DNA as a template or a method of visually discriminating abnormal symptoms of knockout embryos, and it is preferable to visually identify abnormal symptoms.

In addition, the method may further include the step of preparing a homozygous transformant by crossing the wild type transgenic animal prepared by the method of the present invention.

In a specific embodiment of the present invention, the inventors found that patients with Miles-Carpenter Syndrome (MCS) disease have a common ZC4H2 mutant gene based on a clinical report, and based on this, in zebrafish in which the ZC4H2 gene was knocked out Similar to the symptoms of epilepsy in patients, abnormal stiffness and unstoppable movements of the jaw and pectoral muscles (hyperactivity) and abnormal eye positions (see strabismus) (see Fig. 4), ZC4H2 gene knockout transgenic zebrafish with very similar epilepsy, convulsion and seizure symptoms were constructed.

According to the present invention, the ZC4H2 gene knockout zebrafish was produced, and the ZC4H2 gene knockout zebrafish had dyskinesia, and the expression of V2a interneurons, GABA neurons, and V2b inhibitory neurons was reduced. When the ZC4H2 gene knockout zebrafish was restored to the ZC4H2 gene, the expression of GABA neurons was restored, and thus, the ZC4H2 gene knockout zebrafish of the present invention can be usefully used for drug screening methods related to motor disorders. have.

Figure 1 shows a comparison of the ZC4H2 amino acid sequence of human, mouse and zebrafish.

Figure 2 is a diagram showing the temporal and spatial expression of ZC4H2 in zebrafish.

2A and 2B show temporal and spatial expression patterns of ZC4H2 in 48 hpf zebrafish.

2C, 2D and 2E are cross-sectional views of FIG. 2B.

FIG. 3 is a diagram illustrating a ZC4H2 knockout construct fabrication design using transcription activator-like effector nuclease (TALEN).

3A shows the TALEN-mediated mutation target site of ZC4H2 exon2.

3B shows TALEN-mediated mutant lesions.

Figure 3C is a diagram showing the PCR results for determining the ZC4H2 gene knockout zebrafish through electrophoresis results.

Figure 4 is a diagram showing the hyperactivity of the ZC4H2 gene knock-out zebrafish.

4A and 4B show aspects of the degree and frequency of jaw movement in normal and ZC4H2 gene knockout zebrafish.

4C and 4D show abnormal visual movement of normal and ZC4H2 gene knockout zebrafish.

4E and 4F show abnormal pectoral fin movement of normal and ZC4H2 gene knockout zebrafish.

Figure 5 shows the presence of motor neurons of ZC4H2 normal and gene knockout zebrafish.

5A and 5B show the expression of the isl1 gene that labels motor neurons.

5C, 5D, 5E and 5F show the expression of Znp1 protein that labels motor neurons and normal axons.

6 is a diagram showing the neuronal expression patterns of normal and ZC4H2 gene knockout zebrafish.

6A, 6B, 6C and 6D show expression of vsx2 and vsx1 labeling V2a interneurons and V2a / b precursors.

Figures 6E and 6F show the expression of nkx6.1 and dbx2 that label adjacent sites of the ventral neural progenitor domains.

6G and 6H show expression of gad1 labeling GABA neurons.

6I and 6J show the expression of gata3 labeling V2b inhibitory interneurons.

6K and 6L show the expression of glyt2a labeling glycine neurons.

6M and 6N show the expression of vglut2.1 labeling glutamate excitatory neurons.

7 is a diagram showing the expression of neurons when the ZC4H2 gene is restored to normal and ZC4H2 gene knockout zebrafish.

7A and 7B show gad1 expression of normal zebrafish and ZC4H2 gene knockout zebrafish.

7C, 7D, 7E, and 7F show gad1 expression when ZC4H2 gene is restored to ZC4H2 gene knockout zebrafish.

7G, 7H, 7I, 7J, 7K, and 7L are quantitative analysis results of gad1 expression when ZC4H2 gene knockout was restored in ZC4H2 gene knockout zebrafish and when it was not restored.

8 is a diagram showing the control effect on abnormal movement of the jaw muscle when the epilepsy treatment retigabine in normal and ZC4H2 gene knockout zebrafish.

8A and 8B are diagrams showing jaw muscle movements when normal zebrafish were treated with and without retigabine.

8C and 8D show jaw muscle movements with and without retigabine in ZC4H2 gene knockout zebrafish.

8E is a diagram showing the results of quantitative analysis of jaw muscle movements when treated with and without retigabine in normal and ZC4H2 gene knockout zebrafish.

Figure 9 is a diagram showing the control effect on abnormal pectoral fin movement when retigabine treatment in normal and ZC4H2 gene knockout zebrafish.

9A and 9B are diagrams showing pectoral fin movements with and without retigabine in normal zebrafish.

9C and 9D show pectoral fin movement with and without retigabine in ZC4H2 gene knockout zebrafish.

Figure 9E shows the results of quantitative analysis of changes in pectoral fin movement with and without retigabine in normal and ZC4H2 gene knockout zebrafish.

Hereinafter, the present invention will be described in detail by Examples and Experimental Examples.

However, the following Examples and Experimental Examples are only illustrative of the present invention in detail, and the content of the present invention is not limited by the Examples and Experimental Examples.

<< 실시예Example 1> 임상 보고서를 바탕으로 1> Based on clinical report ZC4H2ZC4H2 돌연변이 유전자 확인 Mutation Gene Identification

To identify the causal gene of Miles-Carpenter Syndrome (MCS), one of the X-linked intellectual disability (XLID), 14 people with MCS disease in K8070, K8615, K9333 and K9611 families Men were examined for symptoms of disease and genetic defects.

Clinical evaluation shows that over 50% of men with MCS disease have intellectual disability, slow speech, small stature, microcephaly, distal muscle weakness, and abnormal feet Rocker-bottom, pes planus, club foot, knee or elbow contractures, narrow shoulders, high torso, ptosis, exotropia, long philtrum ), Highly arched palate, spinal curvature (kyphosis, scoliosis, lordosis), hypotonia, drooling, and Symptoms such as cerebral palsy spasticity.

Therefore, the following experiment was performed to identify causative genes and gene mutations in the MCS disease subjects.

Specifically, Exon capture and deep sequencing were performed on 718 genes of the X80 chromosome of the K8070 family.

Screening of the Xq12 region associated with XLID of X86 chromosome of K8615 family was performed using M13 tagged ZC4H2 exon primer, and PCR product was amplified and purified by USB ExoSap. The purified PCR product was performed using a BIGDye Terminator v3.1 Cycle sequencing Kit (Life Technologies) using M13 primer and ABI 3730, DNASTAR (DNASTAR) Sequence data were analyzed by SEQMAN. R213W conversion was found in affected male patients and tested in all families.

For genetic analysis of the K9333 family, an Illumina sequencing library was constructed from gDNA samples of 82 XLID male patients with the Truseq DNA Sample Preparation Kit. Exons of the X chromosome were concentrated using the Agilent SureSelect X chromosome exome kit. Each library was native barcoded and sequenced on the Illumina HiSeq2000 platform using 75-bp or 100-bp pair-end modules. Reorganization and base recalibration of INDEL were performed using GATK. The final mutation results were pretreated by removing the zero range of variation in one strand and the variation close to another variation (<10 bp) in the same sample. Potential XLID mutations were identified using sib-pair comparison filters. Given the scarcity of XLIDs, the filters were assumed to be rare in unique XLID variations and shared only among affected family members. Variation results in sequencing were found to filter out variations shared between related samples in the population, while those shared between irrelevant samples were removed. In addition, shared mutations in 162 male samples (MCS unaffected group) from 1000 genome projects were also removed. The filter reduced the total number of mutations from 1774 ± 240 variations per sample to 31 ± 5 variations per sample and facilitated the identification of potential disease-causing mutations.

For genetic analysis of the K9611 family, DNA from all generations of the family was extracted. Genetic associations were identified between the minimally spaced 70 mb of DXS993 (Xp11.4) and DXS8055 (Xq23). Considering the large spacing and the number corresponding to the candidate genes, the complete genomics (Sequencing-by-ligation method) described by Drmanac et al. Whole genome diploid sequencing was performed at Complete Genomics Inc. Mountain View, CA, USA.

Variations in ZC4H2 were identified using Sanger Sequencing in the second sample of gDNA, and other members of the four families were also sequenced.

<< 실시예Example 2> 다형성 분석(Polymorphism analysis) 2> Polymorphism Analysis

ZC4H2 c.484T> A mutations consisting of allele specific amplification (ASO) and normal control (ZNF711) screening were performed using the primers in Table 1 below. The ZC4H2 product is 177 bp and the ZNF711 product is 498 bp.

서열 번호Sequence number	서열order
ZC4H2 ASO K8070F(서열 번호 1)ZC4H2 ASO K8070F (SEQ ID NO: 1)	ATGGCCCATGTGGAGGAtCA ATGGCCCATGTGGAGGAtCA
ZC4H2 ASO K8070R(서열 번호 2)ZC4H2 ASO K8070R (SEQ ID NO: 2)	CACTACCACAGCCTGCACTGA CACTACCACAGCCTGCACTGA
ZNF711 ex 4AF(서열 번호 3)ZNF711 ex 4AF (SEQ ID NO: 3)	TTCCTGGTTGTTTGATTTTTTCCTGGTTGTTTGATTTT
ZNF711 ex 4AR(서열 번호 4)ZNF711 ex 4AR (SEQ ID NO: 4)	ACAAGGTCAGCCACGAAAACACAAGGTCAGCCACGAAAAC

<< 실시예Example 3> 3> 제브라피쉬Zebrafish 사육 및 관리 Breeding and Care

Zebrafish were maintained under the same reference conditions as known literature. Wild type zebrafish were purchased from an aquarium (Seoul Aquarium, Daejeon), and the food was bred by hatching commercial brine shrimp. The zebrafish were turned on at a temperature of 28.5 ° C. from 9 am to 10 pm and were bred under other time-out conditions. The fertilized eggs obtained in the zebrafish were washed with egg water (egg water, sea salts, 280 g) and generated in a petri dish. Then, the developmental process was observed through an anatomical microscope, and embryos were selected according to morphological changes over time and fixed with 4% paraformaldehyde / PBS. All experiments related to zebrafish were conducted under the approval of the Institutional Animal Care and Use Committees of Chungnam National University.

<< 실시예Example 4> 4> ZC4H2ZC4H2 유전자 발현 확인 Gene expression confirmation

<4-1> <4-1> 제브라피쉬로부터From zebrafish ZC4H2ZC4H2 유전자 분리 Gene isolation

The zebrafish ZC4H2 gene was isolated from the 24 hpf zebrafish cDNA library, first cloned into the pGEM-T Easy Vector System (Promega, A1360) and sub-cloned using EcoRI as the pCS2 + expression vector It was. Primers used for PCR are shown in Table 2:

서열 번호Sequence number	서열order
zc4h2 F(서열 번호 5)zc4h2 F (SEQ ID NO: 5)	ATGGCGGCGAGCAAGAGATAAATGGCGGCGAGCAAGAGATAA
zc4h2 R(서열 번호 6)zc4h2 R (SEQ ID NO: 6)	TGTTACTCGTCAGGTTTTCTCTTGTGTTACTCGTCAGGTTTTCTCTTG

<4-2> <4-2> ZC4H2ZC4H2 유전자의 시간적 및 공간적 발현양상 확인 Identify temporal and spatial expression patterns of genes

In order to confirm the temporal and spatial expression patterns of ZC4H2 gene, whole-mount in situ hybridization was performed.

Specifically, antisense digoxigenin-labeled RNA probes of ZC4H2 were synthesized according to the manufacturer's protocol using DIG and Fluorescein RNA Labeling Mix, Roche catalog number 11277073910, 11685619910. . After fertilization through light microscopy, appropriate timely fertilized eggs were added to 4% paraformaldehyde / PBT and fixed at 4 ° C. for at least 12 hours. More than 20 hours after fertilization, the fertilized egg was removed so that the tail was not bent after removing the chorion with the tweezers, and the fertilized egg was removed before the fertilization. In addition, since 0.2 mM PTU (phenylthiourea) / embryonic water was added from the tail bud (10 hours after fertilization) to inhibit skin pigmentation (pigmentation formation). After the membranes were removed and the fertilized embryos were washed three times for 5 minutes with 1 × phosphate buffered saline (0.1% Tween-20), they were replaced 3-4 times with 100% methanol (MeOH). And stored at -20 ° C. The embryos stored in methanol were washed step by step with 75%, 50% and 25% MeOH / PBS for 5 minutes and then 5 times at 5 minute intervals using PBT. Depending on the developmental stage, PBT containing 10 μg / ml proteinase K was treated in the embryo, and then washed 3 to 4 times at 5 minute intervals using PBT, and 4% paraformaldehyde. Fixed at room temperature for at least 30 minutes with / PBT. Carefully washed five times at 5 minute intervals with PBT to ensure that embryos were intact, then 300 μl HYB (50% formamide, 5X SSC, 0.1% Tween-20) was added and left at 68 ° C. for 15 minutes. Then, 50% HYB (50% formamide, 5X SSC, 5 mg / mL toulala RNA, 50 μg / mL heparin, citric acid, pH 6, 0.1% Tween-20) was added to 300 1 μl was added and prehybridized at 68 ° C. for 1 to 2 hours or more, and probes were added at about 30 to 100 ng for hybridization at 68 ° C. for 12 hours. Probes were removed at 68 ° C. and 100%, 75%, 50% and 25% of HYB * / 0.2X SSCT was washed sequentially every 15 minutes. It was washed for 20 minutes by replacing with 2 X SSCT at the same temperature as above, and washed with 5 times every 30 minutes in 0.2X SSCT to remove the probe (hybrid) failed to hybridize. Then, 75%, 50%, and 25% of 0.2X SSCT / PBT were sequentially replaced at 5 minute intervals at room temperature and washed five times every 5 minutes with PBT. In order to confirm the color development and expression site, 300 μl of 5% horse serum / PBT was added and left at room temperature for 1 hour, and serum was attached to the probe where no probe was attached. And blocked from expression. Then, 300 μl of anti-DIG-AP Fab (anti-DIG-AP Fab) (150 u / 200 μl; Roche, Germany) diluted 1/4000 times in 5% horse serum / PBT was added, and at room temperature, 4 μl. The reaction was carried out at 12 hours or 4 hours at 4 ° C. After washing with PBT for 6 minutes for 10 minutes, 6 times for 20 minutes and 8 times for 30 minutes, staining buffer (0.1 M Tris-Cl pH 9.5, 0.1 M NaCl, 50 mM MgCl 2, 0.1% Tween-20) 3 washes for 5 minutes. Stock (stock) of NBT / BCIP (Nitro Blue Tetrazolium / 5-Bromo 4-Chloro 3- Indolyl Phosphate), a coloring substrate, was added to the staining buffer at 4.5 µl / ml (stock: 50 mg / ml NBT). Containing dimethylformamide) and 3.5 μl / ml (stock solution: dimethylformamide containing 50 mg / ml BCIP) and reacted at room temperature where light was blocked. After staining, the fertilized eggs are washed four times for 5 minutes using a stop solution (1X PBS pH 5.5, 1 mM EDTA, 0.1% Tween-20), followed by 4 to 5 times for 10 minutes with 100% methanol. After dehydration, it was stored at -20 ° C. Photographic work was performed using an MZ-16 microscope (Leica, USA) in 75% glycerol or Benzyl Benzoate: Benzyl Alcohol (2: 1) solution.

As a result. As shown in FIG. 2, ZC4H2 transcription was found mainly near the developing CNS but not from the medial ventricular zone where differentiation progenitors and mature neurons or / and glia are expected to be expressed (FIG. 2).

<4-3> 홀-마운트 면역조직화학 염색법<4-3> Hall-mount immunohistochemical staining

Whole-mount immunohistochemistry staining was performed to observe the formation of motor neurons and axons of ZC4H2 gene knockout zebrafish.

Specifically, 24 and 36 hours post fertilization normal and ZC4H2 gene knockout zebrafish fertilized eggs were fixed at 4 ° C. for at least 12 hours by adding 4% paraformaldehyde / PBT so that the tail was not bent after removing the chorion with tweezers. I was. After the membranes were removed and the fertilized embryos were washed three times for 5 minutes with 1 × phosphate buffered saline (0.1% Tween-20), they were replaced 3-4 times with 100% methanol (MeOH). And stored at -20 ° C. The embryos stored in methanol were washed step by step with 75%, 50% and 25% MeOH / PBS for 5 minutes and then 5 times at 5 minute intervals using PBT. 300 μl of 2% horse serum / PBT was added and allowed to stand at room temperature for 1 hour, followed by 300 primary anti-Znp-1 mouse monoclonal antibody diluted 1 / 500-fold in 2% horse serum / PBT. Μl was added and reacted at room temperature for 4 hours or at 4 ° C. for 12-16 hours. After washing four times with PBT for 15 minutes, 500 μl of a secondary anti-mouse-FITC antibody diluted 1 / 600-fold in 2% malformed / PBT was added and reacted at room temperature for 2 hours. After washing twice with PBT for 15 minutes, photographing was performed using an MZ-16 microscope (Leica, USA) in 75% glycerol.

As a result, as shown in Fig. 5, it was confirmed that the motor neuron and axons of normal and ZC4H2 gene knockout zebrafish normally occurs (Fig. 5).

<< 실시예Example 5> 5> ZC4H2ZC4H2 유전자 녹아웃 Gene knockout 제브라피쉬Zebrafish 라인 제작 Line production

The transcription activator-like effector nuclease (TALEN) method was used to prepare zebrafish knocked out of the ZC4H2 gene.

Specifically, TALEN vectors targeting the second exon of ZC4H2 were designed and constructed through ToolCen (FIG. 3). TALEN vectors were linearized by PvuII and purified by ethanol precipitation. Left and right TALENs encoding mRNAs were synthesized using the mMESSAGE mMACHINE T7 transcription kit (Ambion, AM1344) and purified by phenol / chloroform precipitation. TALEN mRNAs were microinjected into one fertilized embryonic cell. Location-specific TALEN function was then confirmed by target-specific PCR and T7 endonuclease 1 experiments through the isolation of gDNA. gDNA was isolated from single larvae or adult fin-clipped tissues and gDNA isolation buffer (10 mM Tris, 50 mM EDTA, 200 mM NaCl, 0.5% SDS and 7 0.5 mg / ml protease K). It was dissolved for 12 hours at 55 ℃. gDNA was purified using phenol / chloroform method. Specifically, PCR analysis was performed with gDNA as a template with a final reaction volume of 20 μl. The primer was carried out with the primers of Table 3 below, repeated at 95 ° C. for 5 minutes once as an initial heat denaturation process, 95 ° C. 30 seconds for the denature process, 55 ° C. 30 seconds for the annealing process, and 72 ° C. for the extension process. PCR was performed by repeating 30 seconds 30 times and repeating the polymerization process once at 72 ° C. for 7 minutes. 10 μl of the PCR reaction was electrophoresed using 1 × TAE buffer and 3% agarose gel.

서열 번호Sequence number	서열order
zc4h2 exon2 F(서열 번호 7)zc4h2 exon2 F (SEQ ID NO: 7)	GACCGAGTTTGAAGTCTGGGACCGAGTTTGAAGTCTGG
zc4h2 exon2 R(서열 번호 8)zc4h2 exon2 R (SEQ ID NO: 8)	CACGTTAATATCCGCATGAATGCACGTTAATATCCGCATGAATG

As a result, it was confirmed that the ZC4H2 gene knocked out in the manufactured zebrafish (FIG. 3).

<< 실험예Experimental Example 1> 1> ZC4H2ZC4H2 유전자 녹아웃 Gene knockout 제브라피쉬의Zebrafish 행동 관찰 Behavioral observation

Behavioral observation was performed to confirm the effect of ZC4H2 gene loss of ZC4H2 gene knockout zebrafish produced in <Example 5> on zebrafish behavior.

Specifically, to observe free swimming, zebrafish 5 dpf wild type and ZC4H2 gene knockout larvae were placed in slide glass in embryo medium. Zebrafish larvae were observed using stereoscopic microscopes (LEICA, MZ16), cameras (LEICA DC300FX) and microscope imaging software (LEICA, IM50). Free swim recordings and monitor displays were recorded using Camtasia Studio software (TechSmith, Vesion 7.0.0). 5 dpf zebrafish was transferred to slide glass coated with 3% methylcellulose for eye, pectoral and jaw movement observation.

As a result, as shown in Figure 4, ZC4H2 homozygous knockout zebrafish have abnormally active jaw and pectoral movements compared to normal zebrafish, and the position of the eyes is abnormally similar to the exotropia of the human It was confirmed that (Fig. 4).

<< 실험예Experimental Example 2> 2> ZC4H2ZC4H2 유전자에 의한 신경세포 관련 유전자의 발현양상 확인 Identification of neuronal cell related gene expression by genes

<2-1> <2-1> ZC4H2ZC4H2 유전자 녹아웃 Gene knockout 제브라피쉬에서In zebrafish 신경세포 관련 유전자의 발현양상 확인 Identifying Expression Patterns of Neuronal Cell Genes

Whole-mount in situ hybridization using mRNA probes to determine the effect of ZC4H2 gene loss on specific neuronal cell development using the ZC4H2 gene knockout zebrafish prepared in Example 5. mount in situ hybridization was performed.

Specifically, the antisense digoxigenin-labeled RNA probes of zc4h2, gad1, glyt2a, vglut2.1, gata2, gata3, isl1, scn1Lab, vsx2, vsx1, dbx2 and nkx6.1 are selected from DIG and It was synthesized according to the manufacturer's protocol using Fluorescein RNA Labeling Mix, Roche catalog number 11277073910, 11685619910, and the whole-mount in situ hybridization of Example 4-2. The experiment was carried out in the same manner as).

In addition, the hole-mount immunohistochemical staining method of <Example 4-3> using anti-Znp-1 mouse monoclonal antibody to confirm the formation of motor neurons and axons of ZC4H2 gene knockout zebrafish. mount immunohistochemistry staining) was performed.

As a result, as shown in FIG. 5, the expression of isl1, which labels motor neurons, was normal, and it was confirmed that the expression of Znp-1, a protein expressed in the axons of motor neurons, was normal (FIG. 5). However, as shown in FIG. 6, the expression of vsx2 that labels V2a interneurons and vsx1 that labels V2a / b precursors is reduced and adjacent to ventral neural progenitor domains in the midbrain cranial and hindbrain. It was confirmed that the expression of nkx6.1 that marks the site is reduced. In addition, the expression of gad1, which labels GABAergic neurons, reduced the number of GABA neurons consistent with defects of V2 neurons in the intermediate spinal cord, and observed V2b inhibitory neurons. It was observed that expression of gata3 was significantly reduced in knockout zebrafish embryos (FIG. 6).

<2-2> <2-2> ZC4H2ZC4H2 유전자 녹아웃 Gene knockout 제브라피쉬에Zebrafish ZC4H2ZC4H2 유전자를 복원하였을 때, 신경세포 관련 유전자의 발현양상 확인 When the gene is restored, the expression pattern of neuron-related genes is confirmed

ZC4H2 Gene Knockout When ZC4H2 gene was restored in zebrafish, the expression changes of neuron-related genes were checked to determine whether the neuronal expression and abnormal behavior induced by the mutation were restored.

Specifically, zebrafish ZC4H2, human normal, L66H, R213W, and synthetic capped mRNAs of R18K ZC4H2 were transcribed using plasmid DNA linearized into the template via the mMESSAGE mMACHINE SP6 transcription kit (Ambion, AM1340). mRNAs were dissolved in 0.2 M KCl containing 0.2% phenol red as a tracer dye and microinjected into 1-2 cell stage embryos using PV820 Pneumatic PicoPump (WPI).

As a result, as shown in Figure 7, it was confirmed that the expression of gad1 is recovered when micro-injection of zecfish zc4h2 and human normal ZC4H2 mRNA (Fig. 7), showed a normal movement. When ZC4H2 mRNA of L66H, R213W and R18K was induced, some recovery failed in L66H and R213W mRNA microinjection, but gad1 expression was recovered in the case of R18K mutant ZC4H2 mRNA microinjection.

<< 실험예Experimental Example 3> 3> ZC4H2ZC4H2 유전자 녹아웃 Gene knockout 제브라피쉬를Zebrafish 이용한 Used 뇌전증Epilepsy 관련 질환 스크리닝 방법 Related Disease Screening Methods

<3-1> <3-1> ZC4H2ZC4H2 녹아웃 knockout 제브라피쉬의Zebrafish 사육 및 Breeding and 발생배의Embryonated 준비 Preparations

The zebrafish was prepared according to the zebrafish breeding and management method of <Example 3>, a pair of ZC4H2 heterozygous knockout zebrafish male and female were put in a dedicated mating cage the afternoon of the day before the experiment, and then in a dark room. Stored. The following morning, the embryos were collected by in vitro fertilization of a pair of zebrafish male and female with light under fluorescent light. Collected fertilized eggs were transferred to Petri dishes and generated in an incubator at 28.5 ° C. The developmental process was observed through a dissecting microscope, and ZC4H2 homozygous knockout zebrafish showing abnormal movements were selected from day 4 after fertilization.

<3-2> <3-2> 뇌전증Epilepsy 및 운동성 장애 치료제 후보 약물의 스크리닝 방법 And screening method for drug candidates for treating motility disorders

Using the ZC4H2 homozygous knockout zebrafish selected in <Experimental Example 3-1>, drug screening experiments were performed to confirm that the ZC4H2 homozygous knockout zebrafish can be used as a model for epilepsy and motility disorder disease.

Specifically, 5 days after fertilization, selected ZC4H2 homozygous knockout zebrafish were placed in 96-well plates one by one, acting as a potassium channel opener, and from the United States Food and Drug Administration (FDA) in 2010. Retigabine approved as an epilepsy treatment was treated for 1 hour at concentrations of 1, 2.5 and 5 μM. All treatments proceeded with the control and treated with 0.5% DMSO as a negative control for the drug. There was no change in the groups treated at concentrations of 1 μM or 2.5 μM, but abnormal excess pectoral fin and jaw movement of ZC4H2 homozygous knockout zebrafish in the groups treated at concentrations of 5 μM as shown in FIGS. 8 and 9. Movement disorder symptoms such as were suppressed. On the other hand, in the group treated with 0.5% DMSO as a negative control, the excess pectoral fin and jaw movement of ZC4H2 homozygous knockout zebrafish was maintained, demonstrating the specific inhibitory effect of seizure-like symptoms by 5 μM retigabine 8 and 9.

Based on the above results, ZC4H2 knockout zebrafish can be used as an animal model for diseases related to dyskinesia such as epilepsy, convulsions, seizures, Parkinson's syndrome and pediatric epilepsy, and established mass screening technology for related therapeutic substances. It was.

Claims

Transgenic animal knocked out of the ZC4H2 gene.
The transgenic animal according to claim 1, wherein the ZC4H2 gene is composed of SEQ ID NO: 9.
The transgenic animal of claim 1, wherein the transgenic animal has a disorder associated with a movement disorder.
The transgenic animal of claim 3, wherein the movement disorder-related disease is any one selected from the group consisting of epilepsy, convulsions, seizures, Parkinson's syndrome, and pediatric epilepsy.
The transgenic animal of claim 1, wherein the transgenic animal is zebrafish.
Transformed fertilized egg knocked out ZC4H2 gene.
The transformed fertilized egg of claim 6, wherein the ZC4H2 gene consists of SEQ ID NO: 9.
Transformed sperm with knocked out ZC4H2 gene.
The method of claim 8, wherein the ZC4H2 gene is transgenic sperm, characterized in that consisting of SEQ ID NO: 9.
1) treating the transgenic animal of claim 1 with a test compound; And

2) A method for screening a drug for a movement disorder associated with a movement disorder comprising comparing a transgenic animal treated with the test compound of step 1) with a non-treated control to determine whether symptoms are recovered.
The test compound of claim 10, wherein the test compound of step 1) is made from natural compounds, synthetic compounds, RNA, DNA, polypeptides, enzymes, proteins, ligands, antibodies, antigens, metabolites of bacteria or fungi, and bioactive molecules. Exercise disorder-related disease drug screening method, characterized in that any one selected.
11. The method of claim 10, wherein the determination of symptom recovery in step 2) is based on a change in the expression of neuronal genes or recovery of abnormal behavior.
The method of claim 10, wherein the movement disorder-related disease is any one selected from the group consisting of epilepsy, convulsions, seizures, Parkinson's syndrome, and pediatric epilepsy.
1) preparing a ZC4H2 gene knock-out construct;

2) introducing the construct of step 1) into the fertilized egg; And

3) A method for producing a transgenic animal comprising selecting a ZC4H2 gene knockout embryo in the fertilized egg of step 2).
The method of claim 14, wherein the ZC4H2 gene of step 1) comprises SEQ ID NO. 9.
15. The method of claim 14, wherein the introduction of step 2) is carried out by a method of microinjection.
The method of claim 14, wherein the transgenic animal has a disorder associated with a movement disorder.
18. The method of claim 17, wherein the movement disorder-related disease is any one selected from the group consisting of epilepsy, convulsions, seizures, Parkinson's syndrome, and pediatric epilepsy.
15. The method of claim 14, wherein the transgenic animal is zebrafish.
15. The method of claim 14, further comprising preparing a homozygous transformant by crossing the prepared transgenic animal with a wild type.