WO2016186483A1 - Sequences of synthetic deoxyribonucleic acids and heterologous recombinant proteins of the haemagglutinin of the influenza virus expressed in chlamydomonas reinhardtii chloroplast, and use thereof in vaccines - Google Patents

Sequences of synthetic deoxyribonucleic acids and heterologous recombinant proteins of the haemagglutinin of the influenza virus expressed in chlamydomonas reinhardtii chloroplast, and use thereof in vaccines Download PDF

Info

Publication number
WO2016186483A1
WO2016186483A1 PCT/MX2016/000040 MX2016000040W WO2016186483A1 WO 2016186483 A1 WO2016186483 A1 WO 2016186483A1 MX 2016000040 W MX2016000040 W MX 2016000040W WO 2016186483 A1 WO2016186483 A1 WO 2016186483A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
recombinant protein
recombinant
gene
vla
Prior art date
Application number
PCT/MX2016/000040
Other languages
Spanish (es)
French (fr)
Inventor
Inkar Alejandro CASTELLANOS HUERTA
Bernardo BAÑUELOS HERNÁNDEZ
Sergio ROSALES MENDOZA
Luis Gabriel BRIEDA DE CASTRO
Guillermo TÉLLEZ ISAÍAS
Isidro FERNÁNDEZ SIUROB
Original Assignee
Viren S.A. De C.V.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Viren S.A. De C.V. filed Critical Viren S.A. De C.V.
Publication of WO2016186483A1 publication Critical patent/WO2016186483A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A61K39/145—Orthomyxoviridae, e.g. influenza virus

Definitions

  • the present invention relates to the field of medicine, biochemical structure, molecular genetics and genetic engineering preferably applied to the area of infectious-contagious diseases.
  • the present invention relates to the design, synthesis and / or expression of recombinant proteins of the surface type I membrane glycoprotein, hemagglutinin (HA) of avian influenza virus (vl A), the codon optimized nucleotide synthetic sequences of deoxyribonucleic acids (DNA) that encode them and the use of the plastid (cioroplast) of the microalgae species, Ch ⁇ amydomonas reinhardtii, for the expression of the amino acid sequences that encode them. More particularly, the use of these DNA nucleotide sequences and heterogeneous peptide sequences for use as a treatment and / or vaccination for the control of vlA, in all organisms susceptible to vlA-induced disease.
  • AI Avian Influenza
  • NP or M1 proteins
  • types B and C are considered more typical of other species, not including commercial birds.
  • avian influenza (vlA) viruses have a spherical, pylororphic or filamentous shape, with a diameter of 80 to 120 nm, being able to be greater in the case of the filamentous form.
  • the outer surface of the vir ⁇ ón is covered by two types of glycoproteins projected outwards of approximately 10 - 14 nm in length and 4-6 nm in diameter, elongated rod-shaped trimers corresponding to the HA and fungus-shaped tetramers called NA .
  • the vlA virions have a flotation density in aqueous sucrose solution of 1.19 g / cm3, with a nucleocapsid with helical symmetry; (Swayne DE et al.
  • RNA genome vRNA (-) ss
  • segment 4 formed by 1,767 pairs of DNA nudeotides, coding for a protein of 564 amino acids or residues, weighing ⁇ 56 kiloDaltons (kDa), corresponding to HA, this being a type membrane glycoprotein I integrated, with hemagglutination activity, binding of the virion to cell receptors or sialyl oligosaccharide membrane glycoproteins of susceptible cells, being the main object of antibody-mediated neutralization (Swayne DE et al. 2013).
  • vi presents a proteolytic separation site within the peptide sequence in the HA protein, which turns out to be a process of relevance during infection in the host cell; being the type of protease, a determinant in the pathogenicity of each strain of vi.
  • This site is recognized by host cell proteases, being the type of protease, a determinant in the pathogenicity of each strain of vi, classify them under this criterion as high pathogenicity related to a systemic presentation of the disease or low pathogenicity vi , related to a digestive or respiratory presentation of the disease (Swayne DE et al. 2013).
  • the vi replication cycle begins when it is entered into the host cells, through union with the viral or HA receptors with the cell surface receptors or sialyl oiigosaccharides, glycoproteins containing sialic acid (SA by their acronym in English), derived from neuroamine acid (N-acetyl neuroamic acid (NeuAc or NANA) or N-glycolyl neuroamine (NeuGc)), thus initiating endocytosis and its subsequent internal viral replication in the host cell.
  • SA sialyl oiigosaccharides
  • NANA neuroamine acid
  • NeuroGc N-glycolyl neuroamine
  • the HA Due to its own and individual characteristics, the HA has a different configuration and specificity depending on the site of union with the SA.
  • vlA is considered a global problem and risk, since its presence is reported throughout the world in different species, which makes its prevention and control require International cooperation.
  • Vaccination early diagnosis and biosecurity measures are the main strategy for control, because at present, vaccines are not able to confer protection at the same time against various serotypes or varieties of HA, coupled with the risk of easy dispersion of vlA in species of supply animals such as broilers and laying hens (Gailus gallus domesticus), which are susceptible to any serotype of the 17 HA types known.
  • ⁇ Austin FJ, Et al. Antigenic mapping of an avian H1 influenza virus haemagglutinin and interrelationships of H1 viruses from humans, pigs and birds. J Gen Viroi.
  • h5320viren gene (SEQ ID NO: 1) encoding the protein Recombinant ⁇ h5320viren (SEQ ID NO: 8), which starts at the amino acid at position 1 to the amino acid at position 320, h5330viren gene (SEQ ID NO: 2) encoding the recombinant protein Mi5330viren (SEQ ID NO: 9) , which starts from amino acid at position 1 to amino acid at position 330 and hS332viren gene (SEQ ID NO: 3) encoding the recombinant protein ⁇ h5332viren (SEQ ID NO: 10) which starts from amino acid at position 1 to amino acid at position 332, where the numbering of amino acid positions of recombinant proteins, recombinant protein ⁇ h5320viren (SEQ ID NO: 8), recombinant protein ⁇ h53
  • the present invention describes the optimized codon synthetic DNA nucleotide sequences designated as the h5320vtren gene (SEQ ID NO: 1), h5330v ⁇ ran gene (SEQ ID NO: 2) and hS332viran gene (SEQ ID NO: 3), characterized by differentiating from any another sequence previously used for the purpose of expressing recombinant vlA proteins, as well as being codon optimized for their correct genetic expression in the eukaryotic protein expression system of the Chlamydomonas reinhardtii chloropytic genome, in particular, being able to express themselves correctly mind in the eukaryotic system mentioned above by means of synthetic design genes.
  • h5320viren gene (SEQ ID NO: 1) encoding the recombinant protein ⁇ h5320viren (SEQ ID NO: 8), h5330viren gene ( SEQ ID NO: 2) coding for the recombinant protein ⁇ h5330viren (SEQ ID NO: 9) and gene h5332viren (SEQ ID NO: 3) coding for the recombinant protein ⁇ h5332viren (SEQ ID NO.
  • Recombinant proteins, recombinant protein ⁇ h5320viren (SEQ ID NO: 8), recombinant protein ⁇ h5330viren (SEQ ID NO: 9) and recombinant protein ⁇ h5332viren (SEQ ID NO: 10) obtained, produced, synthesized or expressed in the doroplast of Chlamydomonas reinhardtii, starting from amino acid at position 1 to amino acid at position 320 in recombinant protein ⁇ h5320v ⁇ ren (SEQ ID NO: 8), starting from amino acid at position 1 to amino acid at position 330 in the recombinant protein ⁇ h5330viren (SEQ ID NO: 9) and starting from the amino acid at position 1 to the amino acid at position 332 in the recombinant protein ⁇ h5332viren (SEQ ID NO: 10), where the numbering of the Amino acid positions herein refer exclusively to the position of amino acids in SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10, so
  • recombinant protein ⁇ h5320viren SEQ ID NO: 8
  • recombinant protein ⁇ h5330viren SEQ ID
  • recombinant protein ⁇ h5332viren expressed on the basis of the synthetic DNA nucleotide sequences inserted in the dormoblast genome of Chlamydomonas reinhardtii, with the purpose of achieving its protein expression in the doroplast of Chlamydomonas reinhardtii for the prevention and / or control of vlA applied via the digestive tract (example: oral, sublingual), parenteral (example: intramuscular, subcutaneous) and respiratory tract (example: conjunctiva mucous membranes, respiratory mucous membranes), as well as describing as part of the present invention object of the present document the expression of homologous sequences of recombinant proteins it corresponds to the peptide segments described in the present invention, as well as those resulting from the homologous sequences of the HA protein of vlA obtained and expressed by genetic manipulation of the Chlamydomonas reinhardtii doroplast genome.
  • the present invention relates to: i) .- codon DNA nucleotide sequences optimized to be expressed in the chlamydomonas reinhardtii genome of the constitutive object of the present invention, called these DNA nucleotide sequences as h5320viren gene (SEQ ID NO: 1), h5330viren gene (SEQ ID NO: 2) and h5332viren gene (SEQ ID NO: 3), ⁇ and the vlA recombinant protein peptide sequences referred to as recombinant 4h5320viren protein (SEQ ID NO: 8), recombinant protein ⁇ h5330viren (SEQ ID NO: 9) and recombinant protein ⁇ h5332viren (SEQ ID NO: 10) expressed in the heterologous genome system of Chlamydomonas reinhardtii, iii) .- the vaccines object of the present invention based on the use of recombinant vlA proteins called: recomb
  • the development of the present invention focused on the protein expression of recombinant proteins, recombinant protein ⁇ h5320viren (SEQ ID NO: 8), recombinant protein / 4h5330viren (SEQ ID NO: 9) and recombinant protein ⁇ h5332viren (SEQ ID NO: 10) , in the design of the genes that encode them: hS320viren gene (SEQ ID NO: 1), h5330viren gene (SEQ ID NO: 2) and h5332viren gene (SEQ ID NO: 3) respectively, based on the DNA nucleotide sequence encoders for recombinant peptide segments of the H5 protein of vlA, characterized for its correct expression in the system of eukaryotic heterologous protein expression of the chlamydomonas reinhardtii choriooplast genome, the use of the Chlamydomonas minhardtii doroplast protein expression system for the expression of heterotope peptide sequences
  • Protein expression system used for the expression of recombinant proteins recombinant protein ⁇ h5320vlren (SEQ ID NO: 8), recombinant protein ⁇ h5330viren (SEQ ID NO: 9) and recombinant protein ⁇ h5332viren (SEQ ID NO: 10), according to the present invention .
  • the present invention began with the design and commercial synthesis of codon genes optimized for use in the protein expression system in the eukaryotic organism, microalgae of the species Chlamydomonas minhardtii, by inserting these synthetic sequences of DNA nucteotides into the Pestid genome, in particular in the microalgae chiormyplate genome of the species Chlamydomonas minhardtii, taking as a reference the DNA nucleotide sequence of segment 4 of the vlA genome, coding for the HA protein of the V5A serotype H5, being in any case different the new sequences of synthetic DNA nucteotides to the sequence of nucieotides of the reference DNA, which in this case is cited as an illustrative example only, in the Genbank database of the NCBI database (ht ⁇ : //vvww.ncbi.nlm.nih.gov/genbank/ ) with the number (GenBank: ACZ48561.1), these
  • h5320virsn gene (SEQ ID NO: 1), h5330vinn gene (SEQ ID NO: 2) and h5332viren gene (SEQ ID NO: 3) codon optimized for protein expression of the recombinant proteins named: recombinant protein ⁇ h5320viren (SEQ ID NO: 8), recombinant protein ⁇ h5330viren (SEQ ID NO: 9) and recombinant protein ⁇ h5332viran (SEQ ID NO: 10) respectively, were used for its insertion and expression in the genome of the Chamydomonas minhardtii chloroplast through the use of the transformation vector called with the generic term vector pVCC, designed and synthesized for this purpose, leaving as background in the present descriptive document of the present invention, being in In any case, an illustrative example for its correct insertion and correct expression in the Chlamydomonas minhardtii chloroplast genome, not restricting the use of other possible methods for its
  • h5320viren gene (SEQ ID NO: 1), hS330viren gene (SEQ ID NO: 2) and h5332vlren gene (SEQ ID NO: 3) codon optimized for protein expression in the chloroplast genome of Chlamydomonas reinhardtii of the recombinant vlA proteins called recombinant protein ⁇ 5320 ⁇ (SEQ ID NO: 8) f recombinant protein ⁇ h5330vfren (SEQ ID NO: 9) and recombinant protein ⁇ h5332viren (SEQ ID NO: 10).
  • h5320viren gene (SEQ ID NO: 1)
  • h5330viren gene (SEQ ID NO: 2)
  • h5332viren gene (SEQ ID NO: 3 )
  • the expression and transformation elements of the chloroplast genome of Chlamydomonas minhardtii were synthesized and cloned into the commercial vector pUC57 (SEQ ID NO: 4) (figure no. 1.
  • Vector scheme pUC57 giving rise to the vectors: pVCCH5320viren (SEQ ID NO: 5) (figure No.
  • vector scheme pVCCH5320viren with the h5320viren gene (SEQ ID NO: 1)
  • pVCCH5330viren (SEQ ID NO: 6)
  • vector scheme pVCCH5330viren with the h5330viren gene (SEQ ID NO: 2)
  • pVCCH5332viren (SEQ ID NO: 7)
  • Figure No. 4 vector scheme pVCCH5332viren) with the h5332viren gene (SEQ ID NO: 3).
  • Bacterial cells transformed individually with cough vectors pVCCH5320viren (SEQ ID NO: 5), pVCCH5330viren (SEQ ID NO: 6) and pVCCH5332viren (SEQ ID NO: 7) were seeded on Luna Broth solid medium agar plates supplemented with 100 ug / ml ampfcillin, for a time of 14 hours at 37 ° C (Russell DW, Sambrook J. Molecular Cioning: A Laboratory Manual, Volume 1. Edition illustrated, PuWisher, CSHL Press, 2001). Subsequently in the boxes colonies were observed, which were considered as correctly transformed clones.
  • the bacterial cultures resulting from the bacterial transformation process were identified according to the vector used in each case, resulting in the transformation events VCCH5320viren, VCCH5330viren and VCCH5332viren.
  • clones of the aforementioned transformation events were selected to inoculate them in 5 ml of liquid LB medium supplemented with 100 ⁇ / ml ampicillin individually for each transformation event and an incubation was performed at 37 ° C overnight.
  • the plasmid DNA obtained corresponding to the vectors pVCCH5320viren (SEQ ID NO: 5), pVCCH5330viren (SEQ ID NO: 6) and pVCCH5332viren (SEQ ID NO: 7) extracted individually from the transformation events VCCH5320viren l VCCH5330viren and VCCH5332viren and VCCH5332v respectively they were used to carry out a standard restriction reaction with the Ndel and BamHI enzymes of the New England® brand (Biolabs Inc) under the conditions indicated by the supplier (Biolabs Inc), in order to check the presence of the vectors pVCCH5320v ⁇ ren (SEQ ID NO: 5), pVCCH5330viren (SEQ ID NO: 6) and pVCCH5332viren (SEQ ID NO: 7) as well as the presence of synthetic genes: h5320viren gene (SEQ ID NO: 1), h5330viren gene (SEQ ID NO: 2) and h5332viren gene
  • the standard restriction reaction was performed individually and separately for each vector, pVCCH5320viren (SEQ ID NO: 5), pVCCH5330viren (SEQ ID NO: 6) and pVCCH5332viren (SEQ ID NO: 7), as described below, consisting of approximately 100 ng / ⁇ of corresponding plasmid DNA for each vector pVCCH5320viren (SEQ ID NO: 5), pVCCH5330viren (SEQ ID NO: 6) and pVCCH5332viren (SEQ ID NO: 7), 3 units of each of the enzymes Ndel and BamHI of the New England® brand (Biolabs Inc.) under the conditions indicated by the supplier (Biolabs Inc.) corresponding to each individual restriction reaction and appropriate buffer (Biolabs Inc.) for a double digestion reaction (Russell DW Et al.
  • h5320viren gene (SEQ ID NO: 1), h5330viren gene (SEQ ID NO: 2) and h5332viran gene (SEQ ID NO: 3) codon optimized for the expression of the ⁇ h5320viren recombinant proteins (SEQ ID NO: 8), ⁇ h5330viren recombinant protein (SEQ ID NO: 9), and ⁇ h5332viren recombinant protein (SEQ ID NO: 10) respectively, which are described starting from the amino acid at position 1 to the amino acid at position 320 in the recombinant protein ⁇ h5320viren (SEQ ID NO: 8), starting from the amino acid at position 1 to the amino acid at position 330 in the recombinant protein, ⁇ h5330viren (SEQ ID NO: 9) and starting from the amino acid at position 1 to the amino acid at position 332 in the recombinant protein
  • the expression cassette for the aadA gene was added, which encodes the aminoglycoside 3- adenylyltransferase protein that confers resistance to the antibiotic spectinomycin to allow double homotope recombination.
  • the corresponding sequence of nucleotide 40097 to 40924 of the Chlamydomonas reinhardtS chloroplast genome was placed and the corresponding sequence of nucleotide 40925 to 41831 was placed on the right side of the terminator (Sequence ID: tpgBK000554.2)
  • the genomic sequence designed in s ⁇ lt ⁇ was synthesized and donated in the commercial cloning vector pUC57 (SEQ ID NO: 4) (figure no. 1. Vector scheme pUC57), for maintenance and replication in the bacterium Escherichia coli brand TOP ten (Brand Invitrogen TM) according to the provider's protocol.
  • recombinant protein ⁇ h5320viran SEQ ID NO: 8
  • recombinant protein ⁇ h5330viren SEQ ID NO: 9
  • recombinant protein ⁇ h5332vinn SEQ ID NO: 10
  • ios pVCCH5320viren vectors SEQ ID NO: 5
  • pVCCH5330viren SEQ ID NO: 6
  • pVCCH5332viren SEQ ID NO: 7
  • transformation event VCCH5330viren and pVCCH5332viren (SEQ ID NO:
  • transformation event VCCH5332viren by means of the Gene JET Plasmid Miniprep TM Kit (Fermentas Brand) according to the supplier's instructions, carried out in cultures of a volume of 5 ml in liquid medium LB supplemented with ampiálina at a concentration ⁇ per me, quantified in the BioPhotometer piuss spectrophotometer (Eppendorf irte brand) and adjusted to a concentration of 1 ug / 1 ⁇ in each of the pVCCH5320viren vectors (SEQ ID NO: 5) transformation event VCCH5320viren, pVCCH5330viren (SEQ ID NO: 6), transformation event VCCH5330viren and pVCCH5332viren (SEQ ID NO: 7), transformation event VCCH5332viren.
  • 10 ug of the pVCCH5320viren vector (SEQ ID NO: 5), 10 ug of the pVCCH5330viren vector (SEQ ID NO: 6), and 10 ug of the pVCCH5332viren vector (SEQ ID NO: 7), were used to transform individually to independent cultures of microalgae of the species Chlamydomonas reinhardtii with a concentration of 1 X 10 ⁇ cells by means of the bidistic protocol described below:
  • transformation events cl / VCCH5320viren vector used pVCCH5320viren (SEQ ID NO: 5)
  • cl / VCCH5330viren vector used pVCCH5330viren (SEQ ID NO: 6)
  • cl / VCCH5332viren vector used pVCCH5332viren (SEQ ID NO: 7)).
  • the cultures of Chlamydomonas reinhardtii resulting from the transformation events / V CCH5320viren, cl / VCCH5330viren and cl / VCCH5332viren were kept for three days in solid TAP medium (Invitrogen Brand) without antibiotic and subsequently the cultures of Chlamydomonas reinhardtii were collected and passed to solid TAP medium (Invitrogen TM Brand) with spectinomycin at a concentration of 100pg / ml.
  • each sample was similarly and individually subjected to the total DNA extraction process with the following modifications: the samples were centrifuged at 4,000 rpm, 1.5 mi of the liquid culture of the Chlamydomonas reinhardtii clones from the transformation events cl / VCCH5320virenc, l / V CCH5330viren and cl / VCCH5332viren, the supernatant was removed, this process was repeated three times to the cultures from each transformation event CCH5320virenc, l / V CCH5330viren and cl / VCCH5332viren of Chlamydomonas reinhardtii, to the cell pellet obtained individually from each transformation event / V CCH5320virenc, l / V CCH5330viren andcl / V CCH5332viren, 700ul of buffer were added (700ul of buffer mM Tris-HCI, 50mM
  • PCR polymerase chain reaction
  • the PCR reaction mixture was performed with 2.5 ⁇ bufferTaq 10X (New England, btotabs), 1.5 ⁇ MgCb (Invitrogen), 0.5 ⁇ dNTPs (New England, biolabs), ⁇ .5 ⁇ olygonucleotide aadA 5 - ATGGCTCGTGAAGCGGTTAT- 3 '(aadACLF) (Sigma AJdrich brand) and (5 - TTATTTGCCAACTACCTTAG-3' (aadACLR) (Sigma AWrich brand), ⁇ .5 ⁇ of reverse aadA olygonucleotide (Sigma AWrich brand) and 0.3 ⁇ of Taq polymerase enzyme (New England, Biolabs brand) plus 18.2 ⁇ of sterile deionized water
  • the reaction mixture was subjected to amplification in the MuKigene TM MINI thermal cycler (Labnet intemational, Inc.) The amplification cycles were performed under the following conditions: initial denaturation at
  • h5320viren gene (SEQ ID NO: 1), h5330viren gene (SEQ ID NO: 2) and hS332viren gene (SEQ ID NO: 3) codon optimized in the genome of the reinhardtil Chlamydomonas chloroplast genome strains considered as recombinant clones described as GMOs, originating from the transformation events cl / VCCH5320viren, cl / VCCH5330 viren and cl / VCCH5332viren.
  • each sample was similarly and individually subjected to the total DNA extraction process with the following modifications: the samples were centrifuged at 4,000 rpm 1.5 ml of the liquid culture of Chlamydomonas nainhardtii from each transformation eventcl / V CCH5320viren, cl / VCCH5330viren and cl / VCCH5332vren, the supernatant was discarded, this process was repeated three more times.
  • transgene corresponds individually to the h5320v ⁇ ren gene (SEQ ID NO: 1) encoding the recombinant protein of vlA which starts at amino acid at position 1 to amino acid at position 320 in the recombinant protein ⁇ h5320viren (SEQ ID NO: 8) in the event of transformation / V CCH5320viren, gene h5330viren (SEQ ID NO: 2) coding for the recombinant protein of vlA which starts from the amino acid in position 1 to the amino acid in position 330 in the recombinant protein ⁇ h5330viren (SEQ ID NO: 9) in the transformation event cl / VCCH5330viren and gene h5332viren (SEQ ID NO: 3) encoding the recombinant protein of vlA which starts from the amino acid in position 1 to amino acid at position 332 in the recombinant protein
  • h5320viren gene (SEQ ID NO: 1) (canile 1) , in the event of transformation / V CCH5320viren, gene h5330viren (SEQ ID NO: 2) (lane 2) in the transformation event cl / VCCH5330 viren and gene h5332viren (SEQ ID NO: 3) (lane 3) in the event of CI / VCCH5332viren transformation, (M) molecular weight marker and shows DNA control of Chlamydomonas reinhardtii (Canil 4) without genetic modifications).
  • recombinant protein ⁇ h5320viren (SEQ ID NO: 8) encoded in the h5320viren gene (SEQ ID NO: 1)
  • recombinant protein ⁇ h5330viren (SEQ ID NO: 9) encoded in the hS330v ⁇ nn gene ( SEQ ID NO: 2)
  • recombinant protein ⁇ h5332viron (SEQ ID NO: 10) encoded in the h5332viren gene (SEQ ID NO: 3), for its protein expression in the Chlamydomonas reinhardtii chloroplast genome.
  • the present invention describes the recombinant proteins of vlA, recombinant protein ⁇ h5320viran (SEQ ID NO: 8), recombinant protein ⁇ h5330viren (SEQ ID NO: 9) and recombinant protein ⁇ h5332viren (SEQ ID NO: 10), which are described starting from amino acid at position 1 to amino acid at position 320 in recombinant protein ⁇ h5320viren (SEQ ID NO: 8 ), starting from the amino acid at position 1 to the amino acid at position 330 in the recombinant protein, ⁇ hS33 (Mren (SEQ ID NO: 9) and starting from the amino acid at position 1 to the amino acid at position 332 in the ⁇ h5332viren recombinant protein (SEQ ID NO: 10), where the numbering of amino acid positions of the WA recombinant proteins, ⁇ h5320viren recombinant protein (SEQ ID NO: 8), ⁇ h533 recombinant protein (M
  • H5 recombinant proteins of the vlA object of the present invention n, recombinant protein ⁇ h5320viren (SEQ ID NO: 8), recombinant protein ⁇ h5330viren (SEQ ID NO: 9) and recombinant protein ⁇ h5332viren (SEQ ID NO: 10), corresponding to heterologous protein sequences of the peptide sequence of the HA protein, serotype H5 of vlA, with an approximate weight of -38 kDa expressed in microalgae chloroplast of the species Chlamydomonas reinhardtii.
  • CCH5332viren generate heterologous proteins of recombinant origin of the vlA protein, being in any case, different from the sequence of the H5 protein of! vlA observed in nature, presenting in the C-terminal amino acid sequence, at amino acid position 311 to amino acid position 320, the following amino acid residues: His-PiXhPhe-Thr-lle-Gly-Glu-Cys-Pro -Lys in the case of the recombinant protein ⁇ h5320viren (SEQ ID NO: 8), the C-terminal amino acid sequence at amino acid position 321 to amino acid position 330, the following amiix> acid residues: Tyr-VahLys- Ser-Lys-Lys-Leu-Val-Leu-Ala in the case of the recombinant protein ⁇ hS330viren (SEQ ID NO: 9) and the C-terminal amino acid sequence at amino acid position 323 to amino acid position 332, following amino acid residues: Lys-S
  • the present invention comprises the codon synthetic genes optimized for use in the chiamydomonas minhardtii doroplast genome system in transformation events V CCH5320virenc, l / V CCH5330viren and dA / CCH5332vjren, synthetic genes: h5320viren gene (SEQ ID NO: 1), h5330viren gene (SEQ ID NO: 2) and h5332viren gene (SEQ ID NO: 3) codon optimized with the DNA nucleotide sequences encoding the recombinant vlA proteins.
  • ⁇ h5320viren recombinant protein (SEQ ID NO: 8), ⁇ h5330viren recombinant protein (SEQ ID NO: 9) and ⁇ h5332viran recombinant protein (SEQ ID NO: 10), being in any case capable of being expressed in the eukaryotic heterologous expression system of the Ch ⁇ amydomonas rainhardtii doroplast genome, originating from the transformation events / V CCH5320virenc, l / V CCH5330viren and cWCCH5332viren, by inserting them into the nucleotide sequence of the DNA corresponding to the genome in plastids (chloroplasts).
  • its antigenic stimulation is measurable in experimental animals as a vaccine antigen against the vlA applied by various routes such as the following examples: mucous route in general (respiratory, digestive and conjunctival), parenteral route (intramuscular and subcutaneous), for control and treatment of the vlA, in all the organs susceptible to the disease induced by the vlA, as well as the direct determination of antibodies at the blood level by the IH technique, observing antigenic stimulation and immune response with blood titers (geometric mean) of according to the Official Mexican Standard NOM- 055ZOO-1995, by the IH reference technique approved by the WHO at international level through its application as a vaccine antigen, against the vlA applied by various routes such as the following examples: mucous route in general (respiratory, digestive and conjunctival), parenteral route (intramuscular and subcutaneous), for the control and treatment of vlA, in all the organs susceptible to ei vlA-induced disease.
  • Additional aspects of the invention are the use of genetically altered plastids (chloroplasts) for the expression of recombinant vlA proteins in the Chlamydomonas reinhardt ⁇ i organism obtained exclusively illustratively, in the transformation events / V CCH5320virenc, l / V CCH5330viren and V CCH5332viren , conserving its antigenicity crossed with the native protein from which they come by means of the westem blot test and its antigenic evaluation in experimental animals.
  • chloroplasts genetically altered plastids
  • the cell packet was sonicated for 5 cycles of 5 seconds with rest intervals of 5 seconds at an amplitude of 25% in the ULTRASONIC PROCESSOR sonicator model VCX130 (Cole-Palmer ® Company).
  • VCX130 Cold-Palmer ® Company
  • 20 ⁇ of the samples obtained from the transformation events c / V CCH5320viren, cl / VCCH5330viren and cl / VCCH5332viren were used for western blot analysis.
  • the protein extract obtained from each transformation event was submitted individually and in the same way following procedure: 20 ⁇ of each sample of each protein extract was mixed with 20 ⁇ of protein loading buffer (SDS 10%, TRIS 0.25M pH 6.8, Bromophenol Blue 0.1%, DDT 7.73%, glycerol 50%) and denatured by 5 minutes at 95 ° C and the samples were loaded on 12% polyacrylamide gel and run at 120 volts for one hour.
  • protein loading buffer SDS 10%, TRIS 0.25M pH 6.8, Bromophenol Blue 0.1%, DDT 7.73%, glycerol 50%
  • the protein samples were transferred from the 12% polyacrylamide gel to a nitrocellulose membrane by transfer buffer (0.3% Tris-base, 1.44% glycine, methane! 20%) to 150 Volts for one hour on the TV100-EBK Maxi Electroblotter transfer equipment (SCIE-PLAS UK).
  • transfer buffer 0.3% Tris-base, 1.44% glycine, methane! 20%
  • the membrane was washed twice with PBS-T solution (NaCl 0.8%, KCI 0.02%, Na2HP04 0.144%, KHP04 0.024%, Tween-20 0.05%), each wash was made for 2 minutes with stirring at 90 rpm After washing it was blocked with 5% powdered milk (Svetty (8> fat-free) in PBS-T for 1 hour.
  • the protein extract obtained from each transformation event cWCCH5320viren, cl / VCCH5330iren and cl / VCCH5332viren was subjected individually and equally to the following procedure: 20 ⁇ of each protein extract sample was rocked with 20 ⁇ loading buffer for proteins (SDS 10%, TRIS 0.25M pH 6.8, Bromophanol Blue 0.1%, DDT 7.73%, glycerol 50%) and were denatured for 5 minutes at 95 ° C and the samples were gel loaded 12% polyacrylamide and ran at 120 volts for one hour.
  • SDS 10%, TRIS 0.25M pH 6.8, Bromophanol Blue 0.1%, DDT 7.73%, glycerol 50% 20 ⁇ loading buffer for proteins
  • the protein samples were transferred from the 12% polyacrylamide gel to an nltrocellulose membrane by means of the transfer buffer (0.3% Tris-base, 1.44% glycine, 20% methane! At 150VoKs for one hour in the transfer kit TV100-EBK Maxi Electroblotter (SCIE-PLAS UK).
  • the membrane was washed twice with PBS-T solution (NaCl 0.8%, KCI 0.02%, Na2HP04 0.144%, KHP04 0.024%, Tween-20 0.05%), each wash was done for 2 minutes with stirring at 90 rpm After washing it was blocked with 5% powdered milk (Svelty ® without fat) in PBS-T for 1 hour.
  • the nitrocetulose membrane was incubated with the antiserum (polyclonal primary antibody) IgY antiH5 diluted 1/1000 in PBS-T for 12 hours at 4 ° C. After 12 hours the membrane was washed twice with PBS-T and then incubated with the secondary IgY Rabbrt Anti-Chicken IgY H&L (HRP) antibody (ab6753), Rb pAb to ChK IgY (HRP) cat No ab6753 lot GR47125 -12 (Abcam® brand) diluted 1/2000 in PBS-T for one hour at room temperature. After one hour, the membrane was washed twice with PBS-T, 2 minutes with stirring at 90 rpm in each wash.
  • the antiserum polyclonal primary antibody
  • IgY antiH5 diluted 1/1000 in PBS-T for 12 hours at 4 ° C. After 12 hours the membrane was washed twice with PBS-T and then incubated with the secondary IgY Rabbrt Anti-
  • the antiserum (polyclonal primary antibody) IgY antiH5 was obtained from experimental animals (commercial broiler) aged 14 days, vaccinated under two applications at intervals of 1 week, of a commercial emulsion vaccine against avian influenza (influenza vaccine, brand VIREN SA DE CV)) and bleed 28 days after the first application.
  • Figure No. 9 Western btot test (pdidonal antibodies) for the detection of recombinant vlA proteins.
  • Recombinant protein ⁇ h5320viren (lane 1), recombinant protein ⁇ h5330viren (lane 2) recombinant protein ⁇ h5332viren (lane 4), weight marker molecular (lane M), shows tissue control of Chlamydomonas minharcttii without genetic modifications (lane 3).
  • an antigen can be considered as a substance, compound or molecule with characteristics that allow it to trigger an immune response and the possible formation of specific antibodies. Considering any substance, compound or molecule own or exogenous to the organism, which can be recognized by the adaptive immune system.
  • antigen in the present invention considers the use, use or application of recombinant vlA proteins referred to as recombinant protein ⁇ h5320viren (SEQ ID NO: 8), recombinant protein ⁇ h5330viren (SEQ ID NO: 9) and recombinant protein ⁇ 5332viren (SEQ ID NO: 10), however, it should be considered that its designation as a proposed recombinant antigen does not limit its use, use or application in different areas of medicine, encompassing the general impact of the present invention, including its use, use or application in prevention, diagnosis, study and uses not mentioned in the present invention.
  • vlA recombinant proteins ⁇ h5320viren recombinant protein (SEQ ID NO: 8)
  • ⁇ h5330viren recombinant protein (SEQ ID NO: 9) and ⁇ h5332virert recombinant protein (SEQ ID NO: 10) obtained from the transformation events cl / VCCH5320viren, cl / VCCH5330viren and cl / VCCH5332viren, expressed and used directly from the raw culture material of transformation events, as well as their use as an example considered exclusively illustrative in the application routes described in examples 1, 2 and 3, without limiting their possible use in pharmaceutical formulations or vaccines not mentioned in the present invention
  • adjuvant considered to be both plural and singular, if not indicated or specified in the context where it is cited, is used in the present invention in general terms, to describe a chemical substance or mixture, which when integrated or administered together with some antigen, increase the immune response object of that application, being in any case, used to improve the immune response, direct or modulate it.
  • adjuvants used for examples 1, 2 and 3 specifically describe illustrative examples explicitly marked as such, these being possible pharmaceutical combinations, vaccines and / or vehicles proposed as an illustration of the possibilities of use, use or administration, indicating at all times , that these do not reduce or limit the use of other possible adjuvants used in combination or co-administered in the present invention.
  • the "adjuvants" employed for the examples described in the present invention may not necessarily or exclusively include water / oil, oil / water emulsions, aluminum hydroxide, saponins. c) .- Definition of the term "vaccine” and types of "vaccines"
  • vaccine is generally described as the preparation of an antigen, applied in an organism for immune stimulation and conferring a level of immunological stimulation against the antigen or the antigen carrying microorganism for which the pharmaceutical formulation was used.
  • examples 1, 2 and 3 are mentioned. It is to be noted that these represent illustrative examples exclusively of the possibilities of use, use or administration of the recombinant proteins object of the present invention, not limiting its exclusive use to examples 1, 2 and 3. d) .- Emulsified vaccine formula and formulation of ocular vaccines and intranasal application used in examples 1, 2 and 3.
  • recombinant protein ⁇ h5320v ⁇ ren SEQ ID NO: 8
  • recombinant protein ⁇ h5330viren SEQ ID NO: 9
  • recombinant protein ⁇ h5332viren SEQ ID NO: 10
  • h5320viren gene SEQ ID NO: 1
  • h5330viren gene SEQ ID NO: 2
  • h5332viren gene SEQ ID NO: 3
  • Example 1 Emulsion formulation with recombinant antigens ⁇ h5320viren recombinant protein (SEQ ID NO: 8), recombinant protein ⁇ h5330viren (SEQ ID NO: 9) and recombinant protein ⁇ h5332viren (SEQ ID NO: 10).
  • Emulsion vaccine water / oil
  • parenteral application intramuscular / subcutaneous
  • Example 2 Vaccine formulation with recombinant antigens recombinant protein ⁇ h5320viren (SEQ IO NO: 8), recombinant protein ⁇ h5330viren (SEQ ID NO: 9) and recombinant protein ⁇ h5332viren (SEQ ID NO: 10), for mucosal application in general (ocular-nasal).
  • Vaccine ocular-nasal route vacciniasal route
  • Example 3 Vaccine formulation with recombinant antigens ⁇ h5320viren recombinant protein (SEQ ID NO: 8), ⁇ h5330viren recombinant protein (SEQ ID NO: 9) and ⁇ h5332viren recombinant protein (SEQ ID NO: 10) for parenteral application (intramuscular application and subcutaneous). Parenteral vaccine (intramuscular / subcutaneous)
  • the formulations proposed for these animal model tests consisted of the experimental vaccine formulas indicated in conjunction with the experimental designs.
  • the groups of animals consisted of 3-week-old piglets, pigs (Their domestic sap) breed (Yorkshire), without lesions, presence of antibodies to vlA or clinical signotogy associated with infectious processes or disease-associated transtomos. In all cases, control groups were available to assess the absence of antibodies against vlA. ii) .- Experimental design in pigs (Sus scrofa domestica) breed
  • the reference HA antigens H5N2 avian strain authorized by the Mexican Government
  • U HA haemagglutinating units
  • U HA haemagglutinating units
  • the sera are inactivated by heat for 30 minutes at 56 ° C. Dilute to 1/10 with phosphate buffered saline.
  • the vlA test is preferable to perform it in log. base 2.
  • IH produced by positive cough serums should have a pattern similar to that of control erythrocyte cough, a circular button with defined edges that slides in the shape of a tear at the bottom of the well, when tilting the microplate at an angle of 45 °.
  • the erythrocytes sediment forming a uniform layer at the bottom of the wells.
  • the titres of IH are determined as reciprocal coughs of the major dilutions of the serum in which the IH is observed. iv) .- Results to the IH test.
  • the formulations proposed for these animal model tests consisted of the experimental vaccine formulas indicated in conjunction with the experimental designs.
  • the groups of animals consisted of poultry (Gallus gallus domesticus) of 21 days of age without lesions, presence of antibodies to vlA or dynamic sign associated with infectious processes or diseases associated with disease. In all cases, control groups were available to assess the absence of antibodies against vlA.
  • the reference HA antigens (H5N2 avian strain authorized by the Mexican Government) are diluted to a concentration of 4 HAU / 25 ⁇
  • the IH produced by the positive sera must have a pattern similar to that of control erythrocytes, a circular button with defined edges that slides in the shape of a tear at the bottom of the well, by tilting the microplate at an angle of 45 °.
  • cough erythrocytes sediment forming a uniform layer at the bottom of coughs.
  • the titres of IH are determined as reciprocal coughs of the major dilutions of the serum in which the IH is observed. iv) .- Results to the IH test.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Virology (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Pulmonology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical & Material Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

The invention describes sequences of synthetic haemagglutinin nucleotides of the avian influenza virus, more specifically haemagglutinin type 5, characterised by being codon-optimised for correct genetic expression in the Chlamydomonas reinhardtii chloroplast; the codified recombinant proteins codified by these nucleotide sequences, and their use or application in the vaccination of animals and humans.

Description

SECUENCIAS DE ÁCIDOS DESOXIRRIBONUCLEICOS SINTÉTICOS Y SEQUENCES OF SYNTHETIC DEOXIRRIBONUCLEIC ACIDS AND
PROTEÍNAS RECQliBI N ANTES HETERÓL06AS DE LA HEMAGLUTININA DEL VIRUS INFLUENZA EXPRESADAS EN CLOROFLASTO DE CHLAMYDOMONAS REINHARDTII Y SU USO ENPROTEINS RECYCLED BEFORE HETEROL06AS OF THE INFLUENZA VIRUS HEMAGLUTININE EXPRESSED IN CHLAMYDOMONAS REINHARDTII CHLOROPHLINTS AND ITS USE IN
VACUNAS. VACCINES
DESCRIPCIÓN DESCRIPTION
I. - OBJETO DE LA INVENCIÓN I. - OBJECT OF THE INVENTION
La presente invención se refiere ai campo de la medicina, bioquímica estructura!, genética molecular e ingeniería genética preferentemente aplicado al área de enfermedades infecto-contagiosas. En particular, la presente invención se refiere al diseño, síntesis y/o expresión de proteínas recombinantes de la glicoproteína de membrana tipo I de superficie, hemaglutinina (HA) del virus de influenza aviar (vl A), la secuencias sintéticas codón optimizadas de nucleótidos de ácidos desoxirribonudeicos (ADN) que las codifican y el empleo del plástido (cioroplasto) de la especie de microalga, Chíamydomonas reinhardtii, para la expresión de las secuencias de aminoácidos que las codifican. Más particularmente, el empleo de estas secuencias de nucleótidos del ADN y secuencias peptídicas heteróiogas para su uso como tratamiento y/o vacunación para el control de la vlA, en todos los organismos susceptibles a la enfermedad inducida por el vlA. The present invention relates to the field of medicine, biochemical structure, molecular genetics and genetic engineering preferably applied to the area of infectious-contagious diseases. In particular, the present invention relates to the design, synthesis and / or expression of recombinant proteins of the surface type I membrane glycoprotein, hemagglutinin (HA) of avian influenza virus (vl A), the codon optimized nucleotide synthetic sequences of deoxyribonucleic acids (DNA) that encode them and the use of the plastid (cioroplast) of the microalgae species, Chíamydomonas reinhardtii, for the expression of the amino acid sequences that encode them. More particularly, the use of these DNA nucleotide sequences and heterogeneous peptide sequences for use as a treatment and / or vaccination for the control of vlA, in all organisms susceptible to vlA-induced disease.
II. - ANTECEDENTES DE LA INVENCIÓN II. - BACKGROUND OF THE INVENTION
Entre una de las más importantes afecciones inducidas por el virus de influenza (vi) tipo A se encuentra la Influenza aviar (IA), la cual es una enfermedad sistémica en aves que produce síndromes desde infecciones asintomáticas, signos respiratorios, baja de postura, hasta mortalidad cercana al 100 %. Entre los factores que modifican la presentación clínica de IA se encuentran factores como especie del hospedador, edad, sexo, infecciones oportunistas, inmunidad conferida además de otros factores ambientales. (Swayne DE, Et al. Diseases of Pouttry 13th. Editor, John Wiley & Sons, 2013) Los tipos del vi se organizan de acuerdo a reacciones serológicas de proteínas como NP o M1, clasificando a los tipos de vi en A, B, y C, donde los tipos B y C se consideran más propios de otras especies, no incluyendo a las aves comerciales. (Spackman E et al. Methods in molecular bidogy 436, Avian influenza virus, 2007). El vi es clasificado en la familia de los Orthomyxovíridae genero Influenza virus tipo A. (Cox NJ, et al. Orthomyxoviridae. In Regenmortel Van MH, Fauquet CM, Bishop DHL, Carstens EB, Estes MK, Lemon SM, Maniloff J, Mayo MA, McGeoch DJ, Pringie CR, Wickner RB (eds.). Virus taxonomy. Seventh report of the intemational committee on taxonomy of viruses. Academic Press: San Diego, 2000: 585-597). Existe una subclasificación del vi basada en reacciones serológicas de HA y la neuroaminidasa (NA), por lo que se describen 17 tipos de HA y 9 tipos de NA, (Dong G, Peng C, Luo J, Wang C, Han L, Wu B, Ji G, He H. Adamantane-resistant influenza a viruses in the worid (1902-2013): frequency and distribution of m2 gene mutations. PLoS One. 2015; 13:10), de las cuales, la mayoría de las combinaciones de HA y NA se han observado en los vi aislados en polios y aves salvajes. (Alexander DJ. A review of avian influenza in different bird species. Vet. Mterobiol. 2000; 74: 3-13.) Among one of the most important conditions induced by influenza virus (vi) type A is Avian Influenza (AI), which is a systemic disease in birds that produces syndromes from infections asymptomatic, respiratory signs, low posture, until mortality close to 100%. Among the factors that modify the clinical presentation of AI are factors such as host species, age, sex, opportunistic infections, immunity conferred in addition to other environmental factors. (Swayne DE, Et al. Diseases of Pouttry 13th. Editor, John Wiley & Sons, 2013) The types of vi are organized according to serological reactions of proteins such as NP or M1, classifying the types of vi into A, B, and C, where types B and C are considered more typical of other species, not including commercial birds. (Spackman E et al. Methods in molecular bidogy 436, Avian influenza virus, 2007). The vi is classified in the family of the Orthomyxovíridae genus Influenza virus type A. (Cox NJ, et al. Orthomyxoviridae. In Regenmortel Van MH, Fauquet CM, Bishop DHL, Carstens EB, Estes MK, Lemon SM, Maniloff J, May MA , McGeoch DJ, Pringie CR, Wickner RB (eds.). Virus taxonomy. Seventh report of the international committee on taxonomy of viruses. Academic Press: San Diego, 2000: 585-597). There is a subclassification of vi based on serological reactions of HA and neuroaminidase (NA), so 17 types of HA and 9 types of NA are described, (Dong G, Peng C, Luo J, Wang C, Han L, Wu B, Ji G, He H. Adamantane-resistant influenza a viruses in the worid (1902-2013): frequency and distribution of m2 gene mutations. PLoS One. 2015; 13:10), of which, most combinations of HA and NA have been observed in isolated isolates in polios and wild birds. (Alexander DJ. A review of avian influenza in different bird species. Vet. Mterobiol. 2000; 74: 3-13.)
En general, los virus de influenza aviar (vlA), presentan una forma esférica, pieornórfica o filamentosa, con un diámetro de 80 a 120 nm pudiendo ser mayor en el caso de la forma filamentosa. La superficie exterior del viríón esta cubierta por dos tipos de glicoproteínas proyectadas hacia el exterior de aproximadamente 10 - 14 nm de longitud y 4 - 6 nm de diámetro, trímeros alargados con forma de vara correspondientes a la HA y tetrámeros con forma de hongo denominadas NA. Los viriones del vlA presentan una densidad de flotación en solución acuosa sacarosa de 1.19 g/cm3, con una nucleocápside con simetría helicoidal; (Swayne DE et al. 2013) Poseen un genoma viral de ácido ribonucleico (RNA) de cadena sencilla en sentido negativo (vRNA(-) ss), conformado por 8 segmentos los cuales codifican para la expresión de 10 proteínas, donde en el caso del vlA clasificado como H5N2, ei segmento 4 conformado por 1,767 pares de nudeótidos del ADN, codificando para una proteína de 564 aminoácidos ó residuos, con peso de ~56 kiloDaltons (kDa), correspondiente a la HA, siendo esta una glicoproteina de membrana tipo I integrada, con actividad de hemaglutinación, unión del virión a los receptores celulares ó glicoproteínas de membrana sialil-oligosacáridos de las células susceptibles, siendo está, principal objeto de neutralización mediada por anticuerpos (Swayne DE et al. 2013). En general el vi, presenta un sitio de separación proteolítica dentro de la secuencia peptídica en la proteína HA, el cual resulta ser un proceso de relevancia durante la infección en la célula huésped; siendo el tipo de proteasa, un determinante en la patogenicidad de cada cepa del vi. Este sitio es reconocido por proteasas de la célula huésped, siendo el tipo de proteasa, un determinante en la patogenicidad de cada cepa del vi, clasificáoslos bajo este criterio como vi de alta patogenicidad relacionada con una presentación sistémica de la enfermedad ó vi de baja patogenicidad, relacionada con una presentación digestiva o respiratoria de la enfermedad (Swayne DE et al.2013). En general el ciclo de replicación del vi se inicia cuando este es ingresado a las células huésped, por medio de la unión con los receptores virales ó HA con los receptores de superficie cólular ó sialil- oiigosacáridos, glicoprotefnas que contienen ácido siálico (SA por sus siglas en inglés), derivado del ácido neuroamínico (ácido N-acetil neuroamínico (NeuAc o NANA) ó N-glycolil neuroamínico (NeuGc)), iniciando así la endocitosis y su posterior replicación viral interna en la célula huésped. Debido a la características propias e individuales, la HA presenta una diversa configuración y especificidad dependiente del sitio de unión con el SA. (Serme DA, Panigrahy B, Kawaoka Y, PearsonJE, SussJ, LipkindM, KJda H, Webster RG. Surveyofthehemagglutinin (HA) deavage site sequence of H5 and H7 avian influenza virusas: Amino acid sequenoe ai the HA deavage site as a marker of pathogenicity potential. Avian Dis. 1996; 40: 425-437). Entre los diversos tipos del vi, en el caso particular, el vlA es considerado un problema y riesgo global, ya que su presencia es reportada a lo largo de todo el mundo en diversas especies, lo cual hace que su prevención y control requieran de la cooperación internacional. (Alexander DJ. A review of avian influenza in drfferent bird species. Vet. Microbiol. 2000; 74: 3-13). La vacunación, diagnóstico pronto y medidas de biosegurídad son la principal estrategia para el control, debido a que en el presente, las vacunas no son capaces de conferir protección al mismo tiempo contra diversos serotipos o variedades de HA, aunado al riesgo de la fácil dispersión del vlA en especies de animales de abasto como los pollos de engorde y gallinas de postura (Gailus gallus domesticus), los cuales son susceptibles a cualquier serotipo de los 17 tipos HA conocidos. {Austin FJ, Et al. Antigenic mapping of an avian H1 influenza virus haemagglutinin and interrelationships of H1 viruses from humans, pigs and birds. J Gen Viroi. 1986; 67: 983-992), siendo otras especies como el cerdo (Sus scrofa domestica) capaces de replicarse el vlA en diversos tejidos y ser un potencial vínculo entre diferentes animales de abasto y el ser humano (Rahn J, Et al. Vacóme 2015 (30). Vaccines against influenza A viruses in poultry and swine: Status and Mure devetopments.). El empleo de vacunas basadas en virus inactivados ha sido una herramienta útil para prevenir signología clínica y mortalidad en diversas especies, siendo estas elaboradas a partir de su inoculación y manejo en embriones de pollo. (Swayne DE et al. 2013) En la actualidad, el estudio de la genética y proteómica del vi han permitido el desarrollo de estrategias donde estos conocimientos resultan útiles para su control. El conocimiento de la estructura proteica viral ha resultado en el diseño de diversas estrategias para su control: bloqueadores de la HA del vi, (Femandez-Siurob I. Assessment of viral interiérence using a chemical receptor blocker against avian influenza and establishment of pnotection levéis in fíeld outbreaks. Vaccine. 2014 Mar 5; 32(11):1318-22), así como la expresión de proteínas virales del vi. (Swayne DE et al. 2013) Estos trabajos han demostrado inducir protección contra el vlA, además que resultan de igual manera efectivos contra la HA a partir de la cual fue diseñada la vacuna, sea de origen humana o animal. (Swayne DE et al. 2013) Sin embargo en ninguna de las anteriores referencias se hace mención de las secuencias sintéticas de ADN codón optimizadas para expresión en cforoplasto de Chlamydomonas reinhardtü denominadas como gen h5320viren (SEQ ID NO: 1) codificante para la proteína recombinante Δh5320viren (SEQ ID NO: 8), la cual inicia en ei aminoácido en la posición 1 hasta el aminoácido en la posición 320, gen h5330viren (SEQ ID NO: 2) codificante para la proteína recombinante Mi5330viren (SEQ ID NO: 9), la cual inicia desde el aminoácido en la posición 1 hasta el aminoácido en la posición 330 y gen hS332viren (SEQ ID NO: 3) codificante para la proteína recombinante Δh5332viren (SEQ ID NO: 10) la cual inicia desde el aminoácido en la posición 1 hasta el aminoácido en la posición 332, donde la numeración de las posiciones de los aminoácidos de las proteínas recombinantes, proteína recombinante Δh5320viren (SEQ ID NO: 8), proteína recombinante Áh5330v¡ren (SEQ ID NO: 9) y proteína recombinante Δh5332viren (SEQ ID NO: 10), se refieren exclusivamente a la posición de aminoácidos en las secuencias peptldicas SEQ ID NO: 8, SEQ ID NO: 9 y SEQ ID NO: 10 respectivamente; Aunado a que no ha sido propuesto el uso para la expresión proteica en base a la secuencia de nucleótidos de AON sintético referidas como gen h5320viren (SEQ ID NO: 1), gen hS330viren (SEQ ID NO: 2) y gen h5332viren (SEQ ID NO: 3), en el sistema de expresión proteica heteróloga del cloroplasto de Chlamydomonas minharótii, bajo un diseño o modelo de nucleótidos de ADN sintético codificante para su secuencia peptidica, así como tampoco el empleo de estos como antígeno vacunal contra el vlA por diversas vías de aplicación como los siguientes ejemplos: vía mucosas en general (ejemplo: respiratoria, digestiva y conjuntival), vía parenteral (ejemplo: intramuscular y subcutánea) de la proteína recombinante Δh5320 viren (SEQ ID NO: 8), proteína recombinante Δh5330viren (SEQ ID ÑO: 9) y proteína recombinante Δh5332viren (SEQ ID NO: 10), expresadas en base a la secuencia de nucleótidos de ADN sintético insertadas en el genoma del cloroplasto de Chlamydomonas reinhardtii. Por tal motivo, se planteó el diseño y expresión de la proteína reoombinante Δh5320viren (SEQ ID NO: 8), proteína reoombinante Mi5330viren (SEQ ID NO: 9) y proteína reoombinante Δh5332viran (SEQ ID NO: 10), basadas en el diseño de secuencias sintéticas de nucieótidos de AON codificantes para la expresión proteica heterótoga de péptidos clasificados como variantes sintéticas de la proteína HA del vlA, capaces de ser expresadas y/o producidas en el sistema de expresión proteica heterólogo eucaríota del cloroplasto de Chlamydomonas reinhardtii de forma estable mediante la generación de organismos genéticamente modificados (OGM'S), de manera independiente al uso e inoculación del vlA en medios de cultivo convencionales como embrión de pollo y/o cultivo celular, resultando en la obtención de las proteínas recombinantes del vlA, proteína reoombinante Áh5320viren (SEQ ID NO: 8), proteína reoombinante Áh5330viren (SEQ ID NO: 9) y proteína reoombinante Δh5332viran (SEQ ID NO: 10), expresadas mediante la transformación genética del genoma del cloroplasto en el microorganismo Chlamydomonas reinhardtii como se describe en el presente documento. In general, avian influenza (vlA) viruses have a spherical, pylororphic or filamentous shape, with a diameter of 80 to 120 nm, being able to be greater in the case of the filamentous form. The outer surface of the viríón is covered by two types of glycoproteins projected outwards of approximately 10 - 14 nm in length and 4-6 nm in diameter, elongated rod-shaped trimers corresponding to the HA and fungus-shaped tetramers called NA . The vlA virions have a flotation density in aqueous sucrose solution of 1.19 g / cm3, with a nucleocapsid with helical symmetry; (Swayne DE et al. 2013) They have a single-stranded negative-chain ribonucleic acid (RNA) genome (vRNA (-) ss), consisting of 8 segments which code for the expression of 10 proteins, where in the case of vlA classified as H5N2, segment 4 formed by 1,767 pairs of DNA nudeotides, coding for a protein of 564 amino acids or residues, weighing ~ 56 kiloDaltons (kDa), corresponding to HA, this being a type membrane glycoprotein I integrated, with hemagglutination activity, binding of the virion to cell receptors or sialyl oligosaccharide membrane glycoproteins of susceptible cells, being the main object of antibody-mediated neutralization (Swayne DE et al. 2013). In general, vi presents a proteolytic separation site within the peptide sequence in the HA protein, which turns out to be a process of relevance during infection in the host cell; being the type of protease, a determinant in the pathogenicity of each strain of vi. This site is recognized by host cell proteases, being the type of protease, a determinant in the pathogenicity of each strain of vi, classify them under this criterion as high pathogenicity related to a systemic presentation of the disease or low pathogenicity vi , related to a digestive or respiratory presentation of the disease (Swayne DE et al. 2013). In general, the vi replication cycle begins when it is entered into the host cells, through union with the viral or HA receptors with the cell surface receptors or sialyl oiigosaccharides, glycoproteins containing sialic acid (SA by their acronym in English), derived from neuroamine acid (N-acetyl neuroamic acid (NeuAc or NANA) or N-glycolyl neuroamine (NeuGc)), thus initiating endocytosis and its subsequent internal viral replication in the host cell. Due to its own and individual characteristics, the HA has a different configuration and specificity depending on the site of union with the SA. (Serme DA, Panigrahy B, Kawaoka Y, PearsonJE, SussJ, LipkindM, KJda H, Webster RG. Surveyofthehemagglutinin (HA) deavage site sequence of H5 and H7 avian influenza viruses: Amino acid sequenoe ai the HA deavage site as a marker of pathogenicity potential Avian Dis. 1996; 40: 425-437). Among the different types of vi, in the particular case, vlA is considered a global problem and risk, since its presence is reported throughout the world in different species, which makes its prevention and control require International cooperation. (Alexander DJ. A review of avian influenza in drfferent bird species. Vet. Microbiol. 2000; 74: 3-13). Vaccination, early diagnosis and biosecurity measures are the main strategy for control, because at present, vaccines are not able to confer protection at the same time against various serotypes or varieties of HA, coupled with the risk of easy dispersion of vlA in species of supply animals such as broilers and laying hens (Gailus gallus domesticus), which are susceptible to any serotype of the 17 HA types known. {Austin FJ, Et al. Antigenic mapping of an avian H1 influenza virus haemagglutinin and interrelationships of H1 viruses from humans, pigs and birds. J Gen Viroi. 1986; 67: 983-992), being other species such as the pig (Sus scrofa domestica) capable of replicating the vlA in various tissues and being a potential link between different supply animals and humans (Rahn J, Et al. Vacóme 2015 ( 30) Vaccines against influenza A viruses in poultry and swine: Status and Mure devetopments.). The use of inactivated virus-based vaccines has been a useful tool to prevent clinical signology and mortality in various species, these being prepared from inoculation and management in chicken embryos. (Swayne DE et al. 2013) Currently, the study of vi genetics and proteomics has allowed the development of strategies where this knowledge is useful for its control. The knowledge of the viral protein structure has resulted in the design of various strategies for its control: HA blockers of vi, (Femandez-Siurob I. Assessment of viral interaction using a chemical receptor blocker against avian influenza and establishment of pnotection levéis in fíeld outbreaks Vaccine 2014 Mar 5; 32 (11): 1318-22), as well as the expression of viral proteins of vi. (Swayne DE et al. 2013) These works have been shown to induce protection against vlA, in addition to being equally effective against HA from which the vaccine was designed, whether of human or animal origin. (Swayne DE et al. 2013) However, none of the above references mention the synthetic codon DNA sequences optimized for Chlamydomonas reinhardtü cforoplast expression referred to as the h5320viren gene (SEQ ID NO: 1) encoding the protein Recombinant Δh5320viren (SEQ ID NO: 8), which starts at the amino acid at position 1 to the amino acid at position 320, h5330viren gene (SEQ ID NO: 2) encoding the recombinant protein Mi5330viren (SEQ ID NO: 9) , which starts from amino acid at position 1 to amino acid at position 330 and hS332viren gene (SEQ ID NO: 3) encoding the recombinant protein Δh5332viren (SEQ ID NO: 10) which starts from amino acid at position 1 to amino acid at position 332, where the numbering of amino acid positions of recombinant proteins, recombinant protein Δh5320viren (SEQ ID NO: 8), recombinant protein Áh5330v¡ren (SEQ ID NO: 9) and recombinant protein Δh5332viren (SEQ ID NO: 10), refer exclusively to the position of amino acids in the peptide sequences SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10 respectively; In addition to the fact that it has not been proposed for protein expression based on the synthetic AON nucleotide sequence referred to as the h5320viren gene (SEQ ID NO: 1), hS330viren gene (SEQ ID NO: 2) and h5332viren gene (SEQ ID NO: 3), in the heterologous protein expression system of Chlamydomonas minharótii chloroplast, under a design or nucleotide model of synthetic DNA coding for its peptide sequence, as well as the use of these as a vaccine antigen against vlA by various routes of application as the following examples: mucous route in general (example: respiratory, digestive and conjunctival), parenteral route (example: intramuscular and subcutaneous) of the recombinant protein Δh5320 viren (SEQ ID NO: 8), recombinant protein Δh5330viren (SEQ ID ÑO: 9) and recombinant protein Δh5332viren (SEQ ID NO: 10), expressed based on the nucleotide sequence of synthetic DNA inserted in the genome of Chlamydomonas reinhardtii chloroplast. For this reason, the design and expression of the oh5320viren re-dominant protein (SEQ ID NO: 8), Mi5330viren re-dominant protein (SEQ ID NO: 9) and Δh5332viran re-dominant protein (SEQ ID NO: 10), based on the design of synthetic sequences of AON nucieotides encoding the heterotopic protein expression of peptides classified as synthetic variants of the HA protein of vlA, capable of being expressed and / or produced in the eukaryotic heterologous protein expression system of Chlamydomonas reinhardtii chloroplast by stably the generation of genetically modified organisms (GMOs), independently of the use and inoculation of vlA in conventional culture media such as chicken embryo and / or cell culture, resulting in the obtention of recombinant vlA proteins, rehombinant protein Áh5320viren (SEQ ID NO: 8), rhombingent protein Áh5330viren (SEQ ID NO: 9) and rhombic protein Δh5332viran (SEQ ID NO: 10), expressed by the genetic transformation of the chloroplast genome in the Chlamydomonas reinhardtii microorganism as described herein.
DESCRIPCIÓN DETALLADA DE LA INVENCIÓN DETAILED DESCRIPTION OF THE INVENTION
Previo a la descripción de la presente invención, así como la declaración de las reivindicaciones de esta misma, es de aclarar que tos términos técnicos empleados a lo largo del presente documento que describe la presente invención, tienen los mismo significados que tos que entienda un experto reconocido en el área que sea empleada en esta invención, a no ser que se indique de otro modo, los valores, rango y parámetros considerados dentro de la presente descripción pueden varían en un rango de 1 al 5 %, a no ser que sea mencionado de otro modo o que sea del conocimiento de un experto en la técnica o área a la cual se haga referencia. Los términos "un", "una", "la", "el", "vacunación", "vacuna", "vehículo" pueden incluir su referencia en plural, a no ser que el contexto donde se citen indique lo contrario. Aunado a que se procede a declarar una descripción completa de tos métodos y materiales empleados en la presente invención, es posible el empleo de cualquier método o material similar o equivalente para la aplicación ó ensayos de la presente invención. Todas las referencias, publicaciones y antecedentes reportados citados en la presente invención, son enteramente considerados como referencias para la descripción o interpretación de tos procesos, métodos, materiales, técnicas ó protocolos mencionados en el desarrollo de la presente invención. Nada en el presente documento deberá de ser interpretado como una admisión de que la presente invención no tiene el derecho de ser un precedente de tal descripción en virtud de una invención anterior. Siendo todo debidamente descrito claramente en la descripción de la presente invención así como en la sección de reivindicaciones. La presente invención describe las secuencias de nucleótidos de ADN sintéticas codón optimizadas denominadas como gen h5320vtren (SEQ ID NO: 1), gen h5330víran (SEQ ID NO: 2) y gen hS332viran (SEQ ID NO: 3), caracterizadas por diferenciarse de cualquier otra secuencia empleada con anterioridad con el propósito de expresión de proteínas recombinantes del vlA, asi como por ser codón optimizadas para su correcta expresión genética en el sistema de expresión proteica eucariota del genoma del cloropiasto de Chlamydomonas reinhardtii, en particular, ser capaces de expresarse correcta mente en el sistema eucariota mencionado anteriormente mediante genes de diseño sintético. Prioritariamente, las secuencias de nucleótidos del ADN codón optimizadas para uso y expresión proteica en el genoma del cloropiasto de Chlamydomonas rainhardtíí, gen h5320viren (SEQ ID NO: 1) codificante para la proteína recombinante Δh5320viren (SEQ ID NO: 8), gen h5330viren (SEQ ID NO: 2) codificante para la proteína recombinante Δh5330viren (SEQ ID NO: 9) y gen h5332viren (SEQ ID NO: 3) codificante para la proteína recombinante Δh5332viren (SEQ ID NO. 10) y cualquier secuencia adicional de nucleótidos del ADN codón optimizada para el genoma del cloropiasto de Chlamydomonas reinhardtii para la expresión de las proteínas recombinantes, proteína recombinante Δh5320viren (SEQ ID NO: 8), proteína recombinante Δh5330viren (SEQ ID NO: 9) y proteína recombinante Áh5332viren (SEQ ID NO: 10), según descritas en la presente invención, objeto del presente documento. Las proteínas recombinantes, proteína recombinante Δh5320viren (SEQ ID NO: 8), proteína recombinante Δh5330viren (SEQ ID NO: 9) y proteína recombinante Δh5332viren (SEQ ID NO: 10) obtenidas, producidas, sintetizadas o expresadas en el doroplasto de Chlamydomonas reinhardtii, iniciando desde el aminoácido en la posición 1 hasta el aminoácido en la posición 320 en la proteína recombinante Δh5320v¡ren (SEQ ID NO: 8), iniciando desde el aminoácido en la posición 1 hasta el aminoácido en la posición 330 en la proteína recombinante Δh5330viren (SEQ ID NO: 9) e iniciando desde el aminoácido en la posición 1 hasta el aminoácido en la posición 332 en la proteína recombinante Δh5332viren (SEQ ID NO: 10), donde la numeración de las posiciones de los aminoácidos en el presente documento se refieren exclusivamente a la posición de los aminoácidos en la SEQ ID NO: 8, SEQ ID NO: 9 y SEQ ID NO: 10, por lo que al hacer referencia al aminoácido en la posición 320 (aminoácido 320) en la proteína recombinante Δh5320viren (SEQ ID NO: 8), el residuo de aminoácido 320 corresponde al residuo de aminoácido en la posición 320 en la SEQ ID NO: 8, y asi sucesivamente, sin embargo, en todo caso, las secuencias peptídicas y secuencias de nucleótidos del ADN que las codifican, proteína recombinante Δh5320viren (SEQ ID NO: 8) codificada en el gen h5320viren (SEQ ID NO: 1), proteína recombinante Δh5330viren (SEQ ID NO: 9) codificada en el gen h5330viren (SEQ ID NO: 2) y proteína recombinante Δh5332viren (SEQ ID NO: 10) codificada en el gen h5332viren (SEQ ID NO: 3), de acuerdo a la descripción de la presente invención, no presentan similitud alguna a la secuencia de nucleótidos de ADN que se observa en la naturaleza como se muestra en el ejemplo ilustrativo referencia en el presente texto, proteína HA del vlA, serotipo H5 que se menciona (GenBank: GU052588.1) y siendo en el caso de la secuencia peptídica, citada como ejemplo ilustrativo como referencia en el presente texto, proteína HA del vlA, serotipo H5, (GenBank: ACZ48561.1), punto inicial para el diseño de las proteínas recombinantes, proteína recombinante Δh5320viren (SEQ ID NO: 8), proteína recombinante Δh5330 viren (SEQ ID NO: 9) y proteína recombinante Δh5332viren (SEQ ID NO: 10), expresadas en doroplasto de Chlamydomonas reinhardtii, modificadas para su correcta expresión y plegamiento en el interior del plástido, en particular, el doroplasto de Chlamydomonas reinhardtii, siendo explícitamente y claramente señalado este hecho en la presente descripción. Se describe a continuación del mismo modo, objeto de la presente invención, las vacunas en base al antígeno vacunal de origen recombinante expresado en el doroplasto de Chlamydomonas reinhardtii denominado como proteína recombinante Δh5320viren (SEQ ID NO: 8), proteína recombinante Δh5330viren (SEQ ID NO: 9) y proteína recombinante Δh5332viren (SEQ ID NO: 10) expresadas en base a las secuencias de nucleótidos de ADN sintéticas insertadas en el genoma del doroplasto de Chlamydomonas reinhardtii, con el propósito de lograr su expresión proteica en el doroplasto de Chlamydomonas reinhardtii para la prevención y/o control del vlA aplicado vía digestiva (ejemplo: oral, sublingual), parenteral (ejemplo: intramuscular, subcutánea) y vía respiratoria (ejemplo: mucosas de la conjuntiva, mucosas de vías respiratorias), así también describiendo como parte de la presente invención objeto del presente documento la expresión de secuencias homologas de las proteínas recombinantes correspondientes a los segmentos peptídicos descritos en la presente invención, así como los que resulten de las secuencias homologas de la proteína HA del vlA obtenidos y expresados mediante manipuladón genética del genoma del doroplasto de Chlamydomonas reinhardtii. Presentando en todos los casos mencionados ventajas y diferencias, caraterísticas propias y únicas, debido a que el empleo del ctoropiasto de la especie de Chlamydomonas reinhardtii, asi como el diseño de los genes sintéticos y su uso para la expresión de proteínas recombinantes del vlA, permiten la producción de proteínas recombinantes sintéticas de bajo costo, nulos residuos otológicos infecciosos, siendo estas proteínas recombinantes del vlA, un producto basado en un organismo considerado generalmente reconocido como seguro o GRAS (por las siglas en ingles de "Generally Recognized as Safe (GRAS)) por la Administración de drogas y alimentos (FDA, por sus siglas en ingles), siendo en todo caso una ventaja y marco de referencia para la presente invención. Prior to the description of the present invention, as well as the declaration of the claims thereof, it is clear that the technical terms used throughout this document describing the present invention have the same meanings as those understood by an expert recognized in the area used in this invention, unless otherwise indicated, the values, range and parameters considered within the present description may vary in a range of 1 to 5%, unless mentioned otherwise or that is known to an expert in the technique or area to which reference is made. The terms "a", "a", "the", "the", "vaccination", "vaccine", "vehicle" may include their reference in the plural, unless the context in which they are cited indicates otherwise. In addition to declaring a complete description of the methods and materials used in the present invention, it is possible to use any similar or equivalent method or material for the application or testing of the present invention. All references, publications and reported background cited in the present invention are entirely considered as references for the description or interpretation of the processes, methods, materials, techniques or protocols mentioned in the development of the present invention. Nothing in this document shall be construed as an admission that the present invention does not have the right to be a precedent of such description by virtue of a previous invention. Everything being duly described clearly in the description of the present invention as well as in the claims section. The present invention describes the optimized codon synthetic DNA nucleotide sequences designated as the h5320vtren gene (SEQ ID NO: 1), h5330víran gene (SEQ ID NO: 2) and hS332viran gene (SEQ ID NO: 3), characterized by differentiating from any another sequence previously used for the purpose of expressing recombinant vlA proteins, as well as being codon optimized for their correct genetic expression in the eukaryotic protein expression system of the Chlamydomonas reinhardtii chloropytic genome, in particular, being able to express themselves correctly mind in the eukaryotic system mentioned above by means of synthetic design genes. As a priority, the codon DNA nucleotide sequences optimized for use and protein expression in the Chlamydomonas rainhardti genome, h5320viren gene (SEQ ID NO: 1) encoding the recombinant protein Δh5320viren (SEQ ID NO: 8), h5330viren gene ( SEQ ID NO: 2) coding for the recombinant protein Δh5330viren (SEQ ID NO: 9) and gene h5332viren (SEQ ID NO: 3) coding for the recombinant protein Δh5332viren (SEQ ID NO. 10) and any additional DNA nucleotide sequence codon optimized for the Chlamydomonas reinhardtii chloropiaste genome for the expression of recombinant proteins, recombinant protein Δh5320viren (SEQ ID NO: 8), recombinant protein Δh5330viren (SEQ ID NO: 9) and recombinant protein Áh5332viren (SEQ ID NO: 10) , as described in the present invention, object of the present document. Recombinant proteins, recombinant protein Δh5320viren (SEQ ID NO: 8), recombinant protein Δh5330viren (SEQ ID NO: 9) and recombinant protein Δh5332viren (SEQ ID NO: 10) obtained, produced, synthesized or expressed in the doroplast of Chlamydomonas reinhardtii, starting from amino acid at position 1 to amino acid at position 320 in recombinant protein Δh5320v¡ren (SEQ ID NO: 8), starting from amino acid at position 1 to amino acid at position 330 in the recombinant protein Δh5330viren (SEQ ID NO: 9) and starting from the amino acid at position 1 to the amino acid at position 332 in the recombinant protein Δh5332viren (SEQ ID NO: 10), where the numbering of the Amino acid positions herein refer exclusively to the position of amino acids in SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10, so referring to the amino acid at position 320 ( amino acid 320) in the recombinant protein Δh5320viren (SEQ ID NO: 8), amino acid residue 320 corresponds to the amino acid residue at position 320 in SEQ ID NO: 8, and so on, however, in any case, the peptide sequences and nucleotide sequences of the DNA encoding them, recombinant protein Δh5320viren (SEQ ID NO: 8) encoded in the h5320viren gene (SEQ ID NO: 1), recombinant protein Δh5330viren (SEQ ID NO: 9) encoded in the gene h5330viren (SEQ ID NO: 2) and recombinant protein Δh5332viren (SEQ ID NO: 10) encoded in the h5332viren gene (SEQ ID NO: 3), according to the description of the present invention, have no similarity to the sequence of DNA nucleotides that are observed in nature as shown in the illustrative example reference herein, vlA HA protein, H5 serotype mentioned (GenBank: GU052588.1) and being in the case of the peptide sequence, cited as an illustrative example as a reference herein, vlA HA protein, serotype H5, (GenBank: ACZ48561.1), point initial for the design of recombinant proteins, recombinant protein Δh5320viren (SEQ ID NO: 8), recombinant protein Δh5330 viren (SEQ ID NO: 9) and recombinant protein Δh5332viren (SEQ ID NO: 10), expressed in Chlamydomonas reinhardtii doroplast, modified for its correct expression and folding inside the plastid, in particular, the doroplast of Chlamydomonas reinhardtii, this fact being explicitly and clearly indicated in the present description. The vaccines based on the vaccine antigen of recombinant origin expressed in Chlamydomonas reinhardtii doroplast referred to as recombinant protein Δh5320viren (SEQ ID NO: 8), recombinant protein Δh5330viren (SEQ ID) is described below in the same manner, object of the present invention. NO: 9) and recombinant protein Δh5332viren (SEQ ID NO: 10) expressed on the basis of the synthetic DNA nucleotide sequences inserted in the dormoblast genome of Chlamydomonas reinhardtii, with the purpose of achieving its protein expression in the doroplast of Chlamydomonas reinhardtii for the prevention and / or control of vlA applied via the digestive tract (example: oral, sublingual), parenteral (example: intramuscular, subcutaneous) and respiratory tract (example: conjunctiva mucous membranes, respiratory mucous membranes), as well as describing as part of the present invention object of the present document the expression of homologous sequences of recombinant proteins it corresponds to the peptide segments described in the present invention, as well as those resulting from the homologous sequences of the HA protein of vlA obtained and expressed by genetic manipulation of the Chlamydomonas reinhardtii doroplast genome. Presenting in all the mentioned cases advantages and differences, characteristic and unique characteristics, because the use of the chtormystonas reinhardtii species, as well as the design of the synthetic genes and their use for the expression of recombinant vlA proteins, allow the production of low-cost synthetic recombinant proteins, null infectious otological residues, being these recombinant vlA proteins, a product based on an organism considered generally recognized as safe or GRAS (for the acronym in English of "Generally Recognized as Safe (GRAS) ) by the Food and Drug Administration (FDA), being in any case an advantage and frame of reference for the present invention.
Por lo tanto, la presente invención se refiere a: i).- las secuencias de nucleótidos de ADN codón optimizadas para ser expresadas en el genoma del ctoropiasto de Chlamydomonas reinhardtii de manera constitutiva objeto de la presente invención, denominadas estas secuencias de nucleótidos de ADN como gen h5320viren (SEQ ID NO: 1), gen h5330viren (SEQ ID NO: 2) y gen h5332viren (SEQ ID NO: 3), \\y las secuencias peptídicas de la proteína recombinante del vlA denominadas como proteína recombinante 4h5320viren (SEQ ID NO: 8), proteína recombinante Δh5330viren (SEQ ID NO: 9) yprotelna recombinante Δh5332viren (SEQ ID NO: 10) expresadas en el sistema heterólogo del genoma del ctoropiasto de Chlamydomonas reinhardtii, iii).- las vacunas objeto de la presente invención basadas en el uso las proteínas recombinantes del vlA denominadas: proteína recombinante Δh5320viren (SEQ ID NO: 8), proteína recombinante Δh5330viren (SEQ ID NO: 9) y proteína recombinante Δh5332viren (SEQ ID NO: 10), como antígeno vacunal contra el vlA aplicado por diversas vías como los siguientes ejemplos: vía mucosas en general (respiratoria, digestiva y conjuntival), vía parenteral (intramuscular y subcutánea), para el control y tratamiento de la vlA, en todos los organimos susceptibles a la enfermedad inducida por el vlA, iv).-La manipulación genética del genoma del cloroplasto de Chlamydomonas reinhardtii con el proposito de lograr la expresión de proteínas de origen recombinante del vlA, proteína recombinante Δh5320viren (SEQ ID NO: 8), proteína recombinante Δh5330viren (SEQ ID NO: 9) y proteína recombinante Δh5332v¡ren (SEQ ID NO: 10), así como de secuencias homologas para las secuencias peptídicas recombinantes del vlA tipo A, diseñadas a partir de la secuencia de nucteótidos del ADN codificantes para la proteína HA del vlA Siendo estas invenciones mencionadas, descritas y enumeradas en las reenvidicaciones presentes en el documento objeto de la presente invención. Therefore, the present invention relates to: i) .- codon DNA nucleotide sequences optimized to be expressed in the chlamydomonas reinhardtii genome of the constitutive object of the present invention, called these DNA nucleotide sequences as h5320viren gene (SEQ ID NO: 1), h5330viren gene (SEQ ID NO: 2) and h5332viren gene (SEQ ID NO: 3), \\ and the vlA recombinant protein peptide sequences referred to as recombinant 4h5320viren protein (SEQ ID NO: 8), recombinant protein Δh5330viren (SEQ ID NO: 9) and recombinant protein Δh5332viren (SEQ ID NO: 10) expressed in the heterologous genome system of Chlamydomonas reinhardtii, iii) .- the vaccines object of the present invention based on the use of recombinant vlA proteins called: recombinant protein Δh5320viren (SEQ ID NO: 8), recombinant protein Δh5330viren (SEQ ID NO: 9) and protein Recombinant Δh5332viren (SEQ ID NO: 10), as a vaccine antigen against vlA applied by various routes such as the following examples: mucous route in general (respiratory, digestive and conjunctival), parenteral route (intramuscular and subcutaneous), for control and treatment of the vlA, in all the organs susceptible to the disease induced by vlA, iv) .- The genetic manipulation of the Chlamydomonas reinhardtii chloroplast genome with the purpose of achieving the expression of proteins of recombinant origin of vlA, recombinant protein Δh5320viren ( SEQ ID NO: 8), recombinant protein Δh5330viren (SEQ ID NO: 9) and recombinant protein Δh5332v¡ren (SEQ ID NO: 10), as well as homologous sequences for the recombinant peptide sequences of vlA type A, designed from the DNA nucteotide sequence encoding the HA protein of vlA These inventions are mentioned, described and listed in the reenvironments present in the doc umento object of the present invention.
El proceso experimental se describe a continuación: The experimental process is described below:
El desarrollo de la presente invención se enfocó en la expresión proteica de las proteínas recombinantes, proteína recombinante Δh5320viren (SEQ ID NO: 8), proteína recombinante /4h5330viren (SEQ ID NO: 9) y proteína recombinante Δh5332viren (SEQ ID NO: 10), en el diseño de los genes que las codifican: gen hS320viren (SEQ ID NO: 1), gen h5330viren (SEQ ID NO: 2) y gen h5332viren (SEQ ID NO: 3) respectivamente, basados en la secuencia de nucleótidos de ADN codificantes para segmentos peptídicos recombinantes de la proteina H5 del vlA, caracterizados para su correcta expresión en el sistema de expresión proteica heterólogo eucaríota del genoma del cioroplasto de Chlamydomonas reinhardtii, el uso del sistema de expresión proteica del doroplasto de Chlamydomonas minhardtii para la expresión de secuencias peptídicas heterótogas de la proteína HA del vi, el uso de estás proteínas como base arttigénica de origen recombinante para lograr una estimulación del sistema inmune en diversos modelos, que en el caso del presente documento, se describen como ejemplos exclusivamente ilustrativos, modelos animales y la medición de su respuesta inmune mediante técnicas de uso internacional, en este caso como ejemplo ilustrativo, la técnica de inhibición de la hemagluti nación (IH). The development of the present invention focused on the protein expression of recombinant proteins, recombinant protein Δh5320viren (SEQ ID NO: 8), recombinant protein / 4h5330viren (SEQ ID NO: 9) and recombinant protein Δh5332viren (SEQ ID NO: 10) , in the design of the genes that encode them: hS320viren gene (SEQ ID NO: 1), h5330viren gene (SEQ ID NO: 2) and h5332viren gene (SEQ ID NO: 3) respectively, based on the DNA nucleotide sequence encoders for recombinant peptide segments of the H5 protein of vlA, characterized for its correct expression in the system of eukaryotic heterologous protein expression of the chlamydomonas reinhardtii choriooplast genome, the use of the Chlamydomonas minhardtii doroplast protein expression system for the expression of heterotope peptide sequences of the HA protein of vi, the use of these proteins as an arttigenic base of recombinant origin to achieve a stimulation of the immune system in various models, which in the case of the present document, are described as exclusively illustrative examples, animal models and the measurement of their immune response by techniques of international use, in this case as an illustrative example, the technique of hemaggluti nation (IH) inhibition.
Sistema de expresión proteica empleado para la expresión de las proteínas recombinantes: protefna recombinante Δh5320vlren (SEQ ID NO: 8), proteína recombinante Δh5330viren (SEQ ID NO: 9) y proteína recombinante Δh5332viren (SEQ ID NO: 10), según la presente invención. Protein expression system used for the expression of recombinant proteins: recombinant protein Δh5320vlren (SEQ ID NO: 8), recombinant protein Δh5330viren (SEQ ID NO: 9) and recombinant protein Δh5332viren (SEQ ID NO: 10), according to the present invention .
La presente invención se inicio con el diseño y síntesis comercial de los genes codón optimizados para su empleo en el sistema de expresión proteica en el organismo eucaríota, microalga de la especie Chlamydomonas minhardtii, mediante la inserción de estas secuencias sintéticas de nucteótidos de ADN en el genoma del piástido, en particular en el genoma del cioroplasto de la microalga de la especie Chlamydomonas minhardtii, tomando como referencia, la secuencia de nucleótídos de ADN del segmento 4 del genoma del vlA, codificante para la proteína HA del serotipo H5 del vlA, siendo en todo caso distintas las nuevas secuencias de nucteótidos del ADN sintéticas a la secuencia de nucieótidos del ADN referencia, que en este caso se cita como ejemplo ilustrativo exclusivamente, en la base de datos del Genbank de la base de datos de la NCBI (ht^://vvww.ncbi.nlm.nih.gov/genbank/) con el numero (GenBank: ACZ48561.1), siendo estas modificadas y codón optimizadas para su correcta expresión proteica en el cloroplasto de Chlamydomonas minhardtii, proponiéndose tres genes sintéticos de nuevo diseño, codón optimizados denominados gen h5320viren (SEQ ID NO: 1), gen h5330viren (SEQ ID NO: 2) y gen h5332viren (SEQ ID NO: 3), codificantes respectivamente para las proteínas recombinantes, denominadas proteína recombinante Δh5320vtmn (SEQ ID NO: 8), proteína recombinante Δh5330viren (SEQ ID NO: 9) y proteína recombinante Δh5332viren (SEQ ID NO: 10), las cuales se describen iniciando desde el aminoácido en la posición 1 hasta el aminoácido en la posición 320 en la proteína recombinante Δh5320viren (SEQ ID NO: 8), iniciando desde el aminoácido en la posición 1 hasta el aminoácido en la posición 330 en la proteína recombinante Δh5330viren (SEQ ID NO: 9) e iniciando desde el aminoácido en la posición 1 hasta el aminoácido en la posición 332 en la proteína recombinante M)5332viren (SEQ ID NO: 10), donde la numeración de las posiciones de tos aminoácidos de las proteínas recombinantes, proteína recombinante ñh5320viren (SEQ ID NO: 8), proteína recombinante ñhS330víren (SEQ ID NO: 9) y proteína recombinante Δh5332viren (SEQ ID NO: 10) , se refieren exclusivamente a la posición de aminoácidos en la secuencia peptídica SEQ ID NO: 8, SEQ ID NO: 9 y SEQ ID NO: 10, descritas y objeto de la presente invención. Las secuencias de los genes sintéticos denominados: gen h5320virsn (SEQ ID NO: 1), gen h5330vinn (SEQ ID NO: 2) y gen h5332viren (SEQ ID NO: 3) codón optimizados para la expresión proteica de las proteínas recombinantes denominadas: proteína recombinante Δh5320viren (SEQ ID NO: 8), proteína recombinante Δh5330viren (SEQ ID NO: 9) y proteína recombinante Δh5332viran (SEQ ID NO: 10) respectivamente, fueron empleados para su inserción y expresión en el genoma del cloroplasto de Chamydomonas minhardtii mediante el empleo del vector de transformación denominado con el término genérico vector pVCC, diseñado y sintetizado para este fin, dejando como antecedente en el presente documento descriptivo de la presente invención, siendo en todo caso, un ejemplo ilustrativo para su correcta inserción y correcta expresión en el genoma del cloroplasto de Chlamydomonas minhardtii, no restringiendo el empleo de otros métodos posibles para su inserción en el genoma de este plástido, en particular el cloroplasto de las microalgas de la especie Chlamydomonas reinhardtii, sin afectar el impacto global de la presente invención. The present invention began with the design and commercial synthesis of codon genes optimized for use in the protein expression system in the eukaryotic organism, microalgae of the species Chlamydomonas minhardtii, by inserting these synthetic sequences of DNA nucteotides into the Pestid genome, in particular in the microalgae chiormyplate genome of the species Chlamydomonas minhardtii, taking as a reference the DNA nucleotide sequence of segment 4 of the vlA genome, coding for the HA protein of the V5A serotype H5, being in any case different the new sequences of synthetic DNA nucteotides to the sequence of nucieotides of the reference DNA, which in this case is cited as an illustrative example only, in the Genbank database of the NCBI database (ht ^: //vvww.ncbi.nlm.nih.gov/genbank/ ) with the number (GenBank: ACZ48561.1), these being modified and codon optimized for their correct protein expression in the Chlamydomonas minhardtii chloroplast, proposing three newly designed, codon optimized synthetic genes called the h5320viren gene (SEQ ID NO: 1) , gene h5330viren (SEQ ID NO: 2) and gene h5332viren (SEQ ID NO: 3), encoders respectively for recombinant proteins, called recombinant protein Δh5320vtmn (SEQ ID NO: 8), recombinant protein Δh5330viren (SEQ ID NO: 9) and recombinant protein Δh5332viren (SEQ ID NO: 10), which are described starting from amino acid at position 1 to amino acid at position 320 in recombinant protein Δh5320viren (SEQ ID NO: 8), starting from amino acid in position ón 1 to the amino acid at position 330 in the recombinant protein Δh5330viren (SEQ ID NO: 9) and starting from the amino acid at position 1 to the amino acid at position 332 in the recombinant protein M) 5332viren (SEQ ID NO: 10 ), where the numbering of the amino acid positions of recombinant proteins, recombinant protein ñh5320viren (SEQ ID NO: 8), recombinant protein ñhS330vire (SEQ ID NO: 9) and recombinant protein Δh5332viren (SEQ ID NO: 10), are refer exclusively to the position of amino acids in the peptide sequence SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10, described and object of the present invention. The sequences of the synthetic genes called: h5320virsn gene (SEQ ID NO: 1), h5330vinn gene (SEQ ID NO: 2) and h5332viren gene (SEQ ID NO: 3) codon optimized for protein expression of the recombinant proteins named: recombinant protein Δh5320viren (SEQ ID NO: 8), recombinant protein Δh5330viren (SEQ ID NO: 9) and recombinant protein Δh5332viran (SEQ ID NO: 10) respectively, were used for its insertion and expression in the genome of the Chamydomonas minhardtii chloroplast through the use of the transformation vector called with the generic term vector pVCC, designed and synthesized for this purpose, leaving as background in the present descriptive document of the present invention, being in In any case, an illustrative example for its correct insertion and correct expression in the Chlamydomonas minhardtii chloroplast genome, not restricting the use of other possible methods for its insertion in the genome of this plastid, in particular the chloroplast of the species microalgae Chlamydomonas reinhardtii, without affecting the overall impact of the present invention n.
Las siguientes descripciones hacen mención de los materiales, métodos, protocolos y en general, técnicas empleadas para el desarrollo de la presente invención, sin embargo, estas técnicas se proporcionan como modo de guía ilustrativa para su realización, por lo que no deben de ser considerados como limitantes para el logro de los objetivos marcados como reinvldicaciones y el alcance global del presente desarrollo científico.  The following descriptions make mention of the materials, methods, protocols and in general, techniques employed for the development of the present invention, however, these techniques are provided as an illustrative guide mode for their realization, so they should not be considered as limitations for the achievement of the objectives marked as reinvldications and the global scope of the present scientific development.
Empleo de los genes sintéticos, gen h5320viren (SEQ ID NO: 1), gen hS330viren (SEQ ID NO: 2) y gen h5332vlren (SEQ ID NO: 3) codón optimizados para la expresión proteica en el genoma del cloroplasto de Chlamydomonas reinhardtii dé las proteínas recombinantes del vlA denominadas protef na recombinante Δη5320νΐΓβη (SEQ ID NO: 8)f proteína recombínante Δh5330vfren (SEQ ID NO: 9) y proteína recombinante Δh5332viren (SEQ ID NO: 10). Use of synthetic genes, h5320viren gene (SEQ ID NO: 1), hS330viren gene (SEQ ID NO: 2) and h5332vlren gene (SEQ ID NO: 3) codon optimized for protein expression in the chloroplast genome of Chlamydomonas reinhardtii of the recombinant vlA proteins called recombinant protein Δη5320νΐΓβη (SEQ ID NO: 8) f recombinant protein Δh5330vfren (SEQ ID NO: 9) and recombinant protein Δh5332viren (SEQ ID NO: 10).
Dadas las características de las proteínas recombinantes del vlA proteína recombinante Δh5320viren (SEQ ID NO: 8) codificada en la secuencia de nucleótidos de ADN sintéticos denominada como gen h5320viren (SEQ ID NO: 1), proteína recombinante Δh5330viren (SEQ ID NO: 9) codificada en la secuencia de nucleotidos de ADN sintéticos denominada como gen h5330viren (SEQ ID NO: 2) y proteína recombinante Δh5332viren (SEQ ID NO: 10) codificada en la secuencia de nucleotidos de ADN sintéticos denominada como gen h5332viren (SEQ ID NO: 3), cuyas secuencias de nucleotidos de ADN fueron diseñadas en base a la secuencia de nucleótidos de ADN codificantes para el segmento 4 del genoma del vlA, considerando como base los datos del Genbank de la base de datos de la NCBI (http://www.ncbi.nlm.nih.gov/genbank/ ) con el número (GenBank: ACZ48561.1), así como la necesidad de optimización de codones para la correcta expresión de los genes, siendo estos diseñados y sintetizados como genes sintéticos de novo para ser expresados correctamente en el sistema de expresión proteica eucariota del genoma del cloroplasto de Chlamydomonas reinhardtii. Las versiones de los segmentos correspondientes a las secuencias de nucleótidos de ADN sintéticos codón optimizados propuestos en la presente invención, gen h5320viren (SEQ ID NO: 1), gen h5330viren (SEQ ID NO: 2) y gen h5332viren (SEQ ID NO: 3), así como los elementos de expresión y transformación del genoma del cloroplasto de Chlamydomonas minhardtii, fueron sintetizados y clonados en el vector comercial pUC57 (SEQ ID NO: 4) (figura no. 1. Esquema de vector pUC57), dando origen a los vectores: pVCCH5320viren (SEQ ID NO: 5) (figura No. 2, esquema de vector pVCCH5320viren) con el gen h5320viren (SEQ ID NO: 1), pVCCH5330viren (SEQ ID NO: 6) (figura No. 3, esquema de vector pVCCH5330viren) con el gen h5330viren (SEQ ID NO: 2) y pVCCH5332viren (SEQ ID NO: 7) (figura No. 4, esquema de vector pVCCH5332viren) con el gen h5332viren (SEQ ID NO: 3). Las muestras de los vectores, pVCCH5320viren (SEQ ID NO: 5), pVCCH5330viren (SEQ ID NO: 6) y pVCCH5332viren (SEQ ID NO: 7) sintetizados y adquiridos en la compañía Genscrípt (http://www.genscript.com) de manera individual, se emplearon para la transformación de células competentes de Escherichia coli Top10 (Marca Invitrogen™) de acuerdo a protocolo del proveedor. Las células bacterianas transformadas de manera individual con tos vectores pVCCH5320viren (SEQ ID NO: 5), pVCCH5330viren (SEQ ID NO: 6) y pVCCH5332viren (SEQ ID NO: 7) se sembraron en placas de medio agar solido Luna Broth suplementado con 100 ug/ml de ampfcilina, por un tiempo de 14 horas a 37°C (Russell DW, Sambrook J. Molecular Cioning: A Laboratory Manual, Volume 1. Edition illustrated, PuWisher, CSHL Press, 2001). Posteriormente en las cajas se observaron colonias, las cuales fueron consideradas como clonas transformadas correctamente. A los cultivos bacterianos resultantes del proceso de transformación bacteriana, se les identificó de acuerdo al vector empleado en cada caso, resultando en los eventos de transformación VCCH5320viren, VCCH5330viren y VCCH5332viren. Posterior a la obtención de los eventos de transformación VCCH5320viren, VCCH5330viren y VCCH5332viren, se procedió a seleccionar clonas de los eventos de transformación mencionados para inocularlas en 5 mi de medio LB líquido suplementado con 100 μο/ml de ampicilina de forma individual para cada evento de transformación y se realizó una incubación a 37 °C durante toda la noche. Estos cultivo de tos eventos de transformación VCCH5320viren, VCCH5330viren y VCCH5332viren se emplearon individualmente para la extracción de ADN plasmídico correspondiente a los vectores pVCCH5320viren (SEQ ID NO: 5), pVCCH5330viren (SEQ ID NO: 6) y pVCCH5332viren (SEQ ID NO: 7) respectivamente por medio del Kit GeneJET Plasmid Miniprep de Fermentas de acuerdo a las instrucciones del proveedor. El ADN plasmídico obtenido correspondiente a los vectores pVCCH5320viren (SEQ ID NO: 5), pVCCH5330viren (SEQ ID NO: 6) y pVCCH5332viren (SEQ ID NO: 7) extraídos de manera individual de tos eventos de transformación VCCH5320virenl VCCH5330viren y VCCH5332viren respectivamente y se emplearon para llevar cabo una reacción estándar de restricción con las enzimas Ndel y BamHI de la marca New England® (Biolabs Inc) bajo las condiciones indicadas por el proveedor (Biolabs Inc), con la finalidad de comprobar la presencia de tos vectores pVCCH5320v¡ren (SEQ ID NO: 5), pVCCH5330viren (SEQ ID NO: 6) y pVCCH5332viren (SEQ ID NO: 7) así como la presencia de tos genes sintéticos: gen h5320viren (SEQ ID NO: 1), gen h5330viren (SEQ ID NO: 2) y gen h5332viren (SEQ ID NO: 3) codón optimizados codificantes para las proteínas recombinantes denominadas como proteína recombinante Δh5320viren (SEQ ID NO: 8), proteína recombinante Δh5330viren (SEQ ID NO: 9) y proteína recombinante Δh5332viren (SEQ ID NO: 10) respectivamente, empleados en el sistema de expresión proteica eucariota del genoma del cloroplasto de Chlamydomonas reinhardtii. La reacción de restricción estándar se realizó de manera individual y por separado para cada vector, pVCCH5320viren (SEQ ID NO: 5), pVCCH5330viren (SEQ ID NO: 6) y pVCCH5332viren (SEQ ID NO: 7), como se describe a continuación, consistiendo de aproximadamente de 100 ng/μΙ de ADN plasmídico correspondiente para cada vector pVCCH5320viren (SEQ ID NO: 5), pVCCH5330viren (SEQ ID NO: 6) y pVCCH5332viren (SEQ ID NO: 7), 3 unidades de cada una de la enzimas Ndel y BamHI de la marca New England® (Biolabs Inc.) bajo las condiciones indicadas por el proveedor (Biolabs Inc.) correspondiente a cada reacción de restricción individual y buffer apropiado (Biolabs Inc.) para una reacción de doble digestión (Russell DW. Et al. 2001). Los productos de las reacciones de digestión fueron resueltos mediante un gel de agarosa al 1 % (Figura no. 5. Análisis de la presencia de los genes sintéticos, en los vectores pVCCH5320viren (SEQ ID NO. 5), pVCCH5330viren (SEQ ID NO: 6) y pVCCH5332viren (SEQ ID NO: 7). Marcador de peso molecular de 1Kb (Carril M), pVCCH5320viren (carril 1), pVCCH5330viren (carril 2), pVCCH5332viren (carril 3). Los genes tienen un peso aproximado de 1000pb. Las bandas de 1500pb y 4500pb corresponden al resto del vector. Given the characteristics of the recombinant proteins of the vlA recombinant protein Δh5320viren (SEQ ID NO: 8) encoded in the synthetic DNA nucleotide sequence referred to as the h5320viren gene (SEQ ID NO: 1), recombinant protein Δh5330viren (SEQ ID NO: 9) encoded in the synthetic DNA nucleotide sequence designated as the h5330viren gene (SEQ ID NO: 2) and recombinant protein Δh5332viren (SEQ ID NO: 10) encoded in the synthetic DNA nucleotide sequence referred to as the h5332viren gene (SEQ ID NO: 3 ), whose DNA nucleotide sequences were designed based on the DNA nucleotide sequence encoding segment 4 of the vlA genome, based on Genbank data from the NCBI database (http: // www .ncbi.nlm.nih.gov / genbank /) with the number (GenBank: ACZ48561.1), as well as the need for codon optimization for the correct expression of genes, these being designed and synthesized as s genes de novo to be correctly expressed in the eukaryotic protein expression system of the Chlamydomonas reinhardtii chloroplast genome. The versions of the segments corresponding to the optimized codon synthetic DNA nucleotide sequences proposed in the present invention, h5320viren gene (SEQ ID NO: 1), h5330viren gene (SEQ ID NO: 2) and h5332viren gene (SEQ ID NO: 3 ), as well as the expression and transformation elements of the chloroplast genome of Chlamydomonas minhardtii, were synthesized and cloned into the commercial vector pUC57 (SEQ ID NO: 4) (figure no. 1. Vector scheme pUC57), giving rise to the vectors: pVCCH5320viren (SEQ ID NO: 5) (figure No. 2 , vector scheme pVCCH5320viren) with the h5320viren gene (SEQ ID NO: 1), pVCCH5330viren (SEQ ID NO: 6) (figure No. 3, vector scheme pVCCH5330viren) with the h5330viren gene (SEQ ID NO: 2) and pVCCH5332viren (SEQ ID NO: 7) (Figure No. 4, vector scheme pVCCH5332viren) with the h5332viren gene (SEQ ID NO: 3). The samples of the vectors, pVCCH5320viren (SEQ ID NO: 5), pVCCH5330viren (SEQ ID NO: 6) and pVCCH5332viren (SEQ ID NO: 7) synthesized and acquired from the Genscrpt company (http://www.genscript.com) individually, they were used for the transformation of competent Escherichia coli Top10 cells (Invitrogen ™ Brand) according to the provider's protocol. Bacterial cells transformed individually with cough vectors pVCCH5320viren (SEQ ID NO: 5), pVCCH5330viren (SEQ ID NO: 6) and pVCCH5332viren (SEQ ID NO: 7) were seeded on Luna Broth solid medium agar plates supplemented with 100 ug / ml ampfcillin, for a time of 14 hours at 37 ° C (Russell DW, Sambrook J. Molecular Cioning: A Laboratory Manual, Volume 1. Edition illustrated, PuWisher, CSHL Press, 2001). Subsequently in the boxes colonies were observed, which were considered as correctly transformed clones. The bacterial cultures resulting from the bacterial transformation process were identified according to the vector used in each case, resulting in the transformation events VCCH5320viren, VCCH5330viren and VCCH5332viren. After obtaining the events of Transformation VCCH5320viren, VCCH5330viren and VCCH5332viren, clones of the aforementioned transformation events were selected to inoculate them in 5 ml of liquid LB medium supplemented with 100 μο / ml ampicillin individually for each transformation event and an incubation was performed at 37 ° C overnight. These cultures of VCCH5320viren, VCCH5330viren and VCCH5332viren transformation events were used individually for the extraction of plasmid DNA corresponding to the vectors pVCCH5320viren (SEQ ID NO: 5), pVCCH5330viren (SEQ ID NO: 6) and pVCCH5332viren (SEQ ID NO: 6): ) respectively through the GeneJET Plasmid Miniprep Fermentation Kit according to the supplier's instructions. The plasmid DNA obtained corresponding to the vectors pVCCH5320viren (SEQ ID NO: 5), pVCCH5330viren (SEQ ID NO: 6) and pVCCH5332viren (SEQ ID NO: 7) extracted individually from the transformation events VCCH5320viren l VCCH5330viren and VCCH5332viren and VCCH5332v respectively they were used to carry out a standard restriction reaction with the Ndel and BamHI enzymes of the New England® brand (Biolabs Inc) under the conditions indicated by the supplier (Biolabs Inc), in order to check the presence of the vectors pVCCH5320v¡ ren (SEQ ID NO: 5), pVCCH5330viren (SEQ ID NO: 6) and pVCCH5332viren (SEQ ID NO: 7) as well as the presence of synthetic genes: h5320viren gene (SEQ ID NO: 1), h5330viren gene (SEQ ID NO: 2) and h5332viren gene (SEQ ID NO: 3) codon optimized coding for recombinant proteins referred to as recombinant protein Δh5320viren (SEQ ID NO: 8), recombinant protein Δh5330viren (SEQ ID NO: 9) and protein Recombinant Δh5332viren (SEQ ID NO: 10) respectively, used in the eukaryotic protein expression system of the Chlamydomonas reinhardtii chloroplast genome. The standard restriction reaction was performed individually and separately for each vector, pVCCH5320viren (SEQ ID NO: 5), pVCCH5330viren (SEQ ID NO: 6) and pVCCH5332viren (SEQ ID NO: 7), as described below, consisting of approximately 100 ng / μΙ of corresponding plasmid DNA for each vector pVCCH5320viren (SEQ ID NO: 5), pVCCH5330viren (SEQ ID NO: 6) and pVCCH5332viren (SEQ ID NO: 7), 3 units of each of the enzymes Ndel and BamHI of the New England® brand (Biolabs Inc.) under the conditions indicated by the supplier (Biolabs Inc.) corresponding to each individual restriction reaction and appropriate buffer (Biolabs Inc.) for a double digestion reaction (Russell DW Et al. 2001). The products of the digestion reactions were resolved by a 1% agarose gel (Figure no. 5. Analysis of the presence of synthetic genes, in the vectors pVCCH5320viren (SEQ ID NO. 5), pVCCH5330viren (SEQ ID NO: 6) and pVCCH5332viren (SEQ ID NO: 7) 1Kb molecular weight marker (Lane M), pVCCH5320viren (lane 1), pVCCH5330viren (lane 2), pVCCH5332viren (lane 3), genes have an approximate weight of 1000pb. The 1500pb and 4500pb bands correspond to the rest of the vector.
Diseno del caseta de expresión en los vectores pVCCH5320viren (SEQ ID NO: 5), pVCCH5330viren (SEQ ID NO: 6) y pVCCH5332viren (SEQ ID NO: 7) con los genes, gen h5320viren (SEQ ID NO: 1), gen h5330vimn (SEQ ID NO: 2) y gen h5332vlnn (SEQ ID NO: 3) codón optimizados para la expresión de las proteínas recombinantes, proteína recombinante ñh5320viren (SEQ ID NO: 8), protelna recombinante ΔhS330viren (SEQ 10 NO: 9) y proteína recombinante Δh5332viren (SEQ ID NO: 10) respectivamente en cloroplasto de Chlamydomonas reinhardtií. Expression booth design in the vectors pVCCH5320viren (SEQ ID NO: 5), pVCCH5330viren (SEQ ID NO: 6) and pVCCH5332viren (SEQ ID NO: 7) with the genes, h5320viren gene (SEQ ID NO: 1), h5330vimn gene (SEQ ID NO: 2) and h5332vlnn gene (SEQ ID NO: 3) codon optimized for the expression of recombinant proteins, recombinant protein ñh5320viren (SEQ ID NO: 8), recombinant protein ΔhS330viren (SEQ 10 NO: 9) and recombinant protein Δh5332viren (SEQ ID NO: 10) respectively in Chlamydomonas reinhardtií chloroplast.
Para su correcta inserción en el genoma del cloroplasto de la microalga For its correct insertion in the genome of the microalgae chloroplast
Chlamydomonas m/nhardtii y su expresión en el cloroplasto, los genes, gen h5320viren (SEQ ID NO: 1), gen h5330viren (SEQ ID NO: 2) y gen h5332viran (SEQ ID NO: 3) codón optimizados para la expresión de las proteínas recombinantes Δh5320viren (SEQ ID NO: 8), proteína recombinante Δh5330viren (SEQ ID NO: 9), y proteína recombinante Δh5332viren (SEQ ID NO: 10) respectivamente, las cuales se describen iniciando desde el aminoácido en la posición 1 hasta el aminoácido en la posición 320 en la proteína recombinante Δh5320viren (SEQ ID NO: 8), iniciando desde el aminoácido en la posición 1 hasta el aminoácido en la posición 330 en la proteina recombinante, Δh5330viren (SEQ ID NO: 9) e iniciando desde el aminoácido en la posición 1 hasta el aminoácido en la posición 332 en la proteína recombinante Δh5332viren (SEQ ID NO: 10), donde la numeración de las posiciones de tos aminoácidos de las proteínas recombinantes proteína recombinante Δh5320vtren, proteína recombinante Δh5330viren y proteína recombinante Δh5332viren se refieren estrictamente a la posición de aminoácidos en las secuencias peptídicas, SEQ ID NO: 8, SEQ ID NO: 9 y SEQ ID NO: 10 respectivamente, fue necesario el diseño y síntesis de un sistema de transformación mediante manipulación genética del genoma del cloroplasto de Chlamydomonas minhardtii que fuese eficiente para este fin. Por tal motivo, para dirigir la expresión al inicio del cistrón correspondiente para cada gen sintético: gen h5320víren (SEQ ID NO: 1), gen h533(Mran (SEQ ID NO: 2) y gen h5332viren (SEQ ID NO: 3) se colocó el promotor endógeno del genoma del cloroplasto de Chlamydomonas reinharcttii, atp A y al final del cistrón correspondiente para cada gen sintético: gen h5320viran (SEQ ID NO: 1), gen hS33(Mren (SEQ ID NO: 2) y gen h5332viren (SEQ ID NO: 3), el terminador del gen de la subunidad grande de la proteína ru bisco, rbc L. Como marcador de seleccón se añadió el cásete de expresión para el gen de aadA, el cual codifica la proteína aminoglicosido 3- adenililtransferasa que confiere resistencia al antibiótico espectinomicina. Para permitir la doble recombinación homótoga en borde izquierdo del promotor se colocó la secuencia que corresponde del nucleótido 40097 al 40924 del genoma del cloroplasto de Chlamydomonas reinhardtS y al lado derecho del terminador se colocó la secuencia que corresponde del nucleótido 40925 al 41831 (Sequence ID: tpgBK000554.2). La secuencia genómica diseñada in s¡lt∞ fue sintetizada y donada en el vector de clonación comercial pUC57 (SEQ ID NO: 4) (figura no. 1. Esquema de vector pUC57), para su mantenimiento y replicación en la bacteria Escherichia coli marca TOP ten (Marca Invitrogen™) de acuerdo a protocolo del proveedor. Técnica de transformación del genoma del cloroplasto de Chlamydomonas ralnhardtíl con los vectores pVCCH5320viren (SEQ ID NO: 5), pVCCH5330viren (SEQ ID NO: 6) y pVCCH5332viren (SEQ ID NO: 7) por medio de la técnica de biolística para la expresión de las proteínas recombinantes, proteína recombinante Δπ5324Μηη (SEQ ID NO: 8), prateina recombinante Δh5330viren (SEQ ID NO: 9) y proteína recombinante Δh5332viren (SEQ ID NO: 10). Chlamydomonas m / nhardtii and its expression in the chloroplast, the genes, h5320viren gene (SEQ ID NO: 1), h5330viren gene (SEQ ID NO: 2) and h5332viran gene (SEQ ID NO: 3) codon optimized for the expression of the Δh5320viren recombinant proteins (SEQ ID NO: 8), Δh5330viren recombinant protein (SEQ ID NO: 9), and Δh5332viren recombinant protein (SEQ ID NO: 10) respectively, which are described starting from the amino acid at position 1 to the amino acid at position 320 in the recombinant protein Δh5320viren (SEQ ID NO: 8), starting from the amino acid at position 1 to the amino acid at position 330 in the recombinant protein, Δh5330viren (SEQ ID NO: 9) and starting from the amino acid at position 1 to the amino acid at position 332 in the recombinant protein Δh5332viren (SEQ ID NO: 10), where the numbering of the positions of amino acid coughs of recombinant proteins Δh5320vtren recombinant protein, recombinant protein inante Δh5330viren and recombinant protein Δh5332viren strictly refer to the position of amino acids in the peptide sequences, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10 respectively, it was necessary to design and synthesize a transformation system using genetic manipulation of the Chlamydomonas minhardtii chloroplast genome that was efficient for this purpose. For this reason, to direct the expression at the beginning of the cistron corresponding for each synthetic gene: h5320víren gene (SEQ ID NO: 1), h533 gene (Mran (SEQ ID NO: 2) and h5332viren gene (SEQ ID NO: 3) the endogenous Chlamydomonas reinharcttii chloroplast genome promoter was placed, atp A and at the end of the corresponding cistron for each synthetic gene: h5320viran gene (SEQ ID NO: 1), hS33 gene (Mren (SEQ ID NO: 2) and h5332viren gene (SEQ ID NO: 3), the terminator of the gene of the large subunit of the risco bisco protein, rbc L. As the selection marker, the expression cassette for the aadA gene was added, which encodes the aminoglycoside 3- adenylyltransferase protein that confers resistance to the antibiotic spectinomycin to allow double homotope recombination. on the left edge of the promoter, the corresponding sequence of nucleotide 40097 to 40924 of the Chlamydomonas reinhardtS chloroplast genome was placed and the corresponding sequence of nucleotide 40925 to 41831 was placed on the right side of the terminator (Sequence ID: tpgBK000554.2) The genomic sequence designed in s¡lt∞ was synthesized and donated in the commercial cloning vector pUC57 (SEQ ID NO: 4) (figure no. 1. Vector scheme pUC57), for maintenance and replication in the bacterium Escherichia coli brand TOP ten (Brand Invitrogen ™) according to the provider's protocol. Chlamydomonas chloroplast genome transformation technique ralnhardtíl with vectors pVCCH5320viren (SEQ ID NO: 5), pVCCH5330viren (SEQ ID NO: 6) and pVCCH5332viren (SEQ ID NO: 7) by means of the biolistic technique for the expression of Recombinant proteins, Δπ532432ηη recombinant protein (SEQ ID NO: 8), Δh5330viren recombinant pratein (SEQ ID NO: 9) and Δh5332viren recombinant protein (SEQ ID NO: 10).
Para la transformación mediante la técnica descrita como biolística para la manipulación genética del genoma del cloroplasto de las microalgas de la especie Chlamydomonas reinharútii con el objetivo de la obtención de OGM'S capaces de la expresión de las proteínas recombinantes, proteína recombinante Δh5320viran (SEQ ID NO: 8), proteína recombinante Δh5330viren (SEQ ID NO: 9), y proteína recombinante Δh5332vinn (SEQ ID NO: 10) en particular en plástidos, específicamente en cloroplasto de Chlamydomonas minhardtii, se emplearon ios vectores pVCCH5320viren (SEQ ID NO: 5), pVCCH5330viren (SEQ ID NO: 6) y pVCCH5332viren (SEQ ID NO: 7), codón optimizados para la expresión de las proteínas recombinantes, proteína recombinante Δh5320viren (SEQ ID NO: 8), proteína recombinante M5330viren (SEQ ID NO: 9) y proteína recombinante Δh5332viren (SEQ ID NO: 10) respectivamente en cloroplasto de Chlamydomonas minhardtii, obtenidos en los eventos de transformación bacteriana en Escharichia coli TOP ten (Marca Invitrogen™) de acuerdo a protocolo del proveedor, VCCH5320viren1 VCCH5330viren y VCCH5332viren, los cuales fueron obtenidos por medio de extracción de manera individual de ADN plásmidico correspondiente a los vectores pVCCH5320viren (SEQ ID NO: 5), evento de transformación VCCH5320viren, pVCCH5330viren (SEQ ID NO:For the transformation by means of the technique described as biolistic for the genetic manipulation of the chloroplast genome of the microalgae species of the Chlamydomonas reinharútii in order to obtain GMOs capable of the expression of recombinant proteins, recombinant protein Δh5320viran (SEQ ID NO: 8), recombinant protein Δh5330viren (SEQ ID NO: 9), and recombinant protein Δh5332vinn (SEQ ID NO: 10) in particular in plastids, specifically in Chlamydomonas minhardtii chloroplast, ios pVCCH5320viren vectors (SEQ ID NO: 5) were used, pVCCH5330viren (SEQ ID NO: 6) and pVCCH5332viren (SEQ ID NO: 7), codon optimized for the expression of recombinant proteins, recombinant protein Δh5320viren (SEQ ID NO: 8), recombinant protein M5330viren (SEQ ID NO: 9) and Δh5332viren recombinant protein (SEQ ID NO: 10) respectively in Chlamydomonas minhardtii chloroplast, obtained in bacterial transformation events in Escharichia coli TOP ten (Brand Invitrogen ™) according to the protocol of the provider, VCCH5320viren 1 VCCH5330viren and VCCH5332viren, which were obtained by means of individual extraction of plasmid DNA corresponding to the vectors pVCCH5320viren (SEQ ID NO: 5), event VCCH5320viren, pVCCH5330viren (SEQ ID NO:
6) , evento de transformación VCCH5330viren y pVCCH5332viren (SEQ ID NO:6), transformation event VCCH5330viren and pVCCH5332viren (SEQ ID NO:
7) , evento de transformación VCCH5332viren, por medio del Kit Gene JET Plasmid Miniprep™ (Marca Fermentas) de acuerdo a las instrucciones del proveedor, realizado en cultivos de un volumen de 5 mi en medio líquido LB suptementado con ampiálina a una concentración ΙΟΟμς por mi, cuantitícados en el espectrofotómetro BioPhotometer piuss (Marca eppendorf irte.) y ajustados a una concentración de 1 ug / 1 μΙ en cada uno de los vectores pVCCH5320viren (SEQ ID NO: 5) evento de transformación VCCH5320viren, pVCCH5330viren (SEQ ID NO: 6), evento de transformación VCCH5330viren y pVCCH5332viren (SEQ ID NO: 7), evento de transformación VCCH5332viren. 7), transformation event VCCH5332viren, by means of the Gene JET Plasmid Miniprep ™ Kit (Fermentas Brand) according to the supplier's instructions, carried out in cultures of a volume of 5 ml in liquid medium LB supplemented with ampiálina at a concentration ΙΟΟμς per me, quantified in the BioPhotometer piuss spectrophotometer (Eppendorf irte brand) and adjusted to a concentration of 1 ug / 1 μΙ in each of the pVCCH5320viren vectors (SEQ ID NO: 5) transformation event VCCH5320viren, pVCCH5330viren (SEQ ID NO: 6), transformation event VCCH5330viren and pVCCH5332viren (SEQ ID NO: 7), transformation event VCCH5332viren.
10 ug del vector pVCCH5320viren (SEQ ID NO: 5), 10 ug del vector pVCCH5330viren (SEQ ID NO: 6), y 10 ug del vector pVCCH5332viren (SEQ ID NO: 7), se usaron para transformar de manera individual a cultivos independientes de microalgas de la especie Chlamydomonas reinhardtii con una concentración de 1 X 10· células mediante el protocolo de bidística descrito a continuación:  10 ug of the pVCCH5320viren vector (SEQ ID NO: 5), 10 ug of the pVCCH5330viren vector (SEQ ID NO: 6), and 10 ug of the pVCCH5332viren vector (SEQ ID NO: 7), were used to transform individually to independent cultures of microalgae of the species Chlamydomonas reinhardtii with a concentration of 1 X 10 · cells by means of the bidistic protocol described below:
1).- Preparación de partículas de oro para bombardeo. 1) .- Preparation of gold particles for bombardment.
Se pesaron 50mg de partículas de oro de un diámetro de 0.6pm (Bio-Rad Company) y se colocaron en un microtubo de centrifuga de 1.5ml (Marca Axygen™). A estas partículas se les agrego 1000μΙ de etanol absoluto y se mezcló durante 3 minutos en el mezclador VORTEX-GENE 2. Después de mezclar se centrífugo a 13,000 rpm por 5 minutos y se descartó el sobre nadante. A la pastilla de partículas se agregó 1ml de etanol al 70%, se mezcló por 2 minutos y se dejó reposar a temperatura ambiente por 15 minutos mezclando en intervalos de 3 minutos. Después de los 15 minutos se centrifugó a 13,000 rpm durante 3 minutos y se descartó el sobrenadante. A la pastilla obtenida se agregó 1ml de agua desionizada estéril y se mezcló en el VORTEX-GENE 2 hasta la completa resuspensión de las partículas de oro. Las partículas se dejaron asentar durante 2 minutos, luego se centrifugaron a 13,000 rpm durante 2 minutos y se descartó el sobrenadante. Se repitió la adición de agua y la centrifugación dos veces más y la pastilla después de la tercera centrifugación se resuspendió en 800μΙ de gliceroi al 50% esterilizado. Las partículas en esta solución de gliceroi quedan a una concentración aproximada de 60mg/ml. Estas partículas se distribuyeron en alícuotas de 50μΙ en microtubos de 1.5ml (Marca Axygen™) y se almacenaron a -20°C hasta su uso. ii).-. Protocolo de recubrimiento de partículas de oro y transformación por biolística de microalgas de la especie Chlamydomonas rtinhardtil. 50mg of gold particles with a diameter of 0.6pm (Bio-Rad Company) were weighed and placed in a 1.5ml centrifuge microtube (Axygen ™ Brand). 1000μΙ of absolute ethanol was added to these particles and mixed for 3 minutes in the VORTEX-GENE 2 mixer. After mixing, it was centrifuged at 13,000 rpm for 5 minutes and the swimming pool was discarded. To the particle tablet was added 1ml of 70% ethanol, mixed for 2 minutes and allowed to stand at room temperature for 15 minutes mixing at 3 minute intervals. After 15 minutes it was centrifuged at 13,000 rpm for 3 minutes and the supernatant was discarded. To the obtained tablet was added 1ml of sterile deionized water and mixed in the VORTEX-GENE 2 until complete resuspension of gold particles. The particles were allowed to settle for 2 minutes, then centrifuged at 13,000 rpm for 2 minutes and the supernatant was discarded. The addition of water and centrifugation were repeated two more times and the tablet after the third centrifugation was resuspended in 800μΙ of 50% sterilized glyceri. The particles in this glyceri solution remain at an approximate concentration of 60mg / ml. These particles were distributed in 50μΙ aliquots in 1.5ml microtubes (Axygen ™ Brand) and stored at -20 ° C until use. ii) .-. Gold particle coating protocol and transformation by microalgae biolistics of the species Chlamydomonas rtinhardtil.
Para el recubrimiento de las macropartículas de oro se agregaron de manera individual por cada vector, 10 μΙ (lug/μΙ) del vector pVCCH5320viren (SEQ ID NO: 5) a 50μ de partículas de oro (βθμς/μί), 10 μΙ (lug/μΙ) del vector pVCCH5330viren (SEQ ID NO: 6) a 50μ de partículas de oro (βθμς/μί) y 10 μΙ (lug/μ!) del vector pVCCH5332viren (SEQ ID NO: 7) a 50μΙ de partículas de oro (60μο/μL), los siguientes paso se realizaron de manera individual por cada vector en combinación las macropartículas de oro preparadas previamente. Se mezclaron por 5 segundos en el VORTEX-GENE 2. Se les adicionó 50μΙ de CaCI22.5M (Sigma-Aldrich) y 20μΙ de esperimidina 0.1 M (Sigma-Aldrich) a cada. Los tubos con los 4 componentes se mantuvieron mezclándose en el VORTEX- GENE 2 a 4°C por 20 minutos. Trascurridos los 20 minutos se agregaron 200μΙ de etanol absoluto y se mezcló por 5 segundos a 3,100 rpm en la centrifuga miniSpin (Marca Eppendorf™). Se removió el sobrenadante y se repitió el lavado con etanol absoluto 4 veces más. Después del 4to lavado la pastilla obtenida se resuspendió en 30μΙ de etanol absoluto. Estos 30μΙ se distribuyeron en 6 membranas de acarreo (macrocarrier, Marca Bio Rad™) previamente montadas en los anillos metálicos porta-membranas (Macrocarrier holder, Marca Bio Rad™). El disparo de las partículas cargadas en las membranas sobre las muestras de Chlamydomonas reinhardtii en cultivo sólido se hizo utilizando la cámara de blistica PDS-1000/ΗΘ™ Biolistic Partióle Deliver System (Marca Bio Rad™), a una presión de 1,100 paséales sobre pulgada (PSI) a una distancia aproximada de 10 cm y dentro de una campana de flujo laminar en condiciones de esterilidad. Mediante esta metodología se transformaron 2 placas de cultivo solido medio TAP con Chlamydomonas reinhardtii por cada vector, denominados como eventos de transformación cl/VCCH5320viren (vector empleado pVCCH5320viren (SEQ ID NO: 5)), cl/VCCH5330viren (vector empleado pVCCH5330viren (SEQ ID NO: 6)) y cl/VCCH5332viren (vector empleado pVCCH5332viren (SEQ ID NO: 7)). Una vez sometidos al proceso de transformación del genoma del cloroplasto, los cultivos de Chlamydomonas reinhardtii resultantes de los eventos de transformaciócnl/V CCH5320viren, cl/VCCH5330viren y cl/VCCH5332viren se mantuvieron por tres días en medio TAP sólido (Marca Invitrogen™) sin antibiótico y posteriormente los cultivos de Chlamydomonas reinhardtii se recolectaron y pasaron a medio TAP solido (Marca Invitrogen™) con espectinomicina a una concentración de 100pg/ml. En este medio sólido de cultivo después del décimo día, las colonias crecidas se resembraron en un medio TAP solido nuevo (Marca Invitrogen™) con espectinomicina a una concentración de 100ug/ml. Se obtuvieron aproximadamente 50 colonias transformadas por cada evento de transformación (d/VCCH5320viren, cl/VCCH5330viren ycl/V CCH5332viren), las cuales se resembraron en medio TAP solido (Marca Invitrogen™) con espectinomicina a una concentración de 100 ug/ml por tres rondas más. Las colonias obtenidas en cada evento individual de transformacióncl/V CCH5320viren, cl/VCCH5330viren y cl/VCCH5332viren, mantuvieron su capacidad de crecimiento en el medio de selección hasta por 3 años. Posteriormente, de cada evento de transformaciónV CCH5320virenc,l/V CCH5330viren y cl/VCCH5332viren, se escogieron 3 clonas del evento de transformación cl/VCCH5320viren, 3 clonas del evento de transformación cl/VCCH5330viren y 4 clonas del evento de transformación cl/VCCH5332viren, para someterse al proceso de extracción de ADN total de Chlamydomonas reinhardtii, de manera individual mediante el método publicado en "the Chlamydomonas Resource Center"For the coating of the gold macroparticles, 10 μΙ (lug / μΙ) of the vector pVCCH5320viren (SEQ ID NO: 5) to 50μ of gold particles (βθμς / μί), 10 μΙ (lug) were added individually for each vector / μΙ) of the vector pVCCH5330viren (SEQ ID NO: 6) to 50μ of gold particles (βθμς / μί) and 10 μΙ (lug / μ!) of the vector pVCCH5332viren (SEQ ID NO: 7) to 50μΙ of gold particles ( 60μο / μL), the following steps were performed individually for each vector in combination the gold macroparticles previously prepared. They were mixed for 5 seconds in the VORTEX-GENE 2. They were added 50μΙ of CaCI22.5M (Sigma-Aldrich) and 20μΙ of 0.1M sperimidine (Sigma-Aldrich) to each. The tubes with the 4 components were kept mixing in the VORTEX-GENE 2 at 4 ° C for 20 minutes. After 20 minutes, 200μΙ of absolute ethanol was added and mixed for 5 seconds at 3,100 rpm in the miniSpin centrifuge (Eppendorf ™ Mark). The supernatant was removed and the washing was repeated with absolute ethanol 4 times more. After the 4th wash the obtained tablet was resuspended in 30μΙ of absolute ethanol. These 30μΙ were distributed in 6 carry membranes (macrocarrier, Brand Bio Rad ™) previously mounted on the metal membrane holder rings (Macrocarrier holder, Brand Bio Rad ™). Shot of the charged particles in the membranes on the samples of Chlamydomonas reinhardtii in solid culture was done using the PDS-1000 / ΗΘ ™ Biolistic Partióle Deliver System (Bio Rad ™ Brand), at a pressure of 1,100 paséales on inch (PSI) at an approximate distance of 10 cm and inside a laminar flow hood in sterile conditions. Through this methodology, 2 TAP medium solid culture plates were transformed with Chlamydomonas reinhardtii for each vector, referred to as transformation events cl / VCCH5320viren (vector used pVCCH5320viren (SEQ ID NO: 5)), cl / VCCH5330viren (vector used pVCCH5330viren (SEQ ID NO: 6)) and cl / VCCH5332viren (vector used pVCCH5332viren (SEQ ID NO: 7)). Once subjected to the chloroplast genome transformation process, the cultures of Chlamydomonas reinhardtii resulting from the transformation events / V CCH5320viren, cl / VCCH5330viren and cl / VCCH5332viren were kept for three days in solid TAP medium (Invitrogen Brand) without antibiotic and subsequently the cultures of Chlamydomonas reinhardtii were collected and passed to solid TAP medium (Invitrogen ™ Brand) with spectinomycin at a concentration of 100pg / ml. In this solid culture medium after the tenth day, the grown colonies were reseeded in a new solid TAP medium (Invitrogen ™ Brand) with spectinomycin at a concentration of 100ug / ml. They were obtained approximately 50 colonies transformed by each transformation event (d / VCCH5320viren, cl / VCCH5330viren andcl / V CCH5332viren), which were reseeded in solid TAP medium (Invitrogen ™ Brand) with spectinomycin at a concentration of 100 ug / ml for three more rounds . The colonies obtained in each individual transformation eventcl / V CCH5320viren, cl / VCCH5330viren and cl / VCCH5332viren, maintained their growth capacity in the selection medium for up to 3 years. Subsequently, from each transformation event V CCH5320virenc, l / V CCH5330viren and cl / VCCH5332viren, 3 clones of the transformation event cl / VCCH5320viren, 3 clones of the transformation event cl / VCCH5330viren and 4 clones of the transformation event cl / VCCH5332viren were chosen to undergo the total DNA extraction process of Chlamydomonas reinhardtii, individually using the method published in "the Chlamydomonas Resource Center"
(http://www.chlamy.org/methods.html), en todo caso, cada muestra fue sometida de manera similar e individual al proceso de extracción de ADN total con las siguientes modificaciones: se centrifugaron las muestras a 4,000 rpm, 1.5 mi del cultivo líquido de las clonas de Chlamydomonas reinhardtii procedentes de los eventos de transformación cl/VCCH5320virenc,l/V CCH5330viren y cl/VCCH5332viren, se les retiró el sobrenadante, se repitió este proceso tres veces a los cultivos procedentes de cada evento de transformaciónV CCH5320virenc,l/V CCH5330viren y cl/VCCH5332viren de Chlamydomonas reinhardtii, a la pastilla celular obtenida de manera individual de cada evento de transformaciócnl/V CCH5320virenc,l/V CCH5330viren ycl/V CCH5332viren, se les agregaron 700ul de buffer de extracción (10 mM Tris-HCI, 50mM EDTA, 500 mM NaCI) adicionado con beta-mercaptoetanol (1ul/ml) y se mezclaron en VORTEX-GENE 2 durante 10 minutos. Después de tos 10 minutos se agregaron 700μΙ de Fenol cloroformo (24: 1 ) y se centrífugo a 13,000 rpm durante 8 minutos. De las fases separadas en este paso se tomo la fase acuosa superior y se agregan 700μΙ de isopropanol más 40μΙ de Acetato de Sodio 3 Molar pH 5.2. Esta mezcla se incubó por 20 minutos a -20°C para la precipitación del ADN total. Transcurridos tos 20 minutos se centrifugó a 13,000 rpm durante 8 minutos, se tiró el sobrenadante y la pastilla obtenida se lavó con 700μΙ de etanoi al 75%. Después de dos lavados la pastilla se seco a 55°C por diez minutos y finalmente se eluyó en 30ul de agua desionizada estéril para su posterior análisis. Para el análisis de las colonias resistentes al antibiótico espectinomicina (gen aadA) obtenidas en tos eventos de transformaciócnl/V CCH5320viren, cWCCH5330viren y cl/VCCH5332viren, se realizó una reacción en cadena de la poiimerasa (PCR) usando como ADN templado 1μΙ el ADN extraído mediante el proceso referido anteriormente. La mezcla de reacción de PCR se realizó con 2.5μΙ de bufferTaq 10X (New England, btotabs), 1.5μΙ de MgCb (Invitrogen), 0.5 μΙ de dNTPs (New England, biolabs), Ο.5μΙ de olígonucleótido aadA 5 - ATGGCTCGTGAAGCGGTTAT-3' (aadACLF) (Marca Sigma AJdrich) y (5 - TTATTTGCCAACTACCTTAG-3 ' (aadACLR) (Marca Sigma AWrich), Ο.5μΙ de olígonucleótido aadA reverso (Marca Sigma AWrich) y 0.3 μΙ de enzima Taq poiimerasa (New England, Marca biolabs) más 18.2μΙ de agua desionizada estéril. La mezcla de reacción se sometió a amplificación en el termociclador MuKigene™ MINI (Labnet intemational, Inc). Los ciclos de amplificación se realizaron bajo las siguientes condiciones: desnaturalización inicial a 94°C por 5 minutos 1 ciclo, 35 ciclos a 94°C por 30 segundos (desnaturalización), 55°C por 30 segundos (alineamiento) y 72°C por 45 segundos (elongación) y un ciclo de extención final de 5 minutos a 72°C. Al final de la amplificación se tomarón 5ul de la mezcla de reacción y se corrieron en un gel de electroforesis en gel de agarosa al 1% teñido con bromuro de etidio y se visualizó en el fotodocumentador de imágenes Biosens SC 805 gel documentation system (Bio-tech Co, Shangai). Colonias de los eventos de transformación cWCCH5320viren, cl/VCCH5330viren ycl/V CCH5332viren con resistencia al antibiótico dan positivo a la PCR (gen aadA) para el gen de resistencia a espectJnomicina. (Figura No. 6 (a). Extracción de DNA total carriles 1, 2 y 3 (Evento de transformaciócnl/V CCH5320viren), carriles 4, 5 y 6 (Evento de transformaciócnl/V CCH5330v¡ren) y caniles 7, 8, 9, y 10 (evento de transformación cl/VCCH5332viren)). (Figura No. 6 (b). Detección por PCR del gen de resistencia a espectinomicina (gen aadA) carriles 1, 2 y 3 (Evento de transformaciócnl/V CCH5320viren), carriles 4, 5 y 6 (Evento de transformación cl/VCCH5330viren) y caniles 7, 8, 9, y 10 (evento de transformaciónV CCH5332viren)). iii).- Detección de los genes, gen h5320viren (SEQ ID NO: 1), gen h5330viren (SEQ ID NO: 2) y gen hS332viren (SEQ ID NO: 3) codón optimizados en el genoma del cloropiasto de Chlamydomonas reinhardtil en las cepas consideras como clonas recombinantes descritas como OGM'S, originadas en los eventos de transformación cl/VCCH5320viren, cl/VCCH5330 viren y cl/VCCH5332viren. De las donas de Chlamydomonas rainhardtii sometidas a la evaluación para el gen de resistencia aadA provenientes de los eventos de transformaciónV CCH5320viren, cl/VCCH5330viren y cl/VCCH5332viren, se escogió 1 colonia de cada evento de transformación, y mediante el método publicado en "the Chlamydomonas Resource Center" (http:ZMvvw.chlamy.org/methods.html), en todo caso, cada muestra fue sometida de manera similar e individual al proceso de extracción de ADN total con las siguientes modificaciones: se centrifugaron las muestras a 4,000 rpm, 1.5 mi del cultivo líquido de Chlamydomonas nainhardtii procedente de cada evento de transformacióncl/V CCH5320viren, cl/VCCH5330viren y cl/VCCH5332v¡ren, se tiró el sobrenadante, se repitió este proceso tres veces más. A la pastilla obtenida se agrego 700ul de bufter de extracción (10 mM Tris-HCI, 50mM EDTA, 500 mM NaCI) adicionado con beta-mercaptoetanol (1ul/ml) y se mezcló en VORTEX- GENE-2 durante 10 minutos. Después de los 10 minutos se agregaron 700μΙ de fenol cloroformo (24:1) y se centrífugo a 13,000 rpm durante 8 minutos. De las fases separadas en este paso se tomó la fase acuosa superior y se agregó 700μΙ de isopropanol más 40μΙ de acetato de sodio 3 Molar pH 5.2. Esta mezcla se incubó por 20 minutos a -20°C para la precipitación del ADN total. Transcurridos los 20 minutos se centrifugó a 13,000 rpm durante 8 minutos, se tiro el sobrenadante y la pastilla obtenida se lavó con 700μΙ de etanol al 75%. Después de dos lavados la pastilla se seco a 55°C por 10 minutos y finalmente se eluyó en 30μΙ de agua desionizada estéril para su posterior análisis. Para evaluar la presencia del transgen en el genoma del cloroplasto de Chlamydomonas rainhardtii procedentes de cada evento de transformaciócnl/V CCH5320viren, V(http://www.chlamy.org/methods.html), in any case, each sample was similarly and individually subjected to the total DNA extraction process with the following modifications: the samples were centrifuged at 4,000 rpm, 1.5 mi of the liquid culture of the Chlamydomonas reinhardtii clones from the transformation events cl / VCCH5320virenc, l / V CCH5330viren and cl / VCCH5332viren, the supernatant was removed, this process was repeated three times to the cultures from each transformation event CCH5320virenc, l / V CCH5330viren and cl / VCCH5332viren of Chlamydomonas reinhardtii, to the cell pellet obtained individually from each transformation event / V CCH5320virenc, l / V CCH5330viren andcl / V CCH5332viren, 700ul of buffer were added (700ul of buffer mM Tris-HCI, 50mM EDTA, 500 mM NaCI) added with beta-mercaptoethanol (1ul / ml) and mixed in VORTEX-GENE 2 for 10 minutes. After 10 minutes, 700μΙ of Phenol chloroform (24: 1) was added and centrifuged at 13,000 rpm for 8 minutes. From the separated phases in this step the upper aqueous phase was taken and 700μΙ of isopropanol plus 40μΙ of Molar Sodium Acetate 3 pH 5.2 are added. This mixture was incubated for 20 minutes at -20 ° C for total DNA precipitation. After 20 minutes, it was centrifuged at 13,000 rpm for 8 minutes, the supernatant was discarded and the obtained tablet was washed with 700μΙ of 75% etanoi. After two washes the tablet was dried at 55 ° C for ten minutes and finally eluted in 30ul of sterile deionized water for further analysis. For the analysis of the colonies resistant to the antibiotic spectinomycin (aadA gene) obtained in the events of transformation / V CCH5320viren, cWCCH5330viren and cl / VCCH5332viren, a polymerase chain reaction (PCR) was carried out using as DNA tempered 1μΙ the extracted DNA through the process referred to above. The PCR reaction mixture was performed with 2.5μΙ bufferTaq 10X (New England, btotabs), 1.5μΙ MgCb (Invitrogen), 0.5 μΙ dNTPs (New England, biolabs), Ο.5μΙ olygonucleotide aadA 5 - ATGGCTCGTGAAGCGGTTAT- 3 '(aadACLF) (Sigma AJdrich brand) and (5 - TTATTTGCCAACTACCTTAG-3' (aadACLR) (Sigma AWrich brand), Ο.5μΙ of reverse aadA olygonucleotide (Sigma AWrich brand) and 0.3 μΙ of Taq polymerase enzyme (New England, Biolabs brand) plus 18.2μΙ of sterile deionized water The reaction mixture was subjected to amplification in the MuKigene ™ MINI thermal cycler (Labnet intemational, Inc.) The amplification cycles were performed under the following conditions: initial denaturation at 94 ° C by 5 1 cycle minutes, 35 cycles at 94 ° C for 30 seconds (denaturation), 55 ° C for 30 seconds (alignment) and 72 ° C for 45 seconds (elongation) and a final 5 minute extension cycle at 72 ° C. At the end of the amplification, 5ul of the reaction mixture was taken and run on a 1% agarose gel electrophoresis gel stained with ethidium bromide and visualized in the Biosens SC 805 gel documentation system (Photo- Tech Co, Shanghai). Colonies of the transformation events cWCCH5320viren, cl / VCCH5330viren andcl / V CCH5332viren with antibiotic resistance test positive for PCR (aadA gene) for the spectJnomycin resistance gene. (Figure No. 6 (a). Total DNA extraction lanes 1, 2 and 3 (Transformation event / V CCH5320viren), lanes 4, 5 and 6 (Transformation event / V CCH5330vren) and cannons 7, 8, 9, and 10 (transformation event cl / VCCH5332viren)). (Figure No. 6 (b). PCR detection of the spectinomycin resistance gene (aadA gene) lanes 1, 2 and 3 (Transformation event / V CCH5320viren), lanes 4, 5 and 6 (Transformation event cl / VCCH5330viren ) and caniles 7, 8, 9, and 10 (transformation event V CCH5332viren)). iii) .- Detection of the genes, h5320viren gene (SEQ ID NO: 1), h5330viren gene (SEQ ID NO: 2) and hS332viren gene (SEQ ID NO: 3) codon optimized in the genome of the reinhardtil Chlamydomonas chloroplast genome strains considered as recombinant clones described as GMOs, originating from the transformation events cl / VCCH5320viren, cl / VCCH5330 viren and cl / VCCH5332viren. Of the Chlamydomonas rainhardtii donuts submitted to the evaluation for the resistance gene aadA from the transformation events V CCH5320viren, cl / VCCH5330viren and cl / VCCH5332viren, 1 colony of each transformation event was chosen, and by the method published in "the Chlamydomonas Resource Center "(http: ZMvvw.chlamy.org/methods.html), in any case, each sample was similarly and individually subjected to the total DNA extraction process with the following modifications: the samples were centrifuged at 4,000 rpm 1.5 ml of the liquid culture of Chlamydomonas nainhardtii from each transformation eventcl / V CCH5320viren, cl / VCCH5330viren and cl / VCCH5332vren, the supernatant was discarded, this process was repeated three more times. To the tablet obtained was added 700ul of extraction bufter (10 mM Tris-HCI, 50mM EDTA, 500 mM NaCI) added with beta-mercaptoethanol (1ul / ml) and mixed in VORTEX-GENE-2 for 10 minutes. After 10 minutes 700μΙ of phenol chloroform (24: 1) was added and centrifuged at 13,000 rpm for 8 minutes. From the separated phases in this step the upper aqueous phase was taken and 700μΙ of isopropanol plus 40μΙ of sodium acetate 3 Molar pH 5.2 was added. This mixture was incubated for 20 minutes at -20 ° C for total DNA precipitation. After 20 minutes, it was centrifuged at 13,000 rpm for 8 minutes, the supernatant was discarded and the obtained tablet was washed with 700μΙ of 75% ethanol. After two washes the tablet was dried at 55 ° C for 10 minutes and finally eluted in 30μΙ of sterile deionized water for further analysis. To assess the presence of the transgene in the Chlamydomonas rainhardtii chloroplast genome from each CCH5320viren / V transformation event, V
CCH5330viren ycl/V CCH5332viren, donde et transgen corresponde de manera individual al gen h5320v¡ren (SEQ ID NO: 1) codificante para la proteína recombinante del vlA la cual inicia en el aminoácido en la posición 1 hasta el aminoácido en la posición 320 en la proteína recombinante Δh5320viren (SEQ ID NO: 8) en el evento de transformaciócnl/V CCH5320viren, gen h5330viren (SEQ ID NO: 2) codificante para la proteína recombinante del vlA la cual inicia desde el aminoácido en la posición 1 hasta el aminoácido en la posición 330 en la proteína recombinante Δh5330viren (SEQ ID NO: 9) en el evento de transformación cl/VCCH5330viren y gen h5332viren (SEQ ID NO: 3) codificante para la proteína recombinante dei vlA la cual inicia desde el aminoácido en la posición 1 hasta el aminoácido en la posición 332 en la proteína recombinante Μι5332viren (SEQ ID NO: 10) en el evento de transformacióncl/V CCH5332viren, donde la numeración de las posiciones de los aminoácidos de las proteínas recombinantes del vlA: proteína recombinante Δh5320viren (SEQ ID NO: 8), proteína recombinante Δh5330viren (SEQ ID NO: 9) y proteína recombinante Áh5332viren (SEQ ID NO: 10) , se refieren estrictamente a la posición de aminoácidos en la SEQ ID NO: 8, SEQ ID NO: 9, y SEQ ID NO: 10, se realizó mediante el uso de los oligonudeotidos específicos 5' TGCCCGTATAATGGTCGTTCA 3' (H5CLF) y 5'TTTGGCATTTCGCATCACAGT 3' (H5CLR) en una mezcla de reacción de PCR estándar con las siguientes condiciones: desnaturalización a 94°C por 5 minutos, desnaturalización a 94 °C por 30 segundos, alineamiento a 58°C por 30 segundos, elongación a 72°C por 30 segundos y elongación final por 5 minutos a 72°. Al final de la amplificación se tomaron 5ul de la mezcla de reacción y se corrieron en un gel de electrofóresis en gel de agarosa al 1% teñido con bromuro de etidio y se visualizó en el fotodocumentador de imágenes Biosens SC 805 gel documentation system (Bio-tech Co, Shangai). De las clonas seleccionadas de los eventos de transformaciócnl/V CCH5320virenc,l/V CCH5330viren ycl/V CCH5332viren se logró amplificar un fragmento de 436 pares de bases correspondiente a la parte interna de los genes: gen h5320viren (SEQ ID NO: 1), gen h5330viren (SEQ ID NO: 2) y gen h5332viren (SEQ ID NO: 3) (Figura No. 7. Amplificación del fragmento de 436 pares de bases de los genes: gen h5320viren (SEQ ID NO: 1) (canil 1), en el evento de transformaciócnl/V CCH5320viren, gen h5330viren (SEQ ID NO: 2) (carril 2) en el evento de transformación cl/VCCH5330 viren y gen h5332viren (SEQ ID NO: 3) (carril 3) en el evento de transformación CI/VCCH5332viren, (M) marcador de peso molecular y muestra control de ADN de Chlamydomonas reinhardtii (Canil 4) sin modificaciones genéticas). CCH5330viren andcl / V CCH5332viren, where et transgene corresponds individually to the h5320v¡ren gene (SEQ ID NO: 1) encoding the recombinant protein of vlA which starts at amino acid at position 1 to amino acid at position 320 in the recombinant protein Δh5320viren (SEQ ID NO: 8) in the event of transformation / V CCH5320viren, gene h5330viren (SEQ ID NO: 2) coding for the recombinant protein of vlA which starts from the amino acid in position 1 to the amino acid in position 330 in the recombinant protein Δh5330viren (SEQ ID NO: 9) in the transformation event cl / VCCH5330viren and gene h5332viren (SEQ ID NO: 3) encoding the recombinant protein of vlA which starts from the amino acid in position 1 to amino acid at position 332 in the recombinant protein Μι5332viren (SEQ ID NO: 10) in the transformation eventcl / V CCH5332viren, where the numbering of amino acid positions of l The recombinant proteins of vlA: recombinant protein Δh5320viren (SEQ ID NO: 8), recombinant protein Δh5330viren (SEQ ID NO: 9) and recombinant protein Áh5332viren (SEQ ID NO: 10), strictly refer to the amino acid position in SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: 10, was performed using the specific oligonucleotides 5 'TGCCCGTATAATGGTCGTTCA 3' (H5CLF) and 5'TTTGGCATTTCGCATCACAGT 3 '(H5CLR) in a reaction mixture of Standard PCR with the following conditions: denaturation at 94 ° C for 5 minutes, denaturation at 94 ° C for 30 seconds, alignment at 58 ° C for 30 seconds, elongation at 72 ° C for 30 seconds and final elongation for 5 minutes at 72 °. At the end of the amplification 5ul of the reaction mixture was taken and they ran on a 1% agarose gel electrophoresis gel stained with ethidium bromide and visualized in the Biosens SC 805 gel documentation system (Bio-tech Co, Shanghai) image photodocument. From the selected clones of the CCH5320virenc / V transformation events, l / V CCH5330viren and cl / V CCH5332viren was able to amplify a 436 base pair fragment corresponding to the internal part of the genes: h5320viren gene (SEQ ID NO: 1), h5330viren gene (SEQ ID NO: 2) and h5332viren gene (SEQ ID NO: 3) (Figure No. 7. Amplification of the 436 base pair fragment of genes: h5320viren gene (SEQ ID NO: 1) (canile 1) , in the event of transformation / V CCH5320viren, gene h5330viren (SEQ ID NO: 2) (lane 2) in the transformation event cl / VCCH5330 viren and gene h5332viren (SEQ ID NO: 3) (lane 3) in the event of CI / VCCH5332viren transformation, (M) molecular weight marker and shows DNA control of Chlamydomonas reinhardtii (Canil 4) without genetic modifications).
Descripción de las proteínas recom binantes del vlA, proteína recombinante Δh5320viren (SEQ ID NO: 8) codificado en el gen h5320viren (SEQ ID NO: 1), proteína recombinante Δh5330viren (SEQ ID NO: 9) codificado en el gen hS330v¡nn (SEQ ID NO: 2) y proteína recombinante Δh5332viron (SEQ ID NO: 10) codificada en el gen h5332viren (SEQ ID NO: 3), para su expresión proteica en el genoma del cloroplasto de Chlamydomonas reinhardtii. Description of recombinant vlA proteins, recombinant protein Δh5320viren (SEQ ID NO: 8) encoded in the h5320viren gene (SEQ ID NO: 1), recombinant protein Δh5330viren (SEQ ID NO: 9) encoded in the hS330v¡nn gene ( SEQ ID NO: 2) and recombinant protein Δh5332viron (SEQ ID NO: 10) encoded in the h5332viren gene (SEQ ID NO: 3), for its protein expression in the Chlamydomonas reinhardtii chloroplast genome.
La presente invención describe a las proteínas recombinantes del vlA, proteína recombinante Δh5320viran (SEQ ID NO: 8), proteína recombinante Δh5330viren (SEQ ID NO: 9) y proteína recombinante Δh5332viren (SEQ ID NO: 10), las cuales se describen iniciando desde el aminoácido en la posición 1 hasta el aminoácido en la posición 320 en la proteína recombinante Δh5320viren (SEQ ID NO: 8), iniciando desde el aminoácido en la posición 1 hasta el aminoácido en la posición 330 en la proteína recombinante, ΔhS33(Mren (SEQ ID NO: 9) e iniciando desde el aminoácido en la posición 1 hasta el aminoácido en la posición 332 en la proteína recombinante Δh5332viren (SEQ ID NO: 10), donde la numeración de las posiciones de tos aminoácidos de las proteínas recombinantes del WA, protefna recombinante Δh5320viren (SEQ ID NO: 8), proteína recombinante Δh533(Mren (SEQ ID NO: 9) y proteína recombinante Δh5332wen (SEQ ID NO: 10) se refieren estrictamente a la posición de aminoácidos en la SEQ ID NO: 8, SEQ ID NO: 9 y SEQ ID NO: 10, respectivamente. Las proteínas recombinantes H5 del vlA objeto de la presente invención, proteína recombinante Δh5320viren (SEQ ID NO: 8), proteína recombinante Δh5330viren (SEQ ID NO: 9) y proteína recombinante Δh5332viren (SEQ ID NO: 10), correspondientes a secuencias proteicas heterólogas de la secuencia peptídica de la proteína HA, serotipo H5 del vlA, con un peso aproximado de -38 kDa expresadas en cloroplasto de microalgas de la especie Chlamydomonas reinhardtii. Las secuencias peptídicas denominadas como proteínas recombinantes del vlA, proteína recombinante Δh5320viran (SEQ ID NO: 8), proteína recombinante Δh5330v¡mn (SEQ ID NO: 9) y proteína recombinante Δh5332viren (SEQ ID NO: 10), al ser expresadas en el genoma del cloroplasto de Chlamydomonas reinhardtii, resultantes de tos eventos de trareformación denominados como cl/VCCH5320virenc, l/V CCH5330viren y VThe present invention describes the recombinant proteins of vlA, recombinant protein Δh5320viran (SEQ ID NO: 8), recombinant protein Δh5330viren (SEQ ID NO: 9) and recombinant protein Δh5332viren (SEQ ID NO: 10), which are described starting from amino acid at position 1 to amino acid at position 320 in recombinant protein Δh5320viren (SEQ ID NO: 8 ), starting from the amino acid at position 1 to the amino acid at position 330 in the recombinant protein, ΔhS33 (Mren (SEQ ID NO: 9) and starting from the amino acid at position 1 to the amino acid at position 332 in the Δh5332viren recombinant protein (SEQ ID NO: 10), where the numbering of amino acid positions of the WA recombinant proteins, Δh5320viren recombinant protein (SEQ ID NO: 8), Δh533 recombinant protein (Mren (SEQ ID NO: 9) and recombinant protein Δh5332wen (SEQ ID NO: 10) strictly refers to the amino acid position in SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10, respectively. H5 recombinant proteins of the vlA object of the present invention n, recombinant protein Δh5320viren (SEQ ID NO: 8), recombinant protein Δh5330viren (SEQ ID NO: 9) and recombinant protein Δh5332viren (SEQ ID NO: 10), corresponding to heterologous protein sequences of the peptide sequence of the HA protein, serotype H5 of vlA, with an approximate weight of -38 kDa expressed in microalgae chloroplast of the species Chlamydomonas reinhardtii. Peptide sequences referred to as recombinant vlA proteins, recombinant protein Δh5320viran (SEQ ID NO: 8), recombinant protein Δh5330v¡mn (SEQ ID NO: 9) and recombinant protein Δh5332viren (SEQ ID NO: 10), when expressed in the Chlamydomonas reinhardtii chloroplast genome, resulting from trareformation events referred to as cl / VCCH5320virenc, l / V CCH5330viren and V
CCH5332viren, generan las proteínas heterólogas de origen recombinante de la proteina del vlA, siendo en todo caso, distintas a la secuencia de la proteína H5 de! vlA observada en la naturaleza, presentando en la secuencia de aminoácidos C-terminal, en la posición de aminoácidos 311 a la posición de aminoácidos 320, los siguientes residuos de aminoácidos: His-PiXhPhe-Thr-lle- Gly-Glu-Cys-Pro-Lys en el caso de la proteina recombinante Δh5320viren (SEQ ID NO: 8), la secuencia de aminoácidos C-terminal en la posición de aminoácidos 321 a la posición de aminoácidos 330, los siguientes residuos de amiix>ácidos:Tyr-VahLys-Ser-Lys-Lys-Leu-Val-Leu-Ala en el caso de la proteina recombinante ΔhS330viren (SEQ ID NO: 9) y la secuencia de aminoácidos C- terminal en la posición de aminoácidos 323 a la posición de aminoácidos 332, los siguientes residuos de aminoácidos: Lys-Ser-Lys-Lys-Leu-VaLLeu-Ala-Ser- Arg en el caso de la proteína recombinante Δh5332viren (SEQ ID NO: 10), tos cuales en todos tos casos, corresponden a la parte interna de la secuencia peptídica de la proteína HA del vlA observada en la naturaleza y no presentes en la secuencia C-terminal. Siendo esto una cararacterística que les permiten su correcta expresión en el cloroplasto de Chlamydomonas reinhardtii y del mismo modo, conservar su similitud antigéntoa a la proteína de origen viral, así como su capacidad como antigeno de origen recombinante para su uso como vacuna, contra el vlA aplicado por diversas vías como tos siguientes ejemplos: vía mucosas en general (respiratorias, digestiva y conjuntival), vía parenteral (ejemplo: intramuscular y subcutánea) para el control y tratamiento de la IA, en todos tos organimos susceptibles a la enfermedad inducida por el vlA. Asi también, la presente invención comprende tos genes sintéticos codón optimizados para su empleo en el sistema del genoma del doroplasto de Chíamydomonas minhardtii en los eventos de transformaciónV CCH5320virenc,l/V CCH5330viren y dA/CCH5332vjren, genes sintéticos: gen h5320viren (SEQ ID NO: 1), gen h5330viren (SEQ ID NO: 2) y gen h5332viren (SEQ ID NO: 3) codón optimizados con la secuencias de nucleótidos del ADN codificantes de las proteínas recombinantes del vlA. proteína recombinante Δh5320viren (SEQ ID NO: 8), proteína recombinante Δh5330viren (SEQ ID NO: 9) y proteína recombinante Δh5332viran (SEQ ID NO: 10), siendo en todo caso, capaces de ser expresadas en el sistema de expresión heterólogo eucaríota del genoma del doroplasto de Chíamydomonas rainhardtii, originadas en los eventos de transformaciócnl/V CCH5320virenc,l/V CCH5330viren y cWCCH5332viren, mediante su inserción en la secuencia de nucleótidos del ADN correspondiente al genoma en plástidos (cloroplastos). Siendo en todo caso, medible su estímulo antigénico en animales de experimentación como antígeno vacunal contra el vlA aplicado por diversas vías como los siguientes ejemplos: vía mucosas en general (respiratorias, digestiva y conjuntival), vía parenteral (intramuscular y subcutánea), para el control y tratamiento de la vlA, en todos los organimos susceptibles a la enfermedad inducida por el vlA, así como la determinadón directa de anticuerpos a nivel sanguíneo por la técnica de IH, observando estimulación antigéntca y respuesta inmune con títulos sanguíneos (media geométrica) de acuerdo a la Norma Oficial Mexicana NOM- 055ZOO-1995, por la técnica IH de referencia aprobada por la OMS a nivel internacional mediante su aplicación como antígeno vacunal, contra el vlA aplicado por diversas vías como los siguientes ejemplos: vía mucosas en general (respiratorias, digestiva y conjuntival), vía parenteral (intramuscular y subcutánea), para el control y tratamiento de la vlA, en todos los organimos susceptibles a la enfermedad inducida por ei vlA. Aspectos adicionales de la invención, es el empleo de plástidos (cloroplastos) genéticamente alterados para la expresión de proteínas recombinantes del vlA en el organismo Chlamydomonas reinhardtíi obtenidos de forma exclusivamente ilustrativa, en tos eventos de transformaciócnl/V CCH5320virenc,l/V CCH5330viren yV CCH5332viren, conservando su antigenicidad cruzada con la proteina nativa de la cual provengan mediante la prueba de westem blot y a su evaluación antigénica en animales de experimentación. CCH5332viren, generate heterologous proteins of recombinant origin of the vlA protein, being in any case, different from the sequence of the H5 protein of! vlA observed in nature, presenting in the C-terminal amino acid sequence, at amino acid position 311 to amino acid position 320, the following amino acid residues: His-PiXhPhe-Thr-lle-Gly-Glu-Cys-Pro -Lys in the case of the recombinant protein Δh5320viren (SEQ ID NO: 8), the C-terminal amino acid sequence at amino acid position 321 to amino acid position 330, the following amiix> acid residues: Tyr-VahLys- Ser-Lys-Lys-Leu-Val-Leu-Ala in the case of the recombinant protein ΔhS330viren (SEQ ID NO: 9) and the C-terminal amino acid sequence at amino acid position 323 to amino acid position 332, following amino acid residues: Lys-Ser-Lys-Lys-Leu-VaLLeu-Ala-Ser-Arg in the case of the recombinant protein Δh5332viren (SEQ ID NO: 10), which in all cases corresponds to the internal part of the vlA HA protein peptide sequence observed in nature and not present in the C-terminal sequence. This being a characteristic that allows them to be correctly expressed in the Chlamydomonas reinhardtii chloroplast and, in the same way, preserve its antigenic similarity to the protein of viral origin, as well as its ability as an antigen of recombinant origin for use as a vaccine, against vlA applied by various routes such as the following examples: mucous pathways in general (respiratory, digestive and conjunctival), parenteral route (example: intramuscular and subcutaneous) for the control and treatment of AI, in all coughs we are susceptible to disease induced by vlA. Also, the present invention comprises the codon synthetic genes optimized for use in the chiamydomonas minhardtii doroplast genome system in transformation events V CCH5320virenc, l / V CCH5330viren and dA / CCH5332vjren, synthetic genes: h5320viren gene (SEQ ID NO: 1), h5330viren gene (SEQ ID NO: 2) and h5332viren gene (SEQ ID NO: 3) codon optimized with the DNA nucleotide sequences encoding the recombinant vlA proteins. Δh5320viren recombinant protein (SEQ ID NO: 8), Δh5330viren recombinant protein (SEQ ID NO: 9) and Δh5332viran recombinant protein (SEQ ID NO: 10), being in any case capable of being expressed in the eukaryotic heterologous expression system of the Chíamydomonas rainhardtii doroplast genome, originating from the transformation events / V CCH5320virenc, l / V CCH5330viren and cWCCH5332viren, by inserting them into the nucleotide sequence of the DNA corresponding to the genome in plastids (chloroplasts). In any case, its antigenic stimulation is measurable in experimental animals as a vaccine antigen against the vlA applied by various routes such as the following examples: mucous route in general (respiratory, digestive and conjunctival), parenteral route (intramuscular and subcutaneous), for control and treatment of the vlA, in all the organs susceptible to the disease induced by the vlA, as well as the direct determination of antibodies at the blood level by the IH technique, observing antigenic stimulation and immune response with blood titers (geometric mean) of according to the Official Mexican Standard NOM- 055ZOO-1995, by the IH reference technique approved by the WHO at international level through its application as a vaccine antigen, against the vlA applied by various routes such as the following examples: mucous route in general (respiratory, digestive and conjunctival), parenteral route (intramuscular and subcutaneous), for the control and treatment of vlA, in all the organs susceptible to ei vlA-induced disease. Additional aspects of the invention are the use of genetically altered plastids (chloroplasts) for the expression of recombinant vlA proteins in the Chlamydomonas reinhardtíi organism obtained exclusively illustratively, in the transformation events / V CCH5320virenc, l / V CCH5330viren and V CCH5332viren , conserving its antigenicity crossed with the native protein from which they come by means of the westem blot test and its antigenic evaluation in experimental animals.
Caracterización antigénica por medio de la técnica de western blot de las proteínas recombinantes del vi A, proteína recombinante Δh5320víren (SEQ ID NO: 8), proteina recombinante Δh5330víren (SEQ ID NO: 9) y proteína recombinante Δh5332viren (SEQ ID NO: 10), expresadas en el cloroplasto de Chlamydomonas reinhardtíi provenientes de loa eventos de transformación cl/VCCH5320vlrenl cl/VCCH5330viren y cl/VCCHS332viren. Antigenic characterization by means of the western blot technique of recombinant proteins of vi A, recombinant protein Δh5320víren (SEQ ID NO: 8), recombinant protein Δh5330víren (SEQ ID NO: 9) and recombinant protein Δh5332viren (SEQ ID NO: 10) , expressed in the Chlomydomonas reinhardtíi chloroplast from the transformation events cl / VCCH5320vlren l cl / VCCH5330viren and cl / VCCHS332viren.
Para la extracción de proteínas totales de Chlamydomonas reinhardtíi provenientes de los eventos de transformaciócnl/V CCH5320viren, cl/VCCH5330viren ycl/V CCH5332viren para el análisis por westem blot se centrifugaron 5 mi del cultivo líquido de manera individual de los eventos de transformación cl/VCCH5320viren, cl/VCCH5330viren ycl/V CCH5332viren y el paquete celular se resuspendió en 200μΙ de buffer de extracción pH 7 (Tris-HCL 750mM, Sacarosa 15%, 2-mercaptoetanol, PMSF 1mM). En este buffer el paquete celular fue sonicado 5 ciclos de 5 segundos con intervalos de descanso de 5 segundos a una amplitud de 25% en el sonicador ULTRASONIC PROCESSOR modelo VCX130 (Cole-Palmer ® Company). Del lisado total obtenido del tratamiento previamente descrito, se usaron 20μΙ de las muestras obtenidas de los eventos de transformacióncl/V CCH5320viren, cl/VCCH5330viren y cl/VCCH5332viren para su análisis por western blot. For the extraction of total proteins of Chlamydomonas reinhardtíi from the C / VCCH5320viren / cl / VCCH5330viren and cl / V CCH5332viren transformation events for the analysis by westem blot 5 ml of the liquid culture were centrifuged individually from the cl / VCCH5320viren transformation events , cl / VCCH5330viren and cl / V CCH5332viren and the cell packet was resuspended in 200μΙ of pH 7 extraction buffer (Tris-HCL 750mM, 15% Sucrose, 2-mercaptoethanol, 1mM PMSF). In this buffer the cell packet was sonicated for 5 cycles of 5 seconds with rest intervals of 5 seconds at an amplitude of 25% in the ULTRASONIC PROCESSOR sonicator model VCX130 (Cole-Palmer ® Company). Of the total lysate obtained from the previously described treatment, 20μΙ of the samples obtained from the transformation events c / V CCH5320viren, cl / VCCH5330viren and cl / VCCH5332viren were used for western blot analysis.
a).- Desarrollo de la prueba de western blot para la detección de las proteínas recombinantes del vlA, protfena recombinante Δh5320viren (SEQ ID NO: 8), proteína recombinante Δh5330viren (SEQ ID NO: 9) y proteína recombinante Δh5332viren (SEQ ID NO: 10), obtenidas de los eventos de transformaciócnl/V CCH5320viren, cl/VCCH5330viren ycl/V CCH5332viren mediante el uso de anticuerpos monoclonales de origen comercial.  a) .- Development of the western blot test for the detection of recombinant vlA proteins, recombinant protrine Δh5320viren (SEQ ID NO: 8), recombinant protein Δh5330viren (SEQ ID NO: 9) and recombinant protein Δh5332viren (SEQ ID NO : 10), obtained from the transformation events C / V CCH5320viren, cl / VCCH5330viren and C / V CCH5332viren by using monoclonal antibodies of commercial origin.
Para el análisis por la técnica de wester blot mediante el uso de anticuerpos monoclonales de origen comercial, se sometió de manera individual y de igual forma al extracto proteico obtenido de cada evento de transformación, cl/VCCH5320viren, cl/VCCH5330viren y cl/VCCH5332viren al siguiente procedimiento: se mezclo 20μΙ de cada muestra de cada extracto proteico con 20μΙ de buffer de carga para proteínas (SDS 10%, TRIS 0.25M pH 6.8, Azul de bromofenol 0.1 %, DDT 7.73%, glicerol 50%) y se desnaturalizaron por 5 minutos a 95°C y las muestras se cargaron en gel de poliacrilamida al 12% y se corrió a 120 volts durante una hora. Posteriormente las muestras de las proteínas se trasfi rieron del gel de poliacrilamida al 12 % a una membrana de nitrocelulosa mediante el buffer transferencia (Tris-base 0.3%, glicina 1.44%, metano! 20%) a 150 Volts durante una hora en el equipo para transferencia TV100-EBK Maxi Electroblotter (SCIE-PLAS UK). Una vez trasferidas las proteínas, la membrana se lavó dos veces con solución PBS-T (NaCI 0.8%, KCI 0.02%, Na2HP04 0.144%, KHP04 0.024%, Tween-20 0.05%), cada lavado se hizó por 2 minutos en agitación a 90 rpm. Después del lavado se bloqueó con leche en polvo (Svetty (8> sin grasa) al 5% en PBS-T por 1 hora. Al cabo de la hora se eliminó la leche y la membrana de nitrocelulosa se incubó con el anticuerpo primario "Anti-Avian Influenza A Hemagglutinin antibody" [7G48] IgG (Ms mAb To avian influenza A hemaglutinin (7G48) cat no ab 169870 lote GR162995-1 ) (Marca abcam®) diluido 1/1000 en PBS-T durante 12 horas a 4°C. Trascurridas las 12 horas se lavó la membrana dos veces con PBS-T y luego se incubo con el anticuerpo secundario "Rabbit Anti-Mouse IgG H&L" (HRP) IgG (ab97046) (Rb pAb to Ms IgG (HRP) cat no. ab97046 lote GR152852-1) (Marca abcam®) diluido 1/2000 en PBS-T durante una hora a temperatura ambiente. Pasada la hora se lavó la membrana dos veces con PBS-T, 2 minutos con agitación a 90 rpm en cada lavado. La membrana lavada se colocó en una bolsa transparente y se selló. Para revelar se agregó a la membrana solución A diluida 1/40 en la solución B del kit PIERCE Φ ECL PLUS westem Bloting Substrato (Thermo Scientrfic) y se dejó incubar durante 1 minuto, al cabo del minuto se retiró la solución AB y se revelo la imagen en una película radiográfica Kodak (Kodak REF 6040331 ). (Figura No. 8. Prueba de westem btot (anticuerpos monoclonales) para la detección de las proteínas recombinantes del vlA. Proteína recombinante Δh5320viren (carril 2), proteína recombinante Δh5330viren (carril 3) y proteína recombinante Δh5332viren (carril 4), marcador de peso molecular (carril M), muestra control de tejido de Chlamydomonas reinhardtii sin modificaciones genéticas (carril 1)). For the analysis by the wester blot technique through the use of monoclonal antibodies of commercial origin, the protein extract obtained from each transformation event, cl / VCCH5320viren, cl / VCCH5330viren and cl / VCCH5332viren, was submitted individually and in the same way following procedure: 20μΙ of each sample of each protein extract was mixed with 20μΙ of protein loading buffer (SDS 10%, TRIS 0.25M pH 6.8, Bromophenol Blue 0.1%, DDT 7.73%, glycerol 50%) and denatured by 5 minutes at 95 ° C and the samples were loaded on 12% polyacrylamide gel and run at 120 volts for one hour. Subsequently, the protein samples were transferred from the 12% polyacrylamide gel to a nitrocellulose membrane by transfer buffer (0.3% Tris-base, 1.44% glycine, methane! 20%) to 150 Volts for one hour on the TV100-EBK Maxi Electroblotter transfer equipment (SCIE-PLAS UK). Once the proteins were transferred, the membrane was washed twice with PBS-T solution (NaCl 0.8%, KCI 0.02%, Na2HP04 0.144%, KHP04 0.024%, Tween-20 0.05%), each wash was made for 2 minutes with stirring at 90 rpm After washing it was blocked with 5% powdered milk (Svetty (8> fat-free) in PBS-T for 1 hour. After the hour the milk was removed and the nitrocellulose membrane was incubated with the primary antibody "Anti -Avian Influenza A Hemagglutinin antibody "[7G48] IgG (Ms mAb To avian influenza A hemagglutinin (7G48) cat no ab 169870 lot GR162995-1) (brand abcam®) diluted 1/1000 in PBS-T for 12 hours at 4 ° C. After 12 hours the membrane was washed twice with PBS-T and then incubated with the secondary antibody "Rabbit Anti-Mouse IgG H&L" (HRP) IgG (ab97046) (Rb pAb to Ms IgG (HRP) cat no ab97046 lot GR152852-1) (brand abcam®) diluted 1/2000 in PBS-T for one hour at room temperature After the hour the membrane was washed twice with PBS-T, 2 minutes with stirring at 90 rpm at each The washed membrane was placed in a transparent bag and sealed, to reveal solution A diluted 1/40 in solution B of the PIERCE kit Φ ECL PLU was added to the membrane S westem Bloting Substrate (Thermo Scientrfic) and allowed to incubate for 1 minute, after one minute the AB solution was removed and the image was revealed on a Kodak radiographic film (Kodak REF 6040331). (Figure No. 8. Westem btot test (monoclonal antibodies) for the detection of recombinant vlA proteins. Recombinant protein Δh5320viren (lane 2), recombinant protein Δh5330viren (lane 3) and recombinant protein Δh5332viren (lane 4), molecular weight marker (lane M), shows control of Chlamydomonas reinhardtii tissue without genetic modifications (lane 1)).
b).- Desarrollo de la prueba de westem btot para la detección de las proteínas recom binantes del vlA, proteína recombinante Δh5320viren (SEQ ID NO: 8), proteína recombinante Δh5330viren (SEQ ID NO: 9) y proteína recombinante Δh5332viren (SEQ ID NO: 10), obtenidas de los eventos de transformaciócnl/V CCH5320viren, cl/VCCH5330viren ycl/V CCH5332viren mediante el uso de anticuerpos policlonales de origen animal.  b) .- Development of the westem btot test for the detection of recombinant vlA proteins, recombinant protein Δh5320viren (SEQ ID NO: 8), recombinant protein Δh5330viren (SEQ ID NO: 9) and recombinant protein Δh5332viren (SEQ ID NO: 10), obtained from the transformation events / V CCH5320viren, cl / VCCH5330viren andcl / V CCH5332viren through the use of polyclonal antibodies of animal origin.
Para el análisis por la técnica wester blot se sometió de manera individual y de forma igual el extracto proteico obtenido de cada evento de transformación cWCCH5320viren, cl/VCCH5330viren y cl/VCCH5332viren al siguiente procedimiento: se meció 20 μΙ de cada muestra de extracto proteico con 20μΙ de buffer de carga para proteínas (SDS 10%, TRIS 0.25M pH 6.8, Azul de bromofanol 0.1%, DDT 7.73%, glicerol 50%) y se desnaturalizaron por 5 minutos a 95°C y las muestras se cargaron en gel de poliacrilamida al 12% y se corrió a 120 volts durante una hora. Posteriormente las muestras de las proteínas se trasfirieron del gel de poliacrilamkJa al 12 % a una membrana de nltrocelulosa mediante el buffer transferencia (Tris-base 0.3%, glicina 1.44%, metano! 20%) a 150VoKs durante una hora en el equipo para transferencia TV100-EBK Maxi Electroblotter (SCIE-PLAS UK). Una vez trasferidas las proteínas la membrana se lavó dos veces con solución PBS-T (NaCI 0.8%, KCI 0.02%, Na2HP04 0.144%, KHP04 0.024%, Tween-20 0.05%), cada lavado se hizó por 2 minutos en agitación a 90 rpm. Después del lavado se bloqueó con leche en polvo (Svelty ® sin grasa) al 5% en PBS-T por 1 hora. Al cabo de la hora se eliminó la leche y la membrana de nitrocetulosa se incubó con el antisuero (anticuerpo primario policlonal) IgY antiH5 diluido 1/1000 en PBS-T durante 12 horas a 4°C. Trascurridas las 12 horas se lavó la membrana dos veces con PBS-T y luego se incubo con el anticuerpo secundario anti IgY Rabbrt Anti-Chicken IgY H&L (HRP) (ab6753), Rb pAb to ChK IgY (HRP) cat No ab6753 lote GR47125-12 (Marca abcam®) diluido 1/2000 en PBS-T durante una hora a temperatura ambiente. Pasada la hora se lavó la membrana dos veces con PBS-T, 2 minutos con agitación a 90 rpm en cada lavado. La membrana lavada se colocó en una bolsa transparente y se selló. Para revelar se agregó a la membrana solución A diluida 1/40 en la solución B del kit PIERCE ® ECL PLUS westem Btoting Substrato (Thermo Sáerrtrflc) y se dejó incubar durante 1 minuto, al cabo del minuto se retiró la solución AB y se revelo la imagen en una película radiográfica Kodak (Kodak REF 604 0331). El antisuero (anticuerpo primario policlonal) IgY antiH5, fue obtenido de animales de experirnentacion (pollo de engorde comercial) de 14 dias edad, vacunado sometido a dos aplicaciones a intervalos de 1 semana, de una vacuna emulsión comercial contra influenza aviar (vacuna influenza, marca VIREN SA DE CV)) y sangrados a las 28 días posterior a la primera aplicación. (Figura No. 9. Prueba de western btot (anticuerpos pdidonales) para la detección de las proteínas recombinantes del vlA. Proteína recombinante Δh5320viren (carril 1), proteína recombinante Δh5330viren (carril 2) proteína recombinante Δh5332viren (carril 4), marcador de peso molecular (carril M), muestra control de tejido de Chlamydomonas minharcttii sin modificaciones genéticas (carril 3). Usos y aplicaciones de las proteínas recombinantes, proteína recombinante Δh5320viren (SEQ ID NO: 8), proteína recombinante Δh5330viren (SEQ ID NO: 9) y proteína recombinante Δh5332viren (SEQ ID NO: 10), procedentes de los eventos de transformación cl/VCCH5320viren, cl/VCCH5330viren y cl/VCCH5332viren, incluyéndose su empleo para vacunas propuestas (ejemplos) mediante el uso de antfgeno recombinante. a).- Definición del término "antígeno" empleado en la presente invención. For the analysis by the Wester Blot technique, the protein extract obtained from each transformation event cWCCH5320viren, cl / VCCH5330iren and cl / VCCH5332viren was subjected individually and equally to the following procedure: 20 μΙ of each protein extract sample was rocked with 20μΙ loading buffer for proteins (SDS 10%, TRIS 0.25M pH 6.8, Bromophanol Blue 0.1%, DDT 7.73%, glycerol 50%) and were denatured for 5 minutes at 95 ° C and the samples were gel loaded 12% polyacrylamide and ran at 120 volts for one hour. Subsequently, the protein samples were transferred from the 12% polyacrylamide gel to an nltrocellulose membrane by means of the transfer buffer (0.3% Tris-base, 1.44% glycine, 20% methane!) At 150VoKs for one hour in the transfer kit TV100-EBK Maxi Electroblotter (SCIE-PLAS UK). Once the proteins were transferred, the membrane was washed twice with PBS-T solution (NaCl 0.8%, KCI 0.02%, Na2HP04 0.144%, KHP04 0.024%, Tween-20 0.05%), each wash was done for 2 minutes with stirring at 90 rpm After washing it was blocked with 5% powdered milk (Svelty ® without fat) in PBS-T for 1 hour. After the hour the milk was removed and The nitrocetulose membrane was incubated with the antiserum (polyclonal primary antibody) IgY antiH5 diluted 1/1000 in PBS-T for 12 hours at 4 ° C. After 12 hours the membrane was washed twice with PBS-T and then incubated with the secondary IgY Rabbrt Anti-Chicken IgY H&L (HRP) antibody (ab6753), Rb pAb to ChK IgY (HRP) cat No ab6753 lot GR47125 -12 (Abcam® brand) diluted 1/2000 in PBS-T for one hour at room temperature. After one hour, the membrane was washed twice with PBS-T, 2 minutes with stirring at 90 rpm in each wash. The washed membrane was placed in a transparent bag and sealed. To reveal, solution A diluted 1/40 in solution B of the PIERCE ® ECL PLUS westem Btoting Substrate kit (Thermo Sáerrtrflc) was added to the membrane and allowed to incubate for 1 minute, after one minute the AB solution was removed and revealed the image on a Kodak radiographic film (Kodak REF 604 0331). The antiserum (polyclonal primary antibody) IgY antiH5 was obtained from experimental animals (commercial broiler) aged 14 days, vaccinated under two applications at intervals of 1 week, of a commercial emulsion vaccine against avian influenza (influenza vaccine, brand VIREN SA DE CV)) and bleed 28 days after the first application. (Figure No. 9. Western btot test (pdidonal antibodies) for the detection of recombinant vlA proteins. Recombinant protein Δh5320viren (lane 1), recombinant protein Δh5330viren (lane 2) recombinant protein Δh5332viren (lane 4), weight marker molecular (lane M), shows tissue control of Chlamydomonas minharcttii without genetic modifications (lane 3). Uses and applications of recombinant proteins, recombinant protein Δh5320viren (SEQ ID NO: 8), recombinant protein Δh5330viren (SEQ ID NO: 9) and recombinant protein Δh5332viren (SEQ ID NO: 10), from the cl / VCCH5320viren transformation events , cl / VCCH5330viren and cl / VCCH5332viren, including its use for proposed vaccines (examples) through the use of recombinant antigen. a) .- Definition of the term "antigen" used in the present invention.
Como preámbulo se menciona como información adicional que un antígeno puede ser considerado como una sustancia, compuesto o molécula con características que le permiten desencadena una respuesta inmune y la posible formación de anticuerpos específicos. Considerándose cualquier sustancia, compuesto ó molécula propia ó exógena al organismo, que pueden ser reconocidas por el sistema inmune adaptativo. El empleo del término antígeno en la presente invención, considera el uso, empleo ó aplicación de las proteínas recombinantes del vlA denominadas como proteína recombinante Δh5320viren (SEQ ID NO: 8), proteína recombinante Δh5330viren (SEQ ID NO: 9) y proteína recombinante ΔΜ5332viren (SEQ ID NO: 10), sin embargo, deberá de considerarse que su denominación como antígeno recombinante propuesto no limita su uso, empleo o aplicación en diferentes áreas de la medicina, englobado el impacto general de la presente invención, pudiéndose incluir su empleo, uso o aplicación en la prevención, diagnóstico, estudio y usos no mencionados en ta presente invención. En la presente invención, se describe como ejemplo considerado exclusivamente ilustrativo, el empleo de las proteínas recombinantes del vlA, proteína recombinante Δh5320viren (SEQ ID NO: 8), proteína recombinante Δh5330viren (SEQ ID NO: 9) y proteína recombinante Δh5332virert (SEQ ID NO: 10), obtenidas de tos eventos de transformación cl/VCCH5320viren, cl/VCCH5330viren y cl/VCCH5332viren, expresadas y empleadas directamente del material bruto de cultivo de los eventos de transformación, así también su empleo como ejemplo considerado exclusivamente ilustrativo en las vías de aplicación descritas en los ejemplos 1 , 2 y 3, sin limitar su posible uso en formulaciones farmacéuticas ó vacunas no mencionadas en la presente invención, As a preamble it is mentioned as additional information that an antigen can be considered as a substance, compound or molecule with characteristics that allow it to trigger an immune response and the possible formation of specific antibodies. Considering any substance, compound or molecule own or exogenous to the organism, which can be recognized by the adaptive immune system. The use of the term antigen in the present invention considers the use, use or application of recombinant vlA proteins referred to as recombinant protein Δh5320viren (SEQ ID NO: 8), recombinant protein Δh5330viren (SEQ ID NO: 9) and recombinant protein ΔΜ5332viren (SEQ ID NO: 10), however, it should be considered that its designation as a proposed recombinant antigen does not limit its use, use or application in different areas of medicine, encompassing the general impact of the present invention, including its use, use or application in prevention, diagnosis, study and uses not mentioned in the present invention. In the present invention, the use of vlA recombinant proteins, Δh5320viren recombinant protein (SEQ ID NO: 8), is described as an exemplary example. Δh5330viren recombinant protein (SEQ ID NO: 9) and Δh5332virert recombinant protein (SEQ ID NO: 10), obtained from the transformation events cl / VCCH5320viren, cl / VCCH5330viren and cl / VCCH5332viren, expressed and used directly from the raw culture material of transformation events, as well as their use as an example considered exclusively illustrative in the application routes described in examples 1, 2 and 3, without limiting their possible use in pharmaceutical formulations or vaccines not mentioned in the present invention,
b).- Definición de "adyuvante" en general. b) .- Definition of "adjuvant" in general.
Como preámbulo se menciona como información adicional que el término As a preamble it is mentioned as additional information that the term
"adyuvante", considerado esté tanto en plural como en singular, en caso de no indicarlo o especificarlo en el contexto donde sea citado, es empleado en la presente invención en términos generales, para describir una sustancia ó mezcla de químicos, que al integrarse o administrarse en conjunto con algún antigeno, aumentan la respuesta inmune objeto de esa aplicación, siendo en todo caso, empleados para mejorar la respuesta inmune, dirigirla o modularla. Dentro de la descripción de la presente invención, se hace referencia al empleo de diversos adyuvantes empleados con el propósito esperado para un adyuvante en general, sin limitar el uso ó aplicación de otros adyuvantes no mencionados en la presente invención administrados en conjunto con las proteínas recombinantes, proteína recombinante Δh5320viren (SEQ ID NO: 8), proteína recombinante Δh5330víren (SEQ ID NO: 9) y proteína recombinante Δh5332vinen (SEQ ID NO: 10), sin limitar su uso, empleo o aplicación de estas combinaciones en diferentes áreas de la medicina, englobado el impacto general de la presente invención, pudiéndose incluir su empleo, uso ó aplicación en la prevención, el diagnóstico, estudio y usos no mencionados en la presente invención. Los adyuvantes empleados para los ejemplos 1 , 2 y 3, describen en concreto ejemplos ilustrativos explícitamente marcados como tales, siendo estos posibles combinanciones farmacéuticas, vacunas y/o vehículos propuestos como ilustración de las posibilidades de uso, empleo ó administración, indicando en todo momento, que estos no reducen ó limitan el empleo de otros posibles adyuvantes empleados en combinandón ó administrados en conjunto en la presente invención. Los "adyuvantes" empleados para los ejemplos descritos en la presente invención, pueden incluir no necesariamente o exclusivamente, emulsiones agua/aceite, aceite/agua, hidróxido de aluminio, saponinas. c).- Definición del término "vacuna" y tipos de "vacunas" "adjuvant", considered to be both plural and singular, if not indicated or specified in the context where it is cited, is used in the present invention in general terms, to describe a chemical substance or mixture, which when integrated or administered together with some antigen, increase the immune response object of that application, being in any case, used to improve the immune response, direct or modulate it. Within the description of the present invention, reference is made to the use of various adjuvants employed for the purpose intended for an adjuvant in general, without limiting the use or application of other adjuvants not mentioned in the present invention administered in conjunction with the recombinant proteins , recombinant protein Δh5320viren (SEQ ID NO: 8), recombinant protein Δh5330vire (SEQ ID NO: 9) and recombinant protein Δh5332vinen (SEQ ID NO: 10), without limiting their use, use or application of these combinations in different areas of the medicine, encompassed the general impact of the present invention, its use, use or application may be included in prevention, diagnosis, study and uses not mentioned in the present invention. The adjuvants used for examples 1, 2 and 3, specifically describe illustrative examples explicitly marked as such, these being possible pharmaceutical combinations, vaccines and / or vehicles proposed as an illustration of the possibilities of use, use or administration, indicating at all times , that these do not reduce or limit the use of other possible adjuvants used in combination or co-administered in the present invention. The "adjuvants" employed for the examples described in the present invention may not necessarily or exclusively include water / oil, oil / water emulsions, aluminum hydroxide, saponins. c) .- Definition of the term "vaccine" and types of "vaccines"
El término "vacuna", sea condiderado en plural, a menos de que sea indicado en singular en el contexto citado en la presente invención, se decribe en general, como la preparación de un antígeno, aplicado en un organismo para la estimulación inmune y conferir un nivel de estimulación inmunológica contra el antígeno ó el microorganimo portador del antígeno para el cual fue usada la formulación farmacéutica. Entre las preparaciones farmacéuticas o vacunas descritas en la presente invención, se mencionan los ejemplos 1, 2 y 3. Es de señalar que estas representan ejemplos ilustrativos exclusivamente de las posibilidades de uso, empleo o administración de las proteínas recombinantes objeto de la presente invención, no limitando su uso exclusivo a los ejemplos 1 , 2 y 3. d).- Formula de vacunas emulsionadas y formulación de vacunas oculares y aplicación intranasales usados en los ejemplos 1 , 2 y 3. The term "vaccine", be considered in the plural, unless indicated in the singular in the context cited in the present invention, is generally described as the preparation of an antigen, applied in an organism for immune stimulation and conferring a level of immunological stimulation against the antigen or the antigen carrying microorganism for which the pharmaceutical formulation was used. Among the pharmaceutical preparations or vaccines described in the present invention, examples 1, 2 and 3 are mentioned. It is to be noted that these represent illustrative examples exclusively of the possibilities of use, use or administration of the recombinant proteins object of the present invention, not limiting its exclusive use to examples 1, 2 and 3. d) .- Emulsified vaccine formula and formulation of ocular vaccines and intranasal application used in examples 1, 2 and 3.
Ademas de los ejemplos 1, 2 y 3, propuestos en la presente invención, se señala que se ha de entender que en el presente documento, estos ejemplos se presentan exclusivamente como ilustración de su posible uso, empleo ó aplicación y estos no deben de considerarse como limitación en el impacto general de la presente invención. Deberá de considerarse cualquier otro vehículo, aditivo o adyuvante apropiado para el uso en su preparación no descrito dentro del presente documento, en todo caso al incluirse el empleo, uso o aplicación de las proteínas recombinantes del vlA denominadas como proteína recombinante Δh5320viren (SEQ ID NO: 8), proteína recombinante Δh5330viren (SEQ ID NO: 9) y proteína recombinante Δh5332viren (SEQ ID NO: 10), asi como del empleo de los genes que las codifican respectivamente, gen h5320viren (SEQ ID NO: 1), gen h5330viren (SEQ ID NO: 2) y gen h5332viren (SEQ ID NO: 3) codón optimizados para su expresión en el sistema de expresión peptídica del genoma del doroplasto de Chlamydomonas minhardtii en su posible formulación.  In addition to examples 1, 2 and 3, proposed in the present invention, it is noted that it is to be understood that in this document, these examples are presented exclusively as an illustration of their possible use, use or application and these should not be considered as a limitation on the general impact of the present invention. Any other vehicle, additive or adjuvant appropriate for use in its preparation not described herein should be considered, in any case when the use, use or application of recombinant vlA proteins referred to as recombinant protein Δh5320viren (SEQ ID NO : 8), recombinant protein Δh5330viren (SEQ ID NO: 9) and recombinant protein Δh5332viren (SEQ ID NO: 10), as well as the use of the genes that encode them respectively, gene h5320viren (SEQ ID NO: 1), gene h5330viren (SEQ ID NO: 2) and h5332viren gene (SEQ ID NO: 3) codon optimized for expression in the Chlamydomonas minhardtii doroplast genome peptide expression system in its possible formulation.
En la descripción de los ejemplos enumerados a continuación, se denota los posibles usos, empleo ó aplicación de las proteínas recombinantes del vlA denominadas como proteína recombinante Δh5320v¡ren (SEQ ID NO: 8), proteína recombinante Δh5330viren (SEQ ID NO: 9) y proteína recombinante Δh5332viren (SEQ ID NO: 10), así como del empleo de los genes que las codifican respectivamente, gen h5320viren (SEQ ID NO: 1), gen h5330viren (SEQ ID NO: 2) y gen h5332viren (SEQ ID NO: 3) codón optimizados para su expresión en el sistema de expresión proteica del genoma del cloroplasto de Chlamyóomonas minhartitü, sin embargo en todo caso, no se restringe ó limita su uso, empleo ó aplicación solo en los siguientes ejemplos, así como en variaciones de las mismas. In the description of the examples listed below, the possible uses, use or application of the vlA recombinant proteins referred to as recombinant protein Δh5320v¡ren (SEQ ID NO: 8), recombinant protein Δh5330viren (SEQ ID NO: 9) is denoted and recombinant protein Δh5332viren (SEQ ID NO: 10), as well as the use of the genes that encode them respectively, h5320viren gene (SEQ ID NO: 1), h5330viren gene (SEQ ID NO: 2) and h5332viren gene (SEQ ID NO : 3) codon optimized for your Expression in the Chlamyóomonas minhartitü chloroplast genome protein expression system, however in any case, its use, use or application is not restricted or limited only in the following examples, as well as in variations thereof.
• Ejemplo 1: Formulación de emulsiones con antígenos recombinantes proteína recombinante Δh5320viren (SEQ ID NO: 8), proteína recombinante Δh5330viren (SEQ ID NO: 9) y proteína recombinante Δh5332viren (SEQ ID NO: 10). Vacuna en emulsión (agua/aceite) para aplicación parenteral (intramuscular / subcutánea)  • Example 1: Emulsion formulation with recombinant antigens Δh5320viren recombinant protein (SEQ ID NO: 8), recombinant protein Δh5330viren (SEQ ID NO: 9) and recombinant protein Δh5332viren (SEQ ID NO: 10). Emulsion vaccine (water / oil) for parenteral application (intramuscular / subcutaneous)
Figure imgf000047_0001
Figure imgf000048_0001
Figure imgf000047_0001
Figure imgf000048_0001
Figure imgf000048_0002
Figure imgf000048_0003
Figure imgf000048_0002
Figure imgf000048_0003
Figure imgf000049_0001
Figure imgf000049_0001
• Ejemplo 2: Formulación de vacunas con antígenos recombinantes proteína recom binante Δh5320viren (SEQ IO NO: 8), proteína recombinante Δh5330viren (SEQ ID NO: 9) y proteína recombinante Δh5332viren (SEQ ID NO: 10), para su aplicación vía mucosas en general (ocular-nasal). Vacuna vía ocular-nasal • Example 2: Vaccine formulation with recombinant antigens recombinant protein Δh5320viren (SEQ IO NO: 8), recombinant protein Δh5330viren (SEQ ID NO: 9) and recombinant protein Δh5332viren (SEQ ID NO: 10), for mucosal application in general (ocular-nasal). Vaccine ocular-nasal route
Figure imgf000049_0002
Figure imgf000049_0002
Figure imgf000050_0001
Figure imgf000050_0001
Figure imgf000050_0002
Figure imgf000050_0003
Figure imgf000050_0002
Figure imgf000050_0003
Figure imgf000051_0001
Figure imgf000051_0001
• Ejemplo 3: Formulación de vacunas con antígenos recombinantes proteína recombinante Δh5320viren (SEQ ID NO: 8), proteína recombinante Δh5330viren (SEQ ID NO: 9) y proteína recombinante Δh5332viren (SEQ ID NO: 10) para su aplicación vía parenteral (aplicación intramuscular y subcutánea). Vacuna vía parenteral (intramuscular / subcutánea) • Example 3: Vaccine formulation with recombinant antigens Δh5320viren recombinant protein (SEQ ID NO: 8), Δh5330viren recombinant protein (SEQ ID NO: 9) and Δh5332viren recombinant protein (SEQ ID NO: 10) for parenteral application (intramuscular application and subcutaneous). Parenteral vaccine (intramuscular / subcutaneous)
Figure imgf000051_0002
Figure imgf000051_0002
Figure imgf000052_0001
Figure imgf000052_0001
Figure imgf000052_0002
Figure imgf000052_0003
Figure imgf000053_0001
Figure imgf000052_0002
Figure imgf000052_0003
Figure imgf000053_0001
PRUEBAS ANTIGÉNICAS PARA ANIMALES DE EXPERIMENTACIÓN ANTIGENIC TESTS FOR EXPERIMENTATION ANIMALS
1).- Diseño experimental para vacunación en cerdos para la estimulación de anticuerpos específicos contra el vlA, inducidos por las formulaciones propuestas.  1) .- Experimental design for vaccination in pigs for the stimulation of specific antibodies against vlA, induced by the proposed formulations.
i).- Descripción de la prueba:  i) .- Description of the test:
El propósito de este ensayo en cerdos (Sus scrofa domestica) raza (Yorkshire), fue encaminado a la determinación de los niveles de antigenlcidad de los diversos antfgenos recombinantes propuestos, mediante la medición de los títulos a la prueba de IH en modelo animal cerdo; entiéndase como antígenos recombinantes propuestos a las proteínas recombinates del vlA, proteína recombinante Δh5320viren (SEQ ID NO: 8) obtenida del evento de transformación cl/VCCH5320viren, proteína recombinante Δh5330viren (SEQ ID NO: 9) obtenida del evento de transformación cWCCH5330viren y proteína recombinante Δh5332viren (SEQ ID NO: 10) obtenida del evento de transformaciócnl/V CCH5332viren. Las formulaciones propuestas para estos ensayos en modelo animal, consistieron de las formulas vacunales experimentales señaladas en conjunto con los diseños experimentales. Los grupos de animales consistieron de lechónos de 3 semanas de edad, cerdos (Sus savia domestica) raza (Yorkshire), sin lesiones, presencia de anticuerpos al vlA ó signotogía clínica asociada a procesos infecciosos o transtomos asociados a enfermedad. En todos los casos se contaron con grupos testigos para evaluar la ausencia de anticuerpos contra el vlA. ii).- Diseño experimental en cerdos (Sus scrofa domestica) razaThe purpose of this test in pigs (Sus scrofa domestica) breed (Yorkshire), was aimed at determining the levels of antigenlcity of the various recombinant antigens proposed, by measuring the titles to the IH test in pig animal model; understood as recombinant antigens proposed to vlA recombinant proteins, Δh5320viren recombinant protein (SEQ ID NO: 8) obtained from the cl / VCCH5320viren transformation event, Δh5330viren recombinant protein (SEQ ID NO: 9) obtained from the cWCCH5330viren and protein transformation event Δh5332viren recombinant (SEQ ID NO: 10) obtained from the CCH5332viren / V transformation event. The formulations proposed for these animal model tests consisted of the experimental vaccine formulas indicated in conjunction with the experimental designs. The groups of animals consisted of 3-week-old piglets, pigs (Their domestic sap) breed (Yorkshire), without lesions, presence of antibodies to vlA or clinical signotogy associated with infectious processes or disease-associated transtomos. In all cases, control groups were available to assess the absence of antibodies against vlA. ii) .- Experimental design in pigs (Sus scrofa domestica) breed
(Yorkshire) (Yorkshire)
Figure imgf000054_0001
de suero y
Figure imgf000054_0001
of serum and
vacunación  vaccination
intramuscular  intramuscular
en el cuello  in the neck
con un  with a
volumen de 1  volume of 1
mi, con  my with
solución  solution
salina  saline
fisiológica
Figure imgf000055_0001
iii).- Evaluación de muestras de suero a través de la prueba de IH. physiological
Figure imgf000055_0001
iii) .- Evaluation of serum samples through the IH test.
Las muestras sanguíneas obtenidas del punto medio de la fosa yugular, se tomaron empleando agujas 21G x 1 ", jeringas de 12 ce., y tubos colectores de vidrio de 20 ce. Las muestras se conservaron a 4 °C, hasta su centrifugación durante 3 minutos a 3,000 rpm. El suero obtenido se colocó en tubos de polipropileno de 2 ce, con identificación individual, conservándose a -20 °C hasta la realización de las pruebas seroiógicas de IH de los animales, de acuerdo al diseño experimental en cerdos (Sus scrofa domestica) raza (Yorkshire), se planteó la implementactón de la técnica de IH, para la detección de IgG a nivel sanguíneo de estos animales. Para el desarrollo de la técnica de IH, se empleó el virus de referencia autorizado por el Gobierno Mexicano, (Influenza virus/A/Ck/México/CPA-232/94 (H5N2)), de acuerdo al siguiente protocolo descrito en la Norma Oficial Mexicana NOM-055-ZOO-1995. Blood samples obtained from the midpoint of the jugular fossa were taken using 21G x 1 "needles, 12 ce syringes, and 20 ce glass collector tubes. The samples were stored at 4 ° C until centrifugation for 3 minutes at 3,000 rpm The serum obtained was placed in 2 ce polypropylene tubes, with individual identification, kept at -20 ° C until the serobiological tests of IH of the animals were performed, according to the experimental design in pigs (Sus scrofa domestica) breed (Yorkshire), the implementation of the IH technique was proposed, for the detection of IgG at the blood level of these animals.For the development of the IH technique, the reference virus authorized by the Mexican Government was used , (Influenza virus / A / Ck / Mexico / CPA-232/94 (H5N2)), according to the following protocol described in the Official Mexican Standard NOM-055-ZOO-1995.
Desarrollo de la prueba de IH IH test development
·) Se diluyen los antígenos HA de referencia (H5N2 aviar cepa autorizada por el Gobierno Mexicano) hasta una concentración de 4 unidades hemaglutinantes (U HA). 125 μΙ con tampón fosfato salino 0,01 M, pH 7,2. b) Se inactivan los sueros por calor durante 30 minutos a 56°C. Se diluyen a 1/10 con tampón fosfato salino. La prueba de vlA es preferible realizarla en log. base 2. ·) The reference HA antigens (H5N2 avian strain authorized by the Mexican Government) are diluted to a concentration of 4 haemagglutinating units (U HA). 125 μΙ with 0.01 M saline phosphate buffer, pH 7.2. b) The sera are inactivated by heat for 30 minutes at 56 ° C. Dilute to 1/10 with phosphate buffered saline. The vlA test is preferable to perform it in log. base 2.
c) Con la pipeta multicanai, colocar 25 μL de tampón fosfato salino a cada uno de los 96 pozos que se vayan a usar de la microplaca con fondo "V ó "U".  c) With the multicanai pipette, place 25 μL of phosphate buffered saline to each of the 96 wells to be used in the bottom microplate "V or" U ".
d) Se coloca 25 μL de suero problema. Dejar una fila como testigo positivo y otra fila como testigo negativo.  d) 25 μL of problem serum is placed. Leave one row as a positive witness and another row as a negative witness.
·) Con la micropipeta multicanai, realizar diluciones dobles seriadas, hasta la columna No. 12 de la microplaca empleada.  ·) With the multicanai micropipette, make serial double dilutions, up to column No. 12 of the microplate used.
0 Agregar 25 μL de la solución de antígeno de prueba conteniendo (4 U HA del vlA), a cada pozo del suero diluido y a la fila de testigo negativo. Agitar suavemente la microplaca para mezclar tos reactivos.  0 Add 25 μL of the test antigen solution containing (4 U HA of vlA), to each well of the diluted serum and to the negative control row. Gently shake the microplate to mix reagent cough.
g) Cubrir la microplaca e incubar a temperatura ambiente, durante 45 a 60 minutos.  g) Cover the microplate and incubate at room temperature, for 45 to 60 minutes.
h) Agregar 50 μL de la suspensión de eritrocitos al 0.5 % a todos los pozos de la microplaca, incluyendo los sueros problema, tos testigos negativos y los testigos positivos.  h) Add 50 μL of the 0.5% erythrocyte suspension to all microplate wells, including the test sera, the negative control coughs and the positive controls.
Q Cubrir la microplaca e incubar a temperatura ambiente, hasta que tos eritrocitos testigo sedimenten hasta formar un botón bien delimitado, esto ocurre cerca de tos 30 minutos.  Q Cover the microplate and incubate at room temperature, until the cough erythrocytes settle to form a well-defined button, this occurs about 30 minutes.
La IH producida por tos sueros positivos debe tener un patrón semejante al de tos eritrocitos testigo, un botón circular con bordes definidos que se desliza tomando la forma de una lágrima en el fondo del pozo, al inclinar la microplaca en un ángulo de 45°. Cuando los sueros son negativos y no alcanzan a inhibir la acción hemaglutinante del antfgeno, los eritrocitos se sedimentan formando una capa uniforme en el fondo de tos pozos. Los títulos de IH se determinan como tos recíprocos de las diluciones mayores del suero en la que se observa la IH. iv).- Resultados a la prueba de IH. IH produced by positive cough serums should have a pattern similar to that of control erythrocyte cough, a circular button with defined edges that slides in the shape of a tear at the bottom of the well, when tilting the microplate at an angle of 45 °. When the sera are negative and fail to inhibit the haemagglutinating action of the antigen, the erythrocytes sediment forming a uniform layer at the bottom of the wells. The titres of IH are determined as reciprocal coughs of the major dilutions of the serum in which the IH is observed. iv) .- Results to the IH test.
Figure imgf000057_0001
Figure imgf000057_0001
2).- Diseño experimental en vacunación en aves para la estimulación de anticuerpos específicos contra el vlA. 2) .- Experimental design in vaccination in birds for the stimulation of specific antibodies against vlA.
i).- Descripción de la prueba:  i) .- Description of the test:
El propósito de este ensayo en aves (Gallus gallus domesticus) estirpe The purpose of this test on birds (Gallus gallus domesticus) line
(Ross), fue encaminado a la determinación de tos niveles de antigenicidad de los diversos antígenos recom binantes propuestos, mediante la medición de tos títulos a la prueba de IH en modelo animal ave; entiéndase como antígenos recombinantes propuestos a las proteínas recombinates del vlA, proteína recombinante Δh5320viren (SEQ ID NO: 8) obtenida del evento de transformaciócnl/V CCH5320v¡ren, proteína recombinante Δh5330viren (SEQ ID NO: 9) obtenida del evento de transformación cl/VCCH5330viren y proteína recombinante Δh5332viren (SEQ ID NO: 10) obtenida del evento de transformaciócnl/V CCH5332viren. Las formulaciones propuestas para estos ensayos en modelo animal, consistieron de las fórmulas vacunales experimentales señaladas en conjunto con los diseños experimentales. Los grupos de animales consistieron de aves de corral (Gallus gallus domesticus) de 21 días de edad sin lesiones, presencia de anticuerpos al vlA ó signokxjía dinica asociada a procesos infecciosos o transtomos asociados a enfermedad. En todos los casos se contaron con grupos testigos para evaluar la ausencia de anticuerpos contra el vlA. (Ross), was directed to the determination of the levels of antigenicity of the various recombinant antigens proposed, by measuring the titles to the IH test in the animal bird model; understood as recombinant antigens proposed for recombinant vlA proteins, recombinant protein Δh5320viren (SEQ ID NO: 8) obtained from the transformation event / V CCH5320v¡ren, recombinant protein Δh5330vire (SEQ ID NO: 9) obtained from the transformation event cl / VCCH5330viren and recombinant protein Δh5332viren (SEQ ID NO: 10) obtained from the transformation / V event CCH5332viren. The formulations proposed for these animal model tests consisted of the experimental vaccine formulas indicated in conjunction with the experimental designs. The groups of animals consisted of poultry (Gallus gallus domesticus) of 21 days of age without lesions, presence of antibodies to vlA or dynamic sign associated with infectious processes or diseases associated with disease. In all cases, control groups were available to assess the absence of antibodies against vlA.
¡i).- Diseño experimental en aves (Gallus gallus domesticus), estirpe de ave (Ross)  I) .- Experimental design in birds (Gallus gallus domesticus), bird line (Ross)
Figure imgf000058_0001
Figure imgf000059_0001
iii).- Evaluación de muestras de suero a través de la prueba de IH.
Figure imgf000058_0001
Figure imgf000059_0001
iii) .- Evaluation of serum samples through the IH test.
Para las muestras sanguíneas obtenidas de la vena del ala, se emplearon agujas 21G x Γ, jeringas de 10 ce., y tubos colectores de vidrio de 10 ce. Las muestras se conservaron a 4 °C, hasta su centrifugación durante 3 minutos a 3,000 rpm. El suero obtenido se colocó en tubos de polipropileno de 2 ce, con identificación individual, conservándose a -20 °C hasta la realización de las pruebas serológicas de IH de los animales, de acuerdo al diseño experimental en aves de corral (Gallus gallus domesticas) estirpe (Ross), se planteo la implementacion de la técnica de IH, para la detección de las IgY a nivel sanguíneo de estos animales. Para el desarrollo de la técnica de IH, se empleo el vio» de referencia autorizado por el Gobierno Mexicano, (Influenza virus/A/Ck/México/CPA-232/94 (H5N2)), de acuerdo al siguiente protocolo descrito en la Norma Oficial Mexicana NOM-055-ZOO-1995. For blood samples obtained from the wing vein, 21G x agujas needles, 10 ce syringes, and 10 ce glass collecting tubes were used. The samples were stored at 4 ° C, until centrifugation for 3 minutes at 3,000 rpm. The serum obtained was placed in 2 ce polypropylene tubes, with individual identification, kept at -20 ° C until the serological tests of IH of the animals were carried out, according to the experimental design in poultry (Gallus gallus domesticas) lineage (Ross), the implementation of the IH technique was proposed for the detection of IgY at the blood level of these animals. For the development of the IH technique, I use he saw the reference »authorized by the Mexican Government, (Influenza virus / A / Ck / Mexico / CPA-232/94 (H5N2)), according to the following protocol described in the Official Mexican Standard NOM-055-ZOO-1995.
Prueba de IH. IH test.
·) Se diluyen los antígenos HA de referencia (H5N2 aviar cepa autorizada por el Gobierno Mexicano) hasta una concentración de 4 HAU/25 μ| con tampón fosfato salino 0,01 M, pH 7,2.  ·) The reference HA antigens (H5N2 avian strain authorized by the Mexican Government) are diluted to a concentration of 4 HAU / 25 μ | with 0.01 M saline phosphate buffer, pH 7.2.
b) Se inactivan los sueros por calor durante 30 minutos a 56°C. Se diluyen a 1/10 con buffer fosfato salino. La prueba de vlA es preferible realizarla en tog. Base 2.  b) The sera are inactivated by heat for 30 minutes at 56 ° C. Dilute to 1/10 with phosphate buffered saline. The vlA test is preferable to perform it in tog. Base 2
c) Con la pipeta multicanal, colocar 25 uL de tampón fosfato salino a cada uno de los 96 pozos que se vayan a usar de la microplaca con fondo V ó "U".  c) Using the multichannel pipette, place 25 uL of phosphate buffered saline to each of the 96 wells to be used in the microplate with V or "U" bottom.
d) Se coloca 25 uL de suero problema. Dejar una fila como testigo positivo y otra fila como testigo negativo.  d) 25 uL of problem serum is placed. Leave one row as a positive witness and another row as a negative witness.
e) Con la micropipeta multicanal, realizar diluciones dobles seriadas, hasta la columna No. 12 de la microplaca empleada.  e) With the multichannel micropipette, make serial double dilutions, up to column No. 12 of the microplate used.
0 Agregar 25 μL de !a solución de antfgeno de prueba conteniendo (4 U HA del vlA), a cada pozo del suero diluido y a la fila de testigo negativo. Agitar suavemente la microplaca para mezclar los reactivos,  0 Add 25 μL of! To test antigen solution containing (4 U HA of vlA), to each well of the diluted serum and to the negative control row. Gently shake the microplate to mix the reagents,
g) Cubrir la microplaca e incubar a temperatura ambiente, durante 45 - 60 min. h) Agregar 50 μL de la suspensión de eritrocitos ai 0.5 % a todos ios pozos de la microplaca, incluyendo los sueros problema, los testigos negativos y tos testigos positivos. g) Cover the microplate and incubate at room temperature for 45-60 min. h) Add 50 μL of the 0.5% erythrocyte suspension to all the wells of the microplate, including the test sera, the negative controls and the positive controls.
i) Cubrir la microplaca e incubar a temperatura ambiente, hasta que los eritrocitos testigo sedimenten hasta formar un botón bien delimitado, esto ocurre cerca de tos 30 minutos.  i) Cover the microplate and incubate at room temperature, until the control erythrocytes settle to form a well-defined button, this occurs about 30 minutes.
La IH producida por los sueros positivos debe tener un patrón semejante al de tos eritrocitos testigo, un botón circular con bordes definidos que se desliza tomando la forma de una lágrima en el fondo del pozo, al inclinar la microplaca en un ángulo de 45°. Cuando tos sueros son negativos y no alcanzan a inhibir la acción hemaglutinante del antígeno, tos eritrocitos se sedimentan formando una capa uniforme en el fondo de tos pozos. Los títulos de IH se determinan como tos recíprocos de las diluciones mayores del suero en la que se observa la IH. iv).- Resultados a la prueba de IH.  The IH produced by the positive sera must have a pattern similar to that of control erythrocytes, a circular button with defined edges that slides in the shape of a tear at the bottom of the well, by tilting the microplate at an angle of 45 °. When coughs are negative and fail to inhibit the haemagglutinating action of the antigen, cough erythrocytes sediment forming a uniform layer at the bottom of coughs. The titres of IH are determined as reciprocal coughs of the major dilutions of the serum in which the IH is observed. iv) .- Results to the IH test.
Figure imgf000061_0001
Figure imgf000062_0001
Figure imgf000061_0001
Figure imgf000062_0001

Claims

REIVINDICACIONES
De acuerdo a lo descrito en la presente invención como antecedente se reclama la propiedad de lo que acontinuaáón se enumera:  In accordance with what is described in the present invention, the ownership of what is listed below is claimed:
1) Las secuencias de nucleotidos de ADN codón optimizadas, gen hS32(Mren (SEQ ID NO: 1), gen h5330viren (SEQ ID NO: 2) y gen h5332virBn (SEQ ID NO: 3), caracterizadas por ser capaces de traducirse en las proteínas recombinantes del vlA, proteína recom binante Δh5320viren (SEQ ID NO: 8), proteína recombinante Δh5330viren (SEQ ID NO: 9) y proteína recombinante Δh5332v¡ren (SEQ ID NO: 10) respectivamente, una vez insertadas en el genoma del cloroplasto de Chlamydomonas reinhardtíi.  1) The optimized codon DNA nucleotide sequences, hS32 gene (Mren (SEQ ID NO: 1), h5330viren gene (SEQ ID NO: 2) and h5332virBn gene (SEQ ID NO: 3), characterized by being able to translate into recombinant vlA proteins, recombinant protein Δh5320viren (SEQ ID NO: 8), recombinant protein Δh5330viren (SEQ ID NO: 9) and recombinant protein Δh5332v¡ren (SEQ ID NO: 10) respectively, once inserted into the genome of the Chlomydomonas reinhardtíi chloroplast.
2) Las proteínas recombinantes del vlA, proteína recombinante Δh5320viren (SEQ ID NO: 8), proteína recombinante ΔhS33(Mren (SEQ ID NO: 9) y proteína recombinante Δh5332viren (SEQ ID NO: 10), caracterizadas por ser capaces de ser expresadas en el cloroplasto de Chlamydomonas rBinhanJtii de forma independiente al uso o inoculación del vlA, en conformidad con la reivindicación 1. No limitando su uso, empleo ó aplicación en diferentes áreas de la medicina, pudiéndose incluir en la prevención, el diagnóstico y usos diversos no mencionados en la presente invención.  2) Recombinant proteins of vlA, recombinant protein Δh5320viren (SEQ ID NO: 8), recombinant protein ΔhS33 (Mren (SEQ ID NO: 9) and recombinant protein Δh5332viren (SEQ ID NO: 10), characterized by being able to be expressed in Chlamydomonas rBinhanJtii chloroplast independently of the use or inoculation of vlA, in accordance with claim 1. Not limiting its use, use or application in different areas of medicine, being able to include in prevention, diagnosis and various uses not mentioned in the present invention.
3) Las vacunas, en cuyo caso sea empleado ó usado como antígeno, las proteínas recombinantes, proteína recombinante Ah5320viren (SEQ ID NO: 8), proteína recombinante Ah5330viren (SEQ ID NO: 9) y proteína recombinante di5332viren (SEQ ID NO: 10), en conformidad con la reivindicación 1 y 2, aplicadas vía mucosas en general (oral, sublingual, conjutival, respiratoria), vía parenterai (intramuscular, subcutánea, e intraperítoneal), para el control y tratamiento de la IA, en los organimos susceptibles a la enfermedad inducida por el vlA, en animales como aves y cerdos. 3) Vaccines, in which case recombinant proteins, Ah5320viren recombinant protein (SEQ ID NO: 8), Ah5330viren recombinant protein (SEQ ID NO: 9) and di5332viren recombinant protein (SEQ ID NO: 10) are used or used as an antigen. ), in accordance with the claims 1 and 2, applied via mucous membranes in general (oral, sublingual, conjutival, respiratory), parenterai (intramuscular, subcutaneous, and intraperitoneal), for the control and treatment of AI, in the organs susceptible to disease induced by the vlA, in animals such as birds and pigs.
4) Las vacunas, en cuyo caso sea empleado ó usado como antígeno. las proteínas recombinantes del vlA, proteína (-©combinante Δh5320viren (SEQ ID NO: 8), proteína recombinante Δh5330viren (SEQ ID NO: 9) y proteína recombinante Δh5332viran (SEQ ID NO: 10), en conformidad con la reivindicación 1 y 2, aplicada vía mucosas en general (oral, sublingual, conjutival, respiratoria), vía parenterai (intramuscular, subcutánea, e intraperitonela), para el control y tratamiento de la IA, en los organimos susceptibles a la enfermedad inducida por el vlA, incluidos seres humanos, en conformidad con la reivindicación 3 siendo, en todo caso, inmuno estimulantes bajo su administración demostrada en modelo animal.  4) Vaccines, in which case it is used or used as an antigen. vlA recombinant proteins, protein (- Δh5320viren combination (SEQ ID NO: 8), Δh5330viren recombinant protein (SEQ ID NO: 9) and Δh5332viran recombinant protein (SEQ ID NO: 10), in accordance with claim 1 and 2 , applied via mucous membranes in general (oral, sublingual, conjutival, respiratory), parenterai (intramuscular, subcutaneous, and intraperitoneal), for the control and treatment of AI, in organs susceptible to vAA-induced disease, including beings human, in accordance with claim 3 being, in any case, immuno stimulants under its administration demonstrated in animal model.
5) El uso del genoma del cioropiasto de Chlamydomonas rainhardtii para la expresión de secuencias homologas de la secuencia peptídica HA de los virus de influenza tipo A, B y C, de conformidad con la reivindicación 1. 5) The use of the Chlamydomonas rainhardtii chorioopiaste genome for the expression of homologous sequences of the HA peptide sequence of influenza viruses type A, B and C, according to claim 1.
6) La expresión y/ó síntesis en organismos pertenecientes al reino Mantee, en particular en organelos denominados como plástidos, especialmente en el genoma del cioropiasto, las secuencias peptídicas denominadas como proteína recombinante Δh5320vinan (SEQ ID NO: 8), proteína recombinante Δh5330viran (SEQ ID NO: 9) y proteína recombinante Δh5332virsn (SEQ ID NO: 10) en conformidad con la reivindicación 1 y 2, incluyendo su uso como antígeno recombinante propuesto, en conformidad con la reivindicación 3, no limitando su uso, empleo ó aplicación en diferentes áreas de la medicina, pudiéndose incluir en la prevención, el diagnóstico y usos diversos no mencionados en la presente invención. 6) The expression and / or synthesis in organisms belonging to the Mantee kingdom, in particular in organelles called as plastids, especially in the genome of the cioropiasto, the peptide sequences denominated as recombinant protein Δh5320vinan (SEQ ID NO: 8), recombinant protein Δh5330viran ( SEQ ID NO: 9) and recombinant protein Δh5332virsn (SEQ ID NO: 10) in accordance with claim 1 and 2, including its use as a proposed recombinant antigen, in accordance with claim 3, not limiting its use, use or application in different areas of medicine, and may be included in prevention, diagnosis and various uses not mentioned in the present invention.
PCT/MX2016/000040 2015-05-19 2016-04-26 Sequences of synthetic deoxyribonucleic acids and heterologous recombinant proteins of the haemagglutinin of the influenza virus expressed in chlamydomonas reinhardtii chloroplast, and use thereof in vaccines WO2016186483A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
MXMX/A/2015/006599 2015-05-19
MX2015006599A MX2015006599A (en) 2015-05-19 2015-05-19 Sequences of synthetic deoxyribonucleic acids and heterologous recombinant proteins of the haemagglutinin of the influenza virus expressed in chlamydomonas reinhardtii chloroplast, and use thereof in vaccines.

Publications (1)

Publication Number Publication Date
WO2016186483A1 true WO2016186483A1 (en) 2016-11-24

Family

ID=57320758

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/MX2016/000040 WO2016186483A1 (en) 2015-05-19 2016-04-26 Sequences of synthetic deoxyribonucleic acids and heterologous recombinant proteins of the haemagglutinin of the influenza virus expressed in chlamydomonas reinhardtii chloroplast, and use thereof in vaccines

Country Status (2)

Country Link
MX (1) MX2015006599A (en)
WO (1) WO2016186483A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117327742A (en) * 2023-10-12 2024-01-02 深圳大学 Technical method for promoting efficient replacement and homogenization of chlamydomonas chloroplast genome

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070042002A1 (en) * 2005-08-16 2007-02-22 Hawaii Biotech, Inc. Influenza recombinant subunit vaccine
EP1925318A1 (en) * 2006-11-20 2008-05-28 Paul-Ehrlich-Institut Recombinant modified vaccinia virus Ankara (MVA)-based vaccine for the avian flu

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070042002A1 (en) * 2005-08-16 2007-02-22 Hawaii Biotech, Inc. Influenza recombinant subunit vaccine
EP1925318A1 (en) * 2006-11-20 2008-05-28 Paul-Ehrlich-Institut Recombinant modified vaccinia virus Ankara (MVA)-based vaccine for the avian flu

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
EGGERT D. ET AL.: "Characterization and efficacy determination of commercially available Central American H5N2 avian influenza vaccines for poultry.", VACCINE., vol. 28, 12 May 2010 (2010-05-12), pages 4609 - 4615, XP027474775 *
GUIONIE O. ET AL.: "H5-based DNA constructs derived from selected highly pathogenic H5N1 avian influenza virus induce high levels of humoral antibodies in Muscovy ducks against low pathogenic viruses.", VIROLOGY JOURNAL., vol. 11, 24 April 2014 (2014-04-24), pages 74, XP021186683 *
LEE J.-S. ET AL.: "The highly conserved HA2 protein of the influenza a virus induces across protective immune response.", JOURNAL OF VIROLOGICAL METHODS., vol. 194, 1 September 2013 (2013-09-01), pages 280 - 288, XP055331255 *
WANG C.Y. ET AL.: "The cleavage of the hemagglutinin protein of H5N2 avian influenza virus in yeast.", JOURNAL OF VIROLOGICAL METHODS., vol. 146, 2007, pages 293 - 297, XP022327167 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117327742A (en) * 2023-10-12 2024-01-02 深圳大学 Technical method for promoting efficient replacement and homogenization of chlamydomonas chloroplast genome

Also Published As

Publication number Publication date
MX2015006599A (en) 2016-11-18

Similar Documents

Publication Publication Date Title
WO2021254327A1 (en) Envelope replacement-type viral vector vaccine and construction method therefor
US11793871B2 (en) Stabilized group 2 influenza hemagglutinin stem region trimers and uses thereof
ES2597439T3 (en) RSV recombinant antigens
US10400013B2 (en) Fusion polypeptide for immuno-enhancement and method for enhancing stimulation of immune response using the same
ES2588225T3 (en) Nucleic acid sequences of a fish virus and their use
PL220281B1 (en) DNA vaccine, the method of inducing an immune response, the antibody specifically recognizing the protein of the influenza virus hemagglutinin H5 and the use of DNA vaccine
CN110093357B (en) Multi-epitope antigen of porcine epidemic diarrhea virus, encoding gene, preparation method and application
TWI385249B (en) Using a reverse genetic engineering platform to produce protein vaccines and protein vaccine of avian influenza virus
US20240050556A1 (en) Optimized polypeptide for a subunit vaccine against avian reovirus
CN110746496B (en) PAL recombinant protein of Acinetobacter baumannii, encoding gene thereof and application of PAL recombinant protein and encoding gene
Gyu-Jin et al. Analysis of immune responses against nucleocapsid protein of the Hantaan virus elicited by virus infection or DNA vaccination
CN113736749B (en) Avian influenza virus strain and application thereof
WO2016186483A1 (en) Sequences of synthetic deoxyribonucleic acids and heterologous recombinant proteins of the haemagglutinin of the influenza virus expressed in chlamydomonas reinhardtii chloroplast, and use thereof in vaccines
US10918707B2 (en) VirB10 for vaccination against gram negative bacteria
RU2693440C1 (en) STRAIN "vFIRAVAX" FOR PRODUCING AN ATTENUATED ALIVE CULTURE VACCINE FOR PREVENTING VARICELLA
Kim et al. Preliminary study about sublingual administration of bacteria-expressed pandemic H1N1 influenza vaccine in miniature pigs
ES2328350T3 (en) INCLUSION BODIES AS ANTIGENS FOR ORAL VACCINATION OF ANIMALS AGAINST VPPC.
Zhu et al. System for the heterologous expression of NS1 protein of H9N2 avian influenza virus in the ciliate Tetrahymena thermophila
US20240024456A1 (en) Ha stem vaccine for ha antibody-positive targets
Ashraf et al. Development of transgenic algae strain expressing CTB-M2e fusion gene an approach towards the development of a universal edible vaccine in algae
TW202306968A (en) Influenza virus-based isolated recombinant virus for inducing specific immunity to influenza virus and/or preventing influenza virus-related diseases
CN112552397A (en) Rotavirus VP7 recombinant protein and application thereof
Pour et al. Construction of recombinant fusion protein of influenza, a virus neuraminidase and heat shock protein 70 gene: expression in baculovirus and bioactivity
Asadian et al. Development and ELISA-based detection of anti-M2e IgY antibodies using an encoding plasmid for M2e-Hsp70 C-terminal gene.
CN116874607A (en) H9 subtype avian influenza recombinant chimeric vaccine and preparation method thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16796810

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16796810

Country of ref document: EP

Kind code of ref document: A1